November 2021

Sorted by most races

Rank Username Races Month Best Race Wins Win %
1. -MarkVS- (mark40511) 5,686 116.91 163.77 2,084 36.65
2. (vixt) 5,134 120.93 187.30 2,738 53.33
3. noobnoob (garblovian) 4,051 101.91 143.99 1,525 37.65
4. Cole (colemakingprocess) 3,919 67.00 110.43 896 22.86
5. 🐟🐟🐟🐟hn (deliber... 3,509 132.61 171.45 2,279 64.95
6. (poem) 3,453 134.69 207.30 2,183 63.22
7. Stas (tracersm) 3,332 79.46 100.16 825 24.76
8. sykelolxd (sykelolxd) 3,192 123.32 170.24 1,918 60.09
9. MS (damanthc) 3,050 93.74 128.35 1,066 34.95
10. Shashank (kingshashank12) 3,036 90.82 147.10 1,061 34.95
11. Sam Aka 😏 (sam_at_40wpm) 3,000 72.86 109.73 802 26.73
12. Cristiano (christiano_ronaldo) 2,891 60.33 91.23 578 19.99
13. paperboy ditty (wordracer888) 2,864 140.45 191.79 1,968 68.72
14. makeout (wastingtimexd) 2,795 73.94 107.97 648 23.18
15. joel (jouel1234567) 2,666 70.17 101.92 618 23.18
16. skr_j (saikiranj) 2,650 79.27 116.22 778 29.36
17. (scraex) 2,633 113.80 191.09 2,076 78.85
18. [tshafer3] (tshafer3) 2,586 118.39 149.72 1,481 57.27
19. WatchDominion.org (lithox2) 2,573 149.93 207.24 1,095 42.56
20. lavé (traben) 2,569 156.92 224.33 756 29.43
21. Ghost racing medalists suck... 2,550 84.93 117.14 733 28.75
22. Diego (divarela) 2,505 84.10 111.84 730 29.14
23. k (mc0sta) 2,283 86.99 116.13 704 30.84
24. fatih (webfox) 2,281 83.50 113.09 732 32.09
25. praks (praks01) 2,233 93.70 124.74 813 36.41
26. Ramsey (tackheads) 2,221 87.10 123.05 684 30.80
27. neno (nenobid428) 2,189 95.05 129.29 956 43.67
28. chom (chomchomchomchomchom) 2,172 113.50 170.78 1,083 49.86
29. (sura5) 2,161 116.32 176.11 1,252 57.94
30. Ben (koppix) 2,154 67.83 87.41 450 20.89
31. (dawittymidget) 2,139 130.27 165.29 1,310 61.24
32. Colin (geosyog) 2,117 107.14 150.55 987 46.62
33. rilee_h443 (rilee_h443) 2,109 101.80 152.48 900 42.67
34. ¯\_(ツ)_/¯ (glandock1) 2,095 104.68 140.81 941 44.92
35. David (davelish) 2,094 54.00 76.71 280 13.37
36. Md Ubaid (mdubaid_ulllah000) 2,082 60.78 99.99 478 22.96
37. Martin (martinwong) 2,049 93.73 121.93 756 36.90
38. Kinesis (kinesis_quake) 2,032 130.27 159.09 1,331 65.50
39. Ton (2001or2) 2,023 104.03 147.28 905 44.74
40. tebond (tebond) 2,014 112.03 158.67 1,054 52.33
41. oneguardsam (oneguardsam) 2,000 84.45 120.98 526 26.30
42. joshua rose 🇵🇸 (joshu... 1,982 96.17 137.15 730 36.83
43. Am1n (vividus) 1,973 97.01 121.10 791 40.09
44. Wise (wiseuser) 1,952 90.79 133.60 532 27.25
45. Reaching (breakingpoint1) 1,947 73.12 106.82 508 26.09
46. Global (global_typer69) 1,930 78.16 113.55 525 27.20
47. wrists parallel (cheffray) 1,929 131.77 177.70 1,257 65.16
48. Bleedy Basket! (ninjismo) 1,921 83.36 110.71 556 28.94
49. (jasimk) 1,889 99.54 170.13 740 39.17
50. Hemant (hemu_sakunde) 1,870 71.34 102.54 490 26.20
51. StraightUpLuck ¯\_(ツ)_/... 1,866 103.02 144.83 813 43.57
52. (mononym_jisoo) 1,862 138.50 228.44 1,803 96.83
53. sdr4wkc48 (sdr4wkc48) 1,827 69.29 97.55 431 23.59
54. Mirkhad (cmirkhad) 1,825 86.21 129.22 659 36.11
55. (flaneur) 1,822 184.67 282.30 795 43.63
56. adsfjk (jbcabintoy14) 1,818 93.31 124.85 669 36.80
57. infinite (infinite_wotah) 1,802 64.92 93.98 374 20.75
58. Cowbell (morris_l) 1,763 120.55 188.85 995 56.44
59. meow (xrelative) 1,743 145.56 202.54 1,387 79.58
60. MUPH (muphine) 1,724 81.93 119.83 470 27.26
61. Adam (adamjason804) 1,719 105.40 151.08 744 43.28
62. swapneel (swapneel_das) 1,715 57.58 85.07 258 15.04
63. Stefan (fortress_king) 1,709 94.69 130.84 609 35.63
64. Julius (solenopsis) 1,705 103.83 131.54 730 42.82
65. unnamed (unnamedflower) 1,701 85.38 110.81 515 30.28
66. Naut38 (naut38) 1,697 77.24 105.51 354 20.86
67. stalkers (stalkers0418) 1,689 81.01 126.99 516 30.55
68. Dal (astronerd) 1,688 102.36 146.26 656 38.86
69. WheelieTron3000 (wheelietro... 1,686 83.66 109.68 502 29.77
70. Stupid (stupididiot9) 1,651 85.73 121.00 525 31.80
71. Des (desl) 1,638 75.76 114.00 458 27.96
72. Tom (tomme2009) 1,632 70.65 98.99 349 21.38
73. Grandpa (thedengue) 1,628 94.86 163.03 27 1.66
74. Sumit (smtchahal2) 1,628 149.44 193.79 1,348 82.80
75. King (kingthiccness) 1,626 86.84 116.41 508 31.24
76. Christos (__christos__) 1,623 70.08 94.26 410 25.26
77. Soufiane (shinigami25) 1,598 68.22 98.18 367 22.97
78. Rachel (rmsitar) 1,597 129.15 164.89 935 58.55
79. bayu (bayurespati) 1,574 66.98 100.21 355 22.55
80. nilb (nilb) 1,568 72.89 97.28 362 23.09
81. Marco (ankush12) 1,568 61.93 102.47 315 20.09
82. Angelic (angelic_devil) 1,549 108.59 146.70 791 51.07
83. (treje) 1,535 93.23 143.68 687 44.76
84. Patrick Bateman (amit__123) 1,534 54.75 92.21 259 16.88
85. James Paul (ap1ng) 1,527 53.79 75.04 206 13.49
86. Ninaad (saklas_33) 1,519 61.24 112.88 308 20.28
87. (tearsinrain) 1,518 112.56 164.30 782 51.52
88. harshil (monsta_001) 1,514 69.64 96.12 372 24.57
89. qwerty (qwerty235) 1,509 84.51 105.98 461 30.55
90. Ryan (potatoz10) 1,498 102.01 137.06 700 46.73
91. oussama (oussama2000) 1,495 45.19 62.04 141 9.43
92. Elkotte (elkotte) 1,495 110.31 143.76 775 51.84
93. asdf (blackbirdsigloo) 1,494 55.12 84.64 184 12.32
94. Suikyo (suikyo) 1,491 78.65 117.51 391 26.22
95. trick20 (trick2001) 1,490 81.17 116.17 386 25.91
96. griV (griv) 1,489 82.03 117.63 384 25.79
97. Davit (sonofar) 1,472 67.25 105.98 34 2.31
98. Gabriel (tacbacjack) 1,469 89.86 134.41 516 35.13
99. n o t h i n g (whyme__) 1,461 106.98 147.95 647 44.28
100. Tyler (exilereject) 1,458 83.76 125.50 405 27.78
101. Ja-kobe (jrutz26) 1,456 85.69 119.89 413 28.37
102. Ashish (almessi10) 1,454 72.39 98.37 386 26.55
103. Charles (charlesduran27) 1,452 114.66 144.45 731 50.34
104. bryan (bryan2010) 1,452 42.61 71.87 116 7.99
105. JP (supertyperguy2020) 1,449 57.35 74.45 202 13.94
106. monners (monners) 1,449 76.80 100.38 468 32.30
107. a sad story🎬 (xquyen) 1,442 93.24 123.99 534 37.03
108. Cosmic (aji3) 1,440 101.46 151.88 596 41.39
109. Cepheus's 🌌 (parkevan27) 1,434 131.43 175.04 881 61.44
110. Josh (cobra04) 1,434 48.66 69.06 94 6.56
111. swapneel (swapneel1121) 1,431 50.29 77.76 151 10.55
112. (charlieog) 1,428 131.92 224.05 1,052 73.67
113. (ginoo75) 1,427 137.55 249.12 1,057 74.07
114. Ad (shmldb) 1,417 50.80 70.42 122 8.61
115. Sudhir (sudhir_123) 1,414 52.06 70.54 131 9.26
116. Angel does it again (ha_saahn) 1,412 106.82 152.80 660 46.74
117. Nyiela (ncs1020) 1,411 68.67 100.40 346 24.52
118. Anku (gurooatwork) 1,410 60.20 81.11 263 18.65
119. Anh (_azh_) 1,402 81.87 124.74 410 29.24
120. Chris (chrishewson) 1,402 133.17 169.84 988 70.47
121. Luis (luisaes) 1,397 69.35 96.68 315 22.55
122. enminnrawr (zxcvbnm2001) 1,394 71.18 101.07 344 24.68
123. DOES KEVIN RUDD HAVE THAT I... 1,394 191.68 251.98 1,346 96.56
124. Mor (morti_20) 1,394 74.72 107.73 331 23.74
125. Aditya (adityapatel103) 1,393 55.42 72.33 175 12.56
126. Sagi (sagi73) 1,383 87.11 125.20 440 31.81
127. Abdulrahman karkalar (safi3... 1,375 48.30 79.45 130 9.45
128. スレトロン (slethron) 1,371 104.52 132.69 607 44.27
129. Eli Ferdinand Edralin (elfe... 1,371 98.65 132.99 564 41.14
130. A (dicktucker) 1,371 104.41 137.52 621 45.30
131. Eukalyptusbonbon (vogel_adler) 1,364 110.42 138.48 668 48.97
132. Ivan_Eagle (ivan_julia) 1,351 67.68 93.42 347 25.68
133. Claudio (tato41) 1,350 68.60 93.65 296 21.93
134. Sharif (sharif4747) 1,350 82.64 129.37 421 31.19
135. Derf (derfmongrel) 1,350 70.30 99.77 289 21.41
136. তন্ময়_2 (better_t... 1,349 104.16 139.74 635 47.07
137. Kapa (kassyk) 1,347 50.77 71.76 131 9.73
138. HD (hdcodecj) 1,347 81.54 108.18 362 26.87
139. Plinkiplonk (plinkiplonk) 1,325 111.30 156.63 610 46.04
140. Ishit soni (isrhtu_114) 1,316 57.54 84.08 257 19.53
141. yesman (yesman9527) 1,314 84.89 141.81 412 31.35
142. Shahil Suresh (roylar_range... 1,309 67.44 100.45 287 21.93
143. Elias (el_typo_jr) 1,300 74.73 109.47 302 23.23
144. Lucas (st3ezy) 1,291 76.58 102.58 318 24.63
145. Lara (chuiicdhk) 1,289 80.40 120.64 413 32.04
146. tivo (tivotavo) 1,287 96.96 147.87 518 40.25
147. dinqissa (dinqissa) 1,287 80.46 128.64 324 25.17
148. Abhisek (_typing_) 1,284 88.10 113.56 411 32.01
149. auoaeu (aoeuhe) 1,283 81.04 106.58 358 27.90
150. Can (cazzed) 1,279 87.04 124.04 388 30.34
151. Gerben05 (gerbenklapwijk) 1,273 61.02 85.18 228 17.91
152. tbj77 (tbj77) 1,270 65.30 86.93 317 24.96
153. Malaysian Man (xxmlgsniperxx) 1,264 110.17 148.36 595 47.07
154. Gon (frixgon) 1,260 75.61 98.65 316 25.08
155. Sylvie (eat_my_dust_batches) 1,259 83.90 118.84 387 30.74
156. tstats[yju98039] (yju98039) 1,258 90.54 141.59 452 35.93
157. Drews (drwsmnlpg) 1,253 85.11 113.22 373 29.77
158. Benjamin (tryingtouse10fing... 1,250 97.22 131.83 487 38.96
159. Manmit (manny_the_potato) 1,247 83.36 116.64 327 26.22
160. Ra (rayap1010) 1,246 79.45 106.83 346 27.77
161. s3rez (s3rez) 1,238 140.65 186.85 967 78.11
162. صبر (morocco01) 1,231 86.60 123.33 397 32.25
163. Abdulaziz (mubailesh) 1,220 88.87 116.71 400 32.79
164. David (davidpit) 1,219 49.89 73.21 180 14.77
165. Gustaf (gusco933) 1,214 90.69 132.95 382 31.47
166. Logan (theperson60) 1,206 117.30 151.69 612 50.75
167. KIARA (atherynbane) 1,202 83.52 123.90 357 29.70
168. Deshant (djtype2124) 1,199 60.78 93.83 248 20.68
169. Dark (dark_byte) 1,198 79.92 114.42 340 28.38
170. Manol (ari3s) 1,198 81.38 111.90 329 27.46
171. WILMER (handsometomato) 1,195 63.16 94.88 222 18.58
172. Nguyen (rainfall1611) 1,187 93.64 129.59 450 37.91
173. adsf (max_m7) 1,182 101.04 144.36 467 39.51
174. Jaska (jarlewski) 1,182 73.91 103.28 295 24.96
175. Alien (half_alien) 1,181 85.60 117.04 366 30.99
176. jacktheboy211 (jacktheboy211) 1,180 106.92 144.66 547 46.36
177. Ali (ali_pro) 1,180 55.80 80.05 154 13.05
178. Ramses (boinkey) 1,179 87.63 125.10 335 28.41
179. Henry (henry_21) 1,177 43.66 63.16 96 8.16
180. trendy (strongly_typed_trendy) 1,175 59.41 90.32 215 18.30
181. LockStock (lockstock) 1,170 99.69 129.66 442 37.78
182. Michael (kedalg) 1,170 63.59 86.26 222 18.97
183. AKGD (akgd) 1,170 90.75 115.09 425 36.32
184. 雲煙成雨 (1eonardo) 1,167 75.74 108.83 302 25.88
185. Dang Hai (haidanghoang178) 1,165 78.39 104.53 301 25.84
186. ankit (ankitthegreat) 1,160 86.44 109.88 361 31.12
187. Shukuphido (shukuphido) 1,154 66.68 83.29 259 22.44
188. fdsafdsa (szesz) 1,150 77.40 103.32 283 24.61
189. 👋youtu.be/AXNeUMDP3no (o... 1,144 95.65 143.28 482 42.13
190. Zohaib (atazoa) 1,144 59.20 93.35 222 19.41
191. chopst1cksss (chopst1cksss) 1,134 118.12 147.30 660 58.20
192. arijan (arijan_dh) 1,134 130.38 189.19 775 68.34
193. pythagoras (123pythagoras123) 1,134 86.27 119.93 309 27.25
194. Richard (dicklash) 1,131 99.33 128.73 438 38.73
195. SPEXINDER (forest7) 1,129 108.91 152.46 561 49.69
196. Wayne (samehadenough) 1,128 84.00 114.53 342 30.32
197. Typeracerer (typeracerer2020) 1,120 65.47 84.73 242 21.61
198. Colemak Lost (_champ_) 1,111 121.84 175.75 622 55.99
199. Maters (maters48) 1,109 62.86 86.95 210 18.94
200. kim (kim_1409) 1,109 125.54 185.81 706 63.66
201. HudYA (hudyusuf) 1,108 69.32 95.17 250 22.56
202. 0O00O0O0O0O0O0 (bunnystacker) 1,107 79.81 111.72 304 27.46
203. Joel (joel6677) 1,103 105.01 138.08 490 44.42
204. Ritik (beast2402) 1,099 56.56 79.71 155 14.10
205. Ivan (expl1icity) 1,098 83.66 107.49 301 27.41
206. Shivam Kumar (sks123_) 1,096 64.42 97.44 234 21.35
207. i love typing!!! (hebibuki) 1,096 104.96 142.13 454 41.42
208. Erdenebat (speed8019) 1,091 65.19 93.55 259 23.74
209. Korezu (nyanuwin) 1,090 69.67 97.66 223 20.46
210. lobus (lobus_rec) 1,089 97.05 128.26 420 38.57
211. Tinumír (tinumir) 1,086 100.38 125.01 481 44.29
212. zyyy (zyyyyyyyz) 1,077 64.75 94.65 251 23.31
213. i talk to the wind (pastash... 1,075 148.50 269.30 757 70.42
214. Ji (urzz4eva) 1,074 113.17 157.52 544 50.65
215. Artem (gushinartem) 1,071 87.88 135.69 364 33.99
216. Sandro🇬🇪 (jolskey) 1,069 87.02 128.17 338 31.62
217. Operation Sindoor Rocks (pr... 1,063 56.99 86.44 175 16.46
218. fella (fellasaurus) 1,060 60.73 78.25 171 16.13
219. glerou (tudesci) 1,058 90.04 124.52 339 32.04
220. Daniel (smartdevilno) 1,058 76.60 99.37 250 23.63
221. subham (subhamrawat) 1,054 85.59 120.22 269 25.52
222. james (awesome4aces115) 1,053 80.17 133.39 275 26.12
223. Innocent (saquelain) 1,048 68.02 98.94 222 21.18
224. tstats[brandonisstupid] (br... 1,048 89.91 126.27 355 33.87
225. Type (granwizard) 1,046 85.91 117.41 376 35.95
226. lettel (lettel) 1,037 89.07 114.84 315 30.38
227. shuffled neurons (spicytuna1) 1,036 143.75 194.81 69 6.66
228. IRAN PAKISTAN WIN WAR USAAN... 1,033 97.89 127.16 427 41.34
229. Jashe (freshfastjashe) 1,029 167.66 212.33 826 80.27
230. (peaceinchrist) 1,027 120.30 160.56 577 56.18
231. Tim (timlee) 1,024 36.20 51.76 54 5.27
232. Σπύρος (asos11) 1,020 62.26 91.38 198 19.41
233. Andrè (andrree) 1,020 77.62 109.45 251 24.61
234. Typerx (newtyperx) 1,016 95.23 131.95 370 36.42
235. Carmel (m_carmel) 1,008 111.38 147.10 489 48.51
236. 🎈k (konnomon) 1,000 92.43 115.84 357 35.70
237. (jlam55555colemak) 1,000 126.53 170.26 631 63.10
238. Matthew (kylehyde) 997 86.67 116.61 279 27.98
239. jk5621 (jk5621) 995 59.99 82.95 188 18.89
240. 🐍🐍🐍 (despot) 993 154.99 222.45 755 76.03
241. shadmehr (megacrocodile) 990 71.64 101.76 221 22.32
242. alshbalasle (hadisulfe) 988 47.30 70.68 101 10.22
243. Finley (blindfish) 988 77.81 112.40 233 23.58
244. Adarsh M A (adarshm39) 986 51.33 67.55 130 13.18
245. Orka (orka) 979 60.58 78.98 186 19.00
246. Ovidiu (ofydd) 979 111.49 136.99 469 47.91
247. Tommy (dextonjl) 978 114.92 160.00 489 50.00
248. Adrian (adrianvn789) 975 97.47 132.01 423 43.38
249. (´・ω・`) (gahama) 973 126.57 172.14 643 66.08
250. Huy (cross546) 973 55.19 74.45 116 11.92
251. Fallen (giorgiv4) 972 95.50 135.17 390 40.12
252. juswawawa (juswawawawawa) 970 93.05 133.28 368 37.94
253. 💀💀💀 (gospell) 970 113.82 162.29 486 50.10
254. Om (omkashyap007) 965 58.70 85.07 170 17.62
255. Cloud (cloud_bolssom) 965 77.12 115.77 235 24.35
256. jaso (jasocanfly) 957 89.54 133.61 316 33.02
257. AJ (aayushjoshi) 957 57.46 86.20 187 19.54
258. φσ (phi_sigma) 956 62.29 81.65 191 19.98
259. Md Shamim (cseshamim47) 950 62.53 85.62 182 19.16
260. neeraj (neeraj902) 949 73.92 100.09 248 26.13
261. 144p 1998 VW Beetle (stryke... 945 111.69 156.19 467 49.42
262. (◍•ᴗ•◍) (ibi4645) 944 67.88 111.04 561 59.43
263. Birdman (birdman13) 944 79.60 104.40 314 33.26
264. TypingMaster3 (typingmaster... 938 100.68 136.27 384 40.94
265. Xi Jinping (wuhan_virus) 933 69.94 98.12 217 23.26
266. Amarjot (apandher) 933 113.77 155.82 465 49.84
267. Type like never before! (re... 932 101.36 143.82 393 42.17
268. Nyamsick Adrian (minyamisu) 932 55.12 84.26 134 14.38
269. lhdrive (kickmic) 931 63.09 85.92 189 20.30
270. mamoud (__mahmoud__) 930 47.49 66.46 83 8.92
271. Prithbiraj (prithy) 930 62.93 90.33 239 25.70
272. Paolo (invelt) 929 109.46 139.53 484 52.10
273. fazel (the_slow_typer_14wpm) 929 46.92 66.02 88 9.47
274. mohan (mohan2002) 924 73.99 99.58 240 25.97
275. Edward (kailhreds) 924 84.99 109.75 269 29.11
276. Mazhar Andalib (mazharandalib) 923 79.75 117.58 284 30.77
277. Ara Ara (vinhwiu) 922 74.21 106.60 239 25.92
278. Jason (jasonjohnsj27) 922 95.03 141.27 378 41.00
279. Yash (yashshingade28) 921 87.40 116.14 341 37.02
280. Michael (michaelch) 921 97.05 136.99 366 39.74
281. cheikh (cheikhbr) 921 59.28 84.57 158 17.16
282. Saucter (saucter) 920 88.03 118.87 296 32.17
283. kekw (kekwomegalul) 920 132.07 173.98 638 69.35
284. L (easymoneysniper1) 920 131.31 184.00 556 60.43
285. FoTGReckless (fotg_reckless) 916 103.31 130.51 388 42.36
286. jun (jun0sck) 914 79.68 112.41 228 24.95
287. onii-chan (cinnamonorange) 911 76.18 110.02 234 25.69
288. sməxy (smexyflako) 910 102.52 136.70 361 39.67
289. BBB (beermindnor) 910 70.49 96.06 221 24.29
290. monochrome (artemis_05) 910 101.32 132.00 361 39.67
291. Kevin (zhengfeilong) 908 127.07 167.55 539 59.36
292. Ricky (suthxx) 907 36.56 56.72 72 7.94
293. Anthony (goldfrog) 906 55.56 88.54 116 12.80
294. Surya (maurice_mordor) 906 43.22 64.03 60 6.62
295. Jacobo (inztincz) 905 75.82 117.56 224 24.75
296. mrgiorgoulis (mrgiorgoulis) 904 80.97 123.10 248 27.43
297. J-Money (jacobbeaudway) 902 78.42 108.96 239 26.50
298. Lactophenol Cotton Boy (tpy... 901 103.18 140.58 389 43.17
299. Brendan (brendalandan) 900 85.95 115.72 218 24.22
300. Ez (ezpass) 897 78.48 112.82 292 32.55
301. abdullah (abdullah_ui) 897 108.58 149.91 461 51.39
302. The cute girl likes pink (o... 895 117.96 152.37 506 56.54
303. Nick (1truelipstick) 895 111.78 161.78 436 48.72
304. Leo (leotwelve) 891 79.84 101.29 223 25.03
305. (yeekidd) 889 95.81 146.01 339 38.13
306. account deleted (concurrent) 889 100.10 137.17 21 2.36
307. Ankit Kumar (ankitnain) 889 87.38 119.81 612 68.84
308. keiwpie (keikuuuu) 887 93.19 124.21 350 39.46
309. sdfg (nerus_k) 886 39.68 58.49 76 8.58
310. Zak (villzzz420) 885 50.43 76.75 109 12.32
311. jello_jello (jello_jello) 885 109.20 137.06 454 51.30
312. Abu (abu_hussain_03) 885 76.87 100.68 231 26.10
313. Sayandip (sayandip199309) 883 76.60 99.45 232 26.27
314. matan (malsonic) 883 77.87 127.21 240 27.18
315. sudheer singh (justsudheer) 882 65.50 91.00 211 23.92
316. Calvin Low (benderium_123) 881 79.94 100.19 244 27.70
317. Adarsh (krishnan7) 879 60.06 81.55 147 16.72
318. Oliver (rgroli) 878 60.84 81.20 147 16.74
319. Ravi (ravishankarr) 877 47.67 69.41 96 10.95
320. omar (omar_elsayed) 876 56.95 84.40 125 14.27
321. Carlos (carloszapata) 874 63.97 90.14 207 23.68
322. Please use an appropriate n... 873 49.99 71.46 95 10.88
323. (khronic) 873 119.40 154.56 522 59.79
324. Dan (cantdecidedan) 872 65.01 96.90 230 26.38
325. Vashista (vashista) 870 70.69 98.13 208 23.91
326. Densetsu (densetsunobattousai) 869 74.44 98.91 266 30.61
327. SimplyOrange (simplyorange) 867 92.85 122.47 302 34.83
328. Petar (petar17) 866 62.06 82.20 163 18.82
329. heartbeats (jack777) 864 105.91 145.75 366 42.36
330. farzan (farzanhges) 862 93.52 131.23 378 43.85
331. Thinh (thinhtr) 861 78.53 103.84 261 30.31
332. (rayer) 856 117.09 168.57 459 53.62
333. Keira (keiradawn) 856 93.41 119.94 323 37.73
334. philiplol (philiplollll) 855 65.52 91.07 164 19.18
335. John (happyguy2000) 855 52.12 66.38 69 8.07
336. Jonathon (goodstuff11) 852 101.79 148.11 347 40.73
337. dotdotdot (atuladhar1) 848 67.34 97.85 188 22.17
338. (paceyq) 845 132.77 172.58 547 64.73
339. Ivan (ivannechaiev) 845 82.12 106.77 230 27.22
340. Fauggesim (fauggesim) 845 40.25 56.57 60 7.10
341. Kyrgyzstan (zhanarbek) 844 69.06 96.29 197 23.34
342. Ahnaf (stallion1145) 844 73.97 102.60 198 23.46
343. Rishav (rishavmngo) 841 76.82 105.41 211 25.09
344. Big k (lawda) 839 59.82 91.62 168 20.02
345. Lil Mama (ckennedy07) 839 87.95 109.80 232 27.65
346. Vanshraj (vrsempire601) 837 73.13 102.11 208 24.85
347. Almaz (almazzz1) 835 64.05 91.42 225 26.95
348. Winnie (win_) 834 84.55 104.38 228 27.34
349. mahmoud shalhoub (mahmoud77) 833 35.97 52.55 83 9.96
350. The Real Snail (kelvin_paul) 833 98.50 122.83 306 36.73
351. Cameron (sigmaimu) 832 99.40 134.70 284 34.13
352. Free Palestine 🩸🫸 (mo... 832 100.64 141.61 304 36.54
353. Sewnkin (sewnkin23gg) 827 91.43 122.05 296 35.79
354. Kerb (kerby_berby) 827 124.71 175.80 468 56.59
355. Omni (omzi) 826 72.99 116.05 214 25.91
356. Mishel (holosight) 824 76.27 113.70 190 23.06
357. Akash (swfu_akash) 821 75.47 106.67 221 26.92
358. Chrism4 (chrisman44) 818 59.72 86.15 147 17.97
359. QwertyBaguette (smellybague... 817 98.07 121.63 330 40.39
360. Miccalo (miccalo_dv) 817 48.99 92.52 98 12.00
361. Brenden (embracesc2) 812 65.34 96.19 186 22.91
362. Lara (goddess_111) 811 94.29 147.81 294 36.25
363. sugdese (sugdese) 809 69.18 97.58 179 22.13
364. big daddy (shivdatt_op) 809 64.68 98.52 170 21.01
365. Nabeel (nabeelz) 809 76.24 99.79 205 25.34
366. Josh (the_josh) 805 95.36 128.79 317 39.38
367. travdong (travdong) 800 80.52 107.92 197 24.63
368. Max (maxijazz) 799 98.93 132.55 361 45.18
369. rinas (dont_look_at_keyboard) 797 30.86 43.85 74 9.28
370. Trung (danghoangtrung) 797 54.90 82.09 95 11.92
371. Blue (terry25031069) 796 82.20 105.56 210 26.38
372. Saulius (zemfry) 793 91.84 115.31 256 32.28
373. Youssef (sec5x) 793 99.26 125.01 317 39.97
374. subham (syt03) 792 45.64 64.98 99 12.50
375. bleh (devcappy) 792 97.60 146.50 297 37.50
376. David (tintedrange) 790 79.62 110.32 216 27.34
377. Alenygam (provola23) 789 115.48 154.43 425 53.87
378. skippi (skippie) 788 130.53 175.06 490 62.18
379. sharaf (sharaf_makk) 788 62.40 80.90 137 17.39
380. Dhruv (codenta) 788 45.74 66.54 72 9.14
381. Daniel (kool_beenz) 786 66.57 95.05 158 20.10
382. Workman (dagl200) 786 87.13 115.06 245 31.17
383. अध्ययन Adhyan (... 786 50.28 74.54 95 12.09
384. John Anthony (therewere3) 785 61.48 80.92 155 19.75
385. Ramsudhan (sudhanlee) 784 58.22 75.26 115 14.67
386. An (iaman) 783 93.27 118.91 282 36.02
387. John Paul (jp_ramolete16) 782 48.21 65.69 84 10.74
388. mimi (xvni) 777 67.81 86.75 157 20.21
389. Jarod (terminuszwei) 776 102.32 149.66 323 41.62
390. NiteCyperTTV (nitecyper2) 774 137.90 180.98 555 71.71
391. ARK (qwerty account) (arkfr... 773 81.34 105.10 196 25.36
392. ros (heyokay1234) 772 70.49 102.02 188 24.35
393. AxiomDestroyer (axiomdestro... 772 108.78 135.73 368 47.67
394. Andrea (andreavanderjagt) 772 91.17 128.19 250 32.38
395. uty (tisurend) 771 101.63 145.17 315 40.86
396. ASIAN47 (asian47) 771 90.82 131.77 284 36.84
397. nopsky (nauyusimi_) 770 108.83 133.43 351 45.58
398. Anant (hero_shukla) 770 96.30 128.56 303 39.35
399. danniponcho (dponchos) 770 95.09 128.65 276 35.84
400. Filip (hummelur) 769 74.23 98.25 205 26.66
401. Gagan (gagan18) 768 90.01 132.29 269 35.03
402. Tewtadle (tewtadledesktop) 767 91.33 123.96 263 34.29
403. SLSL (slslz) 767 74.07 116.03 185 24.12
404. liz (hamid__) 767 109.18 136.27 373 48.63
405. Tejas (crimcrim) 767 74.42 104.26 196 25.55
406. ghost (theghostbehindyou) 764 56.69 83.86 111 14.53
407. tstats[barockt] (barockt) 763 95.32 119.99 279 36.57
408. fasttyperLoading (fast_type... 763 37.41 55.04 58 7.60
409. (joshua728) 762 221.42 310.07 728 95.54
410. InCredH (harsh_hegishte) 762 83.08 132.63 231 30.31
411. Ayvan (dharmablade) 761 86.68 118.34 231 30.35
412. wakeupvarn (varnontyperacer) 760 101.57 133.09 302 39.74
413. peeush (piefkr) 760 38.67 63.72 49 6.45
414. Anguu (anguubeef) 760 99.23 125.22 301 39.61
415. Ahmad (ahmadmozaffar) 759 73.50 114.70 185 24.37
416. Amar (supatypaxxx) 758 89.96 123.90 273 36.02
417. tstats[parth812] (parth812) 758 55.37 79.60 100 13.19
418. HadiToori (haditoori) 758 78.43 109.56 235 31.00
419. Dana (danayi) 758 126.37 173.49 491 64.78
420. C (ccc123) 757 94.81 123.16 263 34.74
421. hellisgood (hellisgood) 756 62.32 81.88 166 21.96
422. LastSlice (cezara) 756 60.19 84.84 118 15.61
423. 🌹 Black Rose 🌹 (rosew... 755 149.54 184.99 600 79.47
424. Samuel (sambabzz) 754 46.34 68.51 65 8.62
425. yuupoipoi (mimicclone) 754 68.39 89.95 175 23.21
426. piconeeks (piconeeks) 752 98.76 133.71 285 37.90
427. flyaway (saltybaby) 751 69.54 102.10 294 39.15
428. run thru the finish line (p... 750 137.21 170.19 515 68.67
429. PicturingFrames (frame_abil... 750 87.51 135.92 235 31.33
430. Callum (cal_a_mari) 750 53.61 72.43 87 11.60
431. Feynex (imhidayat) 747 103.16 145.43 300 40.16
432. goraput (boom1749) 747 74.22 110.13 187 25.03
433. t̶̢̤͇̪̱̮̿̓̓̕͜ͅ... 746 95.57 132.42 273 36.60
434. Ivan (ivantakashi) 745 90.11 138.20 243 32.62
435. arena (arenacloser204) 745 90.66 136.63 219 29.40
436. Laith (chaoscontrol_jr) 744 63.69 87.44 210 28.23
437. bub (bubmaley) 742 106.29 138.33 333 44.88
438. Mr.Pemguimn (nhatltm) 741 78.10 132.09 250 33.74
439. Felix (promeneraren) 740 113.42 162.61 337 45.54
440. nonquitvinpho (nonquitrainb... 740 115.53 164.74 324 43.78
441. john (nothisisjohn) 738 170.54 205.37 687 93.09
442. Mohammad (mhmmdkholani) 738 38.66 59.58 58 7.86
443. Tang (tangvt97) 736 63.99 83.23 145 19.70
444. Rika (infric) 735 132.11 161.68 36 4.90
445. Ryan (rjbunge99) 734 81.59 105.25 190 25.89
446. Baked and Buttered (mcallen... 730 114.48 167.97 338 46.30
447. Aggy (tuigovno) 728 78.78 111.19 226 31.04
448. Milka (mille993) 728 50.73 67.13 66 9.07
449. anurag tara (fastest_racer) 728 52.00 74.95 85 11.68
450. Idris (kakashirero) 727 77.51 114.03 233 32.05
451. ⠈⠁ᵀ ᴱ ᴵ ᴸ ᴼ... 724 117.63 154.07 364 50.28
452. uzi (cray_f) 724 72.48 98.88 172 23.76
453. derusting (paradoxpigeon) 722 154.93 195.52 652 90.30
454. Tiddy (tiddytwister) 721 94.75 128.19 250 34.67
455. Aelyos learns to type (aely... 721 50.85 71.29 82 11.37
456. Tobbe (tobbedman) 720 80.30 107.01 190 26.39
457. Qwerty (qwerty80801) 720 96.16 126.22 265 36.81
458. (naturaladoption) 719 95.67 156.42 234 32.55
459. Chaddley (chadracer69) 719 94.43 129.14 240 33.38
460. Said (saidenhide) 717 91.69 129.01 260 36.26
461. szymi_gold (szymi_gold) 715 66.80 90.85 156 21.82
462. RIP BYRON (sk8terboi723) 715 145.43 187.97 540 75.52
463. ឡានប្រណាំ... 714 64.41 95.30 162 22.69
464. Luis (chapibol) 714 74.04 95.14 152 21.29
465. akash (akash_sharma) 714 53.23 69.71 120 16.81
466. Ali (imtew_much) 713 81.33 106.21 192 26.93
467. Ravi (ravimajhi) 712 49.25 70.10 83 11.66
468. JCRueco (shizile) 710 83.94 113.44 223 31.41
469. LB (man_onatree) 708 104.07 139.93 324 45.76
470. Ornstein (eliggett) 708 90.16 115.10 241 34.04
471. stop! (ademke) 708 119.21 164.85 387 54.66
472. maxbaldy (maxbaldy) 708 40.47 56.76 44 6.21
473. Vroom! (laptopguy) 706 96.32 137.48 271 38.39
474. Derek (derekkeiley) 706 72.92 92.32 151 21.39
475. sir (zenzir) 704 86.80 119.30 222 31.53
476. waterismagnificent (wateris... 704 100.91 136.98 299 42.47
477. asdfjkl; (deskripper) 704 146.26 201.84 536 76.14
478. Upmanyu (abhishek2175) 704 78.85 100.51 191 27.13
479. Anupam (plaanupam) 703 80.92 103.09 201 28.59
480. Nibblet (nibbletdaking) 700 57.57 79.28 83 11.86
481. Jackalope (jackalopy) 699 107.29 131.11 329 47.07
482. tstats[inbredturtle] (inbre... 699 94.94 130.63 252 36.05
483. Zhuldyzay (zhuz12) 698 64.45 90.58 156 22.35
484. Nika (tinysalmon90) 698 103.46 130.39 299 42.84
485. Billy (oatmeal417) 698 102.34 131.49 319 45.70
486. Gatsu (ace27) 696 52.58 71.68 76 10.92
487. Noah (nodigermanium) 694 89.25 118.09 207 29.83
488. JollyImpulse (jollyimpulse) 694 107.61 140.92 303 43.66
489. Jun Sheng (my40789) 692 71.23 95.36 184 26.59
490. Lane (laneondvorak) 691 85.70 130.96 193 27.93
491. Slethron (fastslethron) 689 102.44 133.57 295 42.82
492. Vignesh (viggie) 688 77.11 100.75 191 27.76
493. Steve (stev_cubed) 688 151.84 189.63 595 86.48
494. camelCase (saisrikantta2) 688 65.12 85.31 137 19.91
495. phlofy (phlofy) 687 135.66 183.84 479 69.72
496. GiftedOtter (giftedotter) 686 106.35 144.88 298 43.44
497. David (dcohen91) 685 98.35 142.14 275 40.15
498. daksh (daksh_2106) 683 65.57 85.69 148 21.67
499. Andy (andy3j) 683 64.79 83.31 161 23.57
500. Max (tehbomb123) 681 79.94 109.36 142 20.85
501. Guddu Jaisawal (suraj_6732786) 680 47.07 70.92 65 9.56
502. Rauhan (rauhan1998) 680 64.80 92.59 160 23.53
503. Manish (mkn0079) 680 54.53 80.27 103 15.15
504. OneRandom (one_random_typer) 679 78.59 100.25 166 24.45
505. LeBaby (funnypoopyeater) 679 99.14 133.88 268 39.47
506. Juan Martín (juanma2700) 675 95.47 117.95 226 33.48
507. raghu (r_strike9437) 674 68.84 90.94 168 24.93
508. E (weihceinre) 670 150.57 202.92 558 83.28
509. Vasanth Raja (vasanthraja) 668 93.67 121.98 214 32.04
510. Gaussian (ndrous20) 668 80.36 105.39 154 23.05
511. John (jakw93) 668 61.02 78.21 134 20.06
512. EconEdgeLinch (linch8) 667 84.69 109.53 192 28.79
513. Jay (dicknm) 667 65.58 87.64 143 21.44
514. Mohammed (modh_) 666 54.88 72.02 56 8.41
515. Aaron (liron2007) 666 38.68 58.60 53 7.96
516. Grzesiu (grzesiubonzo) 665 73.49 102.26 151 22.71
517. mohit (madara989) 664 48.97 70.39 68 10.24
518. Kok Kun (kokkun92) 664 82.12 117.99 188 28.31
519. ayorgo (ayorgo) 664 72.32 90.79 168 25.30
520. Gabe (dyrozang) 662 115.18 158.61 335 50.60
521. 🔰Rayster (rayster1) 660 85.51 117.06 197 29.85
522. J (ckfhd1234) 660 63.17 77.12 133 20.15
523. Gerard (gerard_m_m) 659 70.57 100.46 185 28.07
524. name (anson001) 659 111.15 152.57 289 43.85
525. aaaaaa (hagemanto) 658 83.20 107.44 173 26.29
526. DrLawL (drlawc2) 658 150.74 191.10 553 84.04
527. Nicholas (nicholaswong03) 657 91.45 148.10 236 35.92
528. Siri (sireon) 657 62.62 83.37 127 19.33
529. Shaurya (shaurya2399) 656 106.67 131.36 365 55.64
530. katapi (catapie) 653 98.46 125.37 249 38.13
531. varun (vakot) 651 55.34 74.36 98 15.05
532. Apollo (ahollo) 651 76.86 101.33 170 26.11
533. Prasant (man_iac) 650 96.90 124.60 266 40.92
534. ben (benwang1) 649 80.26 108.54 175 26.96
535. siriusvega TGG-4Q4TGYRIWG (... 648 133.15 168.96 452 69.75
536. tstats[medo_1010] (medo_1010) 648 79.98 116.37 171 26.39
537. 👶 (a_baby) 646 128.20 159.59 417 64.55
538. jazk (axaladyx) 646 100.08 134.50 259 40.09
539. Ayan (ayan_007) 645 60.94 78.25 128 19.84
540. Gerardo (sewingbunion9) 643 57.70 82.69 100 15.55
541. Karl (relentlesstyper) 643 96.16 124.88 238 37.01
542. fratelecarol (fratelecarol) 643 76.75 110.95 185 28.77
543. Tiago (doodoo11) 643 82.06 111.89 169 26.28
544. PMC (pmcc) 642 75.78 105.79 144 22.43
545. itsmin (itsminbin) 642 83.95 112.02 182 28.35
546. Indeed (indeed001) 642 64.12 90.83 148 23.05
547. Tyler (tjking12) 641 88.55 121.87 208 32.45
548. Kevin (kevincamilo) 640 76.58 100.17 130 20.31
549. hyp (hyprix) 640 92.05 136.22 193 30.16
550. Santiago (drebexler) 640 97.79 137.88 229 35.78
551. atef (atef_7534) 640 67.10 111.47 160 25.00
552. Marvuw (hotdog1234444) 639 72.65 99.79 145 22.69
553. Dvorak (blazeencryption) 639 106.89 151.58 259 40.53
554. starry nights (iamsatanic) 638 77.58 122.36 152 23.82
555. Ryan (direwolf05) 637 103.27 131.52 227 35.64
556. Pranav (pgracer25) 636 48.06 81.39 59 9.28
557. Theo (theodosis_aga) 635 93.37 134.14 198 31.18
558. Nicolas (typekaiser) 632 70.85 101.49 165 26.11
559. Taylor (taylor_1121) 632 81.90 114.09 193 30.54
560. corrode (nothanksgiving) 632 119.05 168.51 314 49.68
561. Kabir (kabir_1234) 632 54.57 75.30 88 13.92
562. dva main (thedragonemperor) 631 149.76 209.71 486 77.02
563. a (3lim64) 627 98.54 128.37 221 35.25
564. MrButtersworth (flapjackstax) 626 114.33 137.22 300 47.92
565. Shivam (exergo) 626 74.18 97.88 164 26.20
566. amanullah (amanullah32) 626 85.02 115.39 208 33.23
567. Nico (monnerford) 626 69.68 85.70 138 22.04
568. China (dvorak_king) 625 95.70 146.30 230 36.80
569. Nobody (anhddo) 625 77.83 102.38 159 25.44
570. Habib (habibmalik) 624 83.65 111.09 189 30.29
571. Pragyan (satisfiedmagma) 623 52.44 74.96 91 14.61
572. Mrinal Anand (mrinal_anand) 623 46.93 63.65 61 9.79
573. Serg (drgsus) 623 115.54 156.18 305 48.96
574. timefaker (timeassassin) 622 79.19 109.16 151 24.28
575. Lagom (thelagom) 622 91.19 149.10 208 33.44
576. Ryo (ashida4) 621 99.72 132.69 246 39.61
577. Arash (me_races) 620 50.32 81.54 88 14.19
578. George (stamoulohta) 619 67.48 86.52 148 23.91
579. Andre (andr_ehh) 619 74.82 106.51 161 26.01
580. (floofyaltaria) 618 129.92 169.97 390 63.11
581. anty (antyboi) 618 110.17 149.30 285 46.12
582. Raja (mmahmoodh) 617 82.13 105.68 184 29.82
583. floof (flooffy) 617 95.48 127.40 211 34.20
584. Aryav (aryav123) 617 78.67 116.81 184 29.82
585. Shahbaz (thisisshahbazsb) 616 64.61 80.03 133 21.59
586. abhishek (abhi1912) 616 46.36 68.63 134 21.75
587. Swifty2997 (swifty2997) 615 60.25 76.13 100 16.26
588. Vivek (kill3rking) 615 69.64 91.84 150 24.39
589. Don't bully me plz (dontbul... 615 77.58 114.62 165 26.83
590. Moronic Typer (yong955143) 614 103.04 127.30 278 45.28
591. Charly (swagzzzzz) 613 78.06 121.71 140 22.84
592. mainto (manito7) 613 58.39 80.44 106 17.29
593. Julish (julish13) 613 45.08 59.66 58 9.46
594. Nguyen (nanoforge) 612 66.29 86.18 128 20.92
595. kunal (kunalmachra) 612 84.49 113.10 181 29.58
596. Zi Hao (im_getting_there) 612 77.29 111.29 165 26.96
597. Neodymium (neodytrium) 611 106.81 143.76 269 44.03
598. 🚀 🚀 🚀 (patrickhirsh) 610 76.25 107.91 117 19.18
599. F (lawlnoodle) 610 95.50 123.72 220 36.07
600. 初めは40wmp (hajime40) 610 92.39 118.60 212 34.75
601. Mike (mikety1) 609 49.63 66.84 47 7.72
602. Tien (thetientran) 608 114.70 181.20 331 54.44
603. hafizh (effortlesshuman) 608 47.85 70.07 51 8.39
604. Koupka (koupka) 607 76.96 108.13 168 27.68
605. Supporting Israel (zombiesw... 606 176.20 256.87 436 71.95
606. rishh_ (imrishitpant) 606 65.51 113.82 148 24.42
607. maltinyu (maltinyu) 605 64.40 94.88 136 22.48
608. Started from 3wpm (the_op_p... 603 36.89 60.08 48 7.96
609. Hassan (hamoro) 602 80.18 105.89 135 22.43
610. (e6f4e37l) 602 158.13 213.08 533 88.54
611. Helloween (tranduclocbkmail1) 601 66.77 83.92 146 24.29
612. Naman (naman1601) 600 86.48 133.22 295 49.17
613. P (kwerta) 600 81.10 105.65 164 27.33
614. Electronica__ (electronica__) 600 99.73 126.40 263 43.83
615. wil (wilruns) 599 120.92 159.14 339 56.59
616. Joe (joetelefair) 598 89.91 116.42 227 37.96
617. hilpitome (hilpitome) 598 40.75 61.77 57 9.53
618. i_type_fast_with_good_postu... 597 73.35 112.75 169 28.31
619. Dev (devgupta55) 595 70.99 94.07 134 22.52
620. Xander (xandejesus) 594 107.86 133.61 264 44.44
621. Markycuh420 (theitfactor) 594 93.22 127.83 210 35.35
622. Harshith (ghvsama_123) 594 55.84 77.48 103 17.34
623. ginginggaang (cremleme) 593 86.30 120.33 181 30.52
624. Saiyn (saiynssgssyr) 592 79.11 107.93 141 23.82
625. Lex (pyxelwolf) 592 86.22 110.97 175 29.56
626. Springfield (springfield1903) 591 62.77 87.37 151 25.55
627. shui (sammi76) 591 86.91 115.49 193 32.66
628. Jwickblack (hellwood) 591 83.86 114.22 185 31.30
629. Franco (rubikute) 589 76.52 102.05 143 24.28
630. rocket (mythicalrocket) 589 178.50 222.91 516 87.61
631. hi (ihssm) 589 51.93 72.18 62 10.53
632. Lemonade on Meth (riqlemonade) 588 81.07 116.90 170 28.91
633. CJ (bighiest) 587 99.93 139.10 266 45.32
634. typeyMcTypeFace (mslib9) 586 98.65 129.78 248 42.32
635. Choco (choco22) 586 101.03 159.91 241 41.13
636. (majernja) 585 72.96 97.57 128 21.88
637. Vincent (filtertype) 585 83.90 114.07 188 32.14
638. Nick (coyote96) 585 97.32 119.00 237 40.51
639. Juliet 3 (buckles7809) 585 78.61 104.99 158 27.01
640. Sam (imeowyou) 583 81.97 112.16 183 31.39
641. Beige (beigedaddy) 582 101.76 143.24 270 46.39
642. Chris (rykthos) 581 81.68 109.52 158 27.19
643. taylor (pastford) 581 56.57 78.50 80 13.77
644. Fexo (fexer) 581 94.49 124.33 189 32.53
645. Guest (train9013c) 580 78.51 103.44 134 23.10
646. Knight_Oikos (knight_oikos) 580 128.17 166.09 320 55.17
647. Crooked (crookediyoung) 580 32.90 54.03 70 12.07
648. Ben (bk100) 579 80.80 116.21 173 29.88
649. Mo (medsebri) 578 78.62 113.89 155 26.82
650. Sam (maedrescher) 578 65.41 85.71 116 20.07
651. DF (df__) 578 73.34 102.26 174 30.10
652. Vu (kroken_keyboard) 577 65.79 90.61 127 22.01
653. Abhay (abhay_hadez) 577 91.57 124.55 227 39.34
654. tofe (tofetofe) 577 52.30 72.50 67 11.61
655. Chris (immortaljason) 575 25.29 41.41 110 19.13
656. Nozune (nostar) 574 126.46 178.53 353 61.50
657. Sian Caleb (promechanics) 573 121.26 151.03 336 58.64
658. touch grass (midca) 573 92.87 129.47 196 34.21
659. kaffarell (kaffarell) 573 83.22 117.51 150 26.18
660. carve (carve) 573 109.30 144.78 269 46.95
661. lhdk2712 (lhdk2712) 572 87.07 110.19 178 31.12
662. anas (qanass) 571 40.72 61.25 43 7.53
663. vinoth0708 (vinoth0708) 570 47.82 77.10 59 10.35
664. Fiesty (fiesty_cushion) 570 52.74 73.65 73 12.81
665. Sander (5andos) 570 82.57 103.60 146 25.61
666. Dr. Sector (sharkychompers) 569 77.71 99.77 139 24.43
667. raptor (raptor234) 567 68.30 92.85 127 22.40
668. Abu (kabu22) 567 86.16 113.28 154 27.16
669. Sourav (yashsaha555) 565 74.37 101.39 141 24.96
670. Khoi (khoitran) 565 100.41 128.62 253 44.78
671. Mohammad Rizwaan (freshkebab) 565 83.21 113.21 155 27.43
672. Enxyon (enxyon) 565 123.93 150.60 361 63.89
673. Pouya (pouyal) 564 57.51 77.34 79 14.01
674. Andrew (monochromeocean) 564 94.09 122.02 195 34.57
675. Marc (marcmalha) 564 83.90 102.94 167 29.61
676. utsab (utsab987) 563 62.47 82.16 104 18.47
677. Daniel (tempguan) 563 75.23 97.60 143 25.40
678. cruise control (terminator_... 562 113.55 148.85 275 48.93
679. Hyunsu (onlyu0923) 562 88.02 115.31 161 28.65
680. ChmpionL (lu_fattori) 560 60.33 75.24 5 0.89
681. zapelots (zapelots) 559 78.22 105.52 157 28.09
682. player (writer35) 558 74.64 119.79 139 24.91
683. Harshal (bitbeast18) 558 76.01 106.44 132 23.66
684. Naved (naved_razi) 558 39.92 62.68 46 8.24
685. the one (qaisianas) 557 32.98 48.81 37 6.64
686. Mandip (memandip) 556 59.19 81.13 120 21.58
687. Kathryn (kathryns) 555 72.96 94.60 119 21.44
688. Hamza (hamzaalali) 555 70.16 97.05 110 19.82
689. Satwik (satwik2708) 554 96.71 127.96 214 38.63
690. ChangeS (changes99) 554 82.05 115.97 154 27.80
691. duong (anhhungcolao) 554 81.19 101.07 145 26.17
692. ThisIsHowWeRoll!! (another_... 553 111.12 134.44 279 50.45
693. Train (trainm8) 552 78.16 108.31 138 25.00
694. Shypolarbear (shypolarbear) 552 90.15 131.15 178 32.25
695. Miguel (quevangel) 550 114.40 158.59 301 54.73
696. Arararararararararagi (manaso) 550 81.45 110.97 134 24.36
697. Pongpan (pongpan) 549 55.64 69.71 77 14.03
698. huu duy (huu_duy99) 548 82.30 107.22 145 26.46
699. mike (captaincapitalism) 548 93.43 121.42 202 36.86
700. Harmonygrams (harmonygrams) 548 66.08 91.03 128 23.36
701. pavan (pavan_) 547 43.42 63.01 46 8.41
702. Jean (orangedrum) 547 90.86 119.89 178 32.54
703. Wusien (wusien) 546 88.65 120.61 172 31.50
704. Jagadeshrao (jagadeshrao) 546 56.12 80.01 83 15.20
705. doquan (doquannnn) 543 92.17 134.59 210 38.67
706. JD (ruminant_robot) 542 82.08 102.72 144 26.57
707. Joshua (paper_astronaut) 542 95.55 119.46 170 31.37
708. Ramseus (master_r) 542 92.58 113.93 180 33.21
709. Tushar (tushar23651) 541 78.29 102.15 140 25.88
710. DustySheep (smowbog) 540 86.66 120.04 150 27.78
711. Jacob (jmbreche) 540 89.10 121.49 198 36.67
712. ⁹⁻¹⁰ᵍᵐ (green910) 539 96.39 121.75 215 39.89
713. Miras (mirabil) 538 48.54 66.52 47 8.74
714. JimBob (jasperjimbob) 538 105.97 142.13 272 50.56
715. Eufalasio (eufalasio_11) 538 67.34 90.04 121 22.49
716. Ananta (anantaraha) 538 66.58 86.50 124 23.05
717. Chiradeep (chiradeep) 538 68.34 107.43 132 24.54
718. fakaped (fakaped) 537 72.56 97.01 149 27.75
719. Aviral (aviral_uchiha) 537 106.46 133.74 198 36.87
720. Nistiarius (nistiarius) 536 85.21 122.20 134 25.00
721. Adzenys XR-ODT (iromuanya) 536 107.47 144.95 252 47.01
722. Away From Keyboard (AFK) (d... 536 90.70 111.32 209 38.99
723. akirasendoh07 (akirasendoh07) 536 72.26 103.37 141 26.31
724. Alexander (dencyh) 535 70.44 96.29 140 26.17
725. jack (jackerdd) 534 89.17 113.78 166 31.09
726. Howdy (abinder) 532 115.90 160.24 318 59.77
727. michael (banane_1) 529 118.21 161.69 285 53.88
728. Tanawat (rxrmzriw) 528 38.64 61.04 49 9.28
729. yassin mohamed (yassin123) 528 69.57 90.63 122 23.11
730. Eduardo (elbodrogo1977) 527 56.85 75.80 75 14.23
731. dhikshith (dhikshith) 527 86.14 109.90 131 24.86
732. Luke (lukell) 526 96.41 131.99 181 34.41
733. Bobby (bton) 526 88.83 121.07 192 36.50
734. Prithvi (prithvi18) 525 48.25 69.84 104 19.81
735. Luke (lukeg1209) 525 55.95 73.45 73 13.90
736. Piyush (lanslord11) 524 72.48 93.05 132 25.19
737. parth (parthvaghela) 523 78.64 107.65 155 29.64
738. daniel (danieledward13) 522 89.50 131.62 165 31.61
739. Erik (vofflan) 521 71.67 89.07 119 22.84
740. Arvin (vin_ar) 520 87.72 113.94 190 36.54
741. Mohit (mohit2208) 520 86.95 115.51 162 31.15
742. brahmastra (brahmastra) 520 57.86 73.44 83 15.96
743. N (natejam) 519 120.26 182.62 347 66.86
744. Alan (erical77) 518 75.47 100.47 125 24.13
745. BigChungus (vynzvynz) 517 100.17 142.68 223 43.13
746. Lucas (supermug) 517 100.02 138.14 208 40.23
747. satwik (satwik_060) 517 89.21 127.11 175 33.85
748. Jacque (jrobyabich) 517 64.70 87.53 107 20.70
749. Mohammad (abdel3leam) 517 68.92 95.57 103 19.92
750. f1_racer (f1_racer_car) 516 92.40 112.77 223 43.22
751. AJ (jaded_aj) 516 81.82 117.90 161 31.20
752. EatingFromTrashcan (namtrac... 515 102.75 137.40 202 39.22
753. julsdgreat (julsdgreat) 515 68.50 92.99 127 24.66
754. Juri (jurida) 514 73.86 106.69 110 21.40
755. penrose (penrosecat) 513 84.85 117.05 169 32.94
756. luz (luzyb92109) 513 48.41 76.32 62 12.09
757. Liz (liasokol) 513 132.68 189.86 328 63.94
758. boniu (wincentbugs) 512 84.49 122.79 151 29.49
759. Nick (nicoboo) 511 61.26 76.56 91 17.81
760. laPampara (lapampara69) 511 94.20 125.71 164 32.09
761. yeeth (yeeth_) 510 94.86 126.17 169 33.14
762. Lance (lancelot_29) 510 89.27 128.66 139 27.25
763. Symoun (sim1ong) 510 62.05 79.45 104 20.39
764. nifster (nify) 508 65.08 104.74 104 20.47
765. AcidSid009 (acidsid) 507 74.80 114.33 144 28.40
766. tristen (unitristen) 505 87.10 103.87 163 32.28
767. smoky_ (sahuvipul) 504 60.98 93.75 143 28.37
768. 🫐🌺Ruby (reuben_yeager) 504 91.62 121.78 158 31.35
769. Brian (vance071) 503 70.10 96.56 118 23.46
770. xoceankingx (xoceankingx) 502 98.68 132.58 221 44.02
771. Nishchit (mr0bn0xi0us) 502 74.71 96.85 125 24.90
772. Benjamin (fatjammin) 502 98.35 131.87 187 37.25
773. Maneeb (maneebdin) 501 64.04 92.30 111 22.16
774. Sebastian (grommonon) 501 82.31 110.37 143 28.54
775. amoz r (amoz11) 501 109.53 145.57 227 45.31
776. the ë (inconsistency) 500 189.99 233.65 448 89.60
777. humisar (humisar) 500 50.65 83.11 55 11.00
778. hereugo (hereugo) 500 91.46 125.27 177 35.40
779. Kishan (69_420_ez) 500 43.32 69.47 92 18.40
780. Tri Dung (phantridung123) 499 85.56 119.36 124 24.85
781. M8l8th (glitchsolo) 499 107.99 149.00 225 45.09
782. adderal junkie (dari0) 499 71.89 108.06 137 27.45
783. Balmorax (balmorax) 499 75.62 101.56 141 28.26
784. nana (goomi) 498 86.55 118.31 143 28.71
785. aswanathck.ramesh (aswanath... 498 46.39 62.65 46 9.24
786. Sim (simron_) 497 66.36 91.69 118 23.74
787. mmmagalex (nonquit4ever) 497 122.87 175.93 267 53.72
788. Jorawar (dumb_daas) 496 68.13 100.49 130 26.21
789. Razor Red Rage (ayyaz_nemesis) 496 96.44 137.75 164 33.06
790. Carter (thecartel) 495 100.86 131.59 201 40.61
791. ayush (rocky1708) 495 87.18 116.52 158 31.92
792. Shroomer (zergkiller) 494 106.84 136.90 234 47.37
793. kentlim (lsk133) 494 64.00 83.45 109 22.06
794. Tea (naoto7010) 494 65.84 80.97 109 22.06
795. Maria (marlab) 492 68.26 84.60 123 25.00
796. Jose Ortiz (jortiz1496) 492 73.34 102.32 117 23.78
797. ⓀⒾⓃⒼⓄ (hasnatahmad) 492 113.16 155.20 282 57.32
798. anjumaaa (zenda254) 491 86.43 124.80 150 30.55
799. kkobuk (kkobukchipp) 490 83.09 107.87 154 31.43
800. Cakers (pvpcakers) 489 84.04 111.14 163 33.33
801. CARDEER (cardeer) 489 107.64 136.82 229 46.83
802. Jimmy (zen529) 488 105.44 138.04 408 83.61
803. Kevin (vektronic) 488 89.27 124.15 152 31.15
804. Sssaajj (sanjisan) 488 79.77 111.07 138 28.28
805. Évi (pinglei) 488 121.33 151.15 308 63.11
806. Lam (dyldodyldo) 488 93.77 119.70 168 34.43
807. Fahad (skyclasher_24) 487 76.63 101.47 142 29.16
808. tstats[jancs] (jancs) 487 92.67 124.22 185 37.99
809. Duc (trungducdeptrai) 486 106.52 133.66 244 50.21
810. Priyanshu (neo_trinity) 486 77.10 111.23 142 29.22
811. RHell (kasiarhell) 486 58.27 79.25 73 15.02
812. Acer (core_viper) 486 45.35 63.50 49 10.08
813. sakhaprox (rportnoy) 485 104.72 151.12 167 34.43
814. Gilbert (gargoyletabbi) 485 62.28 83.90 99 20.41
815. Sebstian (sedasti) 484 73.20 96.76 121 25.00
816. ケニー (schnitzelbr0t) 484 81.12 103.48 122 25.21
817. Identitylessness (power_punch) 484 135.67 209.17 456 94.21
818. Patrick (monkyoo) 484 68.04 90.91 108 22.31
819. lelgetrekt (lelgetrekt) 484 98.15 127.27 181 37.40
820. Jahed (jahed100) 484 101.44 122.47 264 54.55
821. Lawrence (wattfox) 483 108.20 132.28 199 41.20
822. Pro (pro_01) 483 35.40 49.90 41 8.49
823. nothisisleo (leofire) 483 84.16 108.02 143 29.61
824. Naufal (naufalmahing) 482 72.63 103.64 97 20.12
825. Mato (matoxz) 482 85.76 118.25 156 32.37
826. Carter (therealwhiterice) 481 96.24 149.81 183 38.05
827. Jayson (jayson22) 481 58.16 80.73 122 25.36
828. Theo (theodoretliu) 480 122.11 158.69 257 53.54
829. fruit (special_vegetable) 480 111.18 145.79 214 44.58
830. いつき (huywee) 480 89.20 142.06 134 27.92
831. Yani (theghak) 479 58.32 84.49 86 17.95
832. Nima (eramthgin) 478 98.21 133.44 168 35.15
833. mibombo (residober) 477 163.40 213.85 260 54.51
834. I'm slower than before :sku... 477 133.64 169.88 357 74.84
835. Loc (loc_phan) 477 65.20 96.73 97 20.34
836. Roadsweeper Dropping D; (ka... 476 138.53 183.12 344 72.27
837. garry (ganesh1998) 476 75.66 95.27 134 28.15
838. Please use an appropriate n... 476 79.68 127.43 99 20.80
839. Vishal Mishra (firethunder2) 476 41.83 71.50 45 9.45
840. Aryaman (aryaman_verma) 476 46.52 62.82 37 7.77
841. Ankur (ankur94516) 476 55.32 75.25 70 14.71
842. los (typossarevalid) 475 61.25 90.33 229 48.21
843. csgo (professorxwing) 475 140.33 186.56 331 69.68
844. KOSTOV (kostov) 475 59.75 87.63 87 18.32
845. Horny (bigben223) 474 88.96 115.14 154 32.49
846. Arnold (victorvolts_123) 473 76.05 110.59 116 24.52
847. manthan (sixtynine_wpm) 473 52.16 77.53 252 53.28
848. 🎈bm (redly) 473 108.90 136.39 223 47.15
849. Sachin Sharma (ragemodeon) 473 143.57 198.77 363 76.74
850. Fierce (littlekitten7) 473 106.84 136.02 269 56.87
851. Arun (arunro45) 473 58.13 81.44 88 18.60
852. Rakesh (rakesh69) 472 55.40 92.05 87 18.43
853. kalmanfilter (eran_raviv) 472 69.37 91.88 89 18.86
854. (carlibou) 471 168.11 215.48 416 88.32
855. enigma_mf (enigma_mf) 470 108.29 147.65 231 49.15
856. Nick (poppyc_ck) 470 65.26 86.00 101 21.49
857. prateek (prateekdhiman) 470 54.89 72.44 55 11.70
858. Samuel (sammassam) 469 53.04 67.55 49 10.45
859. Jehar (rakhunb) 469 83.93 109.73 146 31.13
860. Liban (hujala) 469 151.52 200.60 337 71.86
861. I play tetris too (hkgwife) 469 126.36 163.71 289 61.62
862. you deserve to exist (charmx) 468 111.96 166.24 3 0.64
863. Thanos (thanossonofalars) 467 68.99 99.61 105 22.48
864. Armin (armino112) 467 48.69 62.75 40 8.57
865. Amit (amiteshore) 466 99.43 124.76 173 37.12
866. jek (jekkey) 465 71.67 98.76 95 20.43
867. Fakieshot (fakieshot) 465 51.74 69.91 54 11.61
868. Tyler (tythal) 464 97.25 130.85 188 40.52
869. Dan (danvictor321) 464 93.71 118.95 163 35.13
870. Sapto (saptopriyono) 462 86.53 113.79 155 33.55
871. mike (purdah1234) 461 48.40 62.78 41 8.89
872. drago (drag00me) 461 74.42 92.57 117 25.38
873. CoveredInBees (coveredinbees) 461 81.93 123.19 137 29.72
874. Julian (robthephysician) 460 73.27 99.01 108 23.48
875. Mr.IF (mr_if) 460 74.32 98.33 122 26.52
876. Petruccio (lolbraumm) 460 89.76 120.39 178 38.70
877. Davis (bengalman447) 460 115.06 140.51 218 47.39
878. Enormity (enormity_op) 459 77.13 94.31 127 27.67
879. furci (furci) 459 71.71 97.87 105 22.88
880. Abhay (ab_hay) 458 48.78 84.09 56 12.23
881. Giuseppe (shmebulock2) 457 84.97 123.86 171 37.42
882. Stevne (juninight29) 457 77.01 94.28 80 17.51
883. gojo (gojo9112) 457 71.52 90.00 111 24.29
884. . (chocolatina) 456 135.90 190.73 297 65.13
885. Claudia (aaaaccdillruyz) 456 63.46 79.59 100 21.93
886. NextGoal Avg. 115WPM (redjhon) 455 87.33 123.02 162 35.60
887. zero2 (deadz) 455 33.32 47.92 40 8.79
888. Aisha (aishanick) 455 60.73 88.76 68 14.95
889. Mikhail (mayham92) 454 77.14 99.85 117 25.77
890. Lin (lin_ming) 454 100.70 128.79 190 41.85
891. eric (ericliu04) 454 107.12 133.41 25 5.51
892. Ω (tunfisk) 453 124.36 169.71 250 55.19
893. satya (satya1110) 453 64.15 88.47 104 22.96
894. Bakhtiyar (bakhtiyar17) 453 58.26 72.73 75 16.56
895. Hossain (hossain95) 452 43.69 62.06 42 9.29
896. Smelly (burdturglar) 452 81.09 98.74 127 28.10
897. jia kang (awjack) 452 54.28 71.06 60 13.27
898. Diepday (linhleo372) 451 77.85 105.99 130 28.82
899. Jonatan (gustesmil) 451 104.95 148.46 198 43.90
900. road to 170WPM (royaljaat) 450 104.43 145.45 285 63.33
901. kunal (kunav) 450 77.59 106.05 123 27.33
902. Jeannie (jeanniejackson) 450 63.05 86.56 102 22.67
903. James (icecrusher) 450 88.66 125.10 144 32.00
904. Andrew (xj04129) 449 91.04 112.85 155 34.52
905. bowlingfan21317 (bowlingfan... 449 91.85 120.33 179 39.87
906. Domen (antreu) 449 99.40 139.81 246 54.79
907. abdullah (abdullah3325569) 449 47.65 68.71 50 11.14
908. mlhhsid (mlhhsid) 448 101.52 120.29 178 39.73
909. Marlon (mgr47) 448 66.17 88.02 105 23.44
910. Brian (brainclash) 448 69.81 104.54 108 24.11
911. Simiwag (simiwag) 447 94.52 134.21 156 34.90
912. Luigi (jorge_da_borracha) 447 101.80 152.34 218 48.77
913. rrono (3an_3an) 447 67.85 97.43 149 33.33
914. wilmanbarrios (wilmanbarrios) 446 67.31 90.42 88 19.73
915. Jay (kov_) 446 71.60 109.40 102 22.87
916. Charles (n6w2) 446 48.15 64.46 31 6.95
917. taj (taj256) 445 84.46 111.75 106 23.82
918. Serjs (sedoy) 445 18.10 28.68 92 20.67
919. Radamasz (madarasz) 445 82.51 104.80 116 26.07
920. Jacob (jacob_dev) 445 51.09 66.44 36 8.09
921. Dragon99999 (dragon99999) 444 86.35 118.84 139 31.31
922. HasadBoii (hasadboii) 443 58.75 79.65 228 51.47
923. something (kaibaboi) 442 131.14 171.34 47 10.63
924. Vinny (bullz3y3) 442 53.14 69.73 55 12.44
925. MAF1F (afif5287) 442 54.69 70.66 61 13.80
926. nyet (slickman) 441 79.18 102.59 109 24.72
927. Slatt. (nonquitpracticing) 441 129.96 181.44 276 62.59
928. Nanar (nanarboursal) 441 64.45 93.36 91 20.63
929. Moy (moy280) 441 102.84 134.96 159 36.05
930. Me (i_believe_i_can_type20) 441 67.30 104.12 110 24.94
931. FixioMG (fixio) 441 68.26 87.61 103 23.36
932. komi (rahul_kumayan) 440 64.53 95.31 111 25.23
933. MINH (shinmyou) 439 105.52 137.03 189 43.05
934. Unique (netb) 439 73.33 108.57 102 23.23
935. theo (mewtish) 439 81.49 108.53 115 26.20
936. thanos (thanosmpath) 438 109.78 134.83 205 46.80
937. Sun (headedead) 438 96.86 124.04 170 38.81
938. (c_xor) 438 131.90 179.93 293 66.89
939. Chaitanya (chaitanya608) 438 69.87 88.03 97 22.15
940. Jesse (sarrod) 437 94.65 128.76 152 34.78
941. Amelia (piclo7) 437 86.08 117.08 145 33.18
942. Magishian (magishian) 437 61.57 103.97 117 26.77
943. Free (just_free2318) 437 63.68 89.68 93 21.28
944. mooshi (mooshidv) 437 58.47 78.18 61 13.96
945. Tovic (todave) 436 48.28 63.56 39 8.94
946. Piotr (snooppiotr) 436 81.71 104.07 93 21.33
947. Lasi (lasileuka) 436 87.57 110.10 141 32.34
948. Rockodile (rockodile) 435 110.11 137.95 198 45.52
949. 🌄youtube.com/watch?v=Sa5... 435 158.71 203.40 372 85.52
950. andy (ajggormly) 435 79.62 105.99 112 25.75
951. Chris (chris_p) 434 68.80 86.81 113 26.04
952. batbaven (baislow) 434 47.99 62.51 42 9.68
953. vbk (vbk_) 433 45.78 65.26 44 10.16
954. Igor (skeef79) 433 103.88 130.35 210 48.50
955. Johny (johnyt) 433 60.15 88.77 81 18.71
956. Person (improbhighnotgonnalie) 433 103.08 137.22 187 43.19
957. guy (grayeyes) 433 143.11 179.37 319 73.67
958. vamshidhar (vamshidhar18) 432 59.30 84.00 87 20.14
959. Radriar (slowtype_e) 432 57.84 78.83 62 14.35
960. Anshuman (anshu_8) 431 58.72 79.48 78 18.10
961. soldano (soldano) 430 106.92 139.05 205 47.67
962. Pyren (pyren83) 430 89.29 113.01 136 31.63
963. (dispidi) 430 130.75 179.62 287 66.74
964. Toxic (toxicbaby3000) 429 70.76 101.95 103 24.01
965. Mahmoud (sayed1) 429 85.31 106.58 106 24.71
966. Kianoosh (kia_wp) 429 82.51 107.36 121 28.21
967. Harry (harry_k) 429 80.77 118.63 110 25.64
968. MCSR RANKED ENJOYER (believ... 429 106.84 178.19 203 47.32
969. hunzai (alihunzai) 429 97.20 135.81 156 36.36
970. andrei5 (mute_6) 428 78.15 107.63 110 25.70
971. gaitonde (gaitonde) 428 65.79 88.42 93 21.73
972. reuben (reuben_elias) 427 53.50 75.62 48 11.24
973. discord# unsalek (mustafa_r... 427 86.18 112.91 123 28.81
974. Ben (foereaper4k) 427 78.76 108.34 89 20.84
975. Prydae (prydae_1) 426 79.54 125.78 109 25.59
976. GodSped (falsender) 426 79.07 115.22 108 25.35
977. Ivan (blindingangel) 426 109.16 141.70 238 55.87
978. mr (buabaiban) 426 39.30 52.21 33 7.75
979. Mark (ziggle) 425 61.27 85.42 78 18.35
980. WhatTheHotDog (tdsar102094) 425 90.67 122.65 145 34.12
981. Jake (laketype) 425 62.73 84.26 73 17.18
982. Pablo (p1blis81) 424 77.99 113.98 97 22.88
983. how to type (iwanna_typefast) 424 122.33 164.47 214 50.47
984. Cep (alhabiblidinillah) 424 81.71 100.26 99 23.35
985. JM (tuftycrayfish) 423 73.59 94.14 103 24.35
986. Nobu (nobunakamura) 423 83.54 112.28 142 33.57
987. himanshu (himanshu3198) 423 50.95 71.44 51 12.06
988. Senpai Z (zlashers) 422 72.53 94.19 100 23.70
989. Poo (pooopooo) 422 93.68 124.00 113 26.78
990. weird_virus (imsajan) 422 64.00 89.54 86 20.38
991. Jay kay (imnoob167) 422 39.27 56.91 26 6.16
992. Dulguun (dulguun_) 422 82.25 117.37 120 28.44
993. Alan (alan2406) 422 66.06 92.54 84 19.91
994. MaxVerstappen33 (newrookie15) 421 75.40 116.69 123 29.22
995. Karrrrtik (kartikkkk) 421 54.26 79.03 112 26.60
996. Sonu (intellectualcreatures) 421 89.56 119.21 157 37.29
997. Ayush (improve_buddy) 421 55.51 76.44 84 19.95
998. Ibexus (ibexus) 421 164.27 208.60 388 92.16
999. J (yunatan) 420 80.45 106.63 141 33.57
1000. Ben (thebenman7dv) 420 59.36 82.27 52 12.38
1001. Shashi (shashianand230) 420 45.54 61.30 51 12.14
1002. Mohammad (mr_loooop) 420 82.96 109.89 106 25.24
1003. Ladybug (lady_bug_) 420 56.34 73.43 64 15.24
1004. Fang (fangalpha) 420 80.15 113.36 112 26.67
1005. Optimus (optimusprime98) 419 72.97 90.55 104 24.82
1006. khalil (khalilfa) 419 72.55 99.04 99 23.63
1007. Ahmad (vectors_master) 418 66.50 95.59 83 19.86
1008. SPQR (tringuyen29) 418 79.21 108.89 99 23.68
1009. Crew (crewmate_sus) 418 117.22 159.37 224 53.59
1010. Guest (ksaheb) 417 30.90 44.11 36 8.63
1011. Sumeru_ (kenteezyx) 417 93.48 126.43 159 38.13
1012. _____ (husixu1) 417 106.91 134.04 177 42.45
1013. artist (apg21092002) 417 62.26 85.03 75 17.99
1014. Maria (ladymariag) 417 86.47 109.08 126 30.22
1015. Shriram (shrirammc55) 416 93.37 117.02 146 35.10
1016. Mark (pap1) 416 65.19 88.03 103 24.76
1017. Sian-Yang (rgnerdplayer) 415 115.13 145.78 229 55.18
1018. Jerry_007 (jerry_007) 415 30.54 42.91 27 6.51
1019. R (tumta) 414 68.71 96.67 97 23.43
1020. Dale (livestrong12) 414 114.66 145.30 221 53.38
1021. batbold (bb__) 412 107.80 154.85 193 46.84
1022. Zeep (zeeppt) 411 82.85 100.87 95 23.11
1023. Mandem (madem) 411 71.04 120.82 115 27.98
1024. 🅹🅰🆅🅴 (killer8hy... 411 105.94 143.49 183 44.53
1025. Jiong Yang (yangfoo) 410 95.30 124.14 179 43.66
1026. Nick (cvs_nick) 410 70.04 100.42 96 23.41
1027. Weebmachine (weebmachine) 409 79.08 99.41 91 22.25
1028. पलविंदर स... 409 112.24 140.54 230 56.23
1029. (๑•﹏•)⋆* ⁑⋆* ... 408 81.12 107.74 110 26.96
1030. Razor (mr6pack) 408 63.88 83.35 70 17.16
1031. aman (amanrai2802) 408 62.02 87.08 107 26.23
1032. Ngoune (tyrex1) 407 74.04 100.87 97 23.83
1033. Soirstylo (soirstylo) 407 80.19 101.00 134 32.92
1034. xd (palmate) 407 77.49 108.63 110 27.03
1035. sun (ny_dkxh) 407 72.01 98.09 124 30.47
1036. uwu (mr_mint) 407 81.26 113.39 124 30.47
1037. me_astr (me_astr) 407 59.18 78.75 79 19.41
1038. Alekva (alekva) 407 73.62 98.37 104 25.55
1039. Stop (stop__) 407 47.84 63.38 37 9.09
1040. Vivek (vivektarun1234) 406 29.35 44.08 49 12.07
1041. Onu Kajita (torek87) 406 109.76 145.81 287 70.69
1042. sskhynix (sskhynix) 404 104.61 136.54 199 49.26
1043. sayed (sayedeesam) 404 44.72 58.89 42 10.40
1044. parham (parhamparsa) 404 43.12 66.08 46 11.39
1045. Murad (memento_mori_s) 404 53.95 75.11 51 12.62
1046. Anas (anasghawanmeh) 404 33.38 44.10 21 5.20
1047. Adil (adisan_lc) 404 60.08 84.64 74 18.32
1048. Abhay Shukla (abhayshukla) 404 27.42 41.46 69 17.08
1049. Yohannes (wintersolider) 403 62.01 90.83 91 22.58
1050. Vaj (taychee) 403 75.40 105.23 105 26.05
1051. Brian (taters613) 403 97.05 121.81 145 35.98
1052. Ayong (larrylarogapro) 403 103.03 139.09 179 44.42
1053. jeremy_bearimy (jeremy_bear... 403 92.36 114.17 147 36.48
1054. Dilan (carnage2) 403 83.91 132.76 127 31.51
1055. ♥ (boundaries) 403 148.18 222.61 5 1.24
1056. Munir (munirgkm) 402 88.46 116.12 135 33.58
1057. Jordan (js_jordan) 402 71.60 107.02 87 21.64
1058. Amendity (amendity) 402 80.87 103.31 104 25.87
1059. Adrem (akratic_adrem) 402 84.30 119.87 113 28.11
1060. Go (gomar3n) 402 66.94 88.79 89 22.14
1061. D (javieday) 402 40.27 61.33 33 8.21
1062. pouya (pooyamz) 401 61.37 89.60 79 19.70
1063. Pavan (pavantyperacer) 401 79.15 104.92 110 27.43
1064. Hanny (@hannyglorify) (mons... 401 84.64 111.60 128 31.92
1065. Guest (catg0ty0urlung) 401 111.00 137.13 219 54.61
1066. Yuji (yujixyuji) 400 72.50 95.07 109 27.25
1067. Shuyu (stevenqi) 400 94.02 129.09 149 37.25
1068. damList (damanthm) 400 85.28 114.45 119 29.75
1069. Allan (allandallon) 400 101.55 131.59 176 44.00
1070. Adam (adam2002) 400 88.50 112.54 104 26.00
1071. Sami Wilf (samiwilf) 399 106.42 139.17 180 45.11
1072. Eetu (mandarilleri) 399 84.39 116.75 96 24.06
1073. Irfan (irfan_is_the_best) 399 62.99 78.00 85 21.30
1074. Dylan (dr_gammaray) 399 139.68 173.28 282 70.68
1075. John (xxcooldudexx) 398 107.26 144.22 179 44.97
1076. a (oimanquan) 398 104.68 139.10 194 48.74
1077. Nivan (nivanr06) 398 86.47 117.26 95 23.87
1078. KnightWithSword (mishras839... 398 63.17 89.46 68 17.09
1079. Cxlt (fujimaaa) 398 85.41 117.00 133 33.42
1080. Pedro (pedro5370) 397 91.92 124.80 132 33.25
1081. Kotaro (kotaro_qwerty) 397 84.73 108.81 114 28.72
1082. Ocean (oceanlim) 396 109.58 165.26 190 47.98
1083. ILOVEPALESTINE (iamslow103) 396 145.03 217.38 367 92.68
1084. john (typeman_1234) 395 66.74 93.52 89 22.53
1085. MavrosOplarxigos (oplarxigos) 395 74.79 91.21 137 34.68
1086. Rakib (rakib0hasan) 394 38.27 49.24 23 5.84
1087. Luke (outlandish) 394 93.95 115.22 138 35.03
1088. Louie (lewieee) 394 114.23 147.34 228 57.87
1089. Godrod (god_of_rods) 394 87.57 111.22 111 28.17
1090. Cheechu (cheechu) 394 85.49 114.06 113 28.68
1091. MasterZero (mastrzero) 394 35.67 54.41 26 6.60
1092. Ryzen (ryzen___) 394 38.16 49.71 20 5.08
1093. Kipper (ziuncati) 393 58.87 78.11 68 17.30
1094. Will (greggaz) 393 94.69 132.09 144 36.64
1095. Dio (slado122) 392 85.80 108.63 130 33.16
1096. Nick (neepwithin) 392 88.28 108.08 150 38.27
1097. Lewis (lewisisabo) 392 72.77 98.70 89 22.70
1098. Wanderer (hassanese) 392 56.29 80.33 51 13.01
1099. Ai (aibah) 392 74.98 107.26 108 27.55
1100. Zovi (zovi) 391 89.19 118.74 114 29.16
1101. Glen (alabaster45) 391 46.16 60.31 34 8.70
1102. Re4per (light_exe) 390 56.83 77.25 62 15.90
1103. H!P! (harsh_patel) 390 55.66 75.09 54 13.85
1104. me slow (brandon69eduardo) 390 104.61 131.78 178 45.64
1105. baby (babyshadow) 390 62.30 85.03 91 23.33
1106. Amaury (raymaunet) 389 52.08 66.21 30 7.71
1107. jim (pstengyawa) 388 87.20 120.04 133 34.28
1108. Mooshi (mooshiboy_dvorak) 388 89.61 118.19 104 26.80
1109. Ian (iyaan) 388 68.45 89.20 101 26.03
1110. seven (seven_mark) 387 78.60 98.33 94 24.29
1111. Rage (ragelad) 387 62.18 101.17 73 18.86
1112. BonTear (b0ntear) 387 68.69 94.17 88 22.74
1113. 1_Death (1_death) 387 48.05 65.71 45 11.63
1114. Ahead of you (wadehuangjr) 386 95.19 120.04 145 37.56
1115. Tom (polaricecaps) 386 69.28 98.69 103 26.68
1116. Noah (lorenpike) 386 70.20 93.60 75 19.43
1117. Andy (djentalman) 386 90.92 124.90 129 33.42
1118. Matteo (atteo1000) 386 63.16 101.09 79 20.47
1119. sara (sara1994) 385 40.25 51.56 27 7.01
1120. Himanshu (himsingh11) 385 41.18 65.23 33 8.57
1121. (welltwell) 384 133.70 177.19 279 72.66
1122. Jemma (jmmstvnsn) 384 84.07 106.19 93 24.22
1123. eagle (e4gle) 384 66.33 84.30 98 25.52
1124. chris (fscj4raxhel) 383 70.83 93.52 77 20.10
1125. ccct (fastleopard) 383 49.80 67.92 45 11.75
1126. Betting (buffhorse_) 383 67.27 90.37 73 19.06
1127. quack (shinonin) 382 145.05 166.00 287 75.13
1128. Lei Paul (polley) 382 92.60 119.63 131 34.29
1129. meiol (olete) 382 59.78 72.14 67 17.54
1130. Ben (caaakeeey) 381 77.28 101.82 103 27.03
1131. iChoke@TheEnd (vidivinci) 380 75.64 101.99 102 26.84
1132. Funeral Party (scudvirus2018) 380 65.81 83.94 76 20.00
1133. robbie (robbiemcfly) 380 90.16 120.28 132 34.74
1134. Mikaela (mikaela_e) 380 77.74 105.39 99 26.05
1135. Mukeem (bilawat) 380 90.22 119.14 155 40.79
1136. . (apeninspaaace) 380 95.34 123.10 147 38.68
1137. an4rchy1925 (an4rchy1925) 380 90.57 130.90 137 36.05
1138. Alex (tabkc7) 379 81.09 102.66 87 22.96
1139. Aashish (albatross007) 379 64.34 87.17 83 21.90
1140. DemonKing (zxzf) 378 53.43 69.03 53 14.02
1141. Gabriel (wdarknessw) 378 80.62 103.25 103 27.25
1142. Nick (nidzoni) 378 103.77 131.82 178 47.09
1143. George (linnypurple) 378 86.31 108.75 112 29.63
1144. PMA (huy2272) 378 82.36 110.46 118 31.22
1145. OmicronVirus (deathisnthend) 378 75.83 96.49 92 24.34
1146. (daniel598) 378 155.48 205.79 308 81.48
1147. Afterlife (afterlife71) 378 40.47 52.78 31 8.20
1148. raz🐢 (razman) 377 110.44 145.03 173 45.89
1149. Raffa (raffadanendraa) 377 62.67 86.98 76 20.16
1150. Peter (portiz121803) 377 80.26 114.51 77 20.42
1151. Heet (heetpatel219) 377 58.42 74.57 78 20.69
1152. Derek (thenyaz) 376 96.46 119.13 144 38.30
1153. Human (supertypergrey) 376 60.62 88.02 59 15.69
1154. han (stuckinatimezone) 376 67.35 93.54 98 26.06
1155. prashik0 (prashik0) 376 76.08 113.73 106 28.19
1156. Kimmo (kimorasa) 376 82.82 105.76 92 24.47
1157. kaitlyn (katieostrander) 376 83.20 111.33 82 21.81
1158. Gaurav (absurd_man) 376 70.44 93.32 96 25.53
1159. Nick (wugangabbot) 375 61.97 80.29 81 21.60
1160. S (suhaib_silwadi) 375 73.52 100.38 104 27.73
1161. Marko (polarbear1229) 375 100.84 132.74 147 39.20
1162. phauxy (phauxy) 375 68.32 91.33 103 27.47
1163. khalid (khalidabououalid) 375 73.11 102.63 109 29.07
1164. Cuong (c_nguyenthien) 375 95.84 118.83 144 38.40
1165. Neon (neonman6) 374 46.68 68.65 50 13.37
1166. Demogorgon (typeracer0110) 373 67.27 98.13 91 24.40
1167. HotClaw (hotclaw) 373 96.72 121.41 160 42.90
1168. Zexceed (shorif) 372 92.57 155.25 177 47.58
1169. Smudge (cuteboi) 372 117.55 161.05 202 54.30
1170. Arin (arinkothari) 372 67.23 90.90 76 20.43
1171. Mez69 (mezx69) 371 73.20 96.28 84 22.64
1172. Neel (jydoenwat) 371 66.17 88.00 76 20.49
1173. It'sMe (freakinnickp) 371 109.29 141.27 173 46.63
1174. SnopeySnope (snopeysnope) 370 63.28 91.58 86 23.24
1175. Dolce (dolceparadise) 370 88.53 125.77 126 34.05
1176. em (akosiem) 370 92.01 124.46 111 30.00
1177. Nithin (useless_net) 369 99.80 147.25 163 44.17
1178. Isaac (newton6674) 369 83.12 101.65 94 25.47
1179. Chatpisut (uwu_werkmaine) 368 85.97 113.42 113 30.71
1180. alostman (slowtypist199) 368 134.61 170.94 214 58.15
1181. Zephyr (lay_oreo) 368 93.68 131.18 120 32.61
1182. delfan (delfaaan) 368 88.91 113.30 118 32.07
1183. NickyPP (weenniecat) 367 82.49 117.47 118 32.15
1184. NecroCW (necrocw) 367 81.66 109.46 107 29.16
1185. Mehti (lylehti) 367 84.64 113.21 96 26.16
1186. Wali (captorcarbon) 367 74.07 102.29 103 28.07
1187. Jeremiah (wetsock625) 367 53.26 69.40 39 10.63
1188. david (twistybaer) 366 70.65 94.23 70 19.13
1189. Scopic (scopic) 366 97.95 117.10 128 34.97
1190. Lucas (lukasyoi2) 366 71.08 103.01 121 33.06
1191. Jack (jfragg) 366 77.78 110.28 73 19.95
1192. Maneesh (silentplayz5672) 365 59.02 75.70 67 18.36
1193. Puri (narthar) 365 78.26 113.10 104 28.49
1194. Mahmood Thompson (mat_i) 365 115.94 155.42 209 57.26
1195. Carlos (lufnys) 365 77.03 121.66 88 24.11
1196. Jadon (j20lardo06) 365 77.48 98.73 81 22.19
1197. 3NKRYPT (3nkrypt) 365 54.76 77.62 38 10.41
1198. kuzz (kuzz) 365 74.94 93.41 78 21.37
1199. Not_Stable (not_stable) 364 81.52 123.08 121 33.24
1200. Mega (mega_mushroom) 364 75.87 99.28 83 22.80
1201. Nguyễn Trần (dattran03) 363 86.39 110.96 115 31.68
1202. Curly (curly98) 363 57.37 77.64 58 15.98
1203. byron (bozzarf) 363 75.94 99.43 104 28.65
1204. andrew (washedtyper) 362 93.31 116.39 150 41.44
1205. Smulca (vicker) 362 61.71 84.40 99 27.35
1206. lol (lolspedicey) 362 83.17 121.19 109 30.11
1207. Gilbernet (gilbertonava7) 362 52.48 66.62 31 8.56
1208. Glennis (biotic_god) 362 84.65 117.43 90 24.86
1209. Jae (jaeha99) 362 64.01 94.10 84 23.20
1210. v1step (v1ztep) 361 68.32 95.38 54 14.96
1211. Phish (phishphishphish) 361 109.30 136.14 165 45.71
1212. iglo3141 (iglo3141) 361 72.94 98.38 110 30.47
1213. grace (graceneufeld) 361 78.52 101.20 167 46.26
1214. Mazin (mmazincham) 360 81.50 101.33 73 20.28
1215. Omer (omer_nukic) 359 59.60 81.13 70 19.50
1216. himuman (ignis_05) 359 57.11 84.67 78 21.73
1217. Connor DVORAK (deepwaterbus) 359 83.14 116.59 101 28.13
1218. ~ (katana4teen) 358 61.06 83.59 84 23.46
1219. Declan (dg05) 358 76.89 103.23 83 23.18
1220. Rick Astley (beardybeardy) 358 84.81 115.83 88 24.58
1221. 16/f/cali (ultrashibe) 357 131.80 171.33 233 65.27
1222. George (tormanovi) 357 75.32 96.30 83 23.25
1223. An (ntan1210) 357 88.46 135.77 119 33.33
1224. Aaron (heckndarn) 357 73.38 94.06 81 22.69
1225. Curl2908 (curl2908) 357 49.01 64.90 37 10.36
1226. Benjin (benjin7) 357 71.68 101.08 71 19.89
1227. JheMee (ayyjhey) 357 63.23 87.78 68 19.05
1228. Speed_Reader (nagy_ssbm) 356 84.35 110.01 92 25.84
1229. l502x (l502x) 356 108.64 136.01 160 44.94
1230. bhautik (bhautik0126) 356 40.90 60.91 29 8.15
1231. Alan (alan001) 356 75.18 101.81 82 23.03
1232. DH (deeh_c) 355 81.03 109.85 107 30.14
1233. つべ (tube_jp) 354 58.19 84.85 45 12.71
1234. Eric (thicc_ricc) 354 112.07 145.63 160 45.20
1235. i can't be asked (perfectio... 354 107.35 145.13 165 46.61
1236. Kacsa (kacsa_janos) 354 45.90 67.84 39 11.02
1237. Tom (ax99) 354 51.25 75.45 31 8.76
1238. abs0lutz3r0c007 (abs0lutz3r... 354 84.58 105.74 83 23.45
1239. Sumit (sumit_ghag) 353 91.32 130.18 122 34.56
1240. Adrian (dinfus) 353 109.18 140.43 191 54.11
1241. Evan (__evab__) 352 83.74 113.47 88 25.00
1242. typsterr (typsterr) 352 51.06 70.21 32 9.09
1243. timtam420 (timtam420) 352 80.67 107.20 86 24.43
1244. K (strongballs) 352 81.63 125.00 107 30.40
1245. addy (epicshibexd) 352 102.79 131.79 154 43.75
1246. AngelCaveGTI (angelcavegtio... 352 88.69 121.31 107 30.40
1247. Ryan (ryan2723) 351 75.02 92.49 55 15.67
1248. Ibrahim (ibrahimtyper) 351 115.12 142.41 173 49.29
1249. Alaa Awamleh (alaa_awamleh) 351 68.29 87.28 104 29.63
1250. Simon (wizard_sheep) 350 90.68 127.80 116 33.14
1251. Felix (metr_x) 350 49.89 63.73 35 10.00
1252. Invnty (invnty) 350 37.80 53.12 21 6.00
1253. Zakaru (gaudo1991) 350 79.07 99.87 80 22.86
1254. Sudip (donda) 350 70.82 97.84 83 23.71
1255. Daniel (danielpaanderson) 350 72.92 93.82 66 18.86
1256. Sadat (based_chungus) 350 77.05 101.30 95 27.14
1257. Arnaud (armatt) 350 81.92 106.17 104 29.71
1258. Dusan (dusan01) 350 59.47 84.12 65 18.57
1259. typerinfection (z4k1n470r) 349 74.75 107.61 76 21.78
1260. Marek (lypa) 349 103.78 125.50 167 47.85
1261. Andrew (holocene_learning_d... 349 46.94 70.28 38 10.89
1262. Duncan (dkbrk) 349 116.06 138.06 178 51.00
1263. D (consumption) 349 80.32 104.62 92 26.36
1264. xSora (xsora) 348 114.54 155.76 220 63.22
1265. Vincent (vincexodus) 348 56.51 76.11 52 14.94
1266. L (thereddone) 348 76.26 96.47 78 22.41
1267. Marvin (partass) 348 70.78 89.22 85 24.43
1268. Cray (kweikwei) 348 73.47 86.68 89 25.57
1269. Helena (helenaa_26) 348 46.92 65.21 41 11.78
1270. Taras (gavair) 348 59.35 75.10 59 16.95
1271. 🍉 Palestine Will be Free... 348 110.30 171.84 283 81.32
1272. Dowon (dowon) 348 155.29 193.47 298 85.63
1273. ChimChimChim (chimchimchim) 348 124.49 150.62 208 59.77
1274. Aarvaan (aarvaan) 348 55.82 76.10 47 13.51
1275. Sarvjot (sarvjot42) 348 73.85 97.36 86 24.71
1276. Suren (strongsuren) 347 92.44 127.36 94 27.09
1277. ニシャント (neokun) 347 60.38 81.30 66 19.02
1278. Mike (kb_acolite99) 347 55.42 79.45 45 12.97
1279. chunky (wbcracer) 346 117.42 143.58 199 57.51
1280. ravi (sravi4701) 346 77.08 100.40 78 22.54
1281. dav (candyslug) 346 115.94 148.21 160 46.24
1282. Bharat Rai (bratrai11) 346 28.91 38.73 37 10.69
1283. Salmon (pillowend) 345 110.97 151.27 181 52.46
1284. yoyokeepitup (keepitup) 345 97.10 129.84 131 37.97
1285. m (xxxaliaxxx) 344 87.00 106.02 94 27.33
1286. 🇲🇬 Rina (rina23) 344 104.18 154.58 177 51.45
1287. Văn (pqvan20) 344 66.68 87.03 90 26.16
1288. Evelyn (evline) 344 70.66 86.98 85 24.71
1289. Caxix (caxix) 344 63.21 81.84 72 20.93
1290. Gajendra (techgajen) 343 48.36 66.84 40 11.66
1291. Son (memorrick) 343 80.86 101.31 96 27.99
1292. George (zorkkins) 342 64.79 82.91 69 20.18
1293. Veniax (veniax) 342 57.32 87.76 64 18.71
1294. Praggapan (silentmachine) 342 71.03 97.40 90 26.32
1295. Mudu (muduxd) 342 53.00 70.03 38 11.11
1296. vaibhav (vaibhav6996) 341 80.17 101.41 196 57.48
1297. Momen (momenarafa) 341 63.23 84.52 79 23.17
1298. Will (freewillie18) 341 77.64 110.09 90 26.39
1299. ahiraj (ahirajsingh) 341 19.98 32.62 43 12.61
1300. s'gettifingers (spaghetti_f... 340 65.19 82.46 83 24.41
1301. Jean (seawardsalmon6) 340 93.08 115.38 130 38.24
1302. Preston (prestonsteffenjr) 340 41.55 50.69 15 4.41
1303. nilansh (pralaya) 340 96.59 121.04 188 55.29
1304. Neko (pippaola) 340 91.87 126.40 108 31.76
1305. Robert (nforcer) 340 91.16 117.96 116 34.12
1306. LogicBS (logicbs) 340 62.16 84.02 72 21.18
1307. Elo (eloh) 340 74.88 94.57 80 23.53
1308. :)) (brokenslowhand) 340 110.64 143.75 171 50.29
1309. allan (zhangerbanger) 339 122.82 154.71 198 58.41
1310. Iliya (hichkas_01) 339 47.53 69.09 39 11.50
1311. (dragusprime) 339 117.43 152.77 178 52.51
1312. Bun (bunnypuc) 339 55.88 79.53 57 16.81
1313. Eric (ericnosarcasm) 338 75.11 99.88 82 24.26
1314. Damon (damonc89) 338 90.35 115.63 93 27.51
1315. Biggus (biggboii18) 338 87.51 117.49 94 27.81
1316. Timothy Tiew (timothytiew123) 337 109.80 142.59 157 46.59
1317. Sam (samandthefourdogs) 337 66.48 96.26 73 21.66
1318. ROG (roggy) 337 64.37 84.70 72 21.36
1319. emna (em203) 337 60.60 73.33 60 17.80
1320. khalid (khalidoo17) 337 51.25 70.65 39 11.57
1321. Karl (xillionpro) 336 87.26 121.99 105 31.25
1322. Vilmer (vien0701) 336 83.93 108.01 104 30.95
1323. R (rc_da) 336 62.61 79.40 46 13.69
1324. Ⓐⓝⓣⓞⓝ (racingisaw... 336 90.21 131.35 159 47.32
1325. Fangio (fangio) 336 79.11 98.48 73 21.73
1326. Lei (alnadnetrox) 336 88.66 117.22 120 35.71
1327. Macy (macylace) 335 71.07 95.60 81 24.18
1328. A.H.M. (arceen) 335 82.78 102.85 83 24.78
1329. Olav (thederpygod) 334 90.27 123.20 90 26.95
1330. Chathur (grandesonnerie) 334 96.95 142.25 130 38.92
1331. Guest (superman_ha_ha) 333 76.52 108.40 80 24.02
1332. nimitz (nimitzpro) 333 92.34 119.17 127 38.14
1333. Dominic (mickeyice3) 333 74.64 94.43 85 25.53
1334. Kian (kian32) 333 44.63 56.51 41 12.31
1335. B (bsauter29) 333 89.88 118.34 109 32.73
1336. alex (alex3213213) 333 94.98 134.95 127 38.14
1337. Rikki (rikki_leo) 332 86.98 118.22 101 30.42
1338. - (ndca) 332 50.53 70.75 36 10.84
1339. 🤝🤝 (joejiunn) 332 92.68 116.79 106 31.93
1340. Adrian (adrianc04) 332 93.75 120.00 89 26.81
1341. AbdulQader (abdulqader) 332 74.38 95.49 75 22.59
1342. yourfav (imyofav) 332 43.79 62.26 30 9.04
1343. tstats[totet] (totet) 331 68.83 89.30 67 20.24
1344. eric (ericpr) 331 71.92 98.26 80 24.17
1345. I love my thicc girlfriend ... 331 149.63 231.98 244 73.72
1346. Sam (sam77777) 330 80.52 101.75 75 22.73
1347. Austin (quanglamtran346) 330 73.10 91.16 91 27.58
1348. Keima (lereias_1) 330 67.41 89.92 77 23.33
1349. meow (catnoodles) 330 93.43 124.88 119 36.06
1350. Blunt (blunt_machete) 330 67.66 92.10 67 20.30
1351. tstats[pervez1020] (pervez1... 329 47.90 62.58 39 11.85
1352. Moaz (mo3adh) 329 67.67 95.42 64 19.45
1353. Faiq (faiq_lak) 329 63.01 93.11 75 22.80
1354. Ryan (carefullyslow) 329 102.53 132.54 153 46.50
1355. Artiur (artursaliyev) 329 41.33 59.03 29 8.81
1356. Kickass (vivekvikysharma) 328 60.40 79.05 61 18.60
1357. Jackson (neatoburrito) 328 73.44 109.38 89 27.13
1358. Mostafa (m2a_nj) 328 46.51 62.79 35 10.67
1359. Zak (zak_roger) 327 88.01 109.38 113 34.56
1360. small (smalllittlesheep) 327 66.35 87.34 70 21.41
1361. Captain (scrubwrecker666) 327 83.04 107.18 95 29.05
1362. manthan (manthan123) 327 62.17 83.55 71 21.71
1363. Liu (jazzkey) 326 92.81 112.40 129 39.57
1364. pärskis (borje) 326 76.06 97.48 83 25.46
1365. sdagsad (asvasdba) 326 74.19 100.78 119 36.50
1366. XanderManCan (tacticaltoast) 325 73.35 94.52 71 21.85
1367. Ridoy Chandra Dey (rkprite09) 325 63.21 82.07 64 19.69
1368. Ed (raptorofli) 325 96.48 129.30 129 39.69
1369. Shoemaker-Levy 9 (atthetop) 325 161.64 231.45 227 69.85
1370. Iron Man (007_speed) 325 86.55 107.41 116 35.69
1371. Emma (emma_boy) 325 50.46 72.04 36 11.08
1372. Sumanta (sumanta001) 324 54.84 75.46 45 13.89
1373. A (suleil) 324 114.68 146.08 147 45.37
1374. Samandar1 (samandar1) 324 39.67 55.67 19 5.86
1375. Ian (s0ft3n) 324 104.42 138.84 143 44.14
1376. eric (eric8) 324 86.99 108.57 92 28.40
1377. Ibex (ibexdoyle) 324 34.68 44.92 25 7.72
1378. Racer09 (__nn____ds__) 323 43.69 56.33 24 7.43
1379. Marti (ytram) 323 53.99 74.03 44 13.62
1380. kenneth (tenick) 323 92.82 116.70 109 33.75
1381. Pawan (pawanpdn) 323 72.47 97.19 83 25.70
1382. Orenji (orenji_0987) 323 58.06 80.35 32 9.91
1383. random (myrandomusername) 323 67.17 92.40 83 25.70
1384. J (juuhhhstin) 323 141.41 166.88 263 81.42
1385. tambii (aid1337) 323 121.80 162.76 164 50.77
1386. Viktor (wector77y) 322 100.33 157.78 118 36.65
1387. Hasan (notelex) 322 88.67 111.32 97 30.12
1388. Jee Hoon (jeehoonoh) 322 139.43 193.61 243 75.47
1389. Hoe Hoe (yeyonghe) 321 76.90 98.46 74 23.05
1390. Person (relearner) 321 98.75 116.97 131 40.81
1391. davy (octopu5) 321 76.50 102.10 103 32.09
1392. MantisTyping (mantistyping) 321 88.56 116.00 98 30.53
1393. Jeffrey (jeff7263) 321 91.80 119.44 89 27.73
1394. 18K.ca (hunterwoodchase) 321 104.20 131.33 134 41.74
1395. Rajesh (curseraj) 321 68.07 90.70 81 25.23
1396. Smudge on megamak uwu (snudge) 320 57.33 99.57 68 21.25
1397. Lynn (pvequalsnrt) 320 82.82 105.61 99 30.94
1398. Manik2375 (manik2375) 320 66.15 94.18 89 27.81
1399. Allan (allanwchang) 320 76.08 99.54 78 24.38
1400. Yashpal (ymanju) 319 29.26 44.59 51 15.99
1401. Sahil (shahildhakre) 319 35.58 55.65 23 7.21
1402. javier (jf1442) 319 67.03 87.53 62 19.44
1403. Tyler (tko42) 318 111.35 141.93 147 46.23
1404. Ranak (rakibulranak) 318 61.81 85.48 66 20.75
1405. Ugnius (popcorn325) 318 95.84 119.02 126 39.62
1406. Key (malformant) 318 80.26 106.62 91 28.62
1407. 🙃 (kryptoprocta) 318 67.25 92.30 76 23.90
1408. Jwad (jaziz) 318 114.29 146.78 171 53.77
1409. I type (carsftw) 318 107.02 137.06 160 50.31
1410. Andy (wah_wah_wah) 317 63.39 86.97 75 23.66
1411. Dhaliwal (vishaldhaliwal) 317 69.62 94.52 76 23.97
1412. Sylwester (rex1313) 317 71.17 108.84 90 28.39
1413. how 2 type faster? (not_seg... 317 139.14 169.93 247 77.92
1414. K (khanali2020) 317 95.26 116.17 129 40.69
1415. Sephiroth (jukethehitman) 317 63.41 94.41 61 19.24
1416. Ariful (arifulhaque24434) 317 46.11 59.56 35 11.04
1417. xena (scogx3281) 316 104.97 135.36 123 38.92
1418. Russian (russianemu27) 316 105.53 141.66 130 41.14
1419. ig: erik_toledoo (pepegacha... 316 69.70 91.17 83 26.27
1420. ef (fankan1997) 316 43.64 55.33 33 10.44
1421. Scattish (willierocknroll) 315 72.04 98.97 70 22.22
1422. Ven (v4vendetta) 314 43.81 57.95 23 7.32
1423. Timothy (timply) 314 83.87 117.01 96 30.57
1424. sgbiscuits (snailzzy) 314 85.28 98.23 111 35.35
1425. Nour Hakim (scarfc) 314 49.67 66.74 46 14.65
1426. Memming (qwerty) (memming) 314 102.65 130.16 147 46.82
1427. dayy (lordie) 314 59.28 85.17 63 20.06
1428. Lycin (smokzzzgaming) 313 68.91 96.87 73 23.32
1429. Allistare (shinryu1324alt) 313 100.60 119.41 139 44.41
1430. Patt (rymt) 313 66.40 95.56 78 24.92
1431. ChosilogRTX (chosilogrtx) 313 101.42 143.77 136 43.45
1432. Tony (alpha_911) 313 46.84 64.71 37 11.82
1433. Shelby (typo5) 312 92.13 121.69 95 30.45
1434. Emma (emmasmith2005) 312 89.47 113.69 84 26.92
1435. root (chroot) 312 71.36 125.93 79 25.32
1436. Emad (emadgsamy) 312 38.02 59.50 23 7.37
1437. ADFJEWI FF (weiyd) 311 99.22 129.90 138 44.37
1438. Shendo (shend0) 311 50.71 71.03 26 8.36
1439. Jakab (schttj) 311 104.31 140.58 128 41.16
1440. qMark (renvanoss) 311 88.82 112.72 91 29.26
1441. F3lix (philipyoung) 311 66.45 88.12 69 22.19
1442. Ansar (paxaq) 311 63.98 87.63 69 22.19
1443. mwizard (mwizard) 311 127.55 157.21 192 61.74
1444. chinguun (chinguun_0301) 311 80.26 100.16 75 24.12
1445. Bruh (bruh_widow) 311 69.82 98.08 86 27.65
1446. c (blaf) 311 72.79 92.70 68 21.86
1447. Hari (thor_03) 311 45.72 69.07 33 10.61
1448. Oatmeal (cp_oatmeal) 310 61.39 77.60 67 21.61
1449. Berto (bertoisfast) 310 52.53 73.06 28 9.03
1450. Jason (typing_boi69) 309 76.83 105.07 71 22.98
1451. Nikhil (nik9) 309 67.95 95.29 81 26.21
1452. (macieje) 309 157.48 206.11 264 85.44
1453. Nolan (kiwiq1) 309 88.83 104.64 83 26.86
1454. Lasse (lemlo) 309 82.10 112.52 82 26.54
1455. Hubert Fitzgerald (sinatraa68) 308 47.01 67.19 20 6.49
1456. ScocoPope (scocopal) 308 69.93 89.24 69 22.40
1457. PinkPepper (pinkpepper) 308 94.41 128.84 104 33.77
1458. MegaTron (megatron100101) 308 56.17 75.29 44 14.29
1459. Hersh (hbhargava) 308 115.69 145.44 165 53.57
1460. Daniela (danirmz) 308 55.83 84.33 37 12.01
1461. Alex (bjartex) 308 79.38 124.45 83 26.95
1462. light (light_06) 308 46.48 63.44 29 9.42
1463. jone (jonesoldi) 308 54.77 72.48 45 14.61
1464. Sam (sharris11) 307 74.77 94.62 51 16.61
1465. Sav (savcaruso) 307 98.01 146.87 126 41.04
1466. the (rank1zen) 307 73.52 99.73 67 21.82
1467. ttv.guspenseful (gusm09) 307 88.91 116.33 86 28.01
1468. Charlie (cubez) 307 68.31 91.92 100 32.57
1469. Tong (tongvu) 306 87.05 113.20 110 35.95
1470. Oxey (oxey_was_taken_smh) 306 99.29 130.39 123 40.20
1471. And (andzer0) 306 81.03 105.64 98 32.03
1472. mahamad (mahamad017) 306 45.72 62.58 32 10.46
1473. zzr0t (sulj0o) 305 94.61 127.73 118 38.69
1474. Reece Taylor (reeceybro28) 305 63.25 89.01 54 17.70
1475. Jasnam (jazzygoesomnom) 305 65.50 89.79 68 22.30
1476. b (bonkadonks) 305 91.89 118.64 102 33.44
1477. Avaneesh (avaneeshasokan) 305 67.06 86.43 76 24.92
1478. Max (17maxklivans) 305 118.42 158.87 165 54.10
1479. York (yorkay) 304 84.91 110.84 95 31.25
1480. sloth (mitchie98) 304 96.01 132.43 42 13.82
1481. Md. Mamun (mamun_sheikh) 304 67.47 98.83 76 25.00
1482. Lam (lamnv) 304 49.15 65.21 33 10.86
1483. Safraz (hypertyper94) 304 61.09 77.24 60 19.74
1484. Thor (thorern00) 303 57.37 78.15 45 14.85
1485. Rydia (rydia_miwita) 303 38.63 54.43 17 5.61
1486. kaly (klay7) 303 24.86 41.55 72 23.76
1487. Eddynsky (eddynsky432) 303 58.40 74.83 51 16.83
1488. Anthony (apesina) 303 53.74 72.83 26 8.58
1489. Nidhal (yagamee) 302 73.38 99.18 76 25.17
1490. TopGUN (wayhowma) 302 96.60 118.40 183 60.60
1491. sks (sks6174) 302 74.96 100.54 73 24.17
1492. Pietro (qiit) 302 79.36 114.14 57 18.87
1493. Duc (iamphduc) 302 69.67 87.51 87 28.81
1494. KH (gpx2ero) 302 79.60 102.83 77 25.50
1495. I really suk (cornmaster0411) 302 92.78 117.42 100 33.11
1496. MAYANK (mayank_017) 302 31.66 43.11 37 12.25
1497. learn corne (tomgroenwoldt) 301 92.10 114.47 102 33.89
1498. Torrin (t0rr1n) 301 87.83 110.24 96 31.89
1499. sachin (sachin986) 301 65.89 88.38 66 21.93
1500. Noodles (road2_120wpm) 301 85.73 117.24 94 31.23
1501. yzifioapj;;;🙈🙈 (pipur) 301 91.39 123.10 93 30.90
1502. Kiara (katherynbane) 301 89.64 117.58 107 35.55
1503. tstats[kaitokidokuroba] (ka... 301 88.78 124.02 98 32.56
1504. Charlie (cduong04) 301 106.51 137.61 107 35.55
1505. P. (psilva00) 300 84.27 108.41 96 32.00
1506. Piyush (piyush41y08h) 300 61.77 80.33 57 19.00
1507. ndr2 (ndr2) 300 105.49 128.13 131 43.67
1508. Yaroslav (nashivan) 300 36.79 48.25 21 7.00
1509. J (leunidus) 300 105.17 130.86 115 38.33
1510. Charon (just_you_and_me) 300 46.15 58.80 31 10.33
1511. jmzg (jmzg) 300 79.71 106.92 80 26.67
1512. 😳hotmama😫 (h0tmama) 300 142.56 185.24 229 76.33
1513. blue (bluedragon_) 300 96.97 136.91 117 39.00
1514. Bijji (thatboywulfric) 299 100.11 125.26 138 46.15
1515. Ins (insanic10) 299 72.84 101.64 71 23.75
1516. Sidharth (iamsidman17) 299 84.49 110.54 85 28.43
1517. Jhari (hyunjintinapay) 299 60.41 79.47 58 19.40
1518. Fouracle (fouracle) 299 155.23 188.96 265 88.63
1519. King JF (foongtastic) 299 58.27 74.24 51 17.06
1520. Tiny Tank (anti_vax_cat) 299 98.69 127.80 106 35.45
1521. Chuck (typer_inflation) 298 77.19 103.01 82 27.52
1522. TypeLearner21 (typelearner21) 298 100.91 124.99 141 47.32
1523. Sydney (sydholla) 298 87.62 115.41 82 27.52
1524. JACK (jackemon) 298 49.95 74.00 36 12.08
1525. Macedonian King (ijittqerr_) 298 85.89 113.04 76 25.50
1526. Silent_One (get_a_lif3) 298 133.97 170.26 219 73.49
1527. Neb (cyanidetoast) 298 76.13 106.29 76 25.50
1528. Jc9369 (trotterspiglet) 297 70.06 90.08 67 22.56
1529. Samuel (samuel_7) 297 73.38 100.85 64 21.55
1530. MNM (mnmnour) 297 104.33 128.37 135 45.45
1531. ­ ­­ (enqq) 297 71.88 99.63 75 25.25
1532. Danica (7158dandan) 297 74.34 94.79 85 28.62
1533. csl (csl11) 297 66.54 81.87 76 25.59
1534. Taru (tarukwon) 296 90.51 114.16 102 34.46
1535. chara (rin3) 296 94.07 125.59 113 38.18
1536. Sobuj (greensobuj) 296 58.16 82.93 59 19.93
1537. MK-47 (construct) 296 63.94 82.81 63 21.28
1538. Timothy (adral) 296 85.50 121.46 84 28.38
1539. Catalin (catalinhimself) 296 71.44 97.16 70 23.65
1540. Marius (darkmarox) 296 71.37 101.58 72 24.32
1541. Someone (_some_one_) 295 90.16 120.02 95 32.20
1542. (shaun022) 295 82.31 112.14 90 30.51
1543. Raven (ravens_loft) 295 74.04 99.14 74 25.08
1544. Dvorak 9/16/2021 (mj_dvorak) 295 61.68 82.16 51 17.29
1545. RoadTo69(hehe) (lord_hunter) 295 68.84 91.91 72 24.41
1546. likun (likun) 295 36.98 49.28 21 7.12
1547. kamalesan (kamalesan) 295 69.96 87.80 76 25.76
1548. Nurasyl (black2ing) 295 49.12 62.45 30 10.17
1549. Asm (asmsaikat) 295 57.96 74.40 41 13.90
1550. Touchtyping (touchtypingpro... 294 76.49 112.79 95 32.31
1551. Suhas (suhasmaddali007) 294 102.90 126.79 112 38.10
1552. david (snobellprize) 294 88.68 114.13 98 33.33
1553. Anvar (only_aloner) 294 75.01 93.34 101 34.35
1554. Macro (macro225) 294 82.49 99.74 60 20.41
1555. inspirations (inspirations) 294 56.47 73.98 52 17.69
1556. Kai (gigadelic) 294 91.74 120.65 99 33.67
1557. Horst (feanor) 294 97.30 120.28 107 36.39
1558. :D (rathorr) 294 39.78 56.28 23 7.82
1559. 27thave.bandcamp.com (xxcru... 293 146.15 188.92 233 79.52
1560. Nirmith (nirmith_akash) 293 55.29 72.81 41 13.99
1561. Michael (lastobelus) 293 82.43 97.70 66 22.53
1562. prints (ichigopurin) 293 110.60 154.59 167 57.00
1563. Burint (brenolz) 293 72.41 95.11 75 25.60
1564. bondservant (arenza) 293 91.78 121.57 108 36.86
1565. Amarpreet Singh (amar123200) 293 72.10 100.16 84 28.67
1566. ajit (ajit9999) 293 65.72 88.62 85 29.01
1567. Aditya (adibhandari) 293 71.00 92.80 85 29.01
1568. Logan (36beastgod) 293 72.94 94.91 86 29.35
1569. Veer (the_veer) 292 84.33 108.93 79 27.05
1570. Omar (samura1) 292 65.37 92.38 69 23.63
1571. Pink (pinkbass) 292 66.95 92.34 69 23.63
1572. reem (bacil123) 292 109.63 139.38 132 45.21
1573. zheqe (zheqe) 291 109.95 133.42 148 50.86
1574. Ujjval (ross_specter) 291 55.17 73.45 36 12.37
1575. OpSindoor 2 in June (defone) 291 89.10 125.88 108 37.11
1576. anonym_igelkott (anonym_ige... 291 119.96 143.19 163 56.01
1577. Vanessa (abetterplace) 291 99.06 129.02 120 41.24
1578. carrie (charmed4002) 291 42.97 58.79 22 7.56
1579. t (zyxx) 290 93.32 129.84 115 39.66
1580. Surely (surely_) 290 55.14 74.36 36 12.41
1581. Loma (pbaloma) 290 99.90 123.26 104 35.86
1582. Monotarinai (monotarinai) 290 70.76 93.83 73 25.17
1583. leftovericecream (leftoveri... 290 96.14 121.75 125 43.10
1584. Hello (julius1331) 290 84.50 109.01 87 30.00
1585. a (jdlwahaha) 290 95.44 117.85 111 38.28
1586. meerkat (dr_meerkat) 290 76.39 93.80 69 23.79
1587. puthin_p2n (bugsmasher) 290 83.09 116.97 80 27.59
1588. boiax (boiax) 290 60.92 86.95 65 22.41
1589. aziz (azizkhanfar304) 290 59.86 75.53 57 19.66
1590. Anthony S. (anthonyjshuey) 290 83.59 119.01 80 27.59
1591. wdMahbub (wdmahbub) 290 32.27 44.49 23 7.93
1592. Yeldos (yeldos1) 289 26.38 43.76 48 16.61
1593. Im not a country (taiwankim) 289 88.63 114.78 93 32.18
1594. Struasz (struasz) 289 35.99 52.27 24 8.30
1595. Ross (pyramidgg) 289 109.67 146.18 125 43.25
1596. Navait (nkumar031) 289 59.08 83.48 59 20.42
1597. Rasmus (kennystarfighter_) 289 76.38 103.76 73 25.26
1598. #1 Racist (gnadus) 289 53.83 69.93 26 9.00
1599. Angela (angela_typeracer) 289 46.82 67.20 24 8.30
1600. Kerim (keroma) 289 39.83 52.77 15 5.19
1601. ramen (lightning_poliwag) 288 85.21 119.12 98 34.03
1602. Misha (ladyvander) 288 103.54 129.93 125 43.40
1603. pwp (fickypw) 288 81.54 99.24 64 22.22
1604. usagi704 (usagi704) 287 64.60 79.58 53 18.47
1605. Nilanjan (nilthedev) 287 62.49 86.02 55 19.16
1606. lurak (lurak2131) 287 75.17 97.18 69 24.04
1607. KC Abhinav (kcabdn) 287 55.00 78.53 42 14.63
1608. Pranjal (haanhaargaya) 287 51.52 65.06 25 8.71
1609. Ewan (ewan121) 287 83.03 111.91 78 27.18
1610. Abdzag (abdzag) 287 65.42 91.30 70 24.39
1611. sierra (sierra05) 286 156.11 202.05 243 84.97
1612. Sampharos (sampharos) 286 49.77 66.92 24 8.39
1613. Maxim (mista7) 286 50.45 71.01 29 10.14
1614. Krushna (krush111878) 286 51.72 72.17 34 11.89
1615. Jhonny (jhonny_space0ut) 286 64.37 79.65 63 22.03
1616. Danny (h4ndeye) 286 75.95 100.40 69 24.13
1617. Catalin (georgecatalin) 286 78.58 103.56 64 22.38
1618. Reddington ツ (ericliu17) 286 118.11 155.92 173 60.49
1619. Raj (raxoltron) 285 67.64 95.29 84 29.47
1620. Nursultan (nursultan23) 285 59.71 80.71 41 14.39
1621. mayzerto (mayzerto) 285 68.96 85.66 58 20.35
1622. Jack (jackthesnacc) 285 66.51 93.97 72 25.26
1623. speedyqwertalez (i_am_a_nooby) 285 56.35 69.17 32 11.23
1624. Joe (show_some_moe_joe) 285 57.63 74.61 33 11.58
1625. Jandar (jandar) 285 70.96 91.76 69 24.21
1626. pwned (pwned1337) 284 47.20 63.14 41 14.44
1627. Zaynab (itsyou) 284 67.78 88.47 74 26.06
1628. Gopal (avengergopal) 284 34.83 53.03 25 8.80
1629. ObiJuaan (obijuaan) 284 69.48 102.95 76 26.76
1630. MazzaM (typingproxyz) 283 82.26 131.52 71 25.09
1631. sly (slymaster11) 283 113.67 145.75 132 46.64
1632. 1 (shootingmonkey1) 283 67.83 89.64 66 23.32
1633. Bob (octopus32) 283 107.17 128.89 153 54.06
1634. James (jjhertz) 283 66.58 98.35 65 22.97
1635. butttickler (james29091998) 283 53.77 72.02 41 14.49
1636. Hayrra (hedooxx) 283 52.18 64.88 17 6.01
1637. Jonah (workman04) 282 91.90 124.29 104 36.88
1638. Sam (numberonemega) 282 111.74 146.05 169 59.93
1639. Jethro (jetthrower) 282 77.75 103.96 80 28.37
1640. greenmantis (greenmantis) 282 111.44 145.48 154 54.61
1641. quite fast (edonn) 282 118.13 148.06 125 44.33
1642. AWE (awicek) 282 52.61 65.77 26 9.22
1643. shark (sharkpause) 281 64.41 87.15 60 21.35
1644. Nima (nimayaqmuri) 281 84.81 105.96 81 28.83
1645. Michael (m1ch4el) 281 59.57 75.55 41 14.59
1646. Eddie (eddie_08) 281 73.15 96.94 76 27.05
1647. Somogyi (vincture) 280 97.98 126.12 94 33.57
1648. One last time (ubershah) 280 101.58 136.59 139 49.64
1649. Taejas (taejas) 280 90.53 107.68 101 36.07
1650. Shadow (shadow_monarch) 280 85.64 116.41 79 28.21
1651. butter (rtporpmal) 280 71.85 94.90 62 22.14
1652. Racer (racer_9) 280 55.41 80.13 30 10.71
1653. Eugene (ptes77) 280 152.93 192.14 240 85.71
1654. Ikenna (odogwu) 280 76.67 107.78 79 28.21
1655. notkinruyuu (notkinruyuu) 280 53.89 82.03 33 11.79
1656. Manel (mrnuke) 280 78.92 93.22 76 27.14
1657. Mohamed Sadiq (mohamed_sadi... 280 29.46 39.60 30 10.71
1658. Joe (jgizzi21) 280 74.41 98.73 60 21.43
1659. ?? (form30to100) 280 28.94 45.60 41 14.64
1660. anon (dontrun01) 280 39.41 55.21 22 7.86
1661. Chicken (chicken807) 280 91.67 123.85 98 35.00
1662. Anson (ansonso042802) 280 69.31 95.48 50 17.86
1663. PURPLE_MAGE (grokestray) 280 71.21 95.89 72 25.71
1664. 🧀 Chez (super_not_pro) 279 139.94 174.14 213 76.34
1665. Val (sgtvaltzu) 279 92.31 109.15 83 29.75
1666. Imperator (imperator_357) 279 60.44 70.78 46 16.49
1667. Heufy (heufy) 279 83.94 105.54 90 32.26
1668. god (god_is_here) 279 93.36 117.04 93 33.33
1669. ghaws (ghaws) 279 74.99 97.04 79 28.32
1670. sukhoi su-57 (shezy) 278 41.77 63.73 29 10.43
1671. henry (luckyhenry) 278 83.48 99.64 71 25.54
1672. Liam (lime_da_bestest_colemak) 278 63.40 83.34 56 20.14
1673. Onni (alchem) 278 82.62 121.20 65 23.38
1674. Wave (waveclipping) 277 110.51 147.56 140 50.54
1675. Yusuke (tokyoprogramming) 277 78.67 102.68 79 28.52
1676. ionut (ionut_red) 277 90.70 124.66 106 38.27
1677. antobot (antobot) 277 55.14 73.96 52 18.77
1678. aditya (yusifer_zendric) 276 105.19 130.38 130 47.10
1679. Jamal (xflash) 276 87.52 116.42 92 33.33
1680. Edwin (biggchinoxxl) 276 64.15 95.43 49 17.75
1681. Will (williamwang) 275 109.16 140.26 120 43.64
1682. Robbie (symba369) 275 80.67 104.63 84 30.55
1683. Lark (sirhaxbard) 275 112.99 146.15 127 46.18
1684. Radek (raddzio) 275 65.68 87.49 62 22.55
1685. Chilly (racerrrrrrr) 275 59.80 76.35 44 16.00
1686. Luke (luthedog) 275 77.47 103.12 66 24.00
1687. Hau (jackie1997) 275 64.96 94.14 69 25.09
1688. Aheartz (idul_aheartz06) 275 50.46 67.02 28 10.18
1689. Alex (delvern) 275 71.16 87.59 71 25.82
1690. jerry (sheep0109) 274 52.82 75.40 41 14.96
1691. jinay (noisy_88) 274 73.30 95.67 79 28.83
1692. Murad (murad90) 274 52.37 68.14 29 10.58
1693. Cultist (kishore0305) 274 98.00 125.95 89 32.48
1694. kd (kdrai007) 274 50.33 71.53 31 11.31
1695. Jpjt (jyrah) 274 72.85 90.92 48 17.52
1696. Grover (grover8323) 274 51.46 64.06 18 6.57
1697. askeladd (askeladd_619) 274 44.67 58.97 24 8.76
1698. Ahmad (ahmad7salah) 274 54.68 71.87 30 10.95
1699. Krg (username_example125259) 273 117.07 142.63 155 56.78
1700. razwan (razwan) 273 37.59 61.16 20 7.33
1701. Yanni (moronicmetalman) 273 106.90 127.47 118 43.22
1702. Stefan (fendorian) 273 92.84 116.99 107 39.19
1703. Dayna (daynarrr) 273 87.63 122.42 93 34.07
1704. Lawrence (buffoony) 273 79.30 105.10 91 33.33
1705. Andres (atv2307) 273 64.67 86.53 65 23.81
1706. Leo (asdbooh) 273 90.79 116.85 87 31.87
1707. gabi (g_i_g) 273 51.43 73.44 32 11.72
1708. RAMs3c (xander360) 272 76.18 101.76 59 21.69
1709. fast (n1lotpal) 272 73.54 91.42 77 28.31
1710. Manuel (manuelsandoya) 272 52.65 70.76 21 7.72
1711. humberto torres (humbertoto... 272 88.60 108.76 86 31.62
1712. TheyGotAlex (harshbarger.a@... 272 118.28 164.34 142 52.21
1713. Ambi (dank_ambi) 272 93.41 127.75 114 41.91
1714. Francisco (cdt1) 272 87.38 112.78 80 29.41
1715. Gio (banzy) 272 59.32 73.91 45 16.54
1716. Jonas (supektibol) 271 88.85 106.32 64 23.62
1717. sadsaturdays (sadsaturdays) 271 49.53 64.10 33 12.18
1718. Perceval-_- (perceval) 271 68.71 86.71 62 22.88
1719. mcga (mcga) 271 90.31 114.29 101 37.27
1720. accongero (geononquit) 271 145.64 196.28 183 67.53
1721. Peaches (devastated) 271 122.95 154.23 141 52.03
1722. Mark (datboi1771) 271 94.16 140.44 93 34.32
1723. Dang Hai (dang_hai_ema) 271 36.97 51.90 15 5.54
1724. camden (camdcn) 271 126.49 176.47 183 67.53
1725. Aman (amanengineer) 271 72.70 106.28 65 23.99
1726. nishant (nishp19) 270 76.72 93.47 81 30.00
1727. Lil guy (littlewalken27) 270 52.06 67.30 33 12.22
1728. Hunter (hunter_da_man11) 270 88.01 112.47 81 30.00
1729. frustratedtyper (frustrated... 270 94.89 119.88 95 35.19
1730. Kirin (emptomatoketchup) 270 86.36 129.62 82 30.37
1731. Alfabetica (alfabetica) 270 85.95 105.95 77 28.52
1732. Okiiiieee (acharyas) 270 84.76 111.42 72 26.67
1733. fishfingers (fastfinger5669) 270 69.48 88.18 66 24.44
1734. logan (logannnc) 270 53.20 71.55 20 7.41
1735. Trent (tsteele07) 269 68.53 84.78 63 23.42
1736. Le (lenam12345) 269 46.74 69.89 20 7.43
1737. imscreecher (imscreecher) 269 66.45 91.74 51 18.96
1738. Bill (destroyer_2) 269 82.14 117.00 79 29.37
1739. Ben (thisisben) 268 85.91 105.82 62 23.13
1740. SURFΛCΞ (surface) 268 103.58 138.80 129 48.13
1741. Sandy (sandeshgowda0094) 268 30.12 42.20 34 12.69
1742. Peter (ptnguyen) 268 108.00 143.19 135 50.37
1743. Pradeep (pradeep80) 268 70.81 117.68 62 23.13
1744. Fearless Jutt (lozer098) 268 71.34 92.65 53 19.78
1745. Fraze (dunklioscious) 268 146.23 185.85 196 73.13
1746. akzhol (atomixa) 268 86.24 111.93 89 33.21
1747. Nagai (nagaimatsuge) 267 89.33 111.87 94 35.21
1748. Bình (juliecorstarr) 267 50.46 97.36 25 9.36
1749. Jordi (jordi0lle) 267 53.83 72.75 24 8.99
1750. Matt (inedibility) 267 97.89 122.48 100 37.45
1751. Glass (glass_crys) 267 94.75 130.10 97 36.33
1752. Ali (french_baguette) 267 55.73 80.03 47 17.60
1753. Rory Gower (rxryag) 267 42.97 62.61 22 8.24
1754. Robert (karayicki) 266 102.47 124.31 117 43.98
1755. Kelby (haulzy) 266 94.40 110.91 100 37.59
1756. Hossein (dustylamia) 266 85.77 126.90 108 40.60
1757. zeeee (zeeebra) 265 107.71 146.21 142 53.58
1758. Typing🤯🤯🤯 (sirsoup) 265 95.23 118.96 75 28.30
1759. Jo (jococonutty) 265 87.19 110.79 90 33.96
1760. JP (freshlumpia) 265 81.68 112.19 79 29.81
1761. barry01xd (barry011) 265 117.27 148.10 140 52.83
1762. tudorica1 (tudorel1234) 264 98.90 115.94 91 34.47
1763. Demon (thedemon54) 264 43.87 70.33 21 7.95
1764. severed (severedhand) 264 83.56 115.71 66 25.00
1765. Pavan (sai_pavan) 264 71.17 93.84 60 22.73
1766. Sahariar (noob_sahariar) 264 70.62 98.98 67 25.38
1767. gangreenie (gangreenie) 264 97.49 130.44 105 39.77
1768. Enjoi (enjoisxd) 264 68.27 87.51 58 21.97
1769. Typer Shark (teodorrd27) 263 122.58 144.05 154 58.56
1770. munkeontop (revvitt) 263 141.39 169.47 180 68.44
1771. Abdulelah (hansan) 263 55.16 73.03 36 13.69
1772. Byron (chicken_little1) 263 59.57 72.01 40 15.21
1773. Hyrum (anom4001) 263 90.03 115.87 91 34.60
1774. Shu (shuuouma) 262 60.49 76.10 43 16.41
1775. Poops (poops_magee) 262 116.04 140.37 153 58.40
1776. Hans (phantomreel) 262 49.62 64.27 30 11.45
1777. Lightning (just_lightning_) 262 67.14 94.27 42 16.03
1778. Nigel (nigelhaha) 262 34.20 51.09 11 4.20
1779. Timmy (timexwatch) 261 71.90 99.49 61 23.37
1780. (sputype) 261 102.70 144.79 102 39.08
1781. salem (salem_coder) 261 60.62 91.78 59 22.61
1782. Ndrew138 (ndrewewqe) 261 69.54 89.16 59 22.61
1783. Prem (merpx) 261 77.16 94.66 64 24.52
1784. lukman (kopimaniz) 261 87.72 104.81 87 33.33
1785. Kenway (kenway316) 261 74.00 102.42 59 22.61
1786. Hatandriya (tiko270303) 260 110.82 142.51 126 48.46
1787. Nairwick (nairwick) 260 78.30 117.19 52 20.00
1788. Nagaku (nagaku) 260 99.46 127.84 90 34.62
1789. Mers (mers_0412) 260 99.87 122.50 108 41.54
1790. Meet (meet_patel1588) 260 68.99 94.32 57 21.92
1791. Stormy (jsoccerdude@msn.com) 260 87.45 118.20 79 30.38
1792. yixuan (ixuan) 260 80.75 104.97 87 33.46
1793. Cythrix (boment) 260 110.09 135.59 125 48.08
1794. Adrian (adriangat) 260 90.84 113.69 99 38.08
1795. Adam (adamsyaq) 260 97.81 123.46 108 41.54
1796. H (vigilantvillian_colemak) 259 109.67 130.65 135 52.12
1797. scuba (scuba2x) 259 72.56 111.17 61 23.55
1798. RoosterDunker (roosterdunker) 259 94.18 114.32 73 28.19
1799. Richard (richard_king) 259 72.81 95.59 51 19.69
1800. matiullah (qais_007) 259 39.51 49.78 14 5.41
1801. Joe (neimad7) 259 110.31 144.78 106 40.93
1802. joe (mcmillybear) 259 74.55 98.01 70 27.03
1803. hero (iknowhtml) 259 41.63 56.15 18 6.95
1804. Kade (buph_kade) 259 78.15 113.29 53 20.46
1805. Violet (ackerman_l1) 259 79.33 96.04 65 25.10
1806. Mhark (mharkmharkmhark) 258 83.94 105.77 64 24.81
1807. jonny (jlun23) 258 125.09 155.88 173 67.05
1808. CornPacs (cornpacs) 258 87.58 107.48 79 30.62
1809. CHeezs (cheezs) 258 101.43 135.09 174 67.44
1810. hitham osama (hitham16) 258 27.91 45.48 29 11.24
1811. Vi Kiet (vikiet1456) 257 60.79 77.48 60 23.35
1812. Will (slamdado) 257 72.49 95.56 50 19.46
1813. prplx (prplx) 257 99.51 133.39 113 43.97
1814. veirt (exlog) 257 128.69 165.61 158 61.48
1815. E (evan_30) 257 82.93 103.25 81 31.52
1816. 원숭이 (dweaji) 257 106.15 131.30 116 45.14
1817. craw (clamchowderco) 257 79.84 105.41 80 31.13
1818. Art (artkhl) 257 77.85 99.68 70 27.24
1819. Andrew (andrewsim) 257 61.05 75.38 59 22.96
1820. Mooyodauh (mooyodauh) 257 91.57 127.04 76 29.57
1821. Qi (whathaha) 256 123.49 165.41 157 61.33
1822. Meow (vic12116) 256 68.08 91.86 65 25.39
1823. Mark (requiem__) 256 85.98 109.78 67 26.17
1824. mike (oxfordcomma) 256 94.55 116.19 105 41.02
1825. Anh Ộ i i (odarealpeo321) 256 98.21 133.95 88 34.38
1826. hackthemoon (hackthemoon) 256 81.15 104.71 63 24.61
1827. Severin (elmo96) 256 101.84 120.95 109 42.58
1828. Tony (complex) 256 96.11 131.84 93 36.33
1829. wpmhog (wpmhog) 255 75.77 99.93 55 21.57
1830. Triklino (triklino) 255 137.66 183.78 183 71.76
1831. Yash (thanosyash) 255 70.45 102.01 56 21.96
1832. shashank (shashaank) 255 38.33 47.50 22 8.63
1833. Ishaant (ishaant) 255 57.88 75.88 50 19.61
1834. trash 22424242424 (y6_chris) 254 111.12 137.91 125 49.21
1835. Shuccer (shuccer) 254 69.52 97.88 62 24.41
1836. Saied (saied_en) 254 54.94 75.03 47 18.50
1837. hafidbuilds (hafidium) 254 55.64 68.63 35 13.78
1838. Atif (atifzaheer2028) 254 93.05 116.16 103 40.55
1839. (amithps66) 254 58.64 72.68 36 14.17
1840. PR@NIT (anonymous8) 254 34.27 53.80 19 7.48
1841. Shaikh Nayeem Uddin (snayeemu) 254 41.92 52.07 20 7.87
1842. abhiraj (abhirajzzz) 254 24.79 36.64 42 16.54
1843. Xebion (xebion) 253 78.70 98.81 72 28.46
1844. Lydia (shiruzu) 253 104.32 123.05 96 37.94
1845. Ankan (nc3rtainity) 253 71.12 90.25 63 24.90
1846. myshmeh (myshmeh) 253 69.01 84.91 57 22.53
1847. heh (itno) 253 65.44 85.02 66 26.09
1848. Math (faster_babe) 253 87.70 103.38 69 27.27
1849. Anmol (anmolsaraswat) 253 82.04 121.64 87 34.39
1850. AL (alhasandude) 253 54.68 69.13 32 12.65
1851. Apu (a1p16u21) 253 37.65 53.15 13 5.14
1852. braeden (braeden312) 253 71.75 101.17 76 30.04
1853. Zeltraa (zeltraa) 252 77.10 101.67 68 26.98
1854. Casper (venomizedcasper) 252 78.64 101.53 66 26.19
1855. Alexander (torphon) 252 94.84 115.80 86 34.13
1856. Daniel (incognitus) 252 90.71 105.98 103 40.87
1857. Imagine losing (naaskee) 252 63.28 83.14 44 17.46
1858. Shadow (shadowkitten) 251 104.49 146.52 111 44.22
1859. Savantik (savantik) 251 111.36 146.26 123 49.00
1860. Peter (petepp) 251 45.97 62.30 25 9.96
1861. tstats[gad2443] (gad2443) 251 112.66 140.67 120 47.81
1862. Mohammad (qwertland123) 251 58.22 82.68 48 19.12
1863. Zoe (zhanchi) 250 56.21 69.42 31 12.40
1864. a (vanazkan) 250 68.87 87.57 53 21.20
1865. Tianchang (tcliao) 250 86.64 109.02 73 29.20
1866. Eric (sivade) 250 113.45 168.75 129 51.60
1867. RAAM (raam_d_prince) 250 75.74 112.07 57 22.80
1868. Free-Palestine (mohammed_id... 250 71.97 99.72 70 28.00
1869. Edmilson (milson602) 250 61.41 81.46 51 20.40
1870. McKenna (mcassady13) 250 94.89 122.24 96 38.40
1871. Ngoc (maxq42) 250 100.19 121.94 78 31.20
1872. Illya (maldron) 250 75.59 94.95 54 21.60
1873. JT (jasonthai) 250 36.81 57.17 17 6.80
1874. Jorn (dealermedic) 250 92.96 121.12 77 30.80
1875. Bilbo (bilboballins) 250 99.86 132.19 93 37.20
1876. bendo (bendh) 250 59.59 78.89 40 16.00
1877. Jammie (typos_z) 249 203.76 273.89 245 98.39
1878. Pintu (pintukanjia) 249 59.02 79.17 52 20.88
1879. Michael (mchu519) 249 111.05 131.80 133 53.41
1880. Eldergod of the Universe (l... 249 117.72 157.37 118 47.39
1881. JusticeEX (justiceex) 249 101.43 149.19 97 38.96
1882. Piss Boyy (ineedanickname) 249 94.71 138.47 75 30.12
1883. ignacio (ifarias25) 249 96.54 123.78 72 28.92
1884. DMack (dmack98) 249 89.47 114.53 88 35.34
1885. czus (czus) 249 71.94 98.74 66 26.51
1886. joster150 (joster150) 249 66.74 84.40 50 20.08
1887. zhata1234 (zhata) 248 83.62 111.42 57 22.98
1888. sam (samtheguy10) 248 66.48 88.11 50 20.16
1889. Mamdouh (mamdouh_75) 248 63.65 80.10 54 21.77
1890. Heide (vnit) 247 70.73 96.53 52 21.05
1891. Matthew (poobcum) 247 64.55 85.36 56 22.67
1892. Karthik (karthikkumar) 247 68.34 96.09 52 21.05
1893. GWTNess (gwtness) 247 82.86 109.27 79 31.98
1894. Kopa_Samsu (aaourav0) 247 57.88 75.43 69 27.94
1895. ajrv (aamodvarma) 247 109.86 146.08 118 47.77
1896. https://youtu.be/dQw4w9WgXc... 246 122.33 152.12 136 55.28
1897. 🦉Tenor🦉 (strigibae) 246 127.91 160.99 154 62.60
1898. Serial (serial_typer) 246 77.24 101.55 65 26.42
1899. Luda (ludavis) 246 80.68 103.51 68 27.64
1900. King (kingcrumple) 246 119.75 153.64 157 63.82
1901. Einno (einno) 246 85.68 107.64 81 32.93
1902. Chowda (chowda) 246 103.45 131.08 100 40.65
1903. tstats[spyro1411] (spyro1411) 245 57.69 69.17 35 14.29
1904. K (ksil_surface) 245 101.72 127.98 106 43.27
1905. Coder100 (coder_onehundred) 245 123.08 150.37 134 54.69
1906. ayushwan (ayush6203) 245 24.31 36.13 53 21.63
1907. H (macca619) 245 69.80 86.36 61 24.90
1908. Walson (wals) 244 68.49 98.93 64 26.23
1909. Richard (redjoe) 244 104.77 134.29 112 45.90
1910. norush (norush) 244 84.90 102.24 66 27.05
1911. V01D (inferno888) 244 85.22 122.49 78 31.97
1912. AM (freae) 244 85.46 108.13 87 35.66
1913. Sajib (dipto) 244 51.72 73.31 39 15.98
1914. unseasoned lawyer (dindondoe) 244 150.76 221.67 172 70.49
1915. CrashRAcer1 (crashracer1) 244 52.36 77.70 26 10.66
1916. Ayden (aydensonline) 244 86.53 120.83 67 27.46
1917. mv0 (the_oko) 243 87.45 104.09 75 30.86
1918. Rahaf (rahafalahdab) 243 44.88 57.00 25 10.29
1919. Eric (pawnnub) 243 89.35 131.88 86 35.39
1920. mrbean (mrbean1) 243 87.20 104.54 95 39.09
1921. sk (kasem132) 243 62.87 81.56 49 20.16
1922. Crasedes (crasedes) 243 80.60 104.07 60 24.69
1923. himansh.u7 (mou5etrap) 243 55.91 80.74 27 11.11
1924. Sweats Money (digital_dankie_) 243 49.86 66.00 30 12.35
1925. Shayne (shayneacasio) 242 87.85 124.52 81 33.47
1926. Rabi (rabiulislam9) 242 61.47 86.22 57 23.55
1927. Lirei (lirei) 242 96.79 120.03 68 28.10
1928. jean (jhyppoli) 242 49.57 68.52 16 6.61
1929. Iqbal Ahmad (iqbal2021) 242 47.34 66.06 27 11.16
1930. . (cuzto) 242 76.31 107.97 53 21.90
1931. Damian (kztryu) 242 55.40 77.34 26 10.74
1932. Stijn (stijnmeijssen) 241 77.03 105.23 48 19.92
1933. Hour (soslow_) 241 59.29 76.81 34 14.11
1934. Bijay (shresthabijay) 241 64.17 86.84 48 19.92
1935. Jay (eradekator) 241 94.28 116.24 72 29.88
1936. Benji (benbind1) 241 85.75 109.55 69 28.63
1937. Arschwurst (arschwurst) 241 48.67 62.81 26 10.79
1938. Anisur (anis_017) 241 77.14 99.18 43 17.84
1939. Amogh (amogh_14) 241 80.35 103.45 75 31.12
1940. Aditya (aditya2712) 241 75.28 97.27 62 25.73
1941. Joaquin (wakincloset) 240 91.00 110.57 92 38.33
1942. Andrea (tinola) 240 77.11 96.22 51 21.25
1943. Jonathan (insanegamerwow) 240 132.85 167.10 173 72.08
1944. DeeDee (deedee09) 240 68.04 81.17 49 20.42
1945. Alex (aleksandr797) 240 73.67 94.57 67 27.92
1946. Allen (xs_ageart) 239 106.14 131.82 109 45.61
1947. Konstantinos (sotos01) 239 43.87 61.41 160 66.95
1948. Prajwal (prajwalr) 239 56.67 75.22 38 15.90
1949. page (phrynesc) 239 73.28 86.76 66 27.62
1950. William (bobodahobo54) 239 88.39 105.80 65 27.20
1951. SaeedUllah (asadjani) 239 59.28 76.84 39 16.32
1952. Ritesh (ritesh_98) 238 63.29 86.74 52 21.85
1953. Peter (peter50latam) 238 53.00 80.22 22 9.24
1954. Krispy (krispytypes) 238 119.56 144.01 129 54.20
1955. Snail (type_of_a_typer) 237 57.40 70.43 27 11.39
1956. Missy (lovelydy) 237 84.73 104.69 62 26.16
1957. LoneRusher (lonerusher) 237 78.70 99.87 61 25.74
1958. gabe (gabeeeeee) 237 96.06 140.01 87 36.71
1959. mostafa (eng_mustafa) 237 68.65 91.63 59 24.89
1960. Dhaval (dhaval06) 237 73.67 96.31 71 29.96
1961. Chaos (chaoszed) 237 87.29 112.28 80 33.76
1962. Apple Tragic (baccupacc) 237 142.80 172.17 182 76.79
1963. Absect (absect) 237 44.37 59.62 22 9.28
1964. Noobtyper (noobtyper96) 237 54.71 70.63 30 12.66
1965. Juan (juanmachuca95) 237 58.93 71.47 34 14.35
1966. Doan (zzzhzzz) 236 60.91 83.62 47 19.92
1967. Zen (zenchan123) 236 101.60 147.96 94 39.83
1968. Matrix (ss005) 236 83.74 104.55 68 28.81
1969. Inferno (mohmadrid0) 236 113.37 144.09 191 80.93
1970. be nice slunt (jokii) 236 128.12 162.13 152 64.41
1971. Jejo (jejo03) 236 60.89 83.78 45 19.07
1972. Natchanon (irmia223) 236 86.72 109.02 69 29.24
1973. Anatoli (errormaker) 236 73.65 90.04 42 17.80
1974. Pawel (el3ctron) 236 36.42 49.38 11 4.66
1975. Chronic (cheng01) 236 44.01 59.37 12 5.08
1976. Casper (bighero86) 236 67.32 88.10 59 25.00
1977. beatrace (beatrace21) 236 55.80 76.63 23 9.75
1978. Austin (_8(|) (atrain742) 236 118.35 156.30 115 48.73
1979. ThorNMR (thor_nmr) 236 33.42 47.05 13 5.51
1980. Joe (__joe___mama__) 235 87.84 119.29 62 26.38
1981. dingdong (zuccandsucc) 235 105.29 134.07 149 63.40
1982. Akira (s_akira) 235 55.47 72.59 34 14.47
1983. Stelister (stelister) 235 74.84 96.01 71 30.21
1984. SMoon (smoon343) 235 60.29 75.76 39 16.60
1985. Roshan (roshan_satare) 235 77.79 97.82 73 31.06
1986. Khadea (charter) 235 121.56 154.55 131 55.74
1987. Brandon (baddoodle) 235 68.30 93.63 48 20.43
1988. Shubham (shubham_p) 234 39.79 60.59 16 6.84
1989. Julius (reallyoldfart) 234 33.15 48.11 19 8.12
1990. Kusmir (kusmir) 234 94.80 120.97 78 33.33
1991. jeremyWINZ (jeremiah_munguia) 234 117.12 156.06 110 47.01
1992. Daito (blucantrell) 234 87.29 112.94 65 27.78
1993. Jan (acpehalus) 234 71.02 101.91 57 24.36
1994. Jamo (thewindy) 233 97.00 123.03 93 39.91
1995. Syed Sheraz (syedsherazarshad) 233 32.53 50.38 24 10.30
1996. strgn (strgn) 233 30.40 42.42 24 10.30
1997. Stanislav (stanmkh) 233 90.32 124.68 64 27.47
1998. Saptarshi (lamda_cdm_10) 233 59.88 77.26 50 21.46
1999. Jagadeeswar (jd_300) 233 76.86 103.43 66 28.33
2000. Buchock (buchok) 233 51.97 76.01 23 9.87
2001. Abby (aeheffington) 233 111.10 135.39 116 49.79
2002. Sushant (sushant09) 233 72.82 88.35 58 24.89
2003. Vishwajeet Prasad (vishwaje... 232 62.95 82.22 69 29.74
2004. Ralph Angelo (slow_penguin) 232 85.27 111.21 53 22.84
2005. Nistha Nakarmi (simply_nisu) 232 57.88 77.49 39 16.81
2006. Jerzy (mr_avocado) 232 60.20 76.74 42 18.10
2007. Kotai (kotai) 232 74.16 100.37 56 24.14
2008. Tootels (joenasha10) 232 113.12 151.52 92 39.66
2009. Harry (hai1912001) 232 56.80 72.32 18 7.76
2010. Gojou (gojou_) 232 28.02 43.03 32 13.79
2011. 🧋& TZUYU are from 𝐓... 232 86.29 110.21 64 27.59
2012. Chumchum (aldzia) 232 97.61 127.89 148 63.79
2013. acg (acg26) 232 86.86 118.16 63 27.16
2014. fassasin (fassasin) 232 67.55 91.95 63 27.16
2015. aryan (_ar__yan_) 232 50.31 68.12 57 24.57
2016. Jaime Gabriel (_jetdoza) 231 88.38 123.70 76 32.90
2017. Boba (tapiocaman) 231 84.85 110.28 71 30.74
2018. Jane (sarf) 231 85.35 113.61 81 35.06
2019. RainbowDude (rainbowdudenon... 231 114.69 159.45 93 40.26
2020. projectfupagain (projectfup... 231 91.62 110.20 78 33.77
2021. Ahmed (nesbmido) 231 129.65 168.18 142 61.47
2022. Temple (mason_carlson) 231 89.44 127.78 90 38.96
2023. Quinn (magicsoap444) 231 42.62 64.07 34 14.72
2024. Dhayanandh (ken_adams) 231 104.41 121.91 91 39.39
2025. Doniyorbek (doniyorbek7376) 231 60.16 76.52 39 16.88
2026. David (dave_em) 231 97.84 120.33 45 19.48
2027. nice'nslow (annoyingkid) 231 129.49 159.10 141 61.04
2028. William (willmart16) 230 112.05 134.19 120 52.17
2029. Eric (qwarts) 230 105.53 138.65 83 36.09
2030. Jude (philivey) 230 76.48 96.88 47 20.43
2031. Murat (nocs782) 230 65.56 85.93 49 21.30
2032. jamal (jamalkhan651432) 230 46.78 61.93 21 9.13
2033. galei (galei) 230 100.75 139.88 92 40.00
2034. epic (epicrako123) 230 93.50 117.12 118 51.30
2035. throw (bomnom) 230 113.31 147.38 129 56.09
2036. HATE LAG! (11fingerstypist) 230 115.23 144.48 192 83.48
2037. Matthew (yossarian_milo_22) 229 93.97 110.54 71 31.00
2038. Martin (watchieboy) 229 96.77 128.67 87 37.99
2039. Tutuko (tutuko) 229 50.58 60.75 20 8.73
2040. thotbox (thotb0x) 229 72.10 95.36 58 25.33
2041. M (springfield12) 229 112.36 134.83 135 58.95
2042. prashant (prashant1847) 229 59.10 77.91 41 17.90
2043. Reverend Poo Poo Bum (poopy... 229 86.31 114.32 66 28.82
2044. obada (obada_yahya) 229 98.60 127.83 83 36.24
2045. Niels (nielsjensen) 229 111.52 153.85 106 46.29
2046. Angela (mee_123) 229 39.15 51.08 9 3.93
2047. H7ti guy (eternality) 229 113.46 155.26 98 42.79
2048. Emilio (emilioc) 229 84.92 118.58 54 23.58
2049. ⚡DVORAK (dvorak_mg) 229 105.31 139.59 107 46.72
2050. Brandon (aceryeung) 229 76.05 109.67 53 23.14
2051. Niket (daspacebar) 229 70.69 94.67 61 26.64
2052. Yasser (yass_mg) 229 59.49 71.83 40 17.47
2053. Tuukka (sblankg) 228 89.77 110.74 83 36.40
2054. Minnie (minniemouselondon) 228 87.86 111.45 75 32.89
2055. John (kingpigeon) 228 70.92 96.62 56 24.56
2056. Killyan (killyan) 228 94.72 127.28 89 39.04
2057. Pradhumn (darkinferno) 228 52.72 72.05 34 14.91
2058. bambang (breakingkeyboards) 228 86.06 106.73 77 33.77
2059. INDIAN (armaan25) 228 69.89 89.69 53 23.25
2060. E150D (1omar1) 228 42.41 62.17 23 10.09
2061. AdamS (adamswabel) 228 68.72 88.50 47 20.61
2062. zaoad (zaoad) 227 56.33 71.43 26 11.45
2063. Drovor (wwinder) 227 108.66 143.11 110 48.46
2064. JAFFAR (thetypingfreak) 227 54.78 82.22 47 20.70
2065. Shahryar (srashid3) 227 65.03 90.08 51 22.47
2066. Girl (piemaniac) 227 84.78 113.74 63 27.75
2067. Royce (panda_7) 227 47.79 60.49 24 10.57
2068. Jacob (nutsak) 227 81.94 110.00 60 26.43
2069. Mike (mirkzzz) 227 67.88 83.80 27 11.89
2070. Jazz (melotea) 227 77.74 108.78 52 22.91
2071. Joy (joypark21) 227 77.26 118.02 55 24.23
2072. Ian (iantu) 227 75.26 92.57 51 22.47
2073. Aaron (a_aron) 227 57.01 74.64 32 14.10
2074. ARW🔴 (appleredwarrior) 227 117.71 152.17 132 58.15
2075. QDDFR (qddfr) 227 54.05 77.03 44 19.38
2076. Hussain (sanpilot) 226 96.46 126.39 86 38.05
2077. omid (omidhopeful) 226 69.52 87.03 48 21.24
2078. Neil Franco (neilprangko) 226 116.63 158.38 130 57.52
2079. kemp (imnotflamez) 226 92.48 143.48 74 32.74
2080. Someone (gluroy) 226 57.40 72.77 40 17.70
2081. Rafael (fegelein1234) 226 132.02 169.54 167 73.89
2082. fares (faressonar) 226 46.39 63.08 24 10.62
2083. Christian (amici117) 226 108.45 141.44 113 50.00
2084. bruh_momentum (travis358) 225 104.24 126.13 112 49.78
2085. Flying fingers (tg_gamer) 225 41.64 58.08 15 6.67
2086. Axel (scorchill) 225 63.76 79.16 42 18.67
2087. ak1ra (liamprogamerz) 225 77.70 95.76 56 24.89
2088. Night (anemonighteye) 225 70.98 104.02 55 24.44
2089. Jared (jaredintyper) 225 88.46 111.62 75 33.33
2090. sinc02 (sinc02) 224 82.05 104.25 71 31.70
2091. sanny (scd92318) 224 81.05 115.54 66 29.46
2092. Pontus (ponhav) 224 113.45 142.15 114 50.89
2093. mohamed (mohamed_1800) 224 48.19 61.16 16 7.14
2094. Janis (janisl1993) 224 71.45 92.82 56 25.00
2095. Ankh (ankhaann) 224 39.73 52.09 14 6.25
2096. Ghazi (lynnackerman) 224 65.58 82.47 46 20.54
2097. Antonio (xxaposxx) 223 52.08 73.08 27 12.11
2098. BeltBoy (singbearcar) 223 56.91 71.34 29 13.00
2099. mostafa (mostafa_tantawy) 223 61.56 75.65 43 19.28
2100. mbi (mbi_) 223 36.89 49.22 22 9.87
2101. Khai (khaikhai2) 223 114.23 149.44 120 53.81
2102. jia-da-kong (jiadakong) 223 61.38 74.63 57 25.56
2103. phantom (hrithikhack007) 223 59.05 82.47 33 14.80
2104. Jonathan (fonsdal) 223 74.79 97.38 56 25.11
2105. Nick (checksind) 223 109.93 133.91 106 47.53
2106. BR (brdiesel) 223 109.73 131.32 93 41.70
2107. Bùi (blackfl_12) 223 79.87 98.80 72 32.29
2108. aditya (aditya1003) 223 47.19 56.89 20 8.97
2109. * (000100020003) 223 73.34 95.03 56 25.11
2110. soenke (stinkfuhl) 223 51.91 68.11 24 10.76
2111. Zain (zainabb) 222 63.79 84.08 56 25.23
2112. Adm1n (vilius8) 222 110.69 136.11 109 49.10
2113. tris (trisywc) 222 89.23 116.94 57 25.68
2114. Hendo (slimshadylfc) 222 94.67 124.97 95 42.79
2115. Rony (ravneet_b) 222 92.25 120.73 81 36.49
2116. kyle (poyser) 222 76.46 94.26 54 24.32
2117. mini (kharkongor) 222 80.09 102.96 63 28.38
2118. Darth (darthverde) 222 77.07 106.82 56 25.23
2119. August (august148) 222 46.60 59.21 29 13.06
2120. arindam (ari2007b) 222 54.45 71.91 27 12.16
2121. Andie (andieeee) 222 74.78 123.19 72 32.43
2122. tstats[alexander98] (alexan... 222 64.26 83.02 35 15.77
2123. Abubakar (abubakaravg) 222 47.32 65.58 18 8.11
2124. tstats[cartax] (cartax) 222 51.76 66.93 24 10.81
2125. xiaobao (xiaobaomontgomery) 221 43.98 59.12 16 7.24
2126. quantum (sexhaver25) 221 93.23 136.94 56 25.34
2127. Rinmawia (rinmawia) 221 69.87 90.27 53 23.98
2128. Junkie (qwert_noob) 221 69.02 98.48 46 20.81
2129. nirmit (nirmit0) 221 64.83 80.08 40 18.10
2130. NikoArc (ktp2222) 221 56.87 78.72 27 12.22
2131. Philipp (dasdrache) 221 45.29 57.92 22 9.95
2132. (altrocality) 221 121.19 154.58 117 52.94
2133. Jocho Muaguadabo (alezander... 221 108.33 136.99 98 44.34
2134. Cheyenne (cheyennebuchanan) 221 36.16 53.07 9 4.07
2135. Zeeshan (zeeshan13) 220 94.47 131.94 74 33.64
2136. Richard (tbone001) 220 84.15 105.43 57 25.91
2137. Wilson (starkeyqiu) 220 78.79 106.02 56 25.45
2138. school (modernmarauder) 220 93.24 132.42 81 36.82
2139. Božidar Grgur (marcipanko) 220 68.60 87.13 56 25.45
2140. Sky man (koolienavy) 220 99.75 135.87 91 41.36
2141. Dean (dino22) 220 59.74 71.91 94 42.73
2142. Deepesh (codingdeepesh) 220 38.88 55.79 18 8.18
2143. clgq (clgq) 220 76.79 99.89 44 20.00
2144. Bloxxer (bloxxerboi_rblx) 220 59.88 88.77 46 20.91
2145. Harmonic (blitzzzz) 220 88.42 116.35 65 29.55
2146. Bekboalt (bekbo_0) 220 38.00 47.50 11 5.00
2147. bryan (bczw) 220 135.33 162.62 173 78.64
2148. Taiwan is a country (17lingh1) 220 85.07 109.13 65 29.55
2149. jnk (joelnanakwaku) 220 81.90 104.93 64 29.09
2150. Yash (mitrapandit) 220 55.92 75.26 43 19.55
2151. (timjeffery44) 219 143.55 268.06 183 83.56
2152. Sahaj (sahaj01) 219 62.15 80.34 44 20.09
2153. Robbe (robbelbobel) 219 83.25 106.91 72 32.88
2154. Guest (nherbe_3) 219 62.78 91.45 40 18.26
2155. Mohamad (mohamadasghari) 219 75.67 107.10 50 22.83
2156. lan (lenioniali) 219 48.72 63.14 22 10.05
2157. sunny (kamal787) 219 31.67 44.09 14 6.39
2158. John (blazian11111) 219 103.05 143.47 81 36.99
2159. Aryan (arcuh) 219 85.05 112.37 76 34.70
2160. Andy (andyrox) 219 72.15 94.51 74 33.79
2161. Jeffrey (xxpreheattheoven) 218 89.35 110.06 82 37.61
2162. diva (vampirediva) 218 90.29 123.27 55 25.23
2163. ASHISH (ashish_typer) 218 53.23 74.14 23 10.55
2164. amanmishra (amanmishra) 218 51.42 74.25 23 10.55
2165. Wan Iskandar (wanis02) 218 50.79 68.37 28 12.84
2166. tayoshu (tayoshu) 217 76.14 93.51 57 26.27
2167. not (not_vidhu) 217 71.65 95.81 67 30.88
2168. Jonathan (jonapedia) 217 90.85 121.23 62 28.57
2169. Marcus (flowerskullbeige) 217 86.68 115.24 61 28.11
2170. chang (chang1) 217 126.46 155.13 121 55.76
2171. Wasif (waxif_dad) 216 45.56 63.11 26 12.04
2172. XXX_XXX (ship9x) 216 82.16 104.50 73 33.80
2173. MiamMiam (miammiam100) 216 60.97 76.28 43 19.91
2174. iTay (mengleten) 216 92.62 122.22 78 36.11
2175. Danny (lifeupsidedown) 216 70.29 87.19 47 21.76
2176. J (leathface23) 216 62.06 76.95 37 17.13
2177. Jude (jfendo) 216 81.09 109.76 63 29.17
2178. Tomáš (eyzi25) 216 85.72 108.09 52 24.07
2179. EnkaOsaru (enkaosaru) 216 97.89 124.45 104 48.15
2180. rocket (dk0063) 216 51.71 67.99 12 5.56
2181. Minä (arabwinner) 216 110.06 128.48 96 44.44
2182. Jarred (reed_19) 216 40.34 55.05 15 6.94
2183. Dima (zormik) 215 74.68 97.22 67 31.16
2184. youssef (youssefuser) 215 31.43 40.98 24 11.16
2185. UNSALEK #7379 discord (unsa... 215 90.41 123.61 55 25.58
2186. Sanket (newbie24082002) 215 72.85 99.53 59 27.44
2187. King (kingmaverick07) 215 62.10 80.35 46 21.40
2188. joann (joannyo) 215 60.38 91.45 51 23.72
2189. J (jj024) 215 54.64 74.63 20 9.30
2190. JV (jibs12) 215 83.31 98.14 61 28.37
2191. Kuro (horikta) 215 60.93 85.46 48 22.33
2192. Gautam kumar pandey (gautam... 215 42.45 54.03 16 7.44
2193. Beth (creepmother) 215 92.29 114.01 71 33.02
2194. Anh (billybean__) 215 103.32 131.33 83 38.60
2195. saerith (arabianghosthaunting) 215 220.94 281.09 147 68.37
2196. Aaron (aaron5457) 215 61.86 78.02 38 17.67
2197. Rohit (rawheattt) 215 50.69 67.23 18 8.37
2198. Gulam Mustafa (mr_x003_) 215 30.10 44.92 19 8.84
2199. Spencer (noctis0923) 215 78.84 106.33 67 31.16
2200. Vinayak (vinrana) 214 70.16 89.58 65 30.37
2201. Lian (paullian) 214 83.63 104.78 55 25.70
2202. Nootch (nootch) 214 112.05 146.02 122 57.01
2203. Lin (ltf0501) 214 77.51 96.15 44 20.56
2204. Abudlla.Marofi04 (jonsnow21) 214 44.71 58.46 25 11.68
2205. Isra (israabosada) 214 32.23 44.05 21 9.81
2206. Viktoras (haeven) 214 84.35 113.10 69 32.24
2207. Edmund (emmit3) 214 65.53 90.91 46 21.50
2208. Dyer_Colemak (dyer500) 214 86.07 124.41 63 29.44
2209. Alex (arint) 214 87.60 113.16 71 33.18
2210. Ariffin (ariffin) 214 99.67 127.89 86 40.19
2211. aerospike (aerospike) 214 59.61 83.07 43 20.09
2212. Ems (emman123) 214 52.92 70.79 22 10.28
2213. Stuipedd (stuipedd) 213 82.36 106.68 62 29.11
2214. Byunghyun (stringbottle) 213 74.13 97.47 52 24.41
2215. Ryan (relaxin) 213 143.23 181.36 131 61.50
2216. Brian (pocket_ace) 213 78.15 94.60 56 26.29
2217. Cue (cuewitiwat) 213 72.69 97.79 50 23.47
2218. Chimney (chimneywastaken) 213 66.45 82.42 52 24.41
2219. Shannon (caseius) 213 86.11 110.22 78 36.62
2220. ryan (anonymousboy321) 213 128.60 154.10 149 69.95
2221. Andrew (andumpling) 213 95.82 118.37 91 42.72
2222. victor (hungry_panda) 213 43.36 59.58 12 5.63
2223. Hazem (zomaaa23) 212 61.33 79.01 41 19.34
2224. Dog acc (vick02) 212 129.05 154.08 130 61.32
2225. noah (randylehey) 212 92.69 119.81 74 34.91
2226. :^) (kyeavnign) 212 130.60 176.13 148 69.81
2227. FrozenCroissant (frozencroi... 212 100.47 126.98 100 47.17
2228. exodia (exodiaa) 212 109.24 129.60 106 50.00
2229. Alutic (alutic) 212 91.84 114.13 90 42.45
2230. ROOZBEH (verybadboy) 211 63.02 89.59 37 17.54
2231. Scott (typist2021) 211 64.55 79.52 56 26.54
2232. Mr.Typist (typer456new) 211 60.26 78.29 27 12.80
2233. ExtraSauce (thundertyping) 211 68.78 99.72 47 22.27
2234. kbd warior (spykids3) 211 101.96 139.93 101 47.87
2235. Monroe (monroeshindelar) 211 87.57 111.47 53 25.12
2236. Ghulam (malikgd65) 211 47.62 70.61 20 9.48
2237. LA LUNA, LA BELLA LUNA (fee... 211 120.60 161.68 125 59.24
2238. 👻 (damoru) 211 115.39 158.97 102 48.34
2239. Aarni (aarnib) 211 91.01 119.36 81 38.39
2240. Arun (arunbastola) 211 58.25 71.88 52 24.64
2241. Yuhang (yuhang0722) 210 105.51 137.06 96 45.71
2242. Grzegorz (ulxori) 210 63.74 81.66 51 24.29
2243. Benny (typervain) 210 82.60 106.18 44 20.95
2244. Tahir (tahir_iqbal) 210 100.63 129.73 88 41.90
2245. Samvel (samveland) 210 89.91 125.32 62 29.52
2246. Ryan (rinselmann) 210 87.99 103.57 70 33.33
2247. duglass (rahafduglass) 210 62.43 84.02 46 21.90
2248. Myil (pink_coder0518) 210 51.31 91.51 28 13.33
2249. Morin (lordgroovy) 210 83.07 106.02 67 31.90
2250. Mr. A (itsabhi01) 210 82.74 106.91 90 42.86
2251. Juanpa (gokias_1234) 210 70.11 91.70 50 23.81
2252. Dras (dras227) 210 59.06 77.90 39 18.57
2253. Kratagya (chutiyatyper) 210 77.48 98.83 40 19.05
2254. elite (beatagent) 210 54.39 69.35 19 9.05
2255. Richard (allacrity) 210 71.47 86.02 40 19.05
2256. Ayman (akwah) 210 77.09 100.36 58 27.62
2257. odannnnnnn (quietkid) 209 82.17 111.19 53 25.36
2258. oddblob3000 (oddblob3000) 209 106.90 134.00 98 46.89
2259. Liampbjray (liampbjray) 209 72.48 97.45 50 23.92
2260. kaloyan (kalci) 209 71.58 96.61 46 22.01
2261. Doiv (doiv23) 209 85.99 112.45 62 29.67
2262. Dmitriy (dj1vs) 209 69.67 89.07 54 25.84
2263. Bennett (bnnttnwhk) 209 75.83 95.27 50 23.92
2264. i am (ashou) 209 100.51 141.45 82 39.23
2265. Saken (hareket) 209 36.76 53.20 14 6.70
2266. zetrorectar (zetrorectar) 209 48.11 62.24 25 11.96
2267. Rui Alexandre (tapadinhas) 208 50.13 64.52 16 7.69
2268. shaun (shaunbot_123) 208 68.40 91.34 55 26.44
2269. rt (rtizzle) 208 69.35 92.94 62 29.81
2270. rahul (rku05) 208 46.38 63.97 22 10.58
2271. 𝐱𝐨𝐦𝐞𝐧𝐢... 208 78.88 104.17 53 25.48
2272. kyubkubkubkubyub (kyubkubku... 208 97.89 136.78 88 42.31
2273. jw (jw_c) 208 59.97 81.28 35 16.83
2274. Esman (hedwyn_the_nomad) 208 74.42 97.71 60 28.85
2275. GaN (ganthegreat) 208 50.88 75.09 36 17.31
2276. Dalia (snoppy366) 208 49.07 64.11 27 12.98
2277. zaid (xoxygenkillerx) 207 68.98 95.24 50 24.15
2278. Soyuzbek (soyuzbek) 207 67.65 91.86 47 22.71
2279. SirAlig (siralig) 207 85.37 107.31 57 27.54
2280. Joe (f1rest0rm) 207 64.47 83.59 39 18.84
2281. glenn (bukseng) 207 98.85 122.09 96 46.38
2282. Bean (beansbeansbeans) 207 84.71 106.33 41 19.81
2283. ss (aaassssss) 207 29.21 40.15 25 12.08
2284. Omid (zerodarkshadow) 206 66.25 89.98 52 25.24
2285. Nils (snils) 206 75.12 103.87 49 23.79
2286. Conspiracy (realkingofgames) 206 91.98 112.54 65 31.55
2287. Afsal (npafsal) 206 59.75 75.39 55 26.70
2288. Uncle John Jr. the 5th (che... 206 81.49 108.86 51 24.76
2289. | (canvaslol) 206 77.33 99.52 57 27.67
2290. Ivandro (bigivel) 206 90.15 107.99 75 36.41
2291. God (godalmighty_) 206 26.37 41.74 38 18.45
2292. Nope (_sav) 205 83.13 98.60 61 29.76
2293. Noob (_anto_200) 205 35.83 52.33 22 10.73
2294. Khai (superoiishi) 205 88.12 106.31 78 38.05
2295. Shaishav (shaishav) 205 55.06 73.35 41 20.00
2296. Zor-Pieu (POJUN-Mechanic) (... 205 84.58 103.20 48 23.41
2297. mr (mrantik1) 205 53.46 69.72 28 13.66
2298. Neo (meoo) 205 55.41 83.19 29 14.15
2299. Mathias (mattsric) 205 72.49 89.88 56 27.32
2300. Maheriniaina tstats[kevinrs... 205 84.69 111.69 54 26.34
2301. Grant (grantly) 205 97.61 131.90 90 43.90
2302. Gnarly (gnarlydawg) 205 87.28 110.08 53 25.85
2303. Reiner Rekado Bisara (reine... 205 48.72 65.58 33 16.10
2304. raj bardhan singh rathore (... 205 42.87 55.74 24 11.71
2305. Tyler (superkai65) 204 99.49 127.42 77 37.75
2306. Ryan (ronethenorseman) 204 84.57 102.86 47 23.04
2307. i'm slow (pndspirit) 204 94.97 124.61 78 38.24
2308. (nnas) 204 137.39 164.68 165 80.88
2309. Ngor (nagwick) 204 63.27 80.57 55 26.96
2310. JH (hou32hou) 204 86.85 107.88 59 28.92
2311. Ali (hardstone) 204 67.26 90.58 38 18.63
2312. Gert (hansonagarrett) 204 73.45 92.08 47 23.04
2313. DP (dragonphoenix) 204 57.27 68.25 33 16.18
2314. Darren (darrensey) 204 90.14 122.16 73 35.78
2315. Bas (basawasa) 204 75.41 98.24 55 26.96
2316. Golujs2000 (avinashjs2000) 204 52.48 70.17 20 9.80
2317. Juan (vlect2) 204 70.45 89.66 56 27.45
2318. Sadie (thotchakra) 203 82.29 108.05 70 34.48
2319. Jayson (thezeful) 203 77.65 100.03 80 39.41
2320. supermonkey (sup3rm0nk3y) 203 80.10 98.23 44 21.67
2321. Joshua (shaggymuffin23) 203 88.43 104.39 69 33.99
2322. Ranch (ranchie) 203 80.38 107.34 60 29.56
2323. Ragnar (ragnar000lothbrok) 203 67.13 80.75 46 22.66
2324. Pavan (pavan1000) 203 54.18 65.46 17 8.37
2325. Mattias (matejko203) 203 44.67 64.95 18 8.87
2326. Gordon (gordon_ramsay) 203 87.32 106.13 63 31.03
2327. Fearo (fearowastaken) 203 82.16 107.84 64 31.53
2328. runa (dawn_89) 203 57.29 71.67 30 14.78
2329. bobby (chqnges) 203 141.14 173.40 150 73.89
2330. Byron (byrontan) 203 100.19 125.81 99 48.77
2331. Đỗ (bigcatyoyo) 203 72.13 90.30 47 23.15
2332. Ta-Wei (waynetu) 202 97.18 111.64 88 43.56
2333. Trent (tdavis23540) 202 82.96 109.41 55 27.23
2334. 🤫 (semajames) 202 152.85 195.47 162 80.20
2335. Kim (rsoler) 202 67.80 88.43 35 17.33
2336. 3.14 (rom3_141592) 202 87.98 118.75 47 23.27
2337. Patrik (pbody) 202 79.22 100.66 52 25.74
2338. Mahjabin (mahjabin08) 202 31.27 40.62 17 8.42
2339. Khizer (khizlaw) 202 91.79 114.68 58 28.71
2340. Non-quit (hitman2207) 202 112.21 136.72 106 52.48
2341. harshit (harshit712) 202 73.73 102.39 54 26.73
2342. Feariscool (fearisdumb) 202 60.30 79.45 45 22.28
2343. Donovan (donovanle) 202 92.82 121.21 64 31.68
2344. bataa (batuchka) 202 60.29 83.32 49 24.26
2345. ben (benji2k) 202 90.79 114.79 80 39.60
2346. Vu (vuquynghia2) 201 61.95 80.41 40 19.90
2347. Luna (vexara) 201 109.56 141.93 95 47.26
2348. Nervous (unselfishnervousha... 201 78.98 103.76 60 29.85
2349. TennisGOAT (tennislegend1234) 201 60.66 79.23 32 15.92
2350. adel (thenewb) 201 47.48 60.91 17 8.46
2351. w (shwilliam) 201 80.63 99.98 49 24.38
2352. Pokeman (poke_man) 201 86.84 113.97 64 31.84
2353. Ox (oxtookbronze) 201 83.48 103.85 59 29.35
2354. chupapi (nerve784126) 201 61.06 82.21 45 22.39
2355. Sasha (moongue) 201 59.78 78.71 34 16.92
2356. Ismail (ismailo) 201 92.59 122.04 85 42.29
2357. Bruno (brutal_posso1) 201 42.20 55.63 9 4.48
2358. et (amogus_irl) 201 79.83 104.60 58 28.86
2359. :( (altrocality_dvorak_acc) 201 121.44 145.99 108 53.73
2360. igs (x7041) 200 110.28 136.78 101 50.50
2361. Krimmson (wrk4thjkr) 200 60.00 79.12 24 12.00
2362. turtlesrule (turtlesrule) 200 133.51 173.00 125 62.50
2363. steel (steelmax1214) 200 68.56 88.98 63 31.50
2364. RI (speedraceriyer) 200 85.52 119.92 50 25.00
2365. Luka (soleesoki) 200 75.20 102.31 58 29.00
2366. Deathnote (sanjay_kumar) 200 57.58 83.36 38 19.00
2367. Robert (rrobertt3137) 200 92.99 122.84 75 37.50
2368. RacerTracer (racertracer) 200 44.69 63.25 14 7.00
2369. oni (onifire) 200 79.33 100.32 47 23.50
2370. Murcury (murcury_) 200 60.33 76.85 40 20.00
2371. m0nsteR (m0nsta321) 200 105.03 128.90 98 49.00
2372. Noman (khan_noman14) 200 95.13 115.12 65 32.50
2373. jerome (jonaslabryinth) 200 89.27 113.67 72 36.00
2374. Sensei (jjxjacpot) 200 88.24 114.16 76 38.00
2375. Hussein (husseinabbas) 200 47.96 61.49 17 8.50
2376. Himanshu (himanharsh) 200 53.47 66.82 25 12.50
2377. hein (heinthant) 200 71.51 92.61 40 20.00
2378. Hal (hals11) 200 107.09 139.62 90 45.00
2379. Funky (funkychunkymon) 200 90.04 121.03 61 30.50
2380. Raunak (englishassignment) 200 99.73 130.78 81 40.50
2381. Dastan (dastangosu) 200 82.77 102.99 71 35.50
2382. Drew (bigboisausage) 200 100.18 134.57 79 39.50
2383. Sean Wrona (arenasnow2) 200 183.61 226.45 182 91.00
2384. javaMiddle (java_coder) 200 37.91 55.95 11 5.50
2385. Ivan (sakhman) 199 59.63 80.39 32 16.08
2386. Mirjalol (mirjaloltv) 199 44.71 58.51 21 10.55
2387. Mariam (mariamgharraph) 199 54.51 80.79 28 14.07
2388. Phung (longphung151198) 199 94.99 117.37 89 44.72
2389. TribalAxe (darkulas) 199 76.08 96.52 50 25.13
2390. Cameron (cameronicheese) 199 101.22 137.52 81 40.70
2391. guest (okokok1234) 199 68.58 90.07 36 18.09
2392. J (jdubc) 199 82.18 113.82 56 28.14
2393. Manami (manami_kun) 199 61.69 85.75 28 14.07
2394. Amorphous (tawseef) 198 56.31 69.72 20 10.10
2395. McMac2 (sjm46) 198 108.91 134.41 97 48.99
2396. Shivanju (shivanju) 198 75.21 91.37 47 23.74
2397. rohan (rohanktksu) 198 51.54 81.98 17 8.59
2398. helga (pataki29) 198 43.68 61.30 18 9.09
2399. cody (ocdy1001) 198 87.34 109.40 65 32.83
2400. medD (mistermask___) 198 92.28 132.69 74 37.37
2401. Keo (mightkeo) 198 69.85 91.39 39 19.70
2402. Liu (liusbl) 198 107.11 125.47 90 45.45
2403. Elias (eddyede) 198 73.55 97.68 38 19.19
2404. 🌸Peaches & Cream (easy_g... 198 117.75 143.53 90 45.45
2405. Dhruv (dhruvarora) 198 66.18 85.87 45 22.73
2406. kirito (boscomk3) 198 61.14 78.68 38 19.19
2407. ᕙ( ͡◉ ͜ ʖ ͡◉)ᕗ ... 198 78.94 106.93 55 27.78
2408. yassine (yassie) 197 52.29 74.36 26 13.20
2409. toomuchads (toomuchads) 197 78.98 103.47 50 25.38
2410. Cornelius (salibzz) 197 97.09 120.56 68 34.52
2411. rohan (rohan_verma__) 197 74.73 92.87 36 18.27
2412. salomo (roadto5wpm) 197 112.78 149.72 86 43.65
2413. incendiary (returnoftheince... 197 162.81 196.84 177 89.85
2414. Pogfrog (pogfrog1) 197 112.62 137.89 92 46.70
2415. Jo (noone21) 197 90.38 134.96 84 42.64
2416. Michael (michaelchristian024) 197 96.19 131.46 76 38.58
2417. logan (lacton44) 197 84.27 110.76 70 35.53
2418. Kakini007 (kakini) 197 65.70 96.34 34 17.26
2419. Jynx (jynx__) 197 73.51 93.48 47 23.86
2420. J (jellyfiszh) 197 81.87 114.28 60 30.46
2421. haniel monki (ivious) 197 75.08 100.08 45 22.84
2422. Cain (gigabite) 197 69.07 90.49 53 26.90
2423. Robyn (ghastless_gibus) 197 74.05 101.30 54 27.41
2424. DONTSMOK (dannyzzzzz) 197 101.38 128.31 76 38.58
2425. chigala (chigalakingsley) 197 47.48 74.86 19 9.64
2426. Arasu (arasu) 197 106.63 137.73 94 47.72
2427. Nitin (xintacious) 196 73.26 95.09 34 17.35
2428. wonder wave (wonderwave2) 196 107.55 130.46 90 45.92
2429. Sparsh (sparsh123) 196 91.58 126.74 59 30.10
2430. Mr. (serallfreedbear) 196 101.70 128.68 91 46.43
2431. Pheresint (pheresint) 196 95.89 117.26 68 34.69
2432. Peter (petejim) 196 78.39 100.60 42 21.43
2433. Leo (leo8786) 196 156.46 178.66 167 85.20
2434. tstats[kayeii] (kayeii) 196 85.87 105.89 56 28.57
2435. Juan (juanma09) 196 38.31 53.45 9 4.59
2436. Emperor (aranjani) 196 63.00 83.71 41 20.92
2437. Sotonation (akatrell) 196 95.17 113.40 67 34.18
2438. vishy (drdrunkstain) 196 53.94 75.89 27 13.78
2439. Jairdan (twin_turbo_two) 196 61.28 84.89 64 32.65
2440. Ben (wolfson) 196 156.46 178.66 167 85.20
2441. Technician (tech23) 195 72.67 96.23 60 30.77
2442. Shashank (shashank204) 195 86.34 102.23 43 22.05
2443. Patrick (ricccccckkkkkk) 195 75.08 103.73 56 28.72
2444. ErrorOp (error_op) 195 44.48 63.07 19 9.74
2445. cold (coldmind) 195 74.74 95.91 51 26.15
2446. Aleph (catblahfishblah) 195 73.40 103.21 58 29.74
2447. Bartłomiej (bodidogg) 195 40.74 56.56 19 9.74
2448. keyvan (fayazsoleymani) 195 61.53 79.11 33 16.92
2449. Zuhair (zishraq) 194 83.31 97.62 43 22.16
2450. Jackson (united9jackson) 194 91.91 129.44 75 38.66
2451. west (supernova_00) 194 63.43 87.52 32 16.49
2452. RIP Byron (sir_rebral_palsy) 194 140.36 180.69 139 71.65
2453. not rage (sadge47) 194 86.35 105.72 50 25.77
2454. qbaracerr (qbajanowski) 194 50.82 67.80 13 6.70
2455. Naha's (naha_26) 194 43.00 59.57 22 11.34
2456. Mehedi Islam (mehediislamri... 194 68.34 96.00 40 20.62
2457. marsistX (marsistx) 194 74.09 88.95 45 23.20
2458. Jujee (jujee_poo) 194 55.33 78.03 47 24.23
2459. jkdixit (jkdixit) 194 42.62 56.77 14 7.22
2460. Fuzusu (fuzusu) 194 94.42 122.97 79 40.72
2461. frank (frankpc) 194 78.74 99.97 55 28.35
2462. Anubhav4813 (etra_567) 194 70.70 103.25 47 24.23
2463. code_brains (coderider) 194 104.25 138.57 92 47.42
2464. Ren (landonren) 194 31.48 45.43 11 5.67
2465. Stefan (_tensor) 193 99.24 122.11 94 48.70
2466. FGS (simo666) 193 91.60 121.46 63 32.64
2467. Brys (seabyzz) 193 56.78 69.19 21 10.88
2468. Thijs (qazygv) 193 44.54 63.88 18 9.33
2469. niceu (nice_u) 193 94.58 122.22 62 32.12
2470. Hai (haitathoc) 193 75.00 97.12 37 19.17
2471. Viktor (milkboofer) 193 62.00 78.12 37 19.17
2472. stt (soulert) 193 63.81 85.00 42 21.76
2473. Bo (combobombo) 193 40.68 58.80 10 5.18
2474. Stefan (stefanbm) 192 77.24 91.80 50 26.04
2475. Anthony (smashingted) 192 69.56 92.74 51 26.56
2476. TTVronness_ (ronneclee) 192 96.62 119.91 63 32.81
2477. JanBa (pythonbyte) 192 96.66 127.46 68 35.42
2478. Himal (panthimal) 192 55.84 71.33 22 11.46
2479. Matt (mattymarsh) 192 103.38 126.53 89 46.35
2480. Finally (finallyyes) 192 63.64 84.59 66 34.38
2481. erbol (erbolxac) 192 37.60 51.06 11 5.73
2482. chachasoba (chachasoba) 192 104.99 126.14 101 52.60
2483. Chetan (ch374n) 192 106.22 136.03 85 44.27
2484. A (b04501012) 192 61.48 75.43 36 18.75
2485. Pasin (_hello_world) 191 68.53 86.91 39 20.42
2486. Weed (weeddinosaur) 191 89.41 112.39 87 45.55
2487. Troy (troy517545) 191 67.70 89.16 40 20.94
2488. new keyb who dis(k3 max) (s... 191 104.98 133.70 82 42.93
2489. Punit (punitsubudhi) 191 50.80 69.90 35 18.32
2490. Andreas (mangabro) 191 68.81 87.01 39 20.42
2491. Mustafa (leo_messi_) 191 60.88 80.00 38 19.90
2492. 👻 (james7890) 191 86.80 118.32 53 27.75
2493. Farameer (farameer1) 191 99.41 123.72 69 36.13
2494. Earlvin (earlvin14) 191 124.62 146.79 111 58.12
2495. Death_Dragon (dead_beast) 191 50.47 63.61 15 7.85
2496. Chiaki (chickhiaki) 191 47.47 68.55 18 9.42
2497. Ahnaf (ahnaf75) 191 84.24 101.52 53 27.75
2498. Abdul (asalam) 191 30.80 39.84 11 5.76
2499. Polar (polar_6275) 191 67.56 90.58 49 25.65
2500. zen (zen181) 190 88.90 114.87 70 36.84
2501. Маершон (timeandsoul2) 190 149.41 196.34 158 83.16
2502. Octo (octophobia) 190 109.29 151.94 87 45.79
2503. Peter (metalhead2021) 190 49.04 63.15 12 6.32
2504. Kenn (kenn_double_n) 190 103.36 127.01 76 40.00
2505. Iris (irxs) 190 29.12 46.53 27 14.21
2506. J (irocamora) 190 72.98 92.41 50 26.32
2507. $$$$ (for_fun) 190 83.34 107.18 49 25.79
2508. R (fjasifjaficaom) 190 55.04 70.78 27 14.21
2509. Abdul Hannan (detective_ahg) 190 65.24 85.22 36 18.95
2510. Aurel (big_boss1) 190 128.64 170.37 114 60.00
2511. Бақытжан (baqytjan) 190 51.67 65.90 21 11.05
2512. avocadoLover (avocado_lover) 190 45.48 74.11 22 11.58
2513. AKSHAT (akshat1234) 190 57.09 74.28 89 46.84
2514. Adrianix (adrianixx) 190 92.61 120.48 68 35.79
2515. alaw (its_alaw) 190 67.36 92.27 59 31.05
2516. isekai (krimsonly) 189 78.67 101.72 54 28.57
2517. Kristoffer (koffer96) 189 68.66 94.10 41 21.69
2518. Jimmy (jimmy_voe) 189 77.35 102.55 42 22.22
2519. Gmorcad (gmorcad) 189 105.20 134.39 85 44.97
2520. Danny (beegd) 189 137.62 184.50 154 81.48
2521. Bataa (bataa_cdj) 189 74.67 95.66 46 24.34
2522. Auveed (auveed) 189 92.83 110.82 65 34.39
2523. epicface (adowoable) 189 92.17 120.86 67 35.45
2524. Eli (elisped1) 189 116.35 149.36 113 59.79
2525. Sam (sam12436) 189 48.65 61.56 28 14.81
2526. Spourgon (mattt_hias) 189 35.77 50.77 9 4.76
2527. Vijay (vijays4404) 188 66.03 94.65 45 23.94
2528. Ayush (typer_ayush) 188 67.63 87.28 74 39.36
2529. StevieWonder (steviewonder69) 188 92.04 119.81 62 32.98
2530. Prithvi (psprithvi) 188 78.97 96.93 59 31.38
2531. shawty (pogchampion1969) 188 85.00 101.06 47 25.00
2532. Okh (okh10001) 188 63.29 79.24 40 21.28
2533. OfficerBalls (noob_master9901) 188 86.66 124.71 55 29.26
2534. Himanshu (himanshu_sahni) 188 68.08 86.14 38 20.21
2535. Gjd (gwvj) 188 58.64 77.19 33 17.55
2536. Jaxon (fusion13) 188 80.96 104.87 54 28.72
2537. Ethan (etstein) 188 81.58 103.47 49 26.06
2538. ngoc huy nam (destroy_the_w... 188 102.65 133.57 79 42.02
2539. David Abdelnour (davidabdel... 188 62.02 81.16 44 23.40
2540. neverm0r (datamagi) 188 76.17 107.05 51 27.13
2541. Brrrdman (birdmanmcinnes) 188 59.13 77.24 22 11.70
2542. Banda (bandamaker) 188 70.07 90.92 51 27.13
2543. yomum (ahmet_ergun) 188 57.13 72.24 23 12.23
2544. ReTiRedz (retiredz) 188 78.82 103.88 83 44.15
2545. Julian (jgbuka12) 188 87.13 119.15 55 29.26
2546. bub (_bubble) 187 100.08 125.38 82 43.85
2547. Sassy (taingdavy) 187 60.84 83.06 35 18.72
2548. Merrick (skmq) 187 97.61 115.79 64 34.22
2549. oogy (owogy) 187 72.02 97.89 56 29.95
2550. Othman (othmanaldefer) 187 49.32 63.23 18 9.63
2551. Ron (gambling_addict_69) 187 94.11 113.82 54 28.88
2552. Colemak (colemaknub) 187 67.38 98.86 34 18.18
2553. Timothy (chuzzz) 187 85.96 116.62 48 25.67
2554. Chirp (chirpflewgone) 187 56.19 75.05 34 18.18
2555. Buri (buri_was_taken) 187 68.32 90.47 40 21.39
2556. Aleks (aleks8) 187 71.63 87.09 52 27.81
2557. Yet (yet1208) 186 67.23 92.88 35 18.82
2558. Turtle Speed (turtle_speed31) 186 43.06 66.14 20 10.75
2559. Seth (syarb) 186 100.41 125.31 92 49.46
2560. Samer (samiralbayati) 186 47.19 60.20 21 11.29
2561. Richit (richit690) 186 62.80 87.34 37 19.89
2562. pavan kumar (pavan2406) 186 53.12 64.60 24 12.90
2563. Gene (mckuletzz) 186 136.17 164.93 141 75.81
2564. lunalululu (lunalululu) 186 95.67 115.28 74 39.78
2565. Jia (jia_desai) 186 69.76 92.05 38 20.43
2566. return NULL; (honor12) 186 82.49 100.00 47 25.27
2567. Gabe (gablikestacos) 186 94.34 120.22 69 37.10
2568. Erik (erickano) 186 71.05 92.13 52 27.96
2569. EquityDeadlock (equitydeadl... 186 96.32 128.76 76 40.86
2570. Goyna (demon__rage__) 186 54.39 67.86 29 15.59
2571. Julie (codex13) 186 74.43 104.40 37 19.89
2572. Rajat (buttocks121) 186 50.65 67.17 24 12.90
2573. Beket (bayemirov) 186 103.12 126.40 66 35.48
2574. Social Credit (usa_baby) 185 94.75 121.60 75 40.54
2575. Alex (skoda888) 185 63.47 81.13 40 21.62
2576. NQ (nq_neilprangko) 185 109.16 139.86 92 49.73
2577. MrSaand (mrsaand) 185 100.32 115.98 64 34.59
2578. Chris (letring) 185 98.42 124.01 84 45.41
2579. Italo (italo_x) 185 37.33 50.70 11 5.95
2580. Abhideep (imabhideep) 185 53.31 74.40 20 10.81
2581. Sameer (firefoxqb) 185 75.31 106.14 48 25.95
2582. cole (coldmak) 185 92.78 129.16 64 34.59
2583. Aestuosi (aestuosi) 185 92.46 113.22 56 30.27
2584. jan (toxicwasabi) 185 71.19 94.15 76 41.08
2585. punit (thakelatyper) 184 78.62 101.62 35 19.02
2586. shubham (shubham2468) 184 59.71 81.13 33 17.93
2587. Raahil (ravana09) 184 95.51 127.53 63 34.24
2588. Prashant (pra0337) 184 46.19 59.84 14 7.61
2589. MIKA (oniichan69) 184 87.18 125.42 63 34.24
2590. Fat Squirrel (neihs) 184 100.92 129.56 87 47.28
2591. mai (mai74) 184 46.60 62.15 18 9.78
2592. Mason (luvmasxn) 184 46.55 64.74 32 17.39
2593. Koki (kohki) 184 69.20 84.76 29 15.76
2594. Rishab (kamado_) 184 59.41 76.05 51 27.72
2595. Jearcan (jearcan) 184 99.19 137.28 69 37.50
2596. Sentinel (greatsentinel) 184 122.23 151.95 116 63.04
2597. Adam (deinonysus) 184 61.28 82.81 33 17.93
2598. daZai (dazzai) 184 53.89 65.20 38 20.65
2599. douzhen (akariin) 184 76.63 97.59 56 30.43
2600. Alex (kazuma_sama) 184 45.16 56.54 21 11.41
2601. Rashed (rshod) 184 55.04 71.08 20 10.87
2602. v (vlxu) 183 91.33 115.25 66 36.07
2603. Tuong (tuong_slow) 183 75.42 104.24 59 32.24
2604. arnav (trahimam) 183 65.01 87.32 44 24.04
2605. Sinful Sam (sinfulsam) 183 87.01 108.02 61 33.33
2606. saad (saduman) 183 87.89 111.70 67 36.61
2607. (needforaccuracy) 183 116.62 143.37 96 52.46
2608. Learner (learner_dawg) 183 86.76 117.86 48 26.23
2609. deep (lamborghene) 183 105.40 143.67 88 48.09
2610. Gagan (ggnbakshi38) 183 64.41 83.49 48 26.23
2611. breezy (breezybre) 183 64.89 93.79 37 20.22
2612. Thomas (thomas70) 182 72.78 92.60 40 21.98
2613. sanjeev (sanjeev_2020) 182 21.41 35.25 38 20.88
2614. Robert (robbstark) 182 80.03 99.10 49 26.92
2615. Reg (reggg) 182 101.53 126.94 70 38.46
2616. Paige (pfernandes_) 182 72.77 95.96 40 21.98
2617. N W (niwore) 182 87.17 109.82 57 31.32
2618. Limey (limeycunt) 182 47.98 65.24 19 10.44
2619. Jimmy (jimster123) 182 75.50 93.43 52 28.57
2620. Spartacus (galvarino) 182 70.43 94.14 41 22.53
2621. Danoun (danounidananou255) 182 62.93 81.40 41 22.53
2622. Calvin (calvinguy) 182 130.25 177.11 127 69.78
2623. sergei (youserj) 181 39.02 49.81 15 8.29
2624. Bikram (wood_cutter) 181 75.38 92.39 53 29.28
2625. Sarah (swags20) 181 90.33 117.36 66 36.46
2626. swagatron (swagatron7000) 181 141.61 169.56 123 67.96
2627. Splonk (splonk) 181 84.90 108.20 70 38.67
2628. Soul (soulsforsweet) 181 76.54 97.16 38 20.99
2629. ilove cheese142 (ktylol) 181 83.59 129.56 47 25.97
2630. Karan (iamkaran2) 181 81.32 104.00 40 22.10
2631. dong (dongdong7) 181 79.89 105.06 51 28.18
2632. Tuu (cetarin) 181 77.94 102.11 35 19.34
2633. Benjamin (benjaminsanta) 181 62.65 83.80 44 24.31
2634. aruj (b0b1000) 181 78.09 110.29 64 35.36
2635. Peter (appapollo) 181 78.36 99.10 45 24.86
2636. sausage go brrr (hasini_17) 181 56.50 77.31 30 16.57
2637. Luka (the_lukec) 180 68.95 102.99 42 23.33
2638. Sufi (sufi7) 180 33.33 67.69 14 7.78
2639. Tempepper (smintz) 180 91.42 130.58 77 42.78
2640. Suryakanta (skroy) 180 53.32 67.71 18 10.00
2641. Sanket (maskii) 180 120.48 160.69 116 64.44
2642. Dinja (insanedjoker) 180 70.43 107.33 36 20.00
2643. Ham (hammah713) 180 53.69 68.86 31 17.22
2644. eilonshi (eilonshi) 180 47.71 63.97 28 15.56
2645. Dimo (dimofte) 180 72.18 94.27 49 27.22
2646. hekima (ashery) 180 58.54 80.96 33 18.33
2647. Aniket (aniketsanghi) 180 86.45 107.57 51 28.33
2648. tourist (amey_9) 180 56.99 72.26 26 14.44
2649. Abdelmohaymn (abdelmohaymn) 180 40.46 56.67 16 8.89
2650. Arun (pyinjector) 180 58.06 79.71 43 23.89
2651. whough (williamhough) 179 95.15 118.09 62 34.64
2652. Sandeep Kumar (sandy14k9) 179 54.20 72.41 19 10.61
2653. Ksairos (ksairs) 179 61.03 78.26 44 24.58
2654. Jebediah (jebediah123) 179 117.44 140.40 117 65.36
2655. NZY (janghanseok) 179 84.72 109.36 49 27.37
2656. Hong (hong41) 179 52.77 69.79 16 8.94
2657. Eugene (genedaman94) 179 67.33 98.65 38 21.23
2658. Brussels (brussels11) 179 124.62 146.36 113 63.13
2659. Basil (basilenthusiast) 179 69.11 116.33 53 29.61
2660. RB (rbs_) 179 66.23 84.81 36 20.11
2661. Dylan (yorkingharp67) 178 46.73 65.72 28 15.73
2662. विघ्नेश (no_l... 178 55.15 70.44 23 12.92
2663. Nabeel (nobleboi10) 178 79.39 104.39 95 53.37
2664. 03496203150 (my_whatsapp_nu... 178 57.22 72.68 28 15.73
2665. arigrate (mercury80) 178 99.57 124.59 80 44.94
2666. Lourd (edmund04) 178 69.80 92.58 39 21.91
2667. Chronopolize (chronopolize) 178 100.44 141.64 62 34.83
2668. b!g (b_i_g_em) 178 83.66 99.71 51 28.65
2669. Michael (buckley12) 178 91.84 123.61 44 24.72
2670. Nick (bluepenredpen) 178 84.26 112.33 43 24.16
2671. BLLA (bellaperez) 178 65.58 85.48 44 24.72
2672. Azizbek (azizbek00) 178 62.47 79.41 34 19.10
2673. nightingale (add4line) 178 162.62 213.93 150 84.27
2674. Mark (10100) 178 73.02 91.49 57 32.02
2675. gamer gamer (changishfool) 178 70.35 90.89 42 23.60
2676. Zakk (zakkcp) 177 79.74 99.70 35 19.77
2677. youm (youm) 177 77.07 98.06 40 22.60
2678. Trabota (trabota) 177 113.77 138.25 85 48.02
2679. AllowedUser (slowmanl0l) 177 85.07 115.70 49 27.68
2680. XD (oma3) 177 73.85 88.79 45 25.42
2681. StallmanWasRight (misterhotel) 177 121.64 151.77 93 52.54
2682. Mahay (mahay316) 177 65.11 78.97 40 22.60
2683. Kimie (lil_pulsar) 177 84.86 118.73 53 29.94
2684. judo (judowrld) 177 44.02 65.59 41 23.16
2685. mobin (irmobin) 177 55.00 71.46 36 20.34
2686. Shubham (ikamthania) 177 58.44 72.12 25 14.12
2687. Leo (hogsh9862) 177 93.09 121.54 59 33.33
2688. McKay (heyitsyaboi) 177 71.63 97.28 47 26.55
2689. :) (erincur123) 177 59.94 75.84 32 18.08
2690. Court (courtmw) 177 48.22 64.02 16 9.04
2691. awabin (awabin) 177 48.13 81.11 22 12.43
2692. Zandro (zandrocraft) 176 68.37 96.44 42 23.86
2693. Evgeny (x1p234) 176 55.91 70.16 16 9.09
2694. Scyx (scyx3) 176 59.07 84.67 33 18.75
2695. moosophy (pepperoni_cat) 176 41.53 51.71 14 7.95
2696. Duke (needdiscipline) 176 91.41 121.48 65 36.93
2697. Maksim (morysoff) 176 76.45 97.66 48 27.27
2698. Peace in world (marcog7) 176 80.25 105.47 45 25.57
2699. Nectarios (locomolotov) 176 102.24 138.66 59 33.52
2700. Akizumi (linaaron) 176 62.18 92.48 39 22.16
2701. Kinoktia (kinokita) 176 68.77 88.14 46 26.14
2702. JD (jigglyjd) 176 68.17 86.85 41 23.30
2703. Jack (jacjack) 176 70.44 90.27 27 15.34
2704. Hesh (heshg) 176 81.54 107.55 49 27.84
2705. Jose Ruel (braveheart143) 176 51.01 66.73 24 13.64
2706. Sadiqa (sadiqa_ansari) 176 38.35 50.52 12 6.82
2707. Victo (victo_sn) 175 102.99 144.99 81 46.29
2708. Robby (tddvorak) 175 62.50 92.18 34 19.43
2709. Ryan (rdeorio) 175 83.23 101.49 47 26.86
2710. mayr (mayruwu) 175 67.12 89.65 51 29.14
2711. Mac (mac123456) 175 83.29 104.05 59 33.71
2712. ALI (legend_haddad) 175 55.58 73.03 27 15.43
2713. Julian (juliansmile) 175 86.77 105.69 51 29.14
2714. Ioannis (johndigolis) 175 69.08 83.30 43 24.57
2715. Jake (jakeowens) 175 81.02 105.93 48 27.43
2716. JiGsaW (homeboy2603) 175 105.93 134.06 77 44.00
2717. Mohammed (guitarist999) 175 65.45 89.34 44 25.14
2718. greed (greedthelazy) 175 81.65 106.85 67 38.29
2719. Eveningthing (evntd) 175 76.85 98.27 43 24.57
2720. Choong Hyun (chlee) 175 66.11 91.89 44 25.14
2721. my name (calmthyself) 175 93.67 107.85 55 31.43
2722. Wob (wobber) 174 64.28 88.08 53 30.46
2723. tstats[v415hn4v] (v415hn4v) 174 31.81 42.50 12 6.90
2724. Tarek (o_stady) 174 71.37 84.92 38 21.84
2725. Naman (namanjain) 174 43.25 52.87 20 11.49
2726. Itsuki1 (itsuki1) 174 58.52 79.18 42 24.14
2727. Connor (ct2019) 174 58.70 76.12 32 18.39
2728. John (beefysalad69) 174 96.17 124.10 84 48.28
2729. Rahim Abdur (arbijoy1717) 174 45.10 55.32 14 8.05
2730. Angelo (angelo13c) 174 78.73 93.46 50 28.74
2731. Ian sparks (sparksian) 174 61.47 79.96 38 21.84
2732. Coder (the_coder_bro) 173 68.34 85.61 38 21.97
2733. Warren (slacker_xd) 173 96.19 117.65 71 41.04
2734. adrian (rixoner) 173 54.03 72.78 29 16.76
2735. T (raket124) 173 80.58 95.37 46 26.59
2736. Noobie (nooobie_typer) 173 63.66 84.90 41 23.70
2737. Tech (ninja_typer) 173 75.01 94.87 45 26.01
2738. Chris (mils8545) 173 63.19 77.63 31 17.92
2739. Brandon (kirbyfan107) 173 116.98 151.71 98 56.65
2740. joshua (jimpdashrimp) 173 95.51 126.13 62 35.84
2741. An Ackerman (iamvr) 173 53.39 65.81 15 8.67
2742. Eru (eru2) 173 83.78 110.95 48 27.75
2743. Dev (devk232) 173 50.71 72.67 16 9.25
2744. WindSlashKing (bujkata) 173 99.36 156.18 73 42.20
2745. Kirin (arya_juniko) 173 63.67 89.63 31 17.92
2746. Abhinav :P (abhi_typist) 173 64.33 84.06 42 24.28
2747. Kyle (1cheeseisyummy5) 173 95.64 127.68 78 45.09
2748. RagingChris (ragingchris) 173 89.53 120.41 58 33.53
2749. Prof (profklapz) 173 76.44 102.48 56 32.37
2750. wenlong (wenlong) 172 51.64 69.27 12 6.98
2751. wz (taywzzzz) 172 72.59 94.27 50 29.07
2752. sumit (sumitmgr345) 172 64.57 82.26 37 21.51
2753. silvik (silvik_) 172 107.60 143.36 86 50.00
2754. Neatrianty (neatrianty) 172 110.30 147.24 93 54.07
2755. Krish (krish108) 172 99.15 128.67 63 36.63
2756. Ardan (kevinardani) 172 69.75 90.59 45 26.16
2757. InNeedOfName (inneedofname) 172 96.42 133.56 56 32.56
2758. General (generalmalorn) 172 107.24 128.61 74 43.02
2759. fthe (fthe) 172 70.17 94.74 39 22.67
2760. evil007 (evil007) 172 47.08 66.58 18 10.47
2761. Anjal (deadashell) 172 66.42 85.75 35 20.35
2762. Cadmus (cadmus369) 172 65.79 87.14 40 23.26
2763. AvocadoTM (avocadotm) 172 67.89 87.86 39 22.67
2764. Manoj (manjobanjo) 172 104.89 145.51 137 79.65
2765. moq (moq_) 172 89.79 112.31 65 37.79
2766. Akash (akashshewale) 172 57.80 72.84 29 16.86
2767. Matty (mattyman) 172 52.76 63.11 22 12.79
2768. Nyaruko (tatrz) 171 82.12 108.42 63 36.84
2769. sys (sysuser) 171 46.22 57.02 11 6.43
2770. Sayat (sayko05) 171 37.71 49.80 14 8.19
2771. Nagaro (nagaro) 171 76.65 95.66 47 27.49
2772. Marko (markodob) 171 45.23 58.88 12 7.02
2773. Jacinth (levesis) 171 73.95 103.89 45 26.32
2774. Joshua (lckjosh) 171 109.51 130.91 78 45.61
2775. paddy (kattumanidhan) 171 93.09 140.29 71 41.52
2776. Kate (kate366) 171 78.45 102.02 45 26.32
2777. Richard (jorimi) 171 82.76 119.49 47 27.49
2778. Whatever (hunglatahb1) 171 92.43 113.13 51 29.82
2779. Heather (heannn) 171 75.02 100.65 44 25.73
2780. Cho (cho82) 171 69.09 82.44 46 26.90
2781. Ella (chawahir) 171 152.94 181.26 114 66.67
2782. Arsalan (arsalan_khan) 171 31.79 47.11 31 18.13
2783. Abdujalol (abdujalolerkinov) 171 57.42 73.89 39 22.81
2784. Zhijian (zliangal) 170 59.10 75.41 33 19.41
2785. TheBossOfTheBoss (thebossof... 170 92.42 115.80 57 33.53
2786. Sumit (sumit0003) 170 42.36 66.81 17 10.00
2787. Mateusz (mattinato21) 170 119.43 154.89 3 1.76
2788. Syed Ali (mafailure) 170 69.57 92.55 40 23.53
2789. Jørgen (jorgen1999) 170 65.43 93.01 33 19.41
2790. Jordan (invictusj) 170 72.45 93.13 43 25.29
2791. hello (imfeelingunlucky) 170 82.37 113.68 37 21.76
2792. VP (illermike) 170 67.27 82.20 40 23.53
2793. BLU (glitterblonde) 170 88.20 110.31 57 33.53
2794. Feli (dottedladybug) 170 79.94 98.75 39 22.94
2795. Harsh Yadav (bestial) 170 59.58 81.16 32 18.82
2796. AYOUB (ayoub_dkhissi) 170 44.81 59.13 29 17.06
2797. alv (alvdev) 170 60.02 71.50 28 16.47
2798. Rei (sleepyray) 170 65.22 86.25 45 26.47
2799. Sheen (mercurial_spod) 170 43.48 62.44 22 12.94
2800. Derwin (dwu123) 170 82.30 100.36 43 25.29
2801. 4pf (mawienmawien123) 170 63.48 81.35 35 20.59
2802. MTGAP | Tokimahery (tokimah... 169 79.45 105.28 60 35.50
2803. Malik (sonatabliss) 169 48.38 70.30 30 17.75
2804. Rdk (olegus) 169 71.14 90.42 47 27.81
2805. Gourav (mrgaurav2001) 169 49.24 70.68 35 20.71
2806. Martin (martinmaster) 169 71.23 84.46 44 26.04
2807. Marco (marcomilo) 169 103.47 129.32 70 41.42
2808. leon (leonzalion) 169 154.03 211.71 28 16.57
2809. Kiddoz (kiddoz) 169 67.93 83.31 31 18.34
2810. Toe Typer (ifingeryour) 169 61.75 81.58 34 20.12
2811. Ashish (ashk98) 169 55.28 78.17 30 17.75
2812. Lim (ac1ds) 169 72.21 91.88 40 23.67
2813. Cross (crosscategory) 169 54.87 70.99 19 11.24
2814. Tushar (tjajodia) 168 73.18 102.66 45 26.79
2815. SPICY (spicynote) 168 83.53 101.41 56 33.33
2816. Nate (natekid11) 168 82.95 100.32 42 25.00
2817. Yu (mjtunes) 168 58.00 79.34 26 15.48
2818. ʕ·͡ᴥ·ʔ (memesis) 168 73.40 99.64 48 28.57
2819. Kaloyan (kokicha120) 168 84.86 110.16 49 29.17
2820. kai (kainetic) 168 70.14 112.57 35 20.83
2821. Arjun (k9cruncher) 168 89.70 112.42 55 32.74
2822. Jacob (jwill420) 168 120.35 151.96 104 61.90
2823. Keith (flanneldemigod) 168 80.19 97.28 50 29.76
2824. Geeth (falsethunder) 168 68.17 99.39 32 19.05
2825. aida (cloudywithachanceofme... 168 121.82 160.09 95 56.55
2826. Ghost (ghostdraon) 168 66.87 90.39 42 25.00
2827. Kabi (kabizzare) 168 41.65 67.23 15 8.93
2828. Eli (silversweedie) 167 54.99 78.70 14 8.38
2829. I am on the rise. (refined_... 167 51.95 69.42 81 48.50
2830. Pinekkone (pinekkone) 167 76.18 97.78 48 28.74
2831. Oli (piasekoli) 167 86.99 105.28 44 26.35
2832. Keagan (ngerks) 167 72.48 91.24 42 25.15
2833. Lauren (lsmithers619) 167 48.58 64.91 21 12.57
2834. josh (killer_queen_beats_hi... 167 71.82 84.13 37 22.16
2835. John (jlavelle) 167 92.46 121.13 53 31.74
2836. Halley (halxey) 167 68.52 91.47 131 78.44
2837. dumbosity (dumbosity) 167 126.75 162.99 110 65.87
2838. Gregory (contrum) 167 112.60 139.83 87 52.10
2839. CheemCreem (cheemcreem) 167 83.65 100.60 43 25.75
2840. Abdelrahman (abdelrhaman_sh... 167 66.12 84.12 46 27.54
2841. Constantinos (488pista) 167 73.00 87.52 37 22.16
2842. Ayush (improve_type) 167 49.46 63.36 21 12.57
2843. Abdul Basit (abdul_thetypist) 167 46.26 63.74 16 9.58
2844. joaoabismado (joaoabismado) 167 60.64 92.81 39 23.35
2845. Zakarya (zakarya420) 166 41.80 53.76 10 6.02
2846. Filemon (the_squad7) 166 42.82 51.87 9 5.42
2847. Alf (the_destroyer_of_worlds) 166 96.96 123.49 68 40.96
2848. Janc (psyy1234) 166 88.64 107.09 48 28.92
2849. Angkana (ployyjen) 166 82.88 102.83 38 22.89
2850. Onsterm (onsterm) 166 54.76 70.01 18 10.84
2851. Mike (mikayelb) 166 67.52 83.69 33 19.88
2852. Matthew (matt_daemond) 166 103.84 134.99 73 43.98
2853. moofasa (macywood) 166 84.56 116.59 57 34.34
2854. Lord Of Titans (lord_of_tit... 166 49.35 65.97 26 15.66
2855. Jacob (jacobascool) 166 60.05 77.46 27 16.27
2856. Lobster🦞 (itisu127) 166 79.41 105.53 73 43.98
2857. Voldemort (growthmindset) 166 95.20 114.26 63 37.95
2858. clover (fat_baby_hippo_312) 166 45.98 73.16 18 10.84
2859. 劉韋論 (evan1liu) 166 66.48 83.25 27 16.27
2860. DOO (datblakgai) 166 80.83 108.80 48 28.92
2861. Caegan (caegana) 166 121.39 158.07 87 52.41
2862. Hello (arnab_9997) 166 74.85 96.25 40 24.10
2863. Ab (abdir) 166 74.90 106.79 40 24.10
2864. Free (free_hour) 166 61.98 82.17 32 19.28
2865. Tomas (elanunciadordedoom) 166 65.82 93.43 38 22.89
2866. tade (tadessetic) 165 32.39 40.53 13 7.88
2867. Swaraj (swarajpande4) 165 91.99 119.74 52 31.52
2868. Scott (scottjones25) 165 40.52 52.80 10 6.06
2869. ryu107 (ryu107) 165 59.36 79.60 28 16.97
2870. Rishi (qasz) 165 58.37 75.00 27 16.36
2871. dawid (nuclearmansnothot) 165 81.14 110.78 47 28.48
2872. Nikolai (nikovertus) 165 89.68 124.50 53 32.12
2873. Blue Alps, baby! (model_m_k... 165 84.90 111.41 60 36.36
2874. Mel (mel0214) 165 47.85 59.66 15 9.09
2875. Christos (lexmarkx) 165 60.07 81.49 33 20.00
2876. Leonardo (leo121) 165 62.82 77.03 33 20.00
2877. Matt (kirito3141) 165 88.57 126.81 43 26.06
2878. gujjar (gujjarji) 165 63.23 86.20 35 21.21
2879. bri (greased_lightning10) 165 85.36 113.05 60 36.36
2880. David (dtnero) 165 83.65 103.73 51 30.91
2881. Dylan (dtg32148) 165 88.20 111.68 61 36.97
2882. bhanu (codingbegginer) 165 54.41 73.49 18 10.91
2883. Nick (cluelessneep) 165 87.96 101.08 46 27.88
2884. Beret (boina) 165 82.04 106.52 51 30.91
2885. Isabella (bellaa) 165 73.67 100.61 45 27.27
2886. Shane (shane_666666) 165 51.82 69.40 26 15.76
2887. Shadi (shzdi) 165 88.03 110.34 149 90.30
2888. Nurlanbek (xtil_06) 164 46.04 58.91 8 4.88
2889. Kelvin (winlost2) 164 111.60 129.80 86 52.44
2890. Steve (stevie169) 164 75.35 91.97 33 20.12
2891. Colemax (sqxleaxes) 164 94.90 120.61 63 38.41
2892. bach (shuriken) 164 75.77 92.07 41 25.00
2893. shakthi (shakthi1731u) 164 74.07 98.50 34 20.73
2894. naveen (regretfulsalsa) 164 106.82 134.37 88 53.66
2895. Daggerpov (read_my_name) 164 111.06 133.77 82 50.00
2896. Preetish (preetishmajumdar) 164 76.66 96.70 38 23.17
2897. Manny (mannypack) 164 98.88 139.13 65 39.63
2898. Manjrnm (manjrnm) 164 97.98 124.87 68 41.46
2899. Guðjón (krotari) 164 86.79 109.75 67 40.85
2900. Kenyaaa~~~ (kenzaa) 164 92.49 123.11 52 31.71
2901. kajak_CZ (kajak_cz) 164 64.36 80.99 37 22.56
2902. Hamidbek (hamidbek) 164 53.34 73.18 18 10.98
2903. Enzo (enz0123) 164 97.93 120.64 72 43.90
2904. Emerald-Rose (emmarose_deleon) 164 42.71 56.25 23 14.02
2905. Dipankar (dipankarkumar275) 164 58.94 74.22 30 18.29
2906. damon (damonliv) 164 83.66 106.75 42 25.61
2907. CopiCat (copicat) 164 57.96 76.60 20 12.20
2908. ybf (ybflewis) 163 86.38 118.67 42 25.77
2909. Connecting... (toodey) 163 65.61 84.33 36 22.09
2910. SW1FT808 (sussyboi808) 163 42.73 59.01 16 9.82
2911. Srdjan (srle1312) 163 49.83 61.52 14 8.59
2912. SkyerZ (skyerz) 163 92.15 111.22 60 36.81
2913. Mmonster (mmonsterv11) 163 68.52 97.83 38 23.31
2914. Lur3t (lur3t) 163 73.13 96.84 33 20.25
2915. Brody (echo3006) 163 75.02 112.02 36 22.09
2916. Cheyenne (cheycc) 163 79.08 112.92 40 24.54
2917. AM (amesh8301) 163 67.96 87.20 39 23.93
2918. Almighty (almightysosaakatu... 163 86.64 115.26 59 36.20
2919. Andreas (agehring) 163 25.08 33.03 41 25.15
2920. Sonix (8sonix) 163 70.22 105.90 47 28.83
2921. TOBIRAMA (sipagan90) 163 47.93 66.83 14 8.59
2922. Dominus (dominusreal574) 163 136.04 162.11 112 68.71
2923. TheXFalcon (xavier_poh) 162 74.63 96.80 46 28.40
2924. salsa (spencer_salsa) 162 59.55 83.30 31 19.14
2925. Callum (specktome26) 162 87.65 111.02 40 24.69
2926. Ruel Ryan (ruelryan) 162 71.73 87.17 41 25.31
2927. Rahul (rsrahul1000) 162 82.20 107.42 51 31.48
2928. Priyanshi (priyanshi_gupta) 162 62.42 80.17 34 20.99
2929. nw3x (nw3x) 162 128.05 160.53 110 67.90
2930. Norm (norm_guy) 162 49.55 64.09 17 10.49
2931. Ivan (idjuric) 162 111.51 135.94 82 50.62
2932. Gde (gde1indra) 162 73.44 96.08 45 27.78
2933. Elgamal (elgamal) 162 62.17 86.27 31 19.14
2934. Pisit (compisit) 162 88.17 112.69 48 29.63
2935. Celeste (celeste_b) 162 62.05 81.69 29 17.90
2936. Arsh (batman4ever) 162 59.13 76.64 32 19.75
2937. aditya105 (aditya105) 162 47.95 65.08 17 10.49
2938. something (xuegalaxy) 161 65.02 95.80 33 20.50
2939. manish (typo_beginner19) 161 51.92 68.50 15 9.32
2940. Asma (speedy10123667567) 161 41.48 63.99 13 8.07
2941. scrubs (scrubs1906) 161 64.43 80.41 41 25.47
2942. Adam (schimoda) 161 99.10 121.29 53 32.92
2943. kraken (pronto1) 161 72.00 90.43 38 23.60
2944. Piplup (piplup_) 161 81.33 105.83 32 19.88
2945. Nicki (nickisusanalex) 161 85.65 99.13 39 24.22
2946. xdd (n1kk1) 161 52.47 77.70 22 13.66
2947. mattfus (mattfus2) 161 94.35 112.55 47 29.19
2948. Kingdomfight (kingdomfight) 161 73.01 88.19 35 21.74
2949. tstats[depsy] (depsy) 161 81.31 102.27 41 25.47
2950. RiCyber (curiouscrow) 161 70.80 83.70 52 32.30
2951. nbv (cumming4u) 161 72.04 93.91 42 26.09
2952. yong (coaleo) 161 79.31 122.20 37 22.98
2953. TYPE KITA (carracers) 161 55.10 77.27 23 14.29
2954. April (apesbang) 161 81.20 101.04 48 29.81
2955. Onion (x__onion__x) 160 111.57 173.99 76 47.50
2956. Luca (whitebronco) 160 53.90 77.26 16 10.00
2957. TheCaptainBuster (thecaptai... 160 83.76 136.32 90 56.25
2958. ^o^ (thasial) 160 83.28 111.19 48 30.00
2959. Shivam (sj_pro) 160 59.24 78.17 38 23.75
2960. SCHMURK (schmurk) 160 98.04 124.69 63 39.38
2961. Pavan (pavan_06) 160 52.80 71.46 22 13.75
2962. oukkat2 (oukkat2) 160 89.14 115.67 55 34.38
2963. oscar (oscarhinxdd) 160 73.32 91.72 39 24.38
2964. Com (neon1087) 160 84.62 100.07 48 30.00
2965. Myles (mylessucks) 160 115.32 146.62 79 49.38
2966. Meliflua (meliflua) 160 56.62 68.03 21 13.13
2967. Joshua (manch) 160 89.55 112.54 51 31.88
2968. Kurochi (kurochi_cyril) 160 81.05 100.01 54 33.75
2969. Jackie (jackiechan816) 160 82.32 110.90 47 29.38
2970. badplayer (idk213) 160 91.19 145.82 72 45.00
2971. Hafiz (huseynoff) 160 75.17 94.31 44 27.50
2972. seaweedOrca (h17unicorn) 160 73.74 96.97 34 21.25
2973. Gaurav (gaurav_38) 160 77.47 96.85 42 26.25
2974. Leonardo (finex2126) 160 47.74 65.33 18 11.25
2975. Demian Volkov (demianwolf) 160 124.06 150.14 102 63.75
2976. Chirag (chirag_2580) 160 68.21 95.05 39 24.38
2977. Yo (azurewinter) 160 89.53 124.17 59 36.88
2978. Asura (asura_yt) 160 111.23 141.19 66 41.25
2979. Arsuta (aryasuta13) 160 79.00 100.36 44 27.50
2980. Shaked (aes222) 160 107.84 141.06 73 45.63
2981. Nikita (andriievskyi_2) 160 64.70 84.97 30 18.75
2982. gar (dagmarski) 160 68.69 87.11 37 23.13
2983. Chourrage (chourrage) 160 73.86 93.44 38 23.75
2984. Max (eggrollccc) 160 86.38 105.80 77 48.13
2985. Garotto (uselessusername) 159 94.47 116.78 60 37.74
2986. switchedtocolemak (switched... 159 120.63 144.18 75 47.17
2987. Jakub (serckle) 159 94.92 114.92 67 42.14
2988. Sam (samsrm) 159 69.68 96.84 30 18.87
2989. RRKS (rrks43) 159 89.51 112.99 55 34.59
2990. Oliwier (olix04) 159 84.33 102.75 38 23.90
2991. tstats[madkingxxx] (madking... 159 60.00 82.12 34 21.38
2992. Lloyd (llgraves) 159 77.92 104.62 33 20.75
2993. liz (lizkebab) 159 106.43 130.83 56 35.22
2994. KC (hotdogkc) 159 118.17 160.13 39 24.53
2995. Erin Lanz (erinxmaligaya_) 159 41.90 60.44 13 8.18
2996. Aditya (dhruvaditya) 159 48.91 64.25 11 6.92
2997. Gabriel (dekkoz) 159 63.39 78.50 24 15.09
2998. daniel (danielphantom) 159 90.28 118.92 57 35.85
2999. Liam (bonkatronk) 159 85.77 101.76 56 35.22
3000. Dinkin (blindguy_mcsqueezy) 159 78.11 111.16 36 22.64
3001. Khanh (aygentp) 159 90.79 119.87 51 32.08
3002. Ankit (ankit_10) 159 32.18 44.28 25 15.72
3003. ABM (abm150) 159 66.72 80.76 43 27.04
3004. Zaynski (zaynium) 158 106.32 128.89 74 46.84
3005. Omar (omarbahgat2003) 158 77.66 99.04 36 22.78
3006. Nader (nader12) 158 53.65 66.29 17 10.76
3007. Hieu (larhral) 158 89.72 112.48 58 36.71
3008. Karl (karlpuno) 158 61.87 83.89 29 18.35
3009. Rohit (john_titor234432) 158 69.96 95.93 35 22.15
3010. bsmith4972 (bsmith4972) 158 53.34 72.48 18 11.39
3011. ben (benwu1) 158 86.99 110.02 42 26.58
3012. Aytac (aytac_neigel27) 158 82.30 102.21 49 31.01
3013. Aziyat (aziyatali) 158 46.13 65.51 18 11.39
3014. dilano (dilano55) 158 85.44 112.24 58 36.71
3015. Alpha (unseenalpha) 158 54.88 75.09 15 9.49
3016. Twis (twis23) 157 74.04 100.88 40 25.48
3017. Sundara Subramanian (sundar... 157 81.23 97.99 37 23.57
3018. daniel (nitezu) 157 90.38 118.56 53 33.76
3019. Feris (merelyaferis) 157 141.26 179.23 119 75.80
3020. Filip (l4rry99) 157 89.20 120.59 46 29.30
3021. Firelord (jetray) 157 73.85 90.26 33 21.02
3022. Jay Cartwright (jay_cartwri... 157 110.38 142.76 69 43.95
3023. Jake (jake_tyler) 157 97.00 117.37 62 39.49
3024. Oskar (dailypants) 157 67.87 82.88 36 22.93
3025. khalil (credendo) 157 81.19 100.11 48 30.57
3026. aya (aya1994) 157 48.92 58.23 17 10.83
3027. w0ng (w0ng_dvorak) 156 58.66 74.69 20 12.82
3028. Verve81 (verve81) 156 111.96 136.49 89 57.05
3029. Theroarx (theroarx) 156 88.32 112.14 53 33.97
3030. Ckh (theckh) 156 88.90 108.38 48 30.77
3031. Sonwa (sonwa) 156 55.74 66.69 17 10.90
3032. RMS (sarfaraz008) 156 85.32 120.76 63 40.38
3033. percival (samuelnirina) 156 79.93 98.48 37 23.72
3034. PJR (petrosyan_jr) 156 87.70 104.82 56 35.90
3035. Kwikk (mrkwikk) 156 60.43 82.18 31 19.87
3036. JFL (mialiu0804) 156 61.04 79.19 32 20.51
3037. Luffy-dono (luffy_dono) 156 71.18 88.70 37 23.72
3038. deroche make me 220 nq plea... 156 75.13 98.35 37 23.72
3039. アヒオ (knalb) 156 52.12 68.99 14 8.97
3040. Karim (karimkarim) 156 48.88 64.66 18 11.54
3041. Kieran (kahinjin) 156 127.13 164.65 119 76.28
3042. Abylaikhan (ho1den) 156 78.14 110.78 30 19.23
3043. Fidel Alberto Ramos (Perú)... 156 58.91 77.73 21 13.46
3044. Mike (fastneko) 156 92.05 132.37 55 35.26
3045. deceptiveVI (dsaldana711) 156 113.75 145.60 82 52.56
3046. Tianyi (dreamatd) 156 76.69 93.47 31 19.87
3047. Zurfer (zurfer) 155 70.50 99.29 40 25.81
3048. Salted (whyisitsohardto) 155 82.57 111.59 46 29.68
3049. Uurdmandakh (uurdmandakh) 155 63.97 83.30 35 22.58
3050. typoMaster (tt_qureshi) 155 46.99 60.36 12 7.74
3051. Trying (sakurya) 155 132.87 163.14 102 65.81
3052. John (qui505092) 155 118.55 144.55 86 55.48
3053. Aidan (kubachi) 155 83.36 106.45 48 30.97
3054. Joseph (joseph_468) 155 118.59 140.23 90 58.06
3055. John (jhakala) 155 102.97 118.58 53 34.19
3056. Jordan (jagmasta259) 155 93.97 117.53 61 39.35
3057. Hovari (hovari) 155 66.55 92.22 33 21.29
3058. (ghall) 155 153.46 209.53 64 41.29
3059. Emily (emj9) 155 66.61 81.25 32 20.65
3060. Elliot_1980_UK (elliot_notts) 155 102.90 126.92 66 42.58
3061. calum (calousime) 155 81.77 112.56 61 39.35
3062. Avi (avitoohband) 155 59.14 86.06 33 21.29
3063. Alf (jacv_10) 155 61.89 74.57 31 20.00
3064. Casper (casper_001) 155 70.86 94.94 31 20.00
3065. Zaid (zaidnashihamin) 154 52.55 70.49 25 16.23
3066. Serenity (turkaturka) 154 83.89 103.53 43 27.92
3067. Turning 14 in 2 Weeks! (spe... 154 111.57 163.48 55 35.71
3068. Keyma.sh is better (ryleyx... 154 130.92 155.77 93 60.39
3069. Mohamd (mohamed_hussein) 154 31.07 42.68 23 14.94
3070. Mims (mimzi_who) 154 79.08 104.21 44 28.57
3071. Lai (laiyr) 154 109.87 136.95 67 43.51
3072. Samuel (king_anuus) 154 113.00 139.64 89 57.79
3073. Keelan (keelanf_28) 154 64.78 88.03 39 25.32
3074. Julius (juliuscl2004) 154 51.95 73.37 22 14.29
3075. Andreas Vida (johnbonham) 154 108.27 138.95 75 48.70
3076. tstats[ilaghardcore] (ilagh... 154 105.13 134.02 70 45.45
3077. Muhammad (donnyutsman) 154 82.08 98.98 28 18.18
3078. yo (callmeford) 154 86.15 110.00 47 30.52
3079. Batteekha (batteekha) 154 68.53 83.98 39 25.32
3080. Ayyaz Sajjad (ayyazsajjad) 154 43.53 55.35 18 11.69
3081. alex (ay1259) 154 92.23 123.32 64 41.56
3082. ig=muzi.priva (muzamil69) 154 53.07 87.31 58 37.66
3083. johnny (jdmalcolm) 154 74.00 93.60 47 30.52
3084. ydem2nir9tag (ydem2nir9tag) 153 104.87 132.43 75 49.02
3085. Tanya (tee_85) 153 44.20 70.27 14 9.15
3086. Neko (stanoje) 153 88.89 110.81 41 26.80
3087. Sigmund (sir_renardwil) 153 87.98 109.61 49 32.03
3088. Looserrrrrrrrrrrr (rahulary... 153 28.34 52.04 70 45.75
3089. ace (pressctrlandw) 153 85.06 101.23 44 28.76
3090. pedro (pmedley) 153 46.45 61.03 10 6.54
3091. Ex (not_a_razer) 153 67.26 85.02 34 22.22
3092. vroom💤 (noprop) 153 122.12 145.40 78 50.98
3093. Vito Scaletta (minaricano) 153 87.63 113.61 43 28.10
3094. Никита (mamaxab) 153 31.14 43.39 20 13.07
3095. killer (killerz4564) 153 60.93 78.89 40 26.14
3096. Jamie (jamietyper90) 153 85.33 110.22 45 29.41
3097. declan (dekkiefish) 153 94.63 120.52 57 37.25
3098. Bento (bento420) 153 97.53 121.99 77 50.33
3099. alpha (alphawoman) 153 89.03 121.05 51 33.33
3100. Stephen (s_dog2001) 152 65.06 92.50 44 28.95
3101. Splixy (splixy) 152 70.60 88.42 37 24.34
3102. Darth (rakin000) 152 78.60 94.12 28 18.42
3103. Rahul (rahuls1995) 152 51.35 64.62 15 9.87
3104. AtmoSci (noctilucent) 152 63.77 86.13 30 19.74
3105. netram88 (netram88) 152 77.07 96.55 53 34.87
3106. tstats[marin049] (marin049) 152 112.57 151.03 84 55.26
3107. Luka (lukoloz) 152 89.46 113.47 46 30.26
3108. Laco (koomp) 152 86.47 103.84 46 30.26
3109. Nik (iiirxs) 152 80.60 113.83 37 24.34
3110. Josh (h3hat3m3) 152 93.44 112.28 41 26.97
3111. Fatnot (fatnot) 152 84.71 112.01 39 25.66
3112. Denis (deniii) 152 61.54 78.10 33 21.71
3113. ashok (ashokkasi) 152 79.66 100.74 42 27.63
3114. Ali (alijoon) 152 58.77 74.40 18 11.84
3115. AlexopoulosC (alexopoulosc) 152 92.60 114.78 55 36.18
3116. saam4 (saam4) 152 70.63 94.34 35 23.03
3117. type_racist (the_orange) 152 83.85 108.24 44 28.95
3118. Drew (vegan_freedom_fighter) 151 65.62 85.30 30 19.87
3119. Rasmus (rasmus_v) 151 74.55 90.96 27 17.88
3120. ahmed (puzite) 151 85.52 108.20 37 24.50
3121. IllMind (lllmind) 151 48.64 65.10 24 15.89
3122. Jimmy (jimmmy193) 151 106.15 145.66 67 44.37
3123. jcm (jan500) 151 81.73 104.17 45 29.80
3124. INCOMPETENT (incompetent_co... 151 79.25 108.16 50 33.11
3125. Tom (darkusisdope) 151 47.64 59.25 14 9.27
3126. Aaron (biogence) 151 72.39 93.03 28 18.54
3127. MNL48 Frances DieHardSuppor... 151 89.20 109.59 60 39.74
3128. fingerblaster (linn123321) 151 81.55 105.26 39 25.83
3129. Szektor (szektor) 151 53.75 72.21 12 7.95
3130. Mohanad (mohanad3302) 151 29.84 41.28 18 11.92
3131. Laura (lauraisgreatattypera... 151 61.23 77.20 29 19.21
3132. Sidharth (_ceres_) 150 45.53 57.20 12 8.00
3133. James (wnston) 150 92.16 134.71 54 36.00
3134. Wilson (wilsonthewinner) 150 93.55 117.14 44 29.33
3135. Whyn (why8n) 150 80.33 101.06 44 29.33
3136. ws (wdsyywd) 150 83.75 114.60 35 23.33
3137. Vishal (vishal_kr_saw) 150 74.43 90.92 61 40.67
3138. Unidentified (themunchkin3) 150 125.50 146.39 80 53.33
3139. Daniel (sea_sick) 150 86.65 102.46 53 35.33
3140. backspacechud (novacainr) 150 90.22 112.12 61 40.67
3141. Necdet Ali (necdetaliozdur_... 150 64.14 80.31 31 20.67
3142. Nadav (nadavb9) 150 62.42 97.22 36 24.00
3143. linkai (linkailul) 150 95.94 125.50 56 37.33
3144. Kreoniz (kreoniz) 150 61.41 74.47 31 20.67
3145. jimjom (jimysucks) 150 147.98 187.38 122 81.33
3146. Dmitry (dmitry_turcan) 150 68.58 90.87 32 21.33
3147. David (d4v1dh) 150 103.91 131.43 62 41.33
3148. Cindy (cwycindy) 150 77.99 106.44 51 34.00
3149. Kapal Tua :v (cream777) 150 69.43 89.79 37 24.67
3150. Brian (brianhsu7476) 150 75.03 87.85 46 30.67
3151. (boy_314) 150 140.89 169.64 101 67.33
3152. Bismith (bismith) 150 76.63 93.22 33 22.00
3153. Arvind (arvindlamba454) 150 71.92 104.43 47 31.33
3154. Lily (andisapple32) 150 67.95 86.36 33 22.00
3155. Abby (abkwreu) 150 35.96 62.70 7 4.67
3156. John Le (zingerburgerkfc) 149 73.78 99.74 43 28.86
3157. Zaid (zaids) 149 84.92 108.42 34 22.82
3158. ♛₴𝕥o͓̽ᖇო·₴... 149 73.04 91.82 40 26.85
3159. waseem ahmad bhat (waseemraja) 149 60.40 91.39 29 19.46
3160. john (sharks445) 149 82.96 107.29 41 27.52
3161. Sebastian (sebastian070) 149 35.60 50.06 32 21.48
3162. Rdmm (rdmm) 149 84.60 102.30 46 30.87
3163. Moyosore (mokarios) 149 77.77 94.02 44 29.53
3164. Airbender Aang (lolmode2) 149 94.38 115.62 40 26.85
3165. Logan (laucian) 149 79.36 101.18 39 26.17
3166. Hudson (hudson_the_cat) 149 57.00 75.70 24 16.11
3167. GEMargad (gemrgd_23) 149 53.34 72.14 16 10.74
3168. Eaglekott (eaglekott) 149 93.54 114.39 48 32.21
3169. JesusWrite (jesus_write) 149 45.42 56.11 13 8.72
3170. Connor (cellingson) 149 47.21 59.78 8 5.37
3171. vardhman (vardhman) 149 57.18 83.13 23 15.44
3172. Trent (uninterested) 148 126.29 166.70 95 64.19
3173. Adrian (thebossboi1324) 148 65.41 98.95 46 31.08
3174. ☼_☼ (temuramir) 148 106.75 132.19 56 37.84
3175. Ping Janat (ppppp5541) 148 43.81 64.95 9 6.08
3176. Wenjie (pervysama) 148 128.96 147.46 104 70.27
3177. Leona (onale) 148 125.00 153.06 95 64.19
3178. Max (max_pinc) 148 83.14 108.27 38 25.68
3179. Jupiter8000 (jupiter8000) 148 70.41 96.21 47 31.76
3180. Jony (jonycolemak) 148 76.91 97.93 37 25.00
3181. denis (j4yz11) 148 47.63 60.64 12 8.11
3182. Isaac (inied) 148 99.58 133.35 56 37.84
3183. HiteshM (hiteshm_riptide) 148 76.42 99.36 45 30.41
3184. Habibullah (habibullahhussa... 148 50.02 71.90 19 12.84
3185. Musa (greatwarrior235) 148 83.02 103.21 39 26.35
3186. Jyotirmay (goldenguts) 148 65.32 83.62 36 24.32
3187. Geux (geux) 148 40.84 58.94 14 9.46
3188. WSY (elyx_2302) 148 93.69 111.86 64 43.24
3189. Dennetix (dennetix) 148 57.57 69.45 28 18.92
3190. Tady (concernednecron) 148 41.67 55.59 15 10.14
3191. Arian (arianrz82) 148 62.83 82.06 32 21.62
3192. Marc (andesandwich) 148 68.47 88.25 41 27.70
3193. Anchit (anchit) 148 77.04 92.45 37 25.00
3194. Priyam (priyam_anand) 148 54.33 71.43 9 6.08
3195. Shally (shallybroken) 148 53.00 67.99 26 17.57
3196. Woody (woody_wins_) 147 79.55 98.33 25 17.01
3197. Manas (who_mana) 147 63.53 77.04 35 23.81
3198. Vbee (vb33) 147 96.25 121.00 63 42.86
3199. Justin (ustinj) 147 87.49 112.07 44 29.93
3200. Poly (typingpoly) 147 90.53 118.52 46 31.29
3201. tomdin0 (tomdin0) 147 32.19 43.87 9 6.12
3202. tailcatch (tailcatch) 147 122.63 158.31 92 62.59
3203. vinnii (slowvinni) 147 157.12 193.00 119 80.95
3204. RaV (rav_the_writer) 147 101.26 124.74 61 41.50
3205. Cool (mrcoolguy69) 147 111.12 138.61 72 48.98
3206. MeHdi (mehdiii8) 147 96.82 120.09 69 46.94
3207. Eugene (lilgene1) 147 88.84 114.97 45 30.61
3208. Kaden (lifeshappy) 147 62.86 83.41 37 25.17
3209. Sanji (kuroashi) 147 67.28 83.38 32 21.77
3210. Jeden Osiem L (jedenosieml) 147 99.02 117.42 57 38.78
3211. Bryan (iduhowpeopledo150wpm) 147 104.47 128.20 62 42.18
3212. Hovok (hovok) 147 108.79 148.39 69 46.94
3213. H A (hamada_ali) 147 78.71 98.61 33 22.45
3214. FA (fa00) 147 47.26 57.78 20 13.61
3215. BOTbkchod (bot_bakchod) 147 59.48 72.91 27 18.37
3216. Muruganantham (bossmuruga) 147 40.29 56.74 14 9.52
3217. Mehedi (mehedihasan) 147 61.62 76.27 34 23.13
3218. yoozernaim (yoozernaim) 146 92.73 108.20 49 33.56
3219. Aditya (typingspree31) 146 80.82 96.02 28 19.18
3220. pat (trikster) 146 134.05 164.96 100 68.49
3221. Tracking Time (trackingtime) 146 85.90 111.15 45 30.82
3222. sura (suraflux) 146 83.43 100.09 47 32.19
3223. AAARGH (statim) 146 87.44 111.09 54 36.99
3224. Samuel (ssesena) 146 63.65 85.03 34 23.29
3225. Hydrodoy (qdedmon87) 146 98.38 123.92 56 38.36
3226. Jeon (owokunn) 146 113.88 138.74 74 50.68
3227. Thomas (loboru) 146 133.92 168.71 109 74.66
3228. JJ (jjbonta) 146 92.21 116.89 55 37.67
3229. Tide (firefly441) 146 63.20 80.67 40 27.40
3230. David (dave_h12) 146 78.80 95.38 36 24.66
3231. (clouhhd_) 146 95.44 141.96 4 2.74
3232. Lam (catposter1) 146 115.19 153.74 129 88.36
3233. Nafidz (arckngel) 146 68.36 82.47 29 19.86
3234. AouiGui (andersgrymer) 146 101.12 126.27 64 43.84
3235. Holo (aisha23__) 146 90.99 110.42 55 37.67
3236. (agglomeration) 146 126.28 155.93 98 67.12
3237. m1dK$9T (adepa) 146 49.37 65.26 22 15.07
3238. Lazy (lazy_gamer322) 146 56.17 68.91 17 11.64
3239. Rocky (rockyparks) 146 72.88 83.84 27 18.49
3240. Wayne (xwang4) 145 83.93 114.96 42 28.97
3241. WinterCore (wintercore) 145 127.82 161.42 89 61.38
3242. Umair (umair121) 145 75.76 95.98 34 23.45
3243. ryleigh (thestonedpotato) 145 79.42 108.00 35 24.14
3244. De Leo (theleo) 145 58.25 76.01 22 15.17
3245. Delgerskhn (thege) 145 101.43 121.67 54 37.24
3246. OULAHBIB (suicv) 145 65.69 82.91 30 20.69
3247. spiky (spiky228) 145 101.60 119.92 69 47.59
3248. mikey (snicker861) 145 86.01 107.37 50 34.48
3249. FootedPear (ryanpear0) 145 75.56 99.15 40 27.59
3250. Luis (regneva17) 145 74.60 97.73 35 24.14
3251. parsa (parsa_ktz) 145 57.29 72.28 26 17.93
3252. (palpha) 145 76.03 102.57 70 48.28
3253. NessQuik (nessquik) 145 64.44 83.88 34 23.45
3254. ROCKSTAR008 (mrbest6000) 145 112.81 145.72 77 53.10
3255. IMSL (moonrabbit) 145 129.58 154.95 95 65.52
3256. masterassassin3 (masterassa... 145 65.44 79.45 27 18.62
3257. Hououin Kyouma (makise_kuri... 145 85.77 118.00 58 40.00
3258. Marek (ksydry) 145 105.17 126.62 59 40.69
3259. Luke (kipkat) 145 57.16 76.83 24 16.55
3260. गुरु (jokerster) 145 80.85 103.90 37 25.52
3261. Jiranimo (jiranimo) 145 32.86 52.35 19 13.10
3262. Tane (husquin) 145 112.80 142.52 74 51.03
3263. Gunner (gunner8) 145 90.96 115.49 59 40.69
3264. Gabe (grahamcracker4) 145 69.57 89.96 40 27.59
3265. Ћира (cira12345) 145 84.51 105.40 48 33.10
3266. Alex (atduffaut) 145 70.95 96.04 37 25.52
3267. Leeham (you_smell) 144 78.07 99.65 35 24.31
3268. Xmoonsheep (xmoonsheep) 144 99.06 125.13 65 45.14
3269. Zhu (viviora) 144 76.96 92.51 44 30.56
3270. Sushi (sushixr) 144 70.51 93.38 30 20.83
3271. Sulthan Cendikia (sulthance... 144 65.85 86.19 39 27.08
3272. MAXIM (skramt) 144 55.78 74.49 12 8.33
3273. saeed (saeedhosam) 144 62.47 83.14 31 21.53
3274. Rice Chan (rice_chan) 144 108.76 131.97 103 71.53
3275. Alpine (relambrien) 144 143.20 176.50 106 73.61
3276. Paul (paul5005) 144 63.28 82.15 26 18.06
3277. Sanchi (pachi_sanchi) 144 83.74 110.65 47 32.64
3278. Nooby (noobythenoob) 144 87.32 110.70 51 35.42
3279. Gina (nannelcam) 144 89.45 113.71 54 37.50
3280. kevin (kongdonglong32) 144 85.45 112.20 45 31.25
3281. Jubax (jubax) 144 90.01 110.57 49 34.03
3282. Jayanth (jayanththelegit) 144 46.91 64.69 12 8.33
3283. hossam (hossam_ramadan) 144 53.50 64.40 12 8.33
3284. Francis (francis_7777) 144 60.82 79.70 27 18.75
3285. fhbjnrng (fhbjnrng) 144 132.83 164.66 115 79.86
3286. Eddie_NP (eddie023) 144 102.15 123.87 69 47.92
3287. dylan (crspy) 144 85.30 118.61 29 20.14
3288. Andre (andreandreandre) 144 90.87 113.54 50 34.72
3289. Alex Jane (alex_jane) 144 40.83 54.29 15 10.42
3290. chepe (albetrash) 144 79.32 101.22 46 31.94
3291. Jo (typermac) 143 108.42 150.36 67 46.85
3292. Otto (otto_types) 143 77.30 99.20 40 27.97
3293. HuisbaasJR (ofbasecfin) 143 90.19 116.40 50 34.97
3294. Mohammad (mostat) 143 50.43 62.14 14 9.79
3295. salvation (mo7a_1913) 143 78.52 105.70 34 23.78
3296. Memperor (memeemperor) 143 66.64 89.19 31 21.68
3297. joey (joeraps) 143 119.95 139.13 102 71.33
3298. Jerviz (jerviz) 143 107.24 133.46 80 55.94
3299. Mycargoboom (hayadabest) 143 95.62 132.81 53 37.06
3300. G (goutham_k) 143 45.25 59.16 13 9.09
3301. Bruh? (funkun) 143 63.58 82.77 30 20.98
3302. eunhyun (eunhyun) 143 113.79 145.88 73 51.05
3303. Eric (ericcand) 143 82.36 103.14 35 24.48
3304. jungkook (elizabethngg) 143 57.97 97.74 19 13.29
3305. Notaleksandr (cartonito) 143 74.23 98.40 45 31.47
3306. (bicycleman) 143 101.68 162.95 59 41.26
3307. aspirar (aspirar) 143 97.56 122.32 92 64.34
3308. Arees (arees) 143 77.19 97.64 39 27.27
3309. Ahmad (aawwad172) 143 62.12 76.86 27 18.88
3310. Bumble (rowantheboat) 143 52.17 73.53 17 11.89
3311. w (wonton2) 142 130.54 155.90 93 65.49
3312. TNT92fin (tnt92fin) 142 63.24 76.72 24 16.90
3313. Shoe (shoebox004) 142 86.60 124.31 47 33.10
3314. Andy (run_from_andy) 142 63.66 79.97 23 16.20
3315. ritesh (ritesh123) 142 53.48 71.82 18 12.68
3316. Neeraj (neeraj1) 142 58.66 77.60 22 15.49
3317. Linfeng (llinfeng) 142 101.97 132.48 59 41.55
3318. Rav (impaledbison) 142 80.96 105.07 37 26.06
3319. Arnav (hyp3rn00b10) 142 57.80 77.58 21 14.79
3320. Huoi (huy_truong_le) 142 86.79 117.60 48 33.80
3321. 111 (grimiv) 142 80.07 95.86 30 21.13
3322. Chris (gatoroid37) 142 87.64 111.93 39 27.46
3323. dylan_9802 (dylan_9802) 142 120.90 155.93 73 51.41
3324. Brandon (dreonic) 142 65.88 81.96 28 19.72
3325. Appropriate (d0wny) 142 97.30 133.50 57 40.14
3326. Stanisław (bosastopaa) 142 54.09 75.08 18 12.68
3327. ArklightF0x (arklightf0x) 142 56.35 73.74 30 21.13
3328. antifragile (antifragile) 142 85.15 126.32 42 29.58
3329. Agnar (agnar) 142 80.94 100.22 46 32.39
3330. Marco (grinzosi) 142 45.59 56.67 18 12.68
3331. tanvir (tanvir42) 142 53.75 73.90 24 16.90
3332. anhar (_anhar) 141 104.45 127.91 51 36.17
3333. yen (yennn) 141 62.26 82.47 24 17.02
3334. the (theguy27) 141 80.31 95.69 34 24.11
3335. Tareq (tareq_2007) 141 52.09 68.23 17 12.06
3336. breddreamer (rasel_hasan) 141 50.19 63.16 9 6.38
3337. Just a potato (quocbinhgt3007) 141 53.50 82.16 26 18.44
3338. SirShrek69 (puffers23) 141 108.53 124.51 59 41.84
3339. Nayeem (obaydul_hasan_nayeem) 141 50.10 61.74 18 12.77
3340. Andree (ntuanson97) 141 105.81 127.04 71 50.35
3341. Nim (nim1chimpsky) 141 85.91 111.93 45 31.91
3342. (lwycsrc) 141 125.92 156.81 86 60.99
3343. Michael (kame3200) 141 79.39 106.30 31 21.99
3344. (jlachney) 141 135.20 174.23 96 68.09
3345. Illumin80 (illumin80) 141 60.60 73.33 25 17.73
3346. Ethan (ethant772) 141 116.35 156.80 79 56.03
3347. bruh (diablodvorak) 141 87.49 106.53 35 24.82
3348. Dear (dearme) 141 67.03 81.48 33 23.40
3349. sally (creamdonut) 141 108.02 146.97 69 48.94
3350. (barfing) 141 134.32 168.93 96 68.09
3351. ashiq hussain wani (ashiqwani) 141 46.83 58.56 14 9.93
3352. Ar7N (ar7n) 141 70.60 98.54 31 21.99
3353. anas (ana_1s) 141 77.38 95.36 31 21.99
3354. HADI (adilmuhammadi) 141 58.77 73.52 28 19.86
3355. Abdelrahman (7gab) 141 78.12 109.15 31 21.99
3356. Abhishek (abhishek_mtb) 141 46.55 59.97 18 12.77
3357. Souptacks (souptacks) 140 70.92 96.32 29 20.71
3358. shota.b (shotiko8) 140 90.66 119.96 51 36.43
3359. Lulu (shade_senpai) 140 116.89 150.30 77 55.00
3360. saket (saket1harsh2) 140 58.49 73.53 23 16.43
3361. Aaron (rondc108) 140 62.52 81.43 39 27.86
3362. BEing VinCI (ppubalo) 140 87.46 112.12 49 35.00
3363. Dario (oodarioo) 140 49.93 65.51 17 12.14
3364. hamza (mizoxes) 140 96.28 118.55 58 41.43
3365. Richrad (laci279) 140 77.46 93.26 32 22.86
3366. Hai (ky0ka) 140 83.13 107.77 34 24.29
3367. Viacheslav (krevetko) 140 68.01 85.12 26 18.57
3368. Yunusali (khakimjanovich) 140 60.96 81.15 21 15.00
3369. Jonathan (jonathan888) 140 69.67 88.84 32 22.86
3370. jittery (jittertypes) 140 83.95 105.23 45 32.14
3371. simon (i_am_simon) 140 97.51 128.09 52 37.14
3372. asdf (itz_pvp1235) 140 87.89 110.30 50 35.71
3373. Jan (hokejan_14) 140 37.51 51.11 8 5.71
3374. Alexander (greenocelot26_dv... 140 106.35 130.44 58 41.43
3375. Goldie (goldie87) 140 40.06 54.84 12 8.57
3376. CVH (cvh_) 140 136.45 163.05 106 75.71
3377. Badri (bxdri) 140 123.66 167.54 70 50.00
3378. Joshua (busbud) 140 71.92 94.50 35 25.00
3379. SKY (avid_learner8) 140 29.64 36.69 20 14.29
3380. Anis (anis22) 140 59.05 74.17 29 20.71
3381. 65best (65best) 140 106.89 134.49 61 43.57
3382. Anas (01anas) 140 55.03 72.26 18 12.86
3383. ayman (aymanzraiga) 140 35.69 51.37 9 6.43
3384. hhj (baidu123) 140 57.66 70.67 19 13.57
3385. Indian (typelife2) 140 56.08 70.50 24 17.14
3386. Negatory (saltedslug) 140 64.70 77.95 29 20.71
3387. FREE PALESTINE (zaffles) 139 71.39 94.11 33 23.74
3388. Cal (wiscahhhhnsin) 139 115.70 151.88 76 54.68
3389. Vanza (vanzasetia) 139 53.14 67.42 10 7.19
3390. Ufo23 (ufo23gg) 139 90.17 112.14 55 39.57
3391. Tar (typer_noob) 139 100.58 126.19 47 33.81
3392. Welcome to Brazil (thunder02) 139 111.20 146.30 84 60.43
3393. tayyab (tayyab246) 139 48.02 62.96 18 12.95
3394. sam (swalden) 139 85.63 104.07 51 36.69
3395. (ノ◕ヮ◕)ノ*:・゚... 139 121.17 159.34 79 56.83
3396. Riddy (songridv) 139 84.96 120.42 43 30.94
3397. rafi (sandbomber) 139 79.20 105.03 31 22.30
3398. Rem (remroid66) 139 83.59 104.89 44 31.65
3399. Randall (rdox10) 139 118.65 156.39 83 59.71
3400. Mediumsecy (mediumsecy) 139 67.84 84.20 27 19.42
3401. V¹ҡҡʏ (littlevikky_) 139 76.57 96.00 31 22.30
3402. leo (leokkqqjj) 139 42.74 55.83 14 10.07
3403. Daniel (kimster773) 139 86.38 108.56 46 33.09
3404. Jake (jmanq) 139 66.63 97.12 38 27.34
3405. Ishaan (ishaank10) 139 67.25 86.79 32 23.02
3406. Harjot (harjot2000) 139 59.83 74.70 25 17.99
3407. Justin (ggwp_123) 139 60.88 71.69 16 11.51
3408. Sabrina (getrektttt) 139 66.92 96.43 37 26.62
3409. Le Hoang (gampingbua) 139 52.11 67.45 14 10.07
3410. Soren (cuckslayer) 139 74.01 96.73 40 28.78
3411. crai (crai27) 139 91.29 110.11 43 30.94
3412. Will (carbohydra) 139 63.23 76.63 40 28.78
3413. Yakiniku (bigmeatball) 139 102.17 128.79 44 31.65
3414. Ardison (arddison) 139 100.37 116.73 50 35.97
3415. lakhey (antivenene) 139 94.26 117.50 49 35.25
3416. longi (alongens) 139 95.00 107.29 40 28.78
3417. Nick S. (furbyparade226) 139 105.56 127.91 56 40.29
3418. dlvhdr (dlvhdr) 139 78.71 101.87 32 23.02
3419. a-s-a (kaustiflat) 139 45.01 59.01 34 24.46
3420. Zulsorai (zulsorai) 138 71.40 92.36 33 23.91
3421. Gustavo (yoosteen) 138 66.25 76.67 29 21.01
3422. Alosson (tiger6654) 138 63.87 80.56 32 23.19
3423. Laggy (thefitfatass) 138 122.59 146.03 97 70.29
3424. sidharth (sidharth_71) 138 67.25 95.07 41 29.71
3425. shantal (shantal0924) 138 69.04 98.90 31 22.46
3426. Rodney (rodneyslafuente) 138 92.20 113.50 35 25.36
3427. NOJ8 (noj8) 138 82.24 109.33 44 31.88
3428. Gemeine (nemememky) 138 76.20 99.22 37 26.81
3429. Mahdi Lotfi (mahdilotfi) 138 58.50 72.18 23 16.67
3430. jeyy (jeyy11) 138 35.22 46.29 8 5.80
3431. Liam (je1q) 138 47.77 64.13 17 12.32
3432. Lushtifer (inanutshell) 138 71.41 89.45 41 29.71
3433. hhg (hhg2) 138 60.34 73.66 34 24.64
3434. Evan can't pass the validat... 138 95.52 114.81 47 34.06
3435. Daniel (danvs60) 138 77.77 99.08 36 26.09
3436. Benjamin Martin (benjamin_m... 138 61.52 78.08 31 22.46
3437. Benjamin (banjo_) 138 59.00 75.43 25 18.12
3438. life (armaansoni) 138 76.89 96.81 40 28.99
3439. Arun (thenooboflegend) 137 80.99 95.93 36 26.28
3440. Cuong (qt1003) 137 62.40 83.16 24 17.52
3441. Abror (owl2023) 137 49.43 62.19 15 10.95
3442. ObiWanKeyboardobi (obiwanke... 137 84.97 119.84 36 26.28
3443. myaonfya (myaonfya) 137 72.83 107.41 29 21.17
3444. Mithun (mithu16_2001) 137 57.62 73.14 51 37.23
3445. J (mindjar) 137 27.70 37.13 23 16.79
3446. horyzen1 nq (lucknumber8) 137 87.62 119.49 44 32.12
3447. Casado con Ale (lrip) 137 118.35 145.35 59 43.07
3448. Little (littlepump1) 137 77.34 95.64 38 27.74
3449. kingsley (kings350) 137 68.78 92.82 44 32.12
3450. kacper szybki (kacper1) 137 47.55 60.56 12 8.76
3451. Harish (harish_roxx) 137 57.84 79.51 25 18.25
3452. gcc42 (gcc42) 137 91.93 112.87 51 37.23
3453. Shivanshu (cvanshu) 137 67.96 85.78 28 20.44
3454. Dylan (chrunchy) 137 91.13 117.66 44 32.12
3455. jen (chennyjen) 137 109.65 136.50 69 50.36
3456. Jacy (bohdan_danyltsiv) 137 78.37 97.40 31 22.63
3457. Aparesh (aparex) 137 69.92 87.35 34 24.82
3458. aculeasis (aculeasis) 137 81.96 117.87 37 27.01
3459. abdallah (abdallahmontaser) 137 41.83 52.70 10 7.30
3460. Lorenzo (lolohardy) 137 71.87 92.95 32 23.36
3461. Eran (umm_eran) 136 103.49 131.26 54 39.71
3462. sleepo (sleepotimer) 136 93.96 113.09 56 41.18
3463. Serv (servgd) 136 79.86 99.30 42 30.88
3464. Umer (programmer_1) 136 83.92 101.79 48 35.29
3465. Ibrahim (platon) 136 95.16 124.36 52 38.24
3466. weirdo (master_guy17) 136 81.59 113.48 35 25.74
3467. medkit phighting (gayliquid... 136 95.25 138.80 44 32.35
3468. f2realw (f2realw) 136 67.94 85.12 48 35.29
3469. Bálint (diabolokiller) 136 82.82 102.88 30 22.06
3470. Justin (basicjc) 136 58.05 70.56 25 18.38
3471. asdsfdg (asdfgdsf) 136 76.36 101.33 34 25.00
3472. tstats[vintage_maavirup] (v... 136 57.14 69.22 25 18.38
3473. Midorinn1222 (midorin1222) 136 65.91 89.64 41 30.15
3474. Tayler (tay_bae11) 136 58.05 84.98 35 25.74
3475. Yurii (yura198) 136 66.78 89.34 32 23.53
3476. Zuhaib (zuhaibdam) 135 104.61 135.29 63 46.67
3477. 👺Wainie san (wxia) 135 94.30 124.37 49 36.30
3478. Hyena (wildhyena) 135 84.16 114.03 31 22.96
3479. Guest (whoyoung99) 135 85.75 113.78 37 27.41
3480. Will (w1llmcl) 135 91.95 138.79 49 36.30
3481. Uladzislau (vlad_13_borisov) 135 76.28 90.16 28 20.74
3482. Tor (tortle4444) 135 49.61 66.13 12 8.89
3483. Max (thisismydrive1997) 135 100.99 117.51 43 31.85
3484. Th3BossC (th3bossc) 135 82.41 112.55 34 25.19
3485. Taso (tas123) 135 83.85 108.49 62 45.93
3486. sliptok (sliptok) 135 87.39 115.91 38 28.15
3487. Seb (sebb7y) 135 103.73 120.46 73 54.07
3488. Reenreen (reenreen) 135 70.24 91.67 41 30.37
3489. PogChamp (raziqphantomz) 135 114.80 134.82 77 57.04
3490. Allen (onelonelyguy101) 135 64.58 89.69 30 22.22
3491. Nour (nourxcx) 135 105.50 135.10 66 48.89
3492. Mohammad (moreda1999) 135 74.31 95.54 36 26.67
3493. Michael (mihcael) 135 95.51 125.68 53 39.26
3494. Nour (micasa_ackarmen11) 135 36.86 46.70 10 7.41
3495. J (jihoomoon) 135 75.21 94.54 36 26.67
3496. ヴィエット (hsdpa365) 135 86.69 112.36 38 28.15
3497. chabe (halfu) 135 95.02 123.59 86 63.70
3498. Guggles (guggles) 135 103.60 130.08 71 52.59
3499. Manne (epicblueberry) 135 85.46 106.74 37 27.41
3500. Crystal (arcee143) 135 85.34 113.45 97 71.85
3501. AnasigN (anblk) 135 36.39 56.10 7 5.19
3502. ali (ali79taba) 135 71.16 84.93 46 34.07
3503. Ezad (ezad99) 135 55.62 72.76 21 15.56
3504. Bram (yogurt55) 134 72.70 95.52 36 26.87
3505. 🚀 (wildreamz) 134 104.71 114.06 46 34.33
3506. thinkingds (sohandeshar) 134 74.86 90.29 30 22.39
3507. Ralston (ralstonnub) 134 63.11 80.68 35 26.12
3508. Avery (purplat) 134 105.43 141.72 49 36.57
3509. Vincent (not_a_robot) 134 103.44 130.90 59 44.03
3510. muchinchai (muchinchai) 134 88.82 103.57 43 32.09
3511. Matiss (mazainwastaken) 134 37.18 47.12 5 3.73
3512. loveleen (loveleenasalia) 134 60.04 71.25 19 14.18
3513. Josh (expiredvenom) 134 98.31 116.77 52 38.81
3514. Anik (eternatus) 134 62.70 74.70 36 26.87
3515. Enrico (enricoaf) 134 93.53 133.42 58 43.28
3516. DunDun (dundunbread) 134 56.97 70.21 22 16.42
3517. cadde (cadde) 134 59.00 75.03 18 13.43
3518. morsetyper (typing_with_morse) 134 13.52 21.40 27 20.15
3519. Benjamin (xlr8or) 133 94.01 112.85 38 28.57
3520. 9aswara (victorious1) 133 39.38 59.84 9 6.77
3521. Eugene (sushiwaumai) 133 77.86 97.92 37 27.82
3522. Sean Paolo (seanpaolo_22) 133 80.60 99.23 42 31.58
3523. tstats[rajveer_100] (rajvee... 133 53.27 68.16 18 13.53
3524. Stas (onixflip) 133 72.57 92.06 25 18.80
3525. Omar (omar_ziada) 133 81.54 113.59 42 31.58
3526. J (nothisisjeff) 133 81.40 102.58 30 22.56
3527. . (lun_rix) 133 85.63 103.70 29 21.80
3528. Mamazait (kozhoev1) 133 39.92 69.99 6 4.51
3529. jakub (jakub177) 133 84.44 106.17 37 27.82
3530. JJ (jajo_00) 133 49.98 64.19 15 11.28
3531. Jacob (jacobjuras) 133 115.01 141.86 77 57.89
3532. Cube (cubedefender) 133 84.20 111.91 37 27.82
3533. Em (cookie666) 133 88.03 111.19 93 69.92
3534. Petrus (clavigerpc) 133 62.58 83.59 32 24.06
3535. nub (buildernub) 133 66.87 87.70 33 24.81
3536. Andrei (belearau) 133 81.93 101.65 34 25.56
3537. Bauyrzhan (baurtokenov) 133 107.45 130.06 66 49.62
3538. An (anhanpro2k) 133 82.52 102.76 40 30.08
3539. albert (albertos13) 133 89.74 114.61 43 32.33
3540. Admaster (admaster) 133 59.67 80.33 29 21.80
3541. mohamed (spear_dfjdklf) 133 64.94 84.80 32 24.06
3542. Eryk (erykeryk1998) 133 40.91 59.30 16 12.03
3543. John (whalenj) 132 55.39 69.39 16 12.12
3544. Mau (walfare_12) 132 93.52 122.64 50 37.88
3545. Gary (vision_123) 132 52.25 63.59 25 18.94
3546. Jack (user85793) 132 92.79 123.43 47 35.61
3547. Keith (touchpoint) 132 69.72 86.91 37 28.03
3548. afafaf (tkuo42) 132 113.38 139.23 79 59.85
3549. gfy (tiga6) 132 42.29 59.89 14 10.61
3550. Bùi (thundergod1311) 132 63.57 81.48 30 22.73
3551. gabriel (super_racer1) 132 68.42 88.37 25 18.94
3552. wiredShark (slamerpunch) 132 91.47 123.13 45 34.09
3553. Sam (samsmoke) 132 65.66 80.27 28 21.21
3554. Erik (rocketdog_23) 132 67.73 82.27 17 12.88
3555. Soham (okaysoham) 132 53.32 69.41 21 15.91
3556. trimmtrabb (neyoka) 132 83.64 104.49 43 32.58
3557. M (musketeertypist) 132 108.41 130.35 68 51.52
3558. John (meep_beep) 132 76.19 98.47 39 29.55
3559. 2Centuries (marwankhaled) 132 96.06 118.42 49 37.12
3560. Abhijeet (free_wanderer) 132 59.91 79.97 30 22.73
3561. Fire (fire_rice) 132 77.19 98.72 32 24.24
3562. Dishant (dishant_10) 132 46.52 62.50 11 8.33
3563. Aron (aronbk) 132 91.62 112.41 44 33.33
3564. PinkyPonky (pinky_ponky) 132 61.32 86.71 31 23.48
3565. Shreya (shreya02) 132 36.21 45.05 6 4.55
3566. Dat (dat_amazon) 132 23.42 72.97 21 15.91
3567. Stefan (x2stefan) 131 57.22 78.77 23 17.56
3568. Guest (weruio) 131 72.66 98.31 36 27.48
3569. vrz (vrztaa) 131 64.17 77.04 30 22.90
3570. Dante (therealdante13) 131 58.04 71.86 19 14.50
3571. Lincoln (soupyy34) 131 81.15 110.05 35 26.72
3572. Syie (shinze) 131 110.37 139.79 59 45.04
3573. Roman (romanzm19) 131 35.09 44.62 7 5.34
3574. RHYTHM MOTWANI (rhythm_123) 131 28.09 38.89 26 19.85
3575. Myles (pord) 131 49.94 62.45 8 6.11
3576. Aaditya Pal (ninjaadi7903) 131 86.09 114.24 31 23.66
3577. nivedh (n43527) 131 84.66 103.44 38 29.01
3578. mik (miiik) 131 76.29 93.31 39 29.77
3579. Martin (megdal02) 131 101.75 123.95 58 44.27
3580. Lucy (masterlu789) 131 77.80 97.50 24 18.32
3581. Luis (lmorales) 131 90.97 113.07 49 37.40
3582. Karan (kk11007) 131 34.02 47.04 6 4.58
3583. chuanHui (juchh) 131 37.79 46.43 10 7.63
3584. hello :) (heyimalexsmileyface) 131 105.71 134.81 51 38.93
3585. Usman (grim_09) 131 75.56 98.51 49 37.40
3586. Jayden (gancube) 131 91.99 123.60 37 28.24
3587. Alistair (futuresenator) 131 79.34 109.35 36 27.48
3588. Frara (frara) 131 43.81 61.93 10 7.63
3589. Cuthbert (cuthybert) 131 123.51 163.01 86 65.65
3590. braden (cablebox) 131 63.81 100.35 33 25.19
3591. Abdy (a7xsg) 131 50.58 63.28 11 8.40
3592. Ryan (rtyocum) 131 69.01 83.40 24 18.32
3593. Fabio (fl1410) 131 60.30 77.72 25 19.08
3594. Shnyll (shnyll10) 131 56.31 85.22 21 16.03
3595. bozo (erengunaydin_) 131 78.70 98.61 37 28.24
3596. Zeyad (zeyad_mohamed) 130 45.17 58.82 12 9.23
3597. GOBLIN (xgoblin) 130 106.50 146.84 60 46.15
3598. Hunter (wizardhunter11) 130 85.26 108.99 35 26.92
3599. Daehan (vitamaxdh) 130 93.45 116.83 44 33.85
3600. Md. Tarek Hasan (tarek_racer) 130 60.80 78.86 19 14.62
3601. Timofey (t1m0n) 130 81.38 95.69 39 30.00
3602. sherry (sherry4) 130 75.61 93.31 37 28.46
3603. Remi (remi_11) 130 56.64 72.04 24 18.46
3604. Red (redchristian16) 130 81.57 100.60 42 32.31
3605. Pheontern (pheontern) 130 68.11 83.11 29 22.31
3606. Sriram (nvsriram) 130 83.63 99.69 40 30.77
3607. Mikey (miket349) 130 109.71 147.61 55 42.31
3608. heythisistej (lucknumber8_alt) 130 88.81 115.03 43 33.08
3609. Olexiy (lexk) 130 77.29 98.63 38 29.23
3610. Mohammed (ledger67) 130 76.95 94.65 23 17.69
3611. nakkooo (kuudere) 130 137.10 183.15 90 69.23
3612. mike (jazz_hands) 130 107.40 130.48 60 46.15
3613. laezza (inimitabile) 130 95.00 130.55 51 39.23
3614. SMdG (hyperlord) 130 67.93 80.91 34 26.15
3615. endless (dm475) 130 76.65 105.94 40 30.77
3616. Corné (corneduring) 130 73.41 88.98 34 26.15
3617. Tenzin (cleggmcmuffin) 130 90.15 120.53 45 34.62
3618. Billy (battlefieldragon) 130 101.62 119.08 50 38.46
3619. Basketbla (basketbla) 130 72.87 92.74 40 30.77
3620. Miguel (anckael) 130 101.43 122.90 61 46.92
3621. Akshay (akshay_c123) 130 42.15 57.12 13 10.00
3622. akash_mzp (akash04mzp) 130 34.69 47.40 9 6.92
3623. Steve (addictedtoendorphins) 130 107.32 124.01 68 52.31
3624. Abbey (abbey240901) 130 85.64 101.67 30 23.08
3625. Ni (013ni) 130 94.04 119.56 50 38.46
3626. Lucyfer666 (lucyfer666) 130 71.53 90.06 38 29.23
3627. bg (bbbggg) 130 33.41 44.12 7 5.38
3628. David (nesor) 130 61.88 88.43 32 24.62
3629. winner (winner11) 129 106.50 132.17 72 55.81
3630. Tom (tom09876) 129 53.41 65.75 11 8.53
3631. TJ (timothyjan) 129 86.95 105.65 43 33.33
3632. Pedro (timboly3) 129 98.39 131.60 61 47.29
3633. Rouven (therealr5) 129 44.49 58.46 14 10.85
3634. Person (person753) 129 72.37 96.25 42 32.56
3635. Alexander (need4speed402) 129 91.80 132.07 40 31.01
3636. Naeem (naeemsalarzai) 129 39.45 56.18 15 11.63
3637. Niue (miloszz) 129 74.24 91.13 26 20.16
3638. Kreingkrai (kengkreingkrai) 129 67.06 81.93 33 25.58
3639. Muhammad (junaidqazi) 129 57.53 73.06 19 14.73
3640. Jacob (jacobogbeide) 129 73.71 97.76 28 21.71
3641. David (hanid3) 129 76.81 98.32 37 28.68
3642. Hamza π (hamzza_) 129 104.07 125.08 55 42.64
3643. augustus (guslee) 129 106.61 130.85 57 44.19
3644. Falitac (falitac) 129 78.34 103.16 46 35.66
3645. TypingSince2017 (expeditive) 129 147.70 184.96 98 75.97
3646. radish (onlyradish) 129 94.09 115.88 58 44.96
3647. Nikhil (momo7636) 129 49.06 59.85 11 8.53
3648. CHUGGITYPES (chuggitypes) 129 74.98 97.12 21 16.28
3649. Decent (coolgamerplayer124) 129 73.99 94.61 30 23.26
3650. Wouter (wouter_kuijk) 128 87.93 106.98 40 31.25
3651. venki (venki15) 128 66.16 82.92 60 46.88
3652. Haris (undead_slayer) 128 67.96 83.43 58 45.31
3653. tje (tje04) 128 88.65 119.56 40 31.25
3654. Raymond (szlesh) 128 93.08 121.77 53 41.41
3655. saniya (supersaniya) 128 54.98 68.48 18 14.06
3656. bubbleTEA (stefsbored) 128 77.86 102.63 34 26.56
3657. 10 🆆🅿🅼 (sostdeo) 128 57.95 67.55 20 15.63
3658. Roy (sisalt) 128 99.40 123.30 47 36.72
3659. Shukhrat (shux121995) 128 70.79 87.26 28 21.88
3660. Raghav (redsondude) 128 99.24 119.91 48 37.50
3661. Ravindra (ravindrats) 128 62.42 75.49 19 14.84
3662. Phillip (phillip_kim) 128 84.00 124.64 45 35.16
3663. Caleb (miniso0987) 128 132.14 164.26 53 41.41
3664. johnny :P (johnny234) 128 87.49 108.27 39 30.47
3665. Ivan (ivanv1997) 128 62.88 72.06 21 16.41
3666. gab (ggzl1998) 128 106.15 128.38 72 56.25
3667. AMM (gamesplaytest) 128 61.33 82.90 25 19.53
3668. alloine0220 (d1rtyd33d_5) 128 51.16 70.41 11 8.59
3669. BOOGIE (bobarex) 128 47.02 60.34 10 7.81
3670. blaze (blaze_012) 128 54.57 65.92 10 7.81
3671. tstats[beedi] (beedi) 128 72.41 96.51 38 29.69
3672. Andrew (andrewfischr) 128 66.61 81.81 21 16.41
3673. Abstraxions (abstraxions) 128 115.66 141.64 65 50.78
3674. Gabe (zonazebra) 128 67.65 88.16 34 26.56
3675. shishir_karanth (shishira1203) 128 90.50 112.60 46 35.94
3676. Peter (upsala_koy) 127 75.82 92.01 33 25.98
3677. Aren (tl8xv) 127 89.96 121.55 39 30.71
3678. sheep (theonesheep) 127 100.72 129.58 53 41.73
3679. SR (ssdel) 127 85.13 116.43 48 37.80
3680. HEMEL (sm_hemel) 127 74.20 89.27 23 18.11
3681. Cris (schmidtolini) 127 98.29 123.88 52 40.94
3682. Basti (schinken38) 127 71.79 98.09 35 27.56
3683. Mohamad (mhsyazani) 127 66.43 88.47 30 23.62
3684. mazen (mazen25287) 127 55.84 73.12 13 10.24
3685. Bat-Amgalan (mambatukaa) 127 80.67 97.79 36 28.35
3686. KTH (kthmanish) 127 86.25 115.89 42 33.07
3687. ghoudiy (ghoudiy) 127 66.75 92.12 20 15.75
3688. Kalervo (dilbodeadhorseflog... 127 66.94 81.70 23 18.11
3689. desarly (desarlymarshall) 127 64.01 87.04 32 25.20
3690. Wendy (crystalblue123) 127 56.64 70.84 21 16.54
3691. Chumba1ba (chumba1ba) 127 94.62 118.73 43 33.86
3692. Jimmy Le🇻🇳🇺🇸 (c... 127 70.91 88.72 30 23.62
3693. Krittiphum (100508274) 127 101.36 122.35 54 42.52
3694. Ryan (barnes12) 127 64.10 83.71 30 23.62
3695. Andrei (_son_) 126 169.89 194.72 118 93.65
3696. Pratul NHK (zer_fus) 126 56.45 71.39 20 15.87
3697. Aaron (the_bus) 126 76.67 89.91 35 27.78
3698. no (theovive) 126 101.92 128.87 60 47.62
3699. Sean (seandominic14) 126 78.45 93.72 38 30.16
3700. felix (sanfelix) 126 64.72 87.31 26 20.63
3701. Sam (samb11) 126 102.09 126.16 53 42.06
3702. PUO (puomaster) 126 67.43 83.55 40 31.75
3703. Daniel Mulligan (parubujotuce) 126 41.06 58.84 12 9.52
3704. Panic (panicswitch07) 126 85.86 131.07 44 34.92
3705. idell (notidell) 126 89.58 110.24 42 33.33
3706. Mauro (mauronaval) 126 52.42 68.40 15 11.90
3707. mackysmach (mackysmach) 126 60.64 82.05 35 27.78
3708. John (johnykenny) 126 73.32 98.23 29 23.02
3709. Miles (jetblxckwalls) 126 101.21 126.02 57 45.24
3710. Snowy (it_was_lag) 126 90.74 127.61 40 31.75
3711. Hydrogxn (hydrogenation) 126 87.76 116.76 40 31.75
3712. stained (fartunderwear) 126 170.19 200.25 0 0.00
3713. m&m (egyz) 126 84.13 101.55 43 34.13
3714. Pei Bin (cheongpeibin) 126 93.64 132.28 45 35.71
3715. Bymbadulam (boa_7515) 126 50.49 67.68 12 9.52
3716. Anadi vyas (anadivyas) 126 73.67 88.67 19 15.08
3717. Adam (adammomen) 126 61.44 76.63 19 15.08
3718. Nuub (1brasil) 126 102.42 131.43 51 40.48
3719. Typemasterluka (fica030) 126 56.94 73.17 16 12.70
3720. Bob (wmwmwmwm) 125 81.26 115.25 31 24.80
3721. Tanver (tanverrupos) 125 80.54 107.40 34 27.20
3722. Stafford (staffordv) 125 84.21 111.88 29 23.20
3723. Sphynx (sphynxy) 125 80.83 103.32 32 25.60
3724. Soph (soap28) 125 43.92 57.08 6 4.80
3725. ridicolos (ridicolos) 125 79.93 96.80 37 29.60
3726. Rendi (rendi_touchtype) 125 91.60 120.60 46 36.80
3727. Perry ᗜˬᗜ (perryok) 125 125.45 151.72 77 61.60
3728. Aisha (needforspeed_) 125 52.96 76.27 14 11.20
3729. Shonade (mr_overclocked) 125 87.40 128.17 32 25.60
3730. Ujjwal (megamindx) 125 65.13 96.09 24 19.20
3731. Mayank (mayank1508) 125 71.75 85.59 24 19.20
3732. Murk (marchell0) 125 66.39 91.85 33 26.40
3733. Maninder (mani_ms1) 125 76.42 101.69 32 25.60
3734. Jessica (jeguar) 125 89.30 127.51 36 28.80
3735. Grant (gboi881) 125 65.53 80.93 28 22.40
3736. daniel (dpainter) 125 99.51 118.59 57 45.60
3737. Cuong (cuongdao) 125 78.55 99.60 32 25.60
3738. Jeff (chiefjeef) 125 109.83 136.78 75 60.00
3739. CB (cb_cabral) 125 37.36 47.44 11 8.80
3740. Wen Ree (cataclysm234) 125 79.51 103.72 37 29.60
3741. Brandon (brandon_b) 125 80.53 102.73 28 22.40
3742. Manu (basuramanu) 125 111.15 159.27 65 52.00
3743. ATRAN (atranhehe) 125 76.91 98.36 25 20.00
3744. ارمغان (armaghan_ahmed) 125 56.87 71.22 17 13.60
3745. Slowpoke (amisanthropist) 125 95.14 125.73 41 32.80
3746. araceli nicole (xrxcxlx) 124 73.28 104.45 74 59.68
3747. dude (udead1) 124 108.62 124.60 58 46.77
3748. Quan (tmquan98) 124 77.36 117.83 25 20.16
3749. Scalmole (scalmole) 124 89.09 112.16 47 37.90
3750. Per (perlydersen) 124 67.31 81.15 29 23.39
3751. NickBwalley (nickbiiy) 124 97.16 122.02 52 41.94
3752. mayimbe (mayimbe194) 124 76.99 98.10 28 22.58
3753. Stitch (lostowo) 124 65.58 91.29 48 38.71
3754. Jay (jay_soh) 124 93.89 109.92 41 33.06
3755. Jason (jasonw1121) 124 106.33 134.77 80 64.52
3756. Gabriel (itsgiorno) 124 56.22 68.35 27 21.77
3757. g (georgecolin1221) 124 44.30 62.98 11 8.87
3758. Roman (freasy) 124 59.97 77.91 21 16.94
3759. Anye (farmerfred) 124 81.93 100.57 44 35.48
3760. Edu (edlofe) 124 63.19 84.05 29 23.39
3761. Sir (dsfee) 124 66.21 82.33 33 26.61
3762. hu (crediblez) 124 143.90 190.09 89 71.77
3763. bhavesh (bhanucsgo) 124 55.60 75.51 23 18.55
3764. bangka (bangkabelitung) 124 81.42 102.82 26 20.97
3765. aman729272 (aman729272) 124 55.50 64.91 19 15.32
3766. Tony (adbaldini) 124 45.57 59.79 9 7.26
3767. Vu (3nim3) 124 85.17 108.17 31 25.00
3768. Zx (zxloh) 123 72.11 89.44 25 20.33
3769. Zodi (zodi_dutoit) 123 70.63 84.61 28 22.76
3770. Yash (yash1402_) 123 85.14 108.74 28 22.76
3771. k2K (worthwhile) 123 64.48 85.47 22 17.89
3772. Julia (thejulia) 123 66.91 81.06 21 17.07
3773. sathwik (sathwik_7770) 123 58.16 73.70 18 14.63
3774. RoSchnitzel (sab_lyptical42) 123 63.53 84.00 15 12.20
3775. Logan (ronaldo_02) 123 78.45 106.21 38 30.89
3776. Novandru (novandru98) 123 68.27 87.85 23 18.70
3777. Lawrence Leones (leonnids) 123 114.52 150.73 64 52.03
3778. JuanDa (juanmartinez111) 123 73.25 92.70 30 24.39
3779. AKIS (harkar) 123 62.75 79.12 29 23.58
3780. Desert (desert_eagle) 123 38.80 50.05 9 7.32
3781. isaac (darealjoemama) 123 73.68 95.49 38 30.89
3782. ousssama (cybereagle2001) 123 51.60 65.74 14 11.38
3783. Code_slayer_25 (code_slayer... 123 39.40 49.86 10 8.13
3784. bombplay1 (bombplay1) 123 78.65 102.78 35 28.46
3785. nonaem (apansi) 123 90.16 119.95 39 31.71
3786. Ankit (ankp) 123 47.61 59.30 13 10.57
3787. aero (aeroagg15) 123 84.14 110.91 38 30.89
3788. sketchy (sketchysquirrel) 123 79.02 100.30 36 29.27
3789. jclb (jclb) 123 67.15 88.43 30 24.39
3790. donald_dump. (lookin_xss) 123 58.20 74.23 24 19.51
3791. Alan (alanzim) 123 67.03 90.42 31 25.20
3792. yash (userthree) 122 52.87 67.12 16 13.11
3793. Golf GTI (typeracer_user_) 122 82.96 102.56 35 28.69
3794. vinh (tienvinh) 122 54.25 68.51 13 10.66
3795. Alireza (thealireza) 122 116.11 154.94 76 62.30
3796. snackmancer (snackmancer) 122 141.77 165.38 93 76.23
3797. Mikke (skrammelkonto) 122 59.54 70.20 41 33.61
3798. Sherniiaz (shero2002) 122 64.85 81.09 32 26.23
3799. pablo (pablo_rm1197) 122 82.06 109.61 31 25.41
3800. otto (ottocorrect) 122 91.98 114.45 39 31.97
3801. Phil (miss_you_reck) 122 131.79 153.07 91 74.59
3802. matin (mdmatin4) 122 43.93 58.57 6 4.92
3803. Thank you, (maintrack) 122 135.72 176.94 78 63.93
3804. MAHIR (mahirlabib) 122 56.01 69.25 22 18.03
3805. Muhammad (littlememon) 122 69.19 91.91 33 27.05
3806. Laura (laurga) 122 102.35 125.82 45 36.89
3807. dulux23 (dulux23) 122 99.52 121.63 47 38.52
3808. Ana (druze_tito) 122 53.58 70.42 19 15.57
3809. yah-yeet (dingdong768) 122 105.40 125.98 58 47.54
3810. Andrew (dijkstra) 122 92.33 113.13 46 37.70
3811. CHEESE (chromatickhaled) 122 103.85 121.28 50 40.98
3812. twitch_NotDefense (bravedev... 122 92.21 114.26 31 25.41
3813. Blake (blake4605) 122 75.87 93.24 35 28.69
3814. Binay (binayginodia) 122 68.15 86.16 24 19.67
3815. Homer (aerowang) 122 58.86 72.20 16 13.11
3816. cheesepizza (adarshdhital007) 122 47.11 73.85 17 13.93
3817. Adamelvis (adamelvis) 122 73.56 92.18 27 22.13
3818. Daniel (maddan2016) 122 83.06 106.50 27 22.13
3819. Benjie (xbenjie) 121 125.82 170.31 84 69.42
3820. Eric (wernerosorio) 121 91.94 117.93 36 29.75
3821. vitvlkv (vitvlkv) 121 59.56 73.08 18 14.88
3822. Stank (stankyard) 121 60.30 78.38 33 27.27
3823. Ryan (riceisgoodman) 121 91.80 115.72 40 33.06
3824. Putus (putusbb) 121 24.50 35.84 18 14.88
3825. Lesibana (profles) 121 64.70 87.16 25 20.66
3826. DDIR (pn10401006) 121 59.06 72.98 23 19.01
3827. PAT (pat0216) 121 75.39 93.33 31 25.62
3828. Egg (organicegg) 121 90.75 115.48 43 35.54
3829. Nungkha (nungkha) 121 58.43 81.79 22 18.18
3830. no (nomaybeyes) 121 94.22 121.67 40 33.06
3831. David (jabadahub25) 121 64.57 82.98 28 23.14
3832. a (im_typing_with_my_d) 121 72.19 89.85 27 22.31
3833. Andrew (honeyman) 121 129.37 159.68 79 65.29
3834. Blake (hanlentt) 121 65.27 95.25 26 21.49
3835. Gabriel (gbvicente) 121 80.91 100.96 26 21.49
3836. Andrei (elpelaodank) 121 169.24 204.35 101 83.47
3837. Aloysius (dude101no) 121 95.91 114.58 42 34.71
3838. Arnab (arnab_api) 121 67.69 82.62 22 18.18
3839. Abed (abed42) 121 65.46 98.65 30 24.79
3840. Sandeep (5keleton) 121 28.89 37.89 18 14.88
3841. chi (naviqq) 121 71.27 84.46 35 28.93
3842. Seraphear (_seraphear) 120 73.79 85.75 31 25.83
3843. Vinni (vinnico) 120 60.01 75.13 17 14.17
3844. skyeblu7 (skyeblu7) 120 94.07 115.51 46 38.33
3845. sika (sikathenub) 120 81.85 109.22 52 43.33
3846. Shelpeck (shelpeck) 120 55.18 75.44 17 14.17
3847. serien (serien_) 120 86.00 113.62 28 23.33
3848. Sahil (sahil_sa) 120 57.16 68.32 14 11.67
3849. Rafar (rafar504) 120 62.01 79.30 16 13.33
3850. Mykhailo (pushkarov) 120 52.01 64.43 20 16.67
3851. Prosper (prosperhuang) 120 85.35 105.89 30 25.00
3852. oley (oley11) 120 50.08 65.33 10 8.33
3853. Road (oldayanisnoob) 120 55.06 71.90 25 20.83
3854. Noob (noob_racer1) 120 78.33 100.83 61 50.83
3855. Sreshta Kamya (nikitha) 120 83.55 104.52 37 30.83
3856. Narmichid (narmichid_2003) 120 59.08 76.12 25 20.83
3857. Colin (modernbonsai) 120 79.43 96.21 28 23.33
3858. Mohammad Hossein (mh1998) 120 81.45 99.89 38 31.67
3859. M (magmag00) 120 53.03 64.51 7 5.83
3860. Lord Kuro (lordkuro) 120 91.92 117.59 39 32.50
3861. chromebook user (kuxir97) 120 69.63 92.41 57 47.50
3862. KM9 (kunal2795) 120 88.32 127.09 65 54.17
3863. 光次郎 (koujiro) 120 81.61 109.93 33 27.50
3864. Alfred (junior162007) 120 63.62 87.24 26 21.67
3865. tstats[itchyhuman] (itchyhu... 120 113.72 148.03 62 51.67
3866. Used Notebook (invis_lurker) 120 80.63 119.82 28 23.33
3867. pavle (hello_kittyy) 120 84.68 101.04 34 28.33
3868. Gamer (gamer_equine) 120 53.30 67.48 19 15.83
3869. Gajendra (gajendra_0180) 120 70.68 87.64 113 94.17
3870. Andre (dreson03) 120 85.36 114.59 36 30.00
3871. Mario (dmfz) 120 72.91 91.79 32 26.67
3872. Deltaology (deltaology) 120 48.58 66.64 9 7.50
3873. DeadpoolFromAliBaba (bruhgo... 120 60.58 79.13 22 18.33
3874. Aleks (alexmandev_3) 120 77.21 95.02 36 30.00
3875. click clack (albert471) 120 130.40 160.14 74 61.67
3876. Akkmaharaj (akkmaharaj) 120 67.37 87.37 24 20.00
3877. Ae (aezharhu) 120 77.48 99.77 28 23.33
3878. suhuyini (smaimoro) 120 32.70 46.08 18 15.00
3879. Bed Rock (bedhat7) 120 58.32 84.02 20 16.67
3880. aedan (aedanbinoy) 120 27.65 36.26 27 22.50
3881. jitin (jitinharyana) 120 98.72 119.71 35 29.17
3882. Chad (chad_nuckolls) 120 62.04 74.33 21 17.50
3883. Leo (leoroy7x7) 120 68.19 86.11 31 25.83
3884. Rochtark (rochtark) 120 48.25 61.77 8 6.67
3885. CelerySticks (whatan0b) 119 101.15 123.16 47 39.50
3886. Speed (ututu222) 119 97.89 129.84 43 36.13
3887. pugman (thepugpro) 119 105.91 142.64 56 47.06
3888. ponyo (ponyyo2323) 119 33.73 47.94 2 1.68
3889. polongas (polongas) 119 50.30 67.81 10 8.40
3890. Ben (mrjamminkearl) 119 91.69 120.85 41 34.45
3891. Tralalero Tralala (mita57) 119 101.90 122.26 51 42.86
3892. Anurag (mak42) 119 79.41 100.27 34 28.57
3893. Mark (loggsu) 119 97.94 135.32 47 39.50
3894. mkk (litt1e_ave1) 119 42.44 54.15 31 26.05
3895. bruh (lambertwp) 119 70.96 90.71 30 25.21
3896. Blaze (klblaz) 119 83.64 106.50 29 24.37
3897. buynaa (kamikaze0612) 119 85.94 109.04 26 21.85
3898. Jin Yi (jinyisim) 119 94.36 113.96 43 36.13
3899. VY (india_vikas_yadav) 119 133.58 160.68 88 73.95
3900. Speed is relative (hvan1998) 119 72.15 87.01 20 16.81
3901. Chen (chen_) 119 80.47 96.44 30 25.21
3902. Bharath (bharath0915) 119 50.76 65.87 9 7.56
3903. Amer (amer202) 119 51.08 70.58 14 11.76
3904. albit (albit) 119 35.38 48.68 3 2.52
3905. Ihor (_ihor) 118 47.52 60.02 15 12.71
3906. Shubham (_anonymous) 118 50.80 66.89 10 8.47
3907. Zaid (zaid1012) 118 58.59 78.01 30 25.42
3908. TBo (tbo_) 118 84.69 110.32 30 25.42
3909. Steve (srd93) 118 89.96 106.99 42 35.59
3910. Satyam (sprayinglight0) 118 71.55 89.92 27 22.88
3911. someonewhoisntlikeyou (some... 118 99.54 119.89 57 48.31
3912. Scotf (scottgraham) 118 40.50 53.40 8 6.78
3913. Hussam (samwa7sh800) 118 65.50 80.64 29 24.58
3914. Elliot (privateplague) 118 80.64 100.26 29 24.58
3915. Shinji (nagkagrabe7) 118 96.95 118.73 42 35.59
3916. Michael (mwalter32123) 118 69.77 84.97 29 24.58
3917. matcha (matchamacchiato) 118 111.26 137.29 67 56.78
3918. 🍉 (masqueworld) 118 119.51 141.86 66 55.93
3919. Gaurab (logan_pi) 118 60.01 79.22 25 21.19
3920. Liam (lime_da_bestest) 118 80.81 100.72 29 24.58
3921. VH (jaywild) 118 60.13 77.47 23 19.49
3922. lav (illblowurmind) 118 102.09 131.91 43 36.44
3923. how? (haotingz) 118 105.06 129.65 57 48.31
3924. Garrett (gdiegnan147) 118 119.43 144.32 65 55.08
3925. Exzede (exzede) 118 66.28 88.97 32 27.12
3926. 😳 (expertgeneralist) 118 87.89 111.31 35 29.66
3927. Ethan (ethan_5) 118 100.10 129.70 47 39.83
3928. cod1r (cod1r) 118 89.89 120.20 41 34.75
3929. james (chilty14) 118 76.82 105.39 33 27.97
3930. Argo (argonautika) 118 84.95 108.49 30 25.42
3931. Ankush (ankush_12) 118 57.44 73.02 20 16.95
3932. Aamill (aamill) 118 91.88 117.59 34 28.81
3933. Ryan (8baller) 118 68.17 87.21 29 24.58
3934. (4lsi3w544lwi4lk) 118 129.99 155.49 78 66.10
3935. :( (notabot69) 118 64.59 80.42 23 19.49
3936. SSJ 5 :) (rak99) 118 48.49 62.83 9 7.63
3937. n1tro (n1tro) 118 70.38 90.80 38 32.20
3938. Sam (sambibiriz) 118 51.59 91.55 20 16.95
3939. Safi (_safi_) 118 70.68 87.29 26 22.03
3940. Tom (twatters) 117 75.11 102.40 31 26.50
3941. timgan (timgan) 117 104.24 126.95 51 43.59
3942. testsubject (shamushasha) 117 76.67 101.28 30 25.64
3943. Shai (shaichon) 117 84.42 102.94 37 31.62
3944. Zamami (shadaokami) 117 46.98 62.74 11 9.40
3945. magnus (robertavmagic) 117 74.41 91.66 22 18.80
3946. Chen (nyarlathoteppppp) 117 70.31 85.10 31 26.50
3947. BEECEE (nukecee) 117 107.85 131.53 63 53.85
3948. Nate (ngb125) 117 66.97 86.42 27 23.08
3949. Jester (murvayne) 117 120.32 149.46 61 52.14
3950. MithterMagma (mithtermagma) 117 92.95 112.79 43 36.75
3951. Marc (mghale_215) 117 100.52 126.40 45 38.46
3952. Yevhen (m1rev) 117 38.90 57.69 9 7.69
3953. max (low_wpm) 117 49.40 60.43 11 9.40
3954. kikiki (kiki02613) 117 99.98 117.11 48 41.03
3955. laptopwinterpro (justanothe... 117 146.69 168.37 84 71.79
3956. josh (joshtypes1) 117 107.91 145.30 51 43.59
3957. Jonas (jonasj2001) 117 85.63 105.41 37 31.62
3958. jeff (jeffersongtg) 117 72.85 92.29 31 26.50
3959. 6typeR (hacker888) 117 60.51 74.92 26 22.22
3960. new account fenno4 (fennomak) 117 123.90 157.15 71 60.68
3961. Rahul (endeavour_the_one) 117 58.85 79.26 18 15.38
3962. dvorak (dvorak0211) 117 44.41 68.11 16 13.68
3963. Bea (chilichanga) 117 90.34 119.24 37 31.62
3964. Asif (asif04) 117 75.89 90.87 33 28.21
3965. Micro (apm14) 117 91.61 116.19 28 23.93
3966. Abdulwahab (wahabi56) 117 25.19 34.35 22 18.80
3967. G (zger) 116 90.05 119.68 40 34.48
3968. tobias (thandschin) 116 85.38 102.31 31 26.72
3969. mm (smsa5000) 116 78.26 96.20 20 17.24
3970. Daniel (scumset) 116 102.35 126.87 52 44.83
3971. sanchayay (sanchayay) 116 57.58 72.87 22 18.97
3972. Vincent (rubixon) 116 50.04 59.86 9 7.76
3973. Rohit (rohit_1706) 116 40.48 61.61 10 8.62
3974. Lia (reyi) 116 94.64 124.30 35 30.17
3975. Miłosz (refjel) 116 69.59 82.80 31 26.72
3976. Lord (planta) 116 97.08 121.94 39 33.62
3977. Nitesh (niteshtiwari) 116 64.11 92.22 28 24.14
3978. Judas Escargot (looneyjuice) 116 113.23 148.90 61 52.59
3979. laZorbeamZ (lazorbeamz) 116 101.93 125.27 46 39.66
3980. Kaplana (kaplana) 116 47.77 69.91 26 22.41
3981. Jordan (jordan2380) 116 161.91 196.32 0 0.00
3982. Tru (jhake_1) 116 82.12 110.49 26 22.41
3983. Andreas (drivknuten) 116 38.92 44.93 9 7.76
3984. Divyesh (divyeshm) 116 59.86 78.23 22 18.97
3985. Bob (bob_loblawrl) 116 69.51 82.87 32 27.59
3986. Miguel (bellcros) 116 61.81 84.62 32 27.59
3987. Asad (asad104khan) 116 82.94 100.38 31 26.72
3988. Amal (amal_jyothis) 116 57.84 81.96 15 12.93
3989. Vishagh (vishagh) 116 41.55 54.68 16 13.79
3990. Ronan (ronocoolo) 116 78.72 96.45 32 27.59
3991. pilioko (pilioko) 116 77.23 107.28 38 32.76
3992. Charles (chan_cellor) 116 48.93 60.77 12 10.34
3993. Alden (alden_s) 116 59.33 71.14 16 13.79
3994. Pranav (_vanarp) 115 42.10 58.37 9 7.83
3995. snake_case (_snake_case) 115 45.22 54.77 5 4.35
3996. iosif (y_o_s) 115 44.47 62.54 8 6.96
3997. Areeb (your_avg_aaa) 115 82.37 104.92 36 31.30
3998. s3yf (unclemeat) 115 74.93 95.88 33 28.70
3999. Free Palestine (tidy400) 115 82.62 103.71 28 24.35
4000. TheTIger107 (thetiger107yt) 115 97.89 144.70 51 44.35
4001. Sultan (sultanreal) 115 53.31 71.90 15 13.04
4002. Shil (shilegend) 115 54.43 68.00 12 10.43
4003. PotatoLyfe (potato_lyfe) 115 69.15 92.74 25 21.74
4004. Radwin (nosmirk) 115 90.19 122.23 51 44.35
4005. nazmul (nhasan0290) 115 69.89 87.49 30 26.09
4006. Ken (netski1400) 115 75.87 93.05 28 24.35
4007. Ḿ (m_10) 115 56.19 72.39 18 15.65
4008. Matthew (mstracy) 115 86.54 104.90 35 30.43
4009. bruh (lmnhat2002vn) 115 57.34 74.51 19 16.52
4010. tstats[learning_dvorac] (le... 115 67.38 96.32 32 27.83
4011. Florian (jordanbelfort) 115 89.89 108.87 35 30.43
4012. Jem (jemanema) 115 80.49 101.20 28 24.35
4013. jay (jaymorant) 115 60.74 77.11 21 18.26
4014. race typing (jangyeeunnie616) 115 94.11 131.49 97 84.35
4015. hypeiron (hypeiron) 115 69.62 84.78 29 25.22
4016. heyitsalec (heyitsalec) 115 115.44 140.53 75 65.22
4017. Hans (hansboi) 115 86.51 121.19 42 36.52
4018. labaalli (hajjaba) 115 28.37 39.31 15 13.04
4019. Fadosa (fadosa) 115 86.71 104.40 33 28.70
4020. erk (estalow) 115 121.40 139.61 71 61.74
4021. Ramiei (elli_y) 115 84.38 112.88 38 33.04
4022. vrum vrum (elex_) 115 41.42 55.54 9 7.83
4023. el (elanamax) 115 98.06 116.42 42 36.52
4024. Ethan (eg083) 115 66.75 86.35 30 26.09
4025. Edward (edwardw21) 115 136.32 167.24 74 64.35
4026. Donald (dhonuill) 115 111.47 134.80 53 46.09
4027. dat (datkitteh) 115 35.37 60.03 11 9.57
4028. Sonatry (danyannang) 115 100.67 116.91 43 37.39
4029. Niamh (crystalniamh) 115 105.55 135.83 41 35.65
4030. J (average_typer95) 115 98.67 124.41 42 36.52
4031. Arunreas (arunreas) 115 48.26 65.49 19 16.52
4032. Vielle (arc_sec) 115 178.39 220.10 9 7.83
4033. angie :) (angwie) 115 88.69 117.79 33 28.70
4034. Al (al_gha23) 115 70.11 85.91 35 30.43
4035. Adam (adamhawkins) 115 122.29 151.49 73 63.48
4036. Obi-Wan (6x_ebitda) 115 80.23 94.63 32 27.83
4037. sss (1whiteblack1) 115 58.04 72.81 11 9.57
4038. Jules (layinpip_) 115 67.52 88.20 24 20.87
4039. Isaiah (zayhoncho) 115 44.25 62.20 10 8.70
4040. Jeremy (jeremyperdok) 115 69.13 91.69 24 20.87
4041. William (william_david) 114 89.68 122.02 49 42.98
4042. Tai (weakmee) 114 83.54 109.52 38 33.33
4043. anonym (thefencr) 114 39.71 53.58 5 4.39
4044. Thiago (terjan) 114 77.03 105.66 38 33.33
4045. Tanvir (tanvir_025) 114 74.72 94.24 35 30.70
4046. StewieGriffin (stewiegriffi... 114 101.76 141.45 49 42.98
4047. Salah-eddine (sharrach) 114 42.64 60.14 22 19.30
4048. RAJNISH (rajnishkumar31) 114 69.83 94.96 37 32.46
4049. RacerABM (racerabm) 114 70.79 96.05 32 28.07
4050. badgyalting (pl200834) 114 51.81 67.65 26 22.81
4051. Phil (philwinnem) 114 102.51 127.62 46 40.35
4052. Pacham (pachamcham) 114 75.86 91.54 41 35.96
4053. ogkatumus (ogkatumus) 114 90.73 121.82 46 40.35
4054. Don (odonjeque) 114 64.54 78.76 15 13.16
4055. Moye (moyoka) 114 90.91 119.21 32 28.07
4056. Michael (mercury28) 114 102.79 131.22 49 42.98
4057. Maxwell (mc2006) 114 81.64 98.64 33 28.95
4058. 樊 (krinzkolo) 114 65.99 82.97 24 21.05
4059. kum (kinararidwan) 114 79.96 102.02 37 32.46
4060. Ken (kenkenken_) 114 113.93 131.35 74 64.91
4061. Jonathan (jonyaa) 114 84.19 105.72 33 28.95
4062. Jesus (johangodinho123) 114 85.98 123.80 37 32.46
4063. Doniyor (doni_dev) 114 67.61 89.35 38 33.33
4064. Parik (communistcomradepv) 114 61.45 81.94 18 15.79
4065. david (chu0724) 114 43.70 59.72 19 16.67
4066. Caitlin (caitlin3) 114 98.36 117.55 53 46.49
4067. Samuel (budbeats) 114 53.01 79.01 16 14.04
4068. Joe (bubustrick) 114 60.43 75.14 24 21.05
4069. BooceJooce (boocejooce) 114 58.47 75.19 21 18.42
4070. BMO (balot2020) 114 76.82 100.44 24 21.05
4071. badtyper (badtyper_) 114 72.89 95.98 25 21.93
4072. tstats[abdul_hakeem123] (ab... 114 52.97 69.36 19 16.67
4073. 5000600 (5000600) 114 108.69 171.39 87 76.32
4074. Zia (zia1) 113 45.28 66.04 6 5.31
4075. Xristos (xristos_gav) 113 72.32 94.03 22 19.47
4076. Andre (smallchicken) 113 84.68 113.03 40 35.40
4077. Samar Singla (samluci666) 113 68.86 91.24 29 25.66
4078. Arthur (sagman) 113 85.64 134.41 20 17.70
4079. Rachel (rffree) 113 80.25 103.17 31 27.43
4080. PreciousStats (precious_stats) 113 124.52 166.49 75 66.37
4081. Jayden (nephewjayden) 113 84.41 104.24 31 27.43
4082. Mike (miym) 113 70.96 83.42 19 16.81
4083. winter (kitzy) 113 76.56 105.23 24 21.24
4084. Dyslexic_J (jamjar_) 113 79.92 98.77 23 20.35
4085. Hussein (hussein987) 113 71.46 102.45 33 29.20
4086. TheProdigyHenry (henryv70) 113 125.20 164.70 63 55.75
4087. fish and chips (heavenseer) 113 185.62 220.51 96 84.96
4088. HawksCardinals (hawkscardin... 113 102.66 129.36 52 46.02
4089. Harshit (harshitjindal) 113 68.05 96.18 23 20.35
4090. fares (fares_esam_22) 113 36.38 44.97 4 3.54
4091. on earth, as it is in heave... 113 114.35 145.07 58 51.33
4092. Essi (essi4678) 113 52.96 68.44 24 21.24
4093. Terry (eleftheriosonic) 113 66.03 86.58 29 25.66
4094. Big Pop (broguyman) 113 87.93 110.12 26 23.01
4095. kay (bbsaltlord) 113 89.39 114.12 45 39.82
4096. ashish (ashishroka) 113 52.07 69.18 17 15.04
4097. ghoul (abigail_w) 113 133.72 151.26 71 62.83
4098. I ♥ Gym (2slow_2exist) 113 97.42 115.53 42 37.17
4099. Vibhav (vibhav_1262) 112 63.31 84.29 25 22.32
4100. ican tpye fwtf (sup_chief) 112 93.27 139.40 41 36.61
4101. Steven (stevencd) 112 83.45 102.17 34 30.36
4102. Robert (selbor) 112 74.31 99.87 31 27.68
4103. :D (scottmorrisonmp) 112 90.55 112.47 30 26.79
4104. Yu (sadochist) 112 101.16 119.90 50 44.64
4105. Jiong Liang (odliang_15) 112 60.25 76.37 21 18.75
4106. Tim (littlesprinklesjersey) 112 111.73 141.62 59 52.68
4107. Viktor (knifenoob) 112 89.78 115.46 44 39.29
4108. walid (kasemwalid) 112 52.84 67.71 13 11.61
4109. Isaac (isaacchen_cool) 112 112.81 141.64 57 50.89
4110. Hue (hue_man) 112 75.43 88.83 27 24.11
4111. gdonke (gdonke) 112 57.26 69.55 20 17.86
4112. FMURTADHO (fmurtadho) 112 122.26 151.11 64 57.14
4113. Nikola (flomaster_) 112 82.73 106.83 34 30.36
4114. Exyiaevox (exyia) 112 96.30 132.03 46 41.07
4115. cvxz (cvxz) 112 58.96 80.48 22 19.64
4116. chris (chrisp03) 112 61.13 78.93 28 25.00
4117. jieun (bunnypenguin) 112 111.66 143.38 53 47.32
4118. Vincent (bhangjiwon) 112 122.56 153.53 76 67.86
4119. Balgow (balgow) 112 73.83 93.69 25 22.32
4120. Rakibul Alam (badboirakib) 112 22.83 33.34 15 13.39
4121. Ashutosh (ashutosh6997) 112 73.84 96.29 21 18.75
4122. ziad (ziadbensaada) 111 46.47 65.15 6 5.41
4123. DaVinky (xxlarrylegendxx) 111 70.93 89.07 38 34.23
4124. Teodoras (teoyessir) 111 113.39 141.84 57 51.35
4125. Ammar (s_ammar) 111 46.01 58.12 12 10.81
4126. Sheraz (sherazahmad720) 111 48.95 60.17 20 18.02
4127. Sam (sammusubi27) 111 71.05 87.34 30 27.03
4128. William (normalizejoey) 111 74.52 96.34 45 40.54
4129. MooMoo (moo_24) 111 54.35 69.62 13 11.71
4130. Master (master_2010) 111 45.20 60.91 10 9.01
4131. Kevki (kevki_) 111 84.14 104.61 34 30.63
4132. Jonathan (jah_n_i) 111 85.90 113.25 45 40.54
4133. iCry (icry) 111 90.40 120.90 33 29.73
4134. @smile.hnts on twitter (hyp... 111 85.82 108.35 33 29.73
4135. Syed (hello_guest) 111 47.13 62.11 12 10.81
4136. Lun Mang (halberd237) 111 59.87 75.82 12 10.81
4137. Ricky (galvanize) 111 96.50 126.99 40 36.04
4138. Aditya (fire_smasher1) 111 55.98 72.06 18 16.22
4139. Felix (felixsantoso) 111 69.12 90.72 23 20.72
4140. Mordo (elmordo) 111 77.13 91.23 21 18.92
4141. Sean (drherpdederp) 111 84.38 106.59 36 32.43
4142. Demancer (demancer) 111 107.25 140.13 46 41.44
4143. Ahmad Fatih (afaf_tech19) 111 64.51 86.62 27 24.32
4144. Baramee (6666666666666666) 111 49.58 67.82 7 6.31
4145. Thomas (447tomtom) 111 47.18 60.62 11 9.91
4146. Radoslav (padoto07) 111 71.06 89.56 27 24.32
4147. Leonardo (zadig1789) 111 55.62 72.12 18 16.22
4148. Ester (torreset321) 111 63.39 78.73 19 17.12
4149. Ɓritishyobro (britishyobro) 111 80.25 100.90 24 21.62
4150. aEr0 (_aero) 110 62.80 76.35 22 20.00
4151. Olivia (xlivsteer07x) 110 54.78 72.62 34 30.91
4152. Taradiddle (taradiddle) 110 77.60 92.71 24 21.82
4153. elongated (supreme10001) 110 135.84 161.43 67 60.91
4154. SRI (sr71) 110 86.89 99.82 34 30.91
4155. SpeedTrain (speedtraintyper) 110 82.09 114.90 26 23.64
4156. this quote is sh*t (slowass... 110 81.15 106.27 24 21.82
4157. skycandy (skycandy1) 110 64.40 79.11 24 21.82
4158. Joseph (schmo_) 110 101.57 129.70 48 43.64
4159. sat (sattypants) 110 77.66 104.01 31 28.18
4160. sab (sabpap) 110 65.45 83.24 25 22.73
4161. robloxyboy1212 (robloxyboy2... 110 100.78 136.54 43 39.09
4162. Ring2020 (ring2020) 110 76.46 96.84 24 21.82
4163. Raymando (raymando) 110 95.82 120.08 52 47.27
4164. Rawest_Dawg (raw_dawg) 110 65.67 84.57 24 21.82
4165. Procrastiracer (racerrob) 110 115.16 147.26 55 50.00
4166. Atif (pakistan_786) 110 81.61 109.17 22 20.00
4167. Ngita (ngita) 110 57.94 72.79 16 14.55
4168. Marek (mxrkz) 110 66.50 80.86 27 24.55
4169. Mircox (mircozen) 110 89.40 108.32 32 29.09
4170. Somto (megamined) 110 62.93 79.33 15 13.64
4171. Irham (irhamdinataa) 110 86.79 110.28 39 35.45
4172. Gayathri (gayathri_prabhu) 110 65.99 83.77 27 24.55
4173. nikhil (forceablebean6) 110 108.28 126.19 61 55.45
4174. Daniel (dreilly2231) 110 77.16 91.77 32 29.09
4175. David (dmed519) 110 69.58 82.05 26 23.64
4176. Dwiko (diorite90) 110 59.50 76.33 27 24.55
4177. Daniel (beefichor) 110 75.51 90.58 22 20.00
4178. Maximus (asso2002) 110 97.62 125.83 46 41.82
4179. #$# (ah_ha) 110 74.27 95.44 30 27.27
4180. Amorphic (_amorphic) 110 58.92 89.76 27 24.55
4181. Farid (faridkhan) 110 29.39 41.52 17 15.45
4182. Eric (yellowblankets) 109 83.71 111.98 23 21.10
4183. I'm bad at typing (uzumakid... 109 92.53 120.77 39 35.78
4184. Kian (uls_sanch) 109 95.95 111.05 30 27.52
4185. alipboy (tragicbronson) 109 106.73 131.85 55 50.46
4186. horney (titansmakemehorney) 109 82.17 104.33 27 24.77
4187. Lily (tiptaptyping) 109 112.79 139.23 47 43.12
4188. Roberto (soniic99) 109 45.43 61.69 10 9.17
4189. shrnayvi (shrnayvi) 109 89.13 100.30 33 30.28
4190. Lakshay (shaybas) 109 97.23 123.43 36 33.03
4191. Samuel (samharr) 109 66.96 84.35 19 17.43
4192. Nguyen Truong (racing_typer... 109 102.72 136.72 55 50.46
4193. q4say (q4say) 109 61.55 75.48 27 24.77
4194. boat (narwhalinz) 109 129.12 161.38 72 66.06
4195. Rizwan (mrpassionate) 109 68.24 83.82 20 18.35
4196. Max (maxcampman) 109 79.13 101.57 29 26.61
4197. Sandwich (marlonbrandoseyes) 109 56.59 72.15 18 16.51
4198. Marcos (marcosjlr) 109 75.01 88.71 19 17.43
4199. Banoboo (lasttry) 109 33.62 48.14 9 8.26
4200. David (king_cao1) 109 110.79 133.79 51 46.79
4201. kenneth (kennethnhan) 109 71.57 86.96 23 21.10
4202. jveee (jv223) 109 75.16 94.50 30 27.52
4203. Michael (henderslender11) 109 49.02 62.28 12 11.01
4204. Hassaan (hassaan0180) 109 70.00 92.29 40 36.70
4205. Gareton (gareton) 109 58.80 69.82 14 12.84
4206. Veteran1728 (frenzy1728) 109 97.34 116.55 35 32.11
4207. Desmond (desmond27) 109 84.37 102.03 28 25.69
4208. DeafChef (deafchefsteph) 109 58.30 72.80 16 14.68
4209. Karan (commando_typer) 109 48.26 59.18 12 11.01
4210. crip (cipti) 109 44.18 56.16 13 11.93
4211. Chubby (chubbykidseating) 109 102.38 133.89 41 37.61
4212. Nikita (chervovn04) 109 59.07 74.29 20 18.35
4213. jdyn (ayskiri) 109 78.16 128.28 29 26.61
4214. Aymscird (aymscird) 109 100.81 121.18 45 41.28
4215. www (aaahrgrhh) 109 105.12 135.22 44 40.37
4216. Jacob (peanutboy) 109 64.25 85.17 27 24.77
4217. clarence (zerogly) 108 87.60 104.87 39 36.11
4218. jason (yacine77) 108 74.82 95.29 24 22.22
4219. Elijah (too_ez_) 108 97.74 126.90 49 45.37
4220. THATCHILD (thatchild) 108 103.08 125.76 98 90.74
4221. Sunny (sunny6464n) 108 50.94 61.70 11 10.19
4222. Shubham (srp3003) 108 91.07 115.55 35 32.41
4223. Rosy (rosyport) 108 121.93 159.76 55 50.93
4224. Parag (parag_gn) 108 49.08 62.97 11 10.19
4225. (onah) 108 120.27 150.72 60 55.56
4226. Json (jskfreerunner) 108 74.47 92.35 27 25.00
4227. bruh (jakubd) 108 82.37 106.92 37 34.26
4228. Itay (itzir) 108 56.14 67.00 15 13.89
4229. Jia (icecoldpillow) 108 115.74 139.23 43 39.81
4230. rip reckful (fictorian) 108 116.23 145.75 56 51.85
4231. balls (faygodreams) 108 114.92 140.98 48 44.44
4232. Osh (elvor) 108 92.36 106.17 47 43.52
4233. Joe (edwardstewart69) 108 105.73 153.37 43 39.81
4234. Davi (davi_v) 108 118.83 141.52 52 48.15
4235. Sean (crowded_keyboard) 108 93.35 119.68 52 48.15
4236. Albert (certikbertik) 108 84.89 109.43 33 30.56
4237. Bekzat (blkssmv) 108 64.80 78.97 29 26.85
4238. azu (azux) 108 83.42 111.49 47 43.52
4239. tstats[ayyaz7] (ayyaz7) 108 78.63 96.91 26 24.07
4240. 🌹Ayra (ayraa) 108 78.72 110.50 26 24.07
4241. Emil (awsomeemil25) 108 115.71 151.35 70 64.81
4242. bloomy (atsu) 108 89.16 114.60 38 35.19
4243. xelfeR (armez) 108 122.53 199.14 60 55.56
4244. Markus (ark_sum) 108 65.22 80.27 22 20.37
4245. Amirey (st_amirey) 108 72.84 94.18 24 22.22
4246. Zev (zevaverbach) 107 104.58 146.82 51 47.66
4247. Ty (yomommafav) 107 89.11 113.40 31 28.97
4248. Surya (surya_p) 107 53.57 72.21 17 15.89
4249. Sn1kt (sn1kt) 107 55.38 74.57 17 15.89
4250. Newton (nklflips) 107 94.67 123.18 45 42.06
4251. 🏅🏅🏅 (naod_1225) 107 114.48 146.10 50 46.73
4252. Vishal (mr_sharma01) 107 53.26 65.53 17 15.89
4253. Moghit (moghit44) 107 74.54 117.63 29 27.10
4254. Sean (metrognome12) 107 84.25 105.10 40 37.38
4255. Quan (martinrockon) 107 71.01 96.20 27 25.23
4256. Leonid (leosmrdljak) 107 75.15 95.88 55 51.40
4257. Izzy (izzythompson) 107 81.47 107.91 25 23.36
4258. Emon (emonn) 107 67.88 85.64 22 20.56
4259. Dingus Fish (dingusfish) 107 84.11 101.97 35 32.71
4260. cocoju (cocoju) 107 65.74 82.06 18 16.82
4261. Yoel (chessmaster55) 107 55.40 74.37 13 12.15
4262. Harry (bonogo123) 107 90.99 114.05 28 26.17
4263. Nacho (awooo) 107 90.75 109.37 44 41.12
4264. Allan (allan_g) 107 68.73 88.95 27 25.23
4265. Arnold (10wpmtyper) 107 128.21 162.27 69 64.49
4266. sarampium (saripu) 107 78.62 97.66 28 26.17
4267. Nabibro007 (nabibro_007) 107 60.83 79.45 17 15.89
4268. zach (rz23222) 107 81.78 112.74 22 20.56
4269. RixZorro (rixzorro) 107 70.69 83.97 28 26.17
4270. kartheek (kartheek542) 107 54.55 71.96 29 27.10
4271. Maciey (maciey_ff) 107 71.70 87.66 33 30.84
4272. Deni (zingaraaa) 106 62.81 75.46 23 21.70
4273. Vishnu (vishnu6174) 106 76.45 94.22 22 20.75
4274. Viktor Helgi (viktorhelgi) 106 61.96 77.14 26 24.53
4275. Valeria (valeriale) 106 52.30 64.35 8 7.55
4276. Calculus (uchihalol) 106 162.20 196.11 8 7.55
4277. They Don't Know That (theyd... 106 102.81 131.71 39 36.79
4278. Subir (subir_b) 106 34.27 42.26 2 1.89
4279. feelsclapman (sprenkelz) 106 111.70 137.67 47 44.34
4280. SMhd (smhd) 106 89.44 105.64 26 24.53
4281. skitter315 (skitter315) 106 115.95 134.67 63 59.43
4282. Benga (skebengat) 106 71.29 90.26 28 26.42
4283. Simon (siarnt) 106 93.70 111.16 38 35.85
4284. shane (shanel0l) 106 68.93 84.81 29 27.36
4285. Sebastian (sebz1) 106 80.04 109.14 22 20.75
4286. Cameron (sebajun) 106 95.77 119.28 36 33.96
4287. Samuel (samuelga) 106 91.95 115.58 44 41.51
4288. sami (sami66) 106 89.40 109.23 27 25.47
4289. Ravid (ravid37) 106 18.76 25.56 13 12.26
4290. yashwi (potato0o0) 106 74.85 103.60 30 28.30
4291. peter (peterfan) 106 70.26 93.43 33 31.13
4292. mahmoud (mzridi) 106 46.10 56.89 9 8.49
4293. Mena (mony40) 106 44.95 58.70 13 12.26
4294. Sam (monkeh_type_fast) 106 84.41 113.81 37 34.91
4295. M (mileung) 106 75.42 95.23 30 28.30
4296. Max (max_akyl) 106 52.06 67.35 11 10.38
4297. Luan (luanxpg9) 106 68.95 79.18 35 33.02
4298. khanh (lenguyenkhanh) 106 89.48 104.05 28 26.42
4299. JD_FPS (jd_fps) 106 69.20 96.46 22 20.75
4300. J (itsjustj) 106 93.72 123.15 31 29.25
4301. Eric (insecureforsure) 106 81.36 101.87 31 29.25
4302. ihba (ihba) 106 79.14 106.61 35 33.02
4303. md (duom_1432) 106 71.93 102.87 24 22.64
4304. Dan (danezu) 106 68.21 91.13 15 14.15
4305. Bruce (brucecccccc) 106 105.86 127.84 48 45.28
4306. Elden (bloab) 106 121.10 150.45 86 81.13
4307. Biza (biza) 106 74.22 86.67 24 22.64
4308. Christian (allen2021) 106 56.52 69.24 10 9.43
4309. pnguin (pnguin_) 106 98.06 119.65 55 51.89
4310. Ahjashi (jnguyen21) 106 64.19 78.02 19 17.92
4311. Hayley (hayleylafontaine) 106 71.58 93.99 24 22.64
4312. Caleb (powelcb) 106 52.24 67.91 7 6.60
4313. (zealindaus) 105 132.64 164.72 87 82.86
4314. Willll (yongzew) 105 50.39 59.96 3 2.86
4315. Yanni (yannishams) 105 63.13 80.82 32 30.48
4316. Phoeniix (xiineo) 105 86.71 115.02 37 35.24
4317. Typo (wlofails) 105 112.86 148.63 72 68.57
4318. withan46 (withan46) 105 72.99 85.45 27 25.71
4319. ugga (ugga_ugga) 105 87.09 108.20 42 40.00
4320. Lucas (slappy_rgs) 105 68.26 89.22 20 19.05
4321. Sabari (sabari314) 105 80.81 104.15 35 33.33
4322. slow-af (rohilverma) 105 130.45 152.08 73 69.52
4323. Radmilo (radmilo) 105 96.01 114.88 40 38.10
4324. :| (peanutbutter_665) 105 72.74 111.66 22 20.95
4325. lio (osybius) 105 96.27 118.76 46 43.81
4326. OrangeKomodo (orangekomodo) 105 63.91 82.86 24 22.86
4327. 💾 PROGRESS IS NOT LINEAR... 105 86.37 104.14 29 27.62
4328. Nino (ninospvp) 105 129.65 156.97 66 62.86
4329. ninfueng (ninfueng) 105 61.16 79.26 19 18.10
4330. Eva (niejingtan) 105 77.98 98.85 32 30.48
4331. Nick (nick1236) 105 58.74 78.21 16 15.24
4332. Natsu (n4tsu_dragneel) 105 51.76 66.60 12 11.43
4333. Tien (mr_tien) 105 77.01 110.31 24 22.86
4334. apoodle_ (molltenlol) 105 69.58 91.33 24 22.86
4335. Madara (madara_uchihaking) 105 60.32 77.13 64 60.95
4336. Loopy (loopy_oopy) 105 65.62 81.35 24 22.86
4337. Jatin (jatin_sharma_2005) 105 77.36 92.75 21 20.00
4338. Ctrl + Alt + K (infolepsy) 105 122.33 154.11 63 60.00
4339. Valentina (genericwhitemale) 105 88.53 118.84 33 31.43
4340. Ahmed (gemy_amin) 105 47.74 62.50 10 9.52
4341. 2002hondaaccord (gamingboss... 105 101.83 131.47 45 42.86
4342. DiroDoku (dirodoku) 105 91.84 112.34 38 36.19
4343. bleh (dan1ce) 105 59.71 74.99 38 36.19
4344. Gascoigne (correctionhaha) 105 121.47 158.77 59 56.19
4345. CJ (cj2305) 105 74.09 91.63 26 24.76
4346. [FRLA] Frank Admirer (ciaer... 105 110.17 134.30 81 77.14
4347. Bbbbbbbbb (boohaw) 105 146.80 185.10 80 76.19
4348. Boo (boo42069) 105 62.35 83.38 31 29.52
4349. aymen (aymenalwh) 105 59.18 73.96 22 20.95
4350. April (apping) 105 65.16 80.75 27 25.71
4351. ehe (aeronsic) 105 87.83 100.26 30 28.57
4352. Mahedi (12362) 105 71.21 92.76 29 27.62
4353. Parameshwaran (knparamesh26) 105 54.50 70.42 14 13.33
4354. Gold (goldberger) 105 80.47 107.24 40 38.10
4355. Bitcoin (sreeharshag) 105 46.16 57.84 7 6.67
4356. enes (mr_moonz) 105 51.40 62.98 10 9.52
4357. Kevin (zuperfire1) 104 94.65 111.91 27 25.96
4358. zhizin (zhixin0220) 104 38.11 45.77 10 9.62
4359. Rezaul (vuzinga) 104 63.99 74.44 13 12.50
4360. JL (tsg03) 104 67.22 86.92 24 23.08
4361. Tómas Ingi (tomasingi) 104 66.41 80.69 25 24.04
4362. Andrew (silverdotters) 104 95.51 115.24 42 40.38
4363. Dutch (shawnseb) 104 91.20 112.61 34 32.69
4364. PedroS235 (pedro_s235) 104 59.89 74.66 17 16.35
4365. knoppix (ninopereira) 104 53.89 66.91 10 9.62
4366. Emma (missbennett) 104 86.41 108.71 25 24.04
4367. Apollyon (mik_apollyon) 104 96.84 122.30 46 44.23
4368. Matthew (mattyhassett) 104 102.56 141.91 44 42.31
4369. Kuidurgu (kuidurgu01) 104 40.91 50.60 22 21.15
4370. Karan (karansinghgi18) 104 53.78 67.03 11 10.58
4371. IanL (jeedaiian) 104 52.04 63.63 14 13.46
4372. Honza (honza2535) 104 85.57 101.78 26 25.00
4373. howdoitellherilovehersomuch... 104 71.57 94.02 26 25.00
4374. Drake (gangket) 104 58.97 75.94 13 12.50
4375. Bing (gamerbilplays) 104 96.38 133.28 45 43.27
4376. Calvin (fullrespect) 104 99.71 119.58 59 56.73
4377. femonemonemo (femonemo) 104 73.59 84.40 19 18.27
4378. Nathan (craizar) 104 82.52 99.42 29 27.88
4379. Petr (chytris) 104 54.22 65.73 12 11.54
4380. shiba inu (bamboozledshibe) 104 87.70 124.01 32 30.77
4381. Hello Layth :) (ayoubantita... 104 75.94 102.31 32 30.77
4382. Nick (headhunter_jr) 104 67.99 80.77 17 16.35
4383. Shyam (gamr7564) 104 85.18 108.30 32 30.77
4384. Pawan (fake_name) 104 58.83 76.94 15 14.42
4385. heker the kichuz (kichuz) 104 47.10 62.11 12 11.54
4386. vminh (tvmint) 103 63.62 80.44 25 24.27
4387. Swarmy (swarmy) 103 76.26 94.01 20 19.42
4388. themommajeans (spammaam) 103 105.31 139.84 50 48.54
4389. Galih (sobig_f) 103 80.62 117.66 35 33.98
4390. love (skaldssss) 103 94.24 126.70 48 46.60
4391. Sanchit (sanchitsharma21) 103 85.98 101.95 35 33.98
4392. Mark (redblacktiger) 103 93.53 124.30 45 43.69
4393. pro (pro_napro) 103 37.54 47.99 7 6.80
4394. arun (noobtyperarun) 103 87.25 119.05 53 51.46
4395. Tom (mikeoxverylong) 103 92.42 112.47 46 44.66
4396. Midnight (midnightshadows) 103 79.60 116.27 33 32.04
4397. Midhun (midhunvmurali) 103 55.04 66.05 7 6.80
4398. Lynn (lynnhanananer1) 103 84.07 103.86 24 23.30
4399. tstats[legendarybbk] (legen... 103 87.11 109.36 38 36.89
4400. Stone (kimpors) 103 65.92 82.07 25 24.27
4401. G_4G3 (g4g3) 103 58.04 71.30 16 15.53
4402. durehuu (durehuu_123) 103 34.60 61.50 5 4.85
4403. Nikola (dudeimwhite) 103 69.64 91.65 30 29.13
4404. DINKL3B3RGG (cosmovt) 103 62.64 79.64 20 19.42
4405. clock145 (clock145) 103 74.42 93.09 29 28.16
4406. Chinmoy (chinmoy709) 103 38.56 49.37 13 12.62
4407. Caleb (calebbueckert) 103 79.33 100.90 24 23.30
4408. Tobias (bolleeer) 103 80.57 100.99 18 17.48
4409. bella (bella4088888888) 103 45.23 57.43 53 51.46
4410. Ashwani (ashwani45) 103 72.52 92.69 26 25.24
4411. Cheese (arandomasiankid) 103 73.03 102.32 34 33.01
4412. Release from the pain (abod... 103 80.71 99.86 26 25.24
4413. Abhi (abhinavsanthosh_162008) 103 64.08 83.67 23 22.33
4414. HCKB (hckb21) 103 43.63 59.00 10 9.71
4415. colemak54 (coder054) 103 32.83 41.29 9 8.74
4416. abdullah (aslan19) 103 35.27 42.43 3 2.91
4417. MaBec (_mabecma_) 102 61.46 82.75 16 15.69
4418. Bugs (_bunny) 102 66.76 79.04 30 29.41
4419. Jason (_bagel_) 102 78.73 97.77 31 30.39
4420. zooommm23 (zooommm23) 102 69.70 95.74 16 15.69
4421. Hamza (yamac_kocovali) 102 39.80 52.43 9 8.82
4422. Viran (viranp) 102 99.82 126.07 43 42.16
4423. V3ness (venessang) 102 72.65 104.46 21 20.59
4424. me again (urdogwateruwu) 102 111.04 145.55 49 48.04
4425. Coco (ummena) 102 72.54 88.10 34 33.33
4426. instruments of torture (the... 102 136.97 169.28 77 75.49
4427. Theodore (theo52) 102 76.24 96.07 30 29.41
4428. XIN (tem_per) 102 84.54 109.25 18 17.65
4429. suhayb (suhayb) 102 42.76 63.37 36 35.29
4430. Madison (speedbltch) 102 70.73 93.44 24 23.53
4431. Sarah (sarahmae123) 102 85.46 116.53 31 30.39
4432. Prasoon (prkharel) 102 94.01 125.70 36 35.29
4433. AP (priyanthushara) 102 39.05 54.29 7 6.86
4434. Priyanshu (priyanshu88064) 102 67.31 80.68 20 19.61
4435. Parker (parkerfd9dy) 102 70.17 89.82 32 31.37
4436. Opmrph (opmrph) 102 91.86 124.98 48 47.06
4437. Navid Sadeghi (navid_sadeghi) 102 46.77 62.15 40 39.22
4438. Nathan (nathan_cant_type) 102 90.52 108.51 30 29.41
4439. TechHolmes (mohmmde) 102 55.27 74.15 17 16.67
4440. Lemone (lemonylemone) 102 71.40 93.48 24 23.53
4441. Just a man in a hotdog van ... 102 121.94 164.51 56 54.90
4442. 799 (khs4126428) 102 87.28 111.52 31 30.39
4443. Rest Easy Byron (keatonsmith) 102 146.73 178.11 83 81.37
4444. Jonjon (jonjonlilbas) 102 80.67 107.30 24 23.53
4445. jihoon007 (jihoon007) 102 55.44 69.05 19 18.63
4446. sg my beloved (imperfect_qu... 102 98.86 123.84 44 43.14
4447. mrrizkin (ifixlss) 102 83.83 99.42 28 27.45
4448. Mitchell (godekm) 102 111.76 147.90 44 43.14
4449. billie (eillib) 102 75.20 94.93 19 18.63
4450. Andrius (ciornas) 102 60.14 70.34 23 22.55
4451. 𝕲𝖍𝖔𝖘𝖙♠️ ... 102 78.68 104.10 21 20.59
4452. Budhai (budhai_) 102 51.91 68.48 12 11.76
4453. David Lia (terraform) 102 60.06 81.47 17 16.67
4454. lin (mattlin) 102 51.11 63.40 11 10.78
4455. Varun (purplevarun) 102 55.94 71.44 23 22.55
4456. Anxiietyx (anxiietyx) 102 61.14 74.34 16 15.69
4457. big (bigdesch) 102 63.19 76.26 25 24.51
4458. Dario (darioacg) 102 25.78 52.40 21 20.59
4459. kamothy (kamothy) 102 73.62 94.58 24 23.53
4460. Ryan (_rhou_) 101 108.93 144.95 60 59.41
4461. Zils (zils_) 101 87.87 101.96 29 28.71
4462. uann (uann1) 101 64.53 78.68 27 26.73
4463. hetang (typr_1) 101 62.88 76.47 33 32.67
4464. Ross (trickydick6) 101 105.42 135.11 37 36.63
4465. Welcometomycrucifixion (tim... 101 100.24 118.66 35 34.65
4466. Steve (stevegocoding) 101 60.86 77.89 18 17.82
4467. JD (snag1) 101 72.08 93.45 23 22.77
4468. Nick (slotharms) 101 73.59 89.85 16 15.84
4469. Shanti Swaroop (shanti_swar... 101 79.69 94.45 26 25.74
4470. ScreaM (scream2002) 101 58.04 81.96 12 11.88
4471. Sameer (sameercarpenter) 101 62.16 77.14 21 20.79
4472. Mac (redsmac) 101 73.01 91.46 26 25.74
4473. Aditya (prakashaditya) 101 63.35 72.65 20 19.80
4474. Chaos (numerodos) 101 131.30 161.81 70 69.31
4475. James (james123wu) 101 75.70 101.56 24 23.76
4476. Leviathan (furyx) 101 106.49 157.52 26 25.74
4477. Frank (fizero) 101 58.35 71.93 10 9.90
4478. Endstyle (endstylegg) 101 102.47 123.30 34 33.66
4479. come (comecurry) 101 98.76 125.09 41 40.59
4480. Mikita (byxmend) 101 55.02 68.44 13 12.87
4481. Bonu (bonu21) 101 55.35 65.06 14 13.86
4482. bean boy (binhthetyper) 101 56.20 74.30 17 16.83
4483. Bdoo (bdo0) 101 35.07 48.53 2 1.98
4484. Andy (andygeo) 101 44.02 56.23 14 13.86
4485. Anavo (anavailable) 101 59.94 75.16 1 0.99
4486. Benny (helmet123) 101 60.56 71.75 14 13.86
4487. smq (_smq) 100 97.18 124.93 44 44.00
4488. Brockton (ztgstover) 100 109.28 138.83 48 48.00
4489. zoo (zoo868e) 100 65.19 77.56 25 25.00
4490. Bob (xminer99) 100 61.44 88.97 22 22.00
4491. Victor (victorzasz) 100 53.26 65.77 8 8.00
4492. FREE PALESTINE (then1g) 100 96.10 118.62 34 34.00
4493. Zoomer (somerandomkid76) 100 80.04 100.18 27 27.00
4494. Tyler (slashrage) 100 64.40 80.95 19 19.00
4495. Aidan (sirrahnadia) 100 109.73 137.79 44 44.00
4496. Jimmy (ratjesus) 100 82.53 110.51 27 27.00
4497. pipelined (polarilacari) 100 77.80 97.33 28 28.00
4498. chad (pokeman34) 100 123.58 144.18 49 49.00
4499. plantfan330 (plantfan330) 100 57.23 75.26 15 15.00
4500. Arnau (pestopasta) 100 66.24 85.77 24 24.00
4501. Perich (perich) 100 84.96 108.33 33 33.00
4502. Sven (paindevil07) 100 69.52 80.95 24 24.00
4503. Azar (nxp_azar) 100 60.43 76.57 51 51.00
4504. Marx (marxjp) 100 78.06 99.36 25 25.00
4505. Manish (manish_89) 100 53.47 66.48 18 18.00
4506. Lukas (lukaslechner) 100 67.37 81.90 21 21.00
4507. Kinfi4 (kinfi4) 100 79.35 100.07 21 21.00
4508. khoinhalam (khoinhalam) 100 67.27 88.86 19 19.00
4509. John (johnhemrom) 100 56.44 68.01 8 8.00
4510. rasmus (jemjoyous) 100 77.70 106.50 45 45.00
4511. idk man (ithatme) 100 51.71 71.99 8 8.00
4512. idk_hii (idk_hii) 100 87.05 108.17 28 28.00
4513. hellooooo (hk_in_london) 100 77.56 97.51 23 23.00
4514. Harry (harrycomp16) 100 77.08 98.27 29 29.00
4515. grigoar (grigoar) 100 76.87 98.92 25 25.00
4516. goombamario (goombamario) 100 39.49 53.33 12 12.00
4517. Filip (flameouken) 100 60.28 77.14 25 25.00
4518. ACC [99 - 100] (dinoh_sandys) 100 84.70 105.20 44 44.00
4519. Crystal (crystal_angelo) 100 88.88 116.41 33 33.00
4520. Crash (crash_complete) 100 81.39 105.41 34 34.00
4521. Ethan (conanethan) 100 91.71 114.48 30 30.00
4522. César (c3sar36) 100 79.18 113.30 28 28.00
4523. Big (boosted_ape) 100 67.88 81.52 30 30.00
4524. Marcus (boopbeepboopboop) 100 86.79 108.85 30 30.00
4525. Rashid (beats_exe) 100 73.62 101.36 28 28.00
4526. Anton (antonjr04) 100 78.44 104.05 27 27.00
4527. animalpsyche (animalpsyche) 100 72.52 89.83 24 24.00
4528. Ahmed (ahmeed_a) 100 29.35 37.04 10 10.00
4529. Koma5 (xultronix) 100 91.76 109.54 32 32.00
4530. K a a y (none_available) 100 65.03 84.57 32 32.00
4531. SpeedRacer (the_transporter) 100 53.12 73.43 8 8.00
4532. THE MAK (realbenjaminmak) 100 82.44 99.04 35 35.00
4533. JianClash (jianclash) 100 29.25 40.35 12 12.00
4534. warya (warya) 99 64.64 89.28 77 77.78
4535. Gus (uberro) 99 96.47 121.70 40 40.40
4536. Toodles (toodles678) 99 104.77 151.44 43 43.43
4537. Smokey (smokeytheoni) 99 79.21 97.50 24 24.24
4538. Siddharth (sid_1310) 99 68.84 89.22 18 18.18
4539. samy (samy_mohsen) 99 56.15 73.77 14 14.14
4540. Benjamin (saltysnit) 99 95.66 113.62 39 39.39
4541. Jerm (professional_keyboard... 99 87.70 123.50 36 36.36
4542. Howard (papertofu) 99 137.01 164.59 75 75.76
4543. Nick (nirosmit) 99 58.28 74.31 14 14.14
4544. Yam (metrictensor) 99 110.51 133.98 46 46.46
4545. Meet (meet27) 99 83.09 100.61 27 27.27
4546. 浩丁 (kusogedane) 99 102.32 125.13 43 43.43
4547. Joy (joy_1) 99 70.25 82.13 22 22.22
4548. my fingers are slow (jay12310) 99 92.78 111.56 30 30.30
4549. Able (interstellarnova) 99 69.49 81.28 19 19.19
4550. ibrahim (ibrahiem) 99 60.48 77.42 17 17.17
4551. waifu (helpme_pls) 99 72.67 90.51 28 28.28
4552. HelioSpook (heliospook) 99 34.85 47.95 1 1.01
4553. Ducky (duckyz1) 99 73.13 93.61 23 23.23
4554. Dreamside (dreamside0010) 99 63.88 88.51 18 18.18
4555. isaac (cowwee90) 99 99.01 124.95 32 32.32
4556. David (circuitnerd) 99 64.17 79.48 24 24.24
4557. Montu (axom_shochwave) 99 85.61 104.05 22 22.22
4558. Indian hacker man (asain_du... 99 62.89 80.45 17 17.17
4559. ArkoSammy12 (arkosammy_1208) 99 75.64 105.60 27 27.27
4560. tadej pogačar (acadiantaco) 99 119.98 162.91 53 53.54
4561. lyrxcal (4l3y) 99 116.23 148.85 58 58.59
4562. oscar (skarro) 99 61.42 78.12 24 24.24
4563. Silent (silent_c1c4d4) 99 71.76 101.24 31 31.31
4564. Suman (kissey) 99 60.46 76.02 23 23.23
4565. Madeleine (maddiebeck) 99 73.71 92.47 29 29.29
4566. wi.p (rendyrond) 99 61.83 90.03 19 19.19
4567. Brayan (veraniego) 98 55.29 68.54 16 16.33
4568. Mark (veltzer) 98 92.05 117.94 40 40.82
4569. Vimim (tovtype) 98 81.24 96.95 20 20.41
4570. Mausam (the_witcher) 98 78.22 93.13 33 33.67
4571. JS (thenotorious619) 98 67.79 85.59 23 23.47
4572. Tharun (tharun66) 98 67.15 90.07 11 11.22
4573. Erick (smittywerben) 98 81.44 101.20 31 31.63
4574. Singh (singh_ram) 98 54.23 74.05 10 10.20
4575. myself (sakib9) 98 80.72 104.36 36 36.73
4576. robdude22 (robodude22) 98 101.81 126.07 52 53.06
4577. Pixel269 (pixeltwosixnine) 98 98.83 144.22 35 35.71
4578. Oli (oli94) 98 103.56 138.37 42 42.86
4579. elongatedsquirrel (nba_youn... 98 64.16 90.95 29 29.59
4580. Rest in peace (michaeltrayv... 98 179.97 215.41 95 96.94
4581. uhhhhhhh (membrane_ripper) 98 70.85 92.82 23 23.47
4582. Mark (mamochiro) 98 65.96 81.44 21 21.43
4583. Cody (kingbear2) 98 78.97 100.59 21 21.43
4584. grandsheber (justbagdat) 98 61.23 72.56 37 37.76
4585. jonica (jonicailagan) 98 99.54 123.00 32 32.65
4586. Jack (jackshadow) 98 81.48 101.71 25 25.51
4587. Ice (icedime) 98 88.71 107.21 34 34.69
4588. Hannah (hpelay) 98 96.62 117.72 37 37.76
4589. Freundschaft Bus (freundsch... 98 86.04 105.66 34 34.69
4590. deepak (fireyfingers) 98 46.09 60.31 6 6.12
4591. Erik (erik4) 98 83.55 102.73 31 31.63
4592. Chhavi (chhavijain1111) 98 70.49 88.20 19 19.39
4593. macura (bobbygreg) 98 85.25 122.65 36 36.73
4594. BASIL (basilps123) 98 76.37 88.86 26 26.53
4595. Aditya (aditya9219) 98 76.70 96.26 24 24.49
4596. Dahmer's (hybridtattu) 98 33.03 49.97 10 10.20
4597. Dominik (b14ucky) 98 64.47 81.83 26 26.53
4598. Vroom (woem) 98 61.99 75.20 30 30.61
4599. Nathan (vanderha) 97 80.66 102.72 18 18.56
4600. ton (tonton31) 97 87.47 110.43 32 32.99
4601. Ceres (the445guy) 97 87.56 115.48 38 39.18
4602. Stam (stam_01) 97 79.43 106.06 32 32.99
4603. jojo (spacelion121319) 97 75.50 99.53 23 23.71
4604. Marm (slayerxy) 97 144.59 172.00 69 71.13
4605. Fork (sir_fork) 97 61.70 86.32 12 12.37
4606. Sal-Kal (sal_kal) 97 80.44 101.38 36 37.11
4607. Matt (rosettastoned) 97 93.77 113.84 39 40.21
4608. Roper (ropergames) 97 47.44 75.03 8 8.25
4609. Rany (ranystephan) 97 60.51 87.69 16 16.49
4610. Principle (principle105) 97 120.53 149.70 51 52.58
4611. typer (practise_to_type) 97 59.66 74.46 38 39.18
4612. Om (omsharma612) 97 61.39 80.97 14 14.43
4613. Muhd Khalid (lid313) 97 75.37 95.70 25 25.77
4614. jeremiah (jeremiah12345) 97 87.72 106.98 32 32.99
4615. M (iamake) 97 75.69 93.02 24 24.74
4616. Grim (grimtorcher) 97 68.46 91.23 24 24.74
4617. Kasidit (ganadosa) 97 46.05 58.89 6 6.19
4618. Rask (frederik0147) 97 66.92 77.36 16 16.49
4619. n0 (doo1222) 97 69.81 87.51 16 16.49
4620. Eri (bobtentencarracer) 97 92.51 115.87 34 35.05
4621. Benjamin (bnje1) 97 105.67 139.94 41 42.27
4622. Valentin (bg4uk) 97 57.45 73.73 16 16.49
4623. anjal (anjal23) 97 84.90 107.48 32 32.99
4624. Raunak (aabbccdd4444) 97 81.58 97.53 25 25.77
4625. Syed Faysel (syedfaysel) 97 52.04 66.83 15 15.46
4626. Derrick (quiet_alien) 97 49.54 72.33 10 10.31
4627. Ikeai0515 (uanea0516) 96 88.99 111.87 33 34.38
4628. thunderbeast (thunderbeast_) 96 77.25 101.59 32 33.33
4629. Trevor (thetrevormonreal) 96 85.84 115.48 25 26.04
4630. Vu (taptyping) 96 63.89 85.16 18 18.75
4631. fingerSkate (skhmt) 96 70.52 89.55 18 18.75
4632. oh god dvorak is so bad (se... 96 128.01 148.87 75 78.13
4633. Scryp (scryp) 96 102.24 125.66 41 42.71
4634. qwerab (qwerab) 96 67.54 79.30 19 19.79
4635. Takumi86 (olliedudd) 96 67.44 88.02 15 15.63
4636. Ankur (naresh12) 96 65.26 77.79 24 25.00
4637. FOO (mintaly_unstable) 96 73.94 91.14 25 26.04
4638. average rice enjoyer (kireg... 96 141.68 190.60 33 34.38
4639. Wallapa (kefatypist) 96 47.33 56.42 11 11.46
4640. Jinf931 (jinf931) 96 86.52 108.58 31 32.29
4641. Gergő (gergo225) 96 81.20 100.46 29 30.21
4642. geras (gerastv) 96 98.57 146.89 29 30.21
4643. Steven (gamma_knife17) 96 102.14 123.55 40 41.67
4644. ouchies (evilemmelina) 96 113.04 147.57 47 48.96
4645. Eric (ebiman9726) 96 58.68 86.59 14 14.58
4646. Dr (drchhun) 96 58.82 76.93 15 15.63
4647. develsixteen (develsixteen) 96 94.03 112.32 26 27.08
4648. jb (deamon_214) 96 41.04 60.86 11 11.46
4649. Em (chuchu) 96 77.93 94.83 27 28.13
4650. Catman (catman847) 96 71.18 86.41 24 25.00
4651. Nathan (buddyurslow) 96 89.14 106.35 37 38.54
4652. Bryan.. XD (bryan_xd) 96 76.54 106.42 24 25.00
4653. Thomas (banone) 96 46.80 57.35 10 10.42
4654. Areeb (areebur) 96 68.98 85.24 29 30.21
4655. Shohan (ansshohan) 96 75.41 95.52 23 23.96
4656. alaa (alaa_eddin) 96 44.75 53.13 16 16.67
4657. carina (carina05) 96 107.63 132.67 87 90.63
4658. Lukares (dulacz) 96 80.30 93.21 30 31.25
4659. Andy (graydragon12) 96 78.24 102.85 36 37.50
4660. Ethan (zshooter0077) 95 57.02 74.36 18 18.95
4661. Zito (zrelova) 95 113.61 138.39 52 54.74
4662. YSSH (yosshi) 95 79.83 97.27 20 21.05
4663. Samir (wickedl4ndo) 95 63.18 83.99 24 25.26
4664. WinG9G (vving020515) 95 68.87 85.81 16 16.84
4665. 🎈 (typing_badly) 95 133.99 162.56 55 57.89
4666. Dan (typheratrix) 95 78.74 106.76 21 22.11
4667. turbocell48 (turbocell48) 95 119.43 145.23 57 60.00
4668. Toowe (toowe) 95 73.07 96.91 20 21.05
4669. raj (the_karna) 95 60.25 77.72 21 22.11
4670. Oscar (oarr) 95 57.70 73.33 15 15.79
4671. Sriram (sriramrox) 95 56.83 78.78 30 31.58
4672. Shivam (shivy08) 95 68.13 84.06 38 40.00
4673. cowburrs (satlight) 95 82.62 107.18 30 31.58
4674. clackity (phys1cs) 95 63.37 80.85 19 20.00
4675. morty (morty_lh) 95 49.76 66.69 11 11.58
4676. George (mega_type_racer) 95 95.82 114.07 44 46.32
4677. Marsal (marsalsz) 95 77.27 100.24 30 31.58
4678. Marvin (malvolio) 95 83.69 99.39 27 28.42
4679. Alexa (lexalexa100) 95 120.94 141.71 67 70.53
4680. Leon (leon22) 95 96.68 118.06 33 34.74
4681. Samuel (knightsight) 95 118.33 154.88 68 71.58
4682. krisr17 (kk017) 95 81.71 101.16 35 36.84
4683. sam (justlikethat) 95 54.93 69.83 8 8.42
4684. John (johnrupesh) 95 80.78 101.45 25 26.32
4685. Joosh (jewsh) 95 82.40 103.13 28 29.47
4686. Jelly belly (jellybabysexys... 95 67.73 85.59 20 21.05
4687. Zephyr (introstealer) 95 76.01 96.54 25 26.32
4688. husq (husq) 95 106.70 132.36 46 48.42
4689. huddled (haraldgb) 95 89.32 106.25 27 28.42
4690. AHomieNucleus (galaxxyn1) 95 97.01 116.50 36 37.89
4691. Amirzhan (dungeon_beast13) 95 44.70 55.07 13 13.68
4692. darthinfinix (darthinfinix) 95 77.23 106.85 26 27.37
4693. Ashley (darlavsue12) 95 93.33 114.02 28 29.47
4694. cole (cole_makker) 95 40.98 54.30 9 9.47
4695. Pratap (codeiii) 95 60.07 74.80 17 17.89
4696. Capivara (capivaradafarialima) 95 79.19 98.76 27 28.42
4697. Vladislav Ostrovsky (atmsphrx) 95 94.10 121.16 35 36.84
4698. Aniruddh (arl17) 95 48.24 57.24 7 7.37
4699. trakovsik (beyazzenci) 95 69.68 86.49 27 28.42
4700. rexjo7 (rexjo7) 95 72.86 118.05 30 31.58
4701. Tomas (tigfiend) 95 62.30 76.48 12 12.63
4702. Tze Ning (zzzzzningd) 94 80.94 100.84 27 28.72
4703. Joe (zeppyg) 94 90.72 111.10 31 32.98
4704. z0rp (z0rp) 94 103.87 131.46 47 50.00
4705. Vivek (vivek62) 94 62.46 79.70 18 19.15
4706. lilvic (vickty) 94 102.99 125.62 45 47.87
4707. Hassan (urboyhassan) 94 77.75 96.01 19 20.21
4708. Tamás (tamas) 94 98.79 136.90 44 46.81
4709. Me (something_s) 94 110.92 144.29 42 44.68
4710. Jason (serenity47) 94 94.56 113.21 34 36.17
4711. (records) 94 115.97 147.13 50 53.19
4712. Souvik (rascalam) 94 71.14 95.50 22 23.40
4713. pwxown (pwxown123) 94 64.66 79.70 21 22.34
4714. Goodwmyfingers (polterg3ist) 94 108.73 132.01 37 39.36
4715. pituf0 (pituf0) 94 95.36 123.92 34 36.17
4716. aaaaaaaaaaa (mintlyowo) 94 140.93 185.41 71 75.53
4717. Mark (mastopuppets) 94 61.38 84.63 21 22.34
4718. Madiyor (madiyor) 94 72.81 96.09 30 31.91
4719. Christian (loggityloglog) 94 90.68 116.23 29 30.85
4720. Rohan B. (linuxman_linux) 94 139.79 174.64 78 82.98
4721. Lakshay (lakshay882) 94 51.10 65.68 19 20.21
4722. Koolis (koolisz) 94 92.55 110.01 38 40.43
4723. Jeffy (jeffyl) 94 119.71 150.35 57 60.64
4724. Grzegorz (jag1) 94 70.28 87.93 25 26.60
4725. rebecca (ionn) 94 94.59 114.24 33 35.11
4726. imtiaz (imtiaz12) 94 68.98 97.17 28 29.79
4727. jacob (iljain) 94 89.23 112.89 29 30.85
4728. TASHI (erehh19) 94 40.90 56.90 41 43.62
4729. Divyanshu (dev064) 94 30.25 43.24 14 14.89
4730. Casper (casperliuliuliu) 94 53.34 71.76 12 12.77
4731. Jimmy (carb0n13) 94 92.68 116.35 29 30.85
4732. caesar (caesar03) 94 54.57 68.15 12 12.77
4733. Avi (avi222) 94 29.40 42.46 9 9.57
4734. Anvesh (anveshreddy18) 94 74.72 92.00 24 25.53
4735. goku (dragonballsuper) 94 60.77 73.51 18 19.15
4736. kuutti (pela10) 94 72.59 96.73 49 52.13
4737. husky (hungryhusky) 94 54.60 69.87 17 18.09
4738. Will (squilii) 94 63.95 80.82 20 21.28
4739. Zak (zajawe) 93 80.08 97.50 27 29.03
4740. Yessimkhan (yess_0) 93 26.51 38.62 23 24.73
4741. Yash (yash23) 93 76.20 107.73 26 27.96
4742. gusher (wizardlordbob) 93 62.40 77.98 16 17.20
4743. venky (venkywonka) 93 73.15 97.61 20 21.51
4744. Lord (valharius) 93 94.05 112.48 37 39.78
4745. Vincent (v1ncent) 93 147.32 174.95 74 79.57
4746. tito (titoreo) 93 69.48 94.62 22 23.66
4747. memers (thememers) 93 51.39 63.72 12 12.90
4748. sagar (sgr5) 93 46.52 59.06 12 12.90
4749. Teodor (maniacth) 93 57.08 72.10 16 17.20
4750. md abdullah (mamun220) 93 39.66 51.76 9 9.68
4751. Luis (luismec90) 93 62.67 89.49 26 27.96
4752. 017 (k_chun) 93 69.03 87.83 23 24.73
4753. house (jrsp5) 93 91.46 107.59 28 30.11
4754. JoaoPauluu (joaopauluu) 93 104.05 137.39 50 53.76
4755. Miguel (jalb) 93 92.27 112.77 25 26.88
4756. Hxwk (hxwkoncrack) 93 76.04 97.73 20 21.51
4757. Herbie (hjrand1005) 93 96.85 116.52 37 39.78
4758. Felix (felizocker) 93 75.70 99.48 20 21.51
4759. honk (fallguys) 93 70.80 94.61 26 27.96
4760. Declan (deccazz) 93 93.71 112.19 40 43.01
4761. Siddhant (code_talker) 93 112.74 134.56 42 45.16
4762. Filip (churllix) 93 58.80 73.19 10 10.75
4763. Burak (burakkor434) 93 71.17 87.02 19 20.43
4764. Neo (aonixn) 93 80.80 100.94 24 25.81
4765. angry_grandad (angry_grandad) 93 64.84 78.67 20 21.51
4766. Elk (elkx) 93 50.96 68.17 12 12.90
4767. Johnty (boardsupremacy) 93 85.76 120.10 36 38.71
4768. Utkarsh (utkarshsarkar) 93 36.99 44.32 5 5.38
4769. tstats[jimmyneuson] (jimmyn... 93 87.70 103.82 18 19.35
4770. Ray (thickdoink) 93 29.21 68.15 13 13.98
4771. Jike (procrastinatingking) 93 79.73 103.80 47 50.54
4772. i am (anwar24) 93 53.46 68.92 13 13.98
4773. t0oms (t0oms) 93 57.80 71.00 15 16.13
4774. Jonas (zamurai88) 92 67.53 85.70 23 25.00
4775. x1300252 (x1300252) 92 40.92 49.60 9 9.78
4776. vita_melk (vita_melk) 92 73.76 93.93 28 30.43
4777. Josh (unkret) 92 60.11 77.86 23 25.00
4778. Subhajit (tumpasona) 92 51.43 64.83 11 11.96
4779. timas (timastimas) 92 82.39 98.06 30 32.61
4780. Thickspinach (thickspinach) 92 82.79 102.18 25 27.17
4781. Anna (slewa) 92 46.10 57.98 5 5.43
4782. Derry (siribackwards) 92 80.72 100.69 28 30.43
4783. Vinh (shadeomen) 92 97.95 120.17 39 42.39
4784. Rajish (rajish) 92 90.82 108.17 30 32.61
4785. Typer (pjottur) 92 62.19 76.73 17 18.48
4786. The don (photondestroyer) 92 74.52 91.86 18 19.57
4787. Nahla (na_hla) 92 25.77 37.03 19 20.65
4788. Nuno (n4n0x01) 92 78.38 96.25 30 32.61
4789. msm (mousamlimbu) 92 62.91 81.16 34 36.96
4790. Mohchih (mohchih) 92 78.25 107.79 24 26.09
4791. Melissa (mel8402) 92 70.02 94.88 14 15.22
4792. Kevin (kevinparkit) 92 101.82 121.72 35 38.04
4793. Jack (jx34tech) 92 62.69 87.97 18 19.57
4794. Jun Kang (junkang098) 92 95.55 128.22 33 35.87
4795. Josh (josgo888) 92 60.79 78.38 19 20.65
4796. Jonathan (jontheprinter) 92 79.87 100.22 24 26.09
4797. Jason Hean (jackson95) 92 51.67 63.76 7 7.61
4798. Hawky (itshawky) 92 130.54 158.53 62 67.39
4799. Mark (inthe) 92 79.12 97.23 18 19.57
4800. Kevin (ibekevinn) 92 100.44 124.72 51 55.43
4801. HGud (hgudtk) 92 85.77 116.81 23 25.00
4802. Gerry (gl701) 92 112.15 137.96 46 50.00
4803. Farhan (ft10) 92 73.25 88.82 20 21.74
4804. 🥬 (freshkale_workman) 92 74.83 91.91 24 26.09
4805. Emmanuel (emmanuelmoon) 92 57.55 72.89 18 19.57
4806. Dyllan (dyllanbui) 92 92.08 118.40 38 41.30
4807. Breeze (driftbreeze) 92 108.76 126.84 44 47.83
4808. Sam (disasterlooms) 92 110.69 133.50 38 41.30
4809. demberel (demberel94) 92 73.00 89.49 31 33.70
4810. Vishnu (crazy_typeracer) 92 70.67 92.71 24 26.09
4811. choco (chocolateblocks) 92 105.94 146.75 45 48.91
4812. Pumpkin Raj (chillreksai) 92 96.63 115.98 44 47.83
4813. Bekkhan (bkun) 92 84.24 107.57 22 23.91
4814. mani (bigmeat_) 92 104.82 140.49 48 52.17
4815. Begatim Bytyqi (begatim) 92 54.54 67.76 18 19.57
4816. alam (alamjael) 92 78.25 102.63 18 19.57
4817. Agamemnon (agamemnon_) 92 56.76 74.35 9 9.78
4818. Khulugjin (aceno) 92 89.26 115.39 37 40.22
4819. Direwolf (abdelmoezhj) 92 81.59 100.89 20 21.74
4820. Joe (2513134) 92 109.83 131.26 39 42.39
4821. Henry (taipeik9) 92 66.10 85.23 26 28.26
4822. paul (slowsim) 92 28.75 37.82 13 14.13
4823. ░ (_warrior_) 91 103.71 120.83 41 45.05
4824. Sven (zeverit) 91 97.65 118.18 35 38.46
4825. AlphaQ (zbooya) 91 60.25 72.02 16 17.58
4826. Yhannis (yhannis) 91 82.73 101.70 25 27.47
4827. Bartłomiej (y3v4d) 91 104.54 119.31 41 45.05
4828. Kevin (windn6) 91 96.33 123.33 33 36.26
4829. vm (vm_gojiya) 91 60.63 79.07 17 18.68
4830. Aleksandar (usernamegold) 91 99.66 119.74 38 41.76
4831. Martin (typeracist_) 91 82.27 104.54 47 51.65
4832. tsapi (tsapi) 91 102.78 129.25 31 34.07
4833. Alex (tra_pz) 91 86.83 114.38 24 26.37
4834. Harsh (todorokishotoua15) 91 49.60 70.59 71 78.02
4835. The (the_typing_train) 91 90.21 113.02 34 37.36
4836. bronze (thebronzesword) 91 105.21 130.79 52 57.14
4837. Sydney (sydneykimbell) 91 116.52 134.15 47 51.65
4838. Spam (ssspeed) 91 74.52 94.23 29 31.87
4839. Md Saim (saimahmad) 91 68.92 85.36 25 27.47
4840. Rabbi (rhdevil) 91 36.35 49.11 6 6.59
4841. Rex (rexcaliber_115) 91 83.37 111.23 28 30.77
4842. mashrafi (qweer) 91 44.48 58.57 9 9.89
4843. Parvez (parvez31) 91 46.60 57.86 14 15.38
4844. Andy (parkourmaster302) 91 108.85 137.31 57 62.64
4845. Mmm coffee (orchdork7926) 91 103.73 123.15 36 39.56
4846. Tyler (omni_aspect) 91 81.28 124.76 28 30.77
4847. Jannyx (nyxal) 91 88.15 111.97 31 34.07
4848. Mobinul (mobinhmmh1) 91 46.32 53.13 7 7.69
4849. nomad_valhalla (me_manas17) 91 54.76 70.61 18 19.78
4850. MasonColemak (masoncolemak) 91 92.76 114.15 26 28.57
4851. Yurii (kruason) 91 60.08 71.26 19 20.88
4852. Dvorak (kkqu) 91 96.49 114.55 35 38.46
4853. Ken (kenzymazy) 91 82.13 99.39 28 30.77
4854. kripp (hotdoghunter) 91 85.68 120.03 29 31.87
4855. ahmad (h0gan_2020) 91 51.20 74.25 17 18.68
4856. dinker (gumbolaya) 91 145.49 170.49 14 15.38
4857. Slava (gilescope) 91 44.17 53.96 23 25.27
4858. Hnnnnngh (frostequinox) 91 134.89 157.74 66 72.53
4859. Ritardo (ett5252) 91 120.68 152.90 48 52.75
4860. 白貓 (cutewhitecat) 91 52.64 64.64 22 24.18
4861. chom (chom2474) 91 109.06 164.41 51 56.04
4862. Clay (cduck621) 91 78.17 97.06 27 29.67
4863. Areppa (areppa) 91 75.73 92.87 12 13.19
4864. anth (ant_h) 91 71.30 86.76 23 25.27
4865. Krikium (krikium) 91 68.31 77.15 22 24.18
4866. Jack (hammer_jack) 91 52.45 68.20 13 14.29
4867. Dev (dev_1729) 91 71.02 83.21 21 23.08
4868. MAMUN (wmamunhossain) 90 55.95 70.80 15 16.67
4869. wasim (wasim7198) 90 51.84 60.60 8 8.89
4870. Ranger (turbo_99) 90 74.72 88.50 31 34.44
4871. Tuan (tuan_nguyen) 90 115.28 140.83 49 54.44
4872. fischld (tokiwa) 90 88.47 109.82 25 27.78
4873. storm (stooormmm) 90 98.97 124.15 39 43.33
4874. zyuken (spaceee) 90 100.43 143.40 35 38.89
4875. Vienna (sexystan69) 90 68.85 92.40 23 25.56
4876. Sayu_ (sayu_) 90 53.00 63.14 7 7.78
4877. Brandon (retrogamer56) 90 115.72 138.81 54 60.00
4878. poqe8819 (poqe8819) 90 95.18 121.45 21 23.33
4879. Martin (palchone) 90 74.03 92.01 26 28.89
4880. car (nostalgiatest) 90 100.67 130.51 40 44.44
4881. Kono Dio Da (nankan6111) 90 106.75 130.09 39 43.33
4882. Nak (nakulo) 90 67.49 93.41 19 21.11
4883. Moellie (moelong1) 90 66.02 87.05 20 22.22
4884. maoam (maoamwins) 90 92.04 112.59 32 35.56
4885. Lack (lackhammer) 90 98.31 118.20 34 37.78
4886. Ksizzzzz (ksiz) 90 85.63 107.03 32 35.56
4887. Norik (kingjulian1) 90 60.66 74.38 14 15.56
4888. kj (kellydebow) 90 63.59 87.37 19 21.11
4889. Johnofan (johnofan) 90 91.57 123.15 24 26.67
4890. JBrocksfellas (jbrocksfellas) 90 56.92 70.32 30 33.33
4891. immikeylee (immikeylee) 90 108.76 126.99 49 54.44
4892. hejukaza (hejukaza) 90 58.76 95.38 22 24.44
4893. gloria (glorialostthegame) 90 101.62 126.49 32 35.56
4894. G L O O M Y (gloomy24) 90 46.02 57.15 6 6.67
4895. mingi (gatangae) 90 78.89 95.67 26 28.89
4896. DataCrusader (faruzzy) 90 64.55 74.22 28 31.11
4897. Omega (enmendurana) 90 50.55 65.74 6 6.67
4898. Shane (enahs_py) 90 97.97 119.82 39 43.33
4899. Emmy (emilyelaine) 90 93.02 112.10 31 34.44
4900. oreo (e00d) 90 105.49 135.41 47 52.22
4901. Kebab (durum_kebab) 90 91.33 116.51 33 36.67
4902. Daniel (danielsabox) 90 89.92 111.64 32 35.56
4903. dumbdwei (cringe69) 90 73.99 93.49 17 18.89
4904. Evan (crcd) 90 76.80 92.91 20 22.22
4905. . (cope_and_seethe) 90 115.19 147.17 49 54.44
4906. Venus (ching_ching) 90 69.80 86.26 29 32.22
4907. Celiakos (celiakos) 90 48.93 57.91 8 8.89
4908. Josh (belewcookies) 90 66.36 82.95 22 24.44
4909. Naimul (bangladeshi) 90 31.28 44.23 6 6.67
4910. Hi (aspenink) 90 110.87 142.96 58 64.44
4911. Alejandro (akakmx) 90 78.33 98.39 23 25.56
4912. A (ag2718) 90 113.61 145.09 40 44.44
4913. Adrian (aeroplaneking) 90 98.32 120.70 32 35.56
4914. rieicmio (aerialstunt) 90 84.17 102.22 29 32.22
4915. Deus_Machina (acut3_racy) 90 102.11 134.06 34 37.78
4916. abi19911 (abi19911) 90 63.44 87.02 15 16.67
4917. Nguyen (nguyenpa3963) 90 38.11 51.81 3 3.33
4918. lizzie-beth (lizzie_beth) 90 69.66 87.82 40 44.44
4919. Sunil Nishad (senpaaiii) 90 32.97 44.05 6 6.67
4920. Danylo Dolhopolov (danylos) 90 21.13 31.51 21 23.33
4921. rpx (caspertrxsh) 90 57.39 73.07 12 13.33
4922. WELLINGTON (luissluis202) 90 90.71 119.84 30 33.33
4923. Yelxuh (yelxuh) 89 121.86 162.95 51 57.30
4924. Steve (stevestupidface) 89 104.73 124.59 44 49.44
4925. Stefan (stefanknez03) 89 36.67 51.52 6 6.74
4926. q (scullyy) 89 81.03 108.18 51 57.30
4927. SalahDin (salastro) 89 69.88 86.63 21 23.60
4928. Safi (safeehalim) 89 70.42 89.21 27 30.34
4929. tofu (reversytofu) 89 119.04 150.16 54 60.67
4930. Pendejo (pendejo13) 89 53.87 64.62 7 7.87
4931. Kevin (pekkanator1) 89 100.91 124.15 39 43.82
4932. Paul (pasham999) 89 62.12 72.83 20 22.47
4933. apostolos (orou) 89 39.31 55.93 12 13.48
4934. tstats[orbitaltowel] (orbit... 89 93.15 126.41 38 42.70
4935. Mirtininkas (mirtininkas) 89 63.66 90.64 18 20.22
4936. Leo (me10250) 89 60.04 89.03 19 21.35
4937. Angeline (mangosteen18) 89 59.33 75.46 11 12.36
4938. lone (lone17) 89 59.62 86.34 21 23.60
4939. lolitsgow (lolitsgow) 89 86.23 100.23 26 29.21
4940. Tom (krarc) 89 84.31 110.46 20 22.47
4941. iwillcomboyou (iwillcomboyou) 89 49.59 67.62 6 6.74
4942. Hamza (hamza_type) 89 58.14 74.37 16 17.98
4943. Chef Giuliano (gd27) 89 90.56 113.32 19 21.35
4944. FiB0 (fiboss) 89 95.15 119.63 68 76.40
4945. Affan (fantzy) 89 38.10 55.67 5 5.62
4946. Daedalus (dufficinetic) 89 70.68 87.90 17 19.10
4947. Tim (dreamaz) 89 83.46 99.54 26 29.21
4948. Draco (draco_the_toad) 89 67.75 92.70 29 32.58
4949. Dhruv (dhruv8601) 89 61.91 84.57 12 13.48
4950. Jason (d4tb0i) 89 77.26 93.93 17 19.10
4951. Chagil (chagil) 89 116.39 152.38 41 46.07
4952. mahdi (carpenterbrother) 89 68.63 83.12 20 22.47
4953. billypeppin (billypeppin) 89 112.48 139.43 36 40.45
4954. Long (bachthime) 89 70.89 92.99 19 21.35
4955. Nick (adyingwalrus) 89 118.64 141.06 38 42.70
4956. 6226 (6226) 89 88.07 104.02 26 29.21
4957. KGHZY (kghzy) 89 44.93 65.97 7 7.87
4958. marmar (marmarmarmar) 89 93.87 121.94 31 34.83
4959. bigdoongg (bighotdogg) 89 56.52 74.28 17 19.10
4960. Kristel (speedygonzales1997) 89 45.94 58.02 6 6.74
4961. Michał (michalll) 89 74.63 90.28 20 22.47
4962. Gabe (yokingszn) 88 72.36 87.43 30 34.09
4963. Tarun (tpunhani) 88 70.95 94.01 23 26.14
4964. Spritly (spritly) 88 87.65 106.65 30 34.09
4965. Tamir (recoon44) 88 49.55 67.66 8 9.09
4966. Prabh (prabh1601) 88 85.27 103.95 31 35.23
4967. Pach (pachslayer) 88 112.18 137.70 39 44.32
4968. Neo (neosteps) 88 67.25 90.16 26 29.55
4969. Jonathan (mrschubidu) 88 65.13 87.20 24 27.27
4970. Marc (maarcabiaad) 88 94.25 126.47 22 25.00
4971. Krish (krish7) 88 50.93 64.61 6 6.82
4972. Shakil Kabir (kopbdshakil) 88 66.07 81.52 23 26.14
4973. heavy (heavyshaker) 88 52.61 64.34 17 19.32
4974. Will (ghostal) 88 100.01 125.83 40 45.45
4975. fixing my (fixing_bad_habits) 88 106.98 124.44 37 42.05
4976. JK (ettanin) 88 60.96 73.11 11 12.50
4977. Erza (erza_loves_coffee) 88 59.85 73.42 9 10.23
4978. sdf (delta23) 88 105.14 132.70 42 47.73
4979. 🐸bingus🐸 (dearmr) 88 114.93 136.42 49 55.68
4980. Cat (catcatcatcatcatcatcatcat) 88 107.48 129.09 61 69.32
4981. Cammy (cammy04) 88 70.85 82.82 15 17.05
4982. Pranay (ant1sipater) 88 70.13 87.97 21 23.86
4983. Daniel (altold) 88 91.92 107.52 29 32.95
4984. Alex (alexey0) 88 67.50 81.50 25 28.41
4985. Abdullatif (ak_type_master) 88 62.87 73.73 10 11.36
4986. Adepttyper123 (adepttyper123) 88 92.13 118.09 37 42.05
4987. kumar (kumar_adity_a) 88 54.22 65.22 11 12.50
4988. asfastasurrelation (darryl11) 88 55.37 76.62 6 6.82
4989. Tyler (tylerbeep) 88 39.88 53.86 7 7.95
4990. LAVISH (lavvish) 88 44.75 63.20 18 20.45
4991. Igor (zig84) 87 78.92 97.26 25 28.74
4992. random (waltersgo) 87 95.43 113.19 32 36.78
4993. Tastic (t_tastic) 87 71.30 99.59 49 56.32
4994. tomthegamer150 (tomthegamer) 87 78.26 101.82 23 26.44
4995. Marc (thehobbit6937) 87 69.15 90.73 25 28.74
4996. Jole (sliceoflife) 87 87.74 103.19 33 37.93
4997. s2 (simon_f1) 87 92.21 107.33 28 32.18
4998. Matthew (rush_a) 87 84.77 109.02 25 28.74
4999. Romi (romi14) 87 96.95 127.84 26 29.89
5000. Risheet (risheet_7) 87 64.30 81.23 25 28.74
5001. Prex (prex) 87 54.27 72.12 26 29.89
5002. Sean (polosauris) 87 79.93 102.48 22 25.29
5003. S M (plaban13) 87 42.56 54.11 7 8.05
5004. otomen (nurul_liayana) 87 82.20 104.63 29 33.33
5005. fastkid (notfastkid) 87 89.99 118.38 28 32.18
5006. Nonstoplink (nonstoplink2) 87 94.30 136.60 42 48.28
5007. omar (nightkappa73) 87 71.01 91.41 17 19.54
5008. Nigel Yul (nigelyul) 87 110.38 131.05 49 56.32
5009. Tony (naka__) 87 100.23 129.84 32 36.78
5010. NadAlaba (nadalaba) 87 54.91 79.56 16 18.39
5011. Kumar Charan (mr_kc) 87 48.71 62.51 5 5.75
5012. MH (mh_parag) 87 70.73 88.82 22 25.29
5013. Malcolm (malcolm_) 87 89.17 109.54 38 43.68
5014. Rin (komorebi2) 87 136.26 191.51 48 55.17
5015. Kirubel (kirubelt) 87 58.21 71.02 14 16.09
5016. josca (josca) 87 75.23 92.86 32 36.78
5017. sngr0x0 (jim_my) 87 57.29 73.85 18 20.69
5018. Snail's Pace (hardtack) 87 86.71 108.35 32 36.78
5019. Hoang (feelsdankman_1) 87 83.25 105.65 13 14.94
5020. Eric (erichamers) 87 85.90 106.76 34 39.08
5021. GOTTAGOFAST (b_200910028) 87 59.59 77.09 18 20.69
5022. Patrick (burntriceboi) 87 49.38 76.15 15 17.24
5023. Batbold (burabatbolf) 87 65.77 85.29 26 29.89
5024. Jordan (brownbox) 87 70.75 84.85 29 33.33
5025. Andrej (andy144) 87 72.71 86.08 19 21.84
5026. Ali (amizan8653) 87 84.54 104.56 27 31.03
5027. Abode (abulrahman_kallas) 87 24.67 37.29 19 21.84
5028. faxer (faxer123) 87 33.74 46.96 11 12.64
5029. Tamer (tls_15) 87 56.32 75.29 11 12.64
5030. Jau (maievvvv) 87 62.44 86.72 76 87.36
5031. ikkumaru (ikkumaru) 87 43.18 53.66 7 8.05
5032. David (dragon25321) 87 77.58 96.52 21 24.14
5033. Joaquin (zevolish) 86 106.27 129.98 45 52.33
5034. yeet (yeetanut) 86 114.52 159.17 37 43.02
5035. lokesh (vidhvanshak) 86 56.64 67.64 16 18.60
5036. uzu (uzuiiske) 86 106.77 135.37 47 54.65
5037. Qing En (twea) 86 53.02 69.37 14 16.28
5038. bobby (trowlazer) 86 130.14 149.72 63 73.26
5039. Bruno (tresco) 86 105.21 143.04 33 38.37
5040. treespirit (treespirit) 86 89.97 111.03 25 29.07
5041. Mony The G (skull_slayer) 86 122.45 161.09 52 60.47
5042. Shamseer (shamsu) 86 45.89 62.67 11 12.79
5043. SB (sbjeans) 86 66.09 78.51 24 27.91
5044. Rain (rain_19) 86 68.27 87.65 32 37.21
5045. Jim (pokemontcg2) 86 124.68 152.34 51 59.30
5046. Palish (palish) 86 70.78 87.40 22 25.58
5047. I know ur trying ur best (o... 86 119.00 160.43 49 56.98
5048. TooTired (oturan11) 86 94.18 130.42 24 27.91
5049. Nelson (nelson_typer) 86 51.21 62.08 6 6.98
5050. August (myracule) 86 54.96 68.28 8 9.30
5051. Mohaka (mohaka) 86 55.91 72.49 8 9.30
5052. Junior (mkunaji) 86 60.73 73.93 23 26.74
5053. maxwelljones14 (maxwelljones) 86 99.35 122.31 32 37.21
5054. Ted (lucky_strike) 86 91.05 111.58 22 25.58
5055. Krystall (krystaller) 86 43.30 55.06 6 6.98
5056. Eugene (kpopgay) 86 79.70 104.00 20 23.26
5057. Kevin (kevin_zhang) 86 79.61 99.68 21 24.42
5058. Jayden (jripic137) 86 105.38 123.23 57 66.28
5059. Ashish (grimjaw7) 86 68.13 79.06 14 16.28
5060. Hehe (gagokarin) 86 114.55 158.63 46 53.49
5061. Dvorak on (freddysg) 86 74.72 99.52 85 98.84
5062. Fishy_Types (fishy_types) 86 96.56 126.46 33 38.37
5063. Eli (e_lightning) 86 64.94 81.41 20 23.26
5064. Dong (dongggg) 86 86.54 108.41 29 33.72
5065. dalia (daliafraga) 86 78.09 92.72 21 24.42
5066. Jalen (dabesttypr) 86 90.82 111.40 25 29.07
5067. caleb (caleb123456) 86 125.48 151.84 48 55.81
5068. Adrian (bobsgotepicskills) 86 72.53 90.96 17 19.77
5069. GreatWhiteShark (black_b6969) 86 92.07 114.02 25 29.07
5070. তৌসিফুল ফ... 86 83.40 99.30 25 29.07
5071. Ayy (ayush_parihar) 86 60.27 76.90 12 13.95
5072. Asaan (asaan) 86 48.31 63.74 5 5.81
5073. Anunnaki (anunnaki77) 86 52.17 65.05 17 19.77
5074. Tursunali (ali_khan) 86 60.85 86.76 18 20.93
5075. ahnfnsr (ahnfnsr) 86 78.51 96.99 17 19.77
5076. Green Tea (2001186) 86 99.93 131.76 24 27.91
5077. Peter (cruzp_63_mobile) 86 37.15 52.46 2 2.33
5078. mdawg101 (mdawg10101) 86 65.07 84.29 18 20.93
5079. Layth (a_layth_z) 86 34.88 48.78 6 6.98
5080. hoji (hoging) 86 44.97 53.20 11 12.79
5081. abc (abcijkkkk) 86 47.40 63.56 18 20.93
5082. Nate (n8thenb) 86 66.89 84.90 16 18.60
5083. Chris (___chris) 85 85.05 106.74 24 28.24
5084. zyrch (zyrch) 85 71.30 89.12 26 30.59
5085. Jesse (yojesse__) 85 70.82 101.01 19 22.35
5086. wlof (wlof) 85 64.68 77.55 19 22.35
5087. Luca (tracked) 85 67.08 89.32 16 18.82
5088. TehTrooper (tehtrooper) 85 68.76 83.76 18 21.18
5089. fast_as_f*ck (techniqueee1337) 85 28.99 39.45 8 9.41
5090. Syrup (syrupsandwich) 85 118.48 155.73 41 48.24
5091. Sven (sven0101) 85 57.39 72.30 16 18.82
5092. superkhau (superkhau) 85 104.49 142.57 34 40.00
5093. StevesterH (stevesterh) 85 94.83 117.24 24 28.24
5094. Jake (starbless) 85 98.30 123.66 33 38.82
5095. Saurav (srvsaha) 85 63.65 86.02 20 23.53
5096. Akash (speedy_acj) 85 86.93 104.73 32 37.65
5097. Sicoz (skyarc12) 85 98.32 120.03 30 35.29
5098. HngryChef (siam33162) 85 53.97 73.49 9 10.59
5099. Jacob (shrimploin) 85 126.54 159.24 46 54.12
5100. b (savagesapien) 85 72.91 94.56 18 21.18
5101. Sean (qpalzm123) 85 90.12 112.82 24 28.24
5102. Harvey (precisiongoat) 85 66.75 78.73 16 18.82
5103. Matthew (noobdestroyer69) 85 98.49 120.57 48 56.47
5104. raven (mr_raven) 85 70.70 87.57 28 32.94
5105. Miky (mikymoose) 85 52.66 61.80 9 10.59
5106. Mason (mgbaird) 85 53.46 72.25 11 12.94
5107. Gobind (meri_marzi) 85 73.38 112.74 14 16.47
5108. ZanderL (mcmickeylyc) 85 79.66 95.90 27 31.76
5109. Mars (mars212163) 85 89.54 110.42 29 34.12
5110. Moritz (mango_1212) 85 49.37 66.17 13 15.29
5111. Kusahgra (kushagra813) 85 79.93 94.23 23 27.06
5112. king (kingkuzo) 85 91.01 111.53 30 35.29
5113. ---| (karthivi95) 85 80.04 97.90 22 25.88
5114. Jeremy (jerbear27) 85 83.03 102.97 31 36.47
5115. Bart (itwashishat) 85 49.91 73.32 11 12.94
5116. IMcRoni (imcroni) 85 91.47 123.37 26 30.59
5117. iglo31 (iglo31) 85 74.18 95.01 20 23.53
5118. iAmKaviar (iamkaviar) 85 58.74 76.60 15 17.65
5119. Gabriel (hong_kong_) 85 73.99 93.90 27 31.76
5120. (g_fruit) 85 133.21 157.55 60 70.59
5121. Artur (ester_versuch) 85 57.49 67.43 11 12.94
5122. rawrrr (darrrrrrr) 85 97.74 114.77 33 38.82
5123. conquodS (cobraa) 85 99.51 123.47 39 45.88
5124. Person (ali_666_) 85 98.30 118.07 36 42.35
5125. A (akane49) 85 62.21 76.63 22 25.88
5126. B00P (aaron_sy1) 85 91.65 112.73 30 35.29
5127. Ayman (7times) 85 67.60 93.12 24 28.24
5128. Rui (raiyik) 85 69.36 83.16 23 27.06
5129. Silat (1guts_is_berserk) 85 37.41 49.07 14 16.47
5130. Yem (yemm) 85 53.76 65.97 19 22.35
5131. Jilly (thors_right_nut) 85 75.77 89.07 17 20.00
5132. Gene (dorites) 85 65.65 81.77 21 24.71
5133. Zubair Ali (zubairali) 84 58.79 76.34 11 13.10
5134. Carlton (wizardhero) 84 82.17 96.74 18 21.43
5135. VoiceOfTheWorld (voiceofthe... 84 62.64 77.93 17 20.24
5136. ​​yosefxlr8 (vaniix_) 84 89.01 111.07 22 26.19
5137. Anu (typeradha) 84 109.36 128.27 36 42.86
5138. tourist (tourist18) 84 71.21 80.80 22 26.19
5139. sussyplayer (sussyplayer696... 84 66.95 81.79 13 15.48
5140. Shokhrukh (shokhrukh18) 84 65.59 76.66 32 38.10
5141. Saugat (saugat_regmi) 84 53.57 66.73 7 8.33
5142. Ed (recht) 84 93.34 110.33 40 47.62
5143. Nice (pranavkum123) 84 111.22 136.61 35 41.67
5144. Nasser (nass_1000) 84 53.32 67.50 5 5.95
5145. MoonSpoon (moonspoon1337) 84 47.90 63.15 5 5.95
5146. Mohammad (mohammadmc) 84 70.70 91.08 20 23.81
5147. McBurger (mcburger) 84 67.62 88.62 15 17.86
5148. joey (legend_joey) 84 48.51 65.32 14 16.67
5149. Kitty (kxkixi) 84 116.91 135.95 46 54.76
5150. Paul Kenneth (kennetoy2302) 84 58.67 78.21 20 23.81
5151. Jump (jump420) 84 54.27 71.43 13 15.48
5152. JEWels (juewls) 84 58.63 76.87 16 19.05
5153. Jon (jonlivestrong) 84 83.47 106.21 32 38.10
5154. Jay (jayser6) 84 90.68 116.99 30 35.71
5155. Jason (jachian) 84 107.79 133.84 51 60.71
5156. Harshit (harshu19) 84 51.51 62.38 6 7.14
5157. Ahmed (goushaa) 84 56.74 73.59 11 13.10
5158. SilentHill (gosha666) 84 98.21 117.87 33 39.29
5159. Vikram (galvarino_) 84 49.52 58.85 5 5.95
5160. ant (fourmi) 84 40.01 47.87 3 3.57
5161. MoralCharity (ethicalgivings) 84 115.54 158.96 47 55.95
5162. Jesper (dwingx) 84 104.79 136.37 28 33.33
5163. Chetan (chetankawarkhe) 84 58.80 81.44 16 19.05
5164. carlos (carlit0) 84 96.81 121.90 25 29.76
5165. Jimbo (bugprostate) 84 81.53 101.40 26 30.95
5166. deez (biggy2) 84 104.66 121.02 30 35.71
5167. AYJayeh (ayjayeh) 84 59.91 73.78 20 23.81
5168. Arijit (arijitgupta42) 84 71.91 91.82 28 33.33
5169. Anirudh (anirudh06) 84 74.52 88.13 37 44.05
5170. dj_sevdah (dj_sevdah) 84 63.54 83.45 27 32.14
5171. fnkl (fnkl) 84 77.43 105.66 23 27.38
5172. shinygia (shinygia) 84 65.00 82.21 20 23.81
5173. Shiba (pianolover123) 84 107.44 140.61 50 59.52
5174. Elias (mojolake) 84 72.34 100.28 22 26.19
5175. nick (ismenick) 84 62.84 81.60 16 19.05
5176. tdawg (tdawg11) 84 70.99 102.63 29 34.52
5177. Kid (zenfire9001) 83 85.23 107.71 20 24.10
5178. Toko (xisderr) 83 55.58 75.68 10 12.05
5179. Pp (typerace2002) 83 57.65 70.89 14 16.87
5180. Baby Shark (toinfinity1) 83 97.67 120.18 32 38.55
5181. doctor (timelordvader) 83 48.19 60.36 7 8.43
5182. Storm (st0rm7) 83 50.31 62.57 8 9.64
5183. spider (spidergod) 83 51.09 68.94 10 12.05
5184. . (speedyant) 83 113.17 141.69 37 44.58
5185. Amo (santan_amzy) 83 89.07 101.49 26 31.33
5186. Elliott (s1ldafort) 83 75.83 95.84 23 27.71
5187. Rudolf (rutzzz) 83 94.32 119.98 33 39.76
5188. rideler (rideler) 83 66.28 79.87 19 22.89
5189. darren (raisinnbrann) 83 66.53 91.99 17 20.48
5190. Zach (qwerty1221) 83 90.55 110.30 21 25.30
5191. Jim (problemset) 83 85.40 106.37 27 32.53
5192. JJ (peppermints) 83 78.76 90.57 16 19.28
5193. Zachary (peanutbutter146) 83 69.44 84.54 21 25.30
5194. Omunyokol (omunyokol) 83 64.44 84.09 14 16.87
5195. Obatop (obatop) 83 92.49 122.31 26 31.33
5196. noah (noahruether) 83 57.09 77.52 16 19.28
5197. Noah (noah187) 83 88.97 102.61 27 32.53
5198. Ali (medtype) 83 134.87 164.68 55 66.27
5199. help (mango_mango_mango) 83 103.73 124.72 44 53.01
5200. Sky (lanprodn41) 83 91.87 110.35 28 33.73
5201. Kunal (kunaldutta) 83 40.67 55.60 10 12.05
5202. Kitchen (kitchen_operator) 83 72.38 88.51 17 20.48
5203. MAYANK (kartosbrotherinlaw) 83 57.92 71.85 14 16.87
5204. Harrison (harryblueberry) 83 118.40 158.91 51 61.45
5205. Andrews (godspeeedd) 83 70.24 96.82 20 24.10
5206. Erick (ep1ore) 83 65.59 80.51 20 24.10
5207. Emeer (emeer_macapili) 83 60.35 74.60 16 19.28
5208. Dan (dnor1313) 83 93.03 120.85 31 37.35
5209. D (darueru241) 83 54.85 66.05 13 15.66
5210. Daivat (daivatvaishnani) 83 75.39 89.09 19 22.89
5211. Donked (cyrany) 83 85.67 105.71 26 31.33
5212. chesco (chesco97) 83 73.66 91.37 27 32.53
5213. simon (chainsawteeth) 83 70.91 83.14 21 25.30
5214. Carmondai (carmondai) 83 44.78 53.04 5 6.02
5215. Sherlock (caramel1995) 83 118.25 143.37 45 54.22
5216. buhaN (buhan1337) 83 80.64 95.53 28 33.73
5217. Blade0307 (blade0307) 83 65.21 78.14 14 16.87
5218. ya BOI (beasted6969) 83 110.71 139.32 32 38.55
5219. Bartek (batek_kierownik) 83 105.79 143.15 47 56.63
5220. kes (barubelajarhehe) 83 64.63 77.86 18 21.69
5221. Alex (alexwpm) 83 62.26 81.84 15 18.07
5222. Felix (sp4cebar) 83 70.42 88.30 19 22.89
5223. Bryce (pennydog13) 83 56.09 70.47 12 14.46
5224. Abraiz (abraiz) 83 57.03 68.65 11 13.25
5225. Alpamys (a1pamys) 83 74.26 96.77 16 19.28
5226. GZ (dysonspheres) 83 97.49 112.87 22 26.51
5227. Space (spacecarrot) 83 79.07 95.63 21 25.30
5228. Lauris (toxic_bowl) 82 72.93 85.55 23 28.05
5229. Ron (rounakc18) 82 101.90 117.16 24 29.27
5230. rita (rita_mahato) 82 46.65 62.06 7 8.54
5231. Ravel (raveltan) 82 62.95 73.82 20 24.39
5232. Mayank (person_mayank) 82 77.20 94.78 19 23.17
5233. Nazarii (nazarii_z) 82 72.05 91.99 18 21.95
5234. Mike Adrian (mikeadrian) 82 74.33 86.09 15 18.29
5235. . (lv23) 82 82.01 106.78 20 24.39
5236. Lucas (lucasbush3) 82 74.36 94.67 34 41.46
5237. L (lpuczynski) 82 71.52 88.48 21 25.61
5238. Romit (junior12345) 82 60.62 77.28 19 23.17
5239. qwerty (jowk) 82 84.03 107.27 22 26.83
5240. FT_Zeref (iamzeref) 82 29.49 40.59 15 18.29
5241. Gaurav (gaurav2607) 82 48.88 63.59 12 14.63
5242. Majdi (freuud) 82 84.10 97.35 27 32.93
5243. Aldir (faway) 82 83.26 100.62 19 23.17
5244. M (faster_than_your_father_... 82 54.75 65.14 13 15.85
5245. Ezz Abuzaid (ezzabuzaid) 82 59.83 72.53 20 24.39
5246. Michael (dodus) 82 90.48 106.40 17 20.73
5247. Dipesh (dipeshm77) 82 76.78 91.55 18 21.95
5248. Aranyo (chimichenghiskhan) 82 96.35 114.45 36 43.90
5249. chekic (chekic) 82 88.79 114.60 27 32.93
5250. Ivan (bbqhehe) 82 129.14 152.00 50 60.98
5251. Amit (a_myth) 82 66.50 75.29 15 18.29
5252. Wake (awriter) 82 72.19 98.43 20 24.39
5253. Asis (asis1998) 82 47.80 66.18 11 13.41
5254. ari (aryanonye) 82 67.98 75.77 19 23.17
5255. oscar (ansgar92314) 82 88.32 106.83 27 32.93
5256. Abhishek (abhishekxix) 82 66.58 86.62 21 25.61
5257. Abdelrahman (abdo_mano) 82 42.00 52.63 3 3.66
5258. Govind (404fixer) 82 56.51 69.93 11 13.41
5259. Leo (powerleo101) 82 81.09 114.75 25 30.49
5260. self (fzires) 82 99.82 123.29 32 39.02
5261. Blake (topo666) 82 64.72 91.85 19 23.17
5262. Vedaant (vedu_baba) 82 57.78 73.12 4 4.88
5263. Bbblaire (bbbblaire) 82 78.12 93.43 23 28.05
5264. zach (zacc2285) 81 103.18 124.04 35 43.21
5265. (vizzzard) 81 68.28 88.22 21 25.93
5266. v (vinay747) 81 48.54 64.34 9 11.11
5267. Ben@ (uniconsole) 81 56.12 74.39 11 13.58
5268. Typer4e (unbreakse) 81 90.71 106.26 21 25.93
5269. vulture (typinguntilcompute... 81 111.52 133.09 45 55.56
5270. Jimothy (typeman_69_420) 81 43.87 64.60 3 3.70
5271. user_012 (tsitohaina) 81 46.73 57.43 19 23.46
5272. Tmr (tmr_sa) 81 35.61 45.90 6 7.41
5273. Jaxon Tatton (superjax101st) 81 50.66 74.88 47 58.02
5274. snipa146 (streamsniper146) 81 36.85 50.15 5 6.17
5275. Cathy (strawberrylatte) 81 78.94 101.11 15 18.52
5276. Sourav (sourav008) 81 48.30 58.60 8 9.88
5277. Nick (soltymong) 81 65.33 87.18 21 25.93
5278. sky (skymario) 81 71.85 98.21 15 18.52
5279. Shreyas (shreyastalathi) 81 72.01 88.25 14 17.28
5280. Skipper (samskipper) 81 29.27 39.07 17 20.99
5281. RAJIV RANJAN (rajiv_ranjan_1) 81 42.30 59.29 6 7.41
5282. Blake (raccoonswoon) 81 75.95 96.01 22 27.16
5283. Raaed (raaed_23) 81 96.05 127.39 33 40.74
5284. Jan (q1xter) 81 69.98 84.94 16 19.75
5285. Presiyan (presiyan15) 81 65.53 81.78 13 16.05
5286. Ovidiu (ovidiu0720) 81 61.25 72.17 15 18.52
5287. Omar (omarr84) 81 64.67 77.21 15 18.52
5288. Omer (om3rrr) 81 101.52 128.03 32 39.51
5289. Odo (odo_bean) 81 64.20 80.14 21 25.93
5290. Thao (ncthao) 81 75.00 98.37 31 38.27
5291. mubara (mubara) 81 37.09 49.18 8 9.88
5292. The (mrperfectionista) 81 49.66 59.15 8 9.88
5293. Lakshya (lakshyasharma) 81 69.76 88.47 21 25.93
5294. Tommy (kamuimaru) 81 113.75 145.12 41 50.62
5295. kajuna (kajuna) 81 90.41 123.14 30 37.04
5296. Joshua (justdatotherguy) 81 73.39 90.18 23 28.40
5297. No (jopear) 81 75.39 89.26 17 20.99
5298. Joey (joeyp123) 81 76.43 93.49 14 17.28
5299. Jason (jbb817) 81 128.39 154.54 54 66.67
5300. Baxtiyor (iotype) 81 90.35 104.71 32 39.51
5301. holsoma (holsoma) 81 82.91 97.42 26 32.10
5302. hamada (hamada377) 81 22.44 34.08 14 17.28
5303. akhil (hailk11) 81 77.55 95.64 21 25.93
5304. Håvard (haavga) 81 64.98 83.48 13 16.05
5305. ghxstly-_-kid (ghxstlykid) 81 54.57 69.56 6 7.41
5306. Declan (doctordirl) 81 99.71 116.91 27 33.33
5307. Dew2118 (dew_2118) 81 68.03 79.07 15 18.52
5308. David (davidstakic) 81 58.36 77.56 13 16.05
5309. Danzcotic (danzcotic) 81 85.55 106.54 20 24.69
5310. Ranit (colemakgang) 81 99.95 132.39 32 39.51
5311. Brzzz (brzzz) 81 77.49 94.81 19 23.46
5312. Missile Input (breadlump) 81 83.67 104.08 21 25.93
5313. tstats[ayhamgh] (ayhamgh) 81 59.30 74.04 19 23.46
5314. Salamander (20_minutes_per_... 81 90.50 108.41 47 58.02
5315. mcg (_mcg) 81 74.10 87.57 19 23.46
5316. Bingo Bongo (bingo_bongo_) 81 79.07 97.60 25 30.86
5317. seb (xsebzero) 81 76.74 98.73 23 28.40
5318. Bastien_race28 (bastien_rac... 81 72.88 88.50 20 24.69
5319. Pavel (pavelmirror) 81 37.90 44.35 5 6.17
5320. jyjy (jyking99) 81 75.44 101.46 19 23.46
5321. Kayden (kaydengiang2512) 81 72.09 92.44 62 76.54
5322. The Green (hemanth37) 81 51.70 67.97 9 11.11
5323. Zoltatorrez (zoltatorrez) 80 72.41 88.50 15 18.75
5324. Brandon (zombieapocalypse) 80 67.83 82.53 20 25.00
5325. Zachary (zacharide) 80 61.61 83.03 21 26.25
5326. Viet (viettp) 80 50.16 64.18 6 7.50
5327. Marcel (thiccer_marc) 80 106.42 137.36 42 52.50
5328. Logan (thewhiteowl69) 80 80.22 105.64 21 26.25
5329. Alex (snowbdd9f1) 80 80.55 97.30 26 32.50
5330. Slowman (slowman101) 80 96.67 111.04 30 37.50
5331. sharavsambuu (sharavsambuu) 80 70.95 86.67 22 27.50
5332. Shane (shane_woosh) 80 100.95 123.02 38 47.50
5333. shahan (shahanj) 80 66.66 95.57 25 31.25
5334. Schpuunk (schpuunk) 80 68.84 86.62 25 31.25
5335. Reimar (reimarpb) 80 97.15 115.44 40 50.00
5336. pprav (potato69420) 80 95.74 120.51 23 28.75
5337. Quinn (peea) 80 86.55 107.10 23 28.75
5338. MsPianomama (mspianomama) 80 93.70 121.18 28 35.00
5339. Fadil (mr_fadil48) 80 59.26 79.27 15 18.75
5340. Harry (moto1310) 80 53.72 77.87 22 27.50
5341. Bakhodir (marko_w) 80 59.73 77.02 26 32.50
5342. pen (lock3r) 80 97.15 125.46 25 31.25
5343. TRLT - YouTube (krux_254) 80 51.02 64.22 16 20.00
5344. Kenzen (kenzen18) 80 70.72 87.53 23 28.75
5345. kamal (kemokingdod) 80 22.02 33.09 15 18.75
5346. KMN (kanatbekov_24) 80 54.03 65.83 6 7.50
5347. JoePuttatoe (joeputtatoe626_) 80 63.06 86.93 20 25.00
5348. Dat (jgatz) 80 91.74 107.81 29 36.25
5349. Benjamin (izno) 80 58.12 84.79 19 23.75
5350. tstats[ioannisvrynios] (ioa... 80 110.75 148.15 36 45.00
5351. Hi (hime_) 80 74.07 89.29 19 23.75
5352. Harry (harpreetsingh005) 80 74.70 97.01 16 20.00
5353. Agnes-Joker (guitarbed) 80 104.77 130.99 44 55.00
5354. Gio (gio_etche) 80 96.46 125.10 27 33.75
5355. Nicolas (fruscianterules) 80 81.71 112.68 27 33.75
5356. Fernando (ferthekiller6_) 80 82.20 107.16 27 33.75
5357. fantdm4@gmail.com (evolnizark) 80 60.24 80.99 25 31.25
5358. Helena (evanalfred0817) 80 86.40 111.77 42 52.50
5359. Eli (elithesped) 80 127.72 167.40 54 67.50
5360. m_j (dontlistentome) 80 87.12 115.94 25 31.25
5361. David (davidjohnston20) 80 107.15 134.68 32 40.00
5362. Don Quixote (crunchjunkie) 80 49.55 62.57 12 15.00
5363. EJ (clarencedc) 80 83.89 114.34 30 37.50
5364. Chetan (chetanhaobijam) 80 77.46 101.48 14 17.50
5365. Bingsong (bingsongbingsong) 80 64.45 79.07 11 13.75
5366. Stepan (a_s_v) 80 82.08 94.77 25 31.25
5367. ambi (ambiidextrous) 80 92.79 120.58 38 47.50
5368. k (ahhhjk) 80 81.85 107.21 22 27.50
5369. AbdElazeem (abd_alazeem) 80 39.81 52.41 6 7.50
5370. Abderrahim (aaissa) 80 65.23 88.06 16 20.00
5371. Jakeyboi (00hike) 80 83.59 102.87 25 31.25
5372. Cannelle (cannelle) 80 47.17 59.09 10 12.50
5373. Dirk (treetoucher) 80 56.01 68.38 11 13.75
5374. Rice (riceinbob) 80 70.47 89.12 28 35.00
5375. x (roadtoonehundwpm) 80 76.07 93.62 22 27.50
5376. skiie (huypig11) 80 60.93 73.88 15 18.75
5377. Mo (mo7azeem) 80 94.17 107.28 25 31.25
5378. ahmad (ahmad3r) 80 23.36 32.04 24 30.00
5379. turbo (turbo_fister) 80 82.81 99.48 28 35.00
5380. Vipul (vipulsings) 80 60.08 72.94 15 18.75
5381. wunyan (wunyannie) 79 105.59 128.12 31 39.24
5382. Robert (wobert_) 79 130.41 165.59 52 65.82
5383. Adam (waba_waba) 79 57.52 70.61 11 13.92
5384. trqvcr (trqvcr) 79 66.99 96.27 17 21.52
5385. ThatLastWaffle (thatlastwaf... 79 89.59 117.02 31 39.24
5386. Mikołaj (sweed4life) 79 36.68 54.86 10 12.66
5387. ST (subsonic86) 79 41.41 52.36 2 2.53
5388. Noodle (stayed) 79 95.26 153.12 38 48.10
5389. sssssssssssssss (sssssnake) 79 102.56 131.47 38 48.10
5390. toudouche (seni42) 79 89.06 105.11 27 34.18
5391. sawamura (sawamura) 79 52.20 65.36 12 15.19
5392. ASHIK (samael99) 79 40.58 52.49 5 6.33
5393. Roelof (roeloflucka) 79 78.03 93.32 20 25.32
5394. plip (plip) 79 57.74 69.34 15 18.99
5395. sayba (nusaiba4) 79 49.43 60.51 6 7.59
5396. Nicholson (nic8ag) 79 61.29 79.46 18 22.78
5397. nerif (nerif) 79 122.69 158.35 43 54.43
5398. Nathan (natekruger) 79 89.09 116.01 28 35.44
5399. Naomi (naomielianora) 79 70.21 87.18 20 25.32
5400. ⁦⁧Mukundan (mukundan314) 79 85.35 106.49 23 29.11
5401. md mahadie (mdmahadiehasanh... 79 71.01 88.44 21 26.58
5402. L0G0S (logos_) 79 94.67 114.69 40 50.63
5403. Light (light655) 79 58.30 72.48 19 24.05
5404. Kasper (kaspertypes) 79 132.91 168.48 58 73.42
5405. 종지 (jonge1124) 79 98.81 120.85 31 39.24
5406. Richard (jjjxxx) 79 65.59 80.38 16 20.25
5407. Jayden (jdawwgg) 79 67.29 96.29 20 25.32
5408. Frank (jaxfrank) 79 60.08 73.33 15 18.99
5409. eugene paul (itdrmts) 79 78.60 91.60 26 32.91
5410. Aufan (icepondx) 79 88.61 106.50 22 27.85
5411. Garrett (grgarrett) 79 92.89 112.73 24 30.38
5412. abdelrahman (basyouni74) 79 35.38 44.98 4 5.06
5413. babao (babao) 79 85.06 114.66 23 29.11
5414. Akeisara (ake_e_e) 79 46.24 56.67 9 11.39
5415. Aespar (aespar) 79 93.72 114.27 28 35.44
5416. Aang_Guns (aang_guns) 79 59.63 73.52 13 16.46
5417. fast-typist101 (vuylsteke) 79 90.89 115.41 30 37.97
5418. Hassan (7zn5alid) 79 61.10 75.21 21 26.58
5419. SouL (s4ul) 79 58.40 72.55 16 20.25
5420. Pink (pinkunikorn) 79 60.48 79.72 18 22.78
5421. ineed (buttado_g) 79 61.99 93.39 20 25.32
5422. Mikey (mikey2020) 79 58.34 80.53 12 15.19
5423. Ink (slidxt) 79 62.32 77.24 16 20.25
5424. muhammad (akbacha) 79 44.47 61.37 6 7.59
5425. z (zivry) 78 70.15 84.52 20 25.64
5426. yuh (yuhyeetyaw) 78 103.92 130.74 33 42.31
5427. Youssof (youssof10) 78 62.03 79.18 61 78.21
5428. Gurshaant Singh (waffleflau... 78 60.94 76.30 29 37.18
5429. Vala (valarn) 78 48.53 59.43 4 5.13
5430. Toni (topityper) 78 89.49 110.77 26 33.33
5431. Diego (thebeastboi__) 78 77.74 99.57 31 39.74
5432. Tendinits (tendinits) 78 65.94 93.38 27 34.62
5433. Thomas (tammis) 78 105.67 121.13 39 50.00
5434. Pizdonja (sule57) 78 97.36 115.38 22 28.21
5435. Shubham (shubham_) 78 70.90 87.93 16 20.51
5436. Glade (shogekiha) 78 111.18 134.25 58 74.36
5437. Shen301 (shen301) 78 57.58 69.38 9 11.54
5438. Shaun (shaun_c) 78 88.82 107.67 22 28.21
5439. Shai (shai15) 78 63.32 73.43 14 17.95
5440. Scer_1 (scer) 78 66.92 86.01 18 23.08
5441. Rajesh (rcham) 78 39.63 50.50 3 3.85
5442. Pranto (pranto2722) 78 86.04 103.59 23 29.49
5443. Saul (paulsaredes) 78 93.15 115.34 29 37.18
5444. Yusuf (northernbay4) 78 51.50 68.37 12 15.38
5445. Jay (noj0ke) 78 90.83 122.71 22 28.21
5446. Orion (nettle) 78 41.62 49.86 10 12.82
5447. Natalie (natcard) 78 104.62 130.00 36 46.15
5448. Marc (mwahab_) 78 104.96 137.18 39 50.00
5449. chunchunmaru (mr_mystery4896) 78 87.62 116.87 30 38.46
5450. Tangent (mrtangent) 78 69.23 92.24 16 20.51
5451. Mohamed (mohamedsameh) 78 59.79 70.64 13 16.67
5452. Adley (milf_slayer) 78 46.74 56.68 6 7.69
5453. may (maciem14) 78 66.96 93.54 20 25.64
5454. Arthur (lelface) 78 102.19 131.80 36 46.15
5455. Saba (junior6) 78 91.75 113.42 29 37.18
5456. Yuri (json223) 78 102.75 129.88 39 50.00
5457. Josh (joshjacks) 78 96.67 112.93 36 46.15
5458. PinapL (joshiedean63) 78 50.32 67.80 12 15.38
5459. Eliud (inggoodface) 78 96.77 133.10 19 24.36
5460. Hassan (hassansajjad) 78 94.80 136.72 25 32.05
5461. Gurra (halogurra) 78 81.03 111.92 19 24.36
5462. fool (geekdud) 78 94.29 114.14 21 26.92
5463. Alexeï (g4520u10) 78 37.79 51.06 3 3.85
5464. Me (emailgmailcom) 78 56.34 78.24 6 7.69
5465. Jan (elapid) 78 99.42 116.52 37 47.44
5466. Steven (eeekom) 78 79.65 108.10 22 28.21
5467. Nyora (dvorak_mode) 78 108.65 130.69 41 52.56
5468. dexterj (dexterj) 78 86.52 109.44 20 25.64
5469. Danny (danny_whal) 78 68.09 91.79 22 28.21
5470. Cres (crespear) 78 84.89 105.63 19 24.36
5471. jeff (cqyimo42) 78 114.39 133.67 34 43.59
5472. Brian (bv_altxps) 78 116.73 146.24 40 51.28
5473. toki_crush (boom_51) 78 105.99 128.68 46 58.97
5474. Axel (axeltb) 78 70.84 86.82 23 29.49
5475. Abizer (abizern) 78 80.33 98.83 24 30.77
5476. 79 Camaro (79camaro737) 78 100.18 124.31 30 38.46
5477. Shar (sharkg16) 78 119.13 138.14 32 41.03
5478. Dinah (kirbytyper) 78 90.48 114.50 25 32.05
5479. Matin (pmflash666) 78 28.42 38.25 14 17.95
5480. Casper Tyson (caspertyson) 78 53.54 67.50 11 14.10
5481. Nikk (white13) 77 101.45 123.63 34 44.16
5482. Michael (v3spula) 77 100.86 131.40 19 24.68
5483. nullchilly (tuwuna) 77 122.76 274.05 39 50.65
5484. YT (tim72) 77 57.01 73.11 8 10.39
5485. ... (the_sesquipedalienist) 77 102.27 137.30 36 46.75
5486. KirILL (spl4yce) 77 75.91 98.77 18 23.38
5487. Sparshong (sparshong) 77 78.53 98.59 24 31.17
5488. S (sima0502) 77 84.76 103.66 22 28.57
5489. ritwik (ritwik3856) 77 73.63 97.00 18 23.38
5490. Prem (premkumar12) 77 31.47 40.00 6 7.79
5491. Tiffany (potatosmeller) 77 72.88 90.90 13 16.88
5492. no (noob1720) 77 84.74 98.03 21 27.27
5493. Navdeep (navk007) 77 48.64 64.54 10 12.99
5494. Marwan (marwans) 77 49.61 61.62 6 7.79
5495. sigit (licardi) 77 75.77 96.00 23 29.87
5496. Kyle (kuronkuu) 77 85.57 121.30 23 29.87
5497. Ng (kinkhai) 77 70.25 89.61 17 22.08
5498. Khit (khitnay) 77 96.14 117.89 35 45.45
5499. Hi (jxjx) 77 83.73 97.99 28 36.36
5500. Vincent (jvgcalites) 77 84.11 102.02 18 23.38
5501. que (jhavul) 77 119.85 153.20 48 62.34
5502. Arber (hitit) 77 50.51 71.80 3 3.90
5503. Andrew (greatfighter10) 77 97.02 110.56 27 35.06
5504. john (funkefeet) 77 43.86 57.07 8 10.39
5505. Fabian (fabii1309) 77 90.54 108.23 27 35.06
5506. Tim (eternalwind) 77 67.61 81.57 15 19.48
5507. BBIBBI (eddie110) 77 98.95 116.77 35 45.45
5508. DULAL (dulal744574) 77 39.85 52.82 7 9.09
5509. updog (danielseow) 77 99.62 118.42 25 32.47
5510. Chicken (chickenpowerftw) 77 87.49 115.77 19 24.68
5511. Yogesh (bestyogesh) 77 71.34 88.11 13 16.88
5512. YNCBearz (bear19930414) 77 71.24 85.35 16 20.78
5513. Basel (baselhatata) 77 85.09 108.70 30 38.96
5514. Ahmed (ahmed20) 77 44.26 55.28 6 7.79
5515. zoidburger (adamczh1) 77 127.52 149.36 49 63.64
5516. Bluesherbert (heavenslurp) 77 42.67 52.24 5 6.49
5517. lost (lost2037) 77 36.03 50.09 10 12.99
5518. Sourav (_sourav_sarkar_) 76 59.72 81.10 13 17.11
5519. Beybaris (zstorm_rd) 76 83.52 101.77 21 27.63
5520. Zitti (zittti) 76 67.10 82.79 18 23.68
5521. William (williamy34) 76 75.88 91.46 23 30.26
5522. Lucian (the_eighth_wonder) 76 73.05 92.05 13 17.11
5523. Alex (theflyestlai) 76 69.11 91.56 16 21.05
5524. william (thefastest69) 76 100.76 134.25 23 30.26
5525. Bhar8at (thecalamitousduck) 76 61.24 81.33 9 11.84
5526. swoLee (swolee) 76 94.26 116.46 27 35.53
5527. Sven (swen999) 76 80.27 94.06 25 32.89
5528. Sumit (smromuec) 76 92.85 110.12 24 31.58
5529. Slow (slow_typer111) 76 39.16 49.82 2 2.63
5530. Shingo (shingoshoji) 76 110.63 134.63 36 47.37
5531. shavalli (shavalli) 76 44.75 59.47 7 9.21
5532. Gada go FAAASST (seesawsi) 76 83.80 97.31 17 22.37
5533. Rahul (rocketiscracked) 76 59.21 82.91 22 28.95
5534. Fresca (reifresca) 76 100.53 115.84 19 25.00
5535. Isaac (psachy) 76 98.41 128.40 31 40.79
5536. Bam (phoenixthestral) 76 95.94 118.45 26 34.21
5537. Sergio (perezsergioace) 76 70.15 82.21 22 28.95
5538. Pavan (pa163361) 76 75.67 90.46 43 56.58
5539. Nitro (nitrocrate) 76 95.92 114.08 34 44.74
5540. Nave (naveleon) 76 61.31 81.54 15 19.74
5541. Mr.chops (mr_chops) 76 90.67 104.21 26 34.21
5542. Mohamed Emara (mohamed_emara) 76 47.12 59.99 7 9.21
5543. alex (mimzy1995ns) 76 78.22 95.37 20 26.32
5544. Anthony (mike916) 76 93.32 112.55 37 48.68
5545. Will (lynxwill_bov) 76 75.04 103.88 14 18.42
5546. lol (luv_you) 76 124.96 150.16 50 65.79
5547. ♦☺♦ (lookdownnotjustup) 76 67.63 80.45 19 25.00
5548. Ryan (lilchicken) 76 83.89 99.38 17 22.37
5549. Lego (lamborgotii) 76 113.57 147.64 65 85.53
5550. Shahan Sanjid Khan (korosen... 76 70.59 82.86 17 22.37
5551. David (klassmagicer17) 76 89.87 111.23 24 31.58
5552. Khadiza (khadiza) 76 30.49 37.54 6 7.89
5553. kandarp (kandarp_5) 76 59.55 79.34 17 22.37
5554. Oikawa (kakashihatake1205) 76 74.14 92.12 22 28.95
5555. Jimmy (jiminator) 76 67.20 79.55 17 22.37
5556. JahJi (jahji) 76 91.85 115.21 27 35.53
5557. Dawid (ilordawid) 76 65.85 83.70 13 17.11
5558. Hoasm (hoasm_gnaba) 76 43.67 54.88 11 14.47
5559. Kevin Rendell (hankami37) 76 74.96 92.66 19 25.00
5560. Morris (h0nny) 76 107.28 144.14 26 34.21
5561. BobDaAsianBuilda (fortnitef... 76 115.62 134.70 32 42.11
5562. Fitive (fitive_gaming) 76 63.96 82.64 20 26.32
5563. Farhan (farhan_op) 76 94.44 113.70 40 52.63
5564. fakedpoet (fakedpoet) 76 62.34 72.34 10 13.16
5565. Emma (emmalischka) 76 56.84 65.02 13 17.11
5566. Oneness (dreamtime) 76 89.97 103.59 22 28.95
5567. Valak (dragos_valak12) 76 55.03 79.22 8 10.53
5568. arnab (dark_morty) 76 68.86 87.26 24 31.58
5569. Andrew (completespud) 76 86.30 107.72 25 32.89
5570. Tsunami (bmo12) 76 65.53 80.85 23 30.26
5571. Matt (beano15) 76 76.34 96.46 17 22.37
5572. Braden (barbuthnot) 76 92.94 108.45 30 39.47
5573. Buyandelger (b200970010) 76 43.06 56.30 11 14.47
5574. Adam (azonite) 76 107.47 139.99 45 59.21
5575. Atomic (atomicf) 76 44.50 70.81 18 23.68
5576. Nathan (alteriffic) 76 90.95 113.46 29 38.16
5577. Jimbo (doa_jimbo) 76 66.55 85.51 19 25.00
5578. Chad (douchebagasshole) 76 71.80 84.73 19 25.00
5579. Đạt (thanhdat9503) 76 34.13 42.66 8 10.53
5580. Ahmed (ahmedosama14) 76 84.40 105.04 19 25.00
5581. xtr (xtr_) 76 74.35 94.65 16 21.05
5582. 8N (_8n_) 75 57.11 75.12 14 18.67
5583. Yanterko (yanterko) 75 93.68 112.05 32 42.67
5584. Tyler (xtios) 75 111.04 130.89 36 48.00
5585. Fábio (vallkorion) 75 63.06 74.29 17 22.67
5586. Kris (tymptra) 75 60.80 73.49 14 18.67
5587. Test Project 3 (turkishtyper) 75 77.49 101.79 5 6.67
5588. Motch (treemes) 75 73.67 89.76 16 21.33
5589. Tomaz (tomaz1502) 75 92.23 108.57 25 33.33
5590. Tawalisi (tawalisi_1500) 75 76.81 92.68 18 24.00
5591. Korey (serveo21) 75 61.06 75.04 15 20.00
5592. Saurav (sauravdeore) 75 88.01 103.92 22 29.33
5593. 2fast4u (russell12345) 75 108.62 134.93 36 48.00
5594. Lloyd (rketch) 75 78.55 93.07 18 24.00
5595. Pranav (pranavsetpal) 75 60.68 82.66 11 14.67
5596. potato (potato42069) 75 101.81 132.72 46 61.33
5597. platno (platno) 75 101.90 116.72 33 44.00
5598. Plague (plaguey) 75 81.03 95.88 10 13.33
5599. nizam (nizamovicxi) 75 84.78 103.27 19 25.33
5600. nart (nartyaltchin) 75 65.06 81.93 17 22.67
5601. Nada (nadazz9) 75 31.75 39.33 6 8.00
5602. Michael (mscott3) 75 112.82 137.34 30 40.00
5603. Mostafa (moghorab) 75 41.44 54.20 10 13.33
5604. Miles (miles223) 75 153.98 185.62 62 82.67
5605. Kiryu (kiryugozi) 75 75.11 105.19 18 24.00
5606. Khoa (khoadeptrai111) 75 78.49 113.93 21 28.00
5607. JRT (jrt829) 75 75.49 87.67 15 20.00
5608. poemich (jerkyice) 75 73.69 87.59 28 37.33
5609. Lasse (imlasse) 75 82.26 100.42 20 26.67
5610. Mohsin Ali (gillbest) 75 42.23 51.00 8 10.67
5611. flaneur (flaneurnq) 75 171.49 203.98 71 94.67
5612. Henry (flamekata24) 75 90.78 109.08 33 44.00
5613. Seilacara (eunaosei) 75 65.38 80.23 19 25.33
5614. Rohan (dragami) 75 75.39 110.37 20 26.67
5615. Igor (disstream2) 75 63.29 72.84 16 21.33
5616. Chris (chrisjordan23) 75 82.01 102.30 22 29.33
5617. Chizi (chiziivictor) 75 51.48 61.42 10 13.33
5618. Mort (captain_fredrickson) 75 72.84 88.77 12 16.00
5619. not your dad (buthee) 75 115.38 139.38 44 58.67
5620. GabWasTaken (bored_dude) 75 66.81 89.49 10 13.33
5621. beta (betameta123) 75 89.69 106.47 19 25.33
5622. Edward (batskater1234) 75 87.84 135.94 20 26.67
5623. Kei (aznkei) 75 75.34 90.66 17 22.67
5624. andy (andytixn) 75 146.44 194.75 55 73.33
5625. A.B.G (ahmed_burham_pro) 75 67.42 79.63 12 16.00
5626. 3ymsdet (3ymsdet) 75 121.82 160.85 54 72.00
5627. iuhyuh (iuhyuh) 75 80.62 108.91 29 38.67
5628. Ywq06 (ywq06) 74 93.88 122.54 26 35.14
5629. mateo (yaboimateo) 74 86.86 115.01 23 31.08
5630. Arnav (variable_seal) 74 51.00 71.05 7 9.46
5631. Nonthapat (uniq0rn) 74 48.65 60.52 6 8.11
5632. Totally Not A Cat (totallyn... 74 56.55 71.88 15 20.27
5633. Tormod (tormodfh) 74 44.98 57.24 5 6.76
5634. Toonafisch (toonafisch) 74 75.04 94.90 19 25.68
5635. van (toofasthoot) 74 86.83 103.87 13 17.57
5636. Rishabh (thomasshellby) 74 76.88 96.49 19 25.68
5637. samongcs (thesamuelong10) 74 61.88 74.72 16 21.62
5638. Tenzin (tenzinfrost) 74 40.17 54.77 6 8.11
5639. Stonebreaker (stonebreaker) 74 36.78 48.77 6 8.11
5640. u (stirlo21) 74 77.95 90.01 8 10.81
5641. Nate (somemoresmors) 74 82.96 106.63 20 27.03
5642. Sebastian (shrekbastian) 74 80.90 100.80 33 44.59
5643. sAnideos (sanideos) 74 81.51 97.78 15 20.27
5644. Saket (saketraj) 74 62.68 74.42 10 13.51
5645. Lettuce (rolesg) 74 88.56 133.31 25 33.78
5646. reall (reall) 74 81.88 97.36 21 28.38
5647. Quinten (qspuijman) 74 86.92 102.82 27 36.49
5648. Prathamesh (prathamesh0927) 74 60.78 78.34 10 13.51
5649. payn (paynnn_) 74 102.70 123.30 32 43.24
5650. Oscar (oscrrmrz) 74 66.64 105.52 18 24.32
5651. Mr. Fancy (mr_fancy77) 74 70.48 90.22 18 24.32
5652. PR (mrprx) 74 93.98 114.03 25 33.78
5653. Johny (mijq) 74 42.29 51.10 7 9.46
5654. Lukas (lukasprestonchow) 74 79.98 108.37 32 43.24
5655. amanogawa (lhykv) 74 151.47 186.27 60 81.08
5656. ok (laggyfeetshake123) 74 133.01 161.00 49 66.22
5657. lindsey:) (labercrombie36) 74 110.55 132.20 38 51.35
5658. kyoppiy (kyoppiy) 74 42.58 56.90 3 4.05
5659. mohamed (karray) 74 45.64 57.65 4 5.41
5660. silver_soul (jooeeee) 74 80.85 105.61 18 24.32
5661. Binly (inahee) 74 53.72 66.76 11 14.86
5662. Bhavya (iconic_typer) 74 57.67 69.49 7 9.46
5663. HHpotatoes (hhpotatoes) 74 80.79 101.88 17 22.97
5664. Miika (hakkerijehu) 74 69.93 85.10 15 20.27
5665. Foren (foren) 74 50.32 67.71 14 18.92
5666. Experiment 626 (eee01) 74 93.31 115.46 32 43.24
5667. Jack (ditabyte) 74 66.23 87.38 17 22.97
5668. 🥺👉👈 (daddy_mememas... 74 73.61 93.12 18 24.32
5669. Aidan (coconutwaffle) 74 74.69 93.12 21 28.38
5670. Maddie (ciderto) 74 89.39 121.19 23 31.08
5671. CurryAbalone (careycai) 74 86.64 124.36 27 36.49
5672. Bleu (bleublix) 74 73.19 88.78 20 27.03
5673. Bachiri (bachiri) 74 83.03 95.29 15 20.27
5674. Aaron (ayeayeron) 74 59.28 72.33 20 27.03
5675. Ashton (ashtonnothsa) 74 31.29 43.04 7 9.46
5676. Aryan (aryan7_king) 74 48.89 66.04 5 6.76
5677. Aryaman (aryaman04) 74 86.96 111.64 25 33.78
5678. Ahead (ahadwhat) 74 74.03 100.10 41 55.41
5679. Adrian (adrian_himself) 74 53.45 67.49 9 12.16
5680. aditya (adityaraj322) 74 54.15 69.19 13 17.57
5681. Abhishek (abhichauhan) 74 41.95 57.20 4 5.41
5682. aawan (aawan_viator) 74 56.05 66.59 11 14.86
5683. asdfasdf (211bazooka) 74 99.78 122.23 27 36.49
5684. Mario (mariobeh) 74 52.39 71.39 6 8.11
5685. Benjamin (benjikrafter) 74 62.00 73.43 11 14.86
5686. Farrux (farruxprogg) 74 25.84 34.61 19 25.68
5687. Musa (jaydeep712) 74 74.84 85.62 20 27.03
5688. abc (thedumpster) 74 63.53 92.30 20 27.03
5689. veer pratap singh (_veerpra... 73 45.82 56.22 28 38.36
5690. Richard (zzzcha10) 73 107.46 128.12 38 52.05
5691. Sour (yung246) 73 59.07 70.00 12 16.44
5692. yes (yesmaybeno) 73 99.02 123.37 42 57.53
5693. Yeraly (yeraly_) 73 66.74 86.94 15 20.55
5694. Winter (winter_dawn) 73 95.94 116.60 27 36.99
5695. Malcolm (weatherman7921) 73 66.92 81.16 12 16.44
5696. Steven (vivihuang) 73 89.41 118.28 22 30.14
5697. tstats[typingsid02] (typing... 73 67.46 80.59 14 19.18
5698. Oliver (typer2947) 73 50.23 64.61 6 8.22
5699. Alex (truxior) 73 91.04 108.33 23 31.51
5700. snow leopard (truechaos) 73 120.15 157.43 39 53.42
5701. Kyozō (thegiantchip) 73 96.65 118.76 36 49.32
5702. terrace (terrace2fast) 73 121.56 169.58 35 47.95
5703. Taeyang (taeta3) 73 84.37 107.41 16 21.92
5704. Sam (samtsullivan) 73 121.17 149.61 31 42.47
5705. ROWLAND (rownet) 73 62.33 76.25 14 19.18
5706. Wayne (retroweezy) 73 87.83 105.91 29 39.73
5707. Rigno (redbubba) 73 118.44 144.70 37 50.68
5708. anntz (reaction__) 73 86.89 108.05 26 35.62
5709. dsc: ishwr (psychic7195) 73 102.66 133.30 62 84.93
5710. peaNUTS (prabeshdai) 73 64.18 80.00 15 20.55
5711. Paul (pkanas) 73 113.76 150.25 40 54.79
5712. Peshraw-Kurdi (peshraw) 73 59.24 76.67 12 16.44
5713. paveN (paven_) 73 59.13 73.67 15 20.55
5714. pasha (pasha8800) 73 61.55 74.60 25 34.25
5715. Ryan (nuigit) 73 99.11 134.57 31 42.47
5716. Nadarsha (nadarsha) 73 21.24 29.83 23 31.51
5717. musratte (musratte) 73 81.89 100.11 21 28.77
5718. Never :q! (mista_t) 73 58.06 77.11 12 16.44
5719. Madhvendra (madhvendra) 73 21.27 37.14 23 31.51
5720. Loege (loege) 73 97.35 120.44 28 38.36
5721. Lime (lizzardwizzard) 73 37.75 46.17 3 4.11
5722. leodelfo (leodelfo) 73 95.65 114.47 27 36.99
5723. Torrey (lavamob64) 73 100.17 123.80 35 47.95
5724. KilinWei (kilinwei) 73 62.39 74.09 19 26.03
5725. Kelly (kellyqin) 73 34.79 44.29 2 2.74
5726. Kapi (kapi_boi) 73 58.57 79.33 13 17.81
5727. Jerome (jerome_ctq) 73 86.63 106.52 11 15.07
5728. Jerome (jeromesiu1210) 73 90.30 105.30 26 35.62
5729. Arr (htunkyaw) 73 84.77 107.43 17 23.29
5730. Grenek (grenek) 73 102.40 122.27 30 41.10
5731. Duffy (duffylam) 73 40.95 55.51 5 6.85
5732. Booba (drakonsio) 73 94.69 115.66 22 30.14
5733. noise (dp123) 73 134.48 177.15 52 71.23
5734. davidpasion (davidpasion) 73 93.27 107.88 27 36.99
5735. Darrin (darrinj) 73 68.89 84.45 24 32.88
5736. Daniel (dark0nee) 73 84.09 96.25 20 27.40
5737. veenu (comp_typist) 73 69.86 88.61 17 23.29
5738. Anuj (coder05) 73 92.36 112.89 32 43.84
5739. Chester (chesterization) 73 71.26 82.53 12 16.44
5740. Erica (canadianhuman) 73 69.29 85.44 16 21.92
5741. tehfu (brownmilk) 73 92.28 115.78 28 38.36
5742. Blakley (blakley) 73 93.12 115.71 24 32.88
5743. Aidan (b8its) 73 93.70 107.94 22 30.14
5744. austirol (austirol) 73 20.17 33.25 11 15.07
5745. Austin (austinmarton) 73 101.29 123.85 27 36.99
5746. ang (angelah) 73 94.42 112.37 37 50.68
5747. Adam (adamsawahgamer) 73 76.97 95.48 23 31.51
5748. abh1sh3k (abh1sh3k) 73 81.43 96.30 41 56.16
5749. don (psyfer_69) 73 72.14 92.25 14 19.18
5750. Wallace (timmaddog) 73 94.23 112.96 18 24.66
5751. Ulrich (ulrichji) 73 82.57 98.87 24 32.88
5752. joygerry (joygerry) 73 76.95 96.31 18 24.66
5753. Lorenz (yaramaisus) 73 30.28 42.24 5 6.85
5754. Sam_2021 (sams_69420) 73 56.19 69.05 15 20.55
5755. Darren (zincj) 72 43.14 76.38 7 9.72
5756. The Hunter (the_hunter_) 72 86.25 104.30 28 38.89
5757. Kenneth (thedas) 72 88.23 109.79 25 34.72
5758. Daniel (swietlikkielce) 72 62.18 84.78 15 20.83
5759. travman (sunshinemamba) 72 71.85 91.04 16 22.22
5760. Saurav (saurav555) 72 61.95 86.03 16 22.22
5761. Sanjeevwa (sanjeevwa) 72 79.74 96.38 20 27.78
5762. Sheldon (rooksword3393) 72 88.01 106.47 15 20.83
5763. Raakulan (raakulan_94) 72 46.15 55.56 6 8.33
5764. Pineapple (pineapple_pie1) 72 77.12 95.82 20 27.78
5765. Alvaro (patomalo) 72 49.99 64.65 8 11.11
5766. Nils (nosta_06) 72 82.21 101.43 25 34.72
5767. nishi (nishi_san) 72 67.07 80.80 16 22.22
5768. Toan (nguoichuadangki) 72 68.66 90.40 32 44.44
5769. nexro (nexro44) 72 99.13 114.57 32 44.44
5770. Melwan (melwan) 72 43.98 55.31 3 4.17
5771. Chris (lumms) 72 86.46 116.02 28 38.89
5772. derrick (lewi0332) 72 49.66 64.55 4 5.56
5773. LEANG (leangsy22) 72 34.43 42.22 5 6.94
5774. Marcellus (krouthen) 72 103.15 135.31 24 33.33
5775. k1suxu (k1suxu) 72 69.56 82.14 14 19.44
5776. josh (jshg) 72 102.06 127.78 24 33.33
5777. GreatKing (greatking) 72 104.54 120.48 31 43.06
5778. Goldenpigg (goldenpigg123) 72 90.55 120.13 25 34.72
5779. gegs921 (gegs921) 72 106.65 129.69 30 41.67
5780. dayman (gangbeast_21) 72 73.47 99.43 19 26.39
5781. FROST (frostxdemons) 72 77.56 95.16 26 36.11
5782. Faiq (faiq57) 72 83.40 101.80 28 38.89
5783. Noah (excell) 72 85.16 107.70 21 29.17
5784. Emily (ellajournal13) 72 86.60 104.45 16 22.22
5785. Ekezuke (ekezuke) 72 59.71 77.24 19 26.39
5786. Hernan (edry12) 72 53.36 72.58 15 20.83
5787. Selyaka (ddamyanov) 72 72.09 93.35 29 40.28
5788. Dario (dariovondrasek) 72 46.61 57.65 9 12.50
5789. cvs (cvs_pharmacy) 72 110.51 143.33 32 44.44
5790. Chris (cascade_) 72 75.03 95.11 14 19.44
5791. Bouba (breadbake) 72 107.82 124.47 39 54.17
5792. JC (bid4peace) 72 58.37 72.69 12 16.67
5793. barmijo (barmijo) 72 69.68 92.64 17 23.61
5794. Cameron (ballsinyourface) 72 82.37 109.35 19 26.39
5795. Alex (ask496) 72 111.56 126.42 30 41.67
5796. Asier (asierart) 72 69.38 93.17 24 33.33
5797. Reynol (arsen714) 72 78.45 103.03 13 18.06
5798. Annwesha (annwesha) 72 56.09 66.98 8 11.11
5799. Aidan (amess92304) 72 63.23 77.48 18 25.00
5800. JD (ahiajd) 72 75.91 90.58 12 16.67
5801. Advith (advithshetty02) 72 78.33 98.03 19 26.39
5802. AsiaSeries (adeepra) 72 65.81 75.63 19 26.39
5803. Abhijeet (abhibaj007) 72 41.88 48.83 7 9.72
5804. jojojo (astrot) 72 30.69 38.79 5 6.94
5805. brooke (brookeech) 72 51.77 71.92 13 18.06
5806. Matthew (matty_foo_foo) 72 54.52 67.48 6 8.33
5807. Logan (iceisnice) 72 64.84 89.35 19 26.39
5808. Ru (impurelight) 72 51.17 68.39 11 15.28
5809. CoolBongoBoy (nerdrepellent) 72 79.26 96.85 23 31.94
5810. Matt (shayosu) 72 83.46 103.25 19 26.39
5811. F (_ft__) 71 66.60 88.11 19 26.76
5812. har (zsbzsb) 71 86.44 106.76 26 36.62
5813. Bartek (undg) 71 55.00 69.51 17 23.94
5814. Tunmsie (tunmi_dev) 71 87.84 104.96 26 36.62
5815. Sebastian (tulanir) 71 99.83 122.67 30 42.25
5816. Johan (treeff) 71 92.77 119.30 21 29.58
5817. Sudipta Sarkar (sudipta276) 71 42.38 49.73 7 9.86
5818. Arthur (squekk) 71 39.70 50.47 28 39.44
5819. sonny (sonnysixteen) 71 89.17 111.28 27 38.03
5820. Md. Shafiul Islam (sohan110... 71 42.47 53.53 6 8.45
5821. Slice Dice (slicedice) 71 56.20 71.87 10 14.08
5822. Shahana (shahanas) 71 83.42 102.21 21 29.58
5823. R (sevenexpert) 71 86.35 99.99 26 36.62
5824. sedate (sedatekitten) 71 96.05 135.10 27 38.03
5825. Ravenwolf (rvenwolf) 71 84.21 101.37 22 30.99
5826. Empio (ppdodoqqq) 71 39.68 50.24 12 16.90
5827. Ponymouse (ponymous) 71 96.50 129.56 33 46.48
5828. Nail (nailail) 71 34.27 42.62 3 4.23
5829. Noah Ignacio (nachos_7575) 71 71.31 83.47 14 19.72
5830. Lutfullokh (mirzaqosimov) 71 50.58 65.36 9 12.68
5831. Mr (luke44661) 71 52.33 64.36 5 7.04
5832. Locomotion22 (locomotion22) 71 62.16 85.55 16 22.54
5833. Maserati (latitude_5a) 71 63.18 77.28 13 18.31
5834. Ashish (landxcape) 71 53.39 63.98 5 7.04
5835. Kolock (kolock) 71 100.19 123.92 28 39.44
5836. Homie (kingtrammy) 71 90.48 119.57 25 35.21
5837. Juan (juan_mo) 71 67.85 88.99 12 16.90
5838. Jessica (jesshe183) 71 86.09 102.41 12 16.90
5839. Jacob (jacobr2d3) 71 75.19 98.05 24 33.80
5840. imbad (imbad789) 71 97.49 129.84 19 26.76
5841. Helmi Abdul (helmiabdul) 71 71.47 80.29 15 21.13
5842. Ujjwal (half_blooded) 71 57.60 69.28 6 8.45
5843. BlueCar (greencar) 71 59.09 72.07 10 14.08
5844. ghostspirit (ghostspirit) 71 94.28 115.85 28 39.44
5845. G (gc3shadow) 71 101.39 126.70 38 53.52
5846. Hossen (galacticcheese1) 71 96.88 119.16 25 35.21
5847. Vedica (gairolavedica) 71 34.44 45.21 9 12.68
5848. Danny (flowburst) 71 121.61 153.26 42 59.15
5849. Jacob (emptypaintbrush) 71 80.91 105.37 27 38.03
5850. Alcolopa (emilioelmurr) 71 69.27 92.64 13 18.31
5851. ㋡㋛☹ (chzeeshan) 71 88.99 104.67 29 40.85
5852. Xuanming (caoxuanming) 71 49.19 58.45 8 11.27
5853. Fabijan (bifazg) 71 109.33 132.81 38 53.52
5854. Brandon (bgrospe) 71 102.70 128.55 35 49.30
5855. Garett (assaulted) 71 117.46 140.33 39 54.93
5856. Med Amine (med_amine) 71 42.87 55.92 9 12.68
5857. Kyle (kyle_w27129) 71 42.19 51.50 6 8.45
5858. Sfang (johnblund) 71 80.29 100.32 22 30.99
5859. Zosia Nicholson (zosianicho... 70 76.85 104.60 11 15.71
5860. Yehezkiel Raymundo (yehezki... 70 106.50 129.36 25 35.71
5861. Kasper (yckf2) 70 124.15 155.13 50 71.43
5862. Salman (xinvoker) 70 82.55 109.90 23 32.86
5863. Wildebeest (wildebeest1) 70 60.56 75.04 7 10.00
5864. Toyota (websitejunkie) 70 116.46 158.88 43 61.43
5865. wade (waderf) 70 39.16 53.37 5 7.14
5866. Abhishek (vbunny) 70 57.64 72.57 11 15.71
5867. Valoix (valoixgaming) 70 68.42 81.02 63 90.00
5868. tserse (tserse) 70 89.60 104.09 14 20.00
5869. tony (tony_starc303) 70 55.99 66.73 9 12.86
5870. TC Stinkey Mouse (thst4483) 70 94.05 119.24 19 27.14
5871. teraah (teraah) 70 99.56 133.44 33 47.14
5872. Md. Tarikul (tarikul_01) 70 60.71 80.32 13 18.57
5873. Bob (sydre2) 70 96.42 113.73 35 50.00
5874. victor (swegboi) 70 128.05 162.64 47 67.14
5875. Stefan (stefradjen) 70 102.22 125.99 37 52.86
5876. Stay (stayscaffolded) 70 98.04 125.17 20 28.57
5877. adil (silawatadil) 70 56.47 72.29 15 21.43
5878. Shuxuan (shuxuan) 70 58.48 75.22 13 18.57
5879. nizika (shouronpou) 70 92.52 118.80 22 31.43
5880. Shaina (shainaziza) 70 73.14 99.61 24 34.29
5881. null (sectest) 70 103.39 115.33 30 42.86
5882. Anoy (ranoy) 70 25.45 38.87 14 20.00
5883. Paolo (powlu) 70 76.00 95.56 23 32.86
5884. Nik (nik_farhan) 70 77.75 109.32 21 30.00
5885. Nikolino (nikolinolive) 70 65.62 84.29 40 57.14
5886. lolow (neworange999) 70 101.69 129.58 32 45.71
5887. Myka (mosin_warrior) 70 60.65 73.74 9 12.86
5888. Kevin (moffitt) 70 151.74 173.14 61 87.14
5889. mike (mikehawk12345) 70 96.50 129.78 29 41.43
5890. 5k m1chael (mihai03) 70 94.36 110.00 21 30.00
5891. mitchell (miceol) 70 76.47 105.71 9 12.86
5892. Louis (loucru1) 70 87.47 106.02 21 30.00
5893. tstats[log1xmeister] (log1x... 70 88.80 113.85 26 37.14
5894. Leong (leong_ckai) 70 61.71 76.80 12 17.14
5895. Kimberly (kimboslice16) 70 95.86 120.63 36 51.43
5896. Logi K380 (kedr0n) 70 122.84 144.65 37 52.86
5897. kalisto (kalisto) 70 63.11 76.21 10 14.29
5898. Greatman (jimmy_x) 70 87.06 102.30 16 22.86
5899. kjr (jianrong2004) 70 44.15 53.45 3 4.29
5900. Jav (jav77) 70 71.71 83.14 13 18.57
5901. Jared (jaredblack) 70 98.18 117.10 56 80.00
5902. James (itsbamble) 70 95.60 113.96 25 35.71
5903. ironmk11 (ironmk11) 70 88.36 107.27 21 30.00
5904. Imad (imad_uo) 70 42.83 52.47 6 8.57
5905. Abhas (imabhas) 70 62.09 83.76 11 15.71
5906. hoangnam75 (hoagnnam75) 70 96.03 112.53 26 37.14
5907. . (hanthedude) 70 112.36 129.95 40 57.14
5908. hamza (hamza_8) 70 52.52 63.63 5 7.14
5909. mr.purpose24 (hacker51) 70 72.18 88.66 20 28.57
5910. hrsh (h3rs8) 70 91.03 117.22 20 28.57
5911. John Paulo (guehnwyvar) 70 78.35 97.79 25 35.71
5912. Jerrynick (goldenxbulletz) 70 74.28 98.94 16 22.86
5913. FAITH (fjoel) 70 30.05 45.41 10 14.29
5914. Farid (faridmusayev) 70 87.75 118.17 24 34.29
5915. Evangelos (es305) 70 85.66 110.82 26 37.14
5916. erakai (erakai) 70 140.34 171.34 48 68.57
5917. EG (eg_immortal) 70 43.21 59.90 18 25.71
5918. Eli (eberger03) 70 87.53 110.01 23 32.86
5919. Charles (doubleqin) 70 122.60 145.35 40 57.14
5920. poop (dompozo) 70 66.84 88.05 23 32.86
5921. Charles (charles_good) 70 79.81 92.43 21 30.00
5922. Hadi (charaka) 70 95.95 117.81 25 35.71
5923. napkin (call_me_napkin) 70 133.51 169.54 41 58.57
5924. Kyle (break_fast) 70 53.21 73.14 9 12.86
5925. duncan (bobby29831) 70 97.78 112.17 26 37.14
5926. AD (blastoise13524) 70 74.13 116.72 26 37.14
5927. Salman (blackstrobe) 70 93.58 112.97 26 37.14
5928. Aryan (aryan_16) 70 63.09 74.93 11 15.71
5929. Arsennn (arsenn) 70 88.72 115.39 19 27.14
5930. Aniket (aniket_pithadia) 70 58.35 78.86 12 17.14
5931. megatron (ahnomi) 70 68.18 83.66 18 25.71
5932. Adil (adika_r) 70 71.03 83.63 22 31.43
5933. Sanic (192378) 70 97.11 116.77 27 38.57
5934. Jakub (jakubuwu) 70 49.94 63.30 9 12.86
5935. Möhsün (pogodemon) 70 61.62 79.96 19 27.14
5936. Mohammed (mohammed_almadani) 70 57.57 64.68 7 10.00
5937. Marwan (the_typo_typist) 70 60.85 82.74 16 22.86
5938. Sean (fairx) 70 42.92 53.33 1 1.43
5939. Aditya (zwelgop) 69 76.45 101.48 18 26.09
5940. Zecro (zecro_48) 69 39.76 53.61 2 2.90
5941. yurii (yurcifer) 69 52.64 67.57 8 11.59
5942. Voak (voak) 69 51.31 65.07 11 15.94
5943. Arief (valliante) 69 88.24 105.53 31 44.93
5944. Mike (tonz30) 69 80.52 96.27 18 26.09
5945. Daniel (throwmycage) 69 54.05 67.60 5 7.25
5946. spetterpoep (spetterpoep) 69 94.36 119.78 26 37.68
5947. Jesse (soval) 69 65.43 87.63 8 11.59
5948. Shynali Otep (shynali) 69 27.58 34.85 10 14.49
5949. Scribbled (scribbled_trashhh) 69 61.15 78.07 9 13.04
5950. johan (sagapam) 69 52.22 63.49 9 13.04
5951. Tadej (reyalpdab2) 69 116.12 138.26 41 59.42
5952. Renato Emeric (renatoemeric11) 69 63.58 77.77 10 14.49
5953. Ramez (ramezraymond) 69 88.51 104.72 29 42.03
5954. Prince (prince7589) 69 95.80 116.67 34 49.28
5955. Harry (pandasboob) 69 118.28 143.54 34 49.28
5956. T (omega5002) 69 83.84 98.25 19 27.54
5957. Raiden Shogun (ntd_dll) 69 92.14 111.59 23 33.33
5958. Norman (noromoon) 69 68.17 87.48 15 21.74
5959. Naomi (nmb813) 69 49.90 61.75 5 7.25
5960. naganandana (naganandana) 69 71.17 84.93 17 24.64
5961. Yiming (mymreview) 69 69.99 95.75 24 34.78
5962. moon (moon_anna) 69 67.49 84.12 23 33.33
5963. Alazar (mealazar) 69 58.68 74.71 9 13.04
5964. Isaac (ksspook) 69 43.52 62.22 4 5.80
5965. Khenh (khnhnguyen) 69 60.07 93.28 19 27.54
5966. A-Train (k4sh1zy) 69 71.41 88.39 16 23.19
5967. Jimmy (jimmy890302) 69 60.95 74.41 9 13.04
5968. Anon (jeff10) 69 141.02 173.22 63 91.30
5969. Zhamshid (Jam1lbek) (jam1lbek) 69 44.94 61.14 12 17.39
5970. Mio (i_drive_car_lol) 69 69.24 90.62 17 24.64
5971. i'm a band kid (imabandkid) 69 85.55 107.60 41 59.42
5972. Ernst (hopeofmercy) 69 90.24 117.23 27 39.13
5973. Henry (henrybutschool) 69 81.81 97.75 20 28.99
5974. Gidean (gidean) 69 81.97 98.01 15 21.74
5975. Alejandro (foreversick) 69 89.61 110.91 23 33.33
5976. Femke (fffemke) 69 64.68 80.73 19 27.54
5977. dude_BrahMan (dudebrahman) 69 104.05 131.45 36 52.17
5978. Dustin (dsthegold23) 69 95.06 117.12 23 33.33
5979. Nyxious (demonicious) 69 80.35 96.37 22 31.88
5980. Nimble fingers (deadjarus) 69 57.85 71.03 6 8.70
5981. Danny (danny1901) 69 96.26 116.94 29 42.03
5982. D A M A G E D (dama_ged) 69 107.47 129.73 28 40.58
5983. Abdi (bravenoob) 69 60.94 77.62 13 18.84
5984. Astoshan (astoshan) 69 64.17 83.24 17 24.64
5985. Avalanche (arnobel) 69 62.00 70.75 17 24.64
5986. Arka (arkacsedu) 69 73.23 90.46 13 18.84
5987. Riley (amlockedinfridge) 69 93.61 116.41 26 37.68
5988. Akshay (akshaymkupnoor) 69 52.23 63.48 4 5.80
5989. Af (aepaef17) 69 71.18 90.75 18 26.09
5990. 0verhaul (0verhaul) 69 66.99 104.17 17 24.64
5991. Smitesh (smiteshp) 69 70.51 81.67 16 23.19
5992. Jeferson Beliber (jbyungz) 69 81.17 116.12 26 37.68
5993. Victor (dczxao) 69 74.23 91.31 15 21.74
5994. grim (gri16m) 69 89.20 116.34 25 36.23
5995. DKTang (killnoevil) 69 86.53 108.06 20 28.99
5996. Francisco (frantark) 69 45.70 69.46 5 7.25
5997. vakupen (vakupen) 69 42.13 77.56 16 23.19
5998. Beri (beri_) 69 61.71 75.01 23 33.33
5999. Ghufran Ahmed (gahse) 69 34.17 46.35 1 1.45
6000. Jack (s_7ven) 69 67.62 86.83 28 40.58
6001. Zyad (zyad0magdy) 68 65.20 84.21 15 22.06
6002. F. (yrebainahs) 68 100.42 120.45 28 41.18
6003. Long (wesleylong) 68 80.37 101.53 13 19.12
6004. Wael(▀̿Ĺ̯▀̿ ̿) (wa... 68 62.87 83.46 45 66.18
6005. De9mond (uniwite) 68 72.86 87.43 13 19.12
6006. Parminder (trion129) 68 44.66 56.87 5 7.35
6007. stegmarb (stegmarb) 68 68.14 95.63 16 23.53
6008. SlowBoy (slow_boy_neen) 68 86.85 109.35 17 25.00
6009. Sizzled (sizzledbeans) 68 94.92 117.09 25 36.76
6010. Russellazy (russellazy) 68 84.24 111.76 20 29.41
6011. AG (rollingpanda0) 68 68.17 81.99 15 22.06
6012. 🗿 (rjh7) 68 61.86 82.25 11 16.18
6013. Daryoush (rango__nice) 68 18.08 25.70 14 20.59
6014. pri (prinni) 68 93.16 109.50 23 33.82
6015. H J (ojinjin) 68 80.74 99.95 17 25.00
6016. touko.ursin (oikipoiki) 68 62.55 72.85 17 25.00
6017. nwieuv (nwieuv) 68 135.68 162.53 51 75.00
6018. Nischal (nischal165) 68 64.43 76.15 18 26.47
6019. Nahush (nahush28) 68 63.73 79.12 17 25.00
6020. Bob (mrgeeses) 68 90.57 114.59 25 36.76
6021. tstats[mozra3] (mozra3) 68 61.31 79.26 19 27.94
6022. Nic (matcaps) 68 66.93 81.78 16 23.53
6023. A (kmos) 68 94.88 115.53 29 42.65
6024. shaan (khem92) 68 99.45 110.39 26 38.24
6025. Jerome (jerome251998) 68 75.45 93.36 14 20.59
6026. Johnathan (jellyowar308) 68 101.39 122.61 27 39.71
6027. Diego (isqube) 68 73.98 92.41 15 22.06
6028. Ion (incode4it) 68 95.96 133.97 28 41.18
6029. Hunter (hunterwho43) 68 112.33 131.19 31 45.59
6030. Hamada (hamadasalhab) 68 74.31 93.99 17 25.00
6031. SenAlice (gokamiso) 68 73.98 90.14 14 20.59
6032. v (gamegodv) 68 61.31 75.63 18 26.47
6033. mitchell (fool1shdemxn) 68 88.45 109.59 26 38.24
6034. Tobi (fastestflash) 68 108.93 137.98 39 57.35
6035. Eboy (e_nonymous) 68 66.01 84.79 15 22.06
6036. Ethan (ethanchansk) 68 94.74 119.50 28 41.18
6037. Bray (erasleeps) 68 103.98 136.28 34 50.00
6038. elnaz (elnaznsi) 68 54.40 71.98 45 66.18
6039. Naing Htoo Aung (devii92) 68 86.49 103.50 23 33.82
6040. Dark (darkelevent) 68 74.25 91.95 13 19.12
6041. Iemand (darckshy) 68 73.47 89.53 24 35.29
6042. hanno (busterity) 68 77.88 96.33 16 23.53
6043. bouse7th (bouse7th) 68 52.76 62.77 6 8.82
6044. Bonifacijus (bonifacijus) 68 53.37 74.15 6 8.82
6045. hehe (blazeclash) 68 106.08 130.40 29 42.65
6046. Papa (big_papa69) 68 43.54 54.77 7 10.29
6047. Beata (beata111) 68 76.02 96.11 22 32.35
6048. Lane (asdfedffd) 68 93.20 107.08 15 22.06
6049. Andreas (andi_0324) 68 55.94 69.73 8 11.76
6050. ༄༊࿆Faith࿐ (adaling369) 68 85.44 106.26 16 23.53
6051. Oblivyxia (oblivyxia) 68 84.80 108.77 29 42.65
6052. Faraaz (_faraaz_) 68 45.48 65.06 8 11.76
6053. Akilah (akilah1) 68 56.66 73.59 12 17.65
6054. Caden (csjones1358) 68 33.18 43.51 8 11.76
6055. Jackson (bigstix006) 68 55.20 68.29 13 19.12
6056. rachie (grrachie) 68 97.04 114.25 35 51.47
6057. Ren (yirenwang) 67 61.03 80.26 13 19.40
6058. Loading.... (xbooza) 67 78.48 92.17 14 20.90
6059. wobba (wobba) 67 84.00 99.25 21 31.34
6060. Noah (typer_noah) 67 65.90 81.61 13 19.40
6061. suraj giri (surajgirioffl) 67 69.10 79.77 18 26.87
6062. Steven (stuvun) 67 101.55 118.23 35 52.24
6063. Spy (spy71) 67 39.20 90.45 4 5.97
6064. man (speedweeweeman) 67 112.92 139.02 40 59.70
6065. NeverRage (solid_raiden) 67 108.41 129.75 37 55.22
6066. Master (smartax) 67 98.38 123.59 17 25.37
6067. Tom (rubik1908) 67 79.27 103.94 18 26.87
6068. Reto (reddo) 67 85.68 104.21 21 31.34
6069. purple (purplejust) 67 56.37 72.09 17 25.37
6070. Prashant Kumar (prasha3nt) 67 30.95 38.04 5 7.46
6071. Wiphoothorn (poomws) 67 40.64 54.05 5 7.46
6072. Phong (phong1902) 67 71.59 95.44 15 22.39
6073. Dillon (peak3433) 67 83.16 108.36 12 17.91
6074. Paige (patrickwest) 67 67.59 75.71 15 22.39
6075. noob (noahc207) 67 70.18 99.66 15 22.39
6076. Jeff (navigation07) 67 67.89 84.05 14 20.90
6077. mahmoud (modokatr) 67 51.00 66.27 3 4.48
6078. Mateusz (matswiatek) 67 42.99 54.32 1 1.49
6079. Marni (marniparnie) 67 44.41 60.24 5 7.46
6080. Magz (magzse7en) 67 85.49 106.77 25 37.31
6081. I lost (lxtxmx1) 67 80.09 112.37 10 14.93
6082. Ludvig (lochecho) 67 121.93 146.19 45 67.16
6083. Lộc (loccb90) 67 72.62 92.56 15 22.39
6084. Justin (liontan) 67 87.20 104.74 28 41.79
6085. Kicker (kickermasu) 67 73.39 89.17 16 23.88
6086. karimulla (karimulla12) 67 71.05 96.75 18 26.87
6087. jjjjjj (jitu8149) 67 64.64 79.78 20 29.85
6088. Jennie (jeniibearr) 67 112.93 144.88 39 58.21
6089. zxc (idcidcidcidc) 67 68.25 86.89 15 22.39
6090. SCUT-黄光积 (hy_1314) 67 59.53 76.94 5 7.46
6091. hamzah (hamzahzzs) 67 67.55 88.27 17 25.37
6092. Greg (grrg) 67 81.72 97.72 17 25.37
6093. Nawazish (ghostlead420) 67 49.12 65.26 5 7.46
6094. Fedor (fshabashev) 67 90.14 103.07 17 25.37
6095. Flash (flashyflashy) 67 127.18 146.45 45 67.16
6096. filip (filko) 67 38.99 49.03 9 13.43
6097. Machmori (explainingkamui) 67 65.78 80.63 16 23.88
6098. Evelyn (evelynji) 67 77.09 92.55 20 29.85
6099. Jen (ethima) 67 110.79 132.29 33 49.25
6100. duckyful (duckydatyper) 67 74.24 103.99 9 13.43
6101. Drakka (drakkathedark) 67 68.15 85.17 18 26.87
6102. Diya (dmatulizo13) 67 56.89 75.19 15 22.39
6103. Anurag (debroglie) 67 55.53 70.62 15 22.39
6104. coolzacboy (coolzacboy) 67 97.47 116.83 23 34.33
6105. Chris (bunkieme) 67 127.90 155.44 47 70.15
6106. Brian (briansu) 67 87.03 112.70 14 20.90
6107. Brendan (brenakin) 67 83.71 104.98 23 34.33
6108. Brandon (bqn0309) 67 98.95 131.40 23 34.33
6109. Hans (b3n1s) 67 78.65 99.20 13 19.40
6110. tstats[azhy_01] (azhy_01) 67 82.38 98.71 25 37.31
6111. Bettina (awkventurer) 67 123.78 194.62 45 67.16
6112. Ariscottle (ariscottle3106) 67 77.29 103.00 19 28.36
6113. Amr (amr98) 67 53.18 61.40 6 8.96
6114. Nathan (tposetime) 67 61.30 76.64 13 19.40
6115. Chino (stylish1323) 67 65.13 86.43 13 19.40
6116. Aly (aly_hussien) 67 16.13 22.04 9 13.43
6117. kenzar (kenzar) 67 43.27 52.69 3 4.48
6118. saif (saif07ahmed) 67 52.93 75.19 10 14.93
6119. Joseph (scomosypes) 67 85.50 119.28 20 29.85
6120. Rafiq Ahmed (tanjil2009) 67 38.92 50.41 8 11.94
6121. Shreesh (shreesh) 67 57.35 76.38 11 16.42
6122. Viz (viz_124) 67 59.15 76.84 9 13.43
6123. hope (hopekhembo) 67 39.15 50.62 3 4.48
6124. Ko (__lo) 66 88.21 119.28 23 34.85
6125. Trai (yezurey) 66 38.89 60.11 4 6.06
6126. RyanNXD0120 (xuanduy1269) 66 87.49 109.80 27 40.91
6127. Xassie (xassie) 66 83.82 102.02 24 36.36
6128. Róbert (worder01) 66 78.47 94.60 13 19.70
6129. sam (wongy03) 66 97.33 122.83 40 60.61
6130. Williawar (williawar) 66 86.29 105.63 20 30.30
6131. Wieds (wieds) 66 65.17 80.83 16 24.24
6132. Vinayak (vinayak_7989) 66 65.61 87.99 21 31.82
6133. . (vectorale) 66 108.10 136.54 26 39.39
6134. None (v8_eatr) 66 67.51 81.96 22 33.33
6135. rahul (typer_typer) 66 37.56 45.85 9 13.64
6136. Rod (twors_colemak) 66 109.81 133.80 31 46.97
6137. Nathanael (tunahead) 66 102.94 121.45 37 56.06
6138. Wilson (tigermatos) 66 60.90 74.58 12 18.18
6139. Lewis (the_mysterium) 66 55.98 69.81 12 18.18
6140. Slamsal (slamsal) 66 74.14 92.06 27 40.91
6141. Amanda (simplesecretsauce) 66 88.07 107.94 18 27.27
6142. Luka (sercasm) 66 117.68 136.84 43 65.15
6143. Nic (scylla1) 66 104.88 129.69 30 45.45
6144. Lucas (rlnb) 66 40.90 51.73 4 6.06
6145. Pema (rimuru_tempest2004) 66 29.73 39.25 10 15.15
6146. ricko (ricklo7) 66 96.44 123.48 22 33.33
6147. dead account (ribombee) 66 125.53 163.64 25 37.88
6148. Renardo (renarded) 66 145.50 188.54 34 51.52
6149. 9fingerstyle (readjust) 66 105.43 126.68 31 46.97
6150. pylori (pylori) 66 88.10 108.75 24 36.36
6151. Pouf (pouf_1) 66 53.62 67.14 18 27.27
6152. flis (philip29) 66 97.16 124.86 28 42.42
6153. Kajtebolikitica (patrik131) 66 89.25 108.16 21 31.82
6154. Jeremy (orcane) 66 80.80 106.75 15 22.73
6155. Oken (okenthelfocken) 66 63.81 85.41 14 21.21
6156. kostis (oh_yeah_go) 66 49.21 58.90 5 7.58
6157. femboy (nekokawaiiuwu) 66 127.74 152.18 49 74.24
6158. Carlos (nearbywaffle) 66 93.70 120.99 22 33.33
6159. Mythrick (mythrick) 66 100.69 122.52 27 40.91
6160. Tortle (megahentai) 66 107.57 126.61 27 40.91
6161. Joe (lanolin211) 66 90.92 120.45 28 42.42
6162. Michael (kimbo1414) 66 79.77 105.45 14 21.21
6163. KetanaBlade (ketanablade) 66 104.57 125.71 9 13.64
6164. Ketan (ketan1314) 66 65.22 82.35 26 39.39
6165. Kenneth (kennethraphael) 66 75.91 94.69 21 31.82
6166. ✨MTH Insane Typer✨ (jos... 66 162.40 201.84 57 86.36
6167. Jordan (jordanlreynolds99) 66 79.24 99.33 23 34.85
6168. Craig (jitterjuicegaming) 66 88.11 104.12 18 27.27
6169. JanTheMan (jan_the_man) 66 56.87 68.25 6 9.09
6170. Marzuq (itsmarzuq) 66 47.82 55.89 3 4.55
6171. Hari (harisund) 66 120.47 164.12 44 66.67
6172. Imnatoshi (hanmayujiro) 66 65.00 78.94 9 13.64
6173. Ahmad (gmg12) 66 86.95 113.26 12 18.18
6174. Frosty_Speed (frosty_s_speed) 66 51.92 79.48 9 13.64
6175. jon (fishy159) 66 66.50 79.64 16 24.24
6176. FatherWood (fatherwood) 66 69.71 84.23 16 24.24
6177. Ethan (ethfer_77) 66 83.66 100.03 21 31.82
6178. Emanuel (emanuelchristo) 66 67.53 80.57 19 28.79
6179. Mr Plow (el_putino_1917) 66 65.87 84.86 16 24.24
6180. Ellie (ellieoo) 66 89.98 110.30 16 24.24
6181. Azamat (div2der) 66 75.07 98.16 18 27.27
6182. Del (dellieran) 66 81.98 99.02 19 28.79
6183. uko (darjaw) 66 79.79 97.46 29 43.94
6184. (dafler) 66 117.44 135.05 36 54.55
6185. swfan (curleyx) 66 76.31 96.83 20 30.30
6186. brightness3 (brighness3) 66 80.81 99.27 16 24.24
6187. Bob (bobsvegana) 66 54.44 69.12 6 9.09
6188. Ben (benpoopy) 66 71.97 95.15 22 33.33
6189. Satwik Kashyap (annhilat0r) 66 63.49 79.64 10 15.15
6190. Alexei (alexiedad) 66 85.37 109.09 13 19.70
6191. Aidar (aidar13) 66 55.43 69.99 10 15.15
6192. tamara (tyche1997) 66 39.16 52.32 4 6.06
6193. Kvothe (relarkvothe) 66 83.94 98.04 18 27.27
6194. Napasin (triplesic) 66 67.03 81.16 12 18.18
6195. speedster11 (tygamer) 66 50.61 62.25 5 7.58
6196. Ellis (sneakee) 66 77.54 93.43 15 22.73
6197. Cadmiium (cadmiium) 66 92.96 118.04 31 46.97
6198. Derto12 (derto12) 66 58.99 78.73 11 16.67
6199. Youri (youriwatson) 66 61.95 74.28 8 12.12
6200. Sanidhya (sanidhyas3s) 66 46.11 55.75 8 12.12
6201. Gantulga (tsgantulga) 66 57.69 67.16 19 28.79
6202. gilbo (ch0wner) 66 90.26 115.96 21 31.82
6203. Roman (boycanoy) 66 69.35 84.52 14 21.21
6204. Mrinal (_tt_) 65 82.86 99.48 15 23.08
6205. Anda (_anda_) 65 83.08 104.52 21 32.31
6206. zain (zain_nawaz) 65 57.76 82.48 14 21.54
6207. yashar (yashar1) 65 55.63 67.03 8 12.31
6208. George (wiliu) 65 110.98 161.04 36 55.38
6209. Donee (volts5) 65 82.67 115.86 16 24.62
6210. Chris (tschy) 65 45.52 58.67 5 7.69
6211. Thunderstorm (thunderst0rm27) 65 115.72 137.66 51 78.46
6212. Charlie (swordmole) 65 102.22 116.90 29 44.62
6213. suddernpy (suddernpy) 65 62.43 77.90 20 30.77
6214. Edisa (snoopy34) 65 109.62 129.08 37 56.92
6215. SnakeTwix (snaketwix) 65 90.99 126.35 25 38.46
6216. Shashank (sky08) 65 31.29 46.01 5 7.69
6217. Skiddy (skiddybadoosh) 65 61.42 79.59 10 15.38
6218. Axel (sector7) 65 87.00 108.14 19 29.23
6219. Rodolfo (rojunman) 65 74.89 90.30 20 30.77
6220. RMC (rmcproductions) 65 78.86 92.79 16 24.62
6221. Marc (ratshepard) 65 97.42 119.10 32 49.23
6222. Rahul (rahulburrito) 65 75.46 105.93 13 20.00
6223. Puan (puanpro) 65 63.91 75.39 14 21.54
6224. tommy bhau (pseudonetwork) 65 58.48 74.19 17 26.15
6225. ProRick2358Y (prysp) 65 48.44 61.07 5 7.69
6226. Pauli (pauli___) 65 72.88 92.75 19 29.23
6227. pastarishi (pastarishi) 65 63.59 87.94 21 32.31
6228. nil.rajmane@gmail.com (nila... 65 81.18 106.73 23 35.38
6229. Mai (napping_koala) 65 72.64 87.88 18 27.69
6230. mt005 (mt005) 65 76.65 98.86 15 23.08
6231. Mounir (mounir_typing) 65 42.88 52.12 6 9.23
6232. Miguel (migsarm) 65 79.18 88.43 12 18.46
6233. Michael (meta1) 65 104.94 135.65 28 43.08
6234. Matthew (mattisdabomb77) 65 74.10 92.88 14 21.54
6235. Jui (laboni) 65 39.94 54.88 41 63.08
6236. Max (kinginthenorth78) 65 84.61 99.88 22 33.85
6237. Kiko (kikozz) 65 86.90 109.04 20 30.77
6238. Khusan (khusan) 65 45.76 59.99 12 18.46
6239. Karl (karl_marx_1818) 65 63.46 90.14 14 21.54
6240. Junaid (junaidahmad3) 65 75.54 96.89 9 13.85
6241. Jacob (jmbogo19) 65 67.00 86.37 17 26.15
6242. James (jhoffman1204) 65 95.10 119.43 18 27.69
6243. Daniel (irrrlrvant) 65 114.61 147.10 12 18.46
6244. HenIsTheMan (henry_lim) 65 76.25 88.43 13 20.00
6245. ILoveLofi (ginpaku) 65 71.43 94.39 15 23.08
6246. Gabriel (gabp) 65 85.45 99.62 17 26.15
6247. Derek (frigorific) 65 73.04 93.62 20 30.77
6248. thocky caps (floodvalve) 65 112.24 128.89 32 49.23
6249. Spin (firesquall) 65 90.95 114.81 18 27.69
6250. Zach (encasedthought) 65 90.20 113.76 23 35.38
6251. Yosapol (eji4h) 65 90.74 102.86 16 24.62
6252. John Lizuer (dimasalangchae) 65 59.35 80.66 16 24.62
6253. Deku (dekachu) 65 51.60 66.17 5 7.69
6254. Damos (damos22) 65 51.92 61.68 7 10.77
6255. Colin (cwandell31) 65 81.21 113.46 18 27.69
6256. Todd (cooldude_69) 65 45.16 57.99 3 4.62
6257. Colin (colinn02) 65 97.85 125.06 30 46.15
6258. buruum (buruum) 65 106.34 130.68 36 55.38
6259. Edvinas (bull3tf) 65 121.84 144.56 36 55.38
6260. Ben (bennash13) 65 91.60 114.31 19 29.23
6261. seyyed sina (aseidsina) 65 45.54 55.97 5 7.69
6262. Alo (alooo) 65 48.04 59.26 3 4.62
6263. Akbar (akbarovi) 65 59.08 73.25 8 12.31
6264. Inesh (69420nice) 65 92.70 110.06 21 32.31
6265. Tanya (verko) 65 41.37 51.91 7 10.77
6266. Subhro (subhro_121) 65 54.40 67.73 2 3.08
6267. Ursa (ursagaming) 65 79.29 98.91 23 35.38
6268. Kyle (bloodfall90) 65 75.24 96.59 15 23.08
6269. wol4z (alpha464) 65 77.56 101.84 23 35.38
6270. John (venuntraxo) 65 86.08 120.17 25 38.46
6271. tahmid (tahmid73) 65 52.70 60.97 4 6.15
6272. Zuhaer (zaszuhaer) 64 100.38 115.91 22 34.38
6273. Rika (z3us99) 64 83.95 101.85 23 35.94
6274. Virus (virusinmotion) 64 51.15 67.44 11 17.19
6275. ukimub (ukimub) 64 142.68 157.77 44 68.75
6276. Gin (tonic_gin) 64 94.05 113.36 17 26.56
6277. Tam (tam04101993) 64 73.73 93.39 18 28.13
6278. Essy (supersonics123) 64 58.80 77.23 10 15.63
6279. Marshall (stoppednile) 64 94.67 112.85 21 32.81
6280. Aakash (srinivasan41) 64 132.37 167.18 49 76.56
6281. Sophia (sophia_8) 64 74.18 89.24 12 18.75
6282. Shreesh (shreesh_racer) 64 56.22 66.89 9 14.06
6283. Joe (seph_of_joe) 64 126.47 158.93 39 60.94
6284. Everly (scribblenerd) 64 77.69 99.34 18 28.13
6285. Francisco Amat (saryon) 64 76.40 96.96 22 34.38
6286. raim (raimmillion) 64 31.31 41.25 5 7.81
6287. Priyam (priyam_raj) 64 67.94 83.35 14 21.88
6288. Nooyag (priceisright2) 64 108.10 132.53 31 48.44
6289. prgobet (prgobet) 64 75.17 97.38 26 40.63
6290. Persov (persov) 64 93.39 119.57 21 32.81
6291. Ethan (persom_) 64 77.32 97.04 14 21.88
6292. PeriodicHAiL (periodichail) 64 67.55 79.08 17 26.56
6293. Kim (ntk02) 64 73.14 96.18 16 25.00
6294. altaire (notchrubble) 64 101.11 123.13 23 35.94
6295. Mihovil (mladabobica) 64 86.08 106.40 27 42.19
6296. 💉 (milan_) 64 128.05 159.47 45 70.31
6297. Trpimira (m15k0) 64 96.85 113.98 28 43.75
6298. Jack (jr9810) 64 95.18 113.88 27 42.19
6299. Steve (jack_of_all_trades) 64 87.70 103.39 23 35.94
6300. Jack (jackmcg27) 64 68.17 83.79 20 31.25
6301. Jun (jacketwithpockets) 64 94.26 126.42 21 32.81
6302. bam (iamsobald) 64 95.75 123.43 24 37.50
6303. Michael (hit2u) 64 103.78 148.42 25 39.06
6304. ▄︻̷̿┻̿═━一 (h... 64 88.47 110.74 26 40.63
6305. Nate (haploeco) 64 59.87 80.29 10 15.63
6306. Cecil (goodie1857) 64 96.79 127.35 46 71.88
6307. Gay (fujikage999) 64 91.52 109.18 31 48.44
6308. Frxntize (frxntize) 64 95.31 131.30 27 42.19
6309. Anton (foroi) 64 48.07 60.56 10 15.63
6310. HayfordHumade (flace) 64 59.99 71.74 13 20.31
6311. eren (erenisdevil) 64 56.38 71.95 9 14.06
6312. Elwin (elwin05) 64 60.90 69.70 14 21.88
6313. Xiaorui (dxr1234) 64 69.31 83.39 14 21.88
6314. Hamza (dribbble) 64 57.48 73.87 18 28.13
6315. Damn (dammmson) 64 85.88 106.04 15 23.44
6316. Ian (copywright) 64 88.88 113.34 20 31.25
6317. Andeh (calluxdapotato) 64 101.63 117.42 27 42.19
6318. Al Jade (c00k1e) 64 85.55 106.05 21 32.81
6319. Joshua (buwan) 64 107.99 128.71 31 48.44
6320. Adril (btsbiot) 64 71.53 99.21 17 26.56
6321. bryan (bryan1111) 64 87.00 122.09 23 35.94
6322. fastboi (boyfast) 64 91.72 110.08 35 54.69
6323. Bob (bobtehguy) 64 118.82 139.20 44 68.75
6324. Jonathan (bobjoni1233) 64 67.72 77.62 12 18.75
6325. BobbyWasabi (bobby_wasabi_) 64 85.23 109.33 18 28.13
6326. tstats[ayush_] (ayush_) 64 81.81 101.69 26 40.63
6327. Attila (attila1) 64 44.52 54.91 5 7.81
6328. Nazar (aimogenius) 64 72.28 91.22 9 14.06
6329. absor (absor) 64 89.26 113.61 24 37.50
6330. Abdou (abdoulabani1) 64 50.78 70.52 5 7.81
6331. Lim (doxel) 64 69.83 92.77 13 20.31
6332. audran bobo (audran_bobo) 64 30.12 41.41 17 26.56
6333. Dummy (resshin11) 64 56.11 72.32 43 67.19
6334. Luna (wrackspurt) 64 66.35 83.24 9 14.06
6335. Shaw (shaw_7) 64 23.26 28.41 11 17.19
6336. balint (bailnt) 64 66.17 78.60 17 26.56
6337. まぬーゆき (dudebtm_yt) 64 57.23 98.41 21 32.81
6338. Luka (vashakmadze_luka) 64 79.41 98.23 23 35.94
6339. Jackson (jacksonchen666) 64 77.88 110.98 21 32.81
6340. This person (woeaifsdka) 64 55.28 73.52 12 18.75
6341. Tominator (tominator0_0) 64 53.16 67.94 7 10.94
6342. Uemi (uemichan) 64 86.15 103.33 33 51.56
6343. Sage (el_anticristo) 64 47.19 61.50 10 15.63
6344. left testicle (yggvcdghhigt) 64 27.26 35.96 13 20.31
6345. Wooloo (_extremely_bored) 63 105.92 127.77 20 31.75
6346. Speed Cola (zdj361) 63 124.04 134.17 30 47.62
6347. yoyojuice (yoyojuice) 63 103.42 146.22 21 33.33
6348. suhai (xxrapidfirexx) 63 78.64 97.00 16 25.40
6349. oldaccforpracticing (xsdream) 63 91.43 123.17 31 49.21
6350. Matthew (wormshurm) 63 80.13 114.31 17 26.98
6351. Wilford (wilfordjason) 63 123.95 149.81 32 50.79
6352. They don't know me son (war... 63 96.55 133.65 30 47.62
6353. Vahan (vaki) 63 25.42 33.91 14 22.22
6354. Tommy (tommy_sylver) 63 69.45 90.32 28 44.44
6355. Thymme (thymme) 63 84.55 108.82 26 41.27
6356. Mark (tehone4u) 63 62.81 81.39 15 23.81
6357. Spencer (spenciepoo) 63 120.14 148.39 39 61.90
6358. 👽 (sofreakingslow) 63 76.22 93.76 16 25.40
6359. Jacob (slashingpuma) 63 97.75 114.51 26 41.27
6360. Alice (shadowsofwaxwingsslain) 63 71.84 88.86 13 20.63
6361. Kawaii (saranghoe) 63 99.90 126.73 28 44.44
6362. Rakesh Singu (rakeshsingu) 63 68.55 99.02 15 23.81
6363. Putrid (putridacid) 63 60.94 80.25 11 17.46
6364. Pierrot (pierrotplays) 63 113.03 132.39 39 61.90
6365. I'm so trash (peepolove) 63 114.94 129.41 28 44.44
6366. Ballsdeepinthesoup (onlyico... 63 68.23 83.74 14 22.22
6367. ༼ つ ◕_◕ ༽つ (nyr... 63 54.34 72.31 12 19.05
6368. No (noman75) 63 89.69 115.98 30 47.62
6369. Neil (neilt_) 63 87.73 103.71 17 26.98
6370. Mohab Tharwat (mohab97) 63 59.68 88.49 15 23.81
6371. max (max2817max) 63 55.76 73.16 6 9.52
6372. Amar (masteramar) 63 43.76 57.07 4 6.35
6373. Marius (mariusniveri) 63 73.88 87.67 12 19.05
6374. Magzhan (mako_siaa) 63 72.34 94.20 20 31.75
6375. Max (mafab1) 63 118.94 148.45 38 60.32
6376. Thang (lhg81hc) 63 72.15 86.11 14 22.22
6377. ktzzzuuuu (ktzzz) 63 53.80 72.69 12 19.05
6378. コタ (kotasucksatyping) 63 69.56 94.61 13 20.63
6379. Kostaice (kostaice) 63 61.01 75.67 6 9.52
6380. john (kingtypemaster) 63 75.21 90.36 31 49.21
6381. Kit (kesuki) 63 125.16 149.89 42 66.67
6382. Mate (hhmate) 63 59.90 74.78 10 15.87
6383. George (gkoubbe) 63 67.65 83.45 19 30.16
6384. FlyAtNight (flyonkeyboard) 63 84.95 101.06 22 34.92
6385. Evan (elin4046) 63 102.48 123.48 22 34.92
6386. D (davmarksman) 63 47.48 57.48 4 6.35
6387. Oleksandr (c_u_b_e) 63 50.04 60.06 5 7.94
6388. Collin (collin_felter) 63 89.40 107.20 19 30.16
6389. i like to type (chuggaaconr... 63 115.80 141.01 37 58.73
6390. Chrollo (chrollo283) 63 63.76 77.11 12 19.05
6391. abhi (cheapcoder) 63 84.36 104.67 21 33.33
6392. Cel (celerity_) 63 68.64 93.52 22 34.92
6393. Danielle (bunelle) 63 44.26 64.37 8 12.70
6394. Joseph (bnnes714) 63 43.16 61.62 7 11.11
6395. Thien Nam Anh (benvu3005) 63 44.66 56.34 3 4.76
6396. Awz. (awzcubensis) 63 49.55 65.54 11 17.46
6397. Arnold (arnoldlek) 63 82.73 103.99 22 34.92
6398. Huang.zy (amwzhenyu) 63 104.58 134.70 28 44.44
6399. Von (vonjorie) 63 66.95 97.32 12 19.05
6400. Hoàng (hoangloverboy) 63 78.46 93.90 11 17.46
6401. Litefeather (litefeather) 63 57.67 69.60 10 15.87
6402. AbsurdlyBlack (absurdlyblack) 63 78.22 108.47 18 28.57
6403. Jennie (jorab) 63 50.23 62.23 7 11.11
6404. OTERO81 (shashu_191) 63 45.78 58.99 7 11.11
6405. Jax (jaxsnjohnson) 63 56.74 68.93 7 11.11
6406. Seb (sebnivek) 63 56.52 66.80 10 15.87
6407. Zor (zor365) 62 44.10 52.23 6 9.68
6408. Daniel (zdaniel02_) 62 97.98 115.77 25 40.32
6409. Xyexs (xyexs) 62 87.05 105.23 16 25.81
6410. warm (warmthunder51) 62 68.50 88.67 15 24.19
6411. turgz (turgz) 62 91.46 112.05 20 32.26
6412. Wyman (speedy_boi420) 62 96.85 121.49 25 40.32
6413. Jawad (sixtysicks66) 62 54.33 70.75 16 25.81
6414. jm (sirpricebeach) 62 89.86 108.54 25 40.32
6415. Siddhartha (sid_tiw) 62 99.48 120.07 31 50.00
6416. alaa (salaa) 62 66.16 75.03 9 14.52
6417. Rokas (rokasa369) 62 87.82 106.82 25 40.32
6418. Redwan (redwan_360) 62 65.55 82.39 15 24.19
6419. jungle_cruser (redscorn) 62 62.25 71.72 9 14.52
6420. Jesus gives and takes; prai... 62 42.16 55.08 6 9.68
6421. Rabber (polrabber) 62 65.43 85.79 15 24.19
6422. Brendan (panikooooos) 62 121.50 148.43 33 53.23
6423. Oleg (oleg27) 62 90.96 109.84 22 35.48
6424. Nigel (nigeljames) 62 54.32 75.40 9 14.52
6425. ✔️▄◘🚀!new_luca@y... 62 108.16 134.95 32 51.61
6426. Steven (nerobot) 62 67.30 84.68 9 14.52
6427. Neeecu (neeecu) 62 72.43 90.15 14 22.58
6428. Nathan (nat179) 62 81.96 107.05 55 88.71
6429. (narzzz) 62 79.91 102.99 14 22.58
6430. typeracist (moron212) 62 124.04 149.22 41 66.13
6431. Joseph (meshram2001) 62 97.63 118.48 24 38.71
6432. Faisal (md_faisal) 62 63.68 83.04 20 32.26
6433. Márton (marcityperacer) 62 63.13 78.57 18 29.03
6434. Lūkass (lukasslv) 62 76.48 100.84 14 22.58
6435. Robert (lekia) 62 51.02 64.11 8 12.90
6436. I×Blazar×I (lblazarl) 62 110.71 134.43 38 61.29
6437. kabbo (kabbo25) 62 70.96 99.11 17 27.42
6438. Youssef (jo1999) 62 84.65 99.36 15 24.19
6439. N (jaripozz) 62 81.90 94.87 19 30.65
6440. James (james702) 62 105.20 129.72 23 37.10
6441. Cameron (iliveinabox117) 62 63.64 81.42 9 14.52
6442. Gemma (gemmaaa) 62 70.60 91.83 17 27.42
6443. 3ntr0py (fr3udian) 62 95.86 112.32 20 32.26
6444. Africa (ethiopian1252) 62 53.09 67.45 6 9.68
6445. Joel (easynoob) 62 105.29 124.13 22 35.48
6446. Dusan (dusanmilic95) 62 91.86 113.39 24 38.71
6447. Luis (duelistone) 62 104.32 122.92 31 50.00
6448. Biggus (drthunderface) 62 103.34 120.55 35 56.45
6449. jerk (doofenshmirtzevil_inc) 62 59.69 71.50 16 25.81
6450. Jay (dj_jay) 62 63.68 79.34 7 11.29
6451. Brian (desbrigs) 62 77.00 97.29 12 19.35
6452. dafiyoung (dafiyoung) 62 63.71 78.24 14 22.58
6453. Penguino (cspenguino) 62 147.26 168.97 50 80.65
6454. Copernicus (copernicsus) 62 81.09 112.51 22 35.48
6455. Bryce (brycetifer) 62 86.97 120.45 20 32.26
6456. BOBBY (bobbyquinn23) 62 51.41 68.45 6 9.68
6457. Blitz Anschlag (blitzanschlag) 62 62.46 79.08 12 19.35
6458. Alan (bl4n) 62 72.59 90.70 12 19.35
6459. Sumit Prasad (beyonderr) 62 86.93 102.81 27 43.55
6460. Bal (belgianwaffle) 62 115.69 144.43 35 56.45
6461. (atypicaltypist) 62 117.21 152.11 34 54.84
6462. ATHARVA (atharva07) 62 55.75 65.99 7 11.29
6463. Aries Vince (arvj9) 62 68.19 95.23 18 29.03
6464. Anlun (anlun) 62 77.58 100.03 22 35.48
6465. ali (alimuhammadi) 62 38.52 56.60 1 1.61
6466. Ahmed (ahmekal) 62 71.22 84.14 13 20.97
6467. adugna (adex_22) 62 73.62 99.67 17 27.42
6468. Adam (abrokke) 62 77.39 98.47 12 19.35
6469. Abdallah (abdallah1) 62 72.21 83.46 13 20.97
6470. Kobe (kobeelijah111) 62 86.50 112.54 19 30.65
6471. Brandon (thewinterdonut) 62 70.86 93.02 25 40.32
6472. Ali (iliyati) 62 65.44 77.46 12 19.35
6473. Charles (charleswongnt) 62 82.45 108.18 19 30.65
6474. A (axenaxii) 62 59.40 70.03 18 29.03
6475. Newton Gain (newton7) 62 21.73 28.69 17 27.42
6476. idkwhatoyusay (iuseblackswi... 62 82.39 100.24 19 30.65
6477. evan (etearl) 62 58.63 76.45 8 12.90
6478. James (vmisfit) 62 92.99 119.11 23 37.10
6479. Ivan (realstyle) 62 44.92 54.59 10 16.13
6480. Mike Kevin (mkcastro24) 62 75.27 86.76 18 29.03
6481. Ahmad (gharbawy) 62 30.28 39.59 10 16.13
6482. Matthias (_matthias_) 61 65.42 83.54 15 24.59
6483. Marcus (_flipz) 61 89.89 101.95 13 21.31
6484. Tamerlan (zhanglet) 61 56.33 71.36 10 16.39
6485. Jan (zeekat) 61 87.51 118.47 16 26.23
6486. Mustakim (winterflew) 61 72.44 91.63 20 32.79
6487. Alex (wakeful_celery) 61 68.91 87.98 10 16.39
6488. oldweeb (uchiha_obito) 61 89.88 106.16 33 54.10
6489. E (typemctypeface) 61 100.13 118.95 20 32.79
6490. Jarrett (typeguy14) 61 75.85 93.35 24 39.34
6491. tylerthsss (tylerths) 61 112.23 131.21 28 45.90
6492. Tran (ttphu28) 61 42.37 51.99 5 8.20
6493. 🐵🙈🙉🙊🐒🦍... 61 117.27 151.95 33 54.10
6494. Tashrif (tashrif_shahriar) 61 89.68 109.09 24 39.34
6495. shivam (svmyadav) 61 72.09 85.85 9 14.75
6496. Chapri 👛👛 (sunilswain) 61 60.79 85.74 13 21.31
6497. Brayan (sneymo) 61 52.69 71.24 6 9.84
6498. Krishna (shinigami00) 61 64.40 79.03 18 29.51
6499. mariah (serialfriend) 61 98.94 124.75 21 34.43
6500. Satyam (satyamslow) 61 55.19 70.12 10 16.39
6501. Samiha (sammoha) 61 35.46 47.58 2 3.28
6502. Salah (salah135) 61 54.29 68.67 4 6.56
6503. RoA (romori) 61 56.57 67.65 12 19.67
6504. Foole (rizzbor) 61 75.17 87.89 15 24.59
6505. RicoBaby (ricoricoree_) 61 93.53 117.13 38 62.30
6506. Rafeeq (raf_al) 61 77.21 97.70 17 27.87
6507. Qaplan (qaplan) 61 55.71 64.73 24 39.34
6508. Punder (punderland) 61 76.33 92.25 13 21.31
6509. tstats[pumpkinsoup1] (pumpk... 61 121.94 159.47 36 59.02
6510. Bill (proepicgamer101) 61 89.18 119.37 30 49.18
6511. Said (porta_said) 61 37.74 48.48 3 4.92
6512. Plotinus (plotinusdickens) 61 126.32 154.93 40 65.57
6513. Alexander (olekpark) 61 105.56 124.46 26 42.62
6514. Nicholas Dimitrov (nickytyp... 61 84.91 131.20 20 32.79
6515. Denis (newdenispro) 61 65.54 84.82 14 22.95
6516. MysticNovaLord (mysticnoval... 61 63.07 89.59 16 26.23
6517. Shousha (mshousha29) 61 50.69 65.12 7 11.48
6518. Mayank (mmayank74) 61 61.20 79.37 10 16.39
6519. meli (meli0604) 61 88.29 109.28 18 29.51
6520. matthew (mattchy) 61 73.56 83.49 21 34.43
6521. Mathias (mathias64) 61 72.56 99.60 13 21.31
6522. Haiden (manthetypewriter) 61 42.24 56.89 11 18.03
6523. Leukino (leukino) 61 92.91 127.78 20 32.79
6524. kunal (kunaldongre) 61 78.43 96.99 15 24.59
6525. Jethro (jethrofort) 61 76.51 101.59 20 32.79
6526. Jenna (jennafer323) 61 72.83 106.88 16 26.23
6527. Jainam (jainam123) 61 63.29 71.55 13 21.31
6528. Hrant (hrant0) 61 78.98 92.64 16 26.23
6529. SalmanMKC (hellothen) 61 135.57 177.10 9 14.75
6530. silver (gr0ff) 61 94.83 115.86 31 50.82
6531. im bored (googooalp) 61 62.22 80.26 16 26.23
6532. FlameFrost (flamefrost) 61 90.39 112.56 26 42.62
6533. emily (em0p6) 61 45.46 57.24 31 50.82
6534. ekoadipg (ekoadipg) 61 106.51 135.01 23 37.70
6535. Tomaz (dragart) 61 61.21 70.29 12 19.67
6536. Tapioca (davidararipe) 61 75.58 93.62 19 31.15
6537. Darren (darrentheboi) 61 106.21 130.61 24 39.34
6538. Chloe (c_stvr) 61 89.73 111.60 26 42.62
6539. Nicholas (creamycarrots) 61 113.55 139.24 35 57.38
6540. Cowlor (cowlortyper1) 61 98.81 123.46 26 42.62
6541. Gabs (coolkidswag) 61 96.90 121.66 15 24.59
6542. Bruh (chesswithmath) 61 94.40 126.73 27 44.26
6543. UReal (chc39615) 61 83.49 100.80 15 24.59
6544. Audrey (catholicguilt) 61 80.55 102.84 17 27.87
6545. Brent (brvnt) 61 84.91 103.09 20 32.79
6546. arno (boxhill) 61 107.64 138.59 33 54.10
6547. blood (bloodripper) 61 26.19 33.65 8 13.11
6548. Nathan (axewtypes) 61 88.42 116.24 25 40.98
6549. Andrew (andrewwin2003) 61 75.02 94.54 16 26.23
6550. Ahmed (ahmedhallool) 61 48.24 57.93 5 8.20
6551. Parsa (5barsa5seconds) 61 91.21 110.73 21 34.43
6552. Nadiah (naddyhere) 61 75.09 90.01 22 36.07
6553. Nurs (nurs_sarsenov) 61 65.40 79.90 22 36.07
6554. zeno (zeno_sama) 61 36.25 47.63 13 21.31
6555. Destroyer (destroyer101) 61 41.26 69.22 2 3.28
6556. TH127001 (th127001) 61 48.68 64.34 3 4.92
6557. Keng Soon (kengsoon11) 61 49.73 66.10 13 21.31
6558. Simon (simon6609griley) 61 92.06 114.08 28 45.90
6559. Yzmael (yzmael156) 60 98.44 122.38 31 51.67
6560. Regulus ❄ (yo_yo_honey_si... 60 85.58 105.10 16 26.67
6561. JB (wtfhowareyousofast) 60 117.09 151.56 35 58.33
6562. Jay (wolfjay757) 60 84.33 105.30 21 35.00
6563. william (willi30124) 60 68.75 85.89 15 25.00
6564. gayman (vvvvvccvvvvv) 60 68.57 85.55 18 30.00
6565. Vil (vil_) 60 92.89 117.03 20 33.33
6566. Stefan (unknow_stef) 60 56.13 70.78 7 11.67
6567. uglyjeffrey (uglyjeffrey) 60 69.53 89.36 21 35.00
6568. Tyler (tyster02) 60 85.91 98.57 20 33.33
6569. Typer (typertyping) 60 69.32 82.00 11 18.33
6570. viv (toastexee) 60 91.19 116.60 13 21.67
6571. Sulov (sul49) 60 67.82 86.22 19 31.67
6572. spark (sparkkk) 60 81.99 121.23 19 31.67
6573. Shashank (shashu1509) 60 86.09 107.58 15 25.00
6574. Ace (semiace) 60 96.08 120.54 28 46.67
6575. Rasmus (sbares) 60 92.00 109.14 22 36.67
6576. Sandeep (sandeep_bhandari) 60 47.89 60.84 7 11.67
6577. 💓 (samhurwitz) 60 80.86 107.05 55 91.67
6578. Rustam (rustam687) 60 86.04 111.45 20 33.33
6579. harley (questionable0891) 60 50.13 65.93 7 11.67
6580. NitroOrb (nitroorb) 60 86.85 112.81 21 35.00
6581. Nicholas (nicholaslaw07) 60 78.84 101.20 13 21.67
6582. MH (nibir4422322321) 60 55.81 68.67 5 8.33
6583. NejcSLO (nfaca411) 60 52.62 67.34 9 15.00
6584. x (mxlxdx) 60 128.65 175.95 24 40.00
6585. Michael (ms_12) 60 77.34 98.72 13 21.67
6586. Moritz (mogottsch) 60 82.23 96.97 23 38.33
6587. (mistertfy64) 60 96.44 120.46 19 31.67
6588. Shahadat Hossain (md_shahad... 60 46.29 56.41 8 13.33
6589. Mat (mat78) 60 66.83 82.16 7 11.67
6590. Mario (mariojr16) 60 72.50 90.82 16 26.67
6591. Ian (llamasquad) 60 83.61 105.32 19 31.67
6592. Kiara (liptica_k) 60 70.03 85.59 10 16.67
6593. thursdays (liljuicebox491) 60 87.61 126.63 16 26.67
6594. Mark (lemon________) 60 84.24 116.00 19 31.67
6595. Lent√es (lemoninapie) 60 101.38 135.48 28 46.67
6596. fatma (khadigaz) 60 65.45 82.25 18 30.00
6597. Jynn (jynngecko) 60 50.77 66.67 18 30.00
6598. jivanf (jivan108) 60 141.79 178.93 47 78.33
6599. Mic (jesusluvr) 60 71.21 91.52 16 26.67
6600. Jenny (jenny_02) 60 84.19 107.92 13 21.67
6601. JC (invoicingkarma) 60 84.63 103.69 16 26.67
6602. Horizon (hwinangkoso) 60 69.79 83.28 16 26.67
6603. thanh (hust9x) 60 64.71 75.47 12 20.00
6604. Liban (hujala1) 60 144.19 173.54 45 75.00
6605. Xavier (gshizzahs) 60 106.01 127.62 28 46.67
6606. road to 100wpm (getoar112) 60 93.64 115.53 26 43.33
6607. Rachelle (foolishoni) 60 66.48 83.52 8 13.33
6608. Flip (flip2theleft) 60 114.16 144.58 32 53.33
6609. IndianGuy (fastindianguy) 60 94.05 107.45 31 51.67
6610. jayden (fastest11yearoldtyp... 60 92.21 124.83 13 21.67
6611. eric (ericsy) 60 100.04 118.32 23 38.33
6612. Old Theme Rocks (dthp32776) 60 111.55 139.01 30 50.00
6613. big slo (denvr) 60 72.90 91.51 13 21.67
6614. AsadCoder (darkterror07) 60 74.40 103.10 14 23.33
6615. Cole (coles_lambo_15) 60 87.11 110.85 22 36.67
6616. Chan (cognacchan) 60 67.90 85.03 14 23.33
6617. Sheep (celibustbike) 60 66.52 84.43 19 31.67
6618. Carson (carsonting) 60 70.41 97.55 12 20.00
6619. Jonas (calmdownnnnn) 60 73.54 93.43 10 16.67
6620. Noah (bobapplepie) 60 101.78 117.34 26 43.33
6621. Chua (big_boy_pack) 60 78.62 98.35 51 85.00
6622. White (beast_5) 60 73.60 92.86 15 25.00
6623. bayarjargal (bayaraajr) 60 62.12 79.39 27 45.00
6624. Azaza (azazamaster) 60 57.64 67.70 11 18.33
6625. AstroNomix (astronomix) 60 66.45 84.54 15 25.00
6626. Aryan (aryan1504) 60 49.83 65.67 4 6.67
6627. McQueen (aquino_jk) 60 40.31 51.18 4 6.67
6628. Aibek (aosmonov) 60 80.89 99.42 24 40.00
6629. Ankit (ankit0) 60 67.43 78.74 16 26.67
6630. Marko (akagodyr) 60 43.94 54.88 6 10.00
6631. hello (ajblizzard77) 60 74.28 101.44 20 33.33
6632. Vaibhav (ahthserhsluk) 60 55.90 73.03 15 25.00
6633. ahmet (ahmetyilmaz2002) 60 72.65 95.04 13 21.67
6634. Harrison (happierwizard) 60 73.43 91.23 19 31.67
6635. Joanne (jowelch25) 60 62.74 78.35 14 23.33
6636. Urushihara (urushihara23) 60 40.64 52.36 5 8.33
6637. makenna (kenniekat) 60 67.42 76.16 12 20.00
6638. shiraku (otvxtyper) 60 78.26 91.36 16 26.67
6639. ss (ssiq) 60 48.72 61.11 6 10.00
6640. xdom (xdomiino) 59 82.69 106.41 21 35.59
6641. weeAzuL (weeazul) 59 67.93 85.65 15 25.42
6642. Volxage (volxage) 59 90.84 110.32 17 28.81
6643. viper (viper3315) 59 67.21 78.35 10 16.95
6644. none_of_ur_business (underc... 59 75.02 95.70 16 27.12
6645. Miku (undeadninja) 59 83.34 96.63 15 25.42
6646. Marc (tomatenmarc) 59 62.25 80.39 11 18.64
6647. TITAN (titan_daddy) 59 55.26 73.24 12 20.34
6648. The D Legend (the_d_legend) 59 84.02 97.02 14 23.73
6649. TheZacher5645 (thezacher5645) 59 91.55 114.00 17 28.81
6650. Hamz (thehamzarocks) 59 72.83 86.93 19 32.20
6651. Tasnimul (tasnimul) 59 67.46 87.84 13 22.03
6652. Sylvester (sylvestertyper) 59 94.27 110.76 17 28.81
6653. Karina (syj4434) 59 79.22 100.26 25 42.37
6654. Md Ahad Ali (sumon_ahmmed_001) 59 26.71 31.54 9 15.25
6655. Shikhraj (shikhrajsingh) 59 107.81 129.86 25 42.37
6656. Seb (sebastiancv) 59 87.46 106.19 19 32.20
6657. Santiago (santiago101604) 59 71.39 99.24 15 25.42
6658. tstats[rtupps] (rtupps) 59 63.56 84.67 9 15.25
6659. Sion (retardation69) 59 46.39 55.17 5 8.47
6660. handshurt (ozzytheasian) 59 94.76 125.88 29 49.15
6661. Deimer (ogdeimer) 59 70.26 95.18 15 25.42
6662. Andrew (nosingaround) 59 121.38 142.54 29 49.15
6663. Jordan (mrkentman) 59 81.21 100.73 20 33.90
6664. m0gu (mogumogu_) 59 72.25 91.01 12 20.34
6665. Marcus (marcusmandarin) 59 105.60 132.55 29 49.15
6666. hngggg (m4saki) 59 88.58 112.14 25 42.37
6667. lRaml (lsomeonel) 59 88.02 108.63 23 38.98
6668. Jusuf (kz99) 59 83.38 103.40 17 28.81
6669. JumpingPenguin (jumpingpeng... 59 85.79 103.73 23 38.98
6670. JSlyk (jslyk) 59 69.92 95.16 19 32.20
6671. Mujeeb's (jeffyglue) 59 120.48 151.67 39 66.10
6672. burrito1 (jacobef2) 59 121.46 142.15 29 49.15
6673. Jackoman (jackoman) 59 36.05 41.70 6 10.17
6674. idost (idost) 59 63.75 72.70 14 23.73
6675. ∞ (gatewaydrug) 59 111.03 125.60 29 49.15
6676. frost (frost99) 59 67.69 80.87 12 20.34
6677. ants (fr4nc3) 59 116.43 138.27 30 50.85
6678. finityfly (finity_fly) 59 113.79 131.06 26 44.07
6679. Leroy (fazecringe) 59 87.22 107.09 20 33.90
6680. Michael (ezykielue) 59 91.88 108.06 19 32.20
6681. Vagesh (don1909) 59 60.66 68.67 9 15.25
6682. Dhvanik (dj_viradiya) 59 56.39 67.67 12 20.34
6683. Daniar (dankas23) 59 37.00 45.43 1 1.69
6684. dani (daniellielikesanime) 59 67.92 82.65 10 16.95
6685. Joey (coxoncable) 59 89.56 112.69 19 32.20
6686. Connor Craig (conn_fused1) 59 86.36 102.10 13 22.03
6687. Clint (clint_kun) 59 115.32 135.10 25 42.37
6688. cheryl (cheryl08) 59 78.63 92.94 10 16.95
6689. Kai (cheongengkai) 59 89.38 109.45 15 25.42
6690. Charts (charizardpotato) 59 90.26 106.06 27 45.76
6691. ⭕⃤ (carmatain) 59 102.02 140.32 24 40.68
6692. carl (captain_deadpooooool) 59 66.15 78.04 14 23.73
6693. Viktor (c0re_dump) 59 66.11 84.70 14 23.73
6694. Narut (blowingbubbles) 59 100.59 124.78 22 37.29
6695. Joseph (bigboybo28) 59 76.04 93.30 21 35.59
6696. Caleb (balecus53) 59 77.20 91.56 9 15.25
6697. Ashray (ashraygupta1) 59 72.23 88.29 12 20.34
6698. ark (arkundu) 59 87.70 111.76 41 69.49
6699. arjun (arjun_gamine) 59 54.87 70.02 7 11.86
6700. Alex (alexlea444) 59 96.25 110.45 21 35.59
6701. Feruz (akhbekdev) 59 45.31 56.41 6 10.17
6702. Arthur (ajdem) 59 104.92 125.03 29 49.15
6703. aa (aanyc) 59 59.58 71.25 9 15.25
6704. Raj Gaurav (01indian) 59 56.45 67.56 15 25.42
6705. Rageon (rageon787) 59 51.34 66.04 5 8.47
6706. Sowm (sowm) 59 48.03 60.58 4 6.78
6707. Vance (lamnbda) 59 62.62 79.27 9 15.25
6708. Damian (bigsweat) 59 70.68 90.42 13 22.03
6709. Shahryar (_shahryar_pjr) 58 94.57 124.23 31 53.45
6710. 🏎️Ziad (ziad_hamdy) 58 54.82 73.70 4 6.90
6711. Steven (xuqc01) 58 101.65 122.96 24 41.38
6712. Wepeel (wepeel) 58 88.07 122.85 22 37.93
6713. Adam (vincentadam) 58 70.91 82.22 13 22.41
6714. JP (vikiperle08) 58 65.11 88.92 15 25.86
6715. pp (urppsmolhaha) 58 77.99 93.40 15 25.86
6716. Bill (trainingb4tests) 58 96.88 127.99 22 37.93
6717. purplefr|ction (tesla_diesel) 58 115.38 149.11 28 48.28
6718. diko (sniperab3) 58 41.07 52.00 3 5.17
6719. Sk1tt (sk1tt) 58 87.02 115.22 14 24.14
6720. silver_hamburger (silver_ha... 58 33.25 44.48 6 10.34
6721. Shoaib (shoaibesam) 58 55.78 76.97 2 3.45
6722. (scaphism) 58 130.32 166.57 39 67.24
6723. Sahil (sahil21db) 58 87.01 106.76 10 17.24
6724. ryo (ryolate) 58 85.87 101.85 19 32.76
6725. (razor11223344) 58 87.78 100.28 23 39.66
6726. tango (rangotango) 58 70.94 97.78 34 58.62
6727. Rajesh (rajesh110494) 58 82.23 100.87 16 27.59
6728. Damon (pvdorginal) 58 96.23 117.74 20 34.48
6729. Sebastian (proudpole) 58 91.92 115.47 19 32.76
6730. Professional (professional_... 58 76.44 95.55 16 27.59
6731. WIZard (prasadbhoir6786) 58 76.02 111.14 13 22.41
6732. Boog (pinchejoseph) 58 46.33 59.24 13 22.41
6733. Pharrell (pharrell000000) 58 45.96 65.41 8 13.79
6734. Ronnie (onie12) 58 98.89 134.91 23 39.66
6735. Tyler (oktherefella) 58 105.98 131.93 29 50.00
6736. Chih-hai (oceansfavor) 58 63.66 72.27 10 17.24
6737. Nokzendi (nokzendi) 58 79.28 99.03 13 22.41
6738. Deepanshu (namelesswonder) 58 53.83 69.93 6 10.34
6739. zombo (midgetmigerian) 58 94.27 110.90 24 41.38
6740. i have no (miamam) 58 96.68 132.73 20 34.48
6741. Nathan (memewhat123) 58 62.69 77.17 7 12.07
6742. For_real (mailindra) 58 84.63 106.18 18 31.03
6743. QK Alice Duo (macz1991) 58 128.03 153.35 26 44.83
6744. laljan (laljan) 58 57.92 68.66 10 17.24
6745. Krowa (krowa) 58 82.26 100.05 17 29.31
6746. Krunch (kommanderk) 58 61.81 75.27 9 15.52
6747. kemiy (kemiy) 58 115.95 139.01 30 51.72
6748. Karsen (karguy3) 58 79.41 98.34 19 32.76
6749. Kanna (kannamanna) 58 78.76 96.45 16 27.59
6750. Matthew (juanspoon) 58 110.65 135.70 39 67.24
6751. Jeff (jeformica) 58 91.78 115.38 20 34.48
6752. Wyatt (isometricman) 58 94.61 126.09 30 51.72
6753. Ishaque (ishaque) 58 75.33 88.93 12 20.69
6754. RedRashGrain (improvising_m... 58 86.98 101.13 19 32.76
6755. Highfire1 (higfire1) 58 72.78 88.41 17 29.31
6756. Tom (hes_the_fastest) 58 41.96 54.30 3 5.17
6757. Dao (heavenrefining) 58 50.56 70.17 21 36.21
6758. Glenn (glenn101107) 58 89.63 109.21 21 36.21
6759. sussybaka (fknneeow) 58 85.88 104.85 14 24.14
6760. EM_K (em_k) 58 83.98 100.82 18 31.03
6761. Drew (drew1008) 58 70.11 84.39 18 31.03
6762. Demtros (demtros) 58 91.87 115.63 25 43.10
6763. relaxx (cloudkid) 58 98.70 121.45 21 36.21
6764. Chino (chinotorres_142) 58 57.56 72.90 13 22.41
6765. Marco (chino01) 58 74.77 90.11 11 18.97
6766. Burning (burningyolo) 58 54.16 67.23 7 12.07
6767. berk (birb_v2) 58 49.89 57.95 3 5.17
6768. ㅤ (bazar397) 58 78.18 93.56 14 24.14
6769. baekos (baekos) 58 57.96 73.40 9 15.52
6770. athresh (athresh) 58 79.49 101.22 12 20.69
6771. Ashen (ashencone) 58 62.84 74.01 10 17.24
6772. ARA (araaraara2) 58 50.13 74.75 6 10.34
6773. Mar (aqancake) 58 88.24 107.34 22 37.93
6774. Alvise (anklud) 58 70.17 82.63 13 22.41
6775. Dan Jeryll (almadendj) 58 119.68 133.30 32 55.17
6776. Almas (almas016) 58 46.43 54.00 10 17.24
6777. Akhil (akhil_kunadiya) 58 39.86 51.82 2 3.45
6778. smuel (14adamssam) 58 70.32 83.66 13 22.41
6779. Dr_Sagui (drsagui) 58 63.54 82.26 5 8.62
6780. Lourens (lourens) 58 51.71 63.64 8 13.79
6781. sweet (slowly_salty) 58 40.09 56.33 2 3.45
6782. Zulfiqar (fiqar_29) 58 43.63 52.06 7 12.07
6783. Zuel (zuel) 58 32.81 41.45 3 5.17
6784. tstats[_skrt_skrt_] (_skrt_... 57 72.78 86.42 11 19.30
6785. ... (zviki) 57 68.52 80.82 17 29.82
6786. zhen (zhen_pei) 57 87.34 118.40 16 28.07
6787. Matthew (yourtrashkld) 57 90.15 106.15 20 35.09
6788. Xray (xrayburst) 57 55.22 65.11 9 15.79
6789. Wassim (wxssim) 57 67.36 91.45 19 33.33
6790. wub (wub_wub) 57 95.11 117.60 26 45.61
6791. ezza (winko_) 57 78.72 93.18 18 31.58
6792. Ako ay (walangpera) 57 106.23 128.27 18 31.58
6793. v (typer953) 57 81.01 109.00 19 33.33
6794. Pratik (trippyhob) 57 97.17 116.47 25 43.86
6795. Derp (thelol) 57 97.37 119.01 43 75.44
6796. Taylor (taylorcuber717) 57 95.26 119.06 24 42.11
6797. takenbyWine (takenbywine) 57 60.12 72.22 10 17.54
6798. Shubham (shubham409) 57 29.33 40.73 8 14.04
6799. Shiheng (sbiengo_sama) 57 72.51 86.59 21 36.84
6800. Sarah (sarah_the_slow_typer) 57 53.34 67.58 7 12.28
6801. sanayaa (sanayaa) 57 80.93 98.66 18 31.58
6802. Rocco (roccoduck) 57 78.01 100.66 12 21.05
6803. Rishi (rishipoonia) 57 36.93 53.78 6 10.53
6804. de (paradoxpigeonlaptop) 57 147.99 193.51 35 61.40
6805. Thomas (palsgod) 57 138.99 164.84 46 80.70
6806. Pacu (pacutv) 57 91.64 109.85 11 19.30
6807. Eddie (nightwing_eddie) 57 90.27 108.80 21 36.84
6808. nicole (nicoleyee_) 57 57.40 69.86 13 22.81
6809. Lemon (mrlemon) 57 73.30 104.64 13 22.81
6810. NGONO (mnae) 57 40.43 57.79 2 3.51
6811. Mark (markstone_141) 57 78.84 92.53 19 33.33
6812. mamounitor (mamounitor) 57 55.79 85.75 11 19.30
6813. A (lvorg) 57 72.13 88.19 17 29.82
6814. luckylian123 (luckylian123) 57 71.20 94.04 18 31.58
6815. Ali (lembugoreng) 57 91.91 111.30 15 26.32
6816. krishan (krishan_pro) 57 60.72 76.63 14 24.56
6817. Elvis (krewe11a) 57 148.59 166.93 0 0.00
6818. Jacob (jakkbb) 57 80.38 94.07 32 56.14
6819. jaeg3r (jaeg3r) 57 84.66 99.32 14 24.56
6820. Jacob (jacobtolstrup) 57 51.37 64.43 5 8.77
6821. jack (jack815) 57 98.48 125.58 25 43.86
6822. Troy (ic3b3rg) 57 61.99 76.21 17 29.82
6823. hbomb (hbomber) 57 64.28 84.49 25 43.86
6824. Anthony (funger99) 57 85.82 101.31 10 17.54
6825. F (frogliker) 57 72.98 85.65 11 19.30
6826. Fan (firesale) 57 67.30 81.33 15 26.32
6827. fesd (fesd20) 57 68.50 84.83 16 28.07
6828. Eric (edestroyer2604) 57 66.98 77.31 14 24.56
6829. Joe (dostojoe) 57 54.19 67.73 4 7.02
6830. Mayank (divine_godspeed) 57 72.45 89.99 6 10.53
6831. Ashvini (danger_anna) 57 49.76 66.80 11 19.30
6832. Cristian (crism123dm) 57 59.58 78.16 9 15.79
6833. Chinmay (chinmay26) 57 65.37 78.72 12 21.05
6834. Bob (cakesenpie) 57 113.00 138.65 28 49.12
6835. Jared (buckdancer) 57 96.47 115.20 21 36.84
6836. Joey (bpextermin8) 57 95.44 117.10 24 42.11
6837. Banzexxx (banzexxx) 57 73.32 83.01 12 21.05
6838. Avery (ba0z1) 57 94.22 120.99 35 61.40
6839. Travis (azgoalie) 57 66.10 88.17 13 22.81
6840. avighna (avighna) 57 67.79 92.03 13 22.81
6841. Anshu79 (anshu79) 57 62.05 79.78 15 26.32
6842. and (andy_r8) 57 72.04 92.15 15 26.32
6843. Ella (amhaissup) 57 91.96 113.44 18 31.58
6844. Akuma (akumaayush) 57 60.24 73.22 4 7.02
6845. S J (abhi_28) 57 71.58 92.30 20 35.09
6846. Ziad (0ziadmohamed0) 57 71.25 82.89 16 28.07
6847. pearce (09mantaray) 57 111.83 150.57 31 54.39
6848. Charles (cwayne) 57 73.06 83.77 13 22.81
6849. Andres (primedope27) 57 54.67 63.68 5 8.77
6850. k. (luvmissjanet) 57 44.39 55.36 7 12.28
6851. Matias (matias2030nuevo) 57 26.79 36.46 15 26.32
6852. Michel (michelena) 57 66.54 85.50 13 22.81
6853. dad (dadadu) 57 61.88 72.96 9 15.79
6854. Neesh (neesh774) 57 101.32 127.80 50 87.72
6855. Thomas (mrprgmr) 57 39.06 51.76 3 5.26
6856. divya (divyaggle) 57 39.00 46.47 4 7.02
6857. Im a (belowaveragegang_69) 57 53.81 89.44 13 22.81
6858. Atos (wolfcash) 56 87.05 100.56 15 26.79
6859. Seri (vincent_aik) 56 93.17 109.08 22 39.29
6860. Uxna (uxna) 56 103.73 127.16 26 46.43
6861. Eric (unfazedglitch) 56 102.20 118.23 25 44.64
6862. Vincent (turbovince) 56 63.76 73.14 14 25.00
6863. Tobi_Uchiha_Rama (tobi_uchi... 56 45.98 55.22 9 16.07
6864. sachin (timsixit) 56 54.87 71.89 9 16.07
6865. TastyApple (tastyapple) 56 96.41 112.68 24 42.86
6866. Svetoslav (svera) 56 54.33 64.66 6 10.71
6867. stas (stasats) 56 32.77 42.49 0 0.00
6868. Souhardya (souhardya98) 56 82.34 100.67 20 35.71
6869. Jayden (slawsome) 56 56.45 67.73 2 3.57
6870. Surya (shanky_111) 56 44.80 57.17 4 7.14
6871. rugbyBREAD (rugbybread4free) 56 93.59 111.03 24 42.86
6872. Radek (radecekwriter) 56 85.35 99.32 18 32.14
6873. Provocative (provocativepig... 56 90.19 112.10 20 35.71
6874. Zeus (princey) 56 55.88 66.59 7 12.50
6875. Boeing (planetyper78) 56 100.02 117.84 25 44.64
6876. Khastro (peterakd) 56 108.33 144.60 26 46.43
6877. OvenHeat (ovenheat) 56 117.64 163.03 37 66.07
6878. notoverhere (notoverhere) 56 66.11 85.42 12 21.43
6879. Hamza (nerodine) 56 74.67 89.30 16 28.57
6880. narze (narze) 56 86.80 123.42 15 26.79
6881. Jay (myladyjay) 56 69.52 88.56 13 23.21
6882. MoreZigLessZag (morezig) 56 62.86 78.11 14 25.00
6883. Monjur 101 (monjur_ahmed) 56 33.76 41.70 5 8.93
6884. mataio (mataioo) 56 41.61 51.48 8 14.29
6885. Ludvig (luddez1) 56 93.04 113.82 23 41.07
6886. ✔️▄◘🚀!new_luca@y... 56 133.95 214.36 34 60.71
6887. Santiago (londono19) 56 100.08 123.36 16 28.57
6888. Alex (laralex) 56 85.10 100.32 21 37.50
6889. Md Ibrahim Hossain (komlaka... 56 61.78 69.79 12 21.43
6890. Hùng (kenkenkiota) 56 96.93 116.28 23 41.07
6891. Andrea (kazari) 56 90.97 105.14 26 46.43
6892. Kasiourasg (kasiourasg) 56 108.62 133.06 33 58.93
6893. Kabadahija (kabadahija30) 56 59.63 72.51 3 5.36
6894. Joey (jmschrum) 56 80.10 95.99 17 30.36
6895. Jerichaux (jerichaux) 56 112.70 134.50 28 50.00
6896. Ineluctable (ineluctable) 56 107.00 141.31 27 48.21
6897. Hajun (improve_ever) 56 109.30 135.29 39 69.64
6898. Ren Hariren (hari623) 56 105.94 123.27 36 64.29
6899. KENNETH (happydino) 56 94.75 120.14 24 42.86
6900. James (frxction) 56 98.31 119.23 18 32.14
6901. smolPixie (extraprincess) 56 86.03 105.21 18 32.14
6902. Etienne (etienne_bepo) 56 93.17 111.64 3 5.36
6903. Dave (davethreed) 56 56.11 68.03 5 8.93
6904. Sid (cynocid) 56 93.82 117.15 21 37.50
6905. Cylindian (cylindian) 56 104.53 123.73 21 37.50
6906. Parth (cracker2111) 56 44.72 61.90 7 12.50
6907. ch_tyt (ch_tyt) 56 72.86 90.96 13 23.21
6908. chubbybala (chubbybala) 56 78.18 90.73 14 25.00
6909. juggy (cannary) 56 46.10 61.48 6 10.71
6910. brutalranked (brutalranked) 56 66.42 78.12 13 23.21
6911. Jongchan (bot_chan) 56 75.94 95.03 9 16.07
6912. Tawanda (bigx) 56 54.82 69.17 11 19.64
6913. Benjamin (bigbentypes246) 56 75.61 90.98 15 26.79
6914. besto (besto) 56 57.28 72.09 13 23.21
6915. Ben (benjaminweschler) 56 80.46 107.50 18 32.14
6916. Ahmed (beet790) 56 69.44 83.37 10 17.86
6917. bananana (bana_na) 56 52.06 61.46 5 8.93
6918. June (avvieey) 56 87.04 111.21 15 26.79
6919. Holder (arcanezer0) 56 96.80 122.33 21 37.50
6920. Andraž Gradišnik (andgrad) 56 102.96 123.32 25 44.64
6921. ali (alifat) 56 50.00 58.55 5 8.93
6922. Abhishek (abkrth) 56 78.14 93.47 15 26.79
6923. abhi (abhi_sama) 56 77.02 96.89 18 32.14
6924. 0x045f (0x045f) 56 111.70 142.33 33 58.93
6925. smooll (smoollbrain) 56 46.36 61.01 7 12.50
6926. Ben (benjib) 56 78.45 98.02 17 30.36
6927. ArcWand (arcwand) 56 79.86 101.98 13 23.21
6928. tasnim (r4f1d) 56 37.28 51.86 6 10.71
6929. tstats[kfinimizer] Kfinimiz... 56 49.11 68.18 6 10.71
6930. rex (rex_k) 56 63.59 82.54 16 28.57
6931. Gio (flordepapel) 56 88.65 108.21 16 28.57
6932. Herman (monstrule) 56 61.70 73.40 11 19.64
6933. G (igaurav) 56 35.04 49.02 7 12.50
6934. sexy (sexykid) 56 48.69 60.44 7 12.50
6935. Magnus (magnusfss) 56 54.48 64.49 11 19.64
6936. Ethen (__ethen_03) 55 72.51 89.58 11 20.00
6937. Avi (_avi_) 55 96.38 112.36 20 36.36
6938. Zahra (zahra_a) 55 50.60 62.20 14 25.45
6939. Kaushik (yeswekey) 55 96.65 112.10 16 29.09
6940. marsh (yepeyi) 55 131.86 155.37 34 61.82
6941. Yaniv (yaniv691) 55 55.06 67.69 13 23.64
6942. danny (xsoii) 55 57.54 71.43 8 14.55
6943. Steven (xdstephano) 55 80.01 104.02 8 14.55
6944. fck you latency (whihi) 55 127.31 145.90 29 52.73
6945. VitaliK (vitalik_2961) 55 66.42 79.02 12 21.82
6946. vexx32 (vexx32) 55 49.03 62.26 7 12.73
6947. vayuputra (vayuputra) 55 50.60 67.75 9 16.36
6948. Albert (tastiermite) 55 98.06 118.36 25 45.45
6949. Phil (sticky1981) 55 69.27 83.62 17 30.91
6950. Thomas (speedbro) 55 67.89 89.07 15 27.27
6951. San (slowcatnospeed) 55 27.61 34.71 7 12.73
6952. Shadow (shadow_devil) 55 61.76 81.37 9 16.36
6953. Sambhalang (samkchandy) 55 81.47 101.62 19 34.55
6954. Robert (rzyao) 55 85.58 108.27 16 29.09
6955. Russ (russcoder) 55 88.14 115.91 20 36.36
6956. Ravindu (ravindu08) 55 62.38 75.68 11 20.00
6957. Jack (randomdize) 55 71.50 103.47 13 23.64
6958. Raging (ragingthunder) 55 89.65 107.19 21 38.18
6959. Xavier (qiltz) 55 70.84 86.25 15 27.27
6960. pingukalinu (pingukalinu) 55 55.76 70.78 4 7.27
6961. Nikolay (niki12120) 55 48.20 61.14 26 47.27
6962. Ying-Chen (nash_equilibrium) 55 54.16 64.73 6 10.91
6963. Nabiha (nabiha_fatima01) 55 34.76 40.98 2 3.64
6964. mellismacka (mellismacka) 55 91.21 108.15 21 38.18
6965. McKle (mckle7) 55 85.17 101.79 14 25.45
6966. Matt (mattmen) 55 46.87 68.13 3 5.45
6967. YLime (lacua) 55 67.17 78.65 10 18.18
6968. Konrad (konradgoldammer) 55 83.78 100.95 16 29.09
6969. Victor (kizamui) 55 76.52 94.02 15 27.27
6970. Kirby (kirbyjs) 55 65.89 84.06 12 21.82
6971. fast af (josh53___) 55 94.10 112.89 23 41.82
6972. Joseph (josefmcbrosef) 55 83.68 112.11 21 38.18
6973. joseph (jmuganga544) 55 57.88 73.97 11 20.00
6974. Jasur (jasurava) 55 30.89 44.81 9 16.36
6975. Jaskirat (jaskiratsingh) 55 99.65 128.48 26 47.27
6976. Jack (jack90001) 55 115.33 139.33 28 50.91
6977. Pakko (iam_mzaa) 55 65.96 82.37 14 25.45
6978. Donald (hotdognalds) 55 110.66 151.30 30 54.55
6979. Dalia (flowhy_) 55 76.42 93.03 17 30.91
6980. Halo (fishmona) 55 57.50 74.46 8 14.55
6981. Fireworks (fireworkkss) 55 96.25 111.19 22 40.00
6982. Ficfiris (ficfiris) 55 62.38 72.94 10 18.18
6983. Cobra (devanshj) 55 83.63 98.97 16 29.09
6984. derfet (derfet) 55 53.31 66.08 6 10.91
6985. David (davidcaron) 55 70.62 90.20 15 27.27
6986. danydoo (danydoo) 55 68.36 79.40 14 25.45
6987. Daisy (daisy_sun) 55 66.42 84.75 14 25.45
6988. cool_whip (cool_whip) 55 88.91 106.04 12 21.82
6989. Joe (cobiejoe96) 55 86.12 102.87 14 25.45
6990. Ollie (cheerfulnihilist) 55 83.82 108.08 16 29.09
6991. charlene (charlenemiao) 55 59.30 72.28 7 12.73
6992. Krishna (chaithu97) 55 65.00 76.19 18 32.73
6993. carina (carina_caily) 55 47.03 77.47 17 30.91
6994. mike (brons48) 55 85.41 125.15 19 34.55
6995. Brandon (brandonzfu) 55 93.43 125.23 22 40.00
6996. Pin (bleeep) 55 70.45 82.28 16 29.09
6997. Adrian (bigbadbui) 55 91.34 119.68 18 32.73
6998. Barry (barry21) 55 75.61 90.86 9 16.36
6999. Azaro (azaroarazenka) 55 124.86 157.57 45 81.82
7000. St (amirey) 55 65.40 84.57 14 25.45
7001. Alnebras04 (alnebras04) 55 63.95 91.13 9 16.36
7002. Aljaz (aljazb) 55 62.04 75.25 12 21.82
7003. Al-amin (alamin01) 55 34.25 41.20 4 7.27
7004. Andy (akapgan) 55 75.24 94.72 15 27.27
7005. nela camelia (agatha67) 55 43.95 57.62 5 9.09
7006. Afraidofthebomb (afraidofth... 55 125.16 159.29 38 69.09
7007. Adamite (adamite2k) 55 99.54 122.21 17 30.91
7008. David (actavis666) 55 69.08 83.53 19 34.55
7009. Asilbek (acilbek) 55 35.27 47.83 1 1.82
7010. John Paul (gizoru) 55 52.60 64.27 9 16.36
7011. Jez (jezmann) 55 49.85 65.77 9 16.36
7012. Jojo (jojannes1) 55 66.29 85.55 9 16.36
7013. tstats[david2444] (david2444) 55 76.24 90.75 13 23.64
7014. trangdh (choechoichang) 55 88.00 106.92 22 40.00
7015. Jai (jaipi) 55 40.78 57.98 6 10.91
7016. Josh (hyper_amoeba) 55 66.47 82.30 24 43.64
7017. Dylan (playboiidylan) 55 65.49 81.23 10 18.18
7018. Lucy (ldarwish) 55 63.21 78.96 11 20.00
7019. Jacob (jacob_legere) 55 80.99 96.74 16 29.09
7020. Jupiter (content_jupiter1) 55 44.55 55.90 3 5.45
7021. Ken (kunai502) 55 127.50 149.49 37 67.27
7022. Badi (badi159) 55 71.55 86.98 14 25.45
7023. Tengis (tengis) 55 48.47 59.52 1 1.82
7024. hooj (hoojamaphut) 55 79.78 109.26 19 34.55
7025. Gab (harold156) 55 50.93 63.70 5 9.09
7026. Jack (jackneall) 55 41.29 51.12 5 9.09
7027. kapforty (kapforty) 55 96.96 125.37 17 30.91
7028. Simmons1 (_simmons) 54 71.89 88.11 16 29.63
7029. Wujue (wujue) 54 59.59 68.26 12 22.22
7030. SHIVA (vishu_01) 54 67.43 87.77 17 31.48
7031. Dmitrii (typescore) 54 44.89 59.06 12 22.22
7032. Talby (talby) 54 110.80 143.36 26 48.15
7033. Sujeev (sujeev) 54 53.66 70.40 7 12.96
7034. sturge (sturgee) 54 72.45 105.79 14 25.93
7035. procrastinating (sticknleaf) 54 105.34 129.21 28 51.85
7036. Stanley (stanleyzhang9) 54 111.58 135.86 33 61.11
7037. tstats[ssohrab] (ssohrab) 54 97.75 129.86 15 27.78
7038. e-mili (speedy_007) 54 91.71 117.01 15 27.78
7039. erty (someone8888) 54 107.72 139.67 29 53.70
7040. slayerofthend (slayerofthend) 54 112.72 144.10 35 64.81
7041. Shishcobober (shishcobober2) 54 81.38 98.73 12 22.22
7042. Rommel (seekercuriousityxx) 54 49.72 68.76 7 12.96
7043. Joel (seasmoke) 54 73.10 90.04 11 20.37
7044. Reuben (reubensong) 54 97.82 136.15 26 48.15
7045. Raghavan G V (raghavangv) 54 74.83 96.79 15 27.78
7046. Pszymek (pszym) 54 77.54 109.82 16 29.63
7047. prince (prince_singh) 54 36.66 44.69 6 11.11
7048. James Wolfe (primalnacl) 54 80.03 99.85 20 37.04
7049. pranked (pranker666) 54 84.12 102.91 18 33.33
7050. Cihsa (oddlysatisfly) 54 96.79 115.65 20 37.04
7051. Dennis (ocrayat16) 54 72.07 91.36 12 22.22
7052. Nicholas (nsabadicci) 54 91.68 117.88 17 31.48
7053. Slava (not_okay) 54 74.75 83.76 9 16.67
7054. daniel (notorious13366) 54 33.76 47.73 11 20.37
7055. Kevin (noimkevin) 54 120.65 137.04 31 57.41
7056. Chad (nicwin) 54 112.10 139.29 26 48.15
7057. Nicholas (nicszerman) 54 82.12 100.65 19 35.19
7058. nguyen (nguyenanh2004) 54 61.02 75.38 9 16.67
7059. Yasir (nay_yar110) 54 56.25 79.15 5 9.26
7060. Nate (nateog) 54 103.97 134.72 23 42.59
7061. Muaj17 (muaj17) 54 88.04 110.32 36 66.67
7062. molnar (molnaredom) 54 38.99 47.17 7 12.96
7063. chapo (mnxchapo) 54 97.94 120.79 16 29.63
7064. Maynard (mftrumpet) 54 104.36 133.63 27 50.00
7065. Master (masterdvorak) 54 82.86 98.28 12 22.22
7066. Jun Jie (lemontea387) 54 100.60 124.17 22 40.74
7067. 😳😳😳 (lanterex) 54 97.00 110.60 23 42.59
7068. Made In (kosowarner) 54 112.42 133.99 47 87.04
7069. toki (kizunajemini2205) 54 99.09 129.14 26 48.15
7070. Teeratat (kiwi2002) 54 79.07 96.85 12 22.22
7071. Alex (khanis1) 54 85.96 102.06 15 27.78
7072. Keegan (keegan9503) 54 70.68 87.83 14 25.93
7073. Basil (kaneki_k3n) 54 92.71 114.19 16 29.63
7074. Joshua (joshuawn) 54 151.28 180.63 43 79.63
7075. Jazz (jazzfunk37) 54 79.71 95.65 18 33.33
7076. Jp (j12p21) 54 88.64 110.42 11 20.37
7077. Ben (izeben) 54 100.78 122.07 17 31.48
7078. ibean (ibean) 54 69.15 81.27 15 27.78
7079. hulkari (hulkari) 54 64.13 76.81 16 29.63
7080. BreadForAll (hollowshadow) 54 103.87 126.93 20 37.04
7081. 𒅃 (hdgamez) 54 112.64 134.23 30 55.56
7082. Harjot (harjot_singh) 54 74.37 90.06 13 24.07
7083. Colemak (half_as_fizzy) 54 85.68 105.61 18 33.33
7084. Phil (gunner_shents) 54 35.39 41.95 3 5.56
7085. Boris (goat_56) 54 127.92 199.81 33 61.11
7086. Gazeekoo (gazeekoo) 54 65.59 78.26 12 22.22
7087. Amare (endmaster64) 54 60.53 75.57 53 98.15
7088. Emma (embunde7) 54 92.40 122.10 34 62.96
7089. Ducu (ducu) 54 59.89 67.96 10 18.52
7090. Douglas (douglaswaugh) 54 66.47 78.71 11 20.37
7091. Timothy (dilexed) 54 51.00 66.76 7 12.96
7092. David (davidthegreat) 54 65.99 86.81 16 29.63
7093. A (dasupakiwi) 54 65.99 83.81 13 24.07
7094. Scott (chivalrousbanana) 54 45.44 57.59 4 7.41
7095. bruh (bruhmoment8964) 54 152.60 172.84 47 87.04
7096. Armisael (brandonbro) 54 76.43 101.40 19 35.19
7097. Bone (bonepriest) 54 83.81 119.60 16 29.63
7098. 2XKO WAITING ROOM (bloodyra... 54 100.88 125.12 15 27.78
7099. Bleachinq (bleachinq) 54 85.32 103.50 12 22.22
7100. Amarpreet (bhangu_05) 54 55.81 68.43 4 7.41
7101. Biohazard (b10hazard_) 54 86.54 106.23 7 12.96
7102. Krishna (aurum_est_potestas) 54 71.31 86.05 15 27.78
7103. Arman (arminhammer) 54 50.91 66.58 4 7.41
7104. Ava (argerami) 54 63.35 81.39 17 31.48
7105. V (alfredpennywrth) 54 97.88 113.98 19 35.19
7106. Alfie (alfie_op) 54 55.78 68.77 12 22.22
7107. Round (aboutaroundabout) 54 104.67 124.39 26 48.15
7108. Aaron (aarone123) 54 87.93 101.01 16 29.63
7109. Aadarsh (aadarshmani) 54 59.74 71.17 8 14.81
7110. Ravi (131raviarya) 54 78.88 91.44 11 20.37
7111. Omar (atrozyte) 54 78.68 99.74 21 38.89
7112. Alexander (ysgatora) 54 66.04 84.95 13 24.07
7113. Minh (nhminh) 54 87.36 110.09 21 38.89
7114. Ayush (tueely) 54 90.22 113.36 21 38.89
7115. omar shereef (omar_shereef) 54 54.33 64.48 7 12.96
7116. bluesight (maveblue) 54 54.48 66.21 4 7.41
7117. Rohit (toba89) 54 50.77 61.47 2 3.70
7118. Whil (whil) 54 91.72 111.55 21 38.89
7119. MasterToru (mastertoru) 54 85.83 104.24 13 24.07
7120. tokisuno (tokisuno) 54 103.19 127.93 29 53.70
7121. Andrew (zengwendian) 53 106.39 120.56 24 45.28
7122. Yuval (yuvalalfa) 53 98.69 129.63 23 43.40
7123. :) (yuuuhhh) 53 88.88 110.23 18 33.96
7124. yazan (yazan_2000) 53 33.67 45.48 3 5.66
7125. Wwuly (wwuly) 53 51.89 74.07 5 9.43
7126. wond (wond_k_) 53 77.53 91.39 15 28.30
7127. Jimmy (user39_on_dvorak) 53 81.67 99.58 10 18.87
7128. Harald (updatin) 53 81.59 90.47 13 24.53
7129. Alexander (typelanterne) 53 115.05 134.66 21 39.62
7130. Max (triangl12) 53 107.78 132.10 24 45.28
7131. tania (tlee120) 53 111.12 123.95 22 41.51
7132. Chadwick (supasurreal) 53 48.21 61.87 6 11.32
7133. sir (sirflu) 53 48.68 59.24 6 11.32
7134. Faris (silverskied) 53 73.82 88.52 10 18.87
7135. Syimyk (sam_j5) 53 59.66 72.04 11 20.75
7136. Rikey (reycon) 53 49.41 68.63 6 11.32
7137. rdnblg (rdnblg2) 53 56.99 69.65 14 26.42
7138. rap (raprics8) 53 50.70 64.69 4 7.55
7139. Rafiul (rafiul41) 53 81.49 98.57 14 26.42
7140. Dan (radio_falcon) 53 105.77 128.97 24 45.28
7141. Matt (piza01134) 53 81.96 104.04 13 24.53
7142. AP (phea0001) 53 62.04 75.37 10 18.87
7143. Hugo (paulz_420) 53 52.82 71.52 10 18.87
7144. Chirpy (pandress) 53 102.12 128.83 25 47.17
7145. cheems (pachaczb_dvorak) 53 66.09 78.30 11 20.75
7146. Mahmoud (opssheesh) 53 85.54 110.30 11 20.75
7147. Ollie (ogreig) 53 73.14 94.76 26 49.06
7148. huh (noirblnqqq) 53 81.51 100.22 18 33.96
7149. Nabil (nabil_lam) 53 47.79 70.11 4 7.55
7150. Matthew (mmongillo) 53 63.08 74.16 12 22.64
7151. mira (mlp1214) 53 55.87 70.34 9 16.98
7152. William (michaelp_2222) 53 104.34 129.28 29 54.72
7153. Lets Gooooo!!! (mattymooo2021) 53 47.95 61.64 6 11.32
7154. mangkaw (mangkaw) 53 80.82 98.48 15 28.30
7155. LuminousEgg (luminousegg) 53 77.81 99.56 15 28.30
7156. Link (link_hyrule) 53 111.91 140.37 30 56.60
7157. Mikhail (limedimenine) 53 95.04 115.51 18 33.96
7158. k (kperez755) 53 86.84 116.22 19 35.85
7159. Gabby (kirbykirbykirby) 53 79.84 94.44 10 18.87
7160. Kash79 (kashyap79) 53 78.74 87.71 14 26.42
7161. Carlos (karldan) 53 56.92 69.23 7 13.21
7162. M (kapsa) 53 75.00 87.15 11 20.75
7163. Joy (joyjumper11) 53 92.32 115.39 23 43.40
7164. tstats[jason823] Jason (jas... 53 84.59 110.92 17 32.08
7165. Unigen (id3n) 53 111.73 133.11 30 56.60
7166. Ryan (hougs) 53 60.93 76.34 9 16.98
7167. HawkEye (hawk_eye) 53 79.20 104.88 12 22.64
7168. Rowel Abrasado (hallelujahptl) 53 46.60 61.52 7 13.21
7169. GreenUmbrella (greenumbrella) 53 77.58 94.99 16 30.19
7170. Fusionbolt (fusionbolt) 53 79.14 102.79 21 39.62
7171. fml (fmldave89) 53 77.35 111.42 13 24.53
7172. TK (filfirst) 53 86.42 100.81 17 32.08
7173. Ferricks (ferri_ks) 53 58.55 75.31 11 20.75
7174. Fedwig (fedwig) 53 102.34 125.93 23 43.40
7175. Ethan (ethanos42) 53 73.85 98.37 23 43.40
7176. ed81 (ed81) 53 46.84 55.30 6 11.32
7177. Dungus (duungus) 53 79.11 110.87 14 26.42
7178. lelle (davinkyy) 53 64.01 79.83 12 22.64
7179. Danny (danyeeast) 53 73.36 92.36 13 24.53
7180. winter (cora_) 53 92.33 112.27 22 41.51
7181. Deez (coolio458) 53 78.15 95.69 12 22.64
7182. ChurM8 (churm8) 53 92.77 125.59 38 71.70
7183. Mauro (chunkerchunk) 53 136.58 156.01 36 67.92
7184. ben (chompytheturtle) 53 115.27 141.68 37 69.81
7185. Chinmay (chinmays1999) 53 69.40 78.54 15 28.30
7186. Gabriel (cashewsoda) 53 92.71 109.24 18 33.96
7187. bueno (bueno94) 53 64.75 79.33 15 28.30
7188. ZXCRYO (btscarbon) 53 49.79 63.50 8 15.09
7189. Blue (blue_cow) 53 41.66 60.57 11 20.75
7190. beek (beekul) 53 60.43 77.01 8 15.09
7191. Bee (beejbeeabeey) 53 102.34 124.50 16 30.19
7192. Azhar (azharbhat) 53 67.76 85.16 10 18.87
7193. Atreides (atreidaus) 53 76.23 92.57 13 24.53
7194. Alessandro (asterlr) 53 105.06 130.77 13 24.53
7195. Aruzhan (arrrujjka) 53 37.20 45.69 5 9.43
7196. NoobMaster (anakwibu04) 53 105.66 121.57 36 67.92
7197. cal (achildslaughter) 53 103.93 127.60 20 37.74
7198. Rohan (rohanvit) 53 52.11 67.91 6 11.32
7199. zeyad (zeyad_yasser) 53 27.69 35.61 13 24.53
7200. Elizabeth (elizabethjulia) 53 44.25 61.65 5 9.43
7201. Anjali (lily2001) 53 63.10 79.69 20 37.74
7202. jen (jccen) 53 42.46 52.57 11 20.75
7203. Nick (gelatinpizza) 53 87.65 111.85 14 26.42
7204. Yash (yash_1234) 53 81.67 100.09 12 22.64
7205. Yashwanth (kakashiyash) 53 65.00 80.66 9 16.98
7206. Brandon (brandowompus) 53 83.37 103.44 12 22.64
7207. Blacknight6900 (blacknight6... 53 70.15 87.19 27 50.94
7208. Generals (gwapoko12312323321) 53 64.33 83.54 11 20.75
7209. tyenavatyen (zombiewgoku77) 52 118.05 148.84 31 59.62
7210. Zelalem (zolamk) 52 71.19 85.24 44 84.62
7211. Matthew (zannon23) 52 90.32 108.55 14 26.92
7212. Yutio (yutio) 52 48.88 58.20 3 5.77
7213. vega (xxav) 52 75.12 94.39 11 21.15
7214. Ivan (xaboff) 52 51.03 66.11 8 15.38
7215. Mawon (wonlee) 52 90.76 109.45 19 36.54
7216. ▬|═══ﺤ (vikas112) 52 56.40 69.92 4 7.69
7217. TOH (tohjh) 52 79.16 88.53 22 42.31
7218. twitter.com/jidoreuu (tfuef... 52 124.15 149.30 34 65.38
7219. TcJon (tcjon) 52 49.52 66.33 5 9.62
7220. Nicholas (t0903591) 52 82.99 98.44 10 19.23
7221. Sid (sxd_ss) 52 70.14 88.88 13 25.00
7222. a (stanrude) 52 68.41 82.05 11 21.15
7223. sfairat (sfairat) 52 55.24 63.56 6 11.54
7224. shashi (sekhar184131) 52 81.38 98.42 13 25.00
7225. Scar (scarskald) 52 66.64 88.05 15 28.85
7226. Saurabh (saurabh002) 52 61.74 68.98 12 23.08
7227. Corentin (risemu) 52 80.36 96.49 9 17.31
7228. ダル (rex_rex) 52 75.80 102.57 15 28.85
7229. John McCarthy (providerone) 52 102.83 118.87 25 48.08
7230. PickleCork (proogle_can) 52 81.82 96.34 16 30.77
7231. PracticeTouch (practicingto... 52 48.31 61.34 2 3.85
7232. J (petalss) 52 67.98 84.54 11 21.15
7233. zhlmsji (pathhologic) 52 101.27 141.13 23 44.23
7234. Parsa (parsasq) 52 55.49 70.14 9 17.31
7235. atoms (overblown) 52 67.41 81.64 27 51.92
7236. nope251 (nope251) 52 60.36 72.92 5 9.62
7237. Ian (nelson_kempkey) 52 106.04 133.29 17 32.69
7238. Morgan (morgbot) 52 109.06 139.30 26 50.00
7239. Morgan (morgansoares6) 52 70.41 93.60 9 17.31
7240. Morad (morad_the_beast) 52 70.52 80.61 11 21.15
7241. Ben (meh_guy) 52 109.51 128.84 34 65.38
7242. Duc (maitheduc2002) 52 38.86 46.84 4 7.69
7243. Ma (mahyunyi) 52 72.39 92.00 12 23.08
7244. DaoRider (lowtall2006) 52 98.45 116.52 22 42.31
7245. loungecore (loungecore) 52 98.76 116.52 21 40.38
7246. lior (liorlubek) 52 58.84 78.33 10 19.23
7247. LemonCatTAT (kiddie_sallie) 52 95.14 112.34 16 30.77
7248. Kermilian Nguyen (kermilian... 52 59.22 75.08 10 19.23
7249. Sadi (kandeemusic) 52 83.08 103.97 21 40.38
7250. Suntery (jennk1) 52 59.26 71.39 9 17.31
7251. Henrik (iupgrade) 52 95.94 116.15 22 42.31
7252. Icchan (icchan84) 52 73.61 92.15 13 25.00
7253. mr.hogsman (hogsman) 52 95.88 126.36 23 44.23
7254. Henrique (henri3287) 52 45.84 56.94 3 5.77
7255. Greg (gregdahwhale) 52 86.42 108.14 13 25.00
7256. God (godlevel) 52 85.32 102.04 43 82.69
7257. Elliot (girtholomew) 52 69.16 78.80 10 19.23
7258. Fionalee (fionalee) 52 90.94 107.70 16 30.77
7259. Tony (feetiswhynocaps) 52 90.09 112.37 19 36.54
7260. lillian (fartgaret) 52 80.35 127.53 20 38.46
7261. Eujean (eujean) 52 103.06 119.70 26 50.00
7262. george (doctoras) 52 98.31 121.16 26 50.00
7263. Delphie (delphie_) 52 106.44 127.60 27 51.92
7264. nhim (chikiro) 52 62.88 83.20 7 13.46
7265. max (chaxmase) 52 78.13 97.32 15 28.85
7266. Ivan (breadguru) 52 51.62 61.47 7 13.46
7267. Minh (blue002) 52 53.51 60.69 9 17.31
7268. blendin (blendin11) 52 90.65 109.48 12 23.08
7269. Batian (batiti51) 52 67.69 81.84 10 19.23
7270. BARAA (barrettshot) 52 97.50 113.90 16 30.77
7271. Ayokk (ayokk) 52 83.10 110.76 10 19.23
7272. Jongwon (aviationchief) 52 90.67 121.04 45 86.54
7273. ashalisalamdanam (ashalisal... 52 84.76 96.24 16 30.77
7274. Ankit (ankit_chauhan) 52 69.04 86.35 15 28.85
7275. ali-goes (alibookie) 52 85.91 117.12 15 28.85
7276. Neanderthal (alacrity95) 52 127.41 170.60 27 51.92
7277. miracle man (abindev) 52 31.78 41.86 7 13.46
7278. Julia (348753021) 52 117.41 139.09 33 63.46
7279. Kevin (kevin41714) 52 78.99 93.10 12 23.08
7280. Josh (fearzenemy) 52 56.24 74.16 8 15.38
7281. Gary (yrag) 52 69.01 88.79 15 28.85
7282. Pourya (orangefourinchdoorh... 52 45.29 55.91 6 11.54
7283. Alexander (aexae) 52 51.45 79.58 5 9.62
7284. GoD (1_god_1) 52 61.68 74.42 4 7.69
7285. Darkhan (zhora577) 51 44.09 68.11 3 5.88
7286. Delbert (zeckxel) 51 71.71 83.87 15 29.41
7287. Yami (yamiph) 51 108.10 145.23 33 64.71
7288. Ryan (xxhiny) 51 110.05 125.01 25 49.02
7289. Jaris (xersai) 51 98.43 123.69 21 41.18
7290. asphyxia (wylx) 51 65.44 93.04 12 23.53
7291. William (wwuhoo) 51 75.85 94.00 14 27.45
7292. Vyc (vyctor661) 51 93.70 115.49 17 33.33
7293. Isaak (verysexyman) 51 51.21 66.12 5 9.80
7294. Ernesto (venkinta) 51 86.14 103.46 21 41.18
7295. Asto (ukikunz) 51 113.19 139.74 26 50.98
7296. Teun (typingthunder) 51 48.63 57.89 2 3.92
7297. consistently inconsistent (... 51 91.54 124.48 18 35.29
7298. Swift (swiftens) 51 89.68 110.73 16 31.37
7299. Stevie (stevie_thee_shep) 51 99.82 130.06 24 47.06
7300. Chaerity (ssamurai) 51 88.36 101.99 14 27.45
7301. Vela (somkungza) 51 78.52 99.25 15 29.41
7302. sofa (sofaaa) 51 98.39 129.19 15 29.41
7303. Chad (sixpacksexy) 51 100.92 119.79 16 31.37
7304. mosho (sidosido) 51 85.39 102.59 12 23.53
7305. Shin (shinfx) 51 87.44 106.58 20 39.22
7306. Shayan (shanoo92) 51 63.38 83.59 26 50.98
7307. Chikin (sailestial) 51 92.33 115.78 18 35.29
7308. Safi (safiikram) 51 44.56 55.00 5 9.80
7309. beans (rlbeans) 51 86.22 106.81 19 37.25
7310. Raghav (raghavlaad) 51 70.77 91.80 13 25.49
7311. Pro (progeorge123) 51 100.13 131.70 24 47.06
7312. PoopBug (poop_bug) 51 93.80 110.58 19 37.25
7313. Phoenix (phoenixwolfer) 51 103.30 132.55 26 50.98
7314. laptop keyb (pasta2) 51 135.47 167.58 21 41.18
7315. pepperooni (papipepperooni) 51 84.85 100.56 22 43.14
7316. peckcs (opecks) 51 82.67 99.03 19 37.25
7317. nehal (nehal1337) 51 115.13 134.72 28 54.90
7318. Joshua (mrteeentee) 51 111.15 137.62 23 45.10
7319. Mr. (mrasp) 51 61.74 78.31 13 25.49
7320. anya (monarchunder) 51 95.90 124.26 29 56.86
7321. Tenebrific (molkri) 51 92.55 107.25 17 33.33
7322. Peetor (milleniumpoo) 51 86.04 114.36 13 25.49
7323. Paolo (mcnugget25) 51 117.05 137.82 32 62.75
7324. Max (maxma_69) 51 109.26 139.68 32 62.75
7325. matan (matanselig) 51 27.31 34.56 6 11.76
7326. Marwoleath (marwoleath) 51 76.49 90.97 7 13.73
7327. OmaR (mandoo120) 51 51.77 63.83 7 13.73
7328. Eric (mainsterr) 51 73.60 99.37 30 58.82
7329. andrea (lotta98) 51 64.73 78.07 10 19.61
7330. Kush (kushtek) 51 44.37 64.78 11 21.57
7331. Kunal (kunal299) 51 76.08 94.11 15 29.41
7332. Filip (keyboardwarrior772) 51 97.87 133.91 18 35.29
7333. Jimmy (jx297) 51 103.59 117.21 24 47.06
7334. Julian (julianalex2307) 51 92.63 129.17 21 41.18
7335. JuanimelsPH (juanimels) 51 85.92 103.86 9 17.65
7336. James (jpnjpn6) 51 87.48 109.54 22 43.14
7337. Jeff (jooffy) 51 61.42 79.18 9 17.65
7338. Melchorio (jcquints) 51 95.47 113.62 18 35.29
7339. jamilxt (jamilxt) 51 60.96 73.84 14 27.45
7340. Jamie (jamiegre) 51 114.59 141.98 25 49.02
7341. Isak (isapan) 51 92.82 110.48 18 35.29
7342. The Russian (imdarussian) 51 74.72 89.34 14 27.45
7343. Jack (hyydenjakcz) 51 80.51 99.72 12 23.53
7344. ばにらー tired goodby... 51 123.37 177.82 21 41.18
7345. Hitendra (hitendra) 51 72.68 96.01 37 72.55
7346. zhz (haohauz) 51 126.73 156.22 35 68.63
7347. shmoney (gupty_gang) 51 73.37 87.11 13 25.49
7348. nanashi (greenjohnny135) 51 76.69 101.72 9 17.65
7349. Jako (frafdothehero) 51 76.89 93.34 10 19.61
7350. Fametime (fametime) 51 126.59 166.10 34 66.67
7351. Elie (eliepr0) 51 117.57 142.10 24 47.06
7352. Doge (dopeydoge) 51 79.99 104.19 15 29.41
7353. Daniel (dna89) 51 70.14 85.58 14 27.45
7354. Tristan (devyl) 51 83.12 95.54 13 25.49
7355. epic (densehelium) 51 72.33 84.11 16 31.37
7356. Akhil (deathstroke99) 51 64.01 75.90 9 17.65
7357. Dagger (daggerbxii) 51 66.80 86.83 12 23.53
7358. Radius (d4iry) 51 131.99 172.61 35 68.63
7359. criasier (criasier) 51 113.97 138.02 31 60.78
7360. Jason (cookja2000) 51 86.95 109.56 11 21.57
7361. Brandon (boredintern123) 51 127.60 151.95 40 78.43
7362. Blake (blaketrombone) 51 84.26 108.56 19 37.25
7363. bioboy246 (bioboy246) 51 105.35 131.73 23 45.10
7364. Bekzodbek (bekzod003) 51 44.17 63.11 12 23.53
7365. owen (beemochop) 51 67.98 83.75 6 11.76
7366. Badal Babu (bcube_nimble) 51 93.90 106.78 19 37.25
7367. leon (bangingmyheadonthewall) 51 62.65 83.51 8 15.69
7368. heck (aw_heck) 51 38.89 53.45 6 11.76
7369. Ava (ava_gina) 51 60.38 69.62 4 7.84
7370. ansix (an66) 51 119.74 138.91 29 56.86
7371. Alex (alex_mingguk) 51 73.27 95.76 13 25.49
7372. aleph (alephyphen) 51 106.87 129.77 21 41.18
7373. ahmed (ahmedmadgy711) 51 61.45 77.19 15 29.41
7374. Adam (adumbsun) 51 101.63 134.43 23 45.10
7375. adrianna (adriannna) 51 84.06 115.52 8 15.69
7376. Abu Shaikh (abu_nibir) 51 67.46 78.11 11 21.57
7377. Albert (abt8601) 51 96.62 113.54 23 45.10
7378. 𝔽₃₁ (2802) 51 104.78 124.05 30 58.82
7379. Steve (lehoangkhang9) 51 76.22 89.88 15 29.41
7380. Michaiah (pig101) 51 62.93 76.66 13 25.49
7381. Jai (jaijoshi) 51 59.39 73.56 5 9.80
7382. IdkFreaky (fs_frenchfries77) 51 66.55 76.20 11 21.57
7383. Minate (minate) 51 53.24 64.44 4 7.84
7384. Zi Liang (pohziliang) 51 57.97 71.58 11 21.57
7385. Timo (vryzin) 51 48.72 63.36 5 9.80
7386. Alyssa (agraha91) 51 64.83 76.84 15 29.41
7387. Airwide (airwide) 51 40.16 47.01 7 13.73
7388. Lorenz David (lupusregina) 51 83.82 105.50 14 27.45
7389. Zayden (zayden_blaze) 50 91.27 121.91 18 36.00
7390. zeroguard (z3r0gu4rd) 50 46.83 55.81 7 14.00
7391. Yung (yungmyg) 50 39.36 48.94 4 8.00
7392. Mandom (xristos980) 50 69.15 80.17 10 20.00
7393. ℱ𝔯𝔢𝔢𝔡𝔬𝔪... 50 83.93 102.78 13 26.00
7394. root (wanna_be_pro) 50 51.34 63.61 3 6.00
7395. Tempest (tempestreu) 50 58.07 71.47 10 20.00
7396. Harri (teddybaker) 50 53.22 63.67 7 14.00
7397. Tadas (tadasmak) 50 76.89 91.00 10 20.00
7398. Sylptic (sylptic) 50 98.74 118.60 19 38.00
7399. صنديد (sundid) 50 91.81 114.46 14 28.00
7400. DK ALONE (speed_typing) 50 47.49 62.38 4 8.00
7401. ¯\_(ツ)_/¯ (some_guy4444) 50 91.21 110.26 16 32.00
7402. Tommy (snoopyisop) 50 105.03 148.25 21 42.00
7403. slower than s2000 (slowpacito) 50 140.91 173.35 40 80.00
7404. simon (simonhor1) 50 91.04 118.59 16 32.00
7405. Shreyas (shreyas_jani) 50 74.38 93.45 15 30.00
7406. deceptive (sergisreal) 50 93.92 109.54 16 32.00
7407. ks (sempiedram) 50 87.85 108.68 11 22.00
7408. SapCK (sapck) 50 99.91 122.21 21 42.00
7409. Rodrigo (rugoso) 50 96.80 113.73 22 44.00
7410. Isabella (refundmybirth_21) 50 60.97 79.86 12 24.00
7411. pulkit (pulkitb) 50 31.04 46.89 4 8.00
7412. lu (prymuslu) 50 90.70 106.76 16 32.00
7413. Mihir (plibither8) 50 82.56 95.41 20 40.00
7414. ben (panda_jellyfam) 50 97.44 117.27 25 50.00
7415. PWian racer from chennai (o... 50 38.96 62.84 6 12.00
7416. nostango (nostango) 50 79.68 93.83 16 32.00
7417. Noridomi (noridomi) 50 86.96 102.83 14 28.00
7418. ninja (ninja_op) 50 86.74 104.12 20 40.00
7419. Nick (nick_txt) 50 93.53 120.25 23 46.00
7420. TYPERACER (natem135) 50 96.73 126.65 17 34.00
7421. Naga (nagaspar) 50 56.12 81.07 14 28.00
7422. Narasimha Nadh (nadh_7) 50 70.93 86.99 15 30.00
7423. Muhammad (muhammad95959) 50 44.84 52.48 7 14.00
7424. MuffinMike (muffinmike) 50 91.06 108.87 13 26.00
7425. Martin (mpgo13) 50 86.62 110.34 15 30.00
7426. Matthew (mooncatcher) 50 73.63 96.51 9 18.00
7427. Lloyd (milanh) 50 115.19 139.21 31 62.00
7428. Steven (melkies) 50 80.94 90.94 16 32.00
7429. mats (matserino) 50 49.84 65.02 6 12.00
7430. Maffin (m4ff1n) 50 83.47 98.10 13 26.00
7431. Lepry (leprykun) 50 63.99 82.98 17 34.00
7432. Y Lee (leengau) 50 58.82 77.50 7 14.00
7433. Stephen (laddlez) 50 81.56 109.76 13 26.00
7434. 𝐊 𝐑 𝐀 𝐊 𝐄 ... 50 95.77 113.20 19 38.00
7435. Kevin (kimchioncolemak) 50 96.01 109.53 21 42.00
7436. Kaushik (kaushik_nna) 50 89.65 107.14 18 36.00
7437. ジョーヨ (joeyo) 50 107.11 123.30 24 48.00
7438. joanne (joannekim63) 50 92.89 109.95 23 46.00
7439. Jose (jduran7) 50 80.34 103.63 14 28.00
7440. Jake (jdogcat1) 50 62.28 79.84 9 18.00
7441. Jai (jaideepjr) 50 105.54 122.79 16 32.00
7442. Instinct (instinct1) 50 96.16 130.93 20 40.00
7443. Enzo (hypertxters) 50 94.19 115.63 25 50.00
7444. h (huyho1207) 50 90.08 118.18 27 54.00
7445. hossameldien (hossam23177) 50 59.83 75.25 9 18.00
7446. haidanos (haidanos) 50 79.98 94.44 12 24.00
7447. H4ndss (h4ndss1) 50 84.38 105.87 16 32.00
7448. Gaurav (gauravvv2204) 50 51.74 64.50 4 8.00
7449. Joseph (gauntdarkness) 50 79.94 112.32 7 14.00
7450. TheStyne (fixinit1) 50 87.63 120.50 17 34.00
7451. R0merol (farisfaikar_r) 50 73.40 88.74 16 32.00
7452. yossi (exseibar) 50 57.21 72.88 3 6.00
7453. Mohit (dumb_avocado) 50 51.99 65.89 5 10.00
7454. Duc (dukenhu) 50 92.60 108.83 16 32.00
7455. ddo (detdetjo) 50 81.26 94.55 15 30.00
7456. yop (desuperslayer) 50 55.21 71.98 11 22.00
7457. Name (defaultname) 50 79.63 111.87 15 30.00
7458. don (dandhi) 50 85.70 102.46 20 40.00
7459. Stoian (creep_fire97) 50 102.34 117.42 15 30.00
7460. Connor (congoman) 50 47.47 59.95 4 8.00
7461. Abhishek (coderguy1) 50 65.63 76.68 7 14.00
7462. chlovis (chlovis) 50 28.02 41.81 7 14.00
7463. Tilt (brianrk25) 50 72.05 85.73 49 98.00
7464. BOBA (bobavfett) 50 54.58 66.60 6 12.00
7465. G B (believeb) 50 27.09 37.49 33 66.00
7466. китаец (artur_) 50 74.72 86.59 13 26.00
7467. Arslan (arslan_03) 50 69.23 86.32 11 22.00
7468. arimauta (arimauta) 50 43.28 56.71 1 2.00
7469. Afaq (afaqkhan) 50 85.17 103.64 14 28.00
7470. :] (acision) 50 78.38 93.71 15 30.00
7471. 2Slow (2slowkevin) 50 38.96 48.24 5 10.00
7472. congrats on 1M club (23kuzn... 50 113.52 154.39 27 54.00
7473. Katherine (kat5801) 50 52.65 64.00 1 2.00
7474. SirAmateur (namelessamateur) 50 63.69 78.42 10 20.00
7475. Ahmad (dr_ahmad) 50 42.55 53.38 5 10.00
7476. Protek (protekripper) 50 38.30 48.00 5 10.00
7477. chaaruzu (toishii) 50 63.55 82.57 5 10.00
7478. Nate (jazzybanana) 50 50.19 63.92 9 18.00
7479. Yuvraj (yuvraj_sharma) 50 64.06 79.40 12 24.00
7480. DumbPeanut (dumb_peanut10) 50 45.40 56.10 4 8.00
7481. Ankur (slownsteady108) 50 54.29 64.97 9 18.00
7482. Thomas (tomtwo) 50 73.75 93.04 12 24.00
7483. (negro100000_) 50 65.68 80.36 21 42.00
7484. Happy129 (happy129) 50 63.68 78.76 6 12.00
7485. Priyanshu (_priyanshu_) 49 56.54 67.30 10 20.41
7486. Ziad Zaki (ziadzaki) 49 90.83 133.52 23 46.94
7487. adamz (zhaanga09) 49 79.58 100.71 17 34.69
7488. Shayan (zackroos) 49 70.26 91.23 9 18.37
7489. Tuomo (ystavani_marko) 49 66.14 79.55 11 22.45
7490. Yordanes (yordanes) 49 39.14 48.74 1 2.04
7491. __8k.11Ine_ (yassine999) 49 68.59 87.49 11 22.45
7492. savannah (wiggywonka) 49 100.51 118.85 17 34.69
7493. Gil (violetgil) 49 113.18 124.64 21 42.86
7494. Venderex (venderex) 49 94.43 139.23 25 51.02
7495. Vahid (vahidmoradpour) 49 35.41 43.39 0 0.00
7496. Mason (unelevate) 49 111.79 136.11 32 65.31
7497. TypingAway (typinggggggg) 49 84.57 99.95 15 30.61
7498. tragiƘ (tragik) 49 95.80 121.53 45 91.84
7499. Fran (tippidytap) 49 74.42 94.95 14 28.57
7500. Tipper_Typer (tipper_typer) 49 77.81 100.87 13 26.53
7501. Lawrence (thunder_drain) 49 78.05 103.66 12 24.49
7502. Kerem (tearsfears) 49 67.01 81.93 8 16.33
7503. Pragyan (swordfish999) 49 76.30 101.92 7 14.29
7504. dozingoff (stopcomparing) 49 99.05 118.45 22 44.90
7505. Samuel (spiriteater) 49 84.95 96.81 15 30.61
7506. Sophia (sophianotfound) 49 66.02 93.43 8 16.33
7507. yeet to space (sn00py1310) 49 72.69 97.84 17 34.69
7508. Skyyy06 (skyyy06) 49 99.52 121.67 17 34.69
7509. SH (shrony) 49 64.60 75.41 11 22.45
7510. Shawna (shawnanic856) 49 93.97 111.89 17 34.69
7511. Sebastian (sev___) 49 104.42 136.40 20 40.82
7512. Danyl (seataco) 49 56.09 76.80 16 32.65
7513. sammysamm (sammysamm) 49 77.68 94.92 12 24.49
7514. Rully (rully_monas) 49 72.35 94.39 11 22.45
7515. Rachael (rachaelpoedia) 49 58.83 68.90 7 14.29
7516. zetria (primalknight) 49 143.50 169.47 33 67.35
7517. F*ck Zelenskyy (overmake) 49 82.81 99.26 18 36.73
7518. Orblil (orblil) 49 68.41 97.62 13 26.53
7519. Glenn (nnelg) 49 98.81 133.27 7 14.29
7520. 101 (needlepaws) 49 83.52 94.36 19 38.78
7521. Brett (mrmahn) 49 110.64 125.97 33 67.35
7522. may9 (may9) 49 60.47 71.84 12 24.49
7523. Mati🅱IKL (mati2ooo) 49 97.95 116.03 20 40.82
7524. Normal (marlon_caleb) 49 72.31 87.34 10 20.41
7525. Mach 20 (mach20) 49 63.50 80.62 10 20.41
7526. Lucifer (lucifer_kas) 49 88.36 116.04 23 46.94
7527. repyx (lordgado) 49 51.27 69.40 7 14.29
7528. Lilac (lilaclily) 49 21.91 28.51 9 18.37
7529. Learn to pro (learntopro) 49 63.26 73.66 8 16.33
7530. leaf (leafblower174) 49 103.59 139.80 32 65.31
7531. Eduardo (laloaguirre720) 49 64.65 80.95 14 28.57
7532. Q (kwhan) 49 103.38 124.09 27 55.10
7533. jz (kokosha) 49 85.34 107.02 19 38.78
7534. kiv (kivv) 49 86.85 108.88 20 40.82
7535. kazden (kazdenetienne) 49 82.92 105.86 18 36.73
7536. kalxoz (kalxoz97) 49 65.14 76.15 11 22.45
7537. Tam (josephtambmt) 49 62.03 78.99 8 16.33
7538. John (johnzeds) 49 77.38 95.20 8 16.33
7539. Job (job007) 49 104.33 122.28 22 44.90
7540. Ryan (jellyzerg) 49 90.81 105.96 21 42.86
7541. FeelsGoodMan (jeffryvanessa1) 49 60.61 74.19 17 34.69
7542. Jorge (jdominguezzz) 49 84.22 104.45 17 34.69
7543. Jakm (jahkm) 49 47.89 60.92 8 16.33
7544. Myro Bryan (iskwagong) 49 93.04 113.96 19 38.78
7545. TypingGuy (iramus) 49 97.98 121.56 16 32.65
7546. ABDELLATIF (hktitof) 49 61.26 79.90 11 22.45
7547. Himanshu (himanshukpr) 49 42.69 50.83 4 8.16
7548. haquaman_workman (haquaman_... 49 64.40 75.09 9 18.37
7549. ILikeCars07 (gruhith) 49 86.25 97.81 12 24.49
7550. rock dog (generic_exe) 49 81.62 95.19 16 32.65
7551. Gianni (general_patches) 49 84.34 96.13 21 42.86
7552. Non-quit acc (escri) 49 130.01 146.04 32 65.31
7553. epigee (epigee) 49 105.37 128.88 17 34.69
7554. Enclosed (enclosedletter) 49 85.02 103.09 17 34.69
7555. ellie (ellmell13) 49 44.98 58.14 4 8.16
7556. HMan (edhac) 49 98.06 123.46 16 32.65
7557. Dziobak (dziobak) 49 92.59 118.74 15 30.61
7558. Dumi (dumizeu) 49 43.92 55.47 6 12.24
7559. Dontmindme (dontmindmepls) 49 50.62 62.40 5 10.20
7560. Jay (dflkn4900s4) 49 82.99 99.21 16 32.65
7561. DegageSpoon9280 (degagespoo... 49 53.11 63.13 6 12.24
7562. Domo (dasuxosu) 49 85.71 116.49 20 40.82
7563. Jake (darkxfade240) 49 79.43 93.73 12 24.49
7564. Coru (coru12) 49 83.50 101.33 15 30.61
7565. AHHH (chuckles1357) 49 88.83 110.67 11 22.45
7566. Ryan Smith (chickenhelmet) 49 71.29 92.21 16 32.65
7567. asdasd (chaizhengwen) 49 89.86 107.73 16 32.65
7568. Celestrom (celestrom) 49 70.22 88.92 11 22.45
7569. Carly (carlytarantino) 49 80.59 100.17 11 22.45
7570. Typinator (candymn3) 49 100.75 124.45 17 34.69
7571. Sml (cactusman215) 49 96.79 109.80 18 36.73
7572. Bogoya (bogoya) 49 74.76 88.06 12 24.49
7573. bobs (bobsbee) 49 33.91 49.31 4 8.16
7574. Noah (bobothechimpanzee) 49 87.17 100.86 15 30.61
7575. MM (blunderingpeon12) 49 82.81 99.86 12 24.49
7576. Bryan (blcm123) 49 108.64 120.88 21 42.86
7577. big (bigfudge14) 49 95.17 113.86 23 46.94
7578. Beheshta (beheshta) 49 59.10 74.48 7 14.29
7579. Marikyuun (bananaking121) 49 110.29 154.91 32 65.31
7580. Pushkar (azuloto) 49 65.44 77.81 9 18.37
7581. Ayush (ayush_1511) 49 67.34 80.07 18 36.73
7582. aasdfa (awid) 49 90.29 104.59 16 32.65
7583. 𝕬𝖛𝖊𝖗𝖆𝖌... 49 83.68 111.21 41 83.67
7584. Ahnaf Shahriar (asifthegreat) 49 90.90 110.00 21 42.86
7585. Arlene (arlenieeweenie) 49 132.39 165.75 35 71.43
7586. Argon (argon273) 49 79.83 112.84 13 26.53
7587. John (apathy_incarnate) 49 63.30 76.19 11 22.45
7588. Antony (antonleghost) 49 89.37 116.44 15 30.61
7589. Ankit (anktwd) 49 50.12 57.62 2 4.08
7590. (altroq) 49 90.23 111.20 17 34.69
7591. Adrian (adrianlee196) 49 117.16 133.24 26 53.06
7592. Nicolas (acut3) 49 64.80 81.89 9 18.37
7593. CrazyNeighbor (5qcheng007) 49 100.78 121.85 20 40.82
7594. andrew (gorillaman9k) 49 67.28 82.64 30 61.22
7595. pratham (pratham_s_k) 49 59.31 67.07 4 8.16
7596. Kendall (fishstix_) 49 79.30 97.33 15 30.61
7597. nakshatra (ng07) 49 20.62 25.38 9 18.37
7598. Z4ZI3 (z4zi3) 49 65.71 78.32 41 83.67
7599. Sankalp (sankalpgupta) 49 71.28 86.66 10 20.41
7600. Fluroo (flurouu) 49 79.51 96.85 17 34.69
7601. ⚽⚽⚽⚽🏆🏆 (simon... 49 73.35 93.37 15 30.61
7602. White (whitewolf04) 49 77.44 97.15 16 32.65
7603. tstats[_jamin_] (_jamin_) 48 85.27 102.65 25 52.08
7604. zatoichi (zatoishwan) 48 114.17 143.04 21 43.75
7605. Yash (yomiiiii) 48 68.18 94.89 11 22.92
7606. Jeffrey (weijini) 48 74.82 92.32 8 16.67
7607. h (vondo28) 48 82.62 108.53 9 18.75
7608. Vladislove (vladislove) 48 94.51 108.65 10 20.83
7609. Vishal (vishalsaxena) 48 50.88 63.70 4 8.33
7610. Jared (varmitz1) 48 82.19 103.45 14 29.17
7611. Vab (vaheebee) 48 93.36 104.27 15 31.25
7612. UnreliableSpare (unreliable... 48 63.49 77.75 9 18.75
7613. Pere (unbreaksee) 48 90.65 104.53 15 31.25
7614. roni raz (unbelieveable) 48 117.17 138.36 25 52.08
7615. Tom (tvdb2003) 48 54.30 65.33 3 6.25
7616. Turbo (turbo_typist) 48 90.98 142.68 15 31.25
7617. DatGG (tristanko) 48 57.61 75.52 4 8.33
7618. touchtypepracticer69 (touch... 48 85.79 97.33 12 25.00
7619. Speed (thenimblefinger) 48 120.29 166.50 22 45.83
7620. Kunal (thegamerkunal) 48 74.04 94.75 10 20.83
7621. Andy (tempestxciii) 48 74.91 92.10 29 60.42
7622. Sugeeth (sugeeth14) 48 77.91 110.96 14 29.17
7623. ssshanto (ssshanto) 48 116.03 150.32 21 43.75
7624. Srean (sreantsm) 48 34.24 46.73 3 6.25
7625. Sphage (sphage) 48 91.82 117.10 18 37.50
7626. Taslima (smita123) 48 41.17 52.87 27 56.25
7627. Skewlankus (skewlankus) 48 62.34 79.15 11 22.92
7628. SilicGK (silicgk) 48 89.76 121.79 12 25.00
7629. hehe (shindo333) 48 86.58 100.18 20 41.67
7630. SackHeadSam (sackheadsam) 48 44.07 63.52 4 8.33
7631. Ryan (ryanhz) 48 91.23 113.77 18 37.50
7632. ron (ronj23) 48 75.50 89.81 9 18.75
7633. ronaldo (ronaldo_gao) 48 100.88 131.04 18 37.50
7634. Remy (rmds_dln) 48 84.39 121.02 23 47.92
7635. Acceptance (riskirw) 48 110.90 130.05 27 56.25
7636. Rido (ridoho) 48 63.50 82.35 14 29.17
7637. Joash (raz3rdarkkill) 48 79.91 98.60 13 27.08
7638. James (raking123) 48 71.88 89.41 11 22.92
7639. Quinco (quinco) 48 45.83 61.29 5 10.42
7640. Praveen (praveen3791) 48 84.72 98.48 11 22.92
7641. Simon (plantsdragon) 48 59.25 73.54 11 22.92
7642. Chris (papadroop1) 48 119.52 144.28 23 47.92
7643. Minnot (omar10211) 48 60.66 80.63 9 18.75
7644. Ogg (ogg_) 48 75.30 89.29 16 33.33
7645. NU (nusensei) 48 103.07 133.53 26 54.17
7646. Niv (nivkapadia) 48 62.36 77.66 13 27.08
7647. Kevin (niveik) 48 94.78 126.50 17 35.42
7648. nikolas (nicknt) 48 71.32 87.21 8 16.67
7649. Amir (nao.paladin@yahoo.com) 48 102.00 121.34 24 50.00
7650. MsStPeter (msstpeter) 48 74.48 91.51 14 29.17
7651. mr (mr_pineapple069) 48 68.17 86.05 17 35.42
7652. BOB (mroglan) 48 84.51 96.49 12 25.00
7653. MRBC (mrbc) 48 57.90 76.42 6 12.50
7654. MrPoop (mother_lover) 48 63.11 77.28 10 20.83
7655. mgamble (mgamble) 48 78.73 96.41 10 20.83
7656. Mohammed (md_islam) 48 78.36 90.68 12 25.00
7657. Andrew (mcentag) 48 112.89 140.75 20 41.67
7658. Marius (mariukas_) 48 78.06 88.41 10 20.83
7659. lithium's after image (lith... 48 127.09 148.68 30 62.50
7660. Matt (lightning_mcqueef) 48 114.57 136.02 26 54.17
7661. KA (keshavgrwl96) 48 81.35 104.98 7 14.58
7662. Ken (kenrender) 48 42.21 50.38 3 6.25
7663. Kc (kchehez) 48 75.10 94.90 6 12.50
7664. June (ju_1304) 48 80.30 99.19 10 20.83
7665. suns (jesse_kim) 48 67.08 86.23 20 41.67
7666. Jam (jamtri) 48 114.19 134.91 26 54.17
7667. Winter (jamesbandit) 48 52.11 62.60 3 6.25
7668. Jai (jais) 48 83.61 99.55 12 25.00
7669. Jack (jack2905) 48 94.84 117.44 18 37.50
7670. Daniel (itypekindaquick) 48 64.71 76.29 9 18.75
7671. Invictus (invictus69) 48 97.73 108.84 15 31.25
7672. MKarma (im69d) 48 42.38 53.25 7 14.58
7673. Ilana (ilana12) 48 57.72 68.22 6 12.50
7674. hyhu (hyhy233) 48 78.12 91.45 11 22.92
7675. arache (howeyzeh) 48 73.07 105.12 15 31.25
7676. BNYKGDT (hopelessly_serious) 48 92.94 117.18 19 39.58
7677. Teng (hentaiba3) 48 74.50 90.18 24 50.00
7678. Hau (hauhauh) 48 73.54 86.29 15 31.25
7679. Hadise (hadise) 48 123.30 161.15 31 64.58
7680. Abdullah (ghadanfar) 48 96.33 119.45 17 35.42
7681. Gridcoin (gabeneweii) 48 113.33 158.10 30 62.50
7682. Leon (flopasd) 48 82.34 108.73 11 22.92
7683. Justin (flamingoed02) 48 108.30 122.62 21 43.75
7684. Fiona (fiona55) 48 88.15 104.17 13 27.08
7685. Nik (fastesttyper101) 48 70.63 95.02 7 14.58
7686. Nathan (el_cap_i_tan) 48 89.05 102.98 23 47.92
7687. Edmund (edmundtyw1) 48 115.60 146.08 39 81.25
7688. donkeysbanana (donkeysbanana) 48 83.83 105.76 18 37.50
7689. Dylan (dmc71298) 48 103.60 129.06 27 56.25
7690. Daniel (dansku01) 48 77.01 101.93 16 33.33
7691. cubeian (cubeian) 48 59.09 74.41 5 10.42
7692. CrpL (crippleed) 48 89.81 108.62 19 39.58
7693. Captain (bobispro2) 48 110.13 124.54 25 52.08
7694. Colin (blank9167) 48 114.35 141.20 26 54.17
7695. Jherome Eduard (bl4nkk) 48 56.07 73.22 5 10.42
7696. Soog (beez23) 48 93.50 105.05 11 22.92
7697. auerabreak (auera) 48 81.98 98.06 11 22.92
7698. (ashish_antil248) 48 57.93 74.74 8 16.67
7699. Luis Victor (anubis_9) 48 74.25 86.48 11 22.92
7700. Amritesh (anodyne12371) 48 36.07 51.13 2 4.17
7701. amin (anmiimna) 48 60.34 73.40 8 16.67
7702. Alex (amarcus0100) 48 52.65 66.83 10 20.83
7703. alfie (alfieisback) 48 73.79 90.07 15 31.25
7704. Aleksa (alexample) 48 80.08 93.30 16 33.33
7705. Aidin (aidin177) 48 110.38 129.08 21 43.75
7706. Acnologia (acnologia_123) 48 88.45 96.83 9 18.75
7707. Frederich (acerx032) 48 87.41 106.71 18 37.50
7708. tstats[0anonymous0123] (0an... 48 56.11 69.40 5 10.42
7709. C4ll Me Sir (ssidd) 48 83.10 99.74 7 14.58
7710. LaxiMax (laximax) 48 68.06 86.41 17 35.42
7711. Noah (holyrhombi) 48 67.56 80.30 13 27.08
7712. toby (tobyliekscows) 48 76.33 102.62 16 33.33
7713. Luis (luggibuggi) 48 68.55 86.57 7 14.58
7714. Apotekarne1337 (apotekarne1... 48 57.60 76.07 6 12.50
7715. Panos (panospask) 48 58.95 76.12 13 27.08
7716. mathder (willpackyourmother) 48 69.12 85.87 14 29.17
7717. Klemensi (klemensi) 48 52.29 66.59 3 6.25
7718. vrrrrrrrrm (olivrrm) 48 70.60 90.84 13 27.08
7719. Jonondarnad (egoye) 48 65.40 82.11 36 75.00
7720. Cam (cburr) 48 75.36 89.65 14 29.17
7721. Sam (sam6420) 48 104.77 129.19 28 58.33
7722. Kashmir (haris1) 48 48.85 61.95 4 8.33
7723. Syed (syed_tahsin) 48 75.82 89.72 7 14.58
7724. .... (_otto_) 47 59.19 72.27 7 14.89
7725. Joy (_joy_) 47 65.94 80.34 8 17.02
7726. Nurzhan (_bakytov_) 47 68.60 85.27 13 27.66
7727. Giovanni (zombieagain) 47 56.30 67.89 3 6.38
7728. Zach (zchen717) 47 113.17 135.80 24 51.06
7729. yousuf (z3nko) 47 98.48 124.01 36 76.60
7730. Yoru (yoruu12) 47 59.34 68.29 5 10.64
7731. ♪╠¥ö§€ƒ╣♫ (ye... 47 80.89 99.01 15 31.91
7732. Garrick (yanawanas) 47 89.94 130.48 12 25.53
7733. clement (xortoise) 47 70.07 87.00 18 38.30
7734. William Vince (wvince02) 47 43.43 53.01 1 2.13
7735. Sapphire (wl23) 47 85.08 106.14 14 29.79
7736. Quibz (white_fire) 47 96.78 125.01 19 40.43
7737. weicer (weicer) 47 92.81 113.75 17 36.17
7738. WayLay (waylay17) 47 85.41 121.96 15 31.91
7739. Virt (virtue_raj) 47 68.91 78.75 10 21.28
7740. Vidit (vdop) 47 55.38 78.81 9 19.15
7741. Maw (typemaw) 47 95.82 118.29 4 8.51
7742. totaland (totaland) 47 62.97 75.38 8 17.02
7743. Chris (tomatohead21) 47 112.45 136.42 18 38.30
7744. Crackersontheshelf (taejung... 47 85.38 101.96 16 34.04
7745. HowToTypin9 (supergodnes) 47 70.78 91.14 11 23.40
7746. sprwhk (sprwhwk) 47 71.41 85.58 14 29.79
7747. Zoey (soeyzandiego) 47 101.92 126.17 19 40.43
7748. Stephen (slyspy) 47 49.54 65.64 1 2.13
7749. DuongForeverAlone (sieunhan... 47 97.16 108.80 17 36.17
7750. Joshua (shmucky) 47 122.61 137.88 24 51.06
7751. Shino (shinobami) 47 46.48 58.53 4 8.51
7752. Shiji (shiji_singh) 47 49.13 57.16 4 8.51
7753. Sherzod Nadirov (sherzod_5) 47 29.62 37.67 5 10.64
7754. Sarvang (sarlok393) 47 68.15 88.54 16 34.04
7755. Raviraj (rvrjpdhr) 47 54.35 75.26 10 21.28
7756. Jay (royjay) 47 61.56 78.11 8 17.02
7757. regen45 (regen45) 47 32.41 45.23 4 8.51
7758. Rishabh (rdmighty_i) 47 109.28 132.87 22 46.81
7759. RageRaptor (rageraptor) 47 49.28 57.18 3 6.38
7760. Kevin (popanto) 47 86.90 109.61 12 25.53
7761. naige (pnolan55) 47 46.41 56.33 4 8.51
7762. Chan (pizzx) 47 74.47 91.29 6 12.77
7763. Petar (petars) 47 147.81 192.88 30 63.83
7764. Flame (panutadk) 47 97.41 115.95 16 34.04
7765. Ore (orediamond) 47 127.41 153.94 30 63.83
7766. M (myles_jb) 47 101.78 124.37 20 42.55
7767. mw3m (mw3m) 47 55.14 68.65 4 8.51
7768. Doggy (mr_woofles) 47 73.50 113.18 14 29.79
7769. Mr_Mic (mr_mic) 47 74.88 93.92 13 27.66
7770. Priyansh (mrpriyansh) 47 61.24 71.20 7 14.89
7771. Mriganka (mriganka) 47 66.37 85.86 8 17.02
7772. Moishi (moishi) 47 84.10 102.73 14 29.79
7773. Mohammad (mohammad__) 47 68.29 90.05 15 31.91
7774. milki (milkepro) 47 59.49 85.99 9 19.15
7775. racist (milfed) 47 49.90 72.48 7 14.89
7776. Rostislav (mexanoz) 47 47.21 62.70 4 8.51
7777. Marina (marniass) 47 98.94 117.84 15 31.91
7778. Revolution (maqsoodwor) 47 21.50 33.55 8 17.02
7779. Lonmanbeast (lonmanbeast) 47 70.39 83.05 9 19.15
7780. Latif (lephant) 47 73.81 97.21 11 23.40
7781. Samuel (kyoka_sui) 47 73.86 91.01 6 12.77
7782. Wattsey (krwhlee15) 47 92.83 120.85 22 46.81
7783. krs (krss) 47 63.55 76.97 15 31.91
7784. KingBaby (kingzeroiii) 47 93.71 110.78 14 29.79
7785. Dawn (kidlatako) 47 39.33 50.51 5 10.64
7786. Kevin (kevzjhu) 47 107.54 131.16 18 38.30
7787. kamoo (k4moo) 47 68.38 82.15 9 19.15
7788. Jed (jedmedina) 47 81.13 112.14 11 23.40
7789. Jill (jconn00) 47 67.79 82.93 9 19.15
7790. JtG (jaylegee) 47 103.70 121.30 22 46.81
7791. Jackson (jacksonmississippi) 47 76.30 102.90 13 27.66
7792. itsKrish01 (itskrish01) 47 55.37 70.36 12 25.53
7793. gtg dinner (ijikman) 47 110.76 133.69 18 38.30
7794. Igor (igor2003) 47 70.74 88.92 11 23.40
7795. Qida (ieatpizza) 47 72.35 85.02 8 17.02
7796. Hari (hari_dev) 47 55.96 69.05 0 0.00
7797. Henrik (grimmzl) 47 60.87 73.04 12 25.53
7798. gc21 (giim_chyn) 47 92.42 115.53 17 36.17
7799. George (geogeorge456) 47 54.92 73.21 8 17.02
7800. zombie gaming (galaxybiscui... 47 83.23 105.32 17 36.17
7801. Don Kaboul (gabbaryamdak) 47 70.44 85.45 15 31.91
7802. Fred (fredxster) 47 66.33 80.12 4 8.51
7803. Kamil (finessegod_) 47 78.23 100.02 12 25.53
7804. Masquerade (fidtzy) 47 47.82 58.84 6 12.77
7805. Eldritch (ficuno) 47 44.89 64.24 4 8.51
7806. MY LIFE FOR PAKISTAN (eridpnc) 47 99.02 125.06 20 42.55
7807. Eric (ericlauchiho) 47 62.55 79.71 8 17.02
7808. Dev (devkoli) 47 48.93 64.49 3 6.38
7809. Alyssa (destroyer090) 47 62.68 76.82 4 8.51
7810. Deepan (deepan_hacker) 47 41.96 49.96 0 0.00
7811. David (davers4) 47 78.77 110.18 13 27.66
7812. fish (danf1) 47 95.34 112.09 19 40.43
7813. chandara (chan92) 47 85.14 105.93 21 44.68
7814. Carlkristie (carlkristie) 47 41.65 56.32 7 14.89
7815. Millie (brunomarstm) 47 31.03 38.12 5 10.64
7816. Beedle (bernod) 47 58.77 76.64 8 17.02
7817. Alpuds (alpuds) 47 78.09 102.76 16 34.04
7818. alis (aliss) 47 86.82 98.01 14 29.79
7819. Georgios (aktorion) 47 47.83 56.80 2 4.26
7820. J (akntmzjtj) 47 104.59 130.52 24 51.06
7821. Adam (acassidy24) 47 71.11 90.39 11 23.40
7822. Suvan (1080pixelz) 47 51.60 66.04 4 8.51
7823. alberta (albertaa) 47 68.89 83.61 13 27.66
7824. Kendii_Man (kendii_man) 47 79.04 100.04 28 59.57
7825. Swagata (bulets) 47 53.86 62.83 10 21.28
7826. Dhruv (dhruvmehta_409) 47 57.94 85.94 10 21.28
7827. Plus (mpurasu) 47 56.41 70.58 7 14.89
7828. Sagnik (shagzz_01) 47 60.82 77.90 8 17.02
7829. kk (infinitq_z) 47 66.97 85.82 30 63.83
7830. Maurya (maurya_21) 47 34.68 41.21 5 10.64
7831. Jim (quacksoncrack) 47 81.55 108.33 17 36.17
7832. Pim (_pmirum) 46 92.60 108.15 18 39.13
7833. Emmy (_dadstype_) 46 83.60 103.24 12 26.09
7834. Ziobr (ziobr) 46 92.00 108.72 19 41.30
7835. Brohath (zevo100) 46 81.22 101.34 8 17.39
7836. Enzo (yujiro144) 46 53.98 67.15 6 13.04
7837. Sagar (xdronzer) 46 53.20 69.80 5 10.87
7838. xahriman (xahriman) 46 73.95 93.32 11 23.91
7839. wolfBream (wolfbream45) 46 122.41 139.13 29 63.04
7840. will_t (will_t) 46 125.05 150.82 26 56.52
7841. Wally101 (walrusboy101) 46 79.82 96.57 10 21.74
7842. Daddy D (vr00m_) 46 59.78 79.80 8 17.39
7843. Hans (ts6d) 46 77.61 94.56 13 28.26
7844. thomas (tmastri) 46 74.60 94.22 6 13.04
7845. Nathanael (tinkerer_nat) 46 82.28 102.93 12 26.09
7846. Tilly (tillyrose) 46 92.55 111.13 20 43.48
7847. Jitendra (techjittu) 46 49.86 61.77 5 10.87
7848. 誌綸 (tdog0507) 46 66.69 89.78 13 28.26
7849. Aboostedninja (talonabuser) 46 96.12 125.00 15 32.61
7850. Sunil (sunilislaz) 46 46.08 74.78 6 13.04
7851. Suhas (suhaskurup) 46 87.53 101.81 13 28.26
7852. SPyofgame (spyofgame) 46 89.45 106.47 26 56.52
7853. spoon (spooderrr) 46 75.30 96.38 6 13.04
7854. Christian (speciial) 46 58.83 70.93 6 13.04
7855. BOOST~~~ (somen_chandra) 46 44.94 59.62 6 13.04
7856. Yazeed (snake69) 46 82.73 106.03 15 32.61
7857. Lexi (silentfungus) 46 30.50 48.74 10 21.74
7858. SH (shokha09) 46 53.34 62.22 5 10.87
7859. Hiraya (sheesh_24) 46 52.70 64.06 4 8.70
7860. Saurav (seldom69) 46 59.91 73.26 8 17.39
7861. Samir (samirissa) 46 55.13 72.45 9 19.57
7862. Jai Nepal (sajalpoudel) 46 51.58 59.75 6 13.04
7863. Ryan (ryanssd) 46 121.63 152.33 27 58.70
7864. Caspian (qashu) 46 63.57 86.43 15 32.61
7865. Pseudo (pseudo_here) 46 72.71 92.25 9 19.57
7866. pp (priscillaaa) 46 86.05 107.03 10 21.74
7867. Pranav (pranav16) 46 52.19 62.95 3 6.52
7868. Sondr (pngstr) 46 75.10 88.56 11 23.91
7869. ⠀ (ploop123) 46 73.54 92.60 14 30.43
7870. chiru (phenggot200darken) 46 79.54 99.71 9 19.57
7871. Alexander (pharos) 46 44.10 64.34 15 32.61
7872. Iveth (perlybomb) 46 55.45 67.74 8 17.39
7873. PelMeni (pelmeni) 46 110.78 124.62 24 52.17
7874. Paul (paulllx) 46 70.68 94.77 10 21.74
7875. Angel (olivias69) 46 63.14 70.96 8 17.39
7876. Abhimanyue (obsidian_abhi) 46 77.78 109.26 6 13.04
7877. Nafiul (n_crypted) 46 67.50 80.70 6 13.04
7878. NO_LYF (no_lyf) 46 63.98 79.18 14 30.43
7879. barmanrahul (nothisisrahul) 46 69.72 83.74 10 21.74
7880. Patiphan (nongper) 46 57.28 78.00 11 23.91
7881. Nmn (nmn147) 46 60.52 73.44 11 23.91
7882. Neel (neel19) 46 92.61 108.86 13 28.26
7883. nadeem (nadeemgujjar) 46 67.89 80.09 10 21.74
7884. Mohsen (mohsentypo) 46 63.22 74.60 17 36.96
7885. Mayan (mayan__) 46 66.55 82.19 9 19.57
7886. Max (maxim_brown) 46 65.34 81.60 8 17.39
7887. kim (kimblimblimz) 46 129.61 169.76 32 69.57
7888. Kimberly (kimbear_) 46 56.45 67.46 6 13.04
7889. Justin (juicet1n2) 46 130.98 155.08 27 58.70
7890. Joshua (jhsieh10) 46 88.85 105.24 16 34.78
7891. Jacob (intellectualbrick) 46 66.45 84.42 14 30.43
7892. Aaron (insertwordshere) 46 112.30 144.74 39 84.78
7893. sMarty (imrwonder2) 46 93.98 126.95 13 28.26
7894. icecreamfilling (icecreamfi... 46 89.90 105.12 14 30.43
7895. H A N S (hans_bk) 46 72.74 86.03 12 26.09
7896. guest_typist_new (guest_typ... 46 83.27 106.82 12 26.09
7897. Epzilon (epzilonn) 46 137.12 163.22 38 82.61
7898. Edgar (edgarflorez) 46 38.79 48.94 3 6.52
7899. Dweeb (dweb) 46 76.30 94.48 22 47.83
7900. Eric (draydere) 46 101.48 115.04 14 30.43
7901. Accuracy (dozwolonymein) 46 80.49 98.83 11 23.91
7902. mike (doorman32) 46 95.79 117.62 20 43.48
7903. d'toe 😎😎😎😎 (det... 46 88.24 117.04 12 26.09
7904. Martin (demonakinale) 46 123.40 147.90 29 63.04
7905. Derriel (ddcj90) 46 56.61 68.83 9 19.57
7906. Need (damdebotush) 46 41.80 48.86 4 8.70
7907. Corn Philips (cornphilips) 46 81.59 101.27 15 32.61
7908. David (cmagic_f) 46 90.43 107.61 12 26.09
7909. Check (checkmunza) 46 83.02 100.23 11 23.91
7910. Steven (carnivorous_crustat... 46 31.41 43.04 3 6.52
7911. Julia (bunnimochi) 46 68.65 91.66 10 21.74
7912. Brian (brianyounq) 46 104.03 126.73 22 47.83
7913. Broll (billwong28) 46 79.89 93.43 11 23.91
7914. ARTAN (begaal97) 46 102.05 117.47 17 36.96
7915. Harshit (awpsun) 46 66.06 83.01 11 23.91
7916. Asnar (asnarsar) 46 33.94 54.33 5 10.87
7917. Ash (ashbacchus) 46 59.98 73.65 5 10.87
7918. ansendice (asendice) 46 67.51 88.62 10 21.74
7919. Arata (aratatakeda) 46 65.67 84.28 5 10.87
7920. Annie (annie48) 46 62.98 72.91 11 23.91
7921. Alexander (alexanderbutcheeks) 46 70.13 84.10 5 10.87
7922. Aji (ajimathew) 46 50.84 66.62 11 23.91
7923. chris (aito_cornaro) 46 72.90 92.41 11 23.91
7924. Mohamed (abo4ams) 46 76.33 85.06 13 28.26
7925. Abdu (abduqodirov) 46 71.99 94.54 7 15.22
7926. Eobard (abdouhamel) 46 84.01 111.08 15 32.61
7927. J (22jcoluby) 46 50.01 61.79 3 6.52
7928. Ned (13_w) 46 60.99 78.00 5 10.87
7929. Divy (thivy) 46 58.74 81.95 8 17.39
7930. Sai (moon_toong) 46 31.03 41.03 2 4.35
7931. Ab (timaby) 46 41.14 53.21 3 6.52
7932. Naman (naman_vj) 46 65.20 82.42 11 23.91
7933. Aevaela (aevaela) 46 106.52 131.85 21 45.65
7934. Rithwik (rithwiksharma) 46 81.43 103.07 10 21.74
7935. karim (karimbdf) 46 47.26 57.98 5 10.87
7936. Anj (anj2000) 46 57.70 71.69 9 19.57
7937. Daniel (xdax) 46 59.53 74.32 3 6.52
7938. Rene (yayrene) 46 54.39 65.71 4 8.70
7939. Fabricio (ruk68) 46 46.21 59.71 6 13.04
7940. Admiral (admiralspoon) 46 93.45 115.13 21 45.65
7941. Karl (cheeseborgar) 46 70.94 82.08 8 17.39
7942. Auf (auf10) 46 40.26 51.73 2 4.35
7943. Surendra (zurendra9) 45 73.52 86.32 9 20.00
7944. Sam (zoinks_sam) 45 95.93 121.16 20 44.44
7945. zin (zinzin27bs) 45 55.30 70.56 3 6.67
7946. Daniel (zebrapopcorn) 45 95.45 124.22 18 40.00
7947. Youssef (youssef_ait_bihi) 45 71.34 95.44 9 20.00
7948. Yunus Emre (yemre95) 45 62.91 81.30 6 13.33
7949. I'm_on_mobile (yeetusthyfetus) 45 99.60 126.08 23 51.11
7950. yasser (yasserhr) 45 61.63 76.44 5 11.11
7951. Varun (wolfie12) 45 56.12 65.03 4 8.89
7952. Wiktor (wivvik) 45 47.64 60.21 5 11.11
7953. Wesgar (wesgar) 45 67.82 77.78 15 33.33
7954. Vikram (vikram_) 45 58.02 71.27 7 15.56
7955. unoriginalname (unoriginaln... 45 89.14 102.08 21 46.67
7956. Tsetsen (unknownxxx) 45 69.46 82.45 34 75.56
7957. Bray (turtlebray) 45 69.09 84.76 6 13.33
7958. Sitraka (tsukimurphy) 45 85.34 100.63 9 20.00
7959. Kennon (trainertaco) 45 67.77 80.69 10 22.22
7960. Huan (thehuan2005) 45 68.85 90.34 11 24.44
7961. Sh3y4sh (thegoldeneagle) 45 76.54 95.34 14 31.11
7962. alberto (th3biscuit) 45 46.02 59.03 6 13.33
7963. Ave (tessellatedtalent) 45 94.62 115.93 7 15.56
7964. sv (sv_1419) 45 46.75 56.05 3 6.67
7965. exqlouuebnfpgts (spitemim) 45 101.14 124.09 32 71.11
7966. Kevin (spezzytv) 45 91.11 115.90 14 31.11
7967. Bún Bò (snowk49) 45 90.48 111.07 13 28.89
7968. Diego (snkybkyloike) 45 62.56 79.76 8 17.78
7969. Sar (shift2alt) 45 59.62 70.68 13 28.89
7970. Mona (segasunset) 45 82.78 103.03 18 40.00
7971. Ross (rossmawd) 45 63.61 75.23 11 24.44
7972. Roy (rocko95) 45 72.39 87.37 8 17.78
7973. Michael (redwings20) 45 120.01 151.43 22 48.89
7974. Pryl (pryl) 45 85.79 107.65 12 26.67
7975. Poop (poopbuttpoop) 45 66.53 81.77 12 26.67
7976. B (pbhavin8584) 45 44.39 54.74 0 0.00
7977. Pastasoosi (pastasoosi) 45 49.97 60.86 3 6.67
7978. passivestar (passivestar) 45 116.04 141.98 45 100.00
7979. Zunbileg (ozbileg) 45 75.35 90.81 14 31.11
7980. Asif (orthocresol) 45 79.68 91.61 10 22.22
7981. Nrimanta (nwiziyanow) 45 45.37 63.69 12 26.67
7982. Ritesh (novathor) 45 55.51 67.50 7 15.56
7983. Nakura (nakura_sushi) 45 73.79 91.47 14 31.11
7984. Naaman (nae26) 45 86.76 113.08 16 35.56
7985. mushbert (mushbert) 45 55.60 69.40 12 26.67
7986. E (mosanbrick) 45 106.64 124.13 20 44.44
7987. k (mooneymooves) 45 69.48 88.19 5 11.11
7988. miko (mikesxan) 45 74.77 89.17 18 40.00
7989. Josiah (miitraa) 45 92.51 125.82 21 46.67
7990. aWiltedRhythm (mbh38) 45 110.92 125.84 25 55.56
7991. Max (maxube21) 45 59.46 70.51 12 26.67
7992. Mason (mason8008) 45 95.45 116.30 16 35.56
7993. Mahmoud (mahmoud_zaineldin) 45 63.68 80.32 8 17.78
7994. Lutful (lutful) 45 44.30 50.79 6 13.33
7995. Luciano (lucidokz) 45 72.75 99.55 9 20.00
7996. Hippily (lord_kartikey) 45 26.15 38.20 12 26.67
7997. lofr1t (lofr1t) 45 51.85 61.95 5 11.11
7998. Louzani (lk_kheir) 45 42.77 54.30 2 4.44
7999. Nicholas (legendarykeys) 45 81.36 101.45 13 28.89
8000. Sai Venkat (ksvr) 45 57.41 71.60 7 15.56
8001. KOU (koulangkaya) 45 59.89 72.75 7 15.56
8002. Justin (jubnx) 45 54.17 69.90 5 11.11
8003. Biggs (jobobhi) 45 86.52 104.73 14 31.11
8004. Jubbers (jlin526) 45 125.23 144.28 31 68.89
8005. Jeff (jeffwu1220) 45 93.41 110.12 13 28.89
8006. Aether (its_deep) 45 51.14 66.72 13 28.89
8007. ItsDuckyLol (itsduckylol) 45 77.45 91.02 9 20.00
8008. Debasmit (inmessi) 45 59.57 68.40 14 31.11
8009. XD (hphuonghehe) 45 61.31 74.68 8 17.78
8010. Hiyoshi (hiyochan) 45 155.20 182.66 40 88.89
8011. Eric (heeric) 45 110.41 123.99 19 42.22
8012. Hassan (hassanjazzy143) 45 63.17 72.98 5 11.11
8013. Halftimenerd1 (halftimenerd1) 45 52.92 64.01 7 15.56
8014. GrandMaster (grandmaster101) 45 71.43 84.29 7 15.56
8015. Ben (god0nline) 45 103.23 142.45 25 55.56
8016. Gabbie (gg13) 45 75.47 91.30 9 20.00
8017. Ganesh (gat786) 45 51.21 70.90 3 6.67
8018. Frosted (frosted_bruh) 45 75.24 89.17 7 15.56
8019. Frag_Pumpkin (frag_pumpkin) 45 61.28 71.66 6 13.33
8020. fihee (fihee) 45 60.36 79.78 12 26.67
8021. fedja (fedza) 45 108.59 123.14 20 44.44
8022. ducky (duckyboy0) 45 53.80 62.97 2 4.44
8023. Solomon (donutrk) 45 148.65 187.49 34 75.56
8024. Didoff (didoff) 45 67.48 82.16 10 22.22
8025. dhara (dhara12) 45 37.80 47.15 3 6.67
8026. Cygnus (cygnuss) 45 135.57 161.12 32 71.11
8027. CTLim (ctlim02) 45 76.54 96.78 11 24.44
8028. Cool (creepycumber) 45 82.00 99.28 12 26.67
8029. Conning (conning) 45 108.58 127.67 22 48.89
8030. Chicken (chickenhide) 45 124.47 155.65 29 64.44
8031. Zyrin (captainzyrin1024) 45 85.99 106.12 15 33.33
8032. K (blue_addict) 45 60.43 81.49 9 20.00
8033. Blazian444 (blazian444) 45 108.11 129.57 14 31.11
8034. BEMZ (bemz_mc) 45 50.63 63.38 10 22.22
8035. Izanagi (baguettianmysticism) 45 179.78 210.49 45 100.00
8036. Kevinh (baconpool14) 45 98.38 129.56 17 37.78
8037. Darda (babyonbaby) 45 101.49 126.74 21 46.67
8038. Emma (aria_tran) 45 64.07 84.73 11 24.44
8039. Rajat (arakanfudo) 45 54.76 68.75 42 93.33
8040. (andyjoekool) 45 95.46 159.17 17 37.78
8041. leibniz (anamaya11) 45 63.25 75.53 9 20.00
8042. AmgdHussein (amgd_hussein) 45 46.95 55.74 5 11.11
8043. Alex (alexstrang25) 45 98.63 116.63 17 37.78
8044. Ankit (akjung478) 45 55.07 65.23 4 8.89
8045. acrymoore (acrymoore) 45 87.69 101.48 15 33.33
8046. Abbacchio (abbacchio) 45 96.62 115.66 14 31.11
8047. Spark (5parkmark) 45 84.91 102.04 15 33.33
8048. James (2janghoon) 45 119.58 152.64 24 53.33
8049. abc (1714245ctk41) 45 88.68 108.03 14 31.11
8050. 100% (100percentaccurate) 45 100.45 120.64 20 44.44
8051. REV (krevengek) 45 39.09 46.26 2 4.44
8052. sebastian (teekq) 45 102.46 120.65 12 26.67
8053. Kingpin (bahmandoor) 45 80.96 93.67 18 40.00
8054. Moazzam (qwikiquartz) 45 66.23 75.42 10 22.22
8055. Divyansh (elessar42) 45 34.58 47.38 6 13.33
8056. Cameron (cammy24) 45 90.57 118.57 26 57.78
8057. azer8 (azer8) 45 56.44 69.90 3 6.67
8058. rr (rosandy10) 45 60.28 73.20 10 22.22
8059. Vincent (supersayu) 45 105.82 123.77 21 46.67
8060. Enrico (ricodmarlon) 45 83.18 100.86 11 24.44
8061. Yammine (y__y) 45 77.63 90.53 11 24.44
8062. gufu12 (gufu12) 45 48.30 63.22 38 84.44
8063. James (buttcheeks34) 45 99.31 113.97 17 37.78
8064. Sen (puggowuggo) 45 38.28 49.65 12 26.67
8065. Kirk (maruts) 45 76.36 99.89 15 33.33
8066. Ame (imtodess) 45 75.47 102.03 9 20.00
8067. Mark (bufferx) 45 77.44 93.93 12 26.67
8068. Shohruxxon (shohruxxon7) 45 50.39 67.28 3 6.67
8069. Stacky (headstack) 45 101.21 135.86 21 46.67
8070. Andreas Boulios (boulibouli) 45 65.20 84.68 6 13.33
8071. arne (arnegutten) 45 54.76 64.54 5 11.11
8072. (zesty11) 44 109.68 135.33 14 31.82
8073. xain (xainq) 44 51.71 62.42 7 15.91
8074. weston (westonu) 44 97.70 121.73 20 45.45
8075. Vera (verabee9183) 44 62.15 79.52 9 20.45
8076. uled (uled) 44 71.40 98.57 18 40.91
8077. Ryan (typerace_ryan) 44 56.29 68.69 9 20.45
8078. Dog (tropicaldog17) 44 65.86 86.50 9 20.45
8079. Cornelio (tirdsaba) 44 53.66 65.54 7 15.91
8080. Tobiloba (thetobitron) 44 88.34 105.42 9 20.45
8081. John (thegangplankgod) 44 125.47 152.02 31 70.45
8082. Ivan (t3ry444y) 44 55.82 65.34 4 9.09
8083. Bailey (swagoneering) 44 103.19 122.40 14 31.82
8084. oliver (sushiboyking) 44 94.83 114.58 14 31.82
8085. chikke (srujan_chikke) 44 31.23 39.38 5 11.36
8086. beans (squirtly) 44 106.58 126.96 21 47.73
8087. Hieu (spicy888) 44 61.65 76.67 9 20.45
8088. thetacosmurgf (smurfer1121) 44 112.00 131.52 22 50.00
8089. smug (smugwise_the_brave) 44 79.71 100.87 21 47.73
8090. Zack (smagroda) 44 74.52 85.25 16 36.36
8091. Ivan (s017180) 44 96.27 116.60 15 34.09
8092. Robert (rwa102455) 44 101.59 119.88 17 38.64
8093. tstats[rueo] (rueo) 44 49.16 60.77 5 11.36
8094. Rounak (rouvai) 44 85.56 102.53 12 27.27
8095. Rodrigo (rodrigoferrer) 44 87.93 101.55 17 38.64
8096. Rikesh (rikesh) 44 100.75 129.96 25 56.82
8097. Vineet (raovineet14) 44 58.01 66.38 5 11.36
8098. Qi (qitang) 44 103.12 115.91 12 27.27
8099. poobastank (poobastank) 44 76.17 93.24 7 15.91
8100. pipez (pipez) 44 99.41 116.53 16 36.36
8101. Kyle (pickles3201) 44 126.22 150.77 26 59.09
8102. prehistoriczebra (penguin45) 44 62.21 84.74 13 29.55
8103. An (pastwords) 44 75.59 93.48 16 36.36
8104. Parth (parthpsh) 44 75.89 94.56 36 81.82
8105. allie (oatmilf22) 44 62.62 83.78 11 25.00
8106. ¯\_(ツ)_/¯ (nopatno) 44 140.74 189.90 31 70.45
8107. n0neya (noneyaaa) 44 98.82 114.28 17 38.64
8108. Niraj (nirajkamat) 44 32.17 39.49 2 4.55
8109. Yung N8 (ngreene5) 44 63.81 87.45 13 29.55
8110. (nalyd_on_colemak) 44 101.29 156.07 0 0.00
8111. J (mr_wood) 44 89.64 112.44 15 34.09
8112. MrDot (mr_dot) 44 61.00 78.75 11 25.00
8113. Mo (mosidhom) 44 87.52 109.37 13 29.55
8114. aindriu (morrisa8) 44 66.24 80.89 8 18.18
8115. Mohamed (mednoun) 44 63.18 72.10 5 11.36
8116. Maybe (maybe413) 44 118.62 129.97 22 50.00
8117. Chanokchon (mantarays) 44 61.80 70.32 9 20.45
8118. lumapools (lumapools) 44 92.18 107.46 16 36.36
8119. dennis (ludennis0606) 44 89.06 107.72 11 25.00
8120. luis (lozalui004) 44 66.21 79.33 5 11.36
8121. Lord (lord_v) 44 72.12 85.07 11 25.00
8122. Colemak (life808) 44 93.29 118.20 15 34.09
8123. Igor (kziv) 44 37.70 49.32 1 2.27
8124. KeeG9x (keeg9x) 44 80.11 103.44 17 38.64
8125. Kalin (kalin_a) 44 63.08 73.69 8 18.18
8126. John (juseonghan) 44 120.26 149.15 22 50.00
8127. Jim (jumsey) 44 82.73 106.62 13 29.55
8128. S (juicebox_27) 44 91.22 115.55 17 38.64
8129. now colemak! (jlam55555nonq... 44 125.54 145.63 32 72.73
8130. Jin (jin_an) 44 73.36 87.55 14 31.82
8131. JBK (jeyabalakrishnan) 44 44.24 53.65 3 6.82
8132. jjerry (jerry_nyae) 44 85.74 104.88 7 15.91
8133. Jake (jasala) 44 92.64 108.43 16 36.36
8134. Izhar Ali (izhar368) 44 60.52 71.40 7 15.91
8135. korn (itthikorn777) 44 49.77 59.56 5 11.36
8136. isenze (isenze) 44 70.18 79.93 20 45.45
8137. no (humeunculus) 44 124.97 146.82 24 54.55
8138. Suhel (horacio_chopin) 44 70.42 83.00 9 20.45
8139. heam (heamkream) 44 60.38 73.61 22 50.00
8140. Harvey (harveyqqq) 44 86.21 101.28 12 27.27
8141. Grey (grey2) 44 87.91 109.70 12 27.27
8142. ricchi bambini tristi (giov... 44 134.25 147.90 29 65.91
8143. John (gakbo) 44 82.15 108.68 10 22.73
8144. Jacob (gadekaja) 44 90.45 118.42 13 29.55
8145. John (fsxsteamboss) 44 57.90 70.69 7 15.91
8146. Glen (foxdigits) 44 106.96 136.93 20 45.45
8147. Abhishek (erabh) 44 45.41 56.49 9 20.45
8148. 69 WPM andy (eerietants) 44 69.60 93.46 13 29.55
8149. tstats[easybeef] (easybeef) 44 62.42 80.11 5 11.36
8150. Calvin (doyotko) 44 106.83 134.44 18 40.91
8151. Dan (dgallerz) 44 84.88 106.43 14 31.82
8152. (dev_origami) 44 96.10 117.05 15 34.09
8153. Kshitij (desikheeda) 44 69.62 81.18 14 31.82
8154. giggity (demo_admin) 44 121.53 143.36 21 47.73
8155. Deadman (deadrohan19) 44 43.74 55.56 3 6.82
8156. Ahmed (deadmoonsoldier) 44 66.78 79.70 9 20.45
8157. Dash (darkdash) 44 98.73 116.61 17 38.64
8158. Francis (coronadoloser76) 44 75.92 91.72 11 25.00
8159. Alexander (codec4) 44 82.49 94.72 8 18.18
8160. Sop (coachprincesssoppy) 44 67.02 80.39 11 25.00
8161. Ethan (chung_ethan) 44 72.32 142.94 8 18.18
8162. Coughingmouse (cexora) 44 63.46 84.33 3 6.82
8163. Cedric (cedrilicity) 44 85.46 126.57 15 34.09
8164. Captain (ccap) 44 39.26 50.94 37 84.09
8165. TypeNightmare (bozijovel) 44 53.64 64.85 0 0.00
8166. Blue (blueberkeley) 44 90.98 124.32 13 29.55
8167. be (besalt) 44 85.22 105.90 10 22.73
8168. k1mbap (beaned_fish) 44 107.78 129.52 29 65.91
8169. Bae (baenimbae12) 44 84.02 105.70 13 29.55
8170. bachu (bachu2020) 44 59.38 82.72 12 27.27
8171. Andres (avillarreal14) 44 87.77 99.35 8 18.18
8172. Ausar (ausar0) 44 106.92 124.00 22 50.00
8173. Braylin (atlasrising) 44 106.87 117.08 24 54.55
8174. Chatura (atakatus) 44 51.40 62.07 4 9.09
8175. Alex (aselia_azim) 44 48.40 59.10 4 9.09
8176. Anuj (anujsharma411) 44 76.97 90.37 16 36.36
8177. Ankush (ankushchavhan7596) 44 50.88 60.17 7 15.91
8178. Ankith101 (ankith101) 44 51.93 69.48 7 15.91
8179. Amit (amitu7) 44 68.39 83.04 11 25.00
8180. Al (alriad) 44 59.47 68.28 11 25.00
8181. Alex (alexkylelee) 44 105.51 138.04 22 50.00
8182. Aero (aerosoul) 44 67.97 81.86 4 9.09
8183. 10SlowFingers (aabhas) 44 65.51 84.16 6 13.64
8184. andrew (400wpmalphamale) 44 98.58 136.16 20 45.45
8185. Ole (olenord) 44 79.53 93.77 11 25.00
8186. pudding_ (ericedge3315) 44 83.74 97.66 12 27.27
8187. Syterelic (syterelic) 44 76.52 95.06 14 31.82
8188. Yuni (yuni190) 44 79.78 99.01 11 25.00
8189. Balibari, (balibari) 44 73.51 91.13 10 22.73
8190. Wu (recharge323) 44 48.92 60.35 4 9.09
8191. Blob (blobby21) 44 62.27 84.11 6 13.64
8192. Angel (cyclomos) 44 70.07 90.73 6 13.64
8193. Anand 🇳🇵 (anand_from_... 44 60.66 78.10 7 15.91
8194. Mohamed (lester_ze_molester) 44 50.54 65.33 3 6.82
8195. Darkrydier (darkrydier) 44 90.30 114.68 14 31.82
8196. Llyrad (sopthelast) 44 67.61 77.13 7 15.91
8197. Regine (regineann) 44 74.19 90.07 10 22.73
8198. po1nt (_po1nt_) 43 77.00 87.37 13 30.23
8199. Phi (ze_phi) 43 87.20 102.13 16 37.21
8200. tstats[yeunakho] (yeunakho) 43 38.49 54.04 3 6.98
8201. adrian (yeahaight) 43 52.00 75.05 5 11.63
8202. Coffee Boy (xuantungbrian) 43 45.43 53.92 1 2.33
8203. Eloona (wombatinmaison) 43 91.27 112.37 14 32.56
8204. Juan (wolf_1) 43 64.83 77.32 8 18.60
8205. Prince (wayward_prince) 43 79.88 109.68 13 30.23
8206. Allan (unknownfiles) 43 100.06 120.76 15 34.88
8207. Mihkel (tikstiks) 43 81.40 101.94 17 39.53
8208. Charles (themythicalvlad) 43 107.64 118.91 22 51.16
8209. Rafael (syrena) 43 87.96 109.14 13 30.23
8210. Great (synergy__) 43 91.99 113.97 17 39.53
8211. Steven (steventheplayer) 43 73.38 91.68 16 37.21
8212. steveleeb (steveleeb) 43 131.27 152.07 22 51.16
8213. SHRI (srinivasdokare) 43 53.41 69.96 4 9.30
8214. ☞sondv (sondv) 43 90.82 111.04 16 37.21
8215. Phinix (soaringphinix) 43 84.11 99.62 10 23.26
8216. Hieu (sn1rep) 43 58.14 70.61 6 13.95
8217. sirjan (sirwolf208) 43 60.86 67.55 15 34.88
8218. Dan (sirdanofthedirt) 43 81.61 99.37 11 25.58
8219. Sarah (shetzah) 43 78.22 99.93 8 18.60
8220. severed_toast (severedtoast) 43 102.50 140.59 15 34.88
8221. Sanwal (sanwal_junejo0007) 43 47.98 61.30 2 4.65
8222. Sangi (sangi38) 43 92.00 103.88 13 30.23
8223. Salehbin (saleh_mksd) 43 34.86 42.47 0 0.00
8224. ruby (rubymuzz) 43 61.10 85.57 8 18.60
8225. Kyle Johnson (rickharrisoncoc) 43 85.60 102.58 16 37.21
8226. Rey (reypanerz) 43 51.38 65.10 8 18.60
8227. Butchy (randomguy4ever) 43 70.42 90.17 12 27.91
8228. (quadroopl) 43 159.40 185.48 27 62.79
8229. j (potatostock) 43 72.13 94.08 11 25.58
8230. tstats[pook_dvorak] (pook_d... 43 102.35 125.57 15 34.88
8231. Philip (plip_1021) 43 85.46 94.17 12 27.91
8232. George (peposss) 43 86.40 94.96 12 27.91
8233. osso (osso94) 43 70.02 94.49 15 34.88
8234. oskar (osny19) 43 105.14 123.12 18 41.86
8235. katie (okaykatieokay) 43 80.06 94.36 8 18.60
8236. nicole (nkkicole) 43 74.94 94.36 10 23.26
8237. Aaron (nightcreators) 43 104.37 127.86 16 37.21
8238. 1234 (nemesistroy) 43 70.04 108.55 11 25.58
8239. lmao (nate11111) 43 101.19 119.32 15 34.88
8240. Napplebee (napplebee) 43 60.70 73.73 7 16.28
8241. Nabeel (nabz126) 43 52.76 64.38 6 13.95
8242. Mohammed (mohammed55555) 43 82.39 93.10 14 32.56
8243. Mikel (mikelhector) 43 78.10 96.72 19 44.19
8244. Melas (melas1) 43 98.97 117.14 12 27.91
8245. Maruberry (maruberry) 43 100.61 126.75 15 34.88
8246. Armando (mandy1339) 43 84.36 98.47 12 27.91
8247. :( (magtraxer) 43 102.29 134.71 15 34.88
8248. Trianglateral (luckyashraj) 43 61.16 69.95 7 16.28
8249. Mohamed A. (lim_elnoll96) 43 48.33 64.18 8 18.60
8250. Harley (legendharley) 43 99.28 118.65 19 44.19
8251. Vũ (khanhyeuquan) 43 88.58 108.08 13 30.23
8252. shinkou (kashinkou) 43 57.04 75.24 23 53.49
8253. Jack (jackiechips) 43 31.13 41.66 7 16.28
8254. Sam (ie_dead) 43 72.41 101.69 9 20.93
8255. Himanshu (himanshumishra3198) 43 59.74 68.65 11 25.58
8256. hhdhwuus (hhdhwuus) 43 72.46 88.67 9 20.93
8257. Momo (helloworldwhatniceday... 43 98.35 120.89 12 27.91
8258. salad fingers (guuul) 43 117.18 138.03 20 46.51
8259. Elliot (gofire8) 43 86.32 106.30 7 16.28
8260. goe (goeeeeeeee) 43 83.16 99.75 0 0.00
8261. tameflame (gabrieljohngabri... 43 82.04 95.82 9 20.93
8262. ea (fluxheat) 43 54.37 68.09 7 16.28
8263. faith (flatypus) 43 114.16 146.48 28 65.12
8264. Tausif (fishey3) 43 63.15 81.36 8 18.60
8265. Ezzy (ezzzyz) 43 50.05 60.08 3 6.98
8266. Megaracer BTW (erkytyper) 43 83.04 95.27 14 32.56
8267. Danny (ecgab) 43 99.44 118.32 17 39.53
8268. NCCFlame (dysfunctional_dra... 43 92.43 121.21 12 27.91
8269. Disqusting (disqusting_mclo... 43 50.87 64.71 5 11.63
8270. Дидакус (didacus) 43 96.71 110.21 17 39.53
8271. Tony 🐱👤 (demon0192) 43 106.30 128.51 23 53.49
8272. meow (dalayalia) 43 66.45 82.85 10 23.26
8273. D (dabirik) 43 64.45 78.66 11 25.58
8274. CopyNinja09 (copyninja_) 43 44.02 52.03 2 4.65
8275. Christian (chrisshaw) 43 130.65 154.63 29 67.44
8276. senpai (chottomatte) 43 86.74 117.60 10 23.26
8277. Matt (chillmaster) 43 67.43 78.20 10 23.26
8278. Chase (chezit7) 43 82.09 105.34 11 25.58
8279. Cassie Lynn (cassielynz_00) 43 72.05 86.65 14 32.56
8280. Quốc (cangu07042006) 43 112.48 132.39 22 51.16
8281. typinggawd (brandon934) 43 90.42 115.00 19 44.19
8282. Nick (bopob) 43 93.62 114.99 22 51.16
8283. Bil3ygr (bil3ygr) 43 64.14 90.28 9 20.93
8284. Berty (bertybert) 43 76.93 94.02 18 41.86
8285. TypingNoob (bekarihh) 43 78.95 95.59 11 25.58
8286. BanjoBoss (banjoboss) 43 96.08 119.71 20 46.51
8287. Atom (atom_atom) 43 67.99 85.90 12 27.91
8288. QuietObedientConsent (arrow... 43 92.78 114.36 13 30.23
8289. Arda (ardat96) 43 59.82 73.44 11 25.58
8290. Ankit Sarkar (ankitsarkar) 43 49.74 65.46 40 93.02
8291. Ivan (aivan2) 43 71.97 85.96 11 25.58
8292. Armon (airtyper_11) 43 82.09 109.59 11 25.58
8293. ahmed (ahmed393) 43 68.39 76.61 4 9.30
8294. Aayam (aayam_04) 43 38.62 49.65 1 2.33
8295. MIke (3nd4u) 43 65.10 86.03 16 37.21
8296. Leinad (msdfar) 43 72.87 96.59 10 23.26
8297. iron4in2020 (iron4in2020) 43 64.56 73.71 13 30.23
8298. Abil (phr0zencr3w) 43 47.03 57.16 7 16.28
8299. Edward (smegle2) 43 53.55 67.80 4 9.30
8300. imhemantchaubey (hemantchau... 43 42.56 58.20 2 4.65
8301. Jake (jake1151) 43 50.52 60.49 2 4.65
8302. Kpusta (cabbagemans) 43 76.74 91.18 11 25.58
8303. Josh (josh122203) 43 65.74 80.01 7 16.28
8304. ryujin's footrest (iankenneth) 43 77.08 90.72 14 32.56
8305. sygn (sygn_ray) 43 39.72 46.68 2 4.65
8306. harabau (harabau) 43 70.75 84.65 14 32.56
8307. Zombie (zombiecoder) 42 39.67 50.32 3 7.14
8308. Kyle (zan9etsu) 42 58.49 73.38 12 28.57
8309. Yazan (yazan_al) 42 67.72 78.93 12 28.57
8310. Yas'-' (yaser_) 42 64.92 79.80 6 14.29
8311. Chris (wupops) 42 62.04 82.00 12 28.57
8312. MistakesWereMade (workmanty... 42 81.85 99.00 16 38.10
8313. Adrian (whyisthisnotavailable) 42 104.98 135.56 26 61.90
8314. WhyAre (whyare) 42 78.91 132.92 10 23.81
8315. Vova (v_hg_p) 42 56.41 76.53 4 9.52
8316. vix (vrinze) 42 77.26 92.64 9 21.43
8317. usstudent101 (usstudent101) 42 107.97 140.13 22 52.38
8318. Roma (useflame) 42 88.20 103.80 12 28.57
8319. w_mb1 (trundling) 42 89.42 106.40 23 54.76
8320. Alisher (tourist671) 42 60.62 74.81 14 33.33
8321. justice (totorek) 42 39.86 51.27 2 4.76
8322. keychronk6 (theonlydvorakguy) 42 103.68 121.06 18 42.86
8323. sw0rd (sw0rd) 42 82.17 101.65 15 35.71
8324. Tomas (sumtinlazy) 42 108.11 126.92 19 45.24
8325. reever (ssamu) 42 85.59 108.09 11 26.19
8326. Ahmad (slayman19) 42 133.57 168.27 27 64.29
8327. Ludwig (simontypo) 42 68.42 86.75 15 35.71
8328. shrenik (shrenikr235) 42 90.85 128.02 16 38.10
8329. Shiv (shivam9_) 42 58.98 73.97 13 30.95
8330. Shift (shiftw) 42 77.05 94.54 14 33.33
8331. Scooby (scoobydooby) 42 53.33 65.51 2 4.76
8332. Sanyeet (sanyeet) 42 86.50 104.89 14 33.33
8333. Sam (sam3456) 42 87.01 110.61 10 23.81
8334. Ruben (rubenzhang) 42 93.46 108.15 15 35.71
8335. RjTvqH (rjtvqh) 42 68.99 84.55 7 16.67
8336. Ros (ric_ros_839) 42 41.46 48.75 5 11.90
8337. Fedor (raxker) 42 47.26 53.67 1 2.38
8338. Rain (rainy) 42 70.00 98.38 10 23.81
8339. Parv (parvmodi) 42 56.93 65.66 6 14.29
8340. omardigits (omarmejiaa) 42 54.57 67.02 6 14.29
8341. Niofer (niofer) 42 77.76 98.52 8 19.05
8342. nea (neapollotan) 42 70.67 85.42 8 19.05
8343. Naulitus (naulitus) 42 69.15 79.64 11 26.19
8344. Kristijonas (nasyrke) 42 78.70 90.81 16 38.10
8345. 1step (narcindin) 42 104.88 130.93 14 33.33
8346. Dominik (monteymontey) 42 89.74 112.01 14 33.33
8347. Anonymous (mntlprblm) 42 87.52 113.60 17 40.48
8348. mt (migclare) 42 87.69 109.61 13 30.95
8349. Lőrinc (mbalazs) 42 107.93 119.31 24 57.14
8350. Mathyou (mathyou_177) 42 69.84 78.80 5 11.90
8351. Masy (masy404) 42 66.49 82.20 36 85.71
8352. Fastpoke (make_me_better) 42 69.22 86.07 11 26.19
8353. maikim (maikim) 42 74.58 90.26 12 28.57
8354. Mahatej Varma (mahatejvarma) 42 67.32 84.94 11 26.19
8355. Aman (mag1k_iwnl) 42 63.88 79.92 14 33.33
8356. Mad (mad888) 42 93.01 117.10 28 66.67
8357. Luvie (luvie1310) 42 74.73 91.75 15 35.71
8358. llameow (llameoww) 42 114.04 134.83 25 59.52
8359. MeguminQT (leonathor) 42 90.48 101.83 20 47.62
8360. Justin (leethelethal) 42 93.52 111.58 11 26.19
8361. watchdominion.com (leegunner) 42 100.76 125.28 14 33.33
8362. kanak (k_a_n_a_k) 42 44.20 58.78 3 7.14
8363. Andrei (kulturedschwein) 42 54.20 74.25 4 9.52
8364. sync (kjh2196) 42 102.63 116.28 17 40.48
8365. Kirti (kirti773) 42 49.43 76.98 3 7.14
8366. ω (kerdax) 42 79.94 97.66 8 19.05
8367. john (jpom16) 42 58.77 71.89 9 21.43
8368. Joshua (joshua172) 42 93.45 115.21 17 40.48
8369. Aleksije (jastar) 42 45.53 58.60 8 19.05
8370. Taco (i_the_sausage) 42 86.74 108.92 8 19.05
8371. ivan (ivanchok) 42 94.14 118.25 15 35.71
8372. tstats[isakooooo] (isakooooo) 42 121.50 144.23 21 50.00
8373. Isaac (hyperkids) 42 119.60 142.62 18 42.86
8374. Noah (hvon) 42 104.42 125.19 19 45.24
8375. Hussain (hussainkhan) 42 56.80 71.57 4 9.52
8376. Hreyfill Hreyfill (hreyfill) 42 144.13 180.23 35 83.33
8377. hahnur (hahnurk) 42 98.28 116.57 16 38.10
8378. sarah (hahaimsmart) 42 86.17 106.76 15 35.71
8379. gst (gsttyping) 42 40.96 49.51 4 9.52
8380. Miyamura (grapewiggler) 42 78.65 94.86 14 33.33
8381. Gooby (goobygod) 42 98.48 123.90 25 59.52
8382. Ara (goatrager) 42 64.45 89.79 10 23.81
8383. Tugssaikhan (gantsogtt) 42 53.14 69.83 9 21.43
8384. ludwigg (froggg) 42 75.39 100.33 6 14.29
8385. James (fintero) 42 66.15 83.16 12 28.57
8386. Eli (elity) 42 72.37 88.07 8 19.05
8387. (egahbh) 42 134.81 153.40 28 66.67
8388. Adam (ediggity152005) 42 120.01 135.57 24 57.14
8389. Dmitriy (dimasidorenko) 42 53.68 62.39 7 16.67
8390. Talha (digitaldruglord) 42 68.36 75.84 9 21.43
8391. David (dgiddens928) 42 78.37 101.41 9 21.43
8392. Devesh (dev344) 42 81.45 92.43 12 28.57
8393. nielr (danyl) 42 61.76 81.42 6 14.29
8394. Dingo Dango (dankwanktank) 42 70.65 91.64 14 33.33
8395. Dude (damonjammin) 42 55.87 72.80 6 14.29
8396. daikonsama (daikonsama) 42 52.00 66.66 6 14.29
8397. Daniel (d123aniel) 42 95.71 118.96 18 42.86
8398. crz316 (crz316) 42 41.23 49.16 2 4.76
8399. rawr? (cloudjumper) 42 91.39 104.90 16 38.10
8400. Chris (chrisk_04) 42 60.25 78.47 5 11.90
8401. Charlie (charlieeeee) 42 92.54 110.30 16 38.10
8402. Creams4 (chadzuko) 42 91.72 120.01 10 23.81
8403. Bodyguard (bxdygxard) 42 50.42 64.07 3 7.14
8404. Issaree (boranorben) 42 55.68 66.93 2 4.76
8405. Pranav (bodiez) 42 75.20 101.24 16 38.10
8406. Bobirjon (bob_pro) 42 61.00 72.84 11 26.19
8407. Gibson (better_gibby) 42 99.59 120.04 13 30.95
8408. Angus (benjals9) 42 59.61 78.49 10 23.81
8409. dean (aydeano) 42 88.19 117.73 10 23.81
8410. ariyaninj (aryaninj) 42 48.78 70.89 9 21.43
8411. Angel (angelrami003) 42 51.55 64.20 2 4.76
8412. Andrei (andyspeed) 42 72.19 89.57 13 30.95
8413. Amarant (amarant_) 42 68.27 84.99 7 16.67
8414. Ahpoo (ahpoo) 42 82.43 103.29 12 28.57
8415. Adlin (adlin_typer18) 42 69.73 87.84 15 35.71
8416. accorn (accorn279) 42 128.51 145.35 28 66.67
8417. Abe (abe299) 42 51.83 67.85 6 14.29
8418. Rafael (23woodyj) 42 89.86 108.01 13 30.95
8419. Hunter (sascroc) 42 78.62 98.22 7 16.67
8420. Fred (fgrady3) 42 60.60 72.51 4 9.52
8421. Sanjero (sanjero) 42 63.88 77.55 9 21.43
8422. Vinamr (h_e_y) 42 88.05 101.58 9 21.43
8423. Eric (kusikiwi) 42 90.12 120.92 11 26.19
8424. Cloudyrain (cloudy_rain) 42 44.78 60.40 4 9.52
8425. Hanif (hanifimaduddin) 42 50.28 71.50 6 14.29
8426. Ceus (simply_ceus) 42 67.92 79.56 12 28.57
8427. J (jbddiesel) 42 59.70 73.05 11 26.19
8428. Theo (theomorrison) 42 82.54 97.67 9 21.43
8429. shanky (shasha06) 42 33.06 43.73 4 9.52
8430. Raja (rajatype) 42 59.86 77.93 8 19.05
8431. Pjmarella05 (pjmarella05) 42 55.93 68.36 5 11.90
8432. Mindy (minnie3319) 42 76.53 89.21 16 38.10
8433. Wolfgang (wolfgang_69) 42 46.00 62.33 3 7.14
8434. Nyx (_nyxx_) 41 27.17 31.39 13 31.71
8435. zefanya24k (zefanya24k) 41 111.80 132.29 18 43.90
8436. banvotesgames (x_adware) 41 123.34 153.41 16 39.02
8437. Bryan (xxavalonxx) 41 64.62 75.39 11 26.83
8438. Waterman304 (waterman304) 41 99.27 111.75 12 29.27
8439. Walnert (walnert) 41 96.60 115.29 24 58.54
8440. Hai (vroyibg) 41 61.00 72.31 8 19.51
8441. Pieter (umbravanlocks) 41 67.73 82.16 6 14.63
8442. Car (ufoes) 41 75.76 93.51 7 17.07
8443. Uladzislau (tumilok) 41 66.73 79.42 12 29.27
8444. AJ (theloafingone) 41 109.08 131.73 28 68.29
8445. em (thelawsofjay) 41 130.68 155.15 29 70.73
8446. Bro (termog) 41 72.68 87.45 14 34.15
8447. sean (tak32) 41 83.66 99.97 5 12.20
8448. Josh (syztyqus) 41 82.97 94.64 14 34.15
8449. Sujal (sujal_fast) 41 53.98 69.14 4 9.76
8450. Hhhh (strawbirry) 41 93.41 116.88 14 34.15
8451. Simone (simone79) 41 76.57 83.88 12 29.27
8452. Gabe (silentsnake2398) 41 72.50 85.63 9 21.95
8453. SHU (shu_ik) 41 84.80 107.25 14 34.15
8454. BAZINGA (shruthi_) 41 54.42 61.89 3 7.32
8455. Alex (servicer) 41 76.07 96.92 12 29.27
8456. SECsplitOND (secsplitond) 41 96.58 122.99 20 48.78
8457. scubtle (scrubsworth) 41 88.31 100.20 15 36.59
8458. Sander (s4ndert) 41 61.21 85.26 12 29.27
8459. Rubin (rubintypes) 41 81.34 95.39 12 29.27
8460. Robby (roweki21) 41 81.90 100.17 14 34.15
8461. Ripon Kumar (riponcse) 41 60.05 79.24 9 21.95
8462. Stefan (ringding) 41 102.93 122.57 12 29.27
8463. Rimuru (rim_uru) 41 54.19 64.16 3 7.32
8464. R1CZ4RD (riczard) 41 51.61 61.81 4 9.76
8465. Richie (richiemoring) 41 45.90 58.78 2 4.88
8466. Shawn (rcvroom) 41 109.02 128.62 25 60.98
8467. raymond (raymondgggg) 41 81.18 100.20 4 9.76
8468. Ravi (raviparasar1997@gmail... 41 67.90 84.08 10 24.39
8469. Renzo (raccon) 41 76.12 99.26 13 31.71
8470. person (person625) 41 108.56 121.97 18 43.90
8471. oToToT (ototot3ot) 41 68.70 80.80 10 24.39
8472. noctedie (noctedie) 41 70.28 98.35 13 31.71
8473. Nishit (nishit130) 41 60.79 77.15 9 21.95
8474. Nick (nicklong1599) 41 109.19 127.53 21 51.22
8475. Naren Manikandan (nane_m) 41 64.68 77.56 8 19.51
8476. ko (nakanidashite) 41 63.08 85.91 12 29.27
8477. Mon (m_nguyen05) 41 63.26 73.72 10 24.39
8478. Princh (mvprinch) 41 113.99 135.75 24 58.54
8479. Ricky (muffinpotato) 41 99.70 116.99 23 56.10
8480. Moola_80wpm (moola_80wpm) 41 59.96 71.36 7 17.07
8481. Kato (mkatoh) 41 87.50 108.43 15 36.59
8482. Mukul (mega_mukul) 41 56.23 63.26 6 14.63
8483. Potato (mega_juicer) 41 92.27 115.41 9 21.95
8484. thomas (maxipixels) 41 77.76 102.62 13 31.71
8485. Bojongkers (manqjayak) 41 98.90 122.33 18 43.90
8486. MajesticBudder (majesticbud... 41 78.70 91.54 6 14.63
8487. 𝔏𝔦𝔪𝔬𝔟𝔢... 41 55.53 64.94 2 4.88
8488. Lalith Sharma (lalith_sharma7) 41 40.17 51.70 6 14.63
8489. Lelu (laku_) 41 121.76 143.02 24 58.54
8490. Kyle (kyman73) 41 99.97 127.06 16 39.02
8491. Pawan (kpawans00533) 41 66.03 78.43 5 12.20
8492. Kitzuney (kitzuney) 41 85.05 95.74 13 31.71
8493. NO (kinda_weird_bro) 41 42.86 56.04 6 14.63
8494. Sebastian (jschavesr) 41 59.82 74.99 3 7.32
8495. JC (jollibeech) 41 76.61 90.80 23 56.10
8496. Jake (jkdriven) 41 81.06 98.75 10 24.39
8497. Jiawei (jiaweilin) 41 54.96 69.59 5 12.20
8498. Jack (jack__toast) 41 81.20 96.08 9 21.95
8499. flaneur simp (inariii) 41 149.68 183.65 8 19.51
8500. kei (impeeverything) 41 129.64 165.19 25 60.98
8501. illa (iladnas) 41 54.44 68.45 6 14.63
8502. Jim (hockeyhead019) 41 96.29 110.93 14 34.15
8503. Manish (hi_son) 41 43.74 62.48 6 14.63
8504. Gunter (gunter1963) 41 47.35 58.60 5 12.20
8505. Kieran (godquack) 41 65.91 76.75 10 24.39
8506. Mr (glock19) 41 64.46 83.03 5 12.20
8507. get_on_board (get_on_board) 41 98.39 114.39 21 51.22
8508. georgebax (gbax) 41 94.51 112.69 14 34.15
8509. Andrew (fyir) 41 71.31 90.35 13 31.71
8510. frog! (froggysauce) 41 72.21 92.18 17 41.46
8511. FRATNIX (fratnix) 41 70.68 84.35 13 31.71
8512. Takumi (fractylz) 41 92.30 112.54 11 26.83
8513. flaskur (flaskur) 41 88.42 103.39 10 24.39
8514. A (fdsjaklfdsaj) 41 96.66 113.91 16 39.02
8515. Luffy (fawnful) 41 52.87 65.34 4 9.76
8516. Urolbek (faithful_1707) 41 65.48 77.01 8 19.51
8517. karovD (fablem_workman) 41 77.18 97.88 12 29.27
8518. mushykeys (exileflame282004) 41 68.87 85.60 4 9.76
8519. Reetu Raj (eternal77) 41 41.57 50.39 7 17.07
8520. Jennifer (ennyvanna) 41 18.02 22.53 7 17.07
8521. John (enhoj22) 41 75.54 84.41 8 19.51
8522. Emiesh (emiway247) 41 42.75 52.52 12 29.27
8523. Joze (el_lobe) 41 106.08 127.65 18 43.90
8524. Carrot (elelin) 41 58.03 72.36 11 26.83
8525. BiggyBallsHD (egg_plant_pete) 41 53.29 65.86 3 7.32
8526. Chris (eb_p0pe) 41 99.10 136.65 14 34.15
8527. Dunkmasta (dunkmasta) 41 93.44 114.21 21 51.22
8528. beep (doinyamom1337) 41 56.11 68.56 6 14.63
8529. Jochwa (djoshuahebert) 41 80.67 96.33 12 29.27
8530. D. (dissonvnt) 41 63.56 84.21 6 14.63
8531. Dean (de4n_whit3) 41 100.06 127.57 25 60.98
8532. colin (crustyrustonline) 41 55.67 79.48 7 17.07
8533. N (crazycalm007) 41 88.14 105.61 9 21.95
8534. CPL62Connor (cpl62_connorx) 41 53.93 68.84 9 21.95
8535. coolfission (coolfission) 41 118.84 130.70 21 51.22
8536. Confetix (confetix) 41 94.40 118.53 14 34.15
8537. Cheney (cheneyc9999) 41 81.28 104.20 16 39.02
8538. catfree (catfree) 41 116.05 130.95 21 51.22
8539. Carter (carter44502) 41 87.76 102.10 10 24.39
8540. Jasckon (camochameleon56) 41 79.18 95.06 11 26.83
8541. sixten (calvin2) 41 81.25 98.70 11 26.83
8542. b (byron911) 41 68.62 94.85 11 26.83
8543. (brockbnntt) 41 84.25 110.86 15 36.59
8544. Brendan (brendanlo4) 41 93.10 109.18 19 46.34
8545. tstats[borzoian40] (borzoia... 41 87.46 106.13 18 43.90
8546. Boomer (boomer_typer) 41 88.51 111.75 9 21.95
8547. Noob (bloodylord) 41 46.17 63.67 11 26.83
8548. Bikash (bikash_grg) 41 70.29 88.20 9 21.95
8549. Mouse (atypingmouse) 41 71.65 87.41 12 29.27
8550. Karina (asapkarina) 41 74.39 102.85 13 31.71
8551. Jack (arcinae) 41 120.42 152.31 27 65.85
8552. Amir (48u_54l1m) 41 78.46 90.37 10 24.39
8553. Denny (yoanesdenny) 41 57.54 70.73 5 12.20
8554. Periodude (rastapasta_ke) 41 61.02 72.94 9 21.95
8555. light (light_dawn) 41 55.70 67.01 5 12.20
8556. Connor (connoc) 41 54.71 71.28 4 9.76
8557. kem (krelma) 41 90.70 110.83 17 41.46
8558. Kiet (fagala) 41 46.99 54.05 5 12.20
8559. Ben (xlockedbw) 41 44.00 60.38 1 2.44
8560. Miguel Demonteverde (migs0999) 41 64.74 85.65 11 26.83
8561. Ruby (_truby) 40 66.36 91.66 9 22.50
8562. Alex (zipphys) 40 82.07 101.67 10 25.00
8563. Ja (zentojamorn) 40 80.89 106.66 12 30.00
8564. Yasser (yesserspeed) 40 64.68 78.61 12 30.00
8565. ぜんじろう (yablu) 40 57.68 68.31 16 40.00
8566. Sarves (xmemestar420) 40 98.53 122.17 13 32.50
8567. Mato (xholm) 40 57.15 66.17 7 17.50
8568. Whitecap (whitecap) 40 65.08 79.41 7 17.50
8569. Wealthycentro (wealthycentro) 40 82.54 103.51 18 45.00
8570. karina (wattisgone) 40 88.85 108.57 14 35.00
8571. Enosh (watahec) 40 83.27 101.76 13 32.50
8572. Vanessa (vanessahjp) 40 61.11 76.01 10 25.00
8573. name (username04) 40 75.58 94.66 10 25.00
8574. Uros (uroskrunic1988) 40 88.01 100.11 13 32.50
8575. Joshua (twinklestarchild) 40 65.85 82.61 13 32.50
8576. Esi (tsoob) 40 52.09 60.79 3 7.50
8577. Tsuguto (tkogamer) 40 81.16 100.12 8 20.00
8578. Doomer (thedoomer) 40 71.92 86.24 14 35.00
8579. miranda (tfond) 40 75.60 83.95 10 25.00
8580. Taco (tacobandit) 40 103.89 125.83 12 30.00
8581. Shivam (swadhwa) 40 70.59 91.93 13 32.50
8582. superss2104 (superss2104) 40 71.84 89.48 7 17.50
8583. Sravan (sravanstg) 40 54.45 64.70 8 20.00
8584. sqbaee (sqbaee) 40 41.50 47.72 5 12.50
8585. Sonase (sonase19) 40 65.25 82.62 10 25.00
8586. Joe Smith (slowtypingdino) 40 41.04 54.47 1 2.50
8587. Joe (siyyy) 40 107.83 132.28 17 42.50
8588. sir (sirhelp) 40 86.70 100.98 10 25.00
8589. Alex (silverax3) 40 87.71 101.78 13 32.50
8590. shinutsi (shinutsi) 40 89.76 104.62 17 42.50
8591. Barry (shahkulu) 40 72.01 93.19 23 57.50
8592. Soham (shadeoxide) 40 97.76 115.19 16 40.00
8593. chandra (sekhar_88) 40 69.54 81.59 9 22.50
8594. Ahadh (sedoninju) 40 53.88 63.77 9 22.50
8595. sarthak (sarthak14327) 40 52.95 64.00 3 7.50
8596. Rowan (rusicus) 40 72.42 93.01 10 25.00
8597. geoff_g (roy_the_gizm0) 40 51.68 63.53 6 15.00
8598. Roy (royzz) 40 87.06 108.36 16 40.00
8599. rothdu (rothdu) 40 80.52 97.55 9 22.50
8600. Zapphy (ronaldlincon) 40 88.15 114.57 27 67.50
8601. Ronak (ronakkaria) 40 101.66 138.65 20 50.00
8602. Trung (rohan86) 40 61.16 71.09 8 20.00
8603. rodaina (rodaina) 40 35.28 47.77 4 10.00
8604. Earnest (redwhirl) 40 87.88 97.91 15 37.50
8605. Razor (razor_1) 40 72.05 91.34 11 27.50
8606. hi (razorlemon2) 40 146.36 223.70 25 62.50
8607. Matt (purple_gorilla21) 40 71.66 88.96 9 22.50
8608. Raphael (purified_salt) 40 69.45 86.39 10 25.00
8609. Bodhi$attiva (ptran) 40 84.85 107.19 11 27.50
8610. Artichoke (poofydragon) 40 74.62 93.73 11 27.50
8611. Jason (poleam) 40 86.38 112.95 15 37.50
8612. getfingrd (piggo1228) 40 103.82 123.80 16 40.00
8613. Joel (phitsuh) 40 101.94 121.32 19 47.50
8614. Dimitri (penguinhams) 40 93.03 120.74 14 35.00
8615. Paul (obtrunco) 40 83.86 95.04 9 22.50
8616. Andy (nycnets15) 40 111.38 143.47 19 47.50
8617. Kazz (nutkazz) 40 74.72 91.56 12 30.00
8618. Norbert (norbert515) 40 93.91 113.99 15 37.50
8619. justme (nightval) 40 96.04 126.08 15 37.50
8620. Nicole (nickizard) 40 45.48 69.96 3 7.50
8621. Viktor (niandog) 40 52.96 66.25 5 12.50
8622. Nawaraj Bista (nawaking) 40 52.87 65.54 4 10.00
8623. Joe Mama (musicalsquire) 40 121.44 148.43 20 50.00
8624. Mohamed (mohamedemad13) 40 72.92 87.51 10 25.00
8625. Jack (modesties) 40 84.05 100.25 14 35.00
8626. micur (micur) 40 107.00 125.57 21 52.50
8627. Mendel (mendeljacks) 40 96.96 113.57 20 50.00
8628. Memat (memat) 40 97.98 121.18 23 57.50
8629. Mikel (meekay) 40 96.57 119.64 14 35.00
8630. medo (medocool) 40 79.00 94.62 10 25.00
8631. Nicholas (massive_nick) 40 72.74 94.89 20 50.00
8632. tstats[manuelnara] (manueln... 40 51.98 66.44 4 10.00
8633. Kieran (manawa) 40 77.39 100.48 15 37.50
8634. Yogeshwar (mad_steins) 40 63.43 76.81 5 12.50
8635. lolwut9001 (lolwut9001) 40 116.83 148.85 24 60.00
8636. logicism (logicism) 40 105.52 123.76 17 42.50
8637. Lil (liljuicy) 40 97.04 127.12 14 35.00
8638. Lorenzo (leroiken11) 40 76.26 97.84 6 15.00
8639. (lassolass) 40 80.65 97.62 13 32.50
8640. Landers (landersex) 40 94.15 106.61 16 40.00
8641. KronosBruh (kronosbruh) 40 63.04 86.20 7 17.50
8642. Kris (kris510) 40 54.20 61.05 4 10.00
8643. kr02lc (kreadzz) 40 81.05 109.00 17 42.50
8644. Felipe (krakon_3) 40 74.21 90.43 8 20.00
8645. Kornel (kornelt) 40 76.82 94.03 9 22.50
8646. killerman (killerman_007) 40 54.19 73.81 12 30.00
8647. Kiiryuu (kiiryuu) 40 110.57 127.39 19 47.50
8648. Marcin (kawre) 40 92.21 117.08 14 35.00
8649. Katherine (katherinekelly2012) 40 73.76 88.93 27 67.50
8650. Kamen (kamen08) 40 63.74 82.01 11 27.50
8651. Md Abdul (kader) 40 34.09 47.88 1 2.50
8652. Josh (josh_carlin) 40 63.11 78.61 8 20.00
8653. johnick44 (johnick44) 40 71.24 83.16 7 17.50
8654. Jewmo (jewmo) 40 88.37 107.20 24 60.00
8655. N o y b (jet1k) 40 105.04 120.75 19 47.50
8656. Jester (jestertyper) 40 142.46 175.43 24 60.00
8657. Jakob (jakobgran) 40 63.13 80.59 9 22.50
8658. Jack (jacknachos) 40 77.89 96.09 12 30.00
8659. J0kerJ4y (j0kerj4y) 40 106.58 124.16 18 45.00
8660. skippie (itsskippie) 40 104.65 123.50 21 52.50
8661. marvic (itsmarvic) 40 85.43 106.94 12 30.00
8662. Issam (issam_08) 40 57.11 69.35 5 12.50
8663. Ishaan (ishaanmahajan) 40 46.76 56.86 24 60.00
8664. Jan (ingenieur) 40 84.19 97.98 12 30.00
8665. Aayush (imqwerty) 40 106.82 123.26 21 52.50
8666. ihateonyou (ihateonyou) 40 126.77 156.08 27 67.50
8667. iCanBreathe (icanbreathe) 40 91.42 114.80 15 37.50
8668. hotbx (hotbxlockbx) 40 80.80 93.90 15 37.50
8669. Harry (harrycc3000) 40 87.08 100.23 16 40.00
8670. Gareth (garethlyh) 40 90.19 109.84 13 32.50
8671. Feras (frsbg) 40 92.36 118.28 13 32.50
8672. fakhry (fakhryodi) 40 67.77 87.57 10 25.00
8673. paranoid (enemy1337) 40 77.34 95.89 9 22.50
8674. dwikydd (dwikydd) 40 77.77 91.83 12 30.00
8675. ballentine (drinkitup) 40 106.14 130.07 24 60.00
8676. Tahsin (drevil13) 40 84.92 99.19 12 30.00
8677. Dorel (dorelm) 40 80.86 107.01 12 30.00
8678. David (david_nguyen21) 40 67.70 82.03 4 10.00
8679. curtavian (curtavi) 40 44.17 53.78 3 7.50
8680. CulinArki (culinarki) 40 78.25 91.98 7 17.50
8681. Blank (ct7567) 40 92.37 104.88 10 25.00
8682. chuu (chuuceae) 40 100.76 127.19 36 90.00
8683. Chet (chethus) 40 100.50 120.75 12 30.00
8684. Peter (ch9cken) 40 93.39 123.21 12 30.00
8685. Candlelight (candlelight8) 40 84.72 103.65 12 30.00
8686. Abdullah (bunajim) 40 62.84 80.58 12 30.00
8687. Braden (brad9181) 40 74.95 93.51 10 25.00
8688. Bottlecapbottom (bottlecapb... 40 57.41 67.03 4 10.00
8689. botlof (botl0f) 40 77.60 93.18 7 17.50
8690. Joe (bop1000) 40 100.84 116.67 16 40.00
8691. Emmanuel (blaez_) 40 67.73 78.58 16 40.00
8692. BJ (bjfoutz00) 40 89.25 115.49 8 20.00
8693. Bhuvanesh (bhuvaneshh) 40 35.44 43.56 3 7.50
8694. roshan (bhattaroshan) 40 81.13 89.51 11 27.50
8695. BetTheDerp (betthederp) 40 108.85 140.35 27 67.50
8696. Betelgeuse (betelgeuse2310) 40 45.81 60.24 2 5.00
8697. BakesChamp (bakes1223) 40 111.03 132.62 23 57.50
8698. Aviral (aviralbh1) 40 87.10 103.01 17 42.50
8699. Aril (arielkusnoto) 40 68.72 84.73 8 20.00
8700. Ansh (anshghosh) 40 93.24 114.88 16 40.00
8701. Aditya (anonymoose17) 40 89.91 110.91 9 22.50
8702. Daniel (akr115) 40 48.67 58.68 3 7.50
8703. AbsoluteZeroK (absolutezero... 40 88.54 105.39 15 37.50
8704. Aaron (aasworth) 40 75.05 94.35 10 25.00
8705. Aarondn34 (aarondn34) 40 82.68 98.97 6 15.00
8706. Peter (1_peter_1) 40 53.56 60.60 5 12.50
8707. Dennis (1nys) 40 76.95 100.45 12 30.00
8708. (19wpmavg) 40 87.07 104.79 16 40.00
8709. Speedy (iamspeeeeeeeed) 40 53.82 65.14 1 2.50
8710. Astolfo (astolfokawaii) 40 36.14 46.94 4 10.00
8711. Yogender Singh Jadon (yogen... 40 91.79 113.91 17 42.50
8712. champ (kalmaxz) 40 41.00 58.01 6 15.00
8713. mal (malrie) 40 55.00 66.44 6 15.00
8714. Crinum (crinum) 40 49.23 69.29 4 10.00
8715. Ahnaf (crimson_doe) 40 57.10 67.72 4 10.00
8716. SOUL (soul699) 40 44.57 61.15 10 25.00
8717. jackes (jackez) 40 32.00 41.95 0 0.00
8718. Ibrohim (reedox) 40 47.11 59.72 9 22.50
8719. Cryptic (mbgamer01248) 40 68.34 81.42 11 27.50
8720. Rahil (thekaratekid) 40 81.23 105.87 34 85.00
8721. Guido (guidofe) 40 59.61 77.76 5 12.50
8722. 30 wpm typer (harshshelar) 40 37.80 47.86 2 5.00
8723. TextingDriver (shandysk) 40 68.86 76.90 6 15.00
8724. Divyansh (_divyanshwastaken) 39 24.25 33.53 9 23.08
8725. ( ͡° ͜ʖ ͡°) (zarthax69) 39 100.58 125.44 19 48.72
8726. Allison (zarfynn) 39 89.36 106.26 15 38.46
8727. Shivesh Tiwari (yuvanastra) 39 66.22 87.77 13 33.33
8728. Le (yorkist) 39 55.32 68.36 9 23.08
8729. yonatan (yonatanlib) 39 59.74 71.03 2 5.13
8730. Venus (xxvenusxx) 39 70.39 91.87 10 25.64
8731. William (williamc7879) 39 124.41 158.72 33 84.62
8732. Jason (wepanator) 39 60.83 76.15 8 20.51
8733. William (wdk5013) 39 88.87 111.65 16 41.03
8734. Roger (walki_bv) 39 47.82 54.94 3 7.69
8735. Vlad (vladdycrz) 39 90.48 112.48 11 28.21
8736. Vivek (vivekjoshi556) 39 77.90 96.07 11 28.21
8737. vee (veedoze) 39 86.09 107.14 10 25.64
8738. Tiago (tiagval) 39 57.11 75.43 7 17.95
8739. Thunder (thunder05) 39 38.19 50.26 0 0.00
8740. spoon (thrownspoon) 39 65.82 83.09 6 15.38
8741. The Medium (themedium) 39 61.57 71.27 6 15.38
8742. Bourdon 16' (thekeyofg) 39 90.86 103.39 14 35.90
8743. suff (suffy2) 39 53.80 71.86 9 23.08
8744. burgir. (sub10cuber) 39 103.45 126.27 14 35.90
8745. 0 (studdab) 39 54.82 63.38 2 5.13
8746. ya (stfudesu) 39 96.75 125.33 15 38.46
8747. Juey (spyrox) 39 66.94 79.54 6 15.38
8748. Loudy (skolchem) 39 54.11 65.03 5 12.82
8749. Kevin (siacker) 39 128.18 160.52 28 71.79
8750. Shobaik (shobaik_04) 39 49.54 60.38 6 15.38
8751. Saphrog (saphrog) 39 69.89 87.36 8 20.51
8752. Varun (salmonwings8207) 39 59.19 72.60 10 25.64
8753. Sajal (sajal0809) 39 45.05 55.95 3 7.69
8754. ALIF (ronin98) 39 58.78 70.46 6 15.38
8755. Ricky (rickestsot) 39 96.82 118.33 19 48.72
8756. rethya (reimogi) 39 117.21 142.62 18 46.15
8757. Rehan (rehan_vibes) 39 52.60 70.22 25 64.10
8758. Ray (ray_jan) 39 32.33 39.32 1 2.56
8759. Jr (rattllingsecret) 39 60.20 74.34 26 66.67
8760. Gary (prtuc2) 39 78.36 91.13 10 25.64
8761. Allan (pronewb2325) 39 56.48 68.06 8 20.51
8762. PRANADALA (pranadala) 39 76.76 88.57 17 43.59
8763. Anar (pomegarnet) 39 57.74 74.56 7 17.95
8764. pono (pnawan) 39 88.35 115.13 17 43.59
8765. Pluufi (pluufi) 39 104.97 125.56 34 87.18
8766. Gwen (planetzero) 39 45.99 60.23 4 10.26
8767. Xhu (okxhu) 39 75.88 91.51 11 28.21
8768. Kostboss (okostas) 39 112.56 127.64 18 46.15
8769. Rami (nub_paws) 39 92.74 106.00 14 35.90
8770. Allay (noob_wrath) 39 94.81 111.10 12 30.77
8771. kdjaiel (nobody42) 39 26.60 35.42 3 7.69
8772. ni (nischalace) 39 64.08 81.41 12 30.77
8773. Angel (ninjasneak543) 39 82.67 97.77 13 33.33
8774. Nilias (nilias121) 39 79.42 92.58 11 28.21
8775. Ali (naseria1) 39 62.28 80.64 10 25.64
8776. Nabil (nabil_aldihni) 39 107.72 132.51 20 51.28
8777. Alex (mysterybox) 39 90.46 115.68 20 51.28
8778. Austin (millerlite) 39 54.24 65.94 3 7.69
8779. Christopher (milk38) 39 42.73 54.26 2 5.13
8780. Enkh-Och (mglstew) 39 84.24 110.74 26 66.67
8781. It's Davda ✅👣 (meetdavda) 39 118.84 137.59 25 64.10
8782. Louis (meenepo) 39 107.31 137.45 15 38.46
8783. maufry (maufry) 39 90.79 112.64 11 28.21
8784. lucas (lucas757) 39 86.98 104.17 9 23.08
8785. Lotus (lotus7) 39 99.91 118.74 14 35.90
8786. Locus (locus_) 39 54.47 62.33 3 7.69
8787. Fredric (lockheart456) 39 74.26 89.07 9 23.08
8788. Omik (litynity) 39 44.79 61.33 7 17.95
8789. Tiger (lilnhan) 39 79.69 92.83 6 15.38
8790. Jozef (lawalamp12) 39 88.91 101.58 20 51.28
8791. kyle (kylesch) 39 104.23 115.48 13 33.33
8792. kyasaa (kyasaa) 39 70.38 81.77 13 33.33
8793. Hehe (kumotz) 39 64.91 85.18 17 43.59
8794. Manas (kingmanas) 39 74.26 87.08 8 20.51
8795. Nathan (killzs) 39 68.69 83.40 9 23.08
8796. kila (kila_lol) 39 57.04 68.22 3 7.69
8797. kifumi (kifumi) 39 113.94 129.96 19 48.72
8798. Khawla Halim (khawla_hlm) 39 39.46 46.23 3 7.69
8799. keval (keval18) 39 70.20 84.11 10 25.64
8800. Le Kang (kangkanglw) 39 71.26 89.85 11 28.21
8801. josiah (josiah_is_weird) 39 60.87 73.25 8 20.51
8802. ジョン (johnr_) 39 110.11 150.97 21 53.85
8803. Johnny (johnnyquest30) 39 91.10 104.81 37 94.87
8804. Jen (jen_23) 39 83.09 108.86 18 46.15
8805. William (ithan) 39 64.11 85.13 9 23.08
8806. Izzy (ishey) 39 101.73 126.32 14 35.90
8807. Inrieal. (inrieal) 39 56.93 67.74 4 10.26
8808. InboxRatio (inboxratio) 39 74.67 87.59 13 33.33
8809. can we have some simple sho... 39 120.72 162.37 23 58.97
8810. . (hiradesuwu) 39 59.30 73.00 11 28.21
8811. himanshu (himanshukumar_ce) 39 47.85 60.52 4 10.26
8812. Brandon (hereisausername2) 39 150.39 178.38 19 48.72
8813. llllllllll (gndndfs) 39 61.28 74.07 10 25.64
8814. . (ggsnipes) 39 85.52 103.00 14 35.90
8815. George (geoju) 39 85.15 106.75 13 33.33
8816. Racharg (freedobby) 39 73.40 90.50 7 17.95
8817. Benny (fransiskusbenny) 39 55.10 68.73 5 12.82
8818. fen (fen10) 39 107.41 155.44 22 56.41
8819. slowboiken (fastken) 39 81.66 98.93 9 23.08
8820. Ethna (ethna) 39 86.46 103.72 11 28.21
8821. end (end_pro) 39 65.76 82.72 7 17.95
8822. EkBros (ekbros9_) 39 76.11 96.31 8 20.51
8823. kuan-yu (edisonhello) 39 78.97 90.36 5 12.82
8824. Raul (eatmydusthoe) 39 67.64 83.68 7 17.95
8825. Driew (driew) 39 88.73 113.79 14 35.90
8826. From the river to the sea (... 39 86.75 111.10 11 28.21
8827. Kuczora (drael1024) 39 99.05 123.02 19 48.72
8828. Daniele (dprimon) 39 36.62 46.38 3 7.69
8829. Robin (dontcallmenymphadora) 39 80.41 96.52 11 28.21
8830. Dongles (dongles) 39 128.11 159.88 28 71.79
8831. DONATETOWATERAID (donatetow... 39 117.94 141.04 28 71.79
8832. David (dlreed27) 39 102.06 116.07 21 53.85
8833. Danky (dankyv1) 39 60.68 71.60 11 28.21
8834. Clone (clonex1) 39 60.63 73.61 7 17.95
8835. Tomas (clickity_clark) 39 49.12 62.17 3 7.69
8836. Mike (cherryot) 39 89.49 109.17 9 23.08
8837. charlotte (charltypes) 39 64.94 75.92 16 41.03
8838. Cavid (cavid) 39 54.09 63.91 4 10.26
8839. B (bz___) 39 149.86 196.51 26 66.67
8840. Ian (bunnyian) 39 86.56 106.28 8 20.51
8841. brocco (brocollie) 39 81.42 99.88 12 30.77
8842. Soonbeom (bringu2h) 39 57.19 64.33 7 17.95
8843. UWU (blizztera) 39 77.44 89.14 15 38.46
8844. Beksultan (bexultan) 39 89.87 107.06 16 41.03
8845. _ (baoy) 39 88.68 111.98 12 30.77
8846. Chloe (bananatyper9) 39 98.00 125.69 14 35.90
8847. Alvin (ayesizzle) 39 101.47 116.01 17 43.59
8848. Arsalnovt (arsalnovt) 39 68.05 85.08 11 28.21
8849. ariferrari (ariferrari) 39 60.99 75.90 6 15.38
8850. Max (antmanmax) 39 122.66 141.91 24 61.54
8851. Anmulla (anmulla) 39 29.53 39.44 5 12.82
8852. Andy (andyjg47) 39 107.49 140.00 19 48.72
8853. anand (anandzzz1973) 39 64.01 81.59 15 38.46
8854. Aman (aman_7002) 39 39.87 47.18 5 12.82
8855. ALostKorean (alostkorean) 39 104.52 132.05 16 41.03
8856. Arthur (agouraptor) 39 45.13 60.46 2 5.13
8857. Jacques (acesfracked) 39 79.45 91.61 13 33.33
8858. Syam (aaasssppp) 39 43.11 56.85 10 25.64
8859. রাতুল (1415926535... 39 58.27 72.11 5 12.82
8860. Hugo (vangoulard) 39 50.18 63.76 4 10.26
8861. Elec (elecki) 39 56.65 70.95 14 35.90
8862. Narki (narkivitek) 39 62.07 78.77 4 10.26
8863. Daniel (yourfqace) 39 90.37 116.85 15 38.46
8864. Kingsley (cyber_br0) 39 46.07 57.92 4 10.26
8865. Kartikeya (karotiko) 39 70.21 87.60 9 23.08
8866. TPK (tpk_coff33) 39 48.81 62.47 6 15.38
8867. eli (ollro) 39 56.11 70.69 14 35.90
8868. yousef (yousef3) 39 33.16 43.83 11 28.21
8869. Bruzsa (bruzs) 39 54.41 66.37 2 5.13
8870. saketh (saketh_v) 39 47.80 57.44 4 10.26
8871. Shagirthan (vemidse) 39 42.70 48.23 4 10.26
8872. Noodles (47noodles) 39 72.92 82.35 20 51.28
8873. eivind (limberton) 39 68.77 95.80 13 33.33
8874. 🏎️frank (__slowtypist__) 38 110.93 128.20 14 36.84
8875. yuvibirdi (yuvi_birdi) 38 70.47 83.08 7 18.42
8876. yuth (yuth_isme) 38 51.54 62.91 7 18.42
8877. James (youngthe) 38 45.40 55.40 4 10.53
8878. Ulises (xindrome) 38 64.49 78.34 6 15.79
8879. Xeogran (xeogran) 38 172.82 198.75 35 92.11
8880. Etalm (walter_gilbert) 38 114.43 142.09 22 57.89
8881. Wowa (vovsanka) 38 67.04 77.60 6 15.79
8882. Vmanalt (vmanalt) 38 94.07 111.99 17 44.74
8883. Viet Trung (viettrung9012) 38 93.27 106.99 18 47.37
8884. Jorryn (vicmg) 38 81.35 98.09 7 18.42
8885. Uways (uways) 38 66.04 86.43 7 18.42
8886. Charles (tyuule) 38 95.89 122.28 21 55.26
8887. Tayden (tydn12) 38 76.41 97.01 10 26.32
8888. Christian (trotuele) 38 75.14 88.13 7 18.42
8889. Triton (tritonthetrident) 38 71.71 85.72 12 31.58
8890. Thomaskov (thomas861205) 38 60.61 71.40 5 13.16
8891. Last (thelastmuffin) 38 102.12 118.05 14 36.84
8892. Dasha (thedashaier) 38 87.73 100.44 17 44.74
8893. James (th3james) 38 79.75 97.93 10 26.32
8894. sk (teslateslatesla) 38 89.09 108.60 7 18.42
8895. T (tegicupala) 38 91.66 103.05 14 36.84
8896. Tashima (tashima42) 38 83.55 109.79 13 34.21
8897. Grandjudge (talonted) 38 81.59 102.17 11 28.95
8898. Aaron (suckmeoffhoe) 38 68.63 81.94 8 21.05
8899. Professor (steveisawesomer) 38 62.10 74.28 10 26.32
8900. snowdenwald (snowdenwald) 38 80.78 97.50 9 23.68
8901. Sneha (sneha_1610) 38 35.65 46.48 3 7.89
8902. Luka (smilyee) 38 57.30 69.74 7 18.42
8903. Christ (slowasf1) 38 106.69 132.84 16 42.11
8904. Samuel (slee2) 38 63.08 81.66 4 10.53
8905. Shubham (shubham2007) 38 44.64 60.49 1 2.63
8906. shubham (shubham1999) 38 92.32 115.66 15 39.47
8907. Shlock (shlockington) 38 105.12 124.56 19 50.00
8908. Sharkbait (sharkydabnab) 38 84.27 106.53 13 34.21
8909. Shantanu (shantanugupt) 38 44.74 55.13 6 15.79
8910. Jeffrey (seedotgrass) 38 72.47 83.95 11 28.95
8911. Oscar (scarigam) 38 88.85 102.08 3 7.89
8912. Sanad (sanad) 38 33.34 42.38 7 18.42
8913. Saba (samsungexynos) 38 78.93 104.43 10 26.32
8914. Sami (sami_66) 38 49.28 56.52 3 7.89
8915. Jayseek (saltymood) 38 71.94 93.63 10 26.32
8916. sagar (sagarlama) 38 37.14 47.80 3 7.89
8917. Protein (rsandland) 38 84.77 98.75 9 23.68
8918. Roman (roman_kovalchuk) 38 57.91 67.17 2 5.26
8919. Thi (rodingersmg) 38 87.67 107.95 11 28.95
8920. Mistakes Were Made (rhino1998) 38 73.18 88.72 11 28.95
8921. Renson (renson1) 38 107.05 137.45 16 42.11
8922. 中学 (randomguyhe) 38 83.09 100.15 9 23.68
8923. Crudux-Crue (raman_rr) 38 54.37 65.22 3 7.89
8924. ragnarok (ragnarokiscomming) 38 79.51 98.60 9 23.68
8925. Quintino (quintino123) 38 94.15 109.04 8 21.05
8926. LiterallyYou (quesket) 38 74.61 97.88 8 21.05
8927. pogi (pogy) 38 47.95 69.18 9 23.68
8928. foxgirl (playtoomuchgames) 38 98.43 127.26 10 26.32
8929. Viktor (pineapple212) 38 94.30 127.46 12 31.58
8930. jayp (phrasez) 38 92.72 122.02 27 71.05
8931. не встретил бо... 38 151.56 166.12 34 89.47
8932. Tosti-ijzer (paupermongool) 38 99.14 112.80 10 26.32
8933. bat (origluun) 38 79.59 92.82 8 21.05
8934. clooverhoover (olivesandlem... 38 67.74 95.00 9 23.68
8935. nyouhas (nyouhas_) 38 90.35 112.45 20 52.63
8936. Noukarin (noukarin) 38 84.41 106.47 10 26.32
8937. Nitrogen (nitrogen_addict) 38 47.89 59.10 3 7.89
8938. Nemsi (nemsii) 38 128.77 145.52 23 60.53
8939. Arden (moo_o) 38 93.50 121.21 13 34.21
8940. kayg (miryokucolemakdh) 38 84.10 106.25 20 52.63
8941. shum (michaelshumshum) 38 84.01 101.00 12 31.58
8942. Mewn (mewn) 38 78.47 95.27 12 31.58
8943. Muhammad Amin (mast1999) 38 53.99 77.14 17 44.74
8944. Marouane (maromaro02) 38 53.48 64.09 2 5.26
8945. Mark (markachuang) 38 88.90 108.64 16 42.11
8946. Manas (manasmahanand) 38 60.43 70.92 11 28.95
8947. lin (lty2002) 38 60.33 83.67 10 26.32
8948. The Papal State (loquiera) 38 97.07 113.06 11 28.95
8949. Hitscan (loonatick_src) 38 93.12 112.79 15 39.47
8950. Marty (lagoskid) 38 71.28 91.47 17 44.74
8951. Kevin Carl (kevincarl09) 38 59.07 67.53 7 18.42
8952. Kaushik (kaushik13) 38 64.13 85.68 10 26.32
8953. karina (kar1na_) 38 53.48 66.34 5 13.16
8954. mmmmm (kamenrider345) 38 77.30 95.24 11 28.95
8955. Kagamine Len (kagamine_len) 38 97.00 120.45 9 23.68
8956. Amir (justinpaper) 38 43.23 53.12 7 18.42
8957. Joseph (jsph273) 38 106.14 124.34 21 55.26
8958. Jerry (jerryr5279) 38 94.55 124.68 13 34.21
8959. Ellie (jellylie2005) 38 67.79 79.65 6 15.79
8960. Jacob (jeepers_jake) 38 109.95 134.13 22 57.89
8961. Jan Kozaruk (jackoza) 38 22.60 32.17 21 55.26
8962. (ilikeponyz20) 38 94.55 110.44 15 39.47
8963. Vladislav (iivlad) 38 59.87 74.39 8 21.05
8964. G (hyperglide) 38 129.62 152.16 22 57.89
8965. heclord (heclord) 38 93.13 108.04 11 28.95
8966. H. (hblord) 38 96.47 110.06 21 55.26
8967. hs (hakanserce) 38 75.85 91.08 8 21.05
8968. Hajar (hajar424) 38 89.76 113.89 10 26.32
8969. Gustas (guzhazi) 38 84.29 114.28 13 34.21
8970. Ozz (gravechill) 38 98.95 129.78 15 39.47
8971. 0 (gochoo) 38 93.39 107.68 13 34.21
8972. Filthy (filthyballer) 38 55.92 66.87 5 13.16
8973. ferris (ferrisiscool) 38 82.37 100.06 13 34.21
8974. Feriiii (feriiiiiiii) 38 54.22 63.41 5 13.16
8975. EthanDennisttv (ethandennis) 38 107.63 130.94 14 36.84
8976. john (er3g10us) 38 54.38 70.00 10 26.32
8977. dox3 (dox3m) 38 61.60 75.79 12 31.58
8978. aoeu (dengzacd) 38 132.19 152.75 21 55.26
8979. DR (dekesta_) 38 114.74 144.22 28 73.68
8980. Sangyoung (ddragoons) 38 121.72 154.36 24 63.16
8981. Karthik (darthmortem) 38 60.00 73.95 6 15.79
8982. 粘り (clayjar) 38 120.20 137.27 22 57.89
8983. Hello (clappy) 38 74.63 89.63 13 34.21
8984. C4MFZ (c4mfz) 38 67.48 81.72 7 18.42
8985. Kevin (busterz) 38 43.48 52.58 3 7.89
8986. Burger (burgercheese) 38 110.84 134.18 24 63.16
8987. brobie (brobie747) 38 96.31 120.45 14 36.84
8988. Bit (bitnerik) 38 66.28 77.37 6 15.79
8989. Henry (barihenry) 38 96.91 114.69 15 39.47
8990. Awkward (awkward_fruitcake) 38 90.00 100.82 9 23.68
8991. Peter (avezan) 38 95.33 127.93 14 36.84
8992. Jake (aurelias) 38 104.76 128.77 12 31.58
8993. PrairieBaron (atbaron) 38 77.29 93.98 9 23.68
8994. AspectOfTheNerd (aspectofth... 38 94.59 125.63 15 39.47
8995. Asylbek (askodzhenaliev) 38 35.10 43.55 14 36.84
8996. Arthur (art8urch3ng) 38 53.03 68.61 5 13.16
8997. abracadabra (ariunerdene) 38 35.17 43.51 11 28.95
8998. loli (annalise00) 38 76.11 91.46 9 23.68
8999. Anmol (anmoljaat_) 38 43.19 52.69 9 23.68
9000. Anha (anha05) 38 64.25 77.88 6 15.79
9001. Angelo (angelo123123) 38 124.38 149.20 26 68.42
9002. angelic (angeliccalling) 38 29.28 43.70 4 10.53
9003. Michael (anfestan) 38 29.88 40.25 5 13.16
9004. anas (anas771989) 38 51.53 61.11 3 7.89
9005. AmazingKitchen (amazingkitc... 38 86.92 100.85 10 26.32
9006. Altair (altairaltair) 38 50.98 65.80 7 18.42
9007. Juan (alcaann) 38 67.79 83.93 13 34.21
9008. Akshay (akshayxw69) 38 70.50 85.60 4 10.53
9009. Dara (adoran) 38 79.87 100.97 8 21.05
9010. Slow Typer (4rs3n1c) 38 76.60 90.14 19 50.00
9011. potato (potatoattack) 38 77.63 90.29 13 34.21
9012. Anton kenneth lee bell (m011y) 38 77.20 94.35 9 23.68
9013. Robert (robboy) 38 76.67 102.90 5 13.16
9014. dove (nach9208) 38 90.29 111.18 14 36.84
9015. BlackVerse (drako201) 38 62.74 77.80 7 18.42
9016. mangesh (muxx) 38 29.32 38.99 8 21.05
9017. ANKUR BARNWAL (ankur_123) 38 63.60 79.09 9 23.68
9018. Michal (murb) 38 58.55 69.88 7 18.42
9019. WeWake (we_wake) 38 55.85 66.37 4 10.53
9020. Paulo (bibon98) 38 72.97 89.80 11 28.95
9021. Leemon (leemon_slice) 38 34.70 54.83 3 7.89
9022. vsn (miniliki) 38 90.52 109.45 14 36.84
9023. Michael (biggerpeach) 38 74.27 90.94 6 15.79
9024. Genta (azcr1_) 38 34.92 43.25 17 44.74
9025. Kian (kiwiyan) 38 91.76 110.38 26 68.42
9026. pavan sai (pavan2569) 38 57.95 70.00 5 13.16
9027. iris (noom3000) 38 73.78 92.97 11 28.95
9028. happyft (happyft) 38 123.91 159.64 19 50.00
9029. Lambo (lambodhar) 38 56.05 68.50 27 71.05
9030. forehead (piratebs) 38 124.51 151.56 20 52.63
9031. WAD (_waddup_) 37 66.20 82.54 14 37.84
9032. Ian (zento_x) 37 62.35 72.81 5 13.51
9033. InHuMaN (yminag123) 37 111.41 127.49 16 43.24
9034. yessine (yessine14) 37 62.66 77.81 9 24.32
9035. Ethan (yaboinugget) 37 124.67 152.04 18 48.65
9036. FTL (xxfangtingxx) 37 72.44 86.56 8 21.62
9037. W (w_v_) 37 94.39 120.43 18 48.65
9038. Ben (wippidy) 37 75.15 91.62 9 24.32
9039. hi (watlok) 37 131.93 159.04 20 54.05
9040. Vishal (vpm911) 37 77.15 98.92 5 13.51
9041. Vatsala (vatsala) 37 60.92 71.61 7 18.92
9042. u8y7541 (u8y7541) 37 136.10 160.55 25 67.57
9043. Ball Sweat (typing_man_man) 37 76.77 89.99 8 21.62
9044. I am in school rn (typingin... 37 85.68 98.66 15 40.54
9045. Abhinav (typingcompany) 37 37.94 50.03 3 8.11
9046. Type (type_racer_15) 37 67.71 81.06 8 21.62
9047. Jack (turtlejack) 37 53.67 63.28 5 13.51
9048. TTMo1 (ttmer) 37 143.58 187.08 30 81.08
9049. Rock (trailersg) 37 68.13 77.88 9 24.32
9050. Fast (too_fast_foru) 37 63.89 73.55 5 13.51
9051. John (tmikelburg) 37 107.16 137.61 10 27.03
9052. Fae (suga_spice) 37 38.72 48.76 12 32.43
9053. Amarnath (stormprod) 37 71.93 99.10 11 29.73
9054. Andrew (sq_leonhart) 37 97.87 116.36 18 48.65
9055. Sophia (sophia2020) 37 82.57 101.88 4 10.81
9056. . (solorex_) 37 82.57 120.32 25 67.57
9057. Erick (sockeymeow) 37 92.46 110.13 7 18.92
9058. light (skepnap) 37 42.39 54.79 1 2.70
9059. Jojuh (shojubruh) 37 90.86 112.81 19 51.35
9060. shiru (shiruetto68) 37 116.07 142.18 19 51.35
9061. Shenen (shenenjump) 37 104.95 122.65 20 54.05
9062. Jason (saltybaskets) 37 90.47 106.31 10 27.03
9063. Kyle (sadkhaki) 37 53.97 64.96 3 8.11
9064. Aru (s3rikbaeva) 37 46.26 61.90 5 13.51
9065. Rold (roldmargruv) 37 66.82 82.54 22 59.46
9066. Aarsh (revolt1ng) 37 65.90 77.70 8 21.62
9067. Rekordea (rekordea) 37 85.20 113.35 13 35.14
9068. 1 (reforme) 37 76.34 89.24 9 24.32
9069. Parvez (pz1971) 37 73.45 83.35 14 37.84
9070. Yevhenii (prinzeugen) 37 85.23 100.44 14 37.84
9071. radar (pranav24) 37 59.93 71.62 13 35.14
9072. andrew (potatoh) 37 83.73 102.11 11 29.73
9073. light (pinkyhurts) 37 74.47 87.95 10 27.03
9074. PancakeDAWGZ (pancakedawgz) 37 121.02 139.42 19 51.35
9075. Liad (ozonzono) 37 74.78 93.74 6 16.22
9076. orde (orde) 37 103.03 129.43 10 27.03
9077. Omar (omarabzd) 37 86.97 106.78 15 40.54
9078. Omer (okirnap) 37 86.79 102.96 9 24.32
9079. NC3 (nickkcastaneda) 37 63.10 81.42 13 35.14
9080. Mohammad (naveedroy) 37 36.90 44.41 3 8.11
9081. nadeem (nadeemgujjar560) 37 64.50 80.02 11 29.73
9082. azaab (minsato) 37 69.10 85.07 7 18.92
9083. Matthew (mbryantms) 37 110.89 130.70 19 51.35
9084. Luke (lukedood) 37 106.48 137.71 21 56.76
9085. juliana (lilfl3shy) 37 47.32 54.72 5 13.51
9086. LightUnicorn839 (lightunico... 37 39.47 49.88 1 2.70
9087. Roast (lemonshine) 37 59.68 76.45 7 18.92
9088. RENIEL RENZ (leiner_ross15) 37 73.39 83.94 12 32.43
9089. Ali (lasthunter69) 37 61.03 78.22 7 18.92
9090. Lai (lai_) 37 80.05 94.35 11 29.73
9091. Kijurin (kijurin) 37 75.26 90.83 12 32.43
9092. Kelvin (kelvin666) 37 60.85 71.14 10 27.03
9093. Kyla (kdawg22) 37 95.16 109.56 21 56.76
9094. kamal (kamaluddin) 37 37.68 46.35 1 2.70
9095. tstats[kafuu] (kafuu) 37 104.33 140.60 20 54.05
9096. 詠璿 (justforfun0906) 37 56.78 67.11 7 18.92
9097. Justanalek (justanalek) 37 69.27 79.65 5 13.51
9098. Jimmy (jimmyr1027) 37 90.87 126.65 25 67.57
9099. Jason (jason_the_human) 37 58.16 70.65 8 21.62
9100. Jamie (jamiekwok) 37 48.19 54.99 1 2.70
9101. Justin (j98101237) 37 66.43 85.65 10 27.03
9102. 69 (i_am_better_than_u_lol) 37 66.11 85.48 27 72.97
9103. amanita! (irving1234028) 37 116.00 142.93 18 48.65
9104. Intetsu (intetsun6) 37 30.12 36.70 2 5.41
9105. Oscar (iloveveck) 37 60.99 84.20 2 5.41
9106. iks de (iksdebro) 37 92.56 117.83 13 35.14
9107. hewan (ikan_laut) 37 32.55 36.83 5 13.51
9108. Bart (hubba485) 37 117.82 136.26 17 45.95
9109. Rain (hlbentz) 37 125.33 143.54 22 59.46
9110. Max (hihello12327) 37 70.26 87.86 11 29.73
9111. gyfan10 (gyfan10) 37 75.03 93.31 8 21.62
9112. Gustav (gustavelmqvist) 37 86.31 107.77 12 32.43
9113. Grosse (grossescheisse) 37 56.96 72.20 6 16.22
9114. Grace (gracejin) 37 38.66 51.80 0 0.00
9115. Dawg (goon_goonster) 37 87.37 104.00 13 35.14
9116. Nakoa Blue (goldtiger7) 37 39.50 48.51 1 2.70
9117. Frostsights (frostsights) 37 100.29 119.34 11 29.73
9118. Purpl3 (froghie) 37 67.18 89.56 14 37.84
9119. Sentinel (fedayeen) 37 83.62 98.49 12 32.43
9120. Erza (ewalk91098) 37 51.99 60.30 5 13.51
9121. sky (elsecaller) 37 88.60 98.93 6 16.22
9122. Thundering (electricbiscuit) 37 121.21 139.26 16 43.24
9123. Echo (echo316) 37 78.02 103.61 7 18.92
9124. Alex (eagles1106) 37 105.95 151.99 22 59.46
9125. ZeroNine (dtrix) 37 106.86 137.44 11 29.73
9126. Diego (diegogamer0528) 37 53.47 65.44 11 29.73
9127. Diamond (diamond_desu) 37 67.40 85.76 13 35.14
9128. dezo (deroze) 37 92.58 106.58 9 24.32
9129. Deanna (deanna123) 37 74.02 97.24 6 16.22
9130. Shawn (cubershz) 37 114.78 137.62 19 51.35
9131. chubbypugs21 (chubbypugs21) 37 88.39 106.33 11 29.73
9132. Hugh Janus (chrispoulos) 37 74.26 85.62 11 29.73
9133. Celia (ccelo) 37 48.67 68.06 5 13.51
9134. Ivan (budabudimir) 37 86.51 102.15 12 32.43
9135. Bonzi (bonzibuddy420) 37 104.44 148.88 15 40.54
9136. Ryan (bluesquirrel) 37 87.14 109.97 12 32.43
9137. learning djorjak (blondebois) 37 87.23 110.52 14 37.84
9138. Majed (bestwifi) 37 87.58 101.64 19 51.35
9139. bbcola18 (bbcola18) 37 101.54 130.91 17 45.95
9140. Bart (bartok) 37 65.81 84.14 14 37.84
9141. barrybee789 (barrybee789) 37 58.86 70.13 4 10.81
9142. baekd (baekde) 37 83.53 110.69 10 27.03
9143. i like typing (a_hole) 37 52.05 68.57 25 67.57
9144. Aviv (avivbn263) 37 120.97 132.93 19 51.35
9145. Alex (alkan137) 37 90.49 121.30 16 43.24
9146. Aeriana (aer000) 37 44.70 57.57 3 8.11
9147. GODLIKE (acrimeisnotfine) 37 71.09 93.38 13 35.14
9148. Lintang (8inx) 37 31.58 40.32 6 16.22
9149. nattapakon (63100932) 37 26.83 30.92 12 32.43
9150. Mohammad Imam (1mam) 37 70.85 85.12 13 35.14
9151. Willow (02_wl_04) 37 68.55 83.09 19 51.35
9152. bigchick (bigchickbird) 37 87.29 106.11 11 29.73
9153. AKarudwal (akarudwal) 37 47.19 63.93 5 13.51
9154. mouni (mouni90) 37 48.01 57.17 1 2.70
9155. Arif (arif_shahriar) 37 54.11 64.18 3 8.11
9156. Mara (mara_bbg) 37 76.37 93.11 7 18.92
9157. yaboi (yaboironny) 37 82.17 94.99 10 27.03
9158. Stephen (potsee) 37 76.77 90.21 9 24.32
9159. Drombulje (drombulje) 37 32.71 40.11 2 5.41
9160. soph (nasasoph) 37 57.16 66.09 4 10.81
9161. Bappo (bappoxd) 37 73.49 87.77 9 24.32
9162. Jakin (anonymousty) 37 92.59 115.02 15 40.54
9163. Pitfulll (pitfulll) 37 47.72 58.98 3 8.11
9164. Naman (nnamansingh) 37 33.99 47.32 4 10.81
9165. roth (roth_31) 37 50.65 59.61 0 0.00
9166. Blue (bluzs) 37 58.04 66.98 6 16.22
9167. WeiWeiMan (weiweiman) 37 97.95 118.31 18 48.65
9168. Khurshed (fingers_on_fire69) 37 52.89 68.87 25 67.57
9169. Zol (zoltac) 36 89.46 116.18 8 22.22
9170. Shelby (zalak_b) 36 60.98 76.07 2 5.56
9171. Vinícius (yamatano) 36 57.01 64.62 4 11.11
9172. Xavieku (xavieku) 36 68.48 80.50 14 38.89
9173. Westly (wslafleur) 36 114.69 133.06 19 52.78
9174. Ethan (wolfiedude14) 36 65.62 83.28 30 83.33
9175. chris (walchrisc) 36 80.03 92.80 15 41.67
9176. Vision (vision_of_infinity) 36 80.19 92.45 9 25.00
9177. Jack (tzak) 36 113.77 132.42 15 41.67
9178. tlbi (tla109) 36 106.41 135.72 24 66.67
9179. Evan (theworkmanmuffin) 36 77.06 88.49 11 30.56
9180. thespaghetti27 (thespaghett... 36 67.11 90.39 12 33.33
9181. thepenguinmonkey (thepengui... 36 79.28 90.02 7 19.44
9182. Tesla (teslalord) 36 92.93 112.83 16 44.44
9183. Tanvir (tanvir187) 36 87.92 110.45 9 25.00
9184. Do (tai230) 36 55.99 66.85 4 11.11
9185. Sujit (sujit2000) 36 73.65 92.42 12 33.33
9186. Guest (solovf) 36 155.36 205.65 32 88.89
9187. akum! (solargiants) 36 43.54 55.01 3 8.33
9188. KJ (snthaoeu) 36 117.46 136.94 16 44.44
9189. Levi (sniperkiller2) 36 61.73 73.39 9 25.00
9190. (slowghost) 36 201.90 242.96 34 94.44
9191. Salem (slomy0010) 36 47.93 57.16 3 8.33
9192. (slimaniimededdineabderrah... 36 55.62 66.87 5 13.89
9193. Twinkle (sirius_07) 36 51.24 59.36 1 2.78
9194. Chris Klenø (sircw) 36 135.33 172.14 29 80.56
9195. Kladdigt (sigius) 36 93.49 109.71 11 30.56
9196. Jason (r_matey) 36 94.14 110.31 11 30.56
9197. rufus (rufi999) 36 53.03 63.74 3 8.33
9198. Raimbek (rk_avilbekov) 36 53.26 65.38 6 16.67
9199. R (renxsis) 36 98.93 136.50 11 30.56
9200. Kabera (rcdude27) 36 107.00 123.88 15 41.67
9201. Ramona (ramonaflowers101) 36 98.01 110.32 15 41.67
9202. Adam (photoequal) 36 31.41 37.67 2 5.56
9203. Persy (persy) 36 62.44 82.96 8 22.22
9204. (pepeworm_colemak) 36 148.60 217.82 10 27.78
9205. pennani (pennani) 36 82.65 95.46 17 47.22
9206. P (patrickkayne) 36 74.01 94.57 4 11.11
9207. John (parallaxjedi) 36 98.11 110.13 13 36.11
9208. Napat (omakaze) 36 65.64 80.86 7 19.44
9209. caden (okaydern) 36 93.82 107.72 18 50.00
9210. odezzki (odezzki) 36 81.20 96.98 11 30.56
9211. NutMonger (nutmonger) 36 68.10 82.42 8 22.22
9212. yess (notavailabe) 36 103.17 124.76 15 41.67
9213. Mulosh (mulosh) 36 109.71 125.93 16 44.44
9214. Lawrence (mrlab) 36 74.86 90.63 7 19.44
9215. M (mostafam) 36 83.07 102.81 11 30.56
9216. willy (monvment) 36 80.63 98.14 14 38.89
9217. Mons (monstoonix) 36 82.05 94.42 11 30.56
9218. Mohib (mohib33) 36 81.36 96.23 18 50.00
9219. Mekrigen (mekrigen) 36 62.17 73.53 7 19.44
9220. MasterMind (master__mind) 36 90.96 104.25 17 47.22
9221. Marc (maroenzo) 36 89.16 106.18 13 36.11
9222. Marcel (marcelmladi) 36 30.32 37.79 9 25.00
9223. Mantis (mantisplays) 36 97.02 127.43 8 22.22
9224. Luiz (lznetorox) 36 69.26 85.33 8 22.22
9225. Luis Francisco (luifrancgom) 36 37.14 50.16 2 5.56
9226. LubedCube (lubed_cube) 36 61.01 71.97 10 27.78
9227. Leaderboard is (leaderboard... 36 94.19 139.30 10 27.78
9228. Arsen (konars_04) 36 25.60 33.86 3 8.33
9229. Necrophos (komaroffski) 36 77.70 98.40 9 25.00
9230. bob (kkgd) 36 92.51 105.43 16 44.44
9231. Asian (kiniiranai) 36 92.69 108.06 12 33.33
9232. Karimu (karimuosman) 36 107.43 122.79 21 58.33
9233. El (kandel) 36 61.28 82.47 5 13.89
9234. kabir raj (kabir26) 36 60.59 69.06 6 16.67
9235. Aria (juicyhaluja) 36 116.04 156.76 18 50.00
9236. Joshua (joshuahd) 36 81.89 98.99 14 38.89
9237. Jordan (jordatypist) 36 106.80 132.79 13 36.11
9238. Jonathan (jonathankim1999) 36 83.29 100.04 9 25.00
9239. ghostofnav (jokerhyper) 36 73.28 86.50 9 25.00
9240. Eric (joker4120) 36 63.43 79.83 8 22.22
9241. Jean (jeanerino) 36 60.18 72.11 10 27.78
9242. its_Atrap (its_atrap) 36 94.36 111.53 15 41.67
9243. itssarcazm (itssarcazm) 36 92.81 115.14 10 27.78
9244. Amdadul (imlak) 36 45.00 59.61 3 8.33
9245. Wapiro (ihatejuices) 36 68.80 79.53 6 16.67
9246. BOz (hyund0) 36 117.38 133.49 22 61.11
9247. Christine (hugowolf) 36 96.04 115.77 19 52.78
9248. Sporadic (howsporadic) 36 121.90 154.98 26 72.22
9249. Aisier (hfssma) 36 94.88 109.44 16 44.44
9250. herman (herman159) 36 93.70 109.66 9 25.00
9251. Heorhii (heorhii_hryhorov) 36 82.44 99.96 8 22.22
9252. Anthony (gphobes) 36 118.94 148.08 21 58.33
9253. Ricardo (golden_boi) 36 55.44 64.47 4 11.11
9254. gandastik (gandsatik) 36 84.70 98.82 11 30.56
9255. Damiano (fullomen) 36 83.43 93.28 6 16.67
9256. Fiji (fijired2) 36 88.38 110.76 12 33.33
9257. Fabricio (ffontesb) 36 42.81 52.95 7 19.44
9258. Exxotix (exxotix) 36 62.30 90.93 16 44.44
9259. Eugene (entilaren) 36 99.82 121.37 21 58.33
9260. elizabeth (elizabeth1ee) 36 116.29 136.46 21 58.33
9261. Richard (elevatecrazy_yt) 36 86.46 104.02 11 30.56
9262. egg (egguard) 36 80.33 98.02 7 19.44
9263. Egbadon (egbadon) 36 52.18 61.46 7 19.44
9264. John (dyst0pia) 36 62.85 76.86 26 72.22
9265. Concomitant (dvorakdork) 36 99.17 109.62 16 44.44
9266. dissonantly (dissonantly) 36 107.10 130.99 18 50.00
9267. Cyberstrike (cyberstrike) 36 43.39 56.02 3 8.33
9268. Cucu (cucu_grey) 36 62.44 72.44 7 19.44
9269. Crehan (crayon144) 36 60.64 68.61 11 30.56
9270. scr4tchman (connerkainnerkai) 36 78.54 90.96 12 33.33
9271. 👺 (confiscar) 36 92.79 113.27 10 27.78
9272. Christopher (codaki) 36 47.81 59.99 5 13.89
9273. Kai (ckai) 36 84.89 109.76 6 16.67
9274. Finna (captfinn) 36 71.69 81.44 7 19.44
9275. Cameron (camalb02) 36 42.39 53.06 1 2.78
9276. asdftr (buhdo) 36 74.59 90.21 10 27.78
9277. Batkhishig (btkshg) 36 75.39 86.78 9 25.00
9278. bruuuh (bruhxfish) 36 101.21 120.41 12 33.33
9279. Bruno (brbeans) 36 90.49 114.29 12 33.33
9280. Bipin (bipin_emp123) 36 57.10 66.94 5 13.89
9281. abdullah (billnyezenazispy) 36 58.25 67.76 10 27.78
9282. Bernice Hee Shu Qi (bernice... 36 69.16 80.88 6 16.67
9283. Bek (bekkk) 36 52.53 61.41 7 19.44
9284. aver (aversioneer) 36 63.14 76.69 5 13.89
9285. gta (asldkfj) 36 72.80 90.31 7 19.44
9286. ashbellebsha (ashbel_g) 36 87.59 113.25 9 25.00
9287. Mateo (asetato) 36 69.26 86.32 8 22.22
9288. Arun (arun808) 36 101.98 122.81 16 44.44
9289. Art (arturopakastur) 36 105.82 120.88 14 38.89
9290. Rajat (argentum_1807) 36 73.05 86.53 9 25.00
9291. James (arctos) 36 48.43 59.08 1 2.78
9292. 🐢🐢🐢🐢 (amogh1420) 36 93.58 109.06 16 44.44
9293. Amit (amitkarmakar13) 36 79.85 99.43 14 38.89
9294. Daniel (amai727) 36 116.19 146.70 20 55.56
9295. Joosep (aktos) 36 92.49 111.38 13 36.11
9296. akram (akrambr) 36 37.48 46.06 3 8.33
9297. Ayedread (ade15) 36 72.18 84.09 7 19.44
9298. Fuel plane (1pavanb) 36 54.78 67.90 14 38.89
9299. Happy (happy_jms) 36 69.54 87.29 15 41.67
9300. Soul (quentinlikesaot) 36 76.79 96.82 9 25.00
9301. james (jamesfarmer) 36 71.67 87.30 11 30.56
9302. Peyton (peytonk608) 36 77.92 90.55 4 11.11
9303. Henry (parrotfish) 36 101.78 119.89 15 41.67
9304. Octagonal (octagonalwalnut) 36 111.16 138.44 21 58.33
9305. arcticfox (spiky_echidna) 36 70.98 102.71 7 19.44
9306. yam (yamazakura) 36 66.64 89.51 6 16.67
9307. Harith (6krypto) 36 49.23 59.80 5 13.89
9308. OLMA - (lyndon29) 36 36.76 47.39 6 16.67
9309. Rushikesh Dhatinge (rushike... 36 32.84 39.42 5 13.89
9310. Gabrielle (gabriellerose86) 36 58.76 71.79 6 16.67
9311. Quavis (jewishween) 36 83.26 100.91 14 38.89
9312. amine (laribi) 36 31.07 37.38 5 13.89
9313. Molly (butteryfly) 36 79.74 94.09 6 16.67
9314. Cypan :) (ckrawetko) 36 24.12 33.25 8 22.22
9315. isabella (coscarellai070) 36 52.59 63.67 4 11.11
9316. tgb524 (_yuno) 35 105.75 128.14 18 51.43
9317. devil_02 (_ebad_) 35 41.83 52.55 4 11.43
9318. yntylox (yntylox) 35 37.39 55.96 3 8.57
9319. Muhammad (xxvv) 35 74.05 89.87 8 22.86
9320. Evans (xerodo) 35 83.56 95.13 13 37.14
9321. Johannes (xcillingx) 35 56.66 68.86 5 14.29
9322. Usman (x1itachi) 35 112.96 143.34 17 48.57
9323. Wizrud (wizurd_) 35 78.33 91.31 6 17.14
9324. veryfast (veryfastxd) 35 92.30 108.76 9 25.71
9325. offblacc (vekikornjaca) 35 87.41 109.11 17 48.57
9326. Taiki (vegantaiki) 35 71.03 89.24 11 31.43
9327. Michael (val_slow) 35 86.18 102.59 14 40.00
9328. typer_trainer (typer_trainer) 35 90.36 110.13 12 34.29
9329. ANUP (typekashyap) 35 68.61 83.78 9 25.71
9330. jeff (typecringe) 35 105.10 120.44 14 40.00
9331. Sergey (tsykurawork) 35 59.44 69.71 8 22.86
9332. Nazib (tony_129) 35 60.58 76.14 9 25.71
9333. doncheadle (timothyqian) 35 97.56 117.74 16 45.71
9334. Thiemo (thiemok) 35 68.21 80.50 7 20.00
9335. Eric (thiccbrick) 35 72.31 104.53 11 31.43
9336. Boipelo (the_big_bp) 35 38.47 45.83 5 14.29
9337. ∞ (technolojesus) 35 68.03 75.84 8 22.86
9338. Non (tata32000) 35 75.20 92.06 8 22.86
9339. Tardy (tardyislazy) 35 74.67 90.22 11 31.43
9340. McLovin (tappytyper) 35 103.56 121.86 11 31.43
9341. tap (tappineapple) 35 93.02 121.86 13 37.14
9342. Swastik (swastik220705) 35 56.06 66.22 6 17.14
9343. Soner (soner) 35 127.62 155.63 21 60.00
9344. sol (solshad) 35 69.64 89.60 6 17.14
9345. Choco (slowest_sloth) 35 61.78 79.38 5 14.29
9346. Gabriel (slenders) 35 70.08 100.56 20 57.14
9347. roy (shote) 35 55.35 64.44 1 2.86
9348. Say_the (saythe) 35 63.36 80.07 6 17.14
9349. Shohidujjaman (sajib975) 35 45.26 56.39 33 94.29
9350. Saber (saberspeed777) 35 100.41 121.44 13 37.14
9351. Jay (saberon1402) 35 63.74 72.90 0 0.00
9352. K (rynetemp) 35 70.81 102.61 9 25.71
9353. amy (rose51203) 35 99.67 125.87 8 22.86
9354. رحيم (rahim06) 35 59.71 70.11 3 8.57
9355. Gavin (qwertyparty) 35 98.07 121.19 14 40.00
9356. Peter (ptrmai) 35 83.20 95.56 9 25.71
9357. Under (polish_underdog) 35 107.43 119.89 22 62.86
9358. PK (pkhou) 35 49.72 64.29 3 8.57
9359. aerisslowers (pietrucha33) 35 77.51 98.83 9 25.71
9360. 1234 (perfect_practice) 35 112.01 132.53 17 48.57
9361. PoonPounder (p00np0under) 35 63.96 76.58 12 34.29
9362. Gilbert (ooblek) 35 87.73 106.44 10 28.57
9363. Anton (noviru) 35 72.11 87.33 9 25.71
9364. Novas (novas_arcos) 35 81.88 94.14 7 20.00
9365. Ninja (ninjaacat) 35 90.09 108.48 12 34.29
9366. Neil (neilborde) 35 101.33 122.55 12 34.29
9367. Camden (mypenguinbuddy) 35 103.31 132.65 14 40.00
9368. Ryan (moseqa) 35 63.90 82.02 3 8.57
9369. Jacob (monkeybenq) 35 105.83 129.58 18 51.43
9370. misab (misabshibu) 35 20.67 31.08 14 40.00
9371. Dagareth (mindcrime) 35 86.19 105.25 8 22.86
9372. Jemo (mille_colombes) 35 78.62 96.08 11 31.43
9373. MilkhoundTTV (milkhound) 35 107.39 140.66 12 34.29
9374. MHR (mhrofficial) 35 58.47 72.91 6 17.14
9375. Ajay (metacorb) 35 56.11 66.16 4 11.43
9376. Louis 🤴🏾 (matiny) 35 51.19 61.84 2 5.71
9377. Mark (mark666) 35 67.81 96.93 16 45.71
9378. Maple (maplesyrup789) 35 83.13 101.69 17 48.57
9379. mtn (m0untain) 35 71.54 88.19 8 22.86
9380. Hayaku (m0tt0_hayaku) 35 53.49 66.39 3 8.57
9381. lysrac (lysrac) 35 66.62 88.81 5 14.29
9382. Lux (lux_winters) 35 105.64 127.96 23 65.71
9383. Guilherme (luxidu) 35 75.60 86.45 11 31.43
9384. justin (lookitsjustin) 35 90.19 110.67 15 42.86
9385. Robert (lonewulf92) 35 120.96 156.81 19 54.29
9386. Kylie (kyky_) 35 98.86 111.56 12 34.29
9387. kpsmelvin (kpsmelvin) 35 55.50 67.04 5 14.29
9388. Kizu (kizuiyo) 35 89.08 111.26 10 28.57
9389. Kish (kisharora) 35 57.23 69.68 10 28.57
9390. Blessed (king_blessed) 35 61.78 81.10 9 25.71
9391. kilkuwu (kilkuwu) 35 79.16 93.29 9 25.71
9392. Kenny (kenny053) 35 41.17 49.69 6 17.14
9393. Shalowley (keepitcookie) 35 78.84 99.14 6 17.14
9394. KarstenPH (karstenplayz) 35 47.26 64.77 10 28.57
9395. arnav (junkbaby) 35 118.61 147.69 21 60.00
9396. Juls (juls22) 35 93.33 106.04 8 22.86
9397. Jokūbas (jokstercube) 35 74.51 91.00 14 40.00
9398. JimDeezy (jimdeezy) 35 106.25 145.37 14 40.00
9399. Jorge (jfgf11) 35 78.06 99.90 6 17.14
9400. Jeffryl (jeffryl26) 35 47.44 55.36 5 14.29
9401. jazz (jazzhand) 35 50.53 60.06 2 5.71
9402. Shiba (jasjaapdua) 35 88.15 105.05 17 48.57
9403. Simon (jangjun0901) 35 94.35 117.79 12 34.29
9404. J (jacktwamb52) 35 105.48 120.56 12 34.29
9405. Jackson (jackfast) 35 43.12 50.53 1 2.86
9406. IVAN (ivil) 35 55.90 66.31 6 17.14
9407. Muhammed (iosonoosha) 35 83.21 100.62 8 22.86
9408. Ingyou (ingsta) 35 113.21 126.20 15 42.86
9409. Hani (imonster_22) 35 83.52 109.15 16 45.71
9410. Guest (imadethisfornoreason) 35 42.83 57.07 1 2.86
9411. Jack (ikombo) 35 129.63 144.11 23 65.71
9412. |I|I|I|I|I|I| (iknowwhatimd... 35 81.88 97.84 11 31.43
9413. Ignacio 🧉 (ignatirabo) 35 69.53 87.28 9 25.71
9414. Lukas (iamlukas) 35 50.18 62.98 3 8.57
9415. Amir (iamir) 35 64.87 80.80 8 22.86
9416. Matthew (hotdawg200) 35 69.75 83.81 7 20.00
9417. Chuck (helicopter123) 35 121.45 140.37 25 71.43
9418. x0.25 speed (hazyy324) 35 95.51 113.07 12 34.29
9419. Joshua (gottajet) 35 72.50 85.28 7 20.00
9420. Jason (goosejuice) 35 84.26 98.60 6 17.14
9421. Giovanni (giosda) 35 139.36 179.94 23 65.71
9422. Martin (gibom) 35 75.28 87.30 10 28.57
9423. Emil (genjimaster) 35 82.23 93.90 13 37.14
9424. GeekThrill (geekthrill) 35 56.74 69.14 2 5.71
9425. gameing (gameing_) 35 65.50 79.51 8 22.86
9426. OTL (floormint) 35 63.11 69.79 7 20.00
9427. Financier (financier) 35 121.50 141.06 16 45.71
9428. Farhan M. (farhanmasud) 35 83.36 95.04 8 22.86
9429. David (fantasticdavid) 35 68.89 86.04 8 22.86
9430. 🥇 Evan C. (evancnavarro) 35 103.47 118.45 13 37.14
9431. Max (elsancho5) 35 94.06 112.56 10 28.57
9432. ahmed (elkfafy) 35 55.99 71.17 2 5.71
9433. Rob (ebqs) 35 57.16 68.45 4 11.43
9434. Daniel (dsonger20) 35 90.13 112.44 13 37.14
9435. Derek (doggish) 35 92.99 109.74 12 34.29
9436. Wasabi (distartor) 35 54.78 65.83 7 20.00
9437. Adi (diddly_doo) 35 84.13 95.31 7 20.00
9438. Deron (deronpianoplayer) 35 74.68 92.40 10 28.57
9439. dedendje (dedendje) 35 83.58 94.95 8 22.86
9440. Darian (darian_adiwarna) 35 80.84 104.45 11 31.43
9441. DanGaL2017 (dangal2017) 35 65.56 77.19 10 28.57
9442. Crayon (crayonsc) 35 81.24 98.78 9 25.71
9443. cortmarshal (cortmarshal) 35 97.59 122.44 12 34.29
9444. Comfy_Kitten (comfykitten) 35 100.58 119.53 13 37.14
9445. citrus (citrustrack) 35 111.85 131.40 21 60.00
9446. Chris (chrislowe) 35 82.27 100.06 12 34.29
9447. chalk (chalkboard) 35 78.33 91.20 11 31.43
9448. Dharma (cdharmateja) 35 78.97 95.88 20 57.14
9449. I love ctrl + backspace (ca... 35 85.10 106.68 14 40.00
9450. Carter (cartermanator) 35 65.63 82.45 5 14.29
9451. Cadence (cadence_workman) 35 114.99 135.64 24 68.57
9452. Caco (cacopholey) 35 85.09 111.00 11 31.43
9453. Name (buttface69) 35 128.77 151.17 18 51.43
9454. Brt (brtboi) 35 70.37 90.71 7 20.00
9455. Bread (breadandbuddha) 35 98.88 117.08 25 71.43
9456. Christian (bobbyjrrocks) 35 82.84 108.76 6 17.14
9457. shellyshellyshellyumm (blue... 35 100.35 114.97 13 37.14
9458. Dhia Eddine (bl1ndk) 35 48.10 56.94 1 2.86
9459. Anish (bira_01) 35 58.22 69.92 8 22.86
9460. big (bigfinger420) 35 103.43 122.40 13 37.14
9461. FoolSt0p (beanenthusiast) 35 89.24 114.63 12 34.29
9462. Bartłomiej (baryla69baryla69) 35 79.40 90.78 14 40.00
9463. Camel (bandar314@yahoo.com) 35 67.21 84.63 7 20.00
9464. Bridget (bahns) 35 60.83 80.96 8 22.86
9465. Ilya (azeti1) 35 52.35 58.42 6 17.14
9466. Abdelrahman (awebdo) 35 55.27 65.87 2 5.71
9467. Dalle (ash_ish) 35 76.01 100.43 9 25.71
9468. Alex (aqin24) 35 108.74 121.43 19 54.29
9469. ANDRAGOMOR (andrago_) 35 47.05 59.31 1 2.86
9470. subham (alexus78) 35 58.19 67.36 9 25.71
9471. Aelius (aelius_l) 35 120.10 146.43 16 45.71
9472. Adzeyns (adzenys) 35 97.72 118.45 16 45.71
9473. AIbek (3xter) 35 56.86 65.05 2 5.71
9474. Magieschnuller (magieschnul... 35 70.56 79.15 9 25.71
9475. aeign (eyncore) 35 70.66 85.64 6 17.14
9476. kxngh (kingh17) 35 60.30 74.72 26 74.29
9477. safia (safia1607) 35 50.76 62.36 2 5.71
9478. Xingyu (findmealone) 35 46.54 66.30 6 17.14
9479. JSD (_jsd) 35 44.11 56.19 1 2.86
9480. Anav (dark_winter) 35 75.29 90.51 9 25.71
9481. shahidul islam (prantoislam... 35 44.90 55.32 7 20.00
9482. ahmed (mamado69) 35 51.31 62.49 5 14.29
9483. Allison (ixonic_alli) 35 38.72 50.36 0 0.00
9484. Thumb (tomtom__ever) 35 100.97 125.80 13 37.14
9485. NotInfinite (notinfinite) 35 79.00 97.07 12 34.29
9486. Ahemed (a_loose_cannon) 35 59.34 68.53 9 25.71
9487. Aditya (aditya786123) 35 59.11 72.52 7 20.00
9488. Angus (type_yahweh) 35 72.25 84.94 12 34.29
9489. van (thien3060) 35 67.93 84.00 7 20.00
9490. Simeon (simbg) 35 36.98 46.40 3 8.57
9491. Eva (etty_mijing) 35 92.71 111.66 18 51.43
9492. Nahid Hasan Pallab (pallab4... 35 56.17 68.38 4 11.43
9493. Rick (eric1699) 35 70.70 81.04 8 22.86
9494. Cris Anthony (crisanthonio_... 35 39.97 47.62 3 8.57
9495. Zhroon (znub) 34 81.52 103.73 9 26.47
9496. zizonesol (zizonesol) 34 63.93 75.75 10 29.41
9497. zeko (zekoo) 34 108.22 124.54 13 38.24
9498. Tyler (yppah) 34 104.24 117.27 18 52.94
9499. bofa (xxx_bofa_xxx) 34 107.48 118.74 12 35.29
9500. boop (xkeons) 34 48.41 57.88 0 0.00
9501. Dylan (xdylkay) 34 108.39 122.85 20 58.82
9502. Derek (xdirection) 34 95.80 117.24 14 41.18
9503. Wuchereria (wuchereria) 34 105.17 121.56 19 55.88
9504. wingman41 (wingman41) 34 81.99 98.53 9 26.47
9505. JEFF (wimpyjeff) 34 69.55 86.26 10 29.41
9506. unholy (virus_) 34 55.65 69.72 6 17.65
9507. Charlotte (videogame_hacker) 34 133.74 161.56 28 82.35
9508. Hey (veeceebee) 34 93.23 116.89 18 52.94
9509. Vedant (ved2254) 34 69.97 80.33 7 20.59
9510. Valeria (valeriacervel) 34 65.72 79.41 6 17.65
9511. Tyrocune (tyrocune) 34 58.94 69.64 8 23.53
9512. Jericho (typersimon) 34 86.95 98.30 10 29.41
9513. King Tristan (trippyonions) 34 67.32 86.97 7 20.59
9514. Maksym (trickstermaks) 34 70.96 91.34 7 20.59
9515. Tom (tom1110) 34 65.77 90.73 8 23.53
9516. Iocus (tisabay) 34 62.46 83.61 3 8.82
9517. Timofey (timofey_s) 34 90.26 104.19 9 26.47
9518. Thunderwith (thunderwith) 34 94.54 130.13 14 41.18
9519. rae (thedarkoknight) 34 91.38 113.05 16 47.06
9520. thebeesknees (thebeesknees_) 34 83.67 104.44 16 47.06
9521. Connor (swedish_master) 34 67.17 81.52 6 17.65
9522. Cthulhu (survivcthulhu) 34 74.76 92.38 6 17.65
9523. superultimate23 (superultim... 34 57.47 73.37 6 17.65
9524. Dan (subprime) 34 114.23 143.24 21 61.76
9525. Stick (stick69) 34 59.45 71.92 6 17.65
9526. Cameron (spinnie123) 34 56.93 67.96 4 11.76
9527. an average vietnamese typis... 34 79.98 113.28 9 26.47
9528. Mitsuo (sp33d1sk3y) 34 102.19 118.46 14 41.18
9529. Sole (soleduck) 34 122.41 152.43 14 41.18
9530. ada (smdge) 34 76.16 99.45 9 26.47
9531. Smack (smack_ke) 34 60.33 69.10 6 17.65
9532. (singalong_monkey) 34 87.06 102.70 14 41.18
9533. yan (shocker142) 34 91.62 105.78 12 35.29
9534. katie (shartball) 34 57.25 70.69 5 14.71
9535. Corona Time (shamalamakiwi) 34 71.91 91.61 10 29.41
9536. Serenity (seerenityy) 34 115.84 134.37 21 61.76
9537. raffa (scoradian) 34 93.51 103.55 15 44.12
9538. sangay (sangay2018) 34 53.77 65.47 1 2.94
9539. Pakistan is my Love (sancbae) 34 57.44 71.80 19 55.88
9540. Sami (samitariq94) 34 125.00 142.96 27 79.41
9541. ogamiseta (samarthos) 34 119.95 129.56 12 35.29
9542. salmi (salmitot) 34 88.90 105.94 15 44.12
9543. Sadra (sadra17) 34 102.04 121.03 15 44.12
9544. Russian (russian_comrade) 34 68.68 80.59 11 32.35
9545. Ruben (ruben_ashughyan) 34 68.73 85.42 8 23.53
9546. Mike (roguecurlybracket) 34 98.11 114.51 10 29.41
9547. Robsonwp (robsonwp) 34 86.38 102.34 9 26.47
9548. Raghav (rkaushal_03) 34 39.54 47.95 2 5.88
9549. Richie (richiele_01) 34 94.53 119.92 15 44.12
9550. Lorum (rexicide) 34 105.21 136.33 14 41.18
9551. Fin (resarded) 34 63.08 85.66 10 29.41
9552. (rektbydoge21) 34 83.49 99.87 8 23.53
9553. Ricky (rcheungwtf) 34 95.71 115.68 9 26.47
9554. Wai Yon (ravesplash) 34 70.65 79.24 17 50.00
9555. Rageon (rageon718) 34 62.01 72.55 12 35.29
9556. Emad Iqbal (racer47) 34 88.89 104.01 10 29.41
9557. Racecar (racecar_lettuce) 34 125.54 137.37 22 64.71
9558. Quagsire (quagsireyaj) 34 78.35 98.72 15 44.12
9559. Aviral (programmer_typist) 34 65.52 85.78 7 20.59
9560. MD. Rashedul (porosh45) 34 58.72 75.48 5 14.71
9561. pedro (pedrovales) 34 53.88 63.93 3 8.82
9562. Pawan (pawan_kumar) 34 68.93 81.90 7 20.59
9563. Warley (patrickwarley) 34 41.71 54.24 1 2.94
9564. nocchio (nocchio) 34 100.29 119.60 10 29.41
9565. Ninth (ninth_player) 34 89.52 104.33 23 67.65
9566. go easy (nielsenco) 34 115.51 139.69 27 79.41
9567. Nam (nchu027) 34 84.00 111.22 14 41.18
9568. Nam3tA3n (nam3tak3n) 34 52.59 67.16 1 2.94
9569. Naba (naba0224) 34 95.28 106.29 15 44.12
9570. (mulluchian) 34 76.90 97.63 6 17.65
9571. mmlvx (mmlvx) 34 63.91 74.88 11 32.35
9572. grieves (mmcph36) 34 81.49 91.99 4 11.76
9573. Miz (miztypes) 34 110.23 125.64 16 47.06
9574. gradient (misaelmmorales06) 34 94.37 111.20 12 35.29
9575. ash (mikadole) 34 89.87 109.88 15 44.12
9576. Migsgd (migelawan123) 34 131.34 151.21 27 79.41
9577. Adam (merrth) 34 95.95 111.42 6 17.65
9578. Mole (mementomole) 34 51.44 68.42 8 23.53
9579. Micheal (mbroaders) 34 74.77 89.88 9 26.47
9580. Matthew (matthewdilks) 34 85.51 111.09 17 50.00
9581. Masked (masked_error) 34 60.27 72.97 11 32.35
9582. Marinos (marinosdim) 34 52.59 63.36 1 2.94
9583. Salchica (machete24x) 34 90.93 117.34 9 26.47
9584. Locksley (locksng12) 34 83.74 99.40 13 38.24
9585. Lanlana (llnfriend) 34 54.26 74.15 17 50.00
9586. theerapat (lipertal) 34 62.36 81.72 8 23.53
9587. Nick (lemech) 34 55.07 71.39 6 17.65
9588. Kshitij (kshitij_srv) 34 70.17 80.42 6 17.65
9589. kosmanaut (kosmanaut) 34 90.68 107.06 10 29.41
9590. Kiran (kkdatkiran) 34 78.80 90.49 8 23.53
9591. John (kircher32245) 34 80.11 111.73 14 41.18
9592. Peter (kamikaze1336) 34 79.76 104.47 13 38.24
9593. Jacq (jvjacq) 34 61.18 79.35 8 23.53
9594. Justin (jpsmith) 34 51.79 63.86 2 5.88
9595. Jorgle (jorgleframpleton) 34 88.20 99.62 13 38.24
9596. Jon (jonc5201) 34 85.81 100.11 13 38.24
9597. Jackie (johnsonj13) 34 68.70 83.76 14 41.18
9598. ttv/J0bro (jobrocraftstep) 34 89.54 110.89 10 29.41
9599. Jha (jha94) 34 120.52 145.78 22 64.71
9600. Jetless (jetless27) 34 65.28 84.05 7 20.59
9601. jc.ekrem (jc_ekrem) 34 76.95 95.13 11 32.35
9602. JaydenPrbhd (jayden_prbhd010) 34 66.37 89.82 6 17.65
9603. +923326006034 (janan9233260... 34 57.88 72.31 6 17.65
9604. !dreamer#9577@dscrd (jaixhi... 34 63.06 77.68 8 23.53
9605. jad (jadtriestyping) 34 78.49 92.55 3 8.82
9606. Jalen (jaalen21) 34 86.33 102.57 12 35.29
9607. itbolt (itbolt) 34 95.85 128.38 17 50.00
9608. Ivan (ipenipent) 34 111.82 131.82 23 67.65
9609. Race (im_not_cheating_ur_wi... 34 90.80 107.34 13 38.24
9610. Robbie (idkloltype) 34 45.68 56.43 4 11.76
9611. ryan (hopedarklord1) 34 116.89 140.38 20 58.82
9612. Hk (hk2257853) 34 48.68 61.73 4 11.76
9613. Hikaru (hikaruk) 34 58.13 67.83 4 11.76
9614. heikrana (heikrana) 34 69.81 79.50 10 29.41
9615. Mark (haxos) 34 90.70 104.82 13 38.24
9616. Tzemis (greekjames) 34 90.41 118.03 14 41.18
9617. brooklyn (furretmastr) 34 106.88 126.24 12 35.29
9618. ABC (funnelcake9) 34 122.69 137.00 17 50.00
9619. Justin (flamebun) 34 99.54 118.83 16 47.06
9620. Fauzan (fblues) 34 89.04 99.18 10 29.41
9621. Eryk (fatmamma) 34 91.09 102.49 8 23.53
9622. Askefise (fast_as_sanic) 34 90.72 114.99 18 52.94
9623. Marcus (fakedefulty) 34 41.40 57.26 3 8.82
9624. Fabi (fabilula) 34 43.40 57.05 3 8.82
9625. Erl (erlisgod) 34 54.36 63.01 4 11.76
9626. Skraap (elskrapo) 34 86.51 104.59 7 20.59
9627. elbert (elbert1104) 34 59.27 70.35 6 17.65
9628. harsh spacebar broke lol (d... 34 56.40 71.78 6 17.65
9629. Dileep (dileepnk) 34 87.57 117.66 11 32.35
9630. Vandy (desmaid) 34 105.13 124.53 18 52.94
9631. John (dent12) 34 53.75 67.20 7 20.59
9632. Prdel (dendritic_cell) 34 62.74 69.68 9 26.47
9633. Jay (cutecanadian) 34 57.33 69.82 8 23.53
9634. Iyanically (cryptic_cosmic) 34 80.39 96.72 10 29.41
9635. sion (crossblade06) 34 75.31 87.13 11 32.35
9636. Mehraj Mahmood (comiccypressm) 34 33.87 41.16 0 0.00
9637. Andrew Li (combatwombat123) 34 78.00 91.51 12 35.29
9638. Clement (clem_jestin) 34 48.53 55.28 2 5.88
9639. Cindy (cindy1889) 34 69.69 83.36 16 47.06
9640. Adrian (cheeseshrub) 34 74.18 98.28 8 23.53
9641. Cameron (camerong123) 34 119.11 143.68 19 55.88
9642. brindobob (brindobob) 34 138.97 160.83 27 79.41
9643. Brihoness (brihoness) 34 63.84 76.24 9 26.47
9644. Alexgiomuel (bionicmjallday... 34 56.04 72.97 4 11.76
9645. ben (bentypemaster) 34 64.30 76.00 4 11.76
9646. Benjamin (benhundos) 34 84.16 96.81 8 23.53
9647. bbygirlturtle (bbygirlturtle) 34 49.59 67.23 7 20.59
9648. Bob (baine001) 34 74.90 95.54 5 14.71
9649. loser (badatenglish) 34 88.83 113.70 12 35.29
9650. Ash (ash_ketchump) 34 49.01 65.62 4 11.76
9651. appu (appu46) 34 50.52 61.25 5 14.71
9652. ApocJTL (apocjtl) 34 89.05 115.85 10 29.41
9653. Small (amaro123) 34 84.48 103.96 7 20.59
9654. Alstr (alstr) 34 90.90 118.69 15 44.12
9655. ali (alianggie) 34 48.76 61.25 3 8.82
9656. Aji (ajiwahyuw) 34 94.90 109.00 17 50.00
9657. Ahsan (ahsanhussain) 34 103.08 119.64 13 38.24
9658. Frangsinatra (addaxer) 34 83.04 105.83 10 29.41
9659. Artichamp (abhrajit_saha) 34 78.44 93.13 8 23.53
9660. Abhishek (abhi_720) 34 43.12 54.78 1 2.94
9661. Abdullah (abdullahshah_) 34 45.51 55.04 1 2.94
9662. Aadil (aadil0392) 34 68.10 86.23 10 29.41
9663. ARTHUR (4rthur) 34 85.17 107.92 12 35.29
9664. krittika (mojitroll) 34 73.19 83.47 7 20.59
9665. lerii (lerii) 34 46.47 59.86 3 8.82
9666. Matthew (mpfstudios) 34 52.23 66.38 5 14.71
9667. Aziza (meem_grfx) 34 52.50 62.55 3 8.82
9668. Neelie (neeliee) 34 101.00 115.05 15 44.12
9669. Triyanshu (triyanshu1996) 34 58.68 72.36 6 17.65
9670. Jesse (jrochefo) 34 61.13 69.42 5 14.71
9671. Elya (elyagolry) 34 43.03 58.44 8 23.53
9672. JB (chequer) 34 123.54 146.50 19 55.88
9673. swapnil (sj480) 34 30.52 37.53 4 11.76
9674. Nuradil (nuradil_zhambyl) 34 107.29 130.16 14 41.18
9675. Jakob (shaquer) 34 82.62 101.76 11 32.35
9676. Paul (pauljurgens) 34 65.07 78.85 9 26.47
9677. Kevin (hylo28) 34 103.58 123.87 14 41.18
9678. Jannett (jannett) 34 24.72 35.66 5 14.71
9679. kai (iiiiikai) 34 55.62 72.12 5 14.71
9680. PP (s090351114) 34 53.69 63.39 7 20.59
9681. Jeremy (jeteryankee2) 34 80.99 102.92 13 38.24
9682. Pharaoh (pharaoh_zr) 34 61.38 81.36 14 41.18
9683. Thanh (alians) 34 69.55 82.52 7 20.59
9684. do better (do_better) 34 71.87 90.82 8 23.53
9685. Phillip (jurten) 34 94.31 123.36 24 70.59
9686. Ted (ted_j_kaczynski) 34 75.31 92.92 14 41.18
9687. Nikobaby (robemigani) 34 73.91 96.38 8 23.53
9688. tstats[rafid149] (rafid149) 34 74.68 99.44 6 17.65
9689. Zerrox (zerrox) 33 100.50 116.99 16 48.48
9690. Vilantas (zenblax) 33 44.47 49.97 7 21.21
9691. Zedrick (zedrickbr) 33 128.24 152.60 25 75.76
9692. Doyle (zdubhghaill) 33 68.28 82.14 6 18.18
9693. Zac (zactus_) 33 57.97 70.02 4 12.12
9694. Kutya (ysakovvvs) 33 42.67 52.62 4 12.12
9695. YaBoi (yab0i) 33 63.78 74.61 4 12.12
9696. (xxgamerprofunxx) 33 95.23 111.89 7 21.21
9697. Xeethra (xeethra) 33 89.14 105.31 15 45.45
9698. Santosh (wow123__) 33 50.37 60.55 4 12.12
9699. Wella (wella05) 33 61.23 75.92 24 72.73
9700. Tom (voiovinili) 33 70.54 89.53 7 21.21
9701. vamsi (vamsibharadwaj) 33 55.90 64.41 3 9.09
9702. Uziel1595 (uziel1595) 33 61.57 74.97 7 21.21
9703. Simon (unclesimon) 33 60.59 93.68 18 54.55
9704. Uddaya (uddaya) 33 61.93 77.17 8 24.24
9705. ɥsǝdǝǝᗡ (toxin_d) 33 67.61 80.77 12 36.36
9706. Scarlet (tongli10) 33 69.71 82.98 10 30.30
9707. timmy (timmy14) 33 75.81 88.63 11 33.33
9708. TIFF (tiffanytai888) 33 44.55 51.01 3 9.09
9709. Kurt (thydark) 33 104.77 124.55 19 57.58
9710. Thithiesha (thithiesha) 33 69.37 80.85 11 33.33
9711. Sam (the___sam) 33 71.65 84.52 5 15.15
9712. Ryan (theguy985) 33 87.38 119.70 14 42.42
9713. Matthew (thefinchler) 33 71.23 80.89 6 18.18
9714. Taquid (taquid) 33 70.50 85.79 12 36.36
9715. Tair (tako_01) 33 33.51 41.03 2 6.06
9716. Jake (superduperjake) 33 86.47 100.04 12 36.36
9717. sulux (sulux_14) 33 52.45 60.62 0 0.00
9718. Sylvaen (suggestedrp) 33 90.44 107.64 11 33.33
9719. Kersey (strythio) 33 107.43 125.43 23 69.70
9720. David (spurgeon) 33 82.43 107.54 4 12.12
9721. Spike (sp4rks) 33 64.51 83.90 10 30.30
9722. Socceryolo (socceryolo) 33 57.90 79.55 5 15.15
9723. Guest (slowpokest) 33 77.61 104.52 7 21.21
9724. (slowandinaccurate) 33 121.79 164.93 19 57.58
9725. Lagmybsf (sk0ttt) 33 90.36 109.44 13 39.39
9726. Gilbert (sigalingging_23) 33 88.21 102.77 7 21.21
9727. xD (shabanllokmja) 33 54.25 67.51 4 12.12
9728. Sestain (sestain) 33 76.29 91.21 9 27.27
9729. JDizzle (serinus) 33 99.27 132.74 13 39.39
9730. sasquatch (sasquatchplatypus) 33 40.63 53.57 5 15.15
9731. Andrew (sasamori) 33 92.48 110.11 12 36.36
9732. rodrigo (rodtronx) 33 74.61 86.41 4 12.12
9733. RITIK (ritik1999) 33 32.32 38.22 3 9.09
9734. Vivian Le (riru) 33 65.03 76.29 3 9.09
9735. Ridans (ridans) 33 78.22 98.63 7 21.21
9736. Rhune (rhunetro) 33 68.21 80.14 6 18.18
9737. ralf (rhalfik) 33 72.48 92.53 10 30.30
9738. Ben (random_peepsle12) 33 64.17 74.53 7 21.21
9739. ramu kumar (ramu_kumar) 33 63.43 76.93 10 30.30
9740. rambalaji (rambalaji) 33 75.54 98.37 11 33.33
9741. Rakshit_dvorak (rakshit007) 33 78.13 95.08 14 42.42
9742. rajan (rajan_singh123) 33 44.73 53.91 22 66.67
9743. raging_wolf (raging_wolf) 33 56.67 69.97 3 9.09
9744. r0hkx (r0hkx) 33 88.63 111.67 8 24.24
9745. Quang (puangpro__6969) 33 58.32 69.23 15 45.45
9746. Will (pozzpyo) 33 93.73 104.39 13 39.39
9747. PJ (pjk519) 33 64.72 80.31 8 24.24
9748. Ed (pelly1863) 33 86.29 99.87 6 18.18
9749. Pegasus X (pegasusx) 33 34.08 45.58 1 3.03
9750. Happy (paimon__) 33 70.39 86.15 7 21.21
9751. Null (nullstring) 33 91.65 106.44 11 33.33
9752. Nuan (nuan56) 33 72.06 91.79 7 21.21
9753.   (nt_chill) 33 99.88 118.27 12 36.36
9754. Luke (nsaagent115) 33 92.30 112.83 12 36.36
9755. Garbage (nerdballer) 33 127.63 151.31 22 66.67
9756. Nik (nazeki) 33 96.37 123.41 19 57.58
9757. Andrew (narchio) 33 98.45 118.93 10 30.30
9758. Yuko (naoyuko) 33 77.53 84.74 7 21.21
9759. Naomi (namtheyam) 33 98.29 116.51 16 48.48
9760. Perhs (mrbunnym) 33 64.72 85.51 7 21.21
9761. mky (mky1) 33 85.35 101.89 13 39.39
9762. ig @emkloco (mkplayz) 33 80.40 96.05 6 18.18
9763. Mitchell (mitchell721) 33 74.00 100.07 5 15.15
9764. laffytaffy (mihirsm) 33 69.49 86.36 4 12.12
9765. Mitchell (mdyer44) 33 86.53 107.17 11 33.33
9766. chaotix (mcomm7) 33 75.13 89.31 6 18.18
9767. Maxi (maxi25) 33 65.32 79.69 7 21.21
9768. Marky (mark2most) 33 69.93 85.59 4 12.12
9769. Mandeep (mani7246) 33 66.43 80.56 10 30.30
9770. Couldn't be you (malthekr) 33 83.50 95.89 29 87.88
9771. m0nst3r (m0nst3r9) 33 54.30 67.43 7 21.21
9772. Liam (lwebb167) 33 79.87 89.06 9 27.27
9773. LuciD (luci_d) 33 82.95 94.26 15 45.45
9774. tstats[lil_issam312] (lil_i... 33 31.93 39.19 1 3.03
9775. King Bygone (lil_bygone) 33 95.41 117.08 7 21.21
9776. Wen (legendxiang) 33 87.54 105.84 11 33.33
9777. Noah (l0cket) 33 61.39 75.56 4 12.12
9778. krystall (krrystall) 33 57.37 74.94 7 21.21
9779. Krish (krish_agn) 33 43.05 56.27 14 42.42
9780. Ludvig (krang) 33 60.44 73.16 9 27.27
9781. kevin (kevinstj) 33 94.53 127.61 11 33.33
9782. keb (kerringtonbridges) 33 57.64 74.94 6 18.18
9783. MOHANA (kanthetimohana) 33 59.92 70.37 0 0.00
9784. Kalin (kamarel) 33 84.93 104.81 13 39.39
9785. Yoshi (justayoshi) 33 74.27 91.65 6 18.18
9786. Guest (jun16) 33 82.80 96.27 11 33.33
9787. Ice (juicedicee) 33 73.25 92.19 9 27.27
9788. Joshua (joshuajunhee) 33 83.54 116.76 10 30.30
9789. Jonah (jonahtzy) 33 76.86 106.28 12 36.36
9790. Ron(ald) (jellybeanman) 33 97.38 114.32 20 60.61
9791. James (jameslroll) 33 114.33 134.74 19 57.58
9792. Puntlander (jamaquube) 33 76.19 87.05 8 24.24
9793. Jáky (jaky_) 33 45.45 53.33 4 12.12
9794. Aryan (jai_ho420) 33 42.56 57.11 2 6.06
9795. Ivan (ivangoh321) 33 79.35 88.46 7 21.21
9796. Lynnette (its_lynnie27) 33 111.80 173.89 19 57.58
9797. khy (itskhylmao) 33 59.91 75.57 27 81.82
9798. iterative (iterative) 33 36.76 45.44 1 3.03
9799. Insany (insanyngame) 33 64.11 73.28 17 51.52
9800. Oflu61 (ilkerb) 33 113.26 133.30 18 54.55
9801. hutab (hutab) 33 66.50 81.97 14 42.42
9802. Adam (hodowcaowiec) 33 82.38 93.37 8 24.24
9803. HK_TeddyBear (hk_teddybear) 33 39.10 52.69 4 12.12
9804. HiroHero (hirohero89) 33 100.80 121.10 13 39.39
9805. tstats[harryrich02] (harryr... 33 61.89 73.09 5 15.15
9806. hao (haoatran) 33 93.76 106.25 18 54.55
9807. Hachikachi (hachikachi) 33 105.01 123.28 18 54.55
9808. Habibur (habiburrahman_mu) 33 43.81 68.34 8 24.24
9809. G_low (g_low) 33 59.13 89.87 11 33.33
9810. Adam (goodboyadam) 33 101.39 130.26 9 27.27
9811. R (ghostboy) 33 89.58 115.28 19 57.58
9812. Bootstrap (gaurav021992) 33 66.86 86.57 19 57.58
9813. Vladimír (froggz) 33 107.11 124.04 23 69.70
9814. forever_extinct (forever_ex... 33 77.44 103.84 7 21.21
9815. umang patel (fiasty) 33 48.73 59.55 3 9.09
9816. Jake (faljake) 33 86.51 112.38 16 48.48
9817. Esraa (esraa14) 33 17.64 28.41 10 30.30
9818. Samantha (epoxicx) 33 74.23 101.00 7 21.21
9819. Enreden (enreden) 33 74.49 95.51 11 33.33
9820. Eico (eico66) 33 75.77 90.03 11 33.33
9821. Eduardo (eduardofreitas) 33 59.84 71.35 4 12.12
9822. Ebi13579 (ebenezer13579) 33 107.44 132.69 7 21.21
9823. doniee (doniee) 33 101.14 114.70 12 36.36
9824. streetcar (dohrn1i) 33 74.67 94.43 17 51.52
9825. Jard (dogspa) 33 105.78 122.95 17 51.52
9826. Jan (de_necromancer) 33 47.49 60.21 5 15.15
9827. Deen (deenibsyed) 33 87.98 99.50 9 27.27
9828. Eric (wangjangler) 33 81.92 94.70 7 21.21
9829. Grant (datasianguy23) 33 111.13 136.03 17 51.52
9830. Daniel (danntheman21) 33 54.70 68.78 5 15.15
9831. Dankerino (dankerinohd) 33 79.43 94.15 11 33.33
9832. amalia (chowdergirl) 33 87.21 108.56 10 30.30
9833. butane (butanebutton) 33 81.09 96.80 23 69.70
9834. breadedsouth (breadedsouth) 33 69.22 101.25 4 12.12
9835. August (boxcybrawler) 33 66.59 75.12 8 24.24
9836. Emmett (bigblueyeti) 33 77.58 90.81 5 15.15
9837. binay (biany671) 33 36.80 46.06 3 9.09
9838. Bermet (bermetibr) 33 36.26 44.93 0 0.00
9839. JumboTub4 (ben_is) 33 68.75 86.78 7 21.21
9840. baker (bakervai001) 33 37.25 46.60 1 3.03
9841. Hari (baby1_jimmy) 33 121.69 145.25 17 51.52
9842. Awnvar (awnvar) 33 55.22 70.53 4 12.12
9843. adam (armorcle__) 33 110.31 132.16 15 45.45
9844. starsick (ardentauthoress) 33 103.72 122.72 18 54.55
9845. Appel (appelboer) 33 75.42 93.39 11 33.33
9846. Annie (anniesimp) 33 77.07 91.33 10 30.30
9847. Anisath Kirubakaran (anisath) 33 44.44 52.69 4 12.12
9848. AnesDZ (anes201) 33 79.72 93.98 11 33.33
9849. alexj (alexjonelis) 33 64.61 82.88 14 42.42
9850. Alexey (aleksn7) 33 68.06 82.70 5 15.15
9851. Anton (alejendaryguy) 33 104.58 121.95 1 3.03
9852. TulBott (alb3rth3nry) 33 101.29 118.77 14 42.42
9853. AGTNurat (agtnurat) 33 119.05 142.35 20 60.61
9854. abnf (abnf) 33 78.89 90.44 9 27.27
9855. Max (2zmaxx) 33 96.02 117.32 14 42.42
9856. Angel (angelbullet) 33 76.31 87.82 12 36.36
9857. macc (softiebby) 33 87.57 112.23 9 27.27
9858. shshsh (alex2003_) 33 47.36 55.76 2 6.06
9859. Julien (dadcomeback) 33 92.87 106.88 14 42.42
9860. Arun (arunkodumuru) 33 66.75 81.24 9 27.27
9861. Ajeet (stripedcat12) 33 66.36 79.79 10 30.30
9862. ARF (arf_g3) 33 72.01 87.45 11 33.33
9863. Sun (sun730) 33 105.34 121.70 14 42.42
9864. sarah (samuro) 33 114.40 136.04 18 54.55
9865. GreenMilk (greenmilk7) 33 70.57 97.55 8 24.24
9866. Fold Folded (nomine) 33 86.85 99.28 11 33.33
9867. Anky (ankybisen) 33 39.65 50.29 1 3.03
9868. Gojdoma (gojdoma1910) 33 78.73 99.94 11 33.33
9869. sinnoh (serokai1721) 33 71.92 94.60 10 30.30
9870. carzard (carzard) 33 52.58 61.67 5 15.15
9871. remu (remu_gareu) 33 61.62 69.32 0 0.00
9872. Gergő (gergi7600) 33 63.71 81.53 7 21.21
9873. Venom (_venom) 32 77.04 94.46 10 31.25
9874. AaronIsADonkey (_gg_ez_) 32 114.93 137.46 14 43.75
9875. Zenith (zenith1g) 32 43.65 54.54 1 3.13
9876. Hoang (yungrax) 32 57.50 68.37 6 18.75
9877. Yogesh (yogesh9770) 32 45.98 70.07 4 12.50
9878. MooD (xslel) 32 97.99 125.49 11 34.38
9879. tstats[xeg28] (xeg28) 32 84.39 94.88 11 34.38
9880. a (xdxdxd1234) 32 80.99 92.84 4 12.50
9881. Welame (welame) 32 82.47 96.96 0 0.00
9882. ColeMacca (weenyboi) 32 75.76 89.97 8 25.00
9883. Melissa (wally88) 32 99.28 110.54 11 34.38
9884. Vladi (wacy11) 32 89.41 113.06 10 31.25
9885. Sunil (w0rds) 32 60.18 79.30 5 15.63
9886. VYCanis (vycanis55) 32 97.03 105.75 15 46.88
9887. THE STARDUST (void07) 32 62.15 79.19 7 21.88
9888. Timo (ustimoger) 32 60.48 76.69 11 34.38
9889. Will (urbanmist) 32 80.91 94.96 13 40.63
9890. Ahmed (uproo) 32 63.08 80.86 8 25.00
9891. Uncreeperble (uncreeperble) 32 84.78 117.56 10 31.25
9892. AA (typee45) 32 44.22 54.69 6 18.75
9893. tropics (tropicswpm56) 32 75.48 88.81 11 34.38
9894. Tonchi (tonch1) 32 95.00 109.04 15 46.88
9895. Alex (titleist_pro_v1x) 32 79.70 98.94 18 56.25
9896. Jonathan (the_mechanical) 32 97.86 123.52 9 28.13
9897. Ronny (the_mandalorian) 32 42.89 56.64 2 6.25
9898. theaveragedude (the_avg_dude) 32 81.03 98.09 8 25.00
9899. Timothy (thekoreanbanana) 32 82.68 97.09 14 43.75
9900. Lightning (thecarsfan) 32 68.55 76.71 7 21.88
9901. Taybuscus (taybuscus) 32 71.57 88.24 8 25.00
9902. OnlyStanz (tanni) 32 87.00 104.98 12 37.50
9903. HASHTAG (talk_is_cheap_like... 32 121.98 141.39 17 53.13
9904. E (boop_bop) 32 47.23 57.08 0 0.00
9905. Edward (supereduardus) 32 97.94 117.04 17 53.13
9906. שפיצער (spitzer722) 32 65.51 85.56 7 21.88
9907. Saim (spirit_) 32 77.11 101.49 9 28.13
9908. slowmxbrowns (slowmxbrowns) 32 87.49 103.65 10 31.25
9909. SLEEPINGzZZ (sleepingzzz) 32 53.20 64.03 5 15.63
9910. Simeon (sim80) 32 122.38 148.29 17 53.13
9911. Shon (shonboy21) 32 63.33 75.19 4 12.50
9912. Shiasuni (shiasuni) 32 114.25 138.24 20 62.50
9913. Shaun (shaunlooi) 32 84.04 99.07 11 34.38
9914. Ahanaf Shahriar (shahriar013) 32 48.65 59.37 1 3.13
9915. Logan (shadows36) 32 69.44 93.82 10 31.25
9916. scpals (scpals) 32 79.22 102.64 10 31.25
9917. Sarafraj (sarafraj) 32 49.57 57.20 1 3.13
9918. Samadou (samadou_10) 32 80.59 102.96 12 37.50
9919. RyZe (ryzehopz) 32 62.16 80.30 10 31.25
9920. Ryan (ryanlondon) 32 57.11 72.48 6 18.75
9921. Tyler Rankin (rxnkin) 32 66.81 80.96 6 18.75
9922. ronald (ronaldalbarn) 32 87.25 105.65 7 21.88
9923. Rocks D. (rocksdxebec00) 32 58.24 69.36 6 18.75
9924. Bakugo (respiro72) 32 118.43 136.95 22 68.75
9925. Rachel (rachel85881) 32 105.30 118.79 21 65.63
9926. Anna (rabbitpickles69) 32 93.70 129.75 11 34.38
9927. Raagaception (raagaception) 32 83.33 105.41 11 34.38
9928. uzi (r3yna) 32 74.33 92.13 12 37.50
9929. brownbelly (pvthg) 32 86.92 109.81 12 37.50
9930. PRACTICE (practicecar) 32 117.33 143.37 19 59.38
9931. PropheticNPC (potencity) 32 90.79 110.76 8 25.00
9932. player (player172) 32 39.13 96.44 9 28.13
9933. Arsh (piratexx) 32 78.04 90.39 23 71.88
9934. ninii (paniini) 32 91.87 110.12 17 53.13
9935. Amine (ov4h) 32 59.26 74.26 8 25.00
9936. Lego (outboxer009) 32 44.65 51.82 3 9.38
9937. organic (organic__filter) 32 61.72 73.36 6 18.75
9938. Oscar (oguana) 32 67.44 82.83 6 18.75
9939. Nico (npvalerio8) 32 89.39 109.18 13 40.63
9940. Stalin (notdavidcameron) 32 117.89 146.39 18 56.25
9941. Aanshu (noob_typist_404) 32 68.52 79.94 12 37.50
9942. Martin (niquid) 32 76.77 90.93 9 28.13
9943. Nieid (nieid) 32 87.99 116.68 14 43.75
9944. nakkisoppa666 (nakkisoppa666) 32 98.04 131.34 9 28.13
9945. Nazarbek (na2a_) 32 111.38 125.58 15 46.88
9946. Milan (m_i_n_o) 32 56.55 71.07 4 12.50
9947. Mackenzie (music1713) 32 34.75 40.44 0 0.00
9948. mukrohin (mukrohin) 32 90.41 109.08 9 28.13
9949. tstats[muhd99] (muhd99) 32 68.99 79.29 10 31.25
9950. Matt Tierney (mtierney111) 32 76.22 100.14 9 28.13
9951. Percy (mraudiodrama) 32 98.57 116.05 14 43.75
9952. Matthew (mpb0401) 32 67.64 80.40 5 15.63
9953. Tanakrit (mogoon) 32 56.34 65.62 7 21.88
9954. Mamdouh (mmdh) 32 64.44 80.67 11 34.38
9955. nah (ministermeme) 32 93.31 111.67 9 28.13
9956. Meruem (meruem1919) 32 140.92 173.02 23 71.88
9957. Kaung Pyae (meandmyfriend4) 32 57.76 70.40 6 18.75
9958. Sean (masian08) 32 90.16 105.90 5 15.63
9959. Melon (mailmelon) 32 54.98 67.17 4 12.50
9960. MAGNUS (magnus03) 32 57.01 80.73 6 18.75
9961. Lucia (lucialima) 32 47.18 56.25 2 6.25
9962. Christopher (lord_pretzel) 32 86.94 109.25 7 21.88
9963. long (longlonglong) 32 64.58 80.46 7 21.88
9964. Lojants (lojants1) 32 95.77 111.65 10 31.25
9965. Albert (lnseed) 32 77.28 96.30 6 18.75
9966. Eric (llmangoll) 32 66.10 82.09 17 53.13
9967. LAO (legendoflaohan) 32 69.92 85.76 8 25.00
9968. Brylle (latios12349) 32 55.25 64.48 1 3.13
9969. Lathoa (lathoa) 32 79.99 95.29 17 53.13
9970. Kyle (kyle_15) 32 43.36 57.37 1 3.13
9971. -_- (kxs5) 32 110.77 124.92 24 75.00
9972. Alberto Balsalm (kutaybozkurt) 32 70.56 82.63 12 37.50
9973. twitch.tv/klokkismann (klok... 32 126.39 151.08 8 25.00
9974. hyunki (kirene) 32 72.34 82.12 10 31.25
9975. Keith (keithlor) 32 127.22 147.69 18 56.25
9976. 🥴 (kangjushang) 32 50.65 61.50 1 3.13
9977. v(._.)v (justbeatya) 32 64.92 78.96 6 18.75
9978. Julian (julianeadie) 32 53.33 63.03 3 9.38
9979. Julia (juliaar) 32 56.76 70.15 7 21.88
9980. Juggernaut (jugg07) 32 96.32 112.60 11 34.38
9981. James (jrm371) 32 75.85 103.51 11 34.38
9982. Joshua (joshque) 32 92.67 110.35 4 12.50
9983. Jose (jgeer) 32 66.16 75.42 6 18.75
9984. JackBurst (jackburst) 32 107.16 125.24 12 37.50
9985. Joey (j0ash08) 32 56.37 66.32 16 50.00
9986. Hasit (invincible678) 32 59.20 87.45 5 15.63
9987. Highly unskilled (intenseag... 32 152.54 201.70 20 62.50
9988. Smitty W. (ifartfire) 32 71.42 84.18 7 21.88
9989. ICE TEA (ice_tea911) 32 59.33 70.89 5 15.63
9990. Victor (hueylouisnonews) 32 90.74 103.70 12 37.50
9991. Sclai (house_cat) 32 71.14 81.98 7 21.88
9992. Hobo (hobo_rapper) 32 83.82 101.30 8 25.00
9993. AHEN (henneberg) 32 104.15 138.74 12 37.50
9994. haidilaohotpot (haidilaohot... 32 81.26 91.41 7 21.88
9995. Gleb (gsavchenko) 32 59.90 68.84 3 9.38
9996. Graham (grayham11) 32 85.08 99.76 9 28.13
9997. scarFace (gray25905634) 32 72.53 92.65 7 21.88
9998. Grace (gracecatan) 32 118.34 131.73 14 43.75
9999. GoldenSnitch (goldensnitch73) 32 84.96 103.83 7 21.88
10000. Glad (glad99) 32 74.68 94.57 7 21.88
10001. Giovanni (giovannigando) 32 80.27 89.92 8 25.00
10002. Graham (gfoote) 32 96.44 108.33 12 37.50
10003. Andrew (get_hyped20) 32 95.11 115.36 17 53.13
10004. Flex (flexiblerhyme30) 32 58.01 71.49 8 25.00
10005. Chuanyao (finalconflux) 32 87.96 111.04 13 40.63
10006. Eric (envyhope) 32 87.24 103.21 9 28.13
10007. engager (engager) 32 65.41 73.88 2 6.25
10008. Emily (emilyk_3357) 32 93.47 114.49 12 37.50
10009. Elsawy (elsawy636) 32 78.48 87.78 6 18.75
10010. SirCanaanDoyle (elevayshun) 32 113.39 143.05 18 56.25
10011. SlipperySlope (eeilu) 32 77.30 88.62 10 31.25
10012. Dustin (dustindp99) 32 94.58 110.69 12 37.50
10013. Dustin (dustin099) 32 87.74 104.16 12 37.50
10014. The (dhemagicianking) 32 117.51 140.75 14 43.75
10015. (dev_rec) 32 150.31 185.43 17 53.13
10016. David (davejiggy) 32 62.52 75.09 5 15.63
10017. Darkleonard (darkleonard) 32 109.16 124.14 12 37.50
10018. Danat (danat_ayazbayev) 32 98.52 113.93 10 31.25
10019. Dammsugaren (dammsugaren) 32 81.09 95.00 11 34.38
10020. Curo (curo) 32 77.73 91.73 8 25.00
10021. Cosmin (cosmyd) 32 58.91 69.20 3 9.38
10022. cookie (cookienbo) 32 79.04 107.54 9 28.13
10023. Sai Srujan Kumar (chsrujan) 32 95.43 106.39 9 28.13
10024. Carlos (carlos_007) 32 63.56 75.91 8 25.00
10025. Espii (carlespe13) 32 69.68 82.79 14 43.75
10026. Brennan (brennanminns) 32 86.41 104.38 12 37.50
10027. Putu (boostedwrx) 32 114.72 145.23 17 53.13
10028. Gordon (boboiv) 32 87.37 114.90 8 25.00
10029. ameerah (bluecandy) 32 98.63 109.51 16 50.00
10030. Bibek (bibek_) 32 80.42 94.70 4 12.50
10031. Prem (batprem) 32 58.02 67.59 3 9.38
10032. Zack (averyackz) 32 62.71 85.23 8 25.00
10033. Morpheus14 (atilla_14) 32 81.94 95.50 13 40.63
10034. Aaron (asc_the_fighter) 32 23.57 28.75 7 21.88
10035. aron (aron25) 32 95.65 111.05 20 62.50
10036. Arespi (arespi) 32 89.93 101.79 8 25.00
10037. Antombomb (antombomb) 32 32.36 45.83 3 9.38
10038. Anthony (anthonyjhwu) 32 47.72 56.60 2 6.25
10039. Adebayọ (annonp) 32 67.67 89.19 8 25.00
10040. milyn (alymilyn) 32 64.82 74.86 10 31.25
10041. All-Rounder_28 (allrounder28) 32 74.26 96.16 9 28.13
10042. good (afternoonracer) 32 81.80 101.02 14 43.75
10043. 🐌 (adas291) 32 77.21 86.48 12 37.50
10044. Ace (acechow) 32 91.85 113.51 10 31.25
10045. Abhishek (abhikumar98) 32 65.78 76.72 7 21.88
10046. Abdullah (abdullahbb102) 32 71.71 94.92 4 12.50
10047. Thomas (2minute) 32 68.82 76.45 9 28.13
10048. Leo (1_typer_boy_1) 32 86.91 101.78 8 25.00
10049. Nick (1chompy_) 32 79.40 90.82 11 34.38
10050. Ramakant (ramakant) 32 35.46 49.52 1 3.13
10051. Spectral (sspectral) 32 60.16 74.76 3 9.38
10052. Toni (meecoula) 32 90.54 106.34 10 31.25
10053. Joaquin (joaquino19) 32 46.45 57.39 21 65.63
10054. Matt (hoopenator) 32 62.39 79.16 7 21.88
10055. Adrian (apa9906) 32 71.55 90.94 30 93.75
10056. Yuvi (yuva_yuvi) 32 44.14 55.24 5 15.63
10057. Yul (toonguy) 32 90.22 120.20 16 50.00
10058. sheg (shegsheg) 32 76.66 92.80 8 25.00
10059. Alexander (thefastgumby) 32 56.60 64.95 5 15.63
10060. Uran (uran001) 32 56.91 67.16 15 46.88
10061. Austin (asasa3092) 32 71.45 89.36 7 21.88
10062. Soham (microsword) 32 71.32 82.80 7 21.88
10063. Liam (liamdasilva) 32 80.39 97.22 4 12.50
10064. m (llelouchh) 32 80.25 96.46 9 28.13
10065. Buka (obuka) 32 41.59 52.24 3 9.38
10066. mark (heaterbeater) 32 93.12 111.77 9 28.13
10067. Nikola (_not_) 31 47.92 54.44 1 3.23
10068. mo (yo_mo) 31 56.29 68.65 3 9.68
10069. lol (yowennnn) 31 80.55 99.53 11 35.48
10070. melon (yoonity_) 31 114.05 131.49 21 67.74
10071. Yani (yani916) 31 77.74 89.96 7 22.58
10072. marco (xqz_u) 31 65.21 74.50 9 29.03
10073. Seizoxu (xezious) 31 92.64 110.99 15 48.39
10074. fnf (whitezetra) 31 89.66 111.88 9 29.03
10075. Whelps (whelps) 31 115.37 152.09 18 58.06
10076. K (wh0mst) 31 62.91 73.50 4 12.90
10077. Virbox (web_user) 31 96.99 110.98 11 35.48
10078. Watrdos (watrdos) 31 84.52 103.12 8 25.81
10079. Jeffrey (vlasfack) 31 68.36 81.39 7 22.58
10080. Orca (virtualorca) 31 80.47 92.02 11 35.48
10081. Lux (veyro) 31 63.15 73.35 10 32.26
10082. Hah (verdaderopan) 31 102.75 119.17 11 35.48
10083. Ultimate_Coder (ultimate_co... 31 107.99 122.04 17 54.84
10084. Jammie (nonquit) (typos_zzz) 31 176.19 217.38 22 70.97
10085. (typing_doggo) 31 97.14 115.16 14 45.16
10086. Turuo (turuo) 31 66.51 79.81 7 22.58
10087. Alex (tsaalex) 31 91.52 108.03 9 29.03
10088. Trevor (trevor10) 31 30.38 39.83 3 9.68
10089. 😈 (topthis) 31 94.81 111.46 8 25.81
10090. James (the_swan) 31 108.69 127.33 21 67.74
10091. Daniel (teraminx) 31 129.32 142.46 25 80.65
10092. Eugene (taiwansfinest) 31 96.05 119.95 10 32.26
10093. Mr. (superfat) 31 63.07 75.11 4 12.90
10094. Stuart (stuart000little) 31 56.44 66.17 4 12.90
10095. Rowan (spindlecreek) 31 66.82 80.48 5 16.13
10096. gixxer (somewhat_noob) 31 74.93 89.03 5 16.13
10097. Catering (sneevy) 31 116.30 131.33 14 45.16
10098. sai (smuna13) 31 80.47 96.11 5 16.13
10099. slowAf (slow_af_dvorak) 31 87.95 113.67 6 19.35
10100. Sukanya (siriros) 31 31.44 40.28 2 6.45
10101. shuaib (shuaibabrar) 31 68.97 80.48 7 22.58
10102. Shanon (shadowyshadows) 31 148.71 179.84 24 77.42
10103. Andreas (sgtreent) 31 87.81 105.61 15 48.39
10104. sev (sev4tou) 31 58.85 66.58 7 22.58
10105. Binscuit (scoutzc) 31 70.51 83.82 8 25.81
10106. Sarang (sargfromind) 31 46.32 57.91 4 12.90
10107. Samit (samitkapoor) 31 77.69 97.04 8 25.81
10108. ShyKnee (samflysure) 31 58.81 67.96 3 9.68
10109. nanoray (saliciti) 31 94.02 116.20 11 35.48
10110. sadwipe (sadwipe) 31 79.80 91.18 7 22.58
10111. Rubber (rubberduckcolemak) 31 83.35 110.28 10 32.26
10112. Raul (rromer41) 31 58.41 71.35 0 0.00
10113. Roy (royroyking) 31 89.89 113.16 10 32.26
10114. Rikka (rikka_takanashi) 31 123.04 152.90 18 58.06
10115. Rhevan (rhevan) 31 53.22 61.49 10 32.26
10116. Reyque (reyquexd) 31 107.93 129.88 10 32.26
10117. Raul (raule_maule) 31 69.52 83.88 7 22.58
10118. Raj (raj__) 31 88.12 106.16 10 32.26
10119. Rad (radandrei) 31 99.77 110.83 19 61.29
10120. prasanjith (prasanjith) 31 61.64 73.03 3 9.68
10121. Ivan (pop5a) 31 90.77 113.99 10 32.26
10122. perm (perm_typeracer) 31 62.34 72.55 3 9.68
10123. Paul (paulg2k_csgo) 31 73.53 87.80 7 22.58
10124. Geetansh (pandaculture) 31 74.25 87.42 5 16.13
10125. OMGnesststats[omgness321] (... 31 69.92 88.99 7 22.58
10126. Mudit (n___) 31 68.19 79.50 8 25.81
10127. Nyp3r (nyp3r) 31 59.96 70.85 3 9.68
10128. NoNo (nonoesimposible) 31 110.07 126.26 15 48.39
10129. nitrosquid (nitrosquid) 31 96.52 126.27 10 32.26
10130. nagz (naxumi) 31 82.96 113.98 10 32.26
10131. mustard maiden (mustardmaiden) 31 115.69 135.64 16 51.61
10132. Mukhametkali (mr_koten) 31 31.14 39.45 8 25.81
10133. Mesotelioma (mesotelioma) 31 92.08 107.17 13 41.94
10134. Max (max_6058) 31 82.06 95.36 10 32.26
10135. Markus (markustelser) 31 76.50 87.84 14 45.16
10136. Mads (madsbv) 31 95.95 112.66 15 48.39
10137. Max (madmax89) 31 81.42 90.96 6 19.35
10138. Luthfi (luthfiidrus1612) 31 68.50 78.85 10 32.26
10139. June (lumierevi) 31 84.04 98.72 9 29.03
10140. lotok (lotok_14) 31 86.52 108.30 8 25.81
10141. Bob Gnarly (lobmys) 31 76.93 97.01 10 32.26
10142. LittleYun (littleyun) 31 72.96 91.74 8 25.81
10143. N (lin_snarp) 31 45.93 60.44 3 9.68
10144. Chicony osu! (leva_russian) 31 85.99 98.85 11 35.48
10145. LeTwash (letwash) 31 73.51 92.03 9 29.03
10146. Lasped (lasped) 31 91.43 109.67 7 22.58
10147. Ram (laiforever) 31 46.67 55.48 3 9.68
10148. Jacob (labotski) 31 65.89 79.97 5 16.13
10149. Benjamin (kullaaaa) 31 72.16 84.44 8 25.81
10150. nitram (kros9987) 31 62.93 74.77 4 12.90
10151. Kowalski (kowalski_) 31 109.59 129.52 15 48.39
10152. Mayumi (kogl_mieko) 31 68.56 84.33 4 12.90
10153. Kevin (kidview) 31 68.44 86.43 1 3.23
10154. Kunihiko (keuno) 31 62.72 72.90 7 22.58
10155. Ma (kenma262) 31 88.46 101.82 9 29.03
10156. Jweel (jweel_kar) 31 46.14 55.89 4 12.90
10157. Jason (jwangbang) 31 82.76 95.45 8 25.81
10158. just_tito (just_tito) 31 33.10 41.84 1 3.23
10159. Mattis (juicedrabbit) 31 77.43 94.02 9 29.03
10160. Jonathan (jonathan081) 31 95.75 117.04 12 38.71
10161. Jet (jetwinjo) 31 54.03 62.24 4 12.90
10162. javonte (javonteslow) 31 118.15 153.82 22 70.97
10163. jam (jamhill) 31 61.29 72.31 5 16.13
10164. J (jairo_113) 31 57.02 69.78 11 35.48
10165. ix4l (ix4l19) 31 68.79 79.13 8 25.81
10166. Rahul (itzrall) 31 64.86 85.59 8 25.81
10167. itypeabove130only (itypeabo... 31 134.05 157.89 19 61.29
10168. John (imsoepic) 31 96.33 109.62 10 32.26
10169. A. Moe Gus (iltg) 31 75.34 90.82 10 32.26
10170. HxntedRex (hxntedrex) 31 95.21 108.24 11 35.48
10171. Howard (howardpx2016) 31 108.04 123.93 9 29.03
10172. not (hayso) 31 110.89 130.44 15 48.39
10173. nahte (hawkzle) 31 46.78 61.20 6 19.35
10174. hamin (hamin) 31 102.80 129.19 16 51.61
10175. Hagen (hag3nl) 31 63.06 70.23 8 25.81
10176. wolff (gwolff) 31 151.40 175.67 25 80.65
10177. Gourango (gsrajeni) 31 66.92 83.64 6 19.35
10178. gre (gregoryrogel) 31 59.32 72.30 5 16.13
10179. augh (goodmint) 31 81.00 101.90 9 29.03
10180. dog (ginasmocha) 31 82.35 118.51 11 35.48
10181. Nicholas (gigamammothtyper123) 31 57.35 75.42 3 9.68
10182. Huy (giahuy7753) 31 67.89 82.99 5 16.13
10183. HUONO (gghuono) 31 83.70 95.90 13 41.94
10184. Spartan Warrior (gerogeka1111) 31 72.24 91.01 7 22.58
10185. Gautam (gbasak) 31 52.35 60.03 0 0.00
10186. bashar (fuddle_) 31 40.18 53.64 2 6.45
10187. Faiq Ayubi (froxt) 31 60.54 91.50 8 25.81
10188. Flying (flyingdemon) 31 50.88 67.32 6 19.35
10189. fathima (fathimaa) 31 46.92 58.17 2 6.45
10190. Erik (ezhou21) 31 94.09 116.92 13 41.94
10191. neo (eliteneo) 31 92.92 110.74 7 22.58
10192. Leif (electricronny) 31 109.64 127.83 16 51.61
10193. paul (dunzo18) 31 69.12 95.05 5 16.13
10194. Isaac (dolemitesundae) 31 88.50 109.05 7 22.58
10195. Thai (despotron) 31 95.92 115.01 7 22.58
10196. Daniel (dasno) 31 67.83 78.14 4 12.90
10197. Pascal (darm4n) 31 92.18 106.22 8 25.81
10198. Mad_Dog (darkus_dragonoid) 31 83.05 94.86 11 35.48
10199. . (darkis) 31 112.39 144.41 21 67.74
10200. Cramp (crampdg) 31 111.13 130.71 16 51.61
10201. Conor (conorwalsh1601) 31 63.68 82.96 8 25.81
10202. Chris (chris_9001) 31 87.13 107.14 19 61.29
10203. ChivalKnight (chivalknight) 31 75.32 88.79 8 25.81
10204. chillresident (chillresident) 31 95.76 109.58 8 25.81
10205. Ben (chewy_bran) 31 76.59 91.69 7 22.58
10206. Catrinet (catrinet) 31 35.90 41.85 0 0.00
10207. Schuyler (captainsky03) 31 109.90 131.60 15 48.39
10208. Bertalan (brtln) 31 69.74 86.79 15 48.39
10209. Steven (boomkat) 31 88.12 113.59 9 29.03
10210. Tom (bobtom8482) 31 86.73 109.19 12 38.71
10211. Paul (bisente006) 31 53.41 69.77 10 32.26
10212. Binamra (binamra) 31 64.89 91.97 6 19.35
10213. C (bigcdub) 31 60.82 79.98 9 29.03
10214. bader (bhilal) 31 36.62 45.93 2 6.45
10215. Bhaskar (bhaskar942) 31 59.11 73.79 3 9.68
10216. Brendan (bfay) 31 97.06 119.12 10 32.26
10217. Roberto (bertdog1995) 31 93.36 105.15 9 29.03
10218. BeastBoy (beastboykadil) 31 49.25 61.30 2 6.45
10219. Avrick (avmend) 31 73.34 91.73 11 35.48
10220. laundromatt (austen_washer) 31 90.65 116.11 12 38.71
10221. Renato (ato2000) 31 89.83 106.89 10 32.26
10222. Bruno (armitageb) 31 108.22 132.01 14 45.16
10223. No Mistakes (apsnacks) 31 92.86 114.27 7 22.58
10224. Gio (apex_shrimp) 31 71.81 80.33 6 19.35
10225. Anton (antonium) 31 77.70 102.65 12 38.71
10226. AnniK (anni_k) 31 90.77 111.53 13 41.94
10227. Amit (amitsetty) 31 125.04 144.79 11 35.48
10228. alyssa (alyyyssa) 31 98.07 113.14 9 29.03
10229. Alex (alexyoung) 31 78.30 95.77 4 12.90
10230. Andrew (ajw5196) 31 57.92 77.89 5 16.13
10231. Alasdair (aisaem) 31 106.23 121.14 15 48.39
10232. AgentGarbo (agentgarbo) 31 74.72 93.62 7 22.58
10233. Aditya (aditya_2703) 31 68.76 83.45 3 9.68
10234. abdullah (abdullah1233) 31 58.28 72.10 7 22.58
10235. Abhishek (abc_cs) 31 88.97 102.42 8 25.81
10236. ottar dio (aag3098) 31 61.25 71.52 4 12.90
10237. Igor (6eamed) 31 92.59 112.78 10 32.26
10238. 1980 (1980ops) 31 104.63 119.28 14 45.16
10239. Poul ib Uitsatikitseq (13fu... 31 33.27 44.34 1 3.23
10240. martiangnome (martiangnome) 31 71.90 78.62 8 25.81
10241. zainal (ali200276) 31 54.16 65.20 3 9.68
10242. Suwidiana (suwidhi) 31 70.54 90.76 12 38.71
10243. DolnaNaka (dolnanaka) 31 72.98 93.29 10 32.26
10244. Lost (lostviajero) 31 91.00 105.40 13 41.94
10245. Audrey (cow_rj1204) 31 49.96 83.86 9 29.03
10246. QWERTYsamuel (gottagofast1111) 31 49.98 58.90 3 9.68
10247. Julian (corpse13) 31 71.00 83.22 8 25.81
10248. screaM (scream_) 31 122.64 148.84 20 64.52
10249. Vanessa (vanoob) 31 54.25 66.40 5 16.13
10250. Yashaswe (yash_10) 31 76.54 94.44 11 35.48
10251. mgLover (mannyglover) 31 46.42 53.67 0 0.00
10252. Jacob (jacobdante) 31 68.66 79.12 7 22.58
10253. K (335469854) 31 109.02 129.18 16 51.61
10254. tbgracy (tbgracy) 31 68.43 80.21 2 6.45
10255. Aman (_aman_) 31 56.52 61.69 6 19.35
10256. Gumbers (gumborb) 31 57.18 67.93 3 9.68
10257. Starlitblond (melaniemc) 31 59.17 73.32 6 19.35
10258. Sourab (voyager7) 31 60.62 71.75 5 16.13
10259. cicerolb27 (cicerolb03) 31 99.20 120.72 18 58.06
10260. Jackson (deepfryinit) 31 95.98 127.14 8 25.81
10261. aurophoe (aurophoe) 31 90.63 109.16 11 35.48
10262. P-chan (pchan555) 31 66.19 89.44 6 19.35
10263. Olivia (livbanks) 31 67.75 83.51 10 32.26
10264. JackPlayZ31 (jackplayz31) 31 46.49 55.76 2 6.45
10265. samir (_samir) 30 83.75 107.13 25 83.33
10266. ArV (_arv_) 30 62.59 70.62 6 20.00
10267. Jacob (zoloto67) 30 96.95 111.58 12 40.00
10268. Hazique Mirza (ziquemirza) 30 50.67 59.09 1 3.33
10269. zeropollyvtuber (zeppi) 30 130.25 151.08 23 76.67
10270. Zear (zear5) 30 74.83 92.83 7 23.33
10271. Callum (yuihirasawa) 30 86.87 101.63 14 46.67
10272. sebi (ysebi) 30 62.95 73.01 6 20.00
10273. Yoongo (yoongo) 30 91.14 104.93 10 33.33
10274. Winson (wwang038) 30 89.70 107.27 15 50.00
10275. Arnold (wiktor172003) 30 83.19 99.28 6 20.00
10276. walid (walid1997) 30 77.74 90.60 8 26.67
10277. Derek (vonarxd) 30 90.39 98.97 6 20.00
10278. Mike (unforgotten) 30 108.35 134.75 17 56.67
10279. ayeitsme (ughg) 30 53.95 75.07 3 10.00
10280. Kameloc (twoddle2) 30 80.74 92.64 8 26.67
10281. Tops (tufeng) 30 68.83 84.90 10 33.33
10282. Translator (trnsltr) 30 95.79 112.72 12 40.00
10283. Pavel (trialtry) 30 76.87 88.17 12 40.00
10284. Aidan (trabpukcip) 30 108.04 129.04 16 53.33
10285. Tina (tprentis22) 30 61.58 70.91 4 13.33
10286. Anthony (tonymontaro) 30 74.77 84.87 5 16.67
10287. Toasted (toasted_) 30 71.91 84.30 8 26.67
10288. tnn21 (tnn21) 30 105.67 140.90 8 26.67
10289. thundr (thundr001) 30 43.71 54.01 1 3.33
10290. Theo (the_o_choked) 30 78.91 92.61 7 23.33
10291. notorioustype (thenotorious... 30 49.61 57.62 3 10.00
10292. Johan (thehutt) 30 70.72 81.34 19 63.33
10293. tesseract (tesseract1996) 30 56.48 70.51 4 13.33
10294. Ethan (terean) 30 113.21 126.72 18 60.00
10295. syz (syzzzzzzz) 30 62.29 78.08 3 10.00
10296. SWAPNIL (swapnil326) 30 81.50 94.58 12 40.00
10297. Isak (stitchy_) 30 62.73 83.31 10 33.33
10298. Starry (starsky123) 30 92.88 111.53 13 43.33
10299. Griffin (speedyboi4506) 30 101.55 129.61 14 46.67
10300. SOBO (sobo) 30 76.58 88.18 6 20.00
10301. lol (sngtx) 30 81.81 103.50 8 26.67
10302. Cassi (slowerthanmolasses) 30 59.47 73.09 4 13.33
10303. Avery (skipperbud) 30 73.43 86.16 7 23.33
10304. Josh (shrekker) 30 119.95 141.48 13 43.33
10305. sho (shoshosho1) 30 59.93 75.22 10 33.33
10306. JS (shadyshadez) 30 104.34 122.15 14 46.67
10307. Sergej (segi) 30 65.89 88.13 2 6.67
10308. x (sealnot123) 30 81.65 97.84 9 30.00
10309. Sashaw (sashaww) 30 90.43 111.33 9 30.00
10310. SiD (samueldim) 30 89.94 102.12 13 43.33
10311. Ryan (ryan3760) 30 54.26 67.48 3 10.00
10312. rum3r (rum3r) 30 69.04 78.75 6 20.00
10313. Riser (riser1) 30 60.77 74.61 8 26.67
10314. riggers (riggers) 30 62.85 81.35 6 20.00
10315. revoosh (revoosh) 30 103.80 119.42 14 46.67
10316. Rassulkhair (rassulkhair) 30 54.81 64.62 4 13.33
10317. Sapphic Llama (rare_taco) 30 51.24 68.84 2 6.67
10318. Rankoll (rankoll) 30 75.66 86.90 10 33.33
10319. RadAlienware (rad_alienware) 30 65.86 79.53 6 20.00
10320. Rich (r1hh) 30 87.19 108.99 10 33.33
10321. IwasFASTonQWERTYnowIuseDVOR... 30 78.27 95.51 7 23.33
10322. ben (prizmoasd) 30 96.10 112.97 8 26.67
10323. Caleb (prismiasma) 30 112.65 128.97 11 36.67
10324. Jakub (prism1349) 30 68.06 81.64 4 13.33
10325. Pointyepic (pointyepic) 30 97.55 118.78 13 43.33
10326. MiazMe (pmax) 30 85.57 102.28 9 30.00
10327. Jesse (pinec0ne) 30 82.55 94.40 8 26.67
10328. Petter (ph140) 30 82.44 108.59 13 43.33
10329. pewpewdevildog (pewpewdevil... 30 80.98 92.13 7 23.33
10330. Peter (petermc2007) 30 94.94 109.55 15 50.00
10331. fan de Iknash (pedrou) 30 113.19 139.72 15 50.00
10332. Patrick (patclark) 30 91.23 101.92 11 36.67
10333. Rodrigo (pacha2880) 30 71.12 81.85 7 23.33
10334. Piyush (p1yu5h) 30 59.38 67.88 7 23.33
10335. OwenF (owenf) 30 46.64 72.39 0 0.00
10336. Oliver (oviewill) 30 66.63 75.87 6 20.00
10337. Nox (nymanne) 30 99.52 117.69 16 53.33
10338. nother (nother) 30 54.95 66.47 6 20.00
10339. B (nonemorenegative) 30 100.86 144.79 12 40.00
10340. Sochi (noizi) 30 74.61 94.52 6 20.00
10341. DaddyChill (nightynine) 30 54.43 68.67 2 6.67
10342. Nicholas (nemath) 30 87.27 106.65 10 33.33
10343. Nelvin (nelvin27) 30 89.48 109.67 9 30.00
10344. Piyabuht (nekktheredsand) 30 72.83 90.63 8 26.67
10345. Naitik (naitik_lisa) 30 39.95 48.93 2 6.67
10346. muzakh (muzakkiha) 30 87.52 104.02 6 20.00
10347. Muhammad Musharaf (musharaf35) 30 59.36 74.04 8 26.67
10348. Murfy (murfychia) 30 70.17 81.58 11 36.67
10349. Aman (multiversal_aspirator) 30 64.91 70.77 6 20.00
10350. MtDewaholic (mtdewaholic) 30 103.85 123.99 8 26.67
10351. Mr (mrmindgames) 30 91.61 109.83 25 83.33
10352. MJ (mj_02) 30 93.53 107.60 15 50.00
10353. Mich (michdaevinci) 30 74.36 93.16 7 23.33
10354. Mohamad (mhmd_khlf) 30 87.44 95.75 5 16.67
10355. merlot (merlotsuma) 30 43.68 54.50 3 10.00
10356. Mayur S (mayur_chirttaragi) 30 60.57 72.35 4 13.33
10357. mike (maykqwe) 30 93.95 114.04 11 36.67
10358. stay fresh cheese bags (maw... 30 137.38 157.12 22 73.33
10359. King (maichen777) 30 88.64 100.11 8 26.67
10360. qwerty (longhongc) 30 80.92 94.76 6 20.00
10361. Lokinoha (lokinoha) 30 73.79 85.08 3 10.00
10362. Ivan (ljakpa) 30 95.32 104.93 10 33.33
10363. Pengu (lilpengu) 30 83.88 100.25 10 33.33
10364. chetty (lilchetty_x3) 30 86.18 95.87 11 36.67
10365. E (le_chonks) 30 82.25 102.79 21 70.00
10366. Letter (letterofpower) 30 80.73 100.93 1 3.33
10367. slow_racer (left_arm_chinaman) 30 57.46 66.57 2 6.67
10368. Leah (leahlovesjisung) 30 80.82 93.79 13 43.33
10369. khlaid (kmaf) 30 63.25 84.38 6 20.00
10370. Krish (kkrish100) 30 78.94 101.73 7 23.33
10371. kimhong01 (kimmong) 30 74.61 82.27 7 23.33
10372. Damyian (kight) 30 97.25 126.33 11 36.67
10373. Kaimetsu (kaimetsu) 30 98.88 127.08 11 36.67
10374. Ansar (kabdik) 30 35.72 43.17 2 6.67
10375. Juicedit (juicedit) 30 102.09 127.72 10 33.33
10376. Me (juicedcows) 30 93.78 117.64 5 16.67
10377. Juantonomoe (juantonomoe) 30 115.30 131.74 18 60.00
10378. John (johncha15724) 30 95.83 110.30 10 33.33
10379. Joe (joemamma121) 30 68.78 85.35 10 33.33
10380. Jacob (jkhindo64) 30 92.52 109.54 8 26.67
10381. cody (jiji247) 30 145.81 163.33 23 76.67
10382. Jasmine (jasmine5752) 30 54.43 62.52 5 16.67
10383. Ivan (ivanplaystr) 30 105.69 116.85 16 53.33
10384. Ivan (ivanh922114) 30 64.80 76.01 7 23.33
10385. Khaled (itskhaled) 30 39.70 58.31 2 6.67
10386. Joshua (insanelol) 30 83.44 99.02 9 30.00
10387. Im Hacker (im_hacker) 30 100.05 117.55 16 53.33
10388. Dana (icantthinkofausername) 30 117.19 135.51 20 66.67
10389. Mason (hyojin2k) 30 98.91 112.01 13 43.33
10390. namdo (huynhnamdo96) 30 66.16 74.23 4 13.33
10391. Hot Cross Puns (hot_cross_p... 30 97.86 112.31 29 96.67
10392. James (horjamez) 30 63.93 76.14 7 23.33
10393. Henrique (hnrqe) 30 98.69 150.82 12 40.00
10394. Richard (heferous) 30 57.35 78.52 3 10.00
10395. Hamang (hamangpincong) 30 50.05 60.76 5 16.67
10396. Alicja (gymnast2008) 30 50.88 62.59 3 10.00
10397. Guber (guberxz) 30 62.43 73.55 9 30.00
10398. Gnany (gnanyadapa) 30 48.77 65.93 5 16.67
10399. Jack (giglioroninomicon) 30 103.88 126.94 10 33.33
10400. Garamonde (garamonde) 30 75.21 90.51 10 33.33
10401. Ickooo (gamerchancer) 30 82.41 96.04 8 26.67
10402. Jakub (f_ckshit) 30 69.18 80.81 11 36.67
10403. Clay Cain (fredrafferty) 30 45.26 55.43 2 6.67
10404. jonas (frallan34) 30 61.45 76.37 8 26.67
10405. Fly1nthe5ky (fly1nthe5ky) 30 85.23 100.80 9 30.00
10406. Floopy (floopy__) 30 100.89 122.19 16 53.33
10407. monster (flamewarz) 30 74.06 94.11 11 36.67
10408. Joe (fireflygrave) 30 82.66 105.98 5 16.67
10409. Kauã (fernandes10) 30 72.60 86.93 9 30.00
10410. myth (fear_ed) 30 118.48 135.71 22 73.33
10411. Anton (fantoniko) 30 52.43 56.30 1 3.33
10412. Marcus (evanitez) 30 120.04 143.45 15 50.00
10413. Eugene (eugeneteoh) 30 96.15 122.21 12 40.00
10414. Ethan (etwa) 30 98.27 115.34 16 53.33
10415. E. (esheby) 30 62.51 72.56 5 16.67
10416. Steven (engine210) 30 76.04 91.14 8 26.67
10417. neo (eliteneo_dvo) 30 87.49 101.05 8 26.67
10418. Franzvic (elbruh) 30 90.91 117.93 9 30.00
10419. aokepoke (dweepers) 30 92.70 112.60 7 23.33
10420. Andrew (dodapotato) 30 44.22 58.53 2 6.67
10421. Dizzi (dizzitypes) 30 93.80 116.00 8 26.67
10422. didi (didi_pot) 30 69.83 81.25 7 23.33
10423. nah (determination_) 30 114.42 136.75 14 46.67
10424. Jeremy (definee) 30 86.80 104.16 5 16.67
10425. Shan (debayon4545) 30 104.14 139.38 16 53.33
10426. Vihas (datlightning) 30 82.83 102.74 8 26.67
10427. Siddharth (darksun27) 30 55.04 65.57 6 20.00
10428. daniel (danfinch07) 30 44.44 52.86 4 13.33
10429. Daniel (daknk) 30 56.82 65.72 6 20.00
10430. weird keyboard (cyphex) 30 100.95 118.61 9 30.00
10431. Sashreek (cygnus206) 30 75.89 94.27 11 36.67
10432. Liny (counting_star) 30 64.90 79.23 7 23.33
10433. Norman (codificat) 30 80.07 92.63 10 33.33
10434. YZZUB (chuang010896) 30 84.23 103.25 10 33.33
10435. 1myvar (chowchunfu) 30 104.31 121.99 15 50.00
10436. Chad (chadkorrea) 30 56.38 68.64 5 16.67
10437. |)are2|_eap (cepetir) 30 90.85 109.02 7 23.33
10438. cagdas (cagirtas) 30 64.45 74.85 8 26.67
10439. Brian (brian3927) 30 95.84 118.26 11 36.67
10440. bq666 (bq666) 30 66.79 88.30 6 20.00
10441. bp4dn (bp4dn) 30 100.22 121.91 11 36.67
10442. bongking (bongking) 30 87.78 115.56 8 26.67
10443. Bodie (bodejazz) 30 84.86 98.14 10 33.33
10444. BobdeThird (bobdethird) 30 95.83 136.53 12 40.00
10445. Blue (blue03yt) 30 74.44 102.28 14 46.67
10446. BlazeAries (blaze_aries) 30 75.13 87.61 8 26.67
10447. Ben (benthenoob961) 30 64.62 89.04 6 20.00
10448. plusultratyper (bellpepper) 30 61.20 82.46 6 20.00
10449. Peter (beepseeker) 30 110.35 142.20 14 46.67
10450. be4r (be4r_) 30 63.11 71.10 3 10.00
10451. avisheek (avisheek) 30 46.30 84.29 1 3.33
10452. Asmus (asmus__) 30 59.17 75.14 6 20.00
10453. Ásþór (asibasi) 30 80.50 97.65 8 26.67
10454. Charles (armdev) 30 79.68 96.91 14 46.67
10455. Arif (areyf) 30 49.92 60.02 6 20.00
10456. Ayon (apaul23) 30 107.81 124.59 14 46.67
10457. angry (angryfingers) 30 65.65 76.93 8 26.67
10458. Alyan (alyanm) 30 114.36 135.84 5 16.67
10459. Alvin (alwin630) 30 96.69 116.00 11 36.67
10460. Alex (alexlizx) 30 82.54 98.45 6 20.00
10461. Axolotl (aj0l0tl) 30 69.83 79.56 3 10.00
10462. Afiq (afiqapon91) 30 52.38 64.89 2 6.67
10463. Adres (adres) 30 53.12 62.32 4 13.33
10464. sigma (adelshehadeh) 30 64.69 79.48 5 16.67
10465. Aaron (aaronfrdumb) 30 60.07 74.98 8 26.67
10466. Lars (aaberg) 30 87.20 100.60 5 16.67
10467. Bot (348866896) 30 92.61 114.57 8 26.67
10468. 2E13 (1d14) 30 69.76 83.87 13 43.33
10469. 1776 (17_abe_76) 30 56.03 71.86 4 13.33
10470. 10time (10time) 30 38.53 58.21 5 16.67
10471. 0hyeah (0hyeah) 30 55.01 67.44 4 13.33
10472. Joshua (josheems) 30 85.83 110.11 8 26.67
10473. Sup (harry_kane) 30 50.83 60.65 4 13.33
10474. big fudge (bigfudge84) 30 44.45 59.07 4 13.33
10475. Arvi (arvi4321) 30 91.04 117.07 13 43.33
10476. Yousuf (khanyousuf) 30 59.05 69.15 7 23.33
10477. Parnika:) (parnika) 30 58.53 68.58 4 13.33
10478. Magi (magi_dragon) 30 86.68 105.44 9 30.00
10479. Dalton Machart (dzmachart25) 30 56.19 71.97 4 13.33
10480. Blue (blue03) 30 74.44 102.28 14 46.67
10481. Anjani (aryastark91) 30 93.78 107.97 8 26.67
10482. Vincent (vincent16th) 30 51.30 61.45 7 23.33
10483. will (ballsinjaws) 30 71.18 84.57 5 16.67
10484. taco (tacoooooo) 30 73.11 85.12 5 16.67
10485. Tommy (jymmot) 30 109.40 125.92 18 60.00
10486. haskdfa (asdfbaewf) 30 93.03 110.71 14 46.67
10487. P (guest2911) 30 63.92 90.50 7 23.33
10488. Colin (legeometry) 30 133.89 156.52 27 90.00
10489. dave (shalomski) 30 40.35 48.64 1 3.33
10490. Ahmed (skaly) 30 44.87 55.49 19 63.33
10491. Aidan (a_danroos) 30 68.65 83.68 9 30.00
10492. qwerty (spellboundmage) 30 94.11 114.70 18 60.00
10493. Gamewatchable (gamewatchable) 30 99.84 129.03 16 53.33
10494. shubham (sk_07) 30 33.22 40.83 1 3.33
10495. Sazs (sazs_) 30 57.31 65.28 17 56.67
10496. jeremy (tunefullcobra) 30 56.30 67.57 7 23.33
10497. Guian Cyrus (guiancyrus14) 30 63.44 80.02 7 23.33
10498. XDloco (xdloco) 30 71.21 82.89 15 50.00
10499. Jhairus (jhairus) 30 61.43 73.71 6 20.00
10500. sunil (sunil01) 30 28.26 36.17 4 13.33
10501. gerleva (_mr_e_) 29 65.95 74.99 5 17.24
10502. fastest (_fastest_typist) 29 75.48 96.56 11 37.93
10503. Z-Dvorak (zzdarke) 29 71.87 91.63 8 27.59
10504. zhem_ (zhem) 29 107.52 130.10 14 48.28
10505. Zharfan (zharfanadli) 29 94.03 113.62 16 55.17
10506. Zeryx (zeryx_typing) 29 72.83 83.07 5 17.24
10507. zei (zeizuta) 29 28.27 34.59 7 24.14
10508. Zakaria (zackzack1224) 29 82.35 98.31 11 37.93
10509. Sam (yaboisam_) 29 88.83 108.16 11 37.93
10510. Luna (xluna420) 29 81.38 95.01 17 58.62
10511. Andrew (wongsifu) 29 83.61 99.08 16 55.17
10512. Kelvin - Colemak (winlost) 29 108.44 122.12 14 48.28
10513. William (willteee) 29 99.74 123.77 8 27.59
10514. Jared (willetsjared) 29 73.42 90.09 7 24.14
10515. WhiteRose (whiter9se) 29 37.83 45.97 0 0.00
10516. David (wdnch) 29 76.75 91.79 9 31.03
10517. W (wbhizzle7) 29 100.71 122.04 6 20.69
10518. ( ͡° ͜ʖ ͡°) (warrine... 29 61.23 78.26 5 17.24
10519. VSF (vsf123) 29 28.36 34.47 5 17.24
10520. Victor (victorm900) 29 71.20 79.01 4 13.79
10521. Vaibhav (vibhix) 29 75.17 90.60 6 20.69
10522. Nick (vergil_00) 29 75.23 93.45 11 37.93
10523. Lucas (veraluc) 29 96.99 119.25 8 27.59
10524. Jacob (vanosgaming2014) 29 118.97 138.04 17 58.62
10525. Yupa (valleyofthewin) 29 72.08 80.06 2 6.90
10526. Umalis (umali) 29 54.85 66.59 7 24.14
10527. Fealing (typistboy) 29 88.11 104.98 6 20.69
10528. Twistees (twisteesboy) 29 79.63 98.98 15 51.72
10529. It's me! (tuppence) 29 65.31 84.15 7 24.14
10530. Justin (trudeaucooks) 29 138.37 195.76 22 75.86
10531. Troy (troydaigneau) 29 94.96 118.90 5 17.24
10532. Zkye (trestiel) 29 72.24 93.09 9 31.03
10533. Roo (trepur349) 29 100.82 123.97 11 37.93
10534. cody (tkdanimal) 29 70.15 83.74 5 17.24
10535. Majid (thetypingnerd852) 29 36.59 48.39 4 13.79
10536. swooshmcgoosh (swooshmcgoosh) 29 107.82 133.38 14 48.28
10537. owen (sushisynth12) 29 83.43 102.45 5 17.24
10538. Bertie (sunstonesharptor) 29 70.38 84.29 0 0.00
10539. Eric (sumtypaway) 29 63.32 84.41 6 20.69
10540. Suhas (suhoos) 29 103.68 125.67 16 55.17
10541. gae (subtoentaloop) 29 77.92 99.76 7 24.14
10542. stash (stash_) 29 43.16 53.76 2 6.90
10543. Teddy (stargazingteddy) 29 53.16 63.88 4 13.79
10544. tstats[sspaghettii] (sspagh... 29 92.74 108.16 9 31.03
10545. Austin (splashtime) 29 97.36 109.88 14 48.28
10546. grammy (spicybbqsauce) 29 64.64 78.51 4 13.79
10547. Pinkies (smile_typer) 29 100.43 115.66 15 51.72
10548. Regan (smalltymehero) 29 63.14 73.04 5 17.24
10549. skepsi87 (skepsi87) 29 45.16 58.23 5 17.24
10550. Priscilla (simplyscience) 29 121.78 150.53 23 79.31
10551. Silent G (silentgisback) 29 115.03 135.93 15 51.72
10552. ꧁🎧웃 ֆɨɖɖɦǟռȶ... 29 60.03 78.10 7 24.14
10553. Jhonnathan Ramirez (siaxais) 29 40.62 57.90 0 0.00
10554. yung (shwn) 29 122.29 148.27 17 58.62
10555. Sharath (sharathnirmala) 29 54.43 67.72 4 13.79
10556. shantanu (shantothegreat) 29 67.63 85.57 5 17.24
10557. o (seticl) 29 99.88 125.44 11 37.93
10558. seer23 (seer23) 29 77.05 91.69 21 72.41
10559. Namoonia (sasti_chars) 29 61.54 81.66 4 13.79
10560. Brendyy (sabtooth) 29 126.39 141.21 18 62.07
10561. Ryan (rya02) 29 61.97 77.57 7 24.14
10562. Karl (refllexz) 29 80.67 96.08 7 24.14
10563. Niklas (reeklas) 29 54.85 60.60 21 72.41
10564. Ray (ray1829) 29 114.37 144.37 18 62.07
10565. Rainbow (rainbowdudebh) 29 125.39 157.75 19 65.52
10566. Gnomeツ (raging_gnome) 29 110.72 142.00 14 48.28
10567. Romeo (r0mpan) 29 42.89 51.68 10 34.48
10568. Praise (praisehim) 29 115.05 130.41 11 37.93
10569. Peter (pklly) 29 60.39 78.07 5 17.24
10570. Pinoy (pinoytypist01) 29 83.32 99.34 3 10.34
10571. PingingCarrot16 (pingingcar... 29 67.29 89.20 7 24.14
10572. Pina (pina_pog) 29 125.50 156.11 23 79.31
10573. Pere_Gil (pere_gil) 29 77.26 89.26 3 10.34
10574. Savannah (peaches39) 29 70.82 85.20 8 27.59
10575. Chee (pcheekz) 29 50.12 67.30 7 24.14
10576. Patrick (patbl) 29 87.20 108.40 14 48.28
10577. ThePastor (pastor3974) 29 63.59 89.87 5 17.24
10578. Paracoax (paracoax) 29 106.39 128.42 13 44.83
10579. Thomas (nunu464) 29 60.48 74.57 9 31.03
10580. THE KID (nschattner) 29 94.91 118.90 10 34.48
10581. Novades (novades) 29 69.51 86.45 9 31.03
10582. ℮ (nicepal) 29 137.30 155.75 22 75.86
10583. Esmeralda (niccon) 29 83.07 97.44 5 17.24
10584. Neske (neske) 29 98.48 124.67 14 48.28
10585. (nenontank_) 29 90.05 135.08 10 34.48
10586. Nalahatra (nalahatra) 29 47.90 67.43 2 6.90
10587. Mustafa (musthelegend) 29 90.93 106.47 7 24.14
10588. MoresVance (moresvance) 29 102.82 125.22 15 51.72
10589. Bijay (moneybijay) 29 93.12 112.76 11 37.93
10590. lucas (moisturisingcream) 29 66.09 77.83 7 24.14
10591. Georgi (mitevw) 29 32.58 41.20 1 3.45
10592. Milky (milkxy) 29 96.83 115.09 19 65.52
10593. Munkhsuld (mbior) 29 74.13 82.99 8 27.59
10594. Mark (mariktypes) 29 117.56 141.94 16 55.17
10595. m3d (m3dsh) 29 74.66 91.81 10 34.48
10596. Lyons (lyoons) 29 121.07 150.05 24 82.76
10597. Lush (lush_krom) 29 98.15 111.25 15 51.72
10598. smino (lucskosur420) 29 61.86 78.26 5 17.24
10599. Machine (longshort) 29 58.23 75.27 6 20.69
10600. Nate (lobdog) 29 84.66 106.23 8 27.59
10601. Lil (lil_wymn20) 29 38.90 46.32 3 10.34
10602. LadaSedan (ladasedan) 29 83.61 94.63 3 10.34
10603. Angel (kyngbui) 29 114.91 149.41 15 51.72
10604. kyletsetse (kyletsetse) 29 126.40 150.80 26 89.66
10605. kottt (kweent182) 29 97.72 107.92 9 31.03
10606. Kamiltoni (ktonig1221) 29 33.07 52.81 3 10.34
10607. E (knight250) 29 70.20 83.28 27 93.10
10608. Rae (kmacc) 29 51.08 67.51 2 6.90
10609. Kevin (kevinmeseeyou) 29 102.31 114.28 9 31.03
10610. kenneth (kenneth29) 29 65.34 77.45 3 10.34
10611. Nektarios (kapiras) 29 37.41 50.06 2 6.90
10612. Md Ziaur Rahman (juall) 29 39.92 52.35 2 6.90
10613. Jacob (jsmith182) 29 89.34 102.31 14 48.28
10614. Joshua (joshnah) 29 86.06 105.44 11 37.93
10615. Joshua (joshbenja) 29 97.33 110.35 9 31.03
10616. Jayuke (jontrask) 29 102.10 125.30 13 44.83
10617. Jokrr (jokrr7) 29 77.10 88.67 10 34.48
10618. JC (joker801) 29 44.46 49.46 2 6.90
10619. Jerod (jeroddddd) 29 109.54 129.55 14 48.28
10620. Jeev (jeevjoel) 29 70.26 92.63 7 24.14
10621. Jeemin (jeemini) 29 101.64 124.15 13 44.83
10622. Jayden (jayballr) 29 81.88 102.68 7 24.14
10623. Jacques (jacquesp) 29 85.95 104.94 3 10.34
10624. Jackelton (jackelton) 29 93.27 112.13 10 34.48
10625. tstats[jaadunath] (jaadunath) 29 74.84 90.85 8 27.59
10626. IamUrs (i_am_urs) 29 82.03 102.77 5 17.24
10627. imi (imitavor) 29 55.81 68.16 2 6.90
10628. Jeon (idnyhn) 29 94.31 117.29 12 41.38
10629. hyeonk (hyeonk) 29 99.56 122.70 12 41.38
10630. Hridoy (hridoymahmud71) 29 40.79 46.96 2 6.90
10631. Raheeb (hoenchioma) 29 57.57 71.02 2 6.90
10632. Wixxers (heyitswixx) 29 62.08 80.05 13 44.83
10633. dsc.gg/uk-train (hellomynam... 29 63.75 82.58 19 65.52
10634. haaa (h505) 29 73.73 84.84 7 24.14
10635. GMHazem (gm_hazem02) 29 72.90 90.73 5 17.24
10636. CheetahDude (ghysdd) 29 96.15 115.88 11 37.93
10637. Dum (getintherobotshinji) 29 99.55 118.62 17 58.62
10638. George (gecovin) 29 96.90 118.65 11 37.93
10639. Kowala Bear (gaverpro) 29 141.83 168.60 20 68.97
10640. loiyus (fuzxy) 29 101.53 121.95 10 34.48
10641. mrooogaboooga (foulackfoula... 29 90.90 114.56 4 13.79
10642. Mavis (firkinmugs) 29 72.22 83.97 9 31.03
10643. Henk (fattieruns) 29 74.33 86.55 8 27.59
10644. tstats[faiz_legend] (faiz_l... 29 71.60 94.41 6 20.69
10645. nootnoot (ezoid_nootnoot) 29 50.89 68.92 7 24.14
10646. vion (evions) 29 47.64 66.10 2 6.90
10647. Eder (edertyper) 29 88.13 103.04 10 34.48
10648. Ora Ora (eddyyang2003) 29 102.36 115.96 19 65.52
10649. Hektor (dr_sparkles) 29 60.15 75.88 14 48.28
10650. Zap (drdecember) 29 70.75 86.00 7 24.14
10651. Doven (doven) 29 85.36 104.01 13 44.83
10652. dev (devgiri0082) 29 66.03 76.84 0 0.00
10653. Deepak (deepakthegreat) 29 60.67 79.63 5 17.24
10654. david (davie04) 29 88.59 106.18 8 27.59
10655. davidbird764 (davidbird764) 29 106.74 125.03 13 44.83
10656. Ishmam Jarif Daula (daula507) 29 53.54 71.37 15 51.72
10657. Connor (ctw0611) 29 124.64 146.89 22 75.86
10658. Akashi (coppokim) 29 43.05 53.25 6 20.69
10659. CoolGuy (cool_guy5583) 29 72.16 85.76 12 41.38
10660. Kyjro (codertimeing) 29 66.98 85.09 6 20.69
10661. Cinari (cinari) 29 96.87 108.54 6 20.69
10662. Chris (chrisrapid) 29 50.54 57.17 5 17.24
10663. Chris (chrislh221) 29 91.33 103.66 13 44.83
10664. Chi (chiphan1993) 29 122.33 138.40 16 55.17
10665. CHIEN (chient) 29 101.29 112.36 10 34.48
10666. Cassidy (cassidyfaith) 29 90.36 129.61 12 41.38
10667. yanzhi (cakeuuuu) 29 78.40 91.18 10 34.48
10668. Ben (bv_nie) 29 87.57 112.42 8 27.59
10669. Brian (brianbanri) 29 90.98 107.98 11 37.93
10670. caden (breezynotcheezy) 29 65.98 92.27 11 37.93
10671. Brayden (braddin123) 29 94.97 114.42 11 37.93
10672. Bridget (boomsey) 29 99.48 124.37 13 44.83
10673. Suvhoraj (blazing_cuber) 29 50.49 67.66 3 10.34
10674. Bertra (bertraml) 29 81.70 93.04 8 27.59
10675. berkay (berkayyalin) 29 92.91 107.45 13 44.83
10676. Bennie (beneficial_bean) 29 71.56 89.70 9 31.03
10677. Dustin (belyea) 29 101.63 127.62 12 41.38
10678. Kaymart (barrix) 29 71.15 97.00 10 34.48
10679. Khesar (babywicker) 29 52.22 67.79 1 3.45
10680. Will (awesomeguy1427) 29 63.71 76.10 5 17.24
10681. Andy (avocadocream) 29 81.23 101.99 6 20.69
10682. Andrew (astrel) 29 107.15 123.81 10 34.48
10683. Aman (ashriv88) 29 80.26 104.84 8 27.59
10684. Apathy (apathyy) 29 87.88 103.90 8 27.59
10685. Anshit (anshitgrg) 29 51.73 68.42 3 10.34
10686. Bob (allanbarry) 29 71.56 81.63 12 41.38
10687. Cyber (alifarra) 29 72.61 91.83 11 37.93
10688. aldrigon (aldrigon) 29 93.68 120.66 18 62.07
10689. Andi (agraumann) 29 68.58 89.33 8 27.59
10690. AggieMet (aggiemet) 29 61.26 83.31 9 31.03
10691. 7amada (7amada) 29 80.80 91.86 6 20.69
10692. duy (69discombobulates) 29 61.93 72.52 12 41.38
10693. Edward (1934__) 29 89.36 116.03 12 41.38
10694. k (edhne) 29 60.40 74.07 7 24.14
10695. Lisbeth (l1sbeth_dam) 29 44.86 60.20 2 6.90
10696. Ambuj (ambujsingh) 29 56.29 68.48 6 20.69
10697. Littenator (littenator) 29 58.98 71.94 5 17.24
10698. Brur (brur) 29 62.94 77.10 8 27.59
10699. Jakub (jintax) 29 54.95 66.97 6 20.69
10700. ashley (ashleyyyuwu) 29 35.72 45.84 3 10.34
10701. Aries (notanaries) 29 93.22 108.28 13 44.83
10702. Mani (manissekhon) 29 58.05 73.85 18 62.07
10703. Caltos (caltos_virnam) 29 87.89 105.42 9 31.03
10704. kalki (draken_14) 29 52.60 60.68 7 24.14
10705. Ross Geller (ross191139) 29 58.15 66.55 5 17.24
10706. Levi (levi4th) 29 64.70 82.00 3 10.34
10707. Brock (fastmurphtype) 29 73.40 80.83 17 58.62
10708. Lucas (lucasthetypingmaster) 29 89.09 103.21 8 27.59
10709. R Worth (_crbn) 29 50.67 59.75 1 3.45
10710. VinnyZ (vinnyzed) 29 79.07 99.84 13 44.83
10711. Vincent (just_carbon) 29 72.43 83.82 5 17.24
10712. Jobenveer (jobenveer) 29 30.44 39.83 4 13.79
10713. Blizzard (_bl1zzard) 29 64.21 79.22 12 41.38
10714. Stacks (_stacksqueue2) 28 62.39 77.73 6 21.43
10715. Max (_maxkoo_) 28 61.43 67.11 4 14.29
10716. Lucky (_lucky__verma__) 28 21.62 30.50 5 17.86
10717. Jalex (_jalex) 28 49.17 59.33 1 3.57
10718. Asim (_asim_) 28 83.56 94.47 10 35.71
10719. nattapakon (zudiyeah) 28 25.82 33.03 1 3.57
10720. Justin (zexcel) 28 118.30 128.91 13 46.43
10721. Youri (yourischuur) 28 100.73 125.78 9 32.14
10722. yihuididi (yihuididi) 28 54.38 65.53 3 10.71
10723. Yexsys (yexsys) 28 76.23 105.00 6 21.43
10724. e2blu (yellowe2) 28 108.93 126.84 11 39.29
10725. ((: (yeeyeehehe) 28 117.94 135.53 13 46.43
10726. (xyztcube) 28 94.60 104.91 9 32.14
10727. xhqrry has two fingers (xhq... 28 68.18 78.08 8 28.57
10728. Edward (xarvus) 28 93.86 111.93 9 32.14
10729. John (wolman511) 28 110.58 133.39 12 42.86
10730. THE JEWELL (wildhorsesthe2nd) 28 103.05 137.92 15 53.57
10731. Wiktor (wicker6) 28 78.62 98.43 6 21.43
10732. will (whitedarko) 28 94.46 114.44 12 42.86
10733. Keyser (whereskeyser) 28 92.87 116.61 11 39.29
10734. George (wavy_shakespeare) 28 72.04 88.76 12 42.86
10735. tdsar (volterxien) 28 110.00 126.69 14 50.00
10736. Andrew (viper42usa) 28 92.18 101.89 6 21.43
10737. Vinesh (vineshdodiya) 28 50.89 58.39 3 10.71
10738. Vinay (vinaynani92) 28 82.53 98.85 11 39.29
10739. Josh (vaximus) 28 85.77 100.73 7 25.00
10740. vamsi (vamsivadrevu) 28 88.02 109.34 8 28.57
10741. vakilral (vakilral) 28 85.46 99.12 7 25.00
10742. Joshua (typing_huh1) 28 99.79 120.59 14 50.00
10743. Ryo (troublecuber) 28 80.66 93.66 3 10.71
10744. Andrew (trazer) 28 103.66 112.63 8 28.57
10745. Gary (traeyoung) 28 143.78 171.50 20 71.43
10746. Tokugawa (tokugawapants) 28 131.61 152.08 17 60.71
10747. Evan (toastypoints) 28 97.57 119.97 15 53.57
10748. Harry (tls278) 28 60.18 68.78 8 28.57
10749. Daniel (theyluvdaniell) 28 73.68 89.94 5 17.86
10750. ry (therylyndshow) 28 80.40 97.18 8 28.57
10751. Totus (thepenguin183) 28 91.30 117.94 11 39.29
10752. ༼ つ ◕_◕ ༽つ (the... 28 78.38 95.76 8 28.57
10753. Themi (themis3000) 28 59.76 68.45 5 17.86
10754. Duncan (thedunco) 28 90.11 104.30 9 32.14
10755. Ethan (thatonepear) 28 106.02 117.46 10 35.71
10756. telorbuzzu (telorbusu) 28 113.40 133.37 15 53.57
10757. Justin (tacder) 28 41.09 53.07 2 7.14
10758. Abdulhadi (surebeta) 28 58.85 68.04 3 10.71
10759. Sunbites (sunbites_4610) 28 81.38 102.48 15 53.57
10760. Benjamin (strangelyroblo) 28 74.27 91.81 7 25.00
10761. Spy (spy12150) 28 103.82 118.52 13 46.43
10762. Chris P. Bacon (spicy_toast) 28 88.28 104.95 11 39.29
10763. Be At Peace (spacepajamas) 28 89.03 100.56 11 39.29
10764. Smoke (smoke91) 28 86.52 102.11 6 21.43
10765. Sludge (sludgeneedbeer) 28 48.47 58.31 4 14.29
10766. sleepy (sleepy_tf) 28 92.72 117.76 10 35.71
10767. skeleton (skeleton0) 28 101.29 117.20 13 46.43
10768. Sinkingecstasies (sinkingec... 28 105.27 128.78 10 35.71
10769. ShowMeDaWay (showmak) 28 53.51 68.49 12 42.86
10770. Shimbo (shimbobaby) 28 63.45 80.47 19 67.86
10771. sherif (sherifu3) 28 35.89 43.11 1 3.57
10772. Shadowfader (shadowfader) 28 39.09 45.19 3 10.71
10773. Joshua (sh1nobie) 28 117.80 150.35 8 28.57
10774. Nady (serufidesu) 28 64.49 79.91 6 21.43
10775. Guillermo (schobzax) 28 123.46 154.23 21 75.00
10776. Sawill (sawill) 28 78.73 94.61 6 21.43
10777. Steve (sanptyper) 28 107.28 118.97 11 39.29
10778. Sanjar0126 (sanjar0126) 28 62.45 73.64 10 35.71
10779. spam (sammywammyllamma) 28 94.75 109.11 12 42.86
10780. Sagi (sagi_hv) 28 38.05 45.18 1 3.57
10781. Ryuu (sacreddany) 28 83.24 96.00 7 25.00
10782. RZ5D (rz5d) 28 90.21 113.32 16 57.14
10783. Gabriel (ryulzaki) 28 62.46 85.54 6 21.43
10784. Rishay (rishayg) 28 58.09 68.07 6 21.43
10785. Monica (ricefun) 28 92.78 106.46 8 28.57
10786. Reyna (reyeg4) 28 79.06 97.05 13 46.43
10787. doraemon (reazulislam) 28 60.66 71.48 5 17.86
10788. SDF (rc12chy) 28 37.27 47.21 4 14.29
10789. Ravshan (ravshan) 28 54.45 66.09 3 10.71
10790. RashidTalib123 (rashid_tali... 28 89.49 105.99 13 46.43
10791. rain (qwimnetypes) 28 79.48 100.29 10 35.71
10792. moni (pzza404) 28 68.05 97.90 7 25.00
10793. JO (pinkvelociraptor) 28 58.89 72.90 9 32.14
10794. Mona (picolee) 28 49.59 62.35 6 21.43
10795. Alan (papizene) 28 71.45 85.65 5 17.86
10796. ﹤୨♡୧﹥ (pa1ntwater) 28 56.32 68.26 2 7.14
10797. orthohalmak (orthohalmak) 28 72.42 81.88 8 28.57
10798. nyoomian (nyoomian) 28 100.24 109.45 10 35.71
10799. Nitta (nitta814) 28 85.49 96.19 7 25.00
10800. nikki (nikki0420) 28 63.36 72.05 8 28.57
10801. Niceable (niceable) 28 89.33 108.69 9 32.14
10802. Dr. NedStark (nedstark2_0) 28 34.75 41.48 3 10.71
10803. The (navya2008) 28 44.23 62.77 6 21.43
10804. Nathan (nathanbotas) 28 121.77 155.23 15 53.57
10805. Nalchee (nalchee1) 28 111.41 131.99 7 25.00
10806. Prathamesh (mystic_1) 28 71.08 82.88 9 32.14
10807. Mister (mystery_qwerty) 28 80.99 91.56 12 42.86
10808. Michael (mrk0508) 28 88.58 98.49 9 32.14
10809. Cal (mrbegon) 28 69.14 81.09 6 21.43
10810. Martin (mpenkov) 28 74.06 97.89 3 10.71
10811. John (mernst) 28 77.80 89.80 5 17.86
10812. Mehrshad (mehr74) 28 80.37 117.25 4 14.29
10813. Meeb (meeb24) 28 103.20 134.60 12 42.86
10814. Mark (maverick2455) 28 61.85 71.67 3 10.71
10815. Matt (mattserblo) 28 82.59 99.42 15 53.57
10816. Mark (markgeorge) 28 64.59 73.57 4 14.29
10817. meemw (markenmaw) 28 72.46 87.37 5 17.86
10818. Adrian (mangojuice_) 28 82.93 95.93 9 32.14
10819. Malondee (malondee) 28 93.39 107.95 8 28.57
10820. Malchez Link (malchez) 28 62.96 77.95 5 17.86
10821. sunny (maff_) 28 95.82 111.26 16 57.14
10822. lpd11 (lpd11) 28 85.39 93.21 9 32.14
10823. Roy (lordkite) 28 92.27 117.65 12 42.86
10824. (loom981) 28 121.60 145.51 13 46.43
10825. ‹/hex› (linguistic) 28 106.64 123.08 14 50.00
10826. IONIS (liaro0903) 28 98.01 109.08 5 17.86
10827. Law (law_sm) 28 74.26 93.68 9 32.14
10828. kzara (kzara6) 28 67.37 84.81 10 35.71
10829. David (klydden) 28 103.67 115.12 10 35.71
10830. B (kinfthaderp) 28 118.59 136.09 12 42.86
10831. Kimi (kimichanga) 28 50.52 59.86 6 21.43
10832. nick (kicknenton) 28 86.56 97.76 11 39.29
10833. Kheersagar (kheersagar) 28 36.92 44.69 4 14.29
10834. Kevin (kevinfjbecker) 28 41.11 48.17 4 14.29
10835. Kayyy (kayyy99) 28 38.30 49.42 0 0.00
10836. karsten (karstensen) 28 67.42 83.26 5 17.86
10837. sparda (kamoess0) 28 86.50 101.62 8 28.57
10838. kaede (kaede1) 28 75.62 94.24 3 10.71
10839. Mac (justmac) 28 72.79 87.18 1 3.57
10840. oli (johnvenz16) 28 89.91 101.87 12 42.86
10841. Josh (jnavin54) 28 52.55 63.45 3 10.71
10842. Jmam (jmam) 28 103.40 125.90 10 35.71
10843. A (jllkii123) 28 67.65 77.16 9 32.14
10844. James (jayuplink) 28 85.07 98.82 8 28.57
10845. Jem (jampr) 28 93.53 109.67 9 32.14
10846. jake (jakez) 28 53.20 64.79 6 21.43
10847. Jack (jack8888) 28 130.20 178.00 1 3.57
10848. Nuggs (itsmenuggetz) 28 72.68 94.97 10 35.71
10849. Itay (itay4430) 28 102.05 127.04 14 50.00
10850. isaiah (isaiahturnip) 28 109.15 135.05 14 50.00
10851. Peter (ironman2711) 28 55.60 74.55 6 21.43
10852. Impulsetyper (impulsetyper) 28 78.40 90.00 7 25.00
10853. EpikPanda (imanepikpanda) 28 57.26 67.36 7 25.00
10854. Sam (idcaboutnames) 28 77.36 88.55 10 35.71
10855. Ian (ian1806) 28 132.87 150.74 15 53.57
10856. Ethan Jeff (hypernacho) 28 89.01 115.96 9 32.14
10857. Rathalos (honored1234) 28 64.83 77.41 5 17.86
10858. Hoang (hoangama) 28 58.01 67.55 3 10.71
10859. Hmjo707 (hmjo) 28 92.59 122.09 13 46.43
10860. Aldar Kose (hkoldas) 28 67.48 80.81 10 35.71
10861. Sub to spenzalo (hi_shoemaker) 28 121.59 145.52 15 53.57
10862. Hideto (hikimarun) 28 73.67 90.96 8 28.57
10863. Andrew (happie) 28 72.99 87.96 3 10.71
10864. G (gtyper123) 28 47.56 60.45 5 17.86
10865. Vaibhav (genius6) 28 62.63 84.02 11 39.29
10866. Robert (furyon700) 28 74.75 98.64 5 17.86
10867. Nando (frozgamingz) 28 98.15 121.77 12 42.86
10868. Freowy (freowy) 28 89.25 106.94 6 21.43
10869. Francisco (francisc0) 28 56.08 74.36 2 7.14
10870. Fopuy (fopuy) 28 107.80 124.49 14 50.00
10871. v (fnut) 28 79.83 97.62 21 75.00
10872. John (flyingraven) 28 97.31 116.68 11 39.29
10873. flopvx (flopvx) 28 98.47 123.70 8 28.57
10874. firxe (firxe139) 28 85.84 100.80 8 28.57
10875. Fidelity (fidelityssj) 28 107.76 119.34 11 39.29
10876. Jacob (fastjacob) 28 114.36 133.91 15 53.57
10877. tommy (err0reverafter) 28 103.97 122.15 16 57.14
10878. (erokopes) 28 128.36 144.59 16 57.14
10879. Eric (ericniyigaba) 28 56.98 73.22 3 10.71
10880. Emily (emstand) 28 95.61 105.47 12 42.86
10881. Eli (elikgeneral) 28 82.00 94.11 5 17.86
10882. Gawiweu (edugg98) 28 62.86 78.32 8 28.57
10883. David (dvdtan20) 28 78.47 89.37 3 10.71
10884. David (du6e) 28 51.41 62.73 1 3.57
10885. Drowg (drowg) 28 51.49 62.32 5 17.86
10886. Donovan (donnyredzone) 28 59.85 71.22 4 14.29
10887. Dioscene (dioscene) 28 115.59 135.34 15 53.57
10888. Delvin (delvinsabrin) 28 78.30 88.74 6 21.43
10889. Delve (delve17) 28 101.91 117.42 19 67.86
10890. Lennox (datshall) 28 81.59 99.21 3 10.71
10891. Martin (datlos) 28 48.22 58.75 0 0.00
10892. Luc (darth_luc) 28 45.16 60.29 2 7.14
10893. Darlena (darlena) 28 97.67 124.57 9 32.14
10894. Gustavo Fring (cxmpy) 28 101.01 119.25 11 39.29
10895. Jon (customabilities) 28 105.92 127.12 14 50.00
10896. . (crazyhow7) 28 52.57 69.43 1 3.57
10897. alkalime (cptsprinklez) 28 79.79 95.31 12 42.86
10898. Courtney (clc0778clc) 28 101.63 126.57 11 39.29
10899. chuck1ehead (chuck1ehead) 28 55.27 73.89 4 14.29
10900. Chris (chrissquid) 28 83.66 104.28 9 32.14
10901. Walter (chimken1234) 28 84.45 106.70 10 35.71
10902. Kritik (chaoseyy) 28 63.77 78.56 5 17.86
10903. canadavid1 (canadavid1) 28 38.43 49.95 2 7.14
10904. vjalt (bullymaguire) 28 71.20 84.40 6 21.43
10905. Bala Klava (brullsker) 28 71.81 80.60 7 25.00
10906. Bitgalle (bitgalle) 28 85.67 95.41 11 39.29
10907. Antatia (bi0hazrd_522) 28 77.21 94.53 6 21.43
10908. Anjan (beaszt_nix) 28 93.84 111.28 9 32.14
10909. Vinícius (batovs) 28 57.11 71.95 6 21.43
10910. Basone01 (basone01) 28 74.68 89.74 11 39.29
10911. Muhammed (a_mhmmd) 28 74.62 86.10 7 25.00
10912. albatross (awehiuaf) 28 97.87 120.13 15 53.57
10913. Atsubyo (atsubyo) 28 79.91 104.59 4 14.29
10914. Kartik (artist007) 28 50.87 65.19 4 14.29
10915. arthur (arthurc999) 28 55.40 69.27 4 14.29
10916. ariel (arielsoko) 28 102.43 124.20 15 53.57
10917. Archery (archeryiskey) 28 107.58 124.80 9 32.14
10918. 🚀 (aqua_desu) 28 133.79 158.94 18 64.29
10919. Anton (antonchen) 28 123.04 151.91 27 96.43
10920. Andy (andy_andy) 28 57.94 67.91 4 14.29
10921. Anceint (anceint) 28 83.04 101.10 10 35.71
10922. Ali (alishyper12) 28 86.35 105.83 15 53.57
10923. Akshay (aksseet) 28 120.43 147.47 19 67.86
10924. Adam (adxam) 28 70.49 81.07 5 17.86
10925. adarsh_rzh (adarsh_rzh) 28 59.15 75.44 8 28.57
10926. Raz (adashi) 28 83.94 107.08 12 42.86
10927. Abhinav (abhinav42) 28 53.26 61.88 3 10.71
10928. Adrian (aadoy_) 28 51.28 67.82 2 7.14
10929. bmoney (23bmoney23) 28 118.89 138.17 10 35.71
10930. teeto (1005sv) 28 93.37 116.87 8 28.57
10931. T (0_________0) 28 67.56 79.57 6 21.43
10932. Logan (g0atb0lt) 28 74.53 107.50 8 28.57
10933. Pat2475 (pat2475) 28 44.13 60.70 3 10.71
10934. Quinn (wind_chaser) 28 36.28 45.06 3 10.71
10935. Hexa (hexaa) 28 69.26 83.99 4 14.29
10936. Quynh (spinelsun) 28 73.94 87.02 10 35.71
10937. Angelos (mangas) 28 68.91 81.44 6 21.43
10938. Ken (twofourty) 28 77.37 89.64 11 39.29
10939. sarat (saratrajput) 28 74.59 86.51 5 17.86
10940. darkDEMISE (dark_demise) 28 72.43 84.91 5 17.86
10941. Mae (mimstermae) 28 111.71 133.40 17 60.71
10942. Philip (bigasianmidget) 28 75.86 90.18 11 39.29
10943. Zander (aok9999) 28 54.65 70.71 4 14.29
10944. Slow Typist (oatsy) 28 80.68 92.43 5 17.86
10945. David Baril (dbaril2002) 28 61.29 73.61 6 21.43
10946. Liddle (0_night) 28 68.96 80.58 5 17.86
10947. Martin (martinlq) 28 62.91 72.15 4 14.29
10948. kuroo (kurodra5634) 28 42.25 51.06 2 7.14
10949. Fromix (fromix) 28 108.50 132.31 16 57.14
10950. Soham (infitro) 28 32.12 39.82 3 10.71
10951. Karrot (karrotdraws) 28 87.45 100.94 6 21.43
10952. Rori (rori_) 28 77.72 91.96 6 21.43
10953. |||||||||||||||||| (breadfr... 28 65.87 83.24 2 7.14
10954. aubs (kokokokie) 28 56.90 69.30 3 10.71
10955. Georgi (zoreau) 28 62.57 82.79 5 17.86
10956. Tzurok (tzurok) 28 66.89 77.68 6 21.43
10957. YourWorst (ajplayzthat) 28 68.99 95.36 10 35.71
10958. Rensevt (rensevt) 28 57.12 64.45 4 14.29
10959. Mohamed (_mohammed_taha_) 27 64.18 72.47 2 7.41
10960. z3x7 (zegadb) 27 69.45 84.44 7 25.93
10961. zeeko (zeekomeeko) 27 61.27 71.82 8 29.63
10962. Zachry (zachwn) 27 81.79 98.67 6 22.22
10963. My (z0rtzp1zku) 27 74.94 87.09 9 33.33
10964. Lance Toby (ybot28) 27 67.35 83.38 9 33.33
10965. Jayden (y4nrui) 27 106.17 125.97 14 51.85
10966. wooson (wooson) 27 69.94 81.80 6 22.22
10967. gamem (wkdgurtna) 27 69.43 92.44 8 29.63
10968. Wesley (wesleymelon) 27 116.75 145.46 13 48.15
10969. Warren (war_30) 27 59.64 76.94 5 18.52
10970. Victor (vlnash2002) 27 93.58 108.41 12 44.44
10971. Viwarrior (viwarrior) 27 80.40 95.48 7 25.93
10972. Aleksandar (virage94) 27 55.61 67.37 4 14.81
10973. bruhmoment (victorio_) 27 102.73 129.15 7 25.93
10974. Vicodin (vicodin_freeman) 27 91.02 116.81 8 29.63
10975. AAAAAAAAAAAAAAAAAAAAAAAAA (... 27 139.91 159.73 24 88.89
10976. Vedanta Sharan (vedbro) 27 40.34 58.81 3 11.11
10977. Uwu (uwudesuka) 27 79.16 91.70 12 44.44
10978. Usmon (usmonjonh) 27 50.64 70.38 14 51.85
10979. Vincent (tyt14) 27 58.04 77.77 3 11.11
10980. Tyson (tysonking33) 27 46.20 59.86 0 0.00
10981. Mack (tron__) 27 99.20 111.48 10 37.04
10982. Felix (tresflex) 27 86.70 107.76 9 33.33
10983. Jonowo (trainerjono) 27 109.15 126.95 15 55.56
10984. Elton John (tonundrum) 27 56.74 72.00 7 25.93
10985. t (tomn114) 27 132.18 154.88 16 59.26
10986. ᕙ(˵ ಠ ਊ ಠ ˵)ᕗ (... 27 79.57 99.41 9 33.33
10987. kevin (titiloka) 27 40.80 47.19 2 7.41
10988. Timothy (timothy5597) 27 64.63 79.24 4 14.81
10989. Harsh (the_slow_one_123) 27 48.38 62.29 3 11.11
10990. Thelonious (thelonious) 27 76.72 93.34 7 25.93
10991. Alfie (theaqualord) 27 106.87 134.87 19 70.37
10992. Thane (thaynt) 27 94.51 114.31 12 44.44
10993. Teodor (teo_climber) 27 65.14 77.28 5 18.52
10994. Temu (temex) 27 85.63 92.55 12 44.44
10995. StellarDoc11 (tarth15) 27 80.50 96.70 17 62.96
10996. Sunyog (sunyog) 27 43.08 65.20 5 18.52
10997. Sunny (sunnylee0123) 27 123.07 146.10 20 74.07
10998. omar (streetfighterlan123) 27 149.16 192.98 15 55.56
10999. spycow27 (spycow27) 27 95.40 105.96 26 96.30
11000. Aurora (sparrowfan101) 27 96.84 114.22 9 33.33
11001. sevgik (soranges) 27 88.48 123.64 7 25.93
11002. Snowy (snowysauce) 27 109.57 130.15 12 44.44
11003. Todor (todoriko) 27 31.29 38.52 1 3.70
11004. Bobby (slowtyper557) 27 112.83 128.22 13 48.15
11005. skywalker123 (skywalker123) 27 80.26 99.38 2 7.41
11006. Nenad (sima_car) 27 60.05 73.97 3 11.11
11007. 6969 (silky_) 27 107.48 118.55 13 48.15
11008. Silent (silent_solous) 27 108.13 129.46 20 74.07
11009. barack (shming) 27 118.31 135.06 20 74.07
11010. shahrukh (shahrukh77) 27 61.74 74.00 8 29.63
11011. Duc (setokouse) 27 75.17 91.05 11 40.74
11012. Sanjay (sanjaysins) 27 58.17 71.85 5 18.52
11013. Saif (saif_kitaz) 27 57.10 64.80 4 14.81
11014. Dr. (saddathasan) 27 67.20 79.49 6 22.22
11015. Saber (saber2756) 27 98.74 128.74 12 44.44
11016. Soumyajeet (s0umyajeet) 27 82.55 89.03 13 48.15
11017. Violet (rxviolet) 27 81.98 100.89 8 29.63
11018. Ruben (rubsi) 27 79.07 96.43 11 40.74
11019. Roger (rogerboston) 27 59.43 77.53 4 14.81
11020. robot (robotbb) 27 49.76 64.32 4 14.81
11021. Rictor (rictormidgekin) 27 94.12 114.17 8 29.63
11022. Amit (red2black) 27 65.84 78.92 8 29.63
11023. Ben (realolympian) 27 64.10 78.05 6 22.22
11024. Alikhan (realikh) 27 84.49 97.77 9 33.33
11025. randomyr (randomyr) 27 93.81 107.09 11 40.74
11026. raeraven (raeraven) 27 39.02 47.24 4 14.81
11027. Caleb (qwerty345) 27 55.16 63.69 11 40.74
11028. A (qkrdnwls6) 27 76.74 96.10 26 96.30
11029. Psalmer (psalmer) 27 73.71 91.94 10 37.04
11030. prans (prans12) 27 60.26 75.26 3 11.11
11031. Adam (pop123gyg) 27 29.82 35.90 2 7.41
11032. Himanshu (pluto_ish) 27 72.89 93.45 20 74.07
11033. pz (pingzhi) 27 77.75 87.56 4 14.81
11034. George (piehead567) 27 96.26 109.78 14 51.85
11035. Phenos (phenos) 27 102.48 126.47 10 37.04
11036. Pena (pena_perse) 27 57.29 65.58 3 11.11
11037. Chanel (pandabean) 27 88.18 109.16 6 22.22
11038. paldoo (paldoo) 27 72.78 92.21 6 22.22
11039. Nizar (oxlord) 27 77.58 93.17 8 29.63
11040. Dale (owenone) 27 113.31 127.97 20 74.07
11041. Ali (oplo) 27 99.42 122.04 9 33.33
11042. ollybollydisco (ollybollydi... 27 70.11 95.54 5 18.52
11043. NuclearBacon (nuclearbaconyt) 27 61.11 88.84 7 25.93
11044. OysterRice (notterrancehuang) 27 119.71 137.82 16 59.26
11045. BeGood (notideal) 27 85.19 106.40 6 22.22
11046. N0VA (nooova) 27 65.52 81.62 7 25.93
11047. Noobiest (noobiestmaster) 27 71.14 93.38 7 25.93
11048. Nate (nhanzel) 27 86.47 105.54 7 25.93
11049. Muhammad (muhammad_pak) 27 86.96 106.06 9 33.33
11050. Mr (mrrius99) 27 66.26 76.42 12 44.44
11051. Emre (mr3mr3) 27 109.70 126.43 17 62.96
11052. Rylan (moonraker505) 27 87.24 110.10 17 62.96
11053. ng (minhtuhay123) 27 75.09 90.87 6 22.22
11054. milop (milop) 27 71.90 85.46 9 33.33
11055. Velocitys (mikesyeet) 27 83.01 102.79 8 29.63
11056. Mike (mikereze) 27 54.26 68.54 1 3.70
11057. Darren (meodaze) 27 106.07 122.82 16 59.26
11058. Michael Loh (mclec950125) 27 75.23 84.45 7 25.93
11059. MAYANK (mayank10) 27 46.87 54.25 2 7.41
11060. M (maxopie) 27 85.41 97.79 6 22.22
11061. Max (maxarfvidsson) 27 73.44 91.78 7 25.93
11062. Max (max2004awesome) 27 102.66 119.10 9 33.33
11063. Hugh (mathimati) 27 99.29 126.17 17 62.96
11064. Mary (marymyers) 27 94.97 113.28 12 44.44
11065. Julia (malh) 27 34.34 41.61 2 7.41
11066. Bryan (lufrewaffle) 27 60.61 70.68 5 18.52
11067. Sauce (lolplox123) 27 107.22 148.79 9 33.33
11068. boo (lolitsme) 27 75.52 88.70 6 22.22
11069. Everest (likethemountain) 27 77.16 95.76 7 25.93
11070. David (leepictrollexd) 27 108.70 126.26 16 59.26
11071. Naresh (learnrapid) 27 47.38 57.06 5 18.52
11072. Laznia (lasthomeless) 27 56.06 65.26 1 3.70
11073. tak power (langsungg) 27 85.15 96.64 7 25.93
11074. Thpp (kulaspa) 27 97.62 114.51 13 48.15
11075. kuchukas (kuchukas) 27 51.25 62.64 2 7.41
11076. Kostia (kostia) 27 52.10 63.27 4 14.81
11077. Underscores4Fun (koskos) 27 79.88 96.72 6 22.22
11078. potato (kongkan_) 27 98.75 113.49 13 48.15
11079. Kyle (kle33) 27 67.16 78.30 8 29.63
11080. Alvin (kishoarima) 27 62.32 71.27 4 14.81
11081. Shahobiddin (khusniddinov_uz1) 27 55.07 65.38 6 22.22
11082. keytiX (keyti) 27 41.62 49.69 2 7.41
11083. Kenneth (kensan73) 27 103.48 118.68 18 66.67
11084. Membrane69 (keifermatthew) 27 89.05 109.14 9 33.33
11085. Kaeso (kaeso_krupp) 27 92.70 107.69 12 44.44
11086. kaare (kaare) 27 78.35 105.45 8 29.63
11087. k3n (k3nnn) 27 138.95 152.38 20 74.07
11088. Julian72696 (julian72696) 27 93.64 119.37 7 25.93
11089. John (john_sharks) 27 78.65 85.76 5 18.52
11090. Jimminyyy (jimminyyy) 27 81.73 108.41 9 33.33
11091. Jonathan (jimbothegreat) 27 76.80 99.57 10 37.04
11092. JesseCarl (jessecarl) 27 72.17 85.85 6 22.22
11093. Jaz (jazwolff) 27 61.25 73.60 3 11.11
11094. Jose Antonio (jarceantonio) 27 76.80 94.80 7 25.93
11095. Jake (jakexx) 27 86.12 113.90 9 33.33
11096. Vytenis (jackeddj) 27 69.90 86.67 8 29.63
11097. Jjajangmyeon (izzu) 27 72.90 88.04 7 25.93
11098. irving (irvingnivri) 27 78.68 91.03 5 18.52
11099. 찬우 (inphinity) 27 122.11 163.87 14 51.85
11100. Ben (hurstsys) 27 52.55 62.41 1 3.70
11101. Radu (horixyt21) 27 93.87 108.65 8 29.63
11102. Scott (holyomgida) 27 101.76 118.87 10 37.04
11103. Louis (hlouis) 27 111.34 131.18 16 59.26
11104. Rotem (hi_im_rotem_2006) 27 68.45 83.53 7 25.93
11105. mashed_potato (hello_world199) 27 67.43 80.09 7 25.93
11106. Lasse Hededal (hededal) 27 70.46 86.33 7 25.93
11107. Luke (harrislp1979) 27 59.64 73.20 8 29.63
11108. ﱞﱞﱞﱞﱞﱞﱞﱞﱞ... 27 84.43 98.55 14 51.85
11109. Gabe (gsoares026) 27 111.25 143.58 22 81.48
11110. sangvar (greeker) 27 71.64 87.19 13 48.15
11111. Ainsley (giannis199) 27 69.36 83.48 6 22.22
11112. Tan (ghtann) 27 78.30 90.45 5 18.52
11113. Adam (george_williams14798) 27 109.14 131.04 14 51.85
11114. M.Verstappen (gameroubas) 27 102.55 119.64 12 44.44
11115. Gabby (gabbychan) 27 66.85 83.75 8 29.63
11116. folgue02 (folgue) 27 84.17 99.42 9 33.33
11117. FireGumz (firegumz) 27 56.51 74.00 4 14.81
11118. fei (feiamor) 27 63.46 84.58 6 22.22
11119. Fave (fave_22) 27 52.81 59.18 2 7.41
11120. Henry (fastypr) 27 88.00 106.38 15 55.56
11121. distopia (far_sunflower) 27 53.15 64.05 1 3.70
11122. Fabricio (fabrox) 27 68.33 87.52 7 25.93
11123. Vincent (ezbread) 27 69.79 85.89 11 40.74
11124. Evan (estarr14) 27 52.35 63.45 2 7.41
11125. Ellen (eeecp) 27 76.18 88.15 6 22.22
11126. Edilbek (edok_mal4) 27 48.77 65.67 3 11.11
11127. bum_fluff (dritt) 27 124.47 137.60 18 66.67
11128. Dylan (drink_windex) 27 69.78 82.91 4 14.81
11129. Djaenk (djaenk) 27 107.27 147.99 16 59.26
11130. Vit (denysvit) 27 84.10 94.97 12 44.44
11131. Dennis (dendendenlee) 27 61.36 73.31 6 22.22
11132. Dein (deinfreund) 27 116.63 136.95 27 100.00
11133. wet nightmare (daviddloco) 27 92.74 105.41 13 48.15
11134. Dev (darkpi) 27 71.32 85.34 3 11.11
11135. Darin (darin_ss) 27 46.12 65.96 1 3.70
11136. Daedalus (daedalusmahda) 27 87.39 98.46 14 51.85
11137. æ (c_c_c) 27 91.10 126.62 10 37.04
11138. cung (cungdongma) 27 76.54 91.42 10 37.04
11139. Craig (craiggsell) 27 68.81 77.40 5 18.52
11140. Chirath (cp_guy) 27 64.17 78.68 6 22.22
11141. Casey (covertmidget) 27 66.90 81.79 15 55.56
11142. BUS (bus12) 27 94.09 108.94 8 29.63
11143. Sahabuddin (blitzbibi) 27 51.72 59.97 4 14.81
11144. Ben (blister99) 27 110.76 126.13 19 70.37
11145. Bionodroid (bionodroid) 27 69.21 82.00 3 11.11
11146. BigBreadBaker (bigbreadbaker) 27 130.01 158.06 19 70.37
11147. bianca (bi4nc4hannah) 27 53.08 64.87 10 37.04
11148. Ethan (bewilderex63) 27 107.72 136.22 12 44.44
11149. bayu (bayun2445) 27 45.38 55.99 2 7.41
11150. bacy (bacy) 27 54.05 66.97 2 7.41
11151. Ahmed (a_h5s_h) 27 52.62 63.78 0 0.00
11152. arman (arman_types) 27 112.81 145.96 13 48.15
11153. arham (arham_doshi) 27 51.86 59.27 2 7.41
11154. AranKz (arankz) 27 81.82 97.26 7 25.93
11155. d1ff1cult (apysch) 27 117.08 128.54 15 55.56
11156. Ahmad (apathicss) 27 74.55 90.43 17 62.96
11157. Tran Thai Anh (anh_tran123) 27 65.66 73.83 5 18.52
11158. ana (anachokheli) 27 46.19 57.77 1 3.70
11159. Aman (amansharma10) 27 62.45 74.86 5 18.52
11160. Kelven (agentbowtie) 27 60.76 73.89 7 25.93
11161. Aecor (aecor) 27 103.06 114.74 7 25.93
11162. Adam1t (adam1t) 27 60.93 77.96 5 18.52
11163. Abonkwe (abonkwe) 27 79.94 96.83 9 33.33
11164. tstats[abhishekyeskholiya] ... 27 79.30 95.45 8 29.63
11165. Marco (abababaaaa) 27 69.96 86.13 6 22.22
11166. pwned (16wpm) 27 84.91 95.55 4 14.81
11167. Sinuro (0sty) 27 76.13 102.22 13 48.15
11168. Hifjul (hifjul) 27 57.03 70.07 2 7.41
11169. James (adamorjames) 27 61.51 74.72 7 25.93
11170. Daniel (dxnielchoo) 27 64.69 88.80 10 37.04
11171. Brandan (brandanprice) 27 56.05 70.98 4 14.81
11172. matthew (hewasnumber1) 27 65.63 83.89 6 22.22
11173. Ognian (ogihaxer) 27 56.54 69.27 20 74.07
11174. Stalast (stalast) 27 89.46 111.87 1 3.70
11175. Ivan (potatokingdom) 27 85.78 101.01 6 22.22
11176. scoutie (scoutieee) 27 77.05 92.46 6 22.22
11177. Jon (rockitman) 27 102.66 141.32 12 44.44
11178. Kevin (iuhnivek) 27 82.90 95.84 4 14.81
11179. Samin (_nimas) 27 53.58 66.14 2 7.41
11180. harsha (master_ogasaku) 27 36.31 46.15 3 11.11
11181. Stephanie (zoomer1) 27 32.80 46.09 1 3.70
11182. Arshak (arshak00) 27 56.28 64.02 5 18.52
11183. Sebastian (cohnan) 27 74.66 88.39 8 29.63
11184. ToothDK (dkindred) 27 68.92 98.62 24 88.89
11185. Wegster (nico88villa) 27 56.69 66.15 9 33.33
11186. Cayden (klxverzz) 27 45.45 58.60 7 25.93
11187. Harry (harryswan) 27 66.16 93.02 10 37.04
11188. La (listentonct) 27 68.52 81.52 9 33.33
11189. Fahd (faddyboi) 27 85.80 106.50 7 25.93
11190. ardabil (ardabil) 27 20.13 25.86 6 22.22
11191. hw4nb (hw4nb) 27 57.65 76.19 5 18.52
11192. Greatest (_greatestever_) 26 66.41 79.48 9 34.62
11193. Emrys (zyronwhite123) 26 51.57 63.23 0 0.00
11194. will (zootzootie) 26 84.98 103.06 8 30.77
11195. Peter (zoodoo) 26 97.70 119.13 12 46.15
11196. Zitwitcool (zitwitcool) 26 46.88 57.80 4 15.38
11197. DY (yuyue1) 26 99.80 120.07 13 50.00
11198. Charlie (xharlie) 26 83.12 101.41 5 19.23
11199. wood warrior (wood_warrior) 26 62.95 73.98 5 19.23
11200. Seth (wongaa) 26 74.35 94.23 9 34.62
11201. Trying (whatisyourtalent) 26 55.09 72.75 5 19.23
11202. wgreenihrcorp2 (wgreenihrco... 26 52.54 64.24 8 30.77
11203. Jacob (werjac) 26 72.70 90.04 5 19.23
11204. Winson (weezy_winson) 26 81.59 120.74 11 42.31
11205. Wakil (wakil7) 26 54.77 66.89 6 23.08
11206. Vishnu Chauhan (vishnuchauhan) 26 74.18 83.78 9 34.62
11207. vicky (vickysiva007) 26 53.30 61.37 5 19.23
11208. Victoria (vicksun) 26 59.47 67.92 2 7.69
11209. Vivi (veevaa) 26 75.77 88.21 8 30.77
11210. Ved (ved_) 26 32.31 44.43 1 3.85
11211. Unai (unaiberis) 26 81.51 92.29 12 46.15
11212. Patrick (ugonnaeatthatcrois... 26 67.33 80.51 6 23.08
11213. krunal (triplekbro) 26 66.36 84.00 14 53.85
11214. LM (trashtocash) 26 63.49 76.56 3 11.54
11215. Mitch (toddlerdust) 26 134.49 149.07 0 0.00
11216. tinkureddy (tinkureddy) 26 86.13 104.35 13 50.00
11217. Timothy (timothy273) 26 63.49 75.00 7 26.92
11218. Heather (tilly_day) 26 57.00 64.98 7 26.92
11219. Christian (thermikk) 26 87.16 113.86 7 26.92
11220. (thereayou) 26 84.06 99.22 8 30.77
11221. Theo (theogv) 26 97.41 116.39 13 50.00
11222. thavin (thavinxz) 26 73.98 88.35 8 30.77
11223. Johnny (thatbigboy) 26 113.97 129.71 13 50.00
11224. Itachi (thanos_18) 26 39.95 53.90 4 15.38
11225. Terairk (terairk) 26 106.12 121.79 2 7.69
11226. Teddie (teddie37) 26 65.07 76.47 7 26.92
11227. tia (teayah) 26 58.89 71.81 9 34.62
11228. taseh (taseh) 26 117.27 129.91 14 53.85
11229. Leia (s_leia) 26 127.32 167.05 17 65.38
11230. blob (susuthichansushi) 26 82.74 98.26 6 23.08
11231. Linus (starhiro654) 26 92.41 115.72 9 34.62
11232. s (sqood) 26 69.34 83.12 6 23.08
11233. Speedswiper (speedswiper) 26 111.08 128.03 12 46.15
11234. SPEED (speedbear) 26 109.86 128.32 11 42.31
11235. War (sorted99) 26 54.99 64.29 3 11.54
11236. SJ (sonialj) 26 53.05 62.78 4 15.38
11237. A.A.Fouad (snkpl) 26 69.35 81.74 5 19.23
11238. Aleksei (snejink) 26 38.23 48.56 0 0.00
11239. Jeremy (slorsx89) 26 72.53 86.15 6 23.08
11240. Kendall (skeletonsinc) 26 105.14 123.79 13 50.00
11241. John (sirfightsalot) 26 77.81 92.38 7 26.92
11242. Dev (sident) 26 99.68 118.14 14 53.85
11243. Siberius (siberiusalpha) 26 63.40 76.80 7 26.92
11244. Shreyash (shreyash_he) 26 32.28 37.26 7 26.92
11245. Joe (shmooo) 26 113.22 131.36 13 50.00
11246. scampe (scampe) 26 104.59 119.87 16 61.54
11247. asdf (rushlync) 26 79.75 92.70 6 23.08
11248. Colemak (road2work100) 26 83.15 98.16 7 26.92
11249. Zoe (riverz) 26 86.64 105.31 7 26.92
11250. Kuzma (rikoj02) 26 93.01 115.42 9 34.62
11251. R1 (richthe1kid) 26 94.33 117.46 9 34.62
11252. Ricardo (ricardo1610) 26 66.92 78.50 5 19.23
11253. repeatt (repeatt) 26 81.96 101.96 7 26.92
11254. Sir RB (rblogan3) 26 59.83 70.13 5 19.23
11255. Rajiv (rajiv_431) 26 41.26 51.78 3 11.54
11256. Raivo (raivopleika) 26 32.16 43.30 2 7.69
11257. vijay (pykethtitan) 26 91.74 111.58 10 38.46
11258. Pro (pro_talon) 26 35.02 41.13 0 0.00
11259. Preaben (preabae) 26 81.31 100.77 6 23.08
11260. Omar (postmodernpostman) 26 110.35 134.30 14 53.85
11261. Porkyy (porkyp10) 26 103.15 129.61 14 53.85
11262. Rahul (pirate_racer) 26 49.98 58.33 0 0.00
11263. Phire (phire_xic) 26 67.42 92.24 7 26.92
11264. Peppito (peppito) 26 118.34 147.12 18 69.23
11265. palisfpauul (palisfpauul) 26 96.34 107.97 11 42.31
11266. ozzyy (ozzyy_163) 26 63.75 77.18 10 38.46
11267. zero (ozero) 26 100.68 117.30 11 42.31
11268. Just (ottovon) 26 65.47 85.37 4 15.38
11269. Oscar (oscrrrrrrr) 26 61.37 84.67 9 34.62
11270. Osaji (osaji) 26 80.48 93.53 7 26.92
11271. Stuart (orihsenak) 26 70.05 83.71 8 30.77
11272. Thomas (onlyphams) 26 85.02 112.28 7 26.92
11273. Marco (oblq) 26 77.65 92.52 6 23.08
11274. hard to type (obahi) 26 36.38 42.02 2 7.69
11275. Nathan (n_tber) 26 30.53 43.81 5 19.23
11276. noahrwilly (noahrwilly) 26 87.52 99.28 9 34.62
11277. Nino (ninodoko) 26 121.66 137.50 14 53.85
11278. Niklas (niklash) 26 89.40 109.37 9 34.62
11279. Nikee (nikee25) 26 83.96 97.95 11 42.31
11280. Benji (nepzy) 26 82.51 98.96 13 50.00
11281. Niko Zhang (neko23) 26 81.53 98.14 7 26.92
11282. Daniel (nedgcb) 26 88.75 110.05 7 26.92
11283. c (nb888) 26 109.49 125.02 11 42.31
11284. Nasar (nasarlagenda) 26 60.57 75.75 6 23.08
11285. Nanashi (nanasheen) 26 98.95 128.05 9 34.62
11286. naileuX (naileux) 26 85.47 110.45 10 38.46
11287. MyBihLuhDoCocaine (mybiluhd... 26 97.65 124.05 11 42.31
11288. workmanLayout (mustelad) 26 81.64 95.42 8 30.77
11289. Mustafa (mustafaalyagoub) 26 88.16 101.69 5 19.23
11290. Fluffy (musketeer) 26 52.41 67.78 6 23.08
11291. mursh (mursh) 26 64.41 88.03 8 30.77
11292. Eicy (moreseicy) 26 77.49 87.64 7 26.92
11293. Mojo (mojo1289) 26 81.26 100.11 12 46.15
11294. Julise (mintytea) 26 42.58 54.26 4 15.38
11295. mike (mike4madness) 26 68.20 76.06 6 23.08
11296. saba (midvert) 26 71.18 83.67 14 53.85
11297. methodiical (methodiical) 26 82.44 104.61 3 11.54
11298. Matthijs (matthijsb) 26 65.73 80.99 5 19.23
11299. mart9n (mart9n) 26 108.46 120.89 17 65.38
11300. Marcus (marcustham) 26 59.44 69.46 5 19.23
11301. Darrick (mapleroasted) 26 84.40 108.73 10 38.46
11302. Mackyy. (mackipecko) 26 122.99 138.37 23 88.46
11303. Daan (macdann6) 26 82.77 97.00 7 26.92
11304. i am (lynx_noob) 26 32.62 40.50 5 19.23
11305. Jamliv (lvpec) 26 66.83 82.05 5 19.23
11306. Lubo (lubokkanev) 26 101.44 117.88 10 38.46
11307. zhiyu (losterzu) 26 77.91 96.71 10 38.46
11308. Tao (litao91) 26 89.51 106.59 8 30.77
11309. liperdi (liperdi) 26 53.55 59.36 2 7.69
11310. IChun (lighttodie) 26 88.89 104.44 8 30.77
11311. Lee Bing Bong (lee_bing_bong) 26 95.79 117.54 13 50.00
11312. kwonman99 (kwonman99) 26 91.15 112.54 8 30.77
11313. Kuma (kumatero1) 26 62.31 75.93 5 19.23
11314. Brandon (kosaido) 26 76.58 88.82 11 42.31
11315. kopok (kopokopok) 26 66.62 82.88 4 15.38
11316. Seth (kliney4) 26 74.38 85.33 7 26.92
11317. Khaled (khaled2252) 26 97.95 117.38 11 42.31
11318. Vince (kerokeroro) 26 68.82 82.14 4 15.38
11319. Lucia (kenyousmile) 26 57.86 69.03 2 7.69
11320. Kek_LordDvorak (kek_lorddvo... 26 80.72 101.06 6 23.08
11321. Kay (kaylakhots) 26 79.48 95.62 17 65.38
11322. Kasey (kaseshib) 26 85.13 105.36 6 23.08
11323. KirinChibi (k4nna) 26 119.76 139.44 21 80.77
11324. Jumpye (jumpye) 26 134.62 157.71 18 69.23
11325. JVY (julvi) 26 68.71 86.06 9 34.62
11326. Juggle (juggle6) 26 115.56 133.86 16 61.54
11327. Josh (jtaube) 26 84.75 97.01 7 26.92
11328. jesse (jessef_9000) 26 76.06 96.94 10 38.46
11329. JEREYO05 (jereyo05) 26 44.37 54.27 3 11.54
11330. Jay (jay_cubed22) 26 97.92 111.99 9 34.62
11331. Suh dude (jaykwon) 26 85.88 106.84 6 23.08
11332. j (jas1yne) 26 101.29 114.99 9 34.62
11333. deez (ishkena) 26 88.38 112.01 22 84.62
11334. imslowaf (imslowafuwu) 26 75.64 89.54 8 30.77
11335. Ed (illuxionist) 26 94.99 113.70 16 61.54
11336. Ian Jerome (ianjerome) 26 54.20 62.58 7 26.92
11337. Lucas (huy1804) 26 69.28 88.49 7 26.92
11338. HunTer (hunter420) 26 43.96 50.06 3 11.54
11339. arif (hmmmnotokay) 26 73.50 93.97 7 26.92
11340. hunt (hmich) 26 91.37 105.25 15 57.69
11341. Cody (hippolytus) 26 93.19 124.79 9 34.62
11342. Hien (hien1201) 26 76.25 83.82 5 19.23
11343. lane (hiddenplays) 26 29.22 34.88 0 0.00
11344. Adithiya (havlen1) 26 53.96 63.02 2 7.69
11345. ... (h01001010) 26 89.58 108.86 6 23.08
11346. Varun Goyal (govarun) 26 63.05 73.07 5 19.23
11347. Gnanendar (gnanickky) 26 57.64 64.69 3 11.54
11348. Gintoki (ginnoji) 26 67.93 84.94 6 23.08
11349. Ghislaine (ghislanemaxwell) 26 89.08 110.26 12 46.15
11350. Abdur (genway_dev) 26 37.99 52.23 4 15.38
11351. Garvežiukas (garvezinis) 26 70.04 98.75 8 30.77
11352. Gabe (gabuthebabu) 26 95.82 112.08 13 50.00
11353. FisH...MaN (fish_man) 26 81.69 101.21 26 100.00
11354. Fernando Morato (fernandomo... 26 72.34 86.29 4 15.38
11355. Fandom (fandom_girl) 26 58.09 72.28 7 26.92
11356. Ian (e__n) 26 102.73 120.81 8 30.77
11357. Ivan (evanmico) 26 87.46 96.71 19 73.08
11358. Andrew (entranco) 26 90.97 108.58 9 34.62
11359. emczuk (emczuk) 26 115.87 130.68 8 30.77
11360. Earth (earth_chan) 26 94.29 112.62 15 57.69
11361. Dana (dwhite84) 26 71.54 98.14 10 38.46
11362. Darren (dtwcdarren) 26 76.79 98.14 4 15.38
11363. droLnomeD (drolnomed) 26 77.98 97.47 5 19.23
11364. Jake (drjakeman) 26 118.24 133.71 21 80.77
11365. Denis Çerri (deniscerri) 26 90.62 109.04 10 38.46
11366. DD (ddcute) 26 60.98 70.77 9 34.62
11367. Dave (davidkim123) 26 106.72 123.96 14 53.85
11368. bailey (darkness04) 26 59.00 98.72 11 42.31
11369. Dan (danmarculet) 26 106.71 115.70 14 53.85
11370. Davvy (daavvyy) 26 92.87 122.59 11 42.31
11371. H (curlwurl) 26 89.97 105.32 6 23.08
11372. abhay (cs_abhay) 26 77.46 93.86 6 23.08
11373. Asrar (cruzen) 26 62.56 73.47 3 11.54
11374. Jason (cowlodger123) 26 93.18 127.93 18 69.23
11375. stranger (courage_iberg) 26 50.18 65.73 4 15.38
11376. cooper (cooperwoop) 26 73.92 95.55 10 38.46
11377. Max (convie) 26 98.11 119.20 8 30.77
11378. Cristian (cmatiasc) 26 97.16 112.43 13 50.00
11379. Ozan (clutchupmate) 26 104.55 130.95 11 42.31
11380. Sebastian (cloutimus) 26 88.66 104.95 12 46.15
11381. Sebastian (clicthekeys) 26 45.95 75.91 0 0.00
11382. Charles (chuckly) 26 81.02 95.26 5 19.23
11383. Lim (chiyennn) 26 67.07 75.89 7 26.92
11384. alex (chinese69) 26 108.75 127.44 14 53.85
11385. CelestialAmber (celestialam... 26 86.88 101.97 10 38.46
11386. mo (ceiba) 26 81.38 95.98 5 19.23
11387. Cecil (cecil_behar64) 26 89.33 96.98 5 19.23
11388. Carter (cartersaechoa92) 26 89.53 104.10 6 23.08
11389. tw0f1v3w0n (capricitor) 26 103.78 124.44 14 53.85
11390. Justin (bothon21) 26 100.93 122.88 12 46.15
11391. Blaize (bomoko) 26 73.82 85.93 8 30.77
11392. Dakota (boda69) 26 50.03 58.64 3 11.54
11393. William (bnuldun) 26 92.42 114.05 9 34.62
11394. KMMOPJ1 (blueflammednezha) 26 64.00 78.53 7 26.92
11395. Blitzgate (blitzgate) 26 77.79 92.30 6 23.08
11396. Aaron (bigfategg) 26 77.89 91.84 7 26.92
11397. Darren (baochun2) 26 94.81 115.47 11 42.31
11398. ballz (ballzbazz) 26 71.36 78.39 6 23.08
11399. Daddy (badassabd) 26 47.42 64.22 4 15.38
11400. qwe (azeem838) 26 37.03 45.04 3 11.54
11401. AxelDT (axman292) 26 81.63 93.97 6 23.08
11402. Thomas (ashryx) 26 92.19 109.96 9 34.62
11403. Arunkumar (arunkumar49) 26 72.15 87.49 12 46.15
11404. APS (arsh_aps) 26 68.65 83.22 7 26.92
11405. Alex (aralizer) 26 50.35 58.37 2 7.69
11406. applecards (applecards) 26 60.47 75.67 5 19.23
11407. Anurag (anuragbhatt) 26 69.05 87.58 1 3.85
11408. Mike (anaperius) 26 48.30 59.36 13 50.00
11409. Anas (ananzeh) 26 67.58 77.81 5 19.23
11410. Anthony (an1hony) 26 97.84 116.86 6 23.08
11411. A (amartindale) 26 43.26 54.67 2 7.69
11412. Nissan GT-R (amalyano) 26 72.27 82.02 6 23.08
11413. Jasper (ajaystr) 26 56.09 65.46 4 15.38
11414. Advik (advik123) 26 59.07 66.98 7 26.92
11415. Achuyat (achuyat) 26 38.17 48.86 2 7.69
11416. Abhirup Das (abhirupdas200) 26 72.07 99.17 8 30.77
11417. Abas (abasf14687) 26 62.20 80.39 9 34.62
11418. Ayoub (4youb) 26 36.49 44.65 10 38.46
11419. Jeff (3deer6) 26 59.55 75.12 4 15.38
11420. Wzq (3125114) 26 88.32 100.52 6 23.08
11421. Blake (25kangboyang) 26 94.73 116.77 9 34.62
11422. Ahmed Husayn (pr1vate) 26 44.90 53.92 4 15.38
11423. KURM (kurm) 26 47.03 58.64 2 7.69
11424. kyvu (kyvu) 26 89.20 113.63 5 19.23
11425. VerTue (xmarc) 26 67.33 83.37 9 34.62
11426. J (jus_t) 26 55.50 67.70 4 15.38
11427. Voldemar (voldemortenz) 26 39.97 50.32 1 3.85
11428. Dark (raynous) 26 57.32 66.60 4 15.38
11429. del (yggdrasilll) 26 78.12 89.85 7 26.92
11430. Swice (swice) 26 57.44 71.69 5 19.23
11431. Turd (turd_nugget1337) 26 50.80 63.98 2 7.69
11432. M1 (m1_englondon) 26 62.65 73.09 3 11.54
11433. Xavier (xavierboutot) 26 71.46 84.97 7 26.92
11434. Segale (barbara01) 26 86.61 102.15 8 30.77
11435. Eddie (e2damilla) 26 66.99 81.72 10 38.46
11436. Chee (pigupenguin) 26 81.31 97.66 15 57.69
11437. Nard (hackerskeyboard) 26 89.54 100.17 7 26.92
11438. Hisham (kaalan007) 26 52.55 61.03 3 11.54
11439. Stefano (stefano98) 26 33.21 44.67 1 3.85
11440. Acks (acksmurder) 26 52.52 70.56 2 7.69
11441. Trace (kerotace) 26 44.16 53.75 1 3.85
11442. Sean (seanso952) 26 104.32 118.98 11 42.31
11443. Onlyifpanda (zailahmae) 26 48.83 61.40 0 0.00
11444. Ashraf (ataibani001) 26 88.04 98.41 7 26.92
11445. Estrode (estrode) 26 81.52 103.61 15 57.69
11446. Thanos (thanosrr) 26 64.24 75.00 7 26.92
11447. Fatso (fatsolebatso) 26 82.17 103.26 18 69.23
11448. Nautilus (nautilus_3374) 26 50.37 61.89 3 11.54
11449. N0rmL (_mee_) 25 92.91 104.64 10 40.00
11450. old layout (_darya_) 25 86.47 105.95 6 24.00
11451. allison (_allisonsun) 25 62.98 73.15 5 20.00
11452. Zonic (zonic77) 25 94.43 105.51 14 56.00
11453. zalpro (zalpro) 25 62.98 77.19 4 16.00
11454. Yaas (yaas63) 25 58.52 69.76 3 12.00
11455. Katie (xkaytea) 25 81.07 97.91 7 28.00
11456. Wynton (wyntonrude17) 25 77.29 100.57 6 24.00
11457. Saksham (wrath101) 25 78.82 98.38 6 24.00
11458. Max (winstonlisa) 25 110.94 130.31 12 48.00
11459. Will (willbo2006) 25 60.82 78.54 4 16.00
11460. Wawa (wawasc) 25 74.33 92.01 2 8.00
11461. opperhoofd (wart) 25 62.69 72.89 5 20.00
11462. BrammetjeBaas (vyx_spaghettt) 25 55.64 61.76 1 4.00
11463. Phillip (vuzula) 25 36.04 47.54 3 12.00
11464. volt (voltb) 25 72.64 90.28 5 20.00
11465. vishalvoid (vishalvoid) 25 38.62 45.92 2 8.00
11466. Veedek (veedek) 25 87.91 111.31 8 32.00
11467. UzanR (uzanr) 25 55.63 64.73 2 8.00
11468. MK (uosom) 25 77.12 98.12 7 28.00
11469. VNLEASHED (unlevshed) 25 71.35 89.14 9 36.00
11470. Timo (ubulin) 25 94.24 111.36 10 40.00
11471. Txeru (txeru) 25 71.58 79.32 25 100.00
11472. Quyen (tsaiduk) 25 82.96 102.11 8 32.00
11473. Erik (trixx7) 25 74.18 91.72 7 28.00
11474. anon (triphosphate) 25 89.50 106.49 10 40.00
11475. TotalledZebra (totalledzebra) 25 109.22 129.34 17 68.00
11476. Tim (timoteo_lol) 25 93.15 109.98 9 36.00
11477. Thunderz (thunderz2016) 25 101.78 118.21 12 48.00
11478. The_rock (the_rock97) 25 47.25 61.99 2 8.00
11479. Ternimus (ternimus) 25 74.91 83.79 10 40.00
11480. TANEdos (tanedos) 25 90.93 107.96 7 28.00
11481. Syed (syedmadad) 25 58.85 77.71 2 8.00
11482. Sweater (swtr) 25 77.49 98.12 7 28.00
11483. Ethan (sweethan) 25 97.38 113.11 4 16.00
11484. Aviel (suxhe) 25 94.81 117.81 6 24.00
11485. Kasper (suttergren) 25 52.61 59.06 1 4.00
11486. Surreal (surreal_cereal) 25 72.16 83.61 8 32.00
11487. K (sunfalls) 25 101.90 116.00 13 52.00
11488. suaad (suaad) 25 46.91 56.53 2 8.00
11489. Ana (sturmshatten) 25 41.16 52.14 3 12.00
11490. Azee (speedy65) 25 64.68 70.93 9 36.00
11491. sophia (sophiacav) 25 100.69 111.74 7 28.00
11492. Praveen (solvedbiscuit71) 25 38.54 51.04 1 4.00
11493. BLURB (snowq) 25 100.56 117.44 12 48.00
11494. VaporSZN (vaporszn) 25 90.61 107.33 12 48.00
11495. Ellie (sluis9_halmak) 25 27.04 36.21 10 40.00
11496. gianni (slowasf99) 25 107.02 131.46 10 40.00
11497. siddharth (siddharthr) 25 66.61 79.20 6 24.00
11498. Ty (sick_wubs) 25 47.24 67.32 2 8.00
11499. Ahnaf (shahriarme) 25 42.73 52.76 1 4.00
11500. shahmeer (shahmeernoob) 25 54.24 62.93 3 12.00
11501. Setons (setonsgrandpa) 25 73.31 87.43 9 36.00
11502. Saumya (saumya69) 25 66.91 75.92 6 24.00
11503. sasuke (sasukee) 25 51.40 64.01 1 4.00
11504. Sarah Bisher (sarahbisher) 25 102.55 111.72 12 48.00
11505. ara ara (sage_of_six_trees) 25 66.65 78.06 8 32.00
11506. sabian (sabiansaige) 25 59.41 75.28 4 16.00
11507. Rayleigh (r_chin) 25 93.42 115.14 8 32.00
11508. James (ryyuu) 25 99.63 120.99 13 52.00
11509. dark (rycae) 25 71.49 82.90 9 36.00
11510. Saurabh (rustie_123) 25 67.77 76.88 5 20.00
11511. I can't type!!! (roychan1) 25 100.59 129.92 12 48.00
11512. Vignesh (rosvicky) 25 54.69 65.25 5 20.00
11513. Ron (ronlaniado) 25 92.85 107.66 8 32.00
11514. Brigid (riniti) 25 102.85 115.10 15 60.00
11515. Bryce (ribit500) 25 52.83 65.53 2 8.00
11516. s3Bz (reganisgod) 25 93.49 105.50 8 32.00
11517. Gamer (reallyrandomname) 25 137.14 168.63 21 84.00
11518. Radu (rdrnd) 25 61.68 71.44 7 28.00
11519. Raiym (rayimbek) 25 74.23 89.30 7 28.00
11520. Jebaited (raizzel) 25 81.70 94.99 8 32.00
11521. sabir (rabugi) 25 25.10 34.92 4 16.00
11522. Tran (qsang) 25 62.03 78.26 6 24.00
11523. Kuaz (qaz855175b) 25 65.96 78.22 6 24.00
11524. Helmut (psyonara_dvorak) 25 50.89 61.43 3 12.00
11525. Priyanshu (psxuchiha) 25 59.44 72.99 1 4.00
11526. Suven (psuv) 25 58.48 65.17 0 0.00
11527. efthymios (poios_malphite) 25 66.34 77.36 5 20.00
11528. Shivashis (plant99) 25 94.67 111.69 5 20.00
11529. pastamath (pastalavista) 25 56.73 70.46 8 32.00
11530. password (passworder) 25 66.56 73.09 4 16.00
11531. Bella (papidiabolus) 25 60.79 74.82 3 12.00
11532. PandoraOG (pandoraog) 25 56.30 62.92 2 8.00
11533. Onionkreb (onionkreb) 25 116.04 130.43 15 60.00
11534. zr (oilyfishball123) 25 73.68 81.96 7 28.00
11535. Iwan (ocalukivan) 25 18.08 42.90 4 16.00
11536. Say My Name (notreallyasteve) 25 104.38 138.14 10 40.00
11537. Jason (nooneuknow) 25 75.22 85.66 5 20.00
11538. nolan (nolwoods) 25 52.76 60.10 2 8.00
11539. nlf_thebiebs (nlfthebiebs) 25 60.49 70.42 3 12.00
11540. Faizaan (nitroblast) 25 89.17 133.07 15 60.00
11541. nitrox (nitr0x) 25 99.06 117.44 14 56.00
11542. Nishant (nishantdesai1306) 25 73.42 89.86 5 20.00
11543. NHK (nhk451f) 25 61.34 74.11 8 32.00
11544. Jan (natrix_) 25 49.58 61.04 12 48.00
11545. bode (mywaifubestwaifu) 25 64.96 101.73 5 20.00
11546. Jack Pascoe (mrprotyperman69) 25 71.09 90.59 18 72.00
11547. Pickle (mrpicklebody) 25 56.86 68.81 2 8.00
11548. Secret Animals December 15 ... 25 139.76 164.00 17 68.00
11549. bryan (morenomust) 25 70.28 101.44 8 32.00
11550. Kiyo (misterkiyo) 25 84.28 100.88 5 20.00
11551. Edward (mistaek) 25 97.87 119.58 13 52.00
11552. Michelle (minspire) 25 98.42 115.84 12 48.00
11553. Michael Rostom (michaelrous... 25 58.80 65.85 3 12.00
11554. tstats[meratanak] (meratanak) 25 59.81 74.00 8 32.00
11555. Meditate (meditate) 25 94.75 113.63 6 24.00
11556. Yassin (meddyassin) 25 62.70 77.10 7 28.00
11557. ratbastard (mattbierwirth) 25 115.02 136.19 16 64.00
11558. Jeev (masterjeev) 25 55.88 71.86 5 20.00
11559. mangya (mangya) 25 49.69 61.35 4 16.00
11560. mac☮✈ie← →k🥵 (ma... 25 88.49 98.01 9 36.00
11561. Marius (m4ryu5) 25 60.92 69.66 5 20.00
11562. jeakai (lolilo123) 25 100.46 125.39 7 28.00
11563. Mia (lkortebe) 25 128.11 164.11 18 72.00
11564. Sam (lingbing) 25 82.97 94.90 10 40.00
11565. Lily (lilell) 25 110.29 123.69 6 24.00
11566. btonkh (le_shindeplouf) 25 79.43 96.20 25 100.00
11567. abel (lessthanthirtyfive) 25 101.02 110.57 10 40.00
11568. lenux005 (lenux005) 25 65.03 88.56 5 20.00
11569. Leah (leah_is_not_available) 25 89.52 103.68 9 36.00
11570. ❤❤❤ (lavenenoz) 25 118.75 133.57 4 16.00
11571. Preston (lantzer) 25 95.67 127.84 7 28.00
11572. Nun (lackingnight) 25 65.68 83.90 3 12.00
11573. Kriss (kkright) 25 89.18 105.55 9 36.00
11574. Victor (kingofdawn) 25 72.43 94.11 8 32.00
11575. kingcokes (kingcokes) 25 75.22 89.36 3 12.00
11576. susan (kf7hdw) 25 120.10 140.31 13 52.00
11577. Keti (keti_hawk) 25 75.14 89.15 4 16.00
11578. KaloiNa (kaloina) 25 19.83 31.05 7 28.00
11579. Mohammed Julfikar Ali (julf... 25 70.57 89.74 9 36.00
11580. Josh (joshmankey7) 25 112.32 142.50 15 60.00
11581. Jose (josethomas) 25 97.40 111.38 11 44.00
11582. joon (joonleey) 25 61.58 69.72 5 20.00
11583. Joketts (joketts) 25 81.05 95.82 9 36.00
11584. Joseph (jkc7) 25 101.39 113.25 5 20.00
11585. jhairssteven (jhairssteven) 25 59.83 74.61 3 12.00
11586. Super slow (jan_war) 25 70.49 85.51 6 24.00
11587. Jakawat (jakawat) 25 73.41 88.08 6 24.00
11588. space 65 (jacob1361) 25 84.17 111.16 8 32.00
11589. Daniel (intangiblesniper) 25 135.94 167.94 18 72.00
11590. Jonathan (imprettysaxy) 25 122.74 149.46 15 60.00
11591. ikkyu (ikkyu) 25 40.75 49.04 3 12.00
11592. jimy (iceposident) 25 79.00 97.71 8 32.00
11593. joel (ibeatjoeleverytime) 25 100.83 123.26 7 28.00
11594. Ian (ianduu) 25 58.07 68.37 7 28.00
11595. Hen_r.y (h_enry) 25 47.75 55.20 3 12.00
11596. Hossein (hosseinzafari) 25 52.22 60.81 9 36.00
11597. Miles (hauskaz) 25 89.58 109.60 5 20.00
11598. Haribo (haribooo) 25 80.99 94.75 4 16.00
11599. hannah (hannahvilla) 25 98.00 118.17 15 60.00
11600. Free Palestine (halemogpa) 25 57.01 72.54 3 12.00
11601. Gevashkar (gevashkar) 25 67.25 80.89 10 40.00
11602. gDan (gdan) 25 51.27 66.77 5 20.00
11603. shravan (gammarays) 25 74.87 91.22 6 24.00
11604. Alex (fluffehpander) 25 98.64 111.18 14 56.00
11605. Jay (finikin) 25 86.19 99.98 6 24.00
11606. Abtin (fada1) 25 98.99 116.54 13 52.00
11607. Ezio (ezio129) 25 59.31 71.68 4 16.00
11608. Eskah (eskah) 25 74.64 91.62 5 20.00
11609. eril (eril) 25 108.69 119.51 11 44.00
11610. Captain (eren_eager) 25 54.48 66.73 3 12.00
11611. Yaroslav (eloren) 25 70.91 90.81 3 12.00
11612. Elliot (elliot_cooper) 25 58.17 72.73 5 20.00
11613. Elahe (elldora) 25 44.24 58.61 1 4.00
11614. Elias (eliasy7) 25 97.90 125.05 23 92.00
11615. Edwin Salinas (edos4) 25 65.35 80.33 0 0.00
11616. edna (ednanaanaa) 25 58.61 71.78 5 20.00
11617. et (edcolemak) 25 115.35 130.77 12 48.00
11618. Dat (dvorakprodigy) 25 120.86 137.28 12 48.00
11619. Zed_Query_Base (duyanh3897) 25 51.52 78.80 0 0.00
11620. Jess (dragonfire24) 25 82.42 103.42 12 48.00
11621. Dominic (dominic2382) 25 53.00 64.69 5 20.00
11622. DogHole (doghole) 25 132.23 176.60 14 56.00
11623. Dillruba (dishadipa223) 25 37.03 48.39 7 28.00
11624. Dan (diamond98) 25 49.10 56.25 2 8.00
11625. Theo (dhm_learner) 25 21.33 36.47 3 12.00
11626. Rob (destructo91) 25 97.81 115.21 7 28.00
11627. Jay (destroyer1101) 25 60.86 73.96 6 24.00
11628. David (davidjnovak) 25 81.34 102.99 5 20.00
11629. dantheman27 (dantheman8529) 25 66.45 82.17 7 28.00
11630. Daniel (dannybot) 25 78.42 89.23 6 24.00
11631. damafps (damafps) 25 71.82 84.57 5 20.00
11632. maap_yach (crstlgo09) 25 80.25 102.51 7 28.00
11633. Crricket (crricket) 25 76.48 96.17 8 32.00
11634. crocotyper (crocotyper) 25 130.29 154.74 17 68.00
11635. ToTo (complexion) 25 87.61 106.21 9 36.00
11636. Chris (chrischu) 25 61.28 76.66 5 20.00
11637. Chris (chris979) 25 83.76 105.04 5 20.00
11638. Christoffer (chrippa01) 25 71.44 81.61 3 12.00
11639. Lucas (ceebzz) 25 107.69 118.37 10 40.00
11640. Brian (brianyosua) 25 101.71 120.60 11 44.00
11641. Brendon (brenster) 25 45.85 63.78 1 4.00
11642. Bread (breadmonkey) 25 96.98 114.94 9 36.00
11643. blob_mister (blob_mister) 25 105.08 122.74 9 36.00
11644. Cloud (blackcloud010) 25 112.26 127.79 15 60.00
11645. bino_ (bino_) 25 78.23 88.15 6 24.00
11646. B (benfield) 25 59.79 70.46 1 4.00
11647. Joshua (beastjg) 25 89.23 109.77 11 44.00
11648. earlprotyper (beamerboyy) 25 112.58 127.01 13 52.00
11649. Bala (balaboi) 25 69.10 79.88 8 32.00
11650. Joseph (baggs33) 25 102.56 125.20 10 40.00
11651. aerooo (babatunde_olatunji) 25 61.05 82.57 9 36.00
11652. Avaxar (avaxar) 25 74.66 95.61 13 52.00
11653. typing.bro26 (ashokkaji) 25 39.72 52.32 4 16.00
11654. Artorias (artorias_) 25 84.85 101.15 0 0.00
11655. Arjun (arjun_0004) 25 104.28 116.76 11 44.00
11656. Austin (apollo2020) 25 60.14 69.22 4 16.00
11657. Satis (angpogikotalaga123) 25 138.05 156.29 15 60.00
11658. Albert (aneuck) 25 84.75 110.62 11 44.00
11659. Andrei (andreibanc) 25 80.59 96.47 5 20.00
11660. Amin (amin_eatemad) 25 74.12 87.59 4 16.00
11661. Amelia (amelia03) 25 89.41 109.75 10 40.00
11662. Alfred (alfredsando) 25 88.44 103.26 9 36.00
11663. Alex (alex_ryan) 25 67.31 88.67 2 8.00
11664. alexjr977 (alexjr977) 25 51.37 64.88 1 4.00
11665. Akshat (akshatsingh1_) 25 76.95 99.84 6 24.00
11666. A Owadud (akash655) 25 56.93 69.73 1 4.00
11667. Aaron (ajmoore0351) 25 65.43 79.31 5 20.00
11668. Augusto (ahidalgob) 25 81.34 91.01 15 60.00
11669. André (agdf) 25 70.93 78.58 6 24.00
11670. Adrian (adrianmonaghan) 25 90.21 110.85 6 24.00
11671. Adam (adamcoch) 25 84.99 95.52 7 28.00
11672. Dvorak Klaas (acheron) 25 69.85 83.20 5 20.00
11673. ableable (ableford) 25 96.05 109.43 14 56.00
11674. Adarsh (aadi_2301) 25 38.40 48.22 0 0.00
11675. Temuun (moon50) 25 64.95 81.59 3 12.00
11676. Brendan (brendanr) 25 75.24 85.28 4 16.00
11677. Max (jhared06) 25 63.84 74.12 12 48.00
11678. mowglie (mowgliegaming) 25 67.79 79.36 8 32.00
11679. Luke (lukecooper) 25 87.38 102.40 9 36.00
11680. gregge (gregge_v2) 25 42.14 52.87 1 4.00
11681. Lane (lane2295) 25 83.52 103.31 7 28.00
11682. cameron (souregs) 25 57.07 67.18 3 12.00
11683. DonFinn (fegermitn) 25 65.19 81.12 3 12.00
11684. tteessssaa (tteessssaa) 25 62.16 78.64 8 32.00
11685. Angel (aggel333) 25 87.88 103.73 12 48.00
11686. Link (drainn) 25 60.64 75.79 7 28.00
11687. Jooshua (me_no_good_at_typing) 25 75.94 89.06 3 12.00
11688. AllCrumpledUp (stableigloo) 25 107.53 117.58 9 36.00
11689. Herrah (neiljmth) 25 100.27 117.54 11 44.00
11690. Cobi (cobidortch) 25 82.34 98.09 9 36.00
11691. Fang (fangphire) 25 59.11 67.86 4 16.00
11692. ItsAleq (itsaleq) 25 47.21 62.04 3 12.00
11693. J (nordar) 25 60.99 68.09 4 16.00
11694. Mayowa (paitin) 25 82.62 89.72 3 12.00
11695. Bořek (tvojesestra) 25 89.94 113.59 10 40.00
11696. William (siaomai1030) 25 39.91 44.43 4 16.00
11697. Turtle (turtdagon) 25 88.00 107.77 6 24.00
11698. Jose (rotaryjoey) 25 65.89 83.14 7 28.00
11699. Arnoud (arnoud) 25 61.12 75.40 5 20.00
11700. Umbra (umbra69) 25 67.43 77.82 0 0.00
11701. Rubén (ryn_0) 25 39.83 47.49 4 16.00
11702. Halo (hxlox) 25 71.85 89.71 16 64.00
11703. t11h (t111h) 25 42.95 52.12 2 8.00
11704. bau (padam21) 25 78.17 94.10 6 24.00
11705. Idontknow (practice420) 25 65.77 77.10 4 16.00
11706. Mobin (nibomilad) 25 42.51 52.34 2 8.00
11707. Pulkit (the_tratios) 25 41.28 52.97 4 16.00
11708. C (re4gd) 25 66.24 93.09 3 12.00
11709. poopoo (nofaceman_mp4) 25 69.14 93.77 7 28.00
11710. Sikais (sikais) 25 48.36 57.17 24 96.00
11711. Fighter (fighter23) 25 33.26 40.15 7 28.00
11712. DragonKingCosmos (dragonkin... 25 59.75 79.11 8 32.00
11713. Pasto (pasto_gris) 25 72.22 92.44 4 16.00
11714. Shanto (hi_shanto) 25 49.13 64.05 3 12.00
11715. v33 (__v33__) 24 62.74 72.64 3 12.50
11716. Zint (_zint_) 24 89.69 121.84 7 29.17
11717. Irarref (_ofking) 24 59.97 73.49 4 16.67
11718. Zockie (zockie) 24 74.27 85.32 7 29.17
11719. Pretty Epic (zimbaycoleo) 24 98.80 125.18 11 45.83
11720. Zhalgas (zhalgas_04) 24 40.88 46.99 12 50.00
11721. Nicolas (yulkbbq) 24 101.20 113.42 7 29.17
11722. leo (ytxqz) 24 59.45 71.56 3 12.50
11723. Alex (your_pal_al) 24 88.58 111.47 11 45.83
11724. Juan (yosohs) 24 73.30 88.23 4 16.67
11725. haryson (xooflo) 24 121.89 140.19 8 33.33
11726. akaxls (xlsbestplayer) 24 59.73 73.11 6 25.00
11727. Wojciech (wpietron) 24 74.68 91.22 7 29.17
11728. Wafles (waflebars) 24 73.07 89.73 6 25.00
11729. whoam (w1ld13) 24 70.00 82.58 5 20.83
11730. my fingers hurt (voltwitz) 24 134.71 151.91 18 75.00
11731. Volta (vo1_ta) 24 92.59 110.97 15 62.50
11732. Vishnu (vishnu_is_goated) 24 71.77 89.48 8 33.33
11733. Vinne (vinne10) 24 98.93 127.85 6 25.00
11734. viincent (viiincent) 24 89.27 119.39 7 29.17
11735. V3RN0N (v3rn0n) 24 103.37 120.03 12 50.00
11736. Utsah (utsah470) 24 42.68 56.65 2 8.33
11737. tylgo (tylgo) 24 95.26 108.43 10 41.67
11738. Joe (tormund) 24 67.48 79.33 7 29.17
11739. Tommy (tommywiseau95) 24 32.91 39.18 1 4.17
11740. Aditya (timmyaditya) 24 65.03 82.51 13 54.17
11741. Tim (timhoxton) 24 41.53 49.70 1 4.17
11742. Mig (timenextluck) 24 47.00 58.99 4 16.67
11743. Thomas (thomasltran) 24 98.40 117.61 9 37.50
11744. TheGreatYS (thegreatys) 24 69.28 79.06 8 33.33
11745. megghraj (thegame365) 24 62.55 77.18 2 8.33
11746. thecourtneyv (thecourtneyv) 24 89.47 105.28 12 50.00
11747. Renata (thebluesavvy1) 24 71.63 87.25 3 12.50
11748. Cocoa (thatclassykid) 24 76.79 88.95 6 25.00
11749. Teh (tehtehteh) 24 121.91 135.93 16 66.67
11750. Teen (teenunicorn) 24 101.42 122.26 9 37.50
11751. Daniel (swampy28) 24 47.30 58.57 3 12.50
11752. Surya (suryathoppae) 24 69.15 99.15 5 20.83
11753. streamix (streamix) 24 76.62 89.62 9 37.50
11754. tyler (ssjtyru) 24 95.53 114.39 5 20.83
11755. Filip (sodic) 24 87.81 105.04 13 54.17
11756. Cass (sneakyperryplat) 24 116.19 141.11 11 45.83
11757. Blake (skidaddle) 24 96.82 125.39 6 25.00
11758. sircle (sircle) 24 67.25 75.73 5 20.83
11759. shot607 (shot607) 24 124.03 142.11 19 79.17
11760. shoobb (shooby28) 24 85.54 102.51 7 29.17
11761. Dankey Kang (shabooty) 24 120.61 137.05 14 58.33
11762. Sean (sfeendog) 24 74.95 86.11 1 4.17
11763. Sejer (sejert) 24 73.37 93.53 9 37.50
11764. scor (scorbalope) 24 72.46 84.15 4 16.67
11765. Ankit (savage_floppy) 24 56.70 68.18 18 75.00
11766. abatt (sas_1100) 24 97.85 118.70 8 33.33
11767. Santiago (santi_ooo) 24 60.99 73.81 8 33.33
11768. Salzd (salzd) 24 73.24 85.12 4 16.67
11769. salmonjerky (salmonjerky) 24 118.30 137.98 12 50.00
11770. Ryo (ryonamba) 24 75.49 94.31 3 12.50
11771. Morple (roubry) 24 52.71 61.83 5 20.83
11772. vroom (rott3n) 24 101.95 118.48 11 45.83
11773. Juan (robbyro10) 24 74.18 85.25 11 45.83
11774. Red (redhood07) 24 91.05 104.71 8 33.33
11775. Andy (realasianjesus) 24 97.65 109.93 7 29.17
11776. Randhy (randhy456) 24 86.07 99.27 7 29.17
11777. ibm model m (qpaper) 24 82.95 97.82 7 29.17
11778. elvi (puddingbb) 24 66.92 74.43 6 25.00
11779. poornoday (poornoday) 24 44.64 52.55 3 12.50
11780. Babu (pinklamborghini) 24 97.58 120.02 17 70.83
11781. Hoopty (phantommonk) 24 108.17 121.28 18 75.00
11782. Zöri (pevisa) 24 66.81 82.21 8 33.33
11783. Soumyadip (pelitza) 24 77.66 90.71 3 12.50
11784. paul (paulb20071106) 24 85.52 99.95 8 33.33
11785. PL (patrick_legrand) 24 67.67 81.32 7 29.17
11786. Parker (parqr) 24 81.75 97.38 6 25.00
11787. parasjeet (parasjeet_singh) 24 21.27 30.29 7 29.17
11788. 失败者 (palmtreeeee) 24 88.96 101.76 9 37.50
11789. sausage fingers (otterrr) 24 99.90 127.01 11 45.83
11790. Pj (orchrist) 24 85.37 106.57 2 8.33
11791. Nicholas (omzero) 24 71.25 82.80 5 20.83
11792. Chayton (omenop) 24 65.71 78.74 18 75.00
11793. lol (nutmyballs) 24 88.76 96.67 10 41.67
11794. Dave (nut4) 24 90.25 113.34 5 20.83
11795. Not_Orious (not_computer) 24 111.36 132.76 10 41.67
11796. Leung (noobie_markie) 24 77.87 92.11 4 16.67
11797. Viet (noobaxereport) 24 70.63 82.37 5 20.83
11798. Nono (nono11jp) 24 77.12 92.84 7 29.17
11799. Noah (noaboston) 24 60.80 79.31 3 12.50
11800. Nivekdood (nivekdood) 24 94.04 123.24 13 54.17
11801. Ryan (ninjacowwizard) 24 67.95 86.75 6 25.00
11802. MD Nasir Uddin (nasiruddin1... 24 33.33 45.11 1 4.17
11803. Ruufa (narwhal_cream) 24 58.31 73.16 5 20.83
11804. Nachito007 (nachito007) 24 51.58 67.15 4 16.67
11805. ISRAEL SPEED RACER (nabong) 24 106.31 129.27 20 83.33
11806. Muhammadsiddiq (muhammadsid... 24 46.34 54.97 4 16.67
11807. MrFunk (mrfunkee_) 24 57.20 68.06 6 25.00
11808. mags (moopymags) 24 113.50 143.99 21 87.50
11809. Mohsen (mohsenbing) 24 37.57 44.22 2 8.33
11810. Mohamed (mohamed5550) 24 52.12 64.16 2 8.33
11811. Michael (mkelnei) 24 74.36 90.09 7 29.17
11812. Michael (michaz) 24 61.09 68.34 4 16.67
11813. Brandon (mibbrandon) 24 68.85 78.08 4 16.67
11814. Matías (mendezmatias) 24 51.72 63.48 0 0.00
11815. Michael (mddover) 24 62.01 72.46 6 25.00
11816. Mariol (mcakalli) 24 60.04 70.31 5 20.83
11817. mayo (mayo_tp01) 24 110.16 137.78 3 12.50
11818. Matty (matty_b_raps) 24 71.53 86.84 3 12.50
11819. Matěj (mates542cz) 24 57.76 71.58 3 12.50
11820. M5 (mariahendrikx) 24 105.13 129.64 10 41.67
11821. Arslan (malikarslan) 24 62.27 80.47 7 29.17
11822. Bart (madhavgoyal) 24 70.52 85.06 4 16.67
11823. Macklin (macklin123) 24 92.01 100.86 8 33.33
11824. Lo_key (lo_key) 24 76.39 87.66 4 16.67
11825. LLyn (llyn) 24 88.47 110.16 7 29.17
11826. David (litening72) 24 68.07 78.79 4 16.67
11827. Markus (lil_manila) 24 53.69 65.18 2 8.33
11828. LiKeRoMaNiA (likeromania) 24 73.31 82.12 4 16.67
11829. lexi (leximeow) 24 98.77 119.99 10 41.67
11830. TinyTim (lavoiet) 24 72.46 84.98 4 16.67
11831. Andre (lapp13slaf) 24 70.60 86.02 5 20.83
11832. Laet (laet99) 24 108.03 124.61 12 50.00
11833. Jen (ladyjen) 24 38.08 46.55 0 0.00
11834. Kaiden (ksetay) 24 65.43 84.12 5 20.83
11835. Pavan (kpavankotesh) 24 75.07 92.38 11 45.83
11836. Deven (kikaliyo) 24 79.02 94.66 5 20.83
11837. Kevin (kevink1844) 24 73.16 86.49 7 29.17
11838. Kevin (kevchen0908) 24 77.57 90.92 4 16.67
11839. D4Backdoor (keskin) 24 85.35 103.85 4 16.67
11840. Kelvin (kelvinohhh) 24 64.30 78.99 6 25.00
11841. Will (karl__marx) 24 109.94 144.74 18 75.00
11842. Kaori (kaori13) 24 58.28 69.11 4 16.67
11843. Junle (junlez) 24 82.91 99.31 10 41.67
11844. Jeff (jschillr) 24 61.30 75.63 7 29.17
11845. JN (jnnnn) 24 78.36 85.25 7 29.17
11846. D3athStArBaNana_63 (jmsmnlpz) 24 51.51 67.69 5 20.83
11847. Jay (jaydhanani36) 24 81.39 94.88 9 37.50
11848. Stivang96 (janse122) 24 90.08 114.39 13 54.17
11849. Jan (janpaint4221) 24 88.96 106.81 6 25.00
11850. Jack (jacktheoven) 24 97.84 110.90 9 37.50
11851. Will (iyeiye_captain_) 24 85.73 102.82 5 20.83
11852. Ian (imatson9119) 24 89.60 102.90 8 33.33
11853. ibizabroker (ibizabroker) 24 66.21 73.69 5 20.83
11854. Heathe (hwhl) 24 101.06 119.39 9 37.50
11855. Josh (hsoj1) 24 79.79 87.24 5 20.83
11856. hrithik (hrithikmanoj) 24 58.52 66.37 5 20.83
11857. Henry (hongquan448) 24 62.95 74.42 5 20.83
11858. HiroM (hirom) 24 91.97 114.00 12 50.00
11859. Unknown (hikaru0628) 24 42.50 55.08 5 20.83
11860. HiHowIsYourDay (hihowisyour... 24 101.07 125.45 3 12.50
11861. Tong (hiddenbanana) 24 80.24 94.25 5 20.83
11862. Hendeen (hendeen) 24 55.76 68.23 3 12.50
11863. Daniil (hate_machine) 24 56.57 66.83 13 54.17
11864. Hasano (hasano14) 24 67.22 83.21 8 33.33
11865. Harsh (harsh_dubey) 24 34.88 46.46 1 4.17
11866. Hackai (hackai) 24 45.58 57.47 4 16.67
11867. Yuji (gugox10) 24 120.92 139.53 16 66.67
11868. Grzegorz (gorix) 24 74.15 88.36 3 12.50
11869. Adel (goldfist10) 24 112.02 127.80 11 45.83
11870. krabbygail (goldenxy) 24 81.19 97.59 12 50.00
11871. nothing (galaxiedhomerow) 24 144.83 178.11 18 75.00
11872. fr33ak (fr33ak) 24 63.77 73.96 5 20.83
11873. Chidum (flashstriker007) 24 58.61 79.08 4 16.67
11874. Alan (fireslayer1090) 24 78.51 91.78 5 20.83
11875. Filip (finicky_) 24 71.65 91.15 7 29.17
11876. fiaz (fiazmahmud) 24 48.87 57.71 4 16.67
11877. frank (fastfingersfrank) 24 116.56 137.60 12 50.00
11878. Famesh (fampatel) 24 92.74 120.96 8 33.33
11879. ExpensiveDinner (expensived... 24 113.72 131.93 8 33.33
11880. Memes (ethanlee70) 24 93.51 114.12 9 37.50
11881. Advait (epik_guy1) 24 95.25 113.41 7 29.17
11882. Matts (emzee_a) 24 73.27 86.74 8 33.33
11883. Aviv (el_duckino) 24 76.52 95.29 9 37.50
11884. Ellis (ellismk123) 24 64.40 74.17 3 12.50
11885. ELGstud (elg_stud) 24 46.02 58.15 2 8.33
11886. dxriuz_dvorak (dxriuzdvorak) 24 43.47 51.24 4 16.67
11887. dugnutt (dugnutt) 24 65.63 77.38 6 25.00
11888. DTConks (dtconks) 24 75.96 93.58 6 25.00
11889. aaron (doxxa) 24 125.72 140.91 12 50.00
11890. Mangekyou (double_mangekyou) 24 108.04 131.85 13 54.17
11891. Damn kid (dezzer_legend) 24 88.33 101.94 9 37.50
11892. Dairy (derryne) 24 76.04 88.27 9 37.50
11893. Alish (dek_u) 24 85.45 106.09 9 37.50
11894. Beaster (deeznutshagotch) 24 113.57 132.84 14 58.33
11895. Dave (davidneymar) 24 41.52 49.83 0 0.00
11896. sourabh (datikas) 24 63.67 69.33 5 20.83
11897. Darth (darthhideoustheugly) 24 74.28 82.49 6 25.00
11898. sweet chili (darinoee) 24 119.17 137.10 20 83.33
11899. Dan (danisoz12) 24 95.22 111.24 12 50.00
11900. Cyrus (cyrusnthng) 24 45.46 59.36 2 8.33
11901. Cyptre (cyptre) 24 59.10 77.64 6 25.00
11902. Jonah (cuz_im_batman) 24 66.36 86.85 5 20.83
11903. Controller Player (countarc... 24 69.97 88.66 7 29.17
11904. voopx (coopnorth) 24 67.78 87.05 5 20.83
11905. Azzy (clavanonoyes) 24 57.11 65.30 1 4.17
11906. (っ◔◡◔)っ ♥ Tyoma... 24 86.54 93.48 7 29.17
11907. Charlie (charlibre) 24 85.03 107.31 8 33.33
11908. Celest (celestialpha) 24 46.69 61.26 3 12.50
11909. Henry (ceeefore) 24 67.78 81.57 3 12.50
11910. Christian (cbc2508) 24 93.72 113.33 12 50.00
11911. Cau Be (caubelangthang) 24 93.49 111.02 10 41.67
11912. Carlo (carlofernandez) 24 72.39 86.73 5 20.83
11913. Christian (cardonacx) 24 73.01 88.45 10 41.67
11914. cam (cam69) 24 80.98 100.23 13 54.17
11915. Burr (burrasaurs) 24 76.29 97.72 10 41.67
11916. Please use an appropriate n... 24 73.46 85.63 4 16.67
11917. v0rtex- (bouraoui) 24 66.64 75.47 8 33.33
11918. Sand (bizzarehuman) 24 58.16 70.20 3 12.50
11919. bindyy (bindyy) 24 116.48 136.98 16 66.67
11920. Bill (bill_slouch) 24 95.94 118.64 11 45.83
11921. Lucky (bigowlyeyes) 24 100.16 112.93 7 29.17
11922. Benjamin (ben_jam_in_franklin) 24 79.27 95.57 3 12.50
11923. Bea (bearainbow) 24 84.38 100.32 6 25.00
11924. Brandon (bandantran) 24 105.46 128.80 12 50.00
11925. baha (bahakz) 24 89.98 101.85 9 37.50
11926. Bacte (bacte73) 24 74.87 86.26 9 37.50
11927. Aaron (ayildiztas) 24 60.19 77.03 2 8.33
11928. (aus10_) 24 125.53 142.02 18 75.00
11929. Ashraful (ashraful_alam) 24 54.63 65.51 3 12.50
11930. Dark (arunabh_kalita) 24 48.40 57.61 4 16.67
11931. An (an_dtr) 24 47.38 58.87 1 4.17
11932. Duy (anthonytom) 24 114.09 128.06 10 41.67
11933. Andreas (andysave) 24 78.33 94.27 7 29.17
11934. Alex (alex_ofl) 24 77.56 90.76 5 20.83
11935. Basma (airiii) 24 43.66 59.14 4 16.67
11936. icosaedru (achimia) 24 87.64 98.29 6 25.00
11937. abyl (abyl_10) 24 56.01 65.69 4 16.67
11938. Abrar Shah (abrar_shah) 24 40.80 52.55 4 16.67
11939. abdul (abdullateef4u) 24 60.71 69.87 4 16.67
11940. Dude (48023984) 24 102.90 113.97 14 58.33
11941. root (1_root_1) 24 71.87 83.63 6 25.00
11942. 1938 (1938) 24 57.04 83.79 2 8.33
11943. Saksham (0_lol_0) 24 97.92 109.86 17 70.83
11944. senneres (senneres) 24 66.92 80.69 5 20.83
11945. die (dot65436) 24 54.54 68.50 7 29.17
11946. Brady (bradychen) 24 51.06 60.67 4 16.67
11947. Jackson (yoshiproz) 24 70.82 89.09 7 29.17
11948. Cyrusssss (cyrusysleung) 24 70.96 86.44 4 16.67
11949. don't (silversnow468) 24 59.64 69.93 10 41.67
11950. jonas (jonas889) 24 79.35 94.85 6 25.00
11951. Winter (winterlem) 24 90.98 104.45 11 45.83
11952. Usotsuki (usottsuki) 24 72.88 84.87 5 20.83
11953. Arthur (s4kko_) 24 49.36 62.05 0 0.00
11954. Smac (smacpats) 24 103.33 117.70 8 33.33
11955. Sijiur (Rohingya) (sijiur) 24 33.21 41.04 4 16.67
11956. Rachel (purplerhythm) 24 52.41 61.64 6 25.00
11957. jodie (jodieodieodie) 24 45.87 64.38 0 0.00
11958. Hell (killsohard) 24 65.79 82.02 13 54.17
11959. Ananyobrata (ananyo141) 24 64.39 74.56 5 20.83
11960. Gnomes (gnomes_) 24 59.54 71.97 3 12.50
11961. Bolio (killerjimt) 24 38.29 47.48 1 4.17
11962. Apperentice (kkfarhan23) 24 43.05 52.71 1 4.17
11963. Nick (darknitexbl) 24 50.68 65.42 2 8.33
11964. Haseeb (redhaseeb) 24 88.26 102.40 8 33.33
11965. Khushank (khushsaini) 24 43.85 51.06 2 8.33
11966. Daniel (danield3176) 24 82.83 98.83 7 29.17
11967. Ghal (ghal_dj) 24 98.95 117.96 9 37.50
11968. Diego (perroabuelo) 24 47.85 60.69 3 12.50
11969. Kai (kai_phoenix) 24 52.54 65.05 4 16.67
11970. ryxn (ryanwithax) 24 43.91 52.01 1 4.17
11971. Pax (paxx94) 24 65.22 87.30 7 29.17
11972. corny (cornyjacobie) 24 70.61 88.94 22 91.67
11973. Jeremy (geekjeremy) 24 64.17 74.29 8 33.33
11974. Sumreen (sumreenr) 24 93.18 138.72 7 29.17
11975. Arunava (wizardio) 24 53.57 67.22 3 12.50
11976. Paulo (paulobacelar) 24 79.11 91.28 7 29.17
11977. Abhinav (kodeabhi) 24 49.37 62.23 1 4.17
11978. Olivia (b00bs69) 24 56.95 68.26 6 25.00
11979. ad (adex69) 24 53.69 63.42 3 12.50
11980. Anupam (anupammajhi) 24 47.07 53.76 4 16.67
11981. Cabbage (cabbage_) 24 82.65 101.08 8 33.33
11982. Toby (_toblerone_) 23 78.56 97.86 5 21.74
11983. Yuudai (zilchdear) 23 46.84 54.53 2 8.70
11984. maciek (zadtrie) 23 71.42 91.85 8 34.78
11985. Yarnell (ytoei) 23 75.57 92.09 5 21.74
11986. Yelnur (ye1nur) 23 48.54 56.06 4 17.39
11987. craster (yaboiedgy) 23 82.44 96.16 11 47.83
11988. Kevin (xertheon) 23 108.57 129.11 7 30.43
11989. xCocoaCrazy (xcocoacrazy) 23 75.08 93.17 9 39.13
11990. tstats[wimbleimble] (wimble... 23 94.55 122.00 5 21.74
11991. Georgios (vlassonio) 23 53.59 64.12 5 21.74
11992. BadTyper (very_really_bad_t... 23 43.56 50.40 3 13.04
11993. Varun (varuns924) 23 82.79 105.18 6 26.09
11994. uuind (uuind) 23 117.66 134.81 11 47.83
11995. Aaron (unrealapex) 23 82.59 102.30 11 47.83
11996. andrei (uncleandre) 23 88.08 119.52 8 34.78
11997. speed420 (uhfees) 23 59.01 71.97 2 8.70
11998. Jotaro (udetha) 23 86.48 106.69 6 26.09
11999. Uddi (uddi_racer19) 23 49.63 63.28 2 8.70
12000. Sorin (tur7le0010) 23 97.38 119.31 14 60.87
12001. Tselmeg (tselmegkh) 23 101.67 126.54 15 65.22
12002. Hao (truonganhhao) 23 87.45 107.82 8 34.78
12003. Sheraz (toruowo) 23 87.39 109.15 8 34.78
12004. Aj (toppingsplease) 23 99.22 107.59 11 47.83
12005. tobia (tobiabig) 23 52.48 61.88 3 13.04
12006. Stray (tiemevanderhoek) 23 50.18 67.84 6 26.09
12007. bob (thot_slayer420) 23 90.78 107.58 3 13.04
12008. Thor (thorthegodoflightning) 23 38.96 53.92 1 4.35
12009. SenPIe (thesenpie) 23 75.24 88.77 5 21.74
12010. Natapon (tetracarboxylic) 23 75.94 84.84 4 17.39
12011. Tayyab (tayyabismail149) 23 50.60 65.69 7 30.43
12012. Tandy (tandysu) 23 107.46 134.62 12 52.17
12013. syswinh (syswinh) 23 89.95 103.65 9 39.13
12014. Steve (stevocat) 23 68.55 80.20 12 52.17
12015. Turtle (stevetheturtle) 23 76.32 86.07 5 21.74
12016. Cássio (ssscassio) 23 80.70 91.47 3 13.04
12017. Fite (squidderp) 23 90.35 107.36 7 30.43
12018. devansh (speedcuber05) 23 45.27 54.06 4 17.39
12019. spectrophobia (spectrophobia) 23 38.95 51.19 1 4.35
12020. Slim (slimkevin) 23 60.00 67.03 4 17.39
12021. Dkippy (sirdunklenutsiii) 23 92.39 108.47 6 26.09
12022. Roi (sibo532) 23 86.54 102.02 6 26.09
12023. shebaw (shebaw) 23 97.19 115.28 7 30.43
12024. Justin (shaowen) 23 118.31 131.49 12 52.17
12025. shanranran (shanranran) 23 93.91 111.23 7 30.43
12026. Shamim (shamimiqram) 23 56.86 68.83 3 13.04
12027. Mazze (shadyone) 23 74.35 86.87 10 43.48
12028. oShado (shadowwalker15) 23 87.20 108.25 6 26.09
12029. Sebastian (sfmiguez) 23 96.99 127.37 9 39.13
12030. Ellie (senimoo) 23 116.68 150.67 11 47.83
12031. Kayden (semitart) 23 49.19 59.08 4 17.39
12032. John (seaofnonsense) 23 99.40 118.28 10 43.48
12033. scsdawg (scsdawg) 23 77.75 102.55 5 21.74
12034. santi (santimcc) 23 61.44 69.22 2 8.70
12035. Sameer Gupta (sammyonswitch) 23 72.44 85.09 4 17.39
12036. Chris (s3r4ph) 23 45.49 59.01 2 8.70
12037. Lukas (s018296) 23 108.94 124.90 12 52.17
12038. NotRyan (ryantheexiled) 23 98.57 123.41 11 47.83
12039. justin (rold_jisas) 23 80.12 91.40 5 21.74
12040. richardhead (richardhed) 23 123.35 148.55 13 56.52
12041. Kyle (rexi_typed_you) 23 60.79 69.06 13 56.52
12042. Remark (remark21) 23 76.50 86.85 8 34.78
12043. Reflex1on (reflexion) 23 91.44 113.63 7 30.43
12044. RedXIII (red_xiii) 23 81.95 94.40 7 30.43
12045. ¯\_(ツ)_/¯ (raredutchkil... 23 85.05 103.87 6 26.09
12046. Rajesh (rajeshpanjiyar) 23 41.95 51.41 3 13.04
12047. R4ven (r4ven) 23 80.73 94.83 4 17.39
12048. Adrian (r3ko5) 23 81.20 98.50 4 17.39
12049. Hayden (r1plee) 23 72.21 94.04 8 34.78
12050. qtq🐇🍊🍰 (qtqtq) 23 91.16 103.48 5 21.74
12051. Jacob (q2q1wwe) 23 82.98 96.92 6 26.09
12052. Trent (priyank45) 23 83.09 109.37 14 60.87
12053. Pritom (pritom_99) 23 56.53 67.80 4 17.39
12054. Nobody (pengfire) 23 95.39 116.62 10 43.48
12055. Peanut (peanutpocket) 23 119.70 135.69 8 34.78
12056. paffy (paffy77) 23 87.75 103.31 8 34.78
12057. Paddy (paddyclohessy12) 23 68.99 81.21 7 30.43
12058. P00nsl4y3r (p00nsl4y3r) 23 64.39 76.17 4 17.39
12059. hi lol (overdosednq) 23 126.70 158.63 17 73.91
12060. Osfbro (osfbroofficial) 23 44.73 52.14 3 13.04
12061. أُمنية (omnitypewriter) 23 86.42 105.44 6 26.09
12062. Bakdauet (omir) 23 53.38 63.11 2 8.70
12063. Ojal (ojhhhal) 23 96.26 105.89 6 26.09
12064. Nicholas (nxcholas) 23 80.85 89.97 6 26.09
12065. Nuboo (nuboo) 23 117.15 142.94 14 60.87
12066. Kian (noob123af) 23 61.26 73.06 3 13.04
12067. noob (nonquitburner) 23 125.11 146.23 10 43.48
12068. Nesto (nesto2042) 23 72.44 91.45 2 8.70
12069. Tijme (nemjit) 23 70.26 83.55 4 17.39
12070. Neeraj (neeraj_kumar_coder) 23 77.32 93.18 4 17.39
12071. Stephanie (naderly) 23 76.46 85.93 4 17.39
12072. Murad (muradeliyev) 23 69.01 82.24 8 34.78
12073. Hugh (mrpiface101) 23 109.38 124.66 11 47.83
12074. Max (mpschorr) 23 94.86 111.25 2 8.70
12075. Max (mpegasus) 23 97.94 107.43 8 34.78
12076. Moy (moy231) 23 72.33 83.90 6 26.09
12077. Anton (mojo98) 23 67.63 91.28 6 26.09
12078. Tom (mlgplayer) 23 90.44 109.65 7 30.43
12079. Mimsqueeze (mimsqueeze) 23 75.56 94.60 6 26.09
12080. Mike (mike_shen) 23 96.70 115.75 10 43.48
12081. Mike (micko34) 23 86.52 116.26 5 21.74
12082. Barry Allan (messylingard) 23 69.75 80.82 3 13.04
12083. amy (mesemi) 23 98.36 115.40 12 52.17
12084. Caleb (meow4562) 23 88.75 106.76 5 21.74
12085. Faruk (megaracer_faruk17) 23 89.42 106.35 10 43.48
12086. Maestro (meessus) 23 104.19 131.62 20 86.96
12087. MaxMul (maxmul) 23 83.22 106.89 11 47.83
12088. Max (maxmeza) 23 80.63 99.01 6 26.09
12089. Matthew (matthew_hall2) 23 95.93 119.11 6 26.09
12090. Makhambet (markiz) 23 76.70 94.37 4 17.39
12091. Marcus (marcus_t) 23 68.81 78.41 5 21.74
12092. Manzood (manzood) 23 83.14 93.34 7 30.43
12093. Mangopod (mangopod_) 23 62.49 75.50 6 26.09
12094. Capricorn (mangosquirrel) 23 105.95 119.65 9 39.13
12095. Yuan (lydxlx) 23 123.54 130.87 4 17.39
12096. lunarised (lunarised) 23 62.67 71.71 7 30.43
12097. Lumberjack (lumberpython) 23 89.48 109.43 7 30.43
12098. Lucas (lucasppestana) 23 66.77 83.21 5 21.74
12099. Potato (lovlieice) 23 95.54 119.07 13 56.52
12100. sarang (lovejoy) 23 54.30 63.10 1 4.35
12101. Minwoo (lotuszero) 23 66.39 78.64 3 13.04
12102. Carlos (lagoon_monster) 23 80.47 90.44 6 26.09
12103. laamiya (laamiya) 23 43.11 49.09 2 8.70
12104. Kyle (kyleoh) 23 90.19 106.11 9 39.13
12105. krishna (krishnad) 23 74.14 86.54 2 8.70
12106. Miko (kimonoso) 23 87.61 102.17 8 34.78
12107. ye ye (kermatt3) 23 92.85 130.16 10 43.48
12108. kalirocketdev (kalirocketdev) 23 64.26 83.78 5 21.74
12109. Eman (kaido187) 23 48.47 60.13 3 13.04
12110. Jem (j_enchev) 23 78.65 91.00 5 21.74
12111. Justine (justine_02003) 23 47.42 61.22 1 4.35
12112. Foolish (justashish4556) 23 59.28 66.86 8 34.78
12113. Joel (jsandyt9) 23 91.17 111.29 5 21.74
12114. Jon (jrowephoto) 23 94.38 125.48 7 30.43
12115. Johanna (johanna9813) 23 81.65 91.67 8 34.78
12116. Jiang (jghjianghan) 23 85.73 109.53 6 26.09
12117. Jacobi (jevtrout) 23 64.82 77.03 5 21.74
12118. CommanderJiJi (jeromealmogu... 23 54.93 67.14 3 13.04
12119. McVitie’s (jdfjdghnjdjdf) 23 51.70 64.74 4 17.39
12120. Jc (jcamp0) 23 66.42 79.00 7 30.43
12121. Andre (jahraccoon69) 23 103.57 115.33 10 43.48
12122. Jahir (jahir___) 23 58.31 72.42 6 26.09
12123. Jerry (j27smith) 23 70.11 100.86 5 21.74
12124. JoY (j0y_y) 23 73.14 86.50 4 17.39
12125. ISeeRed (iseered) 23 62.59 73.92 5 21.74
12126. IRDunno (irdunno) 23 57.91 70.18 7 30.43
12127. ilman (ilmannafj) 23 35.49 40.97 1 4.35
12128. Splitslayer Chill (ikramnisar) 23 50.39 68.04 5 21.74
12129. Devanshu (iamdevanshu) 23 50.26 55.88 3 13.04
12130. WiteLightningHWD (hwds1) 23 73.98 99.26 7 30.43
12131. Michael (hulkmagnet) 23 87.96 99.42 6 26.09
12132. asian (hugeterror) 23 72.38 88.52 5 21.74
12133. Heino (hsirvio) 23 107.90 117.42 16 69.57
12134. House (houses) 23 81.79 96.42 3 13.04
12135. James (hot_panty_dropper) 23 94.74 104.77 5 21.74
12136. stand with russia (hellofki... 23 71.58 82.20 9 39.13
12137. heehee (heehee2) 23 55.06 70.12 2 8.70
12138. hau (hau1228) 23 73.30 93.59 5 21.74
12139. Hani (hanibchl) 23 73.52 88.05 9 39.13
12140. HallowSamurai (hallowsamurai) 23 32.77 38.56 1 4.35
12141. gog (guanquan) 23 80.07 96.45 12 52.17
12142. Johnny (gonzales_x_dumpy) 23 114.43 131.08 11 47.83
12143. geo (geomateyt) 23 55.13 68.85 20 86.96
12144. Geirdriful (geirdriful) 23 81.63 99.21 4 17.39
12145. GameChaos (game_chaos) 23 97.52 113.15 9 39.13
12146. Gotcha (g0tcha) 23 90.51 116.77 7 30.43
12147. G Dragon (g.w.l.griffiths@b... 23 63.08 76.97 5 21.74
12148. F u r u y á (furuya) 23 110.67 129.36 10 43.48
12149. Даниел (freewaydani) 23 99.22 122.03 13 56.52
12150. Floixman (floixman) 23 90.17 110.65 11 47.83
12151. James (fisher_man08) 23 36.10 41.98 2 8.70
12152. Dan (fireliar) 23 72.18 79.24 3 13.04
12153. Jimrey (filipinoboi) 23 82.78 108.07 8 34.78
12154. Fiha (fiha16) 23 59.01 71.53 11 47.83
12155. Mercapto (fast_typer10) 23 48.45 63.92 1 4.35
12156. wuque pink (exanta) 23 95.57 122.83 7 30.43
12157. Muhammad (exampz) 23 64.88 81.70 4 17.39
12158. Danny (evolt) 23 66.52 79.73 6 26.09
12159. Theodore (erodoeht) 23 93.59 111.28 8 34.78
12160. Eragon (eragon_kaizen) 23 29.50 44.11 4 17.39
12161. Yihoi (equation) 23 103.49 117.20 15 65.22
12162. Alex (epintus) 23 95.87 112.67 12 52.17
12163. KaoruLikesMakotoYukiTooMuch... 23 65.63 79.01 5 21.74
12164. Eliana (elianaswagmama) 23 79.74 104.01 10 43.48
12165. Michael (eilreivax) 23 101.20 117.91 4 17.39
12166. fwEWE (edward3001) 23 101.29 134.56 18 78.26
12167. D (d_4biden1) 23 95.58 107.47 4 17.39
12168. Raghupati (double_toned) 23 65.79 76.35 8 34.78
12169. kaatak_kataak (doggie0985) 23 75.82 97.69 7 30.43
12170. DFA (dj2119) 23 102.69 123.25 9 39.13
12171. Devin (distortedharmony) 23 97.36 125.34 11 47.83
12172. Dimitar (dimitar2424) 23 93.64 111.23 12 52.17
12173. Dillon (dillon147852) 23 67.18 80.28 7 30.43
12174. no ring finger (denebaltair) 23 128.61 145.74 15 65.22
12175. Lulu (def__init__) 23 84.24 101.67 6 26.09
12176. Daryll (daryll_ko) 23 96.48 110.29 13 56.52
12177. dawdad (darkschore) 23 102.26 116.38 12 52.17
12178. lalit (daredevil_5859) 23 66.23 90.40 6 26.09
12179. Dnyanendra (danyk_16) 23 68.47 80.39 6 26.09
12180. Danger Guy (dangerguy) 23 95.11 116.06 9 39.13
12181. Dan (danclevia) 23 65.70 70.93 4 17.39
12182. cynthia (cynthiween) 23 58.19 69.99 6 26.09
12183. cuong (cuongbt91) 23 84.24 92.52 8 34.78
12184. Ari (cuda_) 23 90.43 105.57 10 43.48
12185. jurc (cruj) 23 43.97 51.92 2 8.70
12186. copter28 (copter28) 23 85.82 104.20 9 39.13
12187. Rony (cleff) 23 102.14 125.57 22 95.65
12188. CHi (chiyippi) 23 41.69 54.33 3 13.04
12189. Chez (chezdude) 23 93.10 103.65 12 52.17
12190. Char (char_meleon) 23 87.21 108.28 5 21.74
12191. lixir (catjam) 23 42.68 57.23 2 8.70
12192. cathating89-dvorak (cathati... 23 92.34 116.60 7 30.43
12193. Obama (captnawesome) 23 73.34 84.29 6 26.09
12194. capo (caporv) 23 95.06 108.50 9 39.13
12195. Malupet si (bugret) 23 66.60 80.73 9 39.13
12196. Bree (briannanimal) 23 68.89 87.37 11 47.83
12197. Bread (bread_store) 23 85.55 102.27 5 21.74
12198. Bodzio (boguslav) 23 73.43 84.22 9 39.13
12199. bobaglow (boabglow) 23 75.24 94.87 3 13.04
12200. Figo (bmfc4444) 23 72.57 88.64 6 26.09
12201. Gaurav (blockcipherr) 23 50.47 62.49 1 4.35
12202. blandfoodman (blandfoodman) 23 68.48 83.20 6 26.09
12203. Blaku (blaku03) 23 64.26 75.66 10 43.48
12204. type beats (blackjack245) 23 80.31 99.10 9 39.13
12205. Sean (bigdinky) 23 123.94 145.59 13 56.52
12206. BigBoiB (bigboib) 23 63.79 70.28 5 21.74
12207. BrocK (bhagvat17) 23 47.46 55.63 0 0.00
12208. BigDiqSix9 (bernazrei69) 23 89.05 105.44 10 43.48
12209. Chicken (bbqsauceonmytitties) 23 86.85 103.33 9 39.13
12210. TheGod (bboytheqt) 23 72.07 83.34 7 30.43
12211. Rohan (barney564) 23 72.80 85.29 10 43.48
12212. bambam (bambamshazam) 23 76.06 86.53 8 34.78
12213. Grace (baddestbich69) 23 89.83 101.59 6 26.09
12214. A.S.M.777 (a_s_m_777) 23 84.39 102.56 7 30.43
12215. Ayera (ayera_04) 23 48.02 55.03 2 8.70
12216. Aubrey (awbrey) 23 44.11 59.96 2 8.70
12217. Andrew (awand0806) 23 111.45 129.11 13 56.52
12218. fast_and_curious (asimali246) 23 94.99 109.94 7 30.43
12219. asdf (asdfdsasdfdsasdf) 23 43.93 53.89 2 8.70
12220. Arif (arif224) 23 67.57 78.65 7 30.43
12221. Anduin (anduin2017) 23 85.75 97.34 6 26.09
12222. an0ma1y (an0ma1y) 23 92.59 107.97 9 39.13
12223. Asir Mosaddek (amsakib) 23 64.98 78.36 16 69.57
12224. alieb (alieb) 23 122.95 151.74 14 60.87
12225. Coolman (alibekesanov) 23 57.87 70.58 3 13.04
12226. Aiman (aiman_a) 23 97.84 110.38 10 43.48
12227. Ian (agenti23) 23 111.18 127.96 11 47.83
12228. (accelerated) 23 132.06 150.16 18 78.26
12229. Abhishek (abhi_bharti) 23 48.62 60.93 2 8.70
12230. abelrobot (abelrobot) 23 86.72 104.85 7 30.43
12231. Aarif (aarif_a) 23 85.94 99.37 5 21.74
12232. Wolfie (aaradhya10) 23 80.37 95.30 15 65.22
12233. Andrei (aandreixon) 23 81.18 95.37 6 26.09
12234. I'm stuck (666769) 23 78.54 93.34 5 21.74
12235. mm (613sadnesses) 23 143.84 171.05 15 65.22
12236. Angelo (2teletabiez) 23 66.60 78.87 3 13.04
12237. _ (2sloww) 23 62.41 72.21 4 17.39
12238. Hugo (21039) 23 62.37 73.88 4 17.39
12239. Kevin (1kevstahz) 23 98.55 118.09 16 69.57
12240. 10 (10thetypist) 23 78.44 88.28 4 17.39
12241. Ben (01ben10) 23 89.98 108.67 6 26.09
12242. Zakaria (zakariaarzoo) 23 54.60 63.85 5 21.74
12243. musavir (musa_2020) 23 43.04 49.64 3 13.04
12244. Geoffrey (cybrxt) 23 76.62 89.56 18 78.26
12245. Kevin (aightwhoshitmyself) 23 77.16 92.51 6 26.09
12246. Aldan (aldany) 23 73.83 89.01 7 30.43
12247. samarth joel (samjrin) 23 47.88 57.97 3 13.04
12248. Tommy (tomister99) 23 68.86 80.02 7 30.43
12249. Kerele (kerele) 23 90.45 104.20 12 52.17
12250. Abir (abir247) 23 57.84 79.82 4 17.39
12251. Bas (bas_hoeflaak) 23 77.02 89.55 7 30.43
12252. Jake (jake_craven) 23 57.35 69.82 4 17.39
12253. Michael (zmjcb) 23 65.76 82.11 6 26.09
12254. Spider (spidey13) 23 57.90 73.19 7 30.43
12255. Dredd (dredd20) 23 67.39 87.32 9 39.13
12256. Maltha (malthazen) 23 52.25 64.08 1 4.35
12257. Lezzgo (romsky1) 23 42.12 50.02 2 8.70
12258. Anudari (anuka01) 23 51.76 62.82 0 0.00
12259. Lesley (powerchopper) 23 81.04 99.42 7 30.43
12260. J D (2ralph2) 23 78.52 95.97 23 100.00
12261. Parsa (pblague) 23 51.20 64.42 2 8.70
12262. Mohanad (nogaf) 23 64.70 71.79 4 17.39
12263. EATMYDUST (bwisus) 23 70.11 82.14 10 43.48
12264. eren (eren_lee) 23 35.07 41.98 1 4.35
12265. Christian (mista_chris) 23 38.46 52.53 14 60.87
12266. JULIANA (siwon22) 23 60.90 73.96 4 17.39
12267. fusekle2226 (fusekle2226) 23 36.18 43.43 0 0.00
12268. Alex (alexkov) 23 48.89 57.33 4 17.39
12269. Nik (nikb89) 23 35.02 47.09 2 8.70
12270. geczy (barnageci) 23 98.68 124.85 9 39.13
12271. Nay (naykuku228) 23 58.44 66.76 6 26.09
12272. Kevin (klinklang) 23 76.06 87.19 7 30.43
12273. munna (munna13) 23 48.82 59.04 1 4.35
12274. Airidas (airisr) 23 75.65 87.57 4 17.39
12275. anu (_anu) 23 33.59 41.23 0 0.00
12276. No (jsonwg) 23 92.67 113.04 10 43.48
12277. Yashi (_o_wobless) 22 50.47 64.30 2 9.09
12278. KIRA (_arik_) 22 43.23 49.99 4 18.18
12279. Ryley (zqroh) 22 59.68 71.13 4 18.18
12280. Zerieox (zerieox) 22 84.21 105.14 5 22.73
12281. That One Guy (zbomber21) 22 115.45 142.54 21 95.45
12282. Eric (yuurrrrr) 22 85.86 95.75 5 22.73
12283. Brody (yuumi) 22 109.20 135.14 14 63.64
12284. maro (yenic) 22 64.08 74.52 3 13.64
12285. Yegor (yegorshevchenko) 22 50.13 58.10 2 9.09
12286. Yassine (yassinejedidi) 22 69.59 94.63 13 59.09
12287. Yaroslav (yaros) 22 67.06 77.23 9 40.91
12288. momo (yaomomo) 22 79.58 94.87 9 40.91
12289. Xzereath (xzereath) 22 95.59 119.47 11 50.00
12290. Wattery (xwattery) 22 43.75 53.56 0 0.00
12291. willybear (willybear) 22 83.79 100.03 5 22.73
12292. b (whylxve) 22 69.90 84.13 3 13.64
12293. eqwt (whuhu) 22 113.08 136.02 17 77.27
12294. Jonas (whatisupyou) 22 115.18 129.92 14 63.64
12295. vyst (vystoric) 22 129.17 141.71 16 72.73
12296. Vinit (vspundir) 22 45.68 55.23 1 4.55
12297. vishnu (visshnu) 22 51.97 62.70 1 4.55
12298. VibrantVanilla (vibrantvani... 22 78.16 97.13 6 27.27
12299. Hiren (userhiren) 22 61.01 76.98 6 27.27
12300. Samay (upadsamay387) 22 77.11 93.07 3 13.64
12301. Umid (umid2000) 22 66.10 77.89 4 18.18
12302. Umair (umairkhan) 22 77.96 86.52 7 31.82
12303. typingboob (typingboob) 22 60.72 71.43 4 18.18
12304. Sub-Par (typerslower) 22 111.13 121.25 12 54.55
12305. Rajveer (typerfastboi27_) 22 62.39 85.13 5 22.73
12306. Triloluc (triloluc) 22 91.05 105.85 11 50.00
12307. Ohh (trappy24) 22 77.64 97.74 5 22.73
12308. ucsd_kid (trainermax) 22 157.18 183.32 19 86.36
12309. Theodor (thimius) 22 86.28 101.63 10 45.45
12310. Phil (themonk) 22 98.42 118.35 7 31.82
12311. Chris (themainchris) 22 78.30 90.84 9 40.91
12312. (thebob2713) 22 60.75 77.24 6 27.27
12313. temazh (temazh) 22 77.26 90.59 6 27.27
12314. Caleb (syfulis) 22 91.14 105.63 5 22.73
12315. Sumnerbean (sumnerbean) 22 60.39 80.14 6 27.27
12316. Stranger (stranger_danger1224) 22 45.73 62.99 1 4.55
12317. misty (sprainedartery) 22 95.02 113.58 9 40.91
12318. Papa (solutional) 22 100.12 122.37 11 50.00
12319. Alexander (solchild) 22 75.73 85.78 8 36.36
12320. soda (sodafortwo) 22 72.59 81.35 7 31.82
12321. RougeGod (socratic74) 22 64.73 71.35 6 27.27
12322. ki (slutsupreme) 22 103.61 127.97 6 27.27
12323. green (sleepingducksanddrag... 22 38.89 45.78 2 9.09
12324. Leah (slanted_sunlight) 22 89.68 99.22 9 40.91
12325. rai (siomaipusa) 22 83.64 109.85 12 54.55
12326. simon (simonnoin) 22 64.99 78.06 8 36.36
12327. Shunrai (shunrai1110) 22 95.27 123.25 9 40.91
12328. shorty (shortygiant) 22 53.61 65.82 4 18.18
12329. Shome (shmoe9806) 22 65.43 73.86 5 22.73
12330. catboy (sheepando) 22 111.23 123.19 7 31.82
12331. Sheel (sheel) 22 102.48 113.80 12 54.55
12332. WAKing (shashashane) 22 35.66 43.85 1 4.55
12333. Shannon (scthemonk) 22 64.65 76.23 5 22.73
12334. for reckful (savioshadow) 22 95.53 107.49 8 36.36
12335. SamSkey (samskey) 22 77.68 94.82 7 31.82
12336. Shabylkhan (saken03) 22 43.80 53.67 3 13.64
12337. saad (saad88) 22 63.69 69.51 4 18.18
12338. Felmer (rustycookieee) 22 86.72 96.63 8 36.36
12339. Vaccination (roughandtumble) 22 94.32 106.16 5 22.73
12340. Matt (robertwill) 22 53.11 65.01 2 9.09
12341. road to 100 (roadtoglobalmc) 22 89.47 110.66 6 27.27
12342. ヤギ (ringtack) 22 107.46 124.21 13 59.09
12343. Abdulla (rifah99) 22 79.42 89.28 2 9.09
12344. Ricky (rictsa05) 22 53.00 62.20 2 9.09
12345. Ricebowl (ricebowljohnson) 22 100.28 121.58 6 27.27
12346. rg2005 (rg2005) 22 88.34 111.94 8 36.36
12347. Dan (reddabbler) 22 63.83 83.12 4 18.18
12348. Ryan (rdem) 22 54.17 65.22 0 0.00
12349. Rare (rare_0001) 22 69.07 82.52 6 27.27
12350. Vinchenzo (qwertyuiopps) 22 94.02 112.89 11 50.00
12351. Qwerty (qwertyazerty) 22 81.74 94.82 7 31.82
12352. Saumya (quinn_1) 22 42.57 52.66 3 13.64
12353. Taksa-orn (proudpi) 22 73.44 96.63 3 13.64
12354. Parsa (pr8222) 22 50.36 59.40 1 4.55
12355. Alex (poop_guy) 22 85.08 98.32 3 13.64
12356. Polar (polishpolarbear) 22 86.60 111.42 9 40.91
12357. adr (poison_pwn) 22 74.34 86.87 2 9.09
12358. Ross (pogchammp) 22 84.13 111.07 7 31.82
12359. Pooh (po0h_) 22 35.91 41.97 1 4.55
12360. pjja (pjja) 22 115.79 145.30 14 63.64
12361. a1ways (pi___) 22 104.18 127.50 9 40.91
12362. Silver (pixel47) 22 97.76 112.47 7 31.82
12363. pinto (pintozza) 22 79.38 92.36 8 36.36
12364. Pina (pinapelzx) 22 78.50 94.66 5 22.73
12365. Pedro (pedroarcem) 22 70.23 81.52 1 4.55
12366. pebble (pebblewebble) 22 85.22 100.32 7 31.82
12367. Payu (payu_w) 22 82.76 91.26 1 4.55
12368. Paul (paul1106) 22 66.93 75.52 5 22.73
12369. Paksolek (paksolek) 22 54.11 67.12 3 13.64
12370. V (p3rplexed) 22 89.59 109.39 7 31.82
12371. Overlay1 (overlay1) 22 63.80 72.48 2 9.09
12372. rotscatpill (orangetinman) 22 65.31 74.83 7 31.82
12373. nuttendabutt (nuttendabutt) 22 33.31 37.26 2 9.09
12374. Umidjon (nouser493) 22 56.52 68.89 17 77.27
12375. wii (nobodylovesraymond) 22 85.19 98.52 7 31.82
12376. Nischay (nitrospeed2709) 22 71.94 82.60 8 36.36
12377. Nels (nels_senti) 22 74.17 91.68 9 40.91
12378. naomi (naomii_) 22 59.94 71.03 5 22.73
12379. L + (n1ckname152) 22 93.28 111.15 12 54.55
12380. MrOkapus (mrokapus) 22 61.46 72.13 7 31.82
12381. Moodrammer (moodrammer) 22 64.39 73.30 5 22.73
12382. Md. Mojnu (mojnu20) 22 38.91 43.96 2 9.09
12383. Jacquelyn (mobear06) 22 89.38 115.20 6 27.27
12384. Matthew (mmeppelink20) 22 97.84 127.06 10 45.45
12385. Maddy (mlong) 22 101.46 116.75 11 50.00
12386. Jake (mjakecarlo) 22 72.60 88.75 9 40.91
12387. Michael (michaelyang) 22 79.20 92.91 5 22.73
12388. mercy (mercy_13) 22 64.44 77.52 4 18.18
12389. carlos (mecsczek) 22 105.46 117.89 11 50.00
12390. Zia (mechatronic_beast) 22 50.46 60.44 2 9.09
12391. Paul (mcbain788) 22 95.12 111.41 18 81.82
12392. Max (maxy_boi) 22 59.54 69.60 11 50.00
12393. rohan (maverick_mind69) 22 77.67 100.86 4 18.18
12394. Martin (maniacal_martin) 22 72.57 82.83 2 9.09
12395. Leslie (mamaleslie81) 22 66.02 82.40 4 18.18
12396. Mahdi (mahdiranjbar) 22 74.88 86.31 1 4.55
12397. chie (lotusimpact) 22 86.01 110.87 7 31.82
12398. John (loki83jcg) 22 93.43 111.12 8 36.36
12399. lokar (lokar123) 22 144.66 178.80 13 59.09
12400. Tu Thien (logan1912) 22 64.47 77.71 3 13.64
12401. llihcchill (llihcchill) 22 70.78 84.76 6 27.27
12402. lulu (llaurenlouise) 22 54.21 64.12 3 13.64
12403. Liz (lizfrizzle) 22 103.48 133.88 8 36.36
12404. Light (lighteous_) 22 72.29 94.98 6 27.27
12405. Licery (licery) 22 61.90 73.75 7 31.82
12406. lgwk (lgwk) 22 51.89 58.73 0 0.00
12407. Ryekane🖤 (lechepapu) 22 135.03 164.86 8 36.36
12408. Lapis (lapis_pislapis) 22 125.74 176.13 15 68.18
12409. Kumar (kumar_thapa1) 22 78.47 87.01 7 31.82
12410. krupa (krups) 22 63.68 84.15 3 13.64
12411. Daniel (korice) 22 92.92 124.00 5 22.73
12412. Adam (koltaia30) 22 65.61 79.72 8 36.36
12413. John (kobas) 22 48.14 56.56 1 4.55
12414. Annabelle (kiwi_punk) 22 64.08 80.59 5 22.73
12415. Kiki (kiki_) 22 39.86 46.78 0 0.00
12416. Tushar (kensei22) 22 49.13 54.08 1 4.55
12417. Kenewbi (kenewbi) 22 71.89 88.57 7 31.82
12418. Yakhe (ken007) 22 76.50 91.59 10 45.45
12419. (keegant) 22 152.27 180.56 4 18.18
12420. Kartavya (kartavyajain) 22 96.75 112.59 11 50.00
12421. James (karonar) 22 98.06 110.94 6 27.27
12422. George (karmatimer) 22 73.88 83.44 7 31.82
12423. Karlsen (karlsenlopez18) 22 90.34 108.98 6 27.27
12424. Jacob (karagiannis1) 22 56.34 65.64 1 4.55
12425. Kanzi (kanzi) 22 70.02 80.74 7 31.82
12426. kage (kage_bigfoot) 22 61.78 74.47 7 31.82
12427. j (jy22019) 22 55.02 63.28 0 0.00
12428. Je (jxnnele) 22 56.42 72.57 17 77.27
12429. jujufrost (jujufrost) 22 73.01 86.19 3 13.64
12430. JTD845 (jtd845) 22 94.21 107.96 15 68.18
12431. God (jpaul100) 22 71.94 86.02 6 27.27
12432. Joy (joyyang810035) 22 87.99 118.20 8 36.36
12433. Joshua (joshuamtinker) 22 62.31 87.21 3 13.64
12434. Jordan (jordy2394) 22 41.80 49.40 2 9.09
12435. Jeydin21 (jeydin21) 22 81.49 101.32 9 40.91
12436. Jess (jessnixon94) 22 106.75 129.75 7 31.82
12437. Jen (jenniferrocks07) 22 97.23 115.29 7 31.82
12438. Jenbi (jenbi) 22 75.89 89.04 3 13.64
12439. MrKK (jeldikk) 22 72.65 85.64 4 18.18
12440. J (jduncanlee) 22 106.58 132.33 11 50.00
12441. jazzy (jazzy_trojan) 22 85.39 102.61 8 36.36
12442. jantheman (jantheman21) 22 81.99 119.73 21 95.45
12443. Jack (jackripper9) 22 53.35 78.77 4 18.18
12444. JackbroDaeGamer (jackbrothe... 22 63.65 75.57 7 31.82
12445. izzy (izzyy2) 22 42.71 53.34 13 59.09
12446. Izzy (izzypistilli) 22 78.55 92.93 10 45.45
12447. kentei (itskentai) 22 67.43 80.27 7 31.82
12448. Sigh (isigh) 22 93.48 110.71 11 50.00
12449. InterLude (interlude) 22 101.61 145.49 10 45.45
12450. ooo (inout) 22 85.69 105.84 7 31.82
12451. Ignite (ignite777) 22 68.34 86.69 11 50.00
12452. jay (icantfeel) 22 59.15 70.25 5 22.73
12453. Abhijith (iabz) 22 56.09 71.82 3 13.64
12454. Muhammad (hydra_assassin) 22 61.05 71.95 6 27.27
12455. Josh (hoverdoge) 22 105.89 133.96 10 45.45
12456. Kay (hothandj) 22 90.64 110.42 4 18.18
12457. Jose (hosey_) 22 85.38 104.71 5 22.73
12458. Stefan (hollownaoya) 22 82.09 99.06 4 18.18
12459. Hekonii (hekonii) 22 82.12 95.63 2 9.09
12460. Havenix (havenix) 22 74.14 87.97 4 18.18
12461. Hasan (hasan95) 22 52.07 66.30 1 4.55
12462. Товарищ (hamkor) 22 85.26 97.15 9 40.91
12463. fun (haifiveywivey) 22 98.84 118.78 12 54.55
12464. hack89 (hack89) 22 63.50 68.59 5 22.73
12465. Michael (grumos) 22 83.06 92.24 5 22.73
12466. DaTa (good_vibes) 22 73.22 86.49 8 36.36
12467. Giorillium (goodguygio) 22 73.96 91.86 3 13.64
12468. 🇲🇳 Mazaalai (goodgodk... 22 97.66 117.30 8 36.36
12469. Jordan (godlysharky) 22 54.19 68.49 1 4.55
12470. ginteaa (ginteaa) 22 102.74 116.36 7 31.82
12471. Gijs (gijs__g) 22 72.86 89.63 7 31.82
12472. gela (gelacutie) 22 38.33 50.77 5 22.73
12473. George (gbotev) 22 91.04 101.19 8 36.36
12474. Jordi (gandalfdablack1) 22 69.90 85.23 5 22.73
12475. Gabriel (gabrielbutu) 22 86.99 102.97 8 36.36
12476. Ada (fumingadam) 22 93.98 112.64 10 45.45
12477. Mary (frailmary) 22 83.21 94.18 6 27.27
12478. Floriaan (floriaanvb) 22 51.10 58.94 1 4.55
12479. Atticus crunch (fablesnfobb... 22 91.23 114.54 9 40.91
12480. Elijah (e___) 22 49.63 68.96 1 4.55
12481. Flusercluck (explocow) 22 78.65 99.84 6 27.27
12482. Eslam (eslamalien) 22 45.43 54.72 2 9.09
12483. erka (erkaboy) 22 76.66 92.59 5 22.73
12484. eric (eric5000) 22 112.38 136.04 16 72.73
12485. hotdogs are sandwiches (era... 22 108.28 122.26 6 27.27
12486. Efgeen (efgeen) 22 100.36 129.99 10 45.45
12487. Eeegh (eeegh) 22 54.61 69.70 2 9.09
12488. Dustan (dustank) 22 47.99 57.80 1 4.55
12489. Dullpig (dullpig) 22 70.11 85.49 4 18.18
12490. Frederik (drlambogamer) 22 76.03 86.46 12 54.55
12491. doubleplusgood (doubleplusg... 22 76.36 96.66 3 13.64
12492. Drew (dmart) 22 73.10 88.84 2 9.09
12493. A (djakl) 22 101.45 114.86 8 36.36
12494. Terence (dijkstras) 22 94.42 105.52 5 22.73
12495. Dev (devyadavv) 22 40.99 49.24 0 0.00
12496. Suktinis (destrain) 22 71.99 85.13 4 18.18
12497. Be (deathpulse) 22 113.14 133.46 9 40.91
12498. Daniel (danielyawn) 22 76.46 94.10 2 9.09
12499. Diego (daigo356) 22 60.75 69.67 6 27.27
12500. David (d8vidherrera) 22 108.67 131.91 12 54.55
12501. Could be you (cycosniper) 22 87.69 113.71 6 27.27
12502. SJ (cwr_sej) 22 80.47 95.47 3 13.64
12503. Electric (cuitcuit) 22 97.38 114.19 12 54.55
12504. Stephanie (cuber155) 22 71.63 86.32 7 31.82
12505. Crims0n (crimsonnn) 22 67.18 77.18 3 13.64
12506. Martin (crimsonmartin) 22 76.09 86.37 4 18.18
12507. Roman (cosmic_mythos) 22 51.49 65.98 4 18.18
12508. a (coolguy73) 22 104.45 124.54 19 86.36
12509. Nemanja (conemanija) 22 42.20 53.90 2 9.09
12510. Clemens (cleminator) 22 59.68 66.31 5 22.73
12511. Murtaza (chichawww) 22 44.95 57.21 1 4.55
12512. Captain (captainalliance) 22 67.49 80.26 7 31.82
12513. caesthetis (caesthetis) 22 107.79 128.13 11 50.00
12514. John (caduke) 22 90.58 115.83 9 40.91
12515. LUKAS (brabomclaren) 22 76.37 87.20 6 27.27
12516. Bozsó (bozso) 22 61.75 77.13 5 22.73
12517. Bolt7911 (bolt7911) 22 52.69 70.04 6 27.27
12518. Sabba7 (bodynasser) 22 49.08 61.23 3 13.64
12519. Inferendum (bloonchipper) 22 68.66 95.63 5 22.73
12520. bo (biznessmun) 22 102.03 116.88 15 68.18
12521. Adam (bezwzglednyadas) 22 67.91 81.29 6 27.27
12522. bepis (bepis_pebis) 22 108.94 125.47 8 36.36
12523. swagb0y (beckseamons) 22 81.17 99.60 6 27.27
12524. Bailey (bbrusca98) 22 82.51 98.68 6 27.27
12525. Austin (austinkg) 22 78.85 90.68 3 13.64
12526. Kevin (ashret) 22 137.70 169.02 19 86.36
12527. ashl5t (ashl5t) 22 52.80 80.22 18 81.82
12528. w (artemisfowl3rd) 22 103.89 130.94 11 50.00
12529. Armaan_Gill (armaan_gill) 22 66.14 77.47 4 18.18
12530. FreeHongKong (aquaficial) 22 106.55 130.75 7 31.82
12531. Antonio (antonio_blueballs) 22 64.85 77.25 6 27.27
12532. Annabelle (annaballlzz) 22 84.39 96.57 4 18.18
12533. Anas (anas023) 22 25.22 34.36 7 31.82
12534. Ana Beatriz (anaporumtriz) 22 43.37 50.26 3 13.64
12535. tstats[an1ma] (an1ma) 22 46.13 57.44 2 9.09
12536. area_51 (amritspkt65) 22 62.35 76.13 5 22.73
12537. poorjar (amgminequality) 22 113.26 133.05 9 40.91
12538. slippedfinger (alpha_centauri) 22 68.02 78.73 4 18.18
12539. Jack (alphamale28) 22 98.20 124.58 3 13.64
12540. Jason (alfa871212) 22 47.86 57.44 5 22.73
12541. Alex (alexrichardson) 22 51.75 62.18 3 13.64
12542. Aleksa (aleksa55) 22 66.00 82.61 4 18.18
12543. Arpit (ak_31loaded) 22 43.64 50.14 2 9.09
12544. Aids (aids___) 22 98.46 107.91 5 22.73
12545. Ahnta (ahnta) 22 68.10 80.16 3 13.64
12546. MD ADNAN (adnantech17) 22 67.30 74.11 3 13.64
12547. 7tysins (acedragonheart) 22 85.62 99.25 9 40.91
12548. ABHISHEK PATEL (abhi_0601) 22 40.97 54.76 3 13.64
12549. Abhishek (abhishake12201) 22 40.09 56.72 3 13.64
12550. Ballistic (8a11istic) 22 70.81 78.96 7 31.82
12551. Juice (4804210474) 22 66.64 83.91 4 18.18
12552. Emman (3mm4n) 22 59.78 69.58 6 27.27
12553. Raggy (a11owed) 22 102.02 115.37 16 72.73
12554. vi (vipandas) 22 83.37 103.00 10 45.45
12555. tudgengthorf (tudgengthorf) 22 77.64 93.27 4 18.18
12556. John (johnwenshoe) 22 95.93 117.96 13 59.09
12557. Kuya JJ (kuya_jj) 22 48.12 59.97 3 13.64
12558. Rene (reniaraq) 22 47.20 62.00 15 68.18
12559. Bryce (bryce4) 22 87.38 105.41 9 40.91
12560. Isaac (ilikepie3) 22 48.08 60.11 2 9.09
12561. Cj (emperorblank) 22 48.69 60.44 1 4.55
12562. Koeliga (koeliga) 22 68.26 78.50 7 31.82
12563. yo (markus1012) 22 102.79 115.04 12 54.55
12564. john (joahuaj) 22 35.83 44.18 1 4.55
12565. wang (wangcai) 22 40.23 48.01 2 9.09
12566. max (vezorack) 22 53.12 60.99 3 13.64
12567. reiyashi (reiyashi) 22 108.18 119.89 9 40.91
12568. Metal09 (metal09) 22 46.62 56.15 1 4.55
12569. cring (cringeman10021) 22 62.72 76.35 6 27.27
12570. jozz (danishbun) 22 39.63 53.02 2 9.09
12571. Tobi (ohcibi) 22 84.85 105.80 8 36.36
12572. inzemamul (inzi2004) 22 47.54 57.55 3 13.64
12573. Joey (saria_calla) 22 31.74 38.45 1 4.55
12574. Nick (envynav) 22 60.69 67.25 4 18.18
12575. Madelaine (madelaineriddle) 22 54.14 61.95 11 50.00
12576. cr1xzs (cr1xzs) 22 63.46 73.04 3 13.64
12577. ali_mehdi (syedmehtab2125) 22 44.49 52.07 1 4.55
12578. Kevin (kevinchangjk) 22 67.53 86.02 6 27.27
12579. Dimitar (dnonov) 22 59.17 65.77 2 9.09
12580. Gotta go (mattjl) 22 107.05 116.17 15 68.18
12581. Abhishek (abhig) 22 57.18 67.46 4 18.18
12582. Grandest (grandest) 22 112.13 130.53 12 54.55
12583. Md (iamtheasad) 22 49.86 59.33 2 9.09
12584. Arad (aradarbel10) 22 76.76 95.00 7 31.82
12585. Matt (rapt0rinasuit) 22 48.11 61.72 2 9.09
12586. Faizan (not_faizan) 22 57.96 77.08 7 31.82
12587. saugat (typersaugat) 22 44.42 53.31 2 9.09
12588. Var (varrenleandro) 22 80.37 93.89 9 40.91
12589. stark16 (stark16) 22 42.26 51.00 1 4.55
12590. jagraj (jagraj) 22 59.87 68.73 4 18.18
12591. Zac (kingkapitolz) 22 56.49 70.61 5 22.73
12592. Lohiek (lohiek) 22 79.66 91.31 22 100.00
12593. A (__a_) 21 84.75 101.27 6 28.57
12594. Sourav (_sourav_) 21 29.80 34.69 1 4.76
12595. beroo (_nwahz) 21 75.66 91.21 11 52.38
12596. zlyxx (zlyxx) 21 84.70 110.47 6 28.57
12597. Ziclue (ziclue) 21 90.25 109.52 8 38.10
12598. Zemo (zemo77) 21 110.47 124.05 9 42.86
12599. asdf (zainamjad) 21 80.37 89.28 5 23.81
12600. wpm + x (x_wpm_more) 21 47.76 56.55 1 4.76
12601. ximecat (ximecat) 21 113.44 133.08 14 66.67
12602. wrentay (wrentay) 21 107.76 140.48 6 28.57
12603. Denny (what_tf_is_up_kyle) 21 59.41 80.73 5 23.81
12604. Whats (whatsderivative) 21 92.91 104.86 10 47.62
12605. wayexzee (wayexzee) 21 71.16 80.68 5 23.81
12606. Murka (wassupbuddy) 21 81.53 100.14 13 61.90
12607. Gabriel (warbros123) 21 77.93 98.53 9 42.86
12608. Velyro (velyro) 21 86.18 96.86 7 33.33
12609. BESTYINA (vdud3) 21 146.90 165.68 17 80.95
12610. Niko (varial) 21 132.33 154.77 17 80.95
12611. nat (vanilla7) 21 75.71 94.08 9 42.86
12612. Villan (v1llan) 21 47.54 54.75 2 9.52
12613. Eli (uvafan) 21 105.73 123.51 11 52.38
12614. David (usainturtle) 21 39.49 50.24 2 9.52
12615. Unique (unique1402) 21 59.69 79.81 7 33.33
12616. (typist215) 21 83.10 97.00 10 47.62
12617. reiden (typingreiden) 21 86.97 104.82 6 28.57
12618. Asters (typer1typer) 21 101.69 117.57 9 42.86
12619. Nabil (twin_n) 21 64.66 86.03 2 9.52
12620. TrOn (tron_691) 21 44.46 50.92 1 4.76
12621. Top (tophatjones) 21 100.70 114.45 21 100.00
12622. Le Van (tlong900) 21 71.71 82.41 8 38.10
12623. Tony (tjzhao) 21 56.87 70.88 4 19.05
12624. tjk113 (tjk113) 21 89.35 105.58 6 28.57
12625. Tim (timduh) 21 52.07 59.04 3 14.29
12626. Matsvei (tictacfruit) 21 70.52 80.96 5 23.81
12627. Thursday (thursdays) 21 106.69 123.77 9 42.86
12628. Raymond (thiccthighs) 21 67.81 81.28 1 4.76
12629. CJ (the_winner_is_here) 21 57.31 70.20 4 19.05
12630. Hayden (the_dizzler) 21 85.35 99.55 8 38.10
12631. Devids (theneo) 21 107.59 126.89 8 38.10
12632. Albert (thehacker08) 21 63.84 73.19 3 14.29
12633. budda (theblackeye) 21 102.05 120.58 9 42.86
12634. th (thanasis2002) 21 93.79 112.30 12 57.14
12635. Reanu (terrenceskill) 21 56.88 67.87 3 14.29
12636. A (taffing) 21 71.01 82.13 0 0.00
12637. Priyabrata (s_h_a_r_k) 21 47.76 53.66 2 9.52
12638. sai (syrus_dhark) 21 49.02 61.33 1 4.76
12639. sus99hant (sus99hant) 21 60.70 73.89 4 19.05
12640. Avi (suppppp) 21 72.75 83.95 5 23.81
12641. Demon (sun_voca) 21 101.55 116.09 5 23.81
12642. Krystal (sunshinenmyeyes) 21 81.49 103.02 6 28.57
12643. Subhaan (subhaan) 21 79.82 97.22 4 19.05
12644. beiluo (beiluo) 21 64.29 74.29 9 42.86
12645. Oakton (oakton) 21 42.68 60.95 2 9.52
12646. squishyiop (squishyiop) 21 44.51 62.06 1 4.76
12647. Speedwalker (speedwalker68) 21 63.56 74.65 2 9.52
12648. Soulreaper (soulreaperdeath... 21 63.96 76.14 4 19.05
12649. slow typer (slooowest_typer) 21 58.47 72.63 2 9.52
12650. Sir (sirmaax) 21 72.55 103.30 6 28.57
12651. Silvia (silvia_thenan) 21 75.10 95.89 6 28.57
12652. Shikhar (shikhar_tyagi) 21 100.45 115.02 10 47.62
12653. shau (shauwei_0510) 21 64.10 79.74 4 19.05
12654. Indian_Lad (shashank5665) 21 52.83 60.74 2 9.52
12655. shailendra (shailendraji) 21 53.33 61.89 1 4.76
12656. Shahmir (shahmirishere) 21 93.70 115.57 10 47.62
12657. Shaheer (shaheer49) 21 64.18 71.08 6 28.57
12658. scqrch (scqrch) 21 60.65 66.30 4 19.05
12659. SaltyHobo (saltyhobo) 21 88.53 105.36 6 28.57
12660. Sharif (sa524402) 21 26.89 37.95 5 23.81
12661. Rylez (rylezyt) 21 65.98 78.13 7 33.33
12662. Rory (roricus) 21 72.09 84.29 5 23.81
12663. ron (ronk17) 21 66.36 73.32 4 19.05
12664. Rodrigo (rodplaying) 21 47.12 53.06 1 4.76
12665. Robert (robertgrylls) 21 70.34 83.67 8 38.10
12666. Hans (retrovibes_11) 21 91.23 105.41 11 52.38
12667. redhotdancer1821 (redhotdan... 21 97.62 114.59 6 28.57
12668. Rebekah (rebekahtomski) 21 65.13 74.34 4 19.05
12669. Rawat (rawat_shiv) 21 43.64 51.01 3 14.29
12670. Rafail (raphaelpap) 21 68.92 82.57 20 95.24
12671. Nick (rageemy) 21 102.59 114.32 14 66.67
12672. Rae (rae149) 21 61.05 79.21 5 23.81
12673. Zuko (rachet_22) 21 91.30 109.61 7 33.33
12674. Sebastian (racermaster_) 21 59.55 72.22 2 9.52
12675. quat (quat) 21 97.79 112.47 7 33.33
12676. Hung (qhung312) 21 77.38 86.83 4 19.05
12677. Kong (qbored) 21 47.35 53.83 1 4.76
12678. Stuart (psephos) 21 93.41 114.47 6 28.57
12679. Prashant (prashant_204) 21 70.85 92.45 4 19.05
12680. ตาแดง (pitagorus) 21 88.42 99.17 5 23.81
12681. Philip (philr12) 21 79.75 91.13 5 23.81
12682. shea (pengu1927) 21 69.49 82.01 5 23.81
12683. Peachbird (peachbird) 21 51.38 65.66 6 28.57
12684. paxuy (paxuy) 21 68.62 80.51 3 14.29
12685. Patrick (patrick_st4r) 21 65.61 75.66 9 42.86
12686. boop (owiwchu) 21 63.21 72.16 2 9.52
12687. FREE PALESTINE (os1506) 21 80.95 92.68 5 23.81
12688. orangie (orangie_) 21 47.50 57.56 2 9.52
12689. Adrian (orangebase) 21 131.34 147.57 15 71.43
12690. Omsin (omsinkrissada) 21 83.00 96.80 8 38.10
12691. S0R4 (omniores22) 21 94.80 110.64 8 38.10
12692. Nazmus (nxbot) 21 53.66 64.11 2 9.52
12693. number1 (number1racer) 21 45.99 54.31 2 9.52
12694. Nully (nullly) 21 74.79 96.62 5 23.81
12695. Noxellar (noxellar) 21 93.52 108.09 7 33.33
12696. William (not_your_username) 21 67.34 92.22 4 19.05
12697. notkailey (notkailey) 21 85.04 98.50 9 42.86
12698. noob_master (noob_master_6_9) 21 65.01 74.86 5 23.81
12699. Nicolai (nicolair222) 21 102.33 114.36 5 23.81
12700. Nick (nickbanderson) 21 85.87 111.20 12 57.14
12701. Blac (nice_tea) 21 72.50 93.12 6 28.57
12702. Narayan (narayan2002) 21 58.85 73.49 16 76.19
12703. AgniArse (n3ug13rd3) 21 79.67 89.44 5 23.81
12704. Moataz (mizosoft) 21 77.89 88.08 7 33.33
12705. Dominik (misiekwiev13) 21 56.79 66.42 2 9.52
12706. Lior (miliday) 21 42.62 52.07 3 14.29
12707. Outlaw (midnight_tuna) 21 77.79 97.52 3 14.29
12708. Michael (michael9009) 21 91.74 126.82 6 28.57
12709. Muhammad (mhasan01) 21 102.13 113.66 6 28.57
12710. meme (mememem) 21 90.62 103.78 9 42.86
12711. invader (megawutt) 21 64.37 75.30 8 38.10
12712. MZ (mbzz) 21 83.43 99.29 8 38.10
12713. Mateus (mateusmelo) 21 64.71 77.77 7 33.33
12714. roee (masterroee3) 21 64.07 80.91 5 23.81
12715. MasterlyHoney (masterlyhone... 21 48.50 59.55 0 0.00
12716. Ammar (marsicus) 21 84.41 101.86 10 47.62
12717. Marcki (marcki) 21 76.20 84.17 4 19.05
12718. Markus (marcasrealaccount) 21 93.93 105.45 10 47.62
12719. Mark (maolson97) 21 87.98 107.89 6 28.57
12720. tstats[mannyblaze] (mannybl... 21 58.17 80.57 3 14.29
12721. Ian (mail_order_bride) 21 56.66 70.02 2 9.52
12722. Roman (madness1st) 21 51.97 60.99 2 9.52
12723. Luke (lukeatme) 21 67.55 80.97 12 57.14
12724. Luis (luismiguelcopadiaz) 21 82.16 92.75 7 33.33
12725. patrick (lucky_ninja3412) 21 69.47 92.00 5 23.81
12726. Tekin (liggrod) 21 79.11 90.39 9 42.86
12727. Leo (leo123457) 21 53.83 63.42 18 85.71
12728. Lazer (lawins) 21 102.96 114.07 3 14.29
12729. Lars (larzz_z) 21 82.13 100.31 10 47.62
12730. Kshitij (kshitij21) 21 55.65 65.01 6 28.57
12731. Sean (kokamell16_) 21 48.43 58.12 2 9.52
12732. Koby (kobyhatton) 21 95.51 115.72 8 38.10
12733. V (kiritoyang) 21 103.19 131.43 7 33.33
12734. Kaylo (kaylo060) 21 80.92 97.99 6 28.57
12735. Mouhamed (karlosalol) 21 64.83 79.28 5 23.81
12736. Karen (karent_x3) 21 70.76 83.96 5 23.81
12737. Katie (kantielope) 21 82.34 99.20 4 19.05
12738. Kamrul (kamrul_ahsan) 21 29.52 34.13 1 4.76
12739. Kai (kaitheguy_) 21 81.52 97.75 7 33.33
12740. Aidyn (justaidyn) 21 95.87 105.53 6 28.57
12741. vroom (junap) 21 96.56 116.70 8 38.10
12742. Juan (juandz) 21 44.08 51.71 4 19.05
12743. Jeffrey (jshen13) 21 88.89 101.22 8 38.10
12744. Jono (jonodvorak) 21 128.40 142.72 13 61.90
12745. Jon (jonbeka) 21 56.10 64.37 3 14.29
12746. johnballs (johnballs) 21 92.20 101.38 6 28.57
12747. Johan (johanapa) 21 97.34 117.48 19 90.48
12748. my mango (joe_froggy) 21 72.93 90.93 1 4.76
12749. Edward (jinsye) 21 96.48 115.18 6 28.57
12750. Jason (jihoon222) 21 134.10 150.88 19 90.48
12751. Jerry24562 (jerry24562) 21 82.38 92.03 0 0.00
12752. Water (jeffersonjap) 21 106.89 117.84 14 66.67
12753. Tobe (jeeko_pogi) 21 72.14 84.97 4 19.05
12754. Jason (jasew) 21 62.75 91.63 4 19.05
12755. Jamshidbek (jamshid_4510) 21 44.72 51.70 8 38.10
12756. James (jamesks) 21 85.44 96.74 7 33.33
12757. Jake (jakeypancakey) 21 108.93 129.44 11 52.38
12758. Corey (i_dont_like_anime) 21 88.11 113.44 7 33.33
12759. I type slow (itypeslowlol1) 21 99.73 117.98 9 42.86
12760. Eric (isoh) 21 94.94 112.59 7 33.33
12761. 스티븐 (ishes) 21 101.48 109.94 9 42.86
12762. Aleksandr Ippatev (ippatev) 21 71.96 95.75 9 42.86
12763. Insulin (insulingaming) 21 74.91 85.61 7 33.33
12764. Siddhant (indianracer385) 21 68.50 88.40 0 0.00
12765. Benji (ijneb) 21 86.04 111.12 5 23.81
12766. iCheese (icheese23) 21 101.81 117.49 10 47.62
12767. Fez (iamsuperspeed) 21 101.79 110.26 9 42.86
12768. xd (huskyyy) 21 102.85 122.23 12 57.14
12769. Nate (hoopstrings) 21 105.36 118.88 9 42.86
12770. Mike (hipsterdufus) 21 95.76 106.32 12 57.14
12771. Ace (hiken_ace) 21 74.60 84.97 14 66.67
12772. Hey (heythere0) 21 74.44 84.88 3 14.29
12773. Ifat (helloitsifat) 21 76.45 89.41 4 19.05
12774. Helena (helena_mp) 21 58.69 67.44 3 14.29
12775. Hecks (hecksadecimal) 21 91.93 113.57 10 47.62
12776. Egor (hawkeg) 21 55.80 66.58 6 28.57
12777. Hahohe (hahohe3) 21 98.74 123.62 9 42.86
12778. Karina (guyrina) 21 102.62 123.44 9 42.86
12779. Grigory (gregkhan) 21 92.42 110.96 12 57.14
12780. Miguel (gheed22) 21 85.91 98.79 8 38.10
12781. Eddie (ger_eddie) 21 71.14 77.07 4 19.05
12782. AtomicSkunk (georgel8314) 21 81.07 93.04 6 28.57
12783. Evan (gemofevan) 21 117.78 145.51 8 38.10
12784. Leo (geckuchicken) 21 68.23 85.15 7 33.33
12785. elio! (gabspyz) 21 80.94 95.30 5 23.81
12786. Charles (future965) 21 63.65 72.71 1 4.76
12787. Frederik (freeder1k) 21 61.67 72.48 2 9.52
12788. Frode (fr0so) 21 59.87 68.70 2 9.52
12789. Kai Wei (fortissimo) 21 108.06 132.69 12 57.14
12790. Foqsi (foqsi) 21 102.33 122.45 9 42.86
12791. Speedy (flux2k) 21 113.14 134.10 12 57.14
12792. Patty (flappypatty420) 21 66.47 89.11 5 23.81
12793. Felipe (felipet) 21 85.93 98.76 4 19.05
12794. Felipe (felipazo_06) 21 57.00 77.43 7 33.33
12795. this is feimser (feimser) 21 67.78 76.21 8 38.10
12796. Harry (feeshgang) 21 109.34 127.77 12 57.14
12797. Ali (fanstic) 21 64.72 74.96 3 14.29
12798. Fairyball (fairyballyt) 21 85.45 98.80 4 19.05
12799. Junito (exter72) 21 75.70 97.03 6 28.57
12800. Mohammed Waseemuddin (ertug... 21 57.08 67.66 5 23.81
12801. Erie (eridu) 21 76.20 101.65 6 28.57
12802. Muhammad (entamalomak) 21 69.92 79.60 7 33.33
12803. emily (emily_chwn) 21 77.13 84.14 2 9.52
12804. Elmer (elmerr) 21 95.24 105.94 7 33.33
12805. Elijah (elijahp24) 21 62.44 75.71 5 23.81
12806. Yaowee (eggyicecream) 21 70.21 82.18 6 28.57
12807. D1FFeR (ec0426) 21 60.76 77.31 2 9.52
12808. D1ck F1ngers (d_wratten18) 21 66.42 76.23 6 28.57
12809. shylingg (dyingllama) 21 109.82 125.47 11 52.38
12810. Nathanael James (dyemz) 21 87.71 98.70 7 33.33
12811. Duschi (duschi) 21 93.96 108.30 8 38.10
12812. K (duhhhhhhhhhhh) 21 87.14 106.22 8 38.10
12813. Typing (drained_typist) 21 101.27 114.27 11 52.38
12814. dq (dqmaniac) 21 123.44 139.80 14 66.67
12815. . (doomslug5) 21 82.55 91.03 4 19.05
12816. Sardar Taha (dice111) 21 107.66 123.58 9 42.86
12817. Dexter (dexter2fast) 21 87.75 105.81 8 38.10
12818. DENYS (denysesjs) 21 100.68 114.35 13 61.90
12819. Nairi (demerton) 21 78.61 95.43 3 14.29
12820. Deko (deko_moon) 21 88.57 105.54 8 38.10
12821. Manye (davemanye) 21 60.32 81.18 8 38.10
12822. Daulet (daukabase) 21 62.79 76.99 3 14.29
12823. Chris (datapointchris) 21 85.61 102.99 5 23.81
12824. balzac (dasbalzac) 21 31.63 38.12 3 14.29
12825. Sisyphus (darkwinterfurry) 21 80.50 96.63 6 28.57
12826. dannsy (dannsy) 21 101.54 115.13 8 38.10
12827. Ryan (dandaflaff) 21 45.39 58.45 2 9.52
12828. Damian (damianm8) 21 76.84 86.71 6 28.57
12829. Aishiteru (daedalus__) 21 79.16 96.03 11 52.38
12830. cuzimogni (cuzimogni) 21 67.42 76.32 1 4.76
12831. cuppajoeman.com (cuppajoeman) 21 95.25 109.17 8 38.10
12832. Clement (clement_ps) 21 107.44 129.20 6 28.57
12833. Akhil (cheetahoo7) 21 85.04 95.98 7 33.33
12834. joe (cbel3111) 21 79.73 98.67 5 23.81
12835. Casual (casualhat) 21 53.11 59.52 4 19.05
12836. Carl (carlalalala) 21 79.52 94.90 11 52.38
12837. Captain M (captain254) 21 51.15 60.53 2 9.52
12838. Mohamed (camposha) 21 63.23 73.53 3 14.29
12839. byrtolet (byrtolet) 21 78.60 92.97 8 38.10
12840. Dan (bupkisdaddy) 21 82.19 107.02 11 52.38
12841. Bram (bramdk) 21 81.82 99.02 10 47.62
12842. bok (bokk) 21 99.15 125.72 12 57.14
12843. Blu (blu_0) 21 85.31 101.64 12 57.14
12844. Zach (blurridge) 21 91.43 110.90 7 33.33
12845. Jonathan (blue_blobfish) 21 88.11 104.88 5 23.81
12846. jeff (blawalaw) 21 112.14 131.27 11 52.38
12847. Kin (binbobum12s) 21 70.49 82.74 6 28.57
12848. Petr (bigbang1112) 21 100.66 116.10 9 42.86
12849. ben (bendoverr05) 21 65.60 84.34 3 14.29
12850. You're not that slow (beast... 21 135.35 162.32 14 66.67
12851. BearJere (bearjere) 21 101.88 112.78 12 57.14
12852. KJ (barraclaw) 21 93.87 107.18 5 23.81
12853. Michael (baomoichoi122) 21 51.18 66.99 1 4.76
12854. Bis (b1s_qu1t) 21 67.11 82.41 3 14.29
12855. Azerniiiic (azernic) 21 91.31 109.40 6 28.57
12856. Typomaster (axioo123) 21 66.77 81.85 6 28.57
12857. Jack (awesomekiwi23) 21 89.63 104.01 13 61.90
12858. Avernu (avernu) 21 81.10 101.36 7 33.33
12859. Josh (auto111032) 21 90.74 107.71 10 47.62
12860. Chelsea (aurialing) 21 96.90 105.57 5 23.81
12861. Anastasya (athh97) 21 64.27 81.22 5 23.81
12862. Askhat (askhat0109) 21 35.38 45.87 0 0.00
12863. Tala (another_ostrich) 21 84.40 95.69 7 33.33
12864. Rijey (anilarq) 21 49.68 59.05 2 9.52
12865. Aniket (aniketb97) 21 54.15 64.20 3 14.29
12866. hecarim jg (angeio) 21 164.89 183.93 19 90.48
12867. no sweat (anduatm) 21 89.45 101.53 9 42.86
12868. Ammar (ammarthetyper) 21 106.19 120.25 9 42.86
12869. AmmarDab3an (ammardab3an) 21 72.75 84.14 5 23.81
12870. al (allizer) 21 36.20 43.86 1 4.76
12871. Aliff (aliffhakimi) 21 95.39 113.95 11 52.38
12872. Alex (alextamago) 21 104.23 125.63 7 33.33
12873. Alb (alb_themighty) 21 62.06 74.98 3 14.29
12874. Alan (alan_hsiu) 21 25.65 34.38 0 0.00
12875. Jean (akrinias) 21 111.10 126.87 11 52.38
12876. Idas (aidasas) 21 97.95 117.92 10 47.62
12877. Residential (agent_resident2) 21 91.97 102.54 8 38.10
12878. ray (afrojelly) 21 91.32 105.36 8 38.10
12879. Sam (advil) 21 115.56 128.76 12 57.14
12880. Jannatul (adon22) 21 53.58 61.97 2 9.52
12881. abhishek (abhisheksaxenasep) 21 57.13 65.40 4 19.05
12882. A7med (a7med_1) 21 41.01 50.88 1 4.76
12883. Enzo (60wpmwhat) 21 86.62 99.85 8 38.10
12884. steve (21steven_) 21 83.54 111.00 3 14.29
12885. InsertNameHere (1ns3rtn4m3h... 21 95.55 117.13 4 19.05
12886. Subikshaa (subikshaa18) 21 63.54 79.94 8 38.10
12887. Chatham (cala95) 21 89.46 105.39 10 47.62
12888. Agno3317 (agno3317) 21 53.78 61.88 1 4.76
12889. Marek (smudla) 21 54.96 63.53 4 19.05
12890. sammy (whymehere) 21 31.88 43.83 3 14.29
12891. Jezzer (60wpmbot) 21 91.29 108.98 9 42.86
12892. Robert (r0bm4c) 21 70.76 82.45 8 38.10
12893. Zaid (kaitania) 21 93.83 115.78 17 80.95
12894. Angus (director7) 21 77.78 88.39 9 42.86
12895. Quamtam (quamtam) 21 71.53 93.24 5 23.81
12896. Dennis (deadmans_22) 21 63.59 74.99 6 28.57
12897. qbit (qixotic) 21 96.52 105.57 7 33.33
12898. go_ez_plz (go_ex_plz) 21 92.44 111.79 8 38.10
12899. Mark (verysourfox) 21 62.66 78.69 7 33.33
12900. Eminem (leonard_jose) 21 63.24 73.58 2 9.52
12901. James (xiero) 21 75.69 84.36 3 14.29
12902. Holden (hrmercer) 21 67.40 79.56 5 23.81
12903. Hudodo (hudodo) 21 48.61 72.80 4 19.05
12904. On the Go (rumasud99) 21 53.20 64.42 1 4.76
12905. Bryan (gambino478) 21 77.32 92.18 6 28.57
12906. Akmentop (akmentop) 21 68.98 84.26 6 28.57
12907. V (usotsuki) 21 48.04 57.39 4 19.05
12908. Carlos (cdrlao) 21 76.59 92.44 8 38.10
12909. felixjack (felixjack) 21 37.35 49.17 1 4.76
12910. Hunter (eidetic) 21 80.21 90.96 12 57.14
12911. mel (merlynmanoj) 21 78.68 94.12 4 19.05
12912. Jass (hsiehjason00) 21 50.68 56.36 4 19.05
12913. Voda (vodatrash) 21 75.00 92.27 7 33.33
12914. Brock (blobweadner) 21 44.06 53.83 6 28.57
12915. Emerald (emeraldz05) 21 74.24 85.43 6 28.57
12916. Rajlohith (mrbadattitude) 21 44.30 51.30 1 4.76
12917. Isabella (himeenthusiast) 21 59.99 72.52 1 4.76
12918. Dev (ananddev) 21 62.34 73.30 4 19.05
12919. Abhinand (abhinandarun02) 21 37.74 51.23 1 4.76
12920. 360 (crankin90s) 21 57.11 77.35 3 14.29
12921. Pip (pipsquik) 21 93.56 115.33 7 33.33
12922. Dimitris (sussy_baka_jimbo) 21 52.97 62.66 1 4.76
12923. Jason (supergjason) 21 105.47 125.60 10 47.62
12924. Samuel (shironeko213) 21 80.02 94.73 10 47.62
12925. Duc Anh (thoidithim2810) 21 51.23 58.96 1 4.76
12926. ajmal (ajmalbinnizam) 21 44.74 49.04 5 23.81
12927. wiz (_wiz_) 20 60.86 71.40 5 25.00
12928. !! (zzzoodle) 20 83.14 103.95 3 15.00
12929. Franky (zyrefe) 20 109.33 128.60 10 50.00
12930. Zack (zqlimy) 20 77.58 90.06 4 20.00
12931. yaotly (yaotli) 20 48.15 54.06 2 10.00
12932. Yadira (yadirairiz) 20 97.01 118.74 7 35.00
12933. XzXc (xzxc4444) 20 72.79 82.97 5 25.00
12934. xtian (xtian91) 20 63.74 73.79 4 20.00
12935. XpORPID (xporpid) 20 85.94 104.79 6 30.00
12936. Xel (xelqqii) 20 77.42 93.35 6 30.00
12937. matvei (xbabushka) 20 60.24 81.32 9 45.00
12938. Bún bò Huế (wynos) 20 125.29 139.48 17 85.00
12939. w0wdead (wowdead) 20 55.27 70.12 18 90.00
12940. Lucas (wollmyth) 20 83.70 97.11 2 10.00
12941. . (wheelzaboo) 20 79.70 90.70 4 20.00
12942. Nathaniel (wetaketolong) 20 91.86 106.82 5 25.00
12943. Wes (wespiard) 20 77.20 92.99 12 60.00
12944. Erlend (weserl) 20 55.56 65.71 2 10.00
12945. Jeff (websterjs) 20 84.00 94.12 3 15.00
12946. Pat (wareem) 20 95.38 114.41 7 35.00
12947. Cedric (vlako) 20 86.72 102.77 5 25.00
12948. Visura (visuraprabod) 20 60.73 66.98 3 15.00
12949. Kranite (vg_infernozz) 20 94.88 115.29 9 45.00
12950. Varaug (varaug33) 20 100.85 110.33 11 55.00
12951. Vaibhav (vaibhav974) 20 89.61 102.56 5 25.00
12952. Sergei (unicrus) 20 63.47 70.86 4 20.00
12953. Atichon (ultraballminorz) 20 74.81 85.55 4 20.00
12954. Roman (tyronefromdetroit_7) 20 61.00 69.36 2 10.00
12955. Sebas (typingtiran) 20 78.16 93.99 6 30.00
12956. Brent (typer1987) 20 93.63 114.03 8 40.00
12957. Tristan (typeinthebox) 20 69.22 89.57 4 20.00
12958. Tycho (tychobroucke) 20 88.89 104.79 5 25.00
12959. Tyler (tybow99) 20 108.39 117.49 6 30.00
12960. Tanya (tyarbrough71) 20 75.22 89.96 4 20.00
12961. bec (twentyonepotato) 20 81.34 94.81 4 20.00
12962. Tunihorn (tunihorn) 20 100.40 131.37 11 55.00
12963. tsds (tsds) 20 67.89 85.02 4 20.00
12964. trut (trut) 20 87.60 100.61 4 20.00
12965. trex (trexwithlasereyes) 20 72.57 82.78 11 55.00
12966. Toktar (tokha) 20 35.94 42.32 0 0.00
12967. Kocsis (tisq13) 20 55.78 67.66 4 20.00
12968. DataDev (tinysingh) 20 52.91 68.36 2 10.00
12969. Ian (tinysilverfish) 20 99.99 144.27 5 25.00
12970. tiglas (tiglas) 20 71.32 80.57 4 20.00
12971. TidyTurtle (tidyturtle) 20 98.79 125.67 6 30.00
12972. Dan (themanisdan) 20 96.31 108.87 7 35.00
12973. Drew (thecomedyne04) 20 90.00 115.35 7 35.00
12974. nabileT (telibanalex) 20 94.33 108.61 9 45.00
12975. ty (tbtbtbt) 20 121.15 154.58 13 65.00
12976. Fabian (tay0w) 20 86.79 110.68 7 35.00
12977. ee (tally_dvorak) 20 93.12 103.56 10 50.00
12978. Jonas (superare) 20 78.39 103.63 3 15.00
12979. Suddenly (suddenlynothing) 20 96.50 108.43 8 40.00
12980. Squeeeeeps (squeeeeeps) 20 48.49 57.70 2 10.00
12981. Spiren (spirenz) 20 113.89 134.49 10 50.00
12982. Victoria (speedrun_dreamstyle) 20 79.33 95.19 16 80.00
12983. snipe (snipe75) 20 50.42 67.45 1 5.00
12984. Jacob (sl_jacob) 20 80.86 92.15 2 10.00
12985. Devin (slinky88) 20 67.29 80.61 6 30.00
12986. Skylos (skylos) 20 107.90 136.79 7 35.00
12987. Manal (skullcicator) 20 91.26 117.20 5 25.00
12988. sknny (sknny) 20 80.64 95.30 13 65.00
12989. sk (skkk) 20 105.77 116.94 6 30.00
12990. SIX (six_p) 20 60.11 66.78 3 15.00
12991. Hmm (sironronron) 20 105.10 123.82 11 55.00
12992. Shuraque (shuraque) 20 74.48 85.56 5 25.00
12993. Shrimpo (shrimpo) 20 82.47 98.82 7 35.00
12994. Shichibukai (shichibukai2002) 20 93.26 103.38 8 40.00
12995. Shashanka (shashankanath) 20 49.04 61.21 13 65.00
12996. Shadow (shadowrose01) 20 43.73 49.09 1 5.00
12997. Themis Evangelinos (sellak) 20 50.86 60.79 2 10.00
12998. MoshuFingers (scotscottie) 20 73.67 85.55 7 35.00
12999. ︻デ═一▸ (santoshmsk) 20 61.65 74.72 7 35.00
13000. Me (sandwichshop) 20 79.89 88.49 11 55.00
13001. Saikiran (sai_kiran_07) 20 56.31 72.76 3 15.00
13002. Sai Mani Raj (saimaniraj) 20 70.34 89.57 6 30.00
13003. Roy (rwfeng72) 20 93.68 114.73 7 35.00
13004. Ron (ronsar) 20 50.89 60.12 3 15.00
13005. Blue (rodtypes) 20 79.79 99.27 8 40.00
13006. student bored in school (ri... 20 62.09 69.34 4 20.00
13007. Rikka (rikkaislife) 20 38.07 45.32 8 40.00
13008. ric (ricman0) 20 70.38 89.12 3 15.00
13009. ReklessDragon (reklessdragon) 20 95.34 113.22 9 45.00
13010. Boris (redsnake07) 20 113.45 132.75 8 40.00
13011. Eugene (rawners) 20 71.77 80.27 8 40.00
13012. Randy (randonandoz) 20 93.58 107.02 12 60.00
13013. Daniel (randomgamer1017) 20 106.39 132.92 10 50.00
13014. Ricardo (rambolis) 20 66.25 75.78 2 10.00
13015. deadass (rajteezy) 20 67.18 77.23 2 10.00
13016. rain (rainnonquit) 20 154.92 178.95 18 90.00
13017. Raghav (raghav8822) 20 74.29 84.35 4 20.00
13018. Robbie (qweens) 20 76.86 89.79 8 40.00
13019. Questt (questtlee) 20 93.01 111.73 9 45.00
13020. qazaqyanke (qazaqyanke) 20 38.72 80.06 1 5.00
13021. Jumpo (purplejumpo) 20 97.78 116.16 6 30.00
13022. O]]!! (prvlg) 20 87.21 104.01 8 40.00
13023. huge (postmortem) 20 97.50 122.23 10 50.00
13024. Poochi (poochizoom) 20 125.91 153.61 13 65.00
13025. poepmannetje (poepmannetje) 20 71.15 86.19 4 20.00
13026. Pavel Kotsev (pkotsev) 20 71.31 78.87 3 15.00
13027. stop quitting (phrosnite) 20 83.60 106.42 3 15.00
13028. Peyush (peyush) 20 45.90 55.42 2 10.00
13029. David (peacehf123) 20 92.64 102.68 0 0.00
13030. The Write Tale (pchanbps1) 20 93.11 99.83 8 40.00
13031. Gibby (papimonster69) 20 84.70 94.25 7 35.00
13032. Ali (oorkade) 20 66.47 77.30 11 55.00
13033. omar (omarkarboul) 20 50.59 56.75 1 5.00
13034. Ohm (ohmstar123) 20 82.72 98.34 9 45.00
13035. Nathan (nper4lta) 20 61.60 75.32 4 20.00
13036. Not (not_cracked_) 20 104.60 120.01 6 30.00
13037. salad (notyoursalad) 20 81.38 93.49 6 30.00
13038. Molly (notevenhalf2000) 20 84.43 103.16 3 15.00
13039. Kaat (norbertathedragon) 20 61.37 79.97 2 10.00
13040. wayne (nonlimit) 20 85.64 98.87 4 20.00
13041. Alex (nobrakes58) 20 90.92 107.22 7 35.00
13042. Decent (nicokart) 20 76.29 92.04 3 15.00
13043. troi lanh uoc dc nam tay e ... 20 59.95 98.35 9 45.00
13044. luzy (neptunehoney) 20 98.27 121.70 8 40.00
13045. Necdet Ali (necdetaliozdur) 20 79.65 87.68 7 35.00
13046. Naveen Kumar (naveen_1729) 20 59.94 73.35 1 5.00
13047. ᕕ༼ ; •̀︿•́༽... 20 102.93 122.52 18 90.00
13048. Adam (musterling) 20 103.03 119.91 16 80.00
13049. mrw1 (mrw1) 20 76.95 91.52 7 35.00
13050. Friden (mrtokke) 20 63.68 77.22 5 25.00
13051. Andy (mrfoggz) 20 87.13 95.69 2 10.00
13052. Mostafah (mosty295) 20 76.19 89.70 8 40.00
13053. eric (mordor5555) 20 77.70 96.66 7 35.00
13054. G.A.F (mochillavila) 20 56.37 69.29 2 10.00
13055. mobo (mobo) 20 123.31 150.55 13 65.00
13056. Eugene (mineugene) 20 85.82 95.65 9 45.00
13057. millstypes (millstypes) 20 70.96 83.81 7 35.00
13058. Zhikouan (mikelee543) 20 87.88 101.44 7 35.00
13059. Hải (microwaveablepasta) 20 77.06 98.74 5 25.00
13060. Mia (miajasmine) 20 76.56 93.78 5 25.00
13061. mg (mgperson) 20 114.81 131.83 11 55.00
13062. memmoman (memmo) 20 74.11 96.62 7 35.00
13063. Tammy (mausaye) 20 79.29 91.70 5 25.00
13064. Matin (matin_pasargad) 20 84.18 98.41 5 25.00
13065. juzerr (markopokupecc) 20 95.93 125.79 5 25.00
13066. Mark (markmango) 20 94.07 112.28 7 35.00
13067. Piccolo (makankasappa) 20 67.83 79.11 6 30.00
13068. MAHMUD (mahmudul_hhh) 20 44.95 56.64 3 15.00
13069. Matthew (m1234d) 20 122.16 146.89 12 60.00
13070. Luke (lukethepuke) 20 47.04 54.23 1 5.00
13071. Lucy (lucyd266) 20 82.28 92.52 9 45.00
13072. Louie John (loumexx12) 20 83.79 97.61 10 50.00
13073. Lilah (livymud) 20 45.69 50.64 5 25.00
13074. lex (lex_isamess) 20 103.73 134.40 12 60.00
13075. lettuce (lettuceandahalf) 20 79.25 104.07 5 25.00
13076. Artur (lepayo) 20 112.02 137.72 9 45.00
13077. Leo (leo_typing) 20 80.10 97.05 3 15.00
13078. ItypeCuzIhavenoGF (leftmask35) 20 46.51 54.27 2 10.00
13079. Darrell (lastronus) 20 98.76 116.35 9 45.00
13080. kRystal (krystal69) 20 67.95 88.79 13 65.00
13081. Kevin (kevinu) 20 112.48 126.59 8 40.00
13082. kp (kennethputra) 20 83.72 100.05 4 20.00
13083. Kaybe (kaybnde) 20 101.70 117.87 8 40.00
13084. Mr. lee's expository writin... 20 134.35 148.58 15 75.00
13085. kauko (kaukokolka) 20 79.52 97.28 17 85.00
13086. Kalash (kalz25) 20 86.18 101.63 2 10.00
13087. salah (kaltab) 20 66.88 76.47 3 15.00
13088. Leo (kakiu2000) 20 51.87 58.14 6 30.00
13089. abdelrhman (kahraba92) 20 40.18 47.43 1 5.00
13090. Eliza (kaeco_) 20 26.16 37.63 3 15.00
13091. J (jyorange) 20 119.26 154.48 12 60.00
13092. Jonathan (jyap042) 20 66.44 74.22 4 20.00
13093. Joseph (jv33zy) 20 103.41 118.82 9 45.00
13094. Joe (jqal) 20 90.32 105.39 6 30.00
13095. Josh (joshmgeorge) 20 81.46 91.80 6 30.00
13096. josh (joshahk) 20 88.90 121.58 7 35.00
13097. Sweaty (josef_stylin) 20 127.95 151.37 11 55.00
13098. 23 (jorgexdlol) 20 70.41 82.16 6 30.00
13099. Johan (joey67) 20 64.59 77.28 8 40.00
13100. Joel (joel_w2) 20 101.62 112.56 5 25.00
13101. jupiter (joaelis) 20 45.98 72.31 2 10.00
13102. John (jjov17) 20 74.01 86.42 1 5.00
13103. Jim (jim90247) 20 58.35 68.09 2 10.00
13104. jesad (jesadilvan) 20 62.87 75.20 6 30.00
13105. hmm (jerm_killer) 20 80.40 95.34 5 25.00
13106. Dominik (jazzon) 20 98.48 122.81 7 35.00
13107. Takoyaki (jayisloco) 20 51.65 59.88 2 10.00
13108. jam_xd_ (jam_xd_) 20 91.14 104.90 3 15.00
13109. Jake (jakepf00dvorak) 20 79.74 89.12 5 25.00
13110. Rahul (jakatir) 20 87.08 106.50 7 35.00
13111. Jaemi (jaimeathedisco) 20 80.50 94.06 5 25.00
13112. Jahid (jahidk9) 20 42.73 53.85 5 25.00
13113. jackmaoff (jackmaoff) 20 68.53 81.63 6 30.00
13114. Jack (jackcoleero) 20 73.96 87.48 7 35.00
13115. isthislewz (isthislewz) 20 93.39 104.83 6 30.00
13116. Isaac (ipohzw) 20 87.23 111.04 8 40.00
13117. IpohGirl (ipohgirl8) 20 56.44 73.40 6 30.00
13118. Kristijan (invisibleloki) 20 110.11 118.74 11 55.00
13119. Stephen (installed) 20 126.09 167.79 9 45.00
13120. Elskrim (important) 20 114.11 138.77 12 60.00
13121. WhatIsLowkey (ihorsedyou) 20 126.67 144.83 12 60.00
13122. Pickle (iceberger17) 20 74.39 95.44 5 25.00
13123. iAmPardi (iampardi) 20 104.16 123.76 11 55.00
13124. Hynoh (hynoh) 20 95.85 116.56 4 20.00
13125. HoDaMoFoDor (hodamofodor) 20 97.57 119.63 11 55.00
13126. hissi (hissi) 20 88.97 109.90 7 35.00
13127. Hibird (hibird) 20 107.80 118.76 15 75.00
13128. Hassan (hassanalmatar) 20 61.28 70.99 3 15.00
13129. Hanica (hanicanii) 20 58.71 70.94 6 30.00
13130. Hamzah (hamzaaho7722) 20 36.13 40.56 2 10.00
13131. Erik (hadooo) 20 79.76 91.64 4 20.00
13132. Guilherme (guilhaugusto) 20 57.68 67.00 2 10.00
13133. tstats[guest_typists] (gues... 20 86.64 114.30 6 30.00
13134. Kevin (gtwatt) 20 75.18 86.56 8 40.00
13135. uhhhhhh (gtiff71) 20 94.16 106.93 9 45.00
13136. Gr0undhog_x (gr0undhog) 20 104.70 125.68 10 50.00
13137. Mr. Penizfaes (gokewho) 20 130.52 150.37 12 60.00
13138. Goal_100wpm (goal_200wpm) 20 53.24 62.40 3 15.00
13139. Hugo (glaucon) 20 82.18 92.54 5 25.00
13140. Yioryis (giorgis) 20 107.75 130.73 13 65.00
13141. Utkarsh (gbuckets30) 20 92.45 101.73 4 20.00
13142. Gabe (garff) 20 55.05 61.52 1 5.00
13143. garetmi (gammex) 20 80.54 97.55 3 15.00
13144. Gamer (gamer650xd) 20 91.00 110.73 9 45.00
13145. Fyter (fyter) 20 75.44 87.74 2 10.00
13146. Earl (furankuring) 20 86.90 98.00 9 45.00
13147. enrique (fugitivecloud) 20 105.59 121.62 9 45.00
13148. nathanael (flyeroscer) 20 56.10 74.40 4 20.00
13149. flourish (fl0urish) 20 81.39 112.48 8 40.00
13150. Draco (fish0228) 20 71.91 88.72 18 90.00
13151. LEB (fhgfl) 20 42.59 51.78 0 0.00
13152. fbabylemon (fbabylemon) 20 85.22 96.15 7 35.00
13153. Fvthy (fathyamer) 20 52.67 61.81 2 10.00
13154. evaqate (evaqate) 20 64.63 77.87 3 15.00
13155. Thav (epic_boyo_123) 20 56.04 66.75 2 10.00
13156. EncodedTyper (encodedtyper) 20 89.79 106.48 6 30.00
13157. Tyrell (elter) 20 53.90 73.70 6 30.00
13158. Joe (elisouthworth) 20 113.89 143.88 13 65.00
13159. Arslan (elbosynov) 20 26.40 30.86 14 70.00
13160. g (eggwen) 20 64.09 73.29 6 30.00
13161. Brian (eeyjnairb) 20 105.23 119.26 8 40.00
13162. Maskedknight (edward5958) 20 94.62 117.06 7 35.00
13163. Tajwar (dxadcircuit) 20 74.25 91.38 6 30.00
13164. DUFOUR (dufour) 20 116.76 139.05 10 50.00
13165. Drifter (drifter103) 20 120.66 133.80 8 40.00
13166. Dhananjay (dk35840) 20 54.49 62.39 5 25.00
13167. Justin (disney6) 20 106.59 136.70 13 65.00
13168. DInokyd (dinokyd) 20 74.37 91.00 6 30.00
13169. Devansh (devansh_dua) 20 39.48 47.96 2 10.00
13170. Peeter (detectiveleht) 20 49.65 58.24 6 30.00
13171. A (deoignition) 20 70.41 79.44 2 10.00
13172. Demon (demon_hunter_bd) 20 48.45 55.67 1 5.00
13173. Dicky (dcstormrage) 20 67.56 78.77 7 35.00
13174. Darjinero (darjinero) 20 88.17 99.41 9 45.00
13175. Alex (dangercomeswithalex) 20 70.14 87.26 9 45.00
13176. fingers hurt (cxyym) 20 100.69 116.49 10 50.00
13177. csAxer8 (csaxer) 20 101.94 126.48 9 45.00
13178. CRISTO (cristomathew7) 20 69.41 83.53 4 20.00
13179. Donkey (crazybraden) 20 82.69 97.28 4 20.00
13180. Nero was here (correct_fing... 20 116.13 132.59 11 55.00
13181. cana (cnry) 20 110.02 125.26 12 60.00
13182. D (chubbieveggie) 20 84.59 96.01 5 25.00
13183. Chris (christrilling) 20 115.70 128.49 15 75.00
13184. Christian (chrillzen) 20 99.26 119.49 5 25.00
13185. chez (chezzion) 20 81.38 96.16 2 10.00
13186. Chad (chad87) 20 98.04 115.80 11 55.00
13187. carpathian (carpathian) 20 83.72 103.11 5 25.00
13188. Shaan (captainshaani) 20 47.06 59.55 5 25.00
13189. Christopher (canorve) 20 53.80 63.70 1 5.00
13190. sam (candle4) 20 93.93 116.23 6 30.00
13191. Callow (callowblack) 20 56.60 67.29 4 20.00
13192. Mohamed (byfarag) 20 122.98 144.18 12 60.00
13193. Brady (bward62) 20 94.75 119.25 8 40.00
13194. Bob (bushybrows) 20 97.90 118.49 9 45.00
13195. Alicia Peas (bundt) 20 65.90 77.87 5 25.00
13196. (bummered) 20 130.52 168.87 10 50.00
13197. Brian (btong) 20 111.37 135.12 7 35.00
13198. Bruh (bruhletuce) 20 63.19 72.75 6 30.00
13199. hamger (broncos1388) 20 60.52 76.54 2 10.00
13200. Sami (britishrifleman) 20 66.45 88.52 1 5.00
13201. Random (bogdanmironov) 20 81.38 93.98 4 20.00
13202. Gregory (bobren) 20 97.35 106.42 5 25.00
13203. noms (bloopdaferd) 20 81.33 98.05 4 20.00
13204. bloncing (bloncing) 20 66.40 77.28 4 20.00
13205. Kana smurf (blackmind) 20 91.77 107.86 11 55.00
13206. Matt (bigrocku) 20 73.50 87.94 6 30.00
13207. Joe (bigboythrows) 20 100.06 113.95 9 45.00
13208. bharat (bharatcoder007) 20 52.51 64.83 4 20.00
13209. z (bazackk4) 20 79.21 97.12 9 45.00
13210. Baran (baranomania) 20 84.62 101.33 5 25.00
13211. Banun (banun) 20 55.99 68.91 2 10.00
13212. Bangerzz (bangerzz) 20 65.31 86.98 2 10.00
13213. Irsyad (azcat01) 20 66.51 77.53 4 20.00
13214. Korbin (auvvia) 20 84.36 102.42 7 35.00
13215. AUDEAMUS (audeamus) 20 61.90 79.57 1 5.00
13216. Astra (astrame) 20 77.14 89.27 4 20.00
13217. ASP00KY (aspooky) 20 57.49 77.33 8 40.00
13218. revaN (ashun) 20 101.69 114.79 6 30.00
13219. nah id win (aragorn_the_snake) 20 125.75 136.98 1 5.00
13220. AppleSnap (applesnap_1) 20 57.27 68.16 5 25.00
13221. Eric (appleipad556) 20 132.93 147.26 17 85.00
13222. anntaylor (anntaylorn) 20 134.77 172.29 17 85.00
13223. Anita (anita0718) 20 99.20 119.83 8 40.00
13224. anik akash (anikakash) 20 40.35 52.45 3 15.00
13225. Wolfie (amrkhaled09) 20 98.61 127.33 10 50.00
13226. Amin (amin_farzane) 20 73.55 80.67 4 20.00
13227. Amelia (amelia_j_s) 20 56.88 64.06 7 35.00
13228. Alper (alperiox) 20 108.08 129.26 7 35.00
13229. Alon (alon276) 20 101.91 113.72 12 60.00
13230. TSpin (all_type) 20 76.05 87.81 4 20.00
13231. Jesse (alfonz) 20 68.70 80.89 5 25.00
13232. Akbor (akbor_ab) 20 52.12 65.11 2 10.00
13233. Eduardo (airplane_cakes) 20 84.07 109.36 5 25.00
13234. Aimbot (aimbot2003) 20 66.96 77.90 7 35.00
13235. Rasmis (ahtavarasmus) 20 54.82 67.23 6 30.00
13236. Afzaal (afzaalahmad) 20 45.86 59.37 3 15.00
13237. Muhammad (afi__afi) 20 43.13 52.91 1 5.00
13238. affnah (affnah) 20 121.36 134.76 6 30.00
13239. Achyut (achyut_india) 20 76.06 90.28 5 25.00
13240. Alan (acfrost3) 20 50.89 60.32 2 10.00
13241. Abqw112 (abqw112) 20 95.42 112.34 8 40.00
13242. Syrus (abbys_sof) 20 80.23 91.80 7 35.00
13243. AA Batteries (aa_batteries) 20 80.02 91.42 3 15.00
13244. aarush_ (aarush_) 20 81.21 92.81 6 30.00
13245. Aadhi (aadhi936) 20 56.19 60.15 1 5.00
13246. Santhosh (54nth05h) 20 62.15 74.50 7 35.00
13247. Suns (49suns) 20 70.75 80.14 2 10.00
13248. Greedy (greedy_78) 20 72.90 89.27 5 25.00
13249. ThPh (thph) 20 18.72 22.86 2 10.00
13250. bence (stefler01) 20 70.94 83.37 6 30.00
13251. Senvidu (galaxy_slayer_zed) 20 56.32 67.11 0 0.00
13252. tstats[mirfattah] (mirfattah) 20 44.75 55.80 1 5.00
13253. Unknown (__unkn0wn__) 20 85.15 102.98 5 25.00
13254. Michael (mspain0729) 20 74.59 87.90 7 35.00
13255. Alex (alexm11593) 20 54.27 64.97 6 30.00
13256. Lulu (aztral) 20 58.75 68.38 6 30.00
13257. Joshua (josh3000) 20 60.13 72.86 7 35.00
13258. G (foad420) 20 74.76 97.59 6 30.00
13259. Lucas (opoutinechooo) 20 76.31 86.61 6 30.00
13260. Tony (generalbob1212) 20 90.57 109.99 8 40.00
13261. Romain (romainl456) 20 65.46 80.79 6 30.00
13262. Dana (cutie68176) 20 39.59 46.69 0 0.00
13263. YellowyLOL (seojoon) 20 81.92 93.87 7 35.00
13264. Di (qazydi) 20 64.67 75.44 13 65.00
13265. Pytist (talentoncolemak) 20 79.13 88.80 8 40.00
13266. Mike (mikechill_69) 20 56.41 70.86 4 20.00
13267. rhi (okrhi) 20 75.01 87.64 2 10.00
13268. Daniel (moixland) 20 100.34 116.07 12 60.00
13269. jlang (jlang2) 20 65.60 83.25 4 20.00
13270. Dave (dsolesvik) 20 102.24 122.71 14 70.00
13271. Hunter (midorieon) 20 57.76 71.42 3 15.00
13272. Haiku (mastahaiku) 20 82.88 96.08 9 45.00
13273. Jonas (jonstep) 20 46.84 59.71 2 10.00
13274. Nightkid (tatami_downshift) 20 45.61 54.24 3 15.00
13275. Alan (autisticfish) 20 101.26 119.16 10 50.00
13276. Mohammed (mohammed_m) 20 67.33 77.35 2 10.00
13277. janina (janinaa) 20 43.62 53.94 3 15.00
13278. KY (9v_lky) 20 62.25 80.85 4 20.00
13279. Bob (bob192433) 20 98.66 108.57 8 40.00
13280. K (keiarcy) 20 87.91 100.46 5 25.00
13281. Blaire (sayurblaires) 20 64.60 76.24 7 35.00
13282. Ben (2benn) 20 74.81 90.56 6 30.00
13283. ja (bigfatpotato) 20 50.64 62.50 4 20.00
13284. miguel (gonzalodtd) 20 76.54 94.75 8 40.00
13285. mk (ekoam) 20 52.02 62.82 5 25.00
13286. velano (velano) 20 64.27 80.93 5 25.00
13287. Ero_Senin (typer_sensei) 20 33.72 39.60 4 20.00
13288. John (minipax) 20 60.18 67.75 4 20.00
13289. Amine (goshey) 20 57.81 67.21 6 30.00
13290. Kenny (rexnihilo) 20 43.12 56.00 3 15.00
13291. ohreo (ohreo) 20 92.78 119.83 8 40.00
13292. Tristan (triscross) 20 67.53 74.03 5 25.00
13293. Claywell (claywello) 20 45.55 52.47 2 10.00
13294. Henry (shocksan) 20 35.03 45.15 0 0.00
13295. xxx (vxnomous_) 20 53.55 62.73 8 40.00
13296. Perry (plebeian7) 20 66.15 88.56 10 50.00
13297. Yashwanth (csyashwanth) 20 35.81 44.47 2 10.00
13298. Nguyễn Minh (shiftk) 20 65.08 102.86 5 25.00
13299. rae (notraeign) 20 100.41 120.48 6 30.00
13300. Penguin (penguin24562) 20 105.83 134.55 19 95.00
13301. Eli (gokutypingwizard_) 20 23.72 31.93 7 35.00
13302. Hopp (461am) 20 82.82 96.46 7 35.00
13303. Lucas (sonic_car_lucas_ling) 20 68.18 90.03 3 15.00
13304. james (minecraft001yt) 20 83.27 97.06 11 55.00
13305. Andi (andih) 20 72.87 91.80 7 35.00
13306. James (__james) 19 57.84 68.73 4 21.05
13307. Hannah (_hannahxr) 19 66.24 76.41 5 26.32
13308. Zakir (z_slayer) 19 68.14 78.35 8 42.11
13309. Cyrus (zombie_kid_likes_tur... 19 87.32 114.42 5 26.32
13310. Kevin (zenicide) 19 100.81 120.76 8 42.11
13311. kushkus (zefirokouz) 19 81.89 96.51 6 31.58
13312. Zamira (zamira89) 19 23.78 27.09 8 42.11
13313. zahid (zahid_hasan_sahin) 19 58.92 70.72 5 26.32
13314. Zach (zacuum) 19 85.34 105.06 5 26.32
13315. Zack (zackjwilk) 19 102.83 122.54 9 47.37
13316. Zach (zachattack8910) 19 75.23 92.82 2 10.53
13317. Shian (ytxiang1997) 19 89.20 101.87 2 10.53
13318. Liam (yourmotherguy) 19 94.60 110.55 10 52.63
13319. Regin (yoloburgerking) 19 109.99 122.59 9 47.37
13320. yaQvadrat (yaqvadrat) 19 61.05 72.86 4 21.05
13321. yang (yangtyper) 19 79.14 87.49 5 26.32
13322. Paul (yangaapaul) 19 125.98 149.66 13 68.42
13323. Marc (xmarcxx) 19 77.53 95.11 3 15.79
13324. Alex (xanderamb) 19 81.16 97.48 9 47.37
13325. wiktor (wiktoroski1995) 19 27.70 36.44 4 21.05
13326. Kevin (whatsyourtype) 19 111.75 131.84 8 42.11
13327. Weegeepootis (weegeepootis) 19 118.44 135.06 8 42.11
13328. Walter (walter1) 19 92.78 102.47 8 42.11
13329. DybVv (vuong02011996) 19 54.00 63.71 4 21.05
13330. Khoi Nguyen (vukhoinguyen8492) 19 105.47 117.36 8 42.11
13331. vormin (vormin) 19 63.00 72.46 5 26.32
13332. Vishishta (vishik_685) 19 71.83 81.02 7 36.84
13333. Dan (videogamewarriortv) 19 114.21 144.77 11 57.89
13334. Boris (vhoma) 19 55.52 60.80 1 5.26
13335. Jun (vegetto1126) 19 112.07 129.66 12 63.16
13336. Valtishqq (valti46) 19 78.93 90.25 5 26.32
13337. Michael (valibukk) 19 66.87 75.21 7 36.84
13338. Utku (utkumaden) 19 75.71 89.14 5 26.32
13339. U (uqs1) 19 63.83 74.67 2 10.53
13340. ungabunga (ungabungaoobunga) 19 87.27 110.66 4 21.05
13341. Obama (underi7) 19 92.26 105.67 10 52.63
13342. Alan (typing_alan) 19 65.28 76.68 5 26.32
13343. Turningworld (turningworld) 19 59.80 70.52 8 42.11
13344. Trey (trxtier) 19 54.21 75.98 2 10.53
13345. Truvius (truvius) 19 86.68 107.89 4 21.05
13346. Josh (tributedajerk) 19 103.69 128.82 10 52.63
13347. Tomasz (toumash) 19 71.55 84.89 8 42.11
13348. Toshi (totora) 19 42.01 54.13 1 5.26
13349. Tobias (tospon) 19 28.73 33.56 6 31.58
13350. tontin (tontinvicinta) 19 92.70 111.85 5 26.32
13351. Tibnel (tonels) 19 115.23 141.30 10 52.63
13352. chalantorn (tonchalantron) 19 71.00 86.51 14 73.68
13353. TapTapTappy (tomcolemak) 19 115.63 136.22 9 47.37
13354. Tej (tjoshi12) 19 94.71 108.84 7 36.84
13355. Faustino (tinoriffic) 19 102.15 112.77 7 36.84
13356. Tan (tim0909) 19 124.53 140.79 12 63.16
13357. Thuong (thuongle19) 19 66.45 76.38 4 21.05
13358. Ryan (thoughtpotato) 19 96.32 112.43 5 26.32
13359. pogchamp (the_frog_champ) 19 119.92 164.12 11 57.89
13360. Radu Codescu (the_eagle) 19 53.19 59.77 4 21.05
13361. Coconut (the_coconut) 19 97.09 107.15 6 31.58
13362. Anson (the_chill_templar) 19 90.32 109.31 10 52.63
13363. Luc (theshadowcuber) 19 92.31 111.84 4 21.05
13364. Aaron (theredspartan) 19 86.84 101.98 5 26.32
13365. theonesomebodey (theonesome... 19 67.52 98.84 3 15.79
13366. daniiar (thedoni) 19 43.04 55.14 1 5.26
13367. the1stpsycho (the1stpsycho) 19 76.71 93.81 6 31.58
13368. Maddy (teruteru2116) 19 113.98 152.51 12 63.16
13369. Iftakhar (tanvir021) 19 45.74 51.75 1 5.26
13370. Tan (tang_) 19 65.52 77.88 7 36.84
13371. Danny (taipmaster) 19 97.55 120.38 10 52.63
13372. Alan (taialan) 19 87.07 99.83 17 89.47
13373. Sumit (sysoutme) 19 65.32 71.25 3 15.79
13374. Maxi (swimincircles) 19 85.15 104.47 8 42.11
13375. MadsFuldGas (swaax) 19 139.32 160.32 17 89.47
13376. सुरेन्द्र... 19 56.55 69.09 1 5.26
13377. Joe (suqmadiqmann) 19 98.70 115.94 10 52.63
13378. Landon (sugamalia) 19 98.88 132.34 6 31.58
13379. Sue (suevang) 19 62.24 78.76 2 10.53
13380. Styo (styofox) 19 53.50 61.59 2 10.53
13381. strange (strangeeggs) 19 133.86 165.74 8 42.11
13382. stormchaserwhienne (stormch... 19 78.75 102.54 6 31.58
13383. Stevey (steveaiva) 19 56.87 67.42 2 10.53
13384. Kasey (kaseykasey) 19 48.02 56.88 3 15.79
13385. Miguel (spiritdesire) 19 79.50 88.61 5 26.32
13386. Aria (spaceface32) 19 82.59 98.42 3 15.79
13387. Tomislav (sovageng) 19 76.39 85.69 6 31.58
13388. Ler (soospooky) 19 97.67 107.05 7 36.84
13389. SoopaKhell (soopakhell) 19 109.73 129.87 14 73.68
13390. Somanos (somanos) 19 96.13 109.36 8 42.11
13391. brad (soccerboyy) 19 91.25 120.56 8 42.11
13392. Daan (skunki) 19 81.70 91.72 7 36.84
13393. tstats[sivert_ivert] (siver... 19 87.85 112.44 5 26.32
13394. Sisi (sisiamor) 19 121.49 141.02 13 68.42
13395. (sirreinz) 19 94.13 106.21 8 42.11
13396. Daniel (siichotic) 19 103.64 121.78 3 15.79
13397. Bertie (shkablameo) 19 54.91 64.61 2 10.53
13398. Shawn (shawtyper) 19 57.59 73.79 4 21.05
13399. SeldRiyo (seldriyo) 19 56.16 63.31 3 15.79
13400. Caro :3 (scary_carrie) 19 59.25 70.82 3 15.79
13401. Sc0rxh (sc0rxh) 19 107.95 123.16 6 31.58
13402. based_hitler_69 (sav_ru) 19 47.90 54.69 1 5.26
13403. Sapphire (sapphirexsky) 19 86.25 129.24 5 26.32
13404. Sapient (sapient) 19 85.69 106.89 4 21.05
13405. 1337 (samseks) 19 89.91 104.82 9 47.37
13406. Samantha (samantha_314) 19 99.96 117.69 10 52.63
13407. SadRoad (sadroad) 19 90.78 123.10 6 31.58
13408. Cherry (s9crs) 19 42.74 51.96 1 5.26
13409. Robin (rxb1nn) 19 75.21 93.25 4 21.05
13410. rpyx (rpyx) 19 115.39 131.24 13 68.42
13411. RPUSam (rpusam) 19 151.38 160.44 18 94.74
13412. rohit (rohitzerofour) 19 47.47 67.35 2 10.53
13413. Rishit (rishitlogar) 19 74.12 89.84 2 10.53
13414. fanatic (rijulbidhan) 19 81.07 91.36 8 42.11
13415. Rick (rick_200wpm) 19 10.83 14.09 10 52.63
13416. Themis (reitgg) 19 105.94 127.35 13 68.42
13417. FreePalestine (reda6aboob) 19 24.83 31.11 5 26.32
13418. ReconMarine (reconmarine117) 19 71.43 81.01 7 36.84
13419. Nefritees (realnefritees) 19 69.79 82.82 6 31.58
13420. rao (raonavdeep) 19 55.62 67.92 5 26.32
13421. Roope (randommaster) 19 57.38 62.82 6 31.58
13422. Rahma (rahhma) 19 69.86 78.92 10 52.63
13423. Clare (radioclare) 19 83.53 102.79 5 26.32
13424. Q3stor (q3stor) 19 35.65 44.80 3 15.79
13425. temp23178946 (previouslol) 19 90.15 112.20 5 26.32
13426. Pramit (pramittt) 19 51.40 64.18 1 5.26
13427. Jason (pradogy) 19 79.73 102.33 2 10.53
13428. Playboifarti (playboifarti) 19 62.54 77.96 3 15.79
13429. PkRb21 (pkrb21) 19 65.05 73.09 5 26.32
13430. PIXI (pixipixi) 19 136.43 176.90 11 57.89
13431. PixelFog (pixelfog) 19 99.96 111.62 6 31.58
13432. Speedy (pindakaaspot123) 19 85.70 109.01 6 31.58
13433. Soós (pbaalt) 19 73.48 88.45 5 26.32
13434. Paulie (paulie_) 19 107.96 126.80 7 36.84
13435. Pasta_Devoured (pasta_devou... 19 45.44 52.68 17 89.47
13436. Parnian (parnian) 19 47.70 56.28 0 0.00
13437. Cael (paile) 19 95.51 117.19 7 36.84
13438. Jo (oyangjo) 19 71.91 92.45 4 21.05
13439. otve (otve) 19 64.41 85.98 6 31.58
13440. OranH77 (oranh77) 19 78.88 94.08 6 31.58
13441. Alex (omggitsalphaa) 19 92.06 106.80 5 26.32
13442. Ollie (olijf) 19 81.75 95.49 8 42.11
13443. Eldin (oktea) 19 100.29 118.98 8 42.11
13444. Nathan (nzhang5075) 19 77.88 89.79 4 21.05
13445. Nynnf (nynnf) 19 82.95 96.11 15 78.95
13446. Nvzhnn (nvzhnn) 19 97.54 113.19 9 47.37
13447. Youssef (nuggetdip) 19 68.20 77.01 4 21.05
13448. NRC_131_G (nrc_131_g) 19 86.08 104.15 16 84.21
13449. Nabin (npboss) 19 52.50 62.93 4 21.05
13450. xuehua (noquitnrooom) 19 120.57 144.58 12 63.16
13451. Daniel (nodasch) 19 64.90 81.91 4 21.05
13452. Jason (njasow) 19 112.17 123.39 12 63.16
13453. Jibon (ninja0x) 19 43.44 50.64 2 10.53
13454. Nicolai (nicolaifeldthaus) 19 79.83 92.38 5 26.32
13455. Jus (nicememe12) 19 97.18 111.32 9 47.37
13456. Nefko (nefko) 19 90.98 108.20 5 26.32
13457. Natan (nati_130) 19 38.97 46.37 0 0.00
13458. Nabil (nabilhuda) 19 64.70 78.06 5 26.32
13459. tstats[nabil365] (nabil365) 19 53.79 68.65 3 15.79
13460. adam (n0tracist) 19 104.77 122.42 11 57.89
13461. MUHAMMAD (m_haris676) 19 33.80 40.59 6 31.58
13462. Mike (mxtinkxm) 19 41.09 60.87 2 10.53
13463. mush (mushkatsu) 19 70.82 91.54 2 10.53
13464. Addis (mryoungaddis) 19 62.78 74.75 2 10.53
13465. lamok (mrgago) 19 96.36 123.72 13 68.42
13466. Sompang (mplegato) 19 87.42 98.32 5 26.32
13467. Mark (mose9634) 19 95.32 110.65 7 36.84
13468. Dill (monkeyman1637) 19 77.97 91.81 8 42.11
13469. Möhri (moehri) 19 72.55 88.80 15 78.95
13470. Moe (moeb1us) 19 82.59 107.02 10 52.63
13471. Nurul (mnislam) 19 86.08 93.35 8 42.11
13472. Paloma (mmmmtype) 19 69.74 80.77 6 31.58
13473. Micah (mjdomo) 19 88.72 101.04 8 42.11
13474. Vãi Trí (minhtrihard) 19 82.37 96.02 3 15.79
13475. Michael (mikenike52899) 19 94.50 110.55 6 31.58
13476. Andrew (mhayes4701) 19 89.44 96.60 6 31.58
13477. Michael (meowmeowmikey) 19 101.32 131.15 9 47.37
13478. Melioninas (melioninas) 19 70.42 83.65 6 31.58
13479. Manos (me1nos) 19 54.10 68.47 0 0.00
13480. Matthew (mcluzar) 19 104.53 127.32 10 52.63
13481. mcjohn_117 (mcjohn_117) 19 91.66 109.37 9 47.37
13482. Son (mcc_sasuke) 19 60.50 75.08 5 26.32
13483. MB (mb_the_lighting) 19 67.45 78.18 6 31.58
13484. Matin (matinkh) 19 83.16 96.89 7 36.84
13485. Martin (martinw89) 19 82.18 96.54 5 26.32
13486. Martine (martine_338) 19 59.82 72.35 14 73.68
13487. Segs (mahrush) 19 56.47 68.10 9 47.37
13488. Mahmoud (mahmoudalbadarin) 19 66.47 75.35 5 26.32
13489. Mack (mackimations) 19 87.73 100.76 7 36.84
13490. tomcr00se (lqszlo) 19 60.57 77.21 17 89.47
13491. Lowie (lowie_987) 19 67.36 78.19 6 31.58
13492. Jonathan (lone_lee) 19 93.49 113.93 7 36.84
13493. Elisabeth (liz4liz5) 19 98.10 121.99 9 47.37
13494. xhulio (lighting11) 19 65.47 79.97 5 26.32
13495. leonardo (leonardouwu) 19 64.90 74.78 3 15.79
13496. Lemons (lemonslmfao) 19 53.56 61.72 10 52.63
13497. Lazyteam (lazyteam) 19 73.07 87.39 4 21.05
13498. Lucas (larkluco) 19 55.97 63.86 4 21.05
13499. Larisa (larisa402) 19 74.54 91.57 4 21.05
13500. ⠀ (lain_) 19 58.53 71.36 4 21.05
13501. Solomann (kuttamma01) 19 108.22 127.85 10 52.63
13502. Jakob (kroelle_korean) 19 94.39 107.52 10 52.63
13503. Kristian (kristiandiana) 19 69.02 80.09 5 26.32
13504. Kazoo (kosu_kat) 19 72.81 79.97 6 31.58
13505. Purple (komnambongo) 19 111.67 143.82 8 42.11
13506. Ebok (kobe5623) 19 94.26 109.34 10 52.63
13507. Yesitsme (kingbee11) 19 49.49 62.49 3 15.79
13508. Tony (kevinneeraj) 19 112.44 130.81 11 57.89
13509. Kazuki (kazuki_kun) 19 88.60 99.76 6 31.58
13510. Kažkas (kazkass) 19 70.76 77.12 5 26.32
13511. Ayush (kanodiaayush) 19 93.33 111.13 5 26.32
13512. Kanazaki (kanazaki) 19 81.14 95.68 7 36.84
13513. Kagero (kagero_) 19 67.36 85.93 4 21.05
13514. bruh (k3nny11) 19 67.54 85.28 4 21.05
13515. Juniper (junipergd) 19 108.54 144.84 12 63.16
13516. Julia (juliazc) 19 88.30 101.75 4 21.05
13517. Jessica (jsilvers27) 19 74.73 85.84 5 26.32
13518. Joseba (jouelcamper555) 19 56.97 73.52 2 10.53
13519. Josiah (josiah_cw) 19 79.92 89.81 2 10.53
13520. yerimiese (johwee) 19 94.59 108.88 7 36.84
13521. Joel (joellimcy129) 19 94.11 111.97 15 78.95
13522. Jxshify (jkbestgamer) 19 106.60 138.24 18 94.74
13523. Thomas (jitensha03) 19 76.95 97.83 10 52.63
13524. Jillian (jillianbonfoeyoops... 19 55.30 67.40 10 52.63
13525. Jesse (jesser1440) 19 73.08 85.06 5 26.32
13526. JerseySlums (jerseyslums) 19 84.12 113.47 7 36.84
13527. Jerin (jerinjames) 19 54.29 63.63 5 26.32
13528. J (jdizzla) 19 121.45 149.63 8 42.11
13529. James (james_jjv) 19 72.61 87.24 7 36.84
13530. James (jameshasconnected) 19 50.01 67.16 1 5.26
13531. James (james0306) 19 79.21 95.95 2 10.53
13532. Jam (jamelele) 19 125.27 145.60 13 68.42
13533. Jax (jacksonn131) 19 84.58 107.12 4 21.05
13534. Jack (iviagicjack) 19 97.65 113.23 7 36.84
13535. ivan (ivanferraro) 19 74.57 86.42 3 15.79
13536. Tact (itstact) 19 98.73 114.36 8 42.11
13537. itsgohtime (itsgohtime) 19 125.10 134.80 13 68.42
13538. Juan (isayuno) 19 100.88 114.53 10 52.63
13539. Kylle (iomeotic) 19 73.44 91.31 6 31.58
13540. amir (ioio) 19 88.30 113.80 13 68.42
13541. Nicolas (insont) 19 78.22 90.78 7 36.84
13542. Inox (inox) 19 85.37 97.25 6 31.58
13543. alvarado (im_wilin) 19 81.86 95.99 5 26.32
13544. Lawrence (imetsia) 19 106.25 116.13 8 42.11
13545. Thomas (ilikebigtitties69) 19 67.31 74.40 7 36.84
13546. Jim (ifeelhyper) 19 114.46 134.56 11 57.89
13547. icening (icening) 19 40.88 45.93 4 21.05
13548. Ian (iango23) 19 59.97 75.34 5 26.32
13549. Skylar (iamskyhawk) 19 90.70 101.64 11 57.89
13550. Ashish (iamprogrammar) 19 66.03 73.90 5 26.32
13551. IAGamingWay (iagamingway) 19 74.86 87.68 14 73.68
13552. Randy (hype_rion) 19 62.18 83.28 3 15.79
13553. Brian (hydrobox) 19 85.30 96.46 2 10.53
13554. Hoang (huyyyyyyyyyyyyyyyyy) 19 70.28 77.67 4 21.05
13555. me (hseruslihkus) 19 49.88 59.32 2 10.53
13556. Steven (hondasivakgaming) 19 77.87 104.50 6 31.58
13557. Hol (holster) 19 92.42 107.00 9 47.37
13558. HerrBlinkenlicht (herrblink... 19 64.46 80.41 1 5.26
13559. ok (herbaltea) 19 97.80 121.03 9 47.37
13560. Hazim (hazm) 19 98.60 116.91 13 68.42
13561. Hari Chandan Das (harichand... 19 57.68 67.19 1 5.26
13562. titty (happyfaceman) 19 67.64 81.72 5 26.32
13563. IHnanah (hanahaoha) 19 134.92 176.36 16 84.21
13564. Hamlet (hamabaya) 19 102.51 115.47 5 26.32
13565. Nah (halo375) 19 58.54 69.88 5 26.32
13566. LE ANH QUAN (hacbachmaquan) 19 82.20 97.58 8 42.11
13567. Andy (gunwing54) 19 96.66 114.89 4 21.05
13568. Nelson (guaxini) 19 53.11 61.88 1 5.26
13569. Gavin (gt3ch1) 19 95.10 118.12 8 42.11
13570. Geo (godex) 19 95.48 114.43 7 36.84
13571. Daniel (gismo359) 19 82.93 92.81 8 42.11
13572. Gabi (gabitzuxxl) 19 109.49 121.68 7 36.84
13573. David (fuzzycheeks) 19 111.26 130.23 8 42.11
13574. blaine (frikker) 19 118.12 151.78 15 78.95
13575. Erika (frenzymania) 19 84.77 101.64 3 15.79
13576. Lewis (fr0stbites) 19 77.75 90.89 8 42.11
13577. fosty (fostyfog) 19 46.57 62.62 5 26.32
13578. Sakura (foreheady) 19 75.64 84.72 1 5.26
13579. fred (foop1) 19 112.20 128.19 10 52.63
13580. Ray (flexray) 19 86.94 108.85 7 36.84
13581. FlaTrix (flatrix) 19 312.06 448.52 19 100.00
13582. Filip (fifi_wilk) 19 81.60 94.37 6 31.58
13583. fergisson (fergiss) 19 65.88 76.47 6 31.58
13584. Aidan (fastflangies) 19 67.29 78.57 8 42.11
13585. Ian (fadedrobin) 19 72.78 100.95 6 31.58
13586. eyeliddy (eyeliddy) 19 99.32 119.86 11 57.89
13587. Leon (extremegamer116) 19 100.29 125.96 5 26.32
13588. Evan (evang_dvorak) 19 103.15 120.28 12 63.16
13589. EthKrae (ethkrae) 19 72.66 82.02 5 26.32
13590. equations (equationslayer12) 19 74.67 94.70 4 21.05
13591. Ahmad (eqbalshekib) 19 65.64 81.49 7 36.84
13592. Epik Dino (epikdinosaur) 19 66.22 76.67 4 21.05
13593. RIP Byron (enriquecollin) 19 131.24 155.19 11 57.89
13594. visily (enlive3) 19 72.63 96.60 6 31.58
13595. Prawny (enderduck247) 19 88.71 119.22 17 89.47
13596. eman borham (ema_burham) 19 42.77 47.67 1 5.26
13597. Emateos (emateos) 19 59.98 67.63 9 47.37
13598. Ella (ellavampyrella) 19 49.53 57.56 2 10.53
13599. elif (eliff) 19 66.57 80.99 7 36.84
13600. Elias (eliasmarcelin0) 19 80.00 103.45 6 31.58
13601. David (electro2020) 19 119.63 143.48 9 47.37
13602. ekupro (ekupro) 19 44.68 51.89 2 10.53
13603. Eifie (eifietheward) 19 62.29 88.50 2 10.53
13604. Satyam (echosatyam) 19 57.48 68.85 3 15.79
13605. Mazeppa (dynozawa) 19 93.63 103.35 4 21.05
13606. dukka (dukka_) 19 106.81 121.46 7 36.84
13607. RIP yomps (dtfps) 19 103.24 122.17 18 94.74
13608. Sascha (dsm716) 19 39.51 45.26 2 10.53
13609. Downsouthspy (drax_) 19 78.01 92.76 7 36.84
13610. jin (dragon51221) 19 86.29 94.76 6 31.58
13611. Dookie Shoes (dookie_shoes) 19 100.54 124.57 6 31.58
13612. Arrogant (dkaocka) 19 102.68 120.91 6 31.58
13613. Steven (df1337) 19 112.93 138.38 9 47.37
13614. desa (desa7645) 19 38.31 45.86 0 0.00
13615. Guest (dbluedb) 19 68.37 92.87 1 5.26
13616. Kike (darkskyflow) 19 51.76 59.51 9 47.37
13617. Darkcryed (darkcryed) 19 90.33 106.41 5 26.32
13618. Lee (cytokid101) 19 136.80 159.07 13 68.42
13619. Cryp_ted (crypted06) 19 106.54 121.42 19 100.00
13620. Ethan (crissps) 19 74.18 92.35 5 26.32
13621. Dumby (cooh) 19 89.01 100.38 5 26.32
13622. Hacker (console0) 19 38.00 45.35 1 5.26
13623. Blackmooer (colinluca) 19 76.86 89.94 7 36.84
13624. Jesse (cliev) 19 126.82 150.33 13 68.42
13625. Clark (clark_d) 19 52.95 70.41 1 5.26
13626. Vlad (ciorap88) 19 67.21 84.01 4 21.05
13627. mark (chuahuonga) 19 62.88 76.36 3 15.79
13628. Devon (cheeky_sneakster) 19 86.39 101.79 8 42.11
13629. Ccucumber12 (ccucumber12) 19 72.80 84.56 5 26.32
13630. Chris (cccxxxl) 19 103.73 116.44 19 100.00
13631. CarrotyLemons (carrotylemons) 19 69.48 84.49 7 36.84
13632. Carlz (carlz19) 19 89.85 105.36 5 26.32
13633. Josh (capitanwalrus) 19 74.44 91.59 3 15.79
13634. Ceramic (caleb_2000) 19 82.75 92.77 5 26.32
13635. bvk (bvkv) 19 64.11 72.09 1 5.26
13636. Arie (buenobonsai) 19 90.77 105.44 5 26.32
13637. Bede (breadstickx) 19 90.85 99.44 4 21.05
13638. Oleg (braga01) 19 83.28 92.31 7 36.84
13639. Brady (bradymoller) 19 77.12 91.29 3 15.79
13640. HUN (botyi22) 19 42.17 51.32 0 0.00
13641. boocoo (boocoo) 19 77.92 94.32 3 15.79
13642. Robert (bonsai_aus) 19 105.08 132.89 7 36.84
13643. Nolan (blerz) 19 103.84 117.38 16 84.21
13644. Blablle (blablle) 19 89.49 107.16 19 100.00
13645. bigpotato24 (bigpotato24) 19 61.94 76.92 5 26.32
13646. tirehtööri (benracer) 19 81.62 102.58 4 21.05
13647. Stefaan (befferdw) 19 92.93 140.75 10 52.63
13648. Brandon (bduick) 19 67.75 79.33 4 21.05
13649. Andy (batt) 19 88.93 100.20 5 26.32
13650. Basti (bastigga_) 19 70.35 83.16 5 26.32
13651. Bakushou (bakushou) 19 56.45 67.79 2 10.53
13652. Hoshi (b1ink) 19 75.47 90.90 6 31.58
13653. Avinash (avinash625) 19 81.68 95.29 2 10.53
13654. AuroraSpirix (auroraspirit) 19 101.08 130.84 8 42.11
13655. Haany (asterp01) 19 61.94 77.11 2 10.53
13656. Oliver (arscenic) 19 77.17 93.89 8 42.11
13657. blooks (aprinter) 19 98.46 115.85 12 63.16
13658. Ansh (ansh_001) 19 66.84 82.44 7 36.84
13659. Guillermo (andragoner) 19 100.61 128.04 3 15.79
13660. Amfomy (amfomy) 19 73.15 89.66 7 36.84
13661. Amal (amalsan) 19 57.59 65.26 5 26.32
13662. Guest (alvinaruto) 19 66.27 81.23 7 36.84
13663. curious (allodic) 19 100.67 116.07 11 57.89
13664. al2qx (al2qx) 19 78.54 92.57 6 31.58
13665. tstats[aisultan] (aisultan) 19 75.30 92.89 4 21.05
13666. Aidan (aidandapenguin) 19 58.65 66.71 1 5.26
13667. lemonade (agolemonade) 19 90.24 115.86 6 31.58
13668. Atanas (aginev) 19 47.08 56.07 3 15.79
13669. Eaton (adgray09) 19 68.29 85.27 4 21.05
13670. Jacob (addthenine) 19 85.79 98.73 5 26.32
13671. blackjeseos (actuallyfadhli) 19 69.89 86.93 4 21.05
13672. Rabia (abdessalam) 19 62.27 68.83 1 5.26
13673. Aafeef (aafeef25) 19 60.20 78.86 17 89.47
13674. Nick (aaaywhatup) 19 83.55 98.76 4 21.05
13675. Eduardo (4lc1d3) 19 78.90 91.53 2 10.53
13676. rome (1ensh1) 19 80.62 92.22 4 21.05
13677. Barteritus (barteritus) 19 67.59 88.04 1 5.26
13678. saktisudarsono (saktisudars... 19 80.68 92.68 3 15.79
13679. Yusome (yusomeli) 19 59.07 71.83 5 26.32
13680. Rustyrare (rustyrare) 19 69.16 82.51 6 31.58
13681. Fábio (thefabio8000) 19 61.92 76.33 6 31.58
13682. Scimza (scimza) 19 87.58 103.41 7 36.84
13683. Bob (iamaninja66) 19 69.86 86.19 5 26.32
13684. Hawk (hawkeye7662) 19 75.08 82.96 18 94.74
13685. Ivan (boringspookycoolivan) 19 74.38 89.60 5 26.32
13686. viktor (killingnexus) 19 58.76 69.70 3 15.79
13687. Noah (trumpybear) 19 76.18 87.17 6 31.58
13688. Z40Abanob (z40abanob) 19 70.87 88.73 12 63.16
13689. hteraG (hterag) 19 78.70 100.74 5 26.32
13690. Hao (hao1110) 19 44.45 61.51 2 10.53
13691. Penguin (itsgirlgamer49) 19 36.04 46.35 0 0.00
13692. kenzo (k3nx0) 19 58.49 68.41 1 5.26
13693. shacha (shacha) 19 36.05 41.56 0 0.00
13694. leo (enrage411) 19 59.02 73.47 7 36.84
13695. Mengkuda (rakaoii) 19 46.14 50.82 1 5.26
13696. John (john_willy) 19 64.61 78.33 10 52.63
13697. Logan (18logsar) 19 68.54 78.74 8 42.11
13698. TOAN (huytoan99z) 19 82.52 112.36 7 36.84
13699. Henry (akarieon) 19 79.78 100.58 13 68.42
13700. Pedro (tishi091) 19 68.56 76.72 5 26.32
13701. ydna (smilez_) 19 81.50 103.37 3 15.79
13702. Mango (monthly_mango) 19 88.42 102.65 10 52.63
13703. Nawaf (equin) 19 77.15 96.13 2 10.53
13704. Prince (pri_royal) 19 45.84 57.45 2 10.53
13705. Ekku (ekkusi) 19 83.45 98.23 4 21.05
13706. Harrison (nonotharry) 19 73.61 87.94 6 31.58
13707. D (numzberouz) 19 82.96 99.67 9 47.37
13708. Charles-John (geetarcharlie17) 19 87.52 111.03 4 21.05
13709. sopology (sopology) 19 73.47 85.28 5 26.32
13710. Kevin (kevinnarvaez) 19 51.29 60.05 17 89.47
13711. David (davrand11) 19 66.01 84.54 6 31.58
13712. Ling (penguinobeano) 19 113.94 138.27 13 68.42
13713. Dieter (c4ntel0pe) 19 75.35 88.16 4 21.05
13714. Edonis (edoedi15) 19 51.06 59.22 2 10.53
13715. Joris (percyjw) 19 49.59 55.07 4 21.05
13716. ilovelolipops (sad_hobbit) 19 55.22 64.34 1 5.26
13717. enigmaticpixels (enigmaticp... 19 85.44 99.79 3 15.79
13718. Aromasin (aromasin) 19 59.89 76.33 2 10.53
13719. Alex (alexey1995) 19 26.27 31.29 2 10.53
13720. Victor (unmighty) 19 98.58 115.54 9 47.37
13721. Rare (neno20022) 19 47.19 57.88 2 10.53
13722. Sckroob (sckroob) 19 113.23 125.38 6 31.58
13723. aaa (adric96) 19 88.28 101.28 7 36.84
13724. CuriousChild (curiouschild) 19 86.81 98.91 6 31.58
13725. v3 (_v3_) 18 166.98 187.28 16 88.89
13726. supreme (_supremes) 18 98.94 109.30 6 33.33
13727. Ionut (ztonaz) 18 61.09 69.98 4 22.22
13728. bob (zirx2) 18 87.33 100.02 3 16.67
13729. Ziffit (ziffit) 18 35.15 42.01 2 11.11
13730. Zachary (zacmanman) 18 99.24 114.50 3 16.67
13731. Josh (yummy4skin) 18 83.54 112.40 5 27.78
13732. Mike (yoshyosh) 18 55.98 66.75 0 0.00
13733. Jan (yentzeg) 18 90.92 107.46 8 44.44
13734. Yasunobu (yasunobu) 18 47.80 54.12 4 22.22
13735. Yaman (yamyoume) 18 69.51 77.42 4 22.22
13736. yabsira sisay (yabsira) 18 49.29 57.04 1 5.56
13737. I AM SPEED (xelestis) 18 96.99 114.84 6 33.33
13738. Xantrum (xantrum1) 18 77.28 96.73 7 38.89
13739. Dan (writfate) 18 68.97 89.26 4 22.22
13740. Work (worklife) 18 71.03 78.05 1 5.56
13741. a (waahello) 18 102.64 119.21 5 27.78
13742. Viniter (viniter_) 18 63.69 76.00 4 22.22
13743. vilo (viloo) 18 94.19 114.46 9 50.00
13744. valeriu (valeriu) 18 46.95 52.89 1 5.56
13745. Emmanuel (ugochuku2000) 18 87.97 105.64 9 50.00
13746. YW (tywee) 18 96.59 106.43 10 55.56
13747. meo (typowriter16) 18 114.41 135.36 11 61.11
13748. Dan (typefffast) 18 76.31 86.86 5 27.78
13749. Joran (turkeyman) 18 107.78 126.42 9 50.00
13750. n8 (ttensu) 18 98.30 113.83 7 38.89
13751. Tomasz (tserbinowski) 18 47.16 53.88 1 5.56
13752. truecoatcrew (truecoatcrew) 18 102.73 118.66 12 66.67
13753. Tripp (tripptypes) 18 52.49 67.36 5 27.78
13754. Travis (travisxball) 18 99.10 115.34 10 55.56
13755. TotalTao (totaltao) 18 69.25 80.99 3 16.67
13756. TornaxO7 (tornax) 18 53.46 58.04 1 5.56
13757. tony (toeknee0) 18 82.54 95.32 4 22.22
13758. tan (tnttant) 18 85.15 98.13 8 44.44
13759. Tir8 (tir8) 18 74.90 88.75 5 27.78
13760. cookie (timecookie) 18 84.91 95.48 8 44.44
13761. Tia (tiaaakayyy) 18 114.93 131.27 9 50.00
13762. Lynan (thonlynan) 18 52.44 67.20 4 22.22
13763. thomas (thoarell) 18 90.68 107.78 1 5.56
13764. Wing (thewing_) 18 83.08 114.78 2 11.11
13765. TheUnder (theunderdoge) 18 78.67 94.26 4 22.22
13766. Stefan (thebeaver5) 18 82.57 93.64 3 16.67
13767. Thai (thaiph244) 18 90.87 108.55 7 38.89
13768. ??? (teslacia) 18 100.05 110.46 10 55.56
13769. Tean (tean) 18 110.64 141.60 17 94.44
13770. Tangguh (tangguh_) 18 76.17 95.25 5 27.78
13771. Thomas (taimeru) 18 55.01 67.73 1 5.56
13772. Tobi (t0b5) 18 74.66 86.43 1 5.56
13773. Surajit (surajit) 18 58.21 69.77 1 5.56
13774. J (superuby5) 18 95.09 107.52 7 38.89
13775. SuperGion915 (supergion915) 18 70.45 82.41 4 22.22
13776. Andy (superchickeneat) 18 88.49 109.20 11 61.11
13777. saku (sukasa) 18 127.08 148.34 10 55.56
13778. anne (strawberrybannenana) 18 82.78 104.31 10 55.56
13779. Alyssa (stewalyssa) 18 76.37 90.75 6 33.33
13780. Mr. (stealthykoalaber) 18 104.44 125.68 7 38.89
13781. stealthevan (stealthevan) 18 109.78 140.70 9 50.00
13782. Stan (stan3999) 18 71.35 84.71 3 16.67
13783. Sticky (st1ckyman) 18 67.50 78.03 4 22.22
13784. ssiKY (ssiky) 18 71.33 83.25 3 16.67
13785. Tom (spicersoanner) 18 73.36 85.77 3 16.67
13786. Soul (soulisgarb) 18 89.09 99.44 3 16.67
13787. vivi (soulace) 18 125.25 153.26 8 44.44
13788. Leonardo (sonoleo) 18 71.24 80.80 4 22.22
13789. jenga (smokythunder) 18 108.06 137.08 5 27.78
13790. jules! (smeme) 18 95.24 117.46 13 72.22
13791. meher (smc181002) 18 53.86 72.15 3 16.67
13792. Subid (slowth_369) 18 55.21 68.55 2 11.11
13793. Simon (simonlee2216) 18 93.89 118.66 11 61.11
13794. Shivam (shivam543) 18 83.79 98.69 5 27.78
13795. Davit (shartavadavit0) 18 73.61 84.05 4 22.22
13796. Sienna (sfdragon) 18 111.31 136.81 9 50.00
13797. S (sestevens) 18 117.88 131.73 6 33.33
13798. Parker (seriousnewt8) 18 71.07 87.01 4 22.22
13799. sendiri (sendiri) 18 79.90 96.20 5 27.78
13800. Seforius (seforius) 18 106.48 129.41 11 61.11
13801. SeeJay (seejay_ferraro) 18 65.57 71.64 4 22.22
13802. Sahil (sahilb7) 18 47.37 60.08 3 16.67
13803. sahani prasad (sahani) 18 47.05 53.19 2 11.11
13804. Victor (sadlad) 18 67.29 77.58 4 22.22
13805. Russell (russellsapphire) 18 99.54 117.19 7 38.89
13806. Russell (rtx420) 18 58.05 65.91 4 22.22
13807. Rodrigo (rodgodkiller) 18 63.97 78.87 4 22.22
13808. Assey (rockae) 18 89.31 109.10 9 50.00
13809. Robbie (roadcasted) 18 101.80 129.76 6 33.33
13810. Ruan (rmontelo) 18 92.65 106.50 7 38.89
13811. rmbench (rmbench) 18 94.06 107.27 5 27.78
13812. Ji (rk42745417) 18 66.00 77.48 1 5.56
13813. Riley (rileygramlich) 18 77.27 91.31 6 33.33
13814. Riley (riela_) 18 75.02 92.74 6 33.33
13815. Richard (rgoulterbm40dsk) 18 85.57 98.34 6 33.33
13816. KOCHENGOREN (renasha) 18 84.10 97.67 7 38.89
13817. Riley (rbogren) 18 76.05 91.37 2 11.11
13818. ray (raytrace) 18 55.59 69.30 0 0.00
13819. R0L3eX (r0l3ex) 18 83.72 109.01 4 22.22
13820. So Slow (quantum1) 18 117.22 137.54 9 50.00
13821. qria (qria) 18 84.67 97.91 5 27.78
13822. Qazz (qazztheqazz) 18 90.05 104.07 8 44.44
13823. Kantapat (pyro_x) 18 55.39 88.02 12 66.67
13824. pvx123 (pvx123) 18 33.37 38.19 0 0.00
13825. presto (presto3000) 18 83.02 94.49 4 22.22
13826. powerofmooogiza (powerofmoo... 18 107.83 125.10 7 38.89
13827. popsickles (popsickles) 18 90.41 102.77 12 66.67
13828. W8 4ME (pmarci9810) 18 86.43 98.50 3 16.67
13829. Jakob Kammerlander (plssnipe) 18 64.45 76.75 3 16.67
13830. paschalis (platoon132002) 18 45.08 48.92 4 22.22
13831. Piggie (piggiepoop) 18 112.59 136.34 8 44.44
13832. Peter (pieter_post) 18 95.00 116.17 14 77.78
13833. hollow knight (phoenixwleft) 18 66.78 78.17 4 22.22
13834. Pho (phobreze) 18 85.01 104.16 2 11.11
13835. Pawan (pawanmsr) 18 55.40 62.03 3 16.67
13836. Parsa (parsal) 18 81.76 92.77 5 27.78
13837. Victor (paralisity) 18 65.04 76.57 3 16.67
13838. Ozymandias (ozymandias_qc) 18 67.96 79.21 5 27.78
13839. Fauzan (ozaenzenzen) 18 109.59 122.36 6 33.33
13840. Owen (owenl131) 18 101.44 113.32 10 55.56
13841. annette (owannette) 18 96.24 109.07 9 50.00
13842. Johnny (onireves) 18 101.36 126.07 10 55.56
13843. om (om0305) 18 65.61 76.69 5 27.78
13844. Omar (oamrelhorbity) 18 55.58 61.77 3 16.67
13845. Nuteee (nutee) 18 47.97 61.56 0 0.00
13846. brayn (nmchanab) 18 80.46 86.34 8 44.44
13847. Nathan (nlaha) 18 78.45 85.88 7 38.89
13848. Nilacake (nilacake) 18 79.41 96.53 5 27.78
13849. niko (nikoooo) 18 58.33 75.13 3 16.67
13850. Nikhil (nikhil142) 18 90.02 106.58 6 33.33
13851. you (nigamot) 18 63.86 84.68 3 16.67
13852. Pratyaksh (nickpratyaksh) 18 76.30 92.12 18 100.00
13853. Bruh (nicesuu) 18 86.33 95.84 5 27.78
13854. God (nicechop) 18 63.11 71.61 2 11.11
13855. Tran (newstrung) 18 82.28 91.04 2 11.11
13856. nara (naraaa) 18 83.73 97.27 3 16.67
13857. Nafre (nafre) 18 105.55 118.92 10 55.56
13858. Jose (m_jose) 18 77.88 92.10 4 22.22
13859. Mymumswims (mymumswims) 18 88.81 106.97 6 33.33
13860. Mudmai (mudmai) 18 31.76 41.09 1 5.56
13861. Moukim (moukim) 18 74.01 83.56 2 11.11
13862. pup (mkpup) 18 73.19 86.67 5 27.78
13863. Edward (minecrafterman) 18 47.79 57.55 0 0.00
13864. mimo200 (mimo200be) 18 90.87 97.98 8 44.44
13865. mike (mikeyfromqueens) 18 94.60 106.78 9 50.00
13866. José Miguel (mikel2077) 18 84.93 101.22 6 33.33
13867. mikaelawashere (mikaelawash... 18 73.08 89.02 5 27.78
13868. midnightsimon (midnightsimon) 18 83.28 104.80 0 0.00
13869. Martin (mewix) 18 87.07 101.44 1 5.56
13870. Naisargi (mehtaphysicalfool) 18 87.11 99.48 5 27.78
13871. Mathijs (mathijsmaes) 18 92.72 108.10 7 38.89
13872. urmom (mars3000) 18 78.86 86.55 3 16.67
13873. Mari (maribun) 18 94.53 116.26 16 88.89
13874. josiah (mangofeline) 18 85.25 113.55 7 38.89
13875. Manfred (manfredxu99) 18 152.20 179.09 17 94.44
13876. Matthais (maciejosas2012) 18 100.67 116.74 5 27.78
13877. Ted (macfan) 18 105.20 115.53 9 50.00
13878. Luke (lukeov) 18 80.24 99.87 5 27.78
13879. Johnathan Walter (luciferin) 18 97.01 108.78 5 27.78
13880. Lukasz (lpodolski) 18 72.92 84.84 1 5.56
13881. lodo4ka (lodo4ka) 18 70.45 83.82 3 16.67
13882. Mr (littyzm) 18 107.27 125.48 4 22.22
13883. Rein (lilpotatopop) 18 89.48 112.50 13 72.22
13884. Klunky (liamrob) 18 85.92 107.44 11 61.11
13885. Ante (ld77) 18 91.04 104.80 9 50.00
13886. Jacob (krucinskij) 18 75.40 87.78 4 22.22
13887. Kelly (kile07) 18 49.27 65.65 2 11.11
13888. Khuslen (khyl) 18 58.41 69.39 3 16.67
13889. Tofumaster (khenglon) 18 68.35 78.49 3 16.67
13890. Kayak (kayakcanoe) 18 60.02 71.41 2 11.11
13891. Kathy (kathy_starfire) 18 72.24 96.57 3 16.67
13892. Kareem (kareemshehata) 18 42.48 53.48 0 0.00
13893. KamilJan (kamil_jan) 18 90.05 100.97 7 38.89
13894. Kacper (kacperpro) 18 99.21 124.38 13 72.22
13895. James (justjames) 18 79.43 96.08 6 33.33
13896. Julio (julio7125) 18 77.04 94.08 2 11.11
13897. jude (judepls) 18 131.14 147.02 11 61.11
13898. JSKE25 (jske25) 18 96.79 119.19 10 55.56
13899. tstats[jpatrocinio5436] (jp... 18 83.14 94.87 9 50.00
13900. JoYo (joyojo) 18 88.70 101.13 11 61.11
13901. Joshua (joshuasymes) 18 87.33 105.68 8 44.44
13902. Jonathan (jonc2002) 18 117.48 136.88 9 50.00
13903. Jonas (jonasv888) 18 74.00 83.99 7 38.89
13904. Mathew (johnnyio) 18 92.73 107.68 7 38.89
13905. Johnny (johneeeee) 18 55.39 70.04 2 11.11
13906. JKJ123 (jkj123) 18 67.18 83.98 1 5.56
13907. J (jiffan) 18 84.86 96.30 4 22.22
13908. snb (jftsnb) 18 60.11 69.69 5 27.78
13909. jewels (jewelsboyfriend) 18 123.81 139.71 11 61.11
13910. Clippy (jesspacito) 18 96.26 117.05 17 94.44
13911. Jeremy (jerms716) 18 77.93 92.87 4 22.22
13912. iquee (jeptha) 18 83.32 94.27 5 27.78
13913. jaycuaa (jaycuaa) 18 77.30 92.44 1 5.56
13914. Jawad (jawadwahmed) 18 73.44 90.04 5 27.78
13915. James (jamesjamesjamesjames... 18 77.48 89.76 6 33.33
13916. Harikrishnan R (ismashmykey... 18 52.40 59.77 4 22.22
13917. Isabelle (isabook) 18 87.44 100.53 7 38.89
13918. IntangiblePri (intangible_pri) 18 86.94 101.21 4 22.22
13919. Ba (injuredninjaz) 18 89.44 108.61 6 33.33
13920. INDO EUROPEAN (indo_europea... 18 70.24 86.45 9 50.00
13921. ImTrash (imreallytrash) 18 91.24 105.19 5 27.78
13922. SirAlhelm (iliur) 18 90.56 114.23 13 72.22
13923. KaRMa (ikillyou22) 18 73.30 84.79 9 50.00
13924. Ian (ianharold99) 18 78.32 98.71 2 11.11
13925. Yato_Gami (hrittik_brittik) 18 37.96 48.22 1 5.56
13926. Ishu (holistic_karma) 18 57.62 67.72 5 27.78
13927. Holden (holden_ford) 18 28.20 36.15 3 16.67
13928. HEMANTA (hemantahazariraipu... 18 61.05 75.25 7 38.89
13929. hello (hello_people123) 18 48.72 58.75 4 22.22
13930. Miyoko (heena_rawat) 18 42.67 49.28 1 5.56
13931. Hari (hari191197) 18 77.64 98.67 6 33.33
13932. Hola (harebrained) 18 89.31 101.28 8 44.44
13933. hannah (hannahq) 18 99.10 120.85 6 33.33
13934. Halo (halo1) 18 69.05 87.71 4 22.22
13935. Manuel (haiyaaa) 18 53.79 66.55 2 11.11
13936. Hmmm2100 (hahha2100) 18 79.96 91.86 8 44.44
13937. Nandika (gzxccalibur) 18 47.87 53.21 3 16.67
13938. no accuracy. can't type (gr... 18 122.34 158.63 9 50.00
13939. Goushique (goushique) 18 80.01 96.97 7 38.89
13940. Goop (goooop) 18 57.61 80.47 3 16.67
13941. Eric (godhand4826) 18 70.34 81.88 3 16.67
13942. gleen (gleenryan) 18 60.79 76.00 5 27.78
13943. Przemysław (girenkol) 18 67.55 81.69 2 11.11
13944. Makar (gatimoro) 18 71.30 81.28 8 44.44
13945. Garrett (garrettchu) 18 128.28 164.03 14 77.78
13946. Gabriel (gabrielfr2001) 18 88.76 102.17 5 27.78
13947. gabral (gabral123) 18 76.12 92.11 4 22.22
13948. (´▽`ʃ♡ƪ) (froggy_y) 18 106.42 128.90 10 55.56
13949. James (frodobaggins_) 18 63.42 75.84 5 27.78
13950. twitch.tv/empyr1cal (fritte... 18 97.30 116.42 9 50.00
13951. fr00t_l00ps (fr00t_l00ps) 18 91.61 99.37 8 44.44
13952. Franklin (fpstone) 18 79.97 96.83 3 16.67
13953. Alex (foxtail8000) 18 72.58 93.46 5 27.78
13954. Sadge (forebe) 18 61.81 70.05 17 94.44
13955. Bryce (flipno) 18 75.45 84.72 3 16.67
13956. Finuz (finuz) 18 51.38 59.80 1 5.56
13957. Filip (fichomaster) 18 85.08 100.42 14 77.78
13958. Jordan (feelingsreal) 18 112.95 131.82 9 50.00
13959. Jáchym (fastfingerrs) 18 74.02 82.90 7 38.89
13960. E dog (evan819) 18 95.84 118.82 8 44.44
13961. Tim (euclid221) 18 90.43 100.35 9 50.00
13962. ethan (ethanwander83) 18 75.96 97.64 3 16.67
13963. Ethan (ethanluu) 18 56.92 64.89 6 33.33
13964. Erza (erzaskill) 18 101.95 112.74 8 44.44
13965. eri :) (eri0002) 18 89.58 113.44 8 44.44
13966. Erdem (erdemhalil) 18 98.65 109.20 9 50.00
13967. epicsyrian (epicsyrian) 18 56.40 63.46 1 5.56
13968. Abraham (emptypilot) 18 90.67 102.38 3 16.67
13969. Empress Irisu (empress_irisu) 18 104.34 124.87 8 44.44
13970. elijah (elijahtheracecar) 18 72.82 90.55 2 11.11
13971. Dzlandis (dzlandis) 18 106.22 138.61 15 83.33
13972. rob (dydtaylor) 18 115.09 129.40 10 55.56
13973. Dyanel (dyanel) 18 61.59 73.40 4 22.22
13974. Draunzer (draunzer23) 18 37.72 44.38 2 11.11
13975. Drama (dramajr) 18 76.67 98.62 5 27.78
13976. Jordan (donkeywhistle) 18 90.42 101.17 7 38.89
13977. Doggo (doggocz) 18 100.17 116.20 5 27.78
13978. Dan (dncn) 18 55.56 71.74 5 27.78
13979. Ellis (disphing) 18 101.05 117.95 8 44.44
13980. DirtJohnson (dirtjohnson) 18 61.34 69.49 4 22.22
13981. dever (deverart) 18 112.96 129.98 9 50.00
13982. Deactrals (deactralsyt) 18 107.45 138.29 6 33.33
13983. dax (daxwastaken) 18 74.65 89.39 6 33.33
13984. Darijuan (darijuan) 18 70.80 83.48 7 38.89
13985. Daniel (dannyxrpm) 18 59.63 74.23 9 50.00
13986. Dan (danmurf) 18 73.27 92.78 8 44.44
13987. Daniel (dani3lju777) 18 113.84 141.89 9 50.00
13988. d (dafeiji) 18 105.68 132.57 8 44.44
13989. Danny (cyicro75366) 18 85.68 111.10 2 11.11
13990. Cade (ctw_) 18 97.27 119.72 8 44.44
13991. Kyi Phyu (crystal_emerson) 18 84.78 95.34 6 33.33
13992. Jorge (crovas) 18 72.78 80.38 3 16.67
13993. Christopher (cprice4124) 18 103.04 122.15 4 22.22
13994. Taufiq Dhanial (conradchill) 18 43.44 47.60 2 11.11
13995. Conrad (conrad7) 18 100.80 117.00 8 44.44
13996. comkichi (comkichi) 18 42.61 50.88 2 11.11
13997. (cnremilia55) 18 129.67 140.93 11 61.11
13998. CD (chris_keum_9) 18 83.13 94.41 7 38.89
13999. Christina (christinacitta) 18 60.19 67.70 2 11.11
14000. Cecil (cecilw) 18 92.63 109.10 6 33.33
14001. Sam (cattheory) 18 82.59 99.87 4 22.22
14002. Captain (captainbravo579) 18 34.02 37.16 0 0.00
14003. cantfindname (cantfindname) 18 73.21 93.60 3 16.67
14004. Cammyy_ (cammyy_) 18 71.63 85.80 4 22.22
14005. Gabriel (bultaqi) 18 30.07 38.05 0 0.00
14006. Jens (bullercool) 18 91.52 108.83 8 44.44
14007. Bugz (bugzmoney) 18 68.84 98.65 16 88.89
14008. Bryce (bryceweedz) 18 91.21 102.25 9 50.00
14009. The Rainbow Dragon (broadwa... 18 89.40 97.72 4 22.22
14010. jan Mase (brasidas422) 18 104.44 114.84 7 38.89
14011. Glen Ford (boyroader) 18 35.48 42.58 1 5.56
14012. Bong (bongman48) 18 45.89 58.47 2 11.11
14013. David (bomely) 18 98.12 122.89 2 11.11
14014. bobby (bobbyo) 18 85.59 99.06 4 22.22
14015. Baba (bobabo) 18 118.76 135.94 7 38.89
14016. twitch.tv/darkmatterv4 (blo... 18 112.61 132.11 6 33.33
14017. Samyak (blk_ht_hk_r) 18 57.80 67.76 7 38.89
14018. Manny (blimps) 18 56.08 68.05 3 16.67
14019. Arman (blazzer1yr) 18 57.84 62.58 0 0.00
14020. Firefingers (birthdaykids) 18 211.50 234.71 17 94.44
14021. Bintang (bintung) 18 103.25 116.43 6 33.33
14022. Julen (bi0hazard_jck) 18 67.67 79.32 3 16.67
14023. Lemons (bhan1115) 18 106.84 122.40 10 55.56
14024. XDXDXD (benskrrt) 18 95.32 114.70 9 50.00
14025. Benjamin (benjaminjam) 18 94.68 118.51 5 27.78
14026. Lizbeth (belthiz) 18 55.18 67.98 0 0.00
14027. Beebit (beebit) 18 72.60 84.62 4 22.22
14028. Ethan (bambamarama) 18 63.99 74.84 4 22.22
14029. BaldricLinus (baldriclinus) 18 88.29 119.02 9 50.00
14030. Victoria (azureale) 18 85.67 108.98 6 33.33
14031. Ayush (ayush08) 18 61.71 73.77 5 27.78
14032. Avery (avidavi) 18 106.16 125.54 6 33.33
14033. Tim (auticons) 18 69.14 85.22 3 16.67
14034. Atzac (atzac) 18 44.10 54.99 1 5.56
14035. Aryan (aryandeore) 18 76.97 99.81 6 33.33
14036. Austin (artannenbaum) 18 117.09 145.07 10 55.56
14037. Adam (armen32cz) 18 70.69 84.31 0 0.00
14038. Ryan (arkephonic) 18 89.59 111.57 5 27.78
14039. archer (archerlkm) 18 45.06 54.93 3 16.67
14040. Abdelghani (aogino) 18 59.70 78.53 5 27.78
14041. Anthony (antoniotheslwotyper) 18 97.60 110.07 6 33.33
14042. Aniket (aniket__sharma_) 18 43.69 55.91 3 16.67
14043. (anfun) 18 69.55 86.50 7 38.89
14044. Carl (andrecar002) 18 57.18 67.48 1 5.56
14045. AMG F1 (amg_gts) 18 67.59 79.05 4 22.22
14046. 205g0 (alpacav2) 18 112.35 127.06 9 50.00
14047. moon11111 (aliyuhaidaru) 18 34.91 40.32 1 5.56
14048. Alexis (alexxxisk) 18 81.64 97.19 4 22.22
14049. LDVBC (alexouou136) 18 105.73 130.03 9 50.00
14050. Alex (alexaaaaa) 18 74.89 88.16 3 16.67
14051. Alex (alex1124) 18 107.36 134.69 10 55.56
14052. akshat (akxs) 18 113.73 127.28 8 44.44
14053. Amanda (aj1111) 18 58.92 79.24 3 16.67
14054. AI (ailinda) 18 40.51 48.88 1 5.56
14055. Ahmer (ahmergondal) 18 112.79 142.58 6 33.33
14056. Killuminati (ahmedali25jan) 18 61.17 68.86 3 16.67
14057. Ahmad (ahmad770) 18 45.87 59.17 2 11.11
14058. aha (aha_aha2) 18 62.09 71.71 3 16.67
14059. AgogFox (agogfox) 18 68.10 75.90 6 33.33
14060. Justin (agent_jl) 18 135.69 149.06 11 61.11
14061. Afroz (afroz23) 18 47.50 55.85 2 11.11
14062. Aniket (aero81101) 18 63.15 75.15 2 11.11
14063. Aditya (aditya_sharma) 18 74.24 87.80 5 27.78
14064. Bruce Wayne (abhirupdas400) 18 70.20 78.77 2 11.11
14065. abfh7002 (abfh) 18 51.63 67.52 4 22.22
14066. Aidan (88its_dvorak) 18 64.19 73.41 7 38.89
14067. Wong (60484916) 18 61.17 75.15 2 11.11
14068. yooko (0ctagon) 18 55.79 62.50 3 16.67
14069. Prince (03000066106) 18 69.35 82.75 8 44.44
14070. CY Tan (slowest_typer_lol) 18 45.04 55.39 12 66.67
14071. Lydia (lydia245) 18 50.70 61.08 4 22.22
14072. Nick (propuzoficj) 18 96.80 117.09 6 33.33
14073. Zakir (drea041455) 18 76.75 95.08 9 50.00
14074. Sourabh (100rab) 18 58.86 64.80 3 16.67
14075. Max (mad_man_max11) 18 57.86 73.78 6 33.33
14076. David (hongduc1312) 18 45.38 58.41 10 55.56
14077. ABDULSALLAM (med905040) 18 19.22 22.98 3 16.67
14078. Abid (abidcsedu) 18 49.37 58.60 1 5.56
14079. Kartlez (kartlez) 18 35.77 45.78 1 5.56
14080. Rajat (rajat_2203) 18 52.39 64.52 16 88.89
14081. Charlie Crossman (iimdrowni... 18 52.78 66.72 1 5.56
14082. Jequiz (jequiz) 18 89.97 113.55 10 55.56
14083. TD (tmd33643) 18 83.02 94.73 4 22.22
14084. Angela (angie361) 18 59.43 67.54 2 11.11
14085. Araxes (boneyflesh) 18 43.12 55.09 2 11.11
14086. Gab (pawsthegabe) 18 75.78 91.84 12 66.67
14087. Manish (manish_84) 18 41.02 47.83 17 94.44
14088. ahmad (shexahmad) 18 70.11 73.85 4 22.22
14089. Unaib Syed (unaibsyed) 18 53.48 64.67 3 16.67
14090. Daniel (danrodbar) 18 42.00 48.57 3 16.67
14091. Viet (cm3rp) 18 100.75 125.81 15 83.33
14092. Keenan (keenanpanda) 18 39.76 49.04 2 11.11
14093. No you (gino455) 18 55.19 66.68 1 5.56
14094. Colby (iamzcolbz) 18 57.01 62.90 10 55.56
14095. Miha (mihabala) 18 22.70 26.22 2 11.11
14096. aialtyn (aialtyn) 18 18.11 21.33 3 16.67
14097. Sima (sima814) 18 50.02 62.97 1 5.56
14098. Ludvig (ludvig_tydanus) 18 47.74 57.11 1 5.56
14099. rob (mortal_) 18 69.61 85.66 7 38.89
14100. eyeris (eyerisheehee) 18 59.77 75.45 2 11.11
14101. Kayna (kayna16) 18 58.10 71.74 5 27.78
14102. Killer (killerswitch) 18 50.55 61.05 8 44.44
14103. Alan (liquidalanzhu39) 18 108.48 131.77 8 44.44
14104. bingo (tobingoiscool) 18 97.51 110.67 4 22.22
14105. Galactipod (galactipod) 18 80.85 93.74 6 33.33
14106. brody (kingbroseidon) 18 47.46 62.57 4 22.22
14107. Thai (thaidollasign) 18 74.53 88.46 5 27.78
14108. Zakary (zakaryatyping) 18 37.43 44.54 2 11.11
14109. Chris (usan3xus) 18 85.57 100.06 7 38.89
14110. Refep (refep123) 18 80.00 102.20 7 38.89
14111. fck israel (zeeeekkkeeee) 18 79.05 98.75 4 22.22
14112. joe (xanthic) 18 120.57 151.28 7 38.89
14113. Justinas (justasss) 18 69.57 77.20 4 22.22
14114. Magisplash (magisplash) 18 82.24 103.27 10 55.56
14115. Will (frostyflakes155) 18 94.85 111.90 9 50.00
14116. Shivend (shivend) 18 34.20 42.40 1 5.56
14117. Aiden (smusky72) 18 66.71 81.35 7 38.89
14118. Sandis (cejayz) 18 75.08 94.68 6 33.33
14119. Some (typerbetyping) 18 70.98 96.08 4 22.22
14120. David (davidg0d) 18 85.77 98.91 5 27.78
14121. 𝐼𝓉𝓈𝑀𝑒_ (itsm... 18 34.76 40.95 2 11.11
14122. Alex M (killawritter) 18 53.25 60.58 7 38.89
14123. Jay (jayinnn) 18 64.40 70.74 4 22.22
14124. Dilli (dillisharma) 18 29.83 34.97 3 16.67
14125. Milan (hwsx) 18 76.50 93.09 7 38.89
14126. Ikin (ikin_ari) 18 102.38 122.34 9 50.00
14127. Crescens (crescent0001) 18 60.25 67.59 7 38.89
14128. J (jeremieshaker) 18 92.99 113.31 6 33.33
14129. Paul (___paul___) 17 87.84 102.23 5 29.41
14130. Gagik (_the_wind) 17 68.69 78.15 4 23.53
14131. Medi (_medi) 17 109.87 127.94 6 35.29
14132. Kyle (_dukz) 17 79.33 88.09 8 47.06
14133. Zaid (zzzaid) 17 112.17 146.06 10 58.82
14134. Winston (zywinston) 17 118.41 138.79 10 58.82
14135. Free Palestine (zobad) 17 114.84 139.60 10 58.82
14136. Znypr (znypr) 17 76.17 89.49 4 23.53
14137. Oscar (zeropuu) 17 72.74 87.67 5 29.41
14138. Zenyth (zenyth) 17 70.74 74.32 3 17.65
14139. Kalap (zenithorigin) 17 135.99 160.74 14 82.35
14140. Mohammad (zargar91) 17 53.91 67.82 2 11.76
14141. Dan (yugurtz) 17 98.76 133.29 7 41.18
14142. Yuelia (yuelia) 17 110.42 126.50 13 76.47
14143. Yousuf Ali (yousuf_97) 17 47.92 55.94 5 29.41
14144. Jo/yf (yousseff) 17 74.90 86.04 7 41.18
14145. youcef (youcef_kehal011) 17 35.10 43.25 0 0.00
14146. Eddie (yogurtdan) 17 83.07 121.00 1 5.88
14147. JRD (yesjrd) 17 107.88 123.19 7 41.18
14148. Suken (x_suken_x) 17 87.69 102.04 4 23.53
14149. Sean (xslslx) 17 79.03 96.98 3 17.65
14150. Grzegorz (xreere) 17 61.36 75.94 0 0.00
14151. Justin (xpirep) 17 101.26 119.19 6 35.29
14152. Nepotism (xjqm_z) 17 89.79 107.80 3 17.65
14153. William (xenosaints) 17 108.43 125.59 7 41.18
14154. Louis (xchampionx) 17 128.38 152.00 14 82.35
14155. Riley (wulfmane) 17 86.16 122.06 5 29.41
14156. Olivier (whiskyforagrownman) 17 93.70 116.56 6 35.29
14157. Joakim (wakakins) 17 61.08 81.68 1 5.88
14158. VyPah (vypah) 17 99.03 113.82 12 70.59
14159. can't type :) (void7750) 17 112.49 126.53 10 58.82
14160. ViktorT (vitr_88) 17 76.87 85.70 7 41.18
14161. Erik (virumdreng) 17 89.55 102.66 11 64.71
14162. Vincent (vincback) 17 104.67 117.42 5 29.41
14163. Raiko (vilo1) 17 46.57 53.96 3 17.65
14164. hallelujah (veil) 17 123.66 153.37 6 35.29
14165. Vavro (vavro) 17 51.20 64.38 0 0.00
14166. Valian (valian) 17 64.98 72.90 2 11.76
14167. Vanessa (v4nv4n) 17 104.42 123.82 9 52.94
14168. yooooooongi (utlyoongs) 17 88.80 107.74 5 29.41
14169. Unicorn017 (unicorn017) 17 50.81 61.68 4 23.53
14170. Ulises (umoreno) 17 62.52 69.77 3 17.65
14171. Tyler47 (tytycrewz) 17 49.20 60.67 5 29.41
14172. tiramisu (typist786) 17 77.91 86.36 5 29.41
14173. typing chad (typing_chad) 17 74.68 97.67 0 0.00
14174. Gerald (tycholoko) 17 74.87 98.40 4 23.53
14175. Lucas (twinbros) 17 39.66 55.29 14 82.35
14176. NIETian (tushgaurav) 17 44.84 54.75 10 58.82
14177. Ryan (turtleboy1017) 17 103.35 112.65 6 35.29
14178. ttvnaaya786 (ttvnaaya786) 17 89.65 101.20 4 23.53
14179. Truong (truong_huy) 17 42.26 46.26 0 0.00
14180. Ralph (triathreat) 17 96.80 124.46 9 52.94
14181. trer10 (trer10) 17 89.57 102.86 6 35.29
14182. Benjamin Netanyahu (tp0d) 17 99.35 122.33 7 41.18
14183. Torron (torronlester) 17 48.16 57.63 1 5.88
14184. Pratik (torpido99) 17 52.94 67.84 4 23.53
14185. ㅤ (toptied) 17 101.98 133.73 7 41.18
14186. Tulaib (toolayb) 17 79.16 94.43 9 52.94
14187. tippy (tippytypo) 17 109.14 122.69 10 58.82
14188. Timothy (timothyp823) 17 82.56 89.56 2 11.76
14189. Nana (tianananana) 17 67.88 75.34 2 11.76
14190. Omnia (the_omnivert) 17 72.91 84.03 5 29.41
14191. Theo (the_o) 17 71.89 85.31 4 23.53
14192. Jon Bob (thejonbob) 17 52.27 66.06 4 23.53
14193. Ky (thaediir) 17 82.28 98.11 6 35.29
14194. Alexandro (terribletyper0) 17 78.24 93.75 5 29.41
14195. Terra (terranavis) 17 98.86 116.53 8 47.06
14196. Carson (terminator2424) 17 81.16 105.42 5 29.41
14197. Teho (tehoo) 17 111.31 129.74 12 70.59
14198. Md. Tahsinul Anwar (tahsinu... 17 63.84 76.47 4 23.53
14199. john (tacozmanz) 17 81.98 94.05 1 5.88
14200. emily (swimmerpenguin) 17 101.22 118.35 10 58.82
14201. John (supercriticalco2) 17 43.84 57.04 4 23.53
14202. kobus (supercatspeed) 17 26.67 32.50 1 5.88
14203. hafit (streekytyper) 17 64.80 76.06 4 23.53
14204. Stefan (stephen27) 17 78.90 86.31 3 17.65
14205. spiderman (spiderman943) 17 41.35 54.61 2 11.76
14206. Rice (speedtoggled) 17 81.54 93.88 7 41.18
14207. Jeel (speedracers_brother) 17 54.72 62.20 0 0.00
14208. Tommy (sparkxd) 17 75.57 97.13 3 17.65
14209. Spanchsan (spanchsan) 17 49.59 60.26 2 11.76
14210. Young (so_many_errors) 17 92.80 112.55 7 41.18
14211. Soren (sorentypes) 17 79.31 95.54 5 29.41
14212. Soham (soham_grover) 17 46.72 60.57 3 17.65
14213. Slowpoke (slowpoketypo) 17 61.07 70.17 2 11.76
14214. Marie (slowestone) 17 31.30 39.41 1 5.88
14215. Slicky (slickyslide) 17 59.60 66.31 4 23.53
14216. Sam (sirgalahad7) 17 71.70 80.23 2 11.76
14217. Katappa (sim007) 17 92.69 123.35 13 76.47
14218. Spencer (silentfoe9) 17 63.00 71.16 7 41.18
14219. Sid (sidd31) 17 51.94 57.05 1 5.88
14220. shcal (shcal) 17 119.96 135.41 7 41.18
14221. Shane (shane_umayanga) 17 53.64 60.22 1 5.88
14222. shmz (shamyob) 17 60.58 70.22 2 11.76
14223. Serhii (sergomashina) 17 58.36 63.57 5 29.41
14224. Sepia (sepiadrunfada) 17 54.78 60.78 1 5.88
14225. SeniorMomo (seniormomo) 17 105.68 131.57 8 47.06
14226. Nathaniel (scryo) 17 70.46 94.65 3 17.65
14227. schru (schru) 17 83.37 90.75 8 47.06
14228. SantiX (santix1225) 17 71.92 91.77 7 41.18
14229. Sammy (sammykiller) 17 82.93 97.08 4 23.53
14230. Sujith (sai_sujith) 17 42.87 51.31 2 11.76
14231. Said (saidahror_2021) 17 85.73 97.57 8 47.06
14232. Leonardo (saborfaze) 17 67.84 80.34 3 17.65
14233. R (ryanteebag) 17 116.09 129.02 12 70.59
14234. Tom (rusteze) 17 66.59 76.41 3 17.65
14235. Ruslan (ruslancik97) 17 58.07 73.76 3 17.65
14236. Jessica (runningfox) 17 35.45 43.28 1 5.88
14237. T (rumikasa) 17 140.68 168.01 17 100.00
14238. Michael (rucc) 17 87.40 109.99 9 52.94
14239. Kuy (rou168) 17 98.49 111.79 9 52.94
14240. Leimondu (roshia) 17 95.37 104.80 7 41.18
14241. tstats[roselaflesh] (rosela... 17 90.70 108.84 6 35.29
14242. Roboute (robosote) 17 85.61 96.18 8 47.06
14243. Ryan (rloftus) 17 65.17 70.70 2 11.76
14244. I'm bad at this :( (rl27) 17 115.27 125.03 12 70.59
14245. spi (ririnasandasimp) 17 68.90 87.88 16 94.12
14246. Tuna (rippleshark) 17 55.76 66.02 3 17.65
14247. Rick (rickssbm) 17 89.08 96.75 6 35.29
14248. daydreamer (rhebbar) 17 29.72 37.49 2 11.76
14249. Rey (reycuadrado) 17 115.20 147.96 8 47.06
14250. Jake (relaxing) 17 57.41 68.16 3 17.65
14251. rehsur (rehsur) 17 76.30 88.43 5 29.41
14252. Regz (regz84) 17 84.70 99.49 8 47.06
14253. Josh (raybanned) 17 84.02 108.86 3 17.65
14254. forrest (rares9110) 17 50.47 57.78 3 17.65
14255. rakushun (rakushun) 17 35.72 43.52 2 11.76
14256. Rae (raedog) 17 119.09 138.95 6 35.29
14257. Joses (radcaly) 17 71.27 86.41 3 17.65
14258. Road to 90 wpm (qimichanga) 17 70.22 82.54 5 29.41
14259. Rahil (prplplay) 17 58.46 67.38 2 11.76
14260. Pradip (pradipg) 17 75.60 109.39 13 76.47
14261. พงษ์ปกรจ์... 17 32.88 40.70 11 64.71
14262. Scott (pogogunner) 17 85.28 103.09 9 52.94
14263. Punch (pognick) 17 100.03 111.93 6 35.29
14264. PNBLVN (pnblvn) 17 87.49 101.95 5 29.41
14265. Plohka (plohka) 17 75.36 89.86 6 35.29
14266. Renaldi (plbu) 17 74.46 92.40 3 17.65
14267. mati (pitoloco) 17 49.98 64.89 1 5.88
14268. PeterParker20 (piter11116) 17 78.75 94.08 6 35.29
14269. Bryan (pinkypoo) 17 69.07 77.41 3 17.65
14270. Myron (piececontrol_inq) 17 47.13 53.19 3 17.65
14271. Hans (phindy) 17 99.50 124.79 3 17.65
14272. Philluminati (philluminati) 17 81.99 95.35 5 29.41
14273. Vidu (pererav) 17 60.13 68.97 3 17.65
14274. Pelli (pellikan) 17 89.82 104.26 4 23.53
14275. Rohith (pebblepot) 17 56.35 72.16 3 17.65
14276. Paul (paultot) 17 32.80 39.35 2 11.76
14277. 🐌 (paultippt) 17 69.84 80.51 4 23.53
14278. Patryk (patryk5361) 17 73.27 86.85 5 29.41
14279. PapaCologne (papacologne1) 17 59.90 70.44 2 11.76
14280. owlsoup (owlsoup) 17 93.34 115.70 8 47.06
14281. OP (owenpatch) 17 99.21 115.02 6 35.29
14282. Otakranio (otakranio) 17 63.91 83.28 4 23.53
14283. piglet (orangepig111) 17 84.93 100.29 6 35.29
14284. Onur (onur0591) 17 83.66 99.52 8 47.06
14285. Omer (omersudo) 17 71.85 81.97 2 11.76
14286. Ascend (obaht) 17 49.44 56.41 1 5.88
14287. Nuwaisir (nuwaisir) 17 70.61 79.55 2 11.76
14288. Tom (noviamagna) 17 104.82 123.16 5 29.41
14289. noctnight (noctnight) 17 107.00 128.26 13 76.47
14290. nkunder (nkunder16) 17 50.73 60.35 2 11.76
14291. Do people have computers in... 17 75.83 91.35 1 5.88
14292. nilebr (nilebr) 17 96.69 108.73 2 11.76
14293. nikola (nikininja13) 17 63.47 79.07 4 23.53
14294. ning (niing) 17 74.38 89.55 7 41.18
14295. Nicholas (nicholaspatrick) 17 88.73 105.12 2 11.76
14296. nam (ngxnam) 17 73.31 86.36 4 23.53
14297. neville (neville_dnbh) 17 55.15 69.03 4 23.53
14298. Natalia (natalia153) 17 55.91 65.61 4 23.53
14299. MehproPlayz (mythicfx) 17 44.32 56.04 7 41.18
14300. Michael (mwik) 17 108.25 122.23 8 47.06
14301. Peter Paul "Paulie Walnuts"... 17 106.88 117.44 12 70.59
14302. Munkhzorig (munkhzorig_0918) 17 42.33 48.37 1 5.88
14303. Multi (multibala) 17 24.67 31.46 5 29.41
14304. k1p (muggz) 17 77.21 100.70 3 17.65
14305. moschisch (moschisch) 17 51.67 62.87 1 5.88
14306. Monica (moni1101) 17 63.74 73.62 4 23.53
14307. Moe (mohannd_h) 17 61.03 69.28 5 29.41
14308. Timotej (mistimmo) 17 53.38 67.53 1 5.88
14309. . (mioumioumiou) 17 53.25 62.40 2 11.76
14310. Jiarui (mike9557) 17 70.50 87.09 4 23.53
14311. mieszko (mieszkomieszko) 17 102.39 114.73 11 64.71
14312. Michael (mhmadhatter) 17 72.11 83.46 3 17.65
14313. Abdulmohsin (mhasen) 17 59.73 68.65 2 11.76
14314. Janssen (mentalpower_ada) 17 67.17 76.86 7 41.18
14315. tobias (memebigboyisbig) 17 62.00 68.54 5 29.41
14316. Maximal (maximalelder) 17 79.06 93.36 7 41.18
14317. Romping (max61090) 17 95.33 107.19 9 52.94
14318. Matthew (matthewb83) 17 91.10 106.01 9 52.94
14319. b lmao (matt16861) 17 129.39 144.72 12 70.59
14320. Tahj (mathpunsaresin) 17 73.46 84.85 5 29.41
14321. Max (marvelnoodles) 17 67.18 81.76 5 29.41
14322. Martina (martinaon) 17 115.70 140.90 12 70.59
14323. Cody (marshmink) 17 88.68 102.61 5 29.41
14324. Aleksa (mandorinaa) 17 68.88 78.70 5 29.41
14325. anAVGtyper (mallunahi) 17 58.24 73.19 0 0.00
14326. mads (madsor) 17 57.51 73.27 7 41.18
14327. Skafi (madps) 17 53.77 64.22 2 11.76
14328. Mack (mack49) 17 59.92 83.06 4 23.53
14329. Aiden (maccraker) 17 77.27 92.27 6 35.29
14330. m3hdi (m3hdi_v1) 17 37.18 42.78 1 5.88
14331. luiz (lzcr) 17 64.82 75.95 7 41.18
14332. jonson (lyfissht) 17 78.28 98.03 5 29.41
14333. Luis (luwec) 17 88.71 103.76 6 35.29
14334. Luminer (luminerr) 17 71.46 82.06 7 41.18
14335. sky (lumihime) 17 116.36 130.91 9 52.94
14336. Lukas (lukaas506) 17 48.97 58.62 2 11.76
14337. Lucifer (lucifer179) 17 98.82 116.88 10 58.82
14338. Lucid (lucideous) 17 57.64 71.20 4 23.53
14339. LoyalPotato (loyalpotato) 17 75.54 86.17 4 23.53
14340. Lock'd (lockd) 17 88.38 102.83 6 35.29
14341. Frederick (liquidfyre) 17 84.21 100.27 5 29.41
14342. John (linkstart15) 17 75.06 98.57 3 17.65
14343. Linh (linhbo5369) 17 57.95 70.03 5 29.41
14344. YEET (lemonstate) 17 95.20 105.68 7 41.18
14345. Endy (legaljeans) 17 76.52 90.58 6 35.29
14346. Lee-Andria (leelo135) 17 52.29 67.67 0 0.00
14347. Aidan (leankirito) 17 54.66 61.51 4 23.53
14348. Dosnt (laxrpy) 17 64.49 74.15 2 11.76
14349. Lavish (lavish10) 17 62.55 75.12 3 17.65
14350. Lasey (lasey) 17 95.22 109.65 9 52.94
14351. Landon (landonthull) 17 73.54 88.77 7 41.18
14352. pearl (l3hargav) 17 88.30 98.37 4 23.53
14353. Kypster (kypster) 17 90.86 111.69 5 29.41
14354. kx_167 (kx_167) 17 46.96 58.80 2 11.76
14355. ItsKevin (kwilz) 17 91.42 103.59 10 58.82
14356. Vipin (kumarvipin) 17 46.43 54.09 1 5.88
14357. Kristjan (krissimoney) 17 112.19 128.37 5 29.41
14358. krishna (krishnatallani) 17 32.11 37.24 0 0.00
14359. Alex (krim19) 17 108.07 120.27 11 64.71
14360. ren (krenz) 17 72.64 87.66 5 29.41
14361. codingmickey (kj_mickey) 17 54.12 66.00 3 17.65
14362. kinderblack (kinderblack) 17 95.66 106.97 2 11.76
14363. Rolf (key_fingerer) 17 38.32 44.42 0 0.00
14364. Kevin (kevinstark10) 17 87.33 103.82 5 29.41
14365. Kevin (kevgod48) 17 115.50 126.71 9 52.94
14366. brandon (kbseah) 17 118.52 133.97 7 41.18
14367. Kathryn (kathrynida) 17 94.40 104.98 8 47.06
14368. Karston (karstonjim) 17 84.02 93.11 17 100.00
14369. n (kantotoro) 17 42.98 64.59 2 11.76
14370. Niko (kale_bog_vremena) 17 51.31 68.39 0 0.00
14371. Avery (jythonscript) 17 90.03 99.44 5 29.41
14372. JustMonotone (justmonotone) 17 117.77 131.15 12 70.59
14373. Juprai (juprai) 17 126.78 155.21 10 58.82
14374. Julien (julien123) 17 38.91 44.81 1 5.88
14375. Jacob (jq231) 17 116.54 138.78 9 52.94
14376. Jonathan (john_ee) 17 58.73 66.67 4 23.53
14377. John (johnnymauser) 17 80.34 96.58 3 17.65
14378. Joe (joemama17) 17 92.86 113.57 5 29.41
14379. bryan (joebidens_son) 17 70.88 92.65 12 70.59
14380. Jorgle (jmgcito) 17 65.78 83.65 5 29.41
14381. Jimmy (jimmyceballos) 17 74.20 97.68 3 17.65
14382. The Dank Duck (jephjeff) 17 73.05 83.54 4 23.53
14383. Jacky (jclau299) 17 94.01 110.55 10 58.82
14384. jazon (jazonandes) 17 121.24 160.25 7 41.18
14385. Jaxson (jaxxxson) 17 110.79 123.81 7 41.18
14386. javoscript (javoscript) 17 83.73 90.36 6 35.29
14387. Jason (jasonliang19) 17 88.47 111.54 5 29.41
14388. Jakob (jagebuuu) 17 52.96 62.75 2 11.76
14389. Jordan (j0rdanb) 17 85.97 99.53 9 52.94
14390. Farrel (i_i_c_h_e_n_i_i) 17 95.63 115.35 5 29.41
14391. Brandon (ivantt) 17 105.62 125.86 9 52.94
14392. ITSPUJIS (itspujis) 17 67.51 89.04 2 11.76
14393. Iris (irxs_q) 17 145.02 168.48 14 82.35
14394. DooDoo (ininjashadows) 17 78.53 106.89 3 17.65
14395. Nolan (ilovebluecars_13) 17 13.71 17.01 5 29.41
14396. Iliya (iliyacloud) 17 53.99 71.22 2 11.76
14397. Imad (ikhan9059) 17 46.81 55.83 2 11.76
14398. IDK (iimarch) 17 36.66 47.60 1 5.88
14399. stef (ihasstuff) 17 71.84 80.29 7 41.18
14400. Ivan (ichauster) 17 109.09 137.19 7 41.18
14401. hwalters360 (hwalters360) 17 108.32 133.34 10 58.82
14402. jib (huwakiin) 17 71.00 79.33 10 58.82
14403. Ante (houci) 17 111.93 131.37 7 41.18
14404. tenzin (hopeful_engineer) 17 83.35 95.89 4 23.53
14405. hubbe (hoffiis) 17 68.92 75.32 4 23.53
14406. hksgiroro (hksgiroro) 17 56.15 67.76 4 23.53
14407. Gaurav (hisdudeness) 17 111.21 124.07 4 23.53
14408. Thebe (hikwon) 17 86.68 98.31 5 29.41
14409. Vinz (hexxel7) 17 105.75 115.95 8 47.06
14410. Hexishu (hexishu) 17 105.70 119.66 17 100.00
14411. Jerry (heatsflamesman) 17 128.45 149.57 14 82.35
14412. haykalive (haykalive) 17 54.97 64.35 7 41.18
14413. tstats[harveycoolestkid69] ... 17 103.34 125.94 5 29.41
14414. Hans (hansyu7) 17 85.19 92.18 6 35.29
14415. Hamza (hamzayt577) 17 66.34 77.24 1 5.88
14416. The Legend of Jones (hadgeo... 17 128.08 166.42 7 41.18
14417. Davey (gujin) 17 113.45 139.35 5 29.41
14418. GpJay (gpjay) 17 56.54 63.60 3 17.65
14419. Lukas (gotorono) 17 80.12 91.94 5 29.41
14420. Connor (gothorpe) 17 65.03 75.03 7 41.18
14421. jack (golduckz) 17 110.21 131.92 8 47.06
14422. knowagh (gnoweagh) 17 96.14 105.33 2 11.76
14423. GitGawd (gitgawd) 17 88.77 104.30 10 58.82
14424. Shimon (gastronom) 17 69.22 82.66 5 29.41
14425. AttackKing (garypop) 17 47.29 53.59 3 17.65
14426. Felix (ganc56141) 17 106.79 130.87 8 47.06
14427. Gabriel (gabrielot) 17 44.63 52.55 7 41.18
14428. gabe (gabersnake) 17 84.44 92.84 4 23.53
14429. IAmAtomicツ (from_phlol) 17 93.28 111.95 9 52.94
14430. Jakub (frogixd) 17 69.94 80.54 2 11.76
14431. trapinch_ (fortissim2) 17 123.57 138.15 10 58.82
14432. Typo (foop101) 17 76.48 92.59 5 29.41
14433. Flash (flashlegion) 17 53.52 67.42 2 11.76
14434. Yeeet (flamestar21) 17 45.24 56.30 4 23.53
14435. Firzan (firzanarmani) 17 68.53 78.11 3 17.65
14436. Jared (filmman2k3) 17 77.38 104.35 7 41.18
14437. Francisco (fanaya2001) 17 50.65 69.94 1 5.88
14438. faf (faf222) 17 48.46 60.26 1 5.88
14439. Eshan (e_khan) 17 89.68 105.35 8 47.06
14440. Eustion (eustion) 17 89.91 103.00 7 41.18
14441. Ethan (ethankramer) 17 68.82 83.58 11 64.71
14442. Ben (essequattro) 17 101.90 116.36 12 70.59
14443. mb3awi (emptybox34) 17 100.50 111.41 7 41.18
14444. wizz (empathetic_orange) 17 48.45 57.81 2 11.76
14445. emma (emmmmmmmaaaaa) 17 75.12 86.68 1 5.88
14446. Emil (emle10) 17 98.94 118.12 3 17.65
14447. Mark (emessdoubleyou) 17 70.10 79.20 4 23.53
14448. Liz (elizabethl3_13) 17 76.68 100.50 5 29.41
14449. Someone (elderpotato) 17 88.42 104.55 6 35.29
14450. Connor (edgeburn) 17 88.67 102.77 5 29.41
14451. e (eddyhack) 17 89.46 105.81 8 47.06
14452. Benjamin (echobox) 17 54.84 65.52 1 5.88
14453. yes (easytoremember1) 17 104.41 116.65 3 17.65
14454. Luuk (dutchprojects) 17 88.76 108.99 7 41.18
14455. Megan (durvish) 17 71.83 89.24 3 17.65
14456. Huy (duchuynguyen94) 17 89.31 97.36 8 47.06
14457. Benjamin (drwumboo) 17 70.79 85.34 5 29.41
14458. Andrew JK Brown (droid2) 17 53.90 62.49 2 11.76
14459. Ghost (djinxkay) 17 116.93 146.25 10 58.82
14460. Đình (dinhhhaii51) 17 75.18 91.60 2 11.76
14461. epic gamer (dianalin2) 17 93.35 104.16 5 29.41
14462. CZ (derpiestme) 17 97.74 111.47 7 41.18
14463. Niels (dekleinekabouter) 17 83.80 99.35 2 11.76
14464. Andres (defmaxer) 17 93.33 110.14 3 17.65
14465. Deepanshu (deepanshu9) 17 66.77 79.33 7 41.18
14466. Amir (dead_developer) 17 44.15 49.57 2 11.76
14467. Cedric (ddeadz) 17 85.48 112.35 10 58.82
14468. David Roberts (davidrobertsla) 17 78.99 99.30 15 88.24
14469. Darren Goh (darrengoh_23) 17 86.72 104.44 7 41.18
14470. Bhavya (dark_knight_2914) 17 58.60 70.67 10 58.82
14471. Patrick (darkpatrick00) 17 99.30 107.26 5 29.41
14472. Dany (danypeter) 17 75.03 93.78 11 64.71
14473. nuzzlebuddy (danieldan937) 17 83.76 97.71 3 17.65
14474. Dana (dana_cardinal) 17 125.09 141.84 13 76.47
14475. dak (dakn) 17 90.48 104.13 6 35.29
14476. Dauren (d0ka) 17 52.73 65.05 1 5.88
14477. Cyrush (cyrus_h) 17 115.97 134.19 11 64.71
14478. David (cuber988) 17 93.76 100.80 11 64.71
14479. Crestyn (crestyn) 17 96.97 110.80 8 47.06
14480. C (cpandar) 17 86.06 101.40 3 17.65
14481. Rod (compangit) 17 93.66 106.37 6 35.29
14482. Cole (coleb117) 17 105.78 114.90 0 0.00
14483. SAM (clencod) 17 65.47 84.76 3 17.65
14484. Matt (choofkoof) 17 100.69 112.59 10 58.82
14485. Chessy (chescahi) 17 96.34 111.00 7 41.18
14486. cheryl (cherylkaiser) 17 66.00 72.71 4 23.53
14487. chepchombir (chepchombir) 17 68.82 77.37 6 35.29
14488. Nieves (cheezy_butter) 17 86.10 104.35 4 23.53
14489. Matija (ch4p0) 17 64.83 74.47 4 23.53
14490. Casper (casperwang) 17 68.55 82.58 4 23.53
14491. Isaac (carokann09) 17 100.58 113.60 1 5.88
14492. mickey (c2sulli) 17 105.74 116.05 9 52.94
14493. Semih (byshadow93) 17 66.88 78.09 6 35.29
14494. DeStuert (bully_hunter) 17 59.79 68.60 2 11.76
14495. deji the tank (bulgewarden) 17 66.92 83.63 7 41.18
14496. Bogart (bogartii) 17 79.90 87.55 5 29.41
14497. bobva (bobva) 17 107.02 128.74 9 52.94
14498. boris (bobi412) 17 54.01 61.83 1 5.88
14499. Bren (bnern) 17 75.34 89.60 4 23.53
14500. Ben (blob1010) 17 47.67 59.97 2 11.76
14501. Björn (bjornboss) 17 69.66 78.60 6 35.29
14502. Zicheng (bin_laggin) 17 90.06 111.93 8 47.06
14503. Finnnnnnn (bigfinsfananza) 17 84.61 101.64 6 35.29
14504. Isabella (bfbubblegum) 17 90.83 103.65 4 23.53
14505. Robert (bertazz) 17 51.27 59.81 1 5.88
14506. Ava (berry_blue) 17 77.04 97.01 3 17.65
14507. Bensie (bensie1) 17 105.05 124.32 14 82.35
14508. bstridr (bellie__) 17 78.19 93.57 5 29.41
14509. Phil (beastfromthe_east) 17 57.01 71.19 3 17.65
14510. Baizak (baizak) 17 43.26 50.86 2 11.76
14511. Austin (auzzyauger) 17 46.83 56.19 0 0.00
14512. Alex Grace (attttyila) 17 91.88 101.88 7 41.18
14513. Dre (atarez) 17 127.68 151.29 16 94.12
14514. 3 (astoria2213) 17 60.56 70.47 6 35.29
14515. Ashveck (ashveck) 17 64.06 75.90 3 17.65
14516. Muahmmad (arul2101) 17 64.09 87.76 5 29.41
14517. ArticSeries (articseries) 17 97.85 106.92 6 35.29
14518. army (armygirl123) 17 44.48 54.38 1 5.88
14519. Ekar (argetlam1) 17 92.62 101.56 4 23.53
14520. Gui (apollovx) 17 65.25 81.25 3 17.65
14521. Janindu (aokiesan) 17 88.90 104.16 6 35.29
14522. Ana (anophoo) 17 79.04 89.13 4 23.53
14523. Annie (anniesshl) 17 66.78 80.13 7 41.18
14524. ami (amisupreme) 17 110.70 130.11 9 52.94
14525. amirhossein (amirho) 17 66.81 80.25 3 17.65
14526. Ashley Harrison (amharrison15) 17 67.76 81.64 2 11.76
14527. Eric (almiightyeric) 17 57.12 69.75 2 11.76
14528. Alkinoos (alkonline66) 17 50.96 56.16 0 0.00
14529. alisha (alishalovesyou) 17 80.12 95.88 2 11.76
14530. Alinferno (alinferno) 17 70.05 87.93 15 88.24
14531. Alex (alexhell) 17 82.23 96.30 3 17.65
14532. Alexandar (alexandargrav) 17 66.77 83.11 4 23.53
14533. Tobias (akwhideki) 17 89.55 102.03 11 64.71
14534. Akela (akela123) 17 103.41 118.51 9 52.94
14535. aibek (aibek210603) 17 43.19 49.76 2 11.76
14536. ahmed (ahmed98) 17 63.36 76.22 2 11.76
14537. Ahmad (ahmad4) 17 74.78 92.88 8 47.06
14538. Louis (advguy) 17 99.00 111.28 9 52.94
14539. Jack (adc6768) 17 97.37 114.43 7 41.18
14540. ace (aceguarde) 17 99.80 118.14 16 94.12
14541. Aboxgwer (aboxthetyper) 17 73.66 89.12 2 11.76
14542. Abhijeet17o (abhijeet17o) 17 54.02 65.45 6 35.29
14543. ABe (abenms92) 17 94.98 120.62 3 17.65
14544. Iam (aaaallleen) 17 71.21 85.18 3 17.65
14545. aaaaaaaaaaaaaa (aaaaaaaaooo... 17 64.27 76.32 6 35.29
14546. 962 Pixels (962pixels) 17 79.05 90.33 8 47.06
14547. Jasper (7essek) 17 90.46 98.08 4 23.53
14548. dd (6768695865) 17 51.17 57.76 1 5.88
14549. David (2mill) 17 108.17 131.18 7 41.18
14550. Li Han (1774li) 17 35.66 48.17 1 5.88
14551. Lime (limabean60923) 17 67.94 77.78 5 29.41
14552. Mariana (marianafa) 17 54.77 68.06 6 35.29
14553. Araina (discobroccoli) 17 80.41 96.60 5 29.41
14554. Jonah (yuuya_hori) 17 71.56 86.24 10 58.82
14555. Joshua (tjosher) 17 96.19 106.61 7 41.18
14556. Kanye (viprin_6749) 17 64.20 78.43 3 17.65
14557. NICK ILARIDIS (nilaridis) 17 30.41 34.37 0 0.00
14558. Ajax (ajaxdavis) 17 83.20 109.64 10 58.82
14559. Pratyush (_darkcrow_) 17 55.39 63.39 4 23.53
14560. Gustav (rexdk123) 17 47.23 55.56 4 23.53
14561. 3Cow (kendogplayz) 17 62.13 82.51 3 17.65
14562. Mike (munduss) 17 121.36 146.77 9 52.94
14563. noyoudweeb (noyoudweeb) 17 68.53 81.11 7 41.18
14564. joe seph (loer) 17 86.40 103.74 6 35.29
14565. Havinastroke (saltyhavin) 17 61.21 80.11 4 23.53
14566. Afraaj (afraj) 17 63.31 74.28 4 23.53
14567. Akshat (nothingness_) 17 55.98 65.54 5 29.41
14568. Degeu (darius_primarul) 17 48.99 55.69 2 11.76
14569. tmurtle123 (whenindan) 17 89.89 113.02 5 29.41
14570. Cole (mechanicalmac) 17 60.26 69.60 4 23.53
14571. AbeerOP (jazztoofast) 17 65.69 75.06 2 11.76
14572. Kazu (kazu_0321) 17 43.23 50.99 4 23.53
14573. Riu (yung_sushi) 17 51.81 64.27 9 52.94
14574. jaoo (joaocunhajeronimo) 17 80.71 105.40 4 23.53
14575. Cooper (cooperskat) 17 96.60 112.28 9 52.94
14576. Sizzles (sizzlessnake) 17 31.79 36.43 2 11.76
14577. Lukas (jabo_o) 17 30.85 36.77 5 29.41
14578. ming (conphusion) 17 85.78 99.34 9 52.94
14579. Eddie (edlebo) 17 77.36 91.51 4 23.53
14580. jfjjrmfjg (jfjjrmfjg) 17 84.53 97.31 5 29.41
14581. Joel (tellurican) 17 77.71 86.57 9 52.94
14582. Daniel (serthh) 17 44.98 51.86 1 5.88
14583. Stan (st4n) 17 72.93 82.01 1 5.88
14584. Galeona (galeona) 17 68.17 77.92 4 23.53
14585. Eats Their Veggies (eatsthe... 17 82.43 99.71 7 41.18
14586. Thomas (tommytunes) 17 54.22 62.65 4 23.53
14587. hoan (hoah_) 17 96.03 123.40 7 41.18
14588. mav (mavx) 17 55.30 65.69 1 5.88
14589. Appu (notappu) 17 46.44 59.45 3 17.65
14590. cal (calcife) 17 94.53 136.45 5 29.41
14591. Ben (crispr) 17 65.52 74.94 4 23.53
14592. Ikhwan (khxirules) 17 43.08 55.99 3 17.65
14593. Jack (jaxk45) 17 76.06 91.98 12 70.59
14594. xc (bighmann) 17 73.15 100.95 4 23.53
14595. Thomas (thetrain) 17 57.09 79.30 1 5.88
14596. Sotoray (sotothecomedian) 17 54.46 67.40 1 5.88
14597. sweatings (sweatings) 17 76.33 90.39 5 29.41
14598. ainchester (razorcluster) 17 59.21 71.12 3 17.65
14599. David (david2026) 17 58.21 66.28 4 23.53
14600. Philippos (exterminator1000) 17 52.71 67.80 5 29.41
14601. Ariz (arizb) 17 70.35 81.60 9 52.94
14602. viDoppio (vidoppio) 17 72.85 91.02 4 23.53
14603. Abdullah (toooi) 17 40.70 45.84 3 17.65
14604. jmarttinen (jmarttinen) 17 76.61 86.78 6 35.29
14605. Mlon Eusk (al2698) 17 75.52 92.28 3 17.65
14606. Jonathan (swatjkon) 17 80.58 95.90 5 29.41
14607. Wise Intelligent (wise_inte... 17 64.59 73.89 5 29.41
14608. Mahboob (mahboob56) 17 86.41 100.48 9 52.94
14609. Ripper (anikettheripper) 17 44.69 54.09 2 11.76
14610. Prad (_rad0n_) 16 39.93 52.75 1 6.25
14611. Itai (zytell) 16 73.08 91.76 3 18.75
14612. Zond (zohend) 16 55.77 64.33 4 25.00
14613. Zogurt (zogurt) 16 69.67 84.55 0 0.00
14614. Jonte (zitrex) 16 91.17 108.37 3 18.75
14615. Alex (zimbo21003) 16 70.73 83.78 2 12.50
14616. Zai (zaibeez) 16 86.44 97.38 12 75.00
14617. Zach (zach_htet) 16 82.76 94.64 3 18.75
14618. yuts (yts1999) 16 76.51 86.39 0 0.00
14619. yourrrfattt (yourrrfattt) 16 66.24 79.56 6 37.50
14620. vaughn (youmomgae) 16 93.91 99.56 6 37.50
14621. Roy (yoruio) 16 96.73 114.35 4 25.00
14622. YoloPlayz (yoloplayz10) 16 61.52 76.33 4 25.00
14623.   (yewk) 16 85.31 101.39 8 50.00
14624. yikes (yeknom) 16 96.03 110.54 7 43.75
14625. Y (ydelirious) 16 87.42 106.82 4 25.00
14626. AloneStranger (yasdf007) 16 73.77 79.56 7 43.75
14627. xnfra (xnfra) 16 65.00 77.21 1 6.25
14628. winterml3on (winterm3lon) 16 116.90 131.08 7 43.75
14629. John (wilde1) 16 87.49 107.82 6 37.50
14630. Mike (wikemazowski) 16 109.51 139.65 6 37.50
14631. Wexxort (wexxort) 16 64.73 75.85 3 18.75
14632. Khalid (weebsensation) 16 89.02 96.86 7 43.75
14633. Teddy (wazazaby) 16 86.59 96.98 1 6.25
14634. Schakrin (wavezzx) 16 66.25 78.39 4 25.00
14635. Allison (vllisunshine) 16 72.42 85.96 3 18.75
14636. Vlad (vlasuo) 16 111.14 138.59 8 50.00
14637. Pavel (vladmrovich) 16 61.76 70.99 3 18.75
14638. GargoyleG (vitalstatistixg) 16 91.80 102.09 6 37.50
14639. viRo (virosnes) 16 116.21 143.24 7 43.75
14640. vineel (vineel) 16 87.71 102.11 4 25.00
14641. Vicente (vincetroid) 16 54.12 62.49 1 6.25
14642. Thanasis (vidani) 16 57.18 68.22 3 18.75
14643. Shawn (vglunatic) 16 79.72 98.14 6 37.50
14644. Velonik (velonik_12) 16 60.67 66.60 4 25.00
14645. Vaibhav (vaibhavvyas) 16 78.67 99.57 5 31.25
14646. Doomguy (vader_) 16 76.03 92.64 6 37.50
14647. Anoos (ushagaming) 16 77.63 97.08 4 25.00
14648. user1458 (user1458) 16 65.39 70.68 4 25.00
14649. alax (urlonglostdog) 16 65.43 74.34 2 12.50
14650. Abdullah Al (uniquesociety) 16 56.84 65.49 10 62.50
14651. YoloSwag (unicornbronie) 16 103.20 117.87 7 43.75
14652. rycechckn (ultimategammer) 16 106.09 120.29 10 62.50
14653. UberTraffic (ubertraffic) 16 73.59 85.85 3 18.75
14654. Typhoid (typhoid) 16 124.08 147.07 10 62.50
14655. Tyler (tyler3143) 16 94.82 115.82 6 37.50
14656. TuffTofu (tufftofu) 16 97.17 115.19 9 56.25
14657. Noemi (tsunommi) 16 87.94 119.76 0 0.00
14658. Traviz (traviz) 16 78.95 102.56 10 62.50
14659. Zelymm (toxicmyles) 16 84.46 124.71 14 87.50
14660. nevergiveup (touristlevelis... 16 80.13 97.26 4 25.00
14661. Tohru (tohruu) 16 71.43 90.78 3 18.75
14662. tochidoh (tochidoh) 16 77.87 85.93 3 18.75
14663. Jump (toadjump) 16 95.57 107.51 5 31.25
14664. querty (thisiscamelcase) 16 65.51 79.53 2 12.50
14665. Semanta (the_who) 16 73.73 90.55 4 25.00
14666. Sriram (theking2007) 16 28.21 32.89 4 25.00
14667. hal (theemak) 16 49.10 59.67 1 6.25
14668. teyedix (teyedix) 16 50.69 56.15 2 12.50
14669. tenxone (tenxone) 16 34.52 45.02 2 12.50
14670. Collin (temposchool) 16 91.12 113.20 6 37.50
14671. Balazs (templomos51) 16 72.33 87.23 5 31.25
14672. Julien (taxes_) 16 60.00 72.28 6 37.50
14673. Taran (tarankloty) 16 128.87 148.23 7 43.75
14674. tamjid (tamjid_hasnat) 16 48.73 52.93 1 6.25
14675. V (tall_in_spirit) 16 141.07 158.97 12 75.00
14676. Nicholas (swissbanklord) 16 59.33 76.21 3 18.75
14677. ahmed (sw7ezztyper) 16 72.66 85.21 8 50.00
14678. Marco (superquack10) 16 52.25 65.21 3 18.75
14679. Sumona (sumona) 16 38.57 43.68 3 18.75
14680. Sultan (sultanbro) 16 45.50 52.54 2 12.50
14681. Hopeless (styrix358) 16 78.40 97.33 2 12.50
14682. vikas (steady_tortoise) 16 42.35 53.68 1 6.25
14683. Mirage (starry_mirage) 16 93.48 104.99 6 37.50
14684. stacie (stackieeeee) 16 77.54 91.73 4 25.00
14685. Srinivas (srini_iitkgp) 16 99.61 114.28 8 50.00
14686. sretsaM (sretsam) 16 106.40 126.97 5 31.25
14687. T-Bird (spartakick) 16 111.51 125.07 6 37.50
14688. Spadger (spadgerr) 16 115.49 128.23 15 93.75
14689. Space (spacedandy) 16 95.02 111.90 7 43.75
14690. Anthony (sp333dy) 16 93.87 115.64 9 56.25
14691. Sora (sosora) 16 43.03 51.62 3 18.75
14692. Josh (sorry_typeracer) 16 75.54 94.59 5 31.25
14693. Hafma (somaliangirl) 16 153.60 169.53 14 87.50
14694. Ben (softaco) 16 126.34 142.89 4 25.00
14695. fea (sofea_m) 16 41.50 52.66 2 12.50
14696. Michal (snowykey) 16 60.76 74.55 4 25.00
14697. Snouto (snoutowo) 16 98.90 116.57 10 62.50
14698. Sergey (snich) 16 108.92 116.17 8 50.00
14699. smowat (smowat) 16 65.26 78.31 2 12.50
14700. Ernesto (smoking_kills) 16 64.87 80.72 2 12.50
14701. SmiIe (smiie) 16 104.22 115.28 6 37.50
14702. Kriss (smashingpinkey) 16 46.87 56.34 2 12.50
14703. Slok (slokregmi___) 16 47.44 53.82 4 25.00
14704. Simon (slimsonkysreformed) 16 78.62 92.41 5 31.25
14705. TianHao (skydrag0n) 16 88.70 99.27 11 68.75
14706. SIlvester (silvesterfake) 16 81.10 92.59 2 12.50
14707. Pitt@_____ (shubhamshinde) 16 26.75 32.72 1 6.25
14708. Shub (shub01) 16 79.50 90.94 2 12.50
14709. Lee (shriveledegg) 16 94.68 116.48 6 37.50
14710. Cheg (sheedipants) 16 57.82 66.81 5 31.25
14711. shumkar (shbarpiev) 16 75.16 92.56 2 12.50
14712. Severin (sevo4a) 16 106.49 132.97 6 37.50
14713. Daniel (semashe) 16 90.03 114.73 8 50.00
14714. segun (segun99) 16 46.65 54.38 1 6.25
14715. Baibars (sazin_me) 16 62.84 70.92 7 43.75
14716. Jason (samuraishinobi) 16 63.49 72.14 3 18.75
14717. siri (sag339) 16 102.81 135.23 5 31.25
14718. karrar (saffa990) 16 60.90 72.01 5 31.25
14719. Ryan (rya_nly) 16 119.87 145.86 11 68.75
14720. Ryan (ryantam279) 16 68.86 80.26 7 43.75
14721. Rustem (rus101) 16 108.82 125.69 6 37.50
14722. Abdurrachman (rrachman) 16 68.11 81.75 6 37.50
14723. Herve Tran (royale81) 16 77.70 90.70 8 50.00
14724. Andrew (ronioz) 16 79.58 91.93 6 37.50
14725. রিফাত (rifat_072) 16 74.52 89.88 6 37.50
14726. LacticMilk (richardios275) 16 73.43 87.53 2 12.50
14727. Yah (reveri) 16 80.23 91.94 5 31.25
14728. OREO (reocraft) 16 108.15 138.98 9 56.25
14729. Shaggy (remrem0) 16 84.97 100.30 3 18.75
14730. Morris (reinheart) 16 114.51 124.60 7 43.75
14731. Robertas (rebutis) 16 69.91 76.43 6 37.50
14732. Preet (rahal) 16 58.80 71.89 4 25.00
14733. My (qwertytheuiop) 16 53.65 61.79 5 31.25
14734. Kim (qwerko) 16 78.77 95.21 6 37.50
14735. Harry (qqwwddvv852) 16 63.13 75.62 3 18.75
14736. Qianxu Guo (qianxug) 16 94.44 112.39 10 62.50
14737. Puppet (puppetsfingers) 16 90.39 114.61 6 37.50
14738. Xingyu (pumpkinlighter) 16 56.79 67.13 3 18.75
14739. PraWin (praveenapk) 16 56.47 63.73 3 18.75
14740. Murphy (pouyacr72) 16 60.05 75.64 2 12.50
14741. PotatoMike (potatomike) 16 89.41 111.48 4 25.00
14742. 21337R (poptart128) 16 109.92 131.56 10 62.50
14743. ahmed (ponochio_) 16 52.92 60.51 4 25.00
14744. PizzaPortal (pizzaportal) 16 77.76 107.24 7 43.75
14745. chimp (phucktyping) 16 106.31 131.82 7 43.75
14746. ph (phmi) 16 85.22 103.23 6 37.50
14747. peppy (peppersteaku) 16 96.22 120.21 4 25.00
14748. Philip (pengzz) 16 81.91 95.23 5 31.25
14749. Farm (pandamkii) 16 99.82 115.63 9 56.25
14750. Polly (pajberman) 16 114.12 134.28 8 50.00
14751. Pablo (pablurp) 16 104.04 133.30 10 62.50
14752. p055am (p055am) 16 55.41 70.01 6 37.50
14753. oriom (orionrw) 16 119.99 138.57 11 68.75
14754. OobertsTyping (oobertstyping) 16 106.38 124.11 7 43.75
14755. Apple (omnipotential_magic) 16 70.82 80.22 1 6.25
14756. Christopher (omicronexe) 16 77.04 94.87 7 43.75
14757. Omar (omarkhair) 16 62.14 70.09 3 18.75
14758. Olan (olan10001) 16 71.05 87.13 4 25.00
14759. Noam (okahama) 16 71.53 86.41 3 18.75
14760. Oink (oinklmao) 16 67.30 80.08 5 31.25
14761. SirDavid (nunyobusiness) 16 123.26 142.17 9 56.25
14762. vignesh (noob_typer16) 16 50.62 57.65 2 12.50
14763. noob_slayer (noob_slayer) 16 98.83 111.37 7 43.75
14764. tstats[n0body] (nobody01) 16 108.31 122.11 7 43.75
14765. Musashi (noble_addiction) 16 75.62 94.11 5 31.25
14766. nitesh (nkpcpr) 16 37.46 42.75 1 6.25
14767. Fluoride Action Network (nize) 16 112.69 146.74 6 37.50
14768. me (ninjagamer0060) 16 61.12 72.74 2 12.50
14769. Nikki (niksta95) 16 124.62 154.84 13 81.25
14770. marc (nightowl) 16 86.57 102.19 5 31.25
14771. Desmond (night9sky) 16 65.19 76.91 4 25.00
14772. nico yes nico (nic_o_nic) 16 103.02 140.12 5 31.25
14773. Nick (nick1347) 16 89.42 102.84 8 50.00
14774. Lucy (nemurinemuri) 16 103.52 112.55 8 50.00
14775. Nathan (nayteo) 16 71.17 84.45 0 0.00
14776. naviman (naviman) 16 94.98 114.02 7 43.75
14777. natc (natc2) 16 84.99 97.86 7 43.75
14778. tuffghost (namtap) 16 106.84 117.14 7 43.75
14779. Milan (nalim) 16 72.90 78.94 2 12.50
14780. Amila (n0wtype) 16 84.01 90.37 8 50.00
14781. MyNameIsGodzLol (mynameisgo... 16 81.97 97.31 7 43.75
14782. Joseph (mwita7) 16 59.88 73.55 0 0.00
14783. Joshua (mr_mushroom_stew) 16 93.18 101.28 2 12.50
14784. Mon (monmcgt) 16 73.29 86.12 3 18.75
14785. Bryce (molohov) 16 90.77 116.36 5 31.25
14786. medham (mohemedham) 16 51.81 61.48 0 0.00
14787. youknow (moelesteronyakids) 16 24.12 28.38 4 25.00
14788. Edwin (minsil) 16 87.72 104.94 8 50.00
14789. ◯__ MAX __◯ (minilaytr) 16 79.55 94.68 4 25.00
14790. TheCuber (mine_star2046) 16 54.56 65.77 5 31.25
14791. WhySoSlow (milktea_1999) 16 70.41 77.77 3 18.75
14792. DaturdMig (migueldathird) 16 82.16 91.11 5 31.25
14793. Emily (miffily) 16 98.22 109.64 12 75.00
14794. Michał (michal_miszcz_123) 16 52.51 62.38 3 18.75
14795. Kael (michael_deleon) 16 69.61 80.45 3 18.75
14796. Garry (megatroop) 16 102.09 108.94 5 31.25
14797. MD Imran (md_imran_hosen) 16 37.36 44.03 2 12.50
14798. Boltedツ (mchackerz) 16 89.86 102.58 6 37.50
14799. matuush (matuush) 16 61.49 70.01 12 75.00
14800. mathemage (mathemage) 16 78.84 86.38 3 18.75
14801. Lindsay (math314) 16 108.54 125.96 14 87.50
14802. tstats[massive_man4] (massi... 16 113.21 144.84 6 37.50
14803. Zach (malkyie) 16 87.34 110.30 6 37.50
14804. maher (maherbmf) 16 46.49 59.05 2 12.50
14805. Lord (mafiosnik) 16 48.29 55.35 2 12.50
14806. Macrene (macrene) 16 102.56 118.82 8 50.00
14807. Mike (m1kep) 16 74.17 97.26 6 37.50
14808. karen (lvl100karen) 16 101.10 111.96 9 56.25
14809. Val (luv2swimv) 16 118.93 148.05 10 62.50
14810. Konstantine (luke_erdman) 16 88.27 96.56 5 31.25
14811. Louis (lodero) 16 95.86 115.19 10 62.50
14812. Abdallah (lno_namel) 16 27.39 32.21 1 6.25
14813. Leo (ljrobispado) 16 68.40 75.88 4 25.00
14814. Rosen (littlepero) 16 43.70 51.18 2 12.50
14815. Zhen Qing (lim0721lim) 16 85.62 98.34 3 18.75
14816. Leon (likarii) 16 88.75 108.00 6 37.50
14817. Liam (liamc2) 16 62.42 74.73 2 12.50
14818. lency (lencyb21) 16 47.68 55.06 2 12.50
14819. Lecailloux (lecailloux) 16 66.49 78.15 5 31.25
14820. Joash (lastassassin1) 16 77.57 91.54 5 31.25
14821. Kate (larleek) 16 78.59 92.43 6 37.50
14822. Kirito (laksh_4uh) 16 65.78 85.19 1 6.25
14823. Kūfuku (kufuku) 16 68.56 83.08 7 43.75
14824. Krzyś (kszysio) 16 85.07 103.15 6 37.50
14825. YAS62kbdfans5 (ksydry6) 16 108.70 119.22 11 68.75
14826. Kraven (kraven_lupei) 16 125.64 143.02 6 37.50
14827. Artur (korfey) 16 35.42 40.43 0 0.00
14828. nick (koot) 16 66.08 82.26 4 25.00
14829. grace (koald) 16 90.13 103.63 4 25.00
14830. Koala (koalazoo) 16 125.71 145.49 12 75.00
14831. (klaritix) 16 137.58 167.33 12 75.00
14832. Kitkat (kitkatt77) 16 64.25 77.33 2 12.50
14833. kit (kitkatpaddywack) 16 97.24 110.89 5 31.25
14834. KimsterH (kimsterh) 16 90.16 110.11 3 18.75
14835. Lazar (kh00m4) 16 57.35 66.84 3 18.75
14836. Ken (kgnishere) 16 83.76 92.33 7 43.75
14837. Kevin (keviniskevy) 16 84.76 101.07 4 25.00
14838. Keihlan (keihlan) 16 45.00 52.82 0 0.00
14839. muhammed (katsh) 16 63.40 80.33 4 25.00
14840. katrina mae (katrinamae_cru... 16 53.87 67.65 11 68.75
14841. Oscar (karos_uchiha) 16 90.11 105.00 4 25.00
14842. Karim Alaswad (karim_alaswa... 16 73.42 88.89 5 31.25
14843. Johan (kankertypen) 16 114.65 137.40 7 43.75
14844. KachoriJalebi (kachori_jalebi) 16 55.87 68.90 3 18.75
14845. Kentaro (k3n74r0) 16 116.04 127.59 6 37.50
14846. Saso McDaso (justtypefast) 16 137.64 161.47 13 81.25
14847. Im slow (justmecha) 16 63.65 84.48 6 37.50
14848. Justin (justbh) 16 97.19 110.95 3 18.75
14849. tesseractive (jupyter) 16 73.73 87.07 2 12.50
14850. Beilvert (jubeilvert) 16 72.48 87.99 1 6.25
14851. Kimchi (jrhee) 16 100.39 125.25 6 37.50
14852. Josh (joshuazhu516) 16 136.50 165.95 6 37.50
14853. Joshua (joshuac_47) 16 67.77 92.72 8 50.00
14854. GoneRogue (josephlee) 16 71.10 82.98 5 31.25
14855. Jordan (jorjorg11) 16 53.27 59.14 3 18.75
14856. Jordi (jordityper) 16 110.42 126.60 9 56.25
14857. john mat (john_mat) 16 44.92 57.52 0 0.00
14858. TypeRacerKid (johnsonbongo) 16 70.46 85.42 4 25.00
14859. Johir (johir) 16 120.30 133.41 10 62.50
14860. Johnny (jnguyen732) 16 90.84 101.61 7 43.75
14861. faster (jjzxc1) 16 75.52 81.13 3 18.75
14862. B (jixlimmy) 16 112.16 133.80 12 75.00
14863. TeddY (jirayut) 16 60.03 70.89 6 37.50
14864. Jezrael (jezjwv) 16 51.63 61.91 5 31.25
14865. jfiewogh (jfiewogh) 16 92.22 121.19 12 75.00
14866. jfkdlsaeng (jfkdlsaeng) 16 81.21 103.47 3 18.75
14867. Mike (jewunit) 16 105.06 131.60 4 25.00
14868. Jesus (jesus08) 16 62.52 72.14 5 31.25
14869. Jaffri (jeffli2000) 16 90.71 103.54 9 56.25
14870. Joseph (jdog_ld) 16 77.35 93.51 5 31.25
14871. Jay Jo (jay20051209) 16 91.83 112.33 6 37.50
14872. Jimbo (jarrydschray) 16 49.73 56.49 1 6.25
14873. Jake (jakesk) 16 97.20 112.21 4 25.00
14874. G (jaden) 16 83.65 93.91 6 37.50
14875. Jack_potta (jack_potta) 16 68.36 79.53 4 25.00
14876. Joerg (jabra11) 16 103.99 115.17 5 31.25
14877. Parker (i_hunger101) 16 58.21 64.72 3 18.75
14878. Victor (its_shadow) 16 108.82 127.36 10 62.50
14879. YT (inverxted) 16 93.56 125.60 9 56.25
14880. huessy (independencyy) 16 129.82 149.98 10 62.50
14881. Jason (illumathottie) 16 97.00 116.33 12 75.00
14882. abdulkhakim (ihkim) 16 65.30 80.25 3 18.75
14883. wakolabot (idc_0306) 16 40.42 45.20 4 25.00
14884. Ian (iancook) 16 95.30 112.66 5 31.25
14885. AlexiaWasFound (iam_selc) 16 52.99 66.04 0 0.00
14886. Raju (iamrajukhan) 16 52.36 60.58 1 6.25
14887. David (hybridlikesrice) 16 124.72 133.70 7 43.75
14888. Hania (hrychania) 16 43.57 54.40 0 0.00
14889. Hrm_710 (hrmmm) 16 69.46 82.29 2 12.50
14890. No one (howardog0707) 16 110.57 132.96 4 25.00
14891. HJ (hjteq) 16 51.91 58.80 1 6.25
14892. Henry (henry2) 16 107.74 116.29 9 56.25
14893. hahah (hahahahahahaaaaa) 16 141.12 156.61 15 93.75
14894. The killer (haaassan) 16 57.46 69.64 2 12.50
14895. guhard (guhardos) 16 71.70 79.95 3 18.75
14896. Chris (guffar) 16 103.57 120.70 5 31.25
14897. Gnany (gnanickky1) 16 53.45 70.07 3 18.75
14898. grace (girlalmighty) 16 80.18 95.98 1 6.25
14899. Christian (gergoss) 16 95.94 117.24 11 68.75
14900. Gavin (gavtoaster) 16 92.89 107.49 5 31.25
14901. Garv (garv1908) 16 66.80 75.57 3 18.75
14902. Galil (galil35) 16 90.16 111.41 7 43.75
14903. Faaris (fxzz) 16 53.56 66.41 0 0.00
14904. Swarnim (futuretonystark) 16 55.82 68.88 4 25.00
14905. e (freshcabbage) 16 65.33 80.76 5 31.25
14906. Alonne (freeman_1337) 16 87.63 95.44 8 50.00
14907. Connor (frantelle) 16 71.23 87.40 6 37.50
14908. 🔱 (frankzzzzzzz) 16 82.54 89.60 1 6.25
14909. Andrew (foruforu) 16 92.09 104.81 3 18.75
14910. Snow (forgotmypassword) 16 103.51 116.87 11 68.75
14911. Flaze07 (flaze07) 16 113.46 136.79 7 43.75
14912. Ryan (flamepopo) 16 110.56 130.41 7 43.75
14913. i was wrong (firewolfrain) 16 159.90 217.71 14 87.50
14914. firealpaca1 (firealpaca1) 16 74.71 93.12 7 43.75
14915. frog (fijixt) 16 92.60 117.46 12 75.00
14916. Tyler Spruill (fightingox) 16 107.91 125.09 6 37.50
14917. gonçalo (figados) 16 95.78 106.59 3 18.75
14918. Abdullah (fe4rlesscloak) 16 100.09 119.65 8 50.00
14919. FatPanduh (fatpanduh) 16 125.40 136.50 9 56.25
14920. Vikram (fast_life) 16 44.39 51.31 2 12.50
14921. Chimaera (excalibur4212) 16 114.09 143.13 9 56.25
14922. Evelyn (evelyn_mh) 16 75.60 100.92 4 25.00
14923. EternalTempest (eternaltemp... 16 54.68 63.88 2 12.50
14924. Eren (eren_ackerman) 16 91.53 108.29 7 43.75
14925. Epoch (epochisepic) 16 87.89 104.51 4 25.00
14926. Epic (epic_gamer2834) 16 107.87 133.62 9 56.25
14927. CJ (entrity_screamr) 16 113.60 136.53 7 43.75
14928. Enea (enea) 16 66.83 79.51 1 6.25
14929. Emre (emre0) 16 75.08 85.62 3 18.75
14930. Elias (eliasjr) 16 72.43 86.45 5 31.25
14931. Eesa (eesa10) 16 75.80 88.29 4 25.00
14932. Edwin (edweezy) 16 104.95 120.12 4 25.00
14933. Edvaize (edvaize) 16 61.02 67.72 4 25.00
14934. Dennis (dwiebe) 16 45.22 55.19 3 18.75
14935. MaskDuck (duongmt) 16 51.09 61.14 6 37.50
14936. Lukas (dundis3000) 16 79.28 90.02 3 18.75
14937. Aj (drome) 16 65.78 74.61 3 18.75
14938. peace in byron (driveroncall) 16 120.53 156.84 9 56.25
14939. Drew (drewsmithworkman) 16 95.09 107.22 5 31.25
14940. Carson (dramagirl82) 16 71.62 80.60 5 31.25
14941. Dvorak Keyboard (douglasawe... 16 61.03 75.64 5 31.25
14942. not a race (donut_gublor) 16 97.77 120.02 5 31.25
14943. Dongo (dongodm) 16 91.25 129.99 5 31.25
14944. Spidget finger (djurancigan) 16 87.26 104.95 3 18.75
14945. Djordje (djo666) 16 97.31 110.20 7 43.75
14946. DiscoOrc (discoorc) 16 123.47 138.08 6 37.50
14947. Alex (dippyshere) 16 86.41 108.72 12 75.00
14948. DJ (dino_dj) 16 60.17 68.01 4 25.00
14949. Dhruv (dhruvs301) 16 83.65 91.16 5 31.25
14950. dewy (dewydh) 16 101.67 121.07 6 37.50
14951. deon (deontan) 16 111.90 124.47 9 56.25
14952. Parth (demolisher_1209) 16 79.74 97.31 7 43.75
14953. Debojoti Das (debojoti_soumya) 16 88.24 98.70 7 43.75
14954. Death (deathexploit) 16 100.79 116.71 16 100.00
14955. dayqpi (dayqpi) 16 110.50 130.36 8 50.00
14956. Davx_d (davx_d) 16 122.41 152.13 12 75.00
14957. Rooster (darkjdm) 16 118.33 142.83 11 68.75
14958. Nick (darapidninja) 16 76.47 88.79 16 100.00
14959. Justin (dainese) 16 70.69 83.07 4 25.00
14960. Christopher X Wu (cw86459) 16 85.75 112.41 1 6.25
14961. Tim (cupboard) 16 62.47 92.64 0 0.00
14962. aoxiang (cuiaoxiang) 16 82.16 98.00 6 37.50
14963. Sid (criptonate) 16 71.87 79.86 6 37.50
14964. NepThePep (creepyreapy) 16 68.85 90.06 1 6.25
14965. Come (cosmeec) 16 73.23 89.68 6 37.50
14966. Mason (contourflyer2) 16 55.73 65.17 0 0.00
14967. lucho (colombimbo) 16 61.15 69.48 3 18.75
14968. Cocospeed (cocospeedy) 16 47.58 53.45 1 6.25
14969. clausrogisch (clausrogisch) 16 48.61 54.54 1 6.25
14970. Alex (chucky9022_) 16 67.69 85.49 3 18.75
14971. Christian (chrixsi) 16 80.44 95.55 6 37.50
14972. Joe (chogpamp) 16 64.80 74.06 4 25.00
14973. Chris (chink344) 16 95.09 110.21 5 31.25
14974. Mert (chineeswall) 16 61.15 75.71 3 18.75
14975. Charles (charles0420) 16 49.65 60.40 2 12.50
14976. Cesar (cesarloachamin) 16 64.28 69.29 2 12.50
14977. Tomlynn (carriganth) 16 47.15 51.63 2 12.50
14978. Carlo (carlofletcher) 16 100.51 121.99 8 50.00
14979. The Milkman (captain_noodle) 16 108.14 125.59 8 50.00
14980. Lachlan (cancer88) 16 66.24 83.27 3 18.75
14981. billy (bzmq) 16 117.24 131.02 12 75.00
14982. Bytes (bytesandbots) 16 77.07 94.58 5 31.25
14983. Mapko (buffi) 16 73.46 85.72 1 6.25
14984. budjetti (budgettypo) 16 85.44 102.27 3 18.75
14985. Kamalesh (brrrr_007) 16 85.12 105.84 4 25.00
14986. Bronze (bronzefrakk) 16 85.08 94.34 5 31.25
14987. Breadman (breadman0123) 16 85.39 96.55 5 31.25
14988. Bosco (boscorj) 16 48.18 61.48 7 43.75
14989. ahmed (borr3y) 16 52.45 59.20 2 12.50
14990. Blue._. (bluewaves54) 16 83.91 98.85 6 37.50
14991. carl (blackhole24) 16 64.15 74.82 5 31.25
14992. Matthew (binko) 16 84.44 95.56 4 25.00
14993. yuh (billbrown86) 16 53.08 64.54 2 12.50
14994. Ben Asam (bemarc) 16 91.14 107.64 6 37.50
14995. Beluga (belugabetter) 16 94.35 105.86 3 18.75
14996. Abijith (believertn) 16 53.43 64.48 2 12.50
14997. Jon (bdnoj618) 16 83.91 96.67 2 12.50
14998. Sebastian (badwine) 16 55.73 71.77 2 12.50
14999. Brian (a_job_well_done) 16 132.07 141.19 12 75.00
15000. Ayush (ayushgandhi) 16 55.93 61.41 4 25.00
15001. ayrus (ayrus01) 16 56.52 64.17 3 18.75
15002. leonidas (awsomaw) 16 166.65 190.62 5 31.25
15003. ava (ava_er) 16 41.40 56.37 2 12.50
15004. kuan-Yu (austin737) 16 73.26 91.99 4 25.00
15005. tobias (atomstodin) 16 65.68 82.78 5 31.25
15006. Askur (askur00) 16 81.14 89.99 7 43.75
15007. Aridia (aridia) 16 88.39 98.26 7 43.75
15008. arichnad (arichnad) 16 80.51 103.64 2 12.50
15009. aorer (aorer) 16 110.01 133.44 9 56.25
15010. Ritu (anritu) 16 63.79 75.69 4 25.00
15011. Luke (angelsfan) 16 89.83 105.57 15 93.75
15012. candyyyyyyy (andewa_05) 16 103.22 121.01 13 81.25
15013. Anderson (andarson) 16 85.84 96.60 5 31.25
15014. Anaru (anaru797) 16 82.56 92.37 2 12.50
15015. Amir (amirtrex) 16 58.06 70.86 3 18.75
15016. Amir (amirb101) 16 88.71 110.71 13 81.25
15017. Maccy (amaccy) 16 66.22 74.11 6 37.50
15018. Ariel :) (alyas94) 16 71.71 85.48 4 25.00
15019. Alles (allesboem) 16 100.14 118.53 6 37.50
15020. alex (alexjimma) 16 26.42 31.45 3 18.75
15021. Karibas (albiones) 16 76.44 89.10 4 25.00
15022. Mohammad (alamin_typist) 16 84.51 98.83 6 37.50
15023. Akribes (akribes) 16 92.33 106.94 6 37.50
15024. Aidan (aidsiskindagoated) 16 67.68 78.03 2 12.50
15025. ahmed saif (ahmedsaif) 16 69.46 76.54 2 12.50
15026. ahmed (ahmedfoad246) 16 63.20 73.12 3 18.75
15027. Harlis (ahk_master) 16 57.41 69.80 1 6.25
15028. Aviram (adsherun) 16 87.78 107.68 4 25.00
15029. Adrian (adrian4k_) 16 74.72 83.52 5 31.25
15030. Karol (adobonimama) 16 83.48 99.08 3 18.75
15031. Adil (adilmamed0v) 16 86.08 101.23 6 37.50
15032. Adham2024 (adham2002) 16 60.57 78.39 3 18.75
15033. Adamowich (adamowich) 16 84.31 102.65 3 18.75
15034. æ (ac343) 16 100.47 118.13 7 43.75
15035. Abhinav (abhinav28061) 16 38.97 44.36 2 12.50
15036. Antoni (aachh) 16 108.91 128.50 8 50.00
15037. Hisham (7ommus) 16 59.68 75.97 3 18.75
15038. Brenda (6renda) 16 72.21 88.25 4 25.00
15039. Mat (3nlist) 16 91.67 108.45 9 56.25
15040. Donovan (24aad) 16 70.55 81.63 2 12.50
15041. Haley (21stcenturyasian) 16 47.40 57.95 0 0.00
15042. ray (rayearly2) 16 74.97 82.07 7 43.75
15043. Anish (anish592) 16 54.62 63.52 1 6.25
15044. Delphin (delmasgdp7) 16 45.59 55.31 0 0.00
15045. Kian (kianhidayat) 16 70.86 84.41 5 31.25
15046. Lucy (moca_lucy) 16 52.37 61.12 3 18.75
15047. Adriane (cordzingerr) 16 73.83 94.23 7 43.75
15048. Bemin (bemin) 16 44.76 63.04 1 6.25
15049. Matthew (matt5671110) 16 93.68 101.01 5 31.25
15050. Alijah (user_504) 16 49.78 57.01 2 12.50
15051. GoldenKoopa (goldenkoopa) 16 60.10 70.79 4 25.00
15052. toshi (toshi2135) 16 79.67 92.03 3 18.75
15053. nicholas (xxxtexascion) 16 45.19 54.30 0 0.00
15054. Sakibul (sakib62) 16 46.27 52.72 5 31.25
15055. Alden (bibbedtoaster) 16 61.61 77.25 6 37.50
15056. Julle (aikarauta) 16 94.85 108.73 10 62.50
15057. tushar mathpal (tmathpal25) 16 49.48 54.69 2 12.50
15058. NatanTopKek (abrn200) 16 48.25 56.98 1 6.25
15059. sys3 (neporian) 16 91.34 118.82 4 25.00
15060. Strattuss (strattuss) 16 101.80 117.40 8 50.00
15061. Lemon (raymond_p21) 16 86.64 132.09 6 37.50
15062. James (jfjames101) 16 85.19 95.55 9 56.25
15063. aspyse (aspyse) 16 85.59 101.37 1 6.25
15064. Taylor (tparr_05) 16 86.69 99.34 12 75.00
15065. Shane (oo123654789) 16 67.84 75.93 5 31.25
15066. quang (lequang89lk) 16 55.82 64.08 4 25.00
15067. somethhing_324 (somethhing_... 16 30.55 45.01 4 25.00
15068. LAvi (getoodasuals) 16 79.34 95.10 7 43.75
15069. OyBer (oyber) 16 51.68 57.41 2 12.50
15070. Andrew (andyroop18) 16 98.43 120.97 6 37.50
15071. LISEK (jeneeczek) 16 25.65 33.33 3 18.75
15072. Anthony (gently162) 16 86.26 108.14 6 37.50
15073. Virgil (baron_red) 16 57.60 69.87 0 0.00
15074. Audge (audge9) 16 101.70 111.51 4 25.00
15075. Tonho (t0nhou) 16 63.07 68.53 1 6.25
15076. One Handed (samilz92) 16 21.90 27.58 2 12.50
15077. Vidun (vidunvj) 16 101.92 120.31 7 43.75
15078. Player5k (player5k) 16 29.65 46.36 3 18.75
15079. Enrique (enriquejh97) 16 58.66 72.20 2 12.50
15080. Volc (volcanic_eruption) 16 65.26 74.05 2 12.50
15081. wiwi (wiwi08) 16 49.40 54.98 2 12.50
15082. Paul (00000000) 16 70.58 87.89 4 25.00
15083. private (awwi) 16 54.33 60.04 0 0.00
15084. xiugaze (xiugaze) 16 76.96 95.82 4 25.00
15085. ashik (ashikmaximus) 16 27.69 35.08 1 6.25
15086. Jeffrey (jeffmoore4815) 16 42.65 51.53 1 6.25
15087. Terrific (samsoft) 16 69.15 82.42 6 37.50
15088. strideisnot (strideisnot_po... 16 52.69 63.06 10 62.50
15089. Mikiroow (mikiroow) 16 120.18 128.84 11 68.75
15090. Stephen (sda370) 16 115.33 133.73 11 68.75
15091. shawn (tesu23) 16 56.09 62.84 4 25.00
15092. Orange (imorange) 16 62.94 79.15 6 37.50
15093. Creamy Poo (mintbreezeplus) 16 55.36 64.02 6 37.50
15094. Przemysław Węglik (weglik) 16 53.27 66.30 1 6.25
15095. Chino (chino_mama) 16 102.18 118.06 7 43.75
15096. nicatiau (nicole_mendes13) 16 50.80 57.69 12 75.00
15097. Reggie (_fast_car_noises_) 15 48.77 55.87 1 6.67
15098. Zozvo (zozvo) 15 45.95 60.35 1 6.67
15099. Ugnius (zorgas) 15 77.30 91.65 5 33.33
15100. Zzzzzz (zokey) 15 82.88 90.68 4 26.67
15101. Varyemez✍️ (ziperz_the_... 15 94.23 103.40 5 33.33
15102. Kaiden (zentacle) 15 86.56 97.07 4 26.67
15103. Secre (zenmt) 15 69.98 84.90 7 46.67
15104. Zane (za_schu) 15 65.66 81.82 3 20.00
15105. Javin (zakurukito) 15 67.24 77.60 3 20.00
15106. z1lo (z1lo) 15 62.05 71.65 2 13.33
15107. ( ͡° ͜ʖ ͡°)🖕 (your... 15 95.15 111.89 4 26.67
15108. yogesh (yogipapu15) 15 60.72 69.48 3 20.00
15109. Yellow (yellowleaf) 15 78.82 106.30 6 40.00
15110. Emmett (yamaicewing) 15 68.57 75.73 3 20.00
15111. Xyhop (xyhop) 15 78.29 92.72 8 53.33
15112. JJ (xvitrix) 15 98.06 115.40 6 40.00
15113. Ricards (xricheeh) 15 50.12 57.84 0 0.00
15114. jie (xonjiex) 15 98.62 113.71 5 33.33
15115. xcz (xcz05) 15 99.82 109.62 4 26.67
15116. enfonius (wssh) 15 136.68 162.85 0 0.00
15117. Mateusz (wirelesss) 15 53.15 60.94 4 26.67
15118. William (will_exe) 15 48.98 55.17 2 13.33
15119. WooshWoosh (wiertsmenator) 15 60.79 71.51 4 26.67
15120. whaterman (whaterman) 15 63.47 78.50 8 53.33
15121. Mikel (wellthatwasfun) 15 98.00 114.07 11 73.33
15122. anousa (weebwithadog67) 15 108.00 123.71 9 60.00
15123. Mark (waybeyondhope) 15 39.29 52.66 2 13.33
15124. ivanchrome (watonearth) 15 103.96 119.73 7 46.67
15125. Ken (waterlemon48) 15 88.79 106.11 7 46.67
15126. Waseem (was11) 15 49.47 52.75 2 13.33
15127. aleX (waisa) 15 67.31 88.72 3 20.00
15128. w8 (w8lkinusa) 15 72.48 82.39 4 26.67
15129. Vodon (vodon) 15 80.56 90.56 2 13.33
15130. Vito (vito_t) 15 44.09 54.98 3 20.00
15131. vioco (vioco) 15 74.96 85.06 1 6.67
15132. Vasi (vasi1333) 15 85.74 95.75 6 40.00
15133. Utkarsh (utkarsh_n) 15 58.91 70.75 3 20.00
15134. Usmon (usmon_h) 15 56.38 61.23 13 86.67
15135. Usman (usmanayubkhan) 15 63.55 76.46 1 6.67
15136. user (user199012) 15 139.21 190.97 11 73.33
15137. Gustav (ultragurkatv) 15 61.38 71.73 2 13.33
15138. uggs (ugo_alo) 15 58.29 71.36 1 6.67
15139. Brennen (uglyer) 15 108.96 120.27 7 46.67
15140. uday (uday12381) 15 84.07 99.02 2 13.33
15141. t_lea (t_lea) 15 87.01 104.62 3 20.00
15142. Hamlet (typing__words) 15 103.07 130.29 9 60.00
15143. Mayank (typingbadal) 15 39.53 47.50 1 6.67
15144. Type (typespeed2020_) 15 87.00 107.07 5 33.33
15145. Jacqueline (typegozoom) 15 44.36 52.21 1 6.67
15146. Krzysztof (tygryz) 15 85.18 102.49 4 26.67
15147. Harry (txharry) 15 96.09 106.71 3 20.00
15148. Rachel (tweetybirdbird) 15 50.92 64.90 2 13.33
15149. Tuan (tuan) 15 71.38 79.85 2 13.33
15150. TryingToBeHooman (tryingtob... 15 63.71 79.15 5 33.33
15151. trip (triphereon) 15 75.97 84.35 6 40.00
15152. trailmix (trialtest) 15 103.85 117.29 10 66.67
15153. Logan (toast_scrubber) 15 87.34 104.49 4 26.67
15154. try (tipewriter123) 15 85.53 103.31 7 46.67
15155. Tristan (timmychikin) 15 103.87 115.71 7 46.67
15156. Justin (thisjustinj) 15 38.93 47.26 0 0.00
15157. dakshesh (the_teslafan) 15 59.18 78.72 9 60.00
15158. theunnoticable (theunnotica... 15 116.34 138.53 8 53.33
15159. Brian (thepinkelephantcar) 15 96.82 124.73 3 20.00
15160. Jeandre (theopgamer) 15 70.39 84.66 15 100.00
15161. TGX20 (thegamerx20) 15 103.16 116.81 7 46.67
15162. the (thebaneet) 15 89.89 108.47 5 33.33
15163. sash (thatguysash) 15 102.39 118.86 7 46.67
15164. TGNYC (tgnyc) 15 118.51 128.45 7 46.67
15165. Temur (temurmannonov) 15 67.20 73.33 4 26.67
15166. 𝕃𝕦𝕗𝕗𝕪 (techon) 15 101.77 113.52 8 53.33
15167. Tarun (tarun6119) 15 45.85 53.58 2 13.33
15168. Dreeows (tanziomee) 15 58.72 72.73 3 20.00
15169. Tanner (tannercraytor) 15 56.64 66.81 5 33.33
15170. Alex (t3dr) 15 73.01 83.83 3 20.00
15171. edyn (sylvyn) 15 51.02 60.10 1 6.67
15172. Alex (swobe) 15 69.50 78.23 4 26.67
15173. Suttikoon (suttikoonpp) 15 62.90 78.18 3 20.00
15174. Surya (suryasunkari) 15 99.11 122.52 15 100.00
15175. Mehmet (superfasttyper_0102) 15 60.94 76.74 3 20.00
15176. Nuts (sumguy69) 15 112.53 125.23 8 53.33
15177. dvorshark 🦈 (strongly_ty... 15 114.06 140.93 4 26.67
15178. StantheAsian90 (stantheasia... 15 84.79 99.35 4 26.67
15179. Stalking (stalkingdog) 15 86.30 103.51 1 6.67
15180. Jeff (st1m) 15 50.93 56.63 1 6.67
15181. George (ssbatch) 15 122.52 136.55 8 53.33
15182. Chris (splixerr) 15 68.78 83.10 4 26.67
15183. Brayden (soygoblin) 15 42.23 49.86 0 0.00
15184. Soxi (soxi_colemak) 15 80.97 101.82 5 33.33
15185. Toasty (somewhat_toasty) 15 67.88 80.30 3 20.00
15186. Some1uknow (some1uknow) 15 58.38 66.62 2 13.33
15187. Sofia (sofia_anical) 15 51.15 58.12 3 20.00
15188. kowi (smoothfingers) 15 57.00 63.71 1 6.67
15189. Prasanta (skyline049) 15 47.84 56.81 3 20.00
15190. MeowPichu (skyarchbeast) 15 101.89 113.33 7 46.67
15191. Dastan (skitllz) 15 40.02 44.09 0 0.00
15192. shazzy (skdreams) 15 87.24 97.31 5 33.33
15193. simmi (simmi999777) 15 55.73 68.89 3 20.00
15194. TruffleJr (silvqrfrost) 15 44.40 49.69 1 6.67
15195. Nedi (silencion) 15 43.44 49.61 2 13.33
15196. Siddharth (siddharthrajpal) 15 71.55 78.09 4 26.67
15197. Shrubber (shrubber) 15 67.92 77.28 3 20.00
15198. Shriram (shri_baj) 15 37.43 44.14 1 6.67
15199. Zachary (showmanthemoney) 15 82.93 89.94 3 20.00
15200. Shashank (shashniq) 15 77.51 83.58 6 40.00
15201. Senin (senin8pagi) 15 102.48 110.91 7 46.67
15202. Syed Ashfaq (satmath) 15 41.45 46.08 2 13.33
15203. Michael (sano459) 15 89.37 95.06 3 20.00
15204. samsolt (samsolt) 15 51.36 62.87 3 20.00
15205. Anuar (sagidollaev_) 15 49.29 57.08 13 86.67
15206. Sagar (sagarcool) 15 48.35 56.00 2 13.33
15207. George (ryallanrya) 15 108.64 127.06 9 60.00
15208. Ruff (roofy2004) 15 81.38 92.97 4 26.67
15209. ROAD TO 100!!! (ronkoe) 15 43.20 49.68 2 13.33
15210. romo (romokom) 15 30.55 36.19 1 6.67
15211. Rod_Regus (rod_regus) 15 78.47 87.83 1 6.67
15212. Rick (rickthetyper) 15 107.66 141.38 4 26.67
15213. Yuzu (rice_senpai) 15 89.77 102.46 4 26.67
15214. RiceBOI111 (riceboi111) 15 103.98 128.26 9 60.00
15215. Ren (renrob13) 15 115.47 132.15 12 80.00
15216. Rashad (rashad19) 15 64.22 76.51 4 26.67
15217. wy (randumbtyper) 15 141.49 160.75 13 86.67
15218. Ryan (raisonfire) 15 97.84 112.90 9 60.00
15219. nic (rainbowarsenal) 15 104.51 130.97 6 40.00
15220. Type (racer4587) 15 62.05 92.43 4 26.67
15221. Cute (rabbit4549) 15 82.22 99.80 4 26.67
15222. R1ng (r1ng) 15 85.23 103.94 4 26.67
15223. 一向 (quan72io) 15 90.39 99.81 7 46.67
15224. Fadhil (qazsxdcfv) 15 89.52 111.85 7 46.67
15225. Pustinek (pustinek) 15 44.39 50.07 1 6.67
15226. punished buster (punishedbu... 15 78.65 89.42 4 26.67
15227. pemba (pttpemba) 15 51.69 65.83 2 13.33
15228. Psychism (psychism) 15 95.19 128.84 7 46.67
15229. Gregory (prosher) 15 52.33 57.16 1 6.67
15230. Yut (poominb) 15 83.04 94.71 3 20.00
15231. Doug (pontiacbandit) 15 73.75 83.23 3 20.00
15232. Pomochko (pomochko) 15 66.75 83.92 1 6.67
15233. Tommy (pnkflwrs) 15 88.32 102.25 6 40.00
15234. Phillip (pjeong3120) 15 96.52 108.72 5 33.33
15235. Pirapat (pirapatqwe) 15 95.03 114.25 5 33.33
15236. pintoa (pintoa) 15 85.29 98.73 5 33.33
15237. Arjun (pikabell) 15 61.46 80.30 3 20.00
15238. Pieces (pieces08) 15 70.49 76.77 7 46.67
15239. Hugo (phudgestuff) 15 61.95 72.18 3 20.00
15240. Phoebo (phooboo) 15 69.57 88.31 4 26.67
15241. Pearl (pearlescent) 15 121.59 137.60 10 66.67
15242. patztablook22 (patztablook22) 15 83.83 95.97 5 33.33
15243. panacotta (panacotta) 15 101.58 114.35 6 40.00
15244. Olaf (p1stachiofurioso) 15 124.79 137.77 7 46.67
15245. B (p1geonkid) 15 49.35 56.50 2 13.33
15246. Krisjanis (overcastace332) 15 88.50 104.05 5 33.33
15247. fastboi (ooofooo) 15 85.07 96.79 3 20.00
15248. Isla (oodley) 15 64.83 75.61 5 33.33
15249. Muhammad Omar (omar_farooq) 15 68.40 80.53 3 20.00
15250. Omar El-Farouk (omarelfarou... 15 51.00 60.30 4 26.67
15251. ollir (ollir) 15 99.70 107.53 9 60.00
15252. Oleg (oleg20111511) 15 77.84 91.21 3 20.00
15253. m (ogtong) 15 92.81 101.85 4 26.67
15254. Ogatinasu (ogatinasu) 15 56.73 71.25 5 33.33
15255. obsidianical (obsidianical) 15 70.17 95.54 3 20.00
15256. Tobi (obiaas) 15 96.46 108.49 6 40.00
15257. Zoya (noximy) 15 37.44 49.61 1 6.67
15258. Nini (notthedestroyer) 15 58.39 69.36 2 13.33
15259. (nonquit) 15 148.28 166.20 13 86.67
15260. noman (noman121) 15 39.03 52.42 5 33.33
15261. Ashraful (noid621376) 15 70.79 86.65 5 33.33
15262. Noah (noahc3) 15 108.36 119.54 4 26.67
15263. Nift (niviman) 15 107.36 120.40 7 46.67
15264. Vinh (ninjapro) 15 75.90 92.57 7 46.67
15265. Nicolas (nick4652) 15 97.41 113.93 10 66.67
15266. Zoran (newslowkeyboard) 15 129.48 148.30 11 73.33
15267. Neko (nekonekokneecaps) 15 93.31 104.32 9 60.00
15268. Nathan (nathanv) 15 96.62 113.67 4 26.67
15269. Miracle- (nakatsumiuchiha) 15 70.62 83.42 2 13.33
15270. Nabil (nabilmuafa) 15 71.26 84.26 4 26.67
15271. MusicSounds (musicsounds) 15 103.96 125.62 5 33.33
15272. Mubashar (mubashar_javed) 15 69.37 85.27 5 33.33
15273. Kirill (mr_beer) 15 46.95 49.72 0 0.00
15274. פלסטין חופשית (... 15 102.60 114.75 6 40.00
15275. Marc (mrives) 15 49.99 56.43 2 13.33
15276. Mr. (mrdayton) 15 61.91 72.87 11 73.33
15277. Gaurav (moodcode) 15 56.17 68.33 3 20.00
15278. mt. (monthon993) 15 64.41 70.75 4 26.67
15279. Justin (moneybagg) 15 67.48 76.20 4 26.67
15280. Joshua (mochi0607) 15 94.64 121.34 8 53.33
15281. foenem (mkmares_qwerty) 15 80.99 96.05 3 20.00
15282. Mistey (mistey) 15 124.86 145.31 14 93.33
15283. mir (mir_rahat) 15 43.79 50.13 3 20.00
15284. mirlan (mirlanbek) 15 23.89 30.07 1 6.67
15285. James (mirdan) 15 81.78 101.64 3 20.00
15286. Mipow (mipow_kun) 15 62.09 70.62 6 40.00
15287. Pisser (minsuk7) 15 98.01 110.97 7 46.67
15288. Deepta (mind_palace) 15 73.12 82.66 2 13.33
15289. miles (milesgreensmith) 15 82.69 92.83 3 20.00
15290. Miles (milesgendreau) 15 87.38 108.00 5 33.33
15291. milan (milansep27) 15 100.59 115.28 14 93.33
15292. lou (mikubeez) 15 108.65 120.68 3 20.00
15293. Miguel (miguelkristian) 15 92.78 101.84 3 20.00
15294. Mayth (melvinmelgar) 15 53.84 60.90 0 0.00
15295. Erik (mcmanerik) 15 53.63 60.87 1 6.67
15296. Mateusz (matusz019) 15 67.05 80.46 6 40.00
15297. tstats[mattinaglass] (matti... 15 68.19 89.61 4 26.67
15298. Marshall (marshallmaofr) 15 108.39 127.06 8 53.33
15299. Zheng_Dao (marmot0814) 15 87.22 104.07 5 33.33
15300. Marlon (marlondestroyer) 15 92.44 101.71 4 26.67
15301. Marley (marley) 15 99.27 105.63 6 40.00
15302. Malik (madx) 15 71.33 78.46 5 33.33
15303. MrDiRamio (madiramio) 15 97.27 108.46 9 60.00
15304. racemaster (madcodez) 15 47.42 53.74 0 0.00
15305. Jose (lupi1) 15 64.95 72.81 2 13.33
15306. RJ (lufulu) 15 105.81 130.68 8 53.33
15307. lucktale (lucktale) 15 92.04 127.67 3 20.00
15308. Good Vibe Tribe (lucas_lm) 15 86.30 101.09 7 46.67
15309. _l.y.m.y_ (loyehmoyeh) 15 64.09 75.44 4 26.67
15310. loow (loowt) 15 59.47 72.54 2 13.33
15311. lorenzo (lolloz98) 15 69.51 77.39 3 20.00
15312. Shan (liushanen) 15 87.38 97.44 4 26.67
15313. Lisa (lissandra) 15 72.39 88.48 11 73.33
15314. andrey (linus01) 15 33.48 42.38 0 0.00
15315. Joel (lil_wheeelz) 15 65.85 78.92 15 100.00
15316. Isaac (libstwo) 15 60.30 73.62 3 20.00
15317. Liam (liamzammit) 15 56.40 66.78 0 0.00
15318. Leith (leith_) 15 75.38 95.65 12 80.00
15319. Kai (leavelux) 15 88.23 99.67 8 53.33
15320. Dylan (lavafxlx) 15 61.52 80.05 12 80.00
15321. LastOfSpades (lastofspades) 15 137.26 150.45 11 73.33
15322. Wade (larrage) 15 95.06 114.71 4 26.67
15323. kym (kym2006) 15 104.97 123.81 12 80.00
15324. kward937 (kward937) 15 80.34 95.99 4 26.67
15325. Kellan (krusher7) 15 62.41 71.72 2 13.33
15326. Kris (kris_z) 15 119.57 141.02 6 40.00
15327. kostasss (kostasss) 15 43.12 54.86 2 13.33
15328. KOOKOWACKYDUCK (kookowackyd... 15 83.86 101.48 6 40.00
15329. Keziah (kookiru) 15 100.89 116.46 7 46.67
15330. Honda (konradowtf) 15 63.08 72.29 3 20.00
15331. Katherine (kleesaunders) 15 101.41 127.75 3 20.00
15332. Chris (kiousaras13) 15 73.83 92.21 6 40.00
15333. Phillip (kinkking123) 15 70.99 92.41 6 40.00
15334. Wil (kingwilyn) 15 56.33 68.50 3 20.00
15335. Dominik (killersshark) 15 57.29 65.49 4 26.67
15336. bc (kilk3) 15 88.52 105.55 4 26.67
15337. Ian (kfcdonutsandwich) 15 93.61 112.84 4 26.67
15338. Edwin (keyhem_) 15 65.48 75.19 4 26.67
15339. Kevin (kev011701) 15 110.86 126.85 10 66.67
15340. Ken (keni98) 15 84.82 99.92 5 33.33
15341. Kelsey (kelseysd) 15 82.21 111.16 7 46.67
15342. kelian (kekelian) 15 62.25 68.11 3 20.00
15343. Justin (keehyu) 15 102.20 113.59 9 60.00
15344. kynght (kd1157) 15 83.49 102.90 4 26.67
15345. kchou (kchou0907) 15 73.20 87.02 0 0.00
15346. grace (katrvey) 15 81.41 95.61 2 13.33
15347. John (karmetier) 15 89.03 108.25 5 33.33
15348. Weeee (k1ngsman) 15 104.67 123.31 6 40.00
15349. Jão (jumamjir) 15 42.56 50.04 1 6.67
15350. jserv23 (jserv23) 15 106.71 115.91 9 60.00
15351. poopy (joyuri) 15 99.23 125.37 7 46.67
15352. Josh (joshcantypefast) 15 112.65 140.89 13 86.67
15353. qqingcheng! 3 (jorjoresp) 15 95.56 109.29 5 33.33
15354. josh (jojothebear03) 15 52.98 62.29 4 26.67
15355. Joe (joe_1) 15 114.15 128.02 9 60.00
15356. Joel (joelthesuperior) 15 128.21 150.94 6 40.00
15357. jlsyber (jlsyber) 15 84.90 98.26 6 40.00
15358. James (jlightning) 15 91.11 100.22 5 33.33
15359. Joshua (jkm711) 15 70.66 86.53 3 20.00
15360. Jim (jimvang8790) 15 72.70 79.05 4 26.67
15361. Logan (jimmybiscuit39) 15 56.25 68.32 3 20.00
15362. Jiezlin (jiezlin) 15 61.00 68.52 3 20.00
15363. jeshen (jeshencx) 15 78.43 93.04 4 26.67
15364. Jelmer (jelmerevers) 15 92.79 107.77 5 33.33
15365. Jamie (jelly_jam_pudding) 15 75.75 94.00 4 26.67
15366. Jeff (jeff_1107) 15 70.32 84.71 2 13.33
15367. Jay (jayl2303) 15 103.23 122.89 6 40.00
15368. BigJuicySlimy (javewave) 15 79.12 89.09 4 26.67
15369. Jason (jasonpike) 15 90.26 98.80 1 6.67
15370. poon (jamiepoon2003) 15 78.25 85.76 5 33.33
15371. James (jamesmz_101) 15 28.16 35.49 0 0.00
15372. JKerb (jakerb19) 15 77.43 97.77 5 33.33
15373. `jakeeee_ (jakee_) 15 99.94 123.41 7 46.67
15374. Long Double E.T. (jackje) 15 96.31 116.62 6 40.00
15375. not (j097) 15 70.68 86.55 3 20.00
15376. iStealCatNips (i_steal_cat_... 15 64.24 84.66 1 6.67
15377. Joey (itzjoeyz) 15 93.56 114.66 5 33.33
15378. Its (itslexemic) 15 61.72 75.78 10 66.67
15379. justin (itsjustinz) 15 81.80 94.75 6 40.00
15380. Brandon (itsbarn) 15 74.66 90.19 1 6.67
15381. John (ionas22) 15 33.56 38.67 2 13.33
15382. banana (intrepid_banana) 15 101.12 119.10 8 53.33
15383. Laughing Fox (inkeet) 15 73.61 82.93 6 40.00
15384. Its Me (infinityyt) 15 87.35 107.34 8 53.33
15385. Inactiv (inactivak) 15 93.55 105.06 4 26.67
15386. [SCC] Ignis (ignis_sphaera) 15 108.78 120.83 7 46.67
15387. Robby (icybot) 15 92.04 106.11 7 46.67
15388. Salvador (ick1salvado) 15 61.88 71.80 3 20.00
15389. iamyellowhead (iamyellowhead) 15 65.68 81.44 8 53.33
15390. H_24 (h_24) 15 81.80 105.70 3 20.00
15391. uy (hygienic) 15 74.20 81.17 1 6.67
15392. Howard (hwd15508) 15 113.25 134.39 11 73.33
15393. Nothing (humblepikachu) 15 76.59 94.32 7 46.67
15394. ben (hobomojo) 15 70.42 82.91 5 33.33
15395. d (hirundinidae) 15 122.08 138.62 12 80.00
15396. Abood (hirotto) 15 49.40 59.27 1 6.67
15397. Henry (henry88k) 15 67.03 76.77 3 20.00
15398. Henrricos (henrricos) 15 88.67 102.35 3 20.00
15399. henlojav (henlojav) 15 93.97 111.40 8 53.33
15400. Harrisandman (harrisandman) 15 66.27 81.69 8 53.33
15401. Hannah (hann5h) 15 138.88 157.75 10 66.67
15402. Jack (handsomejam) 15 100.79 114.51 6 40.00
15403. Haley (halllw) 15 59.10 72.13 6 40.00
15404. Habib (habibjajawie) 15 105.94 125.85 9 60.00
15405. h1b80xwl0g1c (h1b80xwl0g1c) 15 47.64 51.18 1 6.67
15406. Gustavo da Cruz (gustavodac... 15 94.93 123.27 6 40.00
15407. s (gurub) 15 78.41 109.93 5 33.33
15408. typingmonster (greenmonster... 15 95.78 107.97 8 53.33
15409. Vitor (graysheep) 15 54.52 69.52 1 6.67
15410. Jake (gooserman) 15 73.54 86.44 3 20.00
15411. Sishir (goon72) 15 83.65 88.36 4 26.67
15412. Cameron (goldenpenguin) 15 65.77 77.11 3 20.00
15413. giann (giannperez123) 15 115.00 124.24 7 46.67
15414. Bahador (ghostnod) 15 104.65 115.18 8 53.33
15415. Aasish (ghisingo) 15 48.12 56.37 6 40.00
15416. Siegward (ghin) 15 91.20 112.18 13 86.67
15417. Marius (ghebu) 15 107.31 131.63 9 60.00
15418. Genius (genius0teacher) 15 49.32 63.60 12 80.00
15419. Meagan (gazzoo) 15 103.96 129.02 8 53.33
15420. peepee (gamerlegion) 15 97.55 112.48 8 53.33
15421. Gabriel (gabrielvi111) 15 69.87 80.28 1 6.67
15422. Xuan Thong (fxcvs) 15 59.27 71.21 6 40.00
15423. funss (funss) 15 71.61 85.11 1 6.67
15424. Funday (funday11best) 15 71.79 87.42 12 80.00
15425. Fudl (fudl) 15 53.11 65.49 2 13.33
15426. veryfatman (frankknight23) 15 84.06 101.27 5 33.33
15427. Forehead (foreheadq) 15 81.56 96.02 7 46.67
15428. flashy (flashy1996) 15 80.60 90.19 6 40.00
15429. J (fingerbanger96) 15 64.86 75.83 6 40.00
15430. Matyi (filepmatyi) 15 71.40 83.46 3 20.00
15431. Madi (fastcoder05) 15 47.12 53.16 0 0.00
15432. farzi (farzi) 15 27.95 33.76 0 0.00
15433. J (falsekrakk808) 15 101.84 119.18 7 46.67
15434. sasd (fallenlarry) 15 84.76 104.10 7 46.67
15435. Faizan Ali (faizanii) 15 45.20 58.41 2 13.33
15436. facenne (facenne) 15 92.64 110.25 7 46.67
15437. Ezektor (ezecktor) 15 91.70 110.60 4 26.67
15438. Exab (exab) 15 54.28 65.26 6 40.00
15439. Evan (evang12) 15 108.35 127.03 6 40.00
15440. Juhair (error6251) 15 58.40 64.62 0 0.00
15441. Erekle (erekle7) 15 53.75 63.12 1 6.67
15442. Tran (envyriviere) 15 83.63 91.60 3 20.00
15443. ben (enivre) 15 57.54 73.46 2 13.33
15444. Paula (ems1324) 15 51.61 59.01 4 26.67
15445. emre (emrevlog) 15 72.35 82.38 4 26.67
15446. Matthew (emen_) 15 79.66 96.68 14 93.33
15447. ElVash (elvash) 15 72.27 86.84 6 40.00
15448. good (elquines4) 15 104.31 127.97 7 46.67
15449. Ellie (ellie_mp3) 15 57.09 65.26 1 6.67
15450. Lise (elishevah) 15 91.86 104.53 9 60.00
15451. Eli (elijahbu) 15 86.67 97.68 5 33.33
15452. Elgrekost (elgrekost) 15 68.17 81.63 13 86.67
15453. elaine (elainezhu) 15 117.72 130.56 10 66.67
15454. Ethan (ecannoy) 15 105.65 115.28 8 53.33
15455. aurora (e4monn) 15 114.26 132.85 11 73.33
15456. drew (drewg2009) 15 87.41 103.29 5 33.33
15457. DreamCat04 (dreamcat04) 15 43.47 50.37 3 20.00
15458. dbarr (drbarr) 15 44.04 52.90 2 13.33
15459. Vincent (doogley) 15 56.90 64.03 5 33.33
15460. Ali (donlafi) 15 57.18 62.64 3 20.00
15461. I really like lettuce (domi... 15 99.42 117.13 8 53.33
15462. dom (domaniquepham) 15 79.52 96.00 6 40.00
15463. Eddie (diettea) 15 93.84 122.22 4 26.67
15464. Geraldine (dendenmuushi) 15 40.23 49.05 1 6.67
15465. Dankman (dedankman) 15 99.76 112.53 5 33.33
15466. Davis (davis10) 15 61.09 76.07 4 26.67
15467. David (davidliu323) 15 117.62 135.93 7 46.67
15468. tstats[darkhat13] (darkhat13) 15 91.96 114.60 6 40.00
15469. dapho (dapho) 15 73.07 98.05 12 80.00
15470. Daniel (danrike22) 15 58.88 70.13 0 0.00
15471. Dan (dankarnus) 15 67.82 79.85 2 13.33
15472. Dawid (dadik) 15 64.35 75.96 5 33.33
15473. Daniel (d4mage2k) 15 94.12 108.68 9 60.00
15474. Ethan (creamycanoli) 15 98.92 126.26 6 40.00
15475. Peter (crazynumnums) 15 95.17 109.38 9 60.00
15476. Chris (craastad) 15 82.01 93.16 4 26.67
15477. Konrad (cornyflakez) 15 93.88 105.85 8 53.33
15478. Matías (colocolo91) 15 85.24 94.37 4 26.67
15479. Thomas (coasterman) 15 86.46 100.56 5 33.33
15480. sheik (clubs_) 15 82.29 104.20 7 46.67
15481. Alex (citricdolphin) 15 102.34 115.84 7 46.67
15482. christian (chriz411) 15 85.72 97.46 6 40.00
15483. Christian (christian_oudard) 15 98.57 117.46 6 40.00
15484. Chinsetgel (chinsetgel_mgl_3) 15 62.89 72.51 1 6.67
15485. Chili (chilichonga) 15 63.67 73.30 2 13.33
15486. Caine (cainegt) 15 78.83 88.48 3 20.00
15487. Ivan (cactus9800) 15 47.98 53.65 0 0.00
15488. Meme Page (butsuky) 15 106.06 117.46 11 73.33
15489. B (btype123) 15 121.53 135.16 10 66.67
15490. Bryan (bryan675) 15 123.99 145.33 12 80.00
15491. Bruno (brunokoppel) 15 76.52 94.22 5 33.33
15492. Bruh (bruh432) 15 104.37 117.80 9 60.00
15493. brainuser5705 (brainuser5705) 15 89.72 101.72 4 26.67
15494. Ash (boyfromindia) 15 69.88 88.55 7 46.67
15495. E (boxofpaints) 15 68.84 73.20 6 40.00
15496. Joe (bot_joe) 15 85.22 92.19 4 26.67
15497. BobTuring (bobturing) 15 81.43 106.07 10 66.67
15498. Bob (bobtyping) 15 78.09 83.84 2 13.33
15499. Black (blackt) 15 63.33 69.68 7 46.67
15500. chan (blackstarnova) 15 119.99 136.45 11 73.33
15501. Krissz (bish1k) 15 91.64 102.81 5 33.33
15502. Bean (benchen123) 15 91.31 101.10 7 46.67
15503. bella (beliss08) 15 55.47 63.96 1 6.67
15504. bee (bee0) 15 112.76 138.95 14 93.33
15505. bart (bartfart) 15 84.88 92.08 3 20.00
15506. bantan (bantan) 15 94.79 103.12 9 60.00
15507. AJ (bacon_is_life) 15 89.07 102.50 6 40.00
15508. Jacob (a_cheesy_wotsit) 15 85.86 114.16 5 33.33
15509. Aztixz (aztix) 15 71.04 79.30 4 26.67
15510. ayumu (ayumuxe) 15 82.22 94.62 12 80.00
15511. Alex (aymlus) 15 91.36 105.05 6 40.00
15512. Sean (axelsandrods) 15 64.69 78.91 4 26.67
15513. awalvie (awalvie) 15 80.32 94.93 4 26.67
15514. Asif ur rahman (asif_ur_rah... 15 44.83 56.60 2 13.33
15515. Rimuru (ashborn_tempest) 15 75.66 88.56 3 20.00
15516. Chris (aschlar) 15 88.09 119.53 3 20.00
15517. Arzenith (arzou) 15 75.16 91.02 9 60.00
15518. Aria (aria_3_) 15 51.16 65.06 3 20.00
15519. Arian (ariankazemi) 15 35.99 40.97 0 0.00
15520. arachnodactyly (arachnodact... 15 72.91 82.82 0 0.00
15521. Chris (angoril) 15 56.82 67.46 4 26.67
15522. Ele (anemoia) 15 105.68 119.62 5 33.33
15523. Anel (anelbeads) 15 87.26 104.19 6 40.00
15524. André (andrepascoa) 15 102.35 111.19 8 53.33
15525. Anna (ana2007) 15 49.25 60.41 2 13.33
15526. Amr (amrstien) 15 63.08 74.55 3 20.00
15527. Ameen (ameen_a21) 15 66.31 80.24 2 13.33
15528. LolipopAlexx (amazingskep_1) 15 63.89 75.35 3 20.00
15529. AL1 (al1_16) 15 93.96 109.87 5 33.33
15530. Akshy (akshy) 15 67.30 81.54 5 33.33
15531. AjTopper (ajtopper) 15 40.19 47.31 0 0.00
15532. AJamal31 (ajamal31) 15 79.43 107.30 5 33.33
15533. austin (aiven) 15 72.52 79.62 5 33.33
15534. Aidan (aidanmccomsey) 15 108.00 129.23 6 40.00
15535. joe (aidanbbm) 15 59.08 72.05 0 0.00
15536. yan (ahugedistraction) 15 88.51 104.30 7 46.67
15537. Aeiphera (aeiphera) 15 107.33 120.90 6 40.00
15538. Adam (adamrocks21) 15 56.67 62.33 2 13.33
15539. Abu (abushakeeb) 15 93.99 108.19 5 33.33
15540. Abe (abefqy) 15 83.74 116.82 6 40.00
15541. Abdul Rafay (abdulpak) 15 39.64 47.44 2 13.33
15542. Eric (20wpmboi) 15 63.31 74.55 3 20.00
15543. Free Israel (1ocaltechsuppor1) 15 44.28 50.02 2 13.33
15544. Gabe (115162382) 15 91.64 105.36 7 46.67
15545. LilJabari (yesitsngo) 15 54.56 65.41 2 13.33
15546. Sorrow (sorrow_da) 15 45.86 57.47 3 20.00
15547. Julius (jus_kidding) 15 57.31 73.38 2 13.33
15548. Brian (brianprs) 15 85.49 98.13 4 26.67
15549. Gandalf (gandalfthefast) 15 58.89 68.53 2 13.33
15550. Loan (loanvx) 15 96.33 120.43 5 33.33
15551. Adam (ska_) 15 81.42 92.89 3 20.00
15552. Nymeria (nymeria37) 15 93.15 114.05 4 26.67
15553. David (completedark) 15 84.33 95.74 9 60.00
15554. Zalabany (zalabany) 15 41.47 51.35 1 6.67
15555. Yo (yo111) 15 60.15 75.55 4 26.67
15556. Sam (samr7x7) 15 83.72 95.19 8 53.33
15557. Rohit (roohitdagar) 15 40.60 48.06 1 6.67
15558. 近平 (trash_game) 15 34.56 40.11 0 0.00
15559. Jul (happypig2) 15 87.95 104.04 5 33.33
15560. Dr.Gliscor (drgliscor) 15 56.98 70.53 13 86.67
15561. ketchup (rawmeatball) 15 104.41 128.96 8 53.33
15562. captain (fegit) 15 82.87 93.20 3 20.00
15563. VixenxD (vixenxd) 15 77.80 96.27 5 33.33
15564. David (chopstick88) 15 73.01 96.13 2 13.33
15565. josef (cthulhuz) 15 83.08 100.72 7 46.67
15566. Matthew (mattscabrera) 15 106.64 129.01 9 60.00
15567. irfan (irfankia) 15 44.50 59.88 7 46.67
15568. Maddie (massivetrash) 15 73.08 91.05 7 46.67
15569. Abass (abassali092) 15 52.64 62.25 3 20.00
15570. Ollie (sherwoodoj) 15 77.47 96.15 3 20.00
15571. Wenexx (wenexx) 15 75.70 100.13 5 33.33
15572. Kipen (kipenjago) 15 68.28 78.18 7 46.67
15573. Dhia (dhiadbh) 15 43.25 57.90 1 6.67
15574. jlordo (jlordo) 15 91.36 105.98 5 33.33
15575. Oscar (kull) 15 49.25 58.74 2 13.33
15576. Laurence (beala_) 15 40.10 51.53 0 0.00
15577. Andrew (andrew_00) 15 76.24 89.18 4 26.67
15578. Hanan (sourc) 15 76.75 87.11 5 33.33
15579. tstats[blosh] (blosh) 15 65.98 76.73 5 33.33
15580. Adam (secondbesttyper) 15 70.73 83.60 6 40.00
15581. Neil (bruvm8) 15 46.67 59.07 1 6.67
15582. Hadouken (hadouken37) 15 94.57 110.70 7 46.67
15583. Johnnyphan2009 (johnnyphan) 15 89.22 104.70 1 6.67
15584. Vaibhav (kabir4991) 15 75.90 85.32 2 13.33
15585. karim (karim32ar3) 15 67.61 80.26 0 0.00
15586. Christopher (chubbzlyfe) 15 64.43 84.13 1 6.67
15587. Mika (69ftlongshlong) 15 44.10 52.01 0 0.00
15588. Rajat (rajat_maurya) 15 87.12 99.11 6 40.00
15589. Hưng (whathe) 15 46.55 58.50 2 13.33
15590. puggichu (puggichu) 15 78.40 91.69 5 33.33
15591. friggy (friggy0000) 15 49.48 63.96 1 6.67
15592. David (tracreed) 15 71.92 88.55 6 40.00
15593. Samuel (sgpthomas) 15 90.99 111.34 1 6.67
15594. cmc (codemastercpp) 15 76.92 91.39 4 26.67
15595. Aryaman (typist1027) 15 82.26 93.37 8 53.33
15596. Samuel (sammm274) 15 71.21 87.09 1 6.67
15597. Azim (khalilovdev) 15 35.10 39.14 9 60.00
15598. Vincenzo (_a_j_) 15 38.26 45.20 3 20.00
15599. bassic (sakshambassi) 15 48.62 58.19 3 20.00
15600. demonphase (ebullience) 15 68.29 82.12 1 6.67
15601. .-. (peoplemaypee) 15 46.37 54.10 6 40.00
15602. char (wormgirl) 15 80.66 98.03 6 40.00
15603. D (derniee) 15 85.10 93.35 5 33.33
15604. Thuuuuuun (thundertsun1) 15 89.71 109.70 4 26.67
15605. Spect (spect3d) 15 81.93 101.63 6 40.00
15606. Raven (raven_wong) 15 44.67 52.78 2 13.33
15607. No (lexblaster) 15 30.53 34.76 1 6.67
15608. Bhavita Pareshbhai Nakum (b... 15 60.77 84.95 3 20.00
15609. Betsy (tiddy8bricks) 15 56.51 65.37 3 20.00
15610. Mike (plane_crash) 15 52.82 62.14 0 0.00
15611. poli team! (politeam) 15 49.32 60.31 0 0.00
15612. sdmlkdasm (kilcklack) 15 45.60 49.95 0 0.00
15613. Daryl (lyradd) 15 69.91 94.68 4 26.67
15614. Davide Antonio (tamah11) 15 77.11 88.61 6 40.00
15615. Tren (_tren) 14 76.78 89.28 4 28.57
15616. Rishi (_slow_typer) 14 72.26 87.07 3 21.43
15617. zreem (zreem) 14 57.46 90.96 0 0.00
15618. Zoe (zoi77) 14 79.36 98.83 4 28.57
15619. slow stinky balls (znerwill... 14 118.18 127.84 4 28.57
15620. Zhavokhir (zhav0kh1r) 14 59.14 74.62 8 57.14
15621. Zeraphim (zeraphim) 14 97.74 109.31 3 21.43
15622. Zephyr (zephyrkai) 14 111.48 121.24 8 57.14
15623. Zachary (zachary3352) 14 102.65 119.61 9 64.29
15624. yal (yyal) 14 95.71 118.89 6 42.86
15625. Yousef (yusopro) 14 64.35 69.72 7 50.00
15626. PeteJai (yupuiho) 14 47.47 57.47 0 0.00
15627. Justin (yummy_spin05) 14 58.51 67.48 2 14.29
15628. *You're (yourmumlikesmytyping) 14 49.49 57.54 0 0.00
15629. Nikki (yip14) 14 47.61 52.15 2 14.29
15630. QLONA 🥵 (yeyas) 14 100.86 126.92 5 35.71
15631. Jordan White (yepple_) 14 67.86 86.94 4 28.57
15632. Ossi (xyeet) 14 123.84 138.78 8 57.14
15633. Charles (xx_white_racer_xx) 14 102.21 117.92 6 42.86
15634. Adam (xuxiym) 14 134.62 158.63 12 85.71
15635. juicebox (xsolstice) 14 93.83 111.36 4 28.57
15636. xinhui (xinhuixu) 14 46.69 50.57 4 28.57
15637. bigman (xdbigman) 14 73.82 86.91 7 50.00
15638. Jast (xcess0000) 14 34.88 44.40 3 21.43
15639. Kael (wshuwshuwshi) 14 87.19 97.01 4 28.57
15640. wRadion (wradion) 14 109.63 129.61 6 42.86
15641. Wonder (wonderjaxe) 14 49.60 60.57 1 7.14
15642. XOR_ (wisetoad) 14 96.52 114.87 7 50.00
15643. willy (willywongker69) 14 86.17 99.23 3 21.43
15644. WIll (wiillikeer) 14 62.54 70.44 12 85.71
15645. whuwxl (whuwxl) 14 55.27 60.98 2 14.29
15646. wantingpawer (wantingpawer) 14 100.81 120.30 8 57.14
15647. vylnf (vylnf213) 14 48.07 53.60 0 0.00
15648. Cary Zhang (vrozone) 14 99.06 120.67 8 57.14
15649. Hasibuan (voyager28) 14 63.01 75.61 4 28.57
15650. Ray (viruz789) 14 110.02 125.55 7 50.00
15651. Virgin (virginchimp) 14 114.37 147.02 7 50.00
15652. Vidhu Shikhar (vidhu_joshi) 14 61.65 76.79 3 21.43
15653. Jodye (vice_pat) 14 63.09 73.20 3 21.43
15654. vincentius (vgpabm) 14 71.35 83.20 11 78.57
15655. Vernnamae (vernnamae03) 14 50.54 54.91 1 7.14
15656. Allergic to (vanillahamster) 14 86.93 111.93 7 50.00
15657. Van (vanberen) 14 71.18 81.55 6 42.86
15658. kevin (uwupork) 14 96.23 113.88 8 57.14
15659. typist (typist149) 14 53.22 64.25 1 7.14
15660. Diana (typinglover1023) 14 102.98 116.39 8 57.14
15661. Tom (twrig144) 14 89.38 106.46 5 35.71
15662. Two (two_toned_69) 14 50.63 57.31 1 7.14
15663. Trent (twesley20) 14 75.89 82.77 3 21.43
15664. Charlotte (truest) 14 86.75 101.72 5 35.71
15665. TripleMean (triplemean) 14 86.48 101.66 8 57.14
15666. 12Ethan! (towelette) 14 93.09 110.14 4 28.57
15667. Heh (tophatheh) 14 76.65 85.82 3 21.43
15668. Tom (tomshilling) 14 76.63 100.33 3 21.43
15669. Tommy (tom441) 14 95.61 107.77 5 35.71
15670. cock and (tmolls312) 14 83.03 94.81 8 57.14
15671. Timothy (timothylee) 14 99.48 112.05 5 35.71
15672. Tilly (tilly14) 14 72.96 88.14 2 14.29
15673. Karta (thundermoon_911) 14 73.09 85.37 3 21.43
15674. Ron (thtguyovrthr) 14 104.14 115.39 7 50.00
15675. Cody (thoutravesty) 14 68.71 78.42 3 21.43
15676. Thomas (thms_andrsn) 14 56.36 66.63 3 21.43
15677. NongKao (thisiskao09) 14 44.60 51.80 2 14.29
15678. the ayo (the_one_and_only_l... 14 64.11 77.97 5 35.71
15679. Simo (thespeedoflight) 14 106.75 121.83 8 57.14
15680. David (thedaveed) 14 102.28 124.43 10 71.43
15681. Alberto (thearod5) 14 78.16 93.92 4 28.57
15682. Kai (testphylean) 14 100.26 115.06 6 42.86
15683. Nikolaus (testingcolemak) 14 66.27 78.24 3 21.43
15684. bob (termina_112) 14 68.97 84.76 8 57.14
15685. Terence (terence1234567) 14 91.78 104.61 6 42.86
15686. John (tempocount) 14 110.37 126.93 6 42.86
15687. Technetium (technetium_) 14 80.34 91.89 5 35.71
15688. Harry (taytayalldaytay) 14 77.81 88.24 4 28.57
15689. Taxx (taxx) 14 114.07 133.41 5 35.71
15690. Tahbro (tahbro) 14 86.22 100.23 5 35.71
15691. Taco Master (taco989) 14 61.70 69.95 5 35.71
15692. Jasper (t3sted) 14 78.18 99.78 6 42.86
15693. t2fast4u (t2fast4u) 14 97.10 122.86 4 28.57
15694. Shynggyskhan (s_bazarbay) 14 70.05 77.31 4 28.57
15695. syrianii (syrianii) 14 67.35 77.07 2 14.29
15696. Sung (sungsangthesong) 14 106.71 125.27 14 100.00
15697. guy (submer) 14 111.35 133.03 5 35.71
15698. Kirk (lil_laker) 14 48.06 61.15 3 21.43
15699. gautam (stupendous_man) 14 38.02 41.02 0 0.00
15700. stuff423 (stuff423) 14 112.26 126.77 4 28.57
15701. Sawyer (stmcpherso) 14 68.11 73.44 6 42.86
15702. G (squasy) 14 92.04 106.02 3 21.43
15703. Ava (spyder_) 14 56.80 71.70 1 7.14
15704. Speeder (speeder99) 14 37.87 52.96 0 0.00
15705. A (spectre_zero) 14 61.60 70.94 2 14.29
15706. SPACE (spacegamer428) 14 44.58 54.05 2 14.29
15707. Sour (sourbar) 14 55.71 64.40 2 14.29
15708. Mitheelesh (sophomania2803) 14 80.41 91.65 7 50.00
15709. cheruiyot (son_of_man) 14 106.46 122.63 3 21.43
15710. Burger (somental) 14 63.74 75.80 2 14.29
15711. Solo (solohan) 14 68.50 78.24 6 42.86
15712. Simon (soinom) 14 67.45 75.51 7 50.00
15713. Rahul (snickrdodle) 14 60.65 76.71 1 7.14
15714. Lenni (smoldepressedboi) 14 61.48 68.65 1 7.14
15715. Typing (slow_seizure_man) 14 55.44 70.04 3 21.43
15716. Ben (slouchingstork) 14 60.58 65.30 2 14.29
15717. chillin (slekap) 14 177.62 218.43 10 71.43
15718. sleepy (sleeeepy_) 14 62.11 67.65 3 21.43
15719. Slavic (slavicfedora) 14 102.69 124.13 3 21.43
15720. A (sir_riot) 14 84.64 97.03 11 78.57
15721. Isabella (sinnamonroll21) 14 92.31 106.18 6 42.86
15722. Harpreet (singh_is_king) 14 31.42 38.05 1 7.14
15723. Smaran (simpilly05) 14 67.30 83.22 3 21.43
15724. 真好玩 (simonhre) 14 69.57 81.40 3 21.43
15725. David (sidrid) 14 50.50 58.78 1 7.14
15726. shubham (shubham0007) 14 82.99 97.02 2 14.29
15727. Shubhi (shoebee) 14 65.59 79.00 6 42.86
15728. deadend (shiroku) 14 118.13 133.33 9 64.29
15729. Mister (shiriou) 14 109.13 138.23 9 64.29
15730. Mouse (shenx) 14 102.50 113.12 8 57.14
15731. harold (sha_man) 14 47.99 53.10 1 7.14
15732. Shannen (shannen_04) 14 95.97 107.94 6 42.86
15733. shakk (shakk612) 14 79.95 97.70 5 35.71
15734. Slow мΘşħΞ alt (shadow... 14 113.60 133.21 9 64.29
15735. Donn (seabase) 14 39.38 50.03 0 0.00
15736. Dustin (sdustink) 14 87.17 100.05 7 50.00
15737. sdatta (sdatta) 14 73.40 86.28 3 21.43
15738. . (scorae) 14 70.57 82.44 2 14.29
15739. gamig (schleepy_boye) 14 68.88 82.06 2 14.29
15740. Savv (savvey) 14 64.75 70.45 2 14.29
15741. samy (samy_) 14 63.38 70.66 2 14.29
15742. Salad (saladspoon) 14 90.99 102.84 6 42.86
15743. Saj (saji652) 14 74.08 88.00 2 14.29
15744. Safwan (safwanislam111) 14 73.17 80.91 3 21.43
15745. saba (saba_on_mentos) 14 51.83 66.27 1 7.14
15746. Saad (saad_mohammed7) 14 67.24 81.95 4 28.57
15747. Saad Ahmed (saadahmed12858) 14 55.57 63.93 2 14.29
15748. Will (r_u_sure) 14 101.49 113.88 5 35.71
15749. Ryusei (ryu_525) 14 52.54 63.11 2 14.29
15750. SheLuvRui (rushabh161) 14 109.39 118.57 7 50.00
15751. rachel (rsimonton94) 14 97.15 114.78 4 28.57
15752. rozetina (rozetina) 14 108.46 139.41 7 50.00
15753. Roman (romaje_) 14 97.81 116.62 7 50.00
15754. Roi (roi1255) 14 62.42 69.74 3 21.43
15755. Robin (robaxtom) 14 74.03 86.61 5 35.71
15756. RIJU (rijuthetyper) 14 65.82 74.91 4 28.57
15757. Ryan (ricenoodles01) 14 88.75 125.63 4 28.57
15758. Rexoblob (rexoblob) 14 76.75 85.95 2 14.29
15759. rengmain (rengmain) 14 111.67 129.03 13 92.86
15760. itypeforbyron (remez) 14 82.84 95.44 2 14.29
15761. Reigina (reiginayari) 14 88.49 105.06 4 28.57
15762. Redsteel (redsteel87) 14 83.25 105.24 2 14.29
15763. Alex (rednaxt) 14 114.07 129.29 4 28.57
15764. Caal (recumbent) 14 84.11 97.48 2 14.29
15765. rdx (rdxx) 14 78.69 89.55 5 35.71
15766. Raphael (razmataz99) 14 125.46 168.56 6 42.86
15767. raymond (raymondrazer) 14 88.26 107.88 3 21.43
15768. ray16k (ray16k) 14 133.09 146.29 10 71.43
15769. Jona (ravioli_cheesecake12) 14 59.96 72.73 0 0.00
15770. Rany (rany_games) 14 61.27 76.12 6 42.86
15771. ramennoodles924 (ramennoodl... 14 87.19 108.40 3 21.43
15772. reactor2 (rakesh_singh) 14 89.36 105.61 6 42.86
15773. tstats[rajendra_thakur] (ra... 14 51.62 60.27 0 0.00
15774. rk2699 (radhu) 14 74.04 87.00 2 14.29
15775. Michael (raczcar) 14 92.98 110.39 6 42.86
15776. Yeji (racket_21) 14 58.69 68.31 4 28.57
15777. Patrick (pzuknome) 14 123.80 140.23 6 42.86
15778. Puymieyches (puymieyches) 14 82.23 94.20 3 21.43
15779. Iliyan (proto0o) 14 82.64 93.69 3 21.43
15780. praxZ (praxz) 14 114.30 131.11 6 42.86
15781. Mae (practice_type) 14 60.75 71.19 2 14.29
15782. ptt (potatodogg) 14 111.20 126.51 8 57.14
15783. Logan (postlogan) 14 90.57 109.04 6 42.86
15784. Nameless (plot_da_pro) 14 56.55 66.67 8 57.14
15785. Phle (plegethas) 14 67.05 73.91 1 7.14
15786. Mike (pit820) 14 81.30 101.90 7 50.00
15787. Pidguit (pidguit) 14 97.23 112.03 5 35.71
15788. TypeBot (phycer) 14 96.91 110.97 5 35.71
15789. Martynas (peepeeman42069) 14 81.81 94.51 10 71.43
15790. Pana (pana_miguel) 14 83.27 100.01 5 35.71
15791. paco (pacowaco) 14 73.40 80.99 8 57.14
15792. i cant type (o_o_f) 14 110.28 136.86 8 57.14
15793. Clicky (ottoble) 14 66.75 77.79 1 7.14
15794. James (otes10) 14 63.36 71.53 1 7.14
15795. Will (orketscience) 14 40.16 45.21 0 0.00
15796. Justin (orccrusher99) 14 75.25 91.81 1 7.14
15797. hayde (oofba) 14 101.40 118.87 8 57.14
15798. Omkar (omkardalvi001) 14 67.06 77.26 1 7.14
15799. hi (notarock) 14 115.21 130.38 8 57.14
15800. ammu (notammu) 14 47.38 57.88 3 21.43
15801. Josh (nocase) 14 113.17 139.80 11 78.57
15802. Njord (njord19) 14 78.34 95.75 4 28.57
15803. Nithin (nithinsanjey) 14 50.56 64.28 1 7.14
15804. Jaynul A (nishatme) 14 61.26 70.82 2 14.29
15805. Lightning (nirajp) 14 100.45 109.62 5 35.71
15806. Nina (nina_lopes) 14 52.60 60.17 6 42.86
15807. skye (nilumi) 14 39.38 47.23 1 7.14
15808. Luffy (niloy2k76) 14 78.09 88.07 5 35.71
15809. Nicholas (nikorosu) 14 55.40 62.39 2 14.29
15810. Niftski (niftski) 14 88.78 109.74 9 64.29
15811. neromantic (neromantic) 14 77.85 89.09 4 28.57
15812. Mukhtar (nejaiski) 14 55.15 66.18 3 21.43
15813. Sophia (need_to_run) 14 59.29 64.64 0 0.00
15814. Rupesh (nedlog_rupesh) 14 79.13 94.25 5 35.71
15815. Antonin (nebula__) 14 58.78 70.98 6 42.86
15816. nazmush (nazmushsayadat) 14 58.33 70.14 0 0.00
15817. Mew (mw46) 14 117.57 137.64 6 42.86
15818. Muhsin (muhsinaldoori) 14 59.73 73.30 3 21.43
15819. Muffin™ (muffintm) 14 77.50 100.88 7 50.00
15820. Tristan (muffinheadtris) 14 40.88 51.95 1 7.14
15821. mt (mtutunchi) 14 83.66 93.01 6 42.86
15822. Guus (mr_leepel_) 14 92.55 102.57 7 50.00
15823. david (mrriceeater) 14 104.43 123.95 5 35.71
15824. Shahaf (mrpoopydoopy) 14 64.61 77.15 5 35.71
15825. Mr.John (mrjohnwick) 14 55.90 67.63 5 35.71
15826. Moulik (morocks) 14 98.58 116.77 2 14.29
15827. Mooles (mooles) 14 125.42 139.39 10 71.43
15828. Mohit Justin (mohitjustintudu) 14 39.29 51.02 2 14.29
15829. Jeremy (mlgquikscopebruh) 14 92.87 127.49 6 42.86
15830. Victor (mlad) 14 50.85 56.38 0 0.00
15831. Mihai (mizaqe) 14 54.08 62.61 1 7.14
15832. Mitchel (mitchthebaker) 14 99.07 116.95 7 50.00
15833. Mipsy (mipsytheblue) 14 88.80 122.57 11 78.57
15834. Miguel (miguel_leadersarena) 14 60.34 71.96 0 0.00
15835. midayis (midayis) 14 56.77 80.76 4 28.57
15836. Matthew Froehlick (mfro) 14 61.93 75.36 4 28.57
15837. Meysam (meysam1231) 14 65.09 77.31 3 21.43
15838. McNeal (mcnealgwapo) 14 68.96 76.62 3 21.43
15839. Max (maxshaw2411) 14 90.36 102.70 12 85.71
15840. Matt (mattsmouse) 14 93.27 118.31 4 28.57
15841. Matthew (matthewarous) 14 129.84 147.29 14 100.00
15842. Massimo (massir) 14 86.64 95.87 2 14.29
15843. Blade_s0567 (mar_s) 14 63.03 77.25 3 21.43
15844. 1ntellectualL10n (martinledl) 14 79.86 88.19 6 42.86
15845. Fardin (manzif) 14 89.81 102.34 8 57.14
15846. manstick (manstick) 14 90.01 107.53 5 35.71
15847. Maluck (maluck) 14 72.39 83.91 3 21.43
15848. Mahmoud (mahmoud_12) 14 38.67 42.95 3 21.43
15849. Mahbub (mahbubdev) 14 44.72 54.29 0 0.00
15850. Mystik (magic_mystik) 14 64.77 77.07 6 42.86
15851. mafia (mafia207) 14 59.16 74.02 3 21.43
15852. Mac (macthemountain) 14 91.45 115.08 8 57.14
15853. Μάξιμε (macmo) 14 117.70 129.27 8 57.14
15854. Luminious (luminious) 14 81.70 95.13 2 14.29
15855. Luke (lukechevy) 14 74.96 84.94 2 14.29
15856. j (luckyslayer) 14 73.99 88.54 3 21.43
15857. LubO_o (lub0_o) 14 69.39 84.07 6 42.86
15858. Lokyin (lqkii) 14 109.93 138.81 4 28.57
15859. Aryan (lost_arrow) 14 72.18 85.15 1 7.14
15860. JR (lordjoshyy) 14 95.84 103.61 4 28.57
15861. Cookrieme (lonarexiz) 14 80.97 93.41 5 35.71
15862. Slobky (lmaoxdlolrofl) 14 101.04 121.76 5 35.71
15863. decadent movement (lkmatter) 14 58.77 64.66 1 7.14
15864. Sticky (littletea) 14 48.50 56.36 3 21.43
15865. lil_lobster (lil_lobster) 14 67.79 75.32 2 14.29
15866. Likkon (likkon_maddik) 14 71.25 84.31 6 42.86
15867. Lik (lik007) 14 60.87 76.98 5 35.71
15868. levani (levanacixo) 14 91.47 105.73 7 50.00
15869. Eric (leftlaneeric) 14 88.77 100.43 12 85.71
15870. jonathon (laptoptouchpad) 14 67.78 82.46 0 0.00
15871. Landi (landiepileptic) 14 54.14 71.27 1 7.14
15872. Cait (lamby17_) 14 76.32 85.02 4 28.57
15873. Jake (lakejund) 14 105.65 126.08 6 42.86
15874. Jatin (kumar_jatin) 14 67.55 80.78 3 21.43
15875. Krish (krish2882005) 14 63.16 81.51 4 28.57
15876. David (koreanboy) 14 93.21 115.90 3 21.43
15877. Kirtaph (kirtaph) 14 88.96 115.18 4 28.57
15878. Ryan (kingdr) 14 59.28 75.19 4 28.57
15879. Alec (killjoy722) 14 78.62 93.61 4 28.57
15880. Kifah (kifahthespartan) 14 62.14 78.34 2 14.29
15881. Eric (keywe) 14 79.62 89.57 5 35.71
15882. Tomek (kemor) 14 86.48 105.26 4 28.57
15883. Keks (keksfromnextdoor) 14 61.15 67.80 4 28.57
15884. . (keelanlambert) 14 57.97 69.44 5 35.71
15885. Rai (kaythox) 14 108.80 125.70 5 35.71
15886. nunya (karlremarks) 14 72.62 83.55 5 35.71
15887. Johnny (k5kk) 14 108.05 142.62 9 64.29
15888. Bektas (k1ngst0ne) 14 59.36 75.37 3 21.43
15889. Samuel (justanotherasianont... 14 80.28 96.12 5 35.71
15890. junior (junior2000) 14 55.89 67.02 4 28.57
15891. jono (jonohubbard) 14 76.53 95.38 5 35.71
15892. Jon (jonnylauws) 14 97.47 104.53 4 28.57
15893. Jon (jon56) 14 82.22 98.58 7 50.00
15894. John (johnphan05) 14 125.54 144.56 8 57.14
15895. joe (joe_mam101) 14 59.72 72.27 3 21.43
15896. Joe (joe_exotic6969) 14 63.03 72.57 1 7.14
15897. Joey (joeykuo) 14 57.56 70.30 6 42.86
15898. Jman (jkarlik22) 14 55.97 81.36 3 21.43
15899. jjpjimmy (jjpjimmy) 14 81.21 98.59 6 42.86
15900. jithin (jithinjoseph) 14 58.77 69.50 0 0.00
15901. Jim (jimnguyen) 14 82.57 97.80 5 35.71
15902. Rohith (jikki) 14 55.79 67.63 4 28.57
15903. Jerwin (jherwynne) 14 72.08 87.29 3 21.43
15904. JD (jhaaydee) 14 49.85 62.89 1 7.14
15905. Imponed (jg814867) 14 74.24 88.90 3 21.43
15906. JeiJei (jemjem09) 14 62.75 77.99 4 28.57
15907. Jeffrey (jeffreyfeng) 14 95.86 115.79 5 35.71
15908. Harry (jeeeerrrpop) 14 75.51 87.90 8 57.14
15909. joshua (jawwshuaa) 14 99.68 116.47 6 42.86
15910. Daniel (jansson) 14 93.31 105.69 6 42.86
15911. James (jamessmurray) 14 53.53 60.11 1 7.14
15912. James (james494) 14 101.46 112.99 8 57.14
15913. Jakaria (jakaria_sami) 14 56.63 67.65 5 35.71
15914. Barrett (jahspp) 14 70.88 81.45 4 28.57
15915. Jacob (jacob643) 14 81.61 90.57 4 28.57
15916. Isak (izzeww) 14 92.16 108.62 5 35.71
15917. Elias (itzner) 14 45.04 59.21 3 21.43
15918. deydey (iskalaberkberk0427) 14 76.94 88.34 4 28.57
15919. iron (iron_pickaxe) 14 75.68 90.47 3 21.43
15920. Nhaatj (iopaosi) 14 50.82 77.90 2 14.29
15921. qwq (iomeow) 14 47.47 51.77 0 0.00
15922. Simon (imp4l3r) 14 94.41 121.23 7 50.00
15923. kian (imkian) 14 56.82 63.34 0 0.00
15924. impostor (ilikepotatoesixty... 14 92.50 103.50 3 21.43
15925. Igor (ikarus9393) 14 88.52 100.84 5 35.71
15926. ignatius (ig_gy) 14 57.48 66.97 1 7.14
15927. Hugi (hugi97) 14 89.28 100.07 5 35.71
15928. Kai (htplayz2107) 14 82.83 93.69 1 7.14
15929. jburd (htimseiluj) 14 78.32 90.79 5 35.71
15930. Jacob (horenzo) 14 102.72 117.13 7 50.00
15931. Hisham (hisham_m) 14 53.06 67.24 4 28.57
15932. .zyf (hinglect) 14 96.64 110.43 6 42.86
15933. Rohit Singh (himynameisrohi... 14 136.08 156.85 10 71.43
15934. himanshu (himanshu_giri) 14 56.50 68.15 4 28.57
15935. hieser (hieser) 14 32.33 36.57 2 14.29
15936. David (hiddenpants10) 14 94.03 104.33 4 28.57
15937. SomeGuy (hexadecimal101) 14 95.51 118.05 7 50.00
15938. Henry Ruggs (henryruggs) 14 171.65 188.95 13 92.86
15939. hegde_atri (hegde_atri) 14 74.49 89.64 2 14.29
15940. Harsh (harsh1924) 14 55.06 63.78 2 14.29
15941. Andrew (harris75098) 14 68.54 87.73 5 35.71
15942. Bruh (hannibanani) 14 63.64 77.28 3 21.43
15943. Teuku (hahasrul) 14 75.33 91.06 4 28.57
15944. Habib (habib7777) 14 57.22 65.14 2 14.29
15945. gummy (gummysheep) 14 105.34 116.97 7 50.00
15946. tek it (guidryy) 14 37.99 53.19 0 0.00
15947. mikey (grenadejumper) 14 65.86 84.01 3 21.43
15948. Gourav (gourav001) 14 54.81 59.37 1 7.14
15949. kiwiwi (gothickiwi) 14 49.28 61.10 1 7.14
15950. Alh (gotank) 14 49.93 58.71 2 14.29
15951. Maidul (goal100wpm) 14 36.26 43.79 2 14.29
15952. Glen (glennnnn) 14 62.99 69.32 1 7.14
15953. Anonymous (ghajik) 14 84.93 101.58 13 92.86
15954. Last (galya_88) 14 68.43 77.39 3 21.43
15955. Colin (galaxyytr) 14 81.99 94.31 4 28.57
15956. Inic (gadomane) 14 73.08 89.15 4 28.57
15957. Nick (frogd) 14 88.66 105.54 2 14.29
15958. Bob (frenchburrito) 14 78.28 93.62 4 28.57
15959. William (freewille) 14 96.82 115.99 6 42.86
15960. fred777i (fred777i) 14 71.22 98.19 2 14.29
15961. fongof (fongof) 14 89.35 100.03 3 21.43
15962. Flowless (flowlessrusher) 14 64.25 71.24 14 100.00
15963. Landon (floont) 14 120.00 127.79 6 42.86
15964. Fineson (fineson) 14 107.40 138.13 7 50.00
15965. ronan (fibbit) 14 82.26 94.06 3 21.43
15966. Fesak10Fingers (fesak8) 14 60.77 73.05 7 50.00
15967. Fathan (fathanpathurijal) 14 70.47 80.28 4 28.57
15968. Farhan Osman (farhan16) 14 40.28 44.01 0 0.00
15969. Fanturn (fanturn) 14 31.25 44.00 1 7.14
15970. Thomas (f0x169) 14 78.84 90.96 3 21.43
15971. Lucas (excorpse) 14 96.53 115.83 5 35.71
15972. Esophose (esophose) 14 135.36 157.28 9 64.29
15973. Esketitutu (esketitutu) 14 65.80 81.17 8 57.14
15974. Derpy Stingray (ernchenghoo) 14 109.72 131.73 8 57.14
15975. Khanh (erile) 14 59.01 66.74 0 0.00
15976. Enzoo (enderboyx200) 14 131.27 140.68 11 78.57
15977. Emily (emerrin) 14 98.60 106.09 5 35.71
15978. aa (elk111) 14 75.54 91.55 3 21.43
15979. luca (einsluca) 14 83.65 97.07 1 7.14
15980. 𝓰𝓸𝓸 𝓰𝓸𝓸 (... 14 75.50 90.57 7 50.00
15981. Lewis (eatass123) 14 68.66 76.87 2 14.29
15982. ear (earmold) 14 108.52 121.65 7 50.00
15983. Dylan (dylearn) 14 63.38 72.86 0 0.00
15984. dylan52528 (dylan52528) 14 70.59 85.89 4 28.57
15985. Drizzy (dreazy) 14 83.16 104.71 5 35.71
15986. dree (dre3) 14 76.85 92.75 3 21.43
15987. Goomba (dragoomba) 14 148.16 166.18 7 50.00
15988. Marcus Armstrong (down_with... 14 87.76 101.08 2 14.29
15989. Daniel (dninja96) 14 102.13 116.79 4 28.57
15990. Dylan (dkonquerer) 14 104.98 118.53 2 14.29
15991. Hafizuddin (dinios_) 14 30.00 34.26 0 0.00
15992. Dikshit (dikshitupadhya) 14 60.55 68.94 1 7.14
15993. DerpVos (derpvos) 14 83.57 103.12 6 42.86
15994. Nicholas (denicholas) 14 62.17 73.16 5 35.71
15995. Radioactive (denharsh) 14 115.05 134.52 11 78.57
15996. Dele (delenit0r) 14 77.00 88.65 2 14.29
15997. Deiru (deiru) 14 101.76 121.54 3 21.43
15998. Bob (deinosor) 14 105.69 123.84 5 35.71
15999. Jody (deekif) 14 89.15 102.81 8 57.14
16000. Deamon (deamontyper) 14 67.73 81.94 4 28.57
16001. David (davecoolkid) 14 112.21 135.94 7 50.00
16002. Dan (danwest124) 14 60.62 69.92 1 7.14
16003. Dave (dachalco) 14 90.06 99.40 2 14.29
16004. tstats[daball] (daball) 14 104.87 127.48 6 42.86
16005. Czar (czarlol) 14 107.77 124.78 6 42.86
16006. cython (cython) 14 63.72 74.83 2 14.29
16007. Cavit Mert (cvtmrt) 14 64.91 77.65 13 92.86
16008. abidla07 (crystalrep) 14 55.95 77.32 14 100.00
16009. John (cryptx_) 14 93.73 117.81 8 57.14
16010. kj (crioyri) 14 99.47 115.05 8 57.14
16011. coolror (coolroru) 14 84.30 105.01 4 28.57
16012. Josh (complex_j) 14 48.99 56.83 1 7.14
16013. Jon (coltirl) 14 67.32 88.69 1 7.14
16014. Jordan (coffeeaddict99) 14 79.28 87.97 5 35.71
16015. coen (coencidence) 14 106.92 132.61 3 21.43
16016. Michael (clutch69master69) 14 122.41 135.03 11 78.57
16017. Aicez (cluelessbruh) 14 48.86 57.72 0 0.00
16018. Cloudios (cloudios) 14 68.34 84.57 4 28.57
16019. Clfong (clfong) 14 60.46 74.27 1 7.14
16020. CHT (cht64) 14 114.91 139.55 11 78.57
16021. Chocorion (chocorion) 14 67.29 79.93 3 21.43
16022. Timothy (chicken174) 14 21.46 27.87 3 21.43
16023. I don't know (chessbro) 14 43.65 59.57 0 0.00
16024. andygreg (chelloh) 14 62.09 77.69 4 28.57
16025. Cheesetoast (cheesetoastman) 14 57.95 75.78 2 14.29
16026. cha (chachu007) 14 73.51 87.04 2 14.29
16027. celes (celescastro) 14 82.34 97.53 5 35.71
16028. Ceb (cebq) 14 72.34 94.40 4 28.57
16029. Chase (ccummins) 14 85.21 103.73 4 28.57
16030. Talon (cclaww) 14 64.45 81.97 3 21.43
16031. Matty (cannotdivideby0) 14 96.92 115.27 7 50.00
16032. Cancyr (cancyr) 14 96.84 105.98 5 35.71
16033. luis (bumfuzzled) 14 69.27 84.14 4 28.57
16034. Mario (bujmar) 14 60.20 68.93 0 0.00
16035. Anton (bujjaa) 14 68.24 75.23 1 7.14
16036. Bruce (bruceboy1985) 14 116.16 131.86 8 57.14
16037. David (bpsccheney) 14 78.61 86.04 5 35.71
16038. jom (borezu) 14 128.89 145.31 11 78.57
16039. Yoda (booya51) 14 98.63 114.33 5 35.71
16040. Andrew (bonusducky) 14 99.70 115.36 1 7.14
16041. Bob (bobjesus) 14 68.48 80.73 7 50.00
16042. Blub (blub0) 14 86.45 106.36 8 57.14
16043. Ramen (blazingramen) 14 99.84 110.32 6 42.86
16044. Christler (blastydog) 14 120.86 140.91 10 71.43
16045. Valk (blankfox) 14 80.06 94.68 4 28.57
16046. Asma Azim (blackpanther_1) 14 63.35 70.42 4 28.57
16047. Long (bizkidngo) 14 104.14 133.86 10 71.43
16048. Trilo (bishh_27) 14 41.87 45.67 0 0.00
16049. Brandon (birdysofly) 14 108.91 134.94 11 78.57
16050. Bill (billsquare) 14 62.09 71.04 3 21.43
16051. biady (biadyy) 14 96.04 101.54 5 35.71
16052. bhuvi (bhuvi1606) 14 58.77 69.81 3 21.43
16053. beepbeep (beep__beep) 14 71.38 83.19 2 14.29
16054. beehah (beehahem) 14 100.96 115.92 7 50.00
16055. beebooboop (beebooboop) 14 96.23 107.43 3 21.43
16056. Big (beanbeanbean123) 14 44.41 50.10 0 0.00
16057. Kutay (batselot) 14 62.80 72.14 3 21.43
16058. Bailey (baileyeet) 14 73.37 101.71 2 14.29
16059. badfaith (badfaith) 14 81.57 95.22 3 21.43
16060. Gaus (azamku09) 14 57.20 64.60 2 14.29
16061. Axurio (axurio) 14 68.36 80.57 6 42.86
16062. Axel (axei) 14 60.30 71.97 0 0.00
16063. avg (avgr) 14 16.78 22.67 1 7.14
16064. Griffin (avalanchovy) 14 55.03 61.97 1 7.14
16065. Aurel (aurelganteng) 14 79.21 94.24 6 42.86
16066. Ath (athuu) 14 92.00 109.48 5 35.71
16067. Yu (astridjin) 14 50.82 59.93 3 21.43
16068. Adam (assassinbred) 14 97.46 105.67 2 14.29
16069. Ibnu (asqallani) 14 56.91 69.74 3 21.43
16070. Aiden (asiangarlic) 14 64.58 76.07 9 64.29
16071. ashley (ashleyybbae) 14 101.27 113.53 10 71.43
16072. asdf (asdf3) 14 84.44 92.33 2 14.29
16073. ascyt.com (ascyt) 14 60.80 75.36 4 28.57
16074. Aruji (aruji) 14 77.30 86.27 0 0.00
16075. uwos (artuist) 14 97.03 107.13 7 50.00
16076. ArthasEdit (arthasedit) 14 44.50 55.99 0 0.00
16077. arryacc (arryacc) 14 45.17 49.87 2 14.29
16078. Ashvik (ardude566) 14 76.86 99.77 5 35.71
16079. ArcticWoof (arcticwoof) 14 57.84 63.12 2 14.29
16080. Tabs (aptex) 14 94.83 106.69 5 35.71
16081. Mario (applie_turnover) 14 42.31 54.34 2 14.29
16082. Alperen (apleren) 14 55.64 63.54 2 14.29
16083. ibayanto (antichronic) 14 86.39 111.40 8 57.14
16084. qwerty (anoop208) 14 112.74 131.85 11 78.57
16085. Anh Khoa (anhkhoa218) 14 49.40 57.38 2 14.29
16086. Nate (angularblade) 14 71.83 91.98 4 28.57
16087. Andy (andykim18) 14 95.99 110.08 4 28.57
16088. Andrew (andrewlllee) 14 83.17 100.21 4 28.57
16089. Andrew (andrewlwm) 14 78.87 96.84 5 35.71
16090. _Nasta_ (anas_hamrouni) 14 65.87 80.54 7 50.00
16091. Amar (amardhaliwal7) 14 54.40 69.89 1 7.14
16092. Alec (alxiang) 14 100.43 123.94 2 14.29
16093. Alexandros (ale_pouroulllis) 14 93.88 111.88 9 64.29
16094. Alexa (alexa72) 14 105.24 126.98 6 42.86
16095. Alex (alex7r360) 14 111.24 133.00 8 57.14
16096. Aldreich (aldreich) 14 99.77 121.66 8 57.14
16097. Arrtea (akrx) 14 39.53 46.25 0 0.00
16098. asgfd (akjghaf) 14 70.23 77.97 2 14.29
16099. bbbbbbbbbbbbbbbbbbbbbbbbbbb... 14 71.88 83.14 3 21.43
16100. Eddie (agzastrgath) 14 91.20 101.75 5 35.71
16101. Fluff (afluffyflamingo) 14 102.64 133.27 5 35.71
16102. Julio (aero_jb) 14 61.86 70.74 4 28.57
16103. Adnan (adnanasn) 14 51.39 55.75 0 0.00
16104. Lavell (adenda2) 14 68.14 77.63 1 7.14
16105. costin (acostin643) 14 102.24 116.31 3 21.43
16106. Acke (ackehjarn) 14 89.07 104.37 3 21.43
16107. Alyssa (abm10) 14 44.04 57.29 0 0.00
16108. Abdullahi (abdullahi_samiir) 14 77.08 86.44 2 14.29
16109. AK (a2526) 14 77.85 90.30 4 28.57
16110. Andy (6arb) 14 101.36 115.57 7 50.00
16111. 白起小哥哥 (45989871) 14 46.41 60.91 2 14.29
16112. Rebecca (221btimelord) 14 88.30 102.26 4 28.57
16113. Camden (1848910) 14 69.80 86.76 5 35.71
16114. Mohammad (11osos11) 14 78.57 93.47 6 42.86
16115. shudawg (1122) 14 78.18 87.79 3 21.43
16116. Angelo (ruly_2002) 14 76.98 95.23 2 14.29
16117. Euan (euansuba) 14 69.84 82.51 14 100.00
16118. Aaran (ninjatai) 14 43.44 51.46 0 0.00
16119. Nathan (rockthecraft) 14 85.21 91.12 4 28.57
16120. Ian (sirbossk) 14 82.16 93.60 2 14.29
16121. Aniket (ani_ket_kmr) 14 89.37 104.55 5 35.71
16122. ethan (1epyt) 14 76.45 87.98 5 35.71
16123. Saheb (iamsahebgiri) 14 42.47 57.92 1 7.14
16124. Josiah (instantnoodlez) 14 82.75 116.34 6 42.86
16125. John (lilrecci3) 14 40.95 47.73 2 14.29
16126. 'Cannot be blank' (mountain... 14 102.51 120.86 4 28.57
16127. ahmed (ahmedraslan28) 14 43.75 52.31 3 21.43
16128. Toad (toad2six) 14 95.97 127.50 6 42.86
16129. Daniel (iskrowy) 14 74.35 87.58 5 35.71
16130. Abdul Rafay (rafay_angle) 14 43.70 49.19 2 14.29
16131. Prabesh (itsprabesh) 14 60.57 75.14 2 14.29
16132. Victoria (victoria_05) 14 48.52 59.87 1 7.14
16133. rome (zombielols) 14 98.23 114.30 4 28.57
16134. TerrorLlama (terrorllama) 14 73.48 85.14 2 14.29
16135. John (john19221) 14 49.80 53.70 0 0.00
16136. Mohammed (_police_) 14 75.37 87.68 3 21.43
16137. John (omnirabbit) 14 103.23 115.30 8 57.14
16138. Bob (didwin) 14 87.69 103.40 5 35.71
16139. Aniket (theaniketdas) 14 89.04 121.75 5 35.71
16140. Aaron (hertzzy) 14 51.27 55.29 3 21.43
16141. Lee (dinotrooper) 14 78.22 111.69 4 28.57
16142. wes (fckhomerow) 14 117.00 133.45 10 71.43
16143. Bethany (thelegendarybethboii) 14 95.64 106.29 6 42.86
16144. PLUTO (p1luto) 14 66.34 80.72 9 64.29
16145. Anthony (adenn915) 14 76.82 102.05 2 14.29
16146. Tag (terataj) 14 74.57 97.34 6 42.86
16147. . (thediamond_35) 14 82.35 94.66 2 14.29
16148. Emir (kasubukuro) 14 52.58 65.27 2 14.29
16149. iverybadattyping (iverybada... 14 91.50 103.10 4 28.57
16150. sky (forgottensky) 14 60.21 71.42 1 7.14
16151. Arian (alatus_arian) 14 77.25 98.32 2 14.29
16152. Md Abu Torab (torab_0123) 14 47.18 57.90 4 28.57
16153. John (john8999) 14 49.52 57.65 0 0.00
16154. Septrev (septrev) 14 50.28 56.15 1 7.14
16155. Brian (britchkid) 14 103.73 124.69 10 71.43
16156. atharv (xdbotsmaster) 14 52.36 61.92 0 0.00
16157. heidi (emmalouise05) 14 62.96 73.66 3 21.43
16158. Sal (saltypes) 14 51.01 56.83 3 21.43
16159. Namura (namura) 14 83.81 92.80 8 57.14
16160. Cameron (cameron_j) 14 83.59 93.01 6 42.86
16161. thenu (lcfrmrngstr) 14 58.01 70.67 3 21.43
16162. Andrii (shkroba) 14 71.82 86.86 3 21.43
16163. Ahmed Ittihad (andy_dufresn... 14 65.38 72.19 3 21.43
16164. Waldo (glibg10b) 14 64.84 71.99 4 28.57
16165. Quan (quan_lad) 14 70.92 83.38 11 78.57
16166. Gisela (gis99) 14 48.65 56.40 2 14.29
16167. ethonk (ethonk) 14 88.75 96.38 6 42.86
16168. Awesome Name Man (awesomena... 14 71.83 79.43 6 42.86
16169. Esther (phamjam) 14 68.78 75.81 4 28.57
16170. killua (alphaidgaf) 14 59.88 69.16 8 57.14
16171. Dyllan (blockmaniac48) 14 68.76 85.40 3 21.43
16172. Conor (crc1200) 14 70.15 88.18 6 42.86
16173. Chizz (cheezeychizz) 14 82.94 93.17 6 42.86
16174. Sudhir (sudhih) 14 60.37 75.82 4 28.57
16175. Chris (pokedog27) 14 75.48 93.26 4 28.57
16176. nekron35 (nekron35) 14 56.16 61.71 3 21.43
16177. jamhood007 (jamhood007) 14 56.44 62.56 5 35.71
16178. Thom (squiddy32) 14 92.01 124.26 4 28.57
16179. Tyler (loltylerdowney) 14 82.26 93.66 1 7.14
16180. gnat (gnatblue) 14 62.85 73.97 5 35.71
16181. ZhiHan (flinzan) 14 47.62 53.34 1 7.14
16182. samsam (samsamlol) 14 93.70 112.54 11 78.57
16183. Athacal (athacal) 14 46.34 58.80 4 28.57
16184. Rasheed (sheedywonder) 14 68.15 79.03 4 28.57
16185. Waleed (waleed_saleh) 14 51.81 58.58 5 35.71
16186. joni (rozygcf) 14 48.09 54.67 2 14.29
16187. racernumberseven (racernumb... 14 56.34 63.19 1 7.14
16188. Ben (tachibanaben) 14 91.11 110.48 4 28.57
16189. Rosechilde (rosechilde) 14 47.61 56.75 1 7.14
16190. Jeronimo (_slowmotion_) 13 113.70 125.63 5 38.46
16191. Paka (_paka) 13 92.48 100.89 3 23.08
16192. falling down (_nirvana) 13 118.74 124.74 6 46.15
16193. Zakk (z_boi) 13 103.28 119.10 4 30.77
16194. amer (zx_iii) 13 54.09 60.29 1 7.69
16195. ଘ(੭ˊᵕˋ)੭* ੈ✩... 13 120.96 133.01 12 92.31
16196. Zero (zerolelouch) 13 54.07 65.77 2 15.38
16197. logan (zelo_0348) 13 37.63 43.08 0 0.00
16198. Lawrence (zekaeski) 13 52.26 67.67 3 23.08
16199. Yan (zeezyy) 13 48.62 56.88 12 92.31
16200. Yuuto (yuutofood) 13 77.91 95.80 4 30.77
16201. Yohan (yoyo65) 13 32.47 35.84 0 0.00
16202. Lenny (yourboylenny) 13 78.30 92.04 9 69.23
16203. Markus (yoshicp) 13 75.52 92.36 6 46.15
16204. Yoav (yoav24681) 13 63.22 71.62 2 15.38
16205. yjuk (yjuk) 13 79.05 90.37 6 46.15
16206. yinlor (yinlor) 13 75.14 99.66 5 38.46
16207. V (xgerr) 13 76.04 87.99 6 46.15
16208. Darren (xdeclipseee) 13 93.43 114.22 5 38.46
16209. Mintful (worst_typist11) 13 65.97 74.52 2 15.38
16210. Jeff (witlessbox) 13 88.24 94.78 0 0.00
16211. Wil$on (wilsonlee123) 13 103.74 123.18 4 30.77
16212. NotAn0boe (whackygrub) 13 113.79 129.09 9 69.23
16213. wenxers (wenxers) 13 94.46 102.06 1 7.69
16214. weddies (weddies) 13 85.55 95.84 3 23.08
16215. Daniel (weabutakku) 13 64.48 82.18 4 30.77
16216. Tony (watery_tony) 13 40.97 49.03 0 0.00
16217. Nathan (watameelon) 13 38.81 45.78 1 7.69
16218. waryburger (waryburger) 13 81.41 94.80 4 30.77
16219. Waleed (waleedminer) 13 113.72 138.81 4 30.77
16220. WaFik (wafik) 13 66.06 78.01 3 23.08
16221. Nazarii (vyleet) 13 73.37 90.29 6 46.15
16222. AJ (vvatti@gmail.com) 13 82.79 92.11 1 7.69
16223. Casper (volvoracer87) 13 44.21 51.63 1 7.69
16224. Daniel (voiss) 13 94.49 109.50 7 53.85
16225. vocal (vocal) 13 72.84 97.74 3 23.08
16226. Vanellope (vio_melancholy) 13 69.70 84.53 2 15.38
16227. Vikram (vikram031) 13 104.44 120.78 5 38.46
16228. Viggi (viggi_002) 13 39.79 47.24 0 0.00
16229. vibhu (vibhuviv) 13 37.24 44.36 0 0.00
16230. Liny (veronasie) 13 64.79 76.08 3 23.08
16231. Blaise (veresb14) 13 91.06 112.12 6 46.15
16232. ℑ𝔫𝔢𝔵𝔢𝔠𝔯... 13 71.40 78.73 4 30.77
16233. Alex (veifario) 13 29.09 35.68 3 23.08
16234. Marcin (vaster_then_you) 13 69.74 79.24 0 0.00
16235. Vasil (vasito123) 13 86.99 99.08 2 15.38
16236. André (valp) 13 77.09 87.81 3 23.08
16237. randall (valleyy) 13 90.09 103.65 5 38.46
16238. Valdo (valdo_) 13 79.37 93.09 0 0.00
16239. vid (usernem) 13 94.74 117.45 4 30.77
16240. Samuel (upgraded_skilly) 13 72.48 83.88 3 23.08
16241. cooler (unpluged) 13 85.33 95.68 3 23.08
16242. umer (umer901) 13 74.07 96.04 2 15.38
16243. Umbi (umbe10) 13 75.32 87.85 7 53.85
16244. Bat-Ulzii (ulziibox) 13 66.22 79.15 12 92.31
16245. Uno (typesmacker) 13 69.70 80.69 5 38.46
16246. bob (typemaster512) 13 87.10 99.29 4 30.77
16247. Tukanoo (tukano) 13 62.60 71.68 2 15.38
16248. Petros (trakis_pe) 13 53.00 69.23 6 46.15
16249. Noob (touchhyper) 13 87.13 120.50 5 38.46
16250. byronze (toqoz) 13 107.54 115.32 4 30.77
16251. J (tooeasyeh) 13 122.87 139.71 5 38.46
16252. Race (tomatoripper) 13 45.31 50.79 4 30.77
16253. Tree (tmoh) 13 100.73 121.31 12 92.31
16254. Tippy (tippytaptyper) 13 100.41 126.30 3 23.08
16255. nht- (tiny20061) 13 112.21 149.77 4 30.77
16256. Martin (the_martin) 13 86.27 115.21 8 61.54
16257. maple (the_maple_syrup) 13 107.03 118.56 5 38.46
16258. Marlo (the_law_ph) 13 73.30 84.36 3 23.08
16259. Brian (the_bc) 13 70.75 80.04 5 38.46
16260. Evan (thewhailure) 13 75.16 85.95 3 23.08
16261. Bryan (thesilican) 13 93.33 107.78 6 46.15
16262. Nobody (therealtrudeau) 13 113.63 135.05 6 46.15
16263. Talos (therealtalos21) 13 83.21 93.99 3 23.08
16264. TheProperAsian (theproperas... 13 74.01 86.30 7 53.85
16265. - (thegoldentiger) 13 96.32 110.06 4 30.77
16266. Jack (theboakey) 13 72.48 82.02 3 23.08
16267. Iason (thebabo) 13 66.00 76.03 7 53.85
16268. Fox (that_fox) 13 90.40 104.25 2 15.38
16269. Davis (thatrednismo) 13 100.59 118.93 4 30.77
16270. Th3Frog (th3frog) 13 48.68 55.40 3 23.08
16271. tempo (tempoxyz) 13 88.39 109.89 6 46.15
16272. Tehb (tehbb) 13 41.60 51.87 1 7.69
16273. Calvin (teddycom1) 13 66.22 73.30 3 23.08
16274. Ted (ted3x) 13 62.58 71.51 6 46.15
16275. Yếm Hồng (tdinh33) 13 64.78 76.37 1 7.69
16276. Ryan (tazayuki) 13 108.42 117.02 7 53.85
16277. na (syncix) 13 91.64 111.96 9 69.23
16278. sriram (svb1) 13 68.66 74.00 3 23.08
16279. tstats[suraj_hs] (suraj_hs) 13 54.41 66.78 0 0.00
16280. slowpoke (wpm4life) 13 46.29 55.27 2 15.38
16281. Ethan (summerpizza5508) 13 90.03 107.47 7 53.85
16282. Suhan (suhan_pradhan) 13 71.27 85.49 2 15.38
16283. Duirky (sublollipop) 13 64.45 73.22 4 30.77
16284. Rapunzel (subash_) 13 67.85 74.34 2 15.38
16285. Scott (stxiii) 13 79.21 88.43 5 38.46
16286. fries (spotifries) 13 80.11 89.57 3 23.08
16287. Alvin M. (spoderman2100) 13 55.37 65.27 3 23.08
16288. spiros (spiros_gal) 13 91.33 109.29 3 23.08
16289. William (speier70) 13 78.76 84.82 3 23.08
16290. Riyad (spectrumftw) 13 89.78 107.24 8 61.54
16291. ellie (spaghellie) 13 112.65 136.50 8 61.54
16292. Jacob (spacelamar) 13 84.87 96.05 3 23.08
16293. Pavel (sonaru) 13 65.96 72.84 7 53.85
16294. Mevious (someguy) 13 119.00 129.41 5 38.46
16295. GG (smrndmgy) 13 80.99 100.57 9 69.23
16296. stinkass (smitopot) 13 113.33 142.50 6 46.15
16297. pingu (slowpokeboy) 13 104.14 122.03 5 38.46
16298. skydoi (skydoi) 13 69.10 87.80 3 23.08
16299. Hien (skrubtical) 13 115.88 129.87 8 61.54
16300. P (skoop8) 13 104.09 117.68 7 53.85
16301. Skerolt (skerolt) 13 78.60 95.62 7 53.85
16302. Loser (sisyphus_69) 13 84.26 92.56 3 23.08
16303. JIS filco stingray (sigel) 13 149.07 171.38 12 92.31
16304. eden (shoutynubs) 13 83.51 91.18 4 30.77
16305. Hamster (shmex_hamster) 13 89.93 99.81 8 61.54
16306. かりつた (shizuyoru) 13 67.01 73.74 2 15.38
16307. Shirito (shirito) 13 70.54 79.82 2 15.38
16308. Top (sheilsarda) 13 89.10 102.88 6 46.15
16309. Sheenu (sheenz) 13 113.38 130.83 7 53.85
16310. Bauyrzhan (shaykan) 13 61.17 77.26 7 53.85
16311. Shawn (shawnyw) 13 93.42 105.36 4 30.77
16312. shamol (shamolali) 13 47.96 56.89 3 23.08
16313. Shafy (shafy) 13 71.49 83.43 2 15.38
16314. Petar (sevihasanidjos) 13 42.60 50.92 1 7.69
16315. iza (servoracc) 13 117.48 143.33 6 46.15
16316. (secw) 13 90.24 107.21 5 38.46
16317. Sandra (sbs96) 13 116.07 136.37 7 53.85
16318. Sarah (sarahday) 13 100.45 117.75 7 53.85
16319. S (sarahac) 13 100.89 119.16 8 61.54
16320. Sara (sarachespara) 13 60.32 69.77 5 38.46
16321. Saad (saadeldeen) 13 91.41 102.52 3 23.08
16322. Xi (rozaana) 13 86.65 93.34 6 46.15
16323. Roy (roylee0912) 13 123.73 158.29 6 46.15
16324. rory (roryinnit) 13 82.00 96.40 2 15.38
16325. Rocky (rocky_whale) 13 84.04 111.66 7 53.85
16326. robert (robertford) 13 52.75 60.62 1 7.69
16327. Gabe (roastedleather) 13 73.79 88.67 4 30.77
16328. RB3 (rlbryant1982) 13 63.48 70.94 1 7.69
16329. Ralo (rindt_) 13 76.18 84.63 3 23.08
16330. Riggy (rigorodolico) 13 88.76 100.45 6 46.15
16331. Chris (rialac) 13 91.10 111.96 4 30.77
16332. Rennard (rennard) 13 80.85 93.38 5 38.46
16333. Joshua (redscool) 13 102.89 115.96 5 38.46
16334. Redking344 (redking344) 13 64.27 77.27 13 100.00
16335. Xavier (redanky) 13 62.82 69.36 3 23.08
16336. GEORGE (reburm) 13 135.01 152.28 10 76.92
16337. Gio (raskid) 13 71.85 93.26 3 23.08
16338. Paul (randomnoob1) 13 124.39 149.25 8 61.54
16339. random (randomnoob07) 13 51.43 63.13 3 23.08
16340. Ramdizzle (ramdizzle) 13 59.79 69.14 5 38.46
16341. Ralph John (ralph_saintaugu... 13 53.99 63.37 2 15.38
16342. rajus (rajusthedarklord) 13 66.82 71.70 2 15.38
16343. Rainfluff (rainfluff) 13 74.35 84.86 7 53.85
16344. kaedyn (rainbowdad) 13 82.61 101.70 3 23.08
16345. Rahil (rahil3108) 13 69.02 77.45 5 38.46
16346. Hunter (ragingtimebomb) 13 66.51 79.48 2 15.38
16347. Olivier (racoon9009) 13 46.84 51.10 2 15.38
16348. Rab (rabuhana) 13 71.85 76.09 3 23.08
16349. Viktor (quicksorting) 13 73.69 87.08 2 15.38
16350. Al (quicksilver95) 13 112.01 131.81 11 84.62
16351. Qualified (qualified98) 13 98.11 111.73 6 46.15
16352. Theodor (prospitianknightma... 13 88.00 106.00 7 53.85
16353. Prizy (prizypower) 13 54.74 67.99 8 61.54
16354. aiden (poscowsm) 13 86.03 96.87 7 53.85
16355. Posa2000 (posa2000) 13 63.51 74.50 0 0.00
16356. Kelsey (pokewolf) 13 61.38 75.16 3 23.08
16357. Jade (pokemonluv98) 13 86.72 104.05 3 23.08
16358. Myles (pixelen) 13 81.26 99.86 3 23.08
16359. PISSPAINTING (pisspainting) 13 82.48 94.83 6 46.15
16360. miko (pisleo) 13 70.83 81.82 1 7.69
16361. rey (pieri) 13 121.70 146.25 4 30.77
16362. bacon (peter_1860) 13 59.77 71.72 5 38.46
16363. Petr (petajupik) 13 38.52 42.54 1 7.69
16364. bruh (peplee_) 13 87.43 105.78 2 15.38
16365. Pear (pear_smo) 13 64.33 75.18 2 15.38
16366. pb64 (pb64) 13 71.94 78.38 12 92.31
16367. Pavlo (pavelko) 13 45.63 53.63 3 23.08
16368. Paddy (paddyl) 13 76.89 85.30 4 30.77
16369. Owen (owenecollins) 13 84.74 96.24 3 23.08
16370. Cezar (outstanding29wpm) 13 84.19 89.72 4 30.77
16371. oribiya-chan (oribiya) 13 50.90 58.97 1 7.69
16372. ☔️ (orella) 13 88.56 106.74 3 23.08
16373. ayush (orange_master) 13 77.23 88.57 3 23.08
16374. Oobi (oobixyz) 13 85.18 103.29 5 38.46
16375. Chris (ohkaychris) 13 95.85 114.48 5 38.46
16376. Nuge (nugemcgee) 13 106.89 120.44 8 61.54
16377. Norps (norps) 13 70.94 80.82 2 15.38
16378. Nolan (nolanporty) 13 68.81 84.85 1 7.69
16379. nadav (nmcat) 13 19.20 24.70 4 30.77
16380. Nikolas (nkaiser) 13 82.50 97.15 4 30.77
16381. NJ (njc99) 13 69.26 83.05 5 38.46
16382. nikax (nixa202) 13 105.09 118.07 5 38.46
16383. Nivalis (nivalis11) 13 92.24 105.02 3 23.08
16384. Nishal (nishalns) 13 43.95 54.06 1 7.69
16385. Vegard (ninjawegard) 13 59.92 67.88 3 23.08
16386. niko (nikuruuuuu) 13 92.39 100.87 6 46.15
16387. Nikhil Sharma (nikhil_bolt) 13 86.97 93.36 3 23.08
16388. Bash (nidaljaafar1) 13 58.01 71.52 3 23.08
16389. Nick (nickpat) 13 94.52 117.70 4 30.77
16390. nick (nickpanda44) 13 97.19 108.49 8 61.54
16391. Abdul (netf121212) 13 45.29 52.81 2 15.38
16392. Nazmin (naz_1212) 13 72.29 98.19 2 15.38
16393. п8 ʅ(。◔‸◔。)ʃ ... 13 95.42 131.06 5 38.46
16394. Nathaniel (nathaniel999) 13 58.48 64.92 4 30.77
16395. Fran (narfornothing) 13 103.19 146.78 3 23.08
16396. Chamnann (nannostar) 13 62.19 74.09 4 30.77
16397. vinicius (nagahori) 13 70.78 79.14 3 23.08
16398. RED (naga30) 13 29.42 45.73 1 7.69
16399. Daulet (m_daulet) 13 45.34 54.88 2 15.38
16400. Mubtasim (mubtasim91) 13 67.67 83.87 2 15.38
16401. Spencer (mr_rigid) 13 67.81 80.76 4 30.77
16402. Jakob (mrsuperhorse) 13 41.30 46.20 1 7.69
16403. power (mrpowerstudiesyt) 13 86.31 105.22 4 30.77
16404. Matt (mplumado) 13 67.89 80.38 3 23.08
16405. tris (mousiecandy) 13 73.33 87.29 2 15.38
16406. muhammad (moulizax) 13 57.91 69.42 1 7.69
16407. Gareth (morpen8) 13 110.28 126.83 6 46.15
16408. Petar (monkeypants274) 13 62.91 68.32 3 23.08
16409. MO$$ (monilyn) 13 84.82 96.79 5 38.46
16410. Molly (molgreen) 13 94.71 111.20 10 76.92
16411. Mohammad (mohammadkhosravi) 13 50.17 54.27 0 0.00
16412. Mohamed (mohamedsobhi777) 13 72.88 87.88 3 23.08
16413. Mike (mmiller_52) 13 55.77 63.65 1 7.69
16414. MLGIN (mlgin) 13 86.96 122.81 9 69.23
16415. Anon (mklegend) 13 123.10 143.98 11 84.62
16416. Matt (misterc) 13 105.42 121.12 5 38.46
16417. Mischa (mischapotter) 13 88.80 106.34 5 38.46
16418. Miko (mikofinland) 13 65.53 74.90 3 23.08
16419. Mikechun (mikechun) 13 89.23 107.40 3 23.08
16420. mike1808 (mike1808) 13 93.77 106.87 6 46.15
16421. Michael (mike1232b) 13 93.63 116.06 5 38.46
16422. Maggie (migggggie) 13 110.14 121.51 4 30.77
16423. Sofia (michael_bjordy) 13 81.58 91.72 4 30.77
16424. MewX (mewx) 13 78.62 104.09 10 76.92
16425. Samar (mesam22) 13 52.80 61.53 1 7.69
16426. naser (memel0rd420) 13 72.27 86.80 3 23.08
16427. Nur (mehedyhassan865) 13 44.05 59.49 2 15.38
16428. ollie (mech_typer) 13 94.76 105.07 9 69.23
16429. MD Gaziur Rahman Noor (mdga... 13 77.33 96.84 6 46.15
16430. Maven (mavenz) 13 95.69 105.57 5 38.46
16431. Matt (mattlo) 13 107.39 125.03 9 69.23
16432. killerkoli (mattiemb) 13 63.87 75.90 2 15.38
16433. Matan (matan_ati) 13 87.28 99.25 7 53.85
16434. FunkyChicken (mastalampe) 13 73.39 80.82 4 30.77
16435. Mark (markparadise) 13 49.76 58.13 1 7.69
16436. marciano (marcboss06) 13 41.22 48.94 2 15.38
16437. Marcago (marcago) 13 81.49 94.53 3 23.08
16438. mapieko (mapieko) 13 45.00 52.55 1 7.69
16439. Rushikesh (manwatkar) 13 43.24 50.75 0 0.00
16440. Manikkavel (manikkavel_s) 13 70.47 79.85 2 15.38
16441. [Bl4nk] (mahneymchef) 13 84.37 90.18 6 46.15
16442. Mahir (mahirafnan) 13 46.45 52.94 2 15.38
16443. Mad Lad (madlad1) 13 61.12 75.27 0 0.00
16444. Migs (m1gs) 13 50.56 57.45 3 23.08
16445. JA (l_ja) 13 54.87 70.36 11 84.62
16446. lyu (lyurisu) 13 100.09 117.94 9 69.23
16447. Larry (lunchspecial) 13 81.38 100.32 5 38.46
16448. luca (luc_vr_04) 13 98.91 128.97 7 53.85
16449. Buddy (lucedes27) 13 109.34 122.13 8 61.54
16450. Vijay S (lord_viju) 13 45.66 53.24 1 7.69
16451. Logiq (logiqq) 13 61.61 73.55 1 7.69
16452. Joshua Peirce (lodgevirus) 13 90.67 110.87 8 61.54
16453. Ajeje (locreee) 13 56.22 75.48 4 30.77
16454. Andres (lobosolitario) 13 82.84 108.57 8 61.54
16455. Liz (lizard117) 13 69.01 82.68 2 15.38
16456. Joe (littlejoeward) 13 67.41 78.05 2 15.38
16457. Kacper (lilfridge69) 13 60.87 71.86 2 15.38
16458. Travis (lightningslow) 13 68.12 95.23 3 23.08
16459. Liban (liban711) 13 91.91 102.89 6 46.15
16460. Marco (leungtc20001124) 13 87.91 96.30 3 23.08
16461. Lestro-+) (lestroboy) 13 28.98 36.85 1 7.69
16462. Leonard (lentan) 13 119.61 135.15 7 53.85
16463. Barel (lenshom) 13 64.99 79.09 9 69.23
16464. Laxman (laxman_) 13 72.15 80.25 8 61.54
16465. Jake (kyrien) 13 115.71 127.15 9 69.23
16466. Kyle (kyles0610) 13 113.04 124.22 4 30.77
16467. James (kuznecoff) 13 76.69 90.62 2 15.38
16468. Kuba (kubzas) 13 42.00 46.55 3 23.08
16469. guest (ks3rr) 13 76.17 83.50 4 30.77
16470. Kristin (krisis7) 13 65.81 73.89 2 15.38
16471. Justin (krakken858) 13 106.82 121.39 5 38.46
16472. Stephen (korankye) 13 98.29 119.89 11 84.62
16473. Dakota (kodaworms) 13 97.72 110.10 8 61.54
16474. Kritim (kkr_) 13 77.52 87.83 5 38.46
16475. Kanha (kjewels) 13 69.85 83.96 1 7.69
16476. kit (kitsinc11) 13 94.17 116.47 2 15.38
16477. Brando (kingozymandias2) 13 88.31 98.78 6 46.15
16478. Kif (kifm) 13 51.03 57.81 0 0.00
16479. Khoa (khoa1811) 13 96.24 107.19 3 23.08
16480. Raven (kfaulk1216) 13 96.45 107.78 6 46.15
16481. Quick Fox (key_of_boards) 13 79.21 90.87 1 7.69
16482. Kenley (kenfunky32) 13 93.55 109.17 4 30.77
16483. kenestrophic (kenestrophic) 13 63.66 78.12 3 23.08
16484. kevin (kelvinscale) 13 51.94 60.85 3 23.08
16485. kelonline (kelonline) 13 55.38 60.60 0 0.00
16486. Kedolind (kedolind) 13 82.14 93.92 4 30.77
16487. Kamron (kbegmatov96) 13 67.10 76.24 5 38.46
16488. Luna (kavuko_) 13 56.40 65.72 3 23.08
16489. James (kasprovy) 13 56.47 62.01 0 0.00
16490. Karcinogen (karsenj05) 13 73.55 82.67 3 23.08
16491. Kalybay (kalybai) 13 54.54 59.02 2 15.38
16492. Kaleeyse (kaleeysem) 13 61.67 70.94 2 15.38
16493. Eyrton (kalaxee) 13 98.63 112.90 7 53.85
16494. Khadija (kaijaaa) 13 34.63 42.90 3 23.08
16495. kadyn (kadynnn) 13 52.38 62.29 4 30.77
16496. Angel (kablockacha) 13 48.79 59.98 2 15.38
16497. K4_keyChan_ (k4_keychan_) 13 89.51 112.89 6 46.15
16498. Justin (justintam556) 13 85.70 106.00 5 38.46
16499. justinhylee (justinhylee) 13 109.09 130.57 13 100.00
16500. Julio Jose (julioisdaman) 13 68.18 94.06 3 23.08
16501. JudgementCole (judgementcole) 13 48.40 55.99 2 15.38
16502. juan (juanjaho) 13 75.70 91.69 2 15.38
16503. KookyMonster🍪🍪🍪 (j... 13 111.41 131.48 9 69.23
16504. Jellybean (jojo00vvv) 13 104.51 121.24 6 46.15
16505. Joe (joejoeparen) 13 70.60 95.76 9 69.23
16506. James (jimmyt50) 13 79.84 95.11 1 7.69
16507. Dim (jimmylei) 13 88.89 104.80 3 23.08
16508. jim (jimmyl02) 13 113.91 129.08 9 69.23
16509. Alex (jigglytophat) 13 55.92 64.94 2 15.38
16510. patoo (jiahao8) 13 104.55 116.42 6 46.15
16511. JCGP (jgcp) 13 79.09 88.83 5 38.46
16512. Jeritens (jensrichter) 13 82.35 94.34 3 23.08
16513. JDSpark (jdspark) 13 87.89 111.01 4 30.77
16514. Jamie (jcpopp) 13 111.26 125.91 7 53.85
16515. JayGMZ (jaygmz) 13 39.08 47.93 2 15.38
16516. Javla (javlafan) 13 87.76 106.19 5 38.46
16517. Chukwuka (javalon007) 13 71.43 85.21 5 38.46
16518. Jaunty (jaunty_jalopy) 13 88.70 96.64 5 38.46
16519. Jared (jarbarw) 13 96.07 111.62 7 53.85
16520. Habby Derrie (japanese_mapl... 13 93.01 103.02 6 46.15
16521. Jandre (jandre1028) 13 122.32 152.23 8 61.54
16522. Jan (jan3112) 13 61.52 71.74 3 23.08
16523. Jafer (jafer2000) 13 62.85 78.09 1 7.69
16524. Jack (jackwhitten238) 13 82.05 96.47 3 23.08
16525. JJJ (jaakko1) 13 106.64 127.78 8 61.54
16526. Vraj (i_type_really_slow_ok) 13 97.31 107.09 3 23.08
16527. Timothy (iyamdeanser) 13 78.88 90.54 4 30.77
16528. Apithat Sombatsiri (itsmek4nz) 13 92.91 109.05 4 30.77
16529. Itscol (itscol) 13 69.43 82.14 4 30.77
16530. irumpel (irumpelstiltskin) 13 78.28 91.59 6 46.15
16531. Ronan (ironan) 13 140.55 179.95 11 84.62
16532. Im kinda cute (im_kinda_cut... 13 89.65 103.64 3 23.08
16533. Nawaf (iinkz) 13 76.24 83.79 3 23.08
16534. Shino (id_acey) 13 81.84 107.06 1 7.69
16535. Samuel (ichigancs) 13 85.51 98.51 5 38.46
16536. IBRAIM5URFER (ibrahimpro) 13 86.44 103.27 4 30.77
16537. Robert (hypersnitch) 13 75.28 95.13 2 15.38
16538. Huy (huygtran123) 13 76.23 81.73 5 38.46
16539. Nguyen (hungnguyen2912) 13 36.37 43.03 1 7.69
16540. Hugh (hughmarch) 13 103.59 134.62 7 53.85
16541. David (hugger69) 13 80.71 87.96 3 23.08
16542. Putra (hoodedproxy) 13 71.01 81.07 4 30.77
16543. Lingxun (hommieinuw) 13 91.32 101.85 5 38.46
16544. Eduard (holykill) 13 102.17 120.24 5 38.46
16545. Holden (holdcop) 13 91.32 105.67 7 53.85
16546. Muhamed (hjewdjsdjsdjs) 13 45.66 50.38 1 7.69
16547. Hi3rra (hi3rra) 13 40.96 47.74 0 0.00
16548. Jake (hero7785) 13 79.81 88.50 4 30.77
16549. script/script (henville12) 13 102.34 115.54 6 46.15
16550. Hehsbb (hehsbb) 13 72.35 91.82 3 23.08
16551. Phan (hed_wig) 13 90.20 101.46 5 38.46
16552. cat (hecknolol2) 13 73.64 102.17 3 23.08
16553. POCARI (hdpocari) 13 76.03 87.72 6 46.15
16554. haytch (haytch) 13 42.91 58.66 1 7.69
16555. Hans5958 (hans5958) 13 80.77 99.43 4 30.77
16556. Halifay (halifay) 13 80.01 88.26 1 7.69
16557. Haduu (hadiysd) 13 98.94 103.27 7 53.85
16558. GrimRaven26 (grim_raven26) 13 56.31 63.56 1 7.69
16559. amber (gremlinx8) 13 101.55 112.83 8 61.54
16560. Kevin (greenleafy) 13 131.59 152.44 8 61.54
16561. Patryk (grayek) 13 83.97 89.76 0 0.00
16562. Brad (godspeed99) 13 86.12 91.93 4 30.77
16563. Kenneth (godfetus) 13 104.78 117.83 6 46.15
16564. Chips (glucose) 13 111.95 137.51 9 69.23
16565. Robert (glixzor) 13 105.94 115.21 5 38.46
16566. gian (gianthetaco) 13 160.27 173.69 11 84.62
16567. Josh (ghostrider5346) 13 54.72 62.87 3 23.08
16568. TMGAMING (ggatorade) 13 71.57 81.81 4 30.77
16569. Gary (ggaarryy12340) 13 65.96 76.03 3 23.08
16570. George (georgepj) 13 58.03 67.45 1 7.69
16571. gian (geefuco) 13 79.75 96.84 3 23.08
16572. Газиз (gazizaskar_) 13 47.45 56.19 0 0.00
16573. Garv (garvgopalia) 13 45.62 52.92 2 15.38
16574. Garrett (garrettn1899) 13 60.09 67.62 2 15.38
16575. TypeLX (gamerleelxo) 13 123.49 135.39 6 46.15
16576. Gabe (gabrielbj29) 13 64.19 83.31 4 30.77
16577. oof (fyestrietser101) 13 125.36 145.57 9 69.23
16578. ^_^ (fuuje) 13 79.57 94.16 5 38.46
16579. Albert (frequentflyer123) 13 100.18 108.17 5 38.46
16580. jurj (fredkag) 13 98.63 115.99 3 23.08
16581. Fedrick (freddybofte) 13 65.10 83.39 0 0.00
16582. Saleh (foxtheonly) 13 50.91 65.86 1 7.69
16583. foveacapitus (foveacapitus) 13 26.63 54.50 8 61.54
16584. Ford Mustang (ford_mustang) 13 38.68 48.34 1 7.69
16585. Dante (flukierclient) 13 70.92 84.30 4 30.77
16586. Ivan (floki12_) 13 62.13 78.83 6 46.15
16587. m (flashyyy) 13 104.09 123.15 13 100.00
16588. fishy15 (fishy15) 13 115.48 138.64 6 46.15
16589. Filipo (filipomarcel) 13 98.07 109.76 8 61.54
16590. Fernando (fer_8888) 13 56.44 67.73 2 15.38
16591. Luao (fencerperson) 13 76.13 88.62 3 23.08
16592. Femosis (femosis) 13 103.45 123.63 6 46.15
16593. Tim (fast_but_not_the_fastest) 13 101.62 117.33 6 46.15
16594. Basil (falaedor) 13 85.00 95.00 4 30.77
16595. m3dou_ (faheemmeharaj123) 13 46.49 84.24 6 46.15
16596. Eva (evyrose2008) 13 55.97 70.18 1 7.69
16597. Ethan (ethanxiaoful) 13 98.08 108.49 5 38.46
16598. Eskooty (eskooty) 13 94.93 105.58 4 30.77
16599. LilCup (epoli0319) 13 60.30 70.53 3 23.08
16600. Epic (epicgamesceo) 13 85.18 102.89 5 38.46
16601. Emilyyyy (emilyyyy26) 13 46.53 58.56 2 15.38
16602. mle (emilyliz) 13 129.23 150.17 8 61.54
16603. Elxius (elxius) 13 81.83 103.07 2 15.38
16604. El (elnotelanor) 13 55.15 61.23 1 7.69
16605. elay (elaytyping) 13 32.59 36.44 1 7.69
16606. Elandaleb (elandaleb) 13 37.08 43.84 0 0.00
16607. Glooberson (eifersucht) 13 82.02 93.90 3 23.08
16608. efradagod (efradagod) 13 86.53 101.75 11 84.62
16609. matu (eepilinemangur1) 13 128.77 174.03 5 38.46
16610. zvgz (eclfppcmommarsuwof) 13 76.38 83.94 5 38.46
16611. Ronnie (ebedebeds) 13 118.51 128.10 6 46.15
16612. Drei (dy539) 13 78.64 85.29 2 15.38
16613. darius (dxriuzs) 13 96.03 107.46 8 61.54
16614. Chuck (dvorakmrcharles) 13 58.20 66.18 1 7.69
16615. Anthony (duragsensei) 13 103.93 117.66 6 46.15
16616. Martin (drudi1902) 13 64.32 73.50 3 23.08
16617. DrPoppyseed (drpoppyseed) 13 81.84 90.50 3 23.08
16618. Nikola (dropndrag) 13 61.55 72.51 2 15.38
16619. Carrot (dreamsode) 13 108.17 116.62 6 46.15
16620. Dream (dreamsnake) 13 96.93 125.37 5 38.46
16621. DrDynamic (drdynamic) 13 82.69 100.98 1 7.69
16622. dqwlol (dqwlol) 13 77.75 89.56 4 30.77
16623. Perfection (doxxx) 13 133.28 159.55 11 84.62
16624. Austin (dorrzun) 13 107.37 135.05 5 38.46
16625. doodezpz (doodezpz) 13 93.59 111.47 5 38.46
16626. Donnkey (donnkey) 13 103.55 119.67 5 38.46
16627. nhentai (dongpo_pork) 13 98.81 113.21 7 53.85
16628. Xian (doggy2021) 13 88.85 100.31 3 23.08
16629. Troy (dogepowers) 13 89.80 102.53 2 15.38
16630. Pisti (doctorstave) 13 100.31 110.87 8 61.54
16631. DoctorN0gloff (doctorn0gloff) 13 134.38 156.19 9 69.23
16632. David (dlefarth) 13 60.31 68.44 2 15.38
16633. Do-Hyun (dkim00) 13 89.30 101.32 6 46.15
16634. dirtydan (dirtyjdan) 13 67.19 71.63 4 30.77
16635. Digo (digocorbellini) 13 81.62 94.34 4 30.77
16636. Nash (digitalnash) 13 127.34 144.25 10 76.92
16637. Diego (diego190401) 13 68.92 84.56 2 15.38
16638. Diaa (diaa001) 13 55.58 73.80 2 15.38
16639. Jacob (destroyer183) 13 75.06 90.90 4 30.77
16640. Delviurge (delviurge) 13 102.58 110.24 7 53.85
16641. JR (deltav) 13 98.75 112.00 4 30.77
16642. Bang (dbgt0008) 13 91.03 106.12 8 61.54
16643. Jepps (dazzle919) 13 117.86 149.79 6 46.15
16644. david (davtet1) 13 88.39 109.42 6 46.15
16645. Bebo (dark__knight_pro) 13 51.52 59.49 3 23.08
16646. DarkLight (darklight17) 13 76.79 89.70 1 7.69
16647. SWAPAN (dapana610) 13 45.30 53.35 1 7.69
16648. Dan (danslaps) 13 84.49 98.58 3 23.08
16649. Daniel (danielstep65) 13 93.19 108.37 3 23.08
16650. Eric (dango499) 13 121.65 136.25 8 61.54
16651. Adam (damadamadamm) 13 76.45 81.23 3 23.08
16652. Matthew (d3f1n3d) 13 113.96 132.83 6 46.15
16653. Nana (cypher404) 13 87.61 109.59 4 30.77
16654. Cynthia (cynthiaparkk) 13 74.68 93.23 5 38.46
16655. ethxn (cxntrxl) 13 88.01 99.79 4 30.77
16656. cupnode (cupnode) 13 51.74 69.65 1 7.69
16657. ymdsji (crostovik) 13 86.58 95.24 5 38.46
16658. Himanshu (crestfalln) 13 54.40 58.65 2 15.38
16659. Craig (craigo76) 13 60.95 72.70 1 7.69
16660. coolslowboy (coolslowboy) 13 67.69 75.14 4 30.77
16661. CoolGuyConnor (coolguyconnor) 13 81.76 91.61 3 23.08
16662. Abrar (computernerdgenius) 13 64.70 75.47 4 30.77
16663. RIP Zyzz (codecub) 13 159.43 187.60 10 76.92
16664. Mike Oxlong (cmc_05) 13 43.77 50.10 4 30.77
16665. Claire (claire_t_bear) 13 75.06 95.21 4 30.77
16666. Mike (chomeror) 13 64.00 74.22 0 0.00
16667. Chirag (chirag2907) 13 49.44 54.35 2 15.38
16668. chipotle06 (chipotle06) 13 96.94 106.80 8 61.54
16669. Chewing (chewing_bever) 13 98.84 118.01 7 53.85
16670. slow typer (chessbobble) 13 85.40 104.26 6 46.15
16671. Charles (charlesdickson1) 13 124.84 136.88 11 84.62
16672. Charlie (chardlz) 13 100.54 118.24 6 46.15
16673. Chandler (chandlerbing123) 13 72.93 82.38 4 30.77
16674. chander (chanderpal) 13 49.40 54.75 0 0.00
16675. Yuri (ceaseless_melon) 13 88.00 104.21 6 46.15
16676. Charlie (cdicey) 13 85.15 103.93 4 30.77
16677. Ententente (carousell) 13 88.43 99.89 6 46.15
16678. Captain (captainrich) 13 69.88 83.92 4 30.77
16679. canwithbeans (canikomaniko1) 13 59.28 72.87 2 15.38
16680. cake (cake0) 13 142.24 163.49 13 100.00
16681. Busky (buskyhusk) 13 94.03 105.56 7 53.85
16682. Minh Kiet (buimonkey) 13 102.66 124.55 4 30.77
16683. Bucky (buhcky) 13 96.70 123.39 5 38.46
16684. Jacky (bubberducky209) 13 94.65 109.74 5 38.46
16685. Ali (bronzor16) 13 95.10 105.99 1 7.69
16686. Brecken (breckenmueller) 13 63.55 72.29 3 23.08
16687. Bosco (bqscopog) 13 93.62 109.18 6 46.15
16688. Borislav (borko_panterata) 13 73.10 85.99 3 23.08
16689. boom (boompotato123) 13 79.20 93.78 3 23.08
16690. serg (bobanuts) 13 81.39 93.33 7 53.85
16691. Bernard's (bmadayag) 13 100.66 118.59 6 46.15
16692. Mary (bloody_mary) 13 69.99 85.40 3 23.08
16693. 🤠👌🏿 (blackclaw) 13 96.85 108.05 6 46.15
16694. bl731mang (bl731mang) 13 93.63 125.60 6 46.15
16695. Hassan (bipedalfrog) 13 39.21 48.49 1 7.69
16696. ed (bigponpon) 13 88.15 102.64 1 7.69
16697. Slobodan (bekca) 13 96.48 111.74 4 30.77
16698. Matthew (befurl) 13 75.52 97.63 5 38.46
16699. Bedilbek (bedilbek) 13 58.52 66.75 4 30.77
16700. Quang (baoquanggogreen) 13 58.03 73.96 2 15.38
16701. NeverLucky (bambooaxe) 13 83.34 94.10 4 30.77
16702. Balka (balka) 13 77.83 91.39 1 7.69
16703. Dulguun (b180950039) 13 52.50 56.00 2 15.38
16704. Aziz (azizxushvaqtov07) 13 53.68 66.45 4 30.77
16705. John (avantegarden) 13 81.53 102.73 4 30.77
16706. Ast (astrxse) 13 85.37 107.56 3 23.08
16707. Ashish (ashish_m) 13 45.45 49.79 3 23.08
16708. B A L O CH (ashfaq4730) 13 100.40 124.31 5 38.46
16709. Arti (artifictional) 13 117.14 129.05 6 46.15
16710. Arissa (arissahsu) 13 101.95 117.19 8 61.54
16711. Arevilov (arevilov_3) 13 77.46 87.21 3 23.08
16712. Aquatic (aquache) 13 84.36 101.05 1 7.69
16713. Mr.Pickles (ap_ultra) 13 93.28 116.72 4 30.77
16714. Andy (andym04) 13 116.29 139.85 9 69.23
16715. Andrew (andvorak) 13 60.50 65.81 3 23.08
16716. Ridge (anawesomefry) 13 85.84 104.82 6 46.15
16717. Allen (analogaio) 13 112.25 139.19 6 46.15
16718. amr (amr_el7afy) 13 33.98 38.98 1 7.69
16719. AmirrezA (amirrezase7en) 13 92.80 106.89 5 38.46
16720. Amiro (amiro74) 13 47.60 52.70 7 53.85
16721. aluminae (aluminae) 13 99.41 113.80 5 38.46
16722. h3llo (alowqo) 13 49.67 57.54 3 23.08
16723. Abdulaziz (aligonijr) 13 59.45 73.40 3 23.08
16724. AKW (alice1120) 13 77.12 86.74 3 23.08
16725. AlexAustria (alexaustria) 13 81.69 88.06 5 38.46
16726. Ayush (akushwaha11) 13 54.92 65.68 1 7.69
16727. Akram (akrammiru) 13 53.00 59.55 1 7.69
16728. akmal (akmalhisyam) 13 42.18 45.43 2 15.38
16729. Akhil (akhillasrado) 13 82.01 96.98 3 23.08
16730. Aidan (aidan9500) 13 84.38 94.46 3 23.08
16731. Alan (affectedmelon) 13 91.60 106.27 4 30.77
16732. Aye (aexerz) 13 69.52 89.08 3 23.08
16733. Adam (aeoff72) 13 84.04 110.68 4 30.77
16734. Adhitya (adhityanugraha96) 13 61.70 69.17 1 7.69
16735. Adedhuman (adedhuman) 13 77.79 86.45 3 23.08
16736. Marco (acopazzo) 13 81.33 91.74 8 61.54
16737. Ace (ace_dragonheart) 13 79.00 103.32 2 15.38
16738. abdullakh (abdullakh) 13 39.67 45.82 5 38.46
16739. Tchaqazbilla (abdesslam47) 13 74.61 81.75 2 15.38
16740. Issaranuwat (aatsaranuwis) 13 60.38 78.48 4 30.77
16741. Danial (6reload) 13 50.07 55.97 4 30.77
16742. Danillo/Avant (60ppm) 13 104.89 118.71 4 30.77
16743. Esso (3sso) 13 85.81 104.02 0 0.00
16744. itchyaminoacid (335080673) 13 89.93 98.40 3 23.08
16745. 1time (1time4da1time) 13 95.75 105.68 4 30.77
16746. 173adrimor (173adrimor) 13 55.76 69.79 4 30.77
16747. Amanda (111_amanda_111) 13 45.06 59.62 0 0.00
16748. ekrem. (100percentnonquit) 13 123.55 150.38 6 46.15
16749. Dominic (dominic127) 13 83.64 94.70 5 38.46
16750. Maizzie (maizzie) 13 109.94 133.04 4 30.77
16751. QcDaark (qcdaark) 13 59.45 71.61 4 30.77
16752. Harishan (hari1111) 13 98.34 113.50 5 38.46
16753. brendan (brendan4t) 13 61.63 70.27 3 23.08
16754. Metallic Pea (cooler420) 13 87.15 97.30 3 23.08
16755. Keith (fingers_skills) 13 70.91 77.66 4 30.77
16756. Gonen (gonengazit) 13 78.60 96.60 1 7.69
16757. JSU (mr_funiman) 13 68.69 85.03 5 38.46
16758. Matt (dabagraham) 13 84.69 102.39 2 15.38
16759. Knight (knightbedo) 13 59.19 70.44 2 15.38
16760. vasu (vasu021191) 13 75.66 86.67 6 46.15
16761. granola (granolagobbler) 13 67.88 74.76 1 7.69
16762. Kong (denusklo) 13 47.19 51.55 2 15.38
16763. kaden (hobby273broken) 13 39.60 56.70 9 69.23
16764. Rasmus (seglats) 13 48.31 56.65 0 0.00
16765. AyK3r (junior_mlg12) 13 49.76 60.32 1 7.69
16766. Kritika (phoenix_1307) 13 51.42 60.90 1 7.69
16767. Jorge (sheparddow) 13 59.10 68.44 3 23.08
16768. Welton (wxavier) 13 73.88 84.54 3 23.08
16769. Shin (overgeared_god_grid) 13 71.08 80.88 1 7.69
16770. CrayonMuncher (shanejefferson) 13 91.00 99.99 4 30.77
16771. Zeph (zeph_) 13 74.89 92.66 13 100.00
16772. forCodeIns (synowcode) 13 44.80 56.76 3 23.08
16773. Marco (makoko) 13 39.81 45.73 4 30.77
16774. Castlekeepers (castlekeepers) 13 86.68 98.30 2 15.38
16775. Demon (demon_rocrip) 13 69.51 78.58 2 15.38
16776. Alonso (lazerblade14) 13 60.81 80.25 1 7.69
16777. Sigma.Driver (thotslayerron) 13 62.24 72.37 3 23.08
16778. sunil (sunil1990) 13 51.14 57.45 2 15.38
16779. Sophie (sophienguyen2004) 13 65.46 83.49 4 30.77
16780. Gabriel (gabo16quito) 13 62.10 68.07 2 15.38
16781. Adler (adlerbrin) 13 50.54 64.87 1 7.69
16782. Typing_King (typing_king_123) 13 91.22 111.67 8 61.54
16783. wooksen. (wooksen) 13 75.24 86.95 7 53.85
16784. Simon (simon1293) 13 93.03 109.94 3 23.08
16785. josesi (nuevetails) 13 56.75 76.96 2 15.38
16786. Morsbøl (morsboel) 13 83.94 103.84 2 15.38
16787. Marcie (dinkteam) 13 80.82 109.74 6 46.15
16788. arrathore (arrathore) 13 95.57 120.72 4 30.77
16789. jym (jjimjjam) 13 91.92 102.53 3 23.08
16790. Max (rebel_dog) 13 47.88 56.44 0 0.00
16791. Franco (franco404) 13 47.66 56.07 1 7.69
16792. Tachy_Bunker (lo23co7mcpe) 13 90.54 99.66 8 61.54
16793. Roronoa (roronoa_zoro007) 13 51.56 60.45 1 7.69
16794. Alfonso (aagtyperacer) 13 47.98 61.58 2 15.38
16795. Boy Wonder (coding_ninja) 13 54.05 67.96 4 30.77
16796. Nook (nookydoki) 13 70.44 95.02 1 7.69
16797. Charlie (charlzalan) 13 88.31 101.96 5 38.46
16798. The_mayo (rilven) 13 56.97 63.30 1 7.69
16799. Jerome (jerometan) 13 55.34 69.31 3 23.08
16800. Harsh (captain_booga) 13 43.97 52.66 1 7.69
16801. Sabila (sabilaferisya) 13 70.66 85.41 3 23.08
16802. Kevyn (k3vsk1) 13 82.28 102.06 6 46.15
16803. AntMan (antmanreis) 13 86.04 103.89 6 46.15
16804. Audrey (aubreerybak) 13 90.64 101.24 4 30.77
16805. Caitlin (lemoniio) 13 77.96 89.56 6 46.15
16806. breadstick (main32134) 13 88.78 102.46 9 69.23
16807. William (willythewilly) 13 65.98 85.78 1 7.69
16808. Oussama (kappachier) 13 94.06 116.55 6 46.15
16809. faizal (faizal104) 13 33.77 43.55 2 15.38
16810. Darel (dareeellll) 13 73.12 84.09 3 23.08
16811. Hashim (pheonixflame77) 13 41.19 48.56 0 0.00
16812. Ilmari (kaljis) 13 45.59 50.37 2 15.38
16813. Michael (michaeltol) 13 48.48 56.85 2 15.38
16814. Khalifa (justkhalifa) 13 82.19 99.62 6 46.15
16815. Jason Oh (sohleil) 13 75.24 82.93 3 23.08
16816. Jun Kai (phangseafood) 13 50.28 59.67 1 7.69
16817. Manjeet (manjeet1528) 13 48.72 61.91 1 7.69
16818. FlameMage (flamemage) 13 98.44 111.62 4 30.77
16819. Markee (itsmarkee) 13 75.95 98.86 7 53.85
16820. Jasmine (jazzqt) 13 71.38 92.33 5 38.46
16821. Ash (ashgen10) 13 38.15 42.65 1 7.69
16822. takki (liltakki) 13 60.11 83.78 4 30.77
16823. Himanshu (aatransh) 13 45.13 58.27 0 0.00
16824. Kenkz (kenkodstark) 13 65.36 77.32 2 15.38
16825. Nick (christophermarto) 13 54.43 64.79 4 30.77
16826. Jakub (piorunpl) 13 65.07 75.70 2 15.38
16827. DK (dkbozz) 13 65.81 70.99 4 30.77
16828. Sky (_kuraaiii) 13 56.64 79.25 4 30.77
16829. Sergio (sergio91) 13 53.91 59.98 3 23.08
16830. CeepTheMaker101 (ceepthemak... 13 91.98 110.60 5 38.46
16831. seashell (seashell508) 13 39.12 46.87 5 38.46
16832. Dylan (ap0k) 13 91.31 101.09 5 38.46
16833. BraveBer (braveber) 13 66.32 78.32 2 15.38
16834. jiwanshu (jiwanshu_rajput) 13 44.12 62.01 3 23.08
16835. Bintang (bintangdace) 13 91.02 100.30 1 7.69
16836. Ahmed (__ahmed__) 12 80.03 87.58 6 50.00
16837. Zoniax (_zephr) 12 87.77 111.96 4 33.33
16838. Rodrigo (zurrion) 12 101.43 118.53 12 100.00
16839. Zuhes (zuhes7) 12 81.14 89.96 5 41.67
16840. zach (zinfinte57) 12 58.10 62.94 3 25.00
16841. InVerse (zenmonkinverse) 12 90.34 101.06 5 41.67
16842. zehvvu (zehvvu) 12 72.89 77.47 6 50.00
16843. Zeerox (zeerox) 12 61.77 73.61 1 8.33
16844. William (yuwan1) 12 52.70 77.01 2 16.67
16845. Josh (yungjosh) 12 117.69 132.51 6 50.00
16846. APPLE (ytfox_roller) 12 68.59 90.86 5 41.67
16847. andy (yourmumgey) 12 100.25 128.97 5 41.67
16848. Johannes (yoshgasm) 12 48.13 54.04 0 0.00
16849. yellow (yellow00) 12 42.58 51.61 2 16.67
16850. Ayaan Iftikhar YT (yeet_ayaan) 12 39.63 46.20 3 25.00
16851. Yakti (yaktithewise) 12 91.10 104.10 8 66.67
16852. Lorenzo (xxx69420xxx) 12 60.99 77.93 7 58.33
16853. XXV6 (xxv6) 12 54.99 61.17 2 16.67
16854. Hassan (xxhassanixx) 12 93.18 112.44 4 33.33
16855. Erik (xuj1) 12 73.67 78.63 2 16.67
16856. xLukeAzade (xlukeazade123) 12 57.70 67.27 1 8.33
16857. xelopan (xelopan) 12 92.75 104.82 4 33.33
16858. Xbeeft (xbeeft) 12 79.01 95.87 9 75.00
16859. Jakub (xaneth) 12 100.80 115.61 4 33.33
16860. レンゾ (wrenji) 12 81.74 92.88 2 16.67
16861. Ryan (wow963) 12 146.26 164.67 11 91.67
16862. David (wookiewarrior07) 12 85.79 100.54 3 25.00
16863. Willie (williecubed) 12 104.27 116.34 4 33.33
16864. William (willezur) 12 99.30 127.88 5 41.67
16865. Wildan (wildan_fachriz24) 12 67.22 81.35 4 33.33
16866. John (wegelius) 12 77.75 102.18 3 25.00
16867. Arvid (warpzep) 12 51.29 68.22 0 0.00
16868. Eric the Topre King (wanger... 12 130.59 155.96 9 75.00
16869. Walfel (walfel) 12 83.54 97.39 3 25.00
16870. Wahid (wahidhamidi707) 12 51.94 63.58 1 8.33
16871. Dorime (vojing) 12 112.59 123.22 6 50.00
16872. Vlad (vlados_shikos) 12 73.28 91.62 0 0.00
16873. Viper (viper04) 12 74.65 89.52 5 41.67
16874. Vigeous (vigeous) 12 38.24 51.93 2 16.67
16875. Vin (vibnarcus) 12 72.33 80.35 4 33.33
16876. Kyle (vertwon) 12 60.42 68.26 2 16.67
16877. Steven (venste_) 12 72.17 79.59 1 8.33
16878. Alexander (vennor) 12 81.58 95.82 3 25.00
16879. Josh (velocity92c) 12 121.23 140.43 7 58.33
16880. Javi (vatojavier) 12 42.78 54.57 2 16.67
16881. violet (validfingers) 12 95.95 106.56 12 100.00
16882. uxvb (uxvb) 12 109.36 143.83 5 41.67
16883. Unknownbean (unknownbean) 12 67.85 84.27 0 0.00
16884. Bojack (uberjoe) 12 110.99 133.12 7 58.33
16885. in (uaqlover) 12 36.33 43.17 1 8.33
16886. default car (typingslowly) 12 99.12 112.92 6 50.00
16887. Typing (typinglegend16) 12 76.95 88.29 3 25.00
16888. karl (type_of_all_types) 12 67.49 76.69 5 41.67
16889. S (typer78) 12 28.90 32.21 2 16.67
16890. Tom (twmc) 12 99.92 128.89 8 66.67
16891. (tulasaeueng) 12 92.33 101.58 2 16.67
16892. Zoomies (tthuang1998) 12 98.73 116.31 5 41.67
16893. Rudolf (trudo) 12 71.18 78.48 4 33.33
16894. TroulM (troulm) 12 88.06 102.85 4 33.33
16895. TrainTrains (traintrains) 12 71.73 89.48 4 33.33
16896. Arthur Toppenberg (tpperware) 12 49.18 57.57 7 58.33
16897. Eric (toniseo) 12 73.60 81.10 6 50.00
16898. Nadhim (tnadhim) 12 58.71 75.78 1 8.33
16899. Alex B (tisan05) 12 69.28 87.33 6 50.00
16900. Stifmeister (the_stifmeister) 12 107.67 133.41 8 66.67
16901. . (the_ohioan) 12 90.98 100.23 2 16.67
16902. yoshi (themune) 12 84.49 95.79 1 8.33
16903. Seth (thefoxarmy) 12 77.35 90.64 4 33.33
16904. Daan (thedr3aded) 12 78.57 96.17 4 33.33
16905. Amy (thedoctastardis) 12 51.45 64.22 1 8.33
16906. cring (thatguyyoudontknow) 12 69.17 86.43 4 33.33
16907. A (terrible_penguin) 12 56.35 68.76 1 8.33
16908. Terkozz (terkozz) 12 67.85 88.89 3 25.00
16909. Tom (tcrman) 12 70.41 82.95 1 8.33
16910. tangjm5 (tangjm5) 12 107.36 117.43 8 66.67
16911. TacticalTux (tacticaltux) 12 119.20 130.15 9 75.00
16912. Tosic (t0sic) 12 86.94 95.09 6 50.00
16913. Arles (synthicalarles) 12 61.38 73.45 12 100.00
16914. swxh89 (swxh89) 12 109.35 124.45 8 66.67
16915. Sweefty (sweefty) 12 71.76 79.31 2 16.67
16916. Allen (swaggerinooo) 12 112.18 135.99 11 91.67
16917. Benjie (superbench03) 12 76.98 92.94 2 16.67
16918. Duc (sungjinwoo2001) 12 48.47 56.11 1 8.33
16919. sungit2g (sungit2g) 12 80.75 96.03 3 25.00
16920. May (suddy) 12 52.24 60.03 2 16.67
16921. Josh (cuddlysamurai) 12 46.52 56.58 0 0.00
16922. Strudle (strudlepoodel) 12 102.98 113.01 8 66.67
16923. frog (strawfrog) 12 86.49 94.62 5 41.67
16924. Manuel (stonesitter) 12 70.11 79.12 2 16.67
16925. Stewhog (stewhog) 12 55.94 76.50 2 16.67
16926. Steve (steve5731) 12 84.63 95.64 4 33.33
16927. Stella (stellaoctangula) 12 80.60 99.24 1 8.33
16928. Sergey (steelassasin) 12 68.54 77.77 1 8.33
16929. Marshall (stackattack14) 12 100.80 118.15 7 58.33
16930. 📵 (sstormwolf22) 12 105.66 123.30 2 16.67
16931. u slow (spyie) 12 37.62 44.36 3 25.00
16932. Splash (splashcc) 12 108.27 119.15 7 58.33
16933. Faleye Slaven (speedhell) 12 30.04 35.12 2 16.67
16934. Spafa (spafa) 12 93.66 110.95 5 41.67
16935. spacehrt (spacebop) 12 73.52 90.84 2 16.67
16936. Ui (so_ta) 12 83.25 96.75 7 58.33
16937. Soul (soul_eater22) 12 77.10 98.34 2 16.67
16938. soopasoop (soopasoop) 12 48.16 54.91 1 8.33
16939. sompur (sompurkrz) 12 86.85 95.24 4 33.33
16940. (solov) 12 168.86 215.13 11 91.67
16941. Daniel (smurfzilla) 12 76.26 101.05 5 41.67
16942. Stacie (slyfoxxli) 12 72.27 88.64 4 33.33
16943. shams (slo_shams) 12 29.44 34.82 1 8.33
16944. MrBoombastic (sloth_express) 12 60.39 66.59 0 0.00
16945. sanic (sleepmoar) 12 118.63 141.66 11 91.67
16946. Pau (skuhls) 12 58.29 63.18 1 8.33
16947. Nicolas (skinny13timmy) 12 90.68 98.98 2 16.67
16948. taichi (sjwsl) 12 59.41 68.42 2 16.67
16949. Ofir (sipthesoup) 12 86.30 99.05 4 33.33
16950. Simmons2 (simmonsgarbageacc... 12 72.26 91.07 9 75.00
16951. Chris (silentshot64) 12 89.97 99.38 6 50.00
16952. Sierra (sierrasetliff) 12 62.12 73.14 3 25.00
16953. Siddarth (siddthekid1) 12 41.74 50.66 2 16.67
16954. Justin (shouganai_1243) 12 63.69 79.47 1 8.33
16955. Oscar (shopsketch) 12 59.79 65.19 1 8.33
16956. Shoden (shoden) 12 69.63 77.54 4 33.33
16957. Shilo (shilomazouz) 12 72.08 78.43 4 33.33
16958. Shayaan (shayaan206) 12 52.64 65.44 0 0.00
16959. Shantanu (shatanu) 12 58.18 70.27 1 8.33
16960. Sharon (sharon102) 12 42.97 49.98 1 8.33
16961. Aran (sharon032588) 12 96.54 122.38 5 41.67
16962. Big Booty T (sexy_dino) 12 87.42 95.92 2 16.67
16963. sen (senoryx) 12 47.24 55.93 4 33.33
16964. Sendy (sendyakbar) 12 79.93 88.87 3 25.00
16965. SAIF (sci_fi_saif) 12 59.07 66.34 2 16.67
16966. ScanCode (scancode8) 12 59.72 74.49 1 8.33
16967. solsol (scakes) 12 72.18 83.36 2 16.67
16968. Sam (sbush) 12 57.09 69.86 1 8.33
16969. Sausage (sausage_person) 12 77.39 89.43 3 25.00
16970. Saruwatori (saruwatori) 12 81.49 87.18 4 33.33
16971. sara (saramcr) 12 44.16 49.02 0 0.00
16972. Indic (sanatanify) 12 73.33 81.29 4 33.33
16973. sajald77 (sajald77) 12 79.65 92.69 1 8.33
16974. sacresful (sacresful) 12 86.21 94.95 3 25.00
16975. btst (sabelle_) 12 129.72 145.29 5 41.67
16976. sıןʌɥɹ (s1lvhr) 12 88.52 95.56 3 25.00
16977. Vali (ryuzul) 12 100.03 129.08 9 75.00
16978. Jeremy (ryusaki626) 12 80.28 93.91 7 58.33
16979. Rudra (ryder_on_the_storm) 12 96.72 112.66 9 75.00
16980. R (ry20) 12 93.30 101.85 7 58.33
16981. Run (runring) 12 63.51 74.68 3 25.00
16982. T Lewis (runnamok) 12 61.28 67.08 5 41.67
16983. Ralph (rotifer_) 12 47.40 65.63 2 16.67
16984. Shamsuddin (rony0092) 12 43.88 49.68 1 8.33
16985. Tí cần không bạn (ron... 12 59.27 74.33 2 16.67
16986. Hi (rom_s) 12 56.47 64.92 1 8.33
16987. Sergi (rolodophone) 12 74.01 86.62 4 33.33
16988. Jem (rollingapple) 12 101.51 123.10 8 66.67
16989. Rokuazery (rokuazery) 12 83.90 92.04 2 16.67
16990. Rohan (rohan625) 12 54.45 63.51 0 0.00
16991. Julian (rocky_succ) 12 82.66 94.01 2 16.67
16992. robby (robby27) 12 71.86 82.56 4 33.33
16993. Arminda (rmnduhh) 12 93.04 109.23 5 41.67
16994. Jim (rl_magikz) 12 55.28 68.01 4 33.33
16995. John (rlawldjs) 12 64.96 72.23 2 16.67
16996. Ritam (ritam_123) 12 79.23 87.23 6 50.00
16997. Rikos99 (rikos_omegalul) 12 68.44 80.83 4 33.33
16998. e (revengepug) 12 102.07 123.96 8 66.67
16999. George (relaxed_20) 12 58.75 69.93 1 8.33
17000. gabe (rasalguhl) 12 99.53 106.76 2 16.67
17001. Yokaii (rartiko) 12 63.10 75.81 0 0.00
17002. Caio (raposo) 12 62.19 70.93 3 25.00
17003. Alex (ramini0000) 12 62.71 68.95 2 16.67
17004. Grant (ragecandybar) 12 86.97 102.86 5 41.67
17005. aerar (raale) 12 82.18 102.49 5 41.67
17006. Attican (r4ne) 12 76.82 86.53 2 16.67
17007. rocky (r0ckyy) 12 61.53 71.32 1 8.33
17008. Desh (quickzero) 12 106.92 121.52 3 25.00
17009. julian (quasiker) 12 84.08 104.05 4 33.33
17010. punj (punj) 12 76.80 87.62 2 16.67
17011. cockn (pugzip) 12 59.59 71.73 4 33.33
17012. oleg (prot64) 12 76.76 92.01 3 25.00
17013. Pratham (pratham522) 12 43.90 49.01 1 8.33
17014. gb (practicegb) 12 92.37 110.48 4 33.33
17015. Prabhu (prabhusengal) 12 85.06 97.14 4 33.33
17016. Param (pparam5241) 12 77.95 89.41 6 50.00
17017. posaidon (posaidon0802) 12 86.34 97.37 4 33.33
17018. poparaliais (poparaliais) 12 80.15 95.19 4 33.33
17019. Jared (pizzj) 12 74.63 85.20 3 25.00
17020. pizzapablo (pizzapablo) 12 71.87 82.45 12 100.00
17021. Pine (pinechristmas) 12 68.57 79.11 4 33.33
17022. pigeon (pigeon_kun) 12 90.08 108.60 2 16.67
17023. Phobic (phobic21) 12 65.71 81.82 7 58.33
17024. Duy (phamanhduy1990) 12 72.38 80.25 0 0.00
17025. petnob (petnob1987) 12 57.65 65.15 2 16.67
17026. Vicky (person4115) 12 99.10 122.86 2 16.67
17027. Andrew (penguingm1) 12 114.55 129.62 8 66.67
17028. Pika (paxn) 12 89.83 104.69 4 33.33
17029. Mr nyash (paw_sensei) 12 62.53 71.78 2 16.67
17030. Paulian (paulian7) 12 90.39 117.59 2 16.67
17031. Arttu (patu556) 12 57.07 63.03 0 0.00
17032. Parag (paranolverizer) 12 50.82 61.17 4 33.33
17033. Dejan (paranoid112122) 12 44.78 52.58 2 16.67
17034. Pan con Palta (panconpalta123) 12 70.42 91.34 2 16.67
17035. Padwes (padz_kurawa) 12 79.39 96.53 5 41.67
17036. Owen (owentemp) 12 40.26 50.02 1 8.33
17037. Osso (ossobuko) 12 61.42 66.17 2 16.67
17038. HM (opwpahfohuaehiodbfaiwvb... 12 67.15 76.08 2 16.67
17039. omnomnomnom (omnomnomnomnom... 12 68.97 79.26 3 25.00
17040. Omar (omar_letaief) 12 81.85 92.54 2 16.67
17041. Nathan (oliblish) 12 82.42 100.42 1 8.33
17042. twin (oiaao) 12 55.65 63.02 2 16.67
17043. prince (ohnoheisgoodxd) 12 78.09 87.80 12 100.00
17044. ochko (ochkofficial) 12 72.45 85.87 6 50.00
17045. Pepper (ocean_orca) 12 51.35 56.35 2 16.67
17046. VietCoffee (nytrogen99) 12 117.63 134.00 10 83.33
17047. Nyle (nyle_14) 12 80.47 87.87 4 33.33
17048. Nghia (ntn20112006) 12 87.16 102.93 3 25.00
17049. spoon (noyoureaspoon) 12 88.43 101.69 5 41.67
17050. not a typerace account (not... 12 49.01 59.35 4 33.33
17051. Aaron (noobschizz) 12 64.73 72.41 2 16.67
17052. Andrew (noobhunter) 12 124.72 143.32 4 33.33
17053. Nicholas (nkaechele) 12 80.21 89.26 3 25.00
17054. ninguart (ninguart) 12 102.79 126.68 6 50.00
17055. Much (nikitin) 12 86.27 92.06 4 33.33
17056. Liema (nidoc) 12 77.07 86.73 12 100.00
17057. Nick (nickjj) 12 66.59 83.92 3 25.00
17058. Van (nickislit14) 12 77.99 87.63 7 58.33
17059. Niaz (niaztypist) 12 36.34 43.80 0 0.00
17060. Phuc (nholoinhoi) 12 85.42 97.66 5 41.67
17061. Qwerty (nhaye23) 12 58.55 69.03 0 0.00
17062. wen (neverwen) 12 96.38 116.49 5 41.67
17063. Serena (nerdyjoker) 12 108.08 122.70 6 50.00
17064. Neil (neilprime16) 12 84.25 106.10 4 33.33
17065. Vickus (natowns24) 12 81.22 96.81 3 25.00
17066. Nils Backman (naip12) 12 63.54 87.15 4 33.33
17067. Krombaa (nadergharsallah) 12 54.67 64.51 4 33.33
17068. Midhun (mythicalun) 12 112.51 132.93 8 66.67
17069. Blake (mysticz8) 12 59.78 71.07 2 16.67
17070. Mike (mybroom10) 12 85.86 112.61 3 25.00
17071. Rohit (murphy053) 12 64.21 71.45 0 0.00
17072. Mason (mtyperxd) 12 66.84 79.98 5 41.67
17073. Slowpez (mr_slowpez) 12 98.31 110.93 1 8.33
17074. barrack (mr_sandwich1871) 12 105.97 128.25 6 50.00
17075. Marc (mrthegreattypist) 12 55.62 64.08 1 8.33
17076. lhagvaag0d (mr4thousands_) 12 36.67 44.30 5 41.67
17077. Anton (mountainhills) 12 77.38 96.28 2 16.67
17078. austin (monkey648) 12 103.11 119.17 5 41.67
17079. Moniba (moniba) 12 52.39 58.81 0 0.00
17080. mohamed (mohamed_rekaya) 12 57.85 75.60 2 16.67
17081. Steven (misterpear) 12 117.04 128.88 4 33.33
17082. migueles (miqriba) 12 61.78 69.03 3 25.00
17083. Peter (minend) 12 104.07 127.43 9 75.00
17084. jhon (millkman) 12 35.21 40.15 1 8.33
17085. mildlyaggressivecherry (mil... 12 101.87 112.28 6 50.00
17086. Mike (mikystevan) 12 81.37 91.93 3 25.00
17087. Mike (mike6) 12 54.16 64.34 0 0.00
17088. Mikayla (mikaylahumphrey) 12 107.79 128.47 6 50.00
17089. Micah (micahnical) 12 82.19 107.52 1 8.33
17090. Nikolaj (mexination) 12 52.88 65.16 0 0.00
17091. Mexero (mexero) 12 37.40 41.43 1 8.33
17092. Prakhar (menate) 12 64.49 81.58 4 33.33
17093. Melo (melolem) 12 67.48 75.52 4 33.33
17094. bokonet (mehrshadk05) 12 66.23 74.85 7 58.33
17095. platnot (mega2053) 12 86.92 103.35 8 66.67
17096. Mbenga (mbenga) 12 80.01 100.05 2 16.67
17097. Sofia (mayi_o4) 12 70.49 87.51 7 58.33
17098. Julian (mataleao) 12 64.98 71.78 2 16.67
17099. patrick (mastercraft33) 12 58.01 67.78 3 25.00
17100. Magister (masterbert02) 12 60.39 66.97 6 50.00
17101. Perestoronina (mashavtnke) 12 54.17 65.45 1 8.33
17102. Martin (martin_juan) 12 75.41 85.51 3 25.00
17103. Martin (martinthebest) 12 103.41 121.64 6 50.00
17104. Kayla (martina1155) 12 30.41 36.54 1 8.33
17105. Marie (marsiepatootie) 12 77.96 99.61 4 33.33
17106. TyperRacer (marccraft) 12 86.73 100.84 3 25.00
17107. Manraj (man_123lama) 12 78.18 90.53 3 25.00
17108. Manish (manishspot) 12 56.44 62.18 2 16.67
17109. Manguy McPersonface (manguy... 12 66.43 79.78 3 25.00
17110. Kyunghwan (mallardk0h) 12 84.37 100.22 2 16.67
17111. M (maddyjune) 12 86.11 104.51 2 16.67
17112. Mada (mada_) 12 94.57 106.51 1 8.33
17113. Manoj (m00npie) 12 55.65 62.73 3 25.00
17114. thompson (lulugaming_da_pro... 12 79.78 88.35 7 58.33
17115. LUka (lukazmaj) 12 54.74 62.67 3 25.00
17116. (luclukiluc) 12 82.23 94.99 3 25.00
17117. lubi222 (lubi222) 12 124.09 140.97 6 50.00
17118. LordxChongo (lordxchongo) 12 47.86 62.71 7 58.33
17119. Locklyn (locky_) 12 84.08 102.31 2 16.67
17120. Lori (ljflute) 12 95.72 119.38 4 33.33
17121. Lizard (lizardk99) 12 95.42 108.46 4 33.33
17122. fusaishi (litaoge) 12 81.11 93.13 7 58.33
17123. Le Linh (linhkhanhslee) 12 46.29 55.39 1 8.33
17124. Lily (lilythemc) 12 63.14 73.81 0 0.00
17125. Nandies (lilnandies) 12 64.93 73.44 3 25.00
17126. Hisoka (lev872) 12 30.98 35.61 2 16.67
17127. Lila_lut (lei_ruth) 12 73.36 84.32 4 33.33
17128. Iota (legendary_alpha) 12 57.61 65.15 7 58.33
17129. Leang (leangsopoar) 12 48.69 55.53 0 0.00
17130. britney (leah8jean) 12 47.68 62.05 2 16.67
17131. Jan (latino_dino) 12 47.18 54.15 0 0.00
17132. cyamon (kuthiphenchodi) 12 92.39 109.87 5 41.67
17133. Christian (kunuc) 12 89.37 102.39 5 41.67
17134. Krutik (krutikp) 12 66.51 74.50 3 25.00
17135. kovi (kovizzz) 12 100.88 121.63 4 33.33
17136. Koshi (koshigaming) 12 94.69 110.80 5 41.67
17137. Knot (knotcj) 12 69.81 85.89 4 33.33
17138. Klog (klog53) 12 104.94 122.64 5 41.67
17139. matt (kingspyfox) 12 60.34 68.35 3 25.00
17140. BingBong (kingcaiden66) 12 99.10 110.18 5 41.67
17141. Orban (killhorizon23) 12 73.32 87.90 2 16.67
17142. Kebee (kevwickz) 12 92.10 100.49 7 58.33
17143. Herb (kellzer) 12 82.23 99.03 4 33.33
17144. Kean (kean_saneki) 12 71.48 89.26 2 16.67
17145. Kunal (kc596) 12 69.64 75.23 1 8.33
17146. John (kasi95) 12 68.28 78.22 4 33.33
17147. Kanav (kanav__trying) 12 55.41 64.20 0 0.00
17148. Chris Jozef Cad (kamireign) 12 98.72 112.05 5 41.67
17149. Kacper (kacpix2000) 12 109.17 145.07 8 66.67
17150. Lev (kaberan) 12 34.27 39.64 0 0.00
17151. 🤜🏻 (k1s_darya) 12 89.14 101.98 2 16.67
17152. Joe (jych0) 12 83.20 95.53 6 50.00
17153. jwt4517 (jwt4517) 12 99.82 111.07 8 66.67
17154. L (just_a_random_guy_123) 12 71.39 83.11 2 16.67
17155. isaac (justisaac5) 12 76.17 87.24 0 0.00
17156. Julian (julianjelfs) 12 59.49 69.87 1 8.33
17157. JuanDeag111 (juandeag111) 12 83.82 94.58 3 25.00
17158. n (jtrondy) 12 90.49 103.76 6 50.00
17159. Flank (jtall4747) 12 81.07 99.94 1 8.33
17160. JOSH (jo_dpe) 12 82.15 96.48 3 25.00
17161. jonathan (joschio_o) 12 66.32 79.17 1 8.33
17162. Jonathan (jon_daub) 12 82.43 105.17 2 16.67
17163. Esketit (jony1525) 12 95.47 112.09 7 58.33
17164. Johnny (johnnytct) 12 73.89 87.05 6 50.00
17165. Joel (joel10) 12 48.79 54.87 3 25.00
17166. Joseph (joegoldman) 12 105.40 115.18 8 66.67
17167. Jared (jm1289) 12 58.36 66.30 3 25.00
17168. jimi (jimi79) 12 92.85 108.58 10 83.33
17169. Jay (jgupta) 12 98.32 116.83 6 50.00
17170. asldjf (jfulle3518) 12 111.62 132.32 6 50.00
17171. Jess (jessnguy) 12 58.42 72.71 1 8.33
17172. A (jenniesana) 12 74.03 91.46 5 41.67
17173. Triết (jean2002) 12 40.42 47.63 4 33.33
17174. Jd (jdthebeanbag) 12 58.85 67.14 1 8.33
17175. Jatin (jcsteelbender) 12 95.83 106.89 6 50.00
17176. Michael (javamorris) 12 101.73 114.63 6 50.00
17177. Debbie (jaedee_debbie) 12 68.42 82.96 4 33.33
17178. Tim (jackychan564) 12 100.98 129.47 4 33.33
17179. Jackson (jacksons123) 12 94.99 109.82 2 16.67
17180. jachym (jachymneumipsat) 12 41.89 48.44 0 0.00
17181. Justin (iukekini) 12 105.57 115.53 6 50.00
17182. Bryle (itsbrytastic) 12 100.16 114.74 7 58.33
17183. sasuke_uchihha (ironman1123) 12 61.57 67.97 0 0.00
17184. Duy (invinduy) 12 82.24 100.94 10 83.33
17185. Intesar (intesar) 12 61.83 71.13 3 25.00
17186. InfiniteCows (infinitecows) 12 98.50 113.08 8 66.67
17187. Azer (imranovazer) 12 38.50 53.02 0 0.00
17188. tstats[ilyadancshp] (ilyada... 12 66.42 72.36 3 25.00
17189. Alonso (igoalonso) 12 63.20 75.70 3 25.00
17190. Moatasem (idolzy_123) 12 104.84 119.14 5 41.67
17191. Erin (iceflake) 12 84.59 101.62 3 25.00
17192. Daniel (ibedacaptainofdaship) 12 103.05 121.60 4 33.33
17193. VPK (iamvpk) 12 87.11 103.12 6 50.00
17194. Adam (iadam368) 12 72.36 81.95 10 83.33
17195. yoyo (i0y0) 12 53.17 60.04 0 0.00
17196. Andrew (hurricaneandrewbs) 12 85.44 96.96 2 16.67
17197. Hunter (hunterschool22) 12 103.35 116.33 8 66.67
17198. Hramich (hramich) 12 57.22 64.07 2 16.67
17199. Name (housewren) 12 112.40 140.47 8 66.67
17200. houka (houka) 12 79.15 97.01 6 50.00
17201. Peter (hoopla27) 12 75.09 89.49 3 25.00
17202. Juan Raphael (homonovus97) 12 51.72 56.83 1 8.33
17203. awesome (hobo223) 12 91.43 101.80 5 41.67
17204. I_will_not_tell (hitme1111) 12 24.34 28.31 1 8.33
17205. doubt (hightness) 12 86.25 95.30 3 25.00
17206. xi (highrizery) 12 70.30 78.21 2 16.67
17207. hhh (hhhaaahhhaa) 12 74.95 89.15 3 25.00
17208. Alex (heikale) 12 59.56 75.92 1 8.33
17209. Afifu (healme) 12 60.81 74.00 4 33.33
17210. Henry (hchen1021) 12 79.60 92.97 3 25.00
17211. Janet (hasuhime) 12 70.31 85.99 4 33.33
17212. Hashrin (hashrin) 12 75.83 94.51 4 33.33
17213. Harsha (harshatalla) 12 64.98 79.11 3 25.00
17214. Ahsan (haris_ahmed) 12 95.76 106.06 11 91.67
17215. harcipulyka (harcipulyka) 12 71.02 79.90 3 25.00
17216. Haotian (haotianxu) 12 106.70 120.85 4 33.33
17217. j (hanjam) 12 81.19 88.20 4 33.33
17218. Maurice (halpibad) 12 49.23 60.22 1 8.33
17219. cleve. (haipong) 12 123.17 137.28 8 66.67
17220. Kevin (hadoukevin) 12 90.48 101.56 4 33.33
17221. Joseph (gov_issued) 12 97.35 108.56 0 0.00
17222. Zack (goodguyzack) 12 79.52 94.65 9 75.00
17223. GIMLY98 (gimly98) 12 88.01 111.61 5 41.67
17224. Giancarlo (giancarlo_sturla7) 12 97.75 108.17 5 41.67
17225. George (georgedmi) 12 74.83 83.00 0 0.00
17226. Deepak (gdn_td) 12 77.74 92.49 5 41.67
17227. Jayden (gaminglz) 12 85.41 101.85 3 25.00
17228. Michel (gamerz026) 12 93.80 108.63 5 41.67
17229. Friz64 (friz64) 12 78.36 95.91 0 0.00
17230. FrankSauve (franksauve) 12 67.65 80.68 4 33.33
17231. Foxrumor (foxrumor) 12 67.18 81.98 5 41.67
17232. Joel (fonke) 12 80.04 100.64 4 33.33
17233. Matt (flamingbear) 12 79.98 89.80 7 58.33
17234. Filip (filipge) 12 47.53 54.71 1 8.33
17235. Finch (ficxjo) 12 117.93 146.31 6 50.00
17236. fetix (feticks) 12 93.82 121.63 2 16.67
17237. Hien (feederchuluc96) 12 50.59 58.26 1 8.33
17238. Fangxing (fangoling) 12 56.85 64.79 3 25.00
17239. A (fancy_potato) 12 61.59 85.97 3 25.00
17240. Fabian (fabiangomez) 12 94.60 100.93 4 33.33
17241. etienne (etiennne) 12 113.02 122.45 6 50.00
17242. Ethan (ethantai) 12 110.88 125.60 8 66.67
17243. Robert (ert00034) 12 114.90 128.85 4 33.33
17244. Eric (ericplayz132) 12 122.99 133.87 7 58.33
17245. Elvar (elvar333) 12 71.39 89.57 2 16.67
17246. Mohamed (elhedeq) 12 35.60 38.65 0 0.00
17247. Cristian (electpit) 12 57.95 65.71 0 0.00
17248. Ekshore (ekshore) 12 75.81 92.10 3 25.00
17249. Faquarl (ekrpat) 12 93.98 111.49 6 50.00
17250. Eichi (eichitenshouin) 12 100.26 120.58 5 41.67
17251. Egyptian (egyptianlion) 12 105.79 114.46 7 58.33
17252. Zac (eastunder) 12 70.03 90.83 7 58.33
17253. dylan (dywan) 12 85.80 98.00 5 41.67
17254. Daniel (dxnielz) 12 94.70 109.15 12 100.00
17255. David (dwang05) 12 102.53 117.43 4 33.33
17256. Durga (durga32670) 12 47.57 56.48 2 16.67
17257. Adrianus (dungonmahshoe) 12 93.93 116.48 4 33.33
17258. duncs (duncs) 12 89.21 103.95 9 75.00
17259. Duke (dukemagnum) 12 80.68 94.56 1 8.33
17260. D (ducktypist) 12 104.02 116.06 5 41.67
17261. Insub (dskumpf) 12 99.00 110.10 7 58.33
17262. Ariel (drofniarg) 12 101.03 120.51 7 58.33
17263. D1eg8 (drm86) 12 74.85 86.61 5 41.67
17264. Dennis (doxalite) 12 61.95 80.44 4 33.33
17265. Ian (doughs) 12 102.48 125.26 5 41.67
17266. Doug (dougdimmadan) 12 102.07 114.00 6 50.00
17267. DosU (dosu) 12 40.23 44.69 0 0.00
17268. Kevin (dostoyevksy) 12 28.83 36.73 3 25.00
17269. Dodi (dodic) 12 100.89 108.01 5 41.67
17270. David (djtm) 12 70.48 76.98 4 33.33
17271. Dexter (dextergamer) 12 61.71 68.56 4 33.33
17272. something (destroyer27777) 12 81.05 92.11 1 8.33
17273. Deron (deron_09) 12 48.17 66.68 3 25.00
17274. Derek (derekyeh) 12 44.24 53.35 0 0.00
17275. denzel (dennzzz) 12 73.39 79.80 2 16.67
17276. DenDu (dendu_respekt) 12 50.81 61.92 6 50.00
17277. deej (deej195) 12 86.26 96.76 1 8.33
17278. Declan (dec13) 12 52.64 61.24 6 50.00
17279. not_that (darkmaster_30) 12 71.51 82.43 7 58.33
17280. Daniel (danoco) 12 46.37 53.78 0 0.00
17281. dankerkys (dankerkys) 12 59.02 79.64 7 58.33
17282. Dani (danivideda) 12 74.27 91.47 4 33.33
17283. Daniel (dalord) 12 61.61 70.51 2 16.67
17284. Dakize (dakice) 12 90.18 102.49 5 41.67
17285. daebro (daebro) 12 80.87 95.02 6 50.00
17286. CybrZero (cybrzero) 12 53.43 65.98 2 16.67
17287. Curtis (curtisz) 12 85.90 97.64 3 25.00
17288. Zxar (cubercubed) 12 72.37 82.10 4 33.33
17289. Nico (cuber) 12 117.67 148.73 4 33.33
17290. JP (cryoblivious) 12 83.90 97.12 5 41.67
17291. Crescendo (crescendot) 12 97.38 115.50 6 50.00
17292. CrazyhourXD (crazyhourxd) 12 72.11 79.77 3 25.00
17293. gaoshan (crazydonkehhhhh) 12 77.15 92.17 3 25.00
17294. Crafty (craftywastaken) 12 92.45 113.34 6 50.00
17295. aziz (cornea) 12 50.33 55.42 1 8.33
17296. Bean (cornbreadman) 12 81.02 106.92 9 75.00
17297. Eric (cool_armadillo) 12 85.35 100.25 5 41.67
17298. Tyson (cooldude1800) 12 68.23 76.51 4 33.33
17299. Val (codehacker707) 12 98.69 113.89 6 50.00
17300. clout (clouted) 12 80.25 97.03 3 25.00
17301. Clarissa (clarissaclaa) 12 68.30 75.16 1 8.33
17302. Citizen404 (citizen404) 12 89.07 97.79 6 50.00
17303. StickInMyButt (chungi) 12 104.01 116.08 5 41.67
17304. CHRISTIAN (chris7ka) 12 87.65 107.84 4 33.33
17305. choppery (choppery) 12 74.00 82.39 3 25.00
17306. Chipper (chipperdiglett) 12 79.61 91.71 7 58.33
17307. chino (chino69) 12 68.44 77.35 3 25.00
17308. ching (chingchongchangchink) 12 63.87 85.01 1 8.33
17309. Danh (chetdanh) 12 97.51 112.73 2 16.67
17310. 50wpm (chengyangz) 12 83.16 89.65 2 16.67
17311. Sangga (chemicalchaos291) 12 67.91 77.48 2 16.67
17312. chasing (chasingfastpoker9995) 12 103.74 120.10 2 16.67
17313. ChaosNuggets (chaosnuggets) 12 97.81 114.68 3 25.00
17314. chanon (chanonlatt) 12 50.48 54.81 3 25.00
17315. cathy (cathyyyyy) 12 54.37 63.02 1 8.33
17316. Carson (carson_a_r) 12 65.70 74.98 7 58.33
17317. William (caraxd) 12 105.53 118.93 6 50.00
17318. captain357 (captaincool357) 12 88.26 111.57 7 58.33
17319. Candace (candacefumeh) 12 39.52 45.60 10 83.33
17320. callicco (calllicco) 12 111.85 129.29 5 41.67
17321. Cactus (cactus_jones) 12 95.16 106.08 8 66.67
17322. Connor (c42855) 12 87.61 101.10 4 33.33
17323. Bumsu (bumsu) 12 62.03 74.68 3 25.00
17324. Joshua (brothersquid123) 12 84.81 100.59 2 16.67
17325. Bob (bromanswagboy) 12 92.95 118.20 3 25.00
17326. cuki 🍪 (brewlux) 12 107.02 120.42 6 50.00
17327. Rafael (brafs165) 12 63.60 74.44 3 25.00
17328. Anthony (boxa) 12 74.82 87.84 6 50.00
17329. allie (bokutobro) 12 69.92 85.31 3 25.00
17330. tstats[bobfish] (bobfish) 12 32.84 48.64 0 0.00
17331. Narwal (bnarwal) 12 50.22 66.76 4 33.33
17332. BlueTrip (bluetrip) 12 107.94 126.38 8 66.67
17333. Bluefire (bluefire828) 12 95.75 107.40 5 41.67
17334. Sujay (bluebeetle) 12 58.27 66.64 1 8.33
17335. ok (biscuitalex) 12 95.87 114.40 4 33.33
17336. ol (billturbo) 12 82.29 97.99 6 50.00
17337. Chris (bigzaddy) 12 78.39 96.94 0 0.00
17338. cameron (bigmoon) 12 28.91 38.12 3 25.00
17339. mrbasts10000dollarrefrigera... 12 99.54 111.08 5 41.67
17340. Gabor (bgabor) 12 79.39 90.01 5 41.67
17341. Berny (bernyboi) 12 73.81 79.65 3 25.00
17342. Dennis (bejdenn) 12 65.86 78.17 3 25.00
17343. Bayu (bayufajariyanto) 12 50.86 60.25 1 8.33
17344. Rizky (battle_hooks12) 12 82.02 98.34 6 50.00
17345. Balloon (balloon75) 12 47.57 55.91 2 16.67
17346. Ben (bakchansoo) 12 77.53 100.28 5 41.67
17347. Aziron (aziron) 12 122.91 135.91 4 33.33
17348. azhi (azhi_i) 12 28.89 32.84 1 8.33
17349. Avy (avygorg) 12 34.69 47.45 0 0.00
17350. George (ausp1c1ous) 12 93.84 103.92 3 25.00
17351. Tropticl (aupsidedowncup) 12 54.88 63.74 7 58.33
17352. AtticusB (atticusb) 12 85.46 98.34 3 25.00
17353. Accuracy (attempts_at_accur... 12 84.13 94.08 6 50.00
17354. Brian (atrospecter) 12 94.69 115.15 6 50.00
17355. ashtunu (ashtunu) 12 64.43 72.57 5 41.67
17356. Ashraya (ashrayas) 12 59.74 68.86 2 16.67
17357. Ashish (ashishpatel0720) 12 69.53 84.02 4 33.33
17358. ASHISH YADAV (ashish001) 12 28.68 32.92 0 0.00
17359. Sherzod (asdfgh5889) 12 79.57 104.19 6 50.00
17360. Arath (arathjz) 12 87.59 98.17 5 41.67
17361. Apple Magic (applemagic4life) 12 127.45 149.73 8 66.67
17362. Anugrah (anugrahdwikusuma) 12 92.68 116.31 4 33.33
17363. tstats[anotherbandkid] (ano... 12 80.81 91.66 3 25.00
17364. Anit (anit2007) 12 75.54 87.36 5 41.67
17365. angel (angelllfoo) 12 86.07 103.03 4 33.33
17366. Andrew (andrewfbr) 12 101.38 121.86 6 50.00
17367. Andrew (andrewdvorak) 12 96.12 106.30 6 50.00
17368. Abdullah (anarkhos) 12 95.25 101.73 4 33.33
17369. 陳 (amybmy) 12 59.88 73.50 2 16.67
17370. Nafiul (aminafi) 12 82.16 89.77 4 33.33
17371. alex (alexllc) 12 70.10 125.48 6 50.00
17372. Alex (alexlava) 12 78.85 90.18 2 16.67
17373. Al (alexkjenkins) 12 67.26 78.04 1 8.33
17374. Albion (albionthegreat) 12 85.25 96.46 1 8.33
17375. Mohammed (alazzouny) 12 52.53 65.41 1 8.33
17376. Alarming (alarmngracer) 12 72.15 88.97 4 33.33
17377. aka49 (aka49) 12 95.90 114.39 5 41.67
17378. AJspeedy (ajspeedy5) 12 87.08 98.11 5 41.67
17379. Aishuak (aishonnnn) 12 50.90 57.67 9 75.00
17380. hadi (airsmite) 12 78.35 91.25 11 91.67
17381. lelo (aie1900) 12 72.14 84.86 2 16.67
17382. Aggro (aggro_typer) 12 106.92 121.03 5 41.67
17383. The (afsanster) 12 41.56 47.57 3 25.00
17384. Ajitesh (adji2057) 12 61.24 71.33 4 33.33
17385. adibhehe (adibhehe) 12 67.08 81.21 12 100.00
17386. henryk (adeczek) 12 113.85 141.77 2 16.67
17387. Adarsh (adarshkr) 12 76.60 85.31 4 33.33
17388. Ezra (account_name) 12 117.84 128.04 4 33.33
17389. Abhiram (abhiramravi) 12 107.30 120.45 6 50.00
17390. Abdallah (abdallah7) 12 73.04 93.08 3 25.00
17391. Aakash (aakash3697) 12 79.14 92.07 4 33.33
17392. Andy (a1i3n0) 12 108.85 129.46 7 58.33
17393. meme (7fingers) 12 94.00 121.66 5 41.67
17394. swagfish (4thunion) 12 90.56 104.94 5 41.67
17395. Osyrs (3556) 12 66.77 76.57 2 16.67
17396. 2qbingxuan (2qbingxuan) 12 68.62 82.92 1 8.33
17397. 2dnas (2dnas) 12 76.40 86.96 2 16.67
17398. MD (123onick) 12 35.98 42.97 3 25.00
17399. Owen (123ojb) 12 101.26 109.43 0 0.00
17400. Arne (11bricks) 12 86.25 102.59 3 25.00
17401. Jason (j93_quinn) 12 81.14 102.08 3 25.00
17402. Batman (wellin) 12 76.37 87.25 4 33.33
17403. Allen (livehappily16) 12 59.72 76.85 2 16.67
17404. Caboj (dvoraklearner123) 12 86.46 104.00 6 50.00
17405. Triet (triet228) 12 66.16 81.54 1 8.33
17406. Yūgen (yugenamane) 12 76.48 87.47 3 25.00
17407. Rogue_Panda (sanchit___) 12 49.76 60.15 2 16.67
17408. Ja (jarenmatthew) 12 70.34 81.30 4 33.33
17409. soft (shattered_lens) 12 88.35 111.38 6 50.00
17410. matcha (matchanapkin) 12 96.71 112.01 4 33.33
17411. Sagun (sagunmdr) 12 60.23 71.06 4 33.33
17412. Kyle (akilies2401) 12 63.41 72.64 6 50.00
17413. kushal (cheesecakebtw) 12 67.92 76.64 0 0.00
17414. Allen (enigma_801) 12 125.24 135.88 11 91.67
17415. Elias (elreylocro) 12 59.47 71.37 6 50.00
17416. Erik (erhuht) 12 73.79 86.34 2 16.67
17417. kryeohs (kryeohs) 12 50.29 59.75 3 25.00
17418. Tantai (tantai115) 12 56.26 62.47 3 25.00
17419. Mr. (pedley) 12 76.12 85.60 7 58.33
17420. Cesar (lentil_salad) 12 47.97 52.83 1 8.33
17421. london (londonxxx) 12 73.63 88.07 4 33.33
17422. Muhammad (wakype) 12 46.46 51.99 3 25.00
17423. isniffsharpies (isniffsharp... 12 83.19 99.92 3 25.00
17424. Phelix (phelix23) 12 102.14 117.35 9 75.00
17425. Nathalie (larreanathalie) 12 59.18 72.30 1 8.33
17426. lj (yzthesimp) 12 46.36 55.56 3 25.00
17427. spongebob (royalespongebob) 12 86.49 102.73 4 33.33
17428. John (bonsaifarm) 12 89.95 108.77 2 16.67
17429. Nguyen (nguyenminhtri) 12 37.31 48.31 0 0.00
17430. katie (musical_kittycat) 12 98.10 112.24 2 16.67
17431. Edd (christenlanger) 12 94.37 117.14 5 41.67
17432. bibney (bibney) 12 88.84 98.33 4 33.33
17433. ryan (ambush_) 12 73.75 89.93 4 33.33
17434. Kenshee (knshnsrz) 12 73.58 86.79 4 33.33
17435. Chris (c4fernandez) 12 82.40 97.97 4 33.33
17436. novice (kai1234567890) 12 34.69 37.95 0 0.00
17437. airkool (airkool) 12 57.49 68.36 2 16.67
17438. Rick (agira) 12 36.21 61.76 0 0.00
17439. John (khoryl) 12 88.85 100.89 2 16.67
17440. Rafi (sirtheo) 12 48.59 56.33 3 25.00
17441. Hunter (htrautz) 12 67.77 76.63 1 8.33
17442. Dianne (diannutella) 12 86.27 101.56 12 100.00
17443. Joel (joelitoelisha) 12 71.57 86.94 5 41.67
17444. An Existing Person (technon... 12 102.25 117.15 9 75.00
17445. Son Nguyen (xpinpin) 12 70.23 79.38 8 66.67
17446. Lexie (lexie120) 12 72.16 82.91 2 16.67
17447. Callum (lemurple) 12 59.71 70.40 0 0.00
17448. Trying to get to 75wmp (in_... 12 88.74 98.71 5 41.67
17449. Elizabeth (theatribeth) 12 65.35 73.68 3 25.00
17450. Jack (jackkaranjan) 12 81.73 94.01 2 16.67
17451. Prakash (prakash_18) 12 24.03 30.38 4 33.33
17452. Allee (hayyallee) 12 63.79 95.08 10 83.33
17453. Peachy (peachynotsimp) 12 55.62 67.63 0 0.00
17454. ABsuperX (anuraagbarde) 12 57.54 68.49 5 41.67
17455. Aditya (adishegde) 12 80.35 98.94 3 25.00
17456. Monke (monke_with_a_keyboard) 12 61.66 74.88 3 25.00
17457. Mario (marioloop) 12 32.92 38.39 0 0.00
17458. SandTinx (sandtinx) 12 61.19 70.97 4 33.33
17459. Aubrey (aubreylynn14) 12 99.27 125.92 4 33.33
17460. Ridley (ridlz) 12 76.00 83.87 1 8.33
17461. Hafsa (hafsamohammed200) 12 70.16 80.93 3 25.00
17462. Alex (chualexchu) 12 91.14 106.65 4 33.33
17463. Huong (__ian) 12 65.75 73.60 1 8.33
17464. Mucha (mucha_) 12 78.04 89.06 5 41.67
17465. spookydoggo (spookydoggo) 12 91.87 119.67 10 83.33
17466. Manges (friendzonecamper) 12 88.97 112.63 5 41.67
17467. tony (bananaboyy) 12 82.25 92.68 6 50.00
17468. malix (malangi) 12 82.54 94.56 3 25.00
17469. Aeddon (a3ddon) 12 97.18 110.83 3 25.00
17470. Erick (erickis300) 12 96.91 110.45 9 75.00
17471. Ley (leeeeymm) 12 70.72 87.91 1 8.33
17472. Phillip (philyphil) 12 71.55 85.72 2 16.67
17473. Lisa (xoxfko) 12 42.70 61.61 0 0.00
17474. Meh Zall (mehzall) 12 90.60 104.21 7 58.33
17475. mclrn (mclrn) 12 80.67 91.96 3 25.00
17476. Kaeji (kaeji404) 12 62.59 70.21 0 0.00
17477. diamond (diamondthecat) 12 48.46 61.02 0 0.00
17478. Jordi (jordi333) 12 41.36 46.38 11 91.67
17479. David (davethebravemicrowave) 12 72.24 82.79 9 75.00
17480. Blake (weekesy) 12 65.33 72.68 0 0.00
17481. Meister (bmmeister) 12 45.39 53.44 1 8.33
17482. AthenaHuss (mountainhusky) 12 32.61 35.73 0 0.00
17483. Riley (kellerxll) 12 82.24 93.46 4 33.33
17484. Noel (psychoimpulse) 12 70.95 82.02 3 25.00
17485. Chclo (chclo) 12 105.05 121.88 7 58.33
17486. Aaron (dunclapicus) 12 106.70 125.80 7 58.33
17487. Joe (hey__joe) 12 81.13 100.00 12 100.00
17488. 8990 (sinanae) 12 72.84 99.09 4 33.33
17489. Frozenrings (frozenrings) 12 64.18 79.01 9 75.00
17490. Jordan (alienshockz) 12 53.00 63.03 1 8.33
17491. Niam (ninicanuck) 12 79.81 93.59 3 25.00
17492. yamp (yamp) 12 91.03 100.83 2 16.67
17493. Cedar (pumpkin_racer) 12 86.75 102.28 2 16.67
17494. moon (moonrace) 12 77.46 88.89 3 25.00
17495. Lennox (lennoxn) 12 57.28 64.58 3 25.00
17496. antorr (_donpablo) 12 29.58 37.60 1 8.33
17497. Sameen (ninogasuki) 12 86.28 95.63 4 33.33
17498. Puma (bigfast26) 12 40.20 46.93 0 0.00
17499. Shidori (shidori) 12 70.08 79.18 4 33.33
17500. Tonkata (_tonkata_) 11 53.24 63.97 2 18.18
17501. bruh (_sidnair2003_) 11 107.38 130.59 11 100.00
17502. guitrstrngscr (_resh_) 11 66.09 80.60 2 18.18
17503. Pendi (_pendi) 11 120.63 131.72 8 72.73
17504. Daniela (_noodleynoodles_) 11 114.29 131.76 6 54.55
17505. Nilesh (_nex_) 11 76.47 85.69 1 9.09
17506. Mick (_mickey_) 11 69.76 83.82 1 9.09
17507. Jeff (_jeff_) 11 54.02 59.42 1 9.09
17508. MrClumzzy (zxgod) 11 68.80 85.94 4 36.36
17509. Josh (zumoariri) 11 59.00 67.80 2 18.18
17510. Ronnie (zoroaki) 11 51.24 70.59 2 18.18
17511. Zuja (zoojah) 11 95.21 108.76 5 45.45
17512. Zmiester0828 (zmeister0828) 11 76.96 100.75 3 27.27
17513. zoey (zjskating) 11 72.61 83.33 3 27.27
17514. jorje (zhonti) 11 51.97 67.79 4 36.36
17515. ZapSlow (zapadobo) 11 102.26 123.97 5 45.45
17516. tstats[zanies07] (zanies07) 11 48.29 52.62 2 18.18
17517. Jonathan (z33nine) 11 49.12 54.47 0 0.00
17518. lixiang (yuan_yuan) 11 97.55 107.85 5 45.45
17519. yuan (yuanyangty) 11 111.08 122.62 4 36.36
17520. R. (yeetertheskeeter) 11 113.49 146.91 1 9.09
17521. YeetedOrca (yeetedorca) 11 66.87 78.91 1 9.09
17522. Zalvy (ydnav) 11 97.09 116.23 4 36.36
17523. Husain (yahyahusain) 11 87.22 102.47 9 81.82
17524. Dan (x_danma) 11 70.87 82.87 2 18.18
17525. XXRobzz (xxr0bzz) 11 80.51 91.83 5 45.45
17526. OOF (xpinoyx) 11 98.29 111.55 4 36.36
17527. Gunn (xg88) 11 90.34 129.16 7 63.64
17528. Kyle (xdestroyer83) 11 88.98 99.67 4 36.36
17529. Alex (xanfan01) 11 117.46 133.76 7 63.64
17530. oTk (wulongi) 11 86.68 103.71 6 54.55
17531. Khaled (wtcherr) 11 54.03 58.00 0 0.00
17532. wowzaa (wowzaa1) 11 70.57 85.53 1 9.09
17533. kellogg's (wnluqmnn) 11 87.78 109.92 4 36.36
17534. lee (wndnjs4389) 11 59.47 71.56 2 18.18
17535. wlitchw (wlitchw) 11 52.59 63.68 3 27.27
17536. Will (윌) (willwang) 11 91.93 104.42 4 36.36
17537. william (williamivandy) 11 79.62 91.90 2 18.18
17538. wigglyworm (wigglyworm) 11 75.04 92.04 2 18.18
17539. whynottt (whynottt) 11 74.84 98.81 4 36.36
17540. Tray (whitefalcon684) 11 88.29 102.25 3 27.27
17541. WhaleVomit (whalevomit) 11 123.29 129.60 9 81.82
17542. TomCeria (wertyboy) 11 91.84 103.24 6 54.55
17543. weidel (weidel) 11 58.41 70.42 1 9.09
17544. jasmin (wawfles) 11 81.25 93.03 3 27.27
17545. wango (wango) 11 94.11 119.47 7 63.64
17546. Walden (walnutwaldo20) 11 75.81 122.35 3 27.27
17547. Wakeel (wakeel_ahmed) 11 36.68 45.52 1 9.09
17548. wael (wael2) 11 58.65 67.80 1 9.09
17549. Chalach (waddee) 11 89.12 103.93 1 9.09
17550. Omar (v_omar11) 11 88.49 94.30 2 18.18
17551. Ayesha (vogue212) 11 83.73 93.65 2 18.18
17552. Visa (visatron) 11 91.63 119.18 4 36.36
17553. Aashrya (virtualvector) 11 85.97 101.12 10 90.91
17554. Vihaan (vilecn2609) 11 20.52 24.16 10 90.91
17555. V (viktiro) 11 109.72 132.25 8 72.73
17556. Gravity (vgravity) 11 74.46 86.75 0 0.00
17557. Ritika Garg (ve_ronica) 11 40.07 44.80 1 9.09
17558. Vanu (vanu88) 11 56.99 68.98 2 18.18
17559. Sonia (vannvilla) 11 97.03 106.55 8 72.73
17560. Dard (vaderking) 11 69.34 79.72 11 100.00
17561. Vadacurry (vadacurry) 11 74.53 86.71 3 27.27
17562. v1ruso (v1ruso) 11 101.70 110.57 7 63.64
17563. bolt (unreaii) 11 117.70 135.11 7 63.64
17564. unowildcard (unowildcard) 11 101.41 112.47 6 54.55
17565. Trevor (uneasythrower24) 11 59.88 65.69 1 9.09
17566. Mythical (ultrabow) 11 73.84 88.39 2 18.18
17567. Tzo (tzoatplay) 11 59.94 66.31 2 18.18
17568. Tys0100 (tys0100) 11 67.58 74.94 0 0.00
17569. matthew (typeredemption) 11 30.09 36.12 3 27.27
17570. Jesse Klaver (typeracernoob... 11 78.39 93.18 4 36.36
17571. typeracer (typeracer550) 11 73.46 82.87 3 27.27
17572. Colin (typeofwhey) 11 87.14 101.16 3 27.27
17573. Miles (txlore) 11 83.65 99.57 6 54.55
17574. turutupa (turutupa) 11 96.07 110.66 6 54.55
17575. Turtley (turtleyjk) 11 89.54 105.84 6 54.55
17576. Tu (tuawesome) 11 81.48 96.84 5 45.45
17577. T (tt147) 11 100.46 113.00 5 45.45
17578. MoDX (trollcannon) 11 84.94 92.93 2 18.18
17579. Thomas (trinitymeister) 11 54.31 64.41 2 18.18
17580. Travis (travis4d) 11 67.83 78.73 5 45.45
17581. T (toompaxd) 11 83.70 92.55 0 0.00
17582. Toast (toastmaster127) 11 85.87 116.65 4 36.36
17583. professor (tm_professor) 11 64.81 72.98 8 72.73
17584. Dinmarc (tmlololol) 11 53.71 62.56 0 0.00
17585. Scaught (tiktoks) 11 91.91 104.11 4 36.36
17586. Asd (thinedes) 11 101.51 132.88 5 45.45
17587. Captn (the_nobody3786) 11 60.38 80.89 2 18.18
17588. The (the_learning_savage) 11 82.21 104.96 2 18.18
17589. Ayush (the_dealer) 11 75.06 89.50 2 18.18
17590. The Try (thetryhardguy01_) 11 57.31 67.01 3 27.27
17591. Undisclosed (thetechnicalfox) 11 108.24 129.67 3 27.27
17592. Ryan (theryanshan) 11 65.87 72.83 1 9.09
17593. Shreshth (thefoxwithanelytra) 11 93.75 100.26 4 36.36
17594. TheFoodMan52 (thefoodman52) 11 90.44 111.04 7 63.64
17595. steelmonkey (thecornhobble) 11 124.84 149.12 3 27.27
17596. THATGUYtm (thatguytm) 11 79.60 96.61 6 54.55
17597. butterfingers (th3panda) 11 82.47 97.20 2 18.18
17598. Tejas (tejasfarera) 11 64.54 74.75 3 27.27
17599. Teerapat (teerapatlaongdee) 11 69.68 85.94 3 27.27
17600. Joseph (techvideomaster) 11 89.02 103.44 4 36.36
17601. Andy (teaestaye) 11 90.09 108.13 3 27.27
17602. tdrewek (tdrewek) 11 81.66 90.83 1 9.09
17603. Tasnimul Hasan Rafid (tasni... 11 48.80 56.60 0 0.00
17604. Nishant (tarzanjunior) 11 63.51 73.05 4 36.36
17605. Tarun (tarun_valasa) 11 54.23 71.25 2 18.18
17606. Tarashankar (tarashankar) 11 50.61 59.65 0 0.00
17607. Jay (taragine) 11 98.71 111.63 5 45.45
17608. Owen (taenguar) 11 106.90 124.38 5 45.45
17609. Patrik (tacticalnuke) 11 86.78 103.16 3 27.27
17610. Ben (tabman) 11 92.29 104.67 9 81.82
17611. taylor (taayloor) 11 125.82 140.41 5 45.45
17612. ស៊ីថេ (sythe_net) 11 38.04 47.70 2 18.18
17613. Malik (sweetbubblegum_50) 11 85.23 98.80 2 18.18
17614. Swati (swati0609) 11 53.52 63.87 1 9.09
17615. SuperDucky1875 (superducky1... 11 48.45 58.20 2 18.18
17616. a (suk_) 11 97.04 126.01 8 72.73
17617. Suchit (suchit_reddi) 11 48.62 57.44 3 27.27
17618. Filip (sucicf7) 11 93.69 105.34 1 9.09
17619. steven (styper3030) 11 46.85 60.78 1 9.09
17620. Stuart (sturay) 11 99.55 111.77 6 54.55
17621. flyingcakes (strx_) 11 78.93 93.42 2 18.18
17622. #EndCars (stratmann) 11 96.70 102.56 5 45.45
17623. Storm (stormheezen) 11 56.84 61.01 3 27.27
17624. Hayden (stoptake) 11 79.95 96.38 5 45.45
17625. Dan (stefanstef) 11 99.42 114.15 7 63.64
17626. Rong Liew (springbaron) 11 129.63 141.02 8 72.73
17627. Peter (spinbot) 11 63.77 75.08 3 27.27
17628. Shivam (sorcerer626) 11 89.54 107.50 6 54.55
17629. Sophie (sophie0413) 11 87.65 102.92 2 18.18
17630. Travis (sonicspeed06) 11 64.39 71.09 5 45.45
17631. Prosper Solomon (solomontz) 11 53.03 60.65 2 18.18
17632. bjonk (sojho) 11 121.80 133.00 6 54.55
17633. Zoom Zoom (soccerman12345) 11 106.97 124.28 7 63.64
17634. smmbam (smmbam) 11 79.53 88.35 3 27.27
17635. Tamer (smartlead) 11 36.89 42.45 4 36.36
17636. kek (slongdongbong) 11 62.17 68.98 2 18.18
17637. tim (slipperyreptile) 11 106.67 131.41 9 81.82
17638. Ilias (skysrex) 11 78.45 95.94 5 45.45
17639. Skreemmy (skreemmy) 11 56.22 63.71 2 18.18
17640. Aditya (skaarfacee) 11 54.52 59.44 1 9.09
17641. Tyler (silver_typer) 11 103.01 114.24 5 45.45
17642. busshyzDRill (silvercrow0) 11 50.51 54.85 2 18.18
17643. Anthony (sildreon) 11 81.78 94.05 1 9.09
17644. Suienish (sikoesch) 11 69.14 74.55 2 18.18
17645. Nicola (shougt) 11 61.18 71.48 2 18.18
17646. Sharos (sharos) 11 53.66 60.31 2 18.18
17647. hello (sharkyboy) 11 124.91 134.90 6 54.55
17648. Shark (sharkbeargator) 11 92.17 104.85 3 27.27
17649. Shafiq (shafiq7911) 11 78.21 88.78 1 9.09
17650. Andrew (sertria) 11 93.49 100.08 3 27.27
17651. sergieric (sergieric) 11 58.71 68.94 3 27.27
17652. SjåDæmSjøgølls (seethem... 11 63.76 76.19 2 18.18
17653. SeCre (secre13) 11 72.45 84.37 2 18.18
17654. long bus (sealegs) 11 141.36 154.43 9 81.82
17655. Corrin (scynth) 11 98.60 105.44 4 36.36
17656. Kurtis (sauceypubes) 11 104.45 123.40 4 36.36
17657. Sargis (sargispro) 11 77.43 90.66 1 9.09
17658. Sarah (sarahnivans) 11 66.77 75.36 1 9.09
17659. Alix (sarahallisa) 11 66.34 73.78 3 27.27
17660. Sargis (saqo1997) 11 52.31 57.47 0 0.00
17661. Samdo (sammematt) 11 122.10 134.74 6 54.55
17662. Sajan (sajancpatel) 11 91.99 105.72 5 45.45
17663. Saffron (saffronayy) 11 92.21 118.29 10 90.91
17664. Saea (saeamak) 11 86.29 96.53 3 27.27
17665. Sans (s4nsx) 11 62.98 73.17 4 36.36
17666. Shannon (s0lanum) 11 53.02 59.06 2 18.18
17667. James (ryandaryno) 11 63.35 75.88 3 27.27
17668. Raven (rvnfx) 11 71.17 90.00 9 81.82
17669. Ruslan (ruslan_osmanov) 11 93.64 105.18 3 27.27
17670. Panagiotis (rulisogeranoulis) 11 83.22 97.54 6 54.55
17671. Ron (ronald2) 11 81.42 99.70 6 54.55
17672. Free Palestine (rollno14) 11 103.90 125.89 4 36.36
17673. Rolandas (rolandas) 11 24.91 32.26 0 0.00
17674. Roko (rokoroks) 11 79.80 89.47 3 27.27
17675. pentti (rocket_boi) 11 43.82 50.60 3 27.27
17676. Robbie (robbietrimble) 11 104.68 134.38 6 54.55
17677. Absolut (rluyen) 11 82.79 99.44 0 0.00
17678. Ridge (ritzchu) 11 92.40 101.35 11 100.00
17679. Kenny (riggedcontingency) 11 100.61 110.49 5 45.45
17680. ninja (riddickbr) 11 95.04 121.16 4 36.36
17681. Ricky (rickyyeung) 11 83.89 93.13 4 36.36
17682. Rickith (rickith) 11 58.23 63.72 0 0.00
17683. Jeremy (rice_cream) 11 96.18 107.97 5 45.45
17684. ango (rfthefinal) 11 73.00 86.16 4 36.36
17685. red (redwastaken) 11 95.35 104.86 2 18.18
17686. ReddyIsHere (reddy_is_here) 11 58.19 66.40 1 9.09
17687. Rebel (rebelaj) 11 92.81 99.78 2 18.18
17688. D A R K Z (reaching130wpm) 11 56.45 66.84 0 0.00
17689. Rodrigo (rdcmdev) 11 81.67 93.77 2 18.18
17690. Ray (ray_mond) 11 83.78 95.10 3 27.27
17691. RAWs (raws) 11 95.06 108.25 4 36.36
17692. guts (ramosjoshua214) 11 72.67 85.27 3 27.27
17693. Ajwad Hameem (rajin100000) 11 69.33 81.13 1 9.09
17694. Exquisition (raimi) 11 98.84 140.33 5 45.45
17695. Rahmen (rahmennoodles) 11 105.77 136.93 6 54.55
17696. qweasdyxc (qweasdyxc) 11 64.12 73.23 1 9.09
17697. Papa (quamthebomb) 11 97.29 114.43 5 45.45
17698. Pyro (pyromaniac_from_the_sun) 11 78.97 92.43 2 18.18
17699. tapan (psydelix) 11 71.23 79.97 2 18.18
17700. Psycho (psychobrainman) 11 78.36 85.98 3 27.27
17701. Mike (primike) 11 85.69 94.79 6 54.55
17702. Vorakan (ppaaul_) 11 67.86 81.65 2 18.18
17703. Hoang (poulet0306) 11 74.22 85.22 4 36.36
17704. Patric (potric) 11 68.46 88.98 2 18.18
17705. Potato (potatooe) 11 43.82 59.47 0 0.00
17706. PenTest-duck (pokemontypist) 11 114.61 128.35 4 36.36
17707. Cookies (poeannn) 11 70.59 80.58 5 45.45
17708. Nick (pletlibo) 11 104.51 128.68 7 63.64
17709. tstats[pkmkb] (pkmkb) 11 63.75 70.73 0 0.00
17710. Jacob (pinpoint) 11 63.57 74.22 5 45.45
17711. Phungtastic (phungtastic) 11 73.53 78.86 2 18.18
17712. Alex (pheudo) 11 72.90 90.30 6 54.55
17713. ok (phamhuyhuy2005) 11 91.61 108.92 2 18.18
17714. Peter (petero) 11 87.19 96.06 2 18.18
17715. Gavin (perfectgavinator) 11 106.97 124.27 6 54.55
17716. Matous (pelisek16) 11 75.06 85.32 4 36.36
17717. ama (pcfcace) 11 75.39 83.51 2 18.18
17718. Phillip (pc15pdx) 11 51.19 59.15 2 18.18
17719. Payette (payette420) 11 92.78 108.64 1 9.09
17720. paul (paularoni) 11 64.35 77.32 1 9.09
17721. Connor (paintrain23) 11 70.26 88.50 3 27.27
17722. Pinny (p1nny_) 11 65.51 73.05 8 72.73
17723. ozzy (ozzyk) 11 56.30 70.90 1 9.09
17724. Squeak (oweozz) 11 78.03 95.34 2 18.18
17725. Omar (oshnatour) 11 84.73 107.29 2 18.18
17726. opal (opalisbored) 11 53.30 61.93 2 18.18
17727. Lou (onyok2010) 11 60.85 71.22 11 100.00
17728. John (omster83) 11 93.45 111.06 5 45.45
17729. Saul (old_grandma) 11 104.81 124.11 4 36.36
17730. officialpm (officialpm) 11 111.79 131.70 3 27.27
17731. ocodile (ocodile) 11 114.03 132.18 6 54.55
17732. Gabi (ockra_) 11 55.45 69.33 3 27.27
17733. np80658 (np80658) 11 68.96 79.11 2 18.18
17734. Erdal (notasingleduck) 11 58.41 65.39 3 27.27
17735. Vladimir (nolmegar) 11 124.16 145.61 9 81.82
17736. Nobu (nobuhiro777) 11 72.12 86.47 3 27.27
17737. NK (nkpathak1) 11 36.79 51.42 2 18.18
17738. niven (niven_11) 11 74.08 86.80 4 36.36
17739. soraya (nilanjona) 11 36.16 42.76 1 9.09
17740. notjustmetal (nightway11) 11 86.24 95.46 5 45.45
17741. Nick (nickxz) 11 128.64 143.48 6 54.55
17742. Nicholas (nicholas_r) 11 98.30 111.36 7 63.64
17743. Jusuf (nerdtyper) 11 92.29 106.65 7 63.64
17744. Neptune (neptune_22) 11 85.47 98.08 3 27.27
17745. Just (needhelpintyping) 11 96.39 112.93 4 36.36
17746. Jonathan (nebulium) 11 59.21 70.68 2 18.18
17747. Nathan (nbx3k) 11 101.12 114.88 5 45.45
17748. Nathan (nathanpg) 11 93.71 108.44 5 45.45
17749. Nasir (nasir_hussain) 11 62.33 73.65 3 27.27
17750. narqo (narqo) 11 101.53 122.65 8 72.73
17751. Night Fury (naimur_rahman) 11 79.08 84.74 3 27.27
17752. RS (nahor) 11 107.30 129.17 8 72.73
17753. Nada (nada2004) 11 50.53 58.89 1 9.09
17754. MZA (mzakm) 11 98.76 120.68 8 72.73
17755. Mytx (mythflashx) 11 69.39 75.72 3 27.27
17756. diana (mxclfld) 11 84.25 94.38 5 45.45
17757. Muntazar (muntazer1) 11 69.63 78.11 6 54.55
17758. Matthew (msloehr) 11 75.53 84.88 2 18.18
17759. kailh pinks (mrdooks) 11 104.03 132.76 8 72.73
17760. Thiemen (mohouzeg) 11 95.14 108.39 9 81.82
17761. Mohammad (mohammedamarnah) 11 91.80 113.28 4 36.36
17762. mohammadreza (mohammadrezae... 11 71.81 79.62 0 0.00
17763. Kacper (mlociak) 11 58.04 63.38 2 18.18
17764. manjeet (mjydv4548) 11 61.76 69.53 1 9.09
17765. Mr.GrayBoi (mistergrayboi) 11 77.50 89.76 3 27.27
17766. Felzii (missartemis_97) 11 63.92 74.53 2 18.18
17767. mire (mire_kr) 11 88.90 113.26 2 18.18
17768. gannicus (milaikilaiki) 11 108.16 123.06 5 45.45
17769. Mohamed (midoukl) 11 50.55 53.40 0 0.00
17770. Michael Angelo (micky15) 11 101.45 111.12 6 54.55
17771. Michal (micha13) 11 85.05 96.29 2 18.18
17772. Matt (mhorsfield) 11 55.66 67.88 3 27.27
17773. Bob (metsandcavs) 11 77.81 87.78 2 18.18
17774. Aashish kumar (messy84) 11 39.15 43.07 3 27.27
17775. Memresable (memresable) 11 66.98 78.90 3 27.27
17776. Mark Jonathan (max_peterson10) 11 102.79 113.80 4 36.36
17777. Max (max_evans) 11 86.70 100.65 1 9.09
17778. john (maxwelllllllllll) 11 66.25 81.59 4 36.36
17779. Mathias (mattitheguy) 11 77.04 98.32 6 54.55
17780. Matt3k (matt3k) 11 84.49 108.69 5 45.45
17781. matex72 (matex72) 11 74.49 85.32 1 9.09
17782. Marc (marxotkin) 11 98.31 110.15 5 45.45
17783. Marcus (marqueshark) 11 89.81 137.77 10 90.91
17784. Jordan (marceless) 11 131.19 140.70 9 81.82
17785. TOP (man_stop) 11 105.64 115.68 5 45.45
17786. Manuel (mansrz) 11 76.53 87.52 3 27.27
17787. Sean (manbeervark) 11 78.85 91.44 3 27.27
17788. Nitesh (malster) 11 61.21 65.03 3 27.27
17789. Malo (malodrome) 11 43.73 50.29 2 18.18
17790. Adam (maldoren) 11 103.81 126.82 0 0.00
17791. Max (macksx) 11 68.19 80.97 3 27.27
17792. maciej (maciek3290) 11 59.80 66.69 2 18.18
17793. Daniel (macguffinstv) 11 94.67 108.87 3 27.27
17794. Peerawitch (maaaai) 11 57.72 62.67 0 0.00
17795. Tyler (m4rshm4) 11 110.93 131.10 10 90.91
17796. Luxson (luxsonx) 11 40.16 50.54 1 9.09
17797. Luthriel (luthriel) 11 101.53 110.31 8 72.73
17798. Luis (luis_vs_the_world) 11 60.82 71.17 2 18.18
17799. Luis (luisyt) 11 76.17 88.39 3 27.27
17800. jason (luckiestluckster) 11 95.12 105.93 8 72.73
17801. Luke (ltuite) 11 82.09 94.67 6 54.55
17802. Louie (louie4825) 11 101.20 119.26 8 72.73
17803. Louai (louai_zahran) 11 46.60 51.98 0 0.00
17804. No (loisk1) 11 78.48 90.18 6 54.55
17805. Little (littlesailor123) 11 74.15 89.09 1 9.09
17806. Lior (liorg225) 11 66.51 77.57 4 36.36
17807. Lilly (lilly713) 11 105.68 122.20 6 54.55
17808. 🤑 (liljasonmoney) 11 74.77 81.68 4 36.36
17809. Lilikoi (lilikoiv) 11 70.18 92.10 4 36.36
17810. IllIllIllIll (liliiilil) 11 123.47 136.20 5 45.45
17811. Lucius (lightwastaken) 11 91.57 110.97 2 18.18
17812. Christina (libermay) 11 73.28 79.37 2 18.18
17813. Thomas (ldsg99999) 11 56.41 64.43 2 18.18
17814. Flame On Me (lamtrinhan1503) 11 51.70 58.03 1 9.09
17815. Laiyon (laiyon) 11 58.16 63.98 2 18.18
17816. Luke (laaa) 11 105.47 114.56 4 36.36
17817. l0gically (l0gically) 11 73.19 80.82 5 45.45
17818. Alish (kzmadcat) 11 70.46 84.59 0 0.00
17819. Kaptain K (kxdang) 11 82.63 104.52 5 45.45
17820. star (kuuym) 11 93.13 113.74 6 54.55
17821. Speedy (kuulex) 11 71.92 82.73 2 18.18
17822. Lukas (kukess) 11 77.98 84.74 7 63.64
17823. ktns (ktns) 11 71.53 77.39 3 27.27
17824. lai (krylite) 11 82.27 89.49 0 0.00
17825. yes but (krosis2706) 11 70.10 85.72 5 45.45
17826. Derek (kroni) 11 61.48 75.12 1 9.09
17827. Eren (krishi__) 11 50.89 57.46 1 9.09
17828. KW (kraken_wrath) 11 62.20 76.04 2 18.18
17829. KOROCO (koroconotu) 11 88.79 108.38 1 9.09
17830. Andrew (kooey_u) 11 48.35 53.86 3 27.27
17831. KIXK (kixk) 11 69.71 76.53 3 27.27
17832. Kivon (kivonsclipz) 11 76.86 91.87 3 27.27
17833. cat (kitkat79) 11 62.04 73.21 2 18.18
17834. Dimas (kirito_69) 11 43.62 50.84 0 0.00
17835. Ayden (king_nedya) 11 88.24 102.11 3 27.27
17836. Ferret (kingko) 11 47.40 55.87 1 9.09
17837. MA1T8 (kingking540) 11 91.68 99.43 4 36.36
17838. bo (kibums) 11 86.24 104.75 3 27.27
17839. Kent (kfreezen) 11 98.87 113.59 4 36.36
17840. Kevin (kevinliu050505) 11 93.01 102.71 4 36.36
17841. Kevin (kevindkao) 11 100.17 118.18 4 36.36
17842. Kev (kev9933) 11 106.44 117.78 4 36.36
17843. KenDvorak (kensan73dvorak) 11 67.83 83.35 1 9.09
17844. Kenny (kenny1232) 11 68.00 86.22 3 27.27
17845. Kennedy (kennedykozak) 11 72.51 88.09 4 36.36
17846. fover (keitotrash) 11 108.12 127.08 8 72.73
17847. Kate (kate_haha) 11 54.50 62.95 5 45.45
17848. kasra (kasra44) 11 69.15 80.61 1 9.09
17849. Kasra (kasra15) 11 59.30 69.25 1 9.09
17850. kaelan (kae1) 11 110.17 128.14 5 45.45
17851. James (jvlasak) 11 70.12 78.89 2 18.18
17852. Justin (justin000) 11 93.00 103.09 4 36.36
17853. Justa (justaboss101) 11 60.90 69.75 2 18.18
17854. jumpscarez the fox (jumpsca... 11 39.62 50.22 1 9.09
17855. Juan (juanpadoodle) 11 74.55 85.11 3 27.27
17856. Joshua (joshuajoshuak) 11 121.70 133.12 8 72.73
17857. Jonathan (jonathanatx) 11 73.02 86.93 5 45.45
17858. Jo (jojoey21) 11 109.08 125.92 7 63.64
17859. johny2021 (johny2021) 11 48.23 55.17 2 18.18
17860. JohnsDog (johnsdog) 11 114.49 131.45 3 27.27
17861. Johnnybib (johnnybib) 11 103.72 127.20 5 45.45
17862. John (johndzxu) 11 62.64 71.05 2 18.18
17863. Joey (joeygetthedoughy) 11 86.18 99.96 8 72.73
17864. Jonathan (jnybo) 11 72.66 88.55 4 36.36
17865. Jacob (jlagarespo) 11 106.85 122.31 9 81.82
17866. Jeff (jjj11x) 11 93.14 107.04 4 36.36
17867. JTL (jimthelegend) 11 82.45 87.52 3 27.27
17868. jimmhealer (jimmyhealer) 11 60.38 74.08 2 18.18
17869. Jim (jimdavia99) 11 62.93 69.59 2 18.18
17870. jiirrarr (jiirrarr) 11 58.24 67.54 3 27.27
17871. JeffJeff (jeffjeffgames) 11 51.31 59.72 0 0.00
17872. Pierce (jedipierce) 11 102.71 123.72 6 54.55
17873. Jakob (jdwalburger) 11 87.36 104.42 7 63.64
17874. John (jctad) 11 89.69 101.69 5 45.45
17875. Shlim (javah1) 11 80.44 93.36 1 9.09
17876. Jared (jaredtypist) 11 95.77 113.08 6 54.55
17877. Z (jaredezane) 11 102.21 116.20 7 63.64
17878. Hikaru (japism) 11 82.16 104.44 5 45.45
17879. Clive (jadenm770) 11 13.45 18.63 2 18.18
17880. Jacky (jackyjac) 11 72.73 85.78 4 36.36
17881. John (jacks3141) 11 64.42 74.66 2 18.18
17882. Jack (jackkieny) 11 59.92 68.80 3 27.27
17883. i (ivantse2) 11 100.12 111.79 7 63.64
17884. Taken (itztaken) 11 101.37 115.39 6 54.55
17885. Games (itzbond) 11 86.41 101.01 5 45.45
17886. jay! (its_jay_) 11 108.82 117.20 0 0.00
17887. NewbPianist (instantnoodles... 11 111.54 126.39 7 63.64
17888. s3lec (inputselec) 11 64.06 75.39 1 9.09
17889. started from 50 now we here... 11 120.38 146.76 7 63.64
17890. Owen (innitbruv) 11 54.33 64.21 3 27.27
17891. John (infzer0) 11 78.05 88.10 3 27.27
17892. Jayden (infamousphoenix) 11 110.64 134.65 11 100.00
17893. Indiana Mitko (indianamitko) 11 34.61 42.97 1 9.09
17894. Farzad (impulsion) 11 70.10 83.00 4 36.36
17895. Mr. Qwerty (imnotawimpykid) 11 86.22 94.93 4 36.36
17896. DW (immortal_tree) 11 98.78 107.08 6 54.55
17897. Richard (iliveinthexu) 11 147.55 158.38 9 81.82
17898. Michael (idobemikey) 11 63.99 73.06 4 36.36
17899. idkwhojamesis (idkwhojamesis) 11 87.14 99.92 1 9.09
17900. Moko (iamspeedkachiga) 11 83.60 98.05 4 36.36
17901. Player_II (iamplayer) 11 86.52 92.20 4 36.36
17902. Hxrry (hxrry) 11 65.76 93.48 4 36.36
17903. Pady (hundertzwoelf) 11 87.68 104.13 1 9.09
17904. Max (hooterr) 11 83.26 90.09 6 54.55
17905. seanghong (hongracer) 11 87.55 100.47 3 27.27
17906. Dominic (hobomonkey5) 11 76.98 93.29 3 27.27
17907. minnie (hiitzmemini) 11 63.85 76.15 2 18.18
17908. Hessel (hessel_s) 11 80.09 87.86 3 27.27
17909. Santiago (helix_02) 11 80.88 101.02 4 36.36
17910. Skyler (hausky) 11 96.40 109.75 6 54.55
17911. Nayan (hatke42) 11 60.39 71.07 4 36.36
17912. harambe (harambetypes) 11 43.18 57.80 1 9.09
17913. UE (hanue) 11 40.76 53.32 0 0.00
17914. Hana (hanatf2) 11 104.18 118.41 4 36.36
17915. Han (han3) 11 93.14 109.55 3 27.27
17916. Jason (haisaru) 11 76.64 90.30 5 45.45
17917. Haiden (haidenb10) 11 91.73 103.94 4 36.36
17918. Aldrich (gwaldrich) 11 97.00 112.03 3 27.27
17919. gegg (guy_sama) 11 73.63 85.42 3 27.27
17920. vinnie (gun_xox) 11 58.23 78.34 2 18.18
17921. Guest (guest002) 11 79.70 86.69 2 18.18
17922. grossdesign (grossdesign) 11 114.74 129.30 9 81.82
17923. Colin (grolxe_1) 11 91.75 107.52 3 27.27
17924. Clayton (grizzleybear62) 11 57.56 67.18 2 18.18
17925. Grifit (grifit) 11 47.99 61.03 3 27.27
17926. Griffin (grider1) 11 91.97 102.35 2 18.18
17927. GreatLama (greatlama) 11 80.31 93.50 4 36.36
17928. Vivian (gracien) 11 62.19 69.47 2 18.18
17929. George (gpa138) 11 93.66 112.81 7 63.64
17930. Hcaz (gosuperzach) 11 46.38 55.27 3 27.27
17931. Cheap (gorid) 11 64.52 77.33 1 9.09
17932. Mar (gonefishing123) 11 94.36 109.68 5 45.45
17933. Jared (going2prison) 11 66.43 81.00 2 18.18
17934. William (godliam) 11 51.13 62.24 4 36.36
17935. godaberi (godaberi) 11 67.26 76.93 4 36.36
17936. Virtuoso™ (gkarthick) 11 93.87 100.39 3 27.27
17937. gi (gi_prim) 11 44.29 53.95 1 9.09
17938. Willy (gfif01) 11 72.60 82.65 5 45.45
17939. alem (gewaltxd) 11 75.63 91.61 7 63.64
17940. Get Racc'd (getraccd_) 11 58.70 67.67 2 18.18
17941. GerDi (gerdii) 11 61.75 80.20 5 45.45
17942. Genie (genielee) 11 111.77 137.01 6 54.55
17943. Griffin (gdawg_10) 11 70.58 81.07 7 63.64
17944. Sam (garuda1221) 11 86.23 98.47 8 72.73
17945. Gaphnix (gaphnix) 11 63.68 66.80 4 36.36
17946. Galib (galib2051) 11 70.49 77.81 4 36.36
17947. Gabber (gabbergandalf) 11 62.84 67.87 3 27.27
17948. Gochu (g0inginsqne) 11 108.43 116.69 5 45.45
17949. UppedFusion (fusion_) 11 110.27 119.53 6 54.55
17950. FusionHimSelf (fusionraider1) 11 53.87 66.54 2 18.18
17951. Fromitz (fromitz) 11 94.25 111.14 1 9.09
17952. Wilson (friwilly) 11 72.60 85.46 3 27.27
17953. Frat (fratios) 11 113.67 139.61 6 54.55
17954. Lank (franklank) 11 76.14 84.40 1 9.09
17955. Forsegle (forsegle) 11 54.41 59.54 3 27.27
17956. Pog (fooooood) 11 105.56 136.14 6 54.55
17957. Cody (foggen) 11 95.64 113.96 5 45.45
17958. Michal (fly_you_fools) 11 75.15 85.18 6 54.55
17959. Mark Hightower (flytower69) 11 118.65 140.41 9 81.82
17960. Benson (flowery_robot) 11 71.83 88.55 6 54.55
17961. hi (florzie_101) 11 73.52 91.20 4 36.36
17962. floffy (floffyunicorn) 11 100.18 116.69 4 36.36
17963. saar (flappy_dude) 11 66.08 79.26 1 9.09
17964. NotFlame (flameon0703) 11 60.21 65.97 1 9.09
17965. Michael (fkafkaneko) 11 80.11 99.04 4 36.36
17966. Rishabh (fire_tornado3) 11 72.34 80.86 2 18.18
17967. Ferresmash (ferdinandohrn) 11 65.85 81.88 5 45.45
17968. Sasan (farnasirim) 11 107.13 120.43 7 63.64
17969. tuan (fajerso) 11 78.85 97.62 1 9.09
17970. Faded (fadedcrown95) 11 54.00 65.66 3 27.27
17971. Faded7 (faded7) 11 85.11 98.58 3 27.27
17972. Fabrizio (fab_) 11 81.01 99.69 4 36.36
17973. Grant (eyz11327) 11 108.02 116.83 6 54.55
17974. Evan (eyatri) 11 91.43 101.15 4 36.36
17975. sudden (explosionsarenice) 11 75.65 87.12 3 27.27
17976. Pepeg (evolvingpepeg) 11 101.79 123.42 6 54.55
17977. Steeferino (evlpacman) 11 113.55 136.51 7 63.64
17978. Evan250250 (evan250250) 11 97.51 130.91 3 27.27
17979. Eugene (eugene1) 11 73.53 93.31 4 36.36
17980. Roland (errur) 11 90.53 110.90 4 36.36
17981. Champion (error404_winner) 11 59.86 69.21 2 18.18
17982. Not Fast (ernmanke) 11 65.16 71.85 4 36.36
17983. Erim (erimmos) 11 65.49 72.94 6 54.55
17984. Eric (eric_05) 11 76.73 88.25 6 54.55
17985. Alex (equidorian) 11 110.30 116.86 5 45.45
17986. a (eqnzio) 11 100.53 115.31 5 45.45
17987. Eoghan (eoghanshox420) 11 56.81 63.23 3 27.27
17988. deon (emonemoemo) 11 107.96 125.57 3 27.27
17989. Liam (emissions) 11 110.28 136.40 7 63.64
17990. elnino (elnio2803) 11 87.29 104.24 2 18.18
17991. Elibay (elibay98) 11 72.91 79.15 5 45.45
17992. Electro (electrotech17) 11 58.24 67.01 2 18.18
17993. victor (einzu) 11 46.44 56.55 0 0.00
17994. asdfhuiosdfgshiodfhji (efrd... 11 116.06 131.87 10 90.91
17995. eenterr (eenterr) 11 81.27 88.20 2 18.18
17996. Bob (echonex) 11 74.98 85.88 6 54.55
17997. Dekaj (d_kaj) 11 69.73 82.56 11 100.00
17998. dtn (dvdn) 11 106.28 117.93 6 54.55
17999. Davi (dusk_09) 11 137.41 152.87 7 63.64
18000. Daulet (dtk6) 11 48.86 62.58 4 36.36
18001. dsa8 (dsa8) 11 91.00 98.21 2 18.18
18002. Máté (drunkendegroot) 11 84.25 93.99 4 36.36
18003. Hugh (drhugh) 11 68.16 77.81 3 27.27
18004. drew (drewthejedi) 11 75.95 82.44 4 36.36
18005. ha (drchill) 11 90.64 103.58 1 9.09
18006. Deric Lewis (dragon760) 11 24.40 36.49 3 27.27
18007. Jan (draggonnfs) 11 81.42 97.90 2 18.18
18008. Shrig (dracon7260) 11 101.73 116.98 4 36.36
18009. dorj (dorjoo) 11 64.42 76.18 2 18.18
18010. doremy (doremypuyotet) 11 152.03 180.08 9 81.82
18011. dom (domxrare) 11 57.61 68.66 2 18.18
18012. Carl (doctorkohaku) 11 104.75 118.50 4 36.36
18013. ttvdivertingwhale (divertin... 11 116.18 137.66 10 90.91
18014. Dio (dio_b_) 11 73.13 81.35 11 100.00
18015. Diogo (diogosilva) 11 45.58 51.08 1 9.09
18016. Benedikt (dikt73) 11 79.04 93.16 6 54.55
18017. Dennis (dheitinga) 11 78.38 91.00 7 63.64
18018. Dev (devparkk) 11 63.25 73.30 4 36.36
18019. devendra (devendra303) 11 36.48 48.45 0 0.00
18020. Derhein (derhein24) 11 51.97 68.52 2 18.18
18021. Yoshimitsu (deep_impact) 11 64.62 71.69 3 27.27
18022. Deathwish (death_wish) 11 86.53 94.15 2 18.18
18023. Ahmed (dd3x) 11 69.70 78.90 1 9.09
18024. Aman Daudung (daudung_5) 11 43.02 47.92 1 9.09
18025. Anthony (daslayer05) 11 73.30 81.53 2 18.18
18026. Poop (danukas155) 11 91.30 115.60 4 36.36
18027. Daniel (danucu22) 11 37.10 52.04 2 18.18
18028. Salzpanik (daniely1160) 11 86.00 132.61 5 45.45
18029. Spavid (dadkos34) 11 81.34 115.73 7 63.64
18030. Jay Chaudhary (cyber_ace) 11 50.30 58.69 1 9.09
18031. Cris (ctietsort) 11 107.86 121.79 4 36.36
18032. albert (csnake) 11 99.79 106.64 5 45.45
18033. csgo (csaddict) 11 61.71 73.47 1 9.09
18034. Charlie (crystal_gamer) 11 67.12 75.96 3 27.27
18035. Vincent (cruhm) 11 98.49 131.80 3 27.27
18036. NATURELOVER (crafting112) 11 99.43 115.91 3 27.27
18037. CPawx (cpawx) 11 102.32 118.71 2 18.18
18038. Cow (cowscantype) 11 103.44 113.26 4 36.36
18039. Hugo (cortexior) 11 75.95 82.43 3 27.27
18040. Jose (cornjose877) 11 82.48 97.85 2 18.18
18041. CoolMan14 (coolman14) 11 71.27 83.27 8 72.73
18042. Converto (converto) 11 69.20 78.99 3 27.27
18043. ocean man (clickbaitt) 11 89.41 97.74 2 18.18
18044. ㅤ (clarified) 11 131.02 145.38 4 36.36
18045. lord (cintrixity) 11 83.95 97.12 7 63.64
18046. clicky (cinadeeye) 11 114.69 129.14 6 54.55
18047. Christian (christianwells) 11 72.56 85.43 4 36.36
18048. Hyx (christianmoises) 11 88.19 96.78 0 0.00
18049. Luis (chiklay) 11 100.08 123.09 1 9.09
18050. Jason (cherryitbruhnarutojizz) 11 103.38 117.90 4 36.36
18051. Nurbek (cheburekkek) 11 62.87 72.12 2 18.18
18052. Sahil (chazos) 11 46.44 51.71 3 27.27
18053. Wei (charles2007) 11 79.79 94.12 10 90.91
18054. Vei (cengi) 11 97.79 123.29 5 45.45
18055. Cel (celad0n) 11 104.50 118.85 5 45.45
18056. *** (ccccalvinn) 11 73.38 89.03 2 18.18
18057. Carlos (carloshdelreal) 11 55.42 62.57 1 9.09
18058. Cameron (camma) 11 69.10 82.30 1 9.09
18059. c4th0d3 (c4th0d3) 11 97.98 121.30 2 18.18
18060. Heriberto (c4rt4sbarajas) 11 54.12 68.73 2 18.18
18061. Marcus (byteeater) 11 93.96 107.39 7 63.64
18062. ByamB4 (byamb4) 11 81.91 95.61 6 54.55
18063. Benjamin (bxrivx) 11 106.33 125.89 2 18.18
18064. mikey (buzzpmikey) 11 101.24 123.45 7 63.64
18065. Andrew (buttmann64) 11 102.89 126.59 6 54.55
18066. bunkered (bunkeredgame) 11 90.83 109.38 6 54.55
18067. Nicholas (bsg8) 11 55.83 65.16 2 18.18
18068. Bryce (bryce_verberne) 11 76.86 93.82 7 63.64
18069. Marko (bru_) 11 63.90 72.94 1 9.09
18070. Brian (briannstiven) 11 51.77 55.70 5 45.45
18071. brady (bradyone) 11 79.20 92.22 2 18.18
18072. Bradley (bradley_brown) 11 94.94 105.48 1 9.09
18073. Hannah (bored_hannah) 11 53.18 63.25 1 9.09
18074. Not as fast as Reckful (bol... 11 93.92 104.09 6 54.55
18075. bob (bobobb) 11 142.93 169.74 10 90.91
18076. m (bluesiren) 11 96.41 120.45 5 45.45
18077. Richard (blitzd2020) 11 91.19 100.04 3 27.27
18078. Bucecean (blaskowiscz) 11 144.46 189.80 7 63.64
18079. Black (black_pineapple) 11 64.98 76.86 3 27.27
18080. bitte (bitteschnell) 11 85.40 106.22 8 72.73
18081. bishwash (bishwash_patel) 11 42.02 62.78 2 18.18
18082. Bishwash (bishwashadhikari) 11 58.92 75.13 3 27.27
18083. bill (bill_hunt22) 11 29.01 32.41 0 0.00
18084. Brian (bgan) 11 93.49 100.79 6 54.55
18085. Musharaf (benthorzm) 11 86.39 100.82 3 27.27
18086. Ben (bendoman_) 11 107.93 119.29 6 54.55
18087. Borky (beckysingasong) 11 104.20 122.71 6 54.55
18088. Grayson (beanbagman) 11 57.67 70.21 8 72.73
18089. Bdog (bdogblue) 11 50.90 56.78 2 18.18
18090. Batuhan (batuhan_tbb) 11 61.24 74.25 4 36.36
18091. voidtab (battini) 11 68.17 74.50 3 27.27
18092. Bogdan (bartfast42) 11 46.30 51.02 1 9.09
18093. Bartek (barteker19) 11 69.79 80.29 1 9.09
18094. brendan (barnold2) 11 97.31 114.78 4 36.36
18095. li (badplayer970) 11 97.71 118.29 4 36.36
18096. Kyle (badadc) 11 92.70 112.81 5 45.45
18097. Baby (babyfacedassassin) 11 79.15 97.84 1 9.09
18098. Bryan (b27i5n) 11 111.95 129.52 5 45.45
18099. Nany (a_nany) 11 43.09 48.62 1 9.09
18100. ayy (ayy_cocotype17) 11 56.44 69.27 10 90.91
18101. Caleb (awsumbabysnarl) 11 86.55 100.30 2 18.18
18102. Avlotis (avlotis) 11 106.81 114.95 4 36.36
18103. Turbo (avash101) 11 64.56 75.66 1 9.09
18104. Auiyin (auiyin) 11 89.27 99.72 6 54.55
18105. choi (ateezofficial) 11 71.82 83.52 2 18.18
18106. Ahmad (asz13) 11 99.75 109.87 5 45.45
18107. AC (astralcalamity) 11 96.24 107.48 3 27.27
18108. Panagiotis (asifo) 11 47.14 59.28 0 0.00
18109. Living (asianliving) 11 92.14 100.35 2 18.18
18110. Thuan (asianboiii) 11 61.00 81.28 0 0.00
18111. Ashiquzzaman (ashiquzzaman33) 11 70.98 78.21 1 9.09
18112. Buster (artistinthehoodie) 11 48.78 61.22 0 0.00
18113. Artur (arthurisit) 11 86.23 100.30 4 36.36
18114. Adam (armorcle) 11 108.97 122.99 7 63.64
18115. Arjuna (arjuna_) 11 84.63 95.21 3 27.27
18116. NewKeyboardDontLaugh (arisk... 11 86.71 102.38 6 54.55
18117. Ariful (ariful_farhad) 11 52.79 59.37 0 0.00
18118. ayu (areyouayu) 11 91.72 107.20 4 36.36
18119. null (apstamp45) 11 58.80 65.36 1 9.09
18120. DC (applespammer) 11 74.80 89.84 0 0.00
18121. Abhinay (apasunuri) 11 86.04 94.80 0 0.00
18122. Anthony (anthony_787) 11 83.99 99.74 1 9.09
18123. Anthony (ant333man) 11 75.33 83.16 3 27.27
18124. anoniman (anoniman_0001) 11 102.18 117.96 1 9.09
18125. Andrewb (andrewbb) 11 89.42 97.02 7 63.64
18126. Leroy (ancientnoodles) 11 78.17 84.74 7 63.64
18127. Ahmet (amutlugun) 11 75.39 83.73 2 18.18
18128. Aman (amanminerulez) 11 67.63 75.29 2 18.18
18129. Bryo (alta1r) 11 47.85 70.23 7 63.64
18130. AJ (alquinso_) 11 87.43 100.61 3 27.27
18131. alisa (alisalmao) 11 76.27 89.83 5 45.45
18132. Alexander (alexanderfzz) 11 69.53 81.17 4 36.36
18133. Alaa (alaaalmasri00) 11 75.38 84.42 3 27.27
18134. Akitolight (akitolight) 11 106.91 113.86 6 54.55
18135. aki (akiiiwashere) 11 79.68 98.76 5 45.45
18136. Gabriel (akgabe) 11 63.76 69.70 4 36.36
18137. Aidan (aidan605) 11 70.64 78.33 2 18.18
18138. Ahmad (ahmad_a_0) 11 86.22 104.28 2 18.18
18139. ahgirl (ahgirl123) 11 74.29 90.03 2 18.18
18140. Aubrey (ahensley) 11 83.32 95.49 1 9.09
18141. Vincent (aetherxd) 11 94.91 115.81 4 36.36
18142. Aedrick (aedrick) 11 69.19 83.49 1 9.09
18143. Advaanture (advaanture) 11 60.17 71.62 2 18.18
18144. (adma) 11 153.99 186.35 11 100.00
18145. Adam (adam1101) 11 79.14 95.26 5 45.45
18146. Marc (ackermanick) 11 67.46 76.19 2 18.18
18147. Ace (aceofcaps) 11 74.37 89.36 2 18.18
18148. Abyo (abyo) 11 60.68 69.98 1 9.09
18149. Mahmudul Hasan🕋🕌 (abo... 11 62.76 76.06 0 0.00
18150. Dominique - Axl (able_04) 11 54.08 61.96 0 0.00
18151. Fyroo (abelkarbel) 11 60.41 68.47 5 45.45
18152. Homieboy (abcjohnabdjohn) 11 48.20 58.06 2 18.18
18153. TTTT (aa7608327) 11 56.64 65.96 3 27.27
18154. Vikas (a4atom) 11 83.98 94.00 3 27.27
18155. 7zephyr (7zephyr) 11 104.30 117.19 6 54.55
18156. yanna (7yanna) 11 115.49 132.08 4 36.36
18157. Random (65h1000) 11 104.57 111.26 5 45.45
18158. Cody (5niffles) 11 87.78 100.34 4 36.36
18159. Pixel (2pixles) 11 61.99 76.25 4 36.36
18160. Liam (2020lhall) 11 67.81 78.57 2 18.18
18161. Afik (afikrazanafi) 11 33.74 38.78 0 0.00
18162. MeeM (memepolice) 11 73.50 86.96 8 72.73
18163. Amit (_amit_) 11 75.16 84.49 2 18.18
18164. joefromfamilyguy (joefromfa... 11 91.40 111.61 7 63.64
18165. Chris (kringlepringle) 11 85.24 99.34 1 9.09
18166. Alex (yettibvc) 11 41.16 48.33 0 0.00
18167. Kitzia (kavila7) 11 56.11 76.16 0 0.00
18168. ITZZAC (itzzac_youtube) 11 44.20 57.78 2 18.18
18169. Tim (twitchanbumaniac) 11 52.48 65.24 5 45.45
18170. salah (salah1406) 11 66.96 77.88 1 9.09
18171. Phindoll (philosopher_phun) 11 71.35 87.03 4 36.36
18172. Tissue (tissuenoob) 11 55.84 61.56 2 18.18
18173. Participant (_chethan18) 11 55.80 62.71 4 36.36
18174. JMoneyThug (jthugmoney) 11 77.84 92.86 2 18.18
18175. Ryyn (ryyn_isr) 11 71.24 78.30 2 18.18
18176. Firestar162 (firestar162) 11 45.57 61.54 3 27.27
18177. Christian (campi) 11 100.13 122.09 6 54.55
18178. rin (rieiode) 11 65.49 79.40 2 18.18
18179. Ronin (ronin_1) 11 63.07 71.11 3 27.27
18180. Jiyon (johnrhey324) 11 36.21 46.20 0 0.00
18181. Falin (falin224) 11 49.74 59.24 5 45.45
18182. Garenforth III Johnston (si... 11 61.39 70.19 4 36.36
18183. Guillaume (bilaptor) 11 51.39 55.81 0 0.00
18184. AJ (applepie314) 11 66.19 80.74 1 9.09
18185. nht (nhtonmoy) 11 58.53 64.48 5 45.45
18186. Jachin (optimal_husky) 11 85.20 94.15 5 45.45
18187. Dave (jungolo) 11 80.78 90.20 2 18.18
18188. Jason (jpbascon) 11 87.29 95.28 4 36.36
18189. Morgen (germansdfsd) 11 58.46 69.83 2 18.18
18190. Vilgot (fido_mandem) 11 73.35 87.04 4 36.36
18191. Matus (zlatovlasko) 11 67.62 79.36 3 27.27
18192. Steph (stephsim) 11 55.76 65.05 1 9.09
18193. BurntBac0n (burnt_bacon08) 11 91.35 105.66 6 54.55
18194. AcroniX (acronix_iom) 11 83.50 92.33 4 36.36
18195. Rain (ghetsis) 11 66.77 72.26 0 0.00
18196. EdmiszTheProto (edmisz1000) 11 62.85 74.49 1 9.09
18197. Grant (grant_types) 11 66.01 78.26 2 18.18
18198. Philip (philipisawesome4) 11 76.64 91.91 1 9.09
18199. Saif (littleboy291) 11 42.28 48.69 0 0.00
18200. Sam (caldeen) 11 73.42 84.40 3 27.27
18201. Axel (axless) 11 32.49 35.46 1 9.09
18202. hououin (hououinkyouma10) 11 61.43 68.99 2 18.18
18203. Jackson (saintpepsi) 11 44.00 55.47 0 0.00
18204. cameron (cammyteo) 11 99.78 114.25 6 54.55
18205. Ammar (shaikh_ammar) 11 89.97 97.04 6 54.55
18206. Eduard Felipe (efmorab) 11 67.11 75.91 2 18.18
18207. Edris (babyheaven) 11 80.24 101.26 5 45.45
18208. Ehm (doubleuehm) 11 84.13 108.04 2 18.18
18209. Herf (heerf) 11 72.34 84.70 3 27.27
18210. Pai (paipai00) 11 72.03 86.70 1 9.09
18211. Ferdie (ferdiepie) 11 84.78 110.51 7 63.64
18212. Antoni (fixyyy) 11 48.56 52.79 0 0.00
18213. Josh (joshuayu12) 11 85.23 106.68 5 45.45
18214. Bob (bob_the_driver) 11 75.76 95.63 3 27.27
18215. Axrorbek (abduxolikov_axror) 11 41.66 49.07 1 9.09
18216. Vansh (vansh_) 11 85.17 93.02 5 45.45
18217. daniel (danniel_29) 11 71.19 77.94 4 36.36
18218. Jewel (jcpenguin168) 11 94.57 113.21 9 81.82
18219. R (treeondirt) 11 79.65 89.52 3 27.27
18220. LaikaX2 (laikax2) 11 75.05 87.31 4 36.36
18221. Burakki (burakki) 11 90.88 104.60 7 63.64
18222. Rezaul (rezaulhsagar) 11 72.41 87.43 5 45.45
18223. Buggati Beetle (dwiil) 11 103.98 122.95 6 54.55
18224. mikolah (gruby1265) 11 74.80 84.61 1 9.09
18225. Faisal (faisal_eub) 11 39.14 47.61 3 27.27
18226. Imam (imam_droubi) 11 55.76 71.37 2 18.18
18227. Omar (omar963963) 11 50.49 58.01 0 0.00
18228. muffnbuttn (muffnbuttn) 11 69.03 82.46 3 27.27
18229. Michaella Alessandra (bling... 11 68.19 74.36 3 27.27
18230. tongs (skglo) 11 79.57 89.78 5 45.45
18231. Richard (ziveria) 11 47.32 58.10 0 0.00
18232. Džiugas (xdziugas) 11 41.43 50.36 1 9.09
18233. Sai (nikhil_nikky_1221) 11 30.53 37.50 1 9.09
18234. Troy (yeahaha010) 11 68.95 82.31 7 63.64
18235. Julian (julian72cr) 11 41.58 50.87 3 27.27
18236. ked (kedary3) 11 37.15 45.84 2 18.18
18237. TJ (planee) 11 51.16 60.47 8 72.73
18238. asdf (cyber_gny) 11 65.66 85.52 3 27.27
18239. Martin (waldoska) 11 67.07 80.76 4 36.36
18240. Sina (sinaakh) 11 54.83 62.78 3 27.27
18241. Weegee (littleweegee) 11 102.88 119.92 5 45.45
18242. Miya (miya11) 11 54.13 60.55 1 9.09
18243. Nazmul Haque (codebyred) 11 59.34 69.27 3 27.27
18244. Mizuto- (yull) 11 55.29 63.06 0 0.00
18245. tomer (tomerkligman) 11 50.00 60.50 2 18.18
18246. Jun (unicornsandrainbows) 11 82.94 94.31 2 18.18
18247. i write code (_yay) 10 84.83 105.36 8 80.00
18248. Mr.Buttons (_tanuuuu) 10 85.05 93.72 3 30.00
18249. Megatypist (_megatypist_) 10 120.16 138.55 7 70.00
18250. Eoyzyc (_eoyzyc_) 10 34.94 46.27 2 20.00
18251. Fabian (zyzyx) 10 80.93 88.70 4 40.00
18252. Marz (zuchan) 10 94.41 109.12 6 60.00
18253. zoomrickyyy (zoomricky) 10 75.97 87.21 5 50.00
18254. Zachary (zjroote) 10 79.09 89.99 1 10.00
18255. Zir0 (ziiro) 10 93.75 105.60 4 40.00
18256. Tony (zhukant) 10 109.46 121.48 5 50.00
18257. Zen (zencreepz) 10 91.79 110.60 4 40.00
18258. zanydruid (zanydruid) 10 72.35 85.14 2 20.00
18259. Zak (zak1388) 10 73.24 96.74 5 50.00
18260. Cojo (zagoat) 10 62.27 70.51 1 10.00
18261. Tim (yutuyt) 10 112.35 132.08 8 80.00
18262. Zach (yo_zs) 10 58.60 73.16 1 10.00
18263. Aleksandar (yoursis) 10 53.68 62.93 3 30.00
18264. Yothin (yothinix) 10 60.75 66.75 0 0.00
18265. Kevin (yolonce) 10 50.65 57.92 2 20.00
18266. Yerkegul (yerkesha) 10 41.44 45.16 2 20.00
18267. Yelzhan (yelzhansky) 10 36.92 39.88 0 0.00
18268. yamrawr (yamrawr) 10 148.98 167.45 7 70.00
18269. yoshiking (y05h1k1ng) 10 57.82 70.64 2 20.00
18270. huge (xxxtentaciontrippiere... 10 46.31 58.45 2 20.00
18271. Ted (xted) 10 111.56 131.99 6 60.00
18272. Noah (xsonorous) 10 92.38 103.55 2 20.00
18273. xsharawi (xsharawi) 10 64.10 84.60 2 20.00
18274. Nick (xogtwo) 10 49.53 63.35 2 20.00
18275. xLikely (xlikely1) 10 113.72 124.99 7 70.00
18276. Lian (xlian) 10 84.26 106.87 4 40.00
18277. Zach (xachg) 10 70.92 79.00 4 40.00
18278. Hoesmad (woshinidie123) 10 74.32 86.93 2 20.00
18279. Fluffster (wlmao) 10 74.76 105.39 2 20.00
18280. Witre (witred) 10 74.31 91.50 6 60.00
18281. William (willkosasih) 10 66.58 71.19 1 10.00
18282. Nathaniel (wiiman) 10 59.41 68.13 4 40.00
18283. Walter (whunt5757) 10 93.70 115.67 4 40.00
18284. what (what_what_what) 10 97.06 114.98 4 40.00
18285. 50 Year Old Girl (whatsthis) 10 83.47 108.09 3 30.00
18286. Zachary (weiser) 10 83.35 97.23 4 40.00
18287. Wanizame (wanizame) 10 76.44 92.92 2 20.00
18288. TheDecentPretender (wamsly) 10 90.50 99.97 2 20.00
18289. Dean (wahrheit) 10 84.12 102.85 3 30.00
18290. V (vy171) 10 100.35 130.17 1 10.00
18291. Average (vuzid) 10 92.14 119.27 10 100.00
18292. Vojtěch (vojtar) 10 72.44 85.03 1 10.00
18293. Vic (vicjen) 10 99.60 114.09 6 60.00
18294. han (vapour_) 10 106.13 116.04 5 50.00
18295. van (van8878) 10 45.29 54.38 0 0.00
18296. Kevin (v3rmillian) 10 82.26 96.98 0 0.00
18297. Mats (uxorialrook) 10 85.40 94.79 3 30.00
18298. uska95 (uska95) 10 55.56 67.71 1 10.00
18299. Denni (uramazing) 10 102.08 114.44 7 70.00
18300. Smooth (undeadplayer) 10 49.55 54.41 1 10.00
18301. Orlando (ultraonlinexd) 10 46.47 61.79 0 0.00
18302. Esther (ueatmypoop) 10 58.68 70.63 1 10.00
18303. Typing (typotyper1738) 10 59.69 80.18 1 10.00
18304. Rider (typerrider) 10 116.04 132.79 6 60.00
18305. Andrew (typegad) 10 54.25 63.49 4 40.00
18306. Matthew (twixinator) 10 96.81 110.68 2 20.00
18307. Felix (twiizy) 10 71.51 82.27 4 40.00
18308. Daniel (turnercommadan) 10 66.83 71.80 3 30.00
18309. Jim (turkeyfetish) 10 90.03 103.33 5 50.00
18310. Mike (tsunami21) 10 93.91 105.94 1 10.00
18311. Taush (tsampley) 10 85.62 103.19 4 40.00
18312. TREMAINE (tremaine_m) 10 67.97 83.15 1 10.00
18313. Tour2738 (tour2738) 10 42.08 46.69 1 10.00
18314. ToncaIlPunta (toncailpunta) 10 77.57 89.05 4 40.00
18315. Token (token_typer) 10 77.47 91.63 3 30.00
18316. Isaac (tkdwarrior) 10 63.51 70.53 3 30.00
18317. hihihi (tjddb123456) 10 137.77 149.04 7 70.00
18318. Timmy (tjdaroya1) 10 99.07 115.95 9 90.00
18319. Tinky (tinkywinkyy) 10 82.77 94.14 2 20.00
18320. TinklyBell (tinklybell1608) 10 77.21 85.94 4 40.00
18321. Stewart (timberland9x) 10 63.05 83.95 0 0.00
18322. tilen (tilen219) 10 51.07 61.54 2 20.00
18323. Ella (tigger1854) 10 76.37 98.85 4 40.00
18324. TRUMP (tiepin) 10 93.01 102.01 2 20.00
18325. Mrigank (tickatron) 10 40.03 53.52 1 10.00
18326. @itz_ramy (thugsheep) 10 82.12 94.94 3 30.00
18327. Thooq (thooq) 10 57.53 61.23 2 20.00
18328. Lan (thien_hai13) 10 56.25 66.09 1 10.00
18329. Nikolas (the_sleepy) 10 75.89 79.36 1 10.00
18330. the_redcar (the_redcar) 10 93.67 123.69 6 60.00
18331. themar (themar) 10 57.26 66.13 1 10.00
18332. not_inte2 (theinte) 10 93.97 105.12 4 40.00
18333. Thang (thangvu7) 10 83.26 102.39 4 40.00
18334. Patrick (tepill) 10 100.76 116.87 4 40.00
18335. Teo (teotheterminator) 10 56.76 65.88 3 30.00
18336. Sean (tensai888) 10 80.92 97.21 3 30.00
18337. Templeton (templetontsai) 10 63.50 68.46 0 0.00
18338. funky (teletubbystan) 10 59.22 65.18 3 30.00
18339. Caleb (tekksic) 10 61.68 76.23 3 30.00
18340. Harshit (techallbyharshit) 10 67.15 80.30 2 20.00
18341. Tcoman (tcoman1) 10 67.27 72.54 6 60.00
18342. Luke (tbsky92) 10 93.15 110.75 9 90.00
18343. Tavora (tavora) 10 108.41 127.19 6 60.00
18344. Tatsky (tatskynuki) 10 151.19 191.75 6 60.00
18345. Andrew (taroth) 10 101.23 119.97 4 40.00
18346. Talbiya (talbiya) 10 37.12 43.09 4 40.00
18347. takeoutfoo (takeoutfoo) 10 102.43 121.23 6 60.00
18348. Andy (tactilegangriseup) 10 109.47 134.41 5 50.00
18349. Tasman (t4sm4n) 10 66.82 73.75 1 10.00
18350. Sybetron (sybetron) 10 34.21 43.97 1 10.00
18351. Sweeter (sweetervanilla) 10 96.29 112.21 5 50.00
18352. swat (swatxian) 10 64.59 74.83 5 50.00
18353. Sushanth (sushanthgeorgesur... 10 54.02 67.00 3 30.00
18354. Huy (xthyax) 10 58.98 68.01 3 30.00
18355. Sultan (sultanai) 10 92.68 109.64 4 40.00
18356. me (suited4hike) 10 126.04 143.15 10 100.00
18357. lior (sudden_lee) 10 57.22 66.57 0 0.00
18358. deegl0rd (stimoze) 10 93.61 100.85 4 40.00
18359. Sticfigure (sticfigure) 10 45.19 50.61 1 10.00
18360. Starmaster (starmasterx) 10 63.52 71.88 7 70.00
18361. Venice (starbucks272) 10 99.48 107.79 4 40.00
18362. StaliaN (stalian) 10 77.50 88.68 0 0.00
18363. Ok (ss__) 10 69.11 82.56 1 10.00
18364. Soph (sssoooppphhh) 10 85.18 98.02 1 10.00
18365. ssofia (ssofia_bas) 10 28.29 33.91 2 20.00
18366. speed (speed_boiiii) 10 64.70 76.25 3 30.00
18367. Speed (speedarmstrong) 10 95.73 119.65 3 30.00
18368. Specter (spectergrrim) 10 99.12 112.11 2 20.00
18369. Spammer (spammerforlife) 10 100.47 112.48 7 70.00
18370. K. (spacewalker) 10 111.10 128.77 5 50.00
18371. enthium.ejay (spacebars_) 10 79.53 86.11 2 20.00
18372. Moz (soul3n) 10 98.47 114.00 4 40.00
18373. mooth (sooruva) 10 80.87 90.19 4 40.00
18374. Sonic (sonicaks) 10 83.87 90.68 1 10.00
18375. bruh (sojucravings) 10 92.60 109.15 4 40.00
18376. Soggy (soggydog) 10 93.02 106.75 2 20.00
18377. SockYeh (sockyeh) 10 84.99 97.81 5 50.00
18378. void (soberr) 10 75.10 84.99 3 30.00
18379. saumitra (smtrd3) 10 38.89 44.76 0 0.00
18380. tiffany (skipperdee) 10 76.90 94.64 3 30.00
18381. Chris P. (sirjean_pepper) 10 97.28 109.39 4 40.00
18382. Sidveed (sidveed) 10 96.63 116.44 2 20.00
18383. shxvnk (shxvnk) 10 80.55 87.17 3 30.00
18384. Shivam Kumar (shivam51) 10 71.23 84.01 3 30.00
18385. (shinobukocho) 10 126.55 167.48 7 70.00
18386. TWICE Dahyun (sheenic) 10 83.58 100.25 5 50.00
18387. quit=trash (shatapfajjat69) 10 82.41 100.21 3 30.00
18388. Shashank (shanky92) 10 82.23 92.25 2 20.00
18389. Shania (shaniacans) 10 57.49 66.15 1 10.00
18390. Alan (sexillamasexi) 10 84.22 98.33 6 60.00
18391. sebastian (seviago) 10 48.51 54.96 2 20.00
18392. I_love_seulgi (seulgischurro) 10 94.57 103.17 1 10.00
18393. Sergio (sergio96c) 10 91.70 102.53 5 50.00
18394. Summer (sccb_14) 10 46.89 54.56 8 80.00
18395. Acetaminophen (savirbaas) 10 108.32 128.24 2 20.00
18396. Saurus (saurus) 10 77.64 86.30 4 40.00
18397. princeton (santabiii) 10 55.99 62.80 2 20.00
18398. Sanmeel (sanmeel) 10 70.31 85.01 4 40.00
18399. Samz (samzgm) 10 86.70 98.70 6 60.00
18400. Sam (samh410) 10 86.25 101.18 4 40.00
18401. Ezona (sambumbuslayer) 10 67.42 91.04 5 50.00
18402. Rose (salemluna) 10 68.98 74.28 4 40.00
18403. Sadaq (sadaq) 10 59.91 66.25 2 20.00
18404. Saagster (saagster) 10 73.79 86.21 3 30.00
18405. David (ryzeros) 10 94.27 111.16 3 30.00
18406. Ricky (ryckler) 10 87.68 100.95 5 50.00
18407. Rem (ryanz778) 10 117.40 129.51 5 50.00
18408. Robert (rwschuster) 10 122.74 147.40 6 60.00
18409. Antti (rustling) 10 81.53 94.06 4 40.00
18410. Russell (russell_t3ap) 10 98.44 113.24 4 40.00
18411. IMZA (runawayse) 10 71.26 79.33 1 10.00
18412. Yash (rubikstyper) 10 69.76 84.41 1 10.00
18413. Rsijlowpez (rsijlowpez) 10 120.08 131.44 6 60.00
18414. Maroy (roymaaa) 10 107.23 127.22 3 30.00
18415. lap (roeloflucka2) 10 74.99 85.86 2 20.00
18416. Mohammad (robin420024) 10 16.03 19.82 2 20.00
18417. Thint (rma251209) 10 58.41 69.25 2 20.00
18418. Rafi (rkyum) 10 71.88 79.04 2 20.00
18419. hplr (rkg0612) 10 105.27 119.21 3 30.00
18420. Ricky (riyu22) 10 90.37 108.13 3 30.00
18421. Rinat (rinatzh) 10 64.82 77.10 1 10.00
18422. Rim (rimkyul) 10 59.66 69.25 7 70.00
18423. Riggles (riggles) 10 89.74 103.38 1 10.00
18424. ridan (ridanrekas) 10 67.81 75.92 2 20.00
18425. Ricky (rickythedude) 10 61.55 68.54 1 10.00
18426. Rickard (rickyspr) 10 69.67 84.42 4 40.00
18427. I am cool (ribombee_mobile) 10 82.09 104.05 1 10.00
18428. Removeris (removeris) 10 78.83 92.67 1 10.00
18429. Relletro (relletro) 10 65.69 77.66 3 30.00
18430. Relja Bulat (relja0804) 10 48.39 56.28 2 20.00
18431. Krsman (rektix) 10 85.80 93.21 1 10.00
18432. Simon (rehy) 10 41.78 46.28 2 20.00
18433. Regan (regank1) 10 67.02 74.49 2 20.00
18434. Raynei (raynei) 10 90.04 107.34 4 40.00
18435. Ravindi (rav2525) 10 71.95 89.92 4 40.00
18436. Zain (rasnouk) 10 76.14 86.30 2 20.00
18437. Rania (rania_mostafak) 10 40.61 45.85 0 0.00
18438. Rana (rana2706) 10 49.39 57.20 1 10.00
18439. Teddy (rampagingteddy) 10 62.78 69.10 1 10.00
18440. Ramson (rammun) 10 69.27 80.89 0 0.00
18441. Ralph (ralphcyrus0015) 10 68.85 80.67 2 20.00
18442. MD ASHIQUL (rajib470) 10 58.94 66.19 0 0.00
18443. weiss (rag_penguin) 10 107.08 135.37 3 30.00
18444. t (raccoon_emoji) 10 57.76 71.48 4 40.00
18445. Giovanni (qwertyg01) 10 66.18 75.37 3 30.00
18446. tadeo (qwerm) 10 74.58 87.66 3 30.00
18447. Eequla (quintaboy) 10 105.36 120.60 4 40.00
18448. Lucas (pythonvx) 10 84.62 93.26 6 60.00
18449. phasawat (puppaprubchok) 10 46.89 52.78 3 30.00
18450. pun (punoar) 10 65.96 76.07 1 10.00
18451. PulseAD (pulsead) 10 96.75 109.70 7 70.00
18452. ProBlasters (pro_blasters) 10 63.06 76.56 4 40.00
18453. Alexander (prayforwinter) 10 96.59 114.63 5 50.00
18454. Prajwal10s (prajwal10s) 10 49.24 60.50 2 20.00
18455. Molasses (practice12_3) 10 89.22 95.90 3 30.00
18456. Mish (powerpuffgirl23) 10 57.04 66.98 5 50.00
18457. Pouya (pouyav) 10 66.28 79.53 2 20.00
18458. Nick (potatoshavings) 10 104.43 131.26 9 90.00
18459. kyle (popedude22) 10 106.51 127.90 4 40.00
18460. krisztofer (poofartmaster) 10 59.35 65.80 1 10.00
18461. Jakis (polishboy12221) 10 74.07 78.86 2 20.00
18462. Matt (pointlesspostulate) 10 84.60 90.94 7 70.00
18463. podolsero (podolsero) 10 57.92 67.14 4 40.00
18464. Grape (plrplrplr12345) 10 82.19 96.82 4 40.00
18465. Kailh BOX Jade (plixxreeb) 10 101.52 119.95 5 50.00
18466. Joe (playspout) 10 98.11 106.64 3 30.00
18467. Gustavo (pizza_water) 10 68.32 75.34 2 20.00
18468. P (pizzapita) 10 79.71 85.24 2 20.00
18469. Daredevil (piyush_123) 10 66.93 71.86 3 30.00
18470. Piyush (piyushc) 10 71.75 78.77 1 10.00
18471. Phantom (phantomzamber) 10 56.38 67.12 2 20.00
18472. Tim (penguins178) 10 81.76 100.58 3 30.00
18473. peedmypants420 (peedmypants... 10 80.98 95.32 4 40.00
18474. RIP Byron ❤ (pdnegreiros) 10 93.77 105.58 1 10.00
18475. Willy (paxson2008) 10 87.28 96.04 4 40.00
18476. Blagoj (pauc_99) 10 89.23 96.50 1 10.00
18477. Francisco (patleitao) 10 93.37 109.07 7 70.00
18478. Baki (p4n7r0n1c) 10 56.40 63.13 0 0.00
18479. Alex (p08r) 10 86.21 95.15 3 30.00
18480. oTTo (otto43) 10 67.20 83.26 1 10.00
18481. Martin (ostlangarn) 10 62.88 68.66 2 20.00
18482. Josh (orceun) 10 94.98 101.56 3 30.00
18483. hyungjin (optimizion) 10 72.70 80.84 3 30.00
18484. odraeyun (onedrapo) 10 74.75 83.68 1 10.00
18485. Kenneth (omgkenken) 10 104.95 121.10 5 50.00
18486. Olivia (olivisthecow) 10 97.42 112.02 6 60.00
18487. Erwin (oldskoollogik) 10 80.11 94.16 4 40.00
18488. Andy (okiandy) 10 106.40 125.70 6 60.00
18489. Nush (nush98) 10 92.27 108.47 4 40.00
18490. nurmyrza (nurzoik) 10 58.03 68.49 4 40.00
18491. Numpunk (numpunk) 10 75.21 89.86 4 40.00
18492. numdegased (numdegased) 10 96.37 102.96 3 30.00
18493. I'm Bad (nssv101) 10 124.71 143.55 3 30.00
18494. Tintallë (nparadigm) 10 68.96 73.79 2 20.00
18495. Note (note_r) 10 89.86 113.95 5 50.00
18496. kevin (noob98) 10 60.43 66.98 4 40.00
18497. noniino (noniino) 10 53.41 57.38 2 20.00
18498. DirtyDan.jpeg (nomar_76) 10 64.93 84.43 3 30.00
18499. NoFace (nofacecastle) 10 52.07 68.97 1 10.00
18500. Bryan (noddlersnorm) 10 97.08 105.17 4 40.00
18501. Noah (noahbradderz) 10 75.01 90.58 1 10.00
18502. Nitin (nitinaturdsk) 10 60.70 66.78 0 0.00
18503. Sef (niktarera) 10 95.18 122.14 5 50.00
18504. Nightmare (nightmare_foxy) 10 64.67 79.04 2 20.00
18505. Nicholas (nicshoe13) 10 90.99 104.88 1 10.00
18506. Nicholas (nichbillcliff) 10 90.84 93.57 3 30.00
18507. BountifulFever5 (nguyenanhn... 10 47.38 50.27 1 10.00
18508. NeVMiku (nevmiku) 10 67.23 81.07 3 30.00
18509. mat (netman) 10 85.96 99.03 3 30.00
18510. Neil (neil3110) 10 35.53 38.45 2 20.00
18511. aaron (naruto2141) 10 92.08 103.96 2 20.00
18512. nyaa~ (nakkooo) 10 131.02 173.70 6 60.00
18513. Cát Gia (nahidk) 10 67.24 77.31 2 20.00
18514. Nadia Gonzalez (nadiaig) 10 82.94 94.92 5 50.00
18515. danielwolf (n3kro) 10 89.14 103.47 2 20.00
18516. Louay (n0break) 10 36.50 42.85 0 0.00
18517. Michael (m_soutar3) 10 108.35 122.09 6 60.00
18518. Angela (mytypingskillsarent... 10 74.17 85.14 2 20.00
18519. Michael (myki21) 10 70.18 84.68 3 30.00
18520. Mustang (mustangmaster) 10 54.14 62.65 0 0.00
18521. Mukul (mukul27wno) 10 41.53 47.22 0 0.00
18522. M (mttt001) 10 80.94 90.24 4 40.00
18523. Martin (mr_pandabear) 10 92.31 100.75 5 50.00
18524. mr. (mr_maam) 10 91.37 107.29 4 40.00
18525. Cara (mrsham) 10 81.91 104.28 9 90.00
18526. MrLolu (mrlolux) 10 54.95 62.36 1 10.00
18527. Michael (mrgryph0n) 10 104.48 114.33 2 20.00
18528. Jordan (mrempyrean) 10 113.14 125.37 9 90.00
18529. Jack (mopex) 10 63.66 75.95 2 20.00
18530. Light (moory5) 10 86.95 93.18 1 10.00
18531. tstats[montedeu] (montedeu) 10 61.55 69.85 1 10.00
18532. Free Palestine (mohamad01) 10 58.24 66.06 1 10.00
18533. TheScientist (mixalocyber) 10 67.24 79.98 2 20.00
18534. Mistermanfith (mistermanfith) 10 35.31 40.73 0 0.00
18535. Aidana (missboss77) 10 27.51 34.67 0 0.00
18536. Wong (mioky) 10 33.11 38.21 1 10.00
18537. mingw (mingw) 10 105.19 111.82 6 60.00
18538. Mikael (mikael_abe) 10 61.37 71.25 1 10.00
18539. Miday (miday) 10 106.31 118.04 4 40.00
18540. Michael (michaell018) 10 63.28 74.19 3 30.00
18541. SeeStarz (mfahrim) 10 94.22 115.43 4 40.00
18542. Mentafind (mentafind) 10 79.73 93.59 5 50.00
18543. XFootballManX (meme_licker_21) 10 45.30 53.26 0 0.00
18544. Lil (memebigboy69xx) 10 79.03 86.52 5 50.00
18545. Zsombor (melidon) 10 41.43 54.56 1 10.00
18546. melau (melau) 10 105.46 125.84 5 50.00
18547. Laisvidas (meizind) 10 55.14 59.71 1 10.00
18548. Caba (megiorr69) 10 57.96 64.52 3 30.00
18549. Meeze (meeze) 10 98.14 117.00 2 20.00
18550. slow. (meeper24) 10 97.95 109.55 5 50.00
18551. Max (mcm20) 10 94.68 102.52 0 0.00
18552. Max (max_adagio) 10 104.11 121.32 1 10.00
18553. Max (maxies) 10 57.63 65.60 3 30.00
18554. Max (maxbro) 10 85.05 100.12 5 50.00
18555. Matthew (mawalker66) 10 81.90 90.90 9 90.00
18556. Groot (marcogroot) 10 106.35 122.64 4 40.00
18557. bbl_drizzy (marcofia) 10 78.87 89.46 3 30.00
18558. Marvin (marbinelyo) 10 65.49 74.64 3 30.00
18559. Manuel (mannymnz) 10 80.52 96.89 4 40.00
18560. Madhusudan (mainali449) 10 56.01 63.04 2 20.00
18561. RoyMcGround (maggyroyrowins... 10 25.99 28.60 1 10.00
18562. Orion (maggiea718) 10 73.58 82.82 3 30.00
18563. Mae (maeeeeee) 10 143.25 168.65 10 100.00
18564. Nagy (lurgul) 10 49.45 58.65 3 30.00
18565. Luke (lukep421) 10 82.94 94.89 1 10.00
18566. Gabe (lukeimyourdaddy) 10 76.45 82.42 6 60.00
18567. Lucite (lucite) 10 103.77 111.64 5 50.00
18568. Lucifer (lucifer_96) 10 47.04 55.74 2 20.00
18569. Lucas (lucaz_) 10 57.71 64.45 2 20.00
18570. Lowell (lowellfailingenglish) 10 95.59 120.25 3 30.00
18571. Loukas (loukatar) 10 77.81 86.97 1 10.00
18572. Lorky (lorkylav) 10 63.14 71.86 4 40.00
18573. ju (lordofthecoochie) 10 52.19 56.78 0 0.00
18574. 最靚嘅仔 (lookingdepres... 10 82.89 92.44 2 20.00
18575. Doc (lolnice) 10 97.78 125.18 6 60.00
18576. Stephen (lollidude) 10 81.66 94.58 1 10.00
18577. Lluna (lluna) 10 80.55 89.98 1 10.00
18578. lluis (lluissuros) 10 25.73 28.15 1 10.00
18579. simsimhae yagi (ljd1) 10 122.08 137.10 5 50.00
18580. liv (livlyf_) 10 62.58 68.75 1 10.00
18581. lisa (lisa99116) 10 79.07 106.05 1 10.00
18582. Linda (lindaslabbert) 10 31.42 38.61 0 0.00
18583. Youngbin (limesoda14) 10 74.71 80.37 1 10.00
18584. Giannis (lil_spani) 10 74.65 89.88 6 60.00
18585. boomer (lightaway) 10 51.13 62.66 0 0.00
18586. lea (leyley01) 10 37.13 41.61 0 0.00
18587. Francesco (lews_) 10 109.63 120.81 5 50.00
18588. Justin (leslav) 10 114.99 144.04 6 60.00
18589. leakcentral (leakcentral) 10 100.67 112.41 4 40.00
18590. kei (leadmen4y) 10 131.65 145.12 9 90.00
18591. Jason (laysonchillz) 10 73.61 83.60 3 30.00
18592. Veronica (latenightpizza) 10 97.51 111.20 6 60.00
18593. LastStar (laststar) 10 71.49 88.90 4 40.00
18594. Larry (larryquartz) 10 100.91 116.63 7 70.00
18595. Logan (larmack) 10 111.70 129.13 7 70.00
18596. Chris (kyoriosity) 10 99.24 114.65 10 100.00
18597. Sunny (kukie5) 10 90.00 97.39 4 40.00
18598. Chris (kryss_404) 10 63.75 72.70 2 20.00
18599. You're Slow (kronosxfleet) 10 69.01 79.82 2 20.00
18600. Christian (krisco) 10 136.47 156.38 4 40.00
18601. Big (kralefegaming) 10 62.39 72.87 2 20.00
18602. Koiysn (koiysn) 10 59.62 75.71 1 10.00
18603. Koii (koii2003) 10 80.97 89.35 5 50.00
18604. Richard (killerscotchy) 10 73.29 94.07 5 50.00
18605. kiki (kikifrederique) 10 37.05 41.82 3 30.00
18606. KickBull (kickbull) 10 89.99 106.69 3 30.00
18607. Abdulhamid (khamidsultan) 10 59.38 70.55 3 30.00
18608. Not telling (kevinveinein) 10 105.76 120.63 3 30.00
18609. Kevin (kevinchang823) 10 53.78 60.36 1 10.00
18610. Kevin (kevinator314) 10 91.26 95.74 5 50.00
18611. Kenshin (kenshin47) 10 96.10 110.85 7 70.00
18612. Kei 100 (kei100) 10 83.01 95.03 4 40.00
18613. bean (keenheen) 10 94.03 106.32 3 30.00
18614. Keanu (keanu72) 10 88.66 101.26 4 40.00
18615. Kyle (kbuschy) 10 89.16 104.87 1 10.00
18616. Kaz (kaz_the_kuz) 10 90.42 103.73 1 10.00
18617. Dennis (kavalier) 10 108.28 131.66 8 80.00
18618. kang (kasusuwowo) 10 86.52 104.14 6 60.00
18619. karim (karimkohel) 10 75.93 79.71 2 20.00
18620. kamikadze (kamikadze009) 10 69.94 76.05 1 10.00
18621. King of Pirates (kaizokuouu... 10 67.79 72.49 1 10.00
18622. Minh (kaishj91) 10 70.45 77.99 2 20.00
18623. Ka (kafong_0123) 10 39.09 45.10 0 0.00
18624. kae (kaelul) 10 52.52 63.96 5 50.00
18625. Joseph (jwkeating99) 10 98.84 108.93 5 50.00
18626. Just (justdandy_) 10 117.85 141.63 5 50.00
18627. lucy (justarat90) 10 73.84 84.60 4 40.00
18628. Jure (jujecat) 10 87.79 103.05 1 10.00
18629. Sid (judgementdey) 10 74.64 82.74 3 30.00
18630. Judd (judd123) 10 86.70 100.55 1 10.00
18631. jsve (jsve) 10 82.66 97.43 3 30.00
18632. Josh (jrc23) 10 83.11 96.44 4 40.00
18633. Jason (jpngfile) 10 99.99 113.57 4 40.00
18634. Josh (joshtegart) 10 112.08 145.91 3 30.00
18635. Nicholas (joshjoshjoshjosh) 10 107.75 145.27 5 50.00
18636. joey (josephb20252) 10 103.67 115.00 4 40.00
18637. bonsii (jorhlo) 10 88.39 99.19 3 30.00
18638. Jonathan (joni1234) 10 61.63 82.52 3 30.00
18639. Jonathan (jonathan_200605) 10 80.18 94.41 8 80.00
18640. Jonathan Justin (jonathanjw05) 10 96.91 102.67 4 40.00
18641. jolene (jolenech) 10 73.25 85.18 2 20.00
18642. Gamer (joksb2k) 10 44.27 47.89 2 20.00
18643. Sanjay (joker979) 10 62.11 78.00 3 30.00
18644. Ivan (john_the_unigoat) 10 51.11 64.19 0 0.00
18645. Garrett (joejoefriez) 10 79.31 98.91 2 20.00
18646. Kev (joebob1235) 10 90.70 106.24 5 50.00
18647. Antonio (joancoma05) 10 41.74 45.85 1 10.00
18648. Sep (jltariman) 10 63.53 71.43 1 10.00
18649. J (jkim55k) 10 64.57 72.18 5 50.00
18650. I can't type anymore (jjwiz... 10 77.73 95.37 5 50.00
18651. Josh (jjrandle1013) 10 63.92 72.34 1 10.00
18652. Joey (jj4ster) 10 104.42 129.76 6 60.00
18653. Jin (jinjohn) 10 50.41 55.92 2 20.00
18654. Jwarchild (jimmyhaffaren) 10 76.17 93.27 3 30.00
18655. Tim (jimbo112) 10 91.23 111.91 4 40.00
18656. Josh (jgeoppo) 10 59.19 68.05 2 20.00
18657. Joosep (jet_e) 10 80.51 88.84 2 20.00
18658. TheLegend27 (jethro2003) 10 99.95 107.66 6 60.00
18659. Jv (jemish_variya) 10 43.76 48.84 0 0.00
18660. KaptainFroggy_YT (jellybean... 10 74.92 86.08 1 10.00
18661. Jo (jelli017) 10 50.89 60.38 2 20.00
18662. jedishong (jedishong) 10 85.80 114.03 6 60.00
18663. Jon (jcrossley) 10 84.35 93.39 4 40.00
18664. Jin (jchoi1994) 10 134.88 152.29 9 90.00
18665. jboog (jboog) 10 79.87 91.88 8 80.00
18666. Bubbz (jaydenfiesta) 10 61.61 70.96 3 30.00
18667. Tom (javor) 10 76.74 83.89 5 50.00
18668. e (javascriptdude) 10 131.29 156.50 6 60.00
18669. Jamiel (jamiel_exe) 10 71.61 81.78 1 10.00
18670. Jamie (jam8554) 10 68.78 80.90 2 20.00
18671. Johann (jalohann) 10 111.07 136.35 8 80.00
18672. Jacob (jacobru) 10 54.58 66.40 0 0.00
18673. Jack (jack_tran04) 10 93.90 100.62 6 60.00
18674. M (izzyissad) 10 68.69 79.71 2 20.00
18675. eyevy (ivan28283) 10 140.80 161.28 6 60.00
18676. its_zaaid (its_zaaid) 10 42.63 48.50 0 0.00
18677. Tony (itsonlytony) 10 71.52 82.11 1 10.00
18678. kat (itskat_boba) 10 54.74 59.60 0 0.00
18679. Islam (islam_anwer) 10 47.14 55.32 1 10.00
18680. isaacgoe (isaacgoe) 10 97.45 118.71 3 30.00
18681. Instynkt (instynkt) 10 101.97 120.98 5 50.00
18682. InSaein (insaein) 10 49.26 56.55 1 10.00
18683. Kat (inoobo) 10 67.06 79.48 1 10.00
18684. Inferno2332 (inferno2332) 10 105.27 132.41 8 80.00
18685. Il Capitano (ilcapitano) 10 93.13 103.39 3 30.00
18686. beigecactus (idoofus123) 10 144.74 158.69 5 50.00
18687. Ido (idodobird) 10 83.90 100.63 4 40.00
18688. Alexander (idkwhatimdoin9) 10 59.57 71.31 1 10.00
18689. icy (icyxo) 10 75.00 84.26 4 40.00
18690. hi (ibadattyping) 10 105.97 121.16 2 20.00
18691. Smith (iamhablo) 10 59.50 62.24 1 10.00
18692. Daniel (hyunholee13) 10 102.93 123.62 4 40.00
18693. Icy_Istanbul (hypzx_x) 10 82.00 95.95 0 0.00
18694. hydroPUMP (hydropump) 10 58.88 68.14 1 10.00
18695. kvin (hwkhoa) 10 82.04 93.97 5 50.00
18696. Howbtard (howbtard) 10 113.92 147.90 5 50.00
18697. HotTubStream (hottubstream) 10 88.49 97.80 4 40.00
18698. Patrick (hongkongfui) 10 90.03 107.85 2 20.00
18699. HK_BAKA (hkuzumaki) 10 50.52 60.59 2 20.00
18700. Henry (henrytidholm) 10 65.72 72.10 5 50.00
18701. hello1900 (hello1900) 10 18.77 20.99 4 40.00
18702. haylie (hayizme) 10 44.21 53.93 0 0.00
18703. Jan (hautix) 10 53.31 63.27 0 0.00
18704. Kakashi (hatakeclan) 10 87.93 112.81 4 40.00
18705. hasan (hasan2000) 10 75.98 85.32 2 20.00
18706. Zach (hardtoki11) 10 99.13 126.66 3 30.00
18707. Wellington (happydonut) 10 104.28 134.45 5 50.00
18708. Hannah (hannityyy) 10 98.45 117.13 3 30.00
18709. Harry (hajohlay) 10 110.67 130.13 4 40.00
18710. HeMAN (h3m4n) 10 37.31 44.26 0 0.00
18711. Gurman (gurmns) 10 83.82 99.71 1 10.00
18712. Gunel (gunel12) 10 41.96 46.67 1 10.00
18713. Gurveer (gundo_1) 10 64.60 76.70 0 0.00
18714. Smoto (grozmot) 10 57.45 62.65 2 20.00
18715. Godstime (gozi3) 10 51.44 60.81 4 40.00
18716. Robert (gorilla710) 10 92.43 103.15 6 60.00
18717. Gongster (gongster1) 10 95.01 109.13 5 50.00
18718. ishan (gmd_cuber) 10 60.68 66.53 3 30.00
18719. OblivionGlisor (gliscor2004) 10 86.32 100.85 6 60.00
18720. WHEN THE IMPOSTER IS SUS SU... 10 29.39 30.66 0 0.00
18721. Gino (gino758) 10 61.25 69.78 2 20.00
18722. Gianmarco (gianma) 10 63.02 75.96 0 0.00
18723. Superfast (ghoststop) 10 126.97 143.68 7 70.00
18724. GGanon (gganon) 10 88.49 97.85 5 50.00
18725. tian (gfriend) 10 90.23 99.62 5 50.00
18726. GeeBee_29 (geebee29) 10 60.33 71.57 1 10.00
18727. Jacob (gaycob) 10 75.69 83.48 1 10.00
18728. Gat (gatmonke) 10 62.63 69.69 0 0.00
18729. Gary (gary_dahmer) 10 75.04 86.38 2 20.00
18730. garin (garinholiyana) 10 57.29 60.52 0 0.00
18731. garbyal ✌(-‿-)✌ (garb... 10 104.05 115.62 7 70.00
18732. GamersFTV (gamersftv) 10 38.64 45.32 0 0.00
18733. Funnier04 (funnier04) 10 71.79 82.51 5 50.00
18734. Lauto (fuji_puji) 10 98.54 109.35 3 30.00
18735. Pavel (fugives) 10 62.92 77.97 7 70.00
18736. Franz (franzl_fang) 10 48.41 56.11 1 10.00
18737. Force (foce3954) 10 41.38 45.94 1 10.00
18738. Jacob (floodedcodeboy) 10 69.15 77.93 4 40.00
18739. sgfd (fish_speckle) 10 61.78 73.27 3 30.00
18740. Fifi (fififishcake) 10 76.80 87.30 3 30.00
18741. Felipe (felipekde) 10 60.51 69.68 1 10.00
18742. Felipe (felipeav2) 10 27.37 34.51 1 10.00
18743. Elio (fcasper) 10 69.24 76.63 5 50.00
18744. Alan (faux_ray) 10 97.73 121.10 6 60.00
18745. Eric (fastestfatfingers) 10 102.40 115.57 6 60.00
18746. IlhanKhayru (fangian) 10 85.14 103.71 2 20.00
18747. Х. (falcon0338) 10 75.82 86.27 5 50.00
18748. idekbruh (fadedspirits) 10 87.29 100.25 2 20.00
18749. Cece (e_m_p_t_y) 10 79.64 91.52 1 10.00
18750. igig (eztau) 10 56.62 61.33 1 10.00
18751. Ezra (ezratyping) 10 89.78 103.39 5 50.00
18752. eyedin (eyedin) 10 115.21 132.12 5 50.00
18753. Eve (evehelin) 10 85.50 96.81 2 20.00
18754. Adrian (evadetoxinz) 10 44.52 55.32 2 20.00
18755. Ethan (ethro) 10 56.44 76.27 1 10.00
18756. Walter (eskaytee) 10 52.55 64.00 0 0.00
18757. Ashfaque (eshan_) 10 59.83 64.80 9 90.00
18758. typing (errors_intesify) 10 82.87 95.78 3 30.00
18759. Eric (erictie) 10 80.54 107.49 2 20.00
18760. Eric (ericboyce) 10 103.60 115.56 6 60.00
18761. eRFoRever (erforever) 10 110.79 135.13 9 90.00
18762. Henri (enzzzx) 10 112.20 131.47 5 50.00
18763. Renz (enriqatron52) 10 99.77 109.99 5 50.00
18764. Lior (endlease) 10 91.40 103.24 5 50.00
18765. i am Dog (endi_69) 10 66.26 77.61 4 40.00
18766. Sky (elucentx) 10 103.55 116.33 7 70.00
18767. Aron (ellipsoul) 10 111.48 121.77 4 40.00
18768. Elias (elias_17) 10 62.68 76.26 3 30.00
18769. Elias (eliasura) 10 110.99 129.28 8 80.00
18770. el (elchupo) 10 37.35 60.87 2 20.00
18771. ahmed (elberawy) 10 23.72 27.94 1 10.00
18772. Evan (eh30) 10 55.79 62.67 1 10.00
18773. 愛する (ecstxsy) 10 93.99 112.48 0 0.00
18774. Shamil (echonaut) 10 97.00 103.34 4 40.00
18775. Ori (echoloche) 10 56.56 63.57 4 40.00
18776. P. Leboid (eccentricpleboid) 10 44.91 56.60 0 0.00
18777. Dennis (dya26) 10 116.21 134.19 4 40.00
18778. mazen (dweedar) 10 74.71 84.17 2 20.00
18779. Diana (dustystar96) 10 60.21 69.18 0 0.00
18780. Aashish (dunsman) 10 43.74 50.15 1 10.00
18781. speed (druggedrice) 10 121.63 136.81 2 20.00
18782. j (droozyayayaya) 10 143.83 161.89 8 80.00
18783. Matthew (drogoton) 10 63.40 75.90 3 30.00
18784. José (dqcheetqh) 10 67.58 75.03 4 40.00
18785. Dinesh (dineshkandy) 10 77.39 98.37 1 10.00
18786. Dimitris (dimgag) 10 63.63 72.21 2 20.00
18787. Dimfred (dimfred) 10 83.03 98.18 3 30.00
18788. ayd (diamond) 10 22.41 30.47 5 50.00
18789. Dylan (dhatx13) 10 97.43 117.67 4 40.00
18790. 1 (desser2) 10 88.75 96.90 3 30.00
18791. despaciko (despaciko) 10 81.66 90.12 4 40.00
18792. deniz (dendiz) 10 75.50 91.80 2 20.00
18793. Tom (demarini) 10 104.95 117.71 4 40.00
18794. rudraksh (delusionaloptimist) 10 60.76 70.58 2 20.00
18795. Do (dekul1205) 10 79.54 92.60 1 10.00
18796. Osama (default_1011) 10 71.20 81.14 4 40.00
18797. Rui (deathnight1234) 10 73.11 83.53 8 80.00
18798. asdfasdf (ddgg007) 10 73.89 94.26 2 20.00
18799. David (dchoboy) 10 74.37 85.77 2 20.00
18800. Đejms (db007) 10 72.10 87.18 4 40.00
18801. Luyene (dauxsis) 10 103.82 120.41 1 10.00
18802. DatMoonGamer (datmoongamer) 10 115.74 139.38 7 70.00
18803. Khaeran S. (dark_ze7en) 10 56.83 69.45 0 0.00
18804. DarkZplays (darkzplays_qwerty) 10 88.60 96.90 5 50.00
18805. Kadie (darkskies0107) 10 80.32 86.44 3 30.00
18806. DarkPrinceGandalf (darkprin... 10 91.81 103.95 5 50.00
18807. stabby stab (darkholdwizerd) 10 78.93 95.12 3 30.00
18808. Dannica (danni_bear_) 10 48.41 56.20 1 10.00
18809. Daniel (dankasu) 10 34.45 40.06 1 10.00
18810. Daniel (daniel1212) 10 75.25 80.90 2 20.00
18811. Danchik (danchikg) 10 73.09 82.78 3 30.00
18812. Can't (daddaaddad) 10 105.94 118.19 2 20.00
18813. Cyrus (cyrus19) 10 76.98 92.04 5 50.00
18814. Cyden (cyden) 10 58.26 99.51 3 30.00
18815. Adrian (cui3e) 10 99.61 111.93 9 90.00
18816. Colby (ctgap) 10 140.01 152.06 8 80.00
18817. Wall (csgoscam) 10 66.55 88.01 2 20.00
18818. CatToTheFour (cryptica) 10 97.46 112.20 4 40.00
18819. Lau (cryptextinct) 10 83.77 96.70 3 30.00
18820. Crossland (crossjbeer) 10 102.70 122.77 6 60.00
18821. Michael (crecious) 10 99.98 128.13 6 60.00
18822. Cream Of (creamofroach) 10 102.00 113.85 8 80.00
18823. cozy (cozy_c) 10 65.32 85.84 6 60.00
18824. Corin (corlexc) 10 76.72 93.20 0 0.00
18825. rsd.com.au (cooper1289) 10 131.18 143.88 5 50.00
18826. C (cmmg1) 10 78.70 89.17 2 20.00
18827. Connor (cmcl) 10 60.82 68.27 2 20.00
18828. Cole (cmacd) 10 87.84 97.88 2 20.00
18829. CJP (yes-quit) (cjasonp) 10 106.38 119.02 3 30.00
18830. 1234 (chuwii) 10 74.28 82.53 1 10.00
18831. Darkchuby (chubyxdxd) 10 47.13 60.03 2 20.00
18832. Chris... (chrishollow7) 10 98.78 108.92 4 40.00
18833. Chris (chrishene) 10 71.26 80.98 2 20.00
18834. Cyrus (chonky_garfield) 10 48.83 58.08 4 40.00
18835. Chiggas (chinesecodingmaster) 10 59.02 66.03 1 10.00
18836. chetanya (cheti) 10 67.32 76.32 2 20.00
18837. han (chenhan) 10 46.69 51.66 0 0.00
18838. Bruce Mang (cheeseburger_98) 10 93.35 118.59 2 20.00
18839. Chatic (chatic) 10 79.77 92.56 1 10.00
18840. Person (chaon7) 10 80.45 93.79 8 80.00
18841. JOn (chaomeister986) 10 121.06 143.79 6 60.00
18842. Chad (chadley69) 10 53.45 64.49 1 10.00
18843. Cefe (cefe_origol) 10 64.10 68.13 4 40.00
18844. Cat (cat_tanks_mod_maker) 10 68.62 78.82 2 20.00
18845. BigBoss (catalin2522) 10 57.65 63.67 0 0.00
18846. Josh (cantmakemoney) 10 90.34 99.56 2 20.00
18847. Californium (californium) 10 65.32 75.11 2 20.00
18848. Caddar (caddar) 10 117.74 147.15 5 50.00
18849. crowdofworkmen (bu_te) 10 87.22 96.34 5 50.00
18850. Butter (butterfingers_) 10 95.61 105.75 4 40.00
18851. burritorolls-royce (burrito... 10 82.09 96.89 2 20.00
18852. Budder40 (budder40) 10 49.06 55.03 1 10.00
18853. Saran (bssarankumar) 10 66.56 77.50 0 0.00
18854. Bra Steve (bra_steve) 10 66.29 74.10 3 30.00
18855. Brandon (brandonsg) 10 87.19 100.23 2 20.00
18856. Joël (bongo13) 10 94.23 103.06 4 40.00
18857. Bobby (bobnfuz) 10 64.57 78.62 1 10.00
18858. Ezra 🖤⛓ (blurr_yfa_ce) 10 46.77 51.09 1 10.00
18859. Ekko (blue9995566) 10 60.90 65.76 0 0.00
18860. blekekok (blekekok) 10 80.42 118.74 1 10.00
18861. blademagic (blademagic) 10 107.64 115.22 6 60.00
18862. Bruh (blackbacon08) 10 96.75 105.76 5 50.00
18863. bingcheng45 (bingcheng45) 10 93.78 108.87 5 50.00
18864. Hoa (billybobstuff) 10 69.24 73.58 3 30.00
18865. Bharat Kumar (bharat12345) 10 47.48 53.78 1 10.00
18866. Brian (bgriffeth) 10 61.15 76.62 3 30.00
18867. berserker02 (berserker02) 10 61.47 73.12 3 30.00
18868. Daniele (berdelicious) 10 77.45 86.86 1 10.00
18869. benny (bennythecow) 10 69.07 80.10 3 30.00
18870. Benny (bennyni101) 10 62.97 70.58 1 10.00
18871. Benko (benkay) 10 78.00 96.20 6 60.00
18872. Bob (benjiboy970) 10 84.54 90.58 1 10.00
18873. beefchow (beefchow) 10 67.52 79.17 2 20.00
18874. Austin (bear666) 10 61.94 70.19 5 50.00
18875. Kevin (baven) 10 57.33 69.97 3 30.00
18876. :) (bavadin) 10 118.62 129.59 4 40.00
18877. Gus (battm4n) 10 62.68 75.55 2 20.00
18878. Baris (baris23) 10 94.79 104.60 0 0.00
18879. _ (baga_rashy) 10 37.79 43.20 0 0.00
18880. Kaelyn (badpun56) 10 94.35 106.46 2 20.00
18881. Bad (badminton87) 10 47.34 65.76 2 20.00
18882. bachira (bachira) 10 59.55 65.03 2 20.00
18883. Babon (babonbunting) 10 56.27 68.82 2 20.00
18884. Anto (babafroga) 10 75.43 82.58 6 60.00
18885. Robert (b0ssofthisgym) 10 63.65 70.73 3 30.00
18886. Cootsynanus (a_yellow_evan) 10 87.16 100.35 3 30.00
18887. Michael (azumifan) 10 81.39 88.88 4 40.00
18888. Never (azasal) 10 93.15 109.57 2 20.00
18889. hailmatcha (aydenkm) 10 87.46 109.44 2 20.00
18890. Mudit (awesomenessmax) 10 69.92 81.44 7 70.00
18891. Anthony (avald30) 10 75.41 86.72 3 30.00
18892. 🐐 (auaomamm) 10 96.91 108.41 5 50.00
18893. BigMan (attel) 10 80.03 89.70 4 40.00
18894. Isse (attalion) 10 74.81 83.32 3 30.00
18895. ather (athrnls) 10 128.04 150.66 4 40.00
18896. Atakan (atakannguven) 10 54.59 70.02 4 40.00
18897. Jairo (asophiel) 10 63.89 80.53 2 20.00
18898. David (asian_masterium) 10 77.82 92.39 0 0.00
18899. Destiny (asaak) 10 46.72 55.39 0 0.00
18900. Arul (arulseth1998) 10 70.51 83.86 2 20.00
18901. Daniel (arpsteid) 10 83.73 98.08 5 50.00
18902. arman_ferdous (arman_ferdous) 10 85.30 92.64 2 20.00
18903. tstats[armanto] (armanto) 10 80.17 91.01 4 40.00
18904. Anonymous (argong1) 10 100.81 127.62 5 50.00
18905. syed (areeb290805) 10 66.53 86.01 4 40.00
18906. rumi (archsun) 10 94.84 108.34 3 30.00
18907. Aravinthan (aravinthan) 10 47.00 60.79 2 20.00
18908. Aravind (aravindsreeram) 10 100.47 115.86 6 60.00
18909. Aqib (aqib1990) 10 64.55 73.11 1 10.00
18910. TERT (antonhsu) 10 101.45 118.99 5 50.00
18911. anpan (anpann) 10 44.80 55.90 3 30.00
18912. Another (anotherkaneki) 10 88.89 109.66 3 30.00
18913. ANKIT (ankit_2002) 10 22.80 27.29 3 30.00
18914. Doe (animitz) 10 101.74 114.22 3 30.00
18915. Animal (animalracional) 10 105.33 114.54 2 20.00
18916. Anil (anil1631988) 10 46.29 57.44 2 20.00
18917. Angelo (angeloanan) 10 86.51 102.51 2 20.00
18918. Angel (angeldavinci) 10 107.71 125.72 4 40.00
18919. andrucc (andrucc) 10 124.90 137.56 7 70.00
18920. Andrea (andrea_oboe) 10 56.90 70.35 2 20.00
18921. Anastacia (anastaciagurina) 10 43.99 50.57 0 0.00
18922. manizman (amznima) 10 46.88 58.82 1 10.00
18923. Amirun (amumrzmh) 10 49.23 55.98 1 10.00
18924. Amr (amr_alnas) 10 63.57 75.60 2 20.00
18925. chi (amaz1n) 10 122.68 137.95 4 40.00
18926. Amaru (amaruescalante) 10 73.70 86.36 2 20.00
18927. Nux (amades) 10 82.24 93.43 4 40.00
18928. allLuck (allluck) 10 51.71 63.43 0 0.00
18929. M (allinnn) 10 70.00 84.05 4 40.00
18930. Alistair (alistairmross) 10 49.91 56.06 1 10.00
18931. Alif (aliftheruslan) 10 64.30 72.04 2 20.00
18932. Alfie (alfiefogg) 10 68.46 76.79 1 10.00
18933. Aryan (alemantrix) 10 80.47 97.33 1 10.00
18934. Alec Gian (alecgian) 10 59.96 74.87 2 20.00
18935. Ajay (ajaygunacr7) 10 82.83 97.64 1 10.00
18936. noneov (aidentypefast) 10 64.38 72.27 7 70.00
18937. Ahmad (ah_abualrob) 10 39.15 45.42 1 10.00
18938. Ahnaf (ahnaf_habib) 10 72.62 82.00 4 40.00
18939. Annette (ahhooah) 10 53.37 57.11 0 0.00
18940. Diana (agent_artemis) 10 84.30 104.84 2 20.00
18941. Keenan (agentk9) 10 72.52 77.13 4 40.00
18942. muhammad afiq (afiq101) 10 77.69 84.78 3 30.00
18943. Tim (afferin_) 10 127.97 151.63 7 70.00
18944. Fher (aether78) 10 28.93 36.77 3 30.00
18945. Eric (aerran) 10 105.47 113.92 8 80.00
18946. Adhyay (adyr_152) 10 43.35 56.80 1 10.00
18947. Adromrial (adromrial) 10 94.00 103.21 5 50.00
18948. Percy (adladd) 10 78.94 89.23 1 10.00
18949. acidxburn87 (acidxburn87) 10 49.97 56.93 2 20.00
18950. Dr_ (abrarsikder_123) 10 50.19 66.71 2 20.00
18951. primrose (abigaillll) 10 56.10 62.15 2 20.00
18952. gwen (abcdbga) 10 107.73 119.09 4 40.00
18953. Aaryan sharma (aaryan21) 10 54.40 61.02 1 10.00
18954. Mani (93z9a) 10 59.36 68.10 1 10.00
18955. Jason (921jason921) 10 79.21 104.20 3 30.00
18956. Jack (666jack) 10 39.20 47.99 0 0.00
18957. Shalin (29wpm) 10 60.71 65.34 0 0.00
18958. skies (17phantom) 10 103.77 124.70 3 30.00
18959. 1015634 (1015634) 10 103.28 121.34 5 50.00
18960. Masood (004993) 10 74.33 88.86 10 100.00
18961. Alinoo (alinooo) 10 34.19 40.77 0 0.00
18962. i (iiooddaa) 10 67.57 73.94 3 30.00
18963. Avijeet (avijeet_03) 10 46.57 51.59 2 20.00
18964. Colby (kerble) 10 107.38 140.65 6 60.00
18965. JC (alicawj) 10 87.28 96.66 3 30.00
18966. Allen (applausingallen) 10 58.80 73.35 2 20.00
18967. Dante (drogers279) 10 89.42 99.00 5 50.00
18968. Harmony (harms) 10 73.79 88.69 0 0.00
18969. Aito (aitogod) 10 52.85 61.08 1 10.00
18970. Joksa (joksa_19) 10 59.06 65.74 2 20.00
18971. paper (paperhead) 10 65.50 72.42 4 40.00
18972. Daksh (daksh_10) 10 47.21 51.41 0 0.00
18973. matt (skizxo) 10 88.32 106.36 5 50.00
18974. Ryan (cryptopulse) 10 89.04 102.56 4 40.00
18975. Kamshat (jklsyk) 10 36.49 40.58 3 30.00
18976. Leo (leonidas_) 10 89.78 104.85 2 20.00
18977. Terry (terry77) 10 70.37 81.93 10 100.00
18978. phoenix (phoenix_mint) 10 67.76 75.91 2 20.00
18979. _ (ovorampage) 10 81.92 94.75 3 30.00
18980. Aayan (aayanali808) 10 82.24 98.40 3 30.00
18981. Abdelrahman (abdelrahman247... 10 39.49 49.00 0 0.00
18982. john (scholarbackmarathanee) 10 103.34 110.19 8 80.00
18983. Slayer (slayerontwitch) 10 108.23 122.97 5 50.00
18984. mado (mado_sam) 10 29.25 38.25 0 0.00
18985. Tomaz (mali_frodo) 10 53.06 58.54 1 10.00
18986. Fynn (fynn__) 10 86.79 96.39 3 30.00
18987. Sh0t.0 (sudhanshu8302) 10 54.33 61.49 3 30.00
18988. Eric (vulbex) 10 54.75 79.16 1 10.00
18989. 50wpm (verynoob) 10 114.44 139.50 6 60.00
18990. Álvaro (ashsan98) 10 83.41 92.40 6 60.00
18991. Nacca (nacca47) 10 73.74 83.22 4 40.00
18992. Darkn (darkn_yt) 10 120.59 160.37 8 80.00
18993. Mary (maryxo) 10 84.29 98.76 8 80.00
18994. : (lazering_death) 10 74.91 96.09 1 10.00
18995. Someone (arilaro) 10 62.86 68.30 5 50.00
18996. cool cat! (kid_apollo) 10 45.25 50.50 0 0.00
18997. Ronak (raun707) 10 52.14 60.75 0 0.00
18998. Nicholas (nicocook) 10 91.24 103.51 2 20.00
18999. BC190 (bc190) 10 65.08 70.66 3 30.00
19000. Synplet (synplet) 10 79.04 103.57 8 80.00
19001. DADE (dad_ee) 10 71.23 83.45 1 10.00
19002. Leon (dutchwarrior) 10 57.20 62.32 1 10.00
19003. Sul (mrsul_) 10 82.90 92.14 8 80.00
19004. Lorenzo (gr8monk3ys) 10 87.69 95.23 3 30.00
19005. Chapman (sevenagueroes) 10 53.56 57.77 1 10.00
19006. yens_ (jens8732) 10 72.52 79.29 3 30.00
19007. Jonten (jrpx9) 10 43.83 61.77 1 10.00
19008. Brendan (typingtops) 10 65.67 78.87 2 20.00
19009. Vicki (vickil) 10 62.13 72.52 4 40.00
19010. Hamilton (hammer3000) 10 69.46 85.72 1 10.00
19011. Michelle (chickzor) 10 51.09 56.88 1 10.00
19012. tstats[mmh49] (mmh49) 10 55.83 67.23 0 0.00
19013. Brugarin (brugarin) 10 67.50 78.98 4 40.00
19014. Ayberk (ayberkt) 10 101.41 119.10 5 50.00
19015. abua (chelian) 10 84.25 92.77 2 20.00
19016. CleverB (cleverboo) 10 46.75 56.46 0 0.00
19017. Kelvin (amdabest) 10 46.45 63.05 3 30.00
19018. Alec (dhracergc) 10 68.95 87.00 8 80.00
19019. James (james_f) 10 94.04 114.58 9 90.00
19020. lethimcook (aahiiks) 10 39.73 46.17 0 0.00
19021. gamer (rkiks) 10 45.73 53.81 1 10.00
19022. finity (finity_dvorak) 10 26.85 33.74 3 30.00
19023. U-Jean (sedimaster007) 10 93.37 105.36 5 50.00
19024. IIan (ilan7411_) 10 73.09 86.53 3 30.00
19025. Gangnam (andreselcashete) 10 124.52 154.32 8 80.00
19026. Duck (wubbaduck) 10 50.25 63.62 1 10.00
19027. Pedro (pdbaroni) 10 63.63 86.81 4 40.00
19028. Alexander (kiknalex) 10 94.65 114.66 2 20.00
19029. Human (ame5057) 10 79.03 95.48 2 20.00
19030. Sarah (skutti) 10 115.61 122.62 8 80.00
19031. Karan (karan_2505) 10 40.10 45.80 0 0.00
19032. Yamp4 (yamp4) 10 41.41 55.97 1 10.00
19033. arion (arion_) 10 64.19 80.27 7 70.00
19034. Kanon (krsr23) 10 53.30 62.91 0 0.00
19035. Not (notbeluga) 10 73.33 84.05 5 50.00
19036. Mohd (mohdbilal) 10 45.59 50.48 1 10.00
19037. neo (neosylph) 10 85.19 96.97 3 30.00
19038. mehzad (meiyotaco) 10 58.09 67.88 2 20.00
19039. Typeternel (typeternel) 10 92.27 102.07 3 30.00
19040. Fancy_Dog (fancy_dog) 10 43.95 48.67 2 20.00
19041. H (tyrfing) 10 67.36 71.94 1 10.00
19042. DaFishBoi (dafishboi) 10 66.61 75.17 5 50.00
19043. frustration (bczsalba) 10 69.94 80.13 4 40.00
19044. Tyler (tylergm1) 10 60.53 72.05 2 20.00
19045. kim (jasmins3r) 10 40.09 46.00 2 20.00
19046. Omar (meowot) 10 43.53 50.03 0 0.00
19047. H5%hz (h5hztype) 10 47.60 60.09 1 10.00
19048. javier (lechon2103) 10 40.71 46.29 0 0.00
19049. kajal (kajall) 10 29.04 58.48 1 10.00
19050. Bobby (mistabobby) 10 62.18 65.57 10 100.00
19051. Mark (macdalo) 10 60.70 76.80 4 40.00
19052. Ash (lillemann) 10 65.98 82.05 0 0.00
19053. Mahbub (mahasayz) 10 69.72 83.31 5 50.00
19054. LC (64tiananmen) 10 105.80 111.78 5 50.00
19055. C (stormdrain) 10 95.72 110.88 5 50.00
19056. Suspicious McGee (suspiciou... 10 66.87 77.04 4 40.00
19057. Mostafa (3400mostafa) 10 60.40 70.71 1 10.00
19058. 10exer (spartibartfast) 10 72.83 85.18 0 0.00
19059. AN (combaker) 10 56.11 63.28 1 10.00
19060. Petar (crimenibba69) 10 83.83 97.33 7 70.00
19061. Y.S (petitpotat) 10 75.15 88.03 2 20.00
19062. sugar (sugarcqnes) 10 76.34 99.56 0 0.00
19063. Brandon (stokesbro) 10 60.59 65.56 2 20.00
19064. steff (_stuf) 9 114.16 129.16 5 55.56
19065. Iftekharul (_sayeed) 9 66.07 88.91 2 22.22
19066. Kuna (_kuna) 9 85.54 96.44 2 22.22
19067. Adam (_adam_bomb) 9 60.48 66.79 1 11.11
19068. Zven (zven69) 9 109.96 135.73 6 66.67
19069. Daniel (zuse90) 9 61.38 67.11 2 22.22
19070. Violet (znn7) 9 56.76 64.14 2 22.22
19071. adam (zingerbox460) 9 92.88 106.40 4 44.44
19072. zien (ziensoo) 9 50.06 54.64 2 22.22
19073. zenzurie (zenzurie) 9 58.53 65.35 2 22.22
19074. Stefan (zekan) 9 100.55 112.93 3 33.33
19075. boris (zekaida) 9 98.71 106.91 1 11.11
19076. Zia (zeeya) 9 115.44 139.04 4 44.44
19077. Zed (zed_op) 9 29.98 33.93 2 22.22
19078. Naz (zdkraner) 9 77.21 93.95 1 11.11
19079. Yxjou (yxjou) 9 44.13 51.90 0 0.00
19080. 💎 (yx3_darya) 9 83.02 96.36 3 33.33
19081. Alan (yuzhi) 9 84.90 99.45 1 11.11
19082. Yuki (yukisitu) 9 88.45 111.39 5 55.56
19083. Yuich (yuichi123) 9 67.71 80.79 2 22.22
19084. Ryan (ysys9) 9 83.18 93.44 5 55.56
19085. Jarek (yorrickus) 9 77.96 85.98 5 55.56
19086. Yuvraj (yoowee) 9 47.89 52.61 3 33.33
19087. zahra (yoonoh) 9 73.93 85.12 6 66.67
19088. Yo (yongb) 9 68.86 82.26 2 22.22
19089. Yash (yomat) 9 75.98 84.35 2 22.22
19090. ben (yngtwbabd) 9 94.56 100.70 2 22.22
19091. STONES (yiminggg) 9 90.71 103.38 3 33.33
19092. Andrew (yertssbm) 9 123.44 135.13 6 66.67
19093. Korey (yellowdozer) 9 105.45 116.58 2 22.22
19094. Yams (yams_) 9 56.25 62.87 1 11.11
19095. Yamajac (yamajac) 9 153.74 166.82 0 0.00
19096. yaeda (yaeda) 9 100.09 110.97 4 44.44
19097. Josh (xxldaddy69) 9 132.97 139.32 9 100.00
19098. cope (xucolite) 9 90.05 105.69 3 33.33
19099. John (xtrospective) 9 54.54 63.01 1 11.11
19100. Evan (xtremeelectrix) 9 109.03 128.53 4 44.44
19101. Ray (xray2) 9 109.62 118.72 1 11.11
19102. Swaggy (xiarnaq) 9 134.08 172.10 8 88.89
19103. Tony (xiao_hong) 9 61.82 70.94 0 0.00
19104. Xetin (xetin) 9 100.58 117.42 1 11.11
19105. xavier (xavieregan) 9 49.24 53.80 5 55.56
19106. Turtle (xarenox) 9 94.94 109.38 8 88.89
19107. Willem (woosterum) 9 40.55 53.05 0 0.00
19108. Woffy (woffy888) 9 83.42 110.18 6 66.67
19109. William (wmilberry) 9 81.30 90.18 0 0.00
19110. M&W (wmichaelwhitlock) 9 108.99 129.85 4 44.44
19111. Tate (wizard5) 9 56.73 65.88 2 22.22
19112. 48%SuicideRate (wint4r) 9 120.22 144.87 9 100.00
19113. Ryan (wilderrw) 9 84.98 105.01 2 22.22
19114. wiku (wiku025) 9 64.15 73.00 4 44.44
19115. Victor (whitenecro21) 9 93.10 100.26 2 22.22
19116. samantha (whalieninluv) 9 104.84 112.79 6 66.67
19117. Jake (wetfart1738) 9 63.58 71.90 4 44.44
19118. werdnalliw (werdnalliw) 9 80.71 97.37 3 33.33
19119. William (wei9798) 9 73.47 79.52 1 11.11
19120. William (wazambelina) 9 77.33 83.45 2 22.22
19121. wabdeali (wabdeali) 9 99.11 116.19 2 22.22
19122. Vyas (vyas_123) 9 105.88 125.94 4 44.44
19123. Vrum (vrumvrum56) 9 65.28 73.57 0 0.00
19124. dunno (vokunsahvoz) 9 36.44 40.66 1 11.11
19125. Viktor (vixtorr) 9 65.62 76.38 6 66.67
19126. Vipul (vipulr) 9 80.01 100.98 4 44.44
19127. Vinson (vinsonbudiman) 9 76.07 92.56 1 11.11
19128. Victor (victorfaarvang) 9 100.62 121.34 1 11.11
19129. Peter (vettel_) 9 69.61 73.17 4 44.44
19130. Vertennn (vertennn_) 9 100.02 112.50 6 66.67
19131. d'un vecchio caminetto inga... 9 119.41 134.34 5 55.56
19132. Vitalie (veeveeoh) 9 43.27 53.45 1 11.11
19133. Giovanni (vecchiogio) 9 58.14 67.38 1 11.11
19134. BJ (unusualgoose) 9 69.56 82.01 1 11.11
19135. James (unbranded) 9 127.86 142.50 8 88.89
19136. ultraXD (ultragamersss) 9 99.44 109.42 2 22.22
19137. Ultraa (ultrabladez) 9 59.75 73.02 2 22.22
19138. UltimaticCatz (ultimaticcatz) 9 78.20 97.07 6 66.67
19139. Jason (ultimatehumungousaur) 9 89.93 96.32 5 55.56
19140. Toby (ueue_) 9 84.40 102.87 6 66.67
19141. Ucheely (ucheely) 9 124.10 134.89 4 44.44
19142. McClout (type_69_master) 9 96.84 117.44 6 66.67
19143. Johannes (typerjojo) 9 70.83 83.59 0 0.00
19144. TyperDood (typerdoodz) 9 103.60 113.13 2 22.22
19145. Steven (txp2037) 9 65.38 78.27 3 33.33
19146. tuvumba (tuvumba) 9 61.07 66.94 7 77.78
19147. Tubby (tubbsters) 9 141.61 160.84 8 88.89
19148. Joshua (ttemingyu) 9 111.78 138.65 4 44.44
19149. Meinte (trinityy6) 9 61.11 69.72 3 33.33
19150. Trial (trial_name) 9 69.09 84.44 2 22.22
19151. Trevor (trev_23) 9 72.47 90.02 0 0.00
19152. shashank (trash_typer_74) 9 64.28 73.35 2 22.22
19153. Antonín (toniczech) 9 59.90 65.92 2 22.22
19154. Tom (tom020900) 9 91.79 99.17 3 33.33
19155. Tode (todengaard) 9 126.07 146.45 8 88.89
19156. Tinh (tinh1000000) 9 89.54 97.70 4 44.44
19157. Tina (tinangu272) 9 89.48 97.19 3 33.33
19158. Tino (timppara) 9 77.22 92.41 1 11.11
19159. Edwin Chiriboga (tilt_ed) 9 61.23 72.37 0 0.00
19160. trash (thiccumthebig) 9 52.68 64.20 0 0.00
19161. ReRo (the_rero) 9 72.45 92.42 3 33.33
19162. Max (the_maxinater) 9 63.79 72.65 2 22.22
19163. Brandon (theyimi) 9 101.56 112.39 4 44.44
19164. Emery (thetruffinmuffin) 9 53.73 61.37 1 11.11
19165. Henri (therealkanyeeast) 9 113.08 129.45 3 33.33
19166. pbj (thepbj) 9 59.65 75.79 2 22.22
19167. TheMates (themates) 9 43.33 52.72 0 0.00
19168. M (thefastlightningtyper) 9 78.25 89.43 4 44.44
19169. ThatCoolCoder (thatcoolcoder) 9 91.73 104.25 2 22.22
19170. Ethan (thandrew) 9 68.39 84.41 2 22.22
19171. Leo (teslaomega) 9 71.91 83.98 3 33.33
19172. Teriyaki (teriyaki03) 9 92.49 104.13 0 0.00
19173. taramysh (tentech) 9 49.66 55.46 3 33.33
19174. Mark (tenseimaa) 9 90.91 100.79 1 11.11
19175. tasha (tbrown_89) 9 98.63 115.30 4 44.44
19176. Sebastian (tbgseb) 9 70.92 80.55 3 33.33
19177. Eren Yeager (tarzan_19) 9 53.60 62.16 2 22.22
19178. Kevin (taow) 9 102.84 108.55 4 44.44
19179. Tanuj (tanuj23) 9 105.30 114.20 4 44.44
19180. Tanamr (tanamr) 9 99.71 106.19 5 55.56
19181. Kevin (tactictorn) 9 111.81 122.55 6 66.67
19182. S Aditya (s_aditya) 9 60.40 63.90 2 22.22
19183. Vroom (synphade) 9 85.87 96.27 2 22.22
19184. ok doinb (superex23) 9 85.24 89.81 3 33.33
19185. supe (supe56) 9 83.20 93.63 5 55.56
19186. Jordan (sugarytaco) 9 82.39 99.03 8 88.89
19187. NO ONE (subhroxeon) 9 86.74 103.14 1 11.11
19188. Sterling (stvrling) 9 89.38 103.97 5 55.56
19189. Ahri (strylas) 9 104.01 125.85 4 44.44
19190. Strike (strike_elite) 9 103.08 116.86 3 33.33
19191. JL (strikewolfgg) 9 116.34 134.28 5 55.56
19192. Stretch (stretch_flex) 9 77.88 87.90 2 22.22
19193. stream (stream_cipher) 9 48.16 61.11 1 11.11
19194. Stefarno (stefarno) 9 48.32 58.00 1 11.11
19195. Stefan (stefan_t) 9 117.11 128.66 7 77.78
19196. Steel (steeltissue) 9 80.74 92.51 2 22.22
19197. Steady (steady32) 9 80.61 90.08 2 22.22
19198. Stanley (stanley_gogo) 9 56.14 68.06 1 11.11
19199. Josh (standedjoshh) 9 80.65 99.62 8 88.89
19200. St1nk (st1nkk) 9 63.29 78.74 4 44.44
19201. joni (squire2264) 9 86.17 92.80 2 22.22
19202. Kimikazee (squalo101) 9 102.93 121.14 4 44.44
19203. Rafael (spyhard12) 9 114.84 132.90 6 66.67
19204. Jim (sprinks41) 9 80.55 93.60 2 22.22
19205. shaq$ (springrollgod) 9 82.82 93.87 4 44.44
19206. Ayush Hazarika (ayush_hazar... 9 42.55 49.71 0 0.00
19207. Peter (speedyboi95) 9 91.97 115.19 5 55.56
19208. John (speedking456) 9 86.76 102.05 3 33.33
19209. Sourav (souravdey_1) 9 32.78 37.54 1 11.11
19210. xy (soox0001) 9 86.47 113.42 3 33.33
19211. Someone (someonetyping) 9 90.51 101.64 1 11.11
19212. UnoriginalName (someguywhoh... 9 100.91 121.82 8 88.89
19213. Marcus (snuskbulle) 9 87.36 97.23 2 22.22
19214. Snafu (snafudk) 9 92.25 104.17 3 33.33
19215. Sam (smtype100) 9 94.40 104.50 4 44.44
19216. spoon (smallspoon) 9 85.95 109.88 4 44.44
19217. Phuong Anh (smallcat2020) 9 45.14 50.55 6 66.67
19218. smakkacow (smakkacow) 9 70.71 77.11 0 0.00
19219. Slow Spider (slow_spider) 9 58.08 64.00 0 0.00
19220. ur (slowtyperfromcz) 9 59.04 65.63 3 33.33
19221. snail_twin_turbo (sloth_99) 9 54.73 59.47 1 11.11
19222. Simonas (slapukas321) 9 55.81 66.77 1 11.11
19223. Shadow (skyronman) 9 71.79 82.75 3 33.33
19224. SkillfulRheyme4 (skillfulrh... 9 55.88 71.53 2 22.22
19225. Luis (siulul) 9 60.73 71.15 2 22.22
19226. René (sirrene) 9 76.93 90.16 9 100.00
19227. $ (sirenss) 9 124.44 134.81 3 33.33
19228. Sioun (sioun) 9 94.99 102.81 4 44.44
19229. Sindre| (sinros01) 9 63.87 71.75 5 55.56
19230. Sindri (sindri300) 9 72.91 81.04 4 44.44
19231. Silk (silkdragon) 9 50.79 58.69 2 22.22
19232. ⁶⁶⁶ (siign) 9 93.48 98.48 3 33.33
19233. Siddharth28 (siddharth28) 9 49.75 71.43 1 11.11
19234. Shubham (shubham_112013) 9 61.53 65.26 0 0.00
19235. Glenn (shroom_slice) 9 73.26 92.67 3 33.33
19236. shrimp (shrimpcraackers) 9 64.52 69.11 2 22.22
19237. Nate (shortysama) 9 63.38 70.06 3 33.33
19238. Marcus (shock598x) 9 85.68 106.34 3 33.33
19239. Ab (shk_faysal) 9 57.91 66.70 3 33.33
19240. sarthak (shivasarthak) 9 48.28 61.59 0 0.00
19241. karim (shinobikarim) 9 44.35 51.56 2 22.22
19242. Nathan (sharkking487) 9 81.45 95.08 6 66.67
19243. Khalilur (shafiq_02) 9 41.05 50.25 1 11.11
19244. Luke (sfv_) 9 88.99 95.80 3 33.33
19245. Shay (sewer_rat) 9 103.76 111.01 4 44.44
19246. Accuracy (servesh) 9 67.74 84.12 1 11.11
19247. Sergio (sergiorbuge) 9 115.34 129.98 7 77.78
19248. Serenitea (serenitea) 9 91.19 102.50 3 33.33
19249. Patrick (senseiblaze) 9 78.79 94.77 0 0.00
19250. Bobby (senseibets) 9 86.17 103.15 4 44.44
19251. Player (sellnox) 9 71.41 77.53 2 22.22
19252. see you dont bump his head ... 9 86.53 96.00 5 55.56
19253. Ginger (seanwho42) 9 68.93 84.94 2 22.22
19254. Sean (seanshawn198) 9 132.20 146.32 8 88.89
19255. Saral (scrummaster) 9 71.49 78.66 2 22.22
19256. Reynaldi (script303) 9 103.33 120.34 3 33.33
19257. Nate (scourse) 9 65.15 78.22 0 0.00
19258. Scotty (scoma) 9 104.29 124.69 2 22.22
19259. Samantha (sbscruton) 9 50.92 59.48 0 0.00
19260. Kittatro (saysikerightnow) 9 71.67 79.31 2 22.22
19261. NEM0 (saybloo) 9 97.75 113.64 6 66.67
19262. grubres (saveall) 9 117.89 128.94 1 11.11
19263. Saugat (saugat2003) 9 41.90 47.18 0 0.00
19264. saturn (sat3rns) 9 62.02 79.21 9 100.00
19265. sasmit_qwerty (sasmit_neogi) 9 83.95 120.35 3 33.33
19266. Sasha (sasha_satanenko) 9 67.88 80.08 3 33.33
19267. IDK (sarpain) 9 59.21 64.14 2 22.22
19268. Phrog (sargent_frog) 9 86.74 138.49 7 77.78
19269. ChlamydiaHaver (sarcasmx) 9 130.08 137.71 6 66.67
19270. Saph (saphie) 9 85.38 98.76 4 44.44
19271. Jose (sand62) 9 65.70 78.27 3 33.33
19272. sam (samx90s) 9 45.05 53.84 1 11.11
19273. mikduc (samurai_dodo) 9 76.41 90.47 2 22.22
19274. sammito1 (sammito1) 9 106.47 115.74 3 33.33
19275. Samuel (sambg) 9 100.49 109.81 6 66.67
19276. ahmed (sakakill) 9 48.93 53.72 0 0.00
19277. sahil (sahil9057) 9 57.70 68.34 1 11.11
19278. Sahil (sahilmandoliya) 9 45.37 53.15 0 0.00
19279. James (sagpro_23) 9 73.62 80.70 2 22.22
19280. Saeed (saeed247) 9 70.17 83.12 2 22.22
19281. suki (sackclothandashes) 9 99.51 110.88 2 22.22
19282. Guo (s9723) 9 58.50 66.42 1 11.11
19283. siddhanth (s1ddhxnth) 9 69.08 79.43 2 22.22
19284. A (russ1anrock3t) 9 84.38 95.63 9 100.00
19285. Roi (rugh) 9 65.92 72.25 2 22.22
19286. Ethan (rtdrtd) 9 117.42 132.54 3 33.33
19287. Robert (rpmulligan) 9 86.65 105.40 1 11.11
19288. Yash (royal_ralhi) 9 28.17 33.08 2 22.22
19289. Changnam (rotoflemf) 9 55.50 60.24 1 11.11
19290. Roshan (roshan_) 9 73.57 88.07 4 44.44
19291. Ultralord (ronelijahruiz) 9 98.31 119.82 2 22.22
19292. Callum (rockwallaby) 9 51.39 59.32 0 0.00
19293. Alessandro (rocchia) 9 80.82 94.54 2 22.22
19294. Ronald (roanlds12345) 9 91.50 102.23 3 33.33
19295. Quang Trung (rikateamovt1) 9 69.27 76.74 3 33.33
19296. Richard (richyk1) 9 95.96 111.11 3 33.33
19297. Rice (rice363) 9 86.16 92.56 3 33.33
19298. rhyno3d (rhyno3d) 9 92.50 110.80 6 66.67
19299. Randy (rhomusic) 9 96.62 104.47 4 44.44
19300. Tyler (rhodetyl000) 9 79.18 82.95 5 55.56
19301. rhinoracer (rhinoracer) 9 46.84 51.71 1 11.11
19302. Keyan (rezor) 9 95.16 110.85 6 66.67
19303. Zhaparka (retsinnal) 9 47.80 57.95 0 0.00
19304. Red (redsharp) 9 69.27 85.58 3 33.33
19305. Redox (redox_p) 9 96.58 109.27 2 22.22
19306. Raostrich (raostrich) 9 87.82 98.57 2 22.22
19307. Rafa (rafimm) 9 41.68 50.41 2 22.22
19308. S3LVA (r06ramanat) 9 76.74 81.92 4 44.44
19309. qwerty443 (qwerty443) 9 46.58 54.27 1 11.11
19310. Quzrin (quzrin) 9 99.10 107.09 2 22.22
19311. qusdty (qusdty) 9 36.51 43.04 1 11.11
19312. Quer (queroin) 9 61.91 83.24 0 0.00
19313. hand (quarterpastnine) 9 119.33 129.45 5 55.56
19314. quackstuff (quackstuff) 9 84.67 87.80 3 33.33
19315. Riley (qpixel) 9 92.24 101.64 3 33.33
19316. Pupill (pupill) 9 63.64 71.95 7 77.78
19317. Puleva (puleva) 9 77.33 93.73 2 22.22
19318. Tom (pugsay) 9 92.57 101.92 2 22.22
19319. pudge (pudge_phatt) 9 90.53 100.48 4 44.44
19320. Proxima (proxima009) 9 62.27 66.39 4 44.44
19321. Protik (protiknag) 9 59.13 67.77 0 0.00
19322. David (prosic723) 9 49.56 53.39 0 0.00
19323. Project (project_racer) 9 103.99 121.45 6 66.67
19324. Kasper (probablykasper) 9 95.43 104.78 4 44.44
19325. Powerid (poweriddd) 9 85.93 97.13 3 33.33
19326. Matthew (potqto) 9 87.28 102.53 1 11.11
19327. Potate (potatocloud) 9 64.00 69.77 2 22.22
19328. bill nye (pokepo6) 9 91.52 103.48 2 22.22
19329. p (poke1) 9 153.24 171.45 9 100.00
19330. plupl (pluppypluplplupus) 9 72.13 88.91 1 11.11
19331. Plommon (plommon) 9 98.81 108.22 4 44.44
19332. PKDDDroid (pkdddroid) 9 79.21 88.71 3 33.33
19333. egg (pipidozer) 9 63.86 76.25 2 22.22
19334. Nathan (pimpleton) 9 106.14 127.60 2 22.22
19335. pigeonistic (pigeonistic) 9 121.98 133.64 6 66.67
19336. K (phua8686) 9 50.39 54.70 0 0.00
19337. Amangus (phsycomonkek1) 9 81.66 91.47 3 33.33
19338. Phoebe (phoebek99) 9 91.79 113.15 5 55.56
19339. Peyton (peytondk) 9 102.21 112.74 9 100.00
19340. Pernesz (pery) 9 81.24 95.08 5 55.56
19341. penguiny2001 (penguiny2001) 9 98.61 106.98 4 44.44
19342. Peak (peak_dvorak) 9 114.77 139.35 9 100.00
19343. Pcgnome (pcgnome) 9 95.14 115.51 5 55.56
19344. Tappy_333 (pat29403) 9 65.96 73.36 2 22.22
19345. Brendan (partyhipster) 9 108.85 127.06 6 66.67
19346. Gaurav (parthbudds) 9 68.18 76.20 2 22.22
19347. Parhy (parhy) 9 94.45 108.99 3 33.33
19348. Max (parabalt) 9 99.12 120.18 6 66.67
19349. JazzyP (pandawarrior101) 9 92.35 109.71 0 0.00
19350. Gabriel Owen (owen2) 9 40.64 48.23 2 22.22
19351. OMG (omgawannabe) 9 92.45 103.01 6 66.67
19352. Daniel (omegadan_) 9 78.89 89.95 2 22.22
19353. Paolo (oloapss) 9 78.26 95.17 5 55.56
19354. Oliver (oliver_22_11) 9 42.50 46.92 3 33.33
19355. 🦈 (okamiro) 9 55.77 63.11 2 22.22
19356. Ohad (ohadshwartzman) 9 94.91 114.46 2 22.22
19357. totnamjoon (off_the_page) 9 81.30 90.70 2 22.22
19358. yellow car (oddsorcery) 9 99.55 109.44 9 100.00
19359. iGeo (oddhampton) 9 76.54 81.87 1 11.11
19360. Plato (observer_02) 9 103.20 114.06 5 55.56
19361. XxBairyHallsxX (nwalker1129) 9 113.63 135.62 3 33.33
19362. Tushar (nutzingfork) 9 28.72 39.76 0 0.00
19363. Riley (nulll) 9 91.82 105.29 4 44.44
19364. Nullius (nullius) 9 58.93 63.36 2 22.22
19365. Anh (nta1207) 9 92.77 99.75 4 44.44
19366. Novotny (novynevi) 9 63.66 75.49 2 22.22
19367. Minideez (novadeez) 9 50.22 58.49 1 11.11
19368. Nour (nourokbi) 9 44.63 54.69 2 22.22
19369. Elvis (noratic) 9 108.39 128.23 3 33.33
19370. brendi (noobgodbrendi) 9 59.61 75.59 2 22.22
19371. Noober (noobest_noober) 9 103.85 129.11 4 44.44
19372. (nonquitwarrior) 9 114.25 146.90 3 33.33
19373. whutthiphon (nongmai) 9 26.95 31.02 0 0.00
19374. nikole (nmkxos) 9 46.03 53.71 2 22.22
19375. Nicholas (nkt8256) 9 113.08 130.31 3 33.33
19376. njwn (njwnsr) 9 73.71 80.62 2 22.22
19377. Nikolaj (nikolaj808) 9 88.68 95.72 2 22.22
19378. Roberto (neowolf) 9 79.26 89.16 4 44.44
19379. Neo-lap (neolaptop) 9 80.36 100.56 1 11.11
19380. Roland (nemvagyokolyangyors) 9 70.20 80.93 2 22.22
19381. NEKROME2.0 (nekrometwo) 9 60.66 69.28 4 44.44
19382. Name (needevidence) 9 114.72 134.44 2 22.22
19383. Nawfox (nawfox) 9 72.60 76.53 3 33.33
19384. cryptid (naturalcryptid) 9 145.91 174.37 8 88.89
19385. Existential Explorer (natmac4) 9 91.62 110.65 3 33.33
19386. Natalie (natatat48) 9 73.30 87.92 0 0.00
19387. nat2980 (nat2980) 9 65.32 76.01 1 11.11
19388. Nasos (nasos2311) 9 76.86 88.92 2 22.22
19389. Nan (nantuzi) 9 88.35 96.68 3 33.33
19390. naman (naman14) 9 60.78 71.23 1 11.11
19391. Nabalazs (nabalazs) 9 68.39 78.04 3 33.33
19392. Mystree (mystree) 9 86.20 96.90 4 44.44
19393. Cyberbullet (mstfelq) 9 83.06 98.49 4 44.44
19394. Mr (mrghost_yes) 9 65.82 71.83 3 33.33
19395. Amar (mrfartboss) 9 80.11 96.47 7 77.78
19396. Simon (mosie) 9 45.20 53.26 3 33.33
19397. Morshedul (morshedul) 9 36.48 40.19 0 0.00
19398. sadaf (morphinefather) 9 88.59 117.71 4 44.44
19399. Chinese 1800 Keyb (morphine... 9 111.91 128.04 3 33.33
19400. moonlight (moonlight_21) 9 87.94 103.69 5 55.56
19401. monster (monster) 9 115.57 134.20 5 55.56
19402. Monotype2 (monotype2) 9 83.31 101.23 7 77.78
19403. Fickle (mongolo123) 9 104.96 119.91 2 22.22
19404. Nate (mmmcac) 9 59.89 68.24 1 11.11
19405. mllm (mllm1771) 9 57.42 75.24 0 0.00
19406. Michelle (mktsoprano2) 9 103.87 111.62 6 66.67
19407. Muhammed Murad (mkmusafir) 9 49.51 56.04 1 11.11
19408. diya (mixxanber) 9 134.14 167.32 6 66.67
19409. SystemOfAKitty (mischi334) 9 84.72 95.01 1 11.11
19410. Mis (miscellaneous) 9 74.27 100.99 1 11.11
19411. Miranite (Dvorak) (miranite) 9 105.06 125.42 9 100.00
19412. Kaan (mirackhle) 9 53.54 64.81 2 22.22
19413. Mayank (minkk777) 9 87.71 99.60 3 33.33
19414. Jonathan (minifoke) 9 55.09 63.01 0 0.00
19415. Miki (miki888) 9 89.58 93.47 2 22.22
19416. Michael (michaeleh_colemak) 9 69.06 77.07 3 33.33
19417. Hai (michaeldp) 9 77.76 84.77 3 33.33
19418. Mevin (mevinn) 9 75.37 87.74 3 33.33
19419. metrodous (metrodous_yt_6) 9 72.42 89.79 3 33.33
19420. biggestkrug139 (mentalpatient) 9 129.52 145.36 6 66.67
19421. melvynAIDS (melvynaids) 9 92.76 104.00 5 55.56
19422. Matthew (meloooche) 9 82.79 92.65 4 44.44
19423. Oleg (meidebshy) 9 31.40 36.86 1 11.11
19424. Mohit (meeoww) 9 53.90 65.82 1 11.11
19425. Michael (mdstumpfy123) 9 84.59 91.61 4 44.44
19426. Marcus (mckhaann) 9 78.58 88.93 2 22.22
19427. M (mchang416) 9 92.14 103.23 2 22.22
19428. maxigus (maxigus_mcfly) 9 99.46 109.39 6 66.67
19429. maxf (maxf8) 9 87.51 100.12 5 55.56
19430. Alex (maveriiic) 9 67.25 72.41 1 11.11
19431. Matthew (matty_venus) 9 75.69 88.12 2 22.22
19432. Mat (matrix303) 9 74.34 84.46 2 22.22
19433. Henry (matrixial) 9 103.27 123.43 5 55.56
19434. Made Dandy (mathzie) 9 65.31 77.06 3 33.33
19435. harih (masterharish) 9 57.17 64.92 4 44.44
19436. Oyo (marauder316) 9 64.47 71.11 2 22.22
19437. MangalicA (mangalica) 9 64.99 78.08 1 11.11
19438. freelo (majoreuphoria) 9 89.80 94.96 4 44.44
19439. siti (mahmudahsiti) 9 94.76 107.84 4 44.44
19440. mahmud (mahmoudtahaa111) 9 27.37 31.27 3 33.33
19441. Donovan (maggigorengayam) 9 71.78 79.00 2 22.22
19442. Max (maexxx) 9 88.31 93.30 2 22.22
19443. Lycarions (lycarions) 9 93.86 102.32 5 55.56
19444. Luther (luthermanhole) 9 111.09 133.20 4 44.44
19445. poopycock17 (luigi65536) 9 86.12 95.60 2 22.22
19446. Dhruv (loneninja__) 9 70.62 79.54 2 22.22
19447. Hunter (lokitypingusa) 9 91.28 103.40 3 33.33
19448. Ioishi (loishi) 9 59.04 64.67 3 33.33
19449. Logan (loganthewizkid) 9 49.52 56.04 3 33.33
19450. lockheed (lock_heed) 9 78.06 87.35 2 22.22
19451. Lochan (lochanr) 9 68.98 80.18 4 44.44
19452. Misael (llillill) 9 70.74 80.59 3 33.33
19453. liwmus (liwmu) 9 95.38 104.57 4 44.44
19454. Victor (liucow) 9 103.28 129.44 1 11.11
19455. Sam (litesam) 9 79.30 89.82 1 11.11
19456. Óskar (lillibilli) 9 69.52 82.91 0 0.00
19457. Lilith (lilith333) 9 97.17 103.44 8 88.89
19458. from brazil (liech) 9 107.74 114.69 5 55.56
19459. Your (lftam319) 9 67.61 72.18 1 11.11
19460. Ramsha (lexi25) 9 37.58 49.10 0 0.00
19461. tstats[levo2001] (levo2001) 9 58.71 68.94 3 33.33
19462. Levi (levimeijer) 9 57.12 63.73 1 11.11
19463. luce (leuvis) 9 54.87 61.26 1 11.11
19464. (leunn) 9 70.73 81.49 3 33.33
19465. lemon (lemongrabbb) 9 61.17 74.87 1 11.11
19466. FleshEyes (lejitt) 9 95.14 101.02 4 44.44
19467. Legacy (legacylegacy) 9 96.81 111.54 3 33.33
19468. Learning Bone (learning_bone) 9 66.73 71.89 4 44.44
19469. Lewis (lcole) 9 71.90 88.28 1 11.11
19470. chandu (lavinyoutube) 9 32.06 41.84 1 11.11
19471. James Ethan (laszerbeam) 9 91.41 105.22 6 66.67
19472. alex (larrythesnail82) 9 55.24 64.03 2 22.22
19473. laptop (laptopsakti) 9 44.72 46.66 2 22.22
19474. tstats[lapakatapulta] (lapa... 9 120.36 133.32 3 33.33
19475. lahmacun (lahmacun228) 9 61.56 67.50 2 22.22
19476. Sandesh (labradoodle) 9 74.35 82.33 1 11.11
19477. Denis (l2p200iqplays) 9 100.28 110.25 3 33.33
19478. KonoKono (kzunderscoresamao... 9 101.58 114.24 5 55.56
19479. Kyle (kyjasa88) 9 96.78 110.03 3 33.33
19480. Charles (kyaw12) 9 62.11 75.40 4 44.44
19481. kweg (kweg) 9 131.43 148.79 4 44.44
19482. Kai (kulturekiah) 9 56.27 64.13 2 22.22
19483. kuino, (kuino) 9 103.97 124.18 9 100.00
19484. ×͜×KRISHNA _ (krishna00) 9 48.72 54.87 1 11.11
19485. Jano (kossvk) 9 92.03 100.85 4 44.44
19486. Kyle (koshu) 9 64.37 77.50 0 0.00
19487. konvay (konvay) 9 124.85 140.92 9 100.00
19488. Koji (kojinb) 9 90.05 99.46 3 33.33
19489. Luca (kodzack) 9 84.43 98.71 3 33.33
19490. kodzy (kodzy) 9 88.53 101.89 2 22.22
19491. Allen (kochengoren) 9 72.48 83.08 1 11.11
19492. Kleuz (kleuz) 9 64.45 75.81 3 33.33
19493. Aly (kixiris) 9 55.66 68.66 9 100.00
19494. (kingshmoo) 9 75.16 91.79 2 22.22
19495. Kai (kingkaikster) 9 69.08 76.25 1 11.11
19496. thia (kingbarney) 9 65.00 81.63 2 22.22
19497. kiara (kia_via_dia_arara) 9 50.97 66.15 2 22.22
19498. kiannu (kiannaj) 9 68.95 84.09 2 22.22
19499. Khende (khende) 9 64.07 71.29 9 100.00
19500. ionlytype60wpm (keyboardssl... 9 99.10 111.57 5 55.56
19501. Kevin (kevbobbly) 9 83.57 97.22 2 22.22
19502. hmmm (kesh______) 9 108.45 119.33 5 55.56
19503. k (ker1ne) 9 72.02 82.34 3 33.33
19504. Ken (kennoji) 9 83.27 117.87 8 88.89
19505. William (keneth10) 9 65.65 79.01 1 11.11
19506. Kempo (kempochinois) 9 55.10 63.60 0 0.00
19507. Kelopio (kelopio) 9 127.15 149.49 4 44.44
19508. Deni Avdjia fanboy (kelethe... 9 77.09 87.22 4 44.44
19509. Kin (kccchiu) 9 87.65 93.20 2 22.22
19510. kb (kbaccam) 9 94.78 110.08 4 44.44
19511. Katie (kaytay0111) 9 100.69 123.25 1 11.11
19512. kensen (kawatashi) 9 66.25 74.89 1 11.11
19513. Kavita (kavita_chaubey) 9 45.48 50.76 0 0.00
19514. Xero (kataclysm) 9 91.38 102.59 3 33.33
19515. ben (kashikura) 9 49.56 56.28 0 0.00
19516. kap (kappow) 9 107.99 121.44 5 55.56
19517. MySpaceBarIsBroken (kanto) 9 117.10 128.74 6 66.67
19518. kanacurry (kanacurry) 9 104.70 116.92 7 77.78
19519. Kamiye (kamiye) 9 91.75 101.05 2 22.22
19520. kamea (kamea) 9 95.58 111.27 2 22.22
19521. kaka (kakaburra) 9 89.44 102.81 4 44.44
19522. joy (jyyjng) 9 77.63 88.30 3 33.33
19523. Ben (jynn7) 9 107.38 127.64 5 55.56
19524. christine (just_trying_to_g... 9 62.59 77.94 1 11.11
19525. Justin (justin_ephemeral) 9 101.14 112.54 8 88.89
19526. John (jspar) 9 92.30 104.97 2 22.22
19527. jasmine (jsmine) 9 100.76 117.23 1 11.11
19528. j (jrdib57) 9 105.92 121.59 5 55.56
19529. Barokah (jowotulen) 9 94.56 102.40 3 33.33
19530. Josh (joshindahood) 9 92.86 102.89 2 22.22
19531. José (josehenrique91) 9 61.39 77.13 1 11.11
19532. joris (jorisss) 9 86.63 96.08 5 55.56
19533. Jordan (jordansmithnz) 9 81.29 99.18 2 22.22
19534. Jordi (joorrrrrrrr) 9 58.22 68.81 4 44.44
19535. Jon (jonlee17) 9 70.51 81.22 3 33.33
19536. Johann (jona_die_jood) 9 60.50 69.16 0 0.00
19537. John (jolomaho) 9 59.58 63.47 1 11.11
19538. Jo (joemamma_38) 9 125.99 144.88 3 33.33
19539. jnnwn (jnnwn) 9 101.37 108.01 6 66.67
19540. Jordan (jmoneymyer) 9 67.88 75.83 0 0.00
19541. Jeremy (jmetzger55) 9 75.99 94.88 1 11.11
19542. Matin (jivago) 9 63.71 73.39 2 22.22
19543. Jennifer (jinglebingo) 9 92.53 102.49 3 33.33
19544. jimmy (jimnish) 9 44.62 49.44 1 11.11
19545. JIHAD (jihad_14) 9 63.91 68.29 4 44.44
19546. Jerry (jerry_licious) 9 107.24 114.24 5 55.56
19547. Jerry (jerry300) 9 77.28 82.85 1 11.11
19548. jeans (jelowo) 9 72.95 95.07 2 22.22
19549. Jed (jed_) 9 69.46 78.42 1 11.11
19550. Jay (jaysalvi) 9 94.18 108.54 2 22.22
19551. Jayden (jaydensar) 9 96.25 113.87 3 33.33
19552. jawes (jawes123) 9 97.79 114.78 6 66.67
19553. jasmine (jasminneee) 9 68.07 73.03 2 22.22
19554. Jan (janm2001) 9 76.08 87.25 2 22.22
19555. jam (jamola) 9 101.22 113.25 5 55.56
19556. James (james000) 9 71.21 80.42 0 0.00
19557. deskrabbit (jalaymie) 9 74.28 83.95 3 33.33
19558. jaemy (jaemywest) 9 50.65 57.32 0 0.00
19559. acjk (jackolant199) 9 69.38 80.23 1 11.11
19560. Jack (j4ck6643) 9 75.54 82.97 5 55.56
19561. I3B (i_3b) 9 56.39 62.30 8 88.89
19562. Eren Yeager (itzadit) 9 65.06 73.43 1 11.11
19563. Kevin Jeonghun (itskevinjeong) 9 71.94 77.38 5 55.56
19564. ir4un (ir4un) 9 53.48 67.08 2 22.22
19565. IQ1537 (iq1537) 9 131.41 146.28 7 77.78
19566. Libby (inkgenious) 9 68.29 74.25 2 22.22
19567. Vincent (indronna) 9 82.07 90.70 4 44.44
19568. imsynthex (imsynthex) 9 77.92 96.36 5 55.56
19569. aerora (imqyuu) 9 140.41 157.78 9 100.00
19570. Sam (ilikeyourcutghee) 9 86.16 99.33 2 22.22
19571. Reece (iifuze) 9 104.45 122.73 4 44.44
19572. IGO (igo_) 9 65.32 77.18 3 33.33
19573. Igor (igotim) 9 72.58 80.97 2 22.22
19574. Icecuber (icecuber) 9 102.37 112.78 3 33.33
19575. ICANNOTLOSE (icannotlose) 9 134.63 169.24 6 66.67
19576. konnie (ibeatonwhitewomen) 9 76.58 84.53 3 33.33
19577. pillows (hyluu) 9 149.61 167.97 8 88.89
19578. John (hylkinator) 9 108.96 128.62 5 55.56
19579. HY (hygh) 9 33.02 37.45 0 0.00
19580. Hunter (hunterup) 9 98.79 106.96 4 44.44
19581. hunter (hunter667) 9 75.57 86.09 4 44.44
19582. Vlad (hunter4858) 9 80.93 94.16 1 11.11
19583. HUng (hunggnuh0407) 9 78.69 93.25 2 22.22
19584. Who (hunatank) 9 79.83 97.18 1 11.11
19585. Roni (human_ro) 9 85.21 93.70 7 77.78
19586. Shohid (humangod) 9 87.06 112.97 2 22.22
19587. hoku✨ (hokuyato) 9 89.45 96.01 2 22.22
19588. Van Hoang (hoangelec) 9 92.71 106.70 3 33.33
19589. Hmed (hmed_belgassem) 9 34.52 38.20 1 11.11
19590. HiDa (hiida) 9 111.03 129.89 4 44.44
19591. The (hermaninator) 9 64.91 72.20 4 44.44
19592. Adrian (hellfi_18) 9 50.07 55.41 3 33.33
19593. hela (helabwr) 9 49.23 52.41 2 22.22
19594. healy (healy1453) 9 88.82 101.70 3 33.33
19595. headtr1p (headtr1p) 9 100.16 118.12 6 66.67
19596. Typer (haydyn49) 9 77.03 83.65 1 11.11
19597. Kevin (havek) 9 107.76 119.43 5 55.56
19598. Taika (hariyoshi41) 9 84.93 92.65 4 44.44
19599. HARI (hariom_01) 9 49.78 54.01 1 11.11
19600. harbeanger (harbeanger) 9 97.64 102.42 4 44.44
19601. Torben (hansi36) 9 62.88 71.73 7 77.78
19602. Hansel (hansels) 9 65.95 73.11 2 22.22
19603. Hannah (hannahwagner) 9 82.80 92.61 3 33.33
19604. Hannah Mei (hannahmei_steury) 9 52.08 64.05 2 22.22
19605. Michael (hangene92) 9 108.98 128.88 9 100.00
19606. Hamburgahh (hamburgahh) 9 91.93 108.91 2 22.22
19607. Gabriel (halamawala) 9 109.15 118.68 5 55.56
19608. HackzPlayz (hackzplayz) 9 71.99 79.63 3 33.33
19609. Turkey (habibiturkey) 9 84.09 104.57 5 55.56
19610. Anakin (gunmoon) 9 97.60 104.53 5 55.56
19611. Gum (gumwrapper) 9 80.23 85.30 3 33.33
19612. Kevin (gudern) 9 95.59 119.75 6 66.67
19613. ed sheeran (guccigangtae) 9 61.50 73.34 0 0.00
19614. John (gryndal) 9 81.57 88.55 5 55.56
19615. Alexander Grill (grill__alex) 9 57.13 64.94 1 11.11
19616. Gribbit (gribbit) 9 60.39 69.26 2 22.22
19617. Gaby (grebliale) 9 90.58 106.62 3 33.33
19618. Pandaru (grancrackerr) 9 87.79 97.68 5 55.56
19619. Vamsi Krishna (gordongecko) 9 71.72 78.42 4 44.44
19620. Josh (goldfingerer) 9 87.52 98.80 5 55.56
19621. Nguyen (gohweiz) 9 50.87 70.08 6 66.67
19622. mike (godlykanadian) 9 81.60 86.07 2 22.22
19623. GM (gmbao) 9 94.98 104.53 4 44.44
19624. Letsy (glitchyletsy) 9 70.89 95.09 4 44.44
19625. glenn (glenneroo) 9 104.33 119.98 7 77.78
19626. Ghost (gh0st3423) 9 73.09 91.53 2 22.22
19627. Tamjid (getrektfab) 9 47.59 54.10 2 22.22
19628. Max (getmackt) 9 80.22 88.06 6 66.67
19629. Greg (gecko231) 9 89.89 108.17 3 33.33
19630. Gauley (gauley) 9 70.21 77.94 6 66.67
19631. Gansukh (gansuh) 9 40.95 48.44 2 22.22
19632. gamesgant313 (gamesgant313) 9 91.57 112.00 9 100.00
19633. Gallagher (gallaghercat11) 9 60.49 70.36 1 11.11
19634. Owen (furyng) 9 65.30 71.37 9 100.00
19635. Furaha (furfur_beast) 9 71.25 78.95 1 11.11
19636. Mike (fuccuppo) 9 75.26 88.22 1 11.11
19637. Pink Mutt (frugalmussel) 9 70.13 83.31 1 11.11
19638. Adimas (frostyslr) 9 100.43 117.67 7 77.78
19639. Freddo (freddo7) 9 97.82 110.25 3 33.33
19640. Freddie (freddiesanchez) 9 92.55 106.87 2 22.22
19641. Ferrari (fluidcoder) 9 70.62 76.95 4 44.44
19642. Ruth (flirtatiouswizard) 9 90.79 100.16 2 22.22
19643. FlippLoki (flipploki) 9 94.69 114.83 4 44.44
19644. Franklin (flipfloppm) 9 122.47 149.35 7 77.78
19645. 297 (flightsim297) 9 132.29 161.89 8 88.89
19646. Kuldip (flash007) 9 69.22 74.44 3 33.33
19647. Flappy (flappysnake) 9 47.57 54.12 0 0.00
19648. Slow_AF (flaming_gladius) 9 77.42 85.15 1 11.11
19649. Jeremiah (fiveminus1) 9 101.73 129.45 3 33.33
19650. fintelia (fintelia) 9 79.08 85.71 2 22.22
19651. Oliwer (financialojay) 9 46.88 52.64 3 33.33
19652. Fred (fcbsd) 9 45.81 55.29 3 33.33
19653. Farkhan (farkhann) 9 56.75 72.20 0 0.00
19654. Kai حيادي (famboy32) 9 92.41 111.00 5 55.56
19655. Levi (fajpaj) 9 96.29 113.61 2 22.22
19656. Amaranth (fadingamaranth) 9 93.06 110.89 3 33.33
19657. EXT YOYO (ext_yoyo) 9 41.78 59.87 2 22.22
19658. Nathan (exodus_king) 9 82.32 89.43 4 44.44
19659. Fingerkart sweat (exford0) 9 110.26 115.59 5 55.56
19660. daddy (evilaristotle) 9 61.23 66.51 2 22.22
19661. John (everderp) 9 93.64 115.67 4 44.44
19662. Evanz (evanzyt) 9 70.44 78.16 4 44.44
19663. espo (espooooo) 9 86.12 105.37 3 33.33
19664. Nick (escalt) 9 104.43 125.88 6 66.67
19665. (erny2) 9 105.42 115.30 5 55.56
19666. epicgamer412 (epicgamer412) 9 109.23 124.34 5 55.56
19667. Endku (endku) 9 75.43 85.21 1 11.11
19668. Mohammed (enchantful) 9 90.75 99.95 2 22.22
19669. Elvy (elvy_) 9 48.93 57.40 3 33.33
19670. Elemental (elementl) 9 99.68 116.69 3 33.33
19671. Eldin (eldin_) 9 59.86 74.36 2 22.22
19672. Elaine (elainehuang) 9 53.83 63.11 0 0.00
19673. Ethan (egoldman) 9 99.80 122.89 5 55.56
19674. Edward (edwmai18) 9 75.64 98.80 3 33.33
19675. https//typer.news (eduard20) 9 102.88 116.06 4 44.44
19676. engie (edrian_a) 9 106.12 126.44 3 33.33
19677. EddieVonShmeddie (eddievons... 9 84.17 102.75 2 22.22
19678. Ecila246 (ecila246) 9 47.14 50.78 0 0.00
19679. Echo (echoet) 9 65.59 81.47 4 44.44
19680. DZ_no (dzeano) 9 83.26 91.09 3 33.33
19681. Dylan (dyl0e) 9 96.31 101.90 3 33.33
19682. Drake (dunkchai) 9 83.34 97.78 4 44.44
19683. Sam Luke (ducksako) 9 82.32 95.95 2 22.22
19684. Shamit (dr_neshmitz) 9 88.28 96.80 3 33.33
19685. Drixppy (drixppy) 9 49.75 57.11 2 22.22
19686. John (driftan) 9 103.20 115.61 3 33.33
19687. Dries (driesvanspauwen) 9 91.16 101.75 4 44.44
19688. John (drchase) 9 106.53 114.90 3 33.33
19689. Kris (doyouthink) 9 92.81 108.90 4 44.44
19690. DottyShark31762 (dottyshark... 9 52.74 64.56 2 22.22
19691. Juan (dostoevsky) 9 64.14 73.59 1 11.11
19692. Sophie Feldman (doodlefinny) 9 96.19 114.65 4 44.44
19693. Kyle (donttouchmyrice) 9 90.05 110.61 6 66.67
19694. Dominikus (dnk_dom) 9 36.33 43.04 2 22.22
19695. Keegan (djkeegs) 9 84.51 96.04 2 22.22
19696. Ian (disnailandd) 9 107.33 133.79 6 66.67
19697. Velislav (disaster_veli) 9 45.01 49.39 1 11.11
19698. J (dingkid) 9 117.45 125.49 5 55.56
19699. Alan (dick_licker666) 9 90.00 116.87 2 22.22
19700. DewWhite (dewwhite) 9 68.70 75.98 6 66.67
19701. Devin (devingalway) 9 107.27 123.56 2 22.22
19702. Deux (deuxgrosman) 9 94.51 105.34 2 22.22
19703. joanna (deulseobs) 9 120.97 137.00 6 66.67
19704. Domenic (denenfx) 9 110.88 127.07 3 33.33
19705. Tobi (demizu_) 9 110.75 122.39 4 44.44
19706. delfador42 (delfador42) 9 80.34 86.20 4 44.44
19707. Roxx III (deathsoul117004) 9 58.37 66.05 2 22.22
19708. Samson (deathreturns) 9 43.31 49.54 1 11.11
19709. David (davidt585) 9 97.34 108.11 1 11.11
19710. David (davidsayshello) 9 80.25 92.81 3 33.33
19711. DavidFinlForm (davidfinalform) 9 49.17 55.02 0 0.00
19712. DankAlzein (dankalzein) 9 121.93 140.08 6 66.67
19713. arin (dakotubbs) 9 51.07 65.90 0 0.00
19714. nunya (daintyfawn) 9 82.09 111.87 9 100.00
19715. Dauniverse (daimabao2003) 9 60.49 67.96 3 33.33
19716. D (daikuri) 9 103.76 117.24 4 44.44
19717. Mark (cyclingguy536) 9 80.26 92.96 1 11.11
19718. Nid (cyanid_) 9 81.45 97.80 2 22.22
19719. tyler (cyanamethyst) 9 95.11 113.83 3 33.33
19720. Christian (cwoo) 9 93.67 107.64 6 66.67
19721. O (cvxnjopsad) 9 86.62 98.82 2 22.22
19722. Ryan (cuoituoi1996) 9 92.33 114.57 4 44.44
19723. Cody (cuday) 9 91.07 104.44 4 44.44
19724. halloo (crystaalsnow) 9 57.34 66.08 2 22.22
19725. shoop (crimmsy) 9 87.53 98.64 4 44.44
19726. Oual (crankcrash) 9 71.65 90.64 3 33.33
19727. Charly (cpn29) 9 43.98 51.26 1 11.11
19728. Edvin (cowsmacker69) 9 64.44 79.56 4 44.44
19729. Cotle (cotle) 9 53.48 66.33 2 22.22
19730. Fast (cooloppo) 9 88.40 96.81 4 44.44
19731. Ian (coocooman3) 9 84.60 93.28 2 22.22
19732. Wilko (colacake84) 9 83.94 92.95 3 33.33
19733. Cole (cmrrockstar85) 9 106.09 121.38 5 55.56
19734. Bassim. (cmpleteidiot) 9 94.30 113.83 3 33.33
19735. Clit (cliffcatastrophe) 9 146.20 161.46 4 44.44
19736. Xenomorph (claygnot10) 9 88.86 104.48 1 11.11
19737. charlie (cl23456) 9 86.68 101.74 2 22.22
19738. Classical (cl123) 9 47.53 56.91 1 11.11
19739. Cole (ckoehler) 9 77.42 93.98 3 33.33
19740. Cijarot (cijarot) 9 70.86 81.09 2 22.22
19741. Chub (chubbyhands) 9 67.47 80.70 3 33.33
19742. Christian (christian9182) 9 72.74 78.95 4 44.44
19743. Chris (chrisbones) 9 70.86 83.97 2 22.22
19744. Christopher (chrisaua) 9 83.18 101.31 5 55.56
19745. Kevin (chqu7424) 9 91.83 104.08 6 66.67
19746. Chlebíček (chlebicek) 9 36.31 42.49 0 0.00
19747. Lii4 (chjh21005) 9 71.67 79.78 2 22.22
19748. tstats[chihayafuru] (chihay... 9 123.78 134.07 6 66.67
19749. Kachika (chickhicks_) 9 112.09 137.74 4 44.44
19750. cherub (cherub) 9 111.89 126.79 4 44.44
19751. Eduardo (chekedu) 9 47.38 63.29 0 0.00
19752. Jordan (cheetoburritoes) 9 88.22 95.72 3 33.33
19753. LOL (cheesecakeisgud) 9 117.74 129.25 5 55.56
19754. chedted (chedted) 9 78.93 91.73 2 22.22
19755. Chaws5 (chaws5) 9 111.36 120.37 6 66.67
19756. Manos (chatzakes) 9 68.39 77.44 2 22.22
19757. Charmen (charmen) 9 56.03 64.20 3 33.33
19758. charles (charles1106) 9 60.34 70.96 2 22.22
19759. chakuch (chakuch) 9 62.90 84.18 1 11.11
19760. Cian (ceol93) 9 110.76 123.00 6 66.67
19761. Ce (celineusa) 9 86.45 100.96 3 33.33
19762. Carl (cbho73) 9 105.52 112.55 2 22.22
19763. Tika (catluvr543) 9 124.67 146.60 7 77.78
19764. Jason (cathayjason) 9 104.97 115.34 6 66.67
19765. Cassius (cassius_vlok) 9 53.82 62.37 0 0.00
19766. Carbon (carbon28) 9 69.28 80.51 3 33.33
19767. Cao Sy Hai (caosyhailong99) 9 95.29 110.17 2 22.22
19768. Sniffff (can_i_sniffff) 9 67.05 81.71 4 44.44
19769. Cameron (cameron__) 9 78.78 91.76 4 44.44
19770. Lia (calumhood_) 9 76.38 90.15 4 44.44
19771. Calsuis (calsuis) 9 86.29 98.13 3 33.33
19772. mechanical (cakesogood) 9 95.11 132.97 4 44.44
19773. Type (cainvelasquez) 9 75.01 87.46 6 66.67
19774. LongGone (byejack123) 9 64.72 72.28 0 0.00
19775. BWho? (bwho) 9 90.91 97.48 3 33.33
19776. Alex (buttonmeister) 9 75.73 88.94 4 44.44
19777. Topher (burritopher) 9 70.28 82.76 3 33.33
19778. Burner (burnerburner) 9 78.43 89.24 4 44.44
19779. Bucketboi (bucketheadmit13) 9 81.99 94.34 3 33.33
19780. Jason (buckbuck5646) 9 113.50 133.74 7 77.78
19781. brian (bsill) 9 56.65 68.00 2 22.22
19782. Bruce (bs99) 9 54.51 59.89 1 11.11
19783. Bryan (bryangne) 9 75.80 92.70 2 22.22
19784. aaron (brwnmn6) 9 92.35 109.24 3 33.33
19785. bronts (brontus) 9 86.86 103.34 2 22.22
19786. Matt (britzkrieg) 9 91.66 105.60 3 33.33
19787. Brekzit (brekzit__) 9 73.13 86.55 2 22.22
19788. Brandon (brandongva) 9 63.86 70.24 4 44.44
19789. Francisca (borg58hd) 9 65.61 76.23 3 33.33
19790. Tristan (bombomb) 9 57.38 80.13 5 55.56
19791. Max (bolognacolonel) 9 84.16 90.25 5 55.56
19792. dead (bob_mcbobberbob) 9 71.57 81.53 3 33.33
19793. Borislav (bobun) 9 83.91 94.33 1 11.11
19794. Bobby (bobbydhiman69) 9 92.90 104.62 3 33.33
19795. BlueSlimeX (blueslimex) 9 85.02 94.74 8 88.89
19796. blues (blues856) 9 110.14 127.86 3 33.33
19797. blublueagle (blublueagle) 9 58.83 66.49 2 22.22
19798. Bilguun (blgn94) 9 57.30 63.92 2 22.22
19799. Jesse (bleedobsidian) 9 73.46 91.01 4 44.44
19800. Eejay (blazesfolife) 9 80.50 87.33 4 44.44
19801. Daniel (blastanks) 9 100.53 117.49 2 22.22
19802. Saul Goodman (blarg_23) 9 74.44 82.07 2 22.22
19803. frederik (birgerbrosa) 9 90.27 105.17 3 33.33
19804. biotox (biotoxz) 9 112.61 134.34 5 55.56
19805. bincent (bincentlife) 9 85.66 103.39 6 66.67
19806. emmanuel (bigginer20) 9 25.54 29.23 2 22.22
19807. Big Bird (bigbird61) 9 34.39 38.47 0 0.00
19808. bido (bidoteima) 9 97.94 121.84 7 77.78
19809. batmunkh (batmunkh) 9 56.13 61.46 0 0.00
19810. Son (baby_hanz) 9 95.57 109.26 3 33.33
19811. ¯\_(ツ)_/¯ (babanin) 9 73.46 82.31 5 55.56
19812. A Newbie (a_newbie_a) 9 55.38 62.64 1 11.11
19813. Azhar (azhartyper123) 9 43.80 52.03 2 22.22
19814. envy (ayytsklmao) 9 103.06 117.62 1 11.11
19815. AyuAnchor (ayu_anchor) 9 28.25 33.97 3 33.33
19816. Emilio (ayasesenpai) 9 75.94 85.47 4 44.44
19817. Paul (axxmodeus) 9 69.89 80.52 4 44.44
19818. Abigayle (awesomeness2470) 9 42.39 53.24 0 0.00
19819. Alex (awb101) 9 81.75 95.16 3 33.33
19820. Blyon (avocado_punched) 9 78.41 88.34 2 22.22
19821. Vignesh (avkvignesh) 9 68.25 73.88 2 22.22
19822. Avil (avilvineko) 9 55.40 60.77 0 0.00
19823. au_hermit (au_hermit) 9 72.53 85.28 4 44.44
19824. Hugh (atticush99) 9 86.37 96.13 4 44.44
19825. (atomskk) 9 116.09 141.12 5 55.56
19826. Blitz (athul) 9 112.43 124.12 4 44.44
19827. Dustin (athleticsaddict) 9 95.38 108.03 5 55.56
19828. Atabek (atabekarapov14) 9 73.22 91.25 2 22.22
19829. Samit (astro_0) 9 69.62 84.19 3 33.33
19830. Andre (astrothetypist) 9 96.93 107.09 3 33.33
19831. panda bear (astronicus) 9 137.42 147.81 6 66.67
19832. cody (astro8192) 9 65.97 69.41 3 33.33
19833. Alex (aspectings) 9 96.74 123.99 9 100.00
19834. あしくさい (asikusai) 9 77.09 86.21 2 22.22
19835. Asian (asiansupremacy) 9 102.95 119.02 7 77.78
19836. 😷 (ashraaf_k) 9 59.64 71.64 2 22.22
19837. Arvid (arvid_a) 9 54.16 60.78 0 0.00
19838. aiman (armm) 9 27.96 33.26 1 11.11
19839. Cam (archlinuxuser) 9 71.92 81.60 3 33.33
19840. Aqualuma (aqualuma1) 9 97.17 114.43 3 33.33
19841. APR (apr_fernando) 9 39.01 48.84 2 22.22
19842. Alexandre (apeloquin) 9 50.28 55.18 0 0.00
19843. Anthony (anto_onwuka) 9 87.36 92.89 1 11.11
19844. Anton (antonidas) 9 66.98 73.92 3 33.33
19845. Benedek (antokben) 9 78.04 89.53 4 44.44
19846. ante321 (ante321) 9 43.87 48.62 1 11.11
19847. Anoop (anooprajreddym) 9 49.42 62.38 1 11.11
19848. Anmol (anmolmb) 9 37.76 47.07 1 11.11
19849. Aniket (aniiket) 9 66.55 69.93 3 33.33
19850. jon (angbunehneh) 9 71.18 79.16 3 33.33
19851. anepik (anepik) 9 84.90 101.51 7 77.78
19852. 𝐃𝐫𝐞𝐰 (andreanfi... 9 65.91 78.16 3 33.33
19853. Andi (andi_m) 9 47.48 54.84 2 22.22
19854. Someone (anamedplayer) 9 92.43 99.23 4 44.44
19855. zzzzz (amzzzz771) 9 75.58 91.75 0 0.00
19856. Amy (amy159) 9 94.55 109.66 6 66.67
19857. Seeker (amer1996) 9 28.96 31.71 2 22.22
19858. AmbrosiA (ambrosialeeann) 9 62.39 70.58 2 22.22
19859. Amazing (amazinghedgehog) 9 115.15 137.85 7 77.78
19860. Amal (amal_ronak) 9 81.72 97.50 6 66.67
19861. Aluumina (aluumina) 9 73.48 84.41 1 11.11
19862. Jason (altaria13) 9 102.03 114.65 3 33.33
19863. František (alphabettt) 9 61.16 73.38 1 11.11
19864. Nelson (alkatzer) 9 85.85 98.98 2 22.22
19865. alixsch (alixsch) 9 62.77 76.70 5 55.56
19866. Ali (alimann) 9 39.43 48.29 6 66.67
19867. Alfredo (alfredosojr) 9 77.07 96.34 0 0.00
19868. Alex (alextheo) 9 59.94 66.13 1 11.11
19869. Alek (alexno) 9 54.47 58.19 0 0.00
19870. Alex (alexdaguy) 9 89.49 105.29 1 11.11
19871. Hadi (alcatroz) 9 98.91 107.61 6 66.67
19872. ALAKI (alaki_uka) 9 54.03 68.52 1 11.11
19873. Akshay (akshay2604) 9 62.13 78.22 3 33.33
19874. Pash (akratics) 9 54.41 68.42 1 11.11
19875. Sheeky (akiyoto) 9 69.29 80.79 3 33.33
19876. Akshay (ak63) 9 34.58 43.64 2 22.22
19877. aj (ajpingol) 9 94.63 118.95 8 88.89
19878. Ajim (ajimgram) 9 24.64 30.69 1 11.11
19879. Sinon (ajey_de_shadow) 9 88.02 94.17 3 33.33
19880. Corgious (aiwoon) 9 58.98 65.71 1 11.11
19881. Airree (airree) 9 75.81 81.59 4 44.44
19882. aidil (aidilqayyim) 9 81.42 91.31 0 0.00
19883. Agah (agah) 9 52.13 56.95 1 11.11
19884. Becz (adosz_56) 9 43.41 52.12 0 0.00
19885. Shadab (acclr8) 9 77.43 86.85 4 44.44
19886. Alex (abohac99) 9 57.09 63.74 2 22.22
19887. ab (abhi800) 9 55.74 67.88 0 0.00
19888. Aarohi (aarohi24) 9 50.30 59.76 2 22.22
19889. Alex (aalleexx1) 9 46.38 56.81 0 0.00
19890. Ocean (975miles) 9 81.04 87.61 0 0.00
19891. Parikshit (7767064953) 9 64.27 73.04 2 22.22
19892. 74R45 (74r45) 9 112.46 139.83 4 44.44
19893. AJ (5onn) 9 84.75 96.37 2 22.22
19894. WeiChen (50wpmbtw) 9 80.51 92.35 4 44.44
19895. jck (404jmre) 9 99.17 108.03 6 66.67
19896. 3DegreeK (3degreek) 9 82.04 87.24 2 22.22
19897. 32587 (32587cj) 9 78.13 85.48 2 22.22
19898. Amelia (2sidedpolygon) 9 111.51 126.33 6 66.67
19899. mike (1749mike) 9 66.50 84.60 3 33.33
19900. Andrew (10001k) 9 79.57 91.21 2 22.22
19901. Rory (typertypertyping) 9 62.40 75.19 3 33.33
19902. shmuck (devrajwashereyt) 9 72.52 90.81 8 88.89
19903. Sophie (milk8080) 9 62.81 75.51 2 22.22
19904. lulu (lofineedmint) 9 92.28 116.98 1 11.11
19905. Sadge (sadge_da_amateur) 9 89.60 100.50 3 33.33
19906. plusp (plusp) 9 45.95 52.61 2 22.22
19907. marshal (marshalstrakencz) 9 44.13 55.50 4 44.44
19908. harith (hrthtypo_310) 9 47.91 56.71 1 11.11
19909. Nick (flakesflakes) 9 77.25 89.21 7 77.78
19910. Red. (yesbutactuallyno21) 9 78.96 105.33 3 33.33
19911. A (traplordadan) 9 118.83 132.24 6 66.67
19912. tstats[annapal_9288] (annap... 9 60.31 78.70 9 100.00
19913. Speeps (keyzkieidan) 9 74.65 86.29 5 55.56
19914. bry400 (andromeda64) 9 80.91 93.00 2 22.22
19915. Petrowl (rainspringwell) 9 45.95 49.96 0 0.00
19916. Paige (twtvpaigelol) 9 149.65 168.04 5 55.56
19917. Michał (michal2287) 9 79.50 92.87 3 33.33
19918. Jason (hhheeeelllpppp) 9 74.97 84.89 4 44.44
19919. Manish (manish_17) 9 81.20 99.02 0 0.00
19920. Shokhrukhbek (incredible_sy) 9 60.25 66.15 1 11.11
19921. Mellow (mellophor) 9 81.48 91.67 2 22.22
19922. Yiyang (applehuner) 9 102.03 112.22 3 33.33
19923. Variares (variares) 9 59.45 64.76 0 0.00
19924. RyderWxnted#5380 (ryderwxnted) 9 84.58 106.36 2 22.22
19925. Madeline (madee0325) 9 98.94 118.86 5 55.56
19926. Scambodia (eventuallyellie) 9 69.56 79.34 2 22.22
19927. Taki (patini) 9 62.30 71.21 2 22.22
19928. junhan (junhanlee) 9 52.93 59.38 0 0.00
19929. Elah (elaaaaah) 9 66.01 74.52 1 11.11
19930. Justin Thomas (justin_bijoy) 9 56.50 62.13 1 11.11
19931. Jonathan (leadsaf11) 9 98.19 118.77 4 44.44
19932. Pco (pcorow) 9 66.43 74.67 3 33.33
19933. masderryl (masderryl) 9 50.04 57.95 1 11.11
19934. Rūdolfs (rudolfs_w) 9 34.86 37.27 0 0.00
19935. EpikHerolol (epikherolol) 9 57.15 63.77 4 44.44
19936. Isaac (iceman8083) 9 60.14 71.66 3 33.33
19937. Chandramouli (chandramoulig) 9 44.47 55.35 1 11.11
19938. ChoweeXCookie1879 (dojapusa... 9 44.72 49.55 1 11.11
19939. lol (moto31005) 9 76.00 88.57 3 33.33
19940. Jupp (cryt4x) 9 52.14 58.27 2 22.22
19941. Upsideman (upsideman) 9 73.09 85.99 2 22.22
19942. Saleh (salahiano) 9 53.91 60.99 0 0.00
19943. lieky (liekyw) 9 69.19 76.86 0 0.00
19944. Tudor (lad23) 9 67.02 78.82 1 11.11
19945. Wouter (walterdankers) 9 84.03 96.06 1 11.11
19946. Donn (dickies1) 9 49.39 57.72 1 11.11
19947. Zack (kazsz) 9 90.81 101.78 3 33.33
19948. Aaditys (aadityagiri_bis) 9 57.98 64.83 1 11.11
19949. svetina (hotxpuns) 9 81.14 98.30 4 44.44
19950. BQ (bayanda) 9 47.53 62.65 4 44.44
19951. Robert (robmal1) 9 73.10 79.43 2 22.22
19952. Blabbermouth (blabbermouth_) 9 74.74 88.71 3 33.33
19953. Ryan (rns86) 9 89.46 111.38 3 33.33
19954. Sherwin (sherwin_24) 9 39.35 46.80 3 33.33
19955. Mary (kassywithac) 9 57.31 64.90 0 0.00
19956. Amisently (amisently) 9 106.80 127.99 6 66.67
19957. b1nga (b1nga) 9 75.03 94.37 3 33.33
19958. johnlex1k (dark_eclipse) 9 57.91 70.37 1 11.11
19959. Brandon (2fasteyes) 9 78.89 86.87 2 22.22
19960. Bloppy (smurfy_03) 9 47.21 51.08 0 0.00
19961. Antoine (loser3172) 9 75.32 93.00 2 22.22
19962. Kazzzi (kazzzi) 9 26.58 31.18 1 11.11
19963. Joey (lashawna) 9 77.95 89.61 2 22.22
19964. Yeah (donojang) 9 126.68 139.17 5 55.56
19965. Alec (alec935) 9 84.43 93.06 2 22.22
19966. coastal (coastalrookie) 9 78.91 96.56 4 44.44
19967. Washdude7 (yashvarde) 9 80.15 90.40 5 55.56
19968. Blue (blueballerz) 9 62.78 76.24 4 44.44
19969. Noobbkour (noobbykour) 9 72.05 81.74 2 22.22
19970. Hooward (hooward) 9 49.04 55.47 0 0.00
19971. Atomic_Typh00n (star_gaming... 9 111.08 143.43 6 66.67
19972. Peter (pitabreadd) 9 92.78 106.68 1 11.11
19973. adzenny (adzenny) 9 83.54 105.46 5 55.56
19974. shinji-llorica-kun (shinji_... 9 63.16 70.63 7 77.78
19975. Drainyyy (drainyyy) 9 84.35 91.49 4 44.44
19976. Nicolas (itsnickxd1) 9 85.81 110.91 9 100.00
19977. rautji (divyanshrautji123) 9 53.90 60.04 3 33.33
19978. Colt (barksonq) 9 111.84 141.49 9 100.00
19979. John (neptuneposiedon) 9 104.93 127.45 4 44.44
19980. Lovelace (lovelacelovesc) 9 93.38 111.94 7 77.78
19981. Annie (annievalentinekuo) 9 87.36 106.13 4 44.44
19982. zac (tylerblevins43) 9 93.37 100.48 4 44.44
19983. LimiTrix (limitrix) 9 86.61 96.00 4 44.44
19984. Taylor (tayl) 9 80.31 90.32 2 22.22
19985. opmj5 (opmj5) 9 46.33 57.16 3 33.33
19986. Bryan (bryan_shao) 9 85.41 96.14 4 44.44
19987. Severus (surajchopra002) 9 87.47 102.72 2 22.22
19988. Nyuminzt (nyuminzt) 9 33.83 41.52 1 11.11
19989. Nate (fastfingerer1984) 9 71.08 83.56 2 22.22
19990. Jason (jason_n) 9 102.12 118.55 3 33.33
19991. Joe (joe_mama_speed_at_typing) 9 63.85 68.89 1 11.11
19992. cl0ud (hykroz) 9 51.43 59.73 0 0.00
19993. Swag (swagsanji) 9 75.62 81.10 6 66.67
19994. Edmund (edmndfx) 9 54.56 66.85 1 11.11
19995. Keenan (km1nd) 9 67.62 87.97 3 33.33
19996. kat (tehkraft) 9 92.98 115.32 3 33.33
19997. Anjalie :) (cra0009) 9 43.70 53.57 1 11.11
19998. Tatsam (tatsam_03) 9 77.23 87.88 2 22.22
19999. Capeman (godzhell22) 9 57.31 70.91 0 0.00
20000. Ebenezer (ebenezeryu) 9 72.32 84.43 4 44.44
20001. ClassAMaverick (classamaver... 9 76.77 83.27 8 88.89
20002. Eduardo (eder_vs) 9 70.46 87.60 4 44.44
20003. brad (bradpaul525) 9 63.10 70.12 4 44.44
20004. Will (zalear) 9 73.62 81.85 2 22.22
20005. Lilgovo (lilgovo) 9 58.30 72.53 5 55.56
20006. ForGe (dccvx) 9 93.23 114.51 2 22.22
20007. Sammy (virtualtyper) 9 109.76 130.14 3 33.33
20008. Cyborg (cyborg112) 9 51.79 62.16 1 11.11
20009. brateboi (brateboi) 9 77.05 85.38 3 33.33
20010. Blunt (bluntsam) 9 68.29 73.13 2 22.22
20011. Dexter Martin (dexterguilalas) 9 48.14 52.22 4 44.44
20012. Qiyuan (keonjoe) 9 108.36 121.91 3 33.33
20013. Husker (husker9) 9 61.62 71.90 3 33.33
20014. Brisseira (mintdaisy101) 9 51.08 63.96 1 11.11
20015. Matthias (yotuhyper) 9 16.16 33.06 2 22.22
20016. BoomBa (boombaman) 9 74.19 82.98 1 11.11
20017. Fastasfackboi (fast_as_fack... 9 56.72 65.83 3 33.33
20018. tstats[ahmedmhm2024] (ahmed... 9 42.98 47.04 0 0.00
20019. Shambhu (veganshambhu) 9 66.89 73.17 4 44.44
20020. abksabermaster (abksabermas... 9 67.86 81.29 3 33.33
20021. Rafael (rafaelrs) 9 88.00 99.84 3 33.33
20022. birb (smallbirb2) 9 109.74 121.43 4 44.44
20023. fzerty (shreyasminocha) 9 97.30 109.00 5 55.56
20024. Kit (karma_88) 9 65.35 74.66 0 0.00
20025. Lakshya (smashed_potato) 9 23.92 29.22 4 44.44
20026. Start slow (sancriuse) 9 58.58 66.60 2 22.22
20027. JelyRenee' (jelybely_21) 9 55.01 60.54 2 22.22
20028. _ (freshnewname) 9 65.20 80.47 1 11.11
20029. song yuqi (ralkinho) 9 65.71 68.88 0 0.00
20030. WdMalus (_wdmalus31_) 9 36.33 41.21 3 33.33
20031. meerbay (meerbay) 9 60.37 68.58 2 22.22
20032. Sáng (supersentaj) 9 46.04 48.85 3 33.33
20033. Oliver (oliververandus) 9 100.08 117.40 8 88.89
20034. Kayne (kayne256) 9 96.36 116.31 4 44.44
20035. OmNommy (_omnommy) 9 55.35 59.14 1 11.11
20036. Suchanya (suchayann) 9 40.47 46.39 7 77.78
20037. rj (bruh_momento364) 9 70.98 79.36 2 22.22
20038. Seam (shademaster69) 9 67.50 79.47 3 33.33
20039. Einkie (qtr_typer) 9 55.05 60.82 0 0.00
20040. chocolate (chocolate1111) 9 54.57 65.41 3 33.33
20041. Sunil (sunildev) 9 41.68 44.95 5 55.56
20042. Emma (skunkiii) 9 42.49 46.22 1 11.11
20043. Eric (__eric__f__) 8 81.84 90.34 1 12.50
20044. zensei (_zensei_) 8 75.30 82.15 0 0.00
20045. sexyman (_may_) 8 64.30 78.92 2 25.00
20046. Eternap (_eternal_) 8 76.28 87.02 6 75.00
20047. Chris (_c3a) 8 82.45 98.61 0 0.00
20048. zuritor (zuritor) 8 53.47 73.04 8 100.00
20049. Michael (zoyp) 8 84.69 117.43 0 0.00
20050. Kevin (zolt4r) 8 103.30 109.37 2 25.00
20051. Jillian (zolemnx) 8 51.25 59.15 0 0.00
20052. Dwarf (znagol) 8 69.06 72.66 1 12.50
20053. Sanity (zjhaun) 8 61.28 67.37 3 37.50
20054. ZiyanTheZink (ziyan_the_zink) 8 79.73 87.71 8 100.00
20055. Ziron (ziron) 8 86.42 102.86 0 0.00
20056. Zilla1218 (zilla1218) 8 74.28 81.82 2 25.00
20057. Zia (zia__) 8 31.87 35.61 5 62.50
20058. Zeta (zetanegativeone) 8 96.33 109.51 5 62.50
20059. todayis_WanD (zeropatience) 8 84.87 107.43 2 25.00
20060. zerg (zerggirl) 8 110.98 140.14 6 75.00
20061. zenyatta (zenyattamondatta) 8 79.50 95.48 2 25.00
20062. Zekken (zekken12345) 8 89.03 105.94 6 75.00
20063. Jack (zbroooksy) 8 102.35 126.77 2 25.00
20064. ZAKARIAAAAAAAAAAAAAAAAAAAAA... 8 52.20 60.56 0 0.00
20065. tepps (zachtepp) 8 114.85 125.75 5 62.50
20066. Zach (zachninjakiller6) 8 48.80 56.09 1 12.50
20067. Yuuki (yuukiy) 8 75.78 86.79 3 37.50
20068. Yuliana (yuli_a) 8 73.35 83.05 0 0.00
20069. CHONG YU JIE (yujie_is_typing) 8 80.46 88.27 1 12.50
20070. y (ys26908) 8 58.72 67.24 0 0.00
20071. YowzaH (yowzah) 8 131.38 146.23 6 75.00
20072. Jack (yourmomahhahaahaha) 8 106.55 126.79 3 37.50
20073. your mom (yourmother369) 8 114.15 129.26 4 50.00
20074. Yomie (yomie) 8 71.30 82.02 7 87.50
20075. yinho (yinhotype) 8 58.11 74.04 2 25.00
20076. Yimin (yimindvorak) 8 124.97 139.37 5 62.50
20077. Yi-Chen (yichenlo) 8 58.41 72.91 1 12.50
20078. Yasif (yasif345) 8 65.45 71.95 1 12.50
20079. Greg (yaohan) 8 117.51 136.77 8 100.00
20080. yannick (yannickbaze) 8 57.80 62.95 1 12.50
20081. Time (yaboiiiwill) 8 104.20 111.59 3 37.50
20082. six (y33t3r) 8 72.91 86.79 2 25.00
20083. XYZ (xyzabc1799) 8 77.09 83.44 1 12.50
20084. Fabian (xylia_fabian) 8 70.23 77.20 3 37.50
20085. xxxodarap (xxxodarap) 8 40.76 48.25 1 12.50
20086. RelaxCozy (xxodus999) 8 89.77 95.95 3 37.50
20087. Moritz (xp0s31d0nx99) 8 69.88 76.74 2 25.00
20088. jonny (xjboix) 8 93.48 115.36 3 37.50
20089. Rohit (xdeadly) 8 51.20 60.89 2 25.00
20090. charli (xdbiscuits) 8 61.98 70.96 2 25.00
20091. Jeffrey (xcjeffrey) 8 50.21 60.42 0 0.00
20092. Bryan (xarga) 8 103.87 117.26 8 100.00
20093. Jason (xaraer) 8 69.74 78.38 2 25.00
20094. Will (wwwong) 8 97.51 111.79 4 50.00
20095. Fabio (wrist_strength) 8 82.08 89.54 3 37.50
20096. Nicky (wownickywow) 8 75.37 83.30 3 37.50
20097. parker (withouthue) 8 44.95 55.55 0 0.00
20098. C (windyreed) 8 115.71 130.55 3 37.50
20099. Wilson (wilson_ang) 8 74.78 81.57 2 25.00
20100. Tjerk (whiz_nl) 8 102.26 113.59 5 62.50
20101. Hunter (whdahl) 8 94.56 103.93 5 62.50
20102. Erik (whatafuas) 8 94.94 106.61 1 12.50
20103. Michael (whalee) 8 93.14 97.70 2 25.00
20104. Owen (wertls) 8 69.55 82.07 7 87.50
20105. w (wenjun) 8 127.12 144.75 4 50.00
20106. Leonardo (wenjiedrick) 8 93.88 111.36 4 50.00
20107. Jay (wenisknees) 8 88.37 109.67 1 12.50
20108. Shantanu (wckd1) 8 47.41 51.30 1 12.50
20109. James (waterpuree) 8 70.04 80.53 3 37.50
20110. Waterghosteus (waterghosteus) 8 82.03 96.10 3 37.50
20111. Ethan (waitblock) 8 103.17 109.96 0 0.00
20112. Adam (waffelele) 8 71.28 79.81 8 100.00
20113. Cuong (vucuong21) 8 76.46 83.94 2 25.00
20114. vslip (vslipyt) 8 57.64 64.28 3 37.50
20115. Van Philip (vppexis) 8 89.52 97.18 2 25.00
20116. VK (vk_7) 8 41.47 56.71 5 62.50
20117. Visionss (visionss) 8 89.56 108.91 3 37.50
20118. Forrest (verybigpenguin) 8 112.06 128.90 4 50.00
20119. Looking For GF (veiven) 8 113.63 129.48 4 50.00
20120. Vedang (vedang1312) 8 38.52 43.28 2 25.00
20121. Doug (vastvincent) 8 93.25 107.52 6 75.00
20122. josh (vapeypoo) 8 80.36 88.94 1 12.50
20123. Philip (vanp) 8 121.78 138.16 7 87.50
20124. Peter (vajco) 8 66.13 71.40 1 12.50
20125. Hiyam (v1ctor1x) 8 99.43 109.21 4 50.00
20126. v0lkoff (v0lkoff) 8 101.29 119.61 4 50.00
20127. Aya (uwub) 8 108.68 117.48 7 87.50
20128. Prakhar (username_copied) 8 52.73 65.56 2 25.00
20129. 999 WPM (usedarktheme) 8 67.32 77.84 0 0.00
20130. Daniel (unreal_beam) 8 65.78 72.61 1 12.50
20131. unpr0gr4mm3d (unpr0gr4mm3d) 8 91.83 101.90 1 12.50
20132. unnat (unnat) 8 85.55 98.23 2 25.00
20133. ULUSHA (ulugbek0602) 8 70.17 82.16 2 25.00
20134. K Sooraj (ultron_ksk) 8 39.98 47.39 0 0.00
20135. Ultrabooby (ultranooby) 8 125.94 136.62 4 50.00
20136. Ivan Richard (ugololeivan) 8 58.18 64.31 1 12.50
20137. ⌨️🖱️ (t_0nio) 8 116.53 137.06 8 100.00
20138. Split keeeeeb (tzbob) 8 112.45 122.74 6 75.00
20139. Chris (typistgod14) 8 51.38 65.34 3 37.50
20140. typing pro (typingze) 8 38.53 44.27 2 25.00
20141. typing (typingmr) 8 82.88 89.13 2 25.00
20142. bob (typer_bob) 8 100.72 114.41 2 25.00
20143. bhrigu (typer_21) 8 70.24 80.19 6 75.00
20144. Tyler (tylermsmith199) 8 89.89 103.12 2 25.00
20145. TUwU (tuwu) 8 108.84 115.83 1 12.50
20146. Andrej (tunas1337) 8 104.03 120.00 4 50.00
20147. Thomas (tszkoda) 8 48.67 52.40 3 37.50
20148. Grayson (troydenite) 8 86.02 94.62 3 37.50
20149. tay (trongaus) 8 110.90 121.31 4 50.00
20150. MIr (triple_mmm) 8 41.62 47.02 0 0.00
20151. 🇵🇸 (' _ゝ') (trickroom) 8 117.94 126.35 3 37.50
20152. Towbie (towbie) 8 94.34 111.14 3 37.50
20153. Touhid (touhid23du) 8 45.55 52.03 0 0.00
20154. Ofek (too_slow_to_go) 8 81.20 88.83 2 25.00
20155. Toni (tony_playz) 8 79.57 98.36 8 100.00
20156. Tony (tonyngu) 8 95.59 112.14 1 12.50
20157. Antonio (tonibudal) 8 50.46 54.72 1 12.50
20158. TommiTMX (tommitmx) 8 99.43 110.75 5 62.50
20159. Thomas (tmsopogi) 8 90.28 102.85 3 37.50
20160. Tahar (tmasmaliyev) 8 35.56 50.80 0 0.00
20161. tken (tken_tokyo) 8 58.20 66.17 0 0.00
20162. Tyler (tinss619) 8 85.36 91.65 3 37.50
20163. Meeper (timelysaucer) 8 97.99 102.20 1 12.50
20164. Tim (timbob5380) 8 77.20 89.26 4 50.00
20165. testo (tillman1981) 8 79.42 91.89 3 37.50
20166. tilko (tilko) 8 97.09 105.31 3 37.50
20167. Tiberius (tiberiusceter) 8 101.50 121.55 5 62.50
20168. Joshua (the_rockstar) 8 57.92 61.96 3 37.50
20169. The (the_phoenix) 8 46.92 52.48 0 0.00
20170. Sabrina (the_ice_within) 8 119.47 148.60 8 100.00
20171. perky (theperkiestpotato) 8 87.18 96.22 2 25.00
20172. ThePCJakub (thepcjakub) 8 103.07 113.63 5 62.50
20173. Svetlin (thepb) 8 54.35 64.09 1 12.50
20174. 0rz0rz (thenine) 8 99.25 104.58 3 37.50
20175. ­ (thelurkerman) 8 112.37 138.14 2 25.00
20176. Theo (thelogdude) 8 88.65 98.42 2 25.00
20177. JJ (thejapie) 8 100.69 107.24 5 62.50
20178. Michael (thedoctor506) 8 81.16 88.77 1 12.50
20179. bee (tggb) 8 43.92 46.47 0 0.00
20180. Nhat Anh (texward) 8 90.77 98.97 5 62.50
20181. Tor (temyrvang) 8 82.89 89.55 2 25.00
20182. temmo (temmo) 8 121.23 141.89 4 50.00
20183. Benjamin (telekinesis) 8 74.05 90.41 5 62.50
20184. teenpro (teenpro) 8 59.64 76.47 4 50.00
20185. Ted (tednation) 8 86.88 96.54 1 12.50
20186. Alex (tec9rushb) 8 80.59 89.70 2 25.00
20187. Logan (tcalogan) 8 95.31 102.89 5 62.50
20188. mati (taux) 8 95.85 107.35 4 50.00
20189. Umair (tastyorange) 8 68.26 83.37 1 12.50
20190. Tasty (tastytomato) 8 75.97 81.83 5 62.50
20191. TasteOfCancer (tasteofcancer) 8 91.31 107.65 2 25.00
20192. Tam (tamlee573) 8 86.99 95.87 2 25.00
20193. Luis (tallwhitestck) 8 100.13 107.71 7 87.50
20194. Mikasa (tahabashar11) 8 71.92 86.20 3 37.50
20195. Tom (tacocatdeboss) 8 100.34 115.50 2 25.00
20196. swim (swammmy) 8 83.50 100.43 5 62.50
20197. Swah (swahaha) 8 61.26 76.45 1 12.50
20198. Ryan (suzerainy) 8 97.62 109.94 2 25.00
20199. Kachow (suvigya) 8 61.62 70.75 1 12.50
20200. sussy (sussybaka11) 8 58.97 65.35 0 0.00
20201. surdyyy (surdyyy) 8 52.21 57.70 1 12.50
20202. koen (super_stinky) 8 44.20 55.33 1 12.50
20203. eurobeats (super0) 8 75.66 103.85 1 12.50
20204. Suigikawa (suigikawa) 8 85.14 95.97 4 50.00
20205. subhojeet (subho12134) 8 61.59 69.23 0 0.00
20206. Pui (suaingam) 8 47.57 61.61 0 0.00
20207. Stuge (stugefin) 8 58.55 64.99 0 0.00
20208. George (stoptheads) 8 114.25 122.47 4 50.00
20209. Stephy (stephy2202) 8 74.75 86.71 0 0.00
20210. stepbrother69 (stepbrother69) 8 101.68 124.57 4 50.00
20211. Suraj (st1ck14) 8 62.07 70.68 3 37.50
20212. sszebrat (sszebrat) 8 78.67 92.96 4 50.00
20213. Sukh Singh (ssothegreat) 8 62.62 77.47 8 100.00
20214. squirrelslow (squirrelslow) 8 94.47 114.35 2 25.00
20215. Michael (infinity34) 8 64.92 74.16 5 62.50
20216. Maximus (sprachzarathustra) 8 96.26 110.52 2 25.00
20217. Brandon (spookybees) 8 86.26 104.31 3 37.50
20218. Wayne (spollox) 8 88.37 97.55 3 37.50
20219. Tim (speedy_neutron) 8 60.53 65.61 1 12.50
20220. Lul (spammeh) 8 93.96 106.60 3 37.50
20221. Macaroni (spacial_macaroni) 8 77.25 82.60 1 12.50
20222. spacebagel (spacebagel) 8 107.50 132.70 3 37.50
20223. SoupThyme (soupthyme) 8 74.88 88.17 6 75.00
20224. soufiane (soufianebth) 8 42.05 47.20 4 50.00
20225. Sophie (sophiebrown6) 8 56.44 62.10 0 0.00
20226. Redugo (somebodyelse) 8 84.69 99.11 5 62.50
20227. anonRED (somebody_red) 8 46.49 54.12 1 12.50
20228. Barry (somalisam) 8 101.19 114.59 4 50.00
20229. Snek (snekking) 8 89.17 93.85 2 25.00
20230. Anders (snazzy) 8 76.44 86.72 1 12.50
20231. SmokR (smokeydbear) 8 89.84 105.39 1 12.50
20232. Shane (smokedbread) 8 68.37 77.59 4 50.00
20233. Nafeez (smileywee) 8 84.62 97.21 4 50.00
20234. kaydence (smhkaydence) 8 45.66 51.97 1 12.50
20235. Mel (smelons) 8 104.67 117.57 0 0.00
20236. Slow (slow_keyboard) 8 53.61 61.35 1 12.50
20237. I am speed (slowhand18) 8 95.16 111.07 4 50.00
20238. Sam (slimwhit) 8 63.63 66.68 1 12.50
20239. Karthik (slickfalcon) 8 63.74 71.56 3 37.50
20240. Edwin (skitargduva) 8 66.46 77.75 1 12.50
20241. Skillet (skillet18) 8 125.21 136.42 7 87.50
20242. Nhan (skhylines) 8 85.53 109.55 3 37.50
20243. SJ (sjmoon110718) 8 47.72 55.17 0 0.00
20244. Sir (sirnoodles05) 8 93.23 103.52 2 25.00
20245. Gal (sirdouchebag) 8 73.56 92.70 0 0.00
20246. Sinan (sinan) 8 121.62 148.27 4 50.00
20247. Pedro (simplypedro) 8 76.24 90.72 3 37.50
20248. Simas (simgint) 8 77.42 88.72 3 37.50
20249. Josh (shwahhh) 8 111.83 122.70 4 50.00
20250. Shub (shubhamgoel352) 8 69.30 75.60 1 12.50
20251. Denny (shizkr) 8 86.42 98.56 4 50.00
20252. Rey x MountainStride (shinr... 8 83.03 95.82 0 0.00
20253. Mubarak (sgtcuredpanda) 8 48.86 52.03 0 0.00
20254. クローエ (seyasoya) 8 84.33 92.63 2 25.00
20255. Seth (sethbangerter) 8 115.42 127.14 2 25.00
20256. Serji (serji) 8 57.40 65.22 2 25.00
20257. Senseiparks (senseiparks) 8 100.67 111.55 3 37.50
20258. kayla (senlin) 8 72.35 86.69 5 62.50
20259. senara (senara124) 8 91.99 100.10 3 37.50
20260. George (sellers1234) 8 63.87 70.09 1 12.50
20261. seb (sebbbbbbb) 8 82.05 92.54 3 37.50
20262. Bastian (sebastianovoam) 8 71.87 77.67 2 25.00
20263. Shane (sdoyle4499) 8 64.68 78.52 1 12.50
20264. Scorbutsale (scorbutsale) 8 78.13 85.23 1 12.50
20265. BoiledAir7 (sawt) 8 79.91 90.67 0 0.00
20266. Sagar (saucy_d) 8 70.30 80.95 3 37.50
20267. Sarvottam (sarvottampriyada... 8 95.94 112.10 1 12.50
20268. Sarah (sara_g) 8 124.44 132.05 7 87.50
20269. Sara (sarasmile) 8 30.78 45.61 2 25.00
20270. Santiago (santpp85) 8 31.17 35.22 0 0.00
20271. Santosh (santoshm33) 8 58.00 68.89 2 25.00
20272. Sander (sander5151) 8 86.15 93.40 2 25.00
20273. (samuraipie) 8 122.12 144.36 5 62.50
20274. Sam (samschreibt) 8 100.18 112.68 4 50.00
20275. Sami (samihasaspine) 8 102.43 123.84 3 37.50
20276. Patrick (saboe) 8 71.99 82.65 3 37.50
20277. اعجاذ حسين (s183ds... 8 61.89 70.76 2 25.00
20278. Ryley (r_sand11) 8 48.61 63.35 0 0.00
20279. Ryan (ryanmc99) 8 112.00 125.67 3 37.50
20280. Aditya (rust_eze) 8 54.36 67.70 1 12.50
20281. ABtech19 (rushildhar) 8 40.30 44.99 4 50.00
20282. Rushil (rushil13579) 8 68.89 83.54 2 25.00
20283. Joe (rufu) 8 131.46 158.41 7 87.50
20284. Ruben (rubennijhuis) 8 64.25 98.57 2 25.00
20285. RSCArne (rscarne) 8 68.68 81.69 2 25.00
20286. Roy (roywastaken) 8 37.25 41.76 1 12.50
20287. Rotem (rotemsela) 8 102.55 124.70 4 50.00
20288. xRoshx (roshdip) 8 60.51 68.25 2 25.00
20289. Ron (ron107) 8 31.25 40.21 0 0.00
20290. Romin (rominpasa) 8 63.18 70.54 1 12.50
20291. Yessir (romans828) 8 111.10 136.56 3 37.50
20292. Viki (roastedice) 8 99.94 121.66 6 75.00
20293. 6fingers (rktspcr) 8 72.87 89.26 2 25.00
20294. Sadia (riyan_sadia) 8 54.90 64.09 0 0.00
20295. RISE (riseee) 8 57.16 73.20 1 12.50
20296. rickythedino (rickythedino) 8 96.12 115.32 3 37.50
20297. Ricky (rickyb663) 8 89.70 100.14 5 62.50
20298. garry (richgarry) 8 82.12 100.81 4 50.00
20299. ★ d (retronub) 8 125.87 145.37 5 62.50
20300. Islam ❤ (respectedfeeds) 8 102.54 107.54 3 37.50
20301. Yangyang (renasceim) 8 78.77 87.42 2 25.00
20302. Josh (remember000this) 8 80.44 87.38 1 12.50
20303. Reed (reedhaffner) 8 99.63 114.12 2 25.00
20304. Brendo (rebelx) 8 75.01 82.25 0 0.00
20305. real (realscav) 8 111.64 125.61 4 50.00
20306. Roman (rdprice) 8 84.13 95.19 3 37.50
20307. Mikey (rctyogo) 8 72.38 77.07 0 0.00
20308. Heem (rayhim) 8 58.87 64.19 2 25.00
20309. pogron (rawhnald) 8 97.90 113.05 3 37.50
20310. Ian (raveian) 8 49.00 58.79 1 12.50
20311. Rall (raullll) 8 84.73 97.68 2 25.00
20312. Jefferson (rasmus06) 8 109.13 127.46 4 50.00
20313. too_slow (rakki7) 8 76.82 83.32 2 25.00
20314. Prathamesh (rajputprathames... 8 56.46 62.47 3 37.50
20315. rai_10101 (rai_10101) 8 81.62 101.30 5 62.50
20316. Ayuxh (raix29) 8 41.40 45.76 2 25.00
20317. rainmaker (rainmaker6) 8 62.72 70.53 0 0.00
20318. Fred (raijinpanda) 8 103.88 114.91 5 62.50
20319. Quang (quanglc00) 8 52.92 56.00 4 50.00
20320. Pieter (pvanuffelen) 8 66.70 78.27 3 37.50
20321. Angela (purplehalo3) 8 81.63 93.81 0 0.00
20322. Dave (punskilled) 8 117.34 128.92 3 37.50
20323. Jedidiah (puisanberg) 8 102.08 116.63 8 100.00
20324. Puffone (puffone) 8 28.18 32.27 2 25.00
20325. sc4x (pucymae) 8 84.33 93.67 2 25.00
20326. Ben (pro_benny) 8 90.55 106.89 1 12.50
20327. blue (primaryblu) 8 125.52 158.22 2 25.00
20328. Connor (pressurr) 8 94.56 103.15 2 25.00
20329. PRANJAL (pranjalgogoi1999) 8 51.13 56.26 0 0.00
20330. Jeremy (potrainer) 8 102.66 123.84 3 37.50
20331. potato_pig12 (potato_pig12) 8 106.74 118.89 6 75.00
20332. potato0329 (potato0329) 8 66.25 70.44 5 62.50
20333. Eric (potatcs) 8 84.71 99.01 4 50.00
20334. PossiblyRandom (possiblyran... 8 104.68 118.50 4 50.00
20335. Porsit (porsit) 8 68.33 83.04 2 25.00
20336. Dai ca (porrydeptrai) 8 62.73 83.67 7 87.50
20337. . (popdon990) 8 70.16 85.74 3 37.50
20338. Poopy4757 (poopy4757) 8 56.74 69.62 1 12.50
20339. Kom (poobscoob) 8 95.78 113.51 2 25.00
20340. Polyatomic (polyatomic) 8 113.14 126.18 6 75.00
20341. Sid (pokecrater1) 8 99.76 108.81 3 37.50
20342. Lee (pohsien) 8 30.64 39.85 0 0.00
20343. podlesk (podlesk) 8 64.29 74.83 2 25.00
20344. Patrick (pmurfdesign) 8 54.68 61.91 0 0.00
20345. Mads (planntt) 8 53.54 59.53 2 25.00
20346. Patrick (pjawesomegaming) 8 80.20 104.78 4 50.00
20347. Sciencio (pinkdiam0nd) 8 72.11 84.67 0 0.00
20348. Jonas (piglin) 8 67.36 76.75 2 25.00
20349. Goal: 70wpm average (pietpo... 8 28.01 31.29 0 0.00
20350. Pichu (pichu_pals) 8 76.45 89.63 8 100.00
20351. Tim (phuc131) 8 71.96 80.07 0 0.00
20352. Philip (philiplu7777) 8 98.92 109.62 2 25.00
20353. Joseph (phantom5k) 8 75.83 82.85 4 50.00
20354. Patrik (pgdth) 8 62.88 70.45 3 37.50
20355. fastfingas (petryk21) 8 80.09 91.38 0 0.00
20356. Petit (petitjuju) 8 104.89 126.64 3 37.50
20357. alex (peopel) 8 69.89 78.43 0 0.00
20358. Kaleb (penguinunreal) 8 85.57 90.64 3 37.50
20359. black google (peeperin) 8 83.94 105.64 3 37.50
20360. paul (peazie) 8 114.22 122.24 5 62.50
20361. lit (paul615) 8 57.56 64.58 2 25.00
20362. patembe (patembe) 8 72.29 82.45 4 50.00
20363. Brandon (pastaneko) 8 87.24 95.54 1 12.50
20364. Adem (paramone) 8 89.33 102.20 5 62.50
20365. Paper (paperstache) 8 84.57 89.97 1 12.50
20366. Zephaniah (pandu11) 8 79.01 92.13 5 62.50
20367. Palta (palta_hass05) 8 70.38 79.93 1 12.50
20368. Andy (paingle) 8 93.73 104.79 3 37.50
20369. Stelios (paff) 8 103.14 126.46 3 37.50
20370. Speedo (pacmaniac) 8 68.19 76.34 2 25.00
20371. Bill (p0werc0rd0fjustice) 8 83.21 97.00 2 25.00
20372. Barbo (o_mon) 8 117.98 132.50 4 50.00
20373. Ozark (ozarkian) 8 117.78 137.75 7 87.50
20374. Chelsea (oxfordkarma) 8 74.69 84.46 4 50.00
20375. Rick (outrunwolf) 8 82.47 86.41 0 0.00
20376. ONRAGE (onrage) 8 94.12 103.51 2 25.00
20377. onel (onel11) 8 76.54 88.84 2 25.00
20378. omajez (omajez) 8 71.84 86.98 5 62.50
20379. 𝖔𝖑𝖎𝖜𝖆𝖗... 8 121.79 139.65 6 75.00
20380. Okhelloandhi (okhelloandhi) 8 61.96 73.06 2 25.00
20381. rai (ohrai) 8 103.51 128.91 8 100.00
20382. ohad (ohad8353) 8 64.12 82.33 3 37.50
20383. OG3G (og3g) 8 76.12 91.46 0 0.00
20384. Sophia (officialsophiagarman) 8 69.50 72.49 2 25.00
20385. sul (ofb_hunted) 8 42.46 46.61 0 0.00
20386. Arshad (o0arshad0o) 8 46.25 50.76 0 0.00
20387. Kucing (nyandesuyo) 8 56.43 67.79 1 12.50
20388. Hugo (nuvions) 8 54.78 61.70 0 0.00
20389. NukeADS (nukeads101) 8 26.06 31.23 0 0.00
20390. Shanks (nuggetxd) 8 102.13 118.68 4 50.00
20391. Noz (nozz) 8 119.78 132.19 7 87.50
20392. nousmh (nousmh) 8 91.76 106.29 3 37.50
20393. namie (notyournamie) 8 57.99 64.04 1 12.50
20394. SchizoKami (notaniki) 8 74.90 80.70 2 25.00
20395. Jorden (nostera) 8 65.59 71.12 1 12.50
20396. Henry (noodles10) 8 77.28 90.74 2 25.00
20397. Noah (noahboa1234) 8 71.99 82.40 2 25.00
20398. Nneeku (nneeku) 8 80.86 95.55 2 25.00
20399. b1shop (nnebsi) 8 67.13 80.40 1 12.50
20400. nitro (nitrocircus) 8 62.39 71.19 2 25.00
20401. H (nin9zer0) 8 55.73 63.56 1 12.50
20402. Viktor (niktor76) 8 45.31 53.59 1 12.50
20403. Niko (nikolearnstotype) 8 102.22 123.40 4 50.00
20404. Late (nikolaholmes) 8 77.44 88.48 1 12.50
20405. nikita (nikitapelagecha) 8 74.45 87.92 4 50.00
20406. Niheee (niheee) 8 91.01 108.38 8 100.00
20407. ♛ Nick... 8 103.98 118.18 3 37.50
20408. Phuc (nhphucqt) 8 60.94 67.42 2 25.00
20409. Nerret (nerr3t) 8 58.50 67.27 4 50.00
20410. NeoX (neoxbit) 8 72.43 84.81 0 0.00
20411. Rowan (neonowlbar) 8 60.54 66.98 2 25.00
20412. Bendegúz (negyzetracs) 8 40.87 50.07 1 12.50
20413. Adam (nefrepitou) 8 71.21 80.53 6 75.00
20414. Cin_min (needs_alife) 8 74.40 81.97 1 12.50
20415. Hoo (navvvz) 8 82.88 100.38 2 25.00
20416. nathan (nathanfrenzel) 8 104.14 123.72 5 62.50
20417. Matheus (narrogai) 8 57.81 65.51 4 50.00
20418. Narix (narix) 8 88.50 98.33 4 50.00
20419. nailfc (nailfc) 8 75.86 80.54 3 37.50
20420. Nadia (nadiapun) 8 46.78 57.72 1 12.50
20421. Nacho (nachofry) 8 113.98 127.86 4 50.00
20422. Vuh (n00bmaster_69_) 8 61.24 66.70 0 0.00
20423. Kevin (mystified) 8 92.27 106.94 3 37.50
20424. draven (mutable) 8 111.26 127.88 4 50.00
20425. Jasmine (mustardsucks) 8 113.63 140.10 4 50.00
20426. mushi (musfiq) 8 61.40 68.23 1 12.50
20427. Leo (murkymurky) 8 83.85 89.13 3 37.50
20428. Munta (munta) 8 59.55 73.23 2 25.00
20429. Mukhamejan (mukhamejan) 8 48.86 54.17 1 12.50
20430. Marios (mr_kk13) 8 61.83 70.13 4 50.00
20431. Iboo (mriboo) 8 90.64 104.50 2 25.00
20432. Cayke (mrcayke) 8 89.71 99.22 1 12.50
20433. Bara (mrbobby) 8 104.67 125.01 3 37.50
20434. Extreme Bass Tester (mrbass... 8 96.44 110.99 5 62.50
20435. Trevor (mouspe) 8 68.83 83.37 2 25.00
20436. Ike (mouseandkeyboard) 8 97.81 104.87 2 25.00
20437. Motan (motanrobert) 8 52.07 63.52 1 12.50
20438. Mostafa (mostafadelgouda) 8 60.16 69.22 4 50.00
20439. K (mosspath16) 8 97.13 111.19 6 75.00
20440. Koneko (moon_l1ght) 8 65.20 73.77 2 25.00
20441. Petr (monsterkick123) 8 70.18 78.54 2 25.00
20442. Dan (monkyman12) 8 76.73 88.56 2 25.00
20443. Moogii (mongoljan) 8 70.27 72.70 0 0.00
20444. Shiyue (molllllllly) 8 54.78 62.52 2 25.00
20445. Nikita (mohwai) 8 73.12 86.14 2 25.00
20446. محمد (mohammed_mourad) 8 36.03 43.63 0 0.00
20447. Foxes (moazkhaled) 8 51.78 54.48 1 12.50
20448. Mo (moahmed0987) 8 65.36 77.42 8 100.00
20449. Brandon (mo0nfire) 8 69.18 80.56 0 0.00
20450. Matthew (mmcjoynt) 8 84.86 99.79 4 50.00
20451. Miro7543 (miro7543) 8 47.54 56.35 1 12.50
20452. Mindjolt (mindjolt) 8 93.39 105.49 2 25.00
20453. Mik (miks1) 8 92.30 111.71 3 37.50
20454. Mike (mikethompsontech) 8 98.59 106.99 4 50.00
20455. at my own pace (mijacim) 8 129.22 153.46 5 62.50
20456. Midas Gold (midasgold) 8 99.73 131.65 5 62.50
20457. Michael (michaelskyba) 8 135.44 149.16 3 37.50
20458. Michael (michaelshahin2) 8 124.34 159.15 5 62.50
20459. fynn (metallicbow) 8 65.20 73.53 2 25.00
20460. Stanislaw (mestreponas) 8 93.89 100.08 1 12.50
20461. Meppou (meppou) 8 82.55 96.10 3 37.50
20462. Mendyng (mendyng) 8 73.52 85.40 3 37.50
20463. A (melori) 8 49.47 62.82 1 12.50
20464. Melvin (mellikyun) 8 89.72 100.67 1 12.50
20465. mason (meezusxd) 8 82.14 92.61 2 25.00
20466. Subahan (mdsubahan) 8 28.89 33.99 2 25.00
20467. uwu (mdby_enn) 8 68.49 76.33 1 12.50
20468. jumpingjilligan (maxy97322) 8 80.81 101.56 4 50.00
20469. Max (maxstacks) 8 43.02 48.25 2 25.00
20470. Max (maxlau09) 8 100.16 104.42 5 62.50
20471. Mathias (mathi2912) 8 93.20 102.10 3 37.50
20472. mathan (mathanha) 8 111.81 133.04 6 75.00
20473. Marco (marquouo) 8 63.36 69.56 2 25.00
20474. Cream (marom) 8 63.83 78.03 4 50.00
20475. Tiffany (mangles) 8 82.40 94.09 1 12.50
20476. Josue (mangalarge) 8 56.75 73.75 1 12.50
20477. Mohammed (manchi) 8 47.98 53.35 0 0.00
20478. Maxim (malincik) 8 66.70 74.99 5 62.50
20479. Mikhail (maklaya) 8 105.23 117.24 6 75.00
20480. marvin (magnimarve) 8 125.98 147.93 3 37.50
20481. maestro (maestro2048) 8 62.29 69.90 3 37.50
20482. Hina (lyraxh) 8 80.48 92.54 2 25.00
20483. LULU (luluthecow) 8 101.55 119.44 5 62.50
20484. Luke (lukejr0123) 8 61.73 70.77 3 37.50
20485. Luisovc1812 (luisovc1812) 8 59.57 70.10 0 0.00
20486. Luin (luingear) 8 66.64 78.72 1 12.50
20487. Jacob (lugia1572) 8 65.90 72.20 1 12.50
20488. Tachanka (lordtachankatm) 8 102.66 112.19 5 62.50
20489. Guest (lolteamtroll) 8 59.76 70.84 4 50.00
20490. Lachlan (lochstar) 8 51.42 57.58 2 25.00
20491. ellyboycott (localhinatakin... 8 105.16 120.81 4 50.00
20492. liu (liuluil) 8 105.15 114.58 6 75.00
20493. Andrew (littlefleece) 8 108.81 120.14 8 100.00
20494. Litevex (litevvx) 8 133.00 150.02 5 62.50
20495. nic (limpehordlo) 8 98.97 110.58 3 37.50
20496. limdaepicpber (limdaepicpber) 8 59.56 67.50 4 50.00
20497. Erdnaxela (lil_toogood) 8 52.34 62.00 2 25.00
20498. LilTexan (lil_texan) 8 79.07 85.81 3 37.50
20499. Cameron (lilcamwin) 8 46.69 54.35 0 0.00
20500. Liko (likofortino) 8 62.75 75.78 5 62.50
20501. Sam An (liasss) 8 47.43 53.44 0 0.00
20502. Fabian (lgtrushzhm) 8 113.78 130.38 4 50.00
20503. Le' (letyper_) 8 72.68 84.41 2 25.00
20504. NIcola (lenh) 8 84.27 92.20 2 25.00
20505. Itsbuddy⌨ (legendarybeast... 8 35.70 45.72 1 12.50
20506. Lefos (lefos357) 8 44.79 49.90 1 12.50
20507. Dvorak (learningdvorak101) 8 67.47 72.03 2 25.00
20508. Laz (lazzo) 8 71.21 79.05 1 12.50
20509. randint (lawlombie) 8 92.18 103.20 4 50.00
20510. nina (lavendee) 8 94.14 98.09 3 37.50
20511. Laurence (laurencee_desu) 8 80.52 89.34 1 12.50
20512. Jackie (laserelite) 8 115.51 126.20 6 75.00
20513. laobiz (laobiz) 8 88.38 103.29 5 62.50
20514. La (lanumu) 8 78.62 97.21 4 50.00
20515. Malcolm (lampshadess) 8 82.13 91.82 4 50.00
20516. Slow Typist (lammian) 8 98.54 105.07 1 12.50
20517. IckyPixel (kyoneoran) 8 70.18 88.59 4 50.00
20518. Pro (kvis) 8 55.97 60.53 1 12.50
20519. KJ (kushagra_j) 8 55.64 73.52 1 12.50
20520. Kurt (kurtv13) 8 80.49 87.66 1 12.50
20521. kati (ktiisler) 8 52.41 59.32 3 37.50
20522. Rohit (krullun) 8 59.45 64.83 0 0.00
20523. kristjon (kristjon) 8 77.13 81.04 0 0.00
20524. idkhi (krisstesink) 8 74.61 83.99 8 100.00
20525. Krishan Pal (kris987) 8 47.06 52.15 1 12.50
20526. Sandpiper (krafty) 8 113.35 130.01 6 75.00
20527. котакбассик (kot... 8 99.44 113.18 8 100.00
20528. klima7 (klima7) 8 82.65 91.23 1 12.50
20529. Jon (kixoidiot) 8 49.41 59.15 1 12.50
20530. kingcabrams (kingcabrams) 8 103.60 106.82 2 25.00
20531. kimi (kimboli) 8 86.78 116.64 7 87.50
20532. kie (kieret25) 8 95.57 108.13 4 50.00
20533. Christian (kickstyping4thewin) 8 80.33 89.03 3 37.50
20534. khye (khyelerk) 8 100.82 129.55 3 37.50
20535. khem (khemsadon) 8 69.52 76.49 3 37.50
20536. khadie (khadiekun) 8 77.81 90.53 4 50.00
20537. Khabibkhanov (khabibkhanov) 8 43.93 48.86 1 12.50
20538. Kushagra (kgtypes) 8 72.93 84.36 2 25.00
20539. kev2k (kev2k) 8 92.99 110.05 4 50.00
20540. Kenny (kenjeo) 8 103.30 116.46 3 37.50
20541. Keigo (keigo_yoshiura) 8 73.16 81.53 2 25.00
20542. KC (kc2002) 8 95.29 107.30 2 25.00
20543. Katie (katielemaster) 8 79.54 96.49 2 25.00
20544. Katie (kat41911) 8 106.23 117.39 7 87.50
20545. 🍁 (kaspars) 8 105.85 120.86 4 50.00
20546. ryan jason (kapsutka) 8 45.12 53.59 0 0.00
20547. Jonathan (kamikazecupcake) 8 99.70 111.58 4 50.00
20548. kalvin (kalvin2171) 8 40.33 54.57 0 0.00
20549. Daniel (kald3s) 8 93.66 109.88 5 62.50
20550. holymoly (kajohnny) 8 104.91 112.68 5 62.50
20551. abdul (kaium55) 8 49.53 71.85 1 12.50
20552. Kaijou (kaijou) 8 72.01 87.79 6 75.00
20553. skrtskrt (kad832000) 8 103.08 116.94 6 75.00
20554. khai (kaariee) 8 82.20 97.57 4 50.00
20555. Jayshil (just_chillll) 8 49.21 54.26 1 12.50
20556. Jurre (jurrevonk) 8 101.42 131.85 6 75.00
20557. Josh (jshearer34) 8 62.72 72.81 1 12.50
20558. Jorge (jquiroz728) 8 78.19 89.73 2 25.00
20559. jpow (jpowwow) 8 82.73 97.24 3 37.50
20560. Jacob (jpoopy) 8 100.41 108.05 4 50.00
20561. Jimmy (jphan98) 8 104.69 120.40 2 25.00
20562. sakuraphael (joseraphael) 8 67.21 85.28 2 25.00
20563. Jorunn (jorunn) 8 109.60 115.92 5 62.50
20564. JJ (joojoob1004) 8 104.57 121.30 4 50.00
20565. victor (jontakenols) 8 69.52 89.51 0 0.00
20566. jonathanirvings (jonathanir... 8 104.49 124.52 2 25.00
20567. Gjon (johnmanga) 8 78.52 84.30 1 12.50
20568. J0hn (johnjonez23) 8 100.21 107.31 2 25.00
20569. Jomama (johanwashere) 8 110.66 123.18 4 50.00
20570. Johannes (jogameshd) 8 82.26 97.47 2 25.00
20571. Joesph (joecool3) 8 62.89 74.02 1 12.50
20572. Jake (jmp2814) 8 77.82 87.63 1 12.50
20573. jf (jkkl) 8 102.15 122.61 4 50.00
20574. jawad (jiqlsh) 8 50.46 58.64 1 12.50
20575. jip (jipgg) 8 37.05 42.94 0 0.00
20576. Azriel (jing_long) 8 47.65 54.03 1 12.50
20577. guan (jgbiggy96) 8 88.71 98.10 2 25.00
20578. Joe (jfratello) 8 82.21 100.09 3 37.50
20579. Yulia (jewels04) 8 36.17 39.76 0 0.00
20580. Jerry (jernjej) 8 82.36 91.01 3 37.50
20581. Jedwidz (jedwidz) 8 101.81 113.07 4 50.00
20582. Jayden (jay62) 8 85.14 101.12 5 62.50
20583. Jason (jasonledrika) 8 102.50 119.94 4 50.00
20584. Andrew (jargazes) 8 108.56 115.49 5 62.50
20585. JJ (japie4life) 8 106.05 124.82 5 62.50
20586. James (jamvng) 8 127.42 137.77 3 37.50
20587. J (jakobam) 8 132.40 144.90 6 75.00
20588. JackSparrow (jack__sparrow) 8 66.62 74.43 0 0.00
20589. Jack (jacktypeman) 8 68.00 79.52 4 50.00
20590. Jack (jackthehuman) 8 88.73 92.75 4 50.00
20591. EddyEndo (jackpoteddie) 8 56.04 63.51 1 12.50
20592. jackn11 (jackn11) 8 94.30 103.88 2 25.00
20593. Sonny (j3dmosly) 8 90.09 94.74 1 12.50
20594. Jeff (i_bad) 8 40.31 47.83 0 0.00
20595. Elizabeth (i_am_piece_of_tr... 8 54.52 62.50 2 25.00
20596. iwannabebee (iwannabebee) 8 16.65 21.56 1 12.50
20597. honey (ivan_avr) 8 90.03 103.01 4 50.00
20598. BadAtTyping (itzsecretive) 8 83.28 91.09 2 25.00
20599. Khushal (its_warhead) 8 52.79 59.54 1 12.50
20600. forg (itsmetimwastaken) 8 114.75 129.57 5 62.50
20601. Average (isuckattypoing) 8 64.88 69.93 5 62.50
20602. Tobias (iseeicetea) 8 44.35 54.29 0 0.00
20603. Incognito (im_incognito) 8 83.29 92.95 2 25.00
20604. David (imdaveed) 8 51.57 59.76 1 12.50
20605. ilyassq (illiazo) 8 60.13 71.24 2 25.00
20606. Illayne (illayne) 8 71.47 89.95 0 0.00
20607. Zudio (ildosrel) 8 83.08 90.09 3 37.50
20608. Kennie (ikentalk) 8 50.91 59.56 3 37.50
20609. Shut (ihavekillaura) 8 113.45 123.58 6 75.00
20610. oshan (ice_cold) 8 73.99 83.66 1 12.50
20611. glizzy (icecreamgoblin) 8 99.05 121.51 7 87.50
20612. Ibrokhimjon (ibrokhimjon23) 8 30.67 35.55 2 25.00
20613. Ivan (iamiam) 8 78.83 84.94 0 0.00
20614. Daniel (hylianwarrior) 8 111.50 142.52 8 100.00
20615. Hydrix (hydrix03) 8 71.03 79.63 2 25.00
20616. Khanh Hung (hungnkuon) 8 86.45 96.57 2 25.00
20617. Teddy (hulksgreenass) 8 109.47 117.17 6 75.00
20618. Hermogenes (hrivas) 8 41.88 52.28 0 0.00
20619. chubby (hoocub) 8 36.55 45.60 1 12.50
20620. Rionil (holyshock) 8 104.38 134.83 5 62.50
20621. HoldShift (holdshift) 8 69.46 80.32 1 12.50
20622. AAAAAAAAAAAAAAAAAAAAAAAAAAA... 8 84.50 92.14 4 50.00
20623. AZNDAD (hmoth84) 8 94.32 104.22 0 0.00
20624. Hjalte (hjaltebuch) 8 89.97 107.50 4 50.00
20625. Hit360D (hit360d) 8 57.45 73.98 5 62.50
20626. Mari (hisokaslave) 8 78.64 96.98 0 0.00
20627. Anshul (hindu_123) 8 84.18 92.18 4 50.00
20628. henry 🎩 (henzolo) 8 104.03 110.87 3 37.50
20629. Heaven (heavenx) 8 74.17 82.09 4 50.00
20630. Lan (heatblaze) 8 93.44 103.61 3 37.50
20631. Haven (havenjd) 8 85.82 98.84 4 50.00
20632. Mufassir (hashtag_pro) 8 63.32 72.68 0 0.00
20633. Roy (harlos9090) 8 66.17 72.42 2 25.00
20634. coc (han_duo) 8 92.08 111.52 3 37.50
20635. 2Lenne (hannaloresa) 8 67.63 75.08 3 37.50
20636. HamsterSales (hamstersales) 8 75.01 88.02 2 25.00
20637. Khai (haikhaiphan) 8 70.14 79.99 2 25.00
20638. han (hahhan) 8 23.36 26.23 1 12.50
20639. Hashmia (haaashmiah) 8 56.10 67.50 3 37.50
20640. Nicolas (ha27) 8 80.02 84.55 4 50.00
20641. Yifan (gyyy1995) 8 70.98 80.34 3 37.50
20642. :Talpiie (gwaporosh) 8 73.41 87.51 3 37.50
20643. Gusklipsch (gusklipsch) 8 54.41 58.33 0 0.00
20644. gurzil (gurzil) 8 63.15 72.90 0 0.00
20645. Dan (gunpowdergolem) 8 95.64 103.75 7 87.50
20646. gunga (gungafarts) 8 79.98 87.75 1 12.50
20647. guy (guius) 8 80.56 85.80 4 50.00
20648. La (guinea_peeg_1234) 8 93.10 99.65 1 12.50
20649. guid (guid07) 8 74.73 95.01 5 62.50
20650. grantgoosten (grantgoosten22) 8 82.60 93.78 2 25.00
20651. Marko (gragole) 8 94.68 104.44 1 12.50
20652. grac (gracthegrac) 8 63.00 77.21 4 50.00
20653. Yellow (gracet_b) 8 49.50 57.33 1 12.50
20654. Eddie (goombah1) 8 107.83 112.88 4 50.00
20655. dheeraj (goldsnort) 8 68.63 75.03 4 50.00
20656. Leloush (goal9871231st) 8 36.01 41.57 2 25.00
20657. glip (glip014) 8 91.73 102.52 3 37.50
20658. Jack (ginganinjajack) 8 115.15 120.57 4 50.00
20659. Connor Gil (gillionayre) 8 57.35 64.39 2 25.00
20660. Giich (giich) 8 88.95 96.60 2 25.00
20661. Judah (ghostboyjude) 8 48.85 56.79 1 12.50
20662. Bonne (ggraznpv) 8 28.30 30.09 1 12.50
20663. Jaden (ggjaden) 8 75.01 88.57 1 12.50
20664. Geo (geojumper) 8 67.12 72.43 2 25.00
20665. Ray (gelastical) 8 85.37 95.68 2 25.00
20666. Artemida (gayswordfish) 8 87.80 104.77 3 37.50
20667. Gareth (gathlic) 8 57.85 66.68 4 50.00
20668. Garfield (garfield_fluff_jr) 8 78.18 83.92 1 12.50
20669. gamer (gamer_2002) 8 31.91 37.37 0 0.00
20670. Gabryel John (gabryeljison) 8 67.81 81.97 4 50.00
20671. Kevin (fvnction) 8 73.47 89.17 2 25.00
20672. Poop_57 (fuzzydestroyer) 8 55.25 72.68 2 25.00
20673. fuzzed (fuzionite) 8 91.35 116.92 5 62.50
20674. Kenneth (furball728) 8 110.01 122.91 3 37.50
20675. Ronald (funnyturtles) 8 54.76 59.50 3 37.50
20676. f (fulmerformal) 8 101.12 109.90 4 50.00
20677. fuadul (fuadul) 8 38.73 42.20 2 25.00
20678. FruityCigar (fruitycigar) 8 60.22 71.49 3 37.50
20679. Frozen_Robot (frozen_robot) 8 80.27 90.84 1 12.50
20680. Determined (frosty_flame) 8 94.62 99.82 2 25.00
20681. Freshanatha (freshanatha) 8 61.92 68.83 4 50.00
20682. Fran (frannyg) 8 46.76 60.90 1 12.50
20683. rose (fr0gspawnn) 8 108.87 115.68 2 25.00
20684. Fowwer (fowwer) 8 78.34 96.78 2 25.00
20685. Foofmeister (foofmeister) 8 117.45 137.42 3 37.50
20686. Cole (fluke1890) 8 80.68 89.23 1 12.50
20687. flora (flora1111) 8 123.70 144.91 6 75.00
20688. Elvis (flareblu_workman) 8 67.40 81.95 3 37.50
20689. bigdad (fillmeupdaddy) 8 81.90 89.99 2 25.00
20690. El Psy Kongroo (fiive_starboy) 8 67.42 91.53 3 37.50
20691. fffd (fffd) 8 82.89 98.33 5 62.50
20692. Ferris (ferrisprimanugraha) 8 88.49 94.87 4 50.00
20693. Fernando (fedevegili) 8 102.17 115.14 5 62.50
20694. Feakl (feakl) 8 41.73 51.64 1 12.50
20695. Diego (faustian_nero) 8 55.09 61.86 0 0.00
20696. FastTypist448 (fast_typist448) 8 57.00 67.21 2 25.00
20697. Aminul (fardin1bd) 8 55.85 63.03 0 0.00
20698. Austin (fallow64) 8 107.29 124.23 4 50.00
20699. Regent (fagol) 8 74.03 86.91 3 37.50
20700. Danial (fadyboi) 8 87.24 92.22 3 37.50
20701. ChiBai (f0rg0tten) 8 68.55 87.19 1 12.50
20702. Eyal (eyalnir7) 8 58.54 72.15 4 50.00
20703. e (evzh) 8 35.01 42.05 0 0.00
20704. Morgan (evirabbi) 8 100.53 115.46 1 12.50
20705. Sidewalk (euantis) 8 77.05 87.09 3 37.50
20706. Evan (etiger) 8 66.09 77.21 0 0.00
20707. Eternal (eternai) 8 84.47 125.48 3 37.50
20708. Erna (ernasolberg69) 8 80.55 96.66 0 0.00
20709. Erik (eriklvalentin) 8 97.31 111.27 3 37.50
20710. bruh (erik2405_) 8 104.92 115.21 6 75.00
20711. Epsile (epsilian) 8 124.83 149.06 7 87.50
20712. Owen (epic_own_gamer) 8 69.57 78.08 2 25.00
20713. Enamul (enamul) 8 32.31 38.06 2 25.00
20714. Elrohir (elrohirtypo) 8 71.28 78.21 0 0.00
20715. ellowell (ellowell) 8 125.79 150.31 4 50.00
20716. Elius H Himel (eliushhimel) 8 45.91 52.79 0 0.00
20717. Adridri (eidorian) 8 83.07 133.33 4 50.00
20718. Eric (ehshark) 8 108.49 120.03 5 62.50
20719. mrspaghettimeatballs (ehreg... 8 84.00 91.23 2 25.00
20720. Snowbear (ehj1258) 8 90.27 103.86 3 37.50
20721. edward (edwardkarra) 8 47.70 66.00 5 62.50
20722. Ed (ed2005) 8 65.40 74.19 2 25.00
20723. Fee (dylanfee) 8 127.42 137.84 5 62.50
20724. Isa (dxnamic_) 8 70.23 78.77 1 12.50
20725. areyouagirloraguymonkey (dw... 8 151.90 166.24 8 100.00
20726. gale (dwah) 8 86.69 103.85 3 37.50
20727. AAA (duraszess) 8 91.18 99.15 5 62.50
20728. Tung (dungtang) 8 112.38 130.06 3 37.50
20729. 🌷 (dumplinling) 8 52.61 59.24 0 0.00
20730. teethmc (dudeboi63589) 8 85.49 110.97 3 37.50
20731. Per (dubgeiser) 8 81.20 84.91 1 12.50
20732. Sasha (dtelesman1) 8 75.24 86.18 1 12.50
20733. Kristof (driftydifty) 8 53.70 56.53 2 25.00
20734. droo (drew215) 8 112.11 128.22 5 62.50
20735. Dregni (dregni) 8 61.25 66.52 1 12.50
20736. Khondokar (draenor06) 8 70.84 90.06 4 50.00
20737. Manan (dpmanan) 8 57.64 64.80 2 25.00
20738. Kris (doubleace5747) 8 98.16 104.21 3 37.50
20739. 1337 (dotnet) 8 74.91 83.01 3 37.50
20740. Aang (dorjeaang) 8 62.01 71.21 1 12.50
20741. Doodle (doodle_doot) 8 67.83 79.27 4 50.00
20742. sam_sep10l (don_simon) 8 69.26 80.62 1 12.50
20743. Donzelle (donnie12) 8 78.42 85.42 0 0.00
20744. Danish (donish) 8 61.59 65.09 3 37.50
20745. dongster (dongster) 8 96.34 121.51 1 12.50
20746. Dominik (domynig) 8 65.35 79.25 3 37.50
20747. ziomek (dombrol) 8 77.35 88.43 1 12.50
20748. Doctorgreenyou (doctorgreen... 8 88.72 102.66 5 62.50
20749. Daniel (dkincorperated) 8 52.06 61.59 2 25.00
20750. djole (djole) 8 60.26 64.04 2 25.00
20751. Dylan (dillyv) 8 86.07 93.84 3 37.50
20752. Nick (diggle) 8 121.25 146.89 6 75.00
20753. DaRealZubyy (dexisnothome) 8 37.08 48.48 2 25.00
20754. Mart (devli) 8 18.16 19.86 0 0.00
20755. Detha (detha_) 8 63.36 70.97 2 25.00
20756. Neil Adrian (destroyer_46) 8 109.75 119.03 4 50.00
20757. Desmond (desmondspeedy) 8 90.94 107.19 6 75.00
20758. twitch.tv/YasuoNA (denigratez) 8 98.26 110.61 3 37.50
20759. Jack (delysid) 8 100.80 119.46 3 37.50
20760. DeltaDraco (delta_draco) 8 100.90 108.01 3 37.50
20761. Dan (deltaenergy) 8 73.21 78.37 0 0.00
20762. sugi (dea_agent) 8 106.95 119.70 5 62.50
20763. Jeaffffffffffffff (deadvull) 8 66.81 78.62 0 0.00
20764. David (davylern) 8 104.12 114.36 5 62.50
20765. Davin (davinnnnn) 8 78.01 86.51 0 0.00
20766. David (davidm_2020) 8 125.02 138.03 4 50.00
20767. Brian (dataslayer) 8 107.03 122.57 5 62.50
20768. Darkplayer3 (darkplayer3) 8 89.02 97.34 5 62.50
20769. Revolt (darkestrevolt) 8 85.25 92.99 3 37.50
20770. Darapsas (darapsas) 8 84.48 97.03 5 62.50
20771. TIN (daons) 8 85.51 88.53 2 25.00
20772. Daniel (danyu1) 8 86.18 96.88 2 25.00
20773. Jack (dante17) 8 75.08 82.12 1 12.50
20774. danny (dannyvokje) 8 86.14 96.59 3 37.50
20775. Daniel (danielstebbins) 8 68.17 74.75 3 37.50
20776. Russell (dalenu) 8 120.94 138.45 3 37.50
20777. da (dahanci) 8 118.37 127.75 7 87.50
20778. BathTime (daddysbathtime) 8 58.49 71.26 1 12.50
20779. ab (dabglob) 8 99.85 110.67 3 37.50
20780. D3LTA (d3lta) 8 98.10 101.28 4 50.00
20781. G (cyutie__g) 8 91.37 107.47 8 100.00
20782. Cyan (cyan_cloud) 8 66.67 78.62 3 37.50
20783. cyan (cyanaspect) 8 91.08 97.99 2 25.00
20784. Colin (cwreath43) 8 89.69 102.53 3 37.50
20785. curtythurty (curtythurty) 8 45.09 51.56 1 12.50
20786. cursedgandhi (cursedgandhi) 8 93.03 100.32 4 50.00
20787. ravi (culdesaccer) 8 60.51 80.93 1 12.50
20788. Andrew (cuetime) 8 39.88 43.97 1 12.50
20789. cse_kyle (cse_kyle) 8 71.73 85.69 2 25.00
20790. Hoppy (crunchydog) 8 70.91 77.43 1 12.50
20791. Dran (creyon) 8 74.28 78.86 1 12.50
20792. Campbell (cphalen) 8 97.28 120.36 2 25.00
20793. rashawn (corthas) 8 103.14 121.98 3 37.50
20794. Corey (corrreyjay) 8 123.72 147.82 7 87.50
20795. Rainnier (corrby) 8 108.82 166.75 5 62.50
20796. Timothy (cornmono) 8 83.79 95.40 1 12.50
20797. Lorenzo (cool_and_good) 8 62.52 67.34 1 12.50
20798. Helena (coolister3) 8 102.27 119.77 6 75.00
20799. Emmet (contrambulance) 8 92.12 106.25 1 12.50
20800. Alice (communistbean) 8 71.48 84.65 4 50.00
20801. Cole (cole_denson) 8 84.80 90.34 5 62.50
20802. Colemak User (colemak_behbear) 8 92.31 111.37 3 37.50
20803. wEN (coldblacktea) 8 83.53 95.00 3 37.50
20804. ここ (coco_jumbo) 8 72.76 80.08 6 75.00
20805. Coalpi (coalpi) 8 79.82 94.02 3 37.50
20806. CMcK (cmck) 8 89.17 94.95 3 37.50
20807. Clever (cleverdom) 8 61.59 65.90 0 0.00
20808. Clare (clareb31) 8 77.00 89.86 3 37.50
20809. Charles (ckypros) 8 74.46 87.07 4 50.00
20810. Christina (cjkoikara) 8 64.05 66.55 0 0.00
20811. Simon (ciscomalware) 8 67.71 76.06 6 75.00
20812. Bryjeen (chronoalpha) 8 85.35 92.98 4 50.00
20813. ma3ke (chromoplast) 8 84.88 94.54 0 0.00
20814. Chong Shan (chong_shan) 8 69.12 77.89 1 12.50
20815. Oluwatomi (chidori21) 8 42.56 51.56 0 0.00
20816. Calvin (cheekuan321) 8 100.67 121.60 5 62.50
20817. Chayse (chaysegr) 8 90.56 100.62 3 37.50
20818. SpongeBob (cerealkila) 8 67.94 76.72 1 12.50
20819. Athos (cdelafere) 8 74.93 83.14 1 12.50
20820. Jam (cayajam) 8 72.80 86.99 1 12.50
20821. s (caustlc) 8 96.47 110.54 5 62.50
20822. Alex (carrot_ironfoundersson) 8 54.17 59.41 1 12.50
20823. Rystian (cap_redhawk) 8 58.61 65.51 2 25.00
20824. Captain2 (captain_) 8 58.35 66.17 8 100.00
20825. s. (capslooock) 8 91.53 106.68 4 50.00
20826. Cam (camtain) 8 52.29 63.81 2 25.00
20827. Cade (cadelanktree) 8 74.41 94.52 4 50.00
20828. Cache (cachemonet) 8 87.58 95.61 2 25.00
20829. b (b_rabbit019) 8 58.34 71.40 0 0.00
20830. buzz (buzzdale2) 8 80.62 88.17 2 25.00
20831. punk (bulatefishballs) 8 92.53 103.35 2 25.00
20832. Bubbles (bubbles81833) 8 124.80 145.87 6 75.00
20833. Brian (btgrant76) 8 69.31 87.74 3 37.50
20834. AJ (bsptc) 8 105.46 117.64 5 62.50
20835. Brett (brettshaw) 8 85.44 112.11 2 25.00
20836. Brenden (brenden_2021) 8 57.76 68.21 2 25.00
20837. Myth (brendanlai1999) 8 61.19 71.81 2 25.00
20838. Brecken (breck1234) 8 95.91 117.44 3 37.50
20839. boxxibis (boxxibis) 8 102.70 122.70 3 37.50
20840. Bovinova (bovinovain) 8 72.08 82.86 3 37.50
20841. Adhitya (borakx007) 8 90.31 95.59 4 50.00
20842. Alias (boinkus) 8 124.05 145.98 6 75.00
20843. boby (bobybomby) 8 59.97 77.34 3 37.50
20844. Bob (bobanton02) 8 113.36 129.87 4 50.00
20845. Minleg (bminleg) 8 67.03 77.46 2 25.00
20846. Billy (blipdip) 8 59.92 71.11 3 37.50
20847. blitter (blitter56) 8 60.69 72.16 2 25.00
20848. Joshua (blink180dude) 8 81.14 95.14 1 12.50
20849. camille (bleuish) 8 94.77 106.19 5 62.50
20850. Black (blacksiderino) 8 91.79 100.97 3 37.50
20851. Sean (blackandwhitemuppet) 8 142.09 155.35 5 62.50
20852. Christian (bl0btypes) 8 82.78 98.86 1 12.50
20853. bitter (bitternightmares100) 8 100.55 112.57 4 50.00
20854. Bertil (bingobertil) 8 98.53 109.60 3 37.50
20855. Mack (bigmack10) 8 82.25 91.73 1 12.50
20856. bigburd (bigburd) 8 99.23 104.96 4 50.00
20857. Marshall (bigboycold) 8 78.50 88.30 3 37.50
20858. BIdi (bidi) 8 100.67 109.33 4 50.00
20859. Bibek (bibek77) 8 42.56 49.39 0 0.00
20860. Bheta (bheta) 8 122.97 149.14 5 62.50
20861. bhavya (bhav_) 8 50.74 58.27 4 50.00
20862. Kevin (besnier) 8 82.20 87.44 2 25.00
20863. Azerty 0w0 (benz_) 8 94.23 100.95 3 37.50
20864. ben (benlee27) 8 56.79 68.79 3 37.50
20865. Ben (bencyi) 8 122.27 151.75 6 75.00
20866. bench (bench0) 8 101.75 114.50 1 12.50
20867. Bempe (bempe) 8 96.72 106.03 3 37.50
20868. Bektur (bektur8888) 8 31.82 37.47 3 37.50
20869. Tristan (beckonez) 8 92.26 101.51 3 37.50
20870. Elizabeth (bebecam) 8 115.28 129.70 6 75.00
20871. beastboy (beastboy1787) 8 57.09 68.76 0 0.00
20872. batwayne1 (batwayne1) 8 71.57 79.54 4 50.00
20873. Bartacus (bartacus) 8 72.37 79.63 3 37.50
20874. Joseph (barcaftw05) 8 102.33 110.19 6 75.00
20875. Balint (balint2004) 8 79.69 92.34 2 25.00
20876. Bagel (baegirl) 8 122.87 131.75 3 37.50
20877. Baby (baby3am) 8 49.74 62.94 1 12.50
20878. Felix (babford) 8 69.74 73.92 1 12.50
20879. xtian (babbageclunk) 8 48.48 54.31 1 12.50
20880. Zheng Hao (a_random_slow_ty... 8 49.48 61.31 1 12.50
20881. Anubhav (a_a_pandey) 8 52.24 64.04 2 25.00
20882. Ayush (ayushnanda14) 8 82.31 88.96 2 25.00
20883. ayumiii (ayumiii) 8 55.07 70.19 1 12.50
20884. A (axeborn) 8 48.98 56.06 0 0.00
20885. awesomedude1440 (awesomedud... 8 85.04 116.53 5 62.50
20886. Avi (avi_130) 8 95.43 119.89 4 50.00
20887. AvD (avd3369) 8 58.57 67.07 1 12.50
20888. Vladimir (av1ty) 8 69.09 77.19 2 25.00
20889. Austin (austinwc) 8 82.49 97.10 0 0.00
20890. Daniel (aussiegrillgamr) 8 65.06 71.39 2 25.00
20891. Aureus (aureuswastaken) 8 113.08 130.32 5 62.50
20892. Ambrose (astrealix) 8 95.57 105.18 3 37.50
20893. Jason (ason6678) 8 56.29 65.87 6 75.00
20894. Shahariar (ashikkkkk) 8 71.84 90.08 1 12.50
20895. Asher (asher_xxi) 8 52.33 58.09 0 0.00
20896. arti (artiarti) 8 73.02 79.65 1 12.50
20897. Acwyg (arjung0055) 8 39.21 48.40 0 0.00
20898. apexstrada (apexstrada) 8 91.12 118.51 4 50.00
20899. Anzac (anxan) 8 82.24 91.78 3 37.50
20900. Anush Rao (anushrao) 8 40.21 48.49 0 0.00
20901. Anthony (anthonydsr) 8 75.75 87.91 3 37.50
20902. Aniq (aniq_asd) 8 67.91 73.26 1 12.50
20903. Andrius (andriusius) 8 78.51 87.19 1 12.50
20904. Andrew (andmarek) 8 119.37 129.35 5 62.50
20905. jay (anakanjay) 8 74.74 86.20 0 0.00
20906. Amr (amr_emara) 8 48.03 54.59 0 0.00
20907. Amir (amir_bc) 8 71.21 84.87 2 25.00
20908. Amanda (amandaaaa_) 8 71.47 87.00 0 0.00
20909. Altra (altra) 8 86.54 111.43 6 75.00
20910. Alpha (alpha_atk) 8 72.37 89.76 5 62.50
20911. CaccMann (aloned) 8 109.44 139.12 2 25.00
20912. Almonds (almonds_and_nutella) 8 43.10 51.67 1 12.50
20913. Allen (allen8811) 8 56.40 63.85 2 25.00
20914. Alan (allanafdn) 8 136.62 153.43 3 37.50
20915. Alfian (alfianzv) 8 83.86 112.21 2 25.00
20916. Alex (alexk123) 8 58.41 66.35 0 0.00
20917. Aleksandar (alexg2003) 8 87.84 101.49 2 25.00
20918. Alejandra (alejandrabruh29) 8 31.70 38.65 3 37.50
20919. Osama (aldemeery) 8 72.65 79.15 1 12.50
20920. alan (alanthebest1212) 8 74.03 86.16 5 62.50
20921. Alamgir (alamgirvigu) 8 51.77 61.15 1 12.50
20922. Alvin (al04) 8 114.28 126.08 7 87.50
20923. Aaron (akuch32) 8 63.13 68.59 2 25.00
20924. Jun (akiboard) 8 110.91 129.44 7 87.50
20925. AK (ak24) 8 61.69 72.46 4 50.00
20926. Tryin to make a change :-\ ... 8 115.03 131.62 4 50.00
20927. fdgojasfd (ajaypokharel) 8 39.63 46.76 2 25.00
20928. Romil (aidag) 8 93.12 101.29 3 37.50
20929. DevGuyAhnaf (ahnafzamil) 8 101.23 120.12 8 100.00
20930. Arnel II (agujathis) 8 98.77 110.48 5 62.50
20931. Fretzeldurmf (agent_gametur... 8 102.13 115.30 2 25.00
20932. Ahmad Gamal (agazzaz) 8 62.88 68.58 1 12.50
20933. Advit Upadhyay (advit0708) 8 56.18 60.59 2 25.00
20934. Adora (adorablebanana) 8 131.86 145.81 7 87.50
20935. adithedon (adithedon) 8 32.82 36.11 1 12.50
20936. Adhy (adhy) 8 81.43 94.29 0 0.00
20937. Adfrian (adfrianrais) 8 52.81 56.34 0 0.00
20938. Adam (adamxlofaro) 8 88.14 100.30 3 37.50
20939. Adam (adamisspeed) 8 100.32 133.51 3 37.50
20940. Adaephon (adaephon) 8 111.53 120.41 6 75.00
20941. acewiz (acewiz) 8 94.16 98.14 1 12.50
20942. Raiyantstats[accursed_] (ac... 8 82.94 95.76 1 12.50
20943. Abuela (abuela) 8 65.15 74.33 1 12.50
20944. Alex (abrown516) 8 113.04 125.44 8 100.00
20945. Aarya (aaryatambe) 8 58.15 70.37 0 0.00
20946. Aakash (aakash_rp_621) 8 70.32 75.38 4 50.00
20947. Aaron (aaaronnguyen) 8 83.22 93.86 2 25.00
20948. a3533 (a3533) 8 85.41 93.80 1 12.50
20949. jordan (7jrdn) 8 65.17 73.99 3 37.50
20950. Ren (6cdh) 8 72.40 85.76 1 12.50
20951. K (4pple) 8 60.37 77.79 2 25.00
20952. ariel (44tech_) 8 57.22 66.09 0 0.00
20953. Naresh (303nash) 8 100.22 105.30 3 37.50
20954. Ivan (1v4n) 8 60.07 69.24 3 37.50
20955. Zero (0gundam) 8 145.45 169.58 7 87.50
20956. Giuseppe Bottazzi (051znn) 8 66.35 79.92 1 12.50
20957. emanuel (emumu) 8 78.70 91.68 5 62.50
20958. Olivier (opet) 8 90.39 105.69 2 25.00
20959. Yash (kumar02) 8 48.52 59.68 1 12.50
20960. Bluee (blueegamer) 8 128.86 151.91 8 100.00
20961. D2 (dtsu) 8 94.81 117.98 8 100.00
20962. Pulkit (dinodude17) 8 62.81 80.28 1 12.50
20963. Philo (philophobic) 8 65.79 77.01 3 37.50
20964. Nic (nchlsh) 8 80.19 91.39 0 0.00
20965. Ace (acedawg123) 8 72.33 79.41 1 12.50
20966. peepee (gamerman2000) 8 92.47 100.07 4 50.00
20967. brm (brmstr) 8 75.94 85.33 3 37.50
20968. Lucifer (lucifermorningstar... 8 60.69 66.84 0 0.00
20969. longshot (longshot19) 8 37.22 43.52 0 0.00
20970. Tony (dnacid) 8 66.83 88.31 3 37.50
20971. André (aistcold) 8 89.32 103.73 5 62.50
20972. olivia (oliviadance) 8 56.59 64.54 2 25.00
20973. Sretnik (vedran3) 8 99.26 116.38 4 50.00
20974. Hackyeah (hackyeah) 8 69.19 94.64 3 37.50
20975. Yehonatan (yonac) 8 55.77 63.44 0 0.00
20976. Raven (veintan23) 8 62.19 69.92 2 25.00
20977. Bakhtiyar (baha123) 8 30.89 33.62 0 0.00
20978. Longlegdog (longlegdog) 8 103.84 117.53 5 62.50
20979. Jack (wapow811_official) 8 30.65 35.19 4 50.00
20980. Thanh (ncthanh2000) 8 74.13 85.96 5 62.50
20981. Neeraj (nerdarrow) 8 73.47 87.35 3 37.50
20982. raVen (raven01) 8 74.74 81.53 2 25.00
20983. WishICouldLiveLongerThanMyW... 8 70.29 85.79 4 50.00
20984. Matthew (sharen0904) 8 37.59 42.19 0 0.00
20985. Alex (2abc6) 8 66.85 73.54 3 37.50
20986. SP (spider_swing) 8 46.07 48.94 0 0.00
20987. Jacob (wooperking) 8 85.03 94.18 4 50.00
20988. Space (space_bound) 8 60.57 64.67 0 0.00
20989. Evan (alien_lover) 8 132.32 138.57 5 62.50
20990. Nikkulet (nikkulet) 8 70.63 78.03 3 37.50
20991. William (donwee88) 8 59.77 70.47 3 37.50
20992. Gambit (zereth09) 8 82.48 94.42 3 37.50
20993. Alexis (alunesp15) 8 61.29 68.16 1 12.50
20994. LONESTAR (lone_star) 8 49.51 59.85 2 25.00
20995. jisoo (jisoooleee) 8 90.10 117.73 3 37.50
20996. Sky (skyking1484) 8 59.09 65.67 7 87.50
20997. Thanakrit (mnchtnk) 8 46.08 50.39 1 12.50
20998. Mecin Man (mecin_man3011) 8 51.51 56.88 0 0.00
20999. Alexander (sheeplordz) 8 61.19 67.44 0 0.00
21000. Snowman (snowmanisgood) 8 77.23 84.63 0 0.00
21001. Hriju (hriju) 8 55.10 62.96 3 37.50
21002. OrangeJuicer (arskiir) 8 74.42 86.27 2 25.00
21003. Menace (menace101) 8 102.18 107.11 4 50.00
21004. fida (ferarida) 8 82.20 94.65 7 87.50
21005. Winda (windamrtrn) 8 59.23 69.58 8 100.00
21006. Speky (speky) 8 46.28 55.01 1 12.50
21007. Master (medo2006) 8 77.37 95.17 3 37.50
21008. لركيد (lorchid) 8 68.59 74.81 5 62.50
21009. Andrew (thekirkendall) 8 89.90 101.73 7 87.50
21010. Milos (kaoss14) 8 72.13 86.05 3 37.50
21011. Barfo (barfo) 8 80.00 89.96 2 25.00
21012. Dominic (dominicp97) 8 75.53 81.75 1 12.50
21013. Seth (sandwichseth) 8 62.27 81.15 2 25.00
21014. Mikrit (mickey035) 8 92.40 103.38 1 12.50
21015. Jessica (jessi_p3) 8 74.58 87.33 2 25.00
21016. Anlanther (anlanther) 8 81.59 89.58 4 50.00
21017. Sergio (dallmyt) 8 36.87 48.89 0 0.00
21018. Andrew (andrewawesome04) 8 113.01 132.13 7 87.50
21019. axari (axari) 8 70.78 82.70 1 12.50
21020. Rionne (aeolus27) 8 84.66 89.24 2 25.00
21021. pastapirate (pastapirate) 8 98.54 114.14 7 87.50
21022. Dcoldburn (dcoldburn) 8 73.87 80.85 4 50.00
21023. MedicalMuscle (medicalmuscle) 8 55.82 70.68 2 25.00
21024. Prince (prince_sangwan) 8 49.35 56.89 0 0.00
21025. Christian (kirisuto) 8 99.32 118.67 7 87.50
21026. REEE (tiucoken77) 8 91.67 108.78 2 25.00
21027. sw0shy (sw0shy) 8 46.38 66.26 7 87.50
21028. Lukas (tumultlol) 8 76.16 93.14 3 37.50
21029. Jamin (hoonji) 8 74.56 97.15 1 12.50
21030. Rentib (rentib) 8 45.15 52.83 0 0.00
21031. dekfins (usernameistaken03) 8 66.42 84.17 8 100.00
21032. swak (swak_za) 8 48.49 60.01 0 0.00
21033. Dev Akhilesh (devakhil06) 8 65.23 75.98 3 37.50
21034. vishesh (vishesh312) 8 60.99 66.91 5 62.50
21035. David (vapordew) 8 62.96 74.38 3 37.50
21036. Daniel (daw9801) 8 128.25 135.93 5 62.50
21037. $now (oldsnow) 8 74.33 83.49 4 50.00
21038. mostafa (just_dreamer) 8 56.10 63.75 1 12.50
21039. Mi Co (greeds) 8 61.45 68.32 2 25.00
21040. Joseph (mintypenguin) 8 60.81 73.63 0 0.00
21041. Casper-Drawz-Stuff (mrdrawz) 8 44.07 48.48 1 12.50
21042. Jerry Henry Rose (jerryrose89) 8 101.22 114.25 4 50.00
21043. Sergio (sergio_gardella) 8 49.18 54.73 0 0.00
21044. Dan (danpdx) 8 83.82 105.14 5 62.50
21045. ahammed (ahammed_saeed) 8 55.01 74.13 2 25.00
21046. Joshua (krotaku) 8 52.45 59.86 1 12.50
21047. Hans (hjensen) 8 81.79 103.74 3 37.50
21048. Ayana (mangoez) 8 89.57 98.07 3 37.50
21049. lawrence (lawrenc) 8 73.60 93.45 1 12.50
21050. Lis (lussss) 8 64.29 77.15 6 75.00
21051. chair (chairtypingshit) 8 48.34 55.21 3 37.50
21052. Snowbat (snowbat) 8 66.69 73.44 2 25.00
21053. nem (nem2k18) 8 67.31 78.12 3 37.50
21054. colahhh (colahhh) 8 67.70 80.74 5 62.50
21055. Nico (bynixo) 8 58.67 69.52 3 37.50
21056. G M Sohanur Rahman (th3r0b0t) 8 31.46 35.42 0 0.00
21057. Yash (yashkul) 8 63.78 70.98 0 0.00
21058. Pierce (fiercepierce123) 8 79.54 89.87 6 75.00
21059. Akash (kuekuatsu) 8 46.40 57.13 0 0.00
21060. Alex (x731) 8 93.26 100.84 3 37.50
21061. Suka (sukatoho) 8 77.73 84.97 2 25.00
21062. Qasim (qoofbop) 8 66.80 81.57 5 62.50
21063. Brad (braynie) 8 31.40 50.59 1 12.50
21064. Isaiah (icongamingyt) 8 62.38 71.31 0 0.00
21065. Corbyn (skibbity) 8 91.20 107.38 3 37.50
21066. Nashiruddien (diditsadidnsm) 8 34.29 44.61 5 62.50
21067. Guy (need4speed_) 8 55.42 59.45 1 12.50
21068. Hasnat (hasnat79) 8 67.55 74.54 4 50.00
21069. Louis (giantshlong) 8 102.33 116.55 5 62.50
21070. Amir (spaghetti_wolf) 8 42.64 51.90 1 12.50
21071. sunny (mishmish34) 8 77.42 97.55 3 37.50
21072. Raneth (raneth) 8 28.99 32.86 3 37.50
21073. slowaf (slowaf66552) 8 33.83 36.62 0 0.00
21074. willn5702 (willn5702) 8 94.49 106.15 3 37.50
21075. Kq_al (kqal) 8 80.43 87.08 4 50.00
21076. LION784 (lion784) 8 50.84 59.03 1 12.50
21077. acadia (acadiaskye) 8 70.21 74.97 1 12.50
21078. Akash (akashsaxena2308) 8 48.40 64.55 0 0.00
21079. Awak3 (_awak3_) 8 68.97 78.46 2 25.00
21080. Ronni (thepinhead) 8 52.00 65.10 2 25.00
21081. hunnidbens (benrito) 8 102.25 122.87 5 62.50
21082. Why Are We (why_are_we_stil... 8 71.88 85.95 2 25.00
21083. Mátyás (matyas646) 8 41.04 51.73 8 100.00
21084. Matthew (kaisermk) 8 69.83 83.77 3 37.50
21085. Lavi (lavirinea) 8 80.97 92.37 2 25.00
21086. Everton (hissyfits) 8 92.38 101.51 6 75.00
21087. Isaad (colguy123) 8 76.74 88.42 3 37.50
21088. Giancarlo (glitch3890) 8 63.43 69.95 3 37.50
21089. Geoffrey (colleqtivity) 8 105.12 122.11 1 12.50
21090. lucy (royaltoe) 8 92.83 101.31 1 12.50
21091. Epic (foxonlaptop) 8 77.68 90.14 5 62.50
21092. . (__random__) 7 92.20 103.03 2 28.57
21093. damn (_victor667_) 7 55.93 65.76 0 0.00
21094. Dewey (_dewey) 7 108.43 114.06 2 28.57
21095. Federico (_cali) 7 99.78 112.45 4 57.14
21096. Alex (_alwang_) 7 77.83 89.12 2 28.57
21097. Ales (_ales) 7 103.05 111.37 4 57.14
21098. Zimri (zygnus) 7 111.24 133.26 4 57.14
21099. Zyan25 (zyan2525) 7 78.27 84.26 6 85.71
21100. Hans (zozo800) 7 70.36 76.21 0 0.00
21101. joe (zoybls) 7 63.07 75.77 0 0.00
21102. zoomfrog (zoomfrog) 7 95.54 104.62 3 42.86
21103. HollowAri (zokkuu) 7 65.03 70.72 1 14.29
21104. ziolson (ziolo1) 7 66.16 81.41 2 28.57
21105. e (zimboboys) 7 96.91 103.31 3 42.86
21106. jack (zero18) 7 73.99 79.36 1 14.29
21107. Khanon (zero1010_) 7 61.53 69.61 2 28.57
21108. Hopelezz (zerloth) 7 85.98 97.59 1 14.29
21109. Loong (zenloong) 7 94.58 100.84 3 42.86
21110. Zed (zedhabibi) 7 59.44 64.52 6 85.71
21111. Zeddy (zeddyx) 7 90.15 99.18 4 57.14
21112. Zchob (zchob) 7 70.82 77.31 5 71.43
21113. Neeraj (zapidox) 7 42.35 48.05 1 14.29
21114. Zajd (zajd36) 7 105.34 114.52 3 42.86
21115. Zaid (zaid_ansari) 7 47.99 54.72 1 14.29
21116. Ho (zahid11704023) 7 43.05 49.77 1 14.29
21117. Dwi (yvbinjk) 7 77.39 95.27 3 42.86
21118. Rataro (yuugokku) 7 79.86 97.29 1 14.29
21119. Michael (yt_m1gamer2020) 7 65.59 71.76 3 42.86
21120. Aaron (yoyoyonono) 7 106.82 120.28 3 42.86
21121. Sasuke (yosasuke) 7 103.89 120.84 4 57.14
21122. yian (yian31415) 7 68.98 74.87 3 42.86
21123. Yenthe (yenthefromghent) 7 43.94 47.18 2 28.57
21124. Yeldos (yeldosmanap) 7 76.44 80.53 2 28.57
21125. Rohan (yeetarted) 7 103.44 109.45 4 57.14
21126. Sam (ye3et) 7 64.96 67.42 1 14.29
21127. Yaye (yaye2002) 7 29.52 34.47 2 28.57
21128. Yatin (yatin18) 7 53.85 58.46 2 28.57
21129. Yashvir (yashvir_kothari) 7 36.89 41.83 2 28.57
21130. XxDarkSIdexX (xxdarksidexx) 7 30.67 42.46 2 28.57
21131. Eli (xutt) 7 74.13 85.84 6 85.71
21132. reduce (xreduce) 7 150.44 163.72 7 100.00
21133. Steve (xenoxinius) 7 104.09 114.56 5 71.43
21134. Barton (xbarton) 7 101.12 107.24 0 0.00
21135. Jacob (xavior_x) 7 93.81 100.00 4 57.14
21136. Jake (wyol) 7 71.74 77.83 2 28.57
21137. Alex (wu2481632) 7 124.21 134.39 4 57.14
21138. Gerlat (wtcher1066) 7 53.21 57.79 1 14.29
21139. yung (woahthereyungman) 7 67.27 88.61 0 0.00
21140. Wo1v3r (wo1v3r) 7 113.37 120.62 3 42.86
21141. Wissa (wissaa) 7 36.33 47.37 2 28.57
21142. wabi (wisabi) 7 109.43 123.80 7 100.00
21143. Willie (williewho) 7 77.83 89.60 0 0.00
21144. Wikedtik (wikedtik) 7 101.88 107.37 1 14.29
21145. glo (whytho_) 7 92.84 102.78 1 14.29
21146. Llihcon (whoflayslikeme) 7 84.97 89.42 2 28.57
21147. Sarp (whitechocolatee) 7 69.65 75.99 3 42.86
21148. Dots (wheremydots) 7 85.20 101.81 1 14.29
21149. N3gativeZero (whatsupbrandon) 7 85.03 106.44 3 42.86
21150. Wesley (wesilii) 7 103.14 115.49 3 42.86
21151. Warren (warlover94) 7 93.58 101.12 0 0.00
21152. Damian (waninggibbous) 7 70.76 73.86 3 42.86
21153. Wallace (wallacetwo) 7 99.12 104.72 4 57.14
21154. Walker (walkersutton) 7 91.06 116.01 3 42.86
21155. Wacky (wakcy) 7 84.69 101.41 4 57.14
21156. SRW (waifuthebest) 7 36.37 43.20 0 0.00
21157. WaffleAbs (waffleabs) 7 88.64 105.28 1 14.29
21158. Chris (w1ndow) 7 115.14 130.51 3 42.86
21159. Varun (vslala) 7 83.45 94.94 2 28.57
21160. ​ (vonunov) 7 144.33 164.03 2 28.57
21161. thach (vngoct1) 7 68.98 79.18 0 0.00
21162. Vlada (vlaki) 7 74.30 82.40 4 57.14
21163. Patrick (violaissimmo) 7 94.20 104.66 3 42.86
21164. Villads (vilmk) 7 35.96 42.64 0 0.00
21165. Viktor (viktro_touch_type) 7 86.03 95.44 1 14.29
21166. Vivek (viivek) 7 114.71 131.04 5 71.43
21167. NO (veryaveragetyper) 7 59.44 63.19 2 28.57
21168. Hello (venox11) 7 50.03 57.26 3 42.86
21169. Darcy (vendus13) 7 60.55 70.42 1 14.29
21170. Dias (vdios) 7 65.47 70.89 3 42.86
21171. Revil (vasat401) 7 43.28 48.83 0 0.00
21172. Amara (vainguardian29) 7 45.69 53.44 0 0.00
21173. Eva (vagabionda) 7 64.37 70.41 1 14.29
21174. Narkotik (vacban) 7 83.22 96.84 1 14.29
21175. Ikhbayar (u_mad_bruh_ikhee) 7 66.22 69.75 1 14.29
21176. uwunation (uwunation) 7 99.29 109.24 3 42.86
21177. Usurious (usurious_disc730) 7 88.58 99.43 6 85.71
21178. usu (usufails) 7 65.77 75.78 1 14.29
21179. datmeko (uralbeking) 7 80.60 86.83 2 28.57
21180. undeclared (undeclared) 7 104.71 130.83 6 85.71
21181. Ultrabars- (ultrabars) 7 65.90 94.79 0 0.00
21182. Uksza (uksza) 7 74.54 93.15 1 14.29
21183. Tomo (tzxb018) 7 84.36 92.88 1 14.29
21184. Mohaimenul (typun) 7 31.20 37.67 0 0.00
21185. typo11 (typo11) 7 58.04 67.57 2 28.57
21186. mu (typetypetypetypetype) 7 48.66 56.53 0 0.00
21187. Nibir (typer_de_random) 7 94.76 99.43 2 28.57
21188. Christian (typeger) 7 116.20 132.72 5 71.43
21189. kyel (txkyel) 7 87.24 91.33 1 14.29
21190. TuxKnight (tuxknight) 7 64.39 73.77 1 14.29
21191. Tuomas (tumaas) 7 84.34 93.45 3 42.86
21192. yuan (ttkomalake) 7 34.31 37.41 0 0.00
21193. Tom (ttaffy) 7 97.77 112.93 2 28.57
21194. Tycho (tspider4) 7 94.09 114.46 2 28.57
21195. Ahmad (truemagix) 7 49.51 53.77 1 14.29
21196. Always (tromin) 7 103.01 120.73 3 42.86
21197. Triz (triz) 7 111.87 125.87 6 85.71
21198. _trillbits_ (trillbits) 7 62.36 66.87 1 14.29
21199. tran (tranwantdie) 7 92.79 105.74 3 42.86
21200. Tomas (tomas_649) 7 52.72 61.73 0 0.00
21201. Tom Ake (tom4ke) 7 58.53 67.92 1 14.29
21202. János (tokumeikun) 7 64.73 77.99 1 14.29
21203. Michael (todfelton) 7 59.60 64.53 0 0.00
21204. Tj0027 (tj0027) 7 39.14 43.81 0 0.00
21205. Tim (timmaayyt) 7 71.10 86.30 0 0.00
21206. Tim (tigothy) 7 95.89 111.92 2 28.57
21207. PianOreo (thunderoreoz) 7 105.25 122.36 6 85.71
21208. Thunder (thunder2910) 7 74.30 83.17 2 28.57
21209. thummachart (thummachart) 7 55.76 61.91 0 0.00
21210. Thomas (thomastran02) 7 73.90 84.27 0 0.00
21211. Virginia (thomas11) 7 76.53 88.27 2 28.57
21212. The Ro Driver (the_ro_driver) 7 76.87 92.27 2 28.57
21213. David (the_pursuit) 7 102.72 118.36 7 100.00
21214. Patches (the_kirin_master) 7 106.09 132.64 6 85.71
21215. Hali (the_holy_hali) 7 61.18 67.79 7 100.00
21216. Elias (the_dovah) 7 63.95 70.04 0 0.00
21217. Derek (thewarrior_13th) 7 71.91 84.58 1 14.29
21218. Joe (therunner09) 7 98.37 107.42 3 42.86
21219. Alex (therodge) 7 63.62 76.47 1 14.29
21220. Jesse (thepaperman) 7 48.95 57.55 4 57.14
21221. Nam (thenewdawn97) 7 46.49 55.32 1 14.29
21222. thelegendary08 (thelegendar... 7 77.81 85.36 4 57.14
21223. Andrew (thedeathlyhallows) 7 122.77 142.17 4 57.14
21224. TheDasher (thedasherz) 7 54.02 61.00 1 14.29
21225. thatguy (thatguy577) 7 53.73 59.78 1 14.29
21226. thatchipz (thatchipz) 7 77.53 90.88 4 57.14
21227. BEST 54 wpm (terass) 7 33.18 37.55 2 28.57
21228. Tentic (tentic) 7 99.02 108.18 5 71.43
21229. Tellenar (tellenar) 7 82.36 100.00 2 28.57
21230. moyu (teledodol) 7 70.27 86.32 3 42.86
21231. Tea (teawee) 7 63.59 73.30 2 28.57
21232. Troy (tdserapio) 7 100.62 108.22 5 71.43
21233. Nurlan (tasmaev) 7 27.05 30.54 1 14.29
21234. venus (taroxtaroxtaro) 7 101.89 127.88 5 71.43
21235. Tarneem (tarneem) 7 73.38 85.76 3 42.86
21236. Cory (tarisant) 7 136.49 148.05 7 100.00
21237. Tanwa (tanwa) 7 71.42 83.53 1 14.29
21238. tanami (tanami) 7 130.19 154.79 7 100.00
21239. Tamuna (tamuna314) 7 58.30 61.79 1 14.29
21240. Slow (tal4565) 7 49.02 59.93 0 0.00
21241. B (tajooki) 7 87.16 105.37 3 42.86
21242. Ahmed (taftaf) 7 69.68 80.93 2 28.57
21243. Tachibana (tachibanayui) 7 60.83 79.17 2 28.57
21244. Ruiji (taburnalluigi) 7 49.66 65.68 4 57.14
21245. TeeCee (taboka) 7 36.80 44.45 1 14.29
21246. Tom (t0mas_colemak) 7 77.85 90.98 2 28.57
21247. Luke (synthsequence) 7 97.74 105.93 3 42.86
21248. Symawi (symawi) 7 73.11 82.84 1 14.29
21249. ed (sxxos) 7 79.35 88.26 3 42.86
21250. sentim3ntal1 (sweet_malaak) 7 84.88 97.78 1 14.29
21251. Sway (swaycuisway) 7 106.54 122.22 2 28.57
21252. Zihaku (swarmfirehd) 7 62.94 74.83 5 71.43
21253. Maggie (swagmag) 7 85.26 96.60 2 28.57
21254. Kartswag (swagkid) 7 100.40 109.29 5 71.43
21255. svime (svime) 7 87.48 111.91 3 42.86
21256. Chibichan (supersam317) 7 100.77 110.70 4 57.14
21257. Ashish (superman_11) 7 58.08 63.14 1 14.29
21258. Drew (supercoolgamer2) 7 31.64 45.15 0 0.00
21259. sirloc (sunsinghny19) 7 90.91 96.34 5 71.43
21260. sumukha_puranik (sumukha) 7 62.00 73.24 0 0.00
21261. suleman (suleman33) 7 101.30 126.05 5 71.43
21262. Subeesh (subeesh18) 7 70.84 76.99 2 28.57
21263. EMILYMYGODDESS (crlsh_) 7 88.75 102.60 5 71.43
21264. Struedelcat (struedelcat) 7 119.39 131.99 4 57.14
21265. Martin (stroj) 7 71.93 92.01 2 28.57
21266. stoozy (stoozy) 7 90.46 96.92 2 28.57
21267. rat (stinkypissboy) 7 93.40 112.05 6 85.71
21268. Steven (stevie03) 7 108.49 127.12 3 42.86
21269. Stephanie (stephycatz69) 7 51.45 64.50 0 0.00
21270. Adriel (stephencarry) 7 94.70 113.70 1 14.29
21271. steli2 (steli2) 7 111.26 127.07 5 71.43
21272. Ben (steamhawk) 7 44.15 57.42 1 14.29
21273. Star (star_sailorx) 7 112.46 133.25 4 57.14
21274. starscr3am (starscr3am) 7 45.02 50.24 0 0.00
21275. Robin (stapler8) 7 107.22 124.52 4 57.14
21276. Sourav (srax) 7 97.96 114.80 3 42.86
21277. squidite (squidite) 7 59.45 74.20 1 14.29
21278. Tom (spritelad) 7 86.94 95.91 3 42.86
21279. oliver (spou) 7 113.95 122.31 4 57.14
21280. Lucius (spirituslucius) 7 44.45 53.26 0 0.00
21281. Krystin (spetz) 7 75.13 83.69 2 28.57
21282. Martin (speedonthestreet) 7 83.29 89.86 7 100.00
21283. speedguy1 (speedguy1) 7 83.92 89.35 4 57.14
21284. Spanner (spanner77) 7 107.52 112.93 2 28.57
21285. Daniel (spades_syn) 7 59.01 66.50 2 28.57
21286. Jacob (soolseem) 7 93.16 105.03 1 14.29
21287. dhoanqa (sombowde) 7 72.90 80.88 0 0.00
21288. Soham (sohammukherjee2011) 7 79.54 93.22 2 28.57
21289. Soerth (soerth) 7 61.99 65.39 0 0.00
21290. Snow (snowjack) 7 81.40 91.98 2 28.57
21291. Carlos (snorlax7652) 7 52.18 78.27 4 57.14
21292. tstats[sneakyturtle333634] ... 7 72.75 77.12 2 28.57
21293. Jan (smilingjan) 7 84.23 96.91 1 14.29
21294. skeletrix (slownoobtyper) 7 123.27 138.12 4 57.14
21295. 77 (slithernoah) 7 63.35 77.05 1 14.29
21296. Aidan (slippp3r) 7 75.76 83.61 1 14.29
21297. Peter (slapchop18) 7 127.96 134.92 5 71.43
21298. Sklort (skl0rt) 7 76.52 90.80 2 28.57
21299. Kevin (skillz9600) 7 72.90 84.57 2 28.57
21300. Bubly (skelpadderidderen) 7 55.16 72.81 0 0.00
21301. SG Keyboard Warrior (singap... 7 100.44 120.56 3 42.86
21302. Silas (silvanus) 7 70.77 74.59 2 28.57
21303. Timmy (sillytimmy) 7 98.87 113.46 4 57.14
21304. Silly (sillygeeses) 7 77.20 84.99 2 28.57
21305. 516 (sig_sauers) 7 85.47 99.28 4 57.14
21306. Chara (sig_num) 7 83.45 89.94 3 42.86
21307. SighingSlider (sighingslider) 7 80.86 90.84 3 42.86
21308. Sigurdur (siggi84) 7 62.84 69.10 5 71.43
21309. Jed (shreyasgm) 7 109.68 118.85 4 57.14
21310. Shrek Of Justice (shrek_of_... 7 113.81 127.95 4 57.14
21311. . (shrekenberg) 7 122.72 137.22 3 42.86
21312. Jonathan (shoopdasoup) 7 97.09 133.50 6 85.71
21313. a (shibss) 7 87.85 100.10 3 42.86
21314. Shelyn (shelynxj) 7 79.55 84.81 3 42.86
21315. Shaleen (shaleenx) 7 91.26 97.49 1 14.29
21316. shaik (shahul_shaik) 7 78.95 88.30 2 28.57
21317. Shahriar (shahriar_shojib) 7 50.96 59.36 0 0.00
21318. Nick (serpuns) 7 53.00 60.25 2 28.57
21319. Daniel (sergiogahyrof) 7 81.26 91.69 4 57.14
21320. Enrico (serafino89) 7 63.49 71.39 2 28.57
21321. Klein (senserox) 7 64.47 71.18 2 28.57
21322. sedney (sedneyl) 7 55.16 62.94 0 0.00
21323. Screen (screendoor) 7 79.46 87.53 0 0.00
21324. Joshua (scpectre) 7 110.00 123.17 3 42.86
21325. DrCharlesS (scpdrcs) 7 59.17 64.65 2 28.57
21326. pi (schi678) 7 110.19 119.55 4 57.14
21327. Sawyer (sawyer_) 7 75.73 84.67 4 57.14
21328. Saniya (sashimisan_) 7 72.40 79.03 1 14.29
21329. Sang Sabil (sangsabil217) 7 59.09 67.01 1 14.29
21330. Sam (sandwhales) 7 56.74 65.24 3 42.86
21331. Olof (sammipk) 7 97.56 116.87 5 71.43
21332. Sam (samhsmith) 7 79.47 86.29 3 42.86
21333. sameer (sameerlol) 7 118.30 129.28 4 57.14
21334. Samo (sakra) 7 56.38 69.37 1 14.29
21335. Saeed (saeedfx) 7 55.90 65.90 0 0.00
21336. sachin (sachin1234502) 7 42.80 46.07 0 0.00
21337. Sabyasachi (saba10000) 7 48.75 56.54 0 0.00
21338. ryouinuma (ryouinuma) 7 75.01 82.12 0 0.00
21339. ryderrt (ryderrt) 7 55.48 76.31 0 0.00
21340. Ryan (ryanm42) 7 96.00 115.87 3 42.86
21341. Holly (runningnurse) 7 72.39 86.88 2 28.57
21342. Sourav (rubberboa) 7 94.99 99.63 1 14.29
21343. Rex (rrrreeexx) 7 80.64 94.30 2 28.57
21344. Rotala (rotala_macrandra) 7 96.19 106.34 3 42.86
21345. rota (rota22) 7 75.66 80.79 1 14.29
21346. rosina (rosina_24) 7 82.73 90.24 1 14.29
21347. Ozan Can (romuyloyloy) 7 58.70 65.89 1 14.29
21348. Craving (romboowner) 7 93.50 100.25 2 28.57
21349. Justin (rogreat) 7 102.97 117.10 4 57.14
21350. Rockfeller (rock_messi) 7 49.39 56.39 0 0.00
21351. Jan (robi21mlg) 7 83.66 97.21 5 71.43
21352. road_to_150wpm (road_2_150wpm) 7 136.73 147.45 5 71.43
21353. Redox (riyaushino) 7 91.85 101.67 2 28.57
21354. riswan (riswan_1212) 7 37.26 41.58 0 0.00
21355. Riptide (riptidetheta) 7 91.07 107.47 3 42.86
21356. Ri (rijizin) 7 63.57 69.93 1 14.29
21357. Loz (rightytypey) 7 92.18 108.69 2 28.57
21358. R Dizzle (ridzilla) 7 109.27 126.14 2 28.57
21359. Patrick (rick_pat) 7 85.96 96.45 5 71.43
21360. Radu (rhadoo611) 7 70.59 83.19 2 28.57
21361. Derek (rexyoda) 7 49.92 59.75 2 28.57
21362. Paul (retropixel99) 7 96.85 107.34 1 14.29
21363. Rex (redrex) 7 85.45 96.29 1 14.29
21364. RedEye (redeye) 7 96.99 112.63 3 42.86
21365. Lam (rebmal101) 7 71.11 78.45 4 57.14
21366. Matthew (realmtd) 7 66.74 80.11 2 28.57
21367. Harold (realmagilla) 7 81.55 102.04 6 85.71
21368. Griz (realgrizzle123) 7 97.38 107.46 1 14.29
21369. Aaron Martin (reala) 7 37.55 39.14 1 14.29
21370. Reagan (reagss) 7 71.63 85.39 3 42.86
21371. Jeff (rcmaximus) 7 66.50 76.45 1 14.29
21372. M (razorneck) 7 65.10 73.64 2 28.57
21373. RAPdawg (rapdawg530) 7 111.55 128.78 3 42.86
21374. Komol Kunty Rajib (rajib_ra... 7 49.47 54.31 0 0.00
21375. roadto120 (raiyan2423) 7 99.38 109.36 3 42.86
21376. Rain (rainliofficial) 7 95.08 108.87 3 42.86
21377. raider (raider93) 7 48.30 57.16 0 0.00
21378. Rahil (rahilu14) 7 104.13 118.09 6 85.71
21379. youtube.com/TechieDheeraj (... 7 68.19 72.01 1 14.29
21380. really cute ;) (qwnnnnnnn) 7 64.53 74.50 2 28.57
21381. Joshuasdf (qwertoid) 7 115.23 122.30 5 71.43
21382. Type (quic_qwerty) 7 85.12 93.38 2 28.57
21383. QuicoDel8 (quico) 7 71.91 77.65 1 14.29
21384. Qubz (qubz) 7 73.22 83.15 1 14.29
21385. Martina (qkmartina) 7 82.09 99.53 1 14.29
21386. Pyrouge (pyrouge) 7 105.79 117.22 5 71.43
21387. Putte (puttepowertyper) 7 43.14 53.09 0 0.00
21388. putss (putssimply) 7 97.79 110.24 3 42.86
21389. Puss (pussboi) 7 94.18 118.75 4 57.14
21390. the solution to pollution i... 7 127.93 184.40 5 71.43
21391. Ian (pugami) 7 63.98 76.88 3 42.86
21392. ptsd (ptsd92) 7 70.24 79.18 1 14.29
21393. ulreich (prozeal_) 7 77.31 88.18 1 14.29
21394. Omar (prospart) 7 73.20 76.35 2 28.57
21395. Sahil (prosahil) 7 59.05 77.11 1 14.29
21396. Abir (proabir) 7 54.81 62.09 0 0.00
21397. Pranav (preyneyv) 7 108.57 133.32 5 71.43
21398. lukas (preston_frag) 7 47.88 55.34 0 0.00
21399. precarious (preciousgravy) 7 175.62 191.68 4 57.14
21400. Prasad (prasad1999) 7 50.43 56.63 1 14.29
21401. Pranman (pranman123) 7 90.32 94.69 6 85.71
21402. M A T I A S (praise_duarte) 7 147.33 178.53 5 71.43
21403. Bear (pr0d19y) 7 84.84 89.43 1 14.29
21404. potlid43 (potlid43) 7 76.47 91.57 2 28.57
21405. POZ (poooz) 7 44.95 49.30 0 0.00
21406. Nigerian (poobear_) 7 100.26 125.97 3 42.86
21407. Slueben (poijn) 7 97.68 117.80 6 85.71
21408. pogfatherz (pogfatherz) 7 93.04 98.73 3 42.86
21409. Patrick (pjtimmon) 7 65.69 72.08 2 28.57
21410. Parker (pistolpeterulez) 7 44.35 51.33 1 14.29
21411. Lidia (pinguinthecity) 7 65.06 117.56 6 85.71
21412. Ryan (pingu51472) 7 112.18 124.08 3 42.86
21413. pineapple (pineappleink) 7 84.94 96.30 5 71.43
21414. Mathias (pijaye) 7 76.66 90.03 2 28.57
21415. Kercy (phoenixgod213) 7 65.92 75.33 5 71.43
21416. Arnav (phoenixcrusher369) 7 93.71 105.77 3 42.86
21417. Philip (philip79) 7 34.90 37.22 0 0.00
21418. pheck (pheck_) 7 52.35 59.14 2 28.57
21419. Anish (phantom2201) 7 51.58 57.63 2 28.57
21420. Eli (peytoneli) 7 106.87 114.22 2 28.57
21421. Petersoon (peterson_brasil) 7 53.04 61.74 1 14.29
21422. prison mate pete (petermh) 7 118.48 152.98 5 71.43
21423. Davids (petally) 7 96.54 108.32 4 57.14
21424. ( ' - ' ) (pengun) 7 71.07 79.26 4 57.14
21425. Keqings Left Pinky (penguin... 7 106.54 120.26 4 57.14
21426. pear (pearuchiha) 7 55.65 63.90 1 14.29
21427. Pawaox (pawaox) 7 117.33 135.84 4 57.14
21428. Colin (pathetic_worm) 7 69.57 75.73 2 28.57
21429. Pavel (patcm) 7 94.54 106.66 0 0.00
21430. Nathaniel (pastafarianjew) 7 71.24 83.38 1 14.29
21431. pastabooth (pastabooth) 7 97.03 115.68 5 71.43
21432. Papa (papawadee) 7 106.63 113.25 2 28.57
21433. Pan (pan_grammoun) 7 52.98 58.63 1 14.29
21434. Denys (owlydesigner) 7 73.50 81.86 1 14.29
21435. Ovidiu (ov_ant) 7 67.35 82.40 3 42.86
21436. Overpriced (overpriced) 7 98.72 104.14 1 14.29
21437. Oussama (oussamanh) 7 76.13 81.06 3 42.86
21438. eye8 (othereye) 7 71.68 85.06 1 14.29
21439. Jack (orka_qwerty) 7 99.80 122.40 1 14.29
21440. orangeoldfish (orange_oldfish) 7 134.99 153.78 6 85.71
21441. Meredith (onemoremerry) 7 92.63 104.53 1 14.29
21442. omegadeath88 (omegadeath88) 7 93.59 110.02 1 14.29
21443. papryczan (olgi69) 7 82.33 91.55 3 42.86
21444. Owen (ojt_11) 7 53.35 57.37 2 28.57
21445. Wx (oh_hi) 7 78.92 92.84 2 28.57
21446. OhmFreeTime (ohmmeejaa25) 7 58.36 68.11 2 28.57
21447. David (ogwoohoo) 7 86.69 96.30 1 14.29
21448. Ognjennad (ognjennad) 7 95.65 104.79 3 42.86
21449. DIego (ogeid) 7 68.68 72.77 1 14.29
21450. oddrationale (oddrationale) 7 70.70 82.87 1 14.29
21451. S (nyansyde) 7 80.68 90.91 0 0.00
21452. Nyambat (nyambat) 7 75.30 81.84 2 28.57
21453. Nuwan (nuwang69) 7 66.40 78.52 0 0.00
21454. Noxcoma (noxcoma_) 7 67.66 79.50 4 57.14
21455. Victor (notvector) 7 129.66 145.40 5 71.43
21456. Noriphe (noriphe) 7 81.51 92.10 2 28.57
21457. Chad (noodlestrings) 7 71.64 92.70 1 14.29
21458. din (nonquitdondoe) 7 113.77 138.15 7 100.00
21459. toni (noilly) 7 97.60 121.93 2 28.57
21460. Vi (nocivi38) 7 64.31 67.65 6 85.71
21461. Stig (no1irishstig) 7 71.16 93.29 5 71.43
21462. Vanja (njavex) 7 50.82 59.97 2 28.57
21463. Nishanth (nishanth_s) 7 63.52 71.25 1 14.29
21464. Nil (niljovanovic) 7 60.17 68.39 1 14.29
21465. Nikhil (niks_2012) 7 53.10 60.84 1 14.29
21466. Nikki (niknak13) 7 95.17 117.43 1 14.29
21467. Daniel (niggusted) 7 123.56 135.68 7 100.00
21468. Nico (nico_e) 7 92.32 114.61 4 57.14
21469. Niconii (nicopai_) 7 72.51 80.62 3 42.86
21470. Nicole (nicoleogden) 7 106.95 114.03 5 71.43
21471. Sebastian (nichtmonti) 7 81.71 101.71 1 14.29
21472. Jason (nhtiger) 7 87.53 105.42 2 28.57
21473. * (ngong19) 7 105.92 125.61 1 14.29
21474. Himanshu (neutron_star) 7 64.46 69.47 0 0.00
21475. nether (nethersynth) 7 128.47 158.21 3 42.86
21476. makaio (neosifr) 7 107.62 135.36 3 42.86
21477. Joseph (neonjc) 7 126.43 143.06 5 71.43
21478. Nehal (nehaldamania) 7 76.66 83.83 4 57.14
21479. Nechmo (nechmo111) 7 56.01 63.94 0 0.00
21480. Nathaniel (nebuejin) 7 80.18 87.04 1 14.29
21481. Nebula (nebakki) 7 85.09 104.04 4 57.14
21482. jeffery (nctu_jeffery) 7 51.57 54.91 0 0.00
21483. Naziman (naziman) 7 57.48 62.98 2 28.57
21484. Nazar Berkimbay (nazar1005) 7 65.08 74.36 2 28.57
21485. Ryan (nayrx14) 7 92.96 110.29 3 42.86
21486. Nayely (nayelytyperacer) 7 74.96 96.47 1 14.29
21487. nayan (nayan268) 7 56.74 60.79 2 28.57
21488. Joseph (naughtyboy1337) 7 91.19 101.29 1 14.29
21489. Nate (nate11) 7 104.95 113.94 3 42.86
21490. Temirlan (nalrimet) 7 59.08 67.01 1 14.29
21491. Nahin (nahin_r) 7 53.19 55.77 0 0.00
21492. miyu (naevis) 7 77.62 87.40 0 0.00
21493. nabil (nabl) 7 94.37 108.49 2 28.57
21494. Mickey (m_qwerty) 7 101.13 109.32 2 28.57
21495. Sagar (mystic0570) 7 46.77 54.53 0 0.00
21496. Hải (mymomismad) 7 105.95 118.97 4 57.14
21497. moca (mxca) 7 48.50 56.63 1 14.29
21498. Joshua (mvpalmighty) 7 84.70 94.24 1 14.29
21499. MustardNuts (mustardnuts) 7 61.61 76.90 2 28.57
21500. Museum (museum25) 7 81.82 92.56 1 14.29
21501. Murphy (murphsmurf) 7 81.71 87.54 3 42.86
21502. Munyoudoum (munyoudoum) 7 84.07 93.88 1 14.29
21503. Muffin (muffinboi5) 7 71.20 85.58 7 100.00
21504. Muffin (mufff) 7 53.69 72.70 3 42.86
21505. Peter (mubida23) 7 67.63 77.99 2 28.57
21506. Mike (mtwomey) 7 61.91 71.88 2 28.57
21507. M$NEYMAIZE (msneymaize) 7 87.08 105.97 3 42.86
21508. ur boy (msinghh) 7 108.54 125.00 2 28.57
21509. matthew (mshau) 7 108.52 124.73 5 71.43
21510. brian (mr_ritz) 7 40.97 45.28 1 14.29
21511. Mrs.lechuga (mrslechuga) 7 103.22 121.61 6 85.71
21512. BigRocks (mrpluto23) 7 58.15 65.68 2 28.57
21513. Roar (raor) (mrmcmurple) 7 80.76 97.86 2 28.57
21514. Richard (mrm3man) 7 87.77 97.74 2 28.57
21515. Lovre (mrlovre) 7 72.47 77.93 1 14.29
21516. Ronalds (mrbonis) 7 94.53 101.10 4 57.14
21517. Jimmy (motivatorman) 7 91.22 98.14 3 42.86
21518. Mokegang420 (mokegang420) 7 120.15 130.28 4 57.14
21519. Moghazi (moghaazi) 7 54.52 57.47 0 0.00
21520. Moe (moetez1) 7 75.58 82.91 3 42.86
21521. M (mma05) 7 62.01 76.14 1 14.29
21522. k (mkoo) 7 85.69 97.31 3 42.86
21523. Dimitar (mitronix) 7 45.83 58.62 1 14.29
21524. mithilesh (mithilesh3110) 7 75.31 82.42 2 28.57
21525. Mitchell (mitchell807273) 7 93.90 113.03 2 28.57
21526. 🚗💨 (miredirex) 7 126.76 143.55 4 57.14
21527. spectating (minhxuan2507) 7 150.77 187.12 7 100.00
21528. Ming (mings7) 7 78.74 93.41 3 42.86
21529. milord (milordbruh) 7 64.87 76.22 5 71.43
21530. MikeB (mikebfromdk) 7 88.98 107.44 1 14.29
21531. Lux (miintyonyt) 7 64.20 67.53 2 28.57
21532. Miilo (miilo_) 7 64.69 80.96 4 57.14
21533. Mighty (mighty_kurac) 7 95.41 106.72 6 85.71
21534. micah (mickeylmao) 7 86.36 102.57 3 42.86
21535. Mike (mhaimowitz) 7 87.35 91.89 2 28.57
21536. Muaz (mfone) 7 51.08 66.08 1 14.29
21537. Mark (mesm) 7 96.93 114.34 2 28.57
21538. Lauren (merpling) 7 101.25 113.31 5 71.43
21539. Ribub (mercury_millpond) 7 102.03 110.44 3 42.86
21540. Dragon (menacingdragon) 7 108.07 118.27 6 85.71
21541. Melody (melody313) 7 106.52 111.76 3 42.86
21542. Salman (meistr) 7 67.43 83.15 0 0.00
21543. Mehmed (mehmed_) 7 45.62 54.48 1 14.29
21544. Mees (meeszon) 7 82.20 89.61 2 28.57
21545. Seny (mdeekay) 7 99.10 112.81 3 42.86
21546. mcshizney (mcshizney) 7 76.41 91.63 1 14.29
21547. ꧁༒☬刀Ξ℣ł₦ ☬... 7 87.08 104.07 3 42.86
21548. Josef (mcblyat2) 7 93.06 103.77 2 28.57
21549. mazer (mazer706) 7 107.09 116.10 4 57.14
21550. Mayreel (mayreel) 7 130.00 151.62 7 100.00
21551. Bilal (maxty) 7 44.57 56.16 1 14.29
21552. S (mavzero) 7 42.68 48.99 0 0.00
21553. Matt (mattyice445) 7 94.94 102.35 3 42.86
21554. Matt (mattsanruk) 7 77.37 89.41 2 28.57
21555. Matt (mattrmel) 7 90.50 117.89 3 42.86
21556. Justin (maticulous) 7 89.72 106.16 4 57.14
21557. Mathfeli (mathfeli) 7 42.67 45.75 0 0.00
21558. SparklMastr (mastrsparkl) 7 111.08 124.96 3 42.86
21559. Manvik (mastikhorgamer) 7 80.68 89.74 2 28.57
21560. Daniel (masterfiregg) 7 101.66 125.37 7 100.00
21561. Andre (mastergamernerd) 7 92.26 101.84 1 14.29
21562. Massi (massi_goat) 7 107.37 119.52 3 42.86
21563. Masquerade (masq_uerade) 7 60.91 78.23 2 28.57
21564. Martin (martinmadis) 7 80.99 92.53 2 28.57
21565. Mark (markisimo) 7 64.99 74.27 1 14.29
21566. Mark (mark69420) 7 60.96 68.18 1 14.29
21567. Marissa (marissalim) 7 80.87 93.73 2 28.57
21568. Mardon (mapukhuanna) 7 56.13 60.84 1 14.29
21569. mandryx (mandryx) 7 55.33 63.62 1 14.29
21570. mandar (mandar139) 7 61.44 70.05 0 0.00
21571. MamyPoko (mamypoko) 7 106.71 113.62 6 85.71
21572. Maliir (maliir) 7 56.09 62.33 1 14.29
21573. Maks (makso02) 7 60.10 71.42 7 100.00
21574. mairzydoats_mason (mairzydo... 7 86.55 98.15 1 14.29
21575. Sakib (mahmud1) 7 88.08 102.66 2 28.57
21576. mahdy (mahdy7) 7 62.78 72.73 1 14.29
21577. Shane (maggiepie) 7 66.80 91.98 2 28.57
21578. Madsin (madsin) 7 49.54 54.25 1 14.29
21579. Elad (madror1) 7 40.36 48.77 7 100.00
21580. Dan (maddolis) 7 122.00 139.12 6 85.71
21581. Mayank (maaynx) 7 67.60 92.71 4 57.14
21582. LYF (lyf_) 7 55.02 73.20 1 14.29
21583. Tyler (lydes) 7 91.65 103.18 2 28.57
21584. Alexis (lxsmndl) 7 77.84 98.72 4 57.14
21585. Yumzy (lusileven) 7 66.56 75.43 0 0.00
21586. cade (lunacy_) 7 101.29 108.30 3 42.86
21587. Luklein (luklein) 7 53.22 58.46 7 100.00
21588. Dat (ltdat1618) 7 81.10 90.69 6 85.71
21589. andrei (loomit) 7 77.98 98.36 1 14.29
21590. Long (longgho) 7 62.69 75.29 2 28.57
21591. KILLA (longhin_mark) 7 110.53 122.49 3 42.86
21592. Löncswing (loncswing) 7 69.66 84.84 1 14.29
21593. Lovro (lolvrol) 7 63.95 72.16 1 14.29
21594. Lokizypresse_902 (lokizypre... 7 90.07 118.07 4 57.14
21595. Lluis (lluisteixido) 7 74.48 86.87 2 28.57
21596. Ashvik (llamma) 7 63.25 81.13 4 57.14
21597. Paul (llamaking86) 7 86.45 101.94 2 28.57
21598. LionMane (lion_mane_jellyfish) 7 104.46 122.17 3 42.86
21599. Daddy (liondj7) 7 78.21 84.24 1 14.29
21600. lil_vince (lil_vince) 7 81.46 91.67 1 14.29
21601. liv (lilolive) 7 76.73 86.36 0 0.00
21602. lili (lilihsu) 7 59.55 65.12 0 0.00
21603. Liam (liamdaman) 7 52.98 62.90 1 14.29
21604. UnsaidFred (leophidian) 7 82.78 88.47 4 57.14
21605. Lê Hùng Luận (lehungluan) 7 59.32 65.57 1 14.29
21606. Lego (legogurke) 7 53.42 60.28 1 14.29
21607. Reese (leeseree) 7 90.28 107.29 7 100.00
21608. benihana (ledecade) 7 117.35 120.82 4 57.14
21609. Lucas (ldahmm) 7 78.71 89.34 3 42.86
21610. Wahh (lazydude1) 7 83.30 103.27 2 28.57
21611. Lazar (lazer123) 7 71.36 82.15 3 42.86
21612. Catherine (lautherine) 7 67.61 84.84 2 28.57
21613. Hamza (lasthamzastanding) 7 65.56 70.42 2 28.57
21614. Lanz (lanz22) 7 92.00 111.05 1 14.29
21615. Sean (laggermc) 7 89.01 96.54 0 0.00
21616. Labib (l4bib) 7 92.15 106.53 0 0.00
21617. George (kyrite) 7 102.93 119.15 4 57.14
21618. Louise (kyarakutaa) 7 81.26 93.40 3 42.86
21619. nully (kuwurakkuheddo_) 7 72.38 96.01 0 0.00
21620. Kushal (kushaltrivedi5) 7 83.68 89.77 2 28.57
21621. Kushal (kushalkumar) 7 67.15 74.01 2 28.57
21622. Adam RIP Byron (kurfew) 7 105.58 111.22 2 28.57
21623. Kurai (kuraiflame) 7 70.17 76.08 1 14.29
21624. Kuerbiskosar (kuerbiskosar) 7 57.91 64.88 3 42.86
21625. Only typing will save the w... 7 100.09 106.25 2 28.57
21626. Kuanysh (kuanyshby) 7 41.91 50.46 2 28.57
21627. Kristoffer (krioxia) 7 84.60 97.12 5 71.43
21628. supernoob (krcellucci) 7 86.19 90.76 3 42.86
21629. Mateusz (krakeusz) 7 84.33 94.43 2 28.57
21630. Adam (kolcow) 7 52.16 61.32 3 42.86
21631. Ella (kokookie) 7 60.97 69.76 4 57.14
21632. Buo YU (koh100) 7 105.68 117.30 4 57.14
21633. Koco (koco001) 7 36.74 46.69 1 14.29
21634. Knight (knight_shadow) 7 49.70 52.80 2 28.57
21635. Knight (knightfury18) 7 45.92 55.04 1 14.29
21636. Klash (klashghost) 7 89.57 95.81 3 42.86
21637. kizzgotnorest (kizznorest) 7 44.99 51.53 2 28.57
21638. Ika (kitkatslr) 7 60.13 63.17 1 14.29
21639. Toru (kir6meki) 7 86.48 99.26 4 57.14
21640. Kilty (kilty) 7 96.65 108.20 5 71.43
21641. Filip (kicklets) 7 81.01 96.69 2 28.57
21642. Khen (khen2003) 7 90.17 96.41 1 14.29
21643. Khairosh (khairosh) 7 75.64 87.50 3 42.86
21644. Keyser (keyserrr) 7 89.18 94.13 2 28.57
21645. Kevin (kevinm162) 7 73.21 87.71 4 57.14
21646. Kevin (kevinity) 7 132.62 141.05 7 100.00
21647. Brett (kermin) 7 110.10 133.03 5 71.43
21648. h (kenthios) 7 105.62 122.29 2 28.57
21649. Kelton (kelkidman) 7 58.04 60.80 0 0.00
21650. kektor (kektorkuan) 7 76.48 93.22 2 28.57
21651. Anvar (kekstroke) 7 51.17 56.33 0 0.00
21652. Keith (keith_qwerty) 7 53.72 60.65 0 0.00
21653. Jeff (keeperofbees) 7 80.13 87.33 4 57.14
21654. Gábor (kecske116) 7 65.41 75.69 0 0.00
21655. Keagan (keagonian_16) 7 40.71 51.08 0 0.00
21656. Kawasaki (kawasaki_314) 7 66.99 79.73 3 42.86
21657. Ghribi (kaspersaif) 7 50.91 59.63 1 14.29
21658. Sebastian (karuispa) 7 55.43 65.63 1 14.29
21659. Caroline (karialyn) 7 108.94 119.95 5 71.43
21660. Karel (kareldang) 7 81.57 86.83 2 28.57
21661. Kaphran (kaphran) 7 112.23 126.12 6 85.71
21662. marc (kangdashman) 7 71.81 83.39 4 57.14
21663. Jyotirmoy (jyotirmoy_halder) 7 102.53 114.20 4 57.14
21664. James (jynx0) 7 62.31 68.19 2 28.57
21665. Joey (jxmp) 7 62.06 74.59 3 42.86
21666. Jv (jv_2002) 7 79.70 86.93 2 28.57
21667. Ser (juzser) 7 62.84 66.60 2 28.57
21668. Alex (just_alex) 7 74.02 94.29 2 28.57
21669. Rodney (justrodneylee) 7 98.19 102.20 2 28.57
21670. Joke (justjokeing) 7 109.51 117.11 5 71.43
21671. Jens (justjens) 7 82.81 95.11 0 0.00
21672. Nick (justintolerable) 7 66.39 71.65 0 0.00
21673. Justin (justinjd) 7 131.66 146.02 5 71.43
21674. Justienz (justienz) 7 92.10 99.04 1 14.29
21675. justavg (justavg) 7 92.90 99.87 2 28.57
21676. Jr (jrlynn) 7 28.50 30.38 2 28.57
21677. JRey (jreyranoco) 7 96.27 102.15 3 42.86
21678. J (jrazn) 7 77.41 86.84 3 42.86
21679. JQuez (jquez) 7 103.98 115.87 5 71.43
21680. Joy (joyisawesome) 7 114.81 127.60 4 57.14
21681. Jude (joodels) 7 75.20 78.92 3 42.86
21682. Jon (jon_ackbar) 7 92.29 101.78 2 28.57
21683. Jons (jonserino) 7 72.79 79.11 4 57.14
21684. Jon (jonlauws) 7 98.40 106.06 3 42.86
21685. Jonwin (jonawi) 7 38.86 43.90 0 0.00
21686. Jonas (jonasbalante123) 7 62.14 65.93 3 42.86
21687. Jonas (joltux) 7 97.14 100.75 3 42.86
21688. John (johhpreston) 7 53.21 60.15 2 28.57
21689. jody (jody10) 7 64.98 79.75 1 14.29
21690. Jon-Michael (jm_george99) 7 49.99 58.27 2 28.57
21691. Justin (jmgrim16) 7 73.79 88.96 3 42.86
21692. jkrkvld (jkrkvld) 7 71.81 83.46 1 14.29
21693. Joshua (jkim0206) 7 106.77 124.38 7 100.00
21694. Jamie (jkelly21) 7 98.26 111.95 1 14.29
21695. Jun (jjjun) 7 99.77 125.09 6 85.71
21696. Justin (jjallday13) 7 109.46 123.84 5 71.43
21697. Christopher (jingping) 7 96.92 112.45 2 28.57
21698. jim (jimbosenior) 7 88.81 100.56 2 28.57
21699. Jimbo (jimboolio) 7 38.52 40.42 0 0.00
21700. Jessica (jessicapeng) 7 114.37 125.38 4 57.14
21701. Jenerikk (jenerikk) 7 89.72 104.51 1 14.29
21702. jeff (jeffdujon) 7 103.26 120.64 2 28.57
21703. Jecong (jecong) 7 83.49 100.89 2 28.57
21704. Jeffrey (jebbythepanda) 7 112.92 126.00 3 42.86
21705. Jay (jdpthota) 7 92.80 101.39 2 28.57
21706. jA_eur0 (ja_eur0) 7 105.05 119.46 4 57.14
21707. Jay (jay_rush) 7 80.00 89.08 5 71.43
21708. Jayden (jayden_1) 7 62.36 72.11 1 14.29
21709. Jhun Chester (jaycel19) 7 76.33 94.15 1 14.29
21710. Jason (jasonfong06) 7 80.76 91.70 3 42.86
21711. Jasdeep (jasdeepp21) 7 40.43 45.52 0 0.00
21712. Jake (jarljake) 7 74.02 80.88 0 0.00
21713. James (jamesvereen) 7 69.55 75.68 2 28.57
21714. Jakob (jakob170201) 7 57.16 63.22 0 0.00
21715. Nirav Jain (jainnirav88) 7 65.98 70.70 2 28.57
21716. Hello (jadensmith7) 7 102.80 114.86 1 14.29
21717. jacie (jackieblackie3) 7 44.63 49.30 0 0.00
21718. Conner (jabronee) 7 105.43 111.55 1 14.29
21719. Bad (iwillgetbetterattyping) 7 70.47 79.13 2 28.57
21720. Ivo (ivosu_10) 7 64.42 74.63 2 28.57
21721. Ivan (ivansucksattyping) 7 108.85 130.11 4 57.14
21722. zn (ittahb) 7 100.56 117.45 3 42.86
21723. Ichirou (itskotami) 7 69.34 78.03 2 28.57
21724. Jay-Ar (itsjerr) 7 78.97 99.77 2 28.57
21725. Allan (itsgam3tyme) 7 98.06 105.41 3 42.86
21726. Everett (istorm_light) 7 101.98 110.42 6 85.71
21727. iStealthy (istealthy) 7 115.03 138.84 6 85.71
21728. Tyler (isharity) 7 86.03 92.62 3 42.86
21729. Isc (isc30) 7 71.31 80.56 2 28.57
21730. ironjill (ironjill) 7 89.05 98.59 4 57.14
21731. iRqx (irex_) 7 101.02 108.75 5 71.43
21732. Aidan (ireallylovehockey) 7 88.27 99.05 1 14.29
21733. Matt (iproz) 7 90.22 98.41 2 28.57
21734. Quang (ionlyvayne) 7 83.83 101.67 4 57.14
21735. Invincibolos (invincibolos) 7 70.10 82.53 2 28.57
21736. David (inspectahmellow) 7 81.08 96.02 3 42.86
21737. indian_lad365 (indian_lad365) 7 60.65 67.10 1 14.29
21738. Eli (incarnis1) 7 103.57 113.66 2 28.57
21739. Anshorullah (imugetsu6) 7 86.05 102.25 2 28.57
21740. Imme (immevdb) 7 78.03 81.23 3 42.86
21741. Your Mom (imgonnalose69) 7 132.60 141.30 6 85.71
21742. iluvv (iluvv) 7 90.95 94.30 0 0.00
21743. Waaa (iiblazed) 7 59.85 64.50 1 14.29
21744. fuc (ihumpdogs) 7 75.85 80.47 3 42.86
21745. Kenneth (iflippy) 7 114.74 134.16 3 42.86
21746. Bob (ieatyou1) 7 71.44 91.82 0 0.00
21747. Benjamin (idioticben05) 7 103.08 114.05 4 57.14
21748. icon (iconicck) 7 81.43 93.08 1 14.29
21749. Stella (iceeigloo) 7 76.53 91.08 2 28.57
21750. iaxx (iaxx) 7 114.95 131.69 3 42.86
21751. Ian (ian_k_john) 7 70.62 89.96 0 0.00
21752. Helen (iamhelenkeller) 7 74.28 78.59 1 14.29
21753. Ben (hutben) 7 91.65 107.36 4 57.14
21754. Hunt (huntzhang) 7 81.51 96.84 5 71.43
21755. Trần Khải Hưng (hunglc... 7 52.77 58.18 2 28.57
21756. Hossein (hossein_nas) 7 89.19 103.81 4 57.14
21757. air (hopeberries) 7 81.81 103.18 4 57.14
21758. Pham (hitpointsss) 7 95.87 112.23 1 14.29
21759. himanshu (himanshukamani) 7 27.00 30.95 3 42.86
21760. himaji (himaji) 7 70.91 81.64 2 28.57
21761. DvorakRacer (higginsishere) 7 103.46 120.27 3 42.86
21762. Hamza (hhaammzzaa) 7 49.59 60.56 1 14.29
21763. Henry (hezzmasterflash) 7 42.50 53.06 0 0.00
21764. HennesseyDrew (hennydrew) 7 89.51 104.09 2 28.57
21765. Henry (henburger) 7 86.41 99.17 0 0.00
21766. deckard (hell_bovine) 7 104.32 112.37 4 57.14
21767. Victor (helixidron) 7 117.87 137.34 3 42.86
21768. helios (helios69) 7 62.55 72.28 0 0.00
21769. John (helion_) 7 65.84 69.52 2 28.57
21770. Kushagr (heavenclaw) 7 34.43 36.78 0 0.00
21771. vineet (headspace_men) 7 76.98 87.41 3 42.86
21772. Hazem (hazemmy) 7 73.66 80.34 1 14.29
21773. Hatcheco (hatcheco) 7 67.41 77.32 2 28.57
21774. Mehedi Hasan Emo (hasanemo654) 7 71.61 79.77 2 28.57
21775. Harrius (harrius) 7 95.30 109.00 1 14.29
21776. Ignas (harord) 7 49.61 55.01 3 42.86
21777. HARN0LD (harn0ld) 7 80.01 87.39 1 14.29
21778. Harm (harm_) 7 79.75 84.91 6 85.71
21779. Hari (hari_prasath_25) 7 55.42 61.37 2 28.57
21780. Xcentrick (hardiksince1987) 7 46.21 56.73 0 0.00
21781. benhalfpap (happypappy21) 7 123.53 131.53 3 42.86
21782. Harrison (happyg) 7 110.69 124.54 4 57.14
21783. Bish (haogy101) 7 80.76 93.31 4 57.14
21784. HASG (hamzaelgarhy) 7 30.56 34.64 1 14.29
21785. Hamschi (hamschi) 7 74.81 82.02 3 42.86
21786. hahaha (hahaha6969) 7 85.21 101.09 2 28.57
21787. Harry (h3h3pul4t0r) 7 133.87 139.02 4 57.14
21788. Tájpolósch (gunnhallur) 7 84.00 90.48 3 42.86
21789. Jamie (gumboll) 7 78.62 87.82 6 85.71
21790. jeremy (grrmee) 7 87.19 94.18 3 42.86
21791. Gray (grayhollow) 7 82.56 94.82 3 42.86
21792. Siddhartha (gravito12345) 7 94.43 108.93 3 42.86
21793. Rocco (grapefruit95) 7 73.66 80.40 0 0.00
21794. Gracie (graciemyers123) 7 78.22 88.73 4 57.14
21795. Elias (gottabefast) 7 125.26 137.17 4 57.14
21796. Tylor (goofy_goober2006) 7 54.29 67.30 0 0.00
21797. Gonzalo (gonzalocl1024) 7 49.96 59.91 0 0.00
21798. Gold_Borg (gold_borg) 7 44.46 58.14 5 71.43
21799. Konnie (goldentiny) 7 52.91 61.67 1 14.29
21800. lucas (godofthegods111) 7 53.19 58.04 1 14.29
21801. godofpainTR (godofpaintr) 7 85.16 99.10 7 100.00
21802. Gmlord (gmlord) 7 66.88 83.75 1 14.29
21803. Tiago (glinski) 7 67.47 79.50 2 28.57
21804. johnni (gleaned) 7 83.80 93.60 1 14.29
21805. Gislaa (gislaaa) 7 96.00 103.33 3 42.86
21806. Gio (giniguy) 7 88.34 98.66 3 42.86
21807. NinjR (gingerninjr) 7 105.98 115.99 1 14.29
21808. Gilson (gilsoncav) 7 53.42 58.53 1 14.29
21809. GidbinN (gidbinn) 7 82.31 88.95 3 42.86
21810. Gaby's (ggaby) 7 38.60 44.05 0 0.00
21811. gabriel (gfox66) 7 96.38 104.54 6 85.71
21812. George (georgecook) 7 51.82 62.61 0 0.00
21813. C:\cmd (geodev) 7 52.57 62.27 3 42.86
21814. James (gemvoo) 7 95.10 109.62 4 57.14
21815. Gerry (gchenfc) 7 98.18 103.49 3 42.86
21816. Grant (gbuff) 7 87.24 94.80 1 14.29
21817. gavin (gavyoung) 7 30.85 35.86 2 28.57
21818. Gav (gav576) 7 123.26 141.02 4 57.14
21819. Dennis (gardpm) 7 90.14 106.67 5 71.43
21820. Gabboxl (gabboxl) 7 60.15 61.71 1 14.29
21821. D (g1ddriver) 7 70.16 75.84 0 0.00
21822. Vaeciar (fusionn) 7 101.34 115.63 3 42.86
21823. furzoz (furzoz) 7 95.95 105.95 3 42.86
21824. funny (funnybus) 7 81.93 100.71 3 42.86
21825. Anh (fujiwarakazuki) 7 93.37 105.06 0 0.00
21826. jaacouub (fsnxward) 7 111.06 123.22 3 42.86
21827. Pedrovski (frosteye) 7 51.00 60.31 5 71.43
21828. Frisk00 (frisk00) 7 85.88 105.93 2 28.57
21829. Weeb (fredfaye) 7 76.33 84.20 0 0.00
21830. Vlad (foxonwave) 7 70.07 76.67 2 28.57
21831. hola (foocaaat) 7 80.34 94.51 3 42.86
21832. Georgia (fobpatdmcr) 7 54.57 63.01 1 14.29
21833. Fliqqr (fliqqr) 7 89.25 95.17 2 28.57
21834. fajar (fjr123) 7 19.51 32.42 0 0.00
21835. FireHydra (firehydra) 7 51.09 52.86 1 14.29
21836. Winsharp (fimannax) 7 68.54 82.63 3 42.86
21837. Vishal (fieryhydra) 7 86.02 102.50 4 57.14
21838. Fideon (fideon) 7 113.84 133.33 4 57.14
21839. FHVirus (fhvirus) 7 73.58 87.81 1 14.29
21840. Few (fewhakko) 7 81.42 93.06 1 14.29
21841. untechno (fersist) 7 120.42 134.31 3 42.86
21842. Ferc (ferco) 7 53.44 66.24 2 28.57
21843. FeN11x (fen11x) 7 112.81 125.04 4 57.14
21844. Felix (feliksen) 7 80.00 88.60 2 28.57
21845. Feela (feela) 7 53.83 59.97 0 0.00
21846. Steve (feedthejoe) 7 78.58 85.42 1 14.29
21847. FEDERICO (fedecochi) 7 68.20 71.13 3 42.86
21848. Tyrone (fastesthackertyper) 7 115.64 132.63 4 57.14
21849. Farzaan (farzaan) 7 45.07 48.74 1 14.29
21850. FartESport (fartesport) 7 58.29 69.57 3 42.86
21851. Free Palestine (farmahorro) 7 105.41 119.43 2 28.57
21852. @fahmi_2504 (fahmiramadhan) 7 80.65 87.89 0 0.00
21853. dave (fadedave) 7 79.80 88.63 5 71.43
21854. Ian (exeboi) 7 72.37 81.54 1 14.29
21855. e (ex21424) 7 99.33 108.35 3 42.86
21856. Teez (evofury) 7 81.47 89.43 3 42.86
21857. E (etyperacer) 7 78.98 88.92 2 28.57
21858. Erly (erlynorbel) 7 78.82 86.03 5 71.43
21859. irand (eppyprime) 7 69.69 78.22 2 28.57
21860. deez (epicguy69) 7 51.97 57.61 0 0.00
21861. Ramya (envisage) 7 62.74 70.31 1 14.29
21862. Dusa (enjdusan) 7 85.13 95.77 1 14.29
21863. Jason (energetichay) 7 116.63 136.38 3 42.86
21864. Emin (eminspeedtyper) 7 91.47 108.61 3 42.86
21865. Francis (emeritusninoy) 7 108.72 117.53 4 57.14
21866. Emek (emekc) 7 81.07 97.40 3 42.86
21867. Diego (el_villas) 7 74.00 82.95 1 14.29
21868. Elmo (elmotlk) 7 76.04 83.37 1 14.29
21869. ekoth (ekoth) 7 89.09 98.97 3 42.86
21870. Striker09125 (eiren233) 7 71.58 77.32 2 28.57
21871. Miles (eightmiles27) 7 89.36 103.69 3 42.86
21872. Hsu (eh643027) 7 76.09 84.75 1 14.29
21873. EenPotjeMetJam (eenpotjemet... 7 79.72 87.81 2 28.57
21874. Marcia (eedoit) 7 73.95 79.23 3 42.86
21875. Ed (edwinl707) 7 74.46 84.49 3 42.86
21876. Raf (edorableraf) 7 74.31 84.72 3 42.86
21877. Edigar (edigar) 7 48.68 55.06 0 0.00
21878. Ed (edfed) 7 60.20 82.46 2 28.57
21879. Liz (easwans) 7 97.03 119.14 1 14.29
21880. Suyog (earthisflat) 7 92.27 104.73 0 0.00
21881. Luis (ealjkl) 7 58.64 65.38 3 42.86
21882. anagolr (eagle0523) 7 127.62 136.94 6 85.71
21883. Dylan Smith (dylanfromwinni... 7 105.39 119.66 4 57.14
21884. Duong (duong_n) 7 89.59 117.32 1 14.29
21885. andrew (duncan01) 7 70.39 77.11 4 57.14
21886. Dulappy (dulappy) 7 83.11 89.25 2 28.57
21887. Jason (duckyboi) 7 92.24 100.94 4 57.14
21888. daniel (dsong56) 7 100.89 113.23 2 28.57
21889. Terminator (dr_nefarious) 7 97.44 111.06 5 71.43
21890. Samad (dr_drakonix) 7 89.17 98.19 2 28.57
21891. drowez1 (drowez1) 7 96.56 109.11 2 28.57
21892. Eshelmen (drguru) 7 102.44 112.79 4 57.14
21893. light (drawyeh) 7 86.42 94.69 3 42.86
21894. Joakim (draghman) 7 74.25 107.32 6 85.71
21895. Ali (dracius16) 7 100.85 115.26 2 28.57
21896. Andrea (dr3vv) 7 66.67 75.03 3 42.86
21897. Don (dpease7894) 7 139.14 149.05 5 71.43
21898. Do (dothanhtungnb602) 7 56.61 58.93 0 0.00
21899. Dr.D (donghuh601) 7 84.47 99.24 2 28.57
21900. Dominus (dominuslucifer) 7 101.95 111.97 5 71.43
21901. Dominic (dominiccarroll) 7 132.77 151.08 3 42.86
21902. Guy (doge_btw) 7 91.28 103.09 3 42.86
21903. Peter (doc_chungles) 7 91.82 108.04 1 14.29
21904. Dman27 (dman27) 7 68.26 73.26 4 57.14
21905. djchicken (djchicken) 7 64.39 74.42 1 14.29
21906. Ali (divine_typer) 7 59.34 69.82 1 14.29
21907. Dilhan (disgruntled_lemon) 7 68.63 77.57 4 57.14
21908. soup (dirtsoup) 7 73.62 85.25 0 0.00
21909. dimcho (dimisoma12) 7 46.00 51.92 0 0.00
21910. Dewi (dibdabdebby) 7 57.85 64.25 7 100.00
21911. Alaa (diamondtda) 7 78.91 87.99 2 28.57
21912. māvi (dhsnxz) 7 68.89 73.80 1 14.29
21913. Dexter (dexterkun16) 7 63.37 79.79 2 28.57
21914. yo (demailman) 7 115.46 131.05 4 57.14
21915. follow (deleonhle) 7 132.74 145.94 4 57.14
21916. Riley (dedalus) 7 42.09 53.39 1 14.29
21917. debois (debois) 7 84.21 96.43 3 42.86
21918. Veros (deadtwinkz) 7 48.85 57.41 3 42.86
21919. Dylan (dddking) 7 107.96 119.34 4 57.14
21920. Davr (davr) 7 68.54 75.67 2 28.57
21921. David (davgoeck) 7 66.08 73.70 3 42.86
21922. Darkmacsek9 (darkmacsek9) 7 61.64 78.43 0 0.00
21923. John (danred12344) 7 84.17 96.93 5 71.43
21924. daniel (daniel8028) 7 89.83 104.06 4 57.14
21925. Daniel (danguydudebro) 7 96.59 108.14 7 100.00
21926. Danyal (danazeem) 7 65.50 76.85 5 71.43
21927. Deyl (daleaparejado) 7 83.39 94.28 3 42.86
21928. Dakeku (dakeku123) 7 110.06 120.76 5 71.43
21929. dag (dagweg) 7 56.71 64.66 0 0.00
21930. Daffa (daffagusmara31) 7 84.64 90.19 2 28.57
21931. Jeremy (daddystravinsky) 7 108.30 132.03 3 42.86
21932. Elia (d0inky) 7 76.10 85.91 1 14.29
21933. d0bu (d0bucookie) 7 92.34 111.39 3 42.86
21934. David (cydmium) 7 84.40 92.97 3 42.86
21935. nixon (cxboy) 7 74.52 83.36 7 100.00
21936. 🍓 (crustyyy) 7 38.23 41.01 0 0.00
21937. Matthew (crucifix13) 7 104.92 116.16 3 42.86
21938. Daniel (crossfittypist) 7 128.43 140.59 4 57.14
21939. Joseph (cronul) 7 84.63 96.14 4 57.14
21940. Oliver (crocell) 7 68.15 78.91 2 28.57
21941. Cristian (cristian0017) 7 76.35 82.74 1 14.29
21942. crisna (crisnaxx) 7 41.33 46.13 1 14.29
21943. Tony (creampuffy) 7 99.43 123.38 3 42.86
21944. Raphael (crazydrmad) 7 64.85 81.98 2 28.57
21945. CrazyConrad (crazyconrad) 7 72.15 82.64 5 71.43
21946. Kayli (crackerjap) 7 93.69 98.46 6 85.71
21947. Nima (cosmocrat) 7 113.74 129.92 3 42.86
21948. coraline (coraline19) 7 73.38 83.91 2 28.57
21949. day (const_bored) 7 55.44 73.18 4 57.14
21950. conjae (conjae) 7 95.70 106.14 4 57.14
21951. Colt (coltthenark) 7 93.88 107.73 3 42.86
21952. ⁤ (collin_) 7 56.14 62.88 3 42.86
21953. Coels (collie321) 7 72.12 98.28 4 57.14
21954. cold_blood (cold_blood) 7 49.84 52.51 0 0.00
21955. Collin (code_gs) 7 94.69 102.42 4 57.14
21956. Henry (codaassasin) 7 128.44 141.20 3 42.86
21957. Cobra (cobra03) 7 101.28 115.45 3 42.86
21958. sand (cloudth) 7 69.30 80.99 1 14.29
21959. Clickau (clickau) 7 87.28 90.88 1 14.29
21960. George (cleaves) 7 71.37 78.71 1 14.29
21961. Clarb (clarb) 7 75.99 86.98 2 28.57
21962. CK (ckokobean) 7 99.22 120.75 6 85.71
21963. tstats[Cisco516] (cisco516) 7 74.58 82.53 1 14.29
21964. Chuse (chuse) 7 80.73 86.41 2 28.57
21965. chumchumlol (chumchumlol) 7 85.23 90.24 3 42.86
21966. Chuby_j (chuby_j) 7 76.89 86.03 7 100.00
21967. Chronical (chronical_) 7 131.61 142.34 4 57.14
21968. (chromehearts) 7 125.68 135.58 6 85.71
21969. Chris (chriss_maoo) 7 79.74 98.75 5 71.43
21970. Choosecake (choosecake) 7 77.97 87.56 1 14.29
21971. stephen (chonky_boi) 7 60.14 68.16 1 14.29
21972. CHKR (chkr) 7 87.21 94.53 2 28.57
21973. Harishraj (chintubro) 7 85.42 92.36 1 14.29
21974. Chezhiyan (chezhiyan) 7 76.61 86.48 2 28.57
21975. Chris (chee_ms) 7 97.30 106.97 1 14.29
21976. mew (cheeboard) 7 103.24 110.14 4 57.14
21977. Cory (chamblin) 7 109.87 116.98 3 42.86
21978. ASAP LiL Fat Chalsy (chalscc) 7 71.32 79.18 1 14.29
21979. Chadgoomba (chadgoomba) 7 71.04 89.42 1 14.29
21980. cbdm (cbdm) 7 78.72 95.08 0 0.00
21981. CARL (carlkwan) 7 102.01 113.55 4 57.14
21982. Kamjue (camweb_01) 7 43.58 46.51 1 14.29
21983. Calen (calen64) 7 89.02 96.87 5 71.43
21984. Caleb (caleb1243) 7 99.26 109.72 1 14.29
21985. van (cakeblanket) 7 102.70 110.40 2 28.57
21986. Caffeine (caffeinereptile) 7 53.96 59.59 1 14.29
21987. Wesley (c3tangies) 7 89.04 97.23 2 28.57
21988. by (by_law) 7 56.56 64.55 3 42.86
21989. David (butterdawg) 7 83.27 86.98 2 28.57
21990. Maun (bubblojoe) 7 71.48 77.11 0 0.00
21991. Julia (bskdjewels) 7 93.93 108.10 3 42.86
21992. Ben (brokenace) 7 68.63 83.74 6 85.71
21993. Brojo (brojokm) 7 55.29 59.84 0 0.00
21994. Brian (briankusuma) 7 53.23 61.68 2 28.57
21995. Luca (brentspiner) 7 61.02 68.52 3 42.86
21996. Brennan (brennanfisher) 7 69.50 82.18 1 14.29
21997. Brandon (brandondodododo) 7 95.18 102.61 1 14.29
21998. Brandon (brandoncc) 7 61.33 78.87 2 28.57
21999. Wayne (boucherwayne78) 7 75.24 87.88 6 85.71
22000. bowei (botheburp) 7 63.80 70.46 1 14.29
22001. Boshi (boshiwastaken) 7 89.93 102.69 7 100.00
22002. 0902bo (boowie27) 7 44.16 47.85 0 0.00
22003. Space Cowboy (booqueefius69... 7 108.67 135.16 5 71.43
22004. Bongos (bongos_h2o) 7 51.67 61.99 0 0.00
22005. Boncho (bochl1n) 7 98.51 114.12 5 71.43
22006. Bluey (blu_ey) 7 87.72 97.46 1 14.29
22007. Christopher Szabo (bluepizza2) 7 56.04 68.96 1 14.29
22008. Alex (blueninja11103) 7 86.08 102.51 1 14.29
22009. FAHH! (blorfo) 7 44.47 46.30 0 0.00
22010. blobfish (blobfishk) 7 85.20 94.16 1 14.29
22011. Cdrc (blo5) 7 68.58 85.51 0 0.00
22012. Aakash (blaze_type) 7 49.83 54.99 1 14.29
22013. Blast (blast_craft) 7 72.24 78.63 2 28.57
22014. tstats[blannk] (blannk) 7 41.57 56.84 0 0.00
22015. Bladehunter (bladeyz) 7 57.15 67.24 1 14.29
22016. BK (bk21) 7 80.59 88.69 1 14.29
22017. ⠀⠀⠀ (bioluminescent) 7 89.33 99.67 2 28.57
22018. Alex (bigbrian123) 7 74.14 78.12 0 0.00
22019. Aidan (biccythiccy) 7 117.39 124.07 5 71.43
22020. Bhumika (bhumika111) 7 25.32 27.27 2 28.57
22021. betterscramblelikeanegg (be... 7 89.44 99.68 2 28.57
22022. Alfred (bestluxeu) 7 83.98 88.85 2 28.57
22023. Brutale (benvan) 7 82.26 91.53 4 57.14
22024. (benkemal) 7 78.29 83.55 3 42.86
22025. Beksultan (beksultan2001) 7 55.49 65.69 0 0.00
22026. William (beholder92) 7 82.63 99.48 2 28.57
22027. Brad (beardedbradtv) 7 106.28 116.52 7 100.00
22028. beansnboges (beansnboges) 7 81.78 97.15 2 28.57
22029. Blake (bcdelrey) 7 83.71 91.84 2 28.57
22030. Keong (baygonstroberi) 7 73.37 85.13 3 42.86
22031. baxis (baxis) 7 61.97 66.80 0 0.00
22032. Jonathan (baldunker1) 7 73.10 79.71 1 14.29
22033. mohammad (ballisticfpz) 7 66.49 71.37 0 0.00
22034. Dario (baldoius) 7 97.49 113.25 7 100.00
22035. Badral (badralz) 7 84.50 90.14 6 85.71
22036. Ahmed (backslashero) 7 85.53 95.45 3 42.86
22037. ai fachri (a_ifachri) 7 60.19 67.16 2 28.57
22038. azef (azef) 7 65.89 70.09 3 42.86
22039. John (azaza909) 7 130.25 147.14 5 71.43
22040. ayoub50 (ayoub50) 7 82.06 89.97 3 42.86
22041. Andrew (axi_andrew) 7 79.68 88.11 1 14.29
22042. CapooLife (awesomevincent) 7 70.74 89.72 1 14.29
22043. B (awadf) 7 40.15 45.67 1 14.29
22044. Andre (avmoura) 7 74.16 96.49 1 14.29
22045. Avinash (avee_nash) 7 62.25 73.06 1 14.29
22046. Austin (austins350) 7 129.04 142.17 3 42.86
22047. Aidan (attan090) 7 70.28 79.41 1 14.29
22048. Atlasov (atlasnik) 7 21.42 23.78 1 14.29
22049. Atira (atirakun) 7 94.58 106.65 4 57.14
22050. Atiqur (atiqrr) 7 40.06 44.65 1 14.29
22051. Aaron (atg2142) 7 96.37 114.41 1 14.29
22052. astrid (astridtherat) 7 60.47 76.33 1 14.29
22053. Asta (astadweller) 7 80.03 105.85 4 57.14
22054. Aslan (aslanchan7) 7 78.42 87.15 1 14.29
22055. TheChosenOne (askthewizard) 7 104.49 119.80 3 42.86
22056. askryuzaki (askryuzaki) 7 92.03 112.84 5 71.43
22057. Ashot (ashotmovsisyan) 7 37.30 41.21 0 0.00
22058. Ashish (ashish14) 7 62.55 71.79 1 14.29
22059. Rohan (ashavijaysukne) 7 64.47 72.68 1 14.29
22060. Heemy (asdfm) 7 86.90 106.61 3 42.86
22061. ArtyGaming (artygaming) 7 104.52 116.99 7 100.00
22062. Arthur (arthur_007) 7 67.25 79.15 1 14.29
22063. Artemis (artemyx) 7 77.65 86.21 5 71.43
22064. arrantfox (arrantfox) 7 42.50 48.79 2 28.57
22065. Arkinator (arkinator) 7 101.07 117.82 5 71.43
22066. Argon (argon11110) 7 111.41 126.28 3 42.86
22067. rommyarb (arbantas) 7 75.19 84.28 1 14.29
22068. artahian (aram90) 7 130.61 148.08 4 57.14
22069. AtM5 (araconda) 7 90.91 101.71 2 28.57
22070. hi (appleeee) 7 64.89 69.68 1 14.29
22071. Deceime (applebabycare) 7 106.81 115.02 4 57.14
22072. Anuvrat (anuvrat) 7 94.40 100.45 3 42.86
22073. antloflow (antloflow) 7 39.60 47.14 0 0.00
22074. Antlocwe (antlocwe) 7 83.00 106.41 0 0.00
22075. Raisin (annielam) 7 71.81 82.58 1 14.29
22076. Anmol (anmol_786) 7 38.53 44.30 0 0.00
22077. Connor (animegorl2000) 7 67.80 83.61 0 0.00
22078. Tu (anhtu96) 7 103.93 122.11 2 28.57
22079. angie (angelow) 7 52.20 65.76 0 0.00
22080. Andrew (andrewmosey) 7 71.65 77.13 5 71.43
22081. Andrew (andrew03) 7 73.00 87.01 0 0.00
22082. anavel (anavel03) 7 79.69 94.15 2 28.57
22083. K N (ananthan2k) 7 72.30 76.00 0 0.00
22084. Amy (amytypes123) 7 123.38 134.86 5 71.43
22085. Amr (amrhachicho) 7 90.34 101.38 4 57.14
22086. T2DR (amogussus) 7 53.79 59.66 4 57.14
22087. amine (aminerdene17) 7 44.86 50.51 0 0.00
22088. John (amhacking) 7 82.17 86.54 1 14.29
22089. a (aly394) 7 97.39 115.43 2 28.57
22090. al (alpasto) 7 60.29 73.04 1 14.29
22091. Eva (allyve) 7 56.19 65.43 3 42.86
22092. Matthew (allotec) 7 62.60 73.17 1 14.29
22093. a (allorang) 7 113.80 134.36 4 57.14
22094. Alif (alif_) 7 50.25 55.41 0 0.00
22095. Alex (alexthegamer281) 7 88.98 100.09 4 57.14
22096. Alex (alexkyo) 7 85.44 102.28 2 28.57
22097. Alex (alexbananex) 7 55.43 62.05 2 28.57
22098. Tiger (alcatrazx) 7 68.78 80.58 4 57.14
22099. Alan (alansanchez) 7 105.95 118.36 4 57.14
22100. Alaa (alaasultan) 7 27.43 30.41 1 14.29
22101. Veedora (akuyepe) 7 95.46 103.41 7 100.00
22102. Peter (akr0nik) 7 104.07 115.23 6 85.71
22103. Squall (akaisquall) 7 107.61 126.48 5 71.43
22104. Roberto (ajaxlord28) 7 83.72 99.91 3 42.86
22105. Rob (airgo32) 7 82.88 94.37 3 42.86
22106. Ahmed (ahmed_elamory) 7 66.85 73.96 2 28.57
22107. niz (ahegao_hunter) 7 76.06 93.55 1 14.29
22108. I_like_Billie_Eilish (agiun... 7 63.91 71.88 0 0.00
22109. reyal171_ (agdplayer64x) 7 75.57 91.94 3 42.86
22110. Muh. Habibi (agemagi) 7 93.10 101.12 1 14.29
22111. afq984 (afq984) 7 73.58 79.62 3 42.86
22112. Rui (adranos) 7 100.98 108.05 4 57.14
22113. aditya (addy2001) 7 52.25 54.27 1 14.29
22114. Ace (ace_axk) 7 57.31 69.44 5 71.43
22115. iquitwhenimakemistake (ace_... 7 92.08 102.15 5 71.43
22116. Abum (abum) 7 62.59 76.36 1 14.29
22117. ac (abpqjbdhsj) 7 61.86 75.31 0 0.00
22118. Abdurrahman (abood_abu_jawad) 7 51.13 55.89 1 14.29
22119. ABIZABI (abizabi) 7 61.19 69.52 1 14.29
22120. Abdulwahab (abdulwahabksa) 7 95.94 114.80 5 71.43
22121. زياد (aatrox0_0) 7 90.01 105.44 3 42.86
22122. Tony (aarup) 7 114.99 140.07 5 71.43
22123. Aaron (aaronoct) 7 46.38 55.11 0 0.00
22124. Anthony (aantho) 7 98.69 108.33 7 100.00
22125. Elias (9elias) 7 103.86 112.31 4 57.14
22126. Akira (8amb1) 7 64.09 72.13 4 57.14
22127. 86hawks (86hawks) 7 85.51 94.48 2 28.57
22128. G00N (600n) 7 45.85 51.56 0 0.00
22129. Dj (4tonystanit) 7 90.96 106.82 0 0.00
22130. artie (4rtie) 7 73.07 92.15 2 28.57
22131. 4aeon (4aeon) 7 98.60 109.53 1 14.29
22132. Adam (420adam) 7 60.02 70.34 1 14.29
22133. Rachin (33rachin) 7 76.05 84.62 3 42.86
22134. Omar (22omar) 7 42.48 50.36 0 0.00
22135. Tomazio99 (tomazio99) 7 52.28 54.90 0 0.00
22136. Primez (tff_primez) 7 88.00 101.85 1 14.29
22137. Emmanuel (manu_0717) 7 45.02 50.90 0 0.00
22138. Lazer (lazer_michael68) 7 87.69 99.56 4 57.14
22139. Charles (snarls_charles) 7 60.08 69.81 1 14.29
22140. Alan (cabinbeaver) 7 95.14 102.81 4 57.14
22141. neec (neec) 7 58.05 62.92 0 0.00
22142. haziq (gleam467) 7 47.43 55.14 0 0.00
22143. Ed (edddddddie) 7 72.29 77.66 3 42.86
22144. Abdulkader (abdulkader_safi) 7 26.41 29.75 2 28.57
22145. Long (tphl) 7 43.81 57.70 2 28.57
22146. shine (shinepagne) 7 77.60 83.08 4 57.14
22147. Tyron (cerebral_sustenance) 7 66.07 72.39 6 85.71
22148. Ohze (ohze) 7 113.79 133.41 4 57.14
22149. agz (xagz) 7 87.43 92.98 3 42.86
22150. Nathan (yourhomienate) 7 90.85 102.69 2 28.57
22151. Sawad (myrstival) 7 83.42 96.83 1 14.29
22152. Matt (hadot) 7 91.18 105.78 3 42.86
22153. Cat (littlecaaat) 7 76.97 84.09 4 57.14
22154. Felix (kirken) 7 56.73 67.27 2 28.57
22155. rainy (rainypay) 7 40.25 55.81 0 0.00
22156. Reagan (bigsquidwardmomma) 7 50.78 55.55 2 28.57
22157. SHAHIN (shahin98) 7 52.79 64.07 3 42.86
22158. Mykailah (mykailahk) 7 85.32 96.90 5 71.43
22159. PleasedPanda (pleasedpanda) 7 53.20 61.16 1 14.29
22160. Ian (burgerleadr) 7 72.00 79.10 2 28.57
22161. Jahns (lewflo) 7 84.79 98.99 3 42.86
22162. Jimbo toot n fart (shakenfake) 7 84.66 88.71 2 28.57
22163. Whitsy (driedss) 7 87.09 105.03 2 28.57
22164. BleaKrytE (bleakryte) 7 80.18 86.11 1 14.29
22165. Luke (itscrucial) 7 72.67 82.58 1 14.29
22166. Ben (benthedink8) 7 106.92 116.21 1 14.29
22167. Neil Cyril (cycy501) 7 69.77 84.12 1 14.29
22168. 40wpm beta (tenseworthy) 7 74.93 82.78 5 71.43
22169. Nicolas (anicolas26) 7 95.44 105.66 1 14.29
22170. Ákos (mrazakos05) 7 51.95 55.73 0 0.00
22171. sami (sammiethelamest) 7 80.93 98.09 3 42.86
22172. Samuel (cornymovie) 7 32.95 44.92 0 0.00
22173. Elis (speedyboio) 7 37.67 43.98 1 14.29
22174. Alex (imalexorange) 7 88.72 109.47 1 14.29
22175. Caleb (caleb2099) 7 79.57 96.33 0 0.00
22176. Angela (midnitelady1889) 7 81.94 90.80 4 57.14
22177. FIFI (fi_fi) 7 48.35 56.18 6 85.71
22178. nathan (muskratz) 7 98.60 133.70 1 14.29
22179. Nivedit (_nivedit_) 7 67.43 75.50 0 0.00
22180. tacohiro (tacohiro) 7 83.68 98.31 2 28.57
22181. VictorOTrumper1 (apulh1) 7 44.60 53.54 0 0.00
22182. test (eratest) 7 42.99 55.64 2 28.57
22183. Sean (minutoh) 7 112.80 127.28 5 71.43
22184. Cahetel (hyperkevenau) 7 57.94 65.72 1 14.29
22185. Pawsom (pawsom) 7 35.29 42.49 0 0.00
22186. Satya (jordge) 7 74.42 94.88 2 28.57
22187. seennotheard (seennotheard) 7 106.21 116.49 3 42.86
22188. Lucas (brenkie) 7 73.81 82.14 4 57.14
22189. James (pooman111) 7 79.23 85.31 5 71.43
22190. Darren (chem_notebook) 7 89.30 100.96 6 85.71
22191. lila (t4rtagl1a_) 7 55.78 82.20 0 0.00
22192. Suvarchas (suvarchas) 7 69.47 81.94 3 42.86
22193. នាគអាស៊ី (s... 7 71.98 88.35 3 42.86
22194. Link (crimson_mecha) 7 64.18 70.46 1 14.29
22195. Mamnoon (mamnoon7264) 7 49.12 59.02 2 28.57
22196. WkwK (halwiy76) 7 54.86 59.85 1 14.29
22197. Afif87123 (afif87123) 7 61.36 68.94 1 14.29
22198. Long Nguyen (_longnguyen) 7 60.40 63.87 0 0.00
22199. Jacob (dajacob2335) 7 65.98 81.47 0 0.00
22200. Xang (xangszane) 7 122.82 137.88 4 57.14
22201. Rohan (bobzy) 7 78.06 85.25 0 0.00
22202. rumman (rumman_sust) 7 56.09 71.64 0 0.00
22203. Verde (verdezapo) 7 100.18 111.07 7 100.00
22204. Rogin (robogin123) 7 75.61 84.59 3 42.86
22205. or (ordol) 7 66.82 75.82 5 71.43
22206. DcThaGoat (crxxzz11) 7 73.95 82.56 7 100.00
22207. Tony (diceruler) 7 107.18 115.95 7 100.00
22208. Zach (zachmeikle) 7 60.44 63.92 1 14.29
22209. Jia En (jiaennn) 7 61.46 79.45 1 14.29
22210. Henry (flexion) 7 70.83 78.91 4 57.14
22211. carplist (carplist) 7 42.37 49.37 1 14.29
22212. Edward (mudgoth) 7 75.11 89.61 3 42.86
22213. zir (thywolfie) 7 90.28 102.30 2 28.57
22214. Mbappe (kylian_mbappe) 7 82.94 89.52 3 42.86
22215. Erblin (gherblino) 7 112.11 118.29 6 85.71
22216. Sukhendu (shane690) 7 47.60 53.83 1 14.29
22217. Shafayath Jamil (shafayath_jr) 7 65.88 69.24 2 28.57
22218. Gabby (gubbs_cabubs) 7 92.60 104.66 4 57.14
22219. Vas (vasgergo) 7 31.86 37.65 1 14.29
22220. Rashid (sudaneseterrorist) 7 49.37 56.92 2 28.57
22221. hazem (hazem_1) 7 41.75 48.94 0 0.00
22222. Manuel (manuelol) 7 40.80 47.98 1 14.29
22223. Sabyrzhan (olsabyr) 7 46.22 50.70 2 28.57
22224. Matthew (ankka89) 7 63.28 77.30 2 28.57
22225. John (100024701) 7 54.15 58.87 2 28.57
22226. 5hadow (kuro5hadow) 7 62.39 71.13 0 0.00
22227. James (wm370) 7 87.06 92.74 2 28.57
22228. carson (tenson) 7 94.54 108.01 2 28.57
22229. Tulen (tulen) 7 78.46 83.32 2 28.57
22230. RenitentClaw (renitentclaw) 7 78.65 95.25 1 14.29
22231. Sameer (ssr_) 7 41.88 49.15 0 0.00
22232. Max (max_gomez_) 7 47.15 50.42 0 0.00
22233. AK (akraemer) 7 68.50 73.32 0 0.00
22234. reinaru (reinaru) 7 42.08 49.35 1 14.29
22235. Kevin (ksogata) 7 90.09 106.67 6 85.71
22236. [ M E T A ] (metatea) 7 84.93 91.61 3 42.86
22237. Roshan (eending) 7 65.20 76.77 0 0.00
22238. Jay (ljay24) 7 113.99 124.28 4 57.14
22239. Amber (ammbbbeer) 7 89.91 103.79 4 57.14
22240. Al (cheekybastard) 7 81.60 87.94 2 28.57
22241. Jaysheel (redchief10) 7 42.84 52.42 1 14.29
22242. Anastacio (anastacio123) 7 66.01 72.27 2 28.57
22243. bossing (bosslot) 7 36.77 40.78 0 0.00
22244. Niko (niko2925) 7 34.90 42.58 2 28.57
22245. _loeb (loeb___) 7 88.84 98.24 3 42.86
22246. Ajz (ajzprz) 7 32.87 37.58 0 0.00
22247. Oceans (mnd8) 7 64.19 74.70 4 57.14
22248. Alex (awesomepie01) 7 104.81 118.99 4 57.14
22249. david (etherbyte) 7 59.89 66.64 1 14.29
22250. Alejandro (alejandrok) 7 46.56 52.12 1 14.29
22251. Miha (funny_psycho) 7 46.04 52.54 0 0.00
22252. Dgi (dgi09) 7 51.98 56.89 1 14.29
22253. starin (starin) 7 111.74 133.24 4 57.14
22254. Steveee (stephenomenon21) 7 89.13 102.58 4 57.14
22255. TheDude (sushilbokade) 7 49.45 54.12 0 0.00
22256. TZ (tzid) 7 66.03 77.68 2 28.57
22257. Giorgi (tavalf) 7 56.33 65.92 0 0.00
22258. Muhammad Raheem (_muhammadr... 7 50.48 55.63 0 0.00
22259. cole (tofubaru) 7 96.93 109.56 4 57.14
22260. Brhea (beebopowo) 7 74.83 85.06 4 57.14
22261. Tenzin (daposeidonguy) 7 115.88 130.72 5 71.43
22262. victoria (vhirsh12) 7 89.35 110.04 5 71.43
22263. Samira (samira_zareie) 7 24.58 26.92 0 0.00
22264. Auggie (adogjbaum) 7 91.73 98.85 4 57.14
22265. Ethan (narwhals64) 7 93.22 117.25 6 85.71
22266. Jeffrey (googlerjeff) 7 78.51 89.97 3 42.86
22267. Yous (youssefriz) 7 78.77 88.34 1 14.29
22268. Autumn (autumnleaf05) 7 51.83 61.84 3 42.86
22269. Galahad (galahad49) 7 62.61 71.96 0 0.00
22270. precise (precisexd) 7 49.59 58.36 2 28.57
22271. CrazyV (bigsloth) 7 86.40 102.86 3 42.86
22272. Jakub (_imp) 7 88.43 104.63 2 28.57
22273. Bui Thien (vladimir001) 7 33.45 36.57 4 57.14
22274. the heroic trout (theheroic... 7 72.49 84.15 3 42.86
22275. Cartier (cartierflair) 7 101.56 105.70 2 28.57
22276. Plantpreyer (plantpreyer) 7 74.26 84.11 2 28.57
22277. Apple (iisapplepie) 7 48.47 51.76 0 0.00
22278. 16 Typh (binh0411) 7 50.08 59.43 1 14.29
22279. Juan Andrés (darkandy) 7 54.79 62.46 2 28.57
22280. Srinivas (sublimegallant) 7 51.38 62.84 0 0.00
22281. Jacob (moderndaypoison) 7 101.13 112.22 1 14.29
22282. MooMoo18919 (moomoo18919) 7 95.82 113.55 2 28.57
22283. addison (addisoned) 7 49.37 58.99 2 28.57
22284. _____ (___i__) 6 38.32 42.28 2 33.33
22285. Silver (_silver_) 6 35.86 39.92 0 0.00
22286. _i_am_flash (_i_am_flash_) 6 84.22 92.76 0 0.00
22287. Joshua (_f1shy_) 6 75.68 85.51 1 16.67
22288. Derek (_de_re_k_) 6 75.17 83.59 1 16.67
22289. Adam (_adamart_) 6 63.85 73.82 0 0.00
22290. Fox (zzhenry) 6 118.43 145.34 4 66.67
22291. David (zybazoubek) 6 45.33 56.70 0 0.00
22292. Zvezdi (zvezdityper) 6 58.20 63.28 0 0.00
22293. zurakin (zurakin) 6 64.30 70.52 2 33.33
22294. ZULU (zultrixz) 6 75.77 82.78 2 33.33
22295. Nikita (zubrailx) 6 45.11 49.17 0 0.00
22296. Zack (zt44king) 6 84.22 89.85 2 33.33
22297. Ab (zoro_ab) 6 62.07 70.07 1 16.67
22298. Aidan (zoreoam) 6 120.41 137.60 5 83.33
22299. zonked (zonked) 6 78.40 85.15 2 33.33
22300. pitch (znxxx) 6 62.92 67.77 0 0.00
22301. Shivansh (zneth) 6 53.96 61.57 1 16.67
22302. Zachary (zminuk) 6 96.73 104.77 3 50.00
22303. Zisos (zisos78) 6 67.04 76.04 3 50.00
22304. glow2:wave: selling 3k shar... 6 88.72 96.55 4 66.67
22305. John (zidis) 6 50.24 57.55 1 16.67
22306. Anthony (zhengant) 6 114.08 127.84 3 50.00
22307. Ramazan (zheksenov) 6 75.48 88.08 2 33.33
22308. Zeztix (zeztix) 6 83.39 92.32 2 33.33
22309. Cozmin (zethy03) 6 97.07 107.81 4 66.67
22310. Kevin (zerstu) 6 122.02 134.24 6 100.00
22311. Jovan (zer0neon) 6 87.52 95.83 3 50.00
22312. Zaley (zaleykane) 6 97.37 117.32 5 83.33
22313. guy (zagu) 6 77.16 78.91 2 33.33
22314. Echo (zaffir) 6 95.79 108.52 2 33.33
22315. Zack (zack_mitkin) 6 86.34 99.22 0 0.00
22316. Zac (zackiey) 6 46.59 53.44 2 33.33
22317. Zach (zachstarattack) 6 88.56 101.50 4 66.67
22318. Zachery (zacca113) 6 87.89 95.02 2 33.33
22319. Yvess (yvessu) 6 54.50 63.16 0 0.00
22320. yuvirayz (yuvirayz) 6 101.74 110.63 3 50.00
22321. Yuval (yuvalsaricov) 6 69.32 74.10 0 0.00
22322. yuhaocooper (yuhaocooper) 6 98.52 107.08 1 16.67
22323. Euan (you_an) 6 63.90 68.05 3 50.00
22324. Sock (yourlocalsock) 6 99.58 113.16 4 66.67
22325. Yann (yooaaooy) 6 95.37 104.90 5 83.33
22326. Nioex (yokytra) 6 98.97 112.31 2 33.33
22327. Yogi (yogivaleja) 6 72.57 88.17 1 16.67
22328. Efilio (yodigarcia) 6 93.24 101.46 3 50.00
22329. Yasir (ykhan9514) 6 98.71 109.10 6 100.00
22330. Caleb (yjcc) 6 74.94 93.52 1 16.67
22331. abv (yexela) 6 65.76 76.76 1 16.67
22332. yeogi (yeogi) 6 71.84 77.70 0 0.00
22333. Yeeric (yeeric) 6 89.70 98.74 0 0.00
22334. Leo (yasuomaster) 6 105.10 114.93 3 50.00
22335. WhysoSussy? (yasqueen) 6 65.08 72.99 4 66.67
22336. YanSay (yansay) 6 78.70 86.26 1 16.67
22337. Julianna (yannamoo8) 6 79.73 95.95 2 33.33
22338. Seany (yaboiseanyt) 6 44.67 54.70 0 0.00
22339. Rez (xymomelum93) 6 93.78 99.76 2 33.33
22340. leem (xpar65) 6 62.16 65.43 2 33.33
22341. Galatia (xisnyang) 6 96.66 106.69 1 16.67
22342. Alan (xilog) 6 68.34 79.38 0 0.00
22343. xDuskii (xduskii) 6 90.23 106.31 3 50.00
22344. Massimo (xasaza7) 6 93.27 111.78 3 50.00
22345. Ashley (wyq_ashley) 6 51.16 62.55 0 0.00
22346. Tomas (wtfxdc) 6 65.94 72.80 1 16.67
22347. W (world_hello) 6 109.69 118.36 1 16.67
22348. alcoholnotfree (wonwoohu) 6 54.81 65.26 2 33.33
22349. Wolfen (wolfenshroud) 6 95.27 107.88 2 33.33
22350. Wojtek (wojtexpl) 6 103.79 116.06 3 50.00
22351. Alex (wizardoftime) 6 54.15 59.92 0 0.00
22352. Will (will_to_type) 6 50.81 60.75 0 0.00
22353. William (willyutoo) 6 62.15 64.62 0 0.00
22354. William (williamforrester) 6 89.46 100.68 2 33.33
22355. will (will7460) 6 57.08 62.03 0 0.00
22356. Wild (wildwolfas) 6 67.81 72.64 0 0.00
22357. Francois (wildwolf34) 6 33.51 35.98 0 0.00
22358. Whispie (whispie_) 6 117.10 120.53 4 66.67
22359. Jo (whiffking) 6 134.79 149.52 3 50.00
22360. Uni (whenuniqueusername) 6 77.63 87.48 0 0.00
22361. Poonpipob (wheatley001) 6 85.84 91.71 1 16.67
22362. Adam (whalsey1) 6 102.58 108.83 1 16.67
22363. wel (welneco) 6 93.75 103.39 6 100.00
22364. weeed (weeed) 6 71.67 82.19 1 16.67
22365. Jakub (wasiul) 6 110.26 120.70 4 66.67
22366. Bingy (waesoph) 6 107.70 121.26 1 16.67
22367. brandon (wadawdawdw) 6 110.02 122.14 1 16.67
22368. vverbov22 (vverbov22) 6 77.27 88.58 3 50.00
22369. Daniel (vugla1994) 6 85.89 93.92 1 16.67
22370. Vteawt (vteawt) 6 72.01 79.66 3 50.00
22371. vrush (vrush05) 6 59.01 63.18 0 0.00
22372. Minh (votinh1210) 6 61.39 65.63 1 16.67
22373. (vivector) 6 127.06 139.32 4 66.67
22374. Vishal (vishalnehra) 6 96.32 99.66 1 16.67
22375. Vishal (vishal2376) 6 33.15 41.05 0 0.00
22376. david (vinegar__) 6 82.56 92.93 2 33.33
22377. Victor (victorhz) 6 116.84 127.80 4 66.67
22378. Veseyron (veseyron) 6 61.89 69.33 1 16.67
22379. Vesa (vesaninja) 6 71.19 83.46 2 33.33
22380. Veraxanity (veraxanity) 6 113.90 123.32 5 83.33
22381. _Wapi_ (veqisgay) 6 67.75 71.59 2 33.33
22382. Vince (venvince) 6 81.88 110.12 3 50.00
22383. Ved (ved619) 6 91.17 95.63 2 33.33
22384. Jonathan (vczne) 6 102.85 122.27 2 33.33
22385. Varun (varun170) 6 33.95 39.05 1 16.67
22386. Virgil (vanvirgil_) 6 50.84 59.38 1 16.67
22387. Jimmy (vancouver_canada) 6 72.27 81.44 1 16.67
22388. singhvaibhav100@gmail.com (... 6 90.10 94.03 1 16.67
22389. Aiden (urmom696969) 6 61.77 77.43 1 16.67
22390. urbadheehee (urbadheehee) 6 68.11 79.46 1 16.67
22391. Moth (unleashed_furai) 6 94.54 109.14 4 66.67
22392. John (unikmask) 6 83.41 91.14 2 33.33
22393. Harry (undeadkiller112) 6 61.04 73.61 2 33.33
22394. umbercuc (umbercuc) 6 48.90 54.12 0 0.00
22395. Jose (ultra_instinct_joss) 6 89.75 113.98 6 100.00
22396. duebdab (ultraduebdab) 6 58.36 76.96 2 33.33
22397. ugi (ugiex) 6 46.96 58.87 1 16.67
22398. ufoludek (ufoludek) 6 106.04 117.71 3 50.00
22399. sren (uchiha_itachi347) 6 35.71 41.21 2 33.33
22400. Marcie (u53rn4m374k3n) 6 83.38 90.13 3 50.00
22401. Thomas (t_chow) 6 109.43 125.81 2 33.33
22402. u03 (u03_colemak) 6 101.02 113.31 1 16.67
22403. Ty (ty_clark19) 6 56.96 72.10 2 33.33
22404. Henry (typingtaxi) 6 74.57 80.11 2 33.33
22405. Hans (typer_error) 6 77.05 83.22 2 33.33
22406. j_ (typeracerjay1) 6 86.29 95.21 2 33.33
22407. Tommy (txmmy) 6 63.31 75.24 1 16.67
22408. Tweethashtag (tweethashtag2... 6 42.17 48.07 1 16.67
22409. chicken (turborider4) 6 55.14 59.63 1 16.67
22410. TunaFish026 (tunafish026) 6 33.77 38.08 1 16.67
22411. ten (ttennnnnnnnn) 6 31.93 34.29 1 16.67
22412. boss (tsukuyo) 6 76.55 84.25 1 16.67
22413. call me hani (tsmal3rb) 6 70.36 76.65 3 50.00
22414. Kurowa (treefighterh) 6 101.79 124.98 6 100.00
22415. Torunn (torunntrost) 6 57.01 62.75 6 100.00
22416. Tommy (tortipous) 6 101.22 117.79 4 66.67
22417. Topu (topuraihan) 6 64.27 73.27 0 0.00
22418. mdnh (tongil123) 6 60.54 65.19 0 0.00
22419. mike (tonbae) 6 68.90 83.39 1 16.67
22420. tom (tommmy6) 6 57.76 70.28 0 0.00
22421. Tom (tomllic) 6 55.19 63.80 2 33.33
22422. Ania (to16nks) 6 53.31 60.79 0 0.00
22423. Timothy (tmoux) 6 97.78 120.98 1 16.67
22424. Tristan (tmanthetyper) 6 39.13 45.02 0 0.00
22425. Tinn (tinncann) 6 60.89 83.07 4 66.67
22426. Suspicious Food Tin (timotc) 6 81.25 90.83 1 16.67
22427. Temir (timchis_13) 6 61.70 73.41 1 16.67
22428. Krazy (tilatik) 6 76.62 86.69 0 0.00
22429. Tiku (tiku888) 6 54.80 66.80 1 16.67
22430. Tigran (tigranhakobyan) 6 79.77 90.24 3 50.00
22431. Droxe (tierelutz) 6 99.22 105.16 4 66.67
22432. ThySpoon (thyspoon) 6 85.48 95.99 0 0.00
22433. Marc (thygreat) 6 63.12 71.39 6 100.00
22434. Ma (thyassasin98) 6 100.16 106.27 3 50.00
22435. Thun (thun10121) 6 63.25 76.79 1 16.67
22436. Torsten (thorman42) 6 129.70 147.40 3 50.00
22437. Procrastinator (the_procras... 6 136.74 151.37 4 66.67
22438. The_King (the_king111) 6 67.59 76.73 0 0.00
22439. Brydon (the_blackfish) 6 74.11 80.90 1 16.67
22440. Robin (thetamtm) 6 106.66 117.24 4 66.67
22441. Ya boi (thesmores) 6 96.28 116.23 2 33.33
22442. Simon (thesherlocklayout) 6 77.78 84.45 1 16.67
22443. IM-Z (therealxenogen) 6 80.78 163.72 1 16.67
22444. Pro (theproplayer1278) 6 47.94 52.38 0 0.00
22445. Pizza (thepizzaman2013) 6 90.73 102.00 2 33.33
22446. accurate (thenormalracer) 6 92.58 107.78 1 16.67
22447. Mohit (themp3dark) 6 75.45 82.12 3 50.00
22448. TMW98 (themostwanted98) 6 83.99 94.15 0 0.00
22449. melon (themelongirl) 6 49.95 55.88 0 0.00
22450. random (thelastprime) 6 120.59 134.88 1 16.67
22451. Kevin (thehobokid) 6 103.63 115.72 1 16.67
22452. XPmain (thehashtag) 6 75.57 84.63 2 33.33
22453. hilmi (thefroggy) 6 64.30 66.14 1 16.67
22454. The (thedetails) 6 85.22 93.96 2 33.33
22455. Natalie (thebestaround0509) 6 72.87 94.76 4 66.67
22456. Mario (tennisiscool) 6 69.37 80.34 2 33.33
22457. Michael (tempt) 6 67.26 72.36 1 16.67
22458. Temflakes (temflakes403) 6 98.45 116.73 3 50.00
22459. telmac (telmacblack) 6 90.94 97.83 2 33.33
22460. Marshall (tekuin) 6 102.34 113.04 2 33.33
22461. (teinej) 6 68.72 75.03 4 66.67
22462. Kaelib (teegka01) 6 70.53 80.90 1 16.67
22463. Teddy (teddyhol) 6 88.15 101.00 2 33.33
22464. TearyPanda (tearypanda) 6 125.50 139.42 6 100.00
22465. teabiscuit (teabiscuit1) 6 116.42 124.30 1 16.67
22466. Tyler (tdude212) 6 76.64 87.04 2 33.33
22467. Taylorlum3 (taylorlum3) 6 58.43 75.99 0 0.00
22468. Tammie (tamxd) 6 85.78 97.50 2 33.33
22469. Tahsun Rahman (tahsun) 6 51.68 63.04 3 50.00
22470. tareq (tabrar2010) 6 74.86 93.29 1 16.67
22471. Sami (t1sami) 6 80.41 86.72 1 16.67
22472. Tomas (t0mcuhhh) 6 59.24 76.53 1 16.67
22473. antos (szybkipisaczelo) 6 40.00 44.69 2 33.33
22474. Syrgak (syrgak) 6 46.78 52.19 0 0.00
22475. Blank (sydale) 6 67.77 85.18 2 33.33
22476. sweetyukibo (sweetyukibo) 6 80.65 91.47 0 0.00
22477. Sweet Wort (sweetwort) 6 96.89 107.35 4 66.67
22478. Ming (swamis) 6 102.34 116.87 3 50.00
22479. Pheakdey (swagmav69) 6 67.23 73.03 1 16.67
22480. Svoleas (svoleas) 6 55.84 61.17 1 16.67
22481. sven (svenac20) 6 76.96 87.71 2 33.33
22482. 𝙺𝚊𝚒𝚝𝚊𝚕... 6 96.70 118.03 1 16.67
22483. Penguin (superpenguin9) 6 79.76 89.94 3 50.00
22484. Marcel (supermarcel10) 6 78.49 94.28 4 66.67
22485. Billy (super1ha1) 6 67.22 74.05 1 16.67
22486. sunfishho (sunfishho) 6 103.40 110.15 4 66.67
22487. sumuttaja (sumuttaja) 6 87.94 95.26 4 66.67
22488. junior (sukachik3n) 6 104.07 113.46 1 16.67
22489. subol (subolroy) 6 32.71 38.93 0 0.00
22490. Subh (subhyj) 6 95.61 105.35 2 33.33
22491. CallMeBea (callmebea) 6 50.79 63.02 0 0.00
22492. James (strocode) 6 59.85 67.98 0 0.00
22493. Straubrey (straubrey) 6 77.75 92.54 2 33.33
22494. StorMBasilisK (stormbasilisk) 6 86.66 98.31 1 16.67
22495. Lyanne (stiftvilt) 6 63.30 69.36 0 0.00
22496. stibitzer (stibitzer) 6 80.45 85.79 2 33.33
22497. Steve (stevehawk) 6 78.41 90.30 6 100.00
22498. sterling (sterling17) 6 66.60 75.72 3 50.00
22499. that (stepbro) 6 67.12 71.96 1 16.67
22500. Stella (stellakitty7) 6 92.24 101.13 2 33.33
22501. Stef (stefmx) 6 83.97 89.02 3 50.00
22502. Mike (std_psyit_abd) 6 69.52 77.94 2 33.33
22503. Stazenko (stazenko) 6 45.89 50.35 0 0.00
22504. Atiruj (starwp) 6 71.91 82.64 5 83.33
22505. Bob (starre) 6 86.71 96.20 1 16.67
22506. Staris (starix) 6 46.47 56.17 0 0.00
22507. i cant type (stan1) 6 90.28 105.17 3 50.00
22508. Stam (stammm) 6 91.65 100.32 2 33.33
22509. thpenther (sspenkerr) 6 90.58 99.50 2 33.33
22510. Iver Andreas (ssk1ppy) 6 50.16 55.10 2 33.33
22511. Jouii (squigglysploosh) 6 50.90 61.24 2 33.33
22512. Squabbi (squabbi) 6 82.07 93.06 0 0.00
22513. spuffin (spuffin) 6 108.58 121.40 5 83.33
22514. buljangnan (springrolls) 6 142.10 148.14 5 83.33
22515. 420Benny (splergie) 6 80.67 87.44 2 33.33
22516. Speed (speed_demon_123) 6 88.13 107.24 2 33.33
22517. TBSTACK (speedytypister) 6 69.19 73.46 0 0.00
22518. Jayden (speedxer) 6 81.35 86.37 3 50.00
22519. Owen (spectrixbruh) 6 75.14 90.72 1 16.67
22520. Colby (sparklesdudley) 6 68.21 81.74 1 16.67
22521. Spaghetti (spaghetti_au_pot) 6 107.28 124.20 4 66.67
22522. Sorgair (sorgair) 6 127.71 142.77 4 66.67
22523. Sophus (sophustypelikesheit) 6 88.43 109.23 1 16.67
22524. Sophie (sophboph) 6 94.29 107.00 4 66.67
22525. casadaro (solocro) 6 56.01 61.94 0 0.00
22526. soeliphilia (soeliphilia) 6 95.59 105.52 3 50.00
22527. Nishant (soccermaniac95) 6 94.16 105.60 2 33.33
22528. TC (snowboardnw) 6 88.36 107.25 1 16.67
22529. Ruka (snijders) 6 63.56 76.09 2 33.33
22530. Etesam (smogchalk) 6 87.17 101.50 3 50.00
22531. Dian (slyr77) 6 111.01 118.21 1 16.67
22532. Joseph (slurpherpderp) 6 107.75 139.70 3 50.00
22533. Andre (slimas9) 6 51.11 53.95 0 0.00
22534. Skystrike7 (skystrike7) 6 73.21 90.09 2 33.33
22535. travis (skyrevolutionz) 6 86.91 104.47 2 33.33
22536. skyler (skyblake01) 6 115.23 122.41 3 50.00
22537. Worn_out (sks2k0001) 6 72.01 76.85 6 100.00
22538. Darren (skootskii) 6 74.91 91.46 2 33.33
22539. Skooma (skoomtastic) 6 80.97 96.27 2 33.33
22540. SkepticalBubble (skepticalb... 6 64.37 68.76 2 33.33
22541. skanda (skandarajeev) 6 100.12 114.33 5 83.33
22542. Inkus (sinuema) 6 99.36 125.79 4 66.67
22543. $insy (sinsy) 6 113.25 126.73 4 66.67
22544. Andrew (sinnuroko) 6 70.08 77.35 3 50.00
22545. Nomis (simsslabimbum) 6 56.46 64.12 1 16.67
22546. Jayzee (simpy_nimble) 6 75.66 92.11 5 83.33
22547. Simon (simonskos) 6 61.55 64.78 3 50.00
22548. Anuar (silver_anubis) 6 62.84 67.68 2 33.33
22549. smile (silversky666) 6 69.99 93.02 1 16.67
22550. SilverFox (silverfox13) 6 93.81 99.77 2 33.33
22551. Jaidyn (siimba) 6 37.92 44.46 2 33.33
22552. Sam (shy_shy_tomato) 6 80.56 100.24 0 0.00
22553. Milton (shurikenronlojd) 6 62.25 76.93 3 50.00
22554. sohyameow (shoyameow) 6 33.70 35.90 0 0.00
22555. Angi (shorti_74) 6 56.44 64.12 1 16.67
22556. Guillermo (shneme) 6 89.09 104.33 0 0.00
22557. Eduardo (shleepez) 6 107.02 118.11 2 33.33
22558. Jayden (shiakose) 6 77.07 86.19 3 50.00
22559. Shia (shiaushio) 6 94.07 108.61 2 33.33
22560. Alex (shemet) 6 71.98 84.65 0 0.00
22561. Shekhar (shekharchikara) 6 86.13 94.81 2 33.33
22562. Yousif (sheibani) 6 77.68 86.02 1 16.67
22563. Sheckla (sheckla) 6 104.18 116.77 4 66.67
22564. Shashikanth Reddy (shashika... 6 51.33 59.73 0 0.00
22565. Sharaf (sharaf) 6 60.11 68.23 0 0.00
22566. Shantnu (shantnu) 6 91.09 99.18 1 16.67
22567. Shan (shanrauf) 6 125.55 146.62 1 16.67
22568. Shalz (shalzin) 6 48.93 59.79 2 33.33
22569. shay (shaaaay) 6 107.68 122.51 5 83.33
22570. Simon (sgoldins) 6 84.27 93.32 1 16.67
22571. USS Freedom (sfmqur) 6 62.65 66.98 2 33.33
22572. Adam (sfdcoderaz) 6 96.70 106.92 3 50.00
22573. ruth116 (sezzag) 6 85.39 88.80 2 33.33
22574. Sophie (seulrene) 6 96.46 107.74 2 33.33
22575. Axel (setomi) 6 105.30 117.24 4 66.67
22576. Serious (seriousryu) 6 99.14 103.33 3 50.00
22577. SeppahBaws (seppahbaws) 6 75.87 91.02 1 16.67
22578. Gene (senseieggroll) 6 84.51 96.85 1 16.67
22579. Duy (senacen) 6 67.63 76.56 1 16.67
22580. Samuel (semmelknoedel) 6 53.08 62.53 1 16.67
22581. Semi (semi805) 6 76.62 79.92 1 16.67
22582. Max (selfmelody) 6 73.25 81.43 2 33.33
22583. Sela (selawolf) 6 33.69 38.68 0 0.00
22584. Sebastian (sebipagura) 6 123.66 136.50 3 50.00
22585. Sean (seanzie) 6 114.61 133.88 1 16.67
22586. Corbin (sealcircle) 6 58.26 66.83 2 33.33
22587. CJ (seajayyy) 6 70.39 84.62 0 0.00
22588. Meowzer (sd_surfer4) 6 113.81 147.71 2 33.33
22589. scopersz (scopersz) 6 54.90 66.33 1 16.67
22590. Scott (scooty2hooty) 6 47.67 50.80 1 16.67
22591. ScarlettSu (scarlettsu) 6 56.28 68.74 2 33.33
22592. Sebastian (sayferfordyce) 6 88.64 102.34 3 50.00
22593. Isaac (saxxie) 6 96.46 106.81 6 100.00
22594. Sat (satwargamer) 6 45.49 52.39 1 16.67
22595. Satvik (satty010) 6 37.85 40.91 0 0.00
22596. Sarah (sarahsyg) 6 73.89 80.33 2 33.33
22597. Sapah (sapah) 6 102.85 118.95 3 50.00
22598. santol (santol69) 6 104.98 120.03 4 66.67
22599. Sam (samwilkie) 6 85.67 104.18 2 33.33
22600. Ben (samuraiknuth) 6 106.47 120.29 5 83.33
22601. sammy (sammysosa151) 6 69.70 98.79 1 16.67
22602. Sam (sammy3118) 6 68.18 70.65 0 0.00
22603. Sam (sama13) 6 44.80 51.12 1 16.67
22604. Sam (sam629) 6 79.08 94.38 4 66.67
22605. Samantha (sam7597) 6 105.30 116.96 4 66.67
22606. Sam (sam22258) 6 48.99 58.59 0 0.00
22607. DickK (saltybokchoy) 6 113.78 131.00 6 100.00
22608. SaIidat (salidat) 6 49.29 56.43 1 16.67
22609. saladie (saladie) 6 93.08 111.18 4 66.67
22610. Samy (sakashi96) 6 50.72 55.92 0 0.00
22611. Anna (sajtiann) 6 54.90 60.87 1 16.67
22612. Sagnik (sagniks) 6 67.33 86.11 4 66.67
22613. Alisher (saegl) 6 73.11 90.83 4 66.67
22614. shahriar (sadid007) 6 32.81 35.69 0 0.00
22615. Kieran (sackerpunch) 6 48.73 57.12 2 33.33
22616. adder (sabienadderley03) 6 65.77 80.46 0 0.00
22617. Winson (s1nc3d4rk_) 6 57.73 66.20 2 33.33
22618. Ryan (rypenguin219) 6 97.97 108.66 1 16.67
22619. Ryan (rybruh) 6 61.05 71.01 0 0.00
22620. ref (rwef) 6 120.41 131.24 3 50.00
22621. Alex (running_wind) 6 75.25 85.79 0 0.00
22622. Rubyist (rubyist) 6 109.26 120.79 2 33.33
22623. Ryan (rtblast70) 6 77.39 84.28 1 16.67
22624. RAVINDER (rsainichd) 6 63.13 69.21 2 33.33
22625. Rachel (rrachell) 6 111.55 122.24 5 83.33
22626. Rema1000 (rqsxxth) 6 75.87 94.39 3 50.00
22627. numba 1 (royalocean5) 6 129.02 139.74 5 83.33
22628. Rosie (rosepose90) 6 87.52 101.03 1 16.67
22629. Cristiano (ronaldo_is_back) 6 44.06 52.47 0 0.00
22630. Rokas (rokasspeedy) 6 37.79 44.56 0 0.00
22631. Tyler (rockinrollo) 6 96.26 109.65 3 50.00
22632. Raj (rocket_boyz) 6 33.97 41.69 0 0.00
22633. RoboDom711 (robodom711) 6 59.45 71.09 0 0.00
22634. Robochu (robochu) 6 69.68 78.81 2 33.33
22635. Robo (robo0110101) 6 66.59 74.37 3 50.00
22636. Connor (robin_hearts) 6 91.53 96.28 3 50.00
22637. Robin (robinkim2020) 6 78.73 95.01 1 16.67
22638. Robert (roberty579) 6 77.08 87.21 1 16.67
22639. Graham (rizyyyy) 6 86.27 101.50 6 100.00
22640. Rikard (rikardny) 6 98.76 112.79 3 50.00
22641. Rico (ricoencabo) 6 101.88 123.06 4 66.67
22642. Justin (ribena_ais) 6 88.64 98.92 3 50.00
22643. rey (reyreyes) 6 82.26 88.09 3 50.00
22644. Rex (rexsauce) 6 109.57 123.45 2 33.33
22645. Runar Eskild (reskild) 6 48.15 54.13 0 0.00
22646. Kamil (replikant) 6 102.03 110.77 6 100.00
22647. movingpoopscary (renzyr12) 6 89.58 98.18 3 50.00
22648. Ren (reniyuh) 6 65.99 72.83 2 33.33
22649. relative (relativemadlad) 6 88.54 95.20 0 0.00
22650. Reefer (reefer_rr) 6 85.73 107.76 2 33.33
22651. Maruzensky (redromel) 6 82.90 92.21 5 83.33
22652. Floris (redmachine) 6 85.74 90.34 1 16.67
22653. Redempt1on (redempt1on) 6 93.49 102.60 3 50.00
22654. Lily (redborne24) 6 40.50 43.94 1 16.67
22655. aracely (rawracelyy) 6 69.22 79.86 1 16.67
22656. Aneesh (rationaliguana99) 6 68.31 71.91 2 33.33
22657. Dust (rathard) 6 97.95 115.55 4 66.67
22658. Jacob (randomtown) 6 40.03 46.97 1 16.67
22659. Ramram (ramram01) 6 69.89 76.84 2 33.33
22660. RamenWizard (ramenwizard) 6 103.67 118.55 3 50.00
22661. RamBow (rambowrice) 6 54.12 62.53 0 0.00
22662. Ralph (ralph7c2) 6 66.05 75.74 0 0.00
22663. Rakhymzhan (rakhymzhan01) 6 29.65 31.48 0 0.00
22664. rainbowcow (rainbowcoww) 6 83.74 105.06 2 33.33
22665. radu (radu215) 6 68.94 79.98 0 0.00
22666. Anton (racketen) 6 92.31 108.44 2 33.33
22667. R3TURN (r3turn777) 6 89.13 102.66 3 50.00
22668. Owen (qwert8143) 6 65.60 75.50 4 66.67
22669. quibby (quibbytm) 6 97.22 109.90 4 66.67
22670. Gusti (gustilks15) 6 55.48 60.19 2 33.33
22671. aera (qkrdlfk) 6 42.99 49.10 0 0.00
22672. pwoi (pwoi) 6 81.83 99.71 3 50.00
22673. Qing Chi (pumbinking) 6 55.52 60.29 1 16.67
22674. PuiPui (puipuicar) 6 60.87 73.47 1 16.67
22675. Kristel (pugspark) 6 51.65 57.88 0 0.00
22676. Patrick (ptarka05) 6 75.56 87.83 2 33.33
22677. Jesse (psychoticcooki) 6 63.75 67.78 2 33.33
22678. Proximitynow (proximitynow) 6 90.43 115.54 3 50.00
22679. Protocol (protocol93344) 6 42.22 54.06 2 33.33
22680. Luka (propalica) 6 101.67 110.69 5 83.33
22681. Professor (professorprotons) 6 74.41 82.13 4 66.67
22682. YT (pri3t4iz) 6 44.18 55.57 0 0.00
22683. prevolt (prevolt) 6 93.98 105.76 4 66.67
22684. Pratik (pratikwadhai) 6 47.17 52.78 2 33.33
22685. pqpqlaowosjkd (pqpqlaowosjkd) 6 90.57 96.24 3 50.00
22686. PPTheJoker (pp_the_joker) 6 33.73 40.06 0 0.00
22687. 💨💨💨 (ppraisethesun) 6 64.33 67.90 1 16.67
22688. Posty (postymaloney) 6 73.92 79.46 0 0.00
22689. Positive (positiv) 6 47.96 56.46 1 16.67
22690. Bill (porousrock) 6 93.05 99.76 0 0.00
22691. M (poptropica979) 6 109.46 124.96 2 33.33
22692. Phuwit (pooweeh) 6 38.14 42.43 5 83.33
22693. Andrew (poor_hobo) 6 74.87 81.45 0 0.00
22694. dick (pools2) 6 100.41 112.37 5 83.33
22695. ._. (pookao19) 6 60.71 68.46 4 66.67
22696. Quentin (pompomlam) 6 70.50 95.19 4 66.67
22697. Pluto (pluto_the_typer) 6 45.62 48.11 0 0.00
22698. Placebo (placebo_ct) 6 73.95 79.85 1 16.67
22699. PRINCE (pk226894) 6 71.29 75.98 1 16.67
22700. Tyler (pixel_ty) 6 91.89 101.63 1 16.67
22701. Hafizh (pislm) 6 73.14 84.56 1 16.67
22702. Jake (pinkclifford_typing) 6 91.49 114.72 2 33.33
22703. A (pinebug) 6 77.77 84.73 1 16.67
22704. Atiar (pigonantibiotics) 6 46.56 49.92 0 0.00
22705. Pico (pico8) 6 43.65 47.54 0 0.00
22706. Madie (picassy) 6 85.51 92.12 5 83.33
22707. Joseph (peterepeat) 6 101.17 103.47 0 0.00
22708. Pete (pete2015) 6 66.34 70.78 0 0.00
22709. Thomas (pentaa) 6 90.65 96.74 3 50.00
22710. PenguinTypist (penguinfun) 6 115.35 130.17 3 50.00
22711. MuiePonta (pelerin) 6 74.84 90.20 1 16.67
22712. Steven (peebsdasavage) 6 64.02 72.65 0 0.00
22713. Pawi (pawiboy36) 6 131.63 152.13 3 50.00
22714. paul (paulzzzz) 6 58.98 68.92 1 16.67
22715. Angus (patroc1us) 6 76.05 81.96 1 16.67
22716. Pasquiggles (pasquiggles) 6 41.78 48.91 0 0.00
22717. Param (paramt) 6 110.82 120.15 6 100.00
22718. Parafinico (parafinico) 6 63.55 69.27 3 50.00
22719. Ethan (paprikapp) 6 47.51 62.13 0 0.00
22720. Kurtis (pandabear4774) 6 90.02 102.40 3 50.00
22721. Tyson (pajarito) 6 95.60 106.67 5 83.33
22722. PAFxd (pafxd) 6 90.95 108.33 3 50.00
22723. P1qo (p1qo) 6 65.86 76.88 2 33.33
22724. powder (p0wder) 6 58.37 64.47 0 0.00
22725. Owen (owenc1272) 6 108.11 122.28 1 16.67
22726. Owen (owen12) 6 76.02 94.50 2 33.33
22727. Akira (oven_bunny) 6 41.97 52.46 1 16.67
22728. Chase (otumo) 6 89.86 103.20 3 50.00
22729. Otamurod (otamurod_2003) 6 27.15 30.33 0 0.00
22730. Splint (osamabinsmokin) 6 87.28 103.24 2 33.33
22731. N (ortizn) 6 114.33 127.58 6 100.00
22732. Orlando (orlandor3) 6 109.26 124.35 3 50.00
22733. Tom (originaliteit) 6 82.72 90.31 2 33.33
22734. Scott (oooops) 6 128.04 133.30 4 66.67
22735. iice (oofr) 6 74.13 84.53 0 0.00
22736. Zams0 (oofman666) 6 92.70 98.89 3 50.00
22737. Ooflord (ooflord) 6 64.82 86.33 1 16.67
22738. onlyskee (onlyskeelol) 6 55.41 61.64 2 33.33
22739. Billy (onlychance) 6 63.75 74.61 4 66.67
22740. Barry (oniyxx) 6 76.12 81.18 1 16.67
22741. stav (onions127) 6 50.11 59.77 2 33.33
22742. 임아라 (onglaxynx) 6 58.25 61.30 1 16.67
22743. ¹°”ˆ˜¨ 𝐎ϻ ¨˜ˆ... 6 62.52 73.04 2 33.33
22744. not (omgtheworst) 6 107.00 123.04 6 100.00
22745. omar (omar_sabry) 6 38.32 42.74 2 33.33
22746. Om3G4 (om3g4) 6 91.16 113.41 3 50.00
22747. okki (okkiniikko) 6 83.97 92.81 2 33.33
22748. Kat (oh_that_one_person) 6 81.55 100.00 2 33.33
22749. Ollie (oham) 6 93.23 114.02 2 33.33
22750. Oddpie (oddpie) 6 58.98 65.84 0 0.00
22751. Hanseol (observance) 6 87.45 101.31 1 16.67
22752. Adam (oadaam) 6 81.95 89.80 3 50.00
22753. Nyxxiee (nyxxiee_) 6 75.15 81.54 3 50.00
22754. Nathan (nxthantypes) 6 94.68 110.97 3 50.00
22755. Nurzhalgas (nurzhalgas_) 6 28.86 32.68 0 0.00
22756. Nick (ntst22) 6 97.65 109.53 2 33.33
22757. NRM (nrm87) 6 88.36 102.90 1 16.67
22758. vice versa (no_dice) 6 104.94 135.54 3 50.00
22759. Hydro (noynyt) 6 73.01 87.08 5 83.33
22760. (notcayden) 6 127.32 140.13 3 50.00
22761. Noori (noori_) 6 54.70 64.25 0 0.00
22762. P (noobstreamer) 6 69.97 87.32 1 16.67
22763. Skrub (nonametomake) 6 110.34 136.12 1 16.67
22764. NixNox (nixnox) 6 88.44 101.32 4 66.67
22765. John (nixne) 6 122.18 137.54 4 66.67
22766. Nitowl12_ (nitowl12) 6 65.60 73.65 2 33.33
22767. Niteesh (niteeshguptha) 6 73.13 81.37 1 16.67
22768. Marc (ninja221100) 6 81.65 94.77 2 33.33
22769. Nikan (nikan20) 6 69.21 78.38 0 0.00
22770. NIght (nightyin) 6 51.80 55.38 2 33.33
22771. Night (nightvc) 6 87.23 96.89 3 50.00
22772. Adin (nightmarexe) 6 112.13 130.92 3 50.00
22773. Nicholas (nicktanasianman) 6 108.94 128.08 3 50.00
22774. (nickderp) 6 124.33 137.45 5 83.33
22775. Nice (nicekcoc) 6 99.81 114.79 6 100.00
22776. Karma (nexus48) 6 96.54 114.40 3 50.00
22777. Newman (newmanhere) 6 86.15 91.96 2 33.33
22778. Matthew (neweleven) 6 103.87 121.51 4 66.67
22779. Iura (newbeginnings) 6 118.90 129.03 2 33.33
22780. Victor (newbeavictoryhase) 6 111.91 124.64 4 66.67
22781. rogov (netherking1357) 6 79.11 97.80 1 16.67
22782. Jozef (neophyx) 6 50.84 60.31 2 33.33
22783. neil (neil_da_nub) 6 109.70 120.06 4 66.67
22784. shitron (nefaeria) 6 78.43 93.13 2 33.33
22785. Ned420 (ned420) 6 33.39 36.92 2 33.33
22786. nebula (nebula1402) 6 98.16 103.76 4 66.67
22787. David (nayzr) 6 56.86 58.69 0 0.00
22788. Nathan (natehobo) 6 67.54 73.01 1 16.67
22789. Nasir (nasirkabir) 6 68.86 84.70 0 0.00
22790. Napples (napples181) 6 128.84 139.82 4 66.67
22791. Nanos (nanos) 6 87.72 100.88 1 16.67
22792. Ruben (nando520024) 6 78.73 88.76 1 16.67
22793. Nadchen (nadchen) 6 106.77 110.71 4 66.67
22794. Xun (n1ko9471) 6 52.53 59.46 0 0.00
22795. kira (mysticpupper) 6 103.73 124.10 6 100.00
22796. darsh0106 (mynamekaa) 6 78.76 84.13 1 16.67
22797. holymama (mykeyboardcrash) 6 47.58 53.54 0 0.00
22798. Mussie (mussietl) 6 57.50 63.68 1 16.67
22799. Caroline (murungu) 6 89.82 102.50 1 16.67
22800. Kebob (murikk) 6 95.43 107.67 2 33.33
22801. Steven (muppo) 6 116.77 128.49 1 16.67
22802. Mukesh (mukesh05) 6 37.74 41.50 0 0.00
22803. N/A (mudatoxicity) 6 94.93 109.10 5 83.33
22804. Mudathir (mudathir) 6 65.11 74.38 2 33.33
22805. Komail (mr_broodbuck) 6 99.07 109.46 4 66.67
22806. 蔡 (mrzz) 6 51.15 59.61 0 0.00
22807. Matt (mrwizard487) 6 66.53 68.93 2 33.33
22808. mrweissguy (mrweissguy) 6 56.86 58.65 0 0.00
22809. tomas (mrtomaspl) 6 81.05 89.82 2 33.33
22810. Mo (mrmo) 6 105.61 125.74 5 83.33
22811. Mejster (mrmejster) 6 60.11 68.26 2 33.33
22812. Mihael (mrki141) 6 66.87 71.71 2 33.33
22813. TacticalT8R (mrcardmont) 6 68.24 79.97 1 16.67
22814. Jeff (mrblurbyyt) 6 98.17 103.09 3 50.00
22815. big peepee man (mravocadoman) 6 99.44 116.60 5 83.33
22816. Pepe (mrandersonneo) 6 78.43 89.43 0 0.00
22817. Morris (mqrr) 6 73.44 86.86 1 16.67
22818. S (moxeemango) 6 66.59 75.77 3 50.00
22819. Zach (morcheeba) 6 88.01 97.87 2 33.33
22820. MOP (moplock2093) 6 85.76 96.75 4 66.67
22821. Sarawr (mooneclipsedragon) 6 75.64 80.39 1 16.67
22822. malis (monmalis) 6 47.45 55.04 0 0.00
22823. Theo (monkeytheo) 6 44.89 48.81 1 16.67
22824. Carlos (mongrelion) 6 106.52 113.90 5 83.33
22825. The Dude A-Rides (monesta) 6 55.67 66.21 4 66.67
22826. momchil (momchils6) 6 54.25 67.28 6 100.00
22827. Moist (moist_bread) 6 99.49 104.74 3 50.00
22828. Josh (moistking) 6 69.03 84.75 2 33.33
22829. Soliman (moaazsolomon) 6 65.74 76.96 0 0.00
22830. no (mmineo10) 6 78.56 87.76 2 33.33
22831. mmills18 (mmills18) 6 52.43 63.05 0 0.00
22832. Marcus (mizormarcus) 6 99.07 112.78 4 66.67
22833. Cat (misslittlequack) 6 64.33 78.22 0 0.00
22834. ANne (missinglevi) 6 73.25 86.69 6 100.00
22835. Missamig (missamig) 6 109.59 118.22 3 50.00
22836. Mirek (miras_ms) 6 43.01 47.31 1 16.67
22837. Minjae (minjaesong) 6 122.06 130.19 5 83.33
22838. Churro (minishcap) 6 72.02 79.61 3 50.00
22839. Jeff (mingij) 6 64.75 72.03 1 16.67
22840. Mina (minamark) 6 21.51 24.23 2 33.33
22841. Milos (miloskonjarnik) 6 78.58 82.96 2 33.33
22842. Milan (milanmalik) 6 90.77 96.10 1 16.67
22843. Michael (mike_racer) 6 105.96 135.79 5 83.33
22844. Michael (mikeyargueta) 6 61.81 72.42 2 33.33
22845. Mike (mike1835) 6 69.95 75.45 2 33.33
22846. midtrac (midtrac) 6 87.03 96.36 4 66.67
22847. Midnight (midnight510) 6 57.61 61.33 0 0.00
22848. Michael (michhael) 6 116.66 130.74 2 33.33
22849. Michalosnup (michalosnup) 6 29.93 35.49 2 33.33
22850. Micaldos (micaldos) 6 75.40 85.02 2 33.33
22851. Mia (mia_pie) 6 72.89 83.34 1 16.67
22852. Homie (metrically) 6 97.27 113.27 4 66.67
22853. Shadow (methehero_) 6 32.64 39.49 0 0.00
22854. Ashton (mercuryqs) 6 62.07 65.00 1 16.67
22855. Mercers (mercerslegend) 6 91.50 124.39 4 66.67
22856. Milán (meooohun) 6 75.17 85.93 2 33.33
22857. Menke (menkveld) 6 38.08 44.14 0 0.00
22858. Melvin (melli06) 6 126.53 136.87 3 50.00
22859. melanie (melanxi) 6 71.61 89.10 2 33.33
22860. agyon (meikaina) 6 91.93 135.87 0 0.00
22861. Ahmed (meguta) 6 71.18 83.43 2 33.33
22862. medkha (medkhabt) 6 73.54 81.63 2 33.33
22863. asdf (meagar) 6 102.42 113.76 3 50.00
22864. Manan (mdoshi) 6 71.81 81.52 1 16.67
22865. McMurdo42 (mcmurdo42) 6 47.54 56.49 1 16.67
22866. Kenny (mckennythekid) 6 84.46 99.45 1 16.67
22867. mcbtay (mcbtay) 6 107.91 123.37 5 83.33
22868. Tod (mbollinger9) 6 67.30 75.03 3 50.00
22869. Max (maxed0utt) 6 70.34 87.98 0 0.00
22870. Max (maxaldo) 6 63.01 77.67 2 33.33
22871. Mav (mavert) 6 58.00 62.51 2 33.33
22872. Matthew (mattyssss) 6 82.55 89.95 6 100.00
22873. Mattia (mattiasalvetti) 6 58.01 62.99 2 33.33
22874. MatiPati (matipati) 6 55.40 71.70 1 16.67
22875. Mateie (mateie) 6 81.57 91.16 1 16.67
22876. Matteo (matbon01) 6 93.17 96.47 4 66.67
22877. Master21 (master217994) 6 49.18 55.65 1 16.67
22878. Muhammad (masonomar) 6 50.61 54.19 3 50.00
22879. Cristian (marutabeibi) 6 73.57 77.15 5 83.33
22880. Martine (martinee) 6 86.89 101.03 2 33.33
22881. Markas (markas_123) 6 36.25 40.55 1 16.67
22882. Mark (mark427) 6 84.72 96.58 2 33.33
22883. MarioCrafter (mariocrafter101) 6 85.29 98.64 1 16.67
22884. Mario (mario241) 6 55.72 66.04 1 16.67
22885. Marek (marekc256) 6 74.51 86.20 3 50.00
22886. Marco (marcotheboy) 6 142.00 161.45 6 100.00
22887. Manel (manuelp) 6 57.42 64.83 1 16.67
22888. Amanuel (mannyioi) 6 72.44 78.42 4 66.67
22889. manhhuy01 (manhhuy01) 6 71.70 78.52 3 50.00
22890. The (malthelegend104) 6 57.86 83.94 1 16.67
22891. Malvin (malleballen) 6 83.96 100.26 2 33.33
22892. Malia (maliuhh) 6 71.66 81.77 0 0.00
22893. Maia (maia_egg) 6 83.13 96.14 2 33.33
22894. Magykti (magykting) 6 106.68 122.54 3 50.00
22895. maghet (maghet) 6 66.53 72.59 3 50.00
22896. George (madfang) 6 74.65 91.23 1 16.67
22897. Gaurav (machinepainter) 6 52.29 54.35 1 16.67
22898. M3D7 (m3d7) 6 69.70 82.32 3 50.00
22899. Miguel (m1ggy01) 6 73.07 85.18 1 16.67
22900. David (m0zlik) 6 84.67 95.34 0 0.00
22901. Gianni (lxarduinixl) 6 65.20 72.44 0 0.00
22902. Lunar (lunar3clipse) 6 55.56 66.32 0 0.00
22903. Giorgio (luigi123mad) 6 99.87 112.55 2 33.33
22904. Gunjan (lucifergd192) 6 58.23 64.50 0 0.00
22905. Alek (lucazoom) 6 88.45 105.38 3 50.00
22906. Lucas (lucasfah) 6 98.63 106.23 2 33.33
22907. Jacob (lowkdr) 6 59.52 65.71 1 16.67
22908. lost.zombie (lostzombie) 6 75.69 80.83 3 50.00
22909. Phil (lordphil3) 6 94.31 117.74 3 50.00
22910. Alex (longliveharambe) 6 88.25 97.40 2 33.33
22911. Lolli (lollo2000) 6 72.27 81.03 1 16.67
22912. lodg1111 (lodg1111) 6 60.25 69.63 0 0.00
22913. IIIKTG (lllktg) 6 63.90 73.70 0 0.00
22914. hideki (llawlietswaifu) 6 62.29 72.50 1 16.67
22915. LittleTub (littletub) 6 106.04 132.12 3 50.00
22916. Lila (littlebaddiebcwhynot) 6 49.47 56.95 1 16.67
22917. Andrew (littleangels37) 6 76.18 91.85 3 50.00
22918. shamppo (literallyatyper1) 6 99.53 122.22 3 50.00
22919. Aritra (liquidator) 6 89.46 98.05 4 66.67
22920. Marcel (lingman) 6 87.06 101.27 2 33.33
22921. Nikola (limuncovek) 6 56.70 63.80 0 0.00
22922. Limited (limited_atonement) 6 122.38 132.97 4 66.67
22923. Lilmanband (lilmanband) 6 82.81 96.69 4 66.67
22924. Chris (lilchrisbmw) 6 118.55 134.26 5 83.33
22925. lilbaxtian (lilbaxtian) 6 56.58 61.09 0 0.00
22926. Lizzie (lfilart) 6 102.94 116.33 2 33.33
22927. LePetitPili (le_petit_pili) 6 36.21 39.60 6 100.00
22928. a (levelupself) 6 94.68 103.69 4 66.67
22929. Zafir (lethalpuppy) 6 86.54 108.71 3 50.00
22930. Kaleb (leonenthedk) 6 78.55 88.77 2 33.33
22931. Lance (lenzzyyy) 6 92.64 111.50 3 50.00
22932. Lengboii (lengboii) 6 36.81 55.86 2 33.33
22933. Lena (lena2020345) 6 87.80 97.19 1 16.67
22934. nikimii (lemontrees) 6 97.22 107.23 2 33.33
22935. ahmed (lelarino1) 6 89.49 102.91 2 33.33
22936. Ken (leei) 6 87.93 107.82 2 33.33
22937. Lê Việt Bảo (lebao) 6 86.79 98.91 1 16.67
22938. Idk (ldk_howtobreathe) 6 70.48 76.86 4 66.67
22939. Layo (layopro) 6 63.44 77.37 0 0.00
22940. Sebastian (lavaca) 6 54.45 66.60 0 0.00
22941. Andreas (latteinator) 6 86.01 102.41 1 16.67
22942. Travis (lath) 6 93.79 103.48 1 16.67
22943. Justin (laskov) 6 73.21 81.19 0 0.00
22944. LaShawn (lashawnious) 6 79.69 98.71 2 33.33
22945. Ian (langabriel) 6 58.59 71.25 6 100.00
22946. Tom (lambertsfan5858) 6 71.04 79.38 2 33.33
22947. Luis (lalm07) 6 79.22 87.55 0 0.00
22948. Fish (labia_majora) 6 84.92 93.67 2 33.33
22949. kim (kyunreal) 6 67.61 74.94 2 33.33
22950. kyeroh (kyeroh) 6 110.62 119.17 4 66.67
22951. wojtek (kwojtek14) 6 131.74 136.20 4 66.67
22952. Kushagra (kushagra_doodoo) 6 97.19 106.03 6 100.00
22953. Jake (kuch13) 6 70.87 76.80 1 16.67
22954. llarin (krypton1an) 6 91.72 102.90 3 50.00
22955. Krypto (krypto406) 6 85.38 95.60 2 33.33
22956. KroNox (kronoxver) 6 66.33 80.00 3 50.00
22957. Kris (krislee2202) 6 50.18 58.36 1 16.67
22958. kristian (kriskris15) 6 69.33 72.40 1 16.67
22959. Kriso (krischoo276) 6 106.03 124.11 4 66.67
22960. Peter (kraivyne) 6 81.42 91.00 1 16.67
22961. nizar (konizar) 6 65.44 73.10 0 0.00
22962. petr (koleno) 6 46.14 53.09 0 0.00
22963. Daniel (kohrt) 6 64.64 76.90 1 16.67
22964. ez (kobe2605) 6 117.39 123.50 4 66.67
22965. knownymous (knownymous) 6 73.54 85.11 1 16.67
22966. Abhinav (knovelgen) 6 79.57 85.36 1 16.67
22967. Jonas (knochen) 6 68.57 74.37 1 16.67
22968. (kloodah) 6 87.64 107.03 0 0.00
22969. Tuan (kllerman25620) 6 83.60 100.88 2 33.33
22970. Kelli (klandry80) 6 96.38 116.08 2 33.33
22971. Kevin (kjax) 6 92.21 108.08 4 66.67
22972. tstats[kizzu137] (kizzu137) 6 95.00 109.46 3 50.00
22973. Kiva (kivattt) 6 98.71 113.12 3 50.00
22974. Mile (kiticmile69) 6 48.02 58.27 1 16.67
22975. Kyryll (kiruxaker) 6 63.10 69.93 1 16.67
22976. Kirragy (kirragy) 6 95.91 104.84 1 16.67
22977. kion (kionkun1) 6 90.90 94.71 2 33.33
22978. Benjamin (kingtutking) 6 110.08 115.92 3 50.00
22979. Avatar 2 (kingkiller) 6 76.90 92.15 2 33.33
22980. Kinasho (kinasho) 6 90.51 95.18 0 0.00
22981. Rimka (kiingofkebab) 6 51.87 57.25 1 16.67
22982. Emmanuel (khwarz) 6 85.21 95.81 1 16.67
22983. abdul (khoir359) 6 81.13 84.97 0 0.00
22984. KillerK (khanhp4) 6 97.10 109.88 2 33.33
22985. Khalifa (khalifa47) 6 36.71 40.38 1 16.67
22986. kev (kev_wins_again) 6 110.09 126.44 5 83.33
22987. Keviism (keviism) 6 84.06 89.21 4 66.67
22988. Kevin (kevb0) 6 84.43 98.84 1 16.67
22989. Ket (ket93) 6 104.35 118.67 5 83.33
22990. Dominic (kerbalnaught) 6 86.53 92.73 3 50.00
22991. moni (kenma_k0zume) 6 42.83 47.44 0 0.00
22992. kemosaf (kemosaf) 6 89.54 95.55 5 83.33
22993. Kalle (kekeldur1) 6 101.35 123.57 2 33.33
22994. Keencar (keencar) 6 95.22 108.53 2 33.33
22995. kcor (kcorism17) 6 66.34 70.94 1 16.67
22996. Katie (katie2096) 6 92.90 102.06 1 16.67
22997. Kate (katehashope) 6 98.11 112.37 2 33.33
22998. Kary (karygerxd) 6 62.46 73.19 0 0.00
22999. kanai (kanai) 6 96.16 106.80 0 0.00
23000. Kaizo (kaizokuooji) 6 61.84 68.09 1 16.67
23001. Zach (kaito_zach) 6 70.75 77.33 0 0.00
23002. Máté (kadmate) 6 52.32 58.67 1 16.67
23003. bigdaddy (kaden_) 6 81.26 92.83 1 16.67
23004. k (kabirpuri) 6 114.24 127.13 3 50.00
23005. Brett (kaaji03) 6 53.33 62.04 0 0.00
23006. jzbor (jzbor) 6 57.84 62.06 0 0.00
23007. Jyxmix (jyxmix) 6 112.52 119.24 3 50.00
23008. Mr. Presidentus (jyg108) 6 95.69 109.09 3 50.00
23009. Jerry (jwu56) 6 98.26 107.42 4 66.67
23010. Jason (jwatkins) 6 101.98 112.66 1 16.67
23011. justvoid (justvoid0) 6 52.26 55.92 1 16.67
23012. Sam (june_waves) 6 72.55 80.27 1 16.67
23013. FREE PALESTINE (junaidbaloch) 6 103.72 119.54 5 83.33
23014. Julia (julezreid) 6 82.39 99.69 0 0.00
23015. 707 (jujutsu_sorcerer) 6 87.05 104.50 2 33.33
23016. jSteez (jsteez) 6 90.14 100.10 3 50.00
23017. J (jrequa) 6 77.55 86.67 3 50.00
23018. yoy (joy000) 6 105.11 135.00 1 16.67
23019. Joceline (josmanga1) 6 60.27 68.77 0 0.00
23020. Josiah (josiah_wi2) 6 92.86 121.29 3 50.00
23021. Josh (joshsmith29) 6 37.13 48.36 0 0.00
23022. Jospeh (joseph_blota) 6 50.58 57.05 0 0.00
23023. nice (josephldot) 6 72.71 81.89 6 100.00
23024. Jordan (jordybird7) 6 97.51 116.46 3 50.00
23025. joorie (joorie) 6 118.02 131.21 3 50.00
23026. Jonas (jonxasbro) 6 58.96 68.98 0 0.00
23027. Jonathan (jonna1308) 6 59.21 70.27 0 0.00
23028. Jonhan (jonhan) 6 105.15 115.22 6 100.00
23029. Jon (jonathanloh02) 6 93.80 108.46 1 16.67
23030. Luka (jomanji) 6 108.75 113.40 3 50.00
23031. ur mom (jolly_retard6666) 6 59.15 69.30 2 33.33
23032. jobe (jojojobebebe) 6 65.30 74.13 2 33.33
23033. John (johnho) 6 97.42 132.40 3 50.00
23034. jooonyh (johnfast) 6 45.38 55.20 0 0.00
23035. Joe (joegung77) 6 122.66 136.53 3 50.00
23036. JC (joco302) 6 110.92 126.68 1 16.67
23037. j (jj_weeb) 6 99.64 107.16 3 50.00
23038. JjMiReLeS (jjmireles) 6 63.71 70.15 0 0.00
23039. Mariam (jishko) 6 41.34 47.31 0 0.00
23040. Jirafa (jirafious) 6 49.49 57.91 1 16.67
23041. Jindro (jijolindo) 6 68.52 91.41 2 33.33
23042. Joni (jiipee) 6 49.52 58.35 0 0.00
23043. jetmyy (jetmyy) 6 102.43 105.85 2 33.33
23044. Jess (jessdiritowhale) 6 57.46 66.35 0 0.00
23045. Jerson (jersonpogikaayo) 6 60.28 67.99 0 0.00
23046. jesper (jeppe_p) 6 60.13 70.88 1 16.67
23047. potato (jellaye) 6 97.54 123.40 3 50.00
23048. Tanapat (jekkiechan) 6 112.33 119.55 3 50.00
23049. Jeffreypaul (jeffreypaul) 6 51.17 54.67 1 16.67
23050. Jeff (jeffracersf) 6 93.67 105.10 3 50.00
23051. Jeeb (jeebmaster9000) 6 81.06 96.88 2 33.33
23052. Matthew (jconne3646) 6 86.53 95.42 2 33.33
23053. Jon Clarence (jclh127) 6 106.31 126.75 2 33.33
23054. Justin (jchen1923) 6 91.05 98.03 6 100.00
23055. John (jcboss10) 6 73.15 82.62 2 33.33
23056. Jay (jaykimchi) 6 109.42 128.49 3 50.00
23057. Jason (jason_1) 6 51.03 60.63 1 16.67
23058. Jason (jasonjat) 6 101.98 121.98 2 33.33
23059. Jasjit (jasjit) 6 43.34 55.60 0 0.00
23060. apolcube (japollopntr77) 6 53.23 64.22 0 0.00
23061. Jamie (jamie_b818) 6 68.56 81.75 3 50.00
23062. Jakob (jaker8024) 6 76.99 86.64 3 50.00
23063. Evan (jahad) 6 109.98 124.54 2 33.33
23064. Jaemeriiaa (jaemeriiaa) 6 75.53 88.69 1 16.67
23065. B1gjake1 (jacobone) 6 74.83 79.63 0 0.00
23066. jake (jacobchh) 6 98.78 110.17 3 50.00
23067. Jack (jacksaff) 6 70.02 78.25 1 16.67
23068. Jalil (jac28088788) 6 85.59 94.11 4 66.67
23069. Jasmine (j12mapatac) 6 98.90 119.24 2 33.33
23070. so (i_am_sov) 6 64.28 74.82 3 50.00
23071. iwayway (iwayway) 6 81.15 90.61 0 0.00
23072. Type (iwant2typefaster) 6 70.51 80.50 1 16.67
23073. Valliappan (its_me04) 6 53.54 60.22 0 0.00
23074. ItsTurbo (itsturbo) 6 94.16 109.20 1 16.67
23075. Ahmad (itsahmd25) 6 88.05 106.32 3 50.00
23076. gia (issgua) 6 69.45 81.65 2 33.33
23077. Daniel (isnakolah) 6 55.94 61.47 0 0.00
23078. cloudwalker (ismailkhan78642) 6 58.89 66.35 2 33.33
23079. Isaac (isjfw) 6 69.10 83.84 1 16.67
23080. Isaac (isaacmnz2) 6 63.21 70.23 1 16.67
23081. Isaac (isaackane) 6 64.89 80.76 1 16.67
23082. Fenix (isaac.hermens@gmail.... 6 98.46 104.36 2 33.33
23083. Wojciech (irth) 6 97.15 104.74 4 66.67
23084. Irish (irishgallowglass) 6 97.80 110.48 2 33.33
23085. Iris (iris) 6 100.53 115.23 1 16.67
23086. jrnc (intellimouseftw) 6 104.58 114.63 1 16.67
23087. Spencer (instaflip) 6 48.67 52.49 0 0.00
23088. Adam I (innesxam) 6 34.28 37.89 0 0.00
23089. Iniquity (iniquityqt) 6 100.37 107.44 1 16.67
23090. Sam (indecisam) 6 56.86 62.23 2 33.33
23091. Inakoto (inakoto) 6 108.21 117.84 4 66.67
23092. Knob (im_a_nob) 6 74.15 87.24 1 16.67
23093. Tom (imtp) 6 92.94 99.83 1 16.67
23094. Rake (imrakhat) 6 58.54 74.71 5 83.33
23095. Joenutz (improvise101) 6 79.08 91.71 2 33.33
23096. Imp (impm) 6 92.30 99.41 3 50.00
23097. ImEhCanadian (imehcanadian) 6 98.47 112.02 3 50.00
23098. Joe (imatschoolrn123) 6 62.71 66.52 0 0.00
23099. ilham (ill_hum) 6 54.04 61.83 0 0.00
23100. Iranian (iliveiniran) 6 66.21 70.76 2 33.33
23101. ildgaf (ildgaf) 6 75.07 82.35 0 0.00
23102. jason (ihatewyoming) 6 47.80 62.44 4 66.67
23103. Igor (igorfardoc) 6 63.00 67.02 1 16.67
23104. Martin (ightbet) 6 86.55 93.51 5 83.33
23105. jonas (idoseggs) 6 82.63 91.95 0 0.00
23106. idk (idkxdxd) 6 43.54 46.27 2 33.33
23107. Icy (icyexitium) 6 92.43 98.90 2 33.33
23108. Icy (icyblack) 6 74.18 82.61 0 0.00
23109. Farhan (ichinewbi) 6 95.08 111.95 4 66.67
23110. IceTea (iceteaxxd) 6 81.45 88.78 1 16.67
23111. Ian (ic0d) 6 64.16 75.21 0 0.00
23112. Ibrahim (ibro_foreal) 6 73.86 76.59 0 0.00
23113. Parker (iamrex) 6 85.14 92.37 5 83.33
23114. dev (hyprstitious) 6 66.39 78.73 2 33.33
23115. Charlie (hypotrance) 6 84.82 98.43 2 33.33
23116. Dustin (hyper_explosive) 6 45.02 50.09 0 0.00
23117. hy0605 (hy0605) 6 59.70 65.19 1 16.67
23118. Lukas (husafasamus) 6 71.96 80.88 0 0.00
23119. Michael (humormike) 6 67.28 72.25 3 50.00
23120. HumanUnknown (human_unknown) 6 68.87 80.78 3 50.00
23121. Shishank (hulk98) 6 71.78 82.30 1 16.67
23122. Harrison (hs676) 6 51.67 65.93 2 33.33
23123. snails (hovermind) 6 136.40 145.44 6 100.00
23124. Housefly (housefly) 6 40.34 48.10 0 0.00
23125. Daniil (hotdan28) 6 17.12 18.92 1 16.67
23126. Jack (horton_hears_a_j3w) 6 57.46 65.47 2 33.33
23127. Horphex (horphex) 6 80.83 89.68 1 16.67
23128. Hong Yi (hongyi8877) 6 72.01 81.57 2 33.33
23129. Jon (hongatory) 6 76.86 84.05 0 0.00
23130. aman (honeytyper) 6 47.43 51.20 0 0.00
23131. Homie (homie39) 6 52.07 58.04 1 16.67
23132. Ayaz (holografick) 6 81.17 83.65 2 33.33
23133. Vinh (hi_ugly) 6 73.96 84.68 3 50.00
23134. jimmy (hireraprk) 6 93.92 98.66 3 50.00
23135. Himanshu (himanshupander) 6 60.34 68.40 2 33.33
23136. Wilson (hilson_we) 6 77.88 83.21 0 0.00
23137. Hikmat (hikmat) 6 54.71 59.44 0 0.00
23138. hibbobibbo (hibbobibbo) 6 100.17 114.01 1 16.67
23139. Edmund (hhy1996) 6 54.87 64.05 2 33.33
23140. Nathan (hewittdallas) 6 92.25 103.73 1 16.67
23141. luigi420 (heroofthevillage) 6 74.77 81.66 2 33.33
23142. Seymour (heroofnow) 6 105.43 111.24 4 66.67
23143. Geo (heroic_librarian) 6 53.74 59.51 1 16.67
23144. THE ONE PIECE IS REAL (herm... 6 116.29 120.63 6 100.00
23145. BEN (hermanatorpc) 6 111.47 125.21 2 33.33
23146. HeliuMz (heliumz) 6 58.49 65.13 2 33.33
23147. Zuramaru (helena_meta) 6 100.89 112.75 3 50.00
23148. Viktor (heizu) 6 57.54 73.52 0 0.00
23149. Colby (heebiejeebies) 6 94.24 112.30 3 50.00
23150. Achbee (hb69) 6 66.79 76.66 1 16.67
23151. Hayden (haydenism114) 6 55.89 59.26 1 16.67
23152. Hunter (hawsonn) 6 97.99 109.53 3 50.00
23153. Hasan (hasanpranto) 6 62.24 67.15 1 16.67
23154. Jonathan (happyspartan) 6 60.50 63.98 3 50.00
23155. Hannah (hanthetyper) 6 59.21 74.74 0 0.00
23156. Hansol (hansol) 6 140.05 160.25 3 50.00
23157. OhioMewing (hannoobz) 6 60.68 68.68 2 33.33
23158. Hammy (h4mmy) 6 83.69 89.34 2 33.33
23159. Shaun (h0giebear) 6 68.33 73.74 2 33.33
23160. Gyuri (gyuri) 6 80.67 84.43 3 50.00
23161. Xul (gyrofluff) 6 80.73 94.37 4 66.67
23162. Jeb (gwenigale) 6 99.54 108.83 4 66.67
23163. Ryan (gurkenglas9) 6 75.55 84.24 1 16.67
23164. Mr (gunottam) 6 69.15 77.26 1 16.67
23165. g (gunner69) 6 48.83 53.92 1 16.67
23166. Adrian (guncr4ft3r) 6 102.53 114.74 3 50.00
23167. Geo (gsampoerna3) 6 72.56 75.37 0 0.00
23168. glowred (greytime) 6 48.17 52.97 1 16.67
23169. Ben (greentshirtboy) 6 102.84 119.36 4 66.67
23170. Matthew (greatbun) 6 89.36 94.53 2 33.33
23171. gray (grayg52) 6 69.69 76.79 2 33.33
23172. grasstang (grasstang) 6 113.62 138.61 4 66.67
23173. twoheadedboy (grapes_2005) 6 85.21 95.94 0 0.00
23174. you (gotten) 6 80.12 91.16 2 33.33
23175. Trevon (goodwithfingers) 6 89.76 95.05 3 50.00
23176. Goodly (goodlytexas) 6 43.16 60.12 0 0.00
23177. JT (gonroz) 6 65.04 74.78 1 16.67
23178. Nico (gomifune) 6 81.67 88.00 0 0.00
23179. BOss (goldere) 6 107.02 127.45 3 50.00
23180. GodOfTheMetal (godofthemetal) 6 86.82 92.32 3 50.00
23181. Goatinator (go4tinator) 6 93.84 100.38 2 33.33
23182. Sisyphus (gnurlbash) 6 82.91 86.21 1 16.67
23183. Jack (gleesonj) 6 86.43 95.21 6 100.00
23184. Gita (gist23) 6 68.66 88.02 2 33.33
23185. Alex (gincat) 6 71.74 79.54 1 16.67
23186. ghostway (ghostway) 6 53.99 66.17 0 0.00
23187. Caleb (ghostlyaardvark) 6 58.76 61.53 0 0.00
23188. Oskaras (ghostisghost) 6 71.00 86.79 6 100.00
23189. ghostdrain (ghostdrain) 6 107.14 112.32 2 33.33
23190. A (getsavaged) 6 70.61 76.58 4 66.67
23191. tstats[general_iroh] (gener... 6 64.68 71.57 2 33.33
23192. Dios (gembili666) 6 46.39 53.93 6 100.00
23193. Hoang (gelwg1) 6 79.38 92.17 3 50.00
23194. Liam (gearupman) 6 62.01 71.39 0 0.00
23195. Gaurvanshi (gaurvanshi) 6 51.96 55.15 0 0.00
23196. Applesauce (garbagetm) 6 99.76 110.93 0 0.00
23197. Glory (gaminglory) 6 73.46 84.45 1 16.67
23198. Gage (gagedorl) 6 74.93 90.86 1 16.67
23199. gabe (gaberhone) 6 83.78 90.45 1 16.67
23200. gavin (ga123reee) 6 25.45 28.57 1 16.67
23201. edisonhussey (furox) 6 98.59 105.49 3 50.00
23202. Connor (fumania) 6 81.07 88.92 2 33.33
23203. fuad036 (fuad036) 6 75.16 78.77 6 100.00
23204. Radek (fssx) 6 100.86 116.57 2 33.33
23205. fre (fre_24) 6 67.11 76.99 2 33.33
23206. Ryan (fretmo) 6 94.61 107.26 1 16.67
23207. James (freetheguy2) 6 93.09 96.98 1 16.67
23208. keeganchan (forcherie3) 6 129.82 150.15 2 33.33
23209. Fogli (fogli) 6 58.26 66.27 2 33.33
23210. Micah (flyinmnkys) 6 67.19 76.58 0 0.00
23211. Felix (flashy123) 6 111.17 119.39 1 16.67
23212. godofchin (fiyet) 6 89.41 96.86 1 16.67
23213. Fish (fishtent) 6 121.47 132.59 4 66.67
23214. Simon (fishmango) 6 77.75 90.70 3 50.00
23215. Fishcat (fishcat) 6 82.45 93.69 2 33.33
23216. Y (firewatermelon) 6 66.11 78.10 0 0.00
23217. dewgong (fingerlocked) 6 86.69 97.60 1 16.67
23218. Jory (filkyjory) 6 74.47 80.20 2 33.33
23219. Filip (filiplass) 6 107.56 114.53 6 100.00
23220. deohanz (fierywormz) 6 102.39 109.44 3 50.00
23221. Felipe (felipflop) 6 75.99 78.41 3 50.00
23222. SpleF (felipeadn) 6 82.48 92.07 3 50.00
23223. Fat (fattyfatboi) 6 76.74 85.96 3 50.00
23224. Phoexv (fathih) 6 61.31 74.58 0 0.00
23225. Jonas (fanibu) 6 73.33 78.99 1 16.67
23226. FangAbi (fangabi) 6 70.00 79.79 1 16.67
23227. Jason (falminfingaz) 6 114.19 127.33 1 16.67
23228. John (fakelicense) 6 71.76 77.55 2 33.33
23229. Fahrin (fahrin93) 6 53.71 58.29 6 100.00
23230. Ahmad (fadedxtc) 6 59.51 67.85 0 0.00
23231. Francisco (faac98) 6 84.26 87.21 2 33.33
23232. Mars (ezfastboi) 6 67.13 78.10 1 16.67
23233. Alex (extreme360) 6 104.99 113.76 3 50.00
23234. Mark (exec_prod) 6 75.51 82.70 1 16.67
23235. Jared (excline) 6 79.66 84.53 2 33.33
23236. Hadriel (evo_echo) 6 45.37 54.66 1 16.67
23237. (evestay) 6 130.98 147.14 4 66.67
23238. Evan (evanr10190) 6 86.06 92.87 3 50.00
23239. Anthony (euthanasia_) 6 88.68 98.16 1 16.67
23240. E (eunice20) 6 75.37 80.66 3 50.00
23241. Ilya (ethar) 6 64.85 68.82 2 33.33
23242. Ethan (ethaaaaaaaaaan) 6 93.20 111.34 2 33.33
23243. suchir (eternalzx) 6 68.48 75.87 2 33.33
23244. Esther (esthersanti1600) 6 120.09 148.13 5 83.33
23245. Eshwar Reddy (eshwar_god) 6 69.92 76.25 1 16.67
23246. Juver (escoltajuverf) 6 65.07 77.15 1 16.67
23247. Erwin (erwinisgoodenough) 6 110.21 122.68 6 100.00
23248. fast (ersontio) 6 69.18 72.31 1 16.67
23249. No quitting mid race (ersatz) 6 138.45 144.41 5 83.33
23250. Ernie (ernievc) 6 67.99 74.25 2 33.33
23251. eric (erictheass3) 6 78.87 85.99 1 16.67
23252. undefined (epsylon) 6 66.45 99.50 0 0.00
23253. Epoi (epoi_311) 6 56.17 66.81 0 0.00
23254. Joe (eoj05) 6 82.88 95.50 2 33.33
23255. Bleh (entropian) 6 98.36 110.15 4 66.67
23256. Emir (emirthetyper) 6 109.58 114.14 5 83.33
23257. EmiNation | (emingamer) 6 116.55 134.02 4 66.67
23258. Eli (emeyer9) 6 88.76 101.85 3 50.00
23259. Elvis (elvisnator) 6 98.84 111.96 2 33.33
23260. Elo (elovvv) 6 128.16 152.52 6 100.00
23261. ellie (elllllzzz) 6 43.05 48.68 0 0.00
23262. Proximo (elliotkoh) 6 99.69 113.35 3 50.00
23263. Elizur Daniel (elizur_daniel) 6 56.18 64.12 2 33.33
23264. Robert (elitists) 6 73.38 99.84 1 16.67
23265. Elisa (elisac00) 6 99.96 111.87 3 50.00
23266. Elfuun (elfuun) 6 104.50 119.63 4 66.67
23267. SBD (eleets) 6 51.26 60.46 0 0.00
23268. Ariana (electorch) 6 79.87 86.73 1 16.67
23269. eiphosa (eiphosa) 6 64.81 72.54 3 50.00
23270. ninja (ehsaas) 6 64.60 70.76 2 33.33
23271. Evan (eflem32) 6 87.81 100.24 2 33.33
23272. Eduardo (eduojeda55) 6 51.75 58.17 0 0.00
23273. Edison (eddie_boy) 6 68.42 82.33 0 0.00
23274. wuz (echang95) 6 113.98 138.46 2 33.33
23275. Adi (ech0star) 6 106.15 118.12 0 0.00
23276. Evan (ebilton) 6 62.11 72.12 1 16.67
23277. Darnell (dw_doc) 6 54.23 60.59 1 16.67
23278. dnwin (duukki) 6 75.08 93.65 2 33.33
23279. Du (dukuch) 6 98.82 115.47 2 33.33
23280. Ben (dukedukeduke) 6 56.46 64.01 5 83.33
23281. Þorsteinn (duddij) 6 82.79 94.65 2 33.33
23282. Duck (ducklist) 6 62.87 77.49 3 50.00
23283. Osian (dubzzy0) 6 72.82 85.94 2 33.33
23284. Rudy III (dther99) 6 86.62 95.57 4 66.67
23285. Dhruv (droxx76) 6 83.10 109.82 2 33.33
23286. Kobe (dreamer21) 6 53.56 56.84 0 0.00
23287. Drewski (drdrewski) 6 110.60 137.95 2 33.33
23288. Travis (drather) 6 62.48 66.85 3 50.00
23289. Micah (dramaticpineapple47) 6 83.55 94.07 2 33.33
23290. drakcorian (drakcorian) 6 85.44 98.62 3 50.00
23291. YosuaFranly (dragonunik18) 6 52.66 61.22 1 16.67
23292. Eric (doze11) 6 80.55 92.12 4 66.67
23293. Spencer (doucwhatic) 6 56.35 61.54 1 16.67
23294. Donton (donton) 6 79.21 85.96 2 33.33
23295. Dongwoo (dongwoo0504) 6 95.84 102.85 5 83.33
23296. Pyraq (dokson) 6 95.95 106.75 1 16.67
23297. Benjamin (dokdo_korea) 6 101.86 111.91 3 50.00
23298. babe (doggosnutsack) 6 80.28 92.03 2 33.33
23299. Dodoli (dodoli) 6 50.20 58.98 0 0.00
23300. Doctor (doctorina) 6 77.97 91.20 0 0.00
23301. Rose (dkranzberg) 6 97.65 109.34 1 16.67
23302. DJPIXEL (dj_pixel_) 6 80.81 94.11 1 16.67
23303. Tyler (djfjt93) 6 87.98 103.48 0 0.00
23304. dorianmodemusic (djdorian1) 6 114.71 124.57 4 66.67
23305. Diva (divaoxhd) 6 83.95 90.38 1 16.67
23306. Boi (disnoob) 6 112.91 125.22 3 50.00
23307. Dingus (dingus2000) 6 103.34 107.89 2 33.33
23308. Dimitar (dimitard) 6 122.93 140.97 4 66.67
23309. Elias (dillenn) 6 79.33 84.88 2 33.33
23310. Digital (digitalrico) 6 102.22 123.99 4 66.67
23311. digimastersp (digimastersp) 6 75.39 81.68 5 83.33
23312. James Li (diffkey) 6 82.24 97.75 3 50.00
23313. Slick Willy (dick_snapper) 6 80.18 84.99 2 33.33
23314. Dhwaj (dhwxj) 6 59.56 67.16 4 66.67
23315. Dhiva (dhivaa) 6 88.46 95.04 2 33.33
23316. dhia (dhia1) 6 37.07 45.00 0 0.00
23317. Dharma (dharmatycoon) 6 86.74 98.10 1 16.67
23318. dey (deyy) 6 54.52 66.97 1 16.67
23319. Davis (dey1234) 6 91.69 106.04 1 16.67
23320. ronaldo (devildodo) 6 64.46 69.38 2 33.33
23321. Dominc (devdominic) 6 76.02 95.00 1 16.67
23322. Riley (detectiverocket) 6 61.42 68.04 1 16.67
23323. Desmond (desmond012) 6 90.58 97.97 3 50.00
23324. Jonas Heitz (der_junker) 6 64.87 78.16 1 16.67
23325. derftastic (derftastic) 6 89.96 102.51 2 33.33
23326. dennerrr (dennymin) 6 106.36 124.67 5 83.33
23327. Denis (denisjames) 6 59.17 65.44 0 0.00
23328. Pog (deftst) 6 105.30 145.78 1 16.67
23329. Decent (decent_dvorak) 6 33.51 45.76 1 16.67
23330. Noah (dead_dogs) 6 77.18 89.22 0 0.00
23331. Deadlocz (deadlocz) 6 65.27 77.91 1 16.67
23332. David (daychow) 6 70.27 86.51 2 33.33
23333. Jack (dasher11) 6 89.21 98.84 0 0.00
23334. Darren (darren) 6 37.01 41.32 0 0.00
23335. Darkos (darkoser0) 6 64.72 73.03 3 50.00
23336. Darkness_ (darkness_) 6 59.28 65.42 2 33.33
23337. Swapnil (darklonewolf) 6 53.80 56.81 1 16.67
23338. intermediate 2029 (darkis99) 6 130.83 147.02 3 50.00
23339. Rikrish (dardbador) 6 77.15 83.47 1 16.67
23340. Daniel (danyroza) 6 76.68 91.84 1 16.67
23341. Danya (danya_z) 6 56.81 63.64 4 66.67
23342. Daniel (danielnmr) 6 105.67 123.79 6 100.00
23343. Dani (dani321456) 6 52.51 57.55 4 66.67
23344. Charlie (dangdude) 6 56.80 60.78 0 0.00
23345. Mr (dacookieboy) 6 106.05 116.13 4 66.67
23346. den (d3niska) 6 118.69 131.94 2 33.33
23347. Bruce (cybwong) 6 82.30 90.13 4 66.67
23348. Chan (cy0309) 6 32.07 34.48 0 0.00
23349. Marek (cxmu03) 6 70.98 79.05 0 0.00
23350. abhimanyu (cvfz) 6 101.32 114.29 2 33.33
23351. cuddly (cuddly_poetatoe) 6 66.38 72.36 0 0.00
23352. GodIsGood (cruz989) 6 71.63 81.27 1 16.67
23353. Alan (creamedpants) 6 56.15 67.28 5 83.33
23354. Tristan (crazy_bisket) 6 76.04 84.65 3 50.00
23355. Trivendram (crazyzoker) 6 40.98 55.13 0 0.00
23356. eileen (crazyteal1) 6 65.07 73.65 1 16.67
23357. Sam (crapslock) 6 108.05 113.67 3 50.00
23358. Junior (corpseslayer) 6 62.46 66.85 3 50.00
23359. Conner (conmanb) 6 92.81 108.28 4 66.67
23360. Conner (conbrad33) 6 52.20 65.92 2 33.33
23361. Melisa (colorsunimaginable) 6 66.20 72.84 3 50.00
23362. sofL (colemak_is_poggers) 6 106.11 113.25 3 50.00
23363. Danny (colby_brian) 6 114.37 121.31 4 66.67
23364. colaclanth (colaclanth) 6 107.77 118.37 1 16.67
23365. Coeburn (coeburn) 6 64.50 69.36 3 50.00
23366. Code (codename47) 6 90.31 96.55 3 50.00
23367. cmyang (cmyang) 6 54.22 67.37 2 33.33
23368. Josh (cloudworks) 6 103.23 124.34 2 33.33
23369. tstats[clob1414] (clob1414) 6 85.45 95.72 1 16.67
23370. Clement (clementid) 6 55.29 59.39 2 33.33
23371. ciber (cibernike) 6 71.08 74.67 3 50.00
23372. SayGex (ch_alex) 6 75.05 91.35 2 33.33
23373. Kyle (chynkii) 6 83.54 97.02 3 50.00
23374. Christopher (chrizopaz) 6 75.99 87.13 2 33.33
23375. Chris (chrdex789) 6 85.17 97.37 1 16.67
23376. chopsueyrice (chopsueyrice) 6 101.23 109.21 2 33.33
23377. Lamonte (chinpo) 6 83.57 97.74 1 16.67
23378. ChiefSec (chiefsec) 6 83.62 104.65 5 83.33
23379. Judah (chewyglue) 6 61.66 72.09 0 0.00
23380. ༘🐈ᯓ⌇🐾 ₊⁺... 6 65.94 75.45 2 33.33
23381. Che (cherry3330) 6 87.67 97.24 4 66.67
23382. Big Daddy (chef_yeet) 6 75.49 82.76 2 33.33
23383. Pro (cheater_0) 6 102.42 110.99 3 50.00
23384. Charlotte (chazish) 6 87.02 93.01 2 33.33
23385. Juan (chayanneofficial) 6 67.86 73.04 1 16.67
23386. Chawin (chawintree) 6 116.61 127.58 4 66.67
23387. 四百二十 (chapuix) 6 89.71 102.91 4 66.67
23388. ChaosRelik (chaosrelik) 6 47.31 51.03 1 16.67
23389. chanden (chanden) 6 133.48 144.92 5 83.33
23390. kevqiii (chairccc) 6 61.68 73.60 4 66.67
23391. Chaicow (chaicow) 6 124.59 140.97 1 16.67
23392. CF (cfoodc) 6 70.27 79.24 3 50.00
23393. emma (certifiedberries) 6 51.26 55.55 1 16.67
23394. Charlie (celzuk) 6 97.64 114.67 3 50.00
23395. Claudia (cdnnnn) 6 52.73 65.36 0 0.00
23396. Connor (cbec32) 6 83.85 91.90 3 50.00
23397. Gaurab (catinpajamas) 6 85.79 99.86 2 33.33
23398. Isabelle (catgirl_007) 6 46.48 48.95 0 0.00
23399. Annie (caroullri6) 6 45.55 53.07 0 0.00
23400. Austin (captan535) 6 58.66 67.87 2 33.33
23401. OLDASIANLADYzz (captainpj) 6 88.00 108.08 2 33.33
23402. Caothu (caothunet) 6 60.18 66.90 1 16.67
23403. Charles (candydaniel) 6 110.09 132.42 3 50.00
23404. Cameron (camicazz475) 6 97.10 102.41 3 50.00
23405. Noah (cadhp) 6 98.62 118.61 2 33.33
23406. Byran (byran_tech) 6 101.26 121.67 4 66.67
23407. BusinessMan (businessman4) 6 67.78 72.40 5 83.33
23408. bullyjuice (bullyjuice) 6 93.00 116.05 2 33.33
23409. Hiroshi (buhiroshi0205) 6 89.33 102.06 3 50.00
23410. bbb (bugbearbey) 6 55.36 62.80 0 0.00
23411. NOkia (bruhmomemtum) 6 72.84 78.20 2 33.33
23412. bruhlollol (bruhlollol) 6 95.79 102.46 3 50.00
23413. bruhhhelpla (bruhhhelpla) 6 89.77 104.95 2 33.33
23414. bwian (brianschao) 6 119.79 131.46 4 66.67
23415. bRIAn (brianlebrian) 6 96.40 108.86 0 0.00
23416. Bremerton (bremerton) 6 97.07 111.43 6 100.00
23417. Klobásník (boumex) 6 53.26 61.03 0 0.00
23418. my mom (botmon99) 6 72.31 82.30 3 50.00
23419. Gina (borbinon) 6 82.66 92.12 3 50.00
23420. K3VIN (bootunstoppable) 6 98.29 103.36 1 16.67
23421. BootleDootle (bootledootle) 6 68.85 81.14 1 16.67
23422. Jonah (booshie) 6 95.74 117.78 4 66.67
23423. . (boop_69) 6 64.12 78.64 3 50.00
23424. Bone (bonezybeats) 6 101.53 119.55 3 50.00
23425. Bom (bom_dia) 6 60.30 72.66 4 66.67
23426. BOKATHINGYMABOB (bokathingy... 6 68.94 84.81 2 33.33
23427. Boikom (boikom) 6 66.12 70.60 0 0.00
23428. Hampus (bogge_) 6 59.58 61.98 1 16.67
23429. bmwsauber (bmwsauber) 6 25.06 27.53 0 0.00
23430. Ben (bmj774) 6 71.13 79.72 0 0.00
23431. Jayden (bluuser) 6 45.08 52.59 0 0.00
23432. Benjamin (blaptypes) 6 108.90 119.25 5 83.33
23433. Luke (blame_luke) 6 66.25 89.08 2 33.33
23434. Vu Huy (blaccod) 6 59.90 66.43 0 0.00
23435. Bla (blablabla_) 6 63.77 73.04 0 0.00
23436. Brandon (bkavanaugh6) 6 65.98 75.66 1 16.67
23437. Biswajit (biswajit_maity) 6 50.47 55.38 0 0.00
23438. Big (big_peen_budhai) 6 45.09 49.75 1 16.67
23439. Abhinav (bigweeb69) 6 73.34 79.48 0 0.00
23440. Hung (biggestahung) 6 50.06 55.56 0 0.00
23441. Bibek (bibek_khyaju) 6 52.20 63.40 0 0.00
23442. Bendik (bibben) 6 88.55 93.27 3 50.00
23443. Edbert (berted) 6 92.56 100.45 0 0.00
23444. Ben (benwarner) 6 59.12 65.60 2 33.33
23445. Johnnieboy (bently5102) 6 97.36 114.29 5 83.33
23446. Ben (benjikimchi) 6 88.81 98.38 3 50.00
23447. ben (benaiah8) 6 37.53 45.64 0 0.00
23448. BEGMB (begmb) 6 49.86 59.67 6 100.00
23449. Yoshi (beegyoshifan) 6 92.65 101.40 1 16.67
23450. Ryan (beefsoup) 6 92.35 103.92 3 50.00
23451. TardPancake (beastowner69) 6 77.87 90.01 2 33.33
23452. OMEGALUL (bearingsea) 6 89.55 97.81 2 33.33
23453. Bayu (bayoudra) 6 62.48 73.24 3 50.00
23454. bayarhuu (bayarhuu14) 6 38.50 45.85 0 0.00
23455. Almat (bassaroff) 6 37.98 44.94 0 0.00
23456. Cog (baritune) 6 101.07 107.35 3 50.00
23457. Brandon (bardnon) 6 104.36 108.60 4 66.67
23458. Cooper (bannanaman9000) 6 83.97 88.87 1 16.67
23459. Michael (bannable_) 6 109.92 116.14 0 0.00
23460. BadxX (badxx) 6 71.36 79.99 3 50.00
23461. bacon (bacnv) 6 31.68 40.43 0 0.00
23462. Blake (backflip25) 6 103.49 110.92 1 16.67
23463. Babblecat (babblecat) 6 52.12 59.67 0 0.00
23464. aztiokir (aztiokir) 6 111.93 128.74 6 100.00
23465. Clayton (azpinballer) 6 82.45 96.13 2 33.33
23466. ayush (ayush_raj) 6 51.35 57.77 1 16.67
23467. Ayush (ayush729p) 6 74.31 78.57 4 66.67
23468. Saeasd (axol578) 6 90.43 101.09 2 33.33
23469. hock siong (axiang2000) 6 53.45 64.64 1 16.67
23470. lex (axemzo) 6 98.66 110.17 1 16.67
23471. Mister_ (axad007) 6 73.13 85.54 1 16.67
23472. Awzzz (awzzz) 6 108.68 122.84 1 16.67
23473. Praveen (awesomeroks) 6 106.58 123.01 2 33.33
23474. Awaken (awaken_) 6 77.76 86.74 4 66.67
23475. AW50M3 (aw50m3) 6 52.15 61.41 0 0.00
23476. Joseph (avoirjoseph) 6 76.85 82.35 4 66.67
23477. autzmn (autzmn) 6 102.30 127.25 3 50.00
23478. autism (autismboy) 6 103.03 106.47 4 66.67
23479. author (authorrr) 6 70.85 81.81 5 83.33
23480. NongAugust (augustzuz) 6 46.29 54.44 3 50.00
23481. Troy (atheropods) 6 102.61 117.94 4 66.67
23482. Astro (astro_here) 6 45.88 51.53 1 16.67
23483. Astroe (astroe) 6 83.07 93.04 5 83.33
23484. Tin (asianzhang) 6 101.96 117.12 2 33.33
23485. Zi (asianzealand) 6 96.50 113.19 3 50.00
23486. Ashraz (ashraz) 6 47.11 56.66 0 0.00
23487. Ashmie (ashmie) 6 69.28 76.24 0 0.00
23488. lowkeynotash (ashleer) 6 98.42 104.11 3 50.00
23489. AAAA (asdkjfn) 6 99.65 104.37 2 33.33
23490. Amethyst (artesoscuras) 6 105.80 125.62 3 50.00
23491. Arshavir (arshavir777) 6 44.96 48.89 0 0.00
23492. Angelica (arrico128) 6 58.50 65.19 2 33.33
23493. Aristeu (aristeu) 6 64.35 69.50 0 0.00
23494. Charvin (archavint) 6 83.21 99.27 2 33.33
23495. Jacqui (applejakkes) 6 56.90 62.58 1 16.67
23496. Apol (apolmiguel) 6 106.24 114.02 3 50.00
23497. PATH (aperson2003) 6 74.93 83.80 0 0.00
23498. xAnzord (anzord) 6 89.11 91.67 1 16.67
23499. Benedict (anzagta) 6 79.97 93.92 3 50.00
23500. Sha (anything_goes) 6 161.35 166.37 3 50.00
23501. ilysm (angelkiro) 6 117.04 123.12 6 100.00
23502. Andy (andyyy68) 6 128.83 141.43 6 100.00
23503. Andy (andytypeslol) 6 72.09 77.45 1 16.67
23504. Andrew (andrewgoat) 6 117.76 137.72 1 16.67
23505. Andrea (andrea144) 6 49.41 55.79 1 16.67
23506. Andororo (andororo) 6 73.93 76.72 0 0.00
23507. Anch (anch159) 6 151.47 160.57 5 83.33
23508. Amirata (amiratak88) 6 73.01 75.48 2 33.33
23509. Amin (aminarman) 6 72.07 75.72 3 50.00
23510. El cote (alyeet) 6 67.93 84.87 2 33.33
23511. Alvin (alvinarsyh) 6 65.16 67.92 1 16.67
23512. Rafa (alphadog69) 6 53.57 59.78 0 0.00
23513. Jimwell (alohaxjim) 6 71.28 81.75 1 16.67
23514. Cal (almostpoetic) 6 89.97 97.52 1 16.67
23515. Allagance (allagance) 6 92.04 99.09 3 50.00
23516. Ali (alimron) 6 47.83 56.51 1 16.67
23517. alibaba (alibaba_) 6 65.00 71.45 1 16.67
23518. Alex (alex_lele) 6 60.75 73.47 1 16.67
23519. Alexander (alexxela12345) 6 84.21 94.54 5 83.33
23520. Auguto (alegato) 6 40.34 44.81 0 0.00
23521. Cristi (alecucristi) 6 66.03 72.58 0 0.00
23522. Alan (alan186) 6 74.48 86.15 0 0.00
23523. ash (akx_sh) 6 53.92 68.76 4 66.67
23524. Akrish (akrish) 6 83.28 91.29 3 50.00
23525. Akiro (akiroooo) 6 88.88 103.30 1 16.67
23526. Akisa (akisarazbu) 6 92.85 97.16 5 83.33
23527. Andreas (ak9729) 6 58.89 69.40 1 16.67
23528. Adrian (ajwong123) 6 86.83 92.81 0 0.00
23529. rei (airyuki) 6 81.77 90.04 1 16.67
23530. aimas (aimas) 6 46.35 48.76 1 16.67
23531. Luna (aicaya) 6 90.86 96.11 1 16.67
23532. Alex (ahouse101) 6 97.56 113.53 3 50.00
23533. Ahnaf (ahnaf_goku) 6 63.06 68.22 3 50.00
23534. Adam (agbell) 6 57.45 67.60 1 16.67
23535. Agate (agate) 6 42.15 48.91 0 0.00
23536. Sulaiman (agarasulaiman) 6 53.64 59.30 0 0.00
23537. Afra (afra_666) 6 72.68 77.98 1 16.67
23538. Arefin (afrabby) 6 45.72 47.05 0 0.00
23539. Jeff (aeoiuf) 6 104.55 115.78 3 50.00
23540. Soap (adventuroussoap) 6 35.97 40.05 1 16.67
23541. Baris (adrik009) 6 94.59 108.99 3 50.00
23542. Aditya (aditya1024) 6 45.94 48.46 0 0.00
23543. Adarsh (adimall) 6 59.47 65.69 3 50.00
23544. Jason (addictedtobacon) 6 88.32 106.61 4 66.67
23545. Adavidapa (adavidapa) 6 54.02 57.40 4 66.67
23546. Adarsh (adarshtopno) 6 84.46 88.65 2 33.33
23547. kelvin (actualcarton782) 6 82.57 102.85 3 50.00
23548. Adam (acidcypher) 6 73.25 81.27 2 33.33
23549. Ace (acepilot22) 6 92.67 102.58 2 33.33
23550. uks4nddl3 (accuracy2) 6 156.74 166.09 5 83.33
23551. Alex (acblackburn) 6 66.70 77.90 1 16.67
23552. Ahsin (abid1) 6 46.77 52.95 1 16.67
23553. Abhilash (abhilash_kumar) 6 44.95 57.01 1 16.67
23554. Abhi (abhib22) 6 166.97 176.33 6 100.00
23555. Aaron (aaronec2) 6 77.62 85.88 0 0.00
23556. Aalpesh (aalpesh) 6 83.10 86.95 3 50.00
23557. aaaaaaa (aaaaaaayyy) 6 74.80 98.88 2 33.33
23558. s a d b o y (a51nx) 6 112.74 117.63 2 33.33
23559. Joe (9ighty) 6 60.43 73.37 1 16.67
23560. Colin (8_wpm) 6 74.39 78.54 2 33.33
23561. M7moudGadallah (7ooda) 6 61.02 65.42 2 33.33
23562. ... (7mza) 6 61.98 65.04 2 33.33
23563. 6hwh6 (6hwh6) 6 86.31 96.78 3 50.00
23564. Shagato (5hagat0) 6 58.68 61.56 1 16.67
23565. 200wpmgrind (200wpmgrind) 6 80.71 90.55 3 50.00
23566. Sean (157644) 6 66.52 72.03 0 0.00
23567. Zach (11037) 6 98.34 108.00 1 16.67
23568. keyboard (0001wpm) 6 88.78 98.35 1 16.67
23569. J (crazjayz) 6 101.74 118.37 2 33.33
23570. Daniar (kasdan23) 6 36.26 38.90 0 0.00
23571. Thang (dominhthang) 6 51.81 63.19 0 0.00
23572. Meyah (toxikk29) 6 66.95 76.46 3 50.00
23573. Josh (joshtreimer) 6 62.71 67.70 0 0.00
23574. Kith (kithford) 6 78.54 81.30 2 33.33
23575. farge (hongmeiling) 6 58.44 67.38 5 83.33
23576. Vivian (bibian420) 6 82.68 94.25 2 33.33
23577. MrMeatBalls (mrmeatballs) 6 47.45 66.10 1 16.67
23578. josh (5625jj) 6 73.79 83.50 2 33.33
23579. Atticus (sofaboii) 6 37.49 39.24 0 0.00
23580. Charles Francis (cfl_23) 6 62.52 69.72 1 16.67
23581. levon (levonskyway) 6 77.32 85.17 3 50.00
23582. Elias (eliasburs) 6 77.19 80.18 1 16.67
23583. abc (abca123j12o3i) 6 67.16 71.96 0 0.00
23584. David (whyischo) 6 89.23 102.50 3 50.00
23585. tReby (treby08) 6 49.75 55.09 2 33.33
23586. Endrianus (endrianusgohan) 6 85.83 99.91 2 33.33
23587. maxwell (macyq) 6 50.90 60.46 2 33.33
23588. Dan (danphm) 6 92.16 116.28 5 83.33
23589. taco (tacopichu) 6 98.10 101.21 1 16.67
23590. Greg (kotsmile) 6 46.73 52.00 1 16.67
23591. Dw (unrandom) 6 90.19 98.82 4 66.67
23592. melodie (melodiexu) 6 115.01 145.33 3 50.00
23593. SpxwnDev (sghqz) 6 76.79 82.05 2 33.33
23594. Dalton (shazam253) 6 76.13 86.84 1 16.67
23595. cubebuc (cubebuc) 6 82.81 96.28 2 33.33
23596. Jrident (jrident) 6 100.72 107.66 6 100.00
23597. Michael (viperman99) 6 86.12 101.88 1 16.67
23598. Paco (alphagamer4828) 6 69.26 74.27 3 50.00
23599. sofi (madisofian) 6 57.66 65.27 0 0.00
23600. RED_X000 (red_x000) 6 62.98 72.46 1 16.67
23601. Erik (eldrazic) 6 51.59 55.74 3 50.00
23602. snupis (sasore_) 6 77.10 83.05 1 16.67
23603. Baibhav (otaku977) 6 45.69 49.62 4 66.67
23604. Aidan (aida12n) 6 63.94 68.85 3 50.00
23605. max (bluespongecake) 6 62.71 71.74 1 16.67
23606. Aidando (profquif) 6 79.66 92.42 2 33.33
23607. Jason (agent7x) 6 83.70 91.64 3 50.00
23608. Finn (finnjo) 6 89.92 97.94 3 50.00
23609. Billie (shig_186) 6 42.30 46.52 5 83.33
23610. bread (spaghette) 6 80.69 99.29 5 83.33
23611. Thomas (thomascookiehead) 6 66.32 77.28 1 16.67
23612. G0og (acoostic) 6 80.91 85.86 1 16.67
23613. Joda (fruitsnakuh) 6 64.41 73.57 1 16.67
23614. OWL (owl_noob) 6 30.88 35.54 0 0.00
23615. Amy (sxooter777) 6 60.08 71.31 2 33.33
23616. Kohnsagrado (kohnsagrado) 6 79.37 85.76 5 83.33
23617. puffinmuffin (puffiinmuffin) 6 34.45 41.13 1 16.67
23618. Pen (aavian00) 6 73.03 79.08 3 50.00
23619. aringq (aringq) 6 93.22 102.37 5 83.33
23620. sydeth (sydeth) 6 66.36 76.54 5 83.33
23621. Amir (amir265) 6 84.84 94.05 2 33.33
23622. Pranav (spacejet13) 6 51.29 57.87 0 0.00
23623. FX (golden_tiara) 6 91.48 100.23 1 16.67
23624. jared, (yeu0401) 6 100.62 112.34 6 100.00
23625. Lauren (rynnicole) 6 70.49 75.58 6 100.00
23626. just typing (ekkology) 6 65.37 74.93 2 33.33
23627. David (handsome_mango) 6 75.50 90.85 0 0.00
23628. Bartoszek1 (bartoszek_1) 6 62.86 65.74 2 33.33
23629. Nathan (ngong123) 6 112.37 124.25 2 33.33
23630. Gian (maxpain2000) 6 93.26 101.85 2 33.33
23631. pricklydoughnut (pricklydou... 6 66.59 82.00 1 16.67
23632. Donovan (djdon774) 6 79.62 86.67 3 50.00
23633. Cameron (cammikens) 6 63.74 77.98 4 66.67
23634. jogn (ccaian) 6 100.28 119.77 3 50.00
23635. Aditya (gaming_zilla) 6 54.55 63.20 2 33.33
23636. Akash (akash126) 6 32.46 37.71 2 33.33
23637. XIII_siren (xiii_siren) 6 66.93 77.35 4 66.67
23638. Nova (noviepovie) 6 56.87 59.02 3 50.00
23639. Devang (thegoat89) 6 77.66 86.76 3 50.00
23640. Edrick (itsthatoneguy) 6 61.47 69.47 0 0.00
23641. yes (huskeygg) 6 85.80 103.29 0 0.00
23642. em (eeopkc) 6 111.67 115.29 3 50.00
23643. Utsab (utsabghmr) 6 71.33 80.16 0 0.00
23644. H5665m (qpowiepwoiqepoikljs... 6 43.97 59.64 0 0.00
23645. Sard (advblack7) 6 85.73 93.69 2 33.33
23646. Amery Dawn (amerydawn) 6 42.40 51.95 1 16.67
23647. gre114 (gre114) 6 49.11 54.69 2 33.33
23648. Mavvy (luckyidk) 6 55.62 71.89 1 16.67
23649. Matthew (matthewke10) 6 108.86 129.63 5 83.33
23650. Freddy (k4ppacino) 6 92.60 108.18 1 16.67
23651. Lajaj (lajaj) 6 39.82 43.39 1 16.67
23652. DuhKoeYah (duhkoetah_1) 6 51.58 62.21 1 16.67
23653. Allogica (allogica) 6 65.72 73.53 1 16.67
23654. Ryan (ry_lie) 6 64.91 74.46 1 16.67
23655. Jensly (bungie0000) 6 74.48 84.42 1 16.67
23656. ravx (ravx00) 6 50.22 53.45 0 0.00
23657. Matúš (naimakka) 6 51.10 59.11 3 50.00
23658. SeniorPoopypants (pantspooper) 6 79.89 87.19 2 33.33
23659. Blitzs (blitzs) 6 55.36 59.48 1 16.67
23660. Yng_kul (typebota_code_43) 6 45.93 50.16 0 0.00
23661. Dante (dantitos) 6 72.88 83.37 3 50.00
23662. Karnav (karnav_thakur) 6 75.45 77.27 1 16.67
23663. Mayar (mayar_refaat) 6 37.26 43.63 0 0.00
23664. Jordan (jmb777) 6 52.45 65.72 0 0.00
23665. Yuvraj (yuvi08) 6 51.93 55.49 0 0.00
23666. Steven (stevenwonlee) 6 103.33 112.25 5 83.33
23667. Lucas (lucas_69) 6 77.94 90.65 1 16.67
23668. p (masterzedd) 6 38.14 40.89 0 0.00
23669. Cadence (pyromage) 6 114.23 123.87 3 50.00
23670. ReezFreeze (reezfreeze) 6 58.13 64.71 1 16.67
23671. Federico (brokenplayer) 6 49.16 53.36 2 33.33
23672. Bruno (neptoon) 6 73.49 84.43 1 16.67
23673. Anthimos (anthimoskal21) 6 55.77 63.76 0 0.00
23674. beastron2 (beastron2) 6 87.53 126.44 2 33.33
23675. Evanb (longstone) 6 62.80 66.82 0 0.00
23676. Sean (prophetol) 6 63.37 73.31 1 16.67
23677. Funky (funkybuddha) 6 63.44 69.72 0 0.00
23678. Catherine (omgitzcattxo) 6 94.56 122.80 5 83.33
23679. Lasith (z1nc0r3) 6 62.46 68.05 2 33.33
23680. Bronzy (bronzy) 6 120.49 128.15 5 83.33
23681. mario (mario__23) 6 25.45 27.87 0 0.00
23682. Alfredo (thezombiezone) 6 76.86 86.57 3 50.00
23683. SeungHyeon (hacanna42) 6 88.41 102.74 3 50.00
23684. Rebecca (rebeccak0128) 6 64.99 72.78 1 16.67
23685. Marcus (s95073) 6 40.87 43.47 1 16.67
23686. FOR BYRON (kesner) 6 71.51 80.38 1 16.67
23687. Alison (cinnabonbon) 6 93.93 102.53 3 50.00
23688. neil (porpuz) 6 61.48 63.28 3 50.00
23689. Vincent (vincema) 6 42.23 47.72 1 16.67
23690. Joaquin (purplepizzazz) 6 78.16 89.27 4 66.67
23691. henrynguyen2162 (jet404) 6 104.35 135.00 2 33.33
23692. Muhammad (mkr3) 6 46.68 55.22 0 0.00
23693. Nabeel (muhnab) 6 60.12 70.19 1 16.67
23694. Avish (avish233) 6 56.35 64.21 1 16.67
23695. Mcsteve (mcsteve) 6 36.36 40.83 0 0.00
23696. kasper (flits16) 6 72.67 78.65 2 33.33
23697. Rachel (jrachrob) 6 79.11 95.35 0 0.00
23698. Abhishek (abhi_bana) 6 52.98 67.91 0 0.00
23699. Ankit (ankityadav) 6 38.90 43.78 0 0.00
23700. Nate (liquidcrafter) 6 70.54 78.44 1 16.67
23701. Benjamin (benny_makes_music) 6 50.27 60.54 1 16.67
23702. Yusuf (yamr7n) 6 47.88 56.61 4 66.67
23703. Neo (neovanni) 6 101.56 115.11 2 33.33
23704. Jason (jasonee) 6 73.95 90.27 1 16.67
23705. Dominique (tinker_13) 6 62.45 67.59 0 0.00
23706. Curious Beats (curious_beats) 6 86.57 96.60 1 16.67
23707. zVintrix (vintrix) 6 81.39 96.88 2 33.33
23708. elbie (twonangs) 6 58.09 71.63 2 33.33
23709. Jason (jtsao22) 6 104.11 141.09 4 66.67
23710. Sean (wtfseanscool) 6 116.65 124.53 5 83.33
23711. Jamoliddin (farid5266) 6 24.83 26.62 2 33.33
23712. Shark (wozi) 6 78.32 91.74 0 0.00
23713. Tornado (tornadoradon) 6 38.69 42.83 1 16.67
23714. Sean Francis Kilem (seansty... 6 71.29 82.50 6 100.00
23715. ℤℍ (zhulal) 6 35.17 40.58 1 16.67
23716. hackarre (hackarre) 6 73.44 80.18 0 0.00
23717. rongquan (rongquan) 6 84.03 98.62 2 33.33
23718. adam (craker365) 6 42.03 52.80 0 0.00
23719. Gopal (gopalloharnew) 6 47.31 50.86 0 0.00
23720. dragontec12 (dragontec12) 6 34.84 39.82 0 0.00
23721. gabrielallba (rielgbrl) 6 83.91 90.84 2 33.33
23722. Andrew (anhrab) 6 79.05 86.07 1 16.67
23723. yoda (sahxls) 6 74.45 85.51 1 16.67
23724. Hugman (hugoweck) 6 36.32 43.30 0 0.00
23725. taiga (pptaiga) 6 73.52 78.99 2 33.33
23726. sniperdonlung (sniperdonlung) 6 85.92 95.10 5 83.33
23727. Niklas (neoon) 6 80.50 85.70 1 16.67
23728. Jerry (jerryni1996) 6 108.33 113.05 3 50.00
23729. Joe (sokonama) 6 67.66 74.43 1 16.67
23730. Mario (eryngium) 6 59.59 64.14 2 33.33
23731. Carlos Emanuel (ocaarl) 6 30.79 38.29 2 33.33
23732. Reaper (satanreaper) 6 79.34 91.51 2 33.33
23733. Anisha (anisha_) 6 35.80 38.08 0 0.00
23734. Jairo (lukario0037) 6 24.43 27.14 1 16.67
23735. Simon (angelwoodie) 6 65.92 78.87 1 16.67
23736. Jade (wxnderschon) 6 61.74 67.34 0 0.00
23737. Raz (razzlel) 6 59.48 66.04 1 16.67
23738. ella (ellsies10) 6 89.82 96.36 3 50.00
23739. vicissic (sahhdude) 6 66.78 78.58 3 50.00
23740. Soren (grilledkiwi) 6 48.92 55.78 0 0.00
23741. Jonathan (peludo_jamon) 6 96.99 104.28 5 83.33
23742. Ales (alestypes) 6 102.45 117.95 4 66.67
23743. Steuart (sturtt) 6 95.77 113.83 3 50.00
23744. lightninguy (lightninguy) 6 61.15 71.70 1 16.67
23745. Sakuta (sakuta1) 6 102.92 115.64 5 83.33
23746. lei (__lwan) 5 70.81 82.30 3 60.00
23747. Peter (_vroom_vroom_vroom_) 5 64.21 71.44 1 20.00
23748. TQ (_tq_) 5 117.76 123.20 5 100.00
23749. Sebastien (_stigson) 5 78.78 88.12 1 20.00
23750. Alex (_solace) 5 129.09 136.65 5 100.00
23751. Měkš (_kysel_) 5 37.77 42.82 0 0.00
23752. David (zzandland) 5 117.36 124.14 3 60.00
23753. zyx3D (zyx3d) 5 54.18 59.96 0 0.00
23754. kent (zxcvbnmqwertyuiopasdf... 5 105.09 123.29 4 80.00
23755. zsolesz71 (zsolesz71) 5 58.81 71.38 1 20.00
23756. Zechariah (zs1l3nt) 5 51.80 68.15 2 40.00
23757. Zovar (zovar) 5 84.28 91.94 2 40.00
23758. Freddy (zoower) 5 97.86 104.34 2 40.00
23759. sofia (zoophyy) 5 62.66 83.25 3 60.00
23760. Lewis (znake) 5 137.80 140.57 3 60.00
23761. ZJG11 (zjg1) 5 63.68 73.84 2 40.00
23762. Katie (zippolighter) 5 74.49 79.06 0 0.00
23763. Jeremy (ziney) 5 70.18 91.03 2 40.00
23764. Robin (zeyphros) 5 90.79 99.67 2 40.00
23765. R4g3 (zepyxlofficial) 5 64.46 71.72 1 20.00
23766. zeon (zeon000) 5 88.74 111.06 2 40.00
23767. Alexander (zenkarb) 5 70.24 75.53 3 60.00
23768. Abuumin (zemonix) 5 115.64 141.29 2 40.00
23769. zeffxy (zeffxy) 5 58.57 68.83 2 40.00
23770. Lorenzu (zecim) 5 85.81 95.11 2 40.00
23771. yuukinoe (zaxavien) 5 126.25 143.12 4 80.00
23772. zayden (zaydenz12) 5 44.51 55.42 0 0.00
23773. oli (zanthen) 5 50.27 55.75 4 80.00
23774. Dixie (zanarkind) 5 91.33 104.93 1 20.00
23775. Yuki (yuuuukii) 5 90.17 99.89 1 20.00
23776. Yuseph (yuseph) 5 108.16 129.07 1 20.00
23777. Ved (yur_amma_on_me) 5 61.03 68.84 5 100.00
23778. Shapes (yshapes) 5 107.20 123.97 4 80.00
23779. Youssef (youssef1781) 5 84.97 99.56 2 40.00
23780. YourBroChris (yourbrochris) 5 94.76 113.22 3 60.00
23781. Coco (yordle) 5 60.97 69.33 1 20.00
23782. Yonas (yonasthenerd) 5 88.86 94.55 2 40.00
23783. Yohann (yohann27) 5 60.44 63.53 0 0.00
23784. Y (yinted) 5 68.84 73.98 0 0.00
23785. yet (yettoname) 5 43.93 50.16 0 0.00
23786. Ding (yesisd) 5 81.54 86.48 1 20.00
23787. Yerry (yerryracer) 5 101.91 117.52 1 20.00
23788. prithee peace (yeeyeeyeet) 5 73.62 81.78 0 0.00
23789. pica123 (yeeboi) 5 94.74 100.00 3 60.00
23790. yash (yashhh) 5 62.01 71.18 2 40.00
23791. Yana (yanafaisal) 5 70.68 77.96 2 40.00
23792. yamax (yamax) 5 63.79 70.22 0 0.00
23793. Jack (yackpancakes) 5 70.08 76.35 2 40.00
23794. Yersin (y3r51n) 5 56.53 67.80 2 40.00
23795. xxneoxx (xxneoxx) 5 89.68 95.67 0 0.00
23796. Leo (xxlxx) 5 64.57 67.45 1 20.00
23797. XxJrebzxX (xxjrebzxx) 5 47.03 51.35 0 0.00
23798. Daniel (xuanzang44) 5 89.18 103.72 1 20.00
23799. Sander (xtyseth) 5 111.38 131.03 4 80.00
23800. Max (xsrvmy) 5 94.78 103.35 1 20.00
23801. Ryan (xryann_) 5 99.46 104.62 1 20.00
23802. Fábio (xred13) 5 106.92 115.30 4 80.00
23803. aCOLEMAK-ist (xphoenixgod) 5 57.09 62.91 0 0.00
23804. Ximiz (ximiz) 5 71.06 77.40 1 20.00
23805. J (xiji) 5 65.48 72.74 0 0.00
23806. IG/FB @ Jivuls (xhyperize) 5 110.51 127.37 3 60.00
23807. XGRAPHIC (xgraphic) 5 57.92 64.58 5 100.00
23808. Daniel (xdanielx456) 5 84.42 92.07 2 40.00
23809. indo_itu_gampang (xcloretg) 5 113.35 127.48 3 60.00
23810. xavier (xavierguertin) 5 68.31 73.77 1 20.00
23811. Xavier (xavasx) 5 75.87 83.97 2 40.00
23812. Tiffany (xaelium) 5 116.36 125.42 1 20.00
23813. Jim (wrldsmine) 5 114.68 120.88 3 60.00
23814. emma (wooemma) 5 72.96 91.94 2 40.00
23815. woni (woni) 5 56.62 71.39 0 0.00
23816. Himeko (woahhhhhhhhh) 5 87.84 103.23 5 100.00
23817. WizzzyTM (wizzzytm) 5 41.35 45.02 0 0.00
23818. Witox (witho567) 5 89.30 94.73 1 20.00
23819. bleh (wisdoom) 5 69.94 76.44 0 0.00
23820. TetraVoltX (wing_x) 5 63.94 69.03 1 20.00
23821. Matthew (windowsmasherx5) 5 100.20 111.62 2 40.00
23822. Willem (wilm) 5 49.99 54.68 0 0.00
23823. Will (will_colemak) 5 108.94 117.10 3 60.00
23824. Will (willist) 5 105.15 117.52 3 60.00
23825. s (wildbanana3000) 5 124.37 127.22 3 60.00
23826. Wiktor (wiktorelka) 5 63.75 71.33 2 40.00
23827. Isaiah (wijiisaiah) 5 110.82 124.59 0 0.00
23828. WHH (whitehoodhacker) 5 85.59 95.36 3 60.00
23829. Chicken (werdenbot) 5 76.32 88.74 1 20.00
23830. Evan (war_king) 5 47.52 53.10 1 20.00
23831. Xiangyu (wangxiangyu) 5 61.49 66.80 2 40.00
23832. Austin (walktomordor) 5 128.25 139.49 1 20.00
23833. Waflr (waflr) 5 77.37 81.37 1 20.00
23834. Max (wafflless) 5 91.30 93.78 1 20.00
23835. wael (wael64) 5 86.09 88.17 0 0.00
23836. Wicho (w1ch0) 5 81.21 90.23 0 0.00
23837. V (vvww) 5 74.89 85.30 1 20.00
23838. Vuxe (vuxee2) 5 52.08 58.27 0 0.00
23839. Ricky (vricky) 5 93.09 101.79 1 20.00
23840. Colin (vondazel1) 5 91.53 104.79 2 40.00
23841. Boris (voidnothing) 5 98.64 112.13 2 40.00
23842. Russell (voidborn) 5 77.82 90.66 1 20.00
23843. Vlad (vladungu56) 5 42.30 49.07 2 40.00
23844. Vlad (vladiu5an) 5 86.84 97.44 1 20.00
23845. rotivo (vitor999) 5 73.48 80.61 0 0.00
23846. Craig (vitalagendas) 5 100.45 113.81 1 20.00
23847. AB (vital26) 5 78.66 88.95 0 0.00
23848. Vinnie (vinniethegooch) 5 107.12 118.59 2 40.00
23849. Vinh (vinhpham8598nt) 5 140.12 148.17 3 60.00
23850. vinc4n (vinc4n) 5 76.10 82.33 1 20.00
23851. vii (viixivii0) 5 79.68 83.61 0 0.00
23852. Lois (vieze_rat) 5 75.71 83.59 0 0.00
23853. Vi (vichea) 5 60.55 65.93 4 80.00
23854. Rinat (veryshortnamewithspa... 5 125.36 130.04 5 100.00
23855. Vashni (vashek03) 5 66.28 84.15 1 20.00
23856. Vally (vallyofagility) 5 83.88 95.98 1 20.00
23857. val (valerieso) 5 85.03 87.18 4 80.00
23858. vaimelio (vaimelio) 5 48.02 57.28 1 20.00
23859. Usman (usmanfatal) 5 69.64 74.43 1 20.00
23860. urchin (urchinonquit) 5 153.58 166.93 5 100.00
23861. urbad (urbadlolgetgood) 5 74.02 84.22 1 20.00
23862. Kariem (unpluggedzors) 5 100.69 110.84 2 40.00
23863. Jens (unlols) 5 72.54 79.80 2 40.00
23864. L (unlucky_luca) 5 73.88 83.48 2 40.00
23865. undeadclicker (undeadclicker) 5 65.22 71.87 0 0.00
23866. Maverick Jan (umbracato) 5 110.28 112.99 2 40.00
23867. Kieran (ultimatescienceboy) 5 27.37 30.81 1 20.00
23868. Gerard (ultimagnusv2) 5 100.67 107.57 1 20.00
23869. Olivia (uglyratt) 5 56.31 61.96 1 20.00
23870. ugur (u280) 5 44.72 46.42 0 0.00
23871. Keshav (typingtitan) 5 61.20 72.56 0 0.00
23872. olivia (typie06) 5 34.99 43.50 0 0.00
23873. Akshat (typeracer107) 5 38.99 45.25 0 0.00
23874. slow typist (typehero22) 5 72.10 80.29 1 20.00
23875. Dylan (typedylan) 5 83.04 91.37 3 60.00
23876. Hand (typedhype) 5 54.74 60.43 1 20.00
23877. Mr T (tycho77) 5 71.49 73.76 0 0.00
23878. Shriyash (tybaazi) 5 57.10 64.12 2 40.00
23879. Txemi (txemi) 5 41.63 45.35 0 0.00
23880. twikel (twikel) 5 67.26 73.27 2 40.00
23881. Tuxtampa (tuxtampa) 5 86.07 94.75 5 100.00
23882. Tuuli (tuulensilli) 5 76.00 82.74 1 20.00
23883. dayy (turtlestan) 5 63.84 72.04 2 40.00
23884. Bayram (turkmen) 5 52.58 56.27 1 20.00
23885. TurboThiems (turboo_) 5 71.48 77.26 2 40.00
23886. Tuguldur (tugulduruuu) 5 68.35 73.84 2 40.00
23887. Ben (tt_ben) 5 116.91 121.39 4 80.00
23888. tsunamibro (tsunamibro) 5 96.75 109.34 3 60.00
23889. dotMPEG (tsirotinsky) 5 81.23 86.94 3 60.00
23890. TrueShot (trueshotvr) 5 57.22 62.77 1 20.00
23891. darn it (tricks_got) 5 52.54 69.81 3 60.00
23892. Luke (tric331) 5 80.08 94.52 1 20.00
23893. Treffig (treffig) 5 65.52 70.74 2 40.00
23894. TRAraazze (traraazze) 5 91.14 104.33 1 20.00
23895. Kevin (toofpaste) 5 55.25 65.23 0 0.00
23896. Tomás (tom_cor) 5 52.28 53.55 0 0.00
23897. Toby (toby_) 5 94.70 105.03 3 60.00
23898. Tobias (tobiast) 5 53.55 57.92 0 0.00
23899. ToSteR (toastedberd) 5 80.03 85.46 1 20.00
23900. Terrence (tjwz) 5 90.93 103.11 0 0.00
23901. Toastie (tjmck) 5 96.72 104.65 4 80.00
23902. TJ (tjasmus) 5 107.22 118.73 5 100.00
23903. a (tinle1307) 5 117.17 128.07 3 60.00
23904. Timoteo (timoteothegreatest) 5 94.99 107.40 1 20.00
23905. Timmy (timmy127) 5 73.74 77.16 1 20.00
23906. Tima (tima_geek02) 5 48.01 59.64 3 60.00
23907. MiNTy (thriller24) 5 114.29 121.80 4 80.00
23908. Matthew (thooorin) 5 79.80 85.19 3 60.00
23909. Tyler (thizzpwnt) 5 128.10 142.50 4 80.00
23910. Archie (the_real_ace) 5 76.22 81.68 1 20.00
23911. mongs (theworstyuki) 5 58.96 71.62 4 80.00
23912. The Teacher (theteacher1) 5 60.42 75.84 2 40.00
23913. Katherine (theown13) 5 49.30 55.09 0 0.00
23914. theoryofawesome (theoryofaw... 5 72.78 78.69 2 40.00
23915. minion (theminiongod21) 5 103.10 112.90 2 40.00
23916. TheMatsValk (thematsvalk) 5 85.47 94.21 0 0.00
23917. The (theking2004p1y) 5 63.32 72.78 1 20.00
23918. Kayson (theengineer101) 5 55.14 58.64 0 0.00
23919. Lupi (thedogz) 5 96.05 102.98 2 40.00
23920. Zach (thecursedones) 5 90.61 93.57 1 20.00
23921. Martin (thechuchutrain99) 5 42.16 46.13 0 0.00
23922. Travis (theboxiestbox) 5 92.19 103.16 1 20.00
23923. Amir (thebluebear) 5 66.95 78.79 0 0.00
23924. Ben (thebkway) 5 85.17 92.84 0 0.00
23925. the1466 (the1466) 5 73.89 80.65 1 20.00
23926. U (tgod12345) 5 117.79 130.05 5 100.00
23927. Jetsada (tertul44) 5 53.85 57.79 1 20.00
23928. Jason (terminatorer) 5 107.60 118.25 2 40.00
23929. no (tempotutor) 5 94.79 100.61 1 20.00
23930. Banh Bao (teezy1) 5 54.27 61.55 0 0.00
23931. TechnoTurtle (technoturtle) 5 63.89 69.52 5 100.00
23932. Chance (tdskittles) 5 54.67 56.38 1 20.00
23933. Tdaddy (tdaddy) 5 42.91 53.11 0 0.00
23934. Larry (tcaer) 5 122.24 135.85 3 60.00
23935. Ahmed (taymour77) 5 52.26 61.28 1 20.00
23936. Tanuj (tanuj2552) 5 71.45 74.49 0 0.00
23937. issac (tanthanhkaka) 5 62.94 67.86 1 20.00
23938. takaki (takaki216) 5 54.30 62.00 2 40.00
23939. T (taison13) 5 70.53 80.05 1 20.00
23940. Calvin (taintedducky) 5 120.59 138.55 3 60.00
23941. Taiken (taiken) 5 107.10 117.55 4 80.00
23942. Tactics Typer (tacticstyper) 5 43.40 51.23 1 20.00
23943. L (t3rraa) 5 109.21 117.67 3 60.00
23944. Szymon (szymii112) 5 60.45 72.36 3 60.00
23945. Tom (synikalle) 5 90.24 95.65 2 40.00
23946. Michael (symmbowl) 5 109.35 111.83 3 60.00
23947. sam (swissnetizen) 5 96.25 105.89 4 80.00
23948. swirly (swirlybump) 5 87.20 98.19 2 40.00
23949. Harriet (swipathetypa) 5 83.34 93.49 1 20.00
23950. VillePille (surpoz) 5 81.21 89.20 1 20.00
23951. Unai (supernax) 5 97.11 108.89 3 60.00
23952. Izad (superlative) 5 84.84 94.38 3 60.00
23953. SuperFire92 (superfire92) 5 109.28 115.88 4 80.00
23954. JJ (sunnyxiao29) 5 81.18 85.60 2 40.00
23955. sunny (sunnyx23) 5 80.27 93.55 2 40.00
23956. Sumnima (sumnimal) 5 63.23 69.49 2 40.00
23957. Sulaymon (sulaymon) 5 43.57 44.90 1 20.00
23958. Robin (sulami) 5 90.67 98.89 3 60.00
23959. Buddhist Missionary (sucpikle) 5 64.80 69.28 1 20.00
23960. Sub (subtilklokkismann) 5 86.50 104.96 0 0.00
23961. Steven (styledaddy) 5 83.48 86.27 1 20.00
23962. Alex (stupidbtch67) 5 59.23 63.00 0 0.00
23963. avery (stridersword) 5 96.96 107.60 3 60.00
23964. Nirajan (strategist02) 5 95.51 110.39 1 20.00
23965. Stitch (stitch2) 5 54.25 63.83 0 0.00
23966. Colin (sticklin10) 5 100.82 105.71 1 20.00
23967. Matthew (steviewonderful) 5 62.36 67.50 2 40.00
23968. Stephanie (stephanie83) 5 52.39 58.42 1 20.00
23969. Stefan (stefan_150) 5 45.06 47.19 2 40.00
23970. Evan (stars6413) 5 112.43 117.18 3 60.00
23971. Stadics (stadics) 5 105.44 116.78 1 20.00
23972. Sri (sriistired) 5 51.34 55.76 0 0.00
23973. Squock (squock) 5 80.01 92.31 1 20.00
23974. Gian Carlo (squishygian) 5 65.07 72.68 0 0.00
23975. Spridic (spridic) 5 97.03 102.41 3 60.00
23976. Miguel (spideyj) 5 86.38 96.06 2 40.00
23977. No (speedracetypist) 5 124.82 140.67 4 80.00
23978. speedboi (speedboi11307) 5 67.16 74.33 1 20.00
23979. esc (spectroplayer) 5 73.37 81.92 2 40.00
23980. Nazar (spartypro) 5 71.20 86.37 1 20.00
23981. shishir (spark__) 5 52.19 54.34 1 20.00
23982. Spare (spare1) 5 92.87 101.50 2 40.00
23983. Shontay (spacestayshon) 5 84.69 99.51 1 20.00
23984. Dylan (spacedroplet) 5 56.75 60.87 0 0.00
23985. Jakub (sovly) 5 54.96 61.81 1 20.00
23986. Soroush (soroush_xyz) 5 59.26 70.06 0 0.00
23987. Soqii (soqii) 5 96.30 104.49 5 100.00
23988. SONIC (sonic_hyper) 5 81.19 96.11 2 40.00
23989. Sonbeat (sonbeat_94) 5 48.42 59.81 0 0.00
23990. fastjohnny72 (soggylemon) 5 88.86 108.00 3 60.00
23991. Soft (soft_hand) 5 78.44 92.11 1 20.00
23992. Denis (soaresden) 5 72.36 82.51 2 40.00
23993. Snowpheasant (snowpheasant) 5 64.50 77.78 2 40.00
23994. Alnoor (snowkoan) 5 104.94 112.51 2 40.00
23995. Snoozeds (snoozeds) 5 53.32 63.87 0 0.00
23996. Thomas (sniped_) 5 70.97 83.66 2 40.00
23997. Eli (smoothautumn78) 5 61.24 68.53 1 20.00
23998. CA (smallgoldfish) 5 33.50 36.84 1 20.00
23999. joe biden (slowtyper_222) 5 109.62 119.22 4 80.00
24000. Halgh (sloofer) 5 69.50 74.22 4 80.00
24001. Slime (slime_reaper) 5 54.85 68.28 2 40.00
24002. Sleepy (sleepy_torch) 5 89.36 96.38 1 20.00
24003. Bricks (skyzeroblade) 5 55.07 68.15 5 100.00
24004. Serhii (skyiea) 5 148.66 158.86 4 80.00
24005. Sahil (skulltroxx) 5 90.24 96.30 3 60.00
24006. Ryan (skulliex) 5 56.17 68.19 1 20.00
24007. Nikita (skorlupka) 5 60.12 65.11 1 20.00
24008. S (skonzer) 5 98.26 103.97 0 0.00
24009. Skoma (skomawolf) 5 88.63 94.46 1 20.00
24010. Aron (skillervv) 5 117.11 123.71 4 80.00
24011. Jord (skaterjord) 5 105.50 115.03 0 0.00
24012. Logan (sircrazy) 5 65.19 74.17 1 20.00
24013. Siracha (sirachaman) 5 83.30 92.18 2 40.00
24014. SIR (sirbabyboycheeks1449) 5 24.99 27.69 1 20.00
24015. Sin (sin_x) 5 39.78 46.61 0 0.00
24016. Shaikh (sinosco) 5 82.85 91.95 1 20.00
24017. sinexus (sinexus) 5 73.73 80.60 4 80.00
24018. Scotth (simurgh101) 5 66.89 76.99 2 40.00
24019. Simon (simnetz) 5 94.36 105.00 2 40.00
24020. simbacaned (simbacaned) 5 98.71 123.09 2 40.00
24021. Ralph (silyy097) 5 86.12 102.32 0 0.00
24022. Silver (silverknights1) 5 120.46 134.79 4 80.00
24023. Ivy (sil80) 5 52.15 53.57 2 40.00
24024. Sihaubl (sihabul) 5 41.13 45.01 1 20.00
24025. sidd (siddvader) 5 95.86 104.69 1 20.00
24026. Rodrigo (sicutdeux) 5 76.43 87.52 0 0.00
24027. Shvilesh (shvilesh) 5 59.99 75.51 1 20.00
24028. Chris (shumtlc27) 5 88.46 97.42 1 20.00
24029. Shugoshin (shugoshin) 5 67.22 78.11 1 20.00
24030. ShricZ (shricz) 5 78.93 86.57 5 100.00
24031. Shourya (shourya_goddesh) 5 78.18 86.80 1 20.00
24032. shootagain (shootadiditagain) 5 105.15 118.72 0 0.00
24033. jeffrey (shocky147) 5 95.76 103.10 1 20.00
24034. Mitchell (shlo) 5 81.67 92.08 1 20.00
24035. Ryan (shiroeraiyn) 5 124.40 146.05 4 80.00
24036. Shaun (shinypanda) 5 66.68 81.13 4 80.00
24037. abraham (shewdiebro) 5 108.61 121.94 2 40.00
24038. Joshua (shenazki) 5 85.04 92.23 1 20.00
24039. Phil (sheffield712) 5 91.82 107.02 1 20.00
24040. Stefan (sheffbee) 5 69.78 75.79 0 0.00
24041. Sheep (sheeplmao) 5 63.06 68.64 1 20.00
24042. Steven (shb123) 5 105.15 135.54 3 60.00
24043. shashvat (shashvatsawar) 5 69.91 83.39 5 100.00
24044. SharkTed (sharkted) 5 107.16 129.05 5 100.00
24045. Sharjil (sharjil2k02) 5 58.85 69.25 0 0.00
24046. Sharifa ⋆˙⟡♡ (sharif... 5 75.60 81.40 3 60.00
24047. Shankar (shankar1190) 5 66.70 78.30 0 0.00
24048. S (sh19) 5 69.23 79.76 4 80.00
24049. Sevy (sevytiglao) 5 89.15 109.41 0 0.00
24050. Sam (sevans_) 5 61.85 69.65 1 20.00
24051. Seth (sethicz109) 5 48.52 58.18 1 20.00
24052. Serguk (serguk) 5 73.03 79.04 2 40.00
24053. Sen (sen_1257) 5 52.59 58.53 0 0.00
24054. 𝑭𝑹𝑬𝑬 𝑷𝑨... 5 89.83 96.39 0 0.00
24055. don (seichan_04) 5 80.16 89.55 1 20.00
24056. seema (seema1607) 5 43.34 51.39 1 20.00
24057. Michal (sedmilhar) 5 50.97 54.33 2 40.00
24058. Alex (sebvettel5) 5 84.38 91.63 2 40.00
24059. Sebastian (seba2500) 5 83.00 87.62 1 20.00
24060. sean (sean_p_k) 5 61.75 64.95 0 0.00
24061. Sean (seansdb6) 5 84.50 88.58 3 60.00
24062. Dmitry (scrinium) 5 59.41 64.91 2 40.00
24063. Aloïs (scribbleempire) 5 119.65 136.08 4 80.00
24064. Joe (schlegs88) 5 73.62 78.88 2 40.00
24065. Connor (schellc) 5 93.01 100.62 2 40.00
24066. Sawataro (sawatar_o) 5 63.53 73.32 0 0.00
24067. Jaden (sasmiku) 5 64.16 70.74 1 20.00
24068. Arjun (sarjunt) 5 86.31 92.20 2 40.00
24069. :(: (sara_ks) 5 113.45 127.04 3 60.00
24070. Aren (sarckelle) 5 78.03 83.51 5 100.00
24071. Sanh (sanhnguyennt) 5 68.24 73.70 3 60.00
24072. Sam (sam_a17) 5 46.86 57.14 0 0.00
24073. Sam (samz19) 5 74.50 85.34 1 20.00
24074. Sam (samuel_h) 5 64.19 73.71 1 20.00
24075. samuel (samuelfung123) 5 114.21 124.70 2 40.00
24076. Sam (sam313) 5 90.62 96.10 1 20.00
24077. sauce (sam0the0samurai) 5 50.16 52.24 0 0.00
24078. Omar (salthesloth) 5 36.07 42.30 3 60.00
24079. Salmonax (salmonax) 5 114.87 127.37 3 60.00
24080. Celine (salamiii) 5 116.09 132.51 2 40.00
24081. Typing McQueen (sakram07) 5 92.98 100.26 3 60.00
24082. Kite (saizuchi) 5 95.02 104.68 5 100.00
24083. Maxim (saipade) 5 71.32 76.27 2 40.00
24084. Sah (sahsooh) 5 68.79 74.17 2 40.00
24085. SaggiSponge (saggisponge) 5 154.12 168.68 5 100.00
24086. Candelaria (sadtrash) 5 92.27 98.32 2 40.00
24087. TaxKween (sadiek) 5 101.21 108.31 4 80.00
24088. David (saddj001) 5 97.77 114.68 5 100.00
24089. STOIC (sachindra_111) 5 64.30 74.45 1 20.00
24090. Rzn (rzn_) 5 77.55 91.82 0 0.00
24091. Red (rzhvnbrg) 5 71.83 81.84 5 100.00
24092. Ryu (ryusong) 5 112.40 125.83 2 40.00
24093. Ryen (ryenwang) 5 73.00 81.24 2 40.00
24094. Ryan (ryanylee02) 5 76.35 84.50 1 20.00
24095. Ryan On (ryanon0127) 5 80.77 87.63 2 40.00
24096. Ruicky8 (ruicky8) 5 102.01 117.87 3 60.00
24097. RG18 (rudolphgaming18) 5 98.06 111.80 1 20.00
24098. Rudy (rudiferr) 5 91.78 101.82 2 40.00
24099. Ivo (ruberiot) 5 44.95 49.89 0 0.00
24100. R (rswow) 5 50.04 59.03 0 0.00
24101. rryann (rrrrryannnnnn) 5 74.89 77.90 0 0.00
24102. Bobby (rradhak1) 5 113.76 121.82 4 80.00
24103. roy (roylimas) 5 68.25 69.73 1 20.00
24104. Dean (routerboy6126) 5 60.48 71.72 0 0.00
24105. Rosie (rosiem) 5 98.14 105.01 4 80.00
24106. roodley (roodley) 5 92.62 103.36 2 40.00
24107. Orm Tammemäe (romex123) 5 75.35 83.40 2 40.00
24108. Ammo (rokudoku) 5 68.54 72.49 0 0.00
24109. rohaya (rohaya) 5 73.50 79.30 1 20.00
24110. Rohan (rohanji) 5 58.88 67.31 3 60.00
24111. vorp (rohamhasbadaim) 5 116.94 133.63 4 80.00
24112. inhalement (roger4190) 5 133.60 155.92 3 60.00
24113. Robert (robertdchiodo) 5 89.07 98.16 0 0.00
24114. DarkInstinct (road_to_ultra... 5 37.19 44.74 0 0.00
24115. Aubergine (roadto110wpm) 5 56.14 60.61 0 0.00
24116. fishy (roadto135wpm) 5 108.87 117.28 4 80.00
24117. Roachel (roacheljang) 5 72.66 83.54 2 40.00
24118. Ash (rndmash) 5 45.51 48.14 1 20.00
24119. r (rmeev_) 5 54.17 71.00 1 20.00
24120. ___.rishii.____ (rishikesh_... 5 30.56 33.24 1 20.00
24121. (discord: risheek.) (risheek7) 5 68.42 80.04 2 40.00
24122. Rishan (rishancredo) 5 68.18 78.62 1 20.00
24123. RSN (risan_rsn) 5 41.97 52.73 2 40.00
24124. Ripshawryan (ripshawryan) 5 74.27 83.20 3 60.00
24125. rieru (rieru) 5 64.30 71.91 2 40.00
24126. R (richigro) 5 40.83 53.66 2 40.00
24127. Based (riceater) 5 82.04 86.24 4 80.00
24128. Riadath (riadath) 5 63.32 67.14 0 0.00
24129. rhombus (rhombus3) 5 120.40 126.68 4 80.00
24130. Dank Memes (rezzex) 5 67.73 72.65 2 40.00
24131. Reyan (reyanman) 5 65.87 70.48 2 40.00
24132. Alex (revl8er) 5 89.41 99.10 0 0.00
24133. PMD_cLark* (revenge1) 5 48.90 55.58 0 0.00
24134. Retsu (retsu_s) 5 50.68 60.86 0 0.00
24135. reicy (reicy794) 5 70.01 76.13 1 20.00
24136. refrshrs (refrshrs) 5 81.80 86.54 0 0.00
24137. RecoH86 (recoh86) 5 110.82 126.91 2 40.00
24138. @diegosalasix (reclamadcr) 5 75.95 82.39 0 0.00
24139. Reason (reasonspecter) 5 105.27 116.74 3 60.00
24140. Елдынбек (realkotak) 5 35.67 39.61 0 0.00
24141. Kaleb (realkaleb) 5 118.35 123.60 5 100.00
24142. Ryan (rchoi34) 5 101.84 108.23 2 40.00
24143. Rawan (rbadri) 5 52.53 63.47 1 20.00
24144. Rafli (razorndasmu) 5 76.21 90.19 1 20.00
24145. Rayhan (rayhanihsan) 5 60.86 66.26 2 40.00
24146. Rexza (rawr2002) 5 60.34 63.47 2 40.00
24147. Ravi (raviivar) 5 61.27 68.41 1 20.00
24148. Roei (rapidroei) 5 109.67 117.22 3 60.00
24149. Pog (randomguy2005) 5 105.51 117.55 3 60.00
24150. Amadej (ramadox) 5 64.11 69.36 1 20.00
24151. Raj (raj_37) 5 73.97 83.88 1 20.00
24152. Rajshekar (rajshekar__) 5 59.31 61.69 0 0.00
24153. Rajinikanth (rajini_macbook) 5 96.54 103.63 0 0.00
24154. Rajat (rajatbhatnagar) 5 77.38 91.47 2 40.00
24155. Raizen (raizou) 5 89.73 104.19 2 40.00
24156. Kenzo (raindropping) 5 87.19 100.01 3 60.00
24157. Zack (raichubuddy) 5 93.26 116.48 1 20.00
24158. Rahul (rahul1q) 5 76.93 89.24 2 40.00
24159. Rafae (rafae110) 5 68.25 79.09 1 20.00
24160. Rasmus (r4zoth) 5 93.63 101.50 3 60.00
24161. Joe (qwertyuiop4) 5 79.83 85.90 1 20.00
24162. Rafael (qwertyspade) 5 120.24 129.16 3 60.00
24163. ad (quqquqqqu) 5 88.22 97.06 2 40.00
24164. new (quitting101) 5 84.57 94.47 2 40.00
24165. Eric (queeric) 5 90.16 101.27 5 100.00
24166. cryo. (quaintoutcast) 5 75.78 84.86 4 80.00
24167. Not the chosen (qrota_1) 5 68.06 74.68 1 20.00
24168. qiqete (qiqete) 5 60.34 64.37 0 0.00
24169. Annilese (qingkang) 5 69.85 79.71 1 20.00
24170. Paul (qdozaq) 5 66.06 72.97 1 20.00
24171. Evan (qasem_soleimani) 5 82.88 96.98 1 20.00
24172. Jack (putridllama) 5 75.66 80.70 0 0.00
24173. Puskar (puskar_pandey) 5 56.68 61.71 3 60.00
24174. chris (pumpino) 5 67.25 80.32 0 0.00
24175. Alex (pugnation) 5 89.88 98.33 1 20.00
24176. The (pseudotypist) 5 91.60 104.65 1 20.00
24177. proxer05 (proxer05) 5 32.65 34.87 2 40.00
24178. Protoclasm (protoclasm) 5 92.93 101.24 3 60.00
24179. Pro Star (prostar1) 5 49.68 56.40 0 0.00
24180. Fabio (prosfearme) 5 110.09 124.22 1 20.00
24181. Matthew (programcrazy) 5 80.22 97.57 2 40.00
24182. Basliel Z (prince_bz) 5 60.38 73.48 0 0.00
24183. Pranav Abraham (pranavabe) 5 96.69 118.74 2 40.00
24184. saurabh (practisemore) 5 68.38 76.83 2 40.00
24185. duckg (poweryourmind) 5 49.52 59.25 1 20.00
24186. Nathan (potatosaurus) 5 91.28 99.72 2 40.00
24187. Ed (positrone) 5 68.39 73.20 2 40.00
24188. Dominic (porvoolink) 5 74.04 84.69 2 40.00
24189. Nate (poppafig) 5 93.34 100.37 5 100.00
24190. Poop (poopeey) 5 56.48 61.15 1 20.00
24191. Kyle Me (poledancerz) 5 115.45 126.51 3 60.00
24192. Simone (pointy_) 5 78.28 86.52 0 0.00
24193. Youxun (poe0oeo0iie9) 5 69.20 73.10 0 0.00
24194. Poonnawich (pnwkrdsup) 5 79.30 88.32 2 40.00
24195. pluto (plut0_) 5 97.53 112.25 2 40.00
24196. PlusJ (plusj) 5 76.35 86.76 2 40.00
24197. cecilia (plumerias) 5 106.08 119.79 3 60.00
24198. Xavier (plourde27) 5 104.15 118.21 3 60.00
24199. Michael (pixelatedmike) 5 86.97 94.76 2 40.00
24200. PixelatedFungus (pixelatedf... 5 116.65 130.09 5 100.00
24201. Pi (pilover) 5 103.26 111.23 2 40.00
24202. mione (pikapals16) 5 68.72 83.37 2 40.00
24203. daneil (piggasauwus) 5 103.95 114.56 4 80.00
24204. Jordan (pigeye123) 5 57.91 66.79 1 20.00
24205. tstats[pianisthassan] (pian... 5 94.55 102.57 0 0.00
24206. pp (phlyingturtle) 5 85.51 93.94 2 40.00
24207. David (phawkes21) 5 92.92 106.54 2 40.00
24208. PH23NIX (ph23nix) 5 113.71 120.15 3 60.00
24209. Paul (pgailey) 5 48.20 52.56 0 0.00
24210. Allen (pfzhengs) 5 113.48 130.16 4 80.00
24211. Petros (petros2711) 5 44.43 48.72 1 20.00
24212. Berry (peter_parker15) 5 99.71 104.98 1 20.00
24213. Maya (periiwrinkles) 5 96.67 103.22 0 0.00
24214. Me (perfectaim) 5 109.03 116.63 1 20.00
24215. Peppa (peppa_24) 5 67.84 80.82 1 20.00
24216. Emil (pepepls) 5 92.02 96.05 2 40.00
24217. Byron (peace942) 5 76.77 79.94 0 0.00
24218. Pearl (pcaton94) 5 35.00 40.81 0 0.00
24219. Pawel (pawelpro) 5 114.54 122.37 5 100.00
24220. paper2222 (paper2222) 5 96.75 108.97 0 0.00
24221. rosie (paparosie) 5 75.24 82.19 3 60.00
24222. Paolo (paolo23) 5 63.52 66.16 1 20.00
24223. PANTIOS (pantios) 5 41.34 54.31 0 0.00
24224. Alex (pancaxee) 5 62.05 71.99 1 20.00
24225. Pallav (pallav123goyal) 5 83.42 94.08 2 40.00
24226. PaleWhale (palewhale) 5 53.17 60.17 1 20.00
24227. Joshua (pachathighceps) 5 78.22 94.11 2 40.00
24228. Ozma (ozma0foz) 5 96.13 105.09 3 60.00
24229. Left (ozcelllist) 5 126.23 137.67 5 100.00
24230. OverTheRocks (overtherocks) 5 52.74 64.04 1 20.00
24231. Other_Pigeon (otherpigeon) 5 98.36 105.91 1 20.00
24232. JAK (osraild) 5 83.65 88.53 0 0.00
24233. Osian (osian) 5 82.24 97.82 2 40.00
24234. Osama (osama_alkhodairy) 5 69.56 75.38 2 40.00
24235. Blank (orzlyxd) 5 43.51 51.72 1 20.00
24236. Orr (orr10c) 5 86.72 102.45 5 100.00
24237. orphysca (orphysca) 5 86.91 96.48 1 20.00
24238. Orestis (orestisdr) 5 66.84 68.97 1 20.00
24239. oussama (oredshadow) 5 23.65 25.62 0 0.00
24240. Kostas (orange_inc) 5 103.75 115.15 3 60.00
24241. Onny (onny_gwozed) 5 66.15 77.62 1 20.00
24242. oni (onigiri_) 5 60.53 66.01 3 60.00
24243. Erik (onezero_) 5 76.16 89.23 1 20.00
24244. Oncom (oncomlz) 5 62.51 81.77 1 20.00
24245. Christina (omqchristi) 5 69.13 78.27 1 20.00
24246. woland (omario42) 5 90.74 112.68 2 40.00
24247. Olli (olzi) 5 60.60 75.57 1 20.00
24248. Olvi73 (oliverck73) 5 57.85 65.06 1 20.00
24249. Oktoroden (oktoroden) 5 81.98 91.82 0 0.00
24250. aloysius (okitkat) 5 53.49 71.70 0 0.00
24251. O (oking167) 5 45.46 49.43 0 0.00
24252. ojaswi (ojaswi) 5 64.34 67.48 3 60.00
24253. Jed (oh_no_yes) 5 61.07 65.67 0 0.00
24254. senz (offsets) 5 70.72 76.63 0 0.00
24255. Elijah (officialhajile) 5 98.03 101.21 3 60.00
24256. 鐘 (obarisk) 5 67.11 69.97 2 40.00
24257. Fahad (obakfahad) 5 61.42 68.66 1 20.00
24258. Oatseveryday (oatseveryday) 5 58.75 65.71 1 20.00
24259. n_bob (n_bob) 5 92.32 94.07 2 40.00
24260. Nils (nw13) 5 54.14 55.32 2 40.00
24261. Nutel (nutel65) 5 64.11 67.53 0 0.00
24262. Nunya (nunyab) 5 114.35 133.51 3 60.00
24263. Abby (numberonethumbtack) 5 55.69 67.14 1 20.00
24264. Nugsky (nugsky) 5 50.43 55.55 1 20.00
24265. Esli (no_name0312) 5 49.65 51.46 1 20.00
24266. Bricen (nowyouseeme1233) 5 86.76 95.57 2 40.00
24267. Real (not_available_name) 5 109.62 115.28 2 40.00
24268. Victor (notoriousvic) 5 62.08 75.81 2 40.00
24269. Lil J (notlilj) 5 74.93 87.41 0 0.00
24270. James (nothisisjames) 5 110.82 114.78 2 40.00
24271. Stephen (nothamlet) 5 88.37 105.93 3 60.00
24272. Darin (notdvu) 5 96.82 125.12 2 40.00
24273. Nordaxion (nordaxion) 5 115.08 129.29 2 40.00
24274. Plutonium (nooter_booter) 5 81.21 91.23 0 0.00
24275. Justine (noob3tc) 5 80.24 88.88 1 20.00
24276. nongginga (nongginga) 5 51.79 58.09 0 0.00
24277. Ongasm (nong321) 5 83.13 96.93 1 20.00
24278. Bailey (nob0dy) 5 86.45 93.62 1 20.00
24279. Noa (noamax) 5 95.22 101.86 3 60.00
24280. Noam (noamaster88) 5 114.99 120.94 2 40.00
24281. DarkShadowSage (nlopez20) 5 76.82 94.83 0 0.00
24282. Issac (njchicken) 5 103.79 123.66 0 0.00
24283. ( ˙꒳​˙ ) (nizuu) 5 100.47 120.27 2 40.00
24284. Nisse (nissevex) 5 104.77 115.23 1 20.00
24285. Nirved (nirved_06) 5 50.68 55.88 0 0.00
24286. Miras (ninth_hokage) 5 58.84 68.75 2 40.00
24287. Jose (nino1) 5 79.43 89.14 1 20.00
24288. Seth (ninjashark121) 5 113.08 120.55 3 60.00
24289. Nils (nil0y) 5 61.80 67.80 0 0.00
24290. Mykola (nikoliazekter) 5 82.30 85.81 3 60.00
24291. Nikola (nikola5056) 5 85.05 94.88 2 40.00
24292. Nikhil (nikhilaii93) 5 81.59 85.93 1 20.00
24293. nika (nika07) 5 86.46 90.58 0 0.00
24294. Athul (night_shark) 5 60.65 69.48 1 20.00
24295. TYPESTARS (nightprobe) 5 128.52 136.88 4 80.00
24296. Night (nighterror) 5 84.12 91.61 3 60.00
24297. nielrenned (nielrenned) 5 95.08 98.29 3 60.00
24298. nicole (nicoleyee) 5 85.61 89.44 0 0.00
24299. Nicholas (nickowski) 5 84.26 98.44 0 0.00
24300. tony (nickjonaz) 5 88.46 96.92 4 80.00
24301. ნიცკა ✌ (nickga... 5 139.45 146.04 5 100.00
24302. Nicholas (nicholasozarka) 5 61.08 67.81 1 20.00
24303. Daniel (nicedanmonkey) 5 90.60 97.55 1 20.00
24304. Nicole (nhixon) 5 70.49 76.46 2 40.00
24305. ngmnm (ngmnm) 5 58.39 63.23 1 20.00
24306. Nezgar (nezgar) 5 80.78 85.03 2 40.00
24307. Newtotyping (newtotyping07) 5 56.74 64.63 0 0.00
24308. vanhoghe (newbgenjiboy) 5 97.48 106.69 0 0.00
24309. Sven (nevslehcim) 5 59.57 71.30 1 20.00
24310. Michael (nevado247) 5 106.77 120.17 3 60.00
24311. csnormie (nerfedcookie) 5 125.55 143.94 5 100.00
24312. Notorious (neodivin) 5 80.63 93.72 2 40.00
24313. Emilio (nenglara) 5 67.37 94.92 0 0.00
24314. Nemika (nemika) 5 96.20 106.42 2 40.00
24315. niamh (neemogozoom) 5 82.78 106.72 0 0.00
24316. Necredibly (necredibly) 5 69.80 74.33 1 20.00
24317. Filip (necr0nz) 5 103.43 127.14 2 40.00
24318. Balazs (nb666) 5 85.84 93.88 1 20.00
24319. nac (naxx_colemak) 5 123.05 156.25 1 20.00
24320. Nasufp (nasufp) 5 12.21 22.01 0 0.00
24321. Muhammed (naseebnex) 5 45.02 48.73 0 0.00
24322. Naren (narenr2005) 5 59.73 63.90 0 0.00
24323. Narberal (narberal) 5 35.47 43.15 0 0.00
24324. Kovács (namox22) 5 39.22 42.34 0 0.00
24325. ching (nameiso) 5 61.72 72.86 1 20.00
24326. Joe (naman189089) 5 53.47 58.90 1 20.00
24327. Nakul (nakush) 5 44.81 47.02 0 0.00
24328. Naidru (naidru) 5 112.51 133.42 2 40.00
24329. Troy (n1x377) 5 119.77 132.19 5 100.00
24330. NZ (n0tninjaz) 5 107.72 117.22 3 60.00
24331. Aryan (n00bzz) 5 57.32 64.26 0 0.00
24332. Mickey (m_dvorak) 5 85.41 102.10 1 20.00
24333. m_1_1_m (m_1_1_m) 5 60.91 73.54 1 20.00
24334. Jon (mystikj) 5 108.97 119.47 2 40.00
24335. bob (mypotatoflies) 5 86.51 92.43 1 20.00
24336. Mylow (mylow) 5 121.89 132.04 3 60.00
24337. Myles (myles_morris) 5 85.50 90.18 1 20.00
24338. B (mxnxmoon) 5 50.47 54.19 0 0.00
24339. Marcus (mwcx) 5 101.83 104.91 4 80.00
24340. murdershards (murdershards) 5 89.34 96.97 2 40.00
24341. bhufsianm (muhfiasbin) 5 56.97 60.28 1 20.00
24342. Brody (mudspud) 5 60.56 70.07 1 20.00
24343. Patches (mr_bear101) 5 87.57 98.22 1 20.00
24344. brett (mru_uward) 5 26.98 30.53 0 0.00
24345. Lin (mrtuxg) 5 70.44 70.98 0 0.00
24346. Jumz (mrpaperman) 5 110.37 124.04 2 40.00
24347. Bjoern (mrmuetze) 5 81.40 85.81 1 20.00
24348. Just a (mrmuawa) 5 125.35 134.47 3 60.00
24349. Kellan (mrkt59) 5 49.45 52.92 1 20.00
24350. Aniket (mrjerry1q98) 5 59.78 66.54 0 0.00
24351. Roberto (mrgarri) 5 104.28 111.80 4 80.00
24352. Jared (mrfatguy227) 5 110.37 118.71 2 40.00
24353. zarkasi (mozar) 5 55.78 67.61 1 20.00
24354. mouni (mouni576) 5 48.73 59.14 1 20.00
24355. MouldyBaguette (mouldybague... 5 69.78 74.41 0 0.00
24356. MostPassiveUser (mostpassiv... 5 63.77 68.04 2 40.00
24357. disgusting pig (morytain) 5 102.96 108.99 1 20.00
24358. Mohamed (momo5482) 5 47.26 56.02 0 0.00
24359. Mohit (mohitisgreat) 5 87.21 93.49 4 80.00
24360. MOhI (mohi9731) 5 31.53 36.94 0 0.00
24361. Mohamed (mohamed_ayman) 5 84.51 89.03 1 20.00
24362. Mohamed (mohamedafify) 5 68.02 74.15 0 0.00
24363. Moazzem Hossain (moazzemh222) 5 41.69 43.92 0 0.00
24364. Matthew (mjthekandyman) 5 85.02 102.58 2 40.00
24365. mjlambrechtje (mjlambrechtje) 5 83.97 88.68 0 0.00
24366. manoj (mjbx) 5 40.15 43.13 0 0.00
24367. Mizule (mizule) 5 56.39 60.49 1 20.00
24368. Mitchell (mitchellmisayah) 5 86.48 93.95 3 60.00
24369. mischgu (mischgu) 5 76.47 81.63 3 60.00
24370. julia (misailuj) 5 49.48 56.05 2 40.00
24371. MI (misabic) 5 51.20 53.61 1 20.00
24372. Jacob (mini_gaunt) 5 93.88 96.40 0 0.00
24373. 150 how? (minidraco) 5 91.07 103.51 2 40.00
24374. mineschweppes (minescheppes) 5 103.03 121.06 2 40.00
24375. Michael (mikey2312) 5 78.59 101.12 2 40.00
24376. Ryan (mikeeei) 5 94.85 101.22 2 40.00
24377. mikaanz (mikaanz) 5 65.74 73.13 2 40.00
24378. Mihir (mihir1125) 5 103.47 109.47 2 40.00
24379. Mike (migpok35) 5 102.59 117.34 5 100.00
24380. Microwism (microwism) 5 78.79 88.40 2 40.00
24381. Michae; (michaeldamianus) 5 90.60 113.45 1 20.00
24382. michael (michaelabdi) 5 81.66 87.22 2 40.00
24383. jan (micaelaishot123) 5 110.42 118.57 3 60.00
24384. Me (me_myself) 5 77.92 87.13 1 20.00
24385. Max (mexx_) 5 73.25 89.50 2 40.00
24386. Mexikorn (mexikorn) 5 94.54 108.57 0 0.00
24387. Daniel (metalspork) 5 122.88 131.14 5 100.00
24388. Seyed Mostafa (meshkati) 5 79.30 89.72 1 20.00
24389. Merwin (merwin_samuel) 5 55.93 59.21 1 20.00
24390. Mert (mertle) 5 87.31 90.74 0 0.00
24391. marvin (mendelmarvin1) 5 40.67 43.81 0 0.00
24392. memesthatsucc (memesthatsucc) 5 69.33 80.05 1 20.00
24393. Meitou (meitou) 5 68.65 83.46 4 80.00
24394. Mehul (mehulraj69) 5 27.64 28.60 0 0.00
24395. Mehul (mehulparmar459@gmail... 5 67.15 71.62 1 20.00
24396. 💵 (mebank) 5 69.78 74.80 0 0.00
24397. Maddie (mdjjones) 5 66.12 68.86 0 0.00
24398. MB (mbmasher) 5 135.30 155.21 3 60.00
24399. Shoaib Akbar (ma_boi619) 5 85.20 91.63 4 80.00
24400. Patrick (maxmad53) 5 64.63 69.43 1 20.00
24401. Max (maxlikesstuff) 5 87.74 92.58 3 60.00
24402. Max (maximyss) 5 102.21 109.17 2 40.00
24403. マット (mat_rusty) 5 87.24 90.98 1 20.00
24404. Matthew (mattyb_) 5 83.49 90.92 3 60.00
24405. Matthew (matthuwu) 5 76.76 80.98 4 80.00
24406. Matthew (matthew_sellens) 5 45.67 56.02 1 20.00
24407. Matthew (matthewmob) 5 98.67 117.36 2 40.00
24408. Matt (mattdaddy27) 5 81.45 85.07 1 20.00
24409. matej (matejck) 5 95.24 103.48 1 20.00
24410. MasterDebater (masterdebate... 5 116.93 125.56 4 80.00
24411. Espen Oliver (masterabsinthe) 5 77.38 89.65 4 80.00
24412. Mashrur (mashrur45) 5 79.51 87.39 1 20.00
24413. madi (marstooswag) 5 51.53 55.30 4 80.00
24414. マロン (marron) 5 66.47 75.41 1 20.00
24415. Marko (markosc523) 5 65.32 75.31 2 40.00
24416. Zach (markertassel) 5 81.56 93.16 0 0.00
24417. Martin (marh1694) 5 49.33 58.88 3 60.00
24418. Federico (marche96) 5 36.75 43.67 1 20.00
24419. marce (marcelojraj) 5 92.89 104.14 0 0.00
24420. Manu (manuuuuuuu) 5 52.53 55.81 3 60.00
24421. Yvette (mamachoi) 5 41.39 44.23 0 0.00
24422. yusuf (maleky) 5 108.59 125.55 0 0.00
24423. Malakai (malakaidunaway) 5 77.58 88.69 0 0.00
24424. Norbert (makori) 5 60.48 67.83 1 20.00
24425. THE OCKY WAYYYYY (makapoh57) 5 81.90 89.35 3 60.00
24426. Joshua (magic_happened) 5 62.98 73.99 1 20.00
24427. DJ (magentaisnice) 5 77.70 83.93 1 20.00
24428. Max (maffiaboy65) 5 88.76 92.52 4 80.00
24429. Matt (maffhoo) 5 92.75 117.01 2 40.00
24430. MLM (madlittlemods) 5 82.01 86.84 2 40.00
24431. Madi (madi_davey) 5 61.89 67.30 2 40.00
24432. made (madestoel123) 5 78.32 84.79 1 20.00
24433. Maddie (madd204) 5 50.50 54.67 0 0.00
24434. Macen (macen) 5 113.58 121.08 4 80.00
24435. none (lyuseg) 5 84.78 104.23 1 20.00
24436. Psylo (lysergico) 5 212.20 218.72 2 40.00
24437. Lydia (lydia_a) 5 40.85 44.15 1 20.00
24438. Kensie (luxina) 5 94.00 112.39 0 0.00
24439. សុខសប្បាយ... 5 71.85 77.36 1 20.00
24440. Luke (lusouup) 5 61.94 74.16 1 20.00
24441. lush (lush) 5 84.75 91.18 0 0.00
24442. luqehr (luqehr) 5 39.36 40.93 0 0.00
24443. Viktor (lunken42) 5 63.16 76.22 0 0.00
24444. Devin (lundrity) 5 108.55 125.16 1 20.00
24445. plantyoon (lunarboris) 5 73.38 85.81 2 40.00
24446. Luke (luklear) 5 56.85 62.27 0 0.00
24447. luke (lukehaoshuai) 5 105.53 119.11 1 20.00
24448. Luisdi (luisdi) 5 69.79 77.70 1 20.00
24449. Lokesh (lucky_21) 5 80.75 87.58 3 60.00
24450. luckyone (luckyyone) 5 67.71 70.83 0 0.00
24451. Lukas (lubeis) 5 67.32 76.89 1 20.00
24452. Liam (ltrainferry) 5 76.46 88.36 1 20.00
24453. qwerty (love2sing) 5 134.15 147.26 5 100.00
24454. Louie (louietien) 5 111.49 130.71 4 80.00
24455. Ivan (loui127) 5 46.54 51.56 0 0.00
24456. Lotus (lotuspirate) 5 119.32 127.13 2 40.00
24457. Lostleo2347 (lostleo_onytb) 5 37.45 42.04 1 20.00
24458. Lonzo (lonzoballs) 5 75.39 83.39 0 0.00
24459. lolouo (lolouo) 5 94.31 105.11 2 40.00
24460. Kostya (lolopodo) 5 32.55 41.55 0 0.00
24461. Jakob (lokiloki19) 5 103.48 140.21 1 20.00
24462. Martin (lmaozedonggg) 5 71.90 80.90 0 0.00
24463. Yuk (littleyuk) 5 102.38 111.12 2 40.00
24464. liquidii (liqueady) 5 113.01 119.13 2 40.00
24465. Ryan (lindaluhu) 5 63.04 75.45 2 40.00
24466. Emil (lime123) 5 73.00 86.22 0 0.00
24467. li (lilya) 5 69.52 80.78 3 60.00
24468. rat (lilratbb) 5 62.23 77.63 1 20.00
24469. Mark (lilpep_the_6th) 5 71.19 79.70 3 60.00
24470. Lil (lildathrill) 5 67.81 77.57 1 20.00
24471. Boss (likeaboss4579) 5 52.47 56.08 1 20.00
24472. J. Dong (likelihood) 5 39.52 42.31 0 0.00
24473. Light (lightmaster001) 5 50.95 53.06 1 20.00
24474. John (lifeofacow) 5 80.10 91.35 2 40.00
24475. Shiloh (lickington) 5 74.57 86.67 0 0.00
24476. Lex (lex_g91) 5 91.38 112.73 2 40.00
24477. whale (lewist) 5 95.81 106.66 3 60.00
24478. Levi (levi5678) 5 67.40 88.13 1 20.00
24479. Slow мΘşħΞ (letype613) 5 118.16 125.51 3 60.00
24480. Lesya (lesyalackey) 5 78.18 85.71 1 20.00
24481. Leon (leonthehandsome) 5 58.93 64.77 0 0.00
24482. Leon (leonchen125) 5 79.29 98.54 3 60.00
24483. James (lenny_mess) 5 73.27 79.98 1 20.00
24484. Leitão (leitao_feliz) 5 51.09 57.97 1 20.00
24485. Leigh (leightm) 5 68.34 85.00 3 60.00
24486. Jim (legerity) 5 130.33 152.98 3 60.00
24487. Bryan (legendarywind) 5 73.95 80.76 0 0.00
24488. Lee (leemyoung) 5 52.44 61.49 1 20.00
24489. LeeLoo (leeloooooooooooo) 5 42.30 48.52 0 0.00
24490. Angus (leanangusbeef) 5 95.15 103.12 4 80.00
24491. Lauren (lauren) 5 144.67 157.65 4 80.00
24492. Jack (lankyfranky) 5 64.44 73.09 0 0.00
24493. La (lafrans) 5 90.33 97.28 2 40.00
24494. zaman (kzaman) 5 45.30 52.11 0 0.00
24495. only 루비 (kxntzu) 5 89.25 96.51 1 20.00
24496. KW (kwpl) 5 51.42 56.51 2 40.00
24497. poptarts (kwakyunk) 5 100.48 116.46 3 60.00
24498. Leo (kugiyasan) 5 60.03 71.36 1 20.00
24499. Katie (ktdubbs93) 5 85.52 90.10 2 40.00
24500. Krishna Kumar (krish_n_a) 5 50.94 52.38 0 0.00
24501. Kamil (krimy225) 5 56.68 62.06 1 20.00
24502. Dirk (kreefdirk) 5 57.41 63.25 0 0.00
24503. Krampi (krampi) 5 116.82 137.58 5 100.00
24504. kraklo (kraklo) 5 103.39 107.42 2 40.00
24505. Amon (koutarou_amon) 5 110.05 129.04 2 40.00
24506. Korone (koroneinugami) 5 44.20 49.32 1 20.00
24507. Koosh (kooshatron) 5 62.65 66.48 3 60.00
24508. Mark (kooliokek) 5 81.73 94.73 2 40.00
24509. Sara (kookiebeagle) 5 102.71 110.28 3 60.00
24510. konkord (konkord895) 5 64.11 68.13 2 40.00
24511. Martin (kompik) 5 80.91 86.54 3 60.00
24512. Komchan (komchan) 5 97.17 106.50 2 40.00
24513. Jingyue (koalawjy) 5 94.35 110.95 1 20.00
24514. Brandon (koalabearf) 5 90.07 100.28 2 40.00
24515. backtozero (knuckledoritos) 5 96.81 105.55 2 40.00
24516. Kor (kkoo) 5 32.44 35.09 0 0.00
24517. masek (kiwollo) 5 51.85 61.13 0 0.00
24518. Kiwi (kiwiiii) 5 80.15 89.82 1 20.00
24519. Kittyman10 (kittyman10) 5 107.32 116.89 5 100.00
24520. Kishore (kishorep1) 5 85.99 93.24 2 40.00
24521. Nathan (kingdunlop) 5 59.01 62.73 1 20.00
24522. King3131 (king3131) 5 66.64 73.54 2 40.00
24523. Kinda (kindakind) 5 91.84 100.42 1 20.00
24524. Akshat (kim375) 5 71.92 82.15 2 40.00
24525. Kiluath (kiluath) 5 60.80 63.99 2 40.00
24526. Kier (kierr12) 5 94.38 101.98 1 20.00
24527. khasan (khasan) 5 39.70 42.24 0 0.00
24528. Keyon (keyonhanjani) 5 85.22 99.62 4 80.00
24529. Kevin (kevinthedon) 5 42.59 50.43 0 0.00
24530. Kevin (kevinptt0323) 5 80.30 85.36 1 20.00
24531. Kevin (kevinhuo8941) 5 91.30 104.90 1 20.00
24532. Kyle (kevenmegevin321) 5 53.15 62.67 0 0.00
24533. KevC (kevcarreon) 5 89.95 99.71 2 40.00
24534. Måns (kethem) 5 74.33 92.79 1 20.00
24535. kerdo (kerdoqt) 5 107.33 118.34 3 60.00
24536. Keon (keonra) 5 61.46 66.00 0 0.00
24537. kaka (kentuckle) 5 80.61 96.55 2 40.00
24538. Kent (kent777) 5 116.99 129.18 2 40.00
24539. KK (kemal_k) 5 59.35 66.80 2 40.00
24540. Jesus (keeemstarr) 5 108.72 118.15 4 80.00
24541. Kevin (kchoy) 5 131.94 148.01 3 60.00
24542. Kayoro (kayoro_24) 5 52.34 60.48 1 20.00
24543. Kayano (kayano_chi) 5 52.74 56.12 0 0.00
24544. Kavika (kavika30) 5 89.35 98.19 1 20.00
24545. Katie (katriarchy) 5 76.37 85.50 3 60.00
24546. katie (katie2807) 5 86.17 100.91 1 20.00
24547. kasuno (kasuno) 5 62.49 67.99 2 40.00
24548. Emerson (kasai_moyasu) 5 89.88 96.38 2 40.00
24549. Karmalegend (karmalegend) 5 93.06 95.96 1 20.00
24550. Now you gonna see this is h... 5 55.37 63.93 1 20.00
24551. kaqzea (kaqzea) 5 75.08 86.35 2 40.00
24552. Kantel (kantel) 5 125.07 136.25 3 60.00
24553. kalski (kalski) 5 106.05 111.99 2 40.00
24554. Kaldius (kaldius) 5 72.24 85.77 0 0.00
24555. kakujodai (kakujodai) 5 70.41 80.30 1 20.00
24556. Kaintu (kaintu) 5 99.63 105.77 2 40.00
24557. kaihq (kaihq) 5 52.26 58.78 1 20.00
24558. Kostas (kael89) 5 95.89 99.62 1 20.00
24559. Kacper (kacperkazan) 5 88.87 97.43 2 40.00
24560. Jasper (kaasisbaas) 5 74.94 79.07 2 40.00
24561. T (kaampachees) 5 56.17 62.75 0 0.00
24562. Kirsty (k1rsty) 5 67.97 75.20 2 40.00
24563. JONALD (jzwhale) 5 112.07 118.67 2 40.00
24564. j (jyygl) 5 79.94 99.25 1 20.00
24565. Jun (jyl6198) 5 114.45 121.66 4 80.00
24566. Vix (jvixaychack) 5 92.43 102.17 1 20.00
24567. noodle (just_a_noodle) 5 62.03 72.60 1 20.00
24568. jupeti2 (jupeti2) 5 57.71 62.37 0 0.00
24569. Jun (junpoe) 5 91.33 102.50 1 20.00
24570. Junho (junebug14) 5 82.83 94.00 3 60.00
24571. Juicy (juicypolez) 5 77.36 99.01 2 40.00
24572. Zach (jugglinguy) 5 137.05 145.88 4 80.00
24573. jude (jude17) 5 77.75 81.37 2 40.00
24574. John (jstar218) 5 61.70 66.50 2 40.00
24575. James (js921) 5 101.08 110.64 2 40.00
24576. Jessie (jpoopknitting) 5 81.28 88.94 3 60.00
24577. Jovan (jovannjt) 5 97.97 107.90 2 40.00
24578. Joseph (josqu) 5 108.39 125.70 2 40.00
24579. J (jossama) 5 77.25 80.71 1 20.00
24580. Jordan (jordann31) 5 57.47 66.66 0 0.00
24581. Jon (jonksig) 5 59.40 64.70 1 20.00
24582. Jonato (jonato) 5 96.61 112.63 1 20.00
24583. Jonathan (jonathankeyboard) 5 65.37 76.57 0 0.00
24584. mika (jonassenghaas) 5 86.45 90.04 2 40.00
24585. Jonas (jonas19) 5 74.38 84.15 1 20.00
24586. no (jonah1357) 5 111.59 120.15 4 80.00
24587. john (johnstamosfullhouse) 5 90.87 113.21 1 20.00
24588. Josh (johnjena93045) 5 81.69 90.80 1 20.00
24589. John666695 (john666695) 5 145.06 158.92 4 80.00
24590. John (john62180) 5 96.29 112.23 3 60.00
24591. Erik (joezuu) 5 99.77 106.74 3 60.00
24592. Joe (joekerhd) 5 74.42 87.92 1 20.00
24593. JOE (joe345) 5 75.78 93.74 0 0.00
24594. Joseph (jnml19) 5 102.78 110.31 4 80.00
24595. Joe (jj_zhaaaaang) 5 72.11 79.79 0 0.00
24596. Jay (jjthomso_yt) 5 75.82 79.49 1 20.00
24597. Jjy (jjoy12) 5 51.37 59.98 0 0.00
24598. Jiuena (jiuena) 5 103.09 109.67 3 60.00
24599. Jini (jinilee07) 5 101.61 114.58 3 60.00
24600. Jim (jingon93) 5 106.58 117.95 5 100.00
24601. jim (jimdocks) 5 79.92 102.60 2 40.00
24602. Jesse (jesse0908) 5 53.70 58.84 0 0.00
24603. JEM (jem5268) 5 82.54 99.28 1 20.00
24604. ilmari (jejj) 5 64.10 75.68 0 0.00
24605. Sam (jeff_the_pickle) 5 91.13 95.92 2 40.00
24606. Jedidiah (jedidia60) 5 73.84 77.69 2 40.00
24607. Jeffrey (jebbrey) 5 85.01 99.70 3 60.00
24608. Justin (jauntsmirk) 5 58.72 62.47 0 0.00
24609. Jasur (jasur_257) 5 42.81 47.86 1 20.00
24610. Jason (jason534f) 5 88.57 100.61 4 80.00
24611. JK17 (jaredkane17) 5 70.04 72.34 0 0.00
24612. (jannis) 5 131.15 141.14 2 40.00
24613. jame (jame_oxford_11) 5 38.88 42.52 2 40.00
24614. Ilya (jamesakke) 5 57.23 60.64 1 20.00
24615. Jahangir (jalom102) 5 52.06 55.78 0 0.00
24616. Jannik (jako79) 5 45.07 48.81 2 40.00
24617. Jake (jake360) 5 55.60 64.38 0 0.00
24618. Jairel (jairel) 5 104.89 107.60 2 40.00
24619. hotmama (jaggid) 5 106.68 115.84 1 20.00
24620. Jason (jaeson813) 5 86.12 99.11 2 40.00
24621. Jacob (jacobvaneyck) 5 91.89 107.19 1 20.00
24622. Jacob (jacobf01) 5 88.01 95.17 1 20.00
24623. Drift King (jackyyang09) 5 111.36 126.32 1 20.00
24624. Jack (jackpropc) 5 106.21 118.74 2 40.00
24625. Jackson (j4cks0n) 5 61.22 65.48 0 0.00
24626. joshua ray (j2samodal) 5 75.43 80.29 2 40.00
24627. Tom (i_hate_yext) 5 105.38 132.02 3 60.00
24628. .kutty_guppy (i_am_a_tryhard) 5 65.45 69.19 3 60.00
24629. Istaz (iztaz) 5 68.14 79.40 2 40.00
24630. King (izhh) 5 80.74 90.01 2 40.00
24631. Jake (izable) 5 112.86 132.07 3 60.00
24632. Iya (iyaiyayoh) 5 54.72 61.45 0 0.00
24633. Aleks (ixine) 5 80.08 86.55 2 40.00
24634. kommit (iwanttokommitdead) 5 76.39 97.91 5 100.00
24635. Ivysaur (ivysaureg) 5 115.36 130.74 4 80.00
24636. Ivusin (ivusin) 5 74.90 82.12 0 0.00
24637. osuplayer (ivbagbroke) 5 69.50 80.92 1 20.00
24638. Ivan (ivasil) 5 77.76 82.43 1 20.00
24639. Ali (its_alihosam) 5 62.91 71.37 3 60.00
24640. ItsNo06 (itsno06) 5 73.12 80.73 0 0.00
24641. Kevin (itsk3vin) 5 94.18 103.52 2 40.00
24642. Jake (itsemerald) 5 67.27 73.66 0 0.00
24643. Edrin (itsedrin) 5 76.86 84.17 2 40.00
24644. Itamar K. (itakor9) 5 125.02 143.15 4 80.00
24645. kuromi (istrying) 5 67.27 78.41 0 0.00
24646. isham (isham) 5 65.12 71.82 1 20.00
24647. isaac (isaac3416) 5 60.67 73.85 1 20.00
24648. Irfan (irfanshaikh) 5 75.54 84.76 2 40.00
24649. Alexander Miller (iowahawke... 5 53.34 57.67 1 20.00
24650. Spruty (infrasix) 5 70.32 73.48 5 100.00
24651. inaki333 (inaki333) 5 53.53 58.86 0 0.00
24652. Toller (imthetoller) 5 96.03 103.26 4 80.00
24653. impr0ving (impr0ving) 5 55.56 59.29 0 0.00
24654. Mac (immaculatemac) 5 82.10 87.06 2 40.00
24655. Jeremy (imleafing) 5 111.32 115.33 4 80.00
24656. Jens (imcre4tiive) 5 76.70 95.82 1 20.00
24657. Ilyanna (ilygoesboom) 5 124.02 129.39 5 100.00
24658. ILUVpwny (iluvpwny) 5 88.77 104.02 2 40.00
24659. Steve (ijustwanttotype) 5 72.06 77.84 1 20.00
24660. meena (ifeellikeshemarmoore) 5 65.97 77.10 1 20.00
24661. Dean (icysabr3) 5 89.06 98.98 2 40.00
24662. Ice (icedevera) 5 92.67 101.03 4 80.00
24663. Rajan (icecoldreaper07) 5 63.49 69.83 0 0.00
24664. icebear (icebearnose) 5 61.15 64.39 1 20.00
24665. william (iamzyva) 5 91.58 108.37 2 40.00
24666. Marcus (h_mph) 5 78.74 87.35 0 0.00
24667. Chris (hypernovachris) 5 72.93 77.16 1 20.00
24668. tempo (hypergonzx) 5 90.86 98.26 2 40.00
24669. HyattOcto (hyattocto) 5 139.88 165.68 3 60.00
24670. Dan (hwip) 5 115.95 134.75 4 80.00
24671. Hugh (huuugh18) 5 84.46 98.45 1 20.00
24672. Hungry (hungry_stingray) 5 79.65 88.08 2 40.00
24673. huhkdog (huhkdog) 5 43.49 52.37 1 20.00
24674. Hubert (hubertle85639) 5 91.04 105.53 5 100.00
24675. HubaFluba (hubafluba) 5 96.87 109.05 5 100.00
24676. Dave (hottodogu) 5 77.92 86.95 1 20.00
24677. 0% (horiz0n) 5 71.60 76.62 3 60.00
24678. vin (homeloverboy) 5 85.35 91.98 0 0.00
24679. Alex (hollums) 5 113.41 119.30 2 40.00
24680. Max (hoglimogli) 5 70.45 75.37 0 0.00
24681. MHoang (hoang993007) 5 51.49 57.37 2 40.00
24682. H (hkk09) 5 58.17 70.87 0 0.00
24683. icanttypeaccuratelyconsiste... 5 121.36 129.75 2 40.00
24684. Historical (historicalskink) 5 57.62 64.39 1 20.00
24685. ... (hirunaka) 5 47.49 53.03 2 40.00
24686. xy (hihiki) 5 54.63 59.52 0 0.00
24687. Yuki (hiavl) 5 111.88 120.37 1 20.00
24688. Heper (hepersopon) 5 63.01 67.29 0 0.00
24689. Henr1ES (henri2022) 5 61.75 68.83 0 0.00
24690. henpenben (henpenben) 5 95.12 108.18 2 40.00
24691. Luc (hellperson) 5 73.68 81.16 0 0.00
24692. Helix (helix13_) 5 93.80 99.69 4 80.00
24693. heawwi (heawwi) 5 66.11 71.93 2 40.00
24694. H (hdawg187) 5 89.65 97.01 1 20.00
24695. Hay3den_00 (hay3den_00) 5 83.18 91.02 2 40.00
24696. Philipp (haxaffe) 5 75.27 79.60 2 40.00
24697. Alice (hautecouturexx) 5 40.80 62.85 5 100.00
24698. Hassan (hassanamoudi) 5 60.03 66.00 1 20.00
24699. Sultan (hasanoji) 5 88.45 95.35 0 0.00
24700. John (harrumph) 5 80.49 92.61 2 40.00
24701. Harper (harpermh) 5 81.81 89.07 3 60.00
24702. RasDingo (haroxdruiden) 5 96.84 110.40 3 60.00
24703. harish (harishravi) 5 55.45 61.12 0 0.00
24704. ༼ʘ̚ل͜ʘ̚༽ (happyno) 5 116.30 131.65 1 20.00
24705. happy15crazy (happy15crazy) 5 53.20 61.62 0 0.00
24706. Jimmy (hapahunta) 5 68.14 84.66 0 0.00
24707. Hannah (hannahkoh) 5 69.48 86.02 0 0.00
24708. Khamza Shagdar (hamzacer) 5 29.83 35.50 0 0.00
24709. John (hakabubu) 5 100.15 109.92 3 60.00
24710. Haji (hajikoit1_) 5 67.25 80.66 0 0.00
24711. hn (hahahana) 5 65.00 68.93 1 20.00
24712. Haiman (h41man_01) 5 67.54 74.15 1 20.00
24713. Gustavo (gustavo_caria) 5 77.34 89.36 1 20.00
24714. Rushabh Kanadiya (guitarher... 5 71.67 81.90 5 100.00
24715. Guilly (guiltykrow) 5 57.14 66.45 0 0.00
24716. Tim (guiganator) 5 108.13 119.91 2 40.00
24717. Guest (guest2703) 5 83.23 92.07 2 40.00
24718. Tigran (grig_tigran) 5 51.97 54.11 1 20.00
24719. Gregory (gregoryshen212) 5 105.90 113.43 2 40.00
24720. Ritesh (greeaatt_successs) 5 69.31 73.70 2 40.00
24721. Parker (grasshopper_weeb) 5 99.34 105.66 3 60.00
24722. Jakub (grajak) 5 98.31 111.58 4 80.00
24723. Daniel (goldncore) 5 86.21 101.71 2 40.00
24724. Erik (goldfrankenstein) 5 104.51 112.71 0 0.00
24725. Malt0 (godcream) 5 98.78 117.39 2 40.00
24726. Georg (gmpfeifer) 5 65.35 73.67 0 0.00
24727. George (gmorf) 5 73.19 79.48 1 20.00
24728. Goven (gmbarrera) 5 83.10 99.94 0 0.00
24729. gleb (glebusking) 5 75.79 80.72 0 0.00
24730. glassnet (glassnet) 5 61.77 66.33 3 60.00
24731. Griffin (girfster) 5 92.78 97.79 4 80.00
24732. Andija (gingerpolk) 5 85.77 88.28 3 60.00
24733. Gina (ginadoerp) 5 116.94 132.79 2 40.00
24734. Jordon (gimp_jimmy) 5 89.39 98.56 3 60.00
24735. Jmin (gillf) 5 44.94 48.57 0 0.00
24736. melluwellu (giantme1on) 5 71.94 73.60 1 20.00
24737. Ghazanfer (ghazanfer) 5 101.10 115.97 1 20.00
24738. Arturo (gharlock) 5 89.79 105.29 2 40.00
24739. Ghanem (ghanemzein) 5 61.23 68.37 0 0.00
24740. Joseph (gh0stty) 5 51.64 56.20 0 0.00
24741. Zachy (ggohpks) 5 96.39 103.67 3 60.00
24742. Giles (gga_) 5 84.06 88.59 1 20.00
24743. Geno (geno20) 5 124.47 134.04 3 60.00
24744. Ahmed (gemmy2212) 5 68.55 77.41 4 80.00
24745. hiva (gemje) 5 61.68 65.11 2 40.00
24746. Geevar (geevar007) 5 52.69 56.34 0 0.00
24747. Gary (garyboo) 5 112.59 127.58 0 0.00
24748. Garrin (garrins) 5 100.04 111.71 2 40.00
24749. Kristofer (gardeborg) 5 52.60 60.27 2 40.00
24750. Ganesh (ganeshadsul) 5 47.63 53.46 2 40.00
24751. Kenan (gamingkenan) 5 85.83 106.41 3 60.00
24752. Vladimir (galaxygameryay) 5 93.07 101.01 5 100.00
24753. Gajendra (gajutyper) 5 47.98 51.39 1 20.00
24754. avishek (gaberiel0770) 5 51.05 55.74 1 20.00
24755. gabbrueh (gabbrueh) 5 79.32 85.91 5 100.00
24756. Whos (g3trekt) 5 92.81 105.27 5 100.00
24757. Nicholas (fryingpan) 5 115.65 135.05 2 40.00
24758. James (frozenoblivion) 5 70.54 80.47 0 0.00
24759. Nutalie (frostybeep) 5 100.64 107.84 4 80.00
24760. Derf (fredboi) 5 87.14 111.62 2 40.00
24761. Logan (freamish) 5 109.40 121.22 3 60.00
24762. FraYo (frayo) 5 74.14 80.18 2 40.00
24763. Santiago (forero) 5 81.56 88.45 1 20.00
24764. fordatab (fordatab) 5 64.96 100.84 2 40.00
24765. OBsole (footcandilight) 5 92.46 95.33 1 20.00
24766. Rosencrantz (foolbright) 5 78.03 92.59 1 20.00
24767. Frank (floturcocantsee) 5 101.75 114.23 2 40.00
24768. RUDRANSH! (flame_ethnic) 5 72.87 85.70 2 40.00
24769. seth (firewolf_2001) 5 86.53 93.37 1 20.00
24770. Julien (fioul) 5 79.74 86.48 3 60.00
24771. Fionnan (fionnanos2000) 5 70.02 86.55 1 20.00
24772. Michael (fiftyfingers) 5 92.19 105.35 4 80.00
24773. Max (ficko) 5 68.44 72.69 0 0.00
24774. Halis (fezira) 5 81.29 91.29 0 0.00
24775. fer (ferreginaa) 5 51.83 61.01 0 0.00
24776. Femiiiiiiiiii (femiboom) 5 73.35 83.11 0 0.00
24777. alnexus (felipxkillerbr) 5 96.14 103.67 1 20.00
24778. Felipe (felipe2896) 5 62.74 79.39 1 20.00
24779. Fearless (fearless_soul) 5 61.80 79.57 3 60.00
24780. Youssef (fcijuniorr01) 5 51.47 57.83 5 100.00
24781. Yan Yan (fatheryanyan) 5 47.61 52.06 1 20.00
24782. ZeRandom (fastnt) 5 82.66 91.90 4 80.00
24783. Faorle (faorle) 5 95.13 112.97 0 0.00
24784. fang (fangyibkk) 5 62.24 71.85 0 0.00
24785. Fang (fango_) 5 94.95 104.82 5 100.00
24786. Fammis (fammis) 5 79.22 106.83 2 40.00
24787. Fahrenheit (fahrenhite) 5 92.59 108.09 1 20.00
24788. Fadeaway (fadeaway286) 5 68.37 83.27 2 40.00
24789. Fabian (fabiangubler) 5 74.45 80.47 2 40.00
24790. tstats[f6rz9d] (f6rz9d) 5 46.10 51.26 0 0.00
24791. flats (f1ats) 5 59.55 66.51 3 60.00
24792. Vidur (f0rs4k3n) 5 49.89 51.67 1 20.00
24793. Ezequiel (ezk84) 5 66.88 75.11 0 0.00
24794. Garrett (ezekiel6430) 5 46.32 51.63 0 0.00
24795. EzBeau (ezbeau) 5 92.09 100.78 2 40.00
24796. eyosias (eyosi_sol) 5 44.93 53.05 3 60.00
24797. OoOoOoOoOoOoO (extralen) 5 39.01 45.47 0 0.00
24798. Exojay (exojay) 5 115.76 120.46 4 80.00
24799. Matthew (exiamu) 5 98.46 111.10 3 60.00
24800. Evening (eveningtaco) 5 106.83 129.98 3 60.00
24801. Ethan (ethanangg) 5 82.02 90.55 4 80.00
24802. Pixelking251 (espk251) 5 99.42 117.31 2 40.00
24803. eroblaze (eroblaze) 5 62.72 68.91 0 0.00
24804. Erin (erinchipppppppp) 5 82.62 88.11 2 40.00
24805. eric_colemak (eric_colemak) 5 93.45 99.87 3 60.00
24806. eqqi (eqqidvorak) 5 68.31 71.36 1 20.00
24807. Robert (epicsauce32) 5 93.82 101.26 3 60.00
24808. Duy (epicbrick) 5 67.16 80.53 1 20.00
24809. enton (enton420) 5 85.19 91.45 3 60.00
24810. trashbin (ennoch) 5 87.62 95.16 3 60.00
24811. Vlad (engurararazov) 5 64.65 68.69 0 0.00
24812. Ender (endermood) 5 59.89 64.38 1 20.00
24813. Emma (emmaish) 5 86.78 91.33 3 60.00
24814. Jeff (ekuplosion) 5 108.56 120.31 5 100.00
24815. eigo (eigo) 5 56.79 60.84 0 0.00
24816. EHHH (ehhh_) 5 86.90 96.55 2 40.00
24817. zeyad (egyptian_1211) 5 56.46 61.44 1 20.00
24818. egg (egg_soup) 5 95.27 100.36 2 40.00
24819. Alex (eggstreme) 5 109.28 115.64 4 80.00
24820. David (ebiswick) 5 94.70 102.25 2 40.00
24821. Aslan (dzhindzholia) 5 71.47 79.49 1 20.00
24822. D (dylanite13) 5 64.10 72.63 2 40.00
24823. Kelvin (duongkelvin75) 5 72.22 74.15 2 40.00
24824. กูคือความ... 5 74.37 79.77 1 20.00
24825. Duncan (dungrimm) 5 68.94 75.81 3 60.00
24826. vanessa (dumdimsum) 5 111.59 119.67 2 40.00
24827. Abhinav (dudeja55) 5 45.35 51.75 0 0.00
24828. duc (duchihi) 5 64.15 68.41 1 20.00
24829. Gabriel (dsgab) 5 88.49 102.76 2 40.00
24830. DryGer (dryger27_) 5 63.92 72.18 0 0.00
24831. dryeab (dryeab) 5 56.06 65.47 5 100.00
24832. drake (drunk3n) 5 69.25 74.47 1 20.00
24833. Archer (drugzy) 5 57.35 63.97 1 20.00
24834. DrSnackary (drsnackary) 5 102.94 121.34 0 0.00
24835. Dan (drimilyon) 5 97.40 108.23 1 20.00
24836. Dawid (dresik) 5 91.13 99.32 3 60.00
24837. Travis (drdream23) 5 107.17 118.95 2 40.00
24838. Kaloyan (doublelv) 5 75.78 80.47 2 40.00
24839. double (doubleliftisgod) 5 87.28 96.82 0 0.00
24840. Doubledealer (doubledealer) 5 93.88 106.39 3 60.00
24841. Dorito (doritochip) 5 93.28 103.15 1 20.00
24842. Leif :3 (dopotsl) 5 80.71 90.48 1 20.00
24843. Ziwei (dongryeollee) 5 118.16 131.07 3 60.00
24844. Domking (domking) 5 81.14 92.79 2 40.00
24845. Frederik (dobobay) 5 100.65 116.14 2 40.00
24846. Duong (dnx04) 5 68.13 78.22 0 0.00
24847. Peter (dletastar4) 5 99.19 105.17 3 60.00
24848. Ali (djsum) 5 97.17 113.45 0 0.00
24849. CrispTea (distance) 5 145.73 161.47 5 100.00
24850. Dom (disfordom) 5 121.40 145.73 5 100.00
24851. Timothy (disapointing) 5 102.31 114.98 3 60.00
24852. Debdip Das (dipto_debdip) 5 55.52 57.94 0 0.00
24853. deepika (dips26) 5 37.93 41.69 0 0.00
24854. Dimituri (dimituri) 5 83.41 94.62 1 20.00
24855. dmitrijs (dhmitry) 5 97.68 109.84 5 100.00
24856. Deranged (de_ranged) 5 74.81 81.22 2 40.00
24857. Quinn (dewdrive101) 5 84.12 93.13 1 20.00
24858. Andrew (dewdew7) 5 104.85 113.22 3 60.00
24859. Albert (devmood) 5 69.70 73.04 3 60.00
24860. me (devilsdaily) 5 70.05 79.42 1 20.00
24861. Javokhir (developer_007) 5 65.21 73.90 2 40.00
24862. DetectiveRegen (detectivere... 5 73.76 82.36 0 0.00
24863. Jamie (destroyer_of_words) 5 89.33 120.03 0 0.00
24864. Omar (desouky22) 5 53.86 59.76 1 20.00
24865. jayden (dershlibob) 5 75.49 81.81 2 40.00
24866. Derrick (derrickha) 5 112.01 135.87 1 20.00
24867. Micha (derpeus) 5 85.43 97.19 1 20.00
24868. DerexXD (derexd) 5 120.12 139.48 3 60.00
24869. GD (degeemon21) 5 85.76 94.34 3 60.00
24870. Heaven (defintelynotjah) 5 140.59 152.55 5 100.00
24871. deez (deez_nuits) 5 38.72 42.00 0 0.00
24872. Diego (decoarguello) 5 43.54 47.75 0 0.00
24873. Deasy (deasnataly) 5 93.30 104.83 0 0.00
24874. migs12345 (deanfanboy) 5 93.42 105.22 1 20.00
24875. Andrew (ddrone) 5 84.72 88.06 1 20.00
24876. Daniel (dax1536c) 5 49.53 55.79 0 0.00
24877. david (davideman4) 5 58.92 66.99 1 20.00
24878. Davelkling (davelkling) 5 103.76 115.73 3 60.00
24879. Peder (darthpejder) 5 64.73 69.05 3 60.00
24880. Ignacio (darkylove) 5 81.39 96.48 5 100.00
24881. Alejandro (darkian) 5 98.32 110.84 0 0.00
24882. Nyx (darkforrest) 5 54.13 62.28 2 40.00
24883. Dan (danvnbls) 5 57.91 66.85 0 0.00
24884. Dani (danisoltesz) 5 77.58 83.25 3 60.00
24885. Daniel (daniel1353) 5 74.59 87.30 3 60.00
24886. Dant (dancal22) 5 87.66 94.81 2 40.00
24887. coin (damasterofcoin) 5 92.65 102.26 1 20.00
24888. daghag (daghag) 5 80.43 88.23 1 20.00
24889. Dylan (dabair1) 5 72.76 79.19 1 20.00
24890. vehemore (d4bb3r) 5 97.49 120.72 2 40.00
24891. Dmitry (d1pj_123) 5 37.96 40.16 2 40.00
24892. Daniel (d0eza) 5 108.55 121.78 3 60.00
24893. Vanisse (cyphen) 5 65.27 69.70 4 80.00
24894. Cynthia (cynbin) 5 91.43 100.14 0 0.00
24895. cee (cxelle) 5 92.87 104.73 3 60.00
24896. DucNguyen (cuberates) 5 99.27 117.17 1 20.00
24897. cuago (cuago) 5 77.85 95.08 2 40.00
24898. Cryo (cryotalis) 5 141.30 151.00 4 80.00
24899. Craig (crvig) 5 100.91 111.75 4 80.00
24900. Courtney (croy726) 5 71.71 80.84 4 80.00
24901. meme (crimsonvava) 5 79.17 93.91 1 20.00
24902. Arnav (cricketman360) 5 82.04 92.20 3 60.00
24903. Kevin (crazycranberry) 5 93.76 102.25 1 20.00
24904. Kareem (crashhadback) 5 94.41 118.38 2 40.00
24905. Warren (craggles) 5 106.17 113.41 5 100.00
24906. Cuong (cqtshadow) 5 64.02 73.75 1 20.00
24907. Santi (coyang) 5 70.26 74.88 0 0.00
24908. Count (countlizzard) 5 72.02 81.64 0 0.00
24909. cottonaudie (cottonaudie) 5 61.56 69.07 3 60.00
24910. Corny (cornyy) 5 84.82 96.60 2 40.00
24911. Steven (corilx) 5 85.04 90.43 0 0.00
24912. Corey (coreygallagher1194) 5 70.75 77.26 1 20.00
24913. Nguyen (corei9001) 5 77.22 82.62 0 0.00
24914. Michael (coppinslinger) 5 94.63 101.74 2 40.00
24915. Jhoe (cookiemeeps) 5 85.89 94.46 1 20.00
24916. slr (con_d_oriano1) 5 91.40 118.44 1 20.00
24917. connie (conniexlee) 5 113.35 121.90 4 80.00
24918. Jotaro (commandercuber) 5 107.67 110.36 2 40.00
24919. 123 (colemak163) 5 93.33 95.95 0 0.00
24920. Cole (colejay) 5 83.49 93.76 2 40.00
24921. Jake (coike2323) 5 71.60 82.67 1 20.00
24922. Shahzada (coderssalim) 5 53.50 59.06 1 20.00
24923. Cod3 (cod3_catz) 5 79.83 88.58 1 20.00
24924. Manikandan (cmkrss) 5 39.47 46.54 1 20.00
24925. Sree (clyublexx) 5 67.84 76.79 1 20.00
24926. clpz (clpz) 5 83.68 87.58 4 80.00
24927. clock (clockw0rk) 5 94.30 101.84 3 60.00
24928. Brody (clocktoc) 5 100.06 109.22 2 40.00
24929. Alfred (cliserkad) 5 74.19 78.19 5 100.00
24930. Virgil (clinz63) 5 80.99 84.55 1 20.00
24931. clinkz (clinkkz) 5 46.54 49.09 0 0.00
24932. Clay (clay10swag) 5 71.37 76.91 0 0.00
24933. Chris (ckinto) 5 123.52 129.70 1 20.00
24934. CJB314 (cjb314) 5 101.37 103.84 5 100.00
24935. C (ciaram21) 5 47.67 51.13 1 20.00
24936. Chuzz (chuzzilla) 5 121.90 141.41 3 60.00
24937. Chris (chrisp3oh) 5 62.41 70.81 0 0.00
24938. Smiggy (chillnye) 5 119.66 126.27 4 80.00
24939. Chili (chilipaneer) 5 93.65 99.76 2 40.00
24940. nick (chiefotto) 5 57.88 62.38 0 0.00
24941. Chhilz (chhilz) 5 107.17 118.64 4 80.00
24942. Chet (chetbaker) 5 122.90 137.20 4 80.00
24943. Andrew (chessdoudou) 5 69.14 72.90 1 20.00
24944. Cheesie (cheesie_muffin) 5 37.88 39.87 0 0.00
24945. Nolan (cheesedog145) 5 68.93 77.30 0 0.00
24946. Seymour (cheapsunglasses) 5 104.51 110.68 4 80.00
24947. Che (che247) 5 87.84 90.53 1 20.00
24948. Bilal (chaudhryb) 5 108.48 125.93 4 80.00
24949. Mujahid (chaos_knight) 5 84.80 91.43 1 20.00
24950. Challenger (challenger21008) 5 44.59 45.90 0 0.00
24951. Chacho (chacho12) 5 54.28 57.89 2 40.00
24952. bubu (cgfu) 5 87.14 94.40 4 80.00
24953. Tarik (cevapmaster) 5 90.22 112.81 5 100.00
24954. cdolivera (cdolivera) 5 104.28 114.02 2 40.00
24955. Mateusz (ccre) 5 92.95 102.11 2 40.00
24956. choco (cchoki) 5 123.54 132.57 2 40.00
24957. Cathleen (cathleenavrilian) 5 54.90 62.14 0 0.00
24958. Cody (catchytyper) 5 89.85 101.74 0 0.00
24959. Casey (caseyjnguyen) 5 93.71 100.71 3 60.00
24960. Carsyn (carsynw) 5 57.99 63.27 1 20.00
24961. Edgar (carrot9510) 5 72.75 81.38 5 100.00
24962. capmc88 (capmc88) 5 88.03 106.31 1 20.00
24963. Cant (cant_code) 5 89.97 108.55 1 20.00
24964. Ian (call_me_lan) 5 94.83 109.83 1 20.00
24965. Callum (callum__) 5 73.10 91.41 0 0.00
24966. char (calcifer_6) 5 70.76 79.31 4 80.00
24967. Caketin (caketin_cat) 5 90.97 103.74 2 40.00
24968. Isaac (caelstrasza) 5 113.25 120.00 0 0.00
24969. cab (cab23) 5 110.75 122.39 1 20.00
24970. Caleb (cabona) 5 75.48 87.08 3 60.00
24971. bweb (bweb) 5 62.94 84.11 1 20.00
24972. Haytham (bwaredevoodoo) 5 58.04 80.20 1 20.00
24973. Donn Justin (bulos19) 5 70.49 76.22 0 0.00
24974. Edward (buitrungbao) 5 90.57 96.75 5 100.00
24975. Budwecan (budwecan) 5 56.21 60.50 3 60.00
24976. Marty (budmike54) 5 56.47 64.85 3 60.00
24977. brr type man (brrrtypeman) 5 68.36 76.54 5 100.00
24978. Brian (brianlii) 5 45.56 51.58 1 20.00
24979. mesba (brgrkng) 5 95.08 102.30 3 60.00
24980. Leroy (breezytwitch) 5 47.47 52.80 0 0.00
24981. BranClown611 (brandenclown) 5 95.79 110.06 3 60.00
24982. Bram (bramster007) 5 75.35 82.51 1 20.00
24983. Boyang (boyangliuu) 5 71.99 76.03 1 20.00
24984. bowlby (bowlby_) 5 92.32 103.07 3 60.00
24985. Kaylin (boomba506) 5 86.34 92.83 3 60.00
24986. Bob (bobychen) 5 82.97 92.81 1 20.00
24987. Hailey (bobthetem) 5 90.40 109.38 2 40.00
24988. N4aten (bobthebot) 5 81.13 98.78 2 40.00
24989. BobSty (bobsty) 5 68.30 77.21 3 60.00
24990. real_remi (bobbobbio) 5 68.18 87.34 1 20.00
24991. B (bnowba) 5 89.97 106.38 2 40.00
24992. Mohammadamin (bmz8880) 5 59.96 69.42 0 0.00
24993. Blu (blu_mint) 5 62.82 69.23 1 20.00
24994. Herin (bluxygurl) 5 82.95 96.54 2 40.00
24995. blue (blueisblue) 5 47.24 54.08 1 20.00
24996. bloodseeker (bloods33ker136) 5 67.99 81.20 1 20.00
24997. Bloggo (bloggowo) 5 83.49 90.47 2 40.00
24998. Blizzard (blizzardwindx) 5 95.95 102.49 1 20.00
24999. Laith (blissterrz) 5 84.31 96.81 0 0.00
25000. blinno (blinno) 5 77.38 100.25 5 100.00
25001. Pink Guy (bleachuggr) 5 90.44 104.39 2 40.00
25002. r (blazinrt) 5 67.14 72.24 2 40.00
25003. Roger (blasticidin) 5 93.97 100.96 2 40.00
25004. Blafl (blafl) 5 108.34 114.39 2 40.00
25005. Bjorn (bjornbaboon) 5 112.03 129.40 3 60.00
25006. BitBytez (bitbytez) 5 53.95 61.95 0 0.00
25007. Marco (biomean) 5 66.61 77.37 1 20.00
25008. Simp4turtles (bingoringo) 5 43.06 49.15 0 0.00
25009. Brody (bingbongbottledong) 5 87.87 98.34 1 20.00
25010. bigpapa (bigpapathapa) 5 68.30 75.18 2 40.00
25011. Will (bigmac1time) 5 98.25 102.76 0 0.00
25012. Agus (bigbangfuzion) 5 55.12 61.96 0 0.00
25013. Seungil (biam83) 5 60.75 66.72 0 0.00
25014. Brittany (bhunter9) 5 85.49 91.76 1 20.00
25015. Be (be_wise) 5 102.82 109.98 0 0.00
25016. Bethany (bethanyyyy114) 5 72.44 78.85 1 20.00
25017. ben (benwestmercer) 5 93.75 99.94 1 20.00
25018. Oskar (belmondziak) 5 58.08 64.18 1 20.00
25019. Rebecca (beccaloveyou) 5 79.97 98.39 5 100.00
25020. Daniel (beamenace) 5 97.01 106.21 2 40.00
25021. Dvimrak (bchadwick87) 5 72.68 76.57 1 20.00
25022. Borna (bborna) 5 89.21 97.06 2 40.00
25023. bbbbb333 (bbbbb333) 5 83.86 87.66 5 100.00
25024. B (batyrn) 5 88.37 106.10 4 80.00
25025. niki (bateshot) 5 67.18 71.35 1 20.00
25026. bassoon (bassoon_38) 5 105.83 118.57 4 80.00
25027. Brayan (bassclefly) 5 44.43 48.82 1 20.00
25028. FreePalestine (basel_mohamed) 5 73.74 83.86 1 20.00
25029. Barok (bar_ok) 5 80.72 95.27 0 0.00
25030. Bharath (bar_at_5) 5 37.71 48.41 0 0.00
25031. bartosz34ek (bartosz34ek) 5 99.60 111.14 3 60.00
25032. Jeff (bandihoot) 5 86.95 109.38 1 20.00
25033. BananaLieutenant (bananalie... 5 100.63 104.06 2 40.00
25034. Ethan (baldskeppyhalo) 5 76.19 79.84 0 0.00
25035. Jack (balancedman) 5 63.49 77.38 0 0.00
25036. Bailey (bailwillharr) 5 85.70 94.42 2 40.00
25037. Ali (bahjatia) 5 107.75 114.45 4 80.00
25038. Kon (bagelkat) 5 87.76 97.39 3 60.00
25039. Vin (badboi14) 5 65.68 72.57 2 40.00
25040. Brandon (bachasdas) 5 91.25 109.23 2 40.00
25041. Erik (babyleaf) 5 97.59 112.72 1 20.00
25042. shannon (babyface1718) 5 29.64 32.87 2 40.00
25043. Ethan (babyjrprado) 5 72.72 84.16 0 0.00
25044. babubhaiya (babubhaiya) 5 31.81 35.16 1 20.00
25045. Dustin (a_drunk_carry) 5 102.35 111.87 1 20.00
25046. Ayush (ayush011) 5 52.66 58.45 4 80.00
25047. Ayman (ayman_isam) 5 49.21 57.85 1 20.00
25048. Adi (ayhone) 5 98.61 109.35 4 80.00
25049. Ay (aydint222) 5 117.01 132.83 4 80.00
25050. Axlly (axlly) 5 47.04 51.20 0 0.00
25051. Awalid (awalid) 5 83.30 90.68 2 40.00
25052. Gōrudoai (auriculus1) 5 90.42 101.69 4 80.00
25053. Aaron (atoponce) 5 86.20 94.38 2 40.00
25054. Atahan (atahan) 5 82.04 92.17 2 40.00
25055. Arjun (asterbot) 5 84.66 87.53 3 60.00
25056. Bonjomon (asian_driver) 5 116.04 124.40 4 80.00
25057. Kyle (asianshroudy) 5 75.86 83.46 2 40.00
25058. Ethan (ashtroflex) 5 58.01 75.19 5 100.00
25059. Ash (ashsuper18) 5 35.09 38.82 0 0.00
25060. Ashim (ashimghosh) 5 50.58 53.98 2 40.00
25061. 𝔸𝕤𝕖𝕖𝕞 (aseemg) 5 78.11 85.93 0 0.00
25062. Manuel (asdfero) 5 109.25 117.63 5 100.00
25063. asasel010 (asasel010) 5 64.72 72.54 0 0.00
25064. Upendra (asarsh) 5 32.32 36.56 1 20.00
25065. Arthur (arthur_morgan1899) 5 79.20 88.47 1 20.00
25066. NotRyan (arthritispacked) 5 118.88 128.85 4 80.00
25067. Ryan (arstar) 5 96.66 104.74 2 40.00
25068. arsham (arsham11) 5 33.41 36.86 1 20.00
25069. Rafael (arroxa) 5 102.96 124.22 2 40.00
25070. Arman (aroman) 5 49.68 56.97 1 20.00
25071. Ian (arlybadgamer) 5 88.30 91.62 1 20.00
25072. Ari (arihsieh) 5 64.40 70.61 0 0.00
25073. arijan (arijan) 5 126.74 161.82 2 40.00
25074. Adam (aren23) 5 49.83 56.67 0 0.00
25075. Kevin (ardioc) 5 74.68 81.78 1 20.00
25076. ARC6 (arc_6) 5 56.54 66.08 0 0.00
25077. AR4444 (ar4444) 5 105.60 123.72 2 40.00
25078. We (aquadye) 5 105.85 120.43 3 60.00
25079. Antek (apilat) 5 113.89 119.20 2 40.00
25080. Mohammad Anwaar Ul Hassan (... 5 41.00 45.93 1 20.00
25081. Anupam (anupampandey) 5 32.77 37.04 0 0.00
25082. Antón (antoonn_07) 5 46.85 52.90 0 0.00
25083. Anthony (anthonyk) 5 90.82 99.38 0 0.00
25084. anshika (anshi_ka) 5 44.87 54.18 0 0.00
25085. vikalimo (anoba) 5 92.84 99.15 1 20.00
25086. David (annefrankisdead) 5 60.05 73.65 0 0.00
25087. Syd (angryscreech) 5 70.83 75.98 3 60.00
25088. Andry (andry60351) 5 79.25 83.96 0 0.00
25089. Andre (andretx) 5 113.98 140.08 3 60.00
25090. Md. Anamul (anamul_31) 5 37.62 42.09 0 0.00
25091. Swapneel (anactualdick) 5 39.13 45.33 1 20.00
25092. hi cutie (an66atwork) 5 109.51 124.20 1 20.00
25093. Amy (amysync) 5 73.98 82.42 3 60.00
25094. amogus (amogusimposterr) 5 88.90 112.20 1 20.00
25095. Alex Miller (amiller13) 5 81.50 99.37 4 80.00
25096. Houtan (amdbluee) 5 61.14 71.15 2 40.00
25097. Amazing (amazingabu) 5 42.45 54.17 3 60.00
25098. Andrew (alz2) 5 97.66 111.87 2 40.00
25099. Alexis (alt04) 5 92.37 97.81 0 0.00
25100. alpha (alpha_stream) 5 95.43 103.90 0 0.00
25101. Ryan (alphaorionis) 5 112.90 120.61 4 80.00
25102. Alpha147258 (alpha147258) 5 82.59 96.78 1 20.00
25103. Allison (allche208) 5 83.58 94.53 0 0.00
25104. ALEXUNDER (alex_under667) 5 78.82 95.47 3 60.00
25105. Alex (alex_the_flash) 5 55.15 66.00 1 20.00
25106. Alexander (alexkingen) 5 97.16 102.11 4 80.00
25107. Alex (alexisstillalive) 5 85.71 91.26 4 80.00
25108. Aleeya (alemm5293) 5 24.04 30.17 0 0.00
25109. ADF (aldf) 5 88.96 98.82 1 20.00
25110. albert (albert_d) 5 122.81 133.16 5 100.00
25111. Nerond (alambek) 5 70.50 88.19 2 40.00
25112. MAB (al00) 5 72.32 73.44 1 20.00
25113. Singam (akshay_singam) 5 32.82 39.99 0 0.00
25114. Akimbo (akimboshara) 5 51.49 56.81 0 0.00
25115. askela (akiii) 5 57.10 67.11 0 0.00
25116. Akash Atmaram Main (akashma... 5 41.34 47.08 0 0.00
25117. akshay (akannaa19) 5 54.70 60.28 1 20.00
25118. Vroom Vroom (ajgriffy) 5 121.73 133.89 2 40.00
25119. Aimz (aimz123) 5 91.88 104.64 2 40.00
25120. Aidian (aidothepro) 5 60.59 69.32 1 20.00
25121. Aidan who just types (aidnb... 5 70.02 74.90 1 20.00
25122. Aibar (aiburito) 5 65.61 74.59 1 20.00
25123. Wasim (ahsaanfd1) 5 65.76 80.84 0 0.00
25124. A S (ahmad1shmd) 5 28.49 34.36 2 40.00
25125. Alex (ahed1) 5 79.56 88.32 2 40.00
25126. alex (agogalex) 5 97.00 115.62 3 60.00
25127. Aki (agidaman) 5 100.22 109.18 2 40.00
25128. Golden guy (aggressor2007) 5 87.66 94.31 3 60.00
25129. Sherlock (agatecard) 5 90.43 99.97 2 40.00
25130. Aftab (aftab535) 5 51.00 60.45 1 20.00
25131. apark (aesenix) 5 120.13 151.67 3 60.00
25132. Naruto_Uzumaki (aeochs) 5 46.65 50.37 5 100.00
25133. AdventureStorm (adventurest... 5 86.14 92.79 2 40.00
25134. Adur (adurto) 5 49.23 58.05 2 40.00
25135. Dio (adroid28) 5 54.56 62.42 0 0.00
25136. Robin (adraqi) 5 85.67 91.99 1 20.00
25137. Hey (adksljfaslkfjsaf) 5 85.36 98.11 3 60.00
25138. Aditya (aditya23112002) 5 62.65 66.42 1 20.00
25139. Aditya (adi20raj) 5 99.70 108.50 2 40.00
25140. adham (adham123) 5 67.41 76.13 0 0.00
25141. Adarsh (addyempire) 5 88.93 96.18 1 20.00
25142. adamski (adast1337) 5 82.02 109.25 2 40.00
25143. YG | Adam (adamallerton12) 5 159.45 168.59 0 0.00
25144. Alonna (acannoy) 5 97.71 111.99 2 40.00
25145. absorb (abvorb) 5 95.42 103.30 2 40.00
25146. Abn0rmalzzz (abn0rmalzzz) 5 88.19 92.94 0 0.00
25147. Abhinav (abhinav199920) 5 22.21 27.18 0 0.00
25148. abdullah (abdullah_foysal) 5 46.85 52.28 0 0.00
25149. Aaron Huang (aaronslept) 5 94.67 106.54 1 20.00
25150. Ahmad (aalay5558) 5 79.46 92.55 3 60.00
25151. Abdelrahman (aabounegm) 5 80.80 89.87 5 100.00
25152. Asharab (8krinkels) 5 106.25 119.79 1 20.00
25153. hades (83hades) 5 79.36 93.72 0 0.00
25154. Leo (80_wpm) 5 67.19 71.77 2 40.00
25155. 7NNS7 (7nns7) 5 70.35 85.92 2 40.00
25156. Wang (69wangjiaming69) 5 78.12 87.70 3 60.00
25157. abe (404abe) 5 82.25 90.83 1 20.00
25158. ELectr8c (3l3ctr1c) 5 67.80 81.13 2 40.00
25159. Kevin (2erhabanana) 5 126.19 139.25 4 80.00
25160. Ntusekho (2cmngadi) 5 53.89 64.24 0 0.00
25161. Darryl (250wpm) 5 114.42 124.08 5 100.00
25162. PheniX (2504435) 5 61.78 66.98 2 40.00
25163. Joyce (20emilywang20) 5 101.58 112.91 2 40.00
25164. Ikramuzzaman (2017331054) 5 75.28 82.53 1 20.00
25165. SpeedKing (1t2t3t4t) 5 80.38 88.14 2 40.00
25166. Icy (1see_1cy) 5 94.02 104.03 1 20.00
25167. R3d (1ch1g0) 5 47.72 55.24 1 20.00
25168. Jakob (1awesomeblossom) 5 50.40 56.71 0 0.00
25169. Harrison (160810601) 5 101.18 108.39 4 80.00
25170. Knight (14_knights) 5 82.22 103.21 2 40.00
25171. Arman (148038) 5 64.69 69.26 0 0.00
25172. 13grainbreads (13grainbreads) 5 78.89 82.56 1 20.00
25173. Andrew (123andrewli) 5 99.05 106.07 3 60.00
25174. Giorgi (0_alien) 5 100.89 120.59 1 20.00
25175. Bono (sp000neyarc123) 5 70.33 78.26 3 60.00
25176. hemanth (hemanthyt) 5 39.93 44.67 0 0.00
25177. Mohniish (mohniish) 5 38.04 42.81 0 0.00
25178. Mary (fufu778) 5 64.33 70.76 1 20.00
25179. Jacob (3rdkira) 5 80.71 96.88 3 60.00
25180. oralfuntime (oralfuntime) 5 72.34 80.67 1 20.00
25181. スピード モンスタ... 5 74.91 83.59 1 20.00
25182. Brian (canama) 5 80.09 89.11 1 20.00
25183. AdriDraino (adridraino) 5 78.74 86.38 5 100.00
25184. Carol (myersca_718) 5 56.47 69.32 0 0.00
25185. ssefjg (ssefjg) 5 78.58 85.42 1 20.00
25186. Supreme (gogogogogogo) 5 51.65 56.92 1 20.00
25187. Space (spaceusername) 5 61.26 74.25 4 80.00
25188. Dejan (mortle2) 5 79.64 88.26 3 60.00
25189. kenzoku (bubbles0989) 5 60.19 66.37 2 40.00
25190. m (mbregg) 5 105.10 111.10 1 20.00
25191. Zed (zeddyboy) 5 96.98 107.90 2 40.00
25192. Wicked (wickedwizard01) 5 71.68 86.42 1 20.00
25193. Tarun (c2tarun) 5 92.83 105.32 1 20.00
25194. Cath (phamduongthu15) 5 37.95 42.50 1 20.00
25195. Sam (saldag) 5 65.10 66.14 1 20.00
25196. Tabi (tabitopsy) 5 44.25 51.15 0 0.00
25197. Juddas (juddas) 5 37.02 39.58 0 0.00
25198. MrXzurg (sheehanrafif_) 5 41.94 47.54 0 0.00
25199. Akash (xvergil) 5 79.54 92.87 1 20.00
25200. Yassine (alcatrax_x) 5 109.13 118.03 2 40.00
25201. Shawn (shawn02) 5 90.71 98.79 2 40.00
25202. vane (spvlh) 5 28.76 32.77 1 20.00
25203. Sylus Lock (nczeneth) 5 52.02 62.98 2 40.00
25204. Jonathan (olympic4) 5 97.88 102.40 1 20.00
25205. exeSyth (exesyth) 5 40.77 43.25 1 20.00
25206. Spoofii (spoofii) 5 85.63 110.36 1 20.00
25207. Bojan (skender) 5 54.51 64.76 0 0.00
25208. Khian (khian_21pogi) 5 64.43 69.59 3 60.00
25209. catsea (lullabbye) 5 82.63 89.23 2 40.00
25210. animeber (animeber) 5 97.18 118.50 4 80.00
25211. Takeshi (dr4z3n) 5 108.84 116.14 3 60.00
25212. big (bigbuddha) 5 73.99 80.59 2 40.00
25213. attu22 (ogattu) 5 119.00 137.55 4 80.00
25214. IntellectualPotato (intelle... 5 74.87 87.46 1 20.00
25215. Omar (omaro_ib) 5 80.51 90.28 0 0.00
25216. Lana (poopfrog) 5 69.65 75.83 2 40.00
25217. Luan (holdy) 5 75.86 80.55 3 60.00
25218. Autismo (aut1smo) 5 70.66 77.54 2 40.00
25219. Amer (qedady) 5 47.28 51.47 1 20.00
25220. Joshua (jsmooth2121) 5 47.36 52.79 0 0.00
25221. VandronRKD (vandronrkd) 5 111.36 119.62 2 40.00
25222. Alex (alaxe) 5 89.76 107.63 0 0.00
25223. Naveen (navi_kane) 5 53.10 56.11 1 20.00
25224. grey (brianshits) 5 67.98 73.56 1 20.00
25225. Ahmed (ahmedsamy_4664) 5 36.30 40.98 2 40.00
25226. it's Gucci (itsgucci) 5 74.57 78.53 2 40.00
25227. George (telosme) 5 61.47 64.48 2 40.00
25228. Supawat (tamsri) 5 82.06 100.84 2 40.00
25229. Rdawk (rdawk99) 5 65.05 70.65 0 0.00
25230. Noah (kibitzers) 5 81.26 84.68 1 20.00
25231. Finn (finndg) 5 67.32 76.12 1 20.00
25232. Kenma (lovekenma) 5 90.11 92.46 2 40.00
25233. Villiie (villiie) 5 35.09 37.12 0 0.00
25234. Hugo (bofibofi) 5 46.88 50.81 0 0.00
25235. K2 (k_twobit) 5 100.62 117.47 2 40.00
25236. buzz (juzzbuzz) 5 105.51 114.01 5 100.00
25237. Lewis (doomboy98) 5 89.69 102.86 2 40.00
25238. Tim (kingofracer) 5 85.52 99.39 1 20.00
25239. Sloth (intriguedsloth) 5 64.73 71.23 2 40.00
25240. Mohammad (boilingcold) 5 78.32 87.82 1 20.00
25241. Jordy (jordygm) 5 42.19 54.82 1 20.00
25242. Alejandro (olojondro) 5 84.48 98.28 1 20.00
25243. Lars (onedayoumay) 5 26.56 27.39 0 0.00
25244. nawara (_nc_) 5 50.22 59.63 0 0.00
25245. Alex (alexxishere) 5 66.91 84.68 1 20.00
25246. Alberto (ajbananaminion) 5 63.40 74.27 2 40.00
25247. Kieran (asianend) 5 88.16 108.86 4 80.00
25248. _KillerTears (killertears) 5 41.78 45.31 1 20.00
25249. Caitlyn (marbledcake78) 5 35.10 39.97 0 0.00
25250. Bryan (bryanvu93) 5 101.08 128.14 2 40.00
25251. Tom (tomwrld999) 5 43.81 46.05 0 0.00
25252. Daniel (audiopromaster2) 5 106.65 116.13 2 40.00
25253. Master (yuoseefanmu) 5 70.42 76.28 0 0.00
25254. pika (pikanotjx) 5 49.61 55.21 0 0.00
25255. AIR (airtwothousand) 5 73.46 79.20 0 0.00
25256. Ixora (ixo_ra) 5 79.80 87.59 2 40.00
25257. Bianca (morningstar_abba) 5 78.97 92.97 4 80.00
25258. Luciano (lucianom) 5 49.20 54.83 0 0.00
25259. Lai (neutrogena) 5 115.97 133.12 3 60.00
25260. Flame (flame_eddie) 5 85.38 92.05 3 60.00
25261. Alonso (rralonn) 5 49.61 54.41 1 20.00
25262. HowieY (roadto100) 5 99.55 108.42 3 60.00
25263. Tsu (andso_rise8824) 5 64.63 75.70 0 0.00
25264. Tom (smileykorean) 5 95.67 114.54 3 60.00
25265. Isaiah (isatti) 5 50.48 59.72 0 0.00
25266. William (astronaut98) 5 104.57 117.10 4 80.00
25267. John (tommyismad) 5 96.52 105.89 3 60.00
25268. DoNWoLF (donwolf) 5 59.49 64.08 1 20.00
25269. Jago (akskgaksh) 5 49.41 52.12 0 0.00
25270. Nishiora (astroit) 5 103.19 108.79 2 40.00
25271. leno (len0) 5 70.63 76.91 2 40.00
25272. Giancarlo (chiqui2000) 5 57.65 62.88 2 40.00
25273. Noor (noorquacker) 5 100.86 110.73 0 0.00
25274. akhil (akhilc47) 5 69.59 72.93 1 20.00
25275. Matzi (skaug) 5 46.41 50.80 0 0.00
25276. MrEWhite (mrewhite) 5 94.66 99.22 2 40.00
25277. Valter (valtiniho) 5 68.61 73.54 2 40.00
25278. tariqul (tariqul) 5 38.19 44.93 0 0.00
25279. Saadmann (saadmann) 5 61.53 68.42 1 20.00
25280. Michele (razgriz_1) 5 50.25 54.22 0 0.00
25281. prem (prembarri) 5 34.63 39.07 0 0.00
25282. Sri (srivb70) 5 81.24 93.72 2 40.00
25283. Santa (santasanta) 5 85.12 99.59 5 100.00
25284. Lil (lilnuts) 5 62.71 67.68 1 20.00
25285. Ak (a_cake_k) 5 67.24 79.86 0 0.00
25286. Tibster (tiberius87) 5 78.09 90.03 3 60.00
25287. Nosam (nosam1261) 5 44.09 54.72 1 20.00
25288. Arek (arkadiuszu_krocej) 5 92.63 101.34 2 40.00
25289. Donux (donux) 5 41.05 45.11 0 0.00
25290. Jay (hellhunter) 5 94.34 107.89 2 40.00
25291. Mark (merkii) 5 66.01 76.69 2 40.00
25292. Nathan (kolacheater) 5 105.89 131.86 4 80.00
25293. Steve (hollasch) 5 86.55 98.41 4 80.00
25294. Brian (briandreed) 5 96.75 105.12 3 60.00
25295. lim (limjunan) 5 36.67 38.29 0 0.00
25296. kerwiwii (kerweni) 5 56.15 61.36 0 0.00
25297. Nelson (nelsonhh) 5 56.45 62.43 1 20.00
25298. Abdulmalek (abdulmalek69) 5 55.67 68.90 1 20.00
25299. bigbogie (hxrxs) 5 77.94 86.32 1 20.00
25300. Epic (amdryzen95950x) 5 57.93 65.45 0 0.00
25301. mrgila69 (d1sc0rd_m4n) 5 39.88 45.37 0 0.00
25302. Agustin (picklerickm4ster_69) 5 48.49 52.00 1 20.00
25303. Eduard (mistersirr) 5 76.39 87.40 2 40.00
25304. Hello (im_a_snail) 5 52.11 59.22 0 0.00
25305. Benjamin (benjamingmb) 5 55.89 57.83 2 40.00
25306. Justice (justice9659) 5 53.07 58.15 1 20.00
25307. jack (masterkratos) 5 47.61 58.12 0 0.00
25308. jssepinkman (jssepinkman) 5 74.01 81.39 1 20.00
25309. Emma (emjulu) 5 92.02 103.17 1 20.00
25310. 78_18 (flynnforthewin) 5 58.80 63.70 1 20.00
25311. Simon (donracer) 5 81.35 90.97 1 20.00
25312. Shin (jopang) 5 59.70 70.69 1 20.00
25313. ray (rayzx) 5 65.30 74.30 0 0.00
25314. Leah (leahloo) 5 62.82 71.80 0 0.00
25315. Andrew (ajcajc) 5 29.32 33.95 0 0.00
25316. Adit Gupta (qwv1) 5 48.51 55.75 1 20.00
25317. ⠀___🐌⠀ (valdizney) 5 88.96 104.22 2 40.00
25318. Luna (pix100) 5 58.87 63.01 4 80.00
25319. Fran (raisinfran) 5 35.44 40.63 0 0.00
25320. MINO (manuper) 5 75.38 84.82 0 0.00
25321. Siomayu (siomayu) 5 84.30 89.73 0 0.00
25322. Mike (ketakun) 5 95.45 117.40 5 100.00
25323. Martin (manpluskeys) 5 65.36 73.50 1 20.00
25324. zeggsy (zeggsy) 5 54.75 62.68 0 0.00
25325. Joe (funnypear) 5 59.66 74.48 0 0.00
25326. ayoung (theicychickennugget) 5 95.50 109.61 3 60.00
25327. Geri (geri_cs) 5 83.75 88.11 2 40.00
25328. Anton (90mer) 5 51.52 56.10 0 0.00
25329. Akkoza (akkoza) 5 99.69 118.41 2 40.00
25330. Sage (s4je) 5 88.83 92.80 2 40.00
25331. N0PuLS3 (nopulse) 5 64.45 70.28 1 20.00
25332. Andrew (jeffdamoose) 5 87.57 105.39 5 100.00
25333. Edmar (yoedmar) 5 115.03 132.72 5 100.00
25334. kuwl (kuwlman) 5 78.41 90.02 1 20.00
25335. Shantel (typer_racer12345) 5 72.68 80.54 3 60.00
25336. Carol (lo_o_o_ol) 5 50.78 53.31 1 20.00
25337. Trinity (sop0rific) 5 95.65 106.47 4 80.00
25338. JustTimoCraft (justtimocraft) 5 88.96 93.78 2 40.00
25339. F (hfrx) 5 46.69 50.73 1 20.00
25340. Meap (meapme) 5 45.86 48.15 2 40.00
25341. Sri (waaz) 5 83.65 93.13 1 20.00
25342. Angel (angel_v1) 5 31.47 32.80 1 20.00
25343. Maddie (maddiejo37) 5 31.12 35.63 1 20.00
25344. XRed (xred001) 5 43.22 51.18 1 20.00
25345. Othman (nero27) 5 48.32 50.72 1 20.00
25346. Jay (jayryan1823) 5 50.85 54.74 0 0.00
25347. Jerms (jerms575) 5 49.76 56.15 0 0.00
25348. JedOo (jedoo) 5 34.40 38.14 0 0.00
25349. Armagnac (lhason) 5 89.82 98.86 0 0.00
25350. MT (thethai) 5 89.13 93.10 1 20.00
25351. Zain (zainfds) 5 45.76 52.56 0 0.00
25352. Jake (hidragg) 5 90.71 95.21 2 40.00
25353. Foxight (foxight) 5 86.13 91.81 2 40.00
25354. Kobuljon (kobuljon) 5 35.79 40.95 1 20.00
25355. Mohammed (nomaan447) 5 25.11 28.63 0 0.00
25356. Frederick (carolinar7) 5 73.80 78.16 1 20.00
25357. Ejaculator (ibeatandscream) 5 28.25 35.37 1 20.00
25358. Sam (sam5566) 5 50.97 56.54 1 20.00
25359. Jaden (jayby18) 5 90.36 98.52 1 20.00
25360. James (a_watermelown) 5 51.74 53.44 0 0.00
25361. kaptaan (dodger_x) 5 51.34 61.36 0 0.00
25362. Aleyshanime (jocelynwirawan_5) 5 25.00 27.55 2 40.00
25363. jad (jadabbas) 5 57.14 65.89 2 40.00
25364. ever (nothing_here) 5 67.42 81.18 1 20.00
25365. Ghost (internet_ghost) 5 41.68 46.55 2 40.00
25366. thisisname (somenickname) 5 60.89 65.44 0 0.00
25367. Cirmotlan (cirmotlan) 5 80.11 87.76 1 20.00
25368. Nathan (nattys86) 5 77.19 85.81 1 20.00
25369. Reynante (perwisyoboy_0309) 5 51.62 55.97 2 40.00
25370. John (jdaye) 5 84.49 89.27 1 20.00
25371. Wim (circuit_phaser) 5 56.02 62.23 1 20.00
25372. Danny (danielkim762) 5 64.26 74.61 0 0.00
25373. Connor (connor11son) 5 70.76 76.40 2 40.00
25374. Dustin (lonnie_stud) 5 50.52 55.18 0 0.00
25375. rcolinmichael (rcolinmichael) 5 62.16 73.66 2 40.00
25376. Emmet (eedesr) 5 39.46 52.57 0 0.00
25377. Stepan (steppy9) 5 58.33 67.46 2 40.00
25378. Khing (khairo_j1) 5 94.09 99.37 5 100.00
25379. noa (noapejic) 5 48.93 52.46 1 20.00
25380. Ja0-X (ja0_x) 5 71.00 73.37 0 0.00
25381. han (muming) 5 54.59 58.86 0 0.00
25382. Deprest (deprest_jesus) 5 45.44 56.04 0 0.00
25383. pabin (pabin_sh) 5 55.01 63.75 2 40.00
25384. Sami (krimzy) 5 61.63 65.31 4 80.00
25385. Ossian (ossiank) 5 43.19 45.33 2 40.00
25386. lordy123 (lordy123) 5 55.28 63.33 2 40.00
25387. syd (syddakid) 5 59.13 66.42 1 20.00
25388. Cheeseperson (cheeseyman) 5 30.78 36.53 1 20.00
25389. Christian (theonehue) 5 97.03 110.84 4 80.00
25390. swich (swich11) 5 77.30 87.02 1 20.00
25391. Denis (denisbelmondo) 5 104.03 109.38 1 20.00
25392. Jan (jan__) 5 53.67 70.64 2 40.00
25393. arpan (arpan2048) 5 46.95 50.71 2 40.00
25394. Jonathon Lansink (jlansink15) 5 133.45 145.36 5 100.00
25395. chocolate (stratonov16) 5 63.11 64.25 5 100.00
25396. Sam (migrantaxis) 5 53.71 58.78 1 20.00
25397. Vishal (vis_hal) 5 70.45 81.60 0 0.00
25398. grace (_gr4c3g_) 5 64.26 74.39 2 40.00
25399. JONAS (___jonas___) 4 75.68 78.71 0 0.00
25400. Jessy (___jessy___) 4 76.80 79.14 2 50.00
25401. yida (_yoda_) 4 35.16 41.13 1 25.00
25402. Thelegend27 (_thelegend_27_) 4 79.18 87.92 2 50.00
25403. Richard (_spicyramen_) 4 69.63 82.27 1 25.00
25404. MooMoo (_moomoo_) 4 73.29 81.69 1 25.00
25405. _Lxwrxncx_ (_lxwrxncx_) 4 59.64 63.37 2 50.00
25406. Lily (_lily) 4 55.51 66.71 0 0.00
25407. Jansson (_jansson_) 4 68.35 82.09 0 0.00
25408. Damian (_damian_) 4 61.73 67.43 0 0.00
25409. _batonnoir (_batonnoir) 4 121.85 126.06 1 25.00
25410. . (z_edward) 4 114.79 122.05 2 50.00
25411. Alex (zyt3ch) 4 62.42 84.54 1 25.00
25412. S (zotus) 4 86.76 90.36 1 25.00
25413. Eddie (zorrpan) 4 86.25 89.79 3 75.00
25414. Aleks (zooby_san) 4 79.15 84.97 0 0.00
25415. zitsy (zitsy) 4 59.33 66.01 1 25.00
25416. Zion (zionmegalion) 4 98.88 107.14 1 25.00
25417. Zhivko (zikica97) 4 83.64 94.14 2 50.00
25418. Zilong (zhziong) 4 106.73 110.63 2 50.00
25419. zhender (zhender) 4 64.81 88.63 3 75.00
25420. Pengwen (zhaopengwen) 4 76.72 80.56 2 50.00
25421. Zethrian (zethrian) 4 94.92 103.97 3 75.00
25422. zeta (zeta235) 4 43.48 48.74 0 0.00
25423. Diego (zem0nic) 4 110.45 114.89 1 25.00
25424. Zeke (zekedroid) 4 106.07 114.33 1 25.00
25425. Rui (zehs) 4 68.37 72.88 1 25.00
25426. Timothy (zeevox) 4 93.83 100.00 2 50.00
25427. zeek (zeek618) 4 89.07 100.50 0 0.00
25428. Druzie (zectrople) 4 89.35 93.58 2 50.00
25429. Aleksa (zdravce988) 4 80.30 95.78 0 0.00
25430. Serph (zasvern) 4 50.36 55.12 0 0.00
25431. Zarif Rafiul haque (zarifzars) 4 49.17 59.65 4 100.00
25432. Zanzaru (zanzaru) 4 77.10 94.36 0 0.00
25433. Zaniac (zaniac10) 4 135.31 145.45 2 50.00
25434. ............. (zalvary) 4 76.87 84.78 2 50.00
25435. Rarw. (zambodia) 4 131.71 133.63 1 25.00
25436. Zambo (zambo_dev) 4 64.80 66.23 2 50.00
25437. Zaim (zaimanator) 4 102.47 118.33 4 100.00
25438. Damien (zahx666) 4 113.83 120.65 4 100.00
25439. Zahid (zahidconcha) 4 43.95 52.14 1 25.00
25440. Zach (zachyp) 4 61.28 69.52 0 0.00
25441. Zach (zachog) 4 49.00 61.98 0 0.00
25442. zackjh (zacharykjh) 4 100.27 112.56 2 50.00
25443. zach (zacaroniandcheese) 4 105.48 134.06 3 75.00
25444. zaarium (zaarium) 4 55.13 59.25 0 0.00
25445. yath (yyatt) 4 103.32 109.29 0 0.00
25446. Yusuf (yusuft2) 4 69.78 77.53 0 0.00
25447. Vik (yungcoolioth) 4 92.85 111.02 2 50.00
25448. Chan (yunelle) 4 64.14 67.60 0 0.00
25449. Yumin (yumin) 4 68.46 82.16 1 25.00
25450. MDevil - (yt_mdevil) 4 86.02 105.73 3 75.00
25451. Yowmang (yowmang) 4 64.54 72.26 0 0.00
25452. Connor (yowassuphomies) 4 100.04 117.06 1 25.00
25453. Bill (youngbilliam) 4 64.47 68.81 0 0.00
25454. Ampheline (younes_feline) 4 109.98 116.68 3 75.00
25455. You (you3345) 4 65.86 67.56 0 0.00
25456. Adam (yoooooooooooooooooooo... 4 34.47 38.10 3 75.00
25457. YoMoMGae (yomomgae) 4 68.05 77.11 1 25.00
25458. Luan (yoitsluan) 4 101.18 111.77 3 75.00
25459. RaspberryPi1 (yodabyteram) 4 76.58 86.04 0 0.00
25460. RATATA (yiracan2) 4 57.57 66.20 0 0.00
25461. Jugemu (yerden01) 4 62.27 66.69 1 25.00
25462. Jeff (yenemy) 4 130.14 139.38 1 25.00
25463. Randolph (yellowtofu) 4 94.32 107.98 1 25.00
25464. Albert (yellowmoose) 4 59.36 63.24 1 25.00
25465. Lion (yellowlion321) 4 89.14 98.94 2 50.00
25466. Adam (ya_boi27) 4 110.34 120.48 1 25.00
25467. 271 REIS#4706 (yasseir) 4 44.57 45.81 0 0.00
25468. ☺☻☺ (yahyahoo) 4 46.98 50.82 0 0.00
25469. XxKarmaX (xxkarmax) 4 71.24 80.97 0 0.00
25470. youngboy (xthomasedwa) 4 92.52 99.05 2 50.00
25471. heng (xshadowlegendx) 4 121.61 134.69 4 100.00
25472. Skye W. (xpeq7) 4 50.57 51.44 1 25.00
25473. xil (xilvantheous) 4 65.60 67.48 0 0.00
25474. Lunchlady (xg33kx) 4 117.10 132.05 2 50.00
25475. Cameron (xerxes_backwards) 4 82.67 87.05 0 0.00
25476. Xelieu (xelieu) 4 115.16 129.37 4 100.00
25477. Xavonium (xavonium) 4 79.78 87.59 4 100.00
25478. Poyraz (xaryop) 4 65.50 66.77 0 0.00
25479. X0137 (x0137) 4 47.78 53.52 0 0.00
25480. Wyatt (wyattaker) 4 89.69 115.43 3 75.00
25481. Weston (wwalker1) 4 86.38 99.58 1 25.00
25482. Astricd (wunwun2468) 4 63.27 66.69 0 0.00
25483. Wujy (wujy) 4 64.74 76.69 1 25.00
25484. Andrew (wtypo25) 4 63.69 69.10 0 0.00
25485. William (wsz_riptide) 4 72.42 84.34 2 50.00
25486. Wendy (wracicot) 4 63.07 67.86 1 25.00
25487. John (word_weaver) 4 34.44 35.55 0 0.00
25488. Sjors (wordmasterofbooks) 4 76.32 90.58 0 0.00
25489. Akash (wolverine07) 4 37.46 42.80 0 0.00
25490. Wojtek (wojtekwro) 4 51.52 57.45 0 0.00
25491. Derrick (wnorad) 4 87.63 97.49 3 75.00
25492. Thịnh (wizardhire) 4 64.75 79.71 1 25.00
25493. Nathan (wilson_w_wilson) 4 65.24 73.26 2 50.00
25494. Wilson (wilsontanvis) 4 76.32 84.34 1 25.00
25495. Will (will_stz) 4 58.52 63.20 1 25.00
25496. Will Of The Wind (will_of_t... 4 72.75 79.98 3 75.00
25497. Tushar (willingtushar) 4 63.65 72.17 1 25.00
25498. Qi (williamz) 4 79.74 87.24 0 0.00
25499. AsteroGamer (williamvalerian) 4 95.74 109.34 1 25.00
25500. Wilhelm (wilhelm_the_typing... 4 59.89 61.63 0 0.00
25501. Vaibhav (whybhav) 4 61.55 63.95 1 25.00
25502. Weziq (weziq) 4 71.10 77.94 1 25.00
25503. Michael (wevvt) 4 71.48 85.38 2 50.00
25504. Evan (westboys) 4 93.31 97.35 2 50.00
25505. Wengison (wengison) 4 72.08 74.08 0 0.00
25506. nannan (weepee) 4 49.77 56.94 1 25.00
25507. William (wbulovas) 4 76.42 88.47 3 75.00
25508. Waske (waskepro_official) 4 59.56 65.74 1 25.00
25509. Warren (warren98) 4 54.80 67.04 1 25.00
25510. Dimian (want_dimsum) 4 103.08 114.59 2 50.00
25511. Waleed (waleed_sawalhi) 4 84.60 89.59 0 0.00
25512. Vincent (waldoo) 4 88.97 99.62 3 75.00
25513. Big (wakibeast211) 4 39.62 42.93 0 0.00
25514. Dennis (waar_is_de_magnetron) 4 90.35 95.17 0 0.00
25515. vukeli (vukeli) 4 75.30 79.03 1 25.00
25516. Iamsparta (void_snowy) 4 95.73 108.90 2 50.00
25517. Underworld (vnderworld) 4 89.31 102.62 3 75.00
25518. Vncnt (vncntrvldo) 4 30.15 32.78 1 25.00
25519. Vive (vivethemodder) 4 115.02 125.61 4 100.00
25520. lyudmila (vityaz) 4 95.71 110.88 2 50.00
25521. Mimi (virtuamima) 4 82.21 89.30 2 50.00
25522. Virtual (virtualtrash) 4 69.50 75.26 2 50.00
25523. Sacha (viperfang) 4 99.41 104.96 4 100.00
25524. Viktor (viktor3257) 4 57.94 61.92 0 0.00
25525. annop (viiorgmj) 4 94.98 100.62 3 75.00
25526. Viet (vietvhcr) 4 85.04 94.49 1 25.00
25527. Venus (venus_liki) 4 53.06 59.81 1 25.00
25528. Vengence99 (vengence99) 4 105.78 119.00 2 50.00
25529. Veena (venawartmander) 4 75.24 80.21 1 25.00
25530. Mariah (vellichorne) 4 61.09 72.78 0 0.00
25531. vedanttoke20 (vedanttoke20) 4 81.72 89.58 1 25.00
25532. Vaibhav (vaibhav12301) 4 54.99 65.86 0 0.00
25533. Paweł (uuyy) 4 92.03 102.78 2 50.00
25534. Your (urtrashkid906) 4 70.07 79.73 4 100.00
25535. Unsolved (unsolvedcypher) 4 117.73 137.78 3 75.00
25536. Liozyyy (undead_zay) 4 76.14 80.72 2 50.00
25537. Phin (uncleshelby) 4 107.32 118.67 2 50.00
25538. uncal (uncalgg) 4 34.99 37.84 0 0.00
25539. Marcos (ultizin) 4 58.24 65.38 0 0.00
25540. Ultimate (ultimate_pootato) 4 81.27 84.50 1 25.00
25541. Ting (t_mist) 4 77.54 84.15 0 0.00
25542. Yan (tzunyan) 4 48.16 52.51 0 0.00
25543. Katilin (type_casting) 4 97.91 112.48 2 50.00
25544. typeracer2487 (typeracer2487) 4 94.61 97.59 1 25.00
25545. Tynai (tynka) 4 26.38 28.53 1 25.00
25546. (tyleryoung210) 4 112.72 121.70 3 75.00
25547. DownOnMe (twindracula) 4 119.18 125.46 3 75.00
25548. :/ (tweezers) 4 94.28 104.42 1 25.00
25549. Teun (tve9) 4 74.67 77.76 2 50.00
25550. Tuguldur (tuug_16) 4 43.53 47.57 4 100.00
25551. Tushar (tushar_3) 4 69.76 72.81 0 0.00
25552. Smyan (tunafish5555) 4 84.73 96.42 1 25.00
25553. Abby (tuffbluff) 4 63.75 74.07 2 50.00
25554. Zhapyr (tuchka) 4 43.92 49.98 0 0.00
25555. D (tsaf_epyt) 4 52.17 64.97 1 25.00
25556. Flavio Dai (tryonetry) 4 55.02 61.72 1 25.00
25557. Trxnia (trxnia) 4 68.31 71.97 3 75.00
25558. Taylor (trob388) 4 97.46 103.11 3 75.00
25559. Tristan (tris_tan) 4 76.59 81.35 0 0.00
25560. Tristan (trigg770) 4 66.06 74.14 1 25.00
25561. Trigabyte (trigabyte) 4 121.40 132.86 4 100.00
25562. Gowtham (triforceofpi) 4 75.85 83.06 2 50.00
25563. Anton (tricksterequiem) 4 75.46 91.43 2 50.00
25564. Tricia (tricia20) 4 41.34 42.93 1 25.00
25565. Tristan (tribby) 4 38.48 40.79 2 50.00
25566. Trevor (trevorstamour) 4 113.03 155.87 3 75.00
25567. Trevor (trevman) 4 75.88 83.88 0 0.00
25568. trepan (trepan) 4 107.42 121.69 2 50.00
25569. Trap (trapv) 4 84.58 91.72 1 25.00
25570. Daniel (trader29) 4 39.11 44.00 1 25.00
25571. Tom (tomwoolf) 4 39.34 42.49 0 0.00
25572. Thomas (tommy_wang) 4 93.56 99.74 1 25.00
25573. Thomas (tommyspo) 4 82.12 89.23 1 25.00
25574. Tom (tommydws) 4 70.25 72.43 0 0.00
25575. Starfox (tommyhlu) 4 75.37 94.09 1 25.00
25576. cod3hulk (tomave) 4 80.11 85.32 1 25.00
25577. Thomas (tomathon) 4 92.01 97.29 1 25.00
25578. Todd (toddism1) 4 57.44 61.74 2 50.00
25579. Toni (toek) 4 64.22 68.51 0 0.00
25580. Nathan (tna_typing) 4 35.83 40.28 1 25.00
25581. Joseph (tn6mrawesome) 4 60.13 64.29 2 50.00
25582. Takiur (tm0n3y) 4 43.71 47.89 0 0.00
25583. Greg (titogreg) 4 90.19 102.80 0 0.00
25584. tim (timu) 4 110.65 126.32 3 75.00
25585. 0 (timswin) 4 61.51 77.62 1 25.00
25586. Timothy (timataio) 4 100.66 109.77 2 50.00
25587. Michael (tichaelman) 4 90.87 99.72 1 25.00
25588. Othmane (tibicha) 4 52.25 59.56 0 0.00
25589. Tibbitin (tibbitin) 4 83.71 104.47 1 25.00
25590. Chris (thrash3r) 4 112.98 117.66 2 50.00
25591. Thomas (thomas_t) 4 83.41 91.12 2 50.00
25592. Thnift (thnift) 4 89.15 97.70 1 25.00
25593. Drug (thisisscandalous) 4 112.47 120.56 3 75.00
25594. Thirdy (thirdsus) 4 62.75 67.59 0 0.00
25595. Om (thiscuriousbeing) 4 46.23 49.85 1 25.00
25596. WabberDabber (thingexplainer) 4 90.32 94.22 0 0.00
25597. Gooper (thijswillemsen) 4 102.59 110.63 3 75.00
25598. Cris (the_thesaurusrex) 4 59.88 66.02 1 25.00
25599. John (the_miserable_omega) 4 80.92 85.22 1 25.00
25600. the_faceless (the_faceless) 4 70.97 82.89 1 25.00
25601. TheVan (thevan) 4 64.06 67.29 1 25.00
25602. Josh (theunknownhero) 4 127.33 135.33 4 100.00
25603. Subid (theslowtyper8) 4 66.95 74.49 1 25.00
25604. Amogh (therealmog) 4 62.05 74.36 0 0.00
25605. Milan (themilan) 4 47.70 50.31 0 0.00
25606. The Marvello (themarvello) 4 50.98 57.25 0 0.00
25607. Andrew (thelittleninja7) 4 93.14 106.17 2 50.00
25608. Kyle (thekyle0) 4 71.42 75.12 0 0.00
25609. K (thekman) 4 90.82 104.20 0 0.00
25610. Thege (thegenericbanana) 4 132.76 139.31 3 75.00
25611. theFurlong (thefurlong) 4 56.67 61.31 0 0.00
25612. Blake (theengi321) 4 107.15 123.43 2 50.00
25613. MrConvoluted (theduckman) 4 63.13 67.11 1 25.00
25614. Adesh (thechosenadesh) 4 52.03 59.11 1 25.00
25615. Me (thecanuck) 4 65.11 72.30 2 50.00
25616. Ish (theblessedgalaxy) 4 83.87 90.14 3 75.00
25617. Matt (the25thbam) 4 52.29 57.28 0 0.00
25618. SkyleNexo (thaonenub) 4 95.11 102.71 1 25.00
25619. funny (tesseractbeyond) 4 99.16 113.62 1 25.00
25620. Terminal (terminall_07) 4 38.97 42.25 0 0.00
25621. Tenshi (tenshi3_a) 4 69.80 77.98 1 25.00
25622. Cactus (tehcrazycactus) 4 106.88 132.05 1 25.00
25623. Tedward (tedward765) 4 104.58 108.01 2 50.00
25624. William (tea_chan) 4 69.95 77.70 0 0.00
25625. Teal (teal5) 4 49.81 60.03 0 0.00
25626. Diego (tapetepato) 4 95.13 99.65 2 50.00
25627. RC (tandiaman) 4 114.99 125.51 4 100.00
25628. Tams (tamstams16) 4 62.93 70.54 2 50.00
25629. taya (tamey0urimpala) 4 59.37 62.62 2 50.00
25630. Joseph (tamejtm) 4 74.33 79.33 0 0.00
25631. Taka (takatyper) 4 85.35 91.14 0 0.00
25632. Tahsin (tahsin82) 4 65.93 74.28 2 50.00
25633. Dominic (t4dominic) 4 87.64 92.45 2 50.00
25634. Sara (s_sh) 4 58.46 65.81 2 50.00
25635. Islam (s_l_m) 4 41.85 46.52 0 0.00
25636. syuuu (syuuu) 4 120.06 123.38 1 25.00
25637. Sydney (sydmarie) 4 120.91 136.72 3 75.00
25638. swetha (swethaesp) 4 61.28 70.38 2 50.00
25639. Sam (sweatycactus) 4 73.37 82.34 0 0.00
25640. Evan (swang88) 4 101.05 108.63 1 25.00
25641. Arvin Jay (sushisancat) 4 86.59 96.94 1 25.00
25642. sushiwasabi (sushiwasabi) 4 96.79 104.57 3 75.00
25643. Surya (suryapun) 4 67.27 72.03 0 0.00
25644. Suraj03 (suraj03) 4 63.29 69.41 0 0.00
25645. Marvin (super_nam) 4 63.33 69.22 1 25.00
25646. sunny (sunnykr17) 4 37.65 43.43 0 0.00
25647. Sunil (sunilbv) 4 76.69 92.33 2 50.00
25648. Sunho (sunhokwon) 4 106.34 107.90 3 75.00
25649. han (sunhelo1) 4 69.63 73.11 0 0.00
25650. Andre (sundown765) 4 67.14 74.65 0 0.00
25651. Sukritha (sukritha) 4 69.26 72.30 0 0.00
25652. David (subpar_typing) 4 65.70 70.84 2 50.00
25653. John (subarutato) 4 64.55 67.51 1 25.00
25654. Suraj (suarj) 4 51.44 54.75 1 25.00
25655. Ralph (stunnar) 4 75.83 81.23 0 0.00
25656. Luke (stuartlittle6) 4 65.36 71.70 1 25.00
25657. Erik (strezz) 4 107.92 118.48 2 50.00
25658. asdas (strexle) 4 74.95 78.63 3 75.00
25659. Ruben (streakwind) 4 109.78 122.60 4 100.00
25660. Alex (stradivarius64) 4 80.12 102.97 1 25.00
25661. Owen (stoveovenowen) 4 85.91 94.41 2 50.00
25662. Tim (stormblock) 4 99.74 122.69 2 50.00
25663. Zay (stiki_boi) 4 54.92 59.06 1 25.00
25664. Shubham (stickyfingas) 4 50.67 58.32 0 0.00
25665. John (stevie123) 4 82.33 91.39 1 25.00
25666. Vít (stepky) 4 48.30 49.95 0 0.00
25667. Marwan (steelman) 4 83.66 90.98 1 25.00
25668. SServe (sserve) 4 82.99 88.19 2 50.00
25669. Sra1 (sra1) 4 47.77 55.40 0 0.00
25670. Spr_ingg (spr_ingg) 4 76.97 80.93 1 25.00
25671. Enzo (springgs) 4 64.28 66.67 2 50.00
25672. Devin (spratty) 4 105.87 121.80 1 25.00
25673. B (sploops) 4 47.88 58.74 0 0.00
25674. Autism (autismorigins) 4 83.77 105.05 1 25.00
25675. ben (spirxt223) 4 100.27 105.73 3 75.00
25676. aleksi (speedysmurffi) 4 92.92 102.67 0 0.00
25677. SpeedySloth (speedyslothmeh) 4 65.50 74.05 2 50.00
25678. Mohammad (speedyboi108) 4 93.28 105.62 1 25.00
25679. . (speed1x) 4 81.40 91.76 1 25.00
25680. CM (specialize) 4 81.76 89.59 3 75.00
25681. SparkleFace (sparkle_face) 4 64.75 68.03 0 0.00
25682. kosmonautas (spacepeasant) 4 45.57 51.25 0 0.00
25683. viridiAn (spacedooky) 4 94.38 98.16 2 50.00
25684. Mike (so_cool31220) 4 71.53 83.81 1 25.00
25685. Souther (souther1) 4 68.83 71.52 3 75.00
25686. Dan (sonixspeedster) 4 37.88 40.85 0 0.00
25687. Lo (sonia0852) 4 57.02 65.10 2 50.00
25688. Sondi (sondi2234) 4 67.90 77.52 0 0.00
25689. Ethroc (someweirdcuck) 4 73.09 79.44 0 0.00
25690. Lizard (somber_lizard76) 4 107.14 120.07 3 75.00
25691. Phillip (solonjhee) 4 81.40 90.79 1 25.00
25692. Spencer (soliloquial) 4 105.75 113.36 1 25.00
25693. Brad (soldtheworld) 4 36.14 41.77 0 0.00
25694. A (soh_cah_toa) 4 113.53 129.73 1 25.00
25695. Soggy (soggyspartan) 4 53.85 60.18 0 0.00
25696. SOGGY (soggybigbooty) 4 121.52 142.13 1 25.00
25697. Lawn (sofusboisen) 4 76.42 79.76 2 50.00
25698. Isaac (softwilly) 4 50.49 56.65 0 0.00
25699. Sameer (socoolsameer) 4 81.69 98.86 1 25.00
25700. Phoebe (snicklepickles) 4 99.53 101.50 2 50.00
25701. Sm (sm12333) 4 77.39 79.94 0 0.00
25702. SlyBlue (slyblue) 4 45.09 48.42 0 0.00
25703. Ya (slow_typist123) 4 82.02 85.95 0 0.00
25704. varkiziotis (slow_like_ribas) 4 96.03 102.03 2 50.00
25705. Nom (slower_than_shrimp) 4 83.21 88.69 0 0.00
25706. Nathan (slowbo12) 4 102.08 115.86 1 25.00
25707. training hard (slj111) 4 103.80 113.55 3 75.00
25708. slip (sliiiip) 4 114.42 127.65 1 25.00
25709. Slickster (slickster_) 4 40.09 46.92 0 0.00
25710. NAILs (sleepyt0wne) 4 56.09 64.66 0 0.00
25711. Edward (slappyedward) 4 102.42 112.12 1 25.00
25712. Noah (slankynoah) 4 101.25 107.88 4 100.00
25713. GS PVH (skyvn97) 4 74.87 90.95 4 100.00
25714. Skyer (skypeasant) 4 66.35 79.14 4 100.00
25715. Skyler (skylrrr) 4 92.41 95.52 2 50.00
25716. sam (skhavari) 4 78.75 88.61 1 25.00
25717. Nikos (skatzos) 4 52.98 61.65 0 0.00
25718. keith (skagod02) 4 83.47 89.94 0 0.00
25719. Sithindu (sithsiri) 4 79.24 81.93 1 25.00
25720. Lebron (sirsneakycheeks) 4 54.40 62.01 0 0.00
25721. C (sirbop) 4 109.31 116.89 3 75.00
25722. Simon (simco) 4 30.96 34.58 0 0.00
25723. Fabulous (sim5501) 4 79.23 83.54 3 75.00
25724. sillysyl (sillysyl) 4 53.82 59.00 0 0.00
25725. Silen (silentyper) 4 94.32 109.86 3 75.00
25726. Nick (sidj0n) 4 83.13 90.30 0 0.00
25727. ༄༊࿆Lazy (siddharthmmore) 4 74.05 77.58 2 50.00
25728. Siavash (siavash3) 4 87.85 97.29 1 25.00
25729. Shreyas (shrysptl22) 4 67.93 73.07 1 25.00
25730. Alessandro (shrykull_scars) 4 68.31 77.22 0 0.00
25731. Shrav (shravstars15) 4 63.32 70.37 0 0.00
25732. Shiyyo (shiyyo) 4 115.17 126.75 2 50.00
25733. Shiva (shivabalutia) 4 39.60 42.82 0 0.00
25734. ShinyPants (shinypants7112) 4 79.93 85.50 4 100.00
25735. gaf (shinryu1324) 4 109.25 113.80 1 25.00
25736. shine (shine_3) 4 30.95 32.77 0 0.00
25737. Elliott (shim3107) 4 110.81 123.68 1 25.00
25738. Olav (shikkou) 4 90.68 115.64 3 75.00
25739. ceejay (shijei) 4 102.26 113.87 0 0.00
25740. Alec (shifty_py) 4 68.32 76.19 1 25.00
25741. Stanley (shidanley) 4 85.15 91.18 1 25.00
25742. (sherixn) 4 62.82 71.34 0 0.00
25743. sheng (shenglol) 4 64.35 65.50 1 25.00
25744. my coal (sheevpalpatine66) 4 101.81 123.75 2 50.00
25745. Shea (shea378) 4 75.65 89.61 0 0.00
25746. Shayaan (shaynedoan) 4 77.94 90.87 2 50.00
25747. shaun (shaunrtyu) 4 54.69 58.01 0 0.00
25748. Jonathan (sharkeyyy) 4 84.88 93.62 0 0.00
25749. shafay (shafay) 4 54.94 61.37 1 25.00
25750. Shady (shadyhippo) 4 108.25 111.93 2 50.00
25751. Edgar (sgtplasma) 4 74.92 91.80 1 25.00
25752. SGpro (sgpro) 4 78.87 88.37 1 25.00
25753. sean (sgdth) 4 101.84 118.43 1 25.00
25754. Sezim (sezim20_12) 4 22.22 23.47 2 50.00
25755. Diwangkoro (serperone) 4 108.94 115.33 2 50.00
25756. hola (sensei_1st) 4 55.13 60.65 0 0.00
25757. Sloth (senseisloth) 4 91.29 114.00 1 25.00
25758. sensei455 (sensei455) 4 97.88 107.37 2 50.00
25759. Senn (sennvacan) 4 34.17 36.04 0 0.00
25760. Melody (selkie) 4 72.81 77.15 1 25.00
25761. Adam (seleulu) 4 66.69 76.55 1 25.00
25762. Ivan (seivo) 4 77.67 94.36 1 25.00
25763. Seeking (seekingtotype) 4 55.45 63.50 0 0.00
25764. Cedric (sedorikku) 4 98.57 102.52 0 0.00
25765. Ani (secretary_ani) 4 119.12 124.09 3 75.00
25766. Haerin buff (searsokvarkhim) 4 44.93 49.47 1 25.00
25767. Krzysztof (scythonsoul) 4 84.64 93.90 1 25.00
25768. Jinny (sctfgreentae) 4 47.20 50.99 0 0.00
25769. scoopy (scoopyjohnson) 4 93.50 97.62 1 25.00
25770. Noah (scone) 4 83.86 90.00 2 50.00
25771. Scold (scold_) 4 71.88 83.71 1 25.00
25772. Regan (schwett) 4 66.04 69.18 1 25.00
25773. Schlomo (schlomon) 4 67.66 78.27 2 50.00
25774. hassanal (scarymonstrs) 4 62.18 69.24 2 50.00
25775. Jakub (sayunoka) 4 66.07 72.25 1 25.00
25776. SaucySeas (saucy_seas) 4 106.91 116.94 2 50.00
25777. Justin (saucypenguinwee) 4 99.16 105.16 3 75.00
25778. Satvik (satvikbansal) 4 75.25 81.22 0 0.00
25779. Sara (saramarie722) 4 90.37 99.10 2 50.00
25780. sanvi (sanvi_exe) 4 50.94 54.76 0 0.00
25781. Sean (sangpm) 4 72.63 82.14 3 75.00
25782. Sanger (sanger) 4 98.27 112.75 2 50.00
25783. sam (samxkl) 4 85.06 91.30 1 25.00
25784. Samo (samothepro) 4 63.38 70.42 4 100.00
25785. samore (samore) 4 118.36 137.95 4 100.00
25786. Sam (samjm) 4 82.48 88.52 4 100.00
25787. Sam (samdagoat32) 4 92.77 100.98 2 50.00
25788. Sam (samag) 4 32.00 34.40 0 0.00
25789. Sander (salamanderboi) 4 60.20 71.25 0 0.00
25790. Elgeo (saladin_pulverz) 4 102.78 117.28 1 25.00
25791. sakthi2021 (sakthi2021) 4 57.24 65.83 1 25.00
25792. Saitama (saitama001) 4 43.70 46.36 0 0.00
25793. Sai (sait3ja) 4 74.11 78.31 2 50.00
25794. Saidul (saidul_islam) 4 56.74 64.20 1 25.00
25795. Sageofidiocy (sageofidiocy) 4 74.94 80.57 0 0.00
25796. sael (saeleths) 4 100.60 105.08 1 25.00
25797. rararara (sadsatan) 4 41.57 46.98 0 0.00
25798. Sadhav (sadhavsingh) 4 40.02 48.75 1 25.00
25799. nya (saber_ye) 4 161.48 172.15 1 25.00
25800. sanjul (s4njul) 4 88.48 93.76 1 25.00
25801. Lorenzo (rynzen) 4 54.33 60.60 2 50.00
25802. romeo (rxmeo) 4 91.30 104.43 1 25.00
25803. Rupok (rupok_kuet) 4 36.13 44.37 1 25.00
25804. RUPESH (rupeshdodiya123) 4 74.29 85.82 1 25.00
25805. Rupert (rupert_6969) 4 58.16 61.51 0 0.00
25806. Mac (rubixgeek101) 4 82.95 99.47 2 50.00
25807. Ethan (rubiks3) 4 99.87 105.33 2 50.00
25808. Renee (rtvhyde) 4 71.07 78.43 0 0.00
25809. rosa (rtrindade) 4 41.67 44.30 0 0.00
25810. rrrena (rrrena) 4 69.58 76.40 1 25.00
25811. tstats[rrooyy] (rrooyy) 4 79.83 87.76 0 0.00
25812. Alessio (rqidz) 4 66.17 77.84 4 100.00
25813. Machoko (rpbeatizula18) 4 80.60 97.69 2 50.00
25814. Matthew (rookie_avali) 4 63.29 81.50 0 0.00
25815. Ronzingz (ronzingz) 4 98.19 111.31 3 75.00
25816. Rodrigo (romendoin) 4 44.04 53.17 1 25.00
25817. rope (rolnd) 4 88.40 97.90 1 25.00
25818. poopoo (rogue_pp) 4 90.30 105.81 2 50.00
25819. rodrigo (rodrigo_rocha) 4 29.25 31.69 0 0.00
25820. Rod (rod22) 4 58.20 70.56 1 25.00
25821. Rochak (rochak27) 4 39.42 44.79 0 0.00
25822. Robby (robstersgaming) 4 105.45 112.50 3 75.00
25823. robert1003 (robert1003) 4 86.07 89.40 1 25.00
25824. Robby (robdog1) 4 71.01 83.04 1 25.00
25825. Robert (rnschmidt) 4 96.64 104.75 1 25.00
25826. rmanz (rmanz) 4 101.78 116.11 2 50.00
25827. Rtyp (rktypes) 4 95.43 104.80 0 0.00
25828. Fajar (rizqy96) 4 80.62 94.37 2 50.00
25829. Rise (rise_again) 4 67.94 70.73 4 100.00
25830. Алексей (risengod23) 4 39.03 42.29 2 50.00
25831. RingereQQ (ringereqq) 4 60.55 66.79 4 100.00
25832. Raul (rincindishes) 4 95.66 109.30 2 50.00
25833. Cheesy (rikk_merp) 4 90.10 90.95 2 50.00
25834. Rye (riett) 4 140.65 161.70 2 50.00
25835. The One (ridick_the_one) 4 100.48 110.42 2 50.00
25836. Rides (rides1283man) 4 105.04 136.43 4 100.00
25837. Rider (rider2) 4 49.55 54.21 0 0.00
25838. Ricky (rickyr) 4 100.83 113.97 1 25.00
25839. Rick (rickdicker) 4 75.35 87.16 4 100.00
25840. Brantley (rezxbl) 4 82.83 90.21 1 25.00
25841. Gholamreza (rezadar) 4 45.40 51.81 0 0.00
25842. Adrian (revertion) 4 57.13 70.09 2 50.00
25843. Reuben (reureu) 4 105.22 121.43 1 25.00
25844. ret (retiarius) 4 102.22 111.52 4 100.00
25845. Requiem (requiemsolution) 4 87.40 93.25 1 25.00
25846. Renkon (renkon) 4 124.97 138.90 4 100.00
25847. Rad (renaissance_g) 4 54.35 58.60 0 0.00
25848. Daniel (rektrobot) 4 66.81 73.58 0 0.00
25849. Rejinten (rejinten) 4 43.58 47.86 1 25.00
25850. Reggie (reggiedada) 4 72.63 79.97 2 50.00
25851. reena (reenasmart21) 4 48.92 54.55 0 0.00
25852. Brendan (reeeaver) 4 71.29 78.70 1 25.00
25853. pP poopoo (red_five) 4 82.90 92.92 0 0.00
25854. Ethan (redmac135) 4 106.18 112.63 2 50.00
25855. Redheesh (redheeshrj) 4 45.27 49.33 0 0.00
25856. Red (reddened) 4 160.54 170.77 4 100.00
25857. Khang (rebels1) 4 58.59 65.30 0 0.00
25858. reasonable (reasonablegoat) 4 63.31 67.19 0 0.00
25859. Landon (realpizza) 4 68.10 72.69 2 50.00
25860. (reallyam) 4 119.82 134.84 3 75.00
25861. Sarah (realgirlgoodhands) 4 86.69 92.81 4 100.00
25862. Pope (rcpope) 4 73.84 89.38 0 0.00
25863. Archie (rchieallen) 4 84.44 102.10 0 0.00
25864. Tamas (razor15) 4 49.53 52.76 0 0.00
25865. Ravon (ravonhenson) 4 97.65 105.72 3 75.00
25866. Ravi (ravi10000) 4 50.12 63.84 0 0.00
25867. Rasea (rasea) 4 117.00 118.60 3 75.00
25868. David (random_lee) 4 117.69 133.45 2 50.00
25869. Random Guy (randompersonjci) 4 95.51 101.30 3 75.00
25870. Random (randomhumanlmao) 4 94.84 106.02 1 25.00
25871. ramoraros (ramoraros) 4 96.72 108.47 2 50.00
25872. Ramon (rambo_290703) 4 43.77 46.55 0 0.00
25873. Rakuuen (rakuuen) 4 59.75 65.45 1 25.00
25874. rakibul hasan (rakibulhasan... 4 50.07 54.38 1 25.00
25875. Rajashekar (rajashekar0203) 4 46.95 50.89 0 0.00
25876. rainblizz (rainblizz) 4 73.07 75.65 1 25.00
25877. vazhin (rahaaaa) 4 39.26 44.46 2 50.00
25878. Rafsun (rafsunit) 4 94.09 99.98 2 50.00
25879. Radoslav (radosaurus) 4 57.28 64.55 3 75.00
25880. Bumbur (radekzadek) 4 55.57 66.57 1 25.00
25881. Joshua (racingjsj) 4 59.05 65.40 0 0.00
25882. Rachel (rachel_chu) 4 45.66 48.45 1 25.00
25883. Mat (rabbitkiller38) 4 67.60 71.39 1 25.00
25884. Clairvoyant (r2zenith) 4 61.07 68.33 0 0.00
25885. quoc (quoclahn) 4 114.97 129.37 2 50.00
25886. quiskit (quiskit) 4 55.04 60.00 1 25.00
25887. Tom (quickfingerz) 4 85.82 99.86 2 50.00
25888. cosette (queen_weeb) 4 32.63 34.88 0 0.00
25889. Quintin (qt_parzival) 4 36.91 39.06 0 0.00
25890. Qrip (qrip) 4 99.82 129.06 3 75.00
25891. qrill (qrill) 4 68.08 74.42 1 25.00
25892. pyotr (pyotrb) 4 73.43 77.52 3 75.00
25893. Incinous (pxlla) 4 80.04 87.52 1 25.00
25894. Chris (pwncyber) 4 91.51 102.21 3 75.00
25895. putt12343 (putt12343) 4 79.43 86.87 1 25.00
25896. px ツ (purplexion) 4 79.31 87.05 1 25.00
25897. Hank (purplehank7) 4 75.74 78.17 0 0.00
25898. Egor (psinka) 4 49.54 54.30 0 0.00
25899. PseudoNoise (pseudonoise) 4 95.36 101.31 3 75.00
25900. PruXy. (pruxy) 4 92.83 103.15 4 100.00
25901. Andreas (prosurvival_321) 4 93.93 124.27 3 75.00
25902. Prosper (prosperous) 4 81.10 89.12 1 25.00
25903. proovend (proovend) 4 75.47 77.23 1 25.00
25904. Maik (pronikolaidis) 4 80.61 83.55 3 75.00
25905. Etan (probablylagging) 4 91.82 103.93 4 100.00
25906. Anne (princess_lichen) 4 68.14 74.62 1 25.00
25907. hello (prateekskl99) 4 63.81 70.79 1 25.00
25908. Putu (pratamamp) 4 74.11 82.22 2 50.00
25909. pc (prankster5546) 4 118.67 121.39 2 50.00
25910. Pranav (pranavmurray) 4 50.91 53.79 0 0.00
25911. Pranav (pranav0307) 4 66.31 68.26 0 0.00
25912. Pragan (pragan) 4 57.28 63.78 0 0.00
25913. Rafey (practicerace) 4 99.59 114.90 3 75.00
25914. Joe (pp11thebest) 4 37.27 40.55 1 25.00
25915. William (poutine08) 4 114.74 134.65 3 75.00
25916. Poultry (poultryman) 4 86.73 90.65 4 100.00
25917. Ro (posterd) 4 78.34 82.91 0 0.00
25918. Lukas (poseidoncoder) 4 74.48 83.44 2 50.00
25919. ponkl (ponkl) 4 108.26 114.90 4 100.00
25920. Polom (polomfileni) 4 70.40 72.10 2 50.00
25921. Online (polar_beans) 4 70.42 77.89 0 0.00
25922. Plunker (plunker) 4 67.97 82.83 3 75.00
25923. piimpj (pjcrowley) 4 108.23 120.86 0 0.00
25924. ^_^ (pippens_) 4 99.41 119.71 2 50.00
25925. Piotrek (piotrek97) 4 52.48 57.81 1 25.00
25926. Pintu (pintusingh26) 4 42.08 44.79 0 0.00
25927. VJ (pinexpp1edeath) 4 65.69 73.12 0 0.00
25928. Radeyz (pineapples2925) 4 100.70 113.53 0 0.00
25929. ♠Homer (pimpelkram) 4 69.77 79.79 1 25.00
25930. Andy (pilotplater) 4 82.02 88.23 1 25.00
25931. Cody (pikachuisyellow) 4 104.64 114.93 2 50.00
25932. Andres (pickandres) 4 82.81 86.42 0 0.00
25933. Pias (piasroy) 4 70.98 72.36 0 0.00
25934. Bryan (pianudolores) 4 67.08 70.92 1 25.00
25935. Tim (phrozact) 4 66.52 70.23 1 25.00
25936. johan (pho777) 4 91.43 100.42 1 25.00
25937. Alex (philister) 4 78.93 80.12 2 50.00
25938. philip (philiptokareff) 4 113.81 119.96 4 100.00
25939. Patrick (pheonix74) 4 80.51 84.39 2 50.00
25940. PhazedAU (phazedau) 4 90.16 91.44 3 75.00
25941. Tom (phantom74) 4 102.89 110.51 0 0.00
25942. Elias (pgo_13) 4 47.29 61.83 1 25.00
25943. Peter (peterhawthorne) 4 64.40 74.83 1 25.00
25944. Nolan (pestanon23) 4 100.50 119.78 4 100.00
25945. None of (perpetuity_0) 4 66.04 73.19 1 25.00
25946. Alex (pentalex) 4 137.96 152.98 4 100.00
25947. pen (penlume) 4 128.70 134.06 1 25.00
25948. bjonk biggest fan (pengeuin) 4 84.71 93.17 1 25.00
25949. Pegtor (pegtor) 4 88.78 109.93 1 25.00
25950. Peter (peasqueak) 4 89.27 99.26 1 25.00
25951. Pearson (pearsonsm) 4 76.48 93.66 2 50.00
25952. Pingbang (pbb_want_to_sleep) 4 95.28 104.11 0 0.00
25953. Abhi Baby (payalc) 4 50.20 58.06 0 0.00
25954. Paw (pawan42) 4 88.60 94.61 2 50.00
25955. PK (pavanuppari) 4 58.38 65.69 1 25.00
25956. Patrick (patwang123) 4 120.82 124.80 3 75.00
25957. aviad (patish) 4 68.56 70.04 2 50.00
25958. G (pastachilli) 4 80.67 91.97 0 0.00
25959. sid (parallelogrammed) 4 92.31 101.21 0 0.00
25960. parag (paragparag) 4 70.20 78.70 1 25.00
25961. Papa (papaosmurf) 4 85.43 93.77 0 0.00
25962. Mr.Chow (panza_sancho) 4 68.95 77.99 0 0.00
25963. Danica (pandanica) 4 71.15 77.39 1 25.00
25964. Pana (pana1312) 4 71.02 72.17 1 25.00
25965. Palaladin (palaladin) 4 90.70 102.44 3 75.00
25966. Willie (paiswillie) 4 103.27 111.08 1 25.00
25967. Pai Sho (paisho) 4 108.37 125.39 4 100.00
25968. Paint (paintmeblue62) 4 90.52 96.94 1 25.00
25969. James (paintballonu) 4 84.72 93.23 1 25.00
25970. MIMSY (paddydingus) 4 85.92 99.26 2 50.00
25971. Pacman (paco1978) 4 28.41 39.35 2 50.00
25972. ozaninator (ozaninator) 4 84.16 93.22 2 50.00
25973. Pavel (oxxxyd) 4 58.46 62.88 0 0.00
25974. Neckkoooooo (otakgirl_) 4 50.16 50.97 0 0.00
25975. Oussama (osmaxwell) 4 66.36 78.34 1 25.00
25976. Prince Amir (orionic_arkhalis) 4 63.19 69.14 1 25.00
25977. Reyes (oriim) 4 76.77 90.02 2 50.00
25978. origix (origix) 4 67.11 71.02 3 75.00
25979. ore (orezee) 4 82.65 87.40 1 25.00
25980. harry (orekkles) 4 114.45 118.63 2 50.00
25981. da imash ili da budesh (ord... 4 105.74 114.34 2 50.00
25982. Aryan (ordinarytranquil) 4 54.00 62.76 1 25.00
25983. matty (orange_hexagon) 4 31.89 33.78 0 0.00
25984. Orange (orange29) 4 69.63 81.10 1 25.00
25985. OperationType (operationbeg... 4 61.03 67.61 0 0.00
25986. onlycleansnipes (onlycleans... 4 90.49 106.88 3 75.00
25987. Arinjay Salgia (onehandchamp) 4 41.12 44.66 0 0.00
25988. omigumo (omigumo) 4 95.91 121.87 1 25.00
25989. Omar (omareffat) 4 87.82 100.21 1 25.00
25990. Omar Ahmed (omar947203) 4 31.29 33.00 2 50.00
25991. Ollt (ollt) 4 59.57 68.29 0 0.00
25992. Oliver (olliewests) 4 79.60 83.58 2 50.00
25993. Olives (olives123) 4 68.83 80.75 0 0.00
25994. Oldrock (oldrock) 4 38.92 44.63 0 0.00
25995. Josh (okey101) 4 50.44 51.40 0 0.00
25996. Lev (okaymoonstorm) 4 63.96 84.72 3 75.00
25997. Oily (oilyoogway) 4 66.16 68.99 0 0.00
25998. Oscar (oheim) 4 66.32 71.26 1 25.00
25999. ogcoolpepper (ogcoolpepper) 4 78.93 82.04 0 0.00
26000. VSwede (officialvswede) 4 67.13 76.22 0 0.00
26001. Oehan (oehan) 4 76.18 83.83 0 0.00
26002. Obstfliege (obstfliege) 4 67.02 70.53 0 0.00
26003. ObsessiveDuck09 (obsessive_... 4 45.74 48.59 0 0.00
26004. Alden (obeezy) 4 88.07 93.90 3 75.00
26005. Nuttanun (nut_tun) 4 36.10 39.23 1 25.00
26006. Nurti (nurti07) 4 35.89 42.01 0 0.00
26007. Niccolo (nthperez) 4 106.38 112.78 2 50.00
26008. Noz (nozrael) 4 52.60 59.22 1 25.00
26009. Noximini (noximini) 4 99.14 103.49 2 50.00
26010. Noel (nowellrl) 4 75.50 85.22 0 0.00
26011. Viking (not_xp3og) 4 63.64 75.12 1 25.00
26012. Hunter (nottitan) 4 68.87 73.25 2 50.00
26013. Lynxi (notmystik_) 4 85.26 89.92 1 25.00
26014. Minhquan (notminhquan) 4 72.84 79.34 0 0.00
26015. John (notjohn5) 4 103.52 110.57 4 100.00
26016. Emmett (notfunnyorange) 4 85.76 92.16 2 50.00
26017. JOJ (not2gud) 4 85.06 90.56 2 50.00
26018. Adler (nosynevada) 4 40.21 45.56 0 0.00
26019. noonar (noonar) 4 91.52 97.97 3 75.00
26020. Balraj (noob_racer_96) 4 87.41 93.79 0 0.00
26021. Тагир (nonxfx) 4 44.40 49.84 1 25.00
26022. Timothy (noma624) 4 81.40 86.48 2 50.00
26023. Nolan (nolangreub) 4 88.78 101.80 3 75.00
26024. Nolan (nolanelwood) 4 102.73 115.51 2 50.00
26025. Noel (noel_svartsjo) 4 55.51 62.69 1 25.00
26026. Noatak (noatak_) 4 115.23 144.34 2 50.00
26027. Nathan (njd913) 4 72.84 82.31 1 25.00
26028. Ruben (nitrosabre) 4 101.52 112.44 2 50.00
26029. Rens (nismo_gtr) 4 90.77 94.40 0 0.00
26030. Nishanth (nishanthswaminathan) 4 86.91 90.96 3 75.00
26031. Niraj (nirajr4) 4 55.71 57.78 0 0.00
26032. Scott (nikolasvallesteros) 4 84.40 90.61 3 75.00
26033. niecia (nieecia) 4 56.35 63.93 1 25.00
26034. Nicolai (nicolaimanev) 4 84.17 92.22 2 50.00
26035. Nick (nicknyaumwe) 4 58.86 64.98 1 25.00
26036. Nicelec (nicelec_1st) 4 48.04 60.59 0 0.00
26037. NiarbOn (niarbon) 4 84.47 89.80 2 50.00
26038. nh (nhvk) 4 57.03 62.06 0 0.00
26039. LY (ngly) 4 137.46 150.08 4 100.00
26040. alvin (nganinator) 4 76.99 88.33 1 25.00
26041. Denis (netsa) 4 99.22 107.08 4 100.00
26042. Carl (nerarith) 4 78.71 80.26 2 50.00
26043. neotoky0 (neotoky0) 4 124.87 139.48 1 25.00
26044. Daniel (neon95) 4 80.88 86.85 0 0.00
26045. Slow (neolemon) 4 107.24 122.13 2 50.00
26046. Glenn (nemenis) 4 63.72 73.62 0 0.00
26047. Nemanja (nemanja6) 4 74.00 79.23 1 25.00
26048. Nela (nelaach) 4 89.99 95.72 3 75.00
26049. Jacob (necromuncher) 4 100.35 107.27 0 0.00
26050. Nico (ncc5) 4 57.83 62.75 0 0.00
26051. Navid (navid_rahman) 4 55.22 57.29 1 25.00
26052. ╰(▔∀▔)╯ (naufalm02) 4 82.58 91.86 3 75.00
26053. Naol (naolchala) 4 47.61 58.71 1 25.00
26054. Nae (naeakuma) 4 56.33 67.11 0 0.00
26055. Justin (my_friend_justin) 4 82.56 84.59 1 25.00
26056. Mytho (mythoskar) 4 89.97 94.58 3 75.00
26057. Mythic (mythicsane) 4 88.27 90.97 0 0.00
26058. Mysterious (mysteriousacadia) 4 65.11 75.33 0 0.00
26059. mmlt (mvejlund) 4 76.56 80.48 0 0.00
26060. mustang (mustang51) 4 92.17 103.24 2 50.00
26061. Murali Prasanth (muralipras... 4 63.11 70.36 1 25.00
26062. Mukklan (mukklan) 4 46.34 55.93 1 25.00
26063. Mug (mugisabug) 4 68.92 74.90 1 25.00
26064. Muffyn (muffyngg) 4 66.67 69.46 1 25.00
26065. carline (muffintart) 4 107.72 111.69 1 25.00
26066. 희성 (mttprk) 4 94.58 104.40 2 50.00
26067. AhmedSalem (mrtempo) 4 100.82 104.00 2 50.00
26068. Nathan (mrsodacan) 4 104.94 113.01 4 100.00
26069. dean (mrselndyfox) 4 54.31 57.44 1 25.00
26070. Adarsh (mrr0b0t797) 4 72.00 73.78 1 25.00
26071. Dat (mrpiggy123) 4 105.94 114.77 3 75.00
26072. Simon (mrperson_) 4 81.67 91.86 1 25.00
26073. Mrotaku (mrotaku) 4 140.09 156.19 3 75.00
26074. Meerkat (mrmeerkat) 4 84.41 98.89 2 50.00
26075. Mario (mrio) 4 62.26 71.85 1 25.00
26076. Mrinmoy (mrinmoyss) 4 58.90 63.78 0 0.00
26077. Adam (mrgrydzan) 4 102.46 120.92 1 25.00
26078. Mr Grate (mrgrate) 4 80.96 93.69 2 50.00
26079. Cizzo (mrcizzo) 4 108.37 133.39 2 50.00
26080. Andy (mouldy_peanut) 4 114.56 118.91 1 25.00
26081. Mouad (mouadmzn) 4 72.45 79.42 0 0.00
26082. Moshmello (moshmello) 4 104.08 111.39 3 75.00
26083. Moritz Klositz (moritz_klos... 4 69.78 72.46 1 25.00
26084. Josué (morfeu_123) 4 61.03 65.09 2 50.00
26085. Morgan (morche202) 4 88.15 97.50 1 25.00
26086. Morty (moothemighty) 4 62.46 66.79 3 75.00
26087. Ilhan (monzf) 4 67.64 101.23 4 100.00
26088. Krisztian (monsteq) 4 99.73 105.63 1 25.00
26089. Monish (monish2c) 4 65.14 69.19 1 25.00
26090. Mihail (mondic) 4 60.69 63.07 0 0.00
26091. molly (mollidae) 4 90.22 101.17 0 0.00
26092. mohsencs (mohsencs) 4 43.71 50.94 2 50.00
26093. Mohammad (mohammadrokib) 4 46.95 50.68 0 0.00
26094. Mohamed (mohamednabil090) 4 23.24 25.57 2 50.00
26095. allen (modeski) 4 72.08 86.83 2 50.00
26096. Mnohem (mnohem) 4 63.59 72.37 2 50.00
26097. M (mmanhar) 4 81.83 94.58 2 50.00
26098. M (mjrzasa) 4 62.31 76.71 1 25.00
26099. koren (mits321) 4 60.78 64.48 1 25.00
26100. Ben (mister_ghillie) 4 104.30 115.74 1 25.00
26101. Mykhailo (mishok) 4 83.51 87.99 0 0.00
26102. mirnyz (mirnyz) 4 48.85 55.63 4 100.00
26103. Park (miriampark7) 4 80.75 85.63 1 25.00
26104. Guest (minusawpm) 4 106.68 113.66 2 50.00
26105. deez (mintpurple) 4 56.66 60.67 0 0.00
26106. Minerstove (minerstove) 4 87.79 106.44 2 50.00
26107. Andrew (mikzzu) 4 121.54 127.34 3 75.00
26108. michael (mikeyjohn) 4 91.13 103.25 1 25.00
26109. Mike (mikedoel85) 4 94.45 101.20 0 0.00
26110. Miguel (migsarm16) 4 77.31 88.04 3 75.00
26111. Daniel (mickeyyaya) 4 68.35 81.68 0 0.00
26112. Mike (michaelomh) 4 102.53 110.13 2 50.00
26113. Wen-Yuan (michael1017) 4 52.91 58.27 0 0.00
26114. Micah (micahlandry) 4 77.52 100.57 3 75.00
26115. mgupta (mgupta1410) 4 66.90 69.12 1 25.00
26116. Doc G (Bay Area) (mgavino) 4 101.66 106.66 1 25.00
26117. Mohammad (mewsamurai) 4 77.98 83.70 2 50.00
26118. Meet (mete2119) 4 54.28 59.96 0 0.00
26119. Mimi (merrymolly23) 4 82.82 88.75 2 50.00
26120. Meow (meowchamp) 4 69.54 73.07 1 25.00
26121. melanie (mellaniee) 4 63.34 69.39 0 0.00
26122. melinder (melindayao21) 4 70.62 73.83 3 75.00
26123. Michael (mekel_elden) 4 95.40 99.59 3 75.00
26124. Mehrab (mehrab23) 4 46.75 58.65 0 0.00
26125. mitchelle (megets) 4 32.51 45.11 0 0.00
26126. Meet (meet_singh88) 4 37.82 40.11 0 0.00
26127. megan (meaogan) 4 124.02 138.11 3 75.00
26128. Michael (mdz64) 4 71.69 78.65 1 25.00
26129. Mathew (mdwelborn) 4 72.69 79.98 2 50.00
26130. doshishowspeed (mcqueen_v2) 4 67.84 77.34 1 25.00
26131. Matt (mchoe2000) 4 60.49 66.46 2 50.00
26132. Josef (mcblyat) 4 87.60 95.10 1 25.00
26133. Marcus (mb_2001) 4 85.92 89.33 1 25.00
26134. Matias (mazubazu) 4 62.18 71.72 1 25.00
26135. Mazen (mazenayman) 4 90.02 94.51 2 50.00
26136. 22ru (mayushy) 4 122.83 132.75 4 100.00
26137. Beeymax (mayumii) 4 63.00 71.38 1 25.00
26138. Max (maxpoppe) 4 62.18 64.70 0 0.00
26139. Andrea (maxistarling) 4 52.49 55.65 0 0.00
26140. m (mawcks) 4 53.90 70.77 0 0.00
26141. Matthew (matty_g) 4 92.99 99.52 3 75.00
26142. Matt (mattyrice) 4 62.32 74.38 0 0.00
26143. Matthew (matty21988) 4 78.71 83.01 0 0.00
26144. Matthew (mattify) 4 64.68 76.81 0 0.00
26145. Matt (matfia22) 4 62.55 68.61 0 0.00
26146. mathisvan (mashipeas123) 4 83.64 87.32 2 50.00
26147. Marz (marzcovers) 4 94.83 105.63 1 25.00
26148. Marvin (marxman16) 4 64.40 70.28 3 75.00
26149. Martin (martin_lol) 4 58.28 63.22 0 0.00
26150. Martin (martindungeon) 4 97.52 103.75 0 0.00
26151. Mars (marsattacks97) 4 72.73 77.39 0 0.00
26152. Markos (marky35707) 4 79.51 90.41 1 25.00
26153. Mark (mark2912) 4 83.29 95.66 0 0.00
26154. mar (marhaage) 4 56.16 69.37 0 0.00
26155. Marcus (marcusvang1234) 4 83.38 93.74 1 25.00
26156. Mana (mannaa) 4 85.30 92.15 0 0.00
26157. Khang (manhkhangvn) 4 70.76 78.79 0 0.00
26158. Paweł (malzeer) 4 103.45 124.24 4 100.00
26159. Malik (maliksami) 4 60.36 67.73 1 25.00
26160. Maria Julia (maju_matricardi) 4 66.39 77.51 0 0.00
26161. Will (majorchaos) 4 90.94 101.40 1 25.00
26162. majesticjojo (majesticjojo) 4 97.24 109.26 0 0.00
26163. Mainey dawg (mainey) 4 90.64 102.98 1 25.00
26164. maickel (maickelkuhhh) 4 46.07 50.19 0 0.00
26165. Grag (mahavir) 4 95.53 110.38 2 50.00
26166. Alex (magictrick) 4 105.31 106.96 1 25.00
26167. Connor (magicsniper7) 4 60.94 64.71 1 25.00
26168. magicsail (magicsail) 4 51.61 55.86 0 0.00
26169. Magical (magical_yt) 4 89.69 96.84 4 100.00
26170. Joseph (magical_gibus) 4 74.21 89.85 2 50.00
26171. Mafuso (mafuso) 4 102.70 115.17 0 0.00
26172. Moo (mafaraxas) 4 108.28 116.73 3 75.00
26173. Madiyar (madi_k) 4 61.75 66.75 1 25.00
26174. Marcus (mackan096) 4 91.36 105.61 3 75.00
26175. Mahmoud (ma7moud7amdy) 4 35.74 42.15 4 100.00
26176. Maciej (m4v3r) 4 85.50 90.87 3 75.00
26177. M4K3 (m4k3801) 4 42.92 45.73 0 0.00
26178. aaron (m0nk3man) 4 61.55 74.03 1 25.00
26179. pyc (lznuscrfb) 4 41.28 43.90 0 0.00
26180. Aris (lysaris) 4 48.22 49.93 0 0.00
26181. Lynn (lynnkaek) 4 106.53 111.58 1 25.00
26182. Luka (luxx_15) 4 74.03 79.63 2 50.00
26183. Luukster (luukster) 4 56.90 62.33 0 0.00
26184. Lukas (luqq) 4 61.22 65.03 3 75.00
26185. Ele (luminelexx) 4 98.56 104.82 4 100.00
26186. Luka (lukisav) 4 89.15 92.30 4 100.00
26187. Abay (lukcy) 4 100.30 123.06 4 100.00
26188. lufi (lufi148) 4 32.69 35.03 2 50.00
26189. Lucia (luciloo) 4 54.30 58.61 1 25.00
26190. Luca Plat (lucaplat) 4 59.13 66.04 1 25.00
26191. Lucan (lucan616) 4 55.76 60.05 1 25.00
26192. SAM (lsh66191239) 4 57.55 64.79 0 0.00
26193. Thomas (lqserbeans) 4 107.33 121.90 2 50.00
26194. Liz (lovelyliz) 4 48.74 53.78 0 0.00
26195. lorenzo (lorenzo2131) 4 122.72 133.45 3 75.00
26196. Dipendra (lord_jarvis) 4 55.90 67.63 1 25.00
26197. Cheng Loke (lordwiz) 4 96.03 105.42 1 25.00
26198. Lord (lordaizen707) 4 89.04 94.29 1 25.00
26199. Loopy (loopyz) 4 72.66 85.71 2 50.00
26200. Gus (lookitup) 4 109.18 127.71 1 25.00
26201. Lowell (lolwel21) 4 63.17 67.07 2 50.00
26202. lolswag420 (lolswag420) 4 59.08 61.87 2 50.00
26203. Lokki (lokkicubes) 4 119.45 127.24 0 0.00
26204. Aljaž (lojzetka) 4 76.35 84.65 1 25.00
26205. Rafael (locher) 4 107.67 110.59 4 100.00
26206. JL8 (liux888) 4 94.41 98.66 4 100.00
26207. madelief (little_huchu) 4 74.68 83.03 2 50.00
26208. Stephen (litedrizzle) 4 96.29 113.68 3 75.00
26209. Sean (lirrnaiad) 4 94.47 104.18 3 75.00
26210. Liquid (liquidlemon) 4 90.32 98.00 1 25.00
26211. Linus (linusq) 4 95.70 107.50 1 25.00
26212. Linkso (linkso) 4 45.99 48.80 0 0.00
26213. lindsey (lindsey94) 4 75.44 79.66 0 0.00
26214. Linda (lindanguyen_) 4 63.08 72.32 1 25.00
26215. Sunpeng (limsunpeng07) 4 50.89 54.61 3 75.00
26216. Leah (lilybethlily) 4 71.16 81.28 0 0.00
26217. Abdo (lilpunishow) 4 76.50 83.81 4 100.00
26218. Angus (lilchenchen) 4 41.44 45.52 0 0.00
26219. Noah (lightsaber71) 4 48.25 64.48 1 25.00
26220. Lightning (lightning486) 4 103.44 111.69 1 25.00
26221. Light (lightneesan) 4 97.61 108.77 1 25.00
26222. liam (liamtangg) 4 70.79 80.75 2 50.00
26223. Logan (lgan) 4 74.33 92.95 4 100.00
26224. Laura (lgmorse) 4 116.43 126.03 4 100.00
26225. Leyton (leytons) 4 75.38 92.01 2 50.00
26226. Luna (lewisw60) 4 120.55 132.21 2 50.00
26227. leonissenbaum (leonissenbaum) 4 111.07 126.08 0 0.00
26228. Lena (lena_lapa) 4 55.76 59.09 1 25.00
26229. Mathieu (leginacl) 4 84.80 91.57 0 0.00
26230. Lorenzo (leftovers1) 4 89.38 93.65 2 50.00
26231. James (leeroy909) 4 73.43 83.91 0 0.00
26232. Leeisateam (leeisateam) 4 90.07 100.68 1 25.00
26233. Ledion (ledisad) 4 56.53 60.13 1 25.00
26234. Lebaidin (lebaidin) 4 117.89 128.22 3 75.00
26235. okyescool (lc0291) 4 104.45 120.81 3 75.00
26236. Hasnat (lazy_zeus) 4 69.17 79.97 4 100.00
26237. shaolin_scrub (laydbak) 4 89.76 95.02 3 75.00
26238. Erick (laudato) 4 48.48 56.80 2 50.00
26239. Douglas (lasdoug) 4 97.68 111.64 2 50.00
26240. Vincent Jeremy (larcener) 4 52.39 58.81 3 75.00
26241. Benedek (k_dot_b) 4 61.05 63.60 1 25.00
26242. Kyle (kylegt) 4 64.98 70.56 1 25.00
26243. Kushal (kushal_) 4 51.45 58.93 1 25.00
26244. Peter (kushlord) 4 56.18 63.97 0 0.00
26245. Nelson (kuribohno) 4 49.35 53.29 1 25.00
26246. Aiden (kula_) 4 156.63 172.20 4 100.00
26247. ken (kuanying) 4 70.78 76.60 0 0.00
26248. Krisztian (ktypist_) 4 75.15 76.73 1 25.00
26249. Kristian Emil (kruller) 4 78.29 83.51 2 50.00
26250. Jared (krispyyrice) 4 66.40 70.72 0 0.00
26251. Krish (krish987) 4 92.68 112.14 3 75.00
26252. Kris (krilleliten) 4 62.19 69.79 0 0.00
26253. kp (kp_7890) 4 54.22 66.98 1 25.00
26254. Kenneth (kpphamdao) 4 85.09 97.34 3 75.00
26255. KPeep (kpeep) 4 90.64 105.78 1 25.00
26256. Yokubo (kontentlust) 4 62.55 64.72 1 25.00
26257. kon (konkretzz) 4 78.23 90.03 1 25.00
26258. rebecca (kona_coffee) 4 57.49 61.42 0 0.00
26259. komkanit (komcal) 4 50.59 57.12 1 25.00
26260. Loukas (koloz123) 4 81.08 86.83 2 50.00
26261. Ned (kokainegun) 4 119.12 126.21 3 75.00
26262. Koh (kohsuzu) 4 65.48 69.96 2 50.00
26263. Armtz (knotavink) 4 87.69 93.90 2 50.00
26264. VR-un (knight343) 4 48.32 52.44 2 50.00
26265. Keno (kmoreland1) 4 87.68 101.19 1 25.00
26266. Adam (kmine) 4 111.64 120.01 0 0.00
26267. gavinc (klontz) 4 128.01 142.19 3 75.00
26268. Klebb (klebbinet) 4 93.92 97.98 1 25.00
26269. KJ (kjlaw) 4 61.24 64.36 1 25.00
26270. Kirin (kirinichibannn) 4 90.32 91.56 3 75.00
26271. kir (kiranv1584) 4 97.35 101.52 2 50.00
26272. Kiran (kiran11621) 4 58.91 64.09 1 25.00
26273. KiraThePerplexed (kiradonut) 4 55.56 60.44 1 25.00
26274. roshan (kipislekker1) 4 67.08 68.56 3 75.00
26275. weeb (king_of_rice) 4 68.03 74.49 2 50.00
26276. Tristin (kingtdiggitty) 4 51.23 56.02 0 0.00
26277. Kin (kinandra) 4 61.25 66.94 0 0.00
26278. Arjun (killerps) 4 93.87 101.30 2 50.00
26279. Alex (kietdjae) 4 55.93 56.99 1 25.00
26280. Mohamed (kidjunky) 4 94.67 104.92 3 75.00
26281. KW (kiawa88) 4 89.36 95.41 1 25.00
26282. Kevin (khuang891) 4 94.96 110.57 2 50.00
26283. Khoi (khoile9) 4 82.55 91.29 4 100.00
26284. Khertz (khertz) 4 80.38 96.71 0 0.00
26285. Khannen (khannen) 4 61.74 72.73 1 25.00
26286. Kevslinger (kevslinger) 4 104.32 109.90 2 50.00
26287. Kevin (kevinkim) 4 94.27 108.74 2 50.00
26288. Kerubi (kerubii) 4 52.85 55.85 0 0.00
26289. Joshua (kerpoof) 4 88.61 91.30 2 50.00
26290. Kera (kera77) 4 93.50 108.30 2 50.00
26291. Kenzie (kenziesupertoad) 4 77.90 85.39 3 75.00
26292. ZMod (kenortinez) 4 85.86 101.75 2 50.00
26293. Matthew (kelsier) 4 79.56 87.36 1 25.00
26294. Kellan (kellan_) 4 53.21 58.29 1 25.00
26295. Ayden (keetchi3) 4 132.65 145.32 3 75.00
26296. Adam (kedgehog) 4 55.82 61.96 0 0.00
26297. Kyle (kcoppola19) 4 131.25 135.96 3 75.00
26298. kaytec (kaytec) 4 111.91 121.09 1 25.00
26299. Kay (kaypinky) 4 71.71 89.24 2 50.00
26300. 7kay3lee7 (kayleelynette) 4 65.41 68.69 1 25.00
26301. Kawisara (kawi_sk) 4 55.06 67.54 1 25.00
26302. ron peasley (kat_dj) 4 77.16 86.88 3 75.00
26303. Kathryn (katiehughesspaz) 4 116.52 153.22 3 75.00
26304. kassionitro (kassionitro) 4 62.29 70.14 1 25.00
26305. Karsmatic (karsmatic) 4 65.37 73.15 2 50.00
26306. Kareem (kareemserry) 4 90.61 100.80 2 50.00
26307. Kevin (kapoofin) 4 106.77 124.30 3 75.00
26308. Georgi (kapi12666) 4 46.14 51.45 0 0.00
26309. Daan (kantelaardaan) 4 81.57 92.05 3 75.00
26310. Abdelrahman (kandiler) 4 61.44 64.81 1 25.00
26311. David (kandar4) 4 97.84 111.59 1 25.00
26312. Kaliarti (kaliarti) 4 76.18 86.41 1 25.00
26313. uTo (kalabam) 4 30.39 34.14 2 50.00
26314. Kaifishi (kaifishi) 4 37.72 54.27 1 25.00
26315. Johnny (kadkalakooki) 4 65.00 74.30 0 0.00
26316. Emily (kaasmier) 4 67.09 71.64 2 50.00
26317. Haakon (kaarekul) 4 72.55 82.61 2 50.00
26318. Tsurugi (k6kyoin) 4 73.89 90.57 2 50.00
26319. Jay (jvmatt) 4 57.30 68.47 1 25.00
26320. cmp (justinpark3046) 4 65.23 82.99 0 0.00
26321. justin (justinjose2007007) 4 54.98 62.65 1 25.00
26322. Yuriy (jurijo) 4 35.60 39.23 0 0.00
26323. Jun (junisfast) 4 67.82 72.42 1 25.00
26324. Hyunjun (junct127) 4 88.35 100.54 2 50.00
26325. Jiahui (jumban) 4 136.69 146.33 3 75.00
26326. JumbaHumba (jumbahumba) 4 98.92 101.86 2 50.00
26327. Julia (julsaguaro) 4 86.55 94.08 2 50.00
26328. Otroti (julianblow) 4 32.99 38.71 0 0.00
26329. that guy (judewastaken) 4 100.16 105.49 1 25.00
26330. Judar (judar) 4 77.50 81.21 4 100.00
26331. Andrew (jucidy) 4 60.56 81.58 1 25.00
26332. Zach (jubjub_lol) 4 51.39 54.29 0 0.00
26333. Jack (jthomas720) 4 54.72 62.18 1 25.00
26334. Jason (jthayer09) 4 122.66 128.46 4 100.00
26335. Agent (jterzian2) 4 62.73 67.74 0 0.00
26336. J (jsroo3) 4 78.30 79.75 1 25.00
26337. Pablo (jsanc016) 4 89.14 92.17 1 25.00
26338. Jeremy (jrmyh) 4 79.55 100.50 0 0.00
26339. Josie (josuealfredo) 4 40.71 48.77 1 25.00
26340. Jorgimtg (jorgimtheguy) 4 70.45 73.78 1 25.00
26341. Joseph (jolow) 4 108.07 120.26 4 100.00
26342. 100 WPM Dream (jokubas1224) 4 59.54 70.72 0 0.00
26343. MONKE (joker9336) 4 21.19 22.92 0 0.00
26344. Josh (jojothewarrior) 4 111.46 140.70 4 100.00
26345. Cole (jojjj5) 4 113.35 121.59 2 50.00
26346. Jojj (jojjj) 4 51.32 54.98 1 25.00
26347. Jon (jojinismafia) 4 55.41 64.45 0 0.00
26348. john (john_end) 4 78.76 82.93 1 25.00
26349. JAWN (johnsusername) 4 105.13 110.92 2 50.00
26350. Rajiv (johnnymaboi) 4 109.87 120.88 3 75.00
26351. Joe (joemama8144) 4 55.12 60.74 2 50.00
26352. Jan (jmarrin) 4 66.50 76.78 0 0.00
26353. Jayden (jmanspider09) 4 79.04 86.57 0 0.00
26354.   (jlpt) 4 123.50 134.12 2 50.00
26355. Juan (jlah) 4 64.22 71.23 1 25.00
26356. Kristian (jivkovk) 4 72.69 82.68 1 25.00
26357. Michael (jimmychim) 4 111.27 123.08 4 100.00
26358. Jimmy (jimjimr) 4 82.56 98.98 2 50.00
26359. Jimmy (jimbozeubuen) 4 110.53 117.70 1 25.00
26360. Terry (jiatinglu99) 4 71.08 73.18 0 0.00
26361. Jesse (jholwell) 4 81.86 88.70 4 100.00
26362. Jordan (jfilip56) 4 71.25 78.06 2 50.00
26363. Jet (jetchung) 4 90.33 112.66 2 50.00
26364. Jesse (jessechu) 4 84.95 94.20 1 25.00
26365. Jesse (jesse1998114) 4 77.26 81.60 0 0.00
26366. Jesper (jespersch) 4 83.01 89.32 1 25.00
26367. jerry (jerrydang1) 4 74.08 84.85 2 50.00
26368. Jay (jerdman) 4 53.44 60.68 1 25.00
26369. J (jepster007) 4 96.64 106.33 3 75.00
26370. :) (jeof05) 4 80.80 87.12 0 0.00
26371. Jc (jcjcjc_1) 4 87.12 96.73 1 25.00
26372. Camot (jcamot) 4 53.52 68.13 1 25.00
26373. Delphi/Z (jbroman) 4 114.86 123.77 4 100.00
26374. Jonathan (jbrich) 4 96.38 110.29 2 50.00
26375. BE4ST (jb2k1) 4 103.35 107.73 2 50.00
26376. Jayus (jayusi) 4 49.19 56.26 0 0.00
26377. Jassy (jassy69) 4 73.48 79.58 1 25.00
26378. Jacob (jasdfnam) 4 109.65 120.54 2 50.00
26379. Jarvi (jarvireneil) 4 119.24 128.28 1 25.00
26380. Jaron (jaronli) 4 84.18 103.24 0 0.00
26381. janzen (janzenc) 4 96.04 102.62 2 50.00
26382. Jan (janwalther) 4 52.54 54.73 1 25.00
26383. jami (jamson) 4 61.39 67.12 1 25.00
26384. James (jamesnar) 4 94.34 99.21 2 50.00
26385. James (jamesarino) 4 95.16 103.28 2 50.00
26386. James (james7739) 4 57.35 59.57 0 0.00
26387. Jak (jak_man) 4 67.96 72.85 0 0.00
26388. Chureerat (jaja_cw) 4 38.77 41.64 0 0.00
26389. jacob (jacobn279) 4 56.36 69.99 2 50.00
26390. jackens (jackens) 4 60.80 70.15 1 25.00
26391. Jace (jaceypoop) 4 75.63 78.98 0 0.00
26392. Jekamiah (j4k3y_yall) 4 70.73 78.02 0 0.00
26393. J (j206) 4 80.86 102.48 2 50.00
26394. Tess (i_miss_club_penguin) 4 87.02 111.96 3 75.00
26395. JC (i_cannotbewon) 4 68.54 90.31 1 25.00
26396. Tio (izero200) 4 78.13 88.05 0 0.00
26397. Iverson (iverson28) 4 62.83 64.93 1 25.00
26398. Patrik (itsuberrr) 4 114.58 118.14 1 25.00
26399. omar (itsramo) 4 68.51 76.29 1 25.00
26400. Itzopik :D (itsopik_trok) 4 30.17 37.69 0 0.00
26401. Thịnh (itsmedio2110) 4 68.84 78.86 0 0.00
26402. Andrew (itsmebrush) 4 68.62 81.09 1 25.00
26403. Imaad (iszaffar) 4 71.49 80.01 4 100.00
26404. Marissa (issa96) 4 58.68 65.16 0 0.00
26405. workman (isoon_workman) 4 88.65 102.41 4 100.00
26406. Ismail (isma3il) 4 68.45 77.90 2 50.00
26407. IRUSN4F (irusnaf) 4 60.57 62.43 2 50.00
26408. arman (invoker870) 4 81.42 95.66 4 100.00
26409. Sazzad Hossain (invisible_r... 4 55.56 61.67 2 50.00
26410. honey (intheswampwithshrek) 4 96.92 107.53 1 25.00
26411. Nigel (intrexion) 4 118.61 131.91 4 100.00
26412. asdf (intheoryno) 4 116.80 129.24 1 25.00
26413. Ingo (ingo1337) 4 50.56 57.42 0 0.00
26414. Dante (infern03) 4 107.39 120.73 2 50.00
26415. indianpanda (indianpanda250) 4 91.14 94.55 1 25.00
26416. Improwise (improwise) 4 46.81 57.01 2 50.00
26417. Matthew (imhaisee) 4 58.24 62.05 3 75.00
26418. sloth (illeatyou) 4 85.23 88.89 1 25.00
26419. Ilham (ilhamahmad) 4 59.97 65.33 0 0.00
26420. Kolya (iktm) 4 95.50 98.33 4 100.00
26421. STÖCKHÖLM (ikea) 4 73.63 76.38 0 0.00
26422. Kay Eugenia (ikay19) 4 97.66 100.10 2 50.00
26423. The Wok(+1000 social credit... 4 98.94 106.07 1 25.00
26424. IFTClerk (iftclerk) 4 90.96 102.46 1 25.00
26425. Justin (idkman_69) 4 55.76 60.13 1 25.00
26426. Tim (idiotaaa) 4 119.48 122.40 4 100.00
26427. Aimcist (iconic03) 4 92.61 101.43 3 75.00
26428. Olexsandr (icefih) 4 40.52 43.67 1 25.00
26429. Ivan (ibanisanog) 4 83.56 102.75 2 50.00
26430. Avijeet (iavijeet) 4 43.74 45.70 2 50.00
26431. Samin Yasir Sahil (iamyrmthr6) 4 73.69 78.73 1 25.00
26432. Vittal (iamvittaln) 4 61.73 67.43 0 0.00
26433. iAmMichael (iammichael) 4 106.26 121.56 1 25.00
26434. Kriss (iamkriss) 4 44.89 47.96 0 0.00
26435. Astral (iamkoromon) 4 92.48 107.83 2 50.00
26436. Andi (iacidna) 4 93.67 98.51 1 25.00
26437. Hyenitye (hyenite) 4 89.66 108.32 1 25.00
26438. peace (hydrorynex) 4 93.38 102.03 2 50.00
26439. ODVB (hyclonic) 4 111.10 119.62 2 50.00
26440. Half Blood (hwm007) 4 38.87 45.26 0 0.00
26441. hwi (hwi_two) 4 97.01 104.00 2 50.00
26442. Ali (huuu957) 4 67.35 72.06 1 25.00
26443. Hữu Tiến (huutienbk) 4 62.88 68.24 0 0.00
26444. Darko (huskycrafter) 4 103.15 109.33 3 75.00
26445. Haley (hurley328) 4 54.45 59.14 1 25.00
26446. HuntedSlayer (huntedslayer) 4 90.96 97.99 2 50.00
26447. Cassie (humanalien) 4 54.42 60.31 1 25.00
26448. Ben (hulkunleashed) 4 89.74 101.43 2 50.00
26449. ht (htbs) 4 57.52 62.95 1 25.00
26450. Chris (hotdogdaniel) 4 74.93 79.39 1 25.00
26451. Horique (horique) 4 81.60 86.39 4 100.00
26452. Khang (hophopkangaroo) 4 85.90 92.21 0 0.00
26453. Sam (honeyteacakes) 4 123.75 140.42 4 100.00
26454. Marco (holystorm) 4 103.66 110.40 1 25.00
26455. Hockeypaul (hockeypaul) 4 69.73 76.52 0 0.00
26456. Clifford (hlclifford) 4 76.16 85.93 2 50.00
26457. Hjalmar (hjalmardur) 4 68.42 72.48 0 0.00
26458. Pouyan (hitic) 4 99.08 111.01 2 50.00
26459. HiScore (hiscore) 4 67.07 84.04 0 0.00
26460. Billy (hines5791) 4 65.78 73.65 2 50.00
26461. Hai (hiitshai) 4 63.57 74.06 1 25.00
26462. WATB (hermandolezal) 4 51.49 53.91 0 0.00
26463. Henxo (henzomaso) 4 67.48 86.33 1 25.00
26464. R (hellothere1233) 4 71.73 77.93 1 25.00
26465. peepee (hehehe_yup) 4 85.21 88.45 0 0.00
26466. Josh (healingjoe) 4 101.73 106.13 3 75.00
26467. Alex (headadmiral) 4 105.64 110.87 3 75.00
26468. Hashem (hashem__) 4 62.71 64.88 0 0.00
26469. harsh wardhan (harshsingh1703) 4 55.31 58.53 1 25.00
26470. Love♥ (harshs99) 4 92.05 104.36 2 50.00
26471. Harsh (harshretro) 4 48.35 50.70 0 0.00
26472. Hardik (hardfight777) 4 32.24 33.65 1 25.00
26473. Harashta (harashtaw) 4 83.56 92.94 2 50.00
26474. Harrison (har150n) 4 99.84 119.19 0 0.00
26475. Hamza (hamza8864) 4 93.47 102.02 3 75.00
26476. Julie (hamcheese) 4 106.84 119.05 4 100.00
26477. HalfaPencil (halfapencil) 4 92.39 95.52 2 50.00
26478. Hai (haiphan) 4 43.62 53.39 0 0.00
26479. Hai (haiender288) 4 82.11 88.99 2 50.00
26480. Tài (haharious) 4 61.53 63.80 0 0.00
26481. typo_racer (haffe) 4 72.18 84.52 0 0.00
26482. Sully (habs_sully1) 4 67.53 72.99 1 25.00
26483. HoangH7 (h7starlight) 4 66.97 74.54 0 0.00
26484. Bryan (h0tl1nebl1ng) 4 97.27 105.70 2 50.00
26485. Gustav (gurra73333) 4 73.55 86.20 0 0.00
26486. Kristian (guraf) 4 81.01 86.52 1 25.00
26487. Kanti (gunjique) 4 84.96 93.05 2 50.00
26488. Evan (guin366) 4 109.73 114.34 0 0.00
26489. Sean (guac_schmac) 4 67.09 79.07 2 50.00
26490. Garry (gt_meister) 4 95.62 104.33 2 50.00
26491. Micheal (gtukario) 4 65.33 72.63 0 0.00
26492. gsus152 (gsus152) 4 122.42 143.36 3 75.00
26493. Growtopia (growtopiagt) 4 62.82 72.68 2 50.00
26494. groundbeaf (groundbeaf) 4 136.88 157.41 3 75.00
26495. grotesque (grotesque986) 4 33.62 41.84 1 25.00
26496. Fast (greytwa) 4 97.55 103.62 0 0.00
26497. Brus (greksmek) 4 61.25 71.19 0 0.00
26498. mat (greenode) 4 119.94 135.01 4 100.00
26499. greefy (greefy) 4 106.53 117.62 1 25.00
26500. Marko (greasy_feta_cheese) 4 75.39 81.54 1 25.00
26501. Quan (graycard) 4 54.69 57.29 0 0.00
26502. Granted (granted8) 4 104.00 112.96 1 25.00
26503. greg (grant24) 4 81.33 96.94 0 0.00
26504. Ryan (grampsu) 4 72.60 81.10 2 50.00
26505. Gram (gramj_fw) 4 92.15 104.38 0 0.00
26506. Mauricio (gotsicile) 4 88.62 93.06 2 50.00
26507. Gordon (gorlee2013) 4 83.69 90.03 0 0.00
26508. Googolplex (googolplex05) 4 81.63 89.11 4 100.00
26509. Tan (goodrace4u) 4 30.81 36.10 0 0.00
26510. Gonta (gonta_gokuhara) 4 47.51 51.93 0 0.00
26511. gondaloz (gondaloz) 4 42.13 44.35 0 0.00
26512. vincent (godofbokchoy) 4 70.27 75.48 2 50.00
26513. T•rt•ise (gocool21) 4 77.77 87.09 0 0.00
26514. GLX (glxep) 4 102.24 109.34 1 25.00
26515. oswin (glitterji) 4 103.79 117.38 3 75.00
26516. Glenn (glennthemaster) 4 85.43 93.59 0 0.00
26517. Glass (glassda) 4 92.21 108.91 2 50.00
26518. ✨( ͡° ͜ʖ ͡°) (giuse... 4 112.58 123.61 3 75.00
26519. Beanz (gilz242) 4 117.65 132.44 3 75.00
26520. Gilbie (gilbie) 4 89.65 93.29 2 50.00
26521. GIBBBBBBY (gibbous) 4 76.26 81.63 1 25.00
26522. Retro (ghostggum) 4 85.35 92.93 3 75.00
26523. Gahnou (ghanou09) 4 64.65 68.21 0 0.00
26524. ggzor (ggzor) 4 85.61 87.94 0 0.00
26525. Plosing13591 (ge_ge) 4 57.06 67.27 1 25.00
26526. yun (genuak) 4 53.46 55.53 0 0.00
26527. DESCONHECIDO EXTREMAMENTE S... 4 93.96 108.13 3 75.00
26528. Gasp (gasps) 4 85.83 94.50 0 0.00
26529. Garrett (garrettkc) 4 42.77 53.06 0 0.00
26530. Jeremy (gamingbull) 4 97.37 100.53 2 50.00
26531. Mallu (gaminfernofiend) 4 34.35 36.93 0 0.00
26532. Game (game_works) 4 71.96 84.97 4 100.00
26533. Galtorix (galtorix) 4 59.05 60.14 0 0.00
26534. M. Jones (galaxybiscuit) 4 88.23 111.03 2 50.00
26535. galatia (galatia) 4 68.67 74.05 1 25.00
26536. gak (gakman) 4 96.65 109.20 2 50.00
26537. uecchi (gagputa) 4 65.76 70.16 2 50.00
26538. Gagan Deep (gagan0123) 4 75.15 88.11 1 25.00
26539. mohamed (gadmet) 4 61.50 73.24 0 0.00
26540. Gabriel (gabrieltoledo) 4 54.47 57.01 0 0.00
26541. Ozzie (ga05july) 4 96.21 106.24 1 25.00
26542. armin (fx_skrrt) 4 122.80 136.45 1 25.00
26543. Whiffing (fxdk) 4 104.75 128.11 3 75.00
26544. Bethanoo (fuzomania) 4 74.79 76.40 0 0.00
26545. Adelkaa (fuska007) 4 41.13 42.71 1 25.00
26546. Jack (furcifer) 4 82.72 88.54 2 50.00
26547. GusFring (funnyvalentine) 4 82.01 85.50 2 50.00
26548. Jacktes (funnyperson) 4 101.94 117.85 3 75.00
26549. Jamie (fryo) 4 134.35 151.23 2 50.00
26550. yo (fruitjuices) 4 88.00 98.30 2 50.00
26551. Benjamin (frostdeee) 4 82.47 90.24 0 0.00
26552. frontier64 (frontier64) 4 105.91 117.38 3 75.00
26553. Logan (frigidgaming) 4 107.07 119.66 0 0.00
26554. cj (frfrstopcappin) 4 47.31 52.13 0 0.00
26555. typetard (frenchfriessalty) 4 72.76 79.93 0 0.00
26556. Fray (frayazu) 4 73.94 80.37 1 25.00
26557. Francesca (francesca34369) 4 104.81 112.33 4 100.00
26558. Fourty (fractionals) 4 67.94 78.35 2 50.00
26559. Razvan (forreckful) 4 128.76 137.74 3 75.00
26560. lol (formulol) 4 107.76 135.46 2 50.00
26561. Megan (foreverpurple) 4 67.66 72.23 0 0.00
26562. Forestii (forestii) 4 48.93 50.57 4 100.00
26563. Trương (fly1710) 4 36.38 40.24 0 0.00
26564. Foster (fluzii) 4 111.03 119.03 2 50.00
26565. aspen (flooot) 4 56.03 65.15 0 0.00
26566. Florian (flodaking) 4 79.12 85.29 3 75.00
26567. flavouredpig (flavouredpig) 4 85.80 102.85 2 50.00
26568. Flap (flapk) 4 80.72 84.92 1 25.00
26569. Keane (flaminbanana) 4 101.00 115.21 1 25.00
26570. Youssef (flameyoyo64) 4 96.18 114.85 2 50.00
26571. Erick (fishywasabi) 4 102.74 111.74 1 25.00
26572. Brandon (fireinthesoul) 4 55.38 60.80 0 0.00
26573. Lance (firball62) 4 106.91 116.54 1 25.00
26574. Fast (filpix) 4 41.73 46.54 2 50.00
26575. FIGBERT (figbert) 4 105.27 110.69 4 100.00
26576. Trevor (fifty_eight) 4 58.77 65.61 0 0.00
26577. Kalman (ferrmo) 4 61.91 64.01 2 50.00
26578. Felipe Bell (felipebell) 4 59.52 64.99 1 25.00
26579. S (fear4321) 4 122.32 139.32 2 50.00
26580. Faster than (fasterthanshlok) 4 112.40 126.80 2 50.00
26581. Fares (farfosi) 4 64.48 77.53 4 100.00
26582. Falcey (falceb) 4 62.21 89.28 1 25.00
26583. Fake Tree (faketree) 4 65.12 71.36 1 25.00
26584. Steven (faiching89) 4 71.78 76.74 1 25.00
26585. fae (faeswag) 4 89.24 96.33 2 50.00
26586. Adam (ezrice) 4 54.67 61.50 1 25.00
26587. E (ezet208) 4 67.48 83.78 0 0.00
26588. Hans (extrem3typist) 4 93.58 109.35 0 0.00
26589. Silas (experiencedcrafter) 4 53.88 58.76 1 25.00
26590. Existence (existence_vip) 4 67.78 71.66 1 25.00
26591. Riley (examinedrumble7) 4 93.42 103.65 4 100.00
26592. Zagar (ewentuz) 4 26.57 31.23 0 0.00
26593. Kyle (evilone2654) 4 87.63 92.07 4 100.00
26594. rrt (even_faster) 4 85.41 91.58 2 50.00
26595. Evanovache (evanovache) 4 53.95 63.86 0 0.00
26596. Devin (eulertour) 4 93.09 103.12 1 25.00
26597. Sinan (eul3r) 4 70.62 78.74 1 25.00
26598. e10 (ethodo) 4 72.70 82.54 0 0.00
26599. DiveDeep (ethanelm) 4 74.76 89.77 0 0.00
26600. ET (etdreamsofsleep) 4 128.43 141.81 2 50.00
26601. ESJvR (esjvr) 4 53.07 58.68 1 25.00
26602. Nicholas (erpanter) 4 50.19 56.46 0 0.00
26603. Erik (erikberik) 4 96.36 101.54 0 0.00
26604. Eric (eric007) 4 86.91 99.41 2 50.00
26605. Epic (epic360_boy) 4 61.75 69.96 0 0.00
26606. Enrico (enricosrt) 4 87.70 97.10 1 25.00
26607. Enderus (enderus) 4 64.16 67.15 1 25.00
26608. Emil (emild90) 4 101.79 109.10 1 25.00
26609. Ben (emeraldshield) 4 90.37 95.19 1 25.00
26610. Keith (emblazin) 4 119.35 135.41 3 75.00
26611. Emma (embi_) 4 50.75 53.89 1 25.00
26612. Ethan (emanfrazier) 4 57.20 75.71 1 25.00
26613. Elmouradi (elmouradiamine) 4 90.63 93.24 0 0.00
26614. hello (elllowwww) 4 37.39 55.91 1 25.00
26615. - (elliottmozley) 4 149.46 162.62 4 100.00
26616. beth (elizabethbrantt) 4 92.75 97.22 1 25.00
26617. elclid (elclid) 4 83.26 97.28 2 50.00
26618. Telekonesis (eirchue) 4 149.20 158.88 4 100.00
26619. eight (eight293) 4 72.94 75.76 1 25.00
26620. Eli (eiervonsatan) 4 69.93 73.71 2 50.00
26621. egork1dd (egorkidd) 4 84.04 88.92 1 25.00
26622. Jack (eeeeeeeeeeeeeeeeeeeeeee) 4 70.11 82.31 1 25.00
26623. edz (edz81) 4 90.32 104.93 2 50.00
26624. Edith (edith44) 4 46.34 57.52 0 0.00
26625. Eden (edenthompson) 4 88.97 99.11 2 50.00
26626. MA (ec41513) 4 18.60 21.56 1 25.00
26627. Afonso (eatotronic) 4 99.51 106.19 0 0.00
26628. wazzzaah (dzejkobb) 4 87.04 99.04 3 75.00
26629. Dylan (dylanjp) 4 50.88 60.55 2 50.00
26630. Michael (dunsterville) 4 65.97 77.67 0 0.00
26631. binh (dunkbing) 4 53.50 59.32 0 0.00
26632. Albin (dunderalf) 4 68.22 71.25 0 0.00
26633. Vinzel (dukeofweselton) 4 84.16 97.14 1 25.00
26634. Flake (dukebiscko22) 4 82.84 90.83 0 0.00
26635. Peter (duhburry) 4 115.84 126.50 2 50.00
26636. duck (duckupus) 4 67.68 75.86 1 25.00
26637. Duck (duckduckwhale) 4 89.69 102.86 2 50.00
26638. TOfu (dubunism) 4 72.70 79.79 1 25.00
26639. Nghĩa (dtnghia031199) 4 63.20 73.67 1 25.00
26640. David (dstran) 4 88.28 103.08 4 100.00
26641. davorin (dsego) 4 79.90 84.09 2 50.00
26642. Semyon (dsa_ru) 4 37.87 42.26 0 0.00
26643. dr (drpolish) 4 79.01 82.38 2 50.00
26644. Kato (dreamy_soul) 4 61.42 67.81 3 75.00
26645. Andreas (dray101) 4 71.98 83.48 1 25.00
26646. Draven (dravenator) 4 82.15 94.76 4 100.00
26647. Drake (drake251200) 4 96.21 108.12 2 50.00
26648. RoundCustard (dragontunglam) 4 87.53 97.12 3 75.00
26649. Ethereal (dragonfly654) 4 53.38 62.55 0 0.00
26650. Draggun (draggun) 4 81.15 92.38 1 25.00
26651. Double Michael (doublemichael) 4 102.44 107.83 2 50.00
26652. Glitch (dos_santos) 4 52.09 59.99 4 100.00
26653. Burnt Piece (doomlad) 4 98.15 114.26 1 25.00
26654. DoodieMan (doodieman) 4 48.19 56.63 0 0.00
26655. bids (donuxes) 4 100.68 117.26 2 50.00
26656. Hannah (donethat) 4 94.93 108.90 1 25.00
26657. dond (dond_feller4) 4 80.22 91.77 3 75.00
26658. DomeBoy (domeboy) 4 77.23 84.83 0 0.00
26659. T (dolphintail902) 4 87.24 95.66 1 25.00
26660. Andi (dolphingarlic) 4 91.12 93.50 2 50.00
26661. edy (dogusyildiz) 4 54.02 63.52 2 50.00
26662. Matteo (dogshitteo) 4 63.11 72.00 0 0.00
26663. Doychin (dodosaurus) 4 71.07 77.50 1 25.00
26664. Dode (dode_pep) 4 60.08 63.21 0 0.00
26665. Adwyn (dkmplz) 4 135.88 150.91 4 100.00
26666. Dabror (dk9mstar) 4 66.98 71.77 3 75.00
26667. Bane (djex808) 4 94.07 97.56 1 25.00
26668. Dhruv (djdhruv) 4 73.84 88.09 3 75.00
26669. Joys (dj25808) 4 28.37 30.89 2 50.00
26670. Divya (divya_16) 4 68.24 74.44 4 100.00
26671. Brady (dittowog) 4 57.05 60.75 2 50.00
26672. nathaniel (disbigspider) 4 40.28 42.40 0 0.00
26673. Died273 (died273) 4 77.20 91.32 1 25.00
26674. Mohcine (dictatox) 4 81.63 92.83 3 75.00
26675. diana (dianitax) 4 72.03 80.44 1 25.00
26676. HTT (diamond99007) 4 131.66 135.41 3 75.00
26677. the shoe eater (devourer_of... 4 61.51 68.88 0 0.00
26678. Devin (deviniity) 4 101.69 105.73 0 0.00
26679. Vinay (devinay) 4 44.61 48.26 2 50.00
26680. Desodred (desodred) 4 43.08 50.09 1 25.00
26681. Desiigner (desiignerkekw) 4 66.74 77.61 0 0.00
26682. Derryck (derryck) 4 76.57 81.60 3 75.00
26683. Gabriel (derpydood) 4 78.31 80.16 2 50.00
26684. David (depc) 4 68.44 73.06 3 75.00
26685. Veeridel (del_234) 4 77.26 85.29 0 0.00
26686. Typical (deltakoma) 4 71.28 74.69 1 25.00
26687. Daniel (delixx1) 4 97.93 103.38 2 50.00
26688. David (delkos) 4 103.15 109.07 2 50.00
26689. FlyingFlamingo (deinna222) 4 108.78 119.07 1 25.00
26690. Marco (deggamargo) 4 87.41 93.59 2 50.00
26691. J (definetly_not_a_guest) 4 66.32 68.44 1 25.00
26692. Neil (defecto) 4 115.29 124.94 3 75.00
26693. Alex (deeseebro) 4 78.46 83.92 2 50.00
26694. Deddie (deddie_1) 4 115.11 134.41 3 75.00
26695. D (deathnoters) 4 105.90 114.60 3 75.00
26696. DearCows (dearcows) 4 124.93 140.42 4 100.00
26697. David (ddellspe) 4 99.91 108.97 2 50.00
26698. David (davidpo) 4 67.00 75.47 1 25.00
26699. Heyhou (david73) 4 93.88 98.79 1 25.00
26700. David (davalav) 4 59.36 65.00 2 50.00
26701. Darnell (darnell_2502) 4 77.29 81.08 1 25.00
26702. Drake (dark_wing) 4 65.43 77.75 2 50.00
26703. i cant type im trash (darkn... 4 95.45 104.45 3 75.00
26704. Vasyl (dardhard) 4 60.61 70.93 0 0.00
26705. DapperDjent (dapper_djent) 4 48.25 52.67 0 0.00
26706. Daniel (danny_dvlpr) 4 64.21 74.10 1 25.00
26707. Daniel (dannyxo) 4 107.52 109.78 1 25.00
26708. Dannei (dannidarling) 4 58.16 65.22 0 0.00
26709. Dankest (dankesttt) 4 101.32 114.66 0 0.00
26710. Dani (daniespi) 4 48.68 54.16 3 75.00
26711. DanielP (daniel504) 4 116.09 121.91 1 25.00
26712. DangLin (dang_lin_wang) 4 64.32 70.75 2 50.00
26713. DNGZ (dangiuz) 4 128.65 151.83 3 75.00
26714. Andres (dandidandi) 4 66.15 70.70 1 25.00
26715. ruthenia (dancandoit27) 4 65.39 72.56 4 100.00
26716. Danan (dananbookworm) 4 148.18 150.82 4 100.00
26717. Dala (dalarifat) 4 94.28 107.65 3 75.00
26718. Sam (dakiller234) 4 117.65 134.18 3 75.00
26719. Daito (daitozen) 4 63.06 65.70 1 25.00
26720. daisy_lilly (daisy_lilly) 4 42.18 54.22 0 0.00
26721. Daipatinue (daiplatinue) 4 44.52 53.01 2 50.00
26722. david (dafearn) 4 133.42 159.48 3 75.00
26723. Jonathan (daddyiz) 4 63.86 73.27 1 25.00
26724. DriverPT (d4rkdreamspt) 4 45.60 53.12 0 0.00
26725. Dahlia (d4hli4) 4 72.27 75.65 1 25.00
26726. Dom (d0m_) 4 69.48 73.45 1 25.00
26727. yamitori (czas) 4 36.61 37.48 4 100.00
26728. Cyxone (cyxone) 4 91.63 109.57 2 50.00
26729. c (cvu24) 4 77.14 81.44 0 0.00
26730. Ricky (cutlert) 4 69.48 73.23 1 25.00
26731. Alex (cush_palace) 4 54.17 61.07 0 0.00
26732. Colin (cuken) 4 108.12 114.72 4 100.00
26733. Seth (cucookid) 4 101.91 102.51 3 75.00
26734. Jon (cuber1) 4 42.27 44.55 1 25.00
26735. Csutka (csutkabali) 4 48.87 55.84 0 0.00
26736. S (cryten56) 4 81.68 89.59 0 0.00
26737. Crystallyen (crystallyen) 4 59.30 67.42 1 25.00
26738. zzRouxfop_ (cryptic_blade) 4 90.13 103.14 0 0.00
26739. audrey (crustish) 4 110.57 116.10 4 100.00
26740. Crown (crownmp) 4 49.16 56.57 0 0.00
26741. Nate (critic) 4 68.57 78.37 0 0.00
26742. Beqa (crimsy8) 4 94.75 104.04 0 0.00
26743. Sike (creme_egg) 4 87.38 93.46 3 75.00
26744. Patryk (crazzor) 4 88.38 101.45 2 50.00
26745. BeckerGames.com (crazyninja... 4 96.67 104.77 1 25.00
26746. Ryan (cratis) 4 58.24 63.50 1 25.00
26747. CrackedEight (crackedeight) 4 61.37 69.95 1 25.00
26748. Prajna (cptdeka10) 4 67.58 75.66 1 25.00
26749. Spyros (covertcommunist) 4 71.27 83.60 2 50.00
26750. Cory (cory421) 4 89.72 99.63 3 75.00
26751. Coraline (coralinebutton) 4 49.05 50.48 0 0.00
26752. Kacper (coomkacz12345678) 4 40.96 48.31 0 0.00
26753. Meghan (coolmegmc) 4 95.40 101.46 3 75.00
26754. lol (coolkid55) 4 43.73 52.33 1 25.00
26755. SOme (coolhacker420) 4 46.26 49.61 0 0.00
26756. Connor (connor12568) 4 108.49 112.11 4 100.00
26757. chloe (comradebiden) 4 87.00 97.84 2 50.00
26758. Twix (commit147) 4 46.34 52.22 1 25.00
26759. Amin (collypso) 4 70.38 85.36 1 25.00
26760. Martin (codetheidiot) 4 105.51 116.06 2 50.00
26761. codding (codding_beast) 4 52.62 54.85 0 0.00
26762. Tamie (cocota2) 4 73.50 80.34 2 50.00
26763. Justin (cocok97) 4 71.66 75.99 2 50.00
26764. Caitlin (cmonjeau) 4 122.33 139.28 4 100.00
26765. rachel (clxudyss) 4 106.12 121.78 2 50.00
26766. Foster (clovexr) 4 51.82 54.48 0 0.00
26767. Ryan (cloutmasterz) 4 60.48 68.84 2 50.00
26768. Barry (cloolboy) 4 80.34 88.53 1 25.00
26769. clock (clockq) 4 48.35 51.08 1 25.00
26770. Ethan (clobbster) 4 66.15 71.36 1 25.00
26771. Clawzer (clawzer) 4 103.41 107.89 1 25.00
26772. Claire (claireeeieie) 4 89.62 97.93 0 0.00
26773. clarz (claerchen) 4 51.22 57.56 1 25.00
26774. charlie (ck840204) 4 59.63 64.98 1 25.00
26775. CJ (cjcurata) 4 64.86 67.35 1 25.00
26776. Circlestrafin (circlestrafin) 4 93.94 97.90 3 75.00
26777. Ciontel (ciontel) 4 76.77 86.34 0 0.00
26778. cimbraien (cimbraien) 4 102.98 109.86 3 75.00
26779. Ciarbin (ciarbin) 4 65.49 72.05 0 0.00
26780. Chy (chy_) 4 81.71 95.74 0 0.00
26781. chyzellechan (chyzellechan) 4 49.31 60.54 0 0.00
26782. (chugjugwithyou) 4 124.01 143.60 3 75.00
26783. Martin (chubbinub) 4 72.93 79.32 1 25.00
26784. Dilly (chronixz) 4 76.99 81.61 0 0.00
26785. Chrome (chroman00) 4 92.58 96.84 1 25.00
26786. Hello (chroma56) 4 58.12 62.24 1 25.00
26787. Christian (christiangodtdm) 4 94.71 100.63 3 75.00
26788. Chris Klenø (chrisnk) 4 194.26 199.94 3 75.00
26789. Chris (chrisljiang) 4 99.61 117.16 1 25.00
26790. Julie (chowoww) 4 113.91 129.52 2 50.00
26791. ChocoDoco (chocodoco) 4 68.57 71.96 2 50.00
26792. Chittaarth (chitt09) 4 55.40 66.21 4 100.00
26793. Tommy (ching_wong_un) 4 56.45 63.04 0 0.00
26794. CHICKENWINGCHILD (chickenwi... 4 50.68 53.27 0 0.00
26795. Eirik (chickenboomer) 4 81.08 89.44 2 50.00
26796. Chi (chichung91) 4 91.90 97.25 2 50.00
26797. TouchTyping (cheesticks) 4 76.23 94.04 2 50.00
26798. charegg1127 (charegg1127) 4 94.15 107.41 1 25.00
26799. Common Hoopoe (chaoticorder) 4 80.82 94.36 2 50.00
26800. Chaos (chaosfyre) 4 61.89 69.26 1 25.00
26801. Divyanshu (chakanshu) 4 21.81 31.72 0 0.00
26802. Cooper (cglavin) 4 99.42 107.30 4 100.00
26803. Lukas (cerilious) 4 69.48 73.99 0 0.00
26804. Ceptlog (ceptlog) 4 55.64 64.66 0 0.00
26805. Chris (cdyson1313) 4 50.16 56.02 0 0.00
26806. Mitch (cbfworkin) 4 94.13 99.40 1 25.00
26807. bea (cbeae) 4 98.21 107.52 3 75.00
26808. Cavouc (cavouc) 4 74.43 78.86 2 50.00
26809. Catroomba (cat_roomba) 4 101.08 111.31 2 50.00
26810. coal_town (cat_guy) 4 104.97 111.25 3 75.00
26811. Denis (carvedseven) 4 88.41 91.76 1 25.00
26812. Carter (cartersaechao92) 4 84.22 105.98 1 25.00
26813. Speedy Cici (carmur) 4 99.60 101.96 3 75.00
26814. CarelessInternet (carelessi... 4 89.60 95.48 1 25.00
26815. Gggreg (cardriver) 4 53.94 56.56 1 25.00
26816. Mason (captainmom7) 4 106.78 116.52 3 75.00
26817. CapoAgus (capoagus) 4 97.11 107.02 1 25.00
26818. Bumbly (canextro) 4 93.77 113.26 3 75.00
26819. Lili (candazaac) 4 63.10 68.46 0 0.00
26820. dakota (camissonia) 4 103.82 109.26 2 50.00
26821. Cameron (cameron_friday) 4 78.27 87.93 1 25.00
26822. Cam (cambrown) 4 101.23 111.90 3 75.00
26823. kolja (callmemink) 4 72.11 78.77 1 25.00
26824. celine (cald) 4 81.11 91.78 1 25.00
26825. Mary (calamary) 4 100.08 111.40 1 25.00
26826. Chelsea (cakeling) 4 100.84 108.75 3 75.00
26827. Piplup (caitcat) 4 106.06 121.62 3 75.00
26828. Alexander (caesarsgambit) 4 76.53 81.65 0 0.00
26829. Cactusmon (cactusmon) 4 92.79 105.48 1 25.00
26830. christomato (cactichris123) 4 53.89 77.97 3 75.00
26831. ButTtTKiccKeRr (buttkickker) 4 72.41 82.00 2 50.00
26832. BupsterWavelength (bupsterw... 4 117.34 130.49 2 50.00
26833. Paul (bunkerking) 4 88.22 99.88 1 25.00
26834. András (bundikah) 4 63.56 72.73 3 75.00
26835. Bunda (bundapump) 4 100.40 109.19 4 100.00
26836. bie (bumblebie) 4 117.00 121.32 3 75.00
26837. zafreeti (budexxx6) 4 47.35 55.26 0 0.00
26838. Ella (bubble0176) 4 86.44 94.21 0 0.00
26839. getnthr (bspur11) 4 39.83 43.29 0 0.00
26840. Inigo (brotheringo) 4 79.08 83.88 1 25.00
26841. Ibs (brjoker) 4 73.21 79.53 3 75.00
26842. Britney (britney1550) 4 70.85 79.79 2 50.00
26843. (bribe) 4 140.64 150.40 4 100.00
26844. Brian (briandawn) 4 61.89 70.07 1 25.00
26845. brianbear (briand724080) 4 148.42 155.07 4 100.00
26846. b (brgr2022) 4 78.55 80.27 1 25.00
26847. Brent (brentdrns) 4 89.56 99.18 2 50.00
26848. Vincent (breadcheese2021) 4 66.68 78.99 1 25.00
26849. Brantly (brantlyd) 4 108.63 113.66 2 50.00
26850. Brandon (brandonjcox) 4 72.87 82.31 0 0.00
26851. Brandon (brandonabsent) 4 45.21 57.25 0 0.00
26852. Abel (brainstorm122004) 4 74.19 80.47 1 25.00
26853. Bradley (bradleyjohnson) 4 47.33 53.71 0 0.00
26854. brad (bradacook) 4 47.91 50.59 1 25.00
26855. peemer (bot00014) 4 64.13 68.14 0 0.00
26856. Your (bossspy75) 4 87.41 91.19 1 25.00
26857. Ryan (bossmanryan) 4 113.05 121.92 3 75.00
26858. Bosko (bosko) 4 98.95 105.22 0 0.00
26859. boppin (boples) 4 62.03 70.21 0 0.00
26860. Sanju (boomier) 4 68.00 71.26 1 25.00
26861. Andriy (bonbonita) 4 68.10 73.35 1 25.00
26862. bool3max (bolemax) 4 113.80 120.87 2 50.00
26863. Bolam Blom (bolam_blom) 4 64.28 68.04 0 0.00
26864. Anton (boisingkit) 4 81.96 90.43 1 25.00
26865. Bog (bogdanovix) 4 88.64 99.44 1 25.00
26866. Bob (bobthethird) 4 76.56 81.09 2 50.00
26867. Bobross (bobrossrtx) 4 74.38 77.62 1 25.00
26868. Mathias (bluecolibri) 4 52.97 55.30 0 0.00
26869. bloop 💫 (bloopedyblap) 4 108.46 130.58 1 25.00
26870. bla3oss (bla_3oss) 4 47.73 54.30 0 0.00
26871. Blatzien (blatzien) 4 98.59 111.24 1 25.00
26872. Blank (blank28) 4 48.89 61.51 0 0.00
26873. David (bisbalian) 4 58.50 61.48 1 25.00
26874. BinsentKarlo (binsentkarlo) 4 74.73 82.60 2 50.00
26875. B (billus) 4 110.21 123.42 0 0.00
26876. William (billiam98) 4 45.68 55.55 0 0.00
26877. Mini.S (billbang6) 4 95.52 101.86 3 75.00
26878. Terry (big_tarray) 4 95.46 103.93 3 75.00
26879. Big (bigsmokeracer) 4 91.57 101.47 1 25.00
26880. Big (bigpoorboy) 4 91.93 100.98 3 75.00
26881. Big Ole Deezer (bigoledeezer) 4 92.49 112.32 1 25.00
26882. John (bigjohn7256) 4 61.80 71.71 2 50.00
26883. Banana__Plant (bibinprakash) 4 61.16 64.99 1 25.00
26884. Pavle (bezimeni04) 4 53.91 58.42 1 25.00
26885. Tatum (beryl_bee) 4 67.78 77.35 0 0.00
26886. berry (berryroseblood) 4 70.02 76.90 1 25.00
26887. Bernie (berniesanders69) 4 51.45 54.53 2 50.00
26888. Ben (benw12) 4 84.62 95.84 1 25.00
26889. Benji (benjibennick) 4 95.98 105.32 0 0.00
26890. Benjamin (benjaneb) 4 62.89 71.63 0 0.00
26891. Benjamin (benjaminwu) 4 132.40 140.89 4 100.00
26892. Nikhil (benesch) 4 126.58 133.65 2 50.00
26893. Believer09 (believer09) 4 47.24 50.98 0 0.00
26894. Bekzat (bekzat_abdikarimov) 4 42.50 56.61 0 0.00
26895. Belarus (belarus03) 4 52.08 55.64 1 25.00
26896. jason (bekster_) 4 70.00 75.60 1 25.00
26897. Asylkhan (beeppuck) 4 62.68 66.27 0 0.00
26898. Billy (beel00) 4 107.18 111.26 0 0.00
26899. Naren (bearcum) 4 103.46 111.64 2 50.00
26900. bbdnoir (bbd_noir) 4 60.24 68.72 0 0.00
26901. Boris (bb667) 4 124.43 134.92 1 25.00
26902. JOHN (bb5k) 4 106.99 114.78 2 50.00
26903. Zak (bazingazak_v2) 4 88.35 95.71 1 25.00
26904. pebble (baumkuchen) 4 66.60 73.49 1 25.00
26905. Batstark (batstark) 4 61.97 64.11 0 0.00
26906. David (barrard) 4 45.28 48.89 0 0.00
26907. Rolling Thunder (barkingside) 4 87.45 90.23 0 0.00
26908. Harsit (baral) 4 100.62 115.73 2 50.00
26909. Anhar (bantharfanta) 4 77.83 86.37 3 75.00
26910. Banana (banmanan) 4 85.68 87.57 0 0.00
26911. bananabonger (bananabonger) 4 146.64 165.54 3 75.00
26912. ok (banadagril) 4 65.08 73.27 0 0.00
26913. Balazs (balazs11) 4 62.92 73.74 0 0.00
26914. Rahul (badrii) 4 54.12 58.89 0 0.00
26915. Billy (badbikes) 4 95.63 113.51 3 75.00
26916. Andrew (baconpapi) 4 60.24 66.36 0 0.00
26917. b1otch (b1otch) 4 41.21 46.53 1 25.00
26918. Danil (a_str0) 4 80.85 83.74 0 0.00
26919. A (a_goldfish) 4 87.32 94.91 2 50.00
26920. Azri Akmal (azriakmalk) 4 59.68 68.95 1 25.00
26921. Azn (aznrayxz) 4 80.68 90.43 1 25.00
26922. Azimjon (azimjon) 4 30.40 33.18 0 0.00
26923. Azikiro (azikiro) 4 105.91 128.52 1 25.00
26924. Azhar (azharnawaz) 4 76.13 81.37 2 50.00
26925. Axzyte (axzyte) 4 127.56 139.03 3 75.00
26926. Max (axe_) 4 62.73 66.36 2 50.00
26927. Axeor (axeor) 4 50.75 55.32 1 25.00
26928. blop (axemalt) 4 119.85 125.23 4 100.00
26929. Alexa (axela33) 4 113.38 125.85 0 0.00
26930. Avi (avir) 4 60.61 69.08 0 0.00
26931. NANI (aurimuxasltgg) 4 84.03 89.43 2 50.00
26932. Yury (auaster) 4 60.62 66.96 0 0.00
26933. AtomToast (atomtoast) 4 71.47 75.35 2 50.00
26934. Rikard (atmoscube) 4 77.85 88.45 0 0.00
26935. Athanasia (athanasialaras) 4 79.39 82.50 1 25.00
26936. T^T (asylumchess) 4 88.54 103.55 1 25.00
26937. Xeo (astroloser) 4 65.38 72.11 1 25.00
26938. Kadra Don (assem07) 4 37.40 40.37 1 25.00
26939. asottile (asottile) 4 94.66 111.19 1 25.00
26940. marley (asianwonton) 4 96.88 102.76 2 50.00
26941. Hannes (asiansticka) 4 64.36 71.12 1 25.00
26942. Andrew (asianpenguin2) 4 79.86 89.53 1 25.00
26943. Timmy (asianhacker9000) 4 64.24 78.11 0 0.00
26944. Kerschel (asdfjklsemic0lon) 4 104.49 117.32 1 25.00
26945. Mahesh (asc_91) 4 52.87 55.72 0 0.00
26946. Mike (ascential) 4 100.68 111.74 3 75.00
26947. Artemis (artemis64) 4 82.40 87.13 2 50.00
26948. Maarten (arteeh) 4 60.48 92.50 1 25.00
26949. Arsen (arsijo) 4 46.80 52.97 0 0.00
26950. Arsa (arsa2312) 4 74.38 81.11 1 25.00
26951. Arman (armashka_) 4 46.77 58.25 0 0.00
26952. Jorge (armando_villatoro) 4 43.40 54.20 0 0.00
26953. Arjun (arjunnaidu) 4 43.57 47.67 0 0.00
26954. arjayar (arjayar) 4 72.94 76.58 1 25.00
26955. Arif (aripin_cmk) 4 81.17 85.41 1 25.00
26956. Arturs (archey187) 4 97.16 108.52 2 50.00
26957. Alex (arandazzo829) 4 110.57 129.45 2 50.00
26958. Andrea (arachnedefiant) 4 110.47 113.78 2 50.00
26959. Ara (aracelis) 4 50.80 57.45 1 25.00
26960. TaeHyoung (aqweds1) 4 83.38 85.32 3 75.00
26961. superfish (aprettysuperfish) 4 65.21 79.90 1 25.00
26962. Adam (appeac) 4 94.00 104.15 3 75.00
26963. Aoden (aoden) 4 75.11 94.65 0 0.00
26964. Anxiete (anxiete) 4 50.38 56.55 1 25.00
26965. (anumon6395) 4 107.10 112.15 2 50.00
26966. Antogs (antogs) 4 96.27 106.49 2 50.00
26967. Rafi (antirafi) 4 42.69 48.03 0 0.00
26968. Antete (antete) 4 59.56 66.02 0 0.00
26969. Ansh (anshr) 4 87.12 97.59 1 25.00
26970. fastasf (anshisfast) 4 93.67 98.78 1 25.00
26971. Ankush (ankushmishra) 4 56.16 63.89 0 0.00
26972. Michael (angeles_cabilao) 4 107.31 114.95 4 100.00
26973. Angela (angelaho40) 4 62.03 65.50 0 0.00
26974. raf (anemonespotted) 4 96.36 103.59 3 75.00
26975. andy (andypaling) 4 79.01 81.67 2 50.00
26976. Oleksandr (andrusenko) 4 78.56 86.81 1 25.00
26977. Evan (androidlegend) 4 91.25 105.63 2 50.00
26978. A (andrewg124) 4 88.13 101.47 1 25.00
26979. Andrew (andrew4763) 4 66.70 72.57 0 0.00
26980. Andrés (and9686) 4 48.40 51.52 2 50.00
26981. David (anakonda06) 4 47.80 51.24 1 25.00
26982. amos (amoooss88) 4 96.44 98.52 2 50.00
26983. Ammar (ammarsya4) 4 41.94 43.50 0 0.00
26984. Md Aminul (ami_pronoy) 4 61.78 63.12 2 50.00
26985. Amigo (amigom) 4 56.06 59.93 0 0.00
26986. martin (amezquitamartin) 4 50.87 54.98 0 0.00
26987. Amelie (amelierosemcd) 4 74.29 83.24 0 0.00
26988. Ambrosia (ambiic) 4 77.28 85.58 1 25.00
26989. Nick (alphaman3801) 4 97.37 105.04 3 75.00
26990. Allen (allenxxx) 4 84.51 94.44 0 0.00
26991. Ali (alirn76) 4 59.66 64.01 4 100.00
26992. AlirezA (alirezaslayer) 4 81.70 88.08 2 50.00
26993. alios99 (alios99) 4 44.39 48.33 0 0.00
26994. Alina (alinag) 4 92.47 97.73 2 50.00
26995. Alex (alex_575) 4 74.37 82.59 2 50.00
26996. ig: __Alexxzh (alextyperop) 4 89.89 109.80 1 25.00
26997. Alex (alexsun) 4 105.20 115.38 3 75.00
26998. Alex (alexswearingen) 4 100.79 102.01 3 75.00
26999. Alex (alexonboba) 4 58.24 62.37 4 100.00
27000. Alex (alexkwon) 4 93.78 102.97 1 25.00
27001. Alex (aleex) 4 75.20 81.36 1 25.00
27002. Alcor (alcorinf) 4 66.22 70.84 0 0.00
27003. Taiotox (albertosama) 4 51.84 56.47 0 0.00
27004. Albert (albert239825) 4 90.03 97.85 2 50.00
27005. rick (alaric_saltzman) 4 46.97 50.37 0 0.00
27006. alan (alanlaw999) 4 63.65 82.90 2 50.00
27007. Alan (alan2021233) 4 107.74 136.92 3 75.00
27008. Akbar (akbarginanjar) 4 32.72 35.62 2 50.00
27009. bit lee (akazed) 4 98.17 111.76 1 25.00
27010. akash (akash__) 4 56.51 60.74 0 0.00
27011. Akash (akashdeep_912) 4 36.87 41.11 0 0.00
27012. Azad ul Kabir (akash455) 4 45.27 55.70 1 25.00
27013. - (airplane100) 4 131.89 146.83 3 75.00
27014. Aiden (aidmfc) 4 103.14 112.05 4 100.00
27015. Aidan (aidanpr) 4 104.48 114.11 1 25.00
27016. Aidan (aidan0829) 4 65.94 70.76 3 75.00
27017. Ahmed (ahmed_emad21) 4 44.25 48.21 0 0.00
27018. ahmed (ahmedadel2020) 4 60.95 66.10 1 25.00
27019. Agilan (agilan2001) 4 74.96 77.64 1 25.00
27020. Steven (agentsb024) 4 89.38 95.14 4 100.00
27021. Afshin (afshin) 4 43.53 50.63 1 25.00
27022. Jacob (adudethattypes) 4 89.51 103.33 4 100.00
27023. ahmed (admica) 4 75.99 81.54 0 0.00
27024. adityasaini (adityasaini) 4 80.76 91.64 1 25.00
27025. RoadTo100 (adininoxyz) 4 74.31 84.31 0 0.00
27026. Adi (adi321456) 4 83.54 97.61 1 25.00
27027. Adam (adamhitchcock) 4 76.19 96.94 1 25.00
27028. Adalyee (adalyee) 4 81.41 90.76 0 0.00
27029. Адиль (ad1lek) 4 40.90 50.76 2 50.00
27030. idot (achyut_tripathi) 4 72.00 75.55 0 0.00
27031. Lukas (achertin) 4 96.64 111.99 3 75.00
27032. Aiden (acer564) 4 123.22 133.54 4 100.00
27033. Accurate (accurate_typer) 4 94.05 103.85 4 100.00
27034. Nerd Typist (accuracy_goddess) 4 103.21 114.99 0 0.00
27035. AccidentalGrenade (accident... 4 94.18 102.21 2 50.00
27036. ABudgie (abudgie) 4 90.40 110.89 4 100.00
27037. Abhi (abhishekdas1025) 4 33.09 34.40 0 0.00
27038. Abada (abada) 4 64.22 69.43 0 0.00
27039. Albert (aastefanov) 4 111.10 121.07 3 75.00
27040. ☺ AASHRU... (Business Ana... 4 104.22 110.02 2 50.00
27041. Antoni (aaahello) 4 81.45 88.25 3 75.00
27042. aqibzuhaini (a1mplayz) 4 105.20 118.48 4 100.00
27043. vijay (950vijay) 4 64.97 71.39 0 0.00
27044. Joe (8bitsmash) 4 69.67 73.50 2 50.00
27045. Travis (7yl3r) 4 71.38 77.20 0 0.00
27046. Thew (5_years_old) 4 116.80 126.52 1 25.00
27047. Alex (5xlegend) 4 56.75 65.44 1 25.00
27048. Elvira (5oap) 4 65.45 71.87 1 25.00
27049. Timmy (547k4) 4 65.52 77.25 1 25.00
27050. Ahmed (4hmed4dnan) 4 63.72 70.29 2 50.00
27051. hugo (21_hugo) 4 107.37 122.72 2 50.00
27052. Literature (20120623) 4 102.27 104.88 0 0.00
27053. Vasilis (2004vas) 4 70.84 80.51 1 25.00
27054. Kushveer (1nst1nct) 4 69.20 77.08 4 100.00
27055. Justin (1mmure) 4 104.05 109.64 3 75.00
27056. Heloa (1letterfromhell) 4 66.26 72.75 0 0.00
27057. εiз (13uttercup) 4 111.11 131.45 3 75.00
27058. Riley (0wned21) 4 69.24 75.60 0 0.00
27059. ratgirl (0pter) 4 88.27 95.01 3 75.00
27060. Joshua (0forphysics) 4 87.41 88.45 1 25.00
27061. Luan (hungnn1094) 4 79.65 83.21 0 0.00
27062. Bruno (yodidillybaggins) 4 117.42 132.78 2 50.00
27063. sapix (lepordiswhite) 4 55.88 59.81 0 0.00
27064. Jehovahtrashman (jehovahtra... 4 87.87 107.41 0 0.00
27065. Jelly (jellyroll_derp) 4 73.00 79.80 2 50.00
27066. Austin (unf0rgivable) 4 64.78 74.92 2 50.00
27067. paragraph (paragraph) 4 62.05 72.39 1 25.00
27068. Akil (para_ducks) 4 70.86 79.22 1 25.00
27069. Adam (tripzz) 4 44.41 47.93 0 0.00
27070. Jay (jay90) 4 60.72 65.82 0 0.00
27071. Woosh (woosh_7) 4 70.93 91.37 2 50.00
27072. Dusan (dukezyy) 4 61.74 68.08 1 25.00
27073. Dennis (fredaroop12) 4 88.62 104.60 2 50.00
27074. South (southbeastgaming) 4 99.33 119.78 2 50.00
27075. Luis Ortiz (luenorju97) 4 87.74 93.04 0 0.00
27076. Liana (liiiiiiaaaaannnnnaa) 4 94.04 102.64 2 50.00
27077. Dark (darkwizard1980) 4 92.54 97.49 1 25.00
27078. xAwwMan2010 (xawwman_winning_) 4 68.73 73.17 0 0.00
27079. Sreenath (fledgingeagle) 4 63.40 66.89 0 0.00
27080. Brad (bradstecker) 4 46.64 51.81 1 25.00
27081. Yasser (ybeast02) 4 64.97 70.69 1 25.00
27082. Pranjul (prankful) 4 72.58 86.50 1 25.00
27083. Akshat (paneerbiryani) 4 85.82 97.37 1 25.00
27084. pnd88 (pnd88) 4 101.75 115.82 4 100.00
27085. Pavlos10 (alithinospavlakis... 4 70.75 78.52 2 50.00
27086. Yama (yamalolz) 4 91.28 99.53 1 25.00
27087. K1r4 (kira_o) 4 76.45 82.21 0 0.00
27088. Vater (cpttezuka) 4 96.72 100.30 1 25.00
27089. Не знам (justsoni) 4 76.62 83.40 4 100.00
27090. Vilius (vilius5000) 4 79.35 82.65 3 75.00
27091. Amoxcillin (j5098) 4 105.95 131.58 2 50.00
27092. Andy (notclickbait) 4 78.19 94.25 1 25.00
27093. enoch (eenoch) 4 31.56 33.99 0 0.00
27094. Martin (martymcb) 4 56.56 61.86 0 0.00
27095. Chase (creidinger) 4 73.40 81.98 2 50.00
27096. Yew Lee (yewlee) 4 86.93 96.42 2 50.00
27097. ? (m_phisto) 4 68.18 72.62 2 50.00
27098. Adam (soulberry) 4 27.26 30.91 2 50.00
27099. tedro (sktedro) 4 82.96 88.68 1 25.00
27100. Kyle (pikabear) 4 91.97 99.88 3 75.00
27101. Perla (nunezperlaa) 4 43.72 48.90 0 0.00
27102. Justin (jyhyim) 4 64.39 75.45 1 25.00
27103. Sarah (charaliha) 4 67.88 69.25 0 0.00
27104. John (jm12986) 4 65.47 72.22 1 25.00
27105. Bamboo (pyramid322) 4 25.73 37.96 0 0.00
27106. enhbold (enhbold) 4 82.45 86.88 1 25.00
27107. zelsius (zelsius0) 4 37.20 38.23 0 0.00
27108. Mack (alhawks) 4 85.37 107.47 2 50.00
27109. jimmy (pringies) 4 85.27 89.53 4 100.00
27110. Slava (slavah8) 4 93.66 97.83 0 0.00
27111. Isaiah (jifaker) 4 44.46 54.22 3 75.00
27112. Cailer (cailer) 4 99.36 109.89 2 50.00
27113. qih (qih24) 4 56.03 62.16 2 50.00
27114. Michael (meiner_223) 4 54.65 60.41 0 0.00
27115. Azfa (zeinnaku) 4 45.60 47.64 1 25.00
27116. Eason (imharuna) 4 75.20 85.10 1 25.00
27117. Trent (beastchump) 4 70.32 74.46 1 25.00
27118. Inuk (eskimogang2) 4 59.82 65.05 0 0.00
27119. XiaoXie (xiaoxie) 4 51.30 58.39 0 0.00
27120. Thanadol (thanadol_a) 4 58.13 66.71 4 100.00
27121. ACARROT (acarrot) 4 91.70 101.00 0 0.00
27122. Ben (losot557) 4 51.34 59.19 0 0.00
27123. john (totoytikas) 4 56.88 63.82 0 0.00
27124. Matt (mattdust) 4 82.46 97.48 1 25.00
27125. Sabriya (sabri259) 4 108.03 115.20 4 100.00
27126. Damani (slowguyy) 4 52.11 56.51 4 100.00
27127. your (tytu23) 4 77.91 85.82 4 100.00
27128. Colin (bliksem1212) 4 43.57 49.92 0 0.00
27129. Raymond (lemong) 4 95.07 97.76 2 50.00
27130. Mohamed (mido_haitham) 4 53.31 61.24 0 0.00
27131. Tuguldur (tuxindahood) 4 58.43 63.14 0 0.00
27132. Chris (coffeebeans) 4 63.97 66.13 1 25.00
27133. Tomoya (oktomo011) 4 48.13 55.47 0 0.00
27134. Cell (celluloidracer2) 4 67.91 74.46 1 25.00
27135. Reem (reemyziz) 4 60.96 66.32 0 0.00
27136. Jan Nosek (s1ngle_) 4 42.28 44.39 1 25.00
27137. Harsh (yodenharsh) 4 74.45 80.16 4 100.00
27138. k3 (krexcent) 4 100.81 122.12 3 75.00
27139. Ezra (efernandeza) 4 95.50 110.30 1 25.00
27140. Jun (thriftster) 4 69.37 74.66 1 25.00
27141. Spencer (thundersalad) 4 100.37 107.32 3 75.00
27142. Akhsan (haurieel) 4 48.45 49.92 0 0.00
27143. LittleFrench (littlefrench) 4 76.35 80.66 1 25.00
27144. K (kimk12071991) 4 69.34 79.48 2 50.00
27145. Pyreon (pyreon) 4 87.24 99.37 1 25.00
27146. no (manathai) 4 104.96 118.08 2 50.00
27147. ikonikon (ikonikon) 4 59.57 68.26 0 0.00
27148. chloe (picklea) 4 85.43 95.08 1 25.00
27149. Matthew (skywaffle) 4 92.45 102.21 3 75.00
27150. Pete (ple103) 4 81.52 84.44 2 50.00
27151. Liam (piistol) 4 71.76 75.45 1 25.00
27152. Koki (kokitnl) 4 58.83 61.47 0 0.00
27153. Charbel (k12178) 4 98.55 108.64 0 0.00
27154. N (niclashermansson) 4 69.83 80.45 0 0.00
27155. shibal (balbz) 4 64.14 67.89 0 0.00
27156. Shreshth (shoutingmonkey) 4 62.60 73.95 2 50.00
27157. Ariel (achang8) 4 70.59 78.46 1 25.00
27158. Ona (ona_27) 4 54.23 64.71 1 25.00
27159. Tony (hexsymple) 4 85.83 93.71 2 50.00
27160. Blaze (blitzbot) 4 50.61 55.36 1 25.00
27161. MrManOnMars (mrmanonmars) 4 80.03 84.56 2 50.00
27162. Chris (szidat) 4 60.75 69.66 1 25.00
27163. bubby (bubbylol) 4 56.99 58.74 0 0.00
27164. Scrub (scrubfn) 4 97.28 101.65 3 75.00
27165. Caspar (jollofboy) 4 60.13 66.59 1 25.00
27166. Jayke (jayke_narn) 4 94.65 102.43 2 50.00
27167. Murariu (bucovina) 4 101.24 113.33 1 25.00
27168. Nashu (nash0u) 4 46.38 58.35 0 0.00
27169. Technaltech (506302147) 4 23.26 24.85 0 0.00
27170. Ez (hnnh) 4 86.01 88.74 1 25.00
27171. Hjálmar Ingi (molinnn) 4 47.31 51.11 0 0.00
27172. Jordan (jordanfa) 4 76.81 81.01 1 25.00
27173. Ben (bhmorse) 4 78.56 98.74 0 0.00
27174. Aghastlobster (aghastlobster) 4 83.84 87.17 1 25.00
27175. Ryan (yarn_is_fried) 4 49.88 52.99 0 0.00
27176. Will (wsuter13) 4 97.94 111.81 4 100.00
27177. khalil (kak_) 4 68.45 80.68 2 50.00
27178. Nickpask (nickpask) 4 48.06 53.34 0 0.00
27179. Tomás (duk47) 4 88.06 98.37 1 25.00
27180. jungkook (bts_jungkook) 4 79.86 86.04 1 25.00
27181. LeNNis (lennis) 4 60.41 74.27 0 0.00
27182. Paul (polpolpol) 4 73.79 89.51 1 25.00
27183. Meto (meto1337) 4 88.33 92.31 2 50.00
27184. Ons (onsali20) 4 86.84 99.70 3 75.00
27185. Garrison (garrison111) 4 76.17 86.06 1 25.00
27186. ema (emav69) 4 70.92 74.36 1 25.00
27187. Finn (finn22) 4 78.99 86.88 2 50.00
27188. Justin (rainiak) 4 81.79 84.04 1 25.00
27189. uWu (zatmir) 4 46.36 48.45 1 25.00
27190. emily (emi_panda) 4 56.14 57.75 0 0.00
27191. Sly (sly_wolf62) 4 94.19 105.97 2 50.00
27192. Hynerd (skywalker190208) 4 38.31 42.46 0 0.00
27193. Twisted (twistedyoyo20) 4 78.50 83.39 0 0.00
27194. Tien (hinhid89) 4 44.51 53.84 0 0.00
27195. Matt (duckrobin) 4 86.27 94.50 2 50.00
27196. Sudipto (sudiptoshuvo) 4 64.35 77.10 2 50.00
27197. Friday (meli0us) 4 84.54 94.05 4 100.00
27198. mayyy (maybb) 4 67.96 72.75 0 0.00
27199. Danilo (ddcj) 4 82.61 92.91 0 0.00
27200. Oppyyy (oppyyy) 4 44.30 50.12 0 0.00
27201. Bowen (bobobang2) 4 36.89 40.94 0 0.00
27202. Paul (okonkwo9) 4 72.28 76.42 0 0.00
27203. V (moonhiee) 4 71.54 84.87 2 50.00
27204. K (netsukei) 4 80.32 91.11 3 75.00
27205. Pandaemonium (pandaemonium) 4 86.08 93.62 3 75.00
27206. Paul C (pccomputer) 4 69.35 72.81 1 25.00
27207. One (morfar123) 4 75.42 80.28 4 100.00
27208. Sams (sams_) 4 45.00 49.42 1 25.00
27209. Gary (raresiren292) 4 45.02 50.32 0 0.00
27210. Rahmone (rahmone) 4 94.18 98.39 2 50.00
27211. Aria (ariamm) 4 48.96 58.75 0 0.00
27212. j (atribecalledquest) 4 101.14 110.52 2 50.00
27213. Anthony (therealdrum) 4 47.25 50.56 2 50.00
27214. sam (tritoke) 4 78.93 83.56 1 25.00
27215. Dario (dariolol) 4 61.06 68.78 1 25.00
27216. Antonio (astaroth278) 4 51.80 54.61 1 25.00
27217. Curiosity (im_koruto) 4 33.32 36.58 0 0.00
27218. tanly (tanlyk) 4 53.49 58.84 0 0.00
27219. JustSeeker (seeker_playz) 4 66.38 71.47 1 25.00
27220. Crsytal (crystalfyre) 4 31.10 35.40 0 0.00
27221. silvia (silvichu) 4 98.63 109.72 3 75.00
27222. Harry (taylor23harry) 4 81.81 88.55 3 75.00
27223. Blaze (blazw_real) 4 72.24 77.49 2 50.00
27224. Micah (injury_upstairs) 4 54.18 59.73 1 25.00
27225. Aaron (eunskim9) 4 110.44 121.13 2 50.00
27226. Cubiss (cubiss) 4 80.49 87.21 1 25.00
27227. Daredevil (prathameshparit) 4 60.72 66.50 1 25.00
27228. Anthony (tonycalrya) 4 78.39 90.45 4 100.00
27229. Lesky (leskalon) 4 79.55 85.84 1 25.00
27230. Alex (aambro64) 4 74.12 80.32 0 0.00
27231. Ape (fz3725) 4 83.12 85.61 1 25.00
27232. zainelden (zain_22) 4 40.75 46.37 0 0.00
27233. Tai (kronnn) 4 49.19 52.60 0 0.00
27234. Damian (drroxx) 4 52.57 59.36 1 25.00
27235. Eric (thysolar) 4 84.17 98.80 0 0.00
27236. EerDick (eerdick) 4 80.46 91.12 1 25.00
27237. Daniel (zetsuno) 4 76.71 86.16 3 75.00
27238. Josiah (jojesus) 4 102.11 109.26 4 100.00
27239. Gabriel (smileztypes) 4 96.36 111.19 1 25.00
27240. Gareon (axolotlz) 4 47.98 55.64 1 25.00
27241. Asami Sato (asamisato) 4 100.65 108.41 1 25.00
27242. Alex (aaaaaaaa8) 4 52.78 57.33 1 25.00
27243. Sahil (epsilon573) 4 57.61 61.25 4 100.00
27244. chris (chrishuang) 4 93.13 103.14 0 0.00
27245. martin cabello iii (marcodr... 4 103.19 112.55 2 50.00
27246. R (s0401067) 4 71.33 74.51 3 75.00
27247. rishi (zodi99) 4 51.56 55.66 0 0.00
27248. Joshua (your_boi2249) 4 63.65 68.63 0 0.00
27249. Zack (zlaskow) 4 92.25 97.44 3 75.00
27250. Jack (backpack_jack) 4 65.67 71.30 1 25.00
27251. Dan (dhogan) 4 75.55 89.91 0 0.00
27252. Cory (takfull) 4 48.42 57.08 0 0.00
27253. Ionescu (ihrom) 4 120.87 136.21 2 50.00
27254. Fake Guest (cochodau) 4 81.94 92.05 2 50.00
27255. Didoe (didoe) 4 77.79 82.47 0 0.00
27256. fire (firemyballz) 4 71.19 79.26 1 25.00
27257. Kush (kushmaster) 4 95.90 121.46 1 25.00
27258. Creature247 (creature247) 4 51.27 59.06 0 0.00
27259. vic (dexireds) 4 110.99 133.39 2 50.00
27260. Chris (baigels) 4 64.98 77.02 0 0.00
27261. Technoyams (pimplehead) 4 57.40 63.62 1 25.00
27262. Tanner (phorox99) 4 112.87 122.59 2 50.00
27263. Michael (derpymurloc) 4 83.13 92.15 0 0.00
27264. Christian (modernfallacy) 4 72.52 76.97 0 0.00
27265. aws (awsmate) 4 59.77 72.61 3 75.00
27266. Lester (pokeaye) 4 89.98 103.03 1 25.00
27267. Julian (lantrajul99) 4 88.60 95.27 1 25.00
27268. Jennifer (bigbeanondiscord) 4 68.16 75.20 2 50.00
27269. Adam (headtaker) 4 53.44 55.92 0 0.00
27270. Pereira (pereirakawaii) 4 74.92 77.05 1 25.00
27271. Bryan (brakuya888) 4 89.76 103.60 1 25.00
27272. Maarten (toolateqt) 4 52.59 57.16 1 25.00
27273. John (wilkieman) 4 70.75 93.24 3 75.00
27274. Jason (jasonh34) 4 80.59 100.23 2 50.00
27275. Socks (socksjap) 4 91.95 103.95 3 75.00
27276. Sixhexes (sixhexes) 4 73.43 81.90 3 75.00
27277. Stillian (deadnit1_) 4 88.97 104.73 2 50.00
27278. Caden (cadeng1) 4 94.96 109.99 1 25.00
27279. Abby (ab1gael) 4 52.51 57.31 2 50.00
27280. whappened (axis_tilt) 4 80.01 94.17 3 75.00
27281. Yeemail (yeemail) 4 77.34 85.46 2 50.00
27282. Jigglytuft (jigglytuft) 4 90.22 96.06 1 25.00
27283. Montexic (montexic) 4 81.94 95.47 1 25.00
27284. Force (forcebuilder) 4 92.57 105.78 1 25.00
27285. Sloth (slothgod) 4 83.24 91.50 4 100.00
27286. Chulaluck (chulaa14) 4 83.40 92.63 0 0.00
27287. Dahyun (datzu) 4 97.34 121.46 1 25.00
27288. Nancy (nancyb5) 4 47.22 49.71 1 25.00
27289. EmerDuck (emerduck) 4 31.06 37.38 0 0.00
27290. Soumyajoy (soumyajoydas01) 4 39.69 40.69 0 0.00
27291. JP (girkingume) 4 57.34 61.38 1 25.00
27292. leo (leo_zaddy) 4 32.23 36.09 0 0.00
27293. Paddy (weepaddy) 4 93.30 103.26 2 50.00
27294. Joel (fiyinqbread) 4 57.82 63.33 1 25.00
27295. zidbon (zidbon) 4 41.17 46.77 0 0.00
27296. guest (privat) 4 67.29 71.18 1 25.00
27297. Nectar (negtar) 4 43.24 49.93 0 0.00
27298. Hinn (hxnn) 4 93.05 98.96 3 75.00
27299. Mairon (mairont) 4 30.85 32.33 0 0.00
27300. itsme_Subid (itsmesubid) 4 25.83 28.83 0 0.00
27301. Kate (kgw11) 4 65.23 68.53 0 0.00
27302. Aleksandar (bazzbuzzbazz) 4 54.04 58.28 1 25.00
27303. Smriti (smritimdhr) 4 65.13 72.49 3 75.00
27304. biscuit (biscuit112) 4 89.22 98.58 1 25.00
27305. biscuits (veronicalo) 4 80.53 85.92 0 0.00
27306. Zeek (zeekdeek) 4 73.23 77.49 1 25.00
27307. Wasif (wasif_abtahi) 4 78.95 85.57 3 75.00
27308. jessamine (jessaminer) 4 86.91 90.73 2 50.00
27309. Nicholas (nuilifieds) 4 143.17 158.31 4 100.00
27310. Wyanne (wyannethewat) 4 54.36 60.10 0 0.00
27311. Luke (speedy7typer) 4 51.57 56.38 0 0.00
27312. ShinPyro (shinpyro) 4 50.29 62.59 1 25.00
27313. modred (modredias) 4 54.82 62.73 1 25.00
27314. Darkshadow (darkshadow2312) 4 39.14 45.67 0 0.00
27315. Guest (__guest_) 3 105.13 120.28 1 33.33
27316. Paul (_separate) 3 74.92 83.57 0 0.00
27317. lia (_lia1_) 3 37.91 41.88 0 0.00
27318. kenboi (_kenboi) 3 105.52 117.50 2 66.67
27319. Ian (_iii_an) 3 96.80 105.75 2 66.67
27320. Frito (_frito) 3 91.63 100.92 0 0.00
27321. bad (_dingus) 3 129.45 139.98 3 100.00
27322. ZZ (zztypes) 3 74.64 81.90 1 33.33
27323. Shoaib😂🔫 (zvje2da) 3 65.68 70.88 1 33.33
27324. zuwuz (zuwuz) 3 102.78 103.64 1 33.33
27325. Zack (zrobjohn) 3 79.67 88.04 0 0.00
27326. QUACK (zooming235) 3 66.48 68.64 0 0.00
27327. unknown (zoom777) 3 79.44 90.86 2 66.67
27328. zo (zohway) 3 80.24 89.06 0 0.00
27329. ZlotZ (zlotz) 3 101.40 109.38 0 0.00
27330. Z (zixosa) 3 58.80 59.77 0 0.00
27331. Noah (zipzapimoncrack) 3 62.01 62.70 1 33.33
27332. Preston (ziphyy) 3 84.82 91.29 2 66.67
27333. Ziad (zinafzi) 3 23.75 27.93 1 33.33
27334. Jill (zilzili) 3 56.85 67.65 1 33.33
27335. Zid (zid1312) 3 71.08 75.14 3 100.00
27336. Jess (zhoujt23) 3 87.55 97.56 0 0.00
27337. Neyman-Pearson (zhenchao) 3 63.16 63.57 0 0.00
27338. zyn (zezyn) 3 101.88 112.66 1 33.33
27339. Zero (zerowaffles) 3 93.51 106.98 1 33.33
27340. Zerokles (zerokles) 3 113.67 118.75 2 66.67
27341. Furkan (zerdlai) 3 48.40 60.24 1 33.33
27342. Davey (zenyatta_main) 3 92.10 98.43 2 66.67
27343. Zekrew (zekrew) 3 74.30 82.10 2 66.67
27344. Zeb (zebstrikal) 3 93.07 95.98 3 100.00
27345. Sabin (zealousy) 3 76.65 77.66 2 66.67
27346. Mike (zaza_wolfv2) 3 78.32 83.62 0 0.00
27347. Zane (zanecoldyt) 3 28.83 29.85 0 0.00
27348. J (yzy1234) 3 93.64 100.44 1 33.33
27349. alexander (yummyspiderman) 3 85.93 102.56 0 0.00
27350. Kit (yukit123) 3 67.85 70.01 1 33.33
27351. Shakres (yukikow14) 3 57.59 65.46 0 0.00
27352. Yugant (yuga009) 3 58.32 72.88 0 0.00
27353. Youwho1234567 (youwho1234567) 3 51.48 53.81 1 33.33
27354. Yora (yorad) 3 47.97 52.53 1 33.33
27355. YonYon (yonyon205) 3 64.22 67.00 2 66.67
27356. Angel (yomommaspimp) 3 43.36 47.88 0 0.00
27357. scut-黄光积 (yh_1314) 3 64.44 65.58 0 0.00
27358. Gyeoulie (yennie) 3 94.33 98.26 1 33.33
27359. Yellow (yellowbow) 3 87.36 96.64 1 33.33
27360. keker (yash117) 3 118.58 121.96 1 33.33
27361. EC (yapenchong1) 3 70.71 72.51 1 33.33
27362. Yagiz (yagizbahadiroglu) 3 90.99 96.37 3 100.00
27363. Yael (yaeltellez) 3 60.40 65.36 1 33.33
27364. neko (yabaicat) 3 88.79 97.10 3 100.00
27365. y (y1266) 3 79.40 88.73 0 0.00
27366. Eggnog (y0ink) 3 146.11 161.84 1 33.33
27367. Corbin (xx_nut_xx) 3 68.10 71.22 1 33.33
27368. Behind (xx_blaze_xx) 3 64.56 65.62 0 0.00
27369. Nicole (xxnicolexx) 3 125.72 135.67 3 100.00
27370. David (xpoes) 3 100.41 105.11 2 66.67
27371. Nikan (xnikan) 3 114.18 124.59 2 66.67
27372. Spaketi (xngelic) 3 70.34 74.46 1 33.33
27373. Xmen (xmen1404) 3 74.32 82.17 1 33.33
27374. Jakubi (xmask) 3 81.00 81.14 1 33.33
27375. Francisco (xikinho21) 3 58.23 60.35 2 66.67
27376. xiu (xihuan) 3 69.96 93.67 0 0.00
27377. Dennis (xdmeneer) 3 99.22 106.34 2 66.67
27378. Max (xdevilwastaken) 3 62.28 69.20 0 0.00
27379. ravi (xdbanterman321) 3 94.69 101.63 0 0.00
27380. XA25 (xa25) 3 65.74 72.83 1 33.33
27381. wyss (wyss) 3 93.59 102.26 1 33.33
27382. Tsuki (wumi4) 3 70.85 74.88 1 33.33
27383. work in (work_in_progress) 3 132.28 150.10 3 100.00
27384. WongMan4U (wongmanforyou) 3 53.66 56.39 1 33.33
27385. I.M. (wonderl4nd_puff) 3 39.60 41.41 0 0.00
27386. Wonder Bread (wonder590) 3 78.59 80.20 0 0.00
27387. Will (wombat50ng) 3 71.27 81.99 0 0.00
27388. woejang (woejang) 3 65.22 67.64 1 33.33
27389. kristjan (wlayzer) 3 68.95 76.68 0 0.00
27390. Wizard (wizardtypist) 3 77.93 82.36 1 33.33
27391. T (wish_i_could_type) 3 84.62 89.03 1 33.33
27392. windwend (windywendi) 3 73.55 79.63 1 33.33
27393. Will (winam777) 3 89.14 93.36 0 0.00
27394. Ngoc (windblossom0520) 3 66.66 69.95 0 0.00
27395. Ruby (wimbleruby) 3 54.73 63.84 0 0.00
27396. Wilbert (wil_bwrt) 3 74.99 82.16 0 0.00
27397. Will (willtang) 3 126.05 133.57 2 66.67
27398. Willjum (willjum) 3 66.98 83.14 0 0.00
27399. William (williamusa) 3 104.62 114.21 1 33.33
27400. Ree (wild_reemoo) 3 90.30 99.40 1 33.33
27401. Wawan Cahyo (wildanie12) 3 76.50 80.85 1 33.33
27402. Harold (who_da_penguin) 3 97.18 105.32 1 33.33
27403. Isaac (whosisaac) 3 85.15 89.38 2 66.67
27404. WhooAre_you (whooare_you) 3 55.66 73.50 1 33.33
27405. Sebastian (whipees) 3 38.18 41.27 0 0.00
27406. whattywhat (whattywhat) 3 91.16 92.98 0 0.00
27407. Emryys (whako1337) 3 84.56 102.47 1 33.33
27408. Werdna (werdnawerd) 3 100.77 104.22 2 66.67
27409. Marty (wender97) 3 67.33 70.51 0 0.00
27410. Will (wdoutreband) 3 95.97 107.95 1 33.33
27411. wayson (wayson) 3 66.47 69.35 0 0.00
27412. German (wat_germy) 3 83.87 112.38 1 33.33
27413. Ethan (waterman111) 3 65.75 68.87 3 100.00
27414. Dio (waterboyz) 3 85.27 91.01 2 66.67
27415. Joe (watchtheskies) 3 50.17 56.05 0 0.00
27416. Wasshi- (wasshi) 3 106.83 111.96 0 0.00
27417. hula (wasd1234) 3 93.85 100.70 2 66.67
27418. alireza (warlord_08) 3 61.29 62.35 0 0.00
27419. Warhio (warhio) 3 42.98 48.69 0 0.00
27420. tstats[wardenod17] (wardeno... 3 116.19 124.18 1 33.33
27421. Andrew (warden99) 3 112.59 118.18 3 100.00
27422. C4 (wantsomedeath) 3 73.95 83.26 1 33.33
27423. Kunpeng (wankupi) 3 53.95 57.98 2 66.67
27424. isaiah (wamuuuu) 3 83.03 94.66 1 33.33
27425. Phil (walter_mittys_left_kn... 3 77.11 83.26 1 33.33
27426. Walker (walkers12) 3 97.74 103.12 1 33.33
27427. samren (walker452) 3 122.72 131.87 3 100.00
27428. waleed (waleedbinkhalid) 3 74.29 81.89 1 33.33
27429. Albert (waifu420) 3 70.27 76.39 0 0.00
27430. wae (wae_da_algae) 3 109.37 121.46 3 100.00
27431. Adam (w0nsh) 3 107.50 117.14 3 100.00
27432. Tu (vuanhtu52) 3 81.53 90.12 0 0.00
27433. Vrapas (vrapas) 3 57.05 61.35 2 66.67
27434. Steven (vosstingy) 3 90.59 93.44 1 33.33
27435. Charleston (voltricity) 3 61.59 66.83 2 66.67
27436. Eshcole (volcanic515) 3 54.02 58.81 0 0.00
27437. Shukrullo (vodiylik) 3 59.83 64.07 0 0.00
27438. Vaughn (vlonebay) 3 63.32 64.48 1 33.33
27439. Vladimir (vladimirrl) 3 135.66 154.38 3 100.00
27440. vitus (vituschabreholm) 3 50.49 51.61 0 0.00
27441. vishnukumar (vishnu_kumar) 3 51.47 54.08 1 33.33
27442. vishal (vishal2005) 3 72.53 81.26 0 0.00
27443. V (vinn9) 3 66.64 67.67 1 33.33
27444. Said (villager4) 3 78.76 84.36 0 0.00
27445. vic (vikk1234) 3 72.71 78.08 0 0.00
27446. vikash (vikash_hembram) 3 58.04 65.09 1 33.33
27447. viixonn (viixonn) 3 33.21 37.23 1 33.33
27448. Vihanga (vihangatheturtle) 3 40.73 47.08 0 0.00
27449. Vihaan (vihaan89) 3 70.81 85.71 1 33.33
27450. Vince (vietzerg) 3 82.60 85.46 0 0.00
27451. Wouter (victorylion97) 3 104.25 105.75 0 0.00
27452. Victor (victorsaurus) 3 98.32 105.99 1 33.33
27453. Anip (vibeth) 3 97.72 109.54 1 33.33
27454. Androide (vforvali) 3 91.25 96.87 2 66.67
27455. Vivian (vesperine) 3 122.70 144.38 2 66.67
27456. Omar (versohnne_1) 3 102.86 116.00 3 100.00
27457. Verilly (verilly) 3 91.12 95.84 3 100.00
27458. Ashutosh (vegeta_2001) 3 64.06 68.39 1 33.33
27459. veeru (veeru_05) 3 33.06 34.29 0 0.00
27460. Romeo (vatecoucher21) 3 80.54 83.68 0 0.00
27461. Varenuk (varenuk) 3 79.24 88.13 0 0.00
27462. Antonio (vaping_tony96) 3 35.21 35.72 0 0.00
27463. Vanja (vanjamc) 3 66.19 70.15 1 33.33
27464. Ivan (vanchi822) 3 44.90 51.44 0 0.00
27465. Tayden (vanage) 3 60.11 64.06 2 66.67
27466. Maxim (vamsire) 3 85.65 94.92 1 33.33
27467. vamoshi (vamoshi) 3 71.54 73.12 0 0.00
27468. Valzor (valzor) 3 94.66 97.69 2 66.67
27469. (valikor) 3 133.05 138.87 3 100.00
27470. vaintez (vaintez) 3 92.09 107.90 1 33.33
27471. Goodwill (vadrone) 3 76.45 88.82 0 0.00
27472. Banana (vadai) 3 58.50 61.02 0 0.00
27473. Vache (vacheka) 3 89.54 96.38 0 0.00
27474. David (u_david) 3 63.12 65.66 2 66.67
27475. Bob (user4) 3 79.67 82.51 0 0.00
27476. gusss (ursu718) 3 75.21 76.17 2 66.67
27477. Uriel (urielhainzl) 3 99.50 107.63 2 66.67
27478. Aarsh (upward_leap) 3 75.18 85.29 0 0.00
27479. Katelyn (upperbutt) 3 133.69 143.64 1 33.33
27480. Bartek (unua) 3 82.42 85.43 0 0.00
27481. Guus (untitledgoos) 3 46.27 49.49 1 33.33
27482. UnSeen212 (unseen212) 3 79.79 87.92 2 66.67
27483. unknowndivide (unknowndivide) 3 54.01 59.70 0 0.00
27484. Aaron (unhuggity) 3 91.01 97.19 1 33.33
27485. Illusive (uneducated_scholar) 3 59.93 66.22 0 0.00
27486. Johnathan (uneasybbj) 3 77.58 78.57 0 0.00
27487. undecipherable (undeciphera... 3 34.61 35.56 0 0.00
27488. uncle jiggy (unclejiggy) 3 73.00 80.90 1 33.33
27489. Christian (umadandrei) 3 90.54 93.23 1 33.33
27490. Reniar (ulaner1_) 3 85.84 91.66 2 66.67
27491. Ulaai (ulaai) 3 61.71 65.43 1 33.33
27492. Vincent (uincent) 3 60.38 62.18 0 0.00
27493. brandan (uepuejq) 3 123.96 137.92 2 66.67
27494. Thomas (uedoh) 3 111.38 113.91 1 33.33
27495. Ken (tzekenster) 3 111.72 113.64 3 100.00
27496. Andy (tyranttick) 3 111.91 115.40 1 33.33
27497. Tommy (typrtommy) 3 67.98 73.51 3 100.00
27498. typos (typos247) 3 50.21 52.70 0 0.00
27499. NEVER RESET (typing_is_hard... 3 109.98 113.16 0 0.00
27500. type (typesuck) 3 71.25 73.85 0 0.00
27501. Nah (typereally) 3 82.80 89.35 3 100.00
27502. benzhayeed (typemaster2004) 3 53.81 56.86 0 0.00
27503. Robert (typefingerpl) 3 87.28 89.54 0 0.00
27504. e (typecrazyyy) 3 65.63 69.33 0 0.00
27505. Tyler (tylerota2) 3 103.07 111.88 2 66.67
27506. Bryan (tylanstor) 3 118.87 131.00 2 66.67
27507. Tarun (twyoooo) 3 69.03 72.11 0 0.00
27508. Two - (twojokers) 3 82.75 89.67 2 66.67
27509. TvHead (tvhead) 3 71.93 81.47 2 66.67
27510. Heitor (tutesthetyper) 3 76.82 79.46 0 0.00
27511. Johan (turbongus) 3 73.67 90.54 0 0.00
27512. tuna (tunacore) 3 76.09 85.82 0 0.00
27513. Trim (tuechombe) 3 87.34 90.00 2 66.67
27514. Lucas (tublessdart) 3 74.89 76.74 1 33.33
27515. Sinatec (ttv_sinatec) 3 88.86 102.29 2 66.67
27516. Taylor (tttaylor) 3 93.62 107.16 3 100.00
27517. Travis (ttomich) 3 41.23 43.38 1 33.33
27518. t (ttha) 3 111.90 112.54 2 66.67
27519. Terence (tt9000) 3 96.93 107.28 3 100.00
27520. Ali (tsunali) 3 64.10 77.17 3 100.00
27521. Tsogtbayar (tsogtbayarbox) 3 66.84 73.33 1 33.33
27522. Raffael (tschuebi) 3 91.33 101.50 3 100.00
27523. Parker (tsayp) 3 104.45 116.60 3 100.00
27524. Aidan (tryingacrobat52) 3 58.11 59.50 0 0.00
27525. Tryhardest (tryhardest) 3 93.61 100.63 3 100.00
27526. Limbo (trulylimbogene) 3 110.28 115.28 1 33.33
27527. Jake (truejake) 3 131.07 143.87 3 100.00
27528. trucle (tructruc) 3 67.22 69.34 0 0.00
27529. Michael (trotskyy) 3 48.00 50.97 0 0.00
27530. Conner (tropicul) 3 85.90 106.08 2 66.67
27531. trias (trobles) 3 66.38 74.50 1 33.33
27532. Tristan (tristanhilton85) 3 89.41 92.17 0 0.00
27533. Tristan (tristandavoulas) 3 104.48 108.52 2 66.67
27534. Jonathan (trintrun2) 3 84.69 91.20 3 100.00
27535. Typer_Guru (trinity_max) 3 50.43 51.94 2 66.67
27536. Trihedral (trihedral) 3 110.72 116.22 1 33.33
27537. Evan (trigger8) 3 69.95 77.11 0 0.00
27538. Benji (triforce04) 3 74.12 77.31 0 0.00
27539. Trey (trey113) 3 83.28 87.08 0 0.00
27540. treesrnice (treesrnice) 3 76.60 84.15 1 33.33
27541. Tommy (treemantom) 3 91.40 100.54 0 0.00
27542. TrChik (trchik) 3 80.63 83.96 3 100.00
27543. Trav (travm) 3 98.04 104.32 0 0.00
27544. Travis (travisrussell) 3 64.98 74.22 1 33.33
27545. Umbra (tratosian) 3 100.26 115.44 1 33.33
27546. Treeler (trackertree) 3 46.43 54.96 0 0.00
27547. Tozu (tozu2) 3 108.74 117.28 1 33.33
27548. Tom (totallytom) 3 66.25 67.01 0 0.00
27549. Tortol (tortol) 3 108.43 112.23 0 0.00
27550. Vulcan_Onion (top500pro) 3 52.25 61.19 0 0.00
27551. Andre (toothpickjanitor) 3 57.74 61.55 0 0.00
27552. chipmunk (tonyboi) 3 90.03 93.48 2 66.67
27553. Tonmai (tonmaiisawesome) 3 91.03 104.28 2 66.67
27554. tomtom (tomtomm) 3 104.38 124.57 1 33.33
27555. To (tomo01) 3 100.87 106.20 1 33.33
27556. Viper (tomp2) 3 60.89 66.03 0 0.00
27557. Tommy (tomdollars) 3 72.74 74.00 0 0.00
27558. Vincent (tokiix) 3 130.22 133.44 3 100.00
27559. Tobie (tobberd) 3 89.16 94.55 0 0.00
27560. natetron (toasterboy5) 3 116.33 131.99 1 33.33
27561. T_nology (tnology) 3 112.46 121.31 3 100.00
27562. Travis (tjgrant309) 3 103.31 122.71 2 66.67
27563. Tina (tinanuggi) 3 107.46 115.52 0 0.00
27564. Tiffany Hwang (tiffany_hwang) 3 85.92 99.28 1 33.33
27565. (tieninator07) 3 81.10 85.96 0 0.00
27566. Tidez (tidez3) 3 87.42 89.43 1 33.33
27567. Amin (thyfoeracer) 3 111.29 118.74 1 33.33
27568. JOHN (thunderstormsamset) 3 51.86 56.02 0 0.00
27569. thunder (thundersico) 3 64.00 67.60 0 0.00
27570. Thunderer (thunderer) 3 57.32 66.35 1 33.33
27571. Dorian (thrashdivision) 3 64.97 86.94 1 33.33
27572. Thomas (thomasgp98) 3 81.03 84.22 0 0.00
27573. drywalleater34 (thiccblah_) 3 98.17 108.61 1 33.33
27574. Kevin (the_pacifist) 3 68.10 74.21 1 33.33
27575. Shreyas (the_mediocre_gatsby) 3 38.56 41.62 0 0.00
27576. Dipu Kumar (the_marvello_op) 3 56.10 62.67 1 33.33
27577. Leo (the_e_lemonator) 3 97.38 108.53 2 66.67
27578. They23 (they23) 3 78.09 84.23 1 33.33
27579. TheUnMin (theunmin) 3 83.43 90.43 3 100.00
27580. tech (thetechboy) 3 109.80 114.70 1 33.33
27581. devinkhell (thesilverbrid) 3 95.33 101.51 1 33.33
27582. Joshua (thesensinator) 3 130.71 134.10 2 66.67
27583. Christian (theponce88) 3 79.15 81.97 0 0.00
27584. TheMining72 (themining72) 3 89.03 97.77 2 66.67
27585. Sebastian (themanblevins) 3 76.19 80.68 1 33.33
27586. based (thelettuceman) 3 63.34 66.04 0 0.00
27587. TheKRAM (thekram) 3 89.35 91.25 1 33.33
27588. NahFam (thekojiman) 3 77.08 81.82 2 66.67
27589. A (thekingwindsor) 3 65.74 71.48 0 0.00
27590. M. (thehoaxshow) 3 73.84 78.29 0 0.00
27591. godspeed (thegr8kabeer) 3 69.04 69.75 0 0.00
27592. Casey (thefearedturtle) 3 96.53 100.75 3 100.00
27593. TheEwaffle (theewaffle) 3 65.44 66.99 0 0.00
27594. Rusterton (theeg3) 3 92.51 104.70 0 0.00
27595. Radford (theegg) 3 78.62 82.23 1 33.33
27596. adin (thedvoraktypist) 3 116.29 118.59 1 33.33
27597. A (thedirtysouth) 3 78.61 88.25 0 0.00
27598. bk (thebriankwon) 3 104.12 114.85 0 0.00
27599. Adam (thebeast1235) 3 68.80 79.52 0 0.00
27600. Ichiro (theanalyst9344) 3 81.78 87.81 0 0.00
27601. TheAluMinion (thealuminion) 3 95.06 98.14 1 33.33
27602. Tristan (thavelick) 3 60.57 64.75 0 0.00
27603. Guy (thatguyrsa) 3 50.48 56.11 0 0.00
27604. Bradley (tgun) 3 121.41 128.07 1 33.33
27605. Burrito (tgmburrito) 3 92.27 100.69 0 0.00
27606. Tezzori (tezzori_ikki) 3 75.16 83.44 1 33.33
27607. Tey (teyy) 3 67.19 69.61 1 33.33
27608. Tevanuk (tevanuk) 3 75.54 78.75 0 0.00
27609. tengen (tete_12) 3 74.68 85.53 1 33.33
27610. Jordy (testingkeyboard) 3 90.32 96.88 1 33.33
27611. Tesseus (tesseus) 3 107.87 123.16 1 33.33
27612. TEMUCHIN (temuchin) 3 21.20 23.14 0 0.00
27613. pat (teloi) 3 97.01 102.61 2 66.67
27614. Naufal (tehonionpotato) 3 80.51 93.60 1 33.33
27615. TeeDoe (teedoe) 3 74.43 80.16 1 33.33
27616. Austin (teddy_0351) 3 62.27 67.75 2 66.67
27617. Taylor (tayylorngo) 3 108.36 113.84 2 66.67
27618. TayyabPW (tayyabpw) 3 96.19 101.63 1 33.33
27619. Taukekhan (taukekhan) 3 58.39 67.53 0 0.00
27620. Steven (tasgu) 3 82.17 99.82 0 0.00
27621. yst (taro311) 3 119.28 125.21 3 100.00
27622. Alexander (taklit) 3 83.07 91.94 2 66.67
27623. Rustylee (tairl) 3 94.40 105.59 3 100.00
27624. Erek-Shin (t0sh1ro) 3 87.56 91.39 1 33.33
27625. szxlfik (szxlfik) 3 75.15 78.71 2 66.67
27626. Evan (syzer7) 3 68.36 72.60 0 0.00
27627. Kelvin (syraxius) 3 172.04 173.66 3 100.00
27628. sylk (sylk28) 3 92.69 104.14 2 66.67
27629. SwordSwarm (swordswarm) 3 98.90 106.94 2 66.67
27630. bruh (swordsbeef) 3 76.42 85.19 0 0.00
27631. Reno (swifturtle) 3 91.09 92.75 2 66.67
27632. Luke (swarmington5) 3 70.64 80.74 2 66.67
27633. donald balls (swag_man_unli... 3 88.54 93.10 1 33.33
27634. Sonia (swagaholik) 3 102.30 110.68 1 33.33
27635. Steven (sw66666) 3 90.80 94.32 1 33.33
27636. Suze (suze_com) 3 77.90 80.35 1 33.33
27637. Joshua (suresoar) 3 41.34 43.06 0 0.00
27638. Stefan (superman0904) 3 83.92 88.50 0 0.00
27639. Andy (superchubs) 3 99.98 102.60 2 66.67
27640. xiaobai (superbarnie) 3 117.49 120.79 1 33.33
27641. Eden (sunkmantis) 3 87.24 92.32 1 33.33
27642. Sun (suncrusader) 3 100.08 109.49 2 66.67
27643. Sunaiart (sunaiart) 3 88.84 94.44 0 0.00
27644. SuKu (suku_586) 3 80.15 88.18 1 33.33
27645. Suka (sukab1itz) 3 82.07 89.12 1 33.33
27646. Sujith (sujith2005) 3 75.03 85.45 0 0.00
27647. bigfatchickan (suchaslowpoke) 3 79.64 88.27 1 33.33
27648. suchcookies (suchcookies) 3 66.56 68.37 0 0.00
27649. Subhankar (subhankarch) 3 54.17 60.39 0 0.00
27650. suancreative (suancreative) 3 70.95 75.62 1 33.33
27651. Dan (stun100) 3 58.72 68.80 0 0.00
27652. S (stu217) 3 113.28 122.78 2 66.67
27653. Wietse (stroopwafel123) 3 82.27 88.08 0 0.00
27654. Striker (strikerfury) 3 78.81 85.53 2 66.67
27655. StrawHat (strawhat_amine) 3 64.05 64.75 1 33.33
27656. Daniel (stompy361) 3 48.50 50.10 0 0.00
27657. Ollie (stillcanttouchtype) 3 76.41 85.45 0 0.00
27658. Steve (stevehauser11) 3 50.12 50.89 0 0.00
27659. Steve (steveeeeeeeeeeee2) 3 92.05 100.02 0 0.00
27660. Jashua (stelless) 3 92.00 111.22 0 0.00
27661. Stella (stellafav) 3 115.09 128.84 1 33.33
27662. SteffVz (steffvz) 3 60.82 65.72 1 33.33
27663. sander (starkseven) 3 47.32 49.10 0 0.00
27664. poop (stanloon1231) 3 108.14 118.13 1 33.33
27665. Danish (stampynoob) 3 54.61 56.12 0 0.00
27666. Saurabh (ssb456) 3 20.09 21.64 0 0.00
27667. COCO (sryulose) 3 93.85 99.64 0 0.00
27668. Sri Akshya (sri_akshya) 3 72.22 81.98 0 0.00
27669. zoomingfastaf (imfastafb0i) 3 85.76 91.81 0 0.00
27670. Victor (sravn) 3 102.68 114.55 2 66.67
27671. Paraducks (sras208) 3 28.85 31.75 0 0.00
27672. Squidyguin (squidyguin) 3 68.33 69.86 0 0.00
27673. Nich (squiddyjohnlong) 3 44.31 46.53 0 0.00
27674. David (squeetus) 3 121.06 126.17 2 66.67
27675. Squeeb (squeeb) 3 76.71 101.57 1 33.33
27676. Miles (squarepeanut) 3 70.08 80.62 2 66.67
27677. SPOU1 (spou1) 3 37.52 43.93 0 0.00
27678. Spookee (spookee) 3 84.57 93.50 1 33.33
27679. spiky (spikyy) 3 114.88 120.34 2 66.67
27680. hehe (spicyaim) 3 87.50 90.70 1 33.33
27681. S (spencers0730) 3 67.35 76.51 0 0.00
27682. spelling (spellingglitch) 3 82.96 84.74 0 0.00
27683. Speed (speed_weed1) 3 92.21 102.74 2 66.67
27684. Speed Typing (speedytypingyt) 3 128.34 137.63 3 100.00
27685. fastboi (speedofwhite) 3 102.69 119.60 2 66.67
27686. w (speeder_skrr) 3 105.24 119.81 1 33.33
27687. Mike (specialized) 3 96.18 103.05 1 33.33
27688. Sparik (sparik) 3 88.57 89.95 1 33.33
27689. Glenn (spanishomelette) 3 81.25 94.95 1 33.33
27690. spacy (spacyarie) 3 60.32 71.90 1 33.33
27691. Richie (sovitou) 3 88.54 101.88 1 33.33
27692. souvlakeeb (souvlakeeb) 3 66.15 71.55 1 33.33
27693. SoundtrackDan (soundtrackdan) 3 110.21 120.70 2 66.67
27694. Jeffrey (sorisque) 3 103.93 106.67 0 0.00
27695. Sky (soranohana) 3 67.69 73.54 0 0.00
27696. justin (sonzoffury) 3 91.35 97.79 1 33.33
27697. sondosensei (sondosensei) 3 88.38 100.61 0 0.00
27698. solarwind (solarwind75) 3 59.10 75.82 1 33.33
27699. EINSWOOD (solaire119) 3 105.57 113.22 1 33.33
27700. Iamslow (softshui) 3 110.16 114.53 2 66.67
27701. Snowy (snowyhessh) 3 118.62 127.46 2 66.67
27702. Savannah (snowyaussie) 3 122.19 131.82 3 100.00
27703. Sayan (snbk97) 3 48.11 51.26 0 0.00
27704. Snugget (snaiel) 3 76.85 88.52 1 33.33
27705. Xavi (smithtimmytim) 3 62.64 64.33 2 66.67
27706. Smine (sminerino) 3 84.43 98.79 0 0.00
27707. eldon (smile4dasight) 3 84.97 89.22 1 33.33
27708. rt (smigglewiggle23) 3 64.74 68.75 3 100.00
27709. kkgbyn (slyle) 3 129.04 140.10 1 33.33
27710. John Brent (slow_turtle6278) 3 50.57 51.75 1 33.33
27711. Aidan (slowdownplz) 3 54.23 63.16 0 0.00
27712. tico (slowcheetah) 3 72.86 73.99 0 0.00
27713. Jacob (slipperysloper) 3 64.01 71.99 1 33.33
27714. Slim (slimshady2000) 3 93.25 94.37 2 66.67
27715. Slim (slimjesus2) 3 89.10 89.63 1 33.33
27716. zach (slickzach) 3 84.87 89.55 2 66.67
27717. [SMURTEX] (slenex_yt) 3 79.51 82.76 2 66.67
27718. Micah (slenderhog) 3 40.50 43.99 0 0.00
27719. Shaun (sladerrr) 3 70.68 73.58 0 0.00
27720. Skyler (skylerlsx) 3 83.39 89.85 0 0.00
27721. SkyDarkBomber (skydarkbomber) 3 70.75 78.81 1 33.33
27722. Dominic (skrrt_pull_up) 3 50.77 63.76 2 66.67
27723. Law (skreeblenutz) 3 95.86 100.48 0 0.00
27724. Arturo (skikdo) 3 105.40 123.83 1 33.33
27725. Skift (skift2) 3 70.24 79.03 1 33.33
27726. Joey (sjuney) 3 108.08 118.29 2 66.67
27727. Travis (sixyn) 3 132.39 154.93 2 66.67
27728. sitong (sitong) 3 72.12 72.81 0 0.00
27729. Jacob (siskonwich) 3 116.23 124.82 1 33.33
27730. Daniel (sirwatson) 3 77.08 79.87 0 0.00
27731. sirpotatojoe (sirpotatojoe) 3 124.11 128.54 2 66.67
27732. com (sin_ical) 3 88.21 90.05 2 66.67
27733. Curie (silverfox420) 3 60.63 64.06 0 0.00
27734. Sidiq (sidiqbheem) 3 81.79 85.58 2 66.67
27735. Siddhant (siddhantprateek) 3 41.06 44.76 1 33.33
27736. Sicao (sicao) 3 80.39 86.86 2 66.67
27737. Sibert (sibert) 3 65.30 66.81 2 66.67
27738. Sithu (siaung) 3 84.92 89.42 1 33.33
27739. Leex (shyen1337) 3 80.73 85.41 1 33.33
27740. Shuggi (shuggi) 3 67.03 72.62 0 0.00
27741. shua (shuaskies) 3 107.60 109.15 2 66.67
27742. Shocker (shockerzap) 3 57.12 57.72 2 66.67
27743. pj (shmarcus) 3 69.62 73.49 3 100.00
27744. Hari Krishnan (shk_1) 3 43.18 45.88 0 0.00
27745. Shivam (shivamg) 3 59.47 63.85 0 0.00
27746. 水色#0001 (shirogane_ao) 3 122.47 128.26 1 33.33
27747. Daniel (shifu254) 3 65.25 70.45 0 0.00
27748. Dulat (shershen) 3 46.06 50.68 0 0.00
27749. Sheen (sheendinner) 3 104.95 112.43 3 100.00
27750. Shashank (shashank_typer) 3 86.36 90.73 2 66.67
27751. Sharktooth (sharktoothx) 3 49.45 54.01 0 0.00
27752. Hashim (sharkh) 3 91.26 93.04 1 33.33
27753. Shanu (shanu777) 3 63.79 73.03 1 33.33
27754. Mason (shankydanky) 3 52.42 54.75 0 0.00
27755. naruto (shahzadak09) 3 62.52 70.25 3 100.00
27756. Fahim (shahriar193) 3 46.55 50.20 1 33.33
27757. Shahan (shahanneda) 3 92.21 93.86 3 100.00
27758. Shagnik (shagnik) 3 95.77 102.33 1 33.33
27759. Kirumi (shady_blaze0o0) 3 44.28 48.41 0 0.00
27760. Stephan (shadwgod) 3 83.37 95.21 1 33.33
27761. Willey (shadowheart123) 3 102.03 103.13 1 33.33
27762. Shadd (shaddahmed) 3 43.78 46.29 0 0.00
27763. Benito (sevilre) 3 127.75 128.83 2 66.67
27764. Ahmed (severianx) 3 60.73 65.07 0 0.00
27765. Leo (senpaileo) 3 47.08 50.98 0 0.00
27766. Seneca (senecamanu) 3 105.35 112.14 3 100.00
27767. wao (sendnudesplease) 3 82.31 96.66 1 33.33
27768. Seman (semantan06) 3 52.06 56.24 1 33.33
27769. Sedlynne (sedlynne) 3 37.19 37.70 0 0.00
27770. Seal (seal5059) 3 109.45 121.64 3 100.00
27771. Conner (seacitysound) 3 74.81 76.86 0 0.00
27772. Asian (sdf415) 3 92.99 96.93 0 0.00
27773. James (scrubinatub) 3 80.37 85.85 1 33.33
27774. Scratchyjo (scratchyjo) 3 78.08 86.53 1 33.33
27775. Jakub (scrappycz) 3 45.29 47.29 0 0.00
27776. Schalbuch (schalbuch) 3 93.17 97.73 1 33.33
27777. Scarlancy (scarlancy) 3 54.64 59.01 1 33.33
27778. I am speeed (scarea) 3 64.24 65.57 1 33.33
27779. Scalbi (scalbi47yrsold) 3 86.71 94.32 1 33.33
27780. Savatar (sava7ar) 3 48.29 70.06 0 0.00
27781. Sarah (saucypeanut) 3 52.07 54.26 0 0.00
27782. sash (sashtypes) 3 96.39 119.17 1 33.33
27783. Derek (sashimi_exe) 3 64.22 73.37 1 33.33
27784. Sashati (sashati) 3 37.61 40.92 0 0.00
27785. omer (sashasin) 3 99.32 107.31 1 33.33
27786. Saschamz (saschamz) 3 119.84 121.55 2 66.67
27787. OJ (saroisu) 3 92.78 94.52 1 33.33
27788. Sara (sara_9876554432112345... 3 56.76 61.56 3 100.00
27789. Mighty (saranb) 3 109.36 116.43 3 100.00
27790. John Andrew (santiagoja_rog) 3 115.74 118.80 2 66.67
27791. Santiago (santac) 3 90.10 97.93 2 66.67
27792. Sanj (sanjbanz) 3 52.73 59.36 2 66.67
27793. Hoang (sanh01) 3 66.01 70.94 1 33.33
27794. Sangryool (sangryool) 3 42.55 57.35 1 33.33
27795. sandhikagalih (sandhikagalih) 3 57.11 61.17 0 0.00
27796. Sander (sanderv3) 3 94.38 104.94 2 66.67
27797. sam (sam_star99) 3 61.50 74.13 0 0.00
27798. sammy (sam_i_am01) 3 72.68 79.60 1 33.33
27799. Samarth (sam_100) 3 37.93 41.26 0 0.00
27800. Sam687 (samuel687) 3 75.01 78.20 3 100.00
27801. Books (samngoertzen) 3 80.01 83.16 1 33.33
27802. Samuel (sammiedodgers) 3 77.47 81.72 0 0.00
27803. bob (sami1010) 3 99.51 105.72 0 0.00
27804. Sam (samgang) 3 99.84 108.76 1 33.33
27805. sam (samchez) 3 107.06 114.80 2 66.67
27806. Sam (samblez) 3 95.68 103.03 1 33.33
27807. deez (salt_tea) 3 96.38 101.77 3 100.00
27808. Ali (salloum) 3 65.20 68.93 1 33.33
27809. Saky (saky74) 3 78.32 82.22 2 66.67
27810. Sakil_BD (sakil_bdd) 3 55.72 58.93 1 33.33
27811. Anthony (saga_) 3 63.95 79.22 1 33.33
27812. Jean-Michel (safturento) 3 114.44 122.35 3 100.00
27813. Sad1y (sad1y) 3 44.83 49.26 1 33.33
27814. AJ (sacrificials) 3 139.86 173.58 2 66.67
27815. Surkhab (s606) 3 103.12 116.34 2 66.67
27816. Grace (s0porific) 3 80.62 83.17 1 33.33
27817. Slender (r_slender) 3 86.33 93.00 2 66.67
27818. Rzechu12 (rzechu12) 3 35.76 49.91 1 33.33
27819. Anuar (ryuojin) 3 79.35 85.10 2 66.67
27820. Ryokuuy (ryokuuy) 3 59.27 66.23 0 0.00
27821. Randy (ryanrules428) 3 106.78 110.03 1 33.33
27822. Ryan (ryanknav) 3 67.64 76.60 0 0.00
27823. Ryan (ryan767898) 3 85.45 89.13 0 0.00
27824. Ryan (ryachu) 3 70.43 77.09 0 0.00
27825. Henry (rustylimbs) 3 96.76 101.65 0 0.00
27826. Lily (russiantorts) 3 122.12 136.54 3 100.00
27827. Bruno (runichan) 3 46.44 48.58 0 0.00
27828. ruby (ruby_lu) 3 120.98 129.95 3 100.00
27829. Gabe (rubikcrube) 3 92.73 99.48 0 0.00
27830. Nerx (rshield) 3 112.38 115.77 2 66.67
27831. Xoi (roynadhiier) 3 62.61 65.84 1 33.33
27832. Royal (royalman) 3 85.51 96.23 0 0.00
27833. Royce (royck) 3 104.19 108.59 1 33.33
27834. RouxSauced (rouxsauced) 3 54.47 55.87 0 0.00
27835. raegan (rotoole15) 3 46.44 49.74 0 0.00
27836. Rotaberq (rotaberq) 3 54.10 57.81 0 0.00
27837. Rose (roselenataylor) 3 51.65 52.33 1 33.33
27838. CHAU (rookylk) 3 71.04 78.68 2 66.67
27839. Andrei (rooky127) 3 74.83 82.64 2 66.67
27840. tarun (ronythakur) 3 65.29 73.55 1 33.33
27841. 𝙣_𝙞_𝙩_𝙧_𝙤 (r... 3 83.92 86.41 1 33.33
27842. Hålløw (rohanrules21) 3 94.90 97.49 1 33.33
27843. Ritvik (rockey000) 3 94.52 96.65 2 66.67
27844. RobotGG (robotez) 3 66.63 71.27 0 0.00
27845. Elham (rivalry_) 3 99.33 109.28 1 33.33
27846. ritesh (ritesh_k) 3 55.61 59.32 0 0.00
27847. Rishi (rishiosaur) 3 110.19 117.44 2 66.67
27848. Rishabh (rishabhkr) 3 61.65 65.99 0 0.00
27849. rila (rilakuma) 3 95.18 104.32 2 66.67
27850. Rift (rifterk) 3 40.83 45.71 0 0.00
27851. Hussein (rifath33) 3 93.62 104.66 1 33.33
27852. Ricky (ricky54326) 3 140.59 146.98 3 100.00
27853. r (richiedeo) 3 87.10 95.29 0 0.00
27854. Rituparna (ri2parna) 3 59.11 62.92 0 0.00
27855. rhys (rhys22199) 3 75.95 90.88 1 33.33
27856. Ro (rgpdancer) 3 69.66 78.86 0 0.00
27857. Adrian (revi_10) 3 82.79 93.27 1 33.33
27858. Resync (resync) 3 131.24 141.57 1 33.33
27859. Reshoup (reshoup) 3 87.22 93.12 1 33.33
27860. rome (renzo2kpro) 3 78.82 84.35 1 33.33
27861. Renstyfus (renstyfus) 3 58.82 69.49 0 0.00
27862. Dimitar (renoxtv) 3 100.06 111.22 1 33.33
27863. Ozan (remnant) 3 127.66 132.74 1 33.33
27864. lewis (remmurd) 3 76.47 78.36 0 0.00
27865. Kitnipan (remaintion) 3 54.00 57.24 0 0.00
27866. Rein (reindlsu) 3 110.57 121.43 3 100.00
27867. REs (reessss) 3 62.91 66.60 0 0.00
27868. User (redytedy) 3 105.07 109.56 2 66.67
27869. scapegoat (realscapegoat) 3 131.45 144.43 3 100.00
27870. ObamaGaming (realobamagaming) 3 93.10 96.20 3 100.00
27871. David (realdavidcruz) 3 57.90 63.58 1 33.33
27872. Bartek (reaction73) 3 76.89 82.04 1 33.33
27873. Rayni (raynikay) 3 73.48 73.61 0 0.00
27874. Raymoz (raymoz) 3 70.94 84.19 0 0.00
27875. Exooo (ranold) 3 63.94 66.48 0 0.00
27876. Randy (randylee) 3 108.00 116.60 0 0.00
27877. Stefan (random_user231) 3 61.59 65.25 0 0.00
27878. RandomBoy (randomracer5) 3 31.99 36.39 0 0.00
27879. Raiyc (raiyc) 3 68.15 74.70 2 66.67
27880. Raisul (raisulmushfeq) 3 61.75 63.18 0 0.00
27881. rahul (rahularctic) 3 57.20 67.00 0 0.00
27882. Rahul (rahul0379) 3 79.70 86.63 0 0.00
27883. rahmu (rahmu) 3 102.81 103.62 0 0.00
27884. rasmus (ragusa12) 3 79.46 87.72 0 0.00
27885. Affan (raging_fire37) 3 68.00 69.87 0 0.00
27886. Potato (ragingpotato711) 3 100.06 102.34 1 33.33
27887. Ragged (raggedstar) 3 113.68 116.47 3 100.00
27888. Justin (ragegaze) 3 70.80 80.53 1 33.33
27889. Rafsun (rafsun_100) 3 57.63 61.14 0 0.00
27890. race_me_now (I miss Czy) (r... 3 132.23 150.32 3 100.00
27891. Dodger (racedodger) 3 103.56 112.90 3 100.00
27892. Jacob (raazl) 3 52.85 54.59 0 0.00
27893. Keyzard (qwertyzard) 3 88.18 96.58 2 66.67
27894. GOAT (qwerty1111) 3 59.84 64.44 0 0.00
27895. speed demon (quickity) 3 108.96 115.64 3 100.00
27896. Justin (quick2diddle) 3 124.04 130.73 2 66.67
27897. Marcin (quenthel) 3 69.15 73.33 0 0.00
27898. quebequoi (quebequoi) 3 55.39 67.73 0 0.00
27899. Quan (quan_1) 3 55.11 56.52 0 0.00
27900. Quang Minh (quangng711) 3 36.62 37.89 0 0.00
27901. K (quakk) 3 107.38 111.13 2 66.67
27902. Krishna (qrishna59) 3 57.21 68.83 0 0.00
27903. sm (qdbs) 3 81.67 98.34 3 100.00
27904. Mads (pythonmilk) 3 98.37 110.19 1 33.33
27905. Pyare (pyarexpress) 3 42.41 44.21 0 0.00
27906. vachana (pvloveks) 3 55.42 58.99 0 0.00
27907. Alex (putzig) 3 71.96 73.93 0 0.00
27908. NB (purple_turkey) 3 119.35 126.08 1 33.33
27909. Kevin (purplekev) 3 89.03 105.52 0 0.00
27910. purple (purplecity) 3 52.89 54.78 0 0.00
27911. Alex (purpleauro) 3 114.36 120.11 3 100.00
27912. Ivan (pugaelmen) 3 59.71 65.95 2 66.67
27913. David (puchando) 3 100.56 110.50 1 33.33
27914. psyklo10 (psyklo10) 3 75.53 80.24 2 66.67
27915. Ryan (prophetofregret) 3 95.78 98.14 1 33.33
27916. Ventilyator (propeller187) 3 36.36 39.85 2 66.67
27917. Pro (proishere) 3 44.32 45.05 2 66.67
27918. Harry (procuties) 3 70.20 89.80 0 0.00
27919. Robert (privateer) 3 92.75 98.53 1 33.33
27920. Prison (prisonmike69) 3 48.70 50.27 0 0.00
27921. prisky (prisky) 3 84.64 86.98 1 33.33
27922. Princeton (princetonjeffries) 3 98.51 116.59 1 33.33
27923. PRINCE (princeamir) 3 47.43 49.13 1 33.33
27924. PremuimRice (premuimrice) 3 74.16 78.04 0 0.00
27925. Codastix (pranavthetypist) 3 64.46 68.03 1 33.33
27926. ppgg (pp__gg) 3 83.10 86.16 2 66.67
27927. Porpoise (porpoisefantasy) 3 118.94 120.87 3 100.00
27928. ti (popy_15) 3 48.54 51.06 0 0.00
27929. a (poopeater10231) 3 87.74 96.50 3 100.00
27930. Kieran (polaris03) 3 43.56 48.02 0 0.00
27931. Christoffer (poetastrophe) 3 91.65 97.82 1 33.33
27932. Sara (pluto13x) 3 83.64 87.55 0 0.00
27933. Pluto (pluto094) 3 79.55 90.00 0 0.00
27934. Atticus (plutakis) 3 84.97 93.77 0 0.00
27935. ZeppelinRG (plasmapig) 3 82.51 91.34 1 33.33
27936. Abe (plantboy808) 3 78.59 97.23 1 33.33
27937. Oscar (pla3ma) 3 82.36 93.29 2 66.67
27938. Jacob (pjacobh) 3 73.60 79.91 0 0.00
27939. seqqie (pitufita) 3 90.96 115.71 1 33.33
27940. pistonsnick (pistonsnick) 3 85.57 93.62 0 0.00
27941. Pipe (pipeuwu) 3 56.27 60.66 0 0.00
27942. muffin (pintu_otaku) 3 51.68 55.89 0 0.00
27943. Pijke (pijkeee) 3 95.39 100.01 0 0.00
27944. pigoopi (pigoopi) 3 92.17 104.92 0 0.00
27945. Josh (piggygaming1004) 3 89.77 98.02 1 33.33
27946. Peter (picklepete) 3 68.21 70.29 0 0.00
27947. Phycxz (phycxz) 3 74.18 81.06 2 66.67
27948. PJ (phuang) 3 98.97 104.54 1 33.33
27949. Phong (phonglt) 3 58.68 60.78 1 33.33
27950. Pedro (phld) 3 51.22 56.06 0 0.00
27951. Phantom (phantomx0990) 3 77.66 84.17 0 0.00
27952. phantas (phantaslock) 3 70.88 75.86 1 33.33
27953. Phalgooni (phalguni) 3 75.90 78.51 3 100.00
27954. crow (ph4tomz) 3 102.52 115.78 1 33.33
27955. Charles (ph4ntom) 3 66.75 74.31 1 33.33
27956. Liam (ph3zz) 3 82.69 93.77 0 0.00
27957. blahblah (pfftpftpfft) 3 46.68 48.41 0 0.00
27958. Nje (pettsonator) 3 46.68 48.01 0 0.00
27959. Pervasive (pervasive) 3 75.04 82.02 2 66.67
27960. Hian Zing (peperon321) 3 108.96 110.68 1 33.33
27961. Pehz (pehz) 3 103.12 115.42 0 0.00
27962. Justin (peguegue) 3 50.50 55.46 1 33.33
27963. Melvin (peekachoo) 3 111.16 122.56 0 0.00
27964. Pedro (pedrobaptista29) 3 39.44 40.45 0 0.00
27965. Oscar (peccary) 3 100.77 114.85 1 33.33
27966. Jose (peanuts11963) 3 67.66 70.05 1 33.33
27967. aj (peanut2004) 3 94.62 101.71 2 66.67
27968. pd9999 (pd9999) 3 54.06 59.95 0 0.00
27969. Darma (pcfounder) 3 55.95 56.96 0 0.00
27970. psb (pbeeky) 3 46.25 56.92 1 33.33
27971. Kevin (pb9000) 3 68.52 73.45 0 0.00
27972. James (paynedeath) 3 89.46 101.98 2 66.67
27973. pawncheaux (pawncheaux) 3 127.34 152.47 0 0.00
27974. paulo (pauliii) 3 86.63 89.15 0 0.00
27975. Lukas (paulanergarten) 3 51.81 55.43 0 0.00
27976. Paul (paul27) 3 61.79 64.21 1 33.33
27977. Patryk (patryqu08) 3 31.15 35.15 0 0.00
27978. China nº1 (patato123) 3 95.28 109.00 1 33.33
27979. Tata (patata_tata) 3 44.46 47.49 0 0.00
27980. Pasha (pashacccp) 3 70.22 83.93 1 33.33
27981. parto (partoptr) 3 65.91 67.55 1 33.33
27982. TiTi (partiti) 3 86.03 88.14 0 0.00
27983. Парса (parsrch) 3 73.76 75.63 3 100.00
27984. Param (parmy) 3 68.09 69.89 1 33.33
27985. Parking (parkingmeter) 3 71.80 81.32 1 33.33
27986. Andy (parachuteguy500) 3 118.40 128.55 3 100.00
27987. Ezra (papu7505) 3 84.04 97.17 1 33.33
27988. Chris (papadroop) 3 117.36 128.29 2 66.67
27989. papachuro (papachuro) 3 72.13 77.85 2 66.67
27990. Kristán (panika_system) 3 64.97 66.92 1 33.33
27991. Kanye (pangoliar) 3 105.06 109.53 0 0.00
27992. PandaDriver (pandadriver) 3 70.04 73.86 0 0.00
27993. Ahmed (panda679) 3 54.50 62.24 0 0.00
27994. mrnathan (palaceisbad) 3 64.63 71.34 1 33.33
27995. Timmy (pakuyg) 3 114.57 116.95 3 100.00
27996. Paganini (paganinibr) 3 65.01 68.67 0 0.00
27997. pacmansghost (pacmansghost) 3 86.90 94.09 3 100.00
27998. Pablo_35 (pablo35) 3 62.48 69.72 1 33.33
27999. Даниил (p1zda) 3 23.87 25.96 0 0.00
28000. P0neh (p0neh) 3 99.09 106.12 2 66.67
28001. Owen (owenhayes) 3 82.40 98.41 1 33.33
28002. Joe (oveslikeagger) 3 27.53 30.51 1 33.33
28003. Yea (oulliac) 3 95.31 99.10 0 0.00
28004. Owen (oskin_) 3 66.61 69.97 2 66.67
28005. jojodoru (oshihiteo) 3 62.95 65.21 2 66.67
28006. Oscar (oscardangal) 3 46.40 49.84 0 0.00
28007. Afker (oryginalnyitsme) 3 106.09 114.87 2 66.67
28008. Bella (organicsooshi) 3 84.15 87.56 0 0.00
28009. Kamil (oreg0s) 3 77.36 83.12 1 33.33
28010. ozamandias (orbman_) 3 84.61 92.09 1 33.33
28011. Orange (orange_oranges) 3 109.42 120.14 2 66.67
28012. Sinavestos (optictears) 3 117.87 131.17 1 33.33
28013. Trent (opman335) 3 85.31 91.14 1 33.33
28014. opintial (opintial) 3 63.06 63.93 0 0.00
28015. LE (opcleaver0) 3 71.75 74.34 0 0.00
28016. onionshavewings (onionshave... 3 34.06 35.33 0 0.00
28017. haziq aiman (onichan69) 3 51.51 57.08 0 0.00
28018. emo (omylime) 3 75.35 81.27 1 33.33
28019. Tyriq (omgitstyriq) 3 51.50 61.49 0 0.00
28020. OmarTheFast (omarthefast) 3 105.33 114.81 0 0.00
28021. Omar (omar4321) 3 67.91 76.28 1 33.33
28022. Ollie (ollie438) 3 55.33 62.14 0 0.00
28023. oliver (oliver_tacmon) 3 73.14 75.14 2 66.67
28024. oivee (oivee) 3 105.68 121.41 3 100.00
28025. Anica (oica) 3 91.00 97.32 2 66.67
28026. A (ohyoturtles) 3 90.37 97.26 1 33.33
28027. Keigo (ogiekako) 3 86.58 88.60 1 33.33
28028. Lea (offset36) 3 47.28 55.61 0 0.00
28029. e (officialinsert) 3 84.06 93.62 1 33.33
28030. alex (officewarehouse) 3 80.27 86.74 3 100.00
28031. Stan (odeathdragon) 3 117.85 124.09 2 66.67
28032. OddlySerious (oddlyserious) 3 86.79 102.43 1 33.33
28033. Emily (octopanda4) 3 105.51 110.44 2 66.67
28034. Fox (obviouslyweeb) 3 65.30 69.14 0 0.00
28035. Same (obsoletepotato) 3 82.98 91.78 1 33.33
28036. юрій підор (obskur... 3 128.71 144.26 2 66.67
28037. Ashish (obnox33) 3 82.18 88.44 1 33.33
28038. Curtis (obeseocean) 3 131.88 136.05 2 66.67
28039. Jack (oakinsyphon) 3 103.29 109.04 1 33.33
28040. Nathan (nzmaster0516) 3 84.63 101.25 1 33.33
28041. Nymex (nymex67) 3 95.19 98.91 0 0.00
28042. Chris (nukesterz) 3 117.28 137.67 1 33.33
28043. nigus (nuge_2425) 3 46.71 49.33 0 0.00
28044. Nube (nubenoober) 3 68.94 72.79 0 0.00
28045. nuate (nuate) 3 126.20 138.49 3 100.00
28046. Nspace (nspace) 3 89.73 93.58 2 66.67
28047. NotNamedMark (notnamedmark) 3 43.45 52.50 0 0.00
28048. Michael (notillusion) 3 60.08 64.34 0 0.00
28049. @ii (notchaman) 3 71.53 78.97 2 66.67
28050. Norton (nortonmon) 3 113.35 116.37 2 66.67
28051. Norris (norris_is_fat) 3 85.28 90.76 2 66.67
28052. anon (nootathotep) 3 93.71 98.49 0 0.00
28053. Noor (noorrahman) 3 31.09 31.54 0 0.00
28054. noooit (noooit) 3 74.65 80.85 0 0.00
28055. cogz (nooodlefish) 3 76.95 82.33 1 33.33
28056. Joe (nookgun) 3 49.07 54.08 0 0.00
28057. koleraba (noob4love) 3 54.73 61.31 0 0.00
28058. Noir (noirrime) 3 114.36 125.21 2 66.67
28059. Jorge (nogoodlul) 3 77.77 79.43 1 33.33
28060. Mirochi (nobitad) 3 81.68 86.97 0 0.00
28061. Tarso (noaxispe) 3 76.98 80.60 2 66.67
28062. Noah (noahlee) 3 106.14 111.98 1 33.33
28063. Noah (noahcheeseman) 3 65.57 70.62 1 33.33
28064. Noah (noaahhh) 3 116.70 118.70 1 33.33
28065. nmyo (nmyo) 3 136.60 143.73 3 100.00
28066. minh (nminhanh420) 3 49.56 49.84 0 0.00
28067. Speeeeed (nkpaintsil) 3 64.50 66.24 0 0.00
28068. nitai (nitai777) 3 60.41 64.61 1 33.33
28069. Nishan (nishanepic) 3 100.43 101.91 1 33.33
28070. Adam (ninjapadam) 3 86.59 99.29 3 100.00
28071. Ethan (ninjabot5) 3 92.07 101.81 1 33.33
28072. Dominic (ninjabean) 3 89.54 101.60 1 33.33
28073. Oleg (ninele7) 3 56.08 60.92 0 0.00
28074. nim (nimen) 3 85.35 90.21 0 0.00
28075. nik (nikoloose) 3 85.32 94.23 1 33.33
28076. Nikolas (nikolaslim) 3 149.60 167.18 3 100.00
28077. i am (nikhilt) 3 37.84 38.27 0 0.00
28078. naclytyper (nikhila) 3 107.92 110.35 1 33.33
28079. NikeTheProSk8r (nikethepros... 3 66.76 69.32 0 0.00
28080. Joe (niconiconicasio) 3 65.34 71.84 0 0.00
28081. Nicole (nicoleoioioi) 3 57.98 60.35 1 33.33
28082. michael (ngmich) 3 139.84 151.51 3 100.00
28083. Christian (neva_type) 3 54.26 61.22 0 0.00
28084. Nethum (nethum) 3 77.07 81.50 0 0.00
28085. Cuong (nespro) 3 75.38 80.51 0 0.00
28086. Nep (nep_nepped_yuumi) 3 97.82 111.69 3 100.00
28087. Neo (neo7) 3 98.95 103.33 1 33.33
28088. neo (neo007) 3 45.78 48.02 0 0.00
28089. Nenfal (nenfal) 3 92.01 94.71 0 0.00
28090. Nemanja2304 (nemanja2304) 3 72.82 76.52 3 100.00
28091. nelmalu (nelimalu) 3 89.89 94.23 3 100.00
28092. Ning (nekophobia) 3 77.00 80.70 2 66.67
28093. Yui (nekootoko) 3 84.39 90.98 1 33.33
28094. Hugh (negoose) 3 92.82 94.31 1 33.33
28095. Neekon (neekon) 3 110.29 121.64 2 66.67
28096. _(:3) ∠) (neco36) 3 99.05 105.50 0 0.00
28097. ndk100 (ndk100) 3 73.75 79.18 1 33.33
28098. NayoTomato (nayotomato) 3 43.57 45.84 0 0.00
28099. natsuki (natsuki_x) 3 60.21 62.78 0 0.00
28100. Nathan (nathan_benedict) 3 47.31 57.59 1 33.33
28101. Natalie (nataliejw4) 3 64.28 71.50 1 33.33
28102. narikami (narikami) 3 80.64 92.09 2 66.67
28103. Bambi (nanoperceptoin) 3 81.97 90.01 0 0.00
28104. NamhomEG (namhomeg) 3 78.72 84.13 1 33.33
28105. Nameless (nameless_pixel) 3 82.47 84.66 2 66.67
28106. NalynnZ (nalynnz) 3 73.45 80.03 2 66.67
28107. Renato (nadev) 3 68.74 74.85 0 0.00
28108. Naafiyan (naafiyan) 3 92.91 101.13 1 33.33
28109. Toko (n17n) 3 71.07 87.86 1 33.33
28110. Ninja (n0inja_randy) 3 55.94 60.16 0 0.00
28111. Mohamed (m_gemy) 3 54.82 56.16 1 33.33
28112. Tsen (myungjunjun) 3 67.10 76.03 0 0.00
28113. Chris (mythicalocelot) 3 53.98 58.59 1 33.33
28114. Tony (mysticalchime) 3 150.00 156.65 3 100.00
28115. ToastyCPU (mynewuser) 3 93.51 96.14 1 33.33
28116. Kyle (mydoricon) 3 106.12 115.60 2 66.67
28117. Maki (mxki) 3 84.91 99.06 0 0.00
28118. Johnny (muzuki) 3 74.45 80.05 1 33.33
28119. Tony (muuyfeo) 3 75.71 79.61 0 0.00
28120. Soph (murmeline) 3 76.83 80.67 3 100.00
28121. MUKUND (mukundk) 3 80.29 83.64 3 100.00
28122. Mukkuru (mukkuru) 3 73.39 85.55 1 33.33
28123. Tian (mtianms) 3 59.88 64.59 1 33.33
28124. Bakerman (mthnglac) 3 75.32 79.85 2 66.67
28125. Mssd (mssd200927) 3 44.27 52.52 0 0.00
28126. Tomek (mr__t) 3 51.98 58.06 0 0.00
28127. Jarel (mr_dogwater) 3 32.52 38.64 0 0.00
28128. alec (mrwisntworking) 3 71.07 84.49 1 33.33
28129. Joshua (mrjoshy) 3 104.50 114.66 1 33.33
28130. MrFade14 (mrfade14) 3 64.95 70.76 0 0.00
28131. Rip reckful (moudizg) 3 130.73 138.30 3 100.00
28132. Mouad (mouadox) 3 51.11 51.42 0 0.00
28133. Darwisy (motoofast) 3 85.50 90.40 2 66.67
28134. Mostafa (mostfkhttb11) 3 55.17 63.94 0 0.00
28135. Nicolas (morgoth890steno) 3 89.68 100.17 1 33.33
28136. krane (moozies) 3 111.77 126.55 2 66.67
28137. maggie (mooski) 3 56.95 64.39 0 0.00
28138. Ram (moonify) 3 136.91 142.44 2 66.67
28139. Monsquinch (monsquinch) 3 57.36 61.00 2 66.67
28140. Monkeyjwzd (monkeyjwzd) 3 110.47 121.02 1 33.33
28141. J'Lenn (monkeydjiggy) 3 49.67 60.84 0 0.00
28142. Aebel (monkeeeee) 3 55.56 59.20 1 33.33
28143. Andrew (momoterraw) 3 110.09 125.72 1 33.33
28144. Sam (momomcds) 3 112.14 116.92 0 0.00
28145. Aisyah (momogi13) 3 71.88 75.88 1 33.33
28146. momodao (momodao) 3 94.57 104.41 1 33.33
28147. Moises (moi_ses123) 3 51.08 57.50 1 33.33
28148. mohannad (mohanadtab) 3 38.31 43.46 0 0.00
28149. Mohanad (mohanadahmd) 3 91.21 100.18 2 66.67
28150. Mochaeri (mochaeri) 3 85.66 95.40 1 33.33
28151. Mike (mmanzinger) 3 110.53 117.32 2 66.67
28152. Tommy (mizo_ramen) 3 48.29 51.13 0 0.00
28153. mithilesh (mithilesh_just_t... 3 36.92 38.38 0 0.00
28154. Mitchell (mitchow) 3 95.38 98.66 2 66.67
28155. will (mistywaves) 3 88.53 93.43 2 66.67
28156. Nate (mistrpopo) 3 78.99 86.68 0 0.00
28157. Tasnim (misteryoda) 3 53.24 61.13 1 33.33
28158. idontflinch (mistergold) 3 58.72 61.76 0 0.00
28159. mis7ake (mis7ake) 3 48.55 54.08 0 0.00
28160. m (miomo) 3 82.08 90.66 1 33.33
28161. Elliot (mini_toh) 3 94.57 97.28 2 66.67
28162. Min (minimizer123) 3 97.65 111.05 3 100.00
28163. Garret (minecraftkid2007) 3 114.62 131.30 2 66.67
28164. Mindmaster (mindmaster03) 3 54.98 58.89 1 33.33
28165. Milos (milosj) 3 102.52 112.65 1 33.33
28166. Mihir (mihirthecoolboi) 3 101.05 106.73 3 100.00
28167. Madiyar (mightymadik) 3 44.98 45.89 0 0.00
28168. Emil (mielies1) 3 62.95 65.16 0 0.00
28169. Michael (mickyyyr) 3 105.28 114.14 0 0.00
28170. Mishi (mickimouse) 3 117.48 125.96 2 66.67
28171. Mickey (mickeymini) 3 53.67 67.51 0 0.00
28172. MTH (michaeltrayvonheckman) 3 245.46 258.67 3 100.00
28173. Michael (michaelmalgapo10) 3 85.84 97.33 2 66.67
28174. Michael (michaelhau) 3 96.23 113.16 2 66.67
28175. michael (michael1117) 3 14.24 16.77 0 0.00
28176. Mia (miatkd) 3 58.08 63.07 0 0.00
28177. Mieke (miakra) 3 48.43 50.36 0 0.00
28178. MGKPs (mgkps) 3 42.52 46.24 0 0.00
28179. Mike (mferger92) 3 88.05 98.62 1 33.33
28180. hi im merm!! (mermed) 3 145.28 150.69 3 100.00
28181. dave (mercurz) 3 101.48 119.64 1 33.33
28182. merc824 (merc824) 3 44.51 48.94 0 0.00
28183. Arifa (meowx2) 3 51.62 55.23 2 66.67
28184. Matthew (memermatt) 3 64.70 67.31 3 100.00
28185. Alex (memento108) 3 79.73 83.19 1 33.33
28186. melon (melon_aid) 3 97.94 108.81 1 33.33
28187. Austin (melonyt10) 3 88.50 92.09 0 0.00
28188. Mello (melancholic_god) 3 83.86 96.32 2 66.67
28189. Gavin (meizlizard) 3 79.44 81.27 1 33.33
28190. Meirkhan (meirkhans) 3 43.71 45.98 1 33.33
28191. Meghan (meghanbmcl) 3 61.97 68.88 0 0.00
28192. mecharekk (mecharekk) 3 54.95 56.98 0 0.00
28193. Mohamed (mdmod) 3 70.98 77.76 1 33.33
28194. McScoops (mcscoops) 3 65.53 69.32 3 100.00
28195. 🔰Cosmeen (mcpotato) 3 82.05 87.96 0 0.00
28196. Mayoukh (mayoukh) 3 69.49 70.52 0 0.00
28197. Maya (maya_prowers) 3 121.71 129.03 3 100.00
28198. Max (maxzims) 3 80.28 95.85 0 0.00
28199. maxwell (maxwellcude) 3 54.07 55.96 1 33.33
28200. Mauricio (maurizzzio) 3 100.11 112.26 0 0.00
28201. James (mauricetheferret) 3 99.88 110.43 1 33.33
28202. Mats (mats1104) 3 61.27 66.07 2 66.67
28203. Mathias (math225r) 3 86.95 88.80 2 66.67
28204. christian (matebookd) 3 58.22 64.67 1 33.33
28205. Akshat Aggarwal (master_mlnd) 3 63.65 69.80 1 33.33
28206. Msdon (masonarg) 3 46.40 46.76 0 0.00
28207. Matt (masecla22) 3 79.08 81.88 0 0.00
28208. Mase (maseabd) 3 86.35 95.90 1 33.33
28209. :D (marz__s) 3 113.07 126.59 1 33.33
28210. Mark (mark_my_name) 3 35.25 36.69 0 0.00
28211. Markus (markusj99) 3 53.46 56.76 3 100.00
28212. Markus (markusizergin) 3 60.17 68.58 1 33.33
28213. Juan (marksman10) 3 77.78 83.85 2 66.67
28214. Mark (markf0cu5) 3 118.22 128.40 1 33.33
28215. Marijuana (marijuanah) 3 65.66 71.44 0 0.00
28216. jinkook (marikabing) 3 52.60 53.29 0 0.00
28217. Maria (mariatran9) 3 84.58 90.51 0 0.00
28218. Marcos (marcosv) 3 32.08 35.69 3 100.00
28219. Márton (marconka) 3 63.14 73.58 1 33.33
28220. tstats[marcko042] (marcko042) 3 83.41 93.04 2 66.67
28221. Mv (marcellv) 3 64.26 66.91 2 66.67
28222. Marco (marc7202) 3 101.56 106.06 2 66.67
28223. pp (marais) 3 79.29 81.92 2 66.67
28224. Dylan (manyanomalies) 3 75.24 87.04 0 0.00
28225. Martin (manthee1) 3 44.07 47.07 1 33.33
28226. Manley (manley716) 3 86.57 93.87 3 100.00
28227. Jason (manjova) 3 102.41 106.92 1 33.33
28228. Manav (manavkush) 3 66.19 70.27 1 33.33
28229. Victor (malvikus) 3 60.50 63.11 0 0.00
28230. Kevin (malthross) 3 57.32 62.44 1 33.33
28231. Alexandre (malfortune) 3 85.37 91.05 1 33.33
28232. Melvin :) (malevolant_melvin) 3 58.10 61.98 0 0.00
28233. Jacob Miko (makoton815) 3 87.55 91.96 2 66.67
28234. 3DMakerKid (makerkid) 3 81.68 96.77 1 33.33
28235. Mahar (maharkamran01) 3 85.80 89.10 1 33.33
28236. Firstene (magikarpusedfly) 3 51.49 59.35 1 33.33
28237. ray (magicsticks) 3 86.28 96.82 1 33.33
28238. Mae (maesmith) 3 87.54 91.16 1 33.33
28239. Nick (maddogitb) 3 93.73 96.63 3 100.00
28240. SnaccAllister (mactrey) 3 104.61 109.50 3 100.00
28241. Macmed (macmed) 3 80.24 87.80 0 0.00
28242. Macintosh (macintosh_fan) 3 99.15 103.01 3 100.00
28243. Karlo (m4china) 3 66.98 72.95 0 0.00
28244. James (m33pit) 3 107.68 115.46 2 66.67
28245. m (m1604) 3 79.88 89.66 0 0.00
28246. Lily ^& (lysbparker) 3 66.57 72.44 3 100.00
28247. lyricata (lyricata) 3 26.43 28.31 1 33.33
28248. Joshua (lyodd90) 3 121.81 131.45 1 33.33
28249. lynn (lynniee) 3 70.86 75.05 0 0.00
28250. Lydia (lydia_sol) 3 58.97 61.80 1 33.33
28251. lxvxnderry (lxvxnderry) 3 64.58 71.33 1 33.33
28252. Force (lv_force_vl) 3 59.56 67.03 1 33.33
28253. namln.com (luunhatnam) 3 75.76 78.23 0 0.00
28254. YEP (lumpytacos) 3 55.30 63.40 1 33.33
28255. autoelk (lukefly2) 3 100.14 110.32 2 66.67
28256. Lukas (lukbuz) 3 54.02 55.43 0 0.00
28257. Lukas (lukasdw) 3 60.29 60.67 0 0.00
28258. lucky3495 (lucky3495) 3 56.36 57.90 2 66.67
28259. Luc1d (luc1d_on_typeracer) 3 50.97 57.49 1 33.33
28260. tadiyos (lt_tad) 3 71.74 79.93 1 33.33
28261. Loydox8930 (loydox8930) 3 55.64 63.31 0 0.00
28262. Sam (loverofpi) 3 71.96 84.91 1 33.33
28263. Tanishq (lovely_singh) 3 46.34 48.31 1 33.33
28264. Darius (lovefirecrackers) 3 84.06 98.52 1 33.33
28265. Your (lor14510) 3 72.66 77.19 2 66.67
28266. 🐱👤 (loomi) 3 127.16 140.22 2 66.67
28267. Greg (lolzface) 3 108.53 111.85 2 66.67
28268. lollylols1 (lollylols1) 3 63.12 67.72 1 33.33
28269. Mflop (lolgetmoorekt) 3 86.32 94.62 1 33.33
28270. Alpha (lolcat81) 3 71.58 76.67 0 0.00
28271. lokill (lokillfm) 3 39.80 45.36 1 33.33
28272. Loco (locomagoes) 3 91.88 96.83 2 66.67
28273. Pedro (lobin) 3 42.18 43.45 0 0.00
28274. Loay (loayahmed) 3 91.93 104.73 1 33.33
28275. LKB (lkb1) 3 108.33 133.24 1 33.33
28276. Liz (lizchu413) 3 110.92 141.51 1 33.33
28277. Sam (live2cube) 3 62.27 64.33 0 0.00
28278. Peter (litoprobka) 3 68.40 75.66 3 100.00
28279. Kataalyst (litextreme) 3 119.73 129.25 3 100.00
28280. Jeff (litboi101) 3 115.21 132.66 2 66.67
28281. Lisa (lis__) 3 53.80 56.51 1 33.33
28282. Qiwei (liqiwei) 3 74.12 80.43 1 33.33
28283. Banana (lippicp) 3 48.05 54.78 0 0.00
28284. George (linkopen) 3 124.65 135.96 2 66.67
28285. Raimi (limeykun) 3 107.73 126.42 1 33.33
28286. Emil (lime03) 3 56.73 58.34 1 33.33
28287. lillu (lilluwu) 3 96.22 132.64 0 0.00
28288. edith (lilloser) 3 38.09 41.41 0 0.00
28289. Leo (lileo261) 3 76.89 80.86 1 33.33
28290. Dorothy (lildottycat) 3 38.70 42.82 1 33.33
28291. Justin (lightningvoltix) 3 88.40 89.56 1 33.33
28292. Libby (libbyrozzi) 3 81.94 85.31 1 33.33
28293. Dark (lewpur) 3 123.06 139.74 3 100.00
28294. Suparno (letsbecool) 3 55.10 59.53 2 66.67
28295. Matti (lerssi_) 3 53.60 59.00 0 0.00
28296. Leon (leon882888) 3 45.60 47.40 0 0.00
28297. LEO (leolelele) 3 72.02 90.44 2 66.67
28298. Leoinas (leoinas7) 3 78.99 83.20 0 0.00
28299. LenY (lenyx24) 3 65.40 83.09 0 0.00
28300. Len (lennonisbest) 3 86.18 90.93 0 0.00
28301. lemonwaterr (lemonwaterr) 3 87.29 91.74 1 33.33
28302. Daan (lemonob) 3 81.71 89.03 1 33.33
28303. Ludvig (lelzarenn) 3 84.39 91.42 0 0.00
28304. Daniel (leinad_32) 3 82.49 96.27 1 33.33
28305. Leifman (leifman) 3 110.54 113.45 2 66.67
28306. Oonga (legoarmyguy223) 3 60.36 61.64 3 100.00
28307. Lee (leeulrich) 3 78.89 83.75 1 33.33
28308. eat4free (leewei05) 3 55.37 57.63 0 0.00
28309. leetuser (leetuser) 3 69.36 73.89 1 33.33
28310. Melvin (lechero) 3 50.48 58.89 0 0.00
28311. Leax (leax) 3 52.07 54.23 0 0.00
28312. leah (leannah) 3 139.63 161.94 2 66.67
28313. William (lazerpie) 3 82.67 87.18 2 66.67
28314. Valera (layge) 3 32.66 33.18 0 0.00
28315. lawrence (lawrence_nguyen) 3 60.67 64.37 0 0.00
28316. lawnardo (lawnardo) 3 101.29 114.98 3 100.00
28317. Lauren (lauren_conrad) 3 114.32 126.88 0 0.00
28318. Lauge (laugejuul14) 3 72.71 79.47 1 33.33
28319. Last (last220) 3 60.88 64.09 1 33.33
28320. Lapis (lapisor) 3 84.77 94.80 3 100.00
28321. Lana (lana121) 3 69.53 74.76 0 0.00
28322. Ben (lalbtyd25) 3 92.72 104.86 2 66.67
28323. Wei Quan (laiweiquan) 3 57.96 60.80 1 33.33
28324. Michael (kyrano) 3 91.38 100.69 1 33.33
28325. Vannei (kymaz) 3 47.79 48.69 1 33.33
28326. KYLECUMBER (kylecumber) 3 56.76 62.02 0 0.00
28327. ky (kyajin) 3 136.12 144.74 0 0.00
28328. James (kwequay) 3 106.69 109.93 0 0.00
28329. Wrenpy (kuwabaro) 3 66.85 80.46 1 33.33
28330. Kurtis (kurtino) 3 125.73 153.40 3 100.00
28331. Kuripa (kuripa) 3 70.35 74.42 0 0.00
28332. Ivan (kuleee) 3 75.63 79.89 1 33.33
28333. Kris (ktale007) 3 78.14 81.29 1 33.33
28334. Taylor (kryxilis) 3 78.32 89.32 0 0.00
28335. SlowTyperT-T (krusty_krab10) 3 89.47 100.14 0 0.00
28336. krt_ (krt_) 3 87.31 95.91 1 33.33
28337. Kristóf (kristofy) 3 60.04 66.10 0 0.00
28338. Kristen (kristenb225) 3 59.76 62.34 0 0.00
28339. Kristina (krisl9) 3 67.82 72.35 0 0.00
28340. Krish (krishkat) 3 94.19 107.90 1 33.33
28341. Krafci (krafcisky) 3 71.88 75.67 1 33.33
28342. koya (koya8) 3 79.16 84.95 0 0.00
28343. Neyo (kouheisan) 3 78.34 86.32 2 66.67
28344. i am slower than you (koplkop) 3 80.88 85.88 0 0.00
28345. Ishan (kooshnoo) 3 74.09 82.68 1 33.33
28346. Alireza (kolento79) 3 47.02 49.42 1 33.33
28347. Koi (koisoysauce) 3 112.75 118.48 0 0.00
28348. Kohlis (kohlis) 3 73.53 75.97 0 0.00
28349. Knyq (knyq_626) 3 93.81 96.63 1 33.33
28350. Klosure (klosure) 3 66.25 69.32 0 0.00
28351. KlokkisRacer (klokkis_utfor... 3 69.88 82.37 0 0.00
28352. Che (klimkeyboard) 3 46.28 51.60 0 0.00
28353. shaked (kknify) 3 109.93 121.10 3 100.00
28354. kiwomi (kiwomi) 3 38.69 45.47 0 0.00
28355. Kishore (kishorep) 3 87.47 92.82 2 66.67
28356. Biscuit. (kiokuru) 3 117.20 127.12 3 100.00
28357. amk (kingyboi42) 3 74.26 82.21 1 33.33
28358. Kincaid (kincaida) 3 88.65 92.81 0 0.00
28359. Mik (kimses12) 3 65.87 70.41 0 0.00
28360. Kimo (kimota) 3 96.34 107.53 1 33.33
28361. ICEMAN (kimoas) 3 64.59 72.45 1 33.33
28362. James (kimandoxs) 3 78.72 99.65 0 0.00
28363. The great (killerlee3245) 3 31.49 33.73 1 33.33
28364. Ahmed (killer549) 3 45.54 47.39 1 33.33
28365. Andres (kikikiros) 3 68.52 76.82 0 0.00
28366. Kieyas (kieyas) 3 51.46 55.90 0 0.00
28367. Kibasa (kibasa) 3 121.04 137.87 2 66.67
28368. Thomas (khoaph) 3 48.16 50.94 3 100.00
28369. Jessica (khalia12) 3 74.29 83.08 0 0.00
28370. co-pilot (keyboardlogger) 3 62.00 67.10 0 0.00
28371. FSH (kevm8888) 3 104.10 106.87 0 0.00
28372. Kevin (kevinpamberg) 3 80.37 88.14 2 66.67
28373. Kevin (kevgelblitz) 3 62.84 64.45 0 0.00
28374. Ketki (ketki611) 3 48.43 52.20 0 0.00
28375. Ketchup (ketchupsokies) 3 86.05 89.95 1 33.33
28376. Karol (kerol0) 3 85.26 89.81 1 33.33
28377. Andres (kerchingle) 3 98.26 103.36 0 0.00
28378. Omni (kenkaster001) 3 77.75 85.19 2 66.67
28379. Jan (kenaj) 3 80.24 86.60 0 0.00
28380. Kelly (kellyyah) 3 111.81 113.58 1 33.33
28381. kellyfunk (kellyfunk) 3 95.18 112.01 1 33.33
28382. Keegan (kekky) 3 88.10 95.59 0 0.00
28383. Keex (keex) 3 87.01 96.53 1 33.33
28384. Keepito (keepito1337) 3 114.45 121.60 2 66.67
28385. keaten (keaten) 3 88.70 97.29 1 33.33
28386. Keago (keago) 3 82.81 87.19 1 33.33
28387. Daniel (kd19lio) 3 68.92 72.78 0 0.00
28388. Justiss is the best (kbeast) 3 130.02 143.89 3 100.00
28389. Azamat (kayoshi) 3 90.76 93.75 3 100.00
28390. Kaya Toast (kaya_toast) 3 74.91 101.09 3 100.00
28391. kaya (kayawaffle) 3 58.02 60.31 0 0.00
28392. Katrina (katkatkat) 3 77.34 80.27 1 33.33
28393. CiscoAdmin (kaszanka12) 3 103.96 107.70 1 33.33
28394. Kandanai (karnnypicture) 3 49.84 51.07 0 0.00
28395. Karolis (karolingas01) 3 62.68 64.49 1 33.33
28396. Laziness (karinoshuka) 3 105.58 108.73 2 66.67
28397. Karsen (karguy2) 3 78.48 82.54 0 0.00
28398. Abulqadir (kaore) 3 62.88 64.68 1 33.33
28399. Kanvaro (kanvaro) 3 102.40 112.00 2 66.67
28400. Kang (kangplz) 3 79.98 83.55 2 66.67
28401. John Clarence (kamoteforce) 3 95.51 105.26 0 0.00
28402. Kamyk (kamiszewskyy) 3 69.05 74.62 1 33.33
28403. Murray (kamenz) 3 63.52 65.87 0 0.00
28404. Andrey (kalida) 3 34.18 43.02 0 0.00
28405. Ramazan (kalash) 3 45.54 49.26 0 0.00
28406. Vu1can (kaiayush) 3 30.28 35.16 2 66.67
28407. Kage (kagealan) 3 68.22 76.25 0 0.00
28408. jarit (kaastype) 3 37.50 38.36 1 33.33
28409. meowskullsfeetfreaks (k7x1e) 3 46.43 51.92 3 100.00
28410. Kat (k4t3) 3 103.28 111.86 1 33.33
28411. Jojo (j_oey) 3 88.78 91.48 1 33.33
28412. João (jvvv) 3 85.65 89.34 1 33.33
28413. J (jv8111) 3 113.28 119.55 3 100.00
28414. juuuws (juuuws) 3 76.97 79.96 1 33.33
28415. Xavier (justxav) 3 86.23 92.37 3 100.00
28416. Just (justalittlewolf) 3 87.96 91.82 1 33.33
28417. Jun Wen (junwen) 3 62.18 70.39 0 0.00
28418. Ronit (juniorvid) 3 96.03 98.69 1 33.33
28419. jun (junhan) 3 40.96 45.18 0 0.00
28420. Junaed (junaed_siam) 3 75.34 81.82 1 33.33
28421. Junion (jun1on) 3 112.68 130.60 3 100.00
28422. Julian (julianwonghi) 3 113.83 119.05 2 66.67
28423. Julian (julianmonk) 3 45.68 50.09 0 0.00
28424. jugal kishor (jugal_sahu) 3 66.33 69.83 2 66.67
28425. Jude (judeavery) 3 71.96 74.29 0 0.00
28426. Juan (juanpunch) 3 85.92 91.64 1 33.33
28427. Jose (jtrrazo_21) 3 49.81 53.39 2 66.67
28428. Jackson (jtrainpdx1) 3 97.46 100.51 2 66.67
28429. jTnqr (jtnqr) 3 66.88 77.43 2 66.67
28430. johnnyboy (jstav) 3 94.43 100.84 2 66.67
28431. Jack (jsdsparky) 3 82.15 92.77 1 33.33
28432. Jakov (jpalikuca) 3 89.58 93.46 1 33.33
28433. KingJulian (jpaglia61) 3 54.79 56.78 0 0.00
28434. Zak (joyridinglordofdeath) 3 76.30 80.26 1 33.33
28435. joshua (joshunatoir) 3 45.83 48.56 0 0.00
28436. Josh (joshmv) 3 66.87 74.16 0 0.00
28437. Josh (joshlearnsdvorak) 3 94.28 102.83 0 0.00
28438. Josh (josh0561) 3 61.79 63.02 1 33.33
28439. John (josborne) 3 81.04 88.37 0 0.00
28440. Jordan (jorsian) 3 115.47 126.39 0 0.00
28441. Jordan (jordanlangford) 3 69.35 72.77 0 0.00
28442. jOn (jonsport) 3 111.08 123.45 3 100.00
28443. Jon (jonrao) 3 92.38 108.22 2 66.67
28444. ジョンジョンジョン... 3 89.25 102.70 1 33.33
28445. jonjonbon (jonjonbon) 3 87.31 96.59 1 33.33
28446. Jake (jokedac) 3 59.83 65.28 0 0.00
28447. Joe (joeythedice) 3 103.19 111.96 2 66.67
28448. Joerty (joertsy) 3 87.23 102.40 1 33.33
28449. Joe (joenuts007) 3 75.20 78.09 0 0.00
28450. Joe (joegoggin27) 3 46.69 48.96 0 0.00
28451. Jacklyn (jlyn_nn) 3 57.67 63.41 1 33.33
28452. Jeffrey (jlhart1717) 3 82.31 86.71 2 66.67
28453. Jonah (jkeates) 3 48.07 52.62 0 0.00
28454. j (jk993) 3 80.69 87.38 0 0.00
28455. Liam (jjaegui) 3 81.97 84.26 0 0.00
28456. JixS4v (jixs4v) 3 26.34 27.87 0 0.00
28457. Jitender (jitendercool) 3 72.49 80.53 0 0.00
28458. Jitander (jitander) 3 52.63 63.10 0 0.00
28459. Jion (jiondarien) 3 93.19 109.39 2 66.67
28460. Connor (jincwe) 3 80.81 94.84 0 0.00
28461. Jiayan (jiayanluo) 3 108.21 127.49 1 33.33
28462. Jiamin (jiamind) 3 71.64 75.81 1 33.33
28463. Squeeby (jhettman) 3 66.71 69.88 1 33.33
28464. JHDW (jhdw) 3 79.74 82.88 3 100.00
28465. Jhaztyn (jhaztyn) 3 69.70 71.98 0 0.00
28466. Joshua (jh817) 3 91.86 101.87 0 0.00
28467. gogo (jg80990) 3 61.66 61.82 2 66.67
28468. James (jfor8080) 3 47.78 49.97 0 0.00
28469. Jezebelle (jezebe11e) 3 89.93 95.93 1 33.33
28470. Jesse (jessecan) 3 74.58 83.56 3 100.00
28471. Jerico (jericopulvera) 3 93.97 102.00 1 33.33
28472. jeremiejig (jeremiejig) 3 54.85 55.73 0 0.00
28473. jens (jenspie) 3 48.79 53.77 0 0.00
28474. Tobias (jensen9430) 3 58.41 66.80 2 66.67
28475. joshi (jehoshuah) 3 75.71 82.75 0 0.00
28476. Jeffrey (jeffrey3712) 3 97.91 105.08 3 100.00
28477. James (jeffinger38) 3 95.96 104.73 3 100.00
28478. Jed (jedaiski) 3 62.71 65.41 1 33.33
28479. Amar (jebemtimater52) 3 92.65 102.26 3 100.00
28480. Jady (jd_istooshort) 3 81.65 88.23 0 0.00
28481. bimmm (jdrbvgserg) 3 109.48 116.46 3 100.00
28482. Josh (jdh4211) 3 100.67 113.92 1 33.33
28483. JC (jczak) 3 69.57 74.30 0 0.00
28484. JCalibs (jcalibs_13) 3 64.19 71.09 1 33.33
28485. Justin (jbui123) 3 71.95 74.99 3 100.00
28486. Jay (jayssa2) 3 104.49 109.15 1 33.33
28487. Mr. (jayskeels) 3 77.77 81.75 1 33.33
28488. Jawn (jawnblue) 3 90.01 93.49 3 100.00
28489. Javlonbek (javlonbek) 3 24.11 27.34 2 66.67
28490. Jason (jason3103) 3 82.86 88.40 1 33.33
28491. jarif (jarif12) 3 60.15 67.11 1 33.33
28492. tstats[jangstyle] (jangstyle) 3 59.82 60.88 0 0.00
28493. Jakub (jakgin) 3 56.13 59.40 2 66.67
28494. jahed (jahedk) 3 65.72 76.81 0 0.00
28495. some_dude (jad_) 3 112.36 119.79 1 33.33
28496. Jay (jacquesz) 3 85.90 97.95 0 0.00
28497. Jack (jackthetyper) 3 105.75 114.59 1 33.33
28498. Jackson (jacksonsheldon) 3 79.42 84.84 1 33.33
28499. Luke (jaberwacky) 3 70.33 76.48 1 33.33
28500. 0mg (j4s0nb0urn3) 3 61.72 65.98 0 0.00
28501. jiggleburger (j2nkins) 3 89.75 96.14 1 33.33
28502. Joshua (j1_kkk) 3 133.95 151.22 1 33.33
28503. J (i_am_speeed) 3 60.47 67.12 0 0.00
28504. Ivan (ivan_h) 3 65.26 67.93 0 0.00
28505. to sam ja (ivanbire) 3 62.44 75.88 0 0.00
28506. Victor (iusearchbtw) 3 119.42 124.47 0 0.00
28507. tam (iufosonzz) 3 75.89 76.98 0 0.00
28508. itzsamxp (itzsamxp) 3 73.70 76.81 2 66.67
28509. Allen (itzhelix) 3 84.40 86.64 1 33.33
28510. Sohan (itypenow) 3 52.86 55.64 0 0.00
28511. LuJkE (itsthot) 3 74.11 82.04 1 33.33
28512. Sollyy (itssollyy) 3 81.02 83.26 0 0.00
28513. alien (itscloveryt) 3 70.04 81.78 1 33.33
28514. Itay (itay_amit) 3 71.24 74.26 0 0.00
28515. Ishan (ishanxlr8) 3 63.66 73.25 1 33.33
28516. ishakan (ishakan) 3 79.01 86.29 0 0.00
28517. Isaiah (isaluteya) 3 104.70 105.04 1 33.33
28518. Aizakku (isaace) 3 81.29 88.37 1 33.33
28519. Jaden (ironic_) 3 89.83 103.57 1 33.33
28520. InvisWasTaken (inviswastaken) 3 62.20 68.90 1 33.33
28521. aryan (interestedpartridge) 3 47.37 48.85 0 0.00
28522. Druhan (insert_meme_here) 3 65.04 72.91 0 0.00
28523. Colin (infusionpc) 3 88.47 93.38 1 33.33
28524. Brian (infinibro) 3 68.37 70.23 0 0.00
28525. Johnny (im_fast_af_boyyy) 3 53.08 60.21 0 0.00
28526. Tino (imtino) 3 52.54 60.85 2 66.67
28527. Imran (imran_maso) 3 40.84 43.67 0 0.00
28528. Jun (impressed) 3 133.16 142.46 1 33.33
28529. gram (imaginewastaken) 3 46.82 53.28 0 0.00
28530. Jimmy Butler (ilyrxtro) 3 55.95 62.98 1 33.33
28531. Mattias (illmajol) 3 67.34 78.58 0 0.00
28532. Mark (iliekrice) 3 81.74 86.75 2 66.67
28533. ilias (iliakesk) 3 28.98 32.81 1 33.33
28534. bike (ikenim) 3 99.68 107.43 1 33.33
28535. Teresa (iilxvelycrystal) 3 107.33 114.55 3 100.00
28536. (ilii) (iili) 3 95.79 99.44 3 100.00
28537. Nol (iileeper) 3 87.50 93.74 2 66.67
28538. p4n (ihateant1212) 3 57.24 63.02 3 100.00
28539. Alexandre (ignorantez) 3 58.81 68.95 1 33.33
28540. Ignfroggy (ignfroggy) 3 68.19 79.84 0 0.00
28541. Claude Aizen (igie007) 3 49.72 54.20 0 0.00
28542. Ifan (ifan98) 3 58.68 62.38 0 0.00
28543. idunno (idunno_) 3 89.65 96.66 0 0.00
28544. black. (idkmyfriend) 3 70.62 74.60 1 33.33
28545. Icy (icy687) 3 67.16 75.23 3 100.00
28546. Kem (ice_kem) 3 94.97 101.29 2 66.67
28547. Unanymous (iceman0bc) 3 73.26 78.07 2 66.67
28548. Anonimo (ibzjem7v) 3 55.99 60.87 0 0.00
28549. Ian (iboletchek) 3 87.56 89.74 1 33.33
28550. Ibnu (ibenusina) 3 96.76 109.78 2 66.67
28551. iam (iamtypinglin) 3 52.67 53.70 0 0.00
28552. Slow_and_steady_ (iamskk) 3 81.22 82.48 1 33.33
28553. LordTouchMe (iamjustarealga... 3 79.80 87.38 1 33.33
28554. Kerry (i8pp) 3 99.61 133.88 2 66.67
28555. Eris (hyururi) 3 78.52 82.15 2 66.67
28556. HYP34 (hyper_typer200) 3 74.94 78.12 1 33.33
28557. Wesley (hyperwes) 3 138.63 154.78 2 66.67
28558. Hussain (hussain_22) 3 91.34 103.50 0 0.00
28559. Aswin (humble_boy) 3 54.96 59.43 1 33.33
28560. Wahaha (huhduh600) 3 69.00 75.95 0 0.00
28561. Hucare (hucare_) 3 81.12 89.44 1 33.33
28562. Allan (huangkong) 3 97.63 111.11 0 0.00
28563. NekokeN (hr47) 3 86.35 93.90 2 66.67
28564. Erik (hotman_04) 3 41.66 49.81 0 0.00
28565. Hossam (hossamhero7) 3 31.68 32.36 0 0.00
28566. benjamin (hombreba) 3 60.39 66.20 0 0.00
28567. ayusha (hm_yes) 3 59.61 66.00 0 0.00
28568. Hunter (hlikesramen) 3 72.66 74.44 1 33.33
28569. Shinon (hitoshi_shinon) 3 50.33 56.38 0 0.00
28570. Jigar (hiraj) 3 58.40 63.44 0 0.00
28571. Hullu (hilivilperi) 3 74.34 79.25 0 0.00
28572. A-A-RON (hihyooka) 3 81.54 88.58 0 0.00
28573. Andres (highmes) 3 61.78 68.06 0 0.00
28574. High889 (high889) 3 78.02 82.56 1 33.33
28575. Ph (hidenki) 3 64.25 67.92 0 0.00
28576. Hibiscus (hibiscuswaimeae) 3 51.07 56.92 0 0.00
28577. Heysi (heysi) 3 95.77 103.92 2 66.67
28578. hello lads (heymanurgood) 3 57.11 57.61 0 0.00
28579. Herman (hermanleong) 3 79.11 89.14 2 66.67
28580. 亨利 (henry034) 3 56.80 59.15 1 33.33
28581. henrik74 (henrik74) 3 37.63 43.96 1 33.33
28582. Lukiji (hempasaur) 3 109.35 125.37 2 66.67
28583. Free Palestine (hemo313) 3 60.16 65.49 2 66.67
28584. Alexander (helmers) 3 64.77 71.52 1 33.33
28585. Vin (hellotherevin) 3 60.72 65.12 0 0.00
28586. HelixFossil1 (helixfossil1) 3 64.56 69.53 1 33.33
28587. Helios (heliosishot) 3 88.74 89.57 2 66.67
28588. Hehe (hehenaicha) 3 82.02 88.73 2 66.67
28589. Bread (heftybread) 3 80.12 83.37 1 33.33
28590. Hugo (hchang800) 3 103.65 115.45 3 100.00
28591. Haxwhy (haxwhy) 3 47.66 50.77 0 0.00
28592. Havel (havel29) 3 86.61 90.25 0 0.00
28593. hasan (hassan_yousefi) 3 47.08 48.68 0 0.00
28594. Muhammad Hassaan Wajid (has... 3 65.95 68.13 0 0.00
28595. HasiTheAvenger (hasitheaven... 3 44.03 46.54 1 33.33
28596. harsh (harshlunagaria) 3 59.28 63.44 2 66.67
28597. Harry (harrythegreat9) 3 47.72 52.21 2 66.67
28598. Hzifah (hariaz27) 3 37.26 42.08 2 66.67
28599. Matthew (happychau0v0) 3 81.68 84.68 3 100.00
28600. TM22 (hanschen96) 3 86.77 97.26 1 33.33
28601. therealed777 (handwritingch... 3 107.10 115.73 3 100.00
28602. imnotanygood (handicaped) 3 82.32 86.17 2 66.67
28603. Hanami (hanamiaiko) 3 58.79 60.94 1 33.33
28604. Hector (hampsterking9000) 3 68.11 74.51 1 33.33
28605. Ferbo (g_ferbo) 3 90.06 102.40 1 33.33
28606. Gur (gur111) 3 76.57 81.55 3 100.00
28607. Lance (gulickle) 3 88.14 90.82 1 33.33
28608. Guilherme (gui_szk) 3 67.87 73.06 0 0.00
28609. GTank (gtank) 3 103.65 120.59 2 66.67
28610. Grten (grten) 3 70.12 72.23 1 33.33
28611. Eric (grqy) 3 98.94 107.46 3 100.00
28612. Ismail (group4k) 3 74.23 79.11 2 66.67
28613. Grizzle (grizzlemonk) 3 111.35 119.01 2 66.67
28614. Gremble (gremble) 3 87.22 91.20 1 33.33
28615. Kevin (greetedsine6) 3 77.47 80.61 0 0.00
28616. Gravity (gravity_eyes) 3 82.55 86.37 3 100.00
28617. tstats[gravityhurts] (gravi... 3 98.81 105.76 1 33.33
28618. Gratias (gratias1) 3 55.56 61.06 0 0.00
28619. Marco (gras8) 3 43.77 45.36 0 0.00
28620. Ivan (grapfik) 3 43.76 45.31 1 33.33
28621. GG (goldy_boi) 3 79.18 90.60 0 0.00
28622. GoldenPotato (goldenpotato) 3 90.89 105.38 0 0.00
28623. going4speed (going4speed) 3 75.46 78.53 1 33.33
28624. Tushar (god_fingers) 3 78.26 80.89 1 33.33
28625. Gnr. Garst (gnr_garst) 3 68.07 76.33 2 66.67
28626. Ryan (glasses928) 3 72.98 84.22 1 33.33
28627. Greg (gkup8) 3 106.88 111.49 0 0.00
28628. A3gon (giralt) 3 70.78 85.27 0 0.00
28629. Jittimon (gibjittimon) 3 33.46 38.75 0 0.00
28630. Parker (ghxstie) 3 88.10 92.92 0 0.00
28631. Jack (ghoultree) 3 99.01 117.65 2 66.67
28632. Ghosy (ghosy) 3 82.51 89.37 0 0.00
28633. Kosuke (ghostkk) 3 89.39 106.75 3 100.00
28634. ghina (ghinaz) 3 49.78 60.34 2 66.67
28635. celia (ghettogarbagemonster) 3 45.46 54.83 1 33.33
28636. Adam (gh00st) 3 58.04 66.21 1 33.33
28637. Gabriel (gfz1k) 3 46.70 49.01 0 0.00
28638. Geukers (geukers) 3 89.75 100.88 1 33.33
28639. Oseph (getoutofmyhouse) 3 112.47 117.37 3 100.00
28640. Mark (geronimus) 3 72.20 83.40 1 33.33
28641. George (georgesung25) 3 90.06 94.09 1 33.33
28642. Hubert (georgeger) 3 36.24 37.54 0 0.00
28643. gelis (gelis07) 3 68.04 75.28 0 0.00
28644. Gegug (gegug) 3 96.17 107.55 1 33.33
28645. Tom (gearsofvore) 3 88.44 94.73 1 33.33
28646. gaule (gaule) 3 75.63 84.73 1 33.33
28647. Gabriel (gatauahmalesbiasalah) 3 68.55 71.58 0 0.00
28648. Danyon (gasperdb) 3 100.62 116.41 1 33.33
28649. Garvit (garvitar) 3 62.87 69.16 1 33.33
28650. Ryan Kim (gardenhoe) 3 139.83 151.42 0 0.00
28651. Setu (ganjuitta) 3 95.82 102.87 2 66.67
28652. Gamesepic123 (gamesepic123) 3 53.22 60.29 1 33.33
28653. skream² (galil_gaben) 3 87.53 93.02 1 33.33
28654. Austin (galactiac) 3 80.26 90.83 0 0.00
28655. Gabriel (gabrielke) 3 62.86 65.02 1 33.33
28656. fyre_chicken (fyre_chicken) 3 57.49 60.86 0 0.00
28657. Dawson (funkemunky) 3 88.84 89.44 1 33.33
28658. - (fullswingtango) 3 103.03 112.42 1 33.33
28659. Logan (fudge500) 3 82.90 86.12 1 33.33
28660. MOON (frozenmoonage) 3 98.53 111.97 0 0.00
28661. Henry (frostyedits) 3 101.96 106.54 2 66.67
28662. Thomas (froskeprinsen) 3 49.52 52.05 1 33.33
28663. friwerowsky (friwerowsky) 3 93.05 96.52 2 66.67
28664. freemind1992 (freemind1992) 3 53.95 62.76 1 33.33
28665. Freddy (fredyael) 3 43.58 47.07 2 66.67
28666. Meow (franklin31113) 3 86.48 90.63 1 33.33
28667. Frank (frankiboi) 3 54.51 56.20 1 33.33
28668. Fprase (fprase) 3 73.50 87.38 1 33.33
28669. Tony (forthawhur) 3 117.31 127.58 2 66.67
28670. Forb. (forbearance) 3 119.65 130.91 2 66.67
28671. Zeb (foghorn) 3 88.30 95.14 2 66.67
28672. Chris (fogcityroller) 3 117.99 126.86 2 66.67
28673. Francesca (fmbuckley) 3 66.58 76.63 1 33.33
28674. Byte_Zero (flo_one) 3 67.06 72.07 0 0.00
28675. d (flindocks) 3 82.35 86.16 0 0.00
28676. Flex (flex_luthor) 3 69.22 71.29 2 66.67
28677. Rachael (fleefloop) 3 41.22 46.43 1 33.33
28678. Kevin (flash98765) 3 85.02 90.85 3 100.00
28679. Hannah (flambewater) 3 72.84 74.18 1 33.33
28680. Michael (fl4mx) 3 133.32 148.59 3 100.00
28681. Chanson (fistarmeister) 3 96.76 100.21 2 66.67
28682. fistedpancake (fist3dpancake_) 3 92.02 96.53 2 66.67
28683. fishmatt (fishmatt) 3 89.95 107.41 3 100.00
28684. firedarkS (firedarks) 3 108.10 115.24 1 33.33
28685. Nolan (finny210) 3 69.34 75.13 1 33.33
28686. Fingers (fingersgofast) 3 127.01 131.98 2 66.67
28687. Philis (fillegunnar) 3 41.42 45.06 0 0.00
28688. Filip (filis93) 3 109.21 118.62 3 100.00
28689. Filicia (filicia) 3 53.80 55.48 0 0.00
28690. filassy (filassy) 3 95.55 109.75 1 33.33
28691. figher2016 (fighter2016) 3 71.87 81.44 0 0.00
28692. Andi (fianputra157) 3 60.70 67.18 0 0.00
28693. Chris (fhondubity) 3 123.62 125.41 3 100.00
28694. Feliks (fgpfelix) 3 54.06 54.43 0 0.00
28695. Daniel (fflake) 3 79.10 90.59 0 0.00
28696. Jeff (ffej5333) 3 70.81 76.81 0 0.00
28697. Kenneth (feyro) 3 70.94 78.72 3 100.00
28698. Ferotiq (ferotiq) 3 86.17 99.86 1 33.33
28699. Diego (fenderthelion) 3 53.17 55.22 0 0.00
28700. Heather (feedtheflames) 3 86.93 98.96 1 33.33
28701. Feb (feb_ryan) 3 49.39 54.12 1 33.33
28702. Featfox (featfox) 3 91.17 97.33 0 0.00
28703. Travis (fcdrummer01) 3 81.18 87.93 0 0.00
28704. Fred (fblue) 3 76.76 103.11 1 33.33
28705. Nathan (faustytr) 3 81.16 92.52 2 66.67
28706. Faurazeko (faurazeko) 3 60.31 66.04 1 33.33
28707. FatCat (fatcat2) 3 99.40 102.45 2 66.67
28708. amy (fasttrainchoochoo) 3 98.34 100.17 2 66.67
28709. zawa9 (faston) 3 41.00 48.18 1 33.33
28710. Haji (fart_dude) 3 62.22 65.21 0 0.00
28711. farlig (farlig1) 3 95.69 103.78 2 66.67
28712. Fathan (falonez) 3 51.69 58.69 0 0.00
28713. fakakon (fakakon) 3 71.44 73.83 2 66.67
28714. Faith (faithy3) 3 104.64 113.02 2 66.67
28715. Faisal (faisal0) 3 67.23 74.04 1 33.33
28716. Tyler (failuretolaunch) 3 46.29 49.73 0 0.00
28717. (fafadoodle) 3 130.71 146.05 3 100.00
28718. Hikaru (fadilach) 3 87.06 103.39 3 100.00
28719. FadesHandle (fadeshandle) 3 67.26 74.24 1 33.33
28720. Facundo (facundof13) 3 86.69 105.42 1 33.33
28721. AmauryM (facepalmtyping) 3 75.99 78.21 2 66.67
28722. f4ww4z (f4ww4z) 3 90.85 95.23 1 33.33
28723. eyeliddy (eyeliddy2) 3 93.82 98.04 2 66.67
28724. dustin (eyedi) 3 96.02 107.57 1 33.33
28725. Exxon (exxon) 3 75.56 83.44 1 33.33
28726. EXTREMEBEAST537 (extremebea... 3 56.36 59.90 1 33.33
28727. Casey (ewoozy) 3 56.44 66.49 1 33.33
28728. Edward (ewc340) 3 96.57 100.78 1 33.33
28729. Ed (ewardabaus) 3 142.66 154.93 3 100.00
28730. EvJ (ev_j) 3 91.08 96.61 0 0.00
28731. Gray (evlyra) 3 107.43 112.63 3 100.00
28732. Evan (evennumber2) 3 67.12 77.33 0 0.00
28733. onlankershim (eugenethreat) 3 106.72 121.53 1 33.33
28734. followme (ethish) 3 54.79 63.31 1 33.33
28735. etherene (etherene) 3 59.28 70.48 0 0.00
28736. blueturtle (esraels) 3 84.94 89.56 0 0.00
28737. Shikigami (ersunema) 3 53.92 56.88 0 0.00
28738. Error (errorws) 3 97.40 98.70 3 100.00
28739. Erik (erky1952) 3 112.34 120.79 2 66.67
28740. Jon (erikzh) 3 56.68 57.41 0 0.00
28741. Eric (ericyau82) 3 40.13 41.77 0 0.00
28742. Erick (erickp32) 3 75.88 85.51 0 0.00
28743. erayser (erayser) 3 97.88 104.06 0 0.00
28744. Ruda (epic_333) 3 71.28 72.47 0 0.00
28745. Andrew (epiandrew) 3 93.10 100.64 1 33.33
28746. EonDuoLatios (eonduolatios) 3 84.97 86.24 3 100.00
28747. Enrrique (enriqu3714) 3 61.99 68.00 1 33.33
28748. Nathaniel (engage) 3 85.71 87.06 2 66.67
28749. EnderMite (endermite) 3 70.73 76.42 1 33.33
28750. Empirix (empirix) 3 85.47 90.95 0 0.00
28751. emily (emmyentropy) 3 65.93 77.08 0 0.00
28752. EmiRoseMoore (emirosemoore) 3 105.05 128.67 2 66.67
28753. Ethan (eminum99) 3 61.35 64.81 2 66.67
28754. Emily (emilyvol6) 3 50.94 56.00 0 0.00
28755. Electronic (emil2107) 3 101.09 110.25 1 33.33
28756. Maria (emejota) 3 52.11 54.23 0 0.00
28757. EMCL (emcl) 3 134.19 146.90 3 100.00
28758. Raphael (elysian_fields) 3 53.02 59.97 2 66.67
28759. El (eluif4) 3 69.41 72.75 3 100.00
28760. One Finger (elionefinger) 3 61.49 68.82 0 0.00
28761. Elen (eliivapuu) 3 67.45 77.55 1 33.33
28762. Elias (eliasstr53) 3 59.54 61.28 2 66.67
28763. Giovanni (elgiov) 3 82.01 88.77 0 0.00
28764. Eli (elewint) 3 118.22 133.43 3 100.00
28765. Element (elementoop) 3 80.72 91.63 1 33.33
28766. eldrick (eldricck) 3 58.29 68.03 1 33.33
28767. Eldar (eldartoleubay1) 3 35.30 41.60 2 66.67
28768. Addy (egglols) 3 87.04 90.96 0 0.00
28769. eloise (eeloise) 3 86.20 87.77 2 66.67
28770. Eduardo (eduardocg) 3 62.12 64.83 0 0.00
28771. Edo (edo4th) 3 70.46 77.07 0 0.00
28772. Eden (edenboboi) 3 71.13 74.62 0 0.00
28773. Charlie (eatsrice) 3 99.02 106.86 0 0.00
28774. eashr37 (eashr37) 3 70.41 75.66 0 0.00
28775. Thanh (d_t_nguyen) 3 79.86 82.63 1 33.33
28776. 🐢 (dzzz664) 3 91.89 93.04 1 33.33
28777. mangled (dyslectic) 3 103.66 109.24 2 66.67
28778. JEDIDIAH (dyna_myte) 3 63.17 69.45 0 0.00
28779. Fitz (dylab) 3 124.17 128.57 3 100.00
28780. Adam (dwindleflip) 3 82.15 86.12 1 33.33
28781. Daniel (dwang18) 3 117.89 119.34 1 33.33
28782. Denis (dwake) 3 59.24 70.91 1 33.33
28783. DVORAK Dell KB522/Asus G01K... 3 122.70 136.86 2 66.67
28784. Dunking3022 (dunking3022) 3 79.79 81.60 2 66.67
28785. Jimmy (dumplingrecipe) 3 75.98 84.66 0 0.00
28786. Derrick (dummy_123) 3 76.04 78.41 0 0.00
28787. Landen (duklin) 3 106.79 110.98 1 33.33
28788. dude (dudeorino) 3 59.86 68.86 1 33.33
28789. breh (duclc) 3 83.04 88.01 1 33.33
28790. duckie (ducknoodles25) 3 112.33 125.89 2 66.67
28791. duckmoon99 (duckmoon99) 3 91.13 105.00 0 0.00
28792. Alex (dubalpha) 3 98.48 107.33 3 100.00
28793. Chris (dtarzan) 3 79.21 81.80 1 33.33
28794. Dan (dstreety) 3 45.15 51.13 1 33.33
28795. Clifford (drizzleup) 3 51.23 58.95 0 0.00
28796. Austin (driedisland7766) 3 91.68 96.17 2 66.67
28797. Drew (drewsworth) 3 91.09 103.34 1 33.33
28798. Drew (drewsalem) 3 102.62 124.20 2 66.67
28799. John (dregz) 3 71.19 73.94 1 33.33
28800. dreezy (dreeezy) 3 71.69 73.61 1 33.33
28801. Camilo (drcabo26) 3 69.80 78.91 0 0.00
28802. Nguyen (dra_go) 3 78.42 91.66 2 66.67
28803. Carl (draori) 3 114.44 120.06 1 33.33
28804. Andy (drancio) 3 85.03 89.96 1 33.33
28805. matt (drakkus) 3 134.21 141.25 2 66.67
28806. Dragos (dragoselu) 3 75.69 95.00 2 66.67
28807. Drago (dragosan) 3 63.11 68.33 2 66.67
28808. Goon (dragonszn) 3 75.93 86.93 1 33.33
28809. Neon (dragonkingscrown) 3 54.05 64.54 0 0.00
28810. Doug (dougly) 3 87.05 91.55 1 33.33
28811. Douglas (douglasmm24) 3 85.37 93.24 1 33.33
28812. Dora (dorasmoothy) 3 97.83 101.86 2 66.67
28813. hanni3 (dontwakeme) 3 70.86 82.41 2 66.67
28814. Steph (donnerblumen) 3 64.35 71.04 1 33.33
28815. David (donkykong2008) 3 87.57 94.62 2 66.67
28816. George (dolias) 3 118.77 124.24 2 66.67
28817. Vivian (dojacatsfeet) 3 88.92 95.40 1 33.33
28818. DoGe (doge_) 3 92.24 101.49 3 100.00
28819. Mun Hin (dodo_bird) 3 79.32 85.40 0 0.00
28820. Andy (doctorhammer) 3 51.13 55.58 0 0.00
28821. Duc Anh (doc1997) 3 94.94 97.05 1 33.33
28822. D (dmaulish) 3 102.74 109.68 2 66.67
28823. Lucid (dldri) 3 95.78 111.95 1 33.33
28824. Daniel (dlarocque) 3 82.87 91.30 3 100.00
28825. Dkaf (dkaf9497) 3 95.56 102.19 0 0.00
28826. angula (dixiehugh) 3 46.21 49.63 0 0.00
28827. Ditto (dittochang) 3 91.57 112.51 1 33.33
28828. Jörg (dislookskewl) 3 51.74 57.51 1 33.33
28829. discordia (discordia1) 3 81.44 90.56 1 33.33
28830. Julian (disclo5ure) 3 144.65 146.39 3 100.00
28831. Dirix (dirix1219) 3 101.29 115.95 2 66.67
28832. direw (direw) 3 61.55 64.72 0 0.00
28833. Dino (dinzxd) 3 51.81 55.14 1 33.33
28834. dinesh (dinesh66) 3 50.59 52.37 1 33.33
28835. Dimitri (dimitrins) 3 74.79 81.77 2 66.67
28836. Dill (dillz_weed) 3 125.88 138.86 1 33.33
28837. Diego (dieagui) 3 56.11 62.24 1 33.33
28838. Dian (dianeka) 3 43.51 49.93 1 33.33
28839. Emerson (diamondud3) 3 79.70 87.03 1 33.33
28840. Diahpn (diahnurrahmah) 3 42.33 43.44 0 0.00
28841. brian (dhafjkskjh) 3 128.62 132.61 1 33.33
28842. De_Stroyed (de_molished) 3 94.59 104.68 2 66.67
28843. Dex (dexister) 3 100.52 108.93 2 66.67
28844. Alex (dexiple) 3 85.59 89.52 1 33.33
28845. Devender (dev2002) 3 51.40 58.67 0 0.00
28846. Francesco (deto_man) 3 72.82 83.31 1 33.33
28847. Andrew (dethzombi) 3 89.20 99.50 1 33.33
28848. Jacob (derr1) 3 85.66 96.45 1 33.33
28849. Jin (derherro) 3 94.83 103.23 3 100.00
28850. Derek (derekomgmok) 3 47.41 49.77 0 0.00
28851. derdier (derdier) 3 105.59 117.93 2 66.67
28852. Nicky (denmam69) 3 60.78 62.38 0 0.00
28853. Delros (delros) 3 115.17 121.22 3 100.00
28854. Delirious (deliriousbadger) 3 85.00 90.55 0 0.00
28855. D (deffenel_782) 3 95.14 103.90 1 33.33
28856. Deependra (deepak_typer) 3 59.20 64.00 1 33.33
28857. Robert (deeckie) 3 91.77 96.22 1 33.33
28858. deckador (deckador) 3 109.69 115.90 2 66.67
28859. noobboy (debiggay) 3 107.59 134.56 1 33.33
28860. Thuan (deadlydragon100) 3 112.76 130.82 1 33.33
28861. Biscuit (ddxddx) 3 60.14 66.01 2 66.67
28862. Derek (ddw004) 3 67.56 74.44 0 0.00
28863. Anthony (ddragon217) 3 67.21 72.51 1 33.33
28864. Dylan (dc4lif3) 3 70.88 77.31 1 33.33
28865. debwl (dbwls) 3 74.92 78.21 1 33.33
28866. Amritanshu (da_sikka_x) 3 97.73 105.64 1 33.33
28867. daMidu (da_midu) 3 74.11 82.16 1 33.33
28868. Alexander (dawgsrlife) 3 109.80 110.54 0 0.00
28869. David (davidniupa) 3 68.70 72.14 2 66.67
28870. Dave (daviddatroll) 3 56.03 57.95 1 33.33
28871. David (david0524) 3 107.36 125.71 3 100.00
28872. Hector (datafli) 3 72.38 80.22 0 0.00
28873. Daniels (dasis5) 3 78.17 84.12 1 33.33
28874. Darshan (darshanlakkundi) 3 67.30 75.68 3 100.00
28875. Darrix (darrixl) 3 109.86 119.17 3 100.00
28876. s (dapawner) 3 108.58 120.39 2 66.67
28877. dansuke (dansuke) 3 69.12 82.87 0 0.00
28878. Dannyngve (dannyngve) 3 56.71 63.62 3 100.00
28879. Daniel (dannyfannyg) 3 74.69 78.55 0 0.00
28880. Dan (danjohnson1209) 3 68.18 69.44 1 33.33
28881. Daniel (daniel_ga_1309) 3 62.73 67.21 2 66.67
28882. Daniel (danielmini0101) 3 97.32 107.15 3 100.00
28883. Corlex (dani356d) 3 112.37 116.32 2 66.67
28884. Danai (dan9s_) 3 68.06 74.88 0 0.00
28885. Damon (damon1864) 3 50.50 64.68 1 33.33
28886. Damjan (damjank) 3 68.41 75.01 1 33.33
28887. Dakota (dakbell) 3 97.39 99.55 1 33.33
28888. Aaron (daggertye) 3 116.35 131.93 0 0.00
28889. David (dafweeda) 3 86.89 92.74 0 0.00
28890. Mike (daemonevox) 3 65.41 70.21 1 33.33
28891. d4nielle (d4ni_typer) 3 95.81 108.06 3 100.00
28892. Adi (cylify) 3 55.66 56.08 0 0.00
28893. Nirzhor (cyclonite) 3 64.56 72.31 0 0.00
28894. Cyberwolf (cyberwolf555) 3 93.02 99.87 1 33.33
28895. John (cyal8er) 3 113.35 124.58 1 33.33
28896. CWCCX.Artist (cwccx_artist) 3 59.75 62.76 0 0.00
28897. Owen (cvlized) 3 31.00 33.91 0 0.00
28898. Cuthalion (cuthalion) 3 113.70 122.01 1 33.33
28899. Pavel (curlink) 3 46.22 48.53 0 0.00
28900. josh (cubuff8) 3 87.93 103.19 1 33.33
28901. Kavin (cuboidmaniac) 3 72.46 73.64 1 33.33
28902. cty28137 (cty28137) 3 90.03 99.06 2 66.67
28903. Crystal (crystalwen) 3 90.67 95.47 3 100.00
28904. tyrone (crvckhead) 3 52.06 56.97 0 0.00
28905. Spas (crsorsmth) 3 113.96 131.16 2 66.67
28906. chicken (crossedhands) 3 103.74 109.45 3 100.00
28907. Christos (cros107) 3 97.23 111.97 0 0.00
28908. Chris (cronox) 3 127.79 133.62 2 66.67
28909. Christopher (critterjohnson) 3 78.18 80.97 0 0.00
28910. Cris (cris001) 3 75.07 75.92 2 66.67
28911. Crimsoonn (crimsoonn) 3 74.52 78.14 1 33.33
28912. Patrick (crimson_talon) 3 126.50 128.04 1 33.33
28913. Filip (creer) 3 69.78 70.11 1 33.33
28914. Mohammed (creative506) 3 68.02 75.58 0 0.00
28915. Extrode (crazytrends) 3 101.92 116.72 1 33.33
28916. Srihari (crazysriharii) 3 84.20 90.13 0 0.00
28917. crappyper (crappyper) 3 83.96 89.96 0 0.00
28918. DholaSain (cptmujahid) 3 60.02 68.80 0 0.00
28919. Cheembs (cottagethepottage) 3 66.88 71.88 2 66.67
28920. cosmix (cosmix) 3 139.32 156.32 3 100.00
28921. Cory (corydean) 3 108.32 121.15 2 66.67
28922. CortsTypist (cortsvan) 3 96.59 98.27 2 66.67
28923. Cornelius (corneliusyan) 3 96.44 101.86 3 100.00
28924. Cooper (coopy498) 3 86.00 90.82 2 66.67
28925. Conrad (conradkay) 3 123.57 131.83 2 66.67
28926. Conner (connerfitz) 3 104.56 110.31 2 66.67
28927. Arno (computer_9) 3 46.94 49.08 0 0.00
28928. Combo (combospag) 3 119.70 126.52 2 66.67
28929. me type gud (coltvhd) 3 137.42 142.83 3 100.00
28930. wiiiiiiiiiiiiiiiiiiiiiiiiii... 3 116.76 125.25 3 100.00
28931. Abdulla (coldeye3) 3 46.10 53.27 1 33.33
28932. colby (colbyfuchs) 3 61.58 74.11 1 33.33
28933. Coffee (coffeezzz) 3 54.01 55.90 0 0.00
28934. Tim (codingmaster) 3 84.15 89.16 1 33.33
28935. Hi (coarse) 3 104.98 106.54 3 100.00
28936. Ali (cloudy_coyote) 3 80.07 88.68 0 0.00
28937. Cliptic (cliptic_) 3 78.91 86.22 2 66.67
28938. Zeb (cleavecamael) 3 92.98 101.37 2 66.67
28939. Joel (clashofkeys) 3 80.49 84.24 1 33.33
28940. Joel (clarkwest1) 3 38.84 42.16 0 0.00
28941. Cj (cjp2739) 3 62.02 68.00 2 66.67
28942. cj (cjanti) 3 62.29 69.65 2 66.67
28943. Gokula (citizen34) 3 53.99 57.11 0 0.00
28944. cig (cigtype) 3 96.72 100.51 1 33.33
28945. Ian (cigaweed) 3 93.04 101.05 1 33.33
28946. ChyShabo (chyshabo) 3 56.93 58.65 0 0.00
28947. chris (chwis) 3 70.98 77.75 0 0.00
28948. Yam (chunchumh) 3 62.08 67.06 0 0.00
28949. Connor (chuggs1798) 3 99.05 116.90 1 33.33
28950. Matt (chuckleschopstick) 3 90.60 117.00 1 33.33
28951. chubbylc (chubbylc) 3 83.95 90.73 0 0.00
28952. Chronp (chronp) 3 29.59 35.87 0 0.00
28953. CHRON (chronnie) 3 100.77 108.93 1 33.33
28954. Zoot (chroniaro) 3 92.97 94.52 3 100.00
28955. Christof (christofvanhove) 3 50.32 56.25 0 0.00
28956. Christina (christina0907) 3 70.24 78.44 2 66.67
28957. Chris (christaborg) 3 102.07 109.90 2 66.67
28958. chris :) (chrissypop) 3 58.91 67.99 0 0.00
28959. chrissie911 (chrissie911) 3 107.24 111.05 0 0.00
28960. christopher (chrismoss5) 3 20.95 23.75 0 0.00
28961. Chocolate (chocolatekid) 3 82.43 87.79 0 0.00
28962. Chloro (chlorowins) 3 103.16 107.20 2 66.67
28963. Chloe (chloegamedev) 3 98.97 106.19 2 66.67
28964. Shiv (chi_ken) 3 67.15 74.38 2 66.67
28965. Chinmay_Tiwari (chinmay_tiw... 3 66.81 69.22 0 0.00
28966. chiirin (chiirin) 3 78.80 83.07 1 33.33
28967. Rahat (chiefrahat) 3 64.06 68.96 0 0.00
28968. ChickenMaster (chickenmaster1) 3 84.27 99.03 0 0.00
28969. mergaza (chiboub) 3 108.58 118.39 2 66.67
28970. Austin (chewzy) 3 152.43 167.58 1 33.33
28971. Chenna (chenna06) 3 72.31 81.09 0 0.00
28972. Cheska (cheesekuh) 3 109.47 119.21 2 66.67
28973. Creamy (cheesebutt69) 3 137.62 145.91 3 100.00
28974. Hinn (cheehinn) 3 63.61 86.21 3 100.00
28975. lacktoast (cheaky46) 3 42.70 45.48 0 0.00
28976. ChandraMouli (chandramouli) 3 41.80 43.38 0 0.00
28977. glassbottle (chambonu) 3 95.91 100.81 1 33.33
28978. Gevorg (cgev) 3 76.38 78.52 1 33.33
28979. Cezou (cezou) 3 67.49 75.13 1 33.33
28980. Alexander (ceverion) 3 111.59 117.50 2 66.67
28981. Dena (cestdena) 3 57.44 62.35 0 0.00
28982. Hento (ceckerli) 3 76.73 96.73 1 33.33
28983. cecilie (ceci754f) 3 58.15 62.82 1 33.33
28984. Caven (caven) 3 90.30 94.87 3 100.00
28985. Christopher (catmando00) 3 41.22 46.55 0 0.00
28986. Casual (casual_penguin) 3 115.27 123.73 2 66.67
28987. Dolton (caramelsauces) 3 57.72 66.66 2 66.67
28988. mike (capzor) 3 78.77 82.69 0 0.00
28989. Sebastian (cantdefeatairman) 3 34.46 37.35 3 100.00
28990. WHO (candleshands) 3 47.56 51.07 0 0.00
28991. veinrocket (canadianruler) 3 90.37 100.78 1 33.33
28992. Cameron (camd1zy) 3 73.12 75.85 1 33.33
28993. Callum (cal_dis) 3 124.49 138.60 2 66.67
28994. Slobodan (calorifically) 3 78.29 94.37 2 66.67
28995. Audric (callmeric) 3 39.68 50.53 0 0.00
28996. Albert (callmeal) 3 91.44 95.28 0 0.00
28997. Tom (calder27) 3 88.24 104.73 2 66.67
28998. Cain (cainlimbo) 3 69.57 80.10 0 0.00
28999. cooter (c0oter) 3 59.94 64.09 1 33.33
29000. Bri (b_marli) 3 106.05 119.61 0 0.00
29001. Benjamin (bw1625) 3 162.26 164.03 0 0.00
29002. ANNEw (butzy) 3 68.17 68.76 0 0.00
29003. BUSH (bushtyperacer) 3 99.79 103.82 1 33.33
29004. Ashley (bunnymama23) 3 90.92 97.86 1 33.33
29005. Bunjee (bunjeeman27) 3 59.98 72.79 0 0.00
29006. olajide olatunji (bulgelord) 3 96.80 103.32 2 66.67
29007. Buenas Tardes (buenastardes) 3 57.66 62.80 0 0.00
29008. bu (bubu2006) 3 61.98 63.78 0 0.00
29009. Lan (bubbleangel33) 3 112.38 121.94 1 33.33
29010. Almahbuby (bubanz1101) 3 77.18 78.88 1 33.33
29011. neblig (bsy_af) 3 73.92 79.68 1 33.33
29012. Bruh (bruhmoem) 3 81.82 89.68 1 33.33
29013. kewuan (bruhletmein) 3 42.57 45.94 0 0.00
29014. Vathan (bruddinha) 3 72.66 79.37 1 33.33
29015. Aodhan (brsijraz) 3 90.23 101.35 3 100.00
29016. Broodje (broodjebal74) 3 84.15 91.60 2 66.67
29017. Braxton (brontar) 3 59.38 68.94 0 0.00
29018. Brock (brockgoins01) 3 52.55 64.47 0 0.00
29019. Bristopher (bristopherwoods) 3 64.54 73.88 1 33.33
29020. Brian (briank91) 3 114.91 125.72 1 33.33
29021. 😀 (brettkavanaughcj) 3 96.54 102.53 1 33.33
29022. Brenda (brendaiscool) 3 82.77 91.66 3 100.00
29023. Bratke (bratke) 3 82.03 89.58 2 66.67
29024. Brandon (bransap) 3 98.46 110.54 3 100.00
29025. Brandon (brandonhariyanto) 3 98.18 100.12 2 66.67
29026. Brandon (brandinothefilipino) 3 154.55 167.75 1 33.33
29027. Maksym (branchofsin) 3 46.48 53.18 1 33.33
29028. João (brancao) 3 74.79 82.38 1 33.33
29029. Bradley (bradt30h) 3 85.29 87.45 1 33.33
29030. Brandon (bradenpatoni) 3 103.19 106.63 1 33.33
29031. Ethan (boxisfat) 3 37.79 43.45 0 0.00
29032. Andre (bouncybear6969) 3 76.69 79.19 0 0.00
29033. HauntedMop (boss_mario) 3 85.78 93.34 3 100.00
29034. Euan (bossmankrabs) 3 59.86 64.97 1 33.33
29035. Lilac (borntosurvive27) 3 57.81 58.63 0 0.00
29036. borkes (borkes) 3 56.55 60.89 1 33.33
29037. boris (borisu) 3 72.31 79.91 2 66.67
29038. booger (boogerbuttcheeks) 3 101.49 103.03 0 0.00
29039. qwerty_han (booboo_) 3 91.05 104.42 1 33.33
29040. Bonnie (bonbon601) 3 58.10 60.42 1 33.33
29041. Ignacy (bombylius) 3 86.14 90.03 0 0.00
29042. bogo (bogo10) 3 76.53 78.98 1 33.33
29043. Jonathan (bods_88) 3 73.67 79.64 1 33.33
29044. Emmanuel (bodmas) 3 94.55 103.67 0 0.00
29045. bob (bobsmith111) 3 70.83 77.33 1 33.33
29046. Bob (bobrossisfresh792) 3 50.63 59.58 2 66.67
29047. Alex (bobpoopsalot8) 3 92.75 97.22 3 100.00
29048. Veritas (bobo347844) 3 82.61 86.41 1 33.33
29049. nathan (bobhehehe69) 3 49.35 58.80 1 33.33
29050. Bob (bobgolf) 3 77.01 79.98 0 0.00
29051. Eli (bobfrankie) 3 109.36 124.95 3 100.00
29052. boas (boas) 3 92.63 96.96 2 66.67
29053. Akko (blue_akko) 3 67.67 72.70 0 0.00
29054. bluesheep97 (bluesheep97) 3 100.28 102.64 3 100.00
29055. Blue (bluemoonzz) 3 72.28 80.48 0 0.00
29056. Philemon (blubblubgoldfish1... 3 59.31 60.96 2 66.67
29057. dox (bloxyshark) 3 104.29 109.11 3 100.00
29058. Bob (blooperboy) 3 129.20 139.42 2 66.67
29059. Abhay (bloodyhero) 3 78.50 84.52 2 66.67
29060. Calvin (blindpainter) 3 84.09 87.10 1 33.33
29061. Blastoise (blastoise24) 3 103.98 112.54 1 33.33
29062. Xavier (blademaster5) 3 68.16 69.69 0 0.00
29063. Black (blackhacker) 3 55.00 58.67 0 0.00
29064. Jack (blackened_angel) 3 72.85 83.13 0 0.00
29065. Billy (billydoesgaming) 3 122.08 125.78 2 66.67
29066. bilegt (bilegtkka) 3 46.84 48.34 0 0.00
29067. tstats[bilayer] (bilayer) 3 113.72 139.02 1 33.33
29068. Arif (bilai) 3 51.72 53.90 1 33.33
29069. Vibes (big_vibe) 3 68.44 79.07 0 0.00
29070. bigwayv (bigwayv) 3 52.48 55.33 0 0.00
29071. Kevin (bigtimetyperacer) 3 121.01 129.43 2 66.67
29072. Mina (bigoppai) 3 60.77 62.12 2 66.67
29073. Big Khagan (bigkhagan) 3 44.20 46.02 3 100.00
29074. Alan (bigd_16_in) 3 91.52 108.53 1 33.33
29075. f (bigbarney) 3 49.93 53.19 3 100.00
29076. Biasface (biasface) 3 120.91 125.24 2 66.67
29077. Paweł (biah2206) 3 74.43 84.84 1 33.33
29078. sam (beuk15) 3 70.63 74.83 3 100.00
29079. Zhibek (besunshine) 3 35.96 49.29 1 33.33
29080. Albert (bertikcertik) 3 77.21 85.27 0 0.00
29081. Ben (benspeedin) 3 81.66 83.00 1 33.33
29082. Ben (bensilasf) 3 52.64 63.70 1 33.33
29083. beng (benguwu) 3 96.17 105.77 1 33.33
29084. Ben (benf999) 3 111.73 113.36 1 33.33
29085. Vincentius (benaldii) 3 67.31 69.00 1 33.33
29086. bell (bell125) 3 77.12 82.06 2 66.67
29087. Pumpkin (beigepumpkin) 3 80.35 88.26 2 66.67
29088. BÉ HEO (beheo2012) 3 24.48 28.76 1 33.33
29089. BeeTheKay (beethekay) 3 55.27 59.13 1 33.33
29090. Jaloliddin (beebeep) 3 30.99 32.71 0 0.00
29091. because (because_123) 3 88.90 95.72 2 66.67
29092. bebeconsarna (bebeconsarna) 3 36.64 40.76 1 33.33
29093. beans (beans_baked) 3 61.35 63.53 1 33.33
29094. Bean (beanx316) 3 77.52 80.48 0 0.00
29095. BeanLord (beanlordishere) 3 58.15 63.81 2 66.67
29096. Shamus (bbtoskar) 3 55.18 64.71 1 33.33
29097. Brad (bborrell) 3 76.96 82.29 1 33.33
29098. Ambien (bbcocaine) 3 96.39 99.11 1 33.33
29099. Billy (bathtimebilly) 3 96.30 110.26 2 66.67
29100. Lukas (barorak) 3 46.26 49.03 0 0.00
29101. baron (baronvie) 3 78.61 90.31 1 33.33
29102. BaoOtakun (baootakun) 3 44.21 45.52 0 0.00
29103. Sam (bananaman923) 3 101.90 115.90 1 33.33
29104. Anonymous (ballistic_kraken) 3 92.97 104.66 0 0.00
29105. Ramiro (baginius3000) 3 44.99 54.82 0 0.00
29106. Christopher (baby_chou) 3 76.05 102.08 0 0.00
29107. Babylons (babylons) 3 84.20 86.04 1 33.33
29108. Matt (babyeater58) 3 69.40 73.76 0 0.00
29109. Ben (baboo_) 3 78.08 84.23 0 0.00
29110. Evan (bababooouy) 3 47.63 50.14 1 33.33
29111. Hugh (a_very_hughjanus) 3 106.64 122.09 2 66.67
29112. Azaan (azstar) 3 98.38 101.29 2 66.67
29113. Azal (azalro) 3 60.79 67.34 0 0.00
29114. ayytimbo (ayytimbo) 3 88.58 99.22 1 33.33
29115. Marc (ayylmarc) 3 95.23 97.67 1 33.33
29116. Ayush (ayushprem) 3 39.83 42.20 1 33.33
29117. Mr.T (aysanoglu) 3 72.81 74.66 0 0.00
29118. Ayrton (ayrton1110) 3 71.14 73.42 1 33.33
29119. Kyle (awesomeinator42) 3 61.31 64.65 0 0.00
29120. Sebastian (aweseb64) 3 94.46 108.70 1 33.33
29121. Avi (avi_1301) 3 85.15 86.53 1 33.33
29122. Aviatato (aviatato) 3 101.35 110.10 1 33.33
29123. average (average_dude) 3 44.44 47.93 0 0.00
29124. Averie (aveeeriiieee) 3 83.54 88.55 2 66.67
29125. Aaron (auztistic) 3 65.38 70.31 1 33.33
29126. Jacob (author_) 3 115.66 121.81 1 33.33
29127. Austin (austinsnow) 3 112.00 115.09 0 0.00
29128. Austin (austinparkk) 3 82.71 88.06 0 0.00
29129. AURRUM (aurrum007) 3 82.87 89.32 1 33.33
29130. inSomnia (auriskv) 3 95.48 100.89 3 100.00
29131. Zisis (atrogzisis) 3 59.12 64.18 1 33.33
29132. Ato (atorization123) 3 112.75 123.93 3 100.00
29133. atomic (atom1c) 3 74.03 76.14 1 33.33
29134. Ashley (aswenson3907) 3 83.87 94.29 1 33.33
29135. Alex (asleslie) 3 79.52 85.62 1 33.33
29136. Sam (asianshampoo) 3 75.22 79.91 2 66.67
29137. anyou (asianguy2816) 3 102.00 111.30 0 0.00
29138. Jos (asiangei) 3 110.73 121.72 3 100.00
29139. Sirjay (asiafaceboy) 3 68.74 74.44 0 0.00
29140. Ash (ashzs) 3 78.16 96.26 1 33.33
29141. Ashutosh (ashutosh026) 3 64.70 75.64 0 0.00
29142. Ashley (ashleya9790) 3 109.79 117.55 3 100.00
29143. Asger (asgerbf) 3 43.78 49.15 2 66.67
29144. Anthony (asenarith) 3 71.74 76.80 1 33.33
29145. Griffin (asdwz458) 3 101.22 114.32 3 100.00
29146. Made (aryx) 3 83.26 87.83 1 33.33
29147. art (artushhheee) 3 81.23 83.92 0 0.00
29148. Tony (artemisu) 3 109.28 126.88 0 0.00
29149. Gabe (artemiaduch) 3 92.58 104.45 0 0.00
29150. noah (armedwhale) 3 62.23 66.60 1 33.33
29151. Argo (arks200) 3 86.27 96.42 2 66.67
29152. Arjav Jain (arjav_jain) 3 45.11 45.93 0 0.00
29153. Petapa Sakti (arief2014) 3 47.70 48.29 0 0.00
29154. argo (argoneus) 3 122.89 125.79 3 100.00
29155. John (arcticanthony) 3 69.96 72.07 0 0.00
29156. ArchiveAnon (archiveanon) 3 104.99 113.84 2 66.67
29157. Adnrew (arapoib) 3 81.20 102.02 0 0.00
29158. aranav (aranavkacker) 3 79.13 83.44 2 66.67
29159. Moon (aquacharles) 3 83.30 88.36 2 66.67
29160. AYUSH (apx_morris) 3 57.25 62.87 0 0.00
29161. Alex (apw024) 3 76.66 78.95 0 0.00
29162. Ugur (apparro) 3 56.04 64.98 1 33.33
29163. Appalling Camel (appalling_... 3 65.31 68.24 0 0.00
29164. Jonas (aplit) 3 81.14 85.47 1 33.33
29165. Adam (aplesin) 3 85.61 89.44 3 100.00
29166. Anirudh (apie) 3 122.29 122.65 2 66.67
29167. 🖤 R.I.P. reckful ❤️ ... 3 111.03 114.65 1 33.33
29168. an (an_vu41) 3 37.41 46.10 0 0.00
29169. Sunny (anzphoenix) 3 68.54 76.83 0 0.00
29170. Antzlee (antzlee) 3 97.73 103.25 1 33.33
29171. Antonio (antoniopelayo) 3 75.96 79.51 0 0.00
29172. Mr (antoniskan) 3 71.66 74.90 3 100.00
29173. Anti (anti8157) 3 93.80 98.42 1 33.33
29174. Jackson (anonym00se) 3 70.40 79.84 0 0.00
29175. Anon (anonjr) 3 69.68 77.58 1 33.33
29176. Seb (aniuortes) 3 63.73 66.15 0 0.00
29177. Nyrico (angelocuartel) 3 75.73 87.50 1 33.33
29178. Andrei (andythemenace) 3 58.42 64.45 0 0.00
29179. Andrei (andymfd) 3 30.00 33.17 0 0.00
29180. Andy (andyc716) 3 75.23 80.89 0 0.00
29181. Andrew (andrewforce) 3 56.42 57.08 2 66.67
29182. amaan (andrewescott) 3 60.26 64.51 0 0.00
29183. Andrew (andrewdanoob) 3 46.28 51.53 0 0.00
29184. Andrew (andrew530) 3 60.71 71.41 0 0.00
29185. Andra (andrasense) 3 64.49 68.41 0 0.00
29186. Andre (andre2016) 3 26.87 27.78 0 0.00
29187. Anders (andersranum) 3 87.81 89.26 3 100.00
29188. Nick (anc708) 3 131.78 141.41 3 100.00
29189. matthew (ananiku) 3 53.59 55.60 0 0.00
29190. Anand (anand7711) 3 36.42 39.56 0 0.00
29191. Elijah (amusingquill3) 3 92.61 100.50 1 33.33
29192. Marcelo (amsua99) 3 81.92 85.70 0 0.00
29193. Laurence (amphora) 3 101.81 106.59 0 0.00
29194. among us (among_us) 3 78.62 83.14 2 66.67
29195. Ammar Ahmed (ammarahmed001) 3 37.11 41.45 0 0.00
29196. Bryn (ami_kawashima) 3 59.08 62.04 0 0.00
29197. Amit (amit_panwar) 3 57.33 67.76 0 0.00
29198. Amith (amith_c_04) 3 64.15 67.67 0 0.00
29199. tobin (amilliwpm) 3 90.43 97.36 2 66.67
29200. aman (amanostrich) 3 108.67 115.41 1 33.33
29201. Amura (amaar) 3 78.94 86.10 1 33.33
29202. Amaanudeen (amaanudeen) 3 67.29 70.80 2 66.67
29203. alulss (alulss) 3 54.76 73.93 0 0.00
29204. Noah (alpha_tortle) 3 88.12 98.10 0 0.00
29205. Alpha (alpha_sp4rky) 3 69.37 73.90 0 0.00
29206. Alpha (alphatyper123) 3 119.01 125.35 2 66.67
29207. Alphan (alphan) 3 48.14 59.96 1 33.33
29208. Alpha (alpha5466) 3 133.58 146.31 3 100.00
29209. Mahfuz (almahfuz) 3 46.15 49.71 1 33.33
29210. ally (ally004) 3 73.77 82.80 1 33.33
29211. Ronnie (allyosaugh) 3 148.64 152.81 3 100.00
29212. Alloysius (alloysius) 3 103.28 106.66 2 66.67
29213. nate (allin110) 3 61.62 62.69 0 0.00
29214. AlittleJuku (alittlegook) 3 87.83 91.24 2 66.67
29215. ali (alithegrandpa) 3 44.39 46.38 0 0.00
29216. Alissa (alissatabb) 3 111.96 113.34 3 100.00
29217. Alikhan (alikhanzhamankhan_... 3 73.57 77.15 0 0.00
29218. Ali Haider (alihaider12qw) 3 56.55 58.76 1 33.33
29219. bee (aliceisjesus) 3 78.42 98.09 1 33.33
29220. Alex (alexsanderror) 3 53.32 59.25 0 0.00
29221. Alexander (alexloading) 3 54.63 60.59 0 0.00
29222. Alex (alexberroverbite) 3 69.61 80.38 3 100.00
29223. Alex (alex005) 3 81.86 82.82 1 33.33
29224. Martín (albugineo) 3 65.70 77.88 1 33.33
29225. Lex (akitgwapa) 3 63.91 69.38 1 33.33
29226. Blob (akagitsune) 3 60.77 64.53 0 0.00
29227. Aiden (ajargo2) 3 91.06 94.72 0 0.00
29228. Matt (airkeeper) 3 93.15 101.30 1 33.33
29229. Jason (airify) 3 62.72 68.36 3 100.00
29230. Amy (aimeesongg) 3 98.20 109.01 2 66.67
29231. Aaryn (ahong0319) 3 63.18 69.12 1 33.33
29232. ahmir (ahmir123) 3 116.47 120.98 2 66.67
29233. Agung (agungae) 3 70.16 73.19 1 33.33
29234. Siddharth (agrawal97siddharth) 3 71.83 75.48 1 33.33
29235. Allen (agginham) 3 92.93 99.67 2 66.67
29236. LIGHTNING MEKQUEEN (aftrmg) 3 87.04 94.16 3 100.00
29237. Apostolos (afmnt) 3 89.70 97.04 3 100.00
29238. Aether (aetherkiller) 3 62.64 69.02 1 33.33
29239. nisa (aesthetekim) 3 61.45 66.95 3 100.00
29240. Hypatia (aelhypatia) 3 84.80 94.23 1 33.33
29241. Niclas (aegzor) 3 86.36 96.88 0 0.00
29242. adam (adumyumyum) 3 101.44 120.63 2 66.67
29243. Nan (adu04) 3 97.11 105.52 1 33.33
29244. Adrian (adrian_kokot) 3 99.59 115.00 1 33.33
29245. Ryan (adorben) 3 41.19 42.27 1 33.33
29246. Adnan (adnanzami) 3 85.09 89.50 1 33.33
29247. aidan (adizzle) 3 75.44 87.05 2 66.67
29248. Speed_Aditya (aditya_raj) 3 48.28 60.74 0 0.00
29249. Mohammad Adeel (adikhanzai) 3 32.97 35.81 0 0.00
29250. Adhidevan (adhidevansreejith) 3 39.26 41.89 2 66.67
29251. Adam (adakam12) 3 74.48 95.30 2 66.67
29252. Ad4mxp (ad4mxp) 3 84.03 86.54 0 0.00
29253. A (ad1217) 3 85.34 89.45 1 33.33
29254. Alexey (actually_available_... 3 82.05 88.62 2 66.67
29255. aCreativeUsername (acreativ... 3 82.90 84.83 2 66.67
29256. Acid (acidderp) 3 49.50 53.62 0 0.00
29257. Ben (achillesari) 3 75.46 79.07 0 0.00
29258. acey (aceycanttype) 3 111.15 113.63 3 100.00
29259. Diego (aceplex) 3 99.85 104.81 1 33.33
29260. Wambo(dong) (aceizzhi) 3 49.36 60.20 1 33.33
29261. Armo (acduston13) 3 76.26 84.67 3 100.00
29262. Abok (aboookt) 3 46.71 54.58 0 0.00
29263. Abi (abiunsy) 3 53.40 61.49 0 0.00
29264. Abiel (abiel_abrham) 3 36.77 39.03 0 0.00
29265. Abid (abid_zzz) 3 54.21 57.51 0 0.00
29266. Abid Hasan (abid_hasan_abir) 3 71.01 77.83 1 33.33
29267. Abhi (abhishekmalle) 3 90.77 97.58 1 33.33
29268. Abhijeet (abhinitinkale) 3 82.49 85.64 2 66.67
29269. Abhigyan (abhigyan11) 3 89.57 93.27 2 66.67
29270. Abdullah (abdullahsoulat) 3 40.78 41.58 0 0.00
29271. Abdullah (abdullahahmed) 3 40.92 43.47 1 33.33
29272. @abdmhamzah (abdmhamzah) 3 45.01 65.30 0 0.00
29273. Pink Tissue (abdalmoez) 3 108.45 117.39 3 100.00
29274. Aaryan (aaryansarnaik) 3 63.25 69.98 1 33.33
29275. alex (aalextr) 3 100.78 110.42 2 66.67
29276. Maxwell (999maxwell) 3 116.16 129.37 2 66.67
29277. Yosuke (7wolves) 3 71.84 87.81 3 100.00
29278. Jeoff (7dollarburrito) 3 94.91 102.48 3 100.00
29279. Vasil (777vasil) 3 95.68 98.07 0 0.00
29280. 700 (700shots) 3 51.11 54.05 1 33.33
29281. leah (69leah) 3 81.89 87.70 0 0.00
29282. 666Rising (666rising) 3 59.55 62.07 1 33.33
29283. Ruslan (4flamee) 3 52.23 55.09 0 0.00
29284. desyncgod (43243264) 3 83.97 88.23 0 0.00
29285. メラキくん (4146d0n) 3 88.94 94.60 1 33.33
29286. 3li (3licraft) 3 48.87 51.23 2 66.67
29287. STAN JISOO (3kawaii5u) 3 128.05 139.96 1 33.33
29288. moose (3biggiantmoose) 3 86.67 93.79 0 0.00
29289. 333pwn (333pwn) 3 60.31 71.98 1 33.33
29290. Gerglee (333666666333) 3 91.43 96.59 1 33.33
29291. Mac (327type) 3 85.36 96.98 0 0.00
29292. Brad (2slo2calm) 3 76.69 77.18 0 0.00
29293. Small (2pacaklypse) 3 122.26 143.93 3 100.00
29294. 2muchdmg (2muchdmg) 3 87.07 89.98 1 33.33
29295. king (23bish) 3 73.98 81.95 0 0.00
29296. Zod (1zod) 3 96.59 101.59 1 33.33
29297. John (1underman123) 3 58.80 67.80 1 33.33
29298. Earl (1t_r3a11y_h4rtz) 3 91.94 100.23 3 100.00
29299. basil (1trying_to_be_fast1) 3 47.51 51.04 0 0.00
29300. Rika (16yoshino16) 3 91.23 98.41 0 0.00
29301. Joris (129828) 3 81.94 84.51 0 0.00
29302. ryan (10thdentist) 3 84.43 86.70 0 0.00
29303. Kuhaku (0kuhaku1) 3 84.94 94.64 2 66.67
29304. Sheesh (0hpl3as3) 3 78.32 84.32 1 33.33
29305. Piyush (piyushbhati) 3 36.28 36.88 1 33.33
29306. Izzat (frost07) 3 66.00 70.45 2 66.67
29307. Matt (thechyepiez) 3 99.19 107.41 1 33.33
29308. rat (ratdog24) 3 29.02 29.77 0 0.00
29309. Ben (geometrymazter) 3 56.68 76.20 2 66.67
29310. Ayden (aclay47) 3 110.28 118.69 2 66.67
29311. Andrew (andrewalvarez1) 3 79.27 93.15 1 33.33
29312. Jordan (jg75060) 3 101.99 111.16 3 100.00
29313. Lavie (lavish_sharma) 3 53.47 58.31 0 0.00
29314. qTiP (qtipster) 3 95.56 100.82 1 33.33
29315. Till (artlessventure) 3 79.99 84.20 1 33.33
29316. Tristelo (tristelo) 3 82.26 97.61 2 66.67
29317. Rigo (rigoftw) 3 89.37 90.63 2 66.67
29318. Khaqan (khaqan12) 3 43.37 48.76 0 0.00
29319. Axel (axelerrixx) 3 100.08 104.00 3 100.00
29320. Gamaliel (ashura_1126) 3 47.57 55.24 0 0.00
29321. pancho (panchoh) 3 68.91 70.94 0 0.00
29322. Drewster23 (drewster23) 3 82.54 95.16 0 0.00
29323. Enigma (darrenrs) 3 135.83 141.38 3 100.00
29324. Kyle (lazybasilisk) 3 72.97 73.90 1 33.33
29325. Vivi (vivibrian) 3 93.20 98.80 3 100.00
29326. Josseph (joeymtn) 3 96.17 107.71 1 33.33
29327. omkar (crusaderrr) 3 70.95 79.80 0 0.00
29328. Sean (mr_responsible) 3 93.53 98.34 0 0.00
29329. ambak (ambak) 3 62.85 69.40 1 33.33
29330. pufit (anri17) 3 69.58 79.12 1 33.33
29331. JunWOo (junwoo123) 3 45.16 50.28 0 0.00
29332. paige (pagefromabook) 3 60.28 63.17 0 0.00
29333. Chiril (zalmoxis) 3 61.08 63.05 1 33.33
29334. nudel (valord1) 3 48.99 58.02 0 0.00
29335. Izhan (izhan99) 3 68.73 79.35 0 0.00
29336. Sofia (siouxsiexioux) 3 68.95 71.08 0 0.00
29337. mackinzie (mackinzie) 3 49.23 53.13 0 0.00
29338. YokingChain (yokingchain) 3 50.17 55.04 1 33.33
29339. Neo (typo_hypo) 3 84.48 93.76 2 66.67
29340. Khalid (khalid_syfullah) 3 85.99 93.80 3 100.00
29341. Ervin (scripticle) 3 72.17 79.56 1 33.33
29342. Jonathan (jonyface) 3 88.91 93.35 1 33.33
29343. kez (kurax4) 3 72.97 81.34 2 66.67
29344. channie (channiexuhi) 3 60.45 87.43 0 0.00
29345. kidney (k1dn3y) 3 90.54 92.96 1 33.33
29346. Sheesh (vxnerate) 3 90.84 106.23 1 33.33
29347. Abdullah (zhafaat) 3 30.45 35.21 1 33.33
29348. Guskes (guskes) 3 75.10 82.19 2 66.67
29349. j (blowhouse) 3 38.54 42.36 1 33.33
29350. abhay (fladistic) 3 55.16 59.38 0 0.00
29351. Mridul (mridulhaque) 3 50.39 56.35 1 33.33
29352. Mel (melissaseamons) 3 45.96 47.10 0 0.00
29353. Ashlee (ash123450g) 3 41.37 43.81 1 33.33
29354. Dreaming (dreaming_vision01) 3 79.55 80.19 2 66.67
29355. Plickk (jazzferbanasihan86) 3 53.23 55.33 0 0.00
29356. Erin (bubblegumerin16) 3 43.62 46.04 0 0.00
29357. Joe (j_suzz_) 3 97.63 107.25 1 33.33
29358. Joaquin (joaquingallo) 3 76.32 78.92 2 66.67
29359. Hirraree (hirraree) 3 54.21 56.10 0 0.00
29360. k8lyn (k8lyn_kat) 3 76.02 84.49 1 33.33
29361. Oscar (enroze) 3 103.41 106.94 1 33.33
29362. Eric (redcheetofingers) 3 46.81 49.23 0 0.00
29363. Wingo (wingo9967) 3 122.66 132.12 3 100.00
29364. Cindy (chi3tcin) 3 113.87 128.52 2 66.67
29365. THUG (thugrex) 3 96.65 99.18 1 33.33
29366. EteRoWL (eterowl) 3 61.96 72.80 1 33.33
29367. Aaron (kieron2246) 3 43.34 49.37 1 33.33
29368. Airrcrew (arrrow) 3 46.26 48.00 0 0.00
29369. Shaun (afqro) 3 55.92 63.73 3 100.00
29370. Josh (krodnc38) 3 43.01 49.88 2 66.67
29371. Nathan (90snath) 3 59.00 66.14 0 0.00
29372. karl (yelloxmo) 3 69.56 80.01 1 33.33
29373. Budley (pootisspy1) 3 85.57 91.88 0 0.00
29374. Xai (darkxai) 3 88.07 93.24 2 66.67
29375. Marta (martarel) 3 74.50 77.63 1 33.33
29376. toxic (toxicexe) 3 60.17 73.42 1 33.33
29377. Dominik (toxodomo) 3 46.72 47.09 1 33.33
29378. Travis (thetrav) 3 97.86 113.57 0 0.00
29379. Badjo (badjo_1998) 3 53.87 57.60 1 33.33
29380. Typhoic (typhoic) 3 60.26 64.63 0 0.00
29381. Antony (cony77777) 3 79.70 95.95 1 33.33
29382. dement (dement29) 3 96.41 102.75 1 33.33
29383. Petre (epic7865) 3 64.44 70.21 1 33.33
29384. Ava (syryquil) 3 107.01 116.25 2 66.67
29385. Zobeid (zobeid) 3 97.12 105.63 2 66.67
29386. Sondre (sondreeee) 3 63.92 66.88 1 33.33
29387. Saumitra (shukla_23) 3 51.74 55.21 0 0.00
29388. Sebastian (novatypes) 3 101.45 109.11 3 100.00
29389. Marcin (zawadsoon) 3 68.28 69.26 2 66.67
29390. Veronika (verunkajeracer) 3 45.19 51.23 0 0.00
29391. Juan Luis (juan_88818) 3 55.99 62.03 1 33.33
29392. NoaP (noap) 3 56.86 58.41 3 100.00
29393. Maor (hello_its_maor) 3 78.55 86.93 1 33.33
29394. Space (space8) 3 44.26 48.51 1 33.33
29395. David (brodogo) 3 70.58 87.03 1 33.33
29396. OdaPoda (odapoda) 3 37.61 43.17 0 0.00
29397. MoneyStack (moneystackjack) 3 57.87 60.47 0 0.00
29398. sloth (slothonhoth) 3 56.29 57.72 0 0.00
29399. Jadon (jlt831) 3 58.85 64.57 1 33.33
29400. David (redango) 3 46.25 54.16 0 0.00
29401. sanzelda (sanzelda) 3 87.54 96.75 1 33.33
29402. Moshi (moshitang2014) 3 90.31 99.81 2 66.67
29403. abdul (aeza) 3 90.16 96.19 3 100.00
29404. Rito (khabib) 3 85.78 93.58 0 0.00
29405. Luna (heyimluna) 3 59.43 66.59 0 0.00
29406. Luke (woozyfo) 3 84.10 93.46 1 33.33
29407. Riana (mananasy) 3 37.85 39.49 0 0.00
29408. Dante (doogen) 3 60.41 60.56 0 0.00
29409. Martin (kadinov) 3 83.48 92.47 1 33.33
29410. Ian (jay27_22) 3 71.60 76.28 0 0.00
29411. Max (elytrous) 3 50.07 55.50 0 0.00
29412. I SUCK (lthemanl) 3 82.43 84.13 0 0.00
29413. Blur (blur612) 3 94.51 99.65 0 0.00
29414. Andrew (okcandy) 3 73.38 74.29 0 0.00
29415. aly (alyjarjar2) 3 105.23 117.73 3 100.00
29416. Sem (semstreams) 3 81.59 84.65 1 33.33
29417. Tuguy (twoguyswithoutans) 3 42.99 44.27 0 0.00
29418. Poon (shadyxd88) 3 81.81 96.70 0 0.00
29419. Daniel (dinonuggets730) 3 105.75 116.16 1 33.33
29420. DownShiftBG (downshiftbg) 3 68.52 73.15 1 33.33
29421. James (butterypopcorn) 3 67.20 71.41 0 0.00
29422. moftw (moftw) 3 62.22 71.23 2 66.67
29423. Lucas (etcetcetcmkii) 3 85.25 90.36 2 66.67
29424. Aurum (aurumvenatus3) 3 61.80 69.21 1 33.33
29425. Danielle (dhazan29) 3 90.51 98.70 3 100.00
29426. Noah (glancingchair55) 3 59.28 59.61 0 0.00
29427. ljubica (ljubical) 3 67.65 71.37 3 100.00
29428. Palash (palashchanda) 3 47.35 49.06 0 0.00
29429. Bruno (bfig) 3 97.20 103.22 2 66.67
29430. john (john_twisted) 3 41.82 47.68 0 0.00
29431. Tree (thefloatingtree) 3 100.27 112.29 2 66.67
29432. liulian (18838007960) 3 72.56 77.95 1 33.33
29433. Ja'Liah (liahlool) 3 25.82 30.22 0 0.00
29434. Lepiku (dimasokto) 3 79.34 84.46 1 33.33
29435. Phy (phyverr) 3 91.57 93.45 3 100.00
29436. Yakup (frkngbd) 3 38.96 40.92 0 0.00
29437. Amr (amr_bendary) 3 41.44 47.49 0 0.00
29438. Neetij (ltcmdrdata10) 3 113.77 120.32 3 100.00
29439. Jackson (sleepy365) 3 88.07 92.81 1 33.33
29440. Brianne (briannejudson) 3 56.36 57.34 1 33.33
29441. Mateo Montero (zinotu) 3 34.97 36.76 0 0.00
29442. LK (knightcrypto) 3 55.64 58.61 1 33.33
29443. luka (cat_curry) 3 72.22 75.89 1 33.33
29444. EvilPatata (whoop_whoop) 3 58.42 64.29 0 0.00
29445. Alexander (relentlessgamer1) 3 82.15 84.38 1 33.33
29446. Jason (jasonw8) 3 34.85 40.58 0 0.00
29447. Aggy (govno_un420) 3 82.26 89.54 0 0.00
29448. FattyBadger (fattybadger) 3 75.07 82.89 1 33.33
29449. GruLox (grulox) 3 73.08 78.53 2 66.67
29450. Ronnie (roney027) 3 64.44 69.84 3 100.00
29451. Royou (royou) 3 101.04 107.44 1 33.33
29452. Naren (narenm) 3 50.64 58.30 1 33.33
29453. Xiphos (xipho5) 3 72.51 84.05 1 33.33
29454. YogurtMan (yogurtman42) 3 59.01 63.49 1 33.33
29455. Shahriar (shahriar_dhruvo) 3 45.69 48.38 0 0.00
29456. VentusDrake (ventusdrake) 3 74.74 78.82 2 66.67
29457. h0ly (h0ly) 3 75.18 80.31 0 0.00
29458. MrCrazys (mrcrazys02) 3 81.34 83.50 2 66.67
29459. OverLoard (overtherussian) 3 92.34 96.96 2 66.67
29460. #1 (nitin77) 3 40.73 44.96 1 33.33
29461. John (johnathanwu) 3 124.99 133.59 3 100.00
29462. Adrian (adrianchri) 3 45.94 50.09 0 0.00
29463. ch2r (ch2r) 3 50.93 58.25 1 33.33
29464. AmogusSussy1 (rowlet211) 3 104.94 130.94 1 33.33
29465. Tristan (bigwillyhaver96) 3 76.83 83.62 2 66.67
29466. Koustuv (kous2v) 3 81.12 83.12 2 66.67
29467. Phin (phineas05) 3 95.76 113.07 1 33.33
29468. ASmoothCriminal (asmoothcri... 3 92.78 101.03 3 100.00
29469. gang gang (ianthekorean) 3 76.03 78.62 1 33.33
29470. Derek (guest0123) 3 65.44 68.54 0 0.00
29471. Gui (gui1802) 3 71.67 76.40 1 33.33
29472. River (rv1024) 3 65.78 68.04 1 33.33
29473. Sparky_64_ (sparkster49) 3 101.98 112.64 3 100.00
29474. Kriestofur (kriestofur) 3 89.49 97.48 2 66.67
29475. Jon (jonnyguitar00) 3 103.60 114.23 3 100.00
29476. Markian115 (markian76) 3 80.26 92.88 0 0.00
29477. Manfred (fredje33) 3 61.98 68.15 0 0.00
29478. Noah (noahj008) 3 61.90 66.62 0 0.00
29479. Begonia (begonia) 3 88.30 92.34 1 33.33
29480. wen (cuteweiwen) 3 104.45 113.18 2 66.67
29481. who's your daddy (pglworld) 3 69.93 74.16 2 66.67
29482. Orion (obum) 3 71.31 80.39 1 33.33
29483. Kevin (kevinpro97) 3 85.46 94.98 1 33.33
29484. Manas (firebolt19) 3 58.39 62.42 1 33.33
29485. Bradley (bradley36) 3 120.37 124.70 1 33.33
29486. jinky45 (jinky45) 3 53.22 62.72 0 0.00
29487. Drew (big_shibe) 3 49.10 54.65 1 33.33
29488. Francis (completelyclueless) 3 67.44 70.86 0 0.00
29489. Slowest №1 (b210970041) 3 26.41 28.04 0 0.00
29490. Ali (aliomar) 3 72.05 74.35 0 0.00
29491. hyper (xx_hyper_xx) 3 59.53 63.55 0 0.00
29492. Philip (philipafsen) 3 52.48 54.79 2 66.67
29493. Cal Naughton, Jr. (rocket86... 3 79.13 82.13 3 100.00
29494. Katie (katie_kim) 3 50.99 89.49 2 66.67
29495. Nini (ninija) 3 52.96 59.66 0 0.00
29496. Py (pyrovks) 3 61.74 69.37 2 66.67
29497. Azraf (retiredgamer) 3 34.17 44.03 0 0.00
29498. Bloodelfish (bloodelfish) 3 87.96 94.90 1 33.33
29499. MK (mk005) 3 45.80 52.60 0 0.00
29500. Kam (kam_z) 3 95.47 106.85 2 66.67
29501. Guilherme (guissalustiano) 3 57.07 57.95 0 0.00
29502. Winnie (nv3d) 3 68.92 73.97 1 33.33
29503. Andrea (floatterino) 3 53.53 56.77 0 0.00
29504. cameriin (kevisgaming) 3 79.92 86.54 0 0.00
29505. FrostWar (frostwar77) 3 45.51 46.32 0 0.00
29506. burnt_fingers (burnt_fingers) 3 92.09 106.90 3 100.00
29507. Scott (scottyquist) 3 54.50 64.59 0 0.00
29508. 2IIZ (2iiz) 3 54.63 65.36 1 33.33
29509. Trixelit (trixelit) 3 84.31 87.12 2 66.67
29510. Michiel (michilius) 3 64.69 66.59 0 0.00
29511. @zougari47 (zougari) 3 46.61 52.28 0 0.00
29512. Taffy (wreckit) 3 88.25 97.53 2 66.67
29513. mundz (mundz) 3 44.46 46.53 0 0.00
29514. Vlad (wladfox) 3 54.81 59.32 0 0.00
29515. Mr. Bean (leylandmini) 3 56.54 60.73 0 0.00
29516. Nyfo02 (nyfo02) 3 44.26 47.11 0 0.00
29517. Benjamin (schmidtrekt) 3 67.91 80.28 0 0.00
29518. slappy (sslappy) 3 103.91 104.91 1 33.33
29519. Andrew (papercoin) 3 92.37 96.65 2 66.67
29520. Biggiechoco (biggie_choco) 3 39.02 43.94 0 0.00
29521. DarkKillerXL (darkkillerxl) 3 47.79 53.20 2 66.67
29522. Louis (keyboredwarrior) 3 77.52 80.70 1 33.33
29523. michelle (michellebroers) 3 41.88 52.41 2 66.67
29524. Bread (cheeseitlarge) 3 73.25 81.43 1 33.33
29525. iiDxputy (iidxputy) 3 61.73 66.78 1 33.33
29526. Kuip (kuiprux) 3 64.00 73.77 1 33.33
29527. Luigi (stevewang220) 3 95.06 97.74 2 66.67
29528. hungry (swoll) 3 45.71 58.18 2 66.67
29529. rakel (raivsx) 3 98.21 104.98 2 66.67
29530. Jayden (moptus) 3 53.77 57.56 1 33.33
29531. Anton (karton) 3 100.98 109.82 3 100.00
29532. HR (hr_farmer) 3 108.84 122.44 2 66.67
29533. Jordan (starballer) 3 121.43 136.97 0 0.00
29534. Ron (ronn1) 3 45.63 50.46 0 0.00
29535. W.E. (mehrin_) 3 31.53 34.79 1 33.33
29536. Jacob (c0mpl) 3 66.74 70.47 1 33.33
29537. Marc (maarc) 3 58.93 63.97 0 0.00
29538. James (j_srv) 3 79.25 86.21 1 33.33
29539. ben (aviben) 3 52.97 55.65 0 0.00
29540. Luke (sltm) 3 65.81 71.92 0 0.00
29541. Josh (zeubermensch1337) 3 96.99 109.75 0 0.00
29542. Meike (zekernietmeike) 3 68.44 73.17 1 33.33
29543. Cole (lewkaks) 3 95.18 99.32 3 100.00
29544. Darsh (ddashrf) 3 48.64 55.41 1 33.33
29545. Gary (garymt) 3 54.79 69.96 1 33.33
29546. Mateo (matep10) 3 53.95 57.37 0 0.00
29547. jojo nub (jojo_nub) 3 74.95 79.38 1 33.33
29548. GN Vageesh (gnvageesh) 3 44.19 50.60 0 0.00
29549. Jake (evilwhite) 3 92.69 96.74 1 33.33
29550. AAMpro_IV (aampro_iv) 3 68.01 68.76 0 0.00
29551. Nathan (dollophead) 3 122.04 130.29 3 100.00
29552. Tyler (ichihime123) 3 70.93 76.96 0 0.00
29553. V (flashumoneo) 3 64.10 65.54 3 100.00
29554. Man (beastnation1234) 3 86.05 96.73 0 0.00
29555. James (frostycheesecake50) 3 66.63 77.01 0 0.00
29556. T (super_swag) 3 80.16 87.08 1 33.33
29557. Cody (cody0812) 3 77.92 87.45 2 66.67
29558. Jerri (jerrii) 3 108.88 111.67 2 66.67
29559. rpz (_rpz_) 3 72.24 85.51 2 66.67
29560. Stephen (axama) 3 68.22 71.23 1 33.33
29561. Patrick (tehpatrick) 3 87.22 95.70 1 33.33
29562. Michael (mikeyj007) 3 88.45 93.36 2 66.67
29563. Qaris (qklewl) 3 91.63 97.60 2 66.67
29564. peter (peter_heffley) 3 83.08 93.31 0 0.00
29565. GreenScheme (greenscheme) 3 64.18 65.11 0 0.00
29566. Donnie (cod_almighty) 3 56.46 56.97 1 33.33
29567. John (awesomejohn3) 3 81.49 84.37 2 66.67
29568. Marc (cocoloco82) 3 64.76 70.72 2 66.67
29569. Tracy (distracy) 3 75.95 79.90 1 33.33
29570. Serena (serenafu10) 3 61.18 62.98 1 33.33
29571. floof (derpehdoge) 3 98.29 105.19 3 100.00
29572. Soy (soysooye) 3 93.05 98.24 1 33.33
29573. Han Verh (batman69) 3 61.70 75.53 1 33.33
29574. Jiro (jiro__) 3 51.55 62.58 1 33.33
29575. Henry (hraspberries) 3 61.67 69.20 1 33.33
29576. Matthew (barrraoutta) 3 63.21 68.01 0 0.00
29577. AnhellOn (anhellon7) 3 66.52 77.10 1 33.33
29578. Angel (zackcloud) 3 49.72 51.42 0 0.00
29579. Hanseee (hanseee) 3 57.05 59.79 0 0.00
29580. eve (eve2en) 3 41.02 48.00 0 0.00
29581. geret13 (geret13) 3 79.75 87.55 3 100.00
29582. Emily (egrote99) 3 61.09 61.80 0 0.00
29583. Barney (barneyf) 3 77.03 78.69 1 33.33
29584. Chris (xajel) 3 91.08 95.35 0 0.00
29585. Liam (mccrouchyp) 3 72.32 74.14 0 0.00
29586. Anmol (anmolsinghal3035) 3 55.59 60.00 0 0.00
29587. Nolan (ttv_anegg847) 3 109.78 116.85 3 100.00
29588. John Eybs (acidx1221x) 3 63.12 68.78 1 33.33
29589. Shivang (shivang_2602) 3 53.86 62.87 0 0.00
29590. Philip (phoenqx) 3 51.03 54.82 0 0.00
29591. Rishi (srishipandey) 3 51.24 65.35 0 0.00
29592. om1k (om1k) 3 50.46 52.29 1 33.33
29593. john (fromthesource) 3 89.48 98.81 1 33.33
29594. Malkeet (msdfanatic) 3 29.45 33.29 1 33.33
29595. ronin (roc0ast3r) 3 110.90 115.19 2 66.67
29596. Jason (resunz) 3 94.24 110.56 1 33.33
29597. Siddharth (siddharth777) 3 61.52 66.94 1 33.33
29598. Pamonha (pamonhazinha) 3 55.35 56.53 2 66.67
29599. Ferney (ferneyr) 3 102.34 109.48 2 66.67
29600. Mich (michmich112) 3 55.72 59.01 0 0.00
29601. Artur (arciix) 3 93.46 99.97 2 66.67
29602. Antoni (antolaf) 3 46.63 48.91 0 0.00
29603. Ricardo (heretohear) 3 75.17 81.96 3 100.00
29604. Simon (_wed) 3 54.21 59.96 0 0.00
29605. Abdelrahman (_isatan_) 3 51.59 56.16 0 0.00
29606. Yeh (thanano) 3 45.33 48.25 0 0.00
29607. nami (namivague) 3 91.38 95.75 2 66.67
29608. Nicholas (nitrooooo) 3 96.54 103.51 1 33.33
29609. derick (derick1975) 3 92.29 96.34 1 33.33
29610. Gabriel (gabriel425) 3 45.87 47.92 0 0.00
29611. Tino (tino_zz) 3 47.91 53.67 0 0.00
29612. Koala (koalabear2003) 3 89.22 92.12 0 0.00
29613. Halter (halter_101) 3 79.38 81.58 1 33.33
29614. vodahmin (vodahmin) 3 97.74 112.09 2 66.67
29615. dishybloom (dishybloom) 3 50.70 53.79 0 0.00
29616. Chimmy (chimmyjin) 3 79.87 82.79 1 33.33
29617. Vic (vicjang) 3 90.08 95.63 3 100.00
29618. Azad (nano_modzz) 3 35.20 38.05 0 0.00
29619. fleffixza (fleffixza) 3 73.52 77.24 1 33.33
29620. Mihai (cutudestroyer) 3 44.52 47.37 0 0.00
29621. Hasanat (hasanatrn) 3 25.29 27.39 0 0.00
29622. NeonFlamez (neonflamez1000) 3 61.39 64.81 0 0.00
29623. JJP (jjpswfc) 3 86.00 96.69 1 33.33
29624. Trey (treyjohnson_84) 3 84.81 91.28 1 33.33
29625. hello (pandatyper12) 3 61.35 64.41 1 33.33
29626. Keyen (lonedrifter7) 3 101.00 121.83 1 33.33
29627. Rudolf (ovchi1) 3 51.45 54.94 0 0.00
29628. Antony (iamkoch) 3 85.66 95.38 2 66.67
29629. Seig (seighart) 3 40.18 42.76 0 0.00
29630. TwelveFingers (twelvefingers) 3 89.45 91.48 3 100.00
29631. Viru (viru2656) 3 88.55 96.36 1 33.33
29632. Human (human_pi) 3 27.20 29.15 0 0.00
29633. Gordon (gordonxu) 3 79.07 86.19 2 66.67
29634. constanza (slowbch) 3 39.10 42.22 0 0.00
29635. Hans (hansworsttyperacer) 3 58.95 64.71 0 0.00
29636. slow typer (_________o_____... 2 107.92 108.11 0 0.00
29637. reeeeeee (________e________) 2 104.77 106.90 2 100.00
29638. Syo (_syo_) 2 84.96 88.28 0 0.00
29639. Petar (_petar_) 2 49.96 51.80 0 0.00
29640. Ty (_pj1) 2 105.47 109.27 0 0.00
29641. Cole (_noskilljusthax) 2 78.03 85.94 0 0.00
29642. a (_mau) 2 54.32 58.31 1 50.00
29643. _louob_ (_louob_) 2 78.91 81.91 0 0.00
29644. Kroma (_kromaa_) 2 61.21 62.84 0 0.00
29645. Ken (_k3n) 2 60.45 65.73 2 100.00
29646. lol (_harmandeep16) 2 87.93 90.10 1 50.00
29647. Hamid ツ (_hamid_) 2 70.68 85.77 0 0.00
29648. Darkreaper (_darkreaper_) 2 35.20 38.92 0 0.00
29649. Ch1LLz (_chillz) 2 55.94 59.89 1 50.00
29650. Armaan (_armaan_singh24) 2 31.76 33.02 0 0.00
29651. Ariyan (_ariyankhan_) 2 64.94 69.31 0 0.00
29652. mikey (_12mr_) 2 52.55 53.49 0 0.00
29653. Ben (_0icydrizzlez0_) 2 57.77 60.62 0 0.00
29654. RIP RECKFUL (zyphal) 2 87.80 91.72 1 50.00
29655. zyf (zyf_) 2 63.42 64.98 0 0.00
29656. Z (zxxzus) 2 106.54 107.71 2 100.00
29657. Zurchonic (zurchonic) 2 65.26 67.40 0 0.00
29658. Stratos (ztratos) 2 106.15 111.27 1 50.00
29659. Zander (zshark216) 2 55.98 56.79 0 0.00
29660. Byran (zset) 2 39.86 51.38 0 0.00
29661. ZPGStudios (zpgstudios) 2 72.06 81.58 1 50.00
29662. Caleb (zonicon) 2 96.31 105.26 2 100.00
29663. Mainek (zoochan) 2 76.42 78.47 1 50.00
29664. Song (zombieswap3) 2 129.68 139.74 1 50.00
29665. zolorf (zolorf) 2 86.90 102.51 1 50.00
29666. jimmy (zojim) 2 59.42 63.51 0 0.00
29667. Zach (zman30533) 2 100.76 112.94 1 50.00
29668. Zleper8Q (zleper) 2 82.77 83.78 0 0.00
29669. ziyummmm (ziyummmm) 2 55.91 62.87 0 0.00
29670. zircks (zircks) 2 53.88 58.38 0 0.00
29671. Zing (zingclassy) 2 77.36 78.64 0 0.00
29672. zindabaad (zindabaad111) 2 64.82 70.44 0 0.00
29673. zilzil (zilzilp) 2 79.13 89.01 2 100.00
29674. Ike (zike_ang) 2 90.33 96.20 0 0.00
29675. Federico (zigish) 2 78.59 79.43 1 50.00
29676. JY (zhangjinyuan) 2 41.75 45.99 1 50.00
29677. zfrxst (zfrxst0wpm) 2 46.97 57.07 0 0.00
29678. Ze (zewrath) 2 44.10 49.19 0 0.00
29679. Zephy (zephy_yx) 2 91.96 102.82 1 50.00
29680. Wan (zenag) 2 110.29 118.13 2 100.00
29681. zeldaplayergl (zeldaplayergl) 2 81.64 90.23 0 0.00
29682. Moag (zefoos) 2 81.90 87.62 1 50.00
29683. Zeph (zeezallo) 2 102.07 105.31 1 50.00
29684. Axel (zedronar) 2 79.99 81.08 2 100.00
29685. Lukas (zeduke14) 2 82.21 85.93 1 50.00
29686. Zet (zeathus) 2 96.86 102.15 1 50.00
29687. Tan (zdfhzx) 2 73.23 73.67 0 0.00
29688. birdy (zazu7765) 2 101.92 112.64 1 50.00
29689. Nikola (zatharel) 2 116.83 122.06 2 100.00
29690. kimberley (zarkoraven) 2 33.28 37.33 1 50.00
29691. Zaptronic (zaptronic) 2 70.35 72.86 1 50.00
29692. Zach (zank0) 2 94.69 103.91 1 50.00
29693. kenneth (zanekao) 2 77.78 80.56 1 50.00
29694. Alex (zander77777) 2 68.02 71.76 0 0.00
29695. Adam (zamn) 2 116.27 120.68 0 0.00
29696. Zakaria (zakosan) 2 60.38 66.90 0 0.00
29697. Zakir (zakitwelvee) 2 70.65 80.78 0 0.00
29698. Sherwin (zafiros) 2 85.12 91.06 1 50.00
29699. Mason (zadeos) 2 109.32 116.29 0 0.00
29700. Zackyization (zackyization) 2 93.55 94.55 0 0.00
29701. Zachary (zackfromstatefarm) 2 97.88 100.72 0 0.00
29702. Zach (zachary2001) 2 52.24 57.58 0 0.00
29703. yuzuru (yuzuruace) 2 83.42 89.97 1 50.00
29704. lesseH (yung_lesseh1337) 2 90.01 92.87 0 0.00
29705. Kevin (yungwang) 2 103.27 110.04 0 0.00
29706. Y (yungkitchensink) 2 73.08 91.25 0 0.00
29707. Cameron (yungjoon) 2 68.33 78.02 1 50.00
29708. PB (yukiiiipboy) 2 58.31 60.11 1 50.00
29709. yuccai (yucca) 2 73.20 74.67 0 0.00
29710. Achinta (ysachinta) 2 74.79 79.02 1 50.00
29711. Yentl (yp30) 2 56.32 58.80 1 50.00
29712. Hyper (yo_hyper) 2 78.89 80.81 1 50.00
29713. yousuf (yousufmanikfan) 2 84.05 86.76 1 50.00
29714. justin (yourmuther) 2 88.18 122.12 1 50.00
29715. Annie (yourirregulartomboy) 2 55.75 62.19 1 50.00
29716. long (yourdad_69420) 2 57.70 60.16 0 0.00
29717. M (yougottachill) 2 84.91 85.70 1 50.00
29718. yopman (yopman) 2 63.90 68.17 0 0.00
29719. Pachara (yopachara) 2 43.15 46.42 0 0.00
29720. ... (yomer) 2 78.71 80.63 2 100.00
29721. Dylan (yokamaa) 2 90.18 90.62 0 0.00
29722. dove (yohello11) 2 104.55 110.50 1 50.00
29723. Ant (ynosky) 2 86.56 87.71 1 50.00
29724. Michael (yinyanyo3) 2 74.27 76.52 0 0.00
29725. Nii (yhuandebeste) 2 73.63 79.12 2 100.00
29726. Geoffrey (yerffoeg) 2 101.98 107.55 0 0.00
29727. yentup (yentup) 2 103.53 104.21 2 100.00
29728. yehojo (yehojo) 2 60.67 64.02 1 50.00
29729. beew (yeetit) 2 126.03 133.49 1 50.00
29730. Hee (yeecinn13) 2 56.94 58.80 0 0.00
29731. Jawn (yavvaios) 2 110.23 118.18 1 50.00
29732. Yash (yashedp) 2 109.89 113.17 1 50.00
29733. Yap (yap_lee) 2 97.56 98.45 1 50.00
29734. Mia (yalllikefeet) 2 86.47 96.65 0 0.00
29735. Frank (y0l0sweq) 2 113.56 114.61 2 100.00
29736. Bilguun (xyniness) 2 99.23 113.81 1 50.00
29737. Rica (xx_peitapave_xx) 2 103.49 115.43 2 100.00
29738. Blaster (xx_assblaster_xx) 2 89.93 99.77 1 50.00
29739. ty (xtremety) 2 72.41 78.31 2 100.00
29740. xrTForces (xrtforces) 2 86.16 90.29 0 0.00
29741. G̸̡̢̠̼̻̟̠̠̎͊͜ͅ... 2 58.01 62.05 0 0.00
29742. Soleh (xolehahhh) 2 73.22 82.68 1 50.00
29743. rona is on a bike (xnevermi... 2 60.22 60.61 0 0.00
29744. Calvin (xmonkeymonk) 2 85.27 86.42 1 50.00
29745. jerry (xmars) 2 95.57 105.61 1 50.00
29746. xKubsoN (xkubson) 2 61.33 70.89 1 50.00
29747. Darrick (xkj888418) 2 67.91 74.57 0 0.00
29748. Cyrus (xk0ul) 2 83.19 98.66 0 0.00
29749. Insta:remy_xin (xin_shadow) 2 75.91 81.96 0 0.00
29750. xiphias (xiphias_) 2 74.30 75.52 0 0.00
29751. Jean (xjean) 2 141.56 146.50 1 50.00
29752. Nick (xinini) 2 80.21 83.88 1 50.00
29753. Ximzor (ximzor) 2 68.64 76.32 1 50.00
29754. Chris (xilteen) 2 93.89 108.47 0 0.00
29755. green (xgreenbanana) 2 79.20 80.63 0 0.00
29756. ghostly (xghostly) 2 55.39 61.04 1 50.00
29757. Feniks (xfeniks) 2 47.62 49.24 0 0.00
29758. Matt (xerth) 2 95.01 99.91 1 50.00
29759. Xelicus (xelicus_gamingyt) 2 103.39 112.79 2 100.00
29760. Xavier (xcperez) 2 94.56 94.75 1 50.00
29761. Norris (xcnorris) 2 101.15 111.36 0 0.00
29762. xchli (xchli) 2 44.78 50.05 0 0.00
29763. Jordan (xbeastyx) 2 96.93 99.74 2 100.00
29764. James (xaxlox) 2 89.41 92.14 1 50.00
29765. CP Addict (xariniov9) 2 43.52 45.40 0 0.00
29766. Amine (xabri) 2 78.90 87.48 1 50.00
29767. Wes (wyvr) 2 90.51 103.65 1 50.00
29768. Lewis (wyattl1) 2 25.77 26.98 0 0.00
29769. Jit (wtf989) 2 34.46 36.91 0 0.00
29770. Wr (wrish) 2 106.41 112.99 1 50.00
29771. wpnwbn (wpnwbn) 2 59.03 59.21 1 50.00
29772. Artem (wopsmops) 2 98.96 104.22 1 50.00
29773. Raph (wolfzlol) 2 67.82 73.04 1 50.00
29774. Wolfinaa (wolfinaa) 2 74.60 85.32 2 100.00
29775. Czar (wolfga) 2 99.33 109.89 1 50.00
29776. Poogen (wolfer50000) 2 118.68 127.06 2 100.00
29777. Jackson (wok_) 2 61.98 63.01 1 50.00
29778. hi (wmc2000) 2 62.97 63.19 1 50.00
29779. Maverick (wizgamer) 2 55.06 56.69 0 0.00
29780. Drew (withersoldier) 2 81.31 87.31 0 0.00
29781. Jessy (wisticram) 2 53.74 61.00 0 0.00
29782. zWinGaH (winzahg) 2 53.70 58.21 1 50.00
29783. winter (winterruwu) 2 80.66 80.78 0 0.00
29784. Winson (winlee620) 2 70.60 71.00 0 0.00
29785. Wind (windywind) 2 76.84 84.60 2 100.00
29786. Alberth (windwings) 2 46.99 56.80 2 100.00
29787. wilson (wilsoncho360) 2 30.38 36.03 0 0.00
29788. wilson (wilso499) 2 54.19 54.35 1 50.00
29789. Will (willydale) 2 122.16 134.17 2 100.00
29790. William (willeum) 2 87.53 91.76 0 0.00
29791. Will (willdawarrior77) 2 64.50 67.41 0 0.00
29792. Wilfred (wilfredfraser) 2 109.02 115.31 0 0.00
29793. patel to the metal (wildsv2) 2 97.30 102.17 1 50.00
29794. Finn (wildducktca) 2 105.18 109.69 2 100.00
29795. Farzin (wickedjargon) 2 50.94 56.41 2 100.00
29796. Whinnie (whinnie) 2 116.94 120.17 2 100.00
29797. glenu (whetherman) 2 75.97 78.86 0 0.00
29798. phong (whatthephong) 2 97.14 99.86 0 0.00
29799. Seán (whaamp) 2 111.44 117.29 2 100.00
29800. Wetetet (wetetet) 2 97.20 99.60 1 50.00
29801. Yurekemi (wertzwertz12) 2 61.69 67.46 0 0.00
29802. Jason (weekly5112) 2 140.18 144.46 1 50.00
29803. SM (webadnan) 2 72.49 74.30 2 100.00
29804. Michael (wayongg) 2 54.03 56.04 1 50.00
29805. waxman (waxman69) 2 131.70 135.34 1 50.00
29806. . (watertastegoood) 2 129.74 132.71 0 0.00
29807. poophead (watermelon69) 2 97.23 100.37 1 50.00
29808. RSI typer (wasit12348) 2 88.18 100.50 0 0.00
29809. Paul (warrenpya) 2 78.01 78.91 0 0.00
29810. Leo (waoping) 2 100.62 105.03 2 100.00
29811. William (walbertus) 2 70.06 70.54 0 0.00
29812. Wailea (waileadude) 2 35.48 38.12 0 0.00
29813. v (v____) 2 88.54 88.73 0 0.00
29814. V_aura_V (v_aura_v) 2 43.36 44.57 0 0.00
29815. pew (vynxr) 2 102.62 110.54 1 50.00
29816. Vincent (vwong21) 2 68.09 69.45 1 50.00
29817. vradhi (vradhi_108) 2 53.85 57.75 0 0.00
29818. Vosse (vosse) 2 82.47 86.45 1 50.00
29819. Alejandro (vortitex) 2 70.36 75.73 0 0.00
29820. Leo (vonald) 2 60.33 64.37 1 50.00
29821. Mikael (vompo) 2 57.45 58.08 1 50.00
29822. Volhosis (v... 2 167.94 169.73 0 0.00
29823. Dmitry (voidpointer64) 2 116.51 121.80 1 50.00
29824. vladim (vladim) 2 58.48 69.85 2 100.00
29825. Vlad (vlad7777) 2 78.91 95.02 1 50.00
29826. Vivioxide (vivioxide) 2 102.71 104.25 2 100.00
29827. Vitap (vitapramdevputra) 2 74.46 74.50 0 0.00
29828. Vishal (vishalparkour) 2 58.66 68.28 2 100.00
29829. tracy (viscassia) 2 101.25 110.12 1 50.00
29830. virtualflames#1011 (virtual... 2 114.61 132.14 2 100.00
29831. Vicky (viqnt) 2 59.49 63.83 0 0.00
29832. Vinstalia (vinstalia) 2 99.14 104.53 2 100.00
29833. das (vinil10) 2 38.82 41.51 0 0.00
29834. A (viking_) 2 50.59 54.98 0 0.00
29835. Olaf (vikingishly) 2 100.21 110.92 1 50.00
29836. Theis (viggotheis) 2 100.27 112.54 1 50.00
29837. Mclovin (victor_123321) 2 77.53 85.15 1 50.00
29838. mark (victicious) 2 72.86 76.83 0 0.00
29839. vittoria (vibesmvx) 2 70.13 70.74 1 50.00
29840. Hayward (vhenom) 2 84.23 84.53 1 50.00
29841. David (vgodtyper) 2 62.59 62.82 0 0.00
29842. Venky (venkypk) 2 59.34 62.37 0 0.00
29843. F (veneda24) 2 133.31 140.40 1 50.00
29844. Varsovie (vendrige) 2 54.04 58.22 1 50.00
29845. Tahmeed Ibne (vedistaan) 2 77.91 88.65 1 50.00
29846. Vedran (veco98) 2 85.36 87.24 1 50.00
29847. Sabix (veam) 2 60.30 60.56 1 50.00
29848. Vaynez (vaynez) 2 69.49 74.99 1 50.00
29849. Varit (varitfinn) 2 39.14 40.38 1 50.00
29850. 🔥Varcious🔥 (varcious) 2 116.52 118.97 1 50.00
29851. Lakos (vanlakos) 2 62.30 64.73 1 50.00
29852. little uzi (valstroyer) 2 89.70 94.04 1 50.00
29853. Valerious (valeriousking) 2 61.98 75.36 1 50.00
29854. Seth (vadneylol) 2 72.87 82.16 1 50.00
29855. Gus (v1per41) 2 88.58 104.70 0 0.00
29856. uxiator (uxiator) 2 75.06 78.11 1 50.00
29857. Jimmy (user39_on_anagram) 2 68.64 69.91 0 0.00
29858. Ajay (ur_fav_man_ajoy) 2 59.72 60.95 1 50.00
29859. (unwono) 2 45.59 45.63 1 50.00
29860. alf (unocha) 2 85.17 93.20 2 100.00
29861. unleashed (unleashedcode) 2 55.15 60.61 0 0.00
29862. Fry (uncle_youtube) 2 112.01 115.49 2 100.00
29863. Yosua (unclepo) 2 83.44 84.28 0 0.00
29864. Shain (uncledrew09) 2 65.50 73.96 1 50.00
29865. Thomas (unc4me4568) 2 85.11 93.10 1 50.00
29866. duh fast af (umrca) 2 71.04 74.24 1 50.00
29867. Gui (ult_guiks) 2 60.37 61.87 2 100.00
29868. Saad (ultraman287) 2 69.24 77.30 0 0.00
29869. Ulday (ulday) 2 59.02 61.00 0 0.00
29870. Ujjwal (ujjwalavishek) 2 67.70 70.50 0 0.00
29871. U (ugotme) 2 73.36 78.08 0 0.00
29872. Daniel (uheardmetrick) 2 103.65 110.59 1 50.00
29873. ugly (uglygaming) 2 47.72 50.87 0 0.00
29874. uberstrike (uberstrikeghost... 2 62.02 65.74 1 50.00
29875. Tal (t_b_m) 2 52.12 53.67 0 0.00
29876. jasepa (tyreesepapi) 2 100.99 102.15 2 100.00
29877. mikeeeee (typintypist) 2 79.57 84.48 1 50.00
29878. George (typing_bot) 2 96.26 97.61 1 50.00
29879. typingprogram (typingprogram) 2 95.19 97.24 2 100.00
29880. Knut (typeracer5000) 2 62.01 70.61 1 50.00
29881. Nikolas (typer99951) 2 97.69 102.61 1 50.00
29882. Luc (typemasterluc) 2 72.18 72.21 1 50.00
29883. Colin (typemaster612) 2 88.22 99.23 1 50.00
29884. LikeASir (typelikeasir) 2 80.08 84.50 2 100.00
29885. Tim (tymolc) 2 89.86 95.44 1 50.00
29886. Tiffany (tylietz) 2 119.65 122.42 2 100.00
29887. Tyler (tyli) 2 97.76 98.11 0 0.00
29888. Tyler (ty11_24) 2 65.80 66.47 1 50.00
29889. jaye (twojaye) 2 60.87 61.50 2 100.00
29890. Twillerdog (twillerdog) 2 97.11 97.83 0 0.00
29891. Tweece (tweece) 2 98.34 100.47 1 50.00
29892. Is me Tonyyyyy (tw4040nonquit) 2 125.24 125.60 2 100.00
29893. PogChamperino (tutsandallthat) 2 86.85 95.87 0 0.00
29894. fast (turteled) 2 66.55 71.29 0 0.00
29895. Vaito (tunerfrick) 2 64.10 65.68 2 100.00
29896. Thomas (tumpz) 2 62.66 64.56 2 100.00
29897. Ryan (tuffpuppy) 2 69.18 72.44 0 0.00
29898. Tudi (tudipym) 2 84.12 86.46 0 0.00
29899. Todd (ttran65) 2 123.10 123.94 1 50.00
29900. Su (tsunamitdw) 2 49.17 49.83 1 50.00
29901. Travis (tsmith112000) 2 97.32 100.48 1 50.00
29902. Emrick (tsicko) 2 64.02 73.41 0 0.00
29903. Kristoffer (tryyyy) 2 53.70 57.18 0 0.00
29904. Michael (truongm21) 2 70.89 71.70 0 0.00
29905. Lam (trungld) 2 56.71 59.38 0 0.00
29906. FL (trumpetrockslol) 2 119.48 126.78 2 100.00
29907. True (truefalse) 2 84.08 87.75 2 100.00
29908. troy (troysimpson) 2 88.52 91.71 1 50.00
29909. trollingck (trollingck) 2 70.87 72.86 0 0.00
29910. Trixie1018 (trixie1018) 2 86.01 87.70 0 0.00
29911. zesty (tristanducharme07) 2 45.25 51.16 0 0.00
29912. Taylor (trifortay) 2 73.98 79.02 0 0.00
29913. Tricky (trickydot) 2 85.04 87.94 0 0.00
29914. Trav (treiner) 2 92.66 94.48 1 50.00
29915. trac (tractray) 2 37.70 42.86 0 0.00
29916. Perfect (tpspark42) 2 68.52 72.81 1 50.00
29917. Jarod (toxedo999) 2 61.53 61.71 0 0.00
29918. Ely (touch_typer) 2 58.62 59.62 0 0.00
29919. jill (toshiba_jill) 2 101.46 107.95 1 50.00
29920. Brzina (torpedo99) 2 81.19 86.66 0 0.00
29921. Top1nambur (top1nambur) 2 52.25 58.66 0 0.00
29922. tont (tont) 2 97.54 100.37 2 100.00
29923. KundiV1 (tommy3605) 2 61.21 62.34 1 50.00
29924. tstats[tomek1337] (tomek1337) 2 77.54 80.40 0 0.00
29925. Thomas (tomithink) 2 52.02 54.39 0 0.00
29926. Tomás (tomasero) 2 89.30 92.95 0 0.00
29927. KaKundam (toilagun2004) 2 39.68 40.17 0 0.00
29928. Olav (tocke) 2 101.68 116.26 1 50.00
29929. Tobs (tobzs) 2 109.56 119.75 1 50.00
29930. mansur (tmansur) 2 44.17 48.38 0 0.00
29931. Dylan (tlwnl) 2 75.16 79.29 0 0.00
29932. Kelsier (tkelsier) 2 128.51 132.04 1 50.00
29933. TJ (tjheinzo) 2 77.03 79.26 1 50.00
29934. Tjerk (tjerkderacer) 2 68.63 70.41 1 50.00
29935. Z (tiredtyper) 2 105.25 113.80 2 100.00
29936. Tipsy (tipsy_unicorn) 2 70.19 75.04 0 0.00
29937. patzer (tip3) 2 88.62 89.03 0 0.00
29938. Tinkle (tinklesticks) 2 80.75 81.54 1 50.00
29939. Sir (tinapay) 2 97.03 101.97 1 50.00
29940. timothy (timmysuh904) 2 111.93 119.67 1 50.00
29941. Gavin (tictac67) 2 92.20 101.22 1 50.00
29942. Thuxerinho (thuxerinho) 2 55.93 61.69 1 50.00
29943. Thug_TwisterzZ (thug_twiste... 2 83.84 87.60 1 50.00
29944. Jeremy (thugapy) 2 88.77 96.55 1 50.00
29945. Pablo (thotwalker2020) 2 52.29 60.44 0 0.00
29946. Thor (thor3101) 2 96.01 98.22 0 0.00
29947. Thomas (thomas_wong) 2 49.19 49.96 0 0.00
29948. Thomas (thomasbd) 2 74.86 84.41 2 100.00
29949. Claire (thisisforfun) 2 123.27 130.25 2 100.00
29950. Thi (thiorcoffee) 2 77.22 90.12 2 100.00
29951. gabelolll (the_typing_noob1... 2 37.50 41.58 0 0.00
29952. Spookster (the_spookster) 2 92.02 103.12 2 100.00
29953. Thewsomeguy (thewsomeguy) 2 112.05 113.06 0 0.00
29954. Philip (theworstracer) 2 101.00 101.73 1 50.00
29955. thewayistay (thewayistay) 2 42.88 45.66 0 0.00
29956. Vuong (thevuong) 2 53.71 59.31 1 50.00
29957. Vi (thevi25) 2 64.75 66.62 0 0.00
29958. TheUltimateMeme (theultimat... 2 87.90 90.16 0 0.00
29959. SHURA (theshura) 2 43.42 50.60 0 0.00
29960. Chris (thesazh) 2 65.39 72.35 1 50.00
29961. S (therealslim69) 2 89.81 105.46 1 50.00
29962. Martin (therealmartin) 2 100.63 101.43 2 100.00
29963. Will (theracer69) 2 101.12 107.30 0 0.00
29964. plasma (theplasma) 2 95.81 110.50 1 50.00
29965. ThePiProgrammer (thepiprogr... 2 91.37 103.11 1 50.00
29966. winnifred (thepeppery_one) 2 101.84 104.44 1 50.00
29967. Matthew (theoriginalbrick) 2 76.85 81.58 1 50.00
29968. Daniel (theoretic) 2 127.18 129.76 1 50.00
29969. Theodoros (theodoros_1234) 2 75.79 81.15 1 50.00
29970. Nero (theneronex) 2 92.07 96.89 0 0.00
29971. Brendan (themuppet) 2 80.97 82.69 0 0.00
29972. Swiggity (themoleinator) 2 72.47 75.54 0 0.00
29973. Garubles (themoistseacow) 2 89.48 91.58 2 100.00
29974. TheMayoTyrant (themayotyran... 2 100.74 131.53 1 50.00
29975. NaN (thelebdev) 2 118.06 122.67 2 100.00
29976. Scott (theking55555) 2 109.46 113.09 1 50.00
29977. Sagar (theidiotkingboi) 2 70.47 71.77 0 0.00
29978. Rose (thehashparticle) 2 62.19 63.47 0 0.00
29979. Kevin (theguyk) 2 80.77 84.17 0 0.00
29980. the goat (thegoat420) 2 52.13 56.33 0 0.00
29981. Sea (theglowingman) 2 95.91 109.25 0 0.00
29982. Alex (thegamingalex) 2 72.93 73.21 1 50.00
29983. thefalconeye (thefalconeye) 2 64.63 65.43 1 50.00
29984. Duck (theduckracer) 2 69.44 74.95 1 50.00
29985. Nick (thedragon252) 2 93.51 100.11 1 50.00
29986. Thed (thedmango) 2 55.71 57.43 0 0.00
29987. Dhanraj (thedan123) 2 55.99 61.93 0 0.00
29988. Liam (thecodingboy) 2 94.41 98.72 0 0.00
29989. fartmaster69 (theblacksword... 2 52.29 56.17 1 50.00
29990. thebennies (thebennieswho) 2 59.24 60.27 0 0.00
29991. DIlectrix (thebeast_typer) 2 77.63 77.85 2 100.00
29992. Abhi (theabhster) 2 101.09 108.62 1 50.00
29993. Erm (the7erm) 2 49.57 57.01 1 50.00
29994. berbseedle (thatonebedsheet... 2 78.96 84.74 0 0.00
29995. Thatisdifficult (thatisdiff... 2 91.03 95.26 1 50.00
29996. Isaac (th54) 2 114.93 126.03 1 50.00
29997. Cody (tfwarcry) 2 120.24 122.14 2 100.00
29998. Tezz (tezzguru) 2 62.01 66.66 1 50.00
29999. Terrance (terrance1120) 2 101.42 111.35 2 100.00
30000. Termite (termite04) 2 84.94 103.60 1 50.00
30001. Nik (teriki) 2 59.07 61.05 0 0.00
30002. Tiago (teratogo) 2 41.87 43.61 0 0.00
30003. Tenny (tennykim) 2 84.19 90.46 0 0.00
30004. Dean (tennis2002) 2 85.28 96.35 1 50.00
30005. Temir (temir248) 2 51.11 54.83 0 0.00
30006. TelFiRE (telfire) 2 95.30 98.31 0 0.00
30007. max (tekoh) 2 96.82 106.16 2 100.00
30008. Justin (teeheeheeheehee) 2 108.83 110.04 2 100.00
30009. Teddy (teddyb24) 2 58.47 59.84 2 100.00
30010. Nick (technologicnick) 2 78.69 79.80 0 0.00
30011. goofy (technicuwu) 2 76.09 80.55 0 0.00
30012. Lee (tec001) 2 105.81 124.51 1 50.00
30013. Taylor (tdogyhyh) 2 79.65 84.00 0 0.00
30014. tch (tchstf) 2 119.15 122.81 2 100.00
30015. Taylor Ray (taylorrayhoward) 2 85.05 88.76 0 0.00
30016. TataraZ (tataraz) 2 72.98 80.52 1 50.00
30017. Stephen (tape319) 2 98.48 100.17 1 50.00
30018. Ryan (tamekaiyote) 2 66.66 74.95 0 0.00
30019. shivam (tambourinetower) 2 73.53 80.00 1 50.00
30020. Thanathas (tamasama077) 2 80.28 86.93 0 0.00
30021. . (tamagobaka) 2 66.39 73.76 1 50.00
30022. twickortweat (talkingbebuu) 2 70.65 75.44 0 0.00
30023. ICE (talje) 2 69.64 71.82 0 0.00
30024. talayracing (talayracing) 2 64.42 67.07 0 0.00
30025. hanage (takeruokuyama) 2 56.28 56.67 0 0.00
30026. Takio (takioarima) 2 91.23 99.94 0 0.00
30027. humming (tajjyboyrutus) 2 90.72 95.35 0 0.00
30028. Taiyo (taiyo1) 2 61.00 63.26 0 0.00
30029. Tareque Hasan (tahsin24) 2 75.12 79.61 1 50.00
30030. Taher (taher_c) 2 69.93 73.53 2 100.00
30031. Taco (taco_salsa) 2 95.76 106.03 2 100.00
30032. Tacos (tacosforthem) 2 104.91 106.34 2 100.00
30033. Taryn (tabeldt) 2 73.14 80.45 0 0.00
30034. slow account (tabbed) 2 90.80 93.12 0 0.00
30035. Tim (t84nightfall) 2 63.89 71.43 0 0.00
30036. Ted (t3ddybgam3) 2 68.42 70.87 0 0.00
30037. t0xy47 (t0xy47) 2 100.15 102.04 1 50.00
30038. BeefHitTheFan (szqskywalker) 2 76.34 85.91 0 0.00
30039. szk3y (szk3y) 2 76.60 77.69 0 0.00
30040. Zul (szeph) 2 60.29 62.61 2 100.00
30041. Syazani (syazaniii) 2 51.40 54.45 0 0.00
30042. Schzkwan (syafwan000) 2 42.25 49.15 0 0.00
30043. Andrew (swissarmyman) 2 96.83 104.85 1 50.00
30044. Swerpy (swerpy) 2 56.36 60.22 1 50.00
30045. d-Raww (swagtyper123) 2 140.93 147.11 1 50.00
30046. Phi (surphi10) 2 76.23 80.42 0 0.00
30047. surferdude (surferdudepr86) 2 82.52 85.40 0 0.00
30048. SuperHyperbole (superhyperb... 2 81.70 86.14 2 100.00
30049. sabir (supercypok) 2 49.04 52.70 0 0.00
30050. Nicolas (supercarlover888) 2 76.50 85.73 1 50.00
30051. #One More Year (supeer_heroo) 2 49.75 52.59 0 0.00
30052. dayla (sunflxwer9) 2 89.03 91.94 0 0.00
30053. Garima (summerqueen15) 2 47.45 51.96 0 0.00
30054. Brad (sulfernic) 2 90.29 90.96 0 0.00
30055. Subodh (subodhk) 2 74.77 76.09 1 50.00
30056. CircuitMoon (subhampal) 2 72.96 76.16 2 100.00
30057. Gavyn (styxzee) 2 73.95 76.49 1 50.00
30058. StsThorn (ststhorn) 2 122.87 124.81 2 100.00
30059. [[ Stropion (stropion) 2 93.24 94.92 2 100.00
30060. Aditya (strong91105) 2 56.57 63.10 2 100.00
30061. Lev (straward) 2 54.52 58.30 0 0.00
30062. Steven (stoveoveoven) 2 104.45 112.81 1 50.00
30063. storpa (storpa26) 2 100.29 103.22 1 50.00
30064. Darius (stormmate) 2 99.61 114.31 1 50.00
30065. Ben (stormfalcon32) 2 115.40 121.86 1 50.00
30066. Se (stopclimatechange) 2 124.38 125.81 2 100.00
30067. Aleksa (stojke) 2 68.33 69.27 1 50.00
30068. Steyl (steyl) 2 83.70 84.80 2 100.00
30069. Stepman5 (stepman5) 2 85.48 85.81 0 0.00
30070. manorosandy (ster_sandys) 2 44.68 47.09 1 50.00
30071. Stephen (stephen_g19) 2 88.28 94.15 2 100.00
30072. stefanijaya (stefanijayaa) 2 69.98 76.63 2 100.00
30073. Skye (starrysky101) 2 54.81 55.56 0 0.00
30074. Star (starplatypus) 2 57.91 58.23 1 50.00
30075. Meowsiez (stanleyz4) 2 60.02 60.87 0 0.00
30076. 🤔 (stabilized) 2 80.80 91.34 0 0.00
30077. Mirto (st4rb0y) 2 89.67 94.26 1 50.00
30078. SSStealthy (ssstealthy) 2 41.55 43.79 1 50.00
30079. spam (sspammy) 2 69.07 69.67 0 0.00
30080. keystroker03 (sserium) 2 112.14 116.70 0 0.00
30081. Sebastian (ssanso) 2 93.93 97.55 1 50.00
30082. Srijonchi (srijonchi) 2 46.64 50.40 2 100.00
30083. Eduardo (sr142898) 2 55.08 57.12 0 0.00
30084. Squill (squill098) 2 106.22 108.85 2 100.00
30085. Brandon (spudslayer1990) 2 68.47 75.67 2 100.00
30086. Wilson (springmaple) 2 71.89 78.73 2 100.00
30087. Grace (sprang1) 2 117.95 118.60 1 50.00
30088. Rocky (spookiestmeme) 2 103.47 105.81 1 50.00
30089. Nick (spirk) 2 89.09 98.01 1 50.00
30090. hanuyoo (spicymiso) 2 80.09 91.98 1 50.00
30091. PB (spic3) 2 89.61 100.97 2 100.00
30092. Callmequick (spellings) 2 86.23 90.79 1 50.00
30093. Daniel (speks97) 2 62.81 65.15 0 0.00
30094. speedy (speedydemonguy) 2 100.03 108.57 2 100.00
30095. edot (speedymandan) 2 105.62 106.46 2 100.00
30096. Rohith (specialabyss6_) 2 63.64 65.74 0 0.00
30097. Chaitanya (spcspeedracer) 2 81.69 84.26 0 0.00
30098. Scott (spditsme) 2 73.90 79.06 0 0.00
30099. Sparkils (sparkils) 2 78.04 79.00 0 0.00
30100. Naloxone (spark89) 2 93.94 101.27 2 100.00
30101. Soz (soz3177) 2 61.72 73.03 0 0.00
30102. Sowri Raja Majeti (sowri) 2 70.12 75.23 0 0.00
30103. Aditya (soulofshades) 2 79.77 79.89 0 0.00
30104. Soulhae (soulhae) 2 104.96 122.30 0 0.00
30105. Sorton101 (sorton101) 2 103.91 112.03 0 0.00
30106. Soren (sorennoob) 2 112.35 118.24 1 50.00
30107. Anthony (sora2848) 2 89.43 90.96 2 100.00
30108. sophai (sophai) 2 76.72 92.75 0 0.00
30109. sonny (sonnyb_) 2 116.12 124.99 1 50.00
30110. sonic (sonic_the_hedgehog_lol) 2 112.39 123.27 1 50.00
30111. Brian (sonicf312) 2 76.73 80.38 1 50.00
30112. Song (songjoon) 2 74.76 80.24 1 50.00
30113. somrand (somrand) 2 65.40 69.97 1 50.00
30114. Pikachu (someone_cool) 2 59.75 69.63 0 0.00
30115. Matthew (solosice) 2 74.93 76.45 1 50.00
30116. sojo (sojoyes) 2 120.43 123.41 2 100.00
30117. Eman (sodium0112) 2 65.26 66.92 1 50.00
30118. Socrates (socratesbatis) 2 86.08 89.03 0 0.00
30119. Seraph (snowpenguin2) 2 118.01 119.13 1 50.00
30120. Stephen (snivithefox) 2 101.00 101.12 1 50.00
30121. Julia (sneakyjelly) 2 43.34 46.85 0 0.00
30122. Snayne (snayne) 2 89.88 92.29 1 50.00
30123. Snapdragon (snapdragonsounds) 2 110.08 110.90 1 50.00
30124. Vigor (snakehater) 2 67.42 69.74 1 50.00
30125. Joshua (snabic) 2 83.28 94.19 0 0.00
30126. jer (slugbug2) 2 61.02 63.16 0 0.00
30127. Fox (slowlightning) 2 103.44 111.18 1 50.00
30128. chelz (slowcolt) 2 107.71 109.62 1 50.00
30129. elp (slothisasin) 2 66.11 67.52 0 0.00
30130. talia (sllvio) 2 83.94 88.99 2 100.00
30131. Jake (slimypeanut) 2 86.80 89.20 2 100.00
30132. slick (slickgogo) 2 70.32 73.67 2 100.00
30133. David (slezterp) 2 105.30 139.13 1 50.00
30134. Shane (slee23) 2 128.78 131.31 1 50.00
30135. Jessica (slacker1998) 2 79.85 83.68 1 50.00
30136. Gavin (sl0wnsteady) 2 55.49 55.53 0 0.00
30137. Sky (skytheguyhigh) 2 76.09 78.02 2 100.00
30138. Skourou (skourou) 2 35.53 40.94 0 0.00
30139. Snowern (skiriius) 2 98.06 104.75 2 100.00
30140. Sean (skimchi) 2 85.15 87.71 1 50.00
30141. Nick (skillofnoob) 2 83.21 87.52 0 0.00
30142. Lynn (skebi) 2 105.52 111.99 2 100.00
30143. skaoakeboarder (skaoakeboar... 2 90.74 93.64 1 50.00
30144. Febri (skafkas) 2 68.50 75.11 1 50.00
30145. Sk (sk07) 2 77.62 78.07 1 50.00
30146. julian Schwarz (sjd2042) 2 31.22 31.79 0 0.00
30147. galt (siuto) 2 51.52 57.09 1 50.00
30148. Yellow (siunam963) 2 104.61 104.90 2 100.00
30149. s (siscari) 2 100.52 110.65 2 100.00
30150. Green (sir_onion) 2 87.01 87.10 0 0.00
30151. Sir (sirknight) 2 51.35 56.24 0 0.00
30152. Ahmed (sirniceman) 2 38.28 40.97 2 100.00
30153. David (sirlaser) 2 70.71 78.70 2 100.00
30154. Angel (sireisenburgh) 2 74.38 74.82 1 50.00
30155. Cahid Enes (sirceness) 2 82.55 85.35 0 0.00
30156. Andrew (sirbobcat2836) 2 126.06 126.12 0 0.00
30157. Blixenn17 (sinonion17) 2 60.05 61.01 0 0.00
30158. Sinai (sinaifonseca) 2 45.01 46.20 0 0.00
30159. simon (simon_racer) 2 84.43 84.71 0 0.00
30160. Simon (simonk33) 2 59.08 61.67 0 0.00
30161. Yasin (silznce) 2 69.01 70.94 0 0.00
30162. Kyle (qwewqa) 2 100.35 103.30 2 100.00
30163. vroom (silimisim) 2 92.63 105.13 1 50.00
30164. Silvan (sili2000) 2 73.85 81.92 0 0.00
30165. Ares (silentglare) 2 106.65 109.72 2 100.00
30166. Damn (sigge200) 2 69.15 72.47 1 50.00
30167. Siddhant (sids2k) 2 70.38 73.37 1 50.00
30168. Siddiqjon (siddiqjonuz) 2 68.77 68.82 1 50.00
30169. Siah (siahbautista) 2 72.15 77.93 1 50.00
30170. Leonard (shutupleonard) 2 119.90 123.59 2 100.00
30171. shufi (shufi2) 2 87.03 88.18 0 0.00
30172. Shubham (shubham1428) 2 74.83 87.91 1 50.00
30173. Shromeone (shromeone) 2 112.58 117.84 2 100.00
30174. Japonizm (showhey0705) 2 82.18 92.30 0 0.00
30175. shortrug (shortrug) 2 123.67 134.50 2 100.00
30176. Krzyscs (shockacs) 2 75.17 79.11 0 0.00
30177. Aiden (shmaiden) 2 49.55 50.34 0 0.00
30178. Shlock07 (shlocktheshlock) 2 81.05 89.42 0 0.00
30179. tstats[shishoro] (shishoro) 2 136.48 149.17 1 50.00
30180. Murid (shinymoogle) 2 114.56 114.85 1 50.00
30181. Shinoto (shinoto) 2 50.46 54.16 0 0.00
30182. Nick (shiningspark) 2 62.56 71.12 0 0.00
30183. hyunho (shinesky0420) 2 73.74 78.46 1 50.00
30184. shinchan (shinchan6nohara9) 2 66.76 68.97 1 50.00
30185. shimona (shimonas) 2 99.80 106.94 1 50.00
30186. Shibasis (shibasisp) 2 60.03 63.06 0 0.00
30187. Sheena (shehoy19) 2 34.75 43.00 0 0.00
30188. Shebes (shebes) 2 77.49 82.81 2 100.00
30189. Maksim (shchmax) 2 42.41 47.22 2 100.00
30190. Peemie (shdwrv) 2 103.69 108.61 0 0.00
30191. Lamb (sharkk) 2 104.67 107.21 1 50.00
30192. fcwaffles (shanice0427) 2 89.41 93.46 1 50.00
30193. Shane (shanelyons1020) 2 70.37 73.89 1 50.00
30194. idk (shaham1) 2 89.93 92.35 2 100.00
30195. Shad (shad_psycho) 2 58.56 63.61 2 100.00
30196. @imshdx_ (shadox999) 2 58.88 65.44 0 0.00
30197. Daniel (shadebyte) 2 92.29 95.97 0 0.00
30198. Seth (sethrhcp) 2 97.05 104.39 1 50.00
30199. Sesame (sesamebagel) 2 86.24 91.10 2 100.00
30200. Senyuu (senyuu) 2 113.43 118.31 1 50.00
30201. Jack (senteran) 2 87.71 89.84 2 100.00
30202. Jabez (senpaijabz) 2 79.36 79.56 1 50.00
30203. Sen (senjaeger) 2 82.52 87.68 0 0.00
30204. Chris (segunobunaga) 2 78.77 81.07 0 0.00
30205. Seth (sefer) 2 57.94 60.07 1 50.00
30206. seelan (seelan) 2 90.30 91.36 0 0.00
30207. Sedao (sedaolicious) 2 90.60 92.37 1 50.00
30208. Sebastian (sebiai) 2 49.74 54.67 0 0.00
30209. ᕕ( ᐛ )ᕗ (sebastiuon) 2 113.80 117.77 0 0.00
30210. seba (sebastianbie) 2 31.26 33.31 0 0.00
30211. seabass (sebasawesome) 2 46.81 48.83 0 0.00
30212. Seanpanpan (seanpanpan) 2 76.19 77.28 0 0.00
30213. Seann (seanntastic) 2 87.27 93.61 2 100.00
30214. seal (sealtypes) 2 90.02 94.48 2 100.00
30215. A (sd_era) 2 69.09 71.86 0 0.00
30216. Chan (sc_chan) 2 62.18 66.22 1 50.00
30217. Rudra (sdes) 2 37.26 40.68 1 50.00
30218. scxrpion (scxrpion) 2 74.87 86.74 1 50.00
30219. Scuba (scubatank) 2 97.95 103.41 2 100.00
30220. Majd (scrollchamp) 2 100.80 105.39 1 50.00
30221. slam man (scriptyvevo) 2 66.06 70.19 0 0.00
30222. Trihard (screwsps) 2 96.95 97.22 2 100.00
30223. Gavyn (scoutpack151) 2 74.71 81.36 1 50.00
30224. Scotty (scottypills) 2 123.31 126.96 2 100.00
30225. Scoob (scooterscoob) 2 67.44 70.82 0 0.00
30226. Save Gaza! (scisaif) 2 77.30 79.17 0 0.00
30227. Michael (schuh98) 2 79.95 83.85 2 100.00
30228. Dalton (schnoook) 2 91.23 92.63 0 0.00
30229. Sebastian (schmiffy) 2 85.84 88.70 0 0.00
30230. scalt (scalt) 2 89.53 103.07 0 0.00
30231. sbie (sbie) 2 72.02 75.40 1 50.00
30232. only quit (sberens) 2 96.70 107.69 1 50.00
30233. Sazeraq (sazeraq) 2 93.83 97.50 0 0.00
30234. Savitar (savitarramen) 2 105.21 107.26 0 0.00
30235. Austin (sausie) 2 60.38 61.78 0 0.00
30236. 𝖘𝖆𝖙𝖗𝖙𝖒... 2 87.63 94.32 1 50.00
30237. Sarthak (sarthaksidhant) 2 48.10 49.41 2 100.00
30238. Haris (sarakas) 2 49.51 49.53 0 0.00
30239. Santiago (santicer06) 2 68.41 75.78 0 0.00
30240. San (sanletem) 2 57.45 57.52 1 50.00
30241. Sander (sandyon) 2 80.57 87.74 1 50.00
30242. David (sandshrew4) 2 95.91 99.58 1 50.00
30243. SandoBanjo (sandobanjo) 2 91.71 97.75 1 50.00
30244. KFXSANDDLE (sandle) 2 159.72 168.17 2 100.00
30245. Hasandi (sandipatriawan) 2 92.08 93.15 1 50.00
30246. Sander (sandiboii) 2 48.30 48.40 0 0.00
30247. Sander (sanderbot66) 2 108.31 113.44 0 0.00
30248. Sandeep (sandeep_balachandran) 2 60.34 60.60 1 50.00
30249. Sam (sam_staz) 2 67.09 70.32 0 0.00
30250. Guest404 (sam_sapeol) 2 51.66 53.18 0 0.00
30251. Sam (samstarfish2013) 2 80.66 83.88 2 100.00
30252. joe (samoyeet) 2 96.35 99.82 0 0.00
30253. Sam (samoc9549) 2 92.49 93.18 2 100.00
30254. Jotaro (sammy82) 2 71.89 74.38 2 100.00
30255. Samuel (sam9182) 2 53.81 54.23 1 50.00
30256. SALTY (saltytap3) 2 69.96 71.39 0 0.00
30257. Salted (salted_mangoes) 2 116.18 120.42 2 100.00
30258. tstats[salahf5] (salahf5) 2 80.86 81.07 0 0.00
30259. Marcin (sakyuz) 2 71.44 73.21 1 50.00
30260. Broken (sakambagal_aba) 2 95.86 102.27 0 0.00
30261. sajinator (sajinator) 2 65.48 69.42 1 50.00
30262. sAjAn (sajansingh) 2 90.78 93.27 2 100.00
30263. saizenG (saizen) 2 118.29 126.92 1 50.00
30264. Venkatasai (saivenkata521) 2 59.12 61.67 0 0.00
30265. Carlos (saint1124) 2 56.64 62.01 1 50.00
30266. Saira (sairacraft) 2 93.76 94.07 0 0.00
30267. Sam (saimbintalib) 2 49.17 58.94 0 0.00
30268. HARDCORE (sailingboat) 2 107.01 112.58 1 50.00
30269. sahil (sahilratra) 2 39.86 41.09 0 0.00
30270. Marcus (safetymarcus) 2 97.03 103.61 1 50.00
30271. jared (sadtom) 2 91.57 99.78 0 0.00
30272. sadbanana (sadbanana0) 2 73.92 76.74 0 0.00
30273. Zach (saccery) 2 63.16 63.94 2 100.00
30274. saarim (saarim) 2 83.64 84.36 0 0.00
30275. S2dent (s2dent) 2 115.96 119.06 1 50.00
30276. S (s2929) 2 91.81 98.05 2 100.00
30277. Ethan (s1ip2r) 2 43.64 45.22 2 100.00
30278. Rizky (rzkyog) 2 58.75 69.23 1 50.00
30279. Ryu (ryu_00) 2 58.66 60.97 0 0.00
30280. Rytis (rytux369) 2 46.98 49.31 1 50.00
30281. Ryoma (ryomak) 2 105.74 112.90 1 50.00
30282. Rygah (rygah) 2 124.25 145.27 1 50.00
30283. Ryan (ryan_ng1234) 2 87.65 103.72 2 100.00
30284. Ryan (ryan_dicenzo) 2 98.75 108.26 0 0.00
30285. Ryan (ryannnnnnnnn) 2 81.01 81.22 1 50.00
30286. Aquaris (ryankim834) 2 99.93 104.43 2 100.00
30287. Alex (rxndom) 2 66.50 67.32 0 0.00
30288. Juri (rvotaenota13) 2 28.30 30.13 1 50.00
30289. Ryan (rvisich5) 2 96.33 98.89 1 50.00
30290. Rutvij (rutvij2811) 2 59.73 60.64 0 0.00
30291. Kayden (russiangangsta) 2 115.45 122.06 1 50.00
30292. arTCap (rusaterbang01) 2 41.74 42.32 1 50.00
30293. ruohola (ruohola) 2 70.58 75.19 1 50.00
30294. Runa Peru (runaperu) 2 107.45 108.66 1 50.00
30295. Harry (ruggers) 2 53.52 58.36 1 50.00
30296. ruditheracer (ruditheracer) 2 48.78 52.76 0 0.00
30297. William (rubrubmytubtub) 2 97.92 99.74 0 0.00
30298. WowRobertisWinning (rtruong) 2 78.67 80.91 2 100.00
30299. Gunnar (rs_gunny) 2 74.06 77.78 0 0.00
30300. Rakha (rrsplay) 2 50.38 50.59 0 0.00
30301. Rosa (rrosie1213) 2 101.64 107.21 2 100.00
30302. Notsuo (rrhousti93) 2 50.39 53.85 2 100.00
30303. rraei (rraei) 2 91.64 93.23 1 50.00
30304. abi (rqizel) 2 54.15 55.35 0 0.00
30305. rpbanker (rpbanker) 2 71.42 76.54 0 0.00
30306. Joey (rosuoammdo) 2 104.66 107.66 0 0.00
30307. rose (roseishot) 2 70.44 75.01 0 0.00
30308. (rontran) 2 117.03 125.84 1 50.00
30309. Roni (rondeexe) 2 52.65 56.63 0 0.00
30310. Roizor (roizor) 2 102.09 110.58 2 100.00
30311. Rohan (rohanrao) 2 94.64 98.98 1 50.00
30312. Rohan (rohanr) 2 127.12 128.56 1 50.00
30313. Dan (rock_god_dan) 2 77.32 80.25 1 50.00
30314. Rockey (rockey_3) 2 83.68 88.82 1 50.00
30315. rocket (rocketz) 2 52.22 53.62 0 0.00
30316. cobrobdob (rocketjuice) 2 75.07 77.04 1 50.00
30317. Kisara (rock125zz) 2 93.94 95.02 2 100.00
30318. Kool (robozarp) 2 88.74 95.74 1 50.00
30319. Jacob (robleroj76) 2 52.97 55.01 0 0.00
30320. Robi (robi_trabl) 2 76.78 78.05 1 50.00
30321. Robert - NFS (robert2345) 2 80.67 91.15 2 100.00
30322. Ryan (roadrash09) 2 65.40 107.69 1 50.00
30323. RoachLok (roachlok) 2 93.55 97.97 1 50.00
30324. Ryji (rmccs) 2 53.43 59.28 0 0.00
30325. Harsh K.C. (rkcrocks144) 2 49.91 55.88 0 0.00
30326. rjlee (rjlee) 2 94.91 96.58 2 100.00
30327. rizzRacer (rizz94) 2 66.63 68.99 0 0.00
30328. Riverspirit (riverspirit) 2 124.81 138.61 1 50.00
30329. rivo (rivayet) 2 61.81 63.56 0 0.00
30330. Dan (rivalesque) 2 94.37 98.63 1 50.00
30331. ritvik (ritvikrustagi) 2 122.54 127.69 2 100.00
30332. Rito (rito_nsj) 2 98.17 98.68 1 50.00
30333. Ring (ringtackyeet) 2 113.44 118.94 2 100.00
30334. kabootar (rijaezahra) 2 80.12 80.67 2 100.00
30335. Rıfat (rifguli) 2 61.94 67.41 2 100.00
30336. Rieko (rieko) 2 91.69 99.53 2 100.00
30337. RidThe (ridthetwoladders) 2 67.31 78.97 0 0.00
30338. ricky (rickysingh) 2 38.80 40.20 0 0.00
30339. snova (rickdiculous) 2 93.22 94.87 1 50.00
30340. Eric (rickby) 2 97.75 100.48 1 50.00
30341. richa (richa69) 2 92.95 96.49 1 50.00
30342. Richard (ricehard) 2 73.87 75.66 0 0.00
30343. rialagma (rialagma) 2 67.35 69.79 1 50.00
30344. Joseph (rhubarbasia) 2 136.51 144.32 1 50.00
30345. Teuku (rhazzdawg) 2 96.83 100.14 2 100.00
30346. rez1 (rezoan90) 2 72.18 73.79 1 50.00
30347. Ollie (revvylo) 2 108.30 116.79 0 0.00
30348. Jonathan (reverbcs) 2 92.11 92.68 0 0.00
30349. Rev (revcows) 2 81.61 91.98 0 0.00
30350. kream (remmie2k) 2 135.57 135.65 1 50.00
30351. Relay (relay5131) 2 74.71 75.98 0 0.00
30352. Goose (reichmatthew) 2 71.09 71.33 1 50.00
30353. Caleb (reflux2k) 2 71.05 75.35 1 50.00
30354. Rushaan (redrush12) 2 54.05 59.19 0 0.00
30355. Rederdex (rederdex) 2 61.91 64.66 0 0.00
30356. Rory (redder_colemak) 2 112.18 119.13 2 100.00
30357. Robyn (realtcc) 2 82.90 94.94 0 0.00
30358. Realslow24 (realslow24) 2 41.47 42.72 0 0.00
30359. Ryan (rcanete26) 2 73.74 78.23 0 0.00
30360. andre (razukandre) 2 43.18 47.83 0 0.00
30361. Ray (ray_maddox) 2 85.78 90.29 0 0.00
30362. Raymond (raymo_nd) 2 96.79 99.35 0 0.00
30363. Raymond (raymondrudman) 2 58.88 62.01 0 0.00
30364. Rayf (rayfisfast) 2 122.13 139.51 1 50.00
30365. RayDaren (raydaren) 2 65.73 75.19 0 0.00
30366. noob (rayat) 2 82.82 88.39 1 50.00
30367. Ravi (ravioliolioli) 2 70.82 75.37 0 0.00
30368. Ravi (ravi15a) 2 113.85 118.39 2 100.00
30369. Varshinee (raventhunderblac... 2 72.46 79.93 2 100.00
30370. Toby (ratolp) 2 62.85 64.06 0 0.00
30371. Rasul (rasulyakhyaev) 2 62.26 64.49 1 50.00
30372. Jack (raspyspartan) 2 94.75 101.96 2 100.00
30373. Rashen (rashen33) 2 54.16 59.02 0 0.00
30374. raptor (raptor233) 2 44.09 55.92 1 50.00
30375. Benimaru (raphieldropout) 2 98.51 103.73 0 0.00
30376. Ranger (rangerelk76) 2 96.65 104.46 0 0.00
30377. randy (randy022) 2 88.11 98.79 1 50.00
30378. No (randomnamehere) 2 73.92 73.96 1 50.00
30379. Dorothy (randomhoomanbean) 2 95.60 97.03 1 50.00
30380. RandomDraco (randomdraco) 2 90.15 93.80 1 50.00
30381. Jason (randombananazz) 2 85.01 88.91 0 0.00
30382. Kiet (random22) 2 69.76 69.93 1 50.00
30383. Mark (rampagingmoose) 2 71.29 71.44 0 0.00
30384. hritik (raj_veer) 2 36.60 37.13 0 0.00
30385. Rajput (rajput77) 2 43.15 46.36 0 0.00
30386. Raikyryu (raikyryu) 2 121.36 129.54 2 100.00
30387. Rahid (rahid_) 2 73.84 74.34 2 100.00
30388. Rafael (rafmonster) 2 110.24 110.86 1 50.00
30389. rafał (rafixxx) 2 55.81 62.98 1 50.00
30390. Rafiq (rafiq) 2 58.07 67.75 0 0.00
30391. Rafid (rafid2908) 2 43.11 46.71 0 0.00
30392. Rafid (rafid20) 2 62.37 64.63 0 0.00
30393. rafew (rafew) 2 41.05 43.89 0 0.00
30394. Rafa (raffab) 2 44.30 45.21 0 0.00
30395. Rafal (rafaldrath) 2 66.23 72.63 2 100.00
30396. Rachel (rachelbug) 2 90.46 91.55 1 50.00
30397. Alfred (racer421) 2 64.65 64.82 0 0.00
30398. Spring (rabeeh97) 2 111.43 115.54 1 50.00
30399. Kumar (r3dcherry) 2 75.01 76.09 0 0.00
30400. Angu (r3dcamo) 2 52.85 53.32 0 0.00
30401. reebad (r33bad) 2 81.17 88.99 2 100.00
30402. R2bEEaton (r2beeaton) 2 94.38 98.77 0 0.00
30403. Rohit (r1walz) 2 93.62 98.91 1 50.00
30404. qwerty (qwertyuser3) 2 111.51 118.29 1 50.00
30405. qwer (qwertyuiop232) 2 96.07 97.85 0 0.00
30406. QwertyQurht (qwertyqurht) 2 40.32 45.08 2 100.00
30407. Nikhil (qwertyiop56) 2 95.32 101.88 0 0.00
30408. Alex (qwertyesque) 2 106.31 114.13 0 0.00
30409. Qwerty (qwerty91994) 2 148.37 148.89 2 100.00
30410. Kirsten (qupidd) 2 106.70 115.09 2 100.00
30411. Quittance (quittance) 2 109.61 120.55 0 0.00
30412. Enrique (quiquenrique) 2 88.09 91.93 0 0.00
30413. Nikhil (quill_workman) 2 95.68 95.92 1 50.00
30414. Jack (quertx) 2 85.46 90.04 0 0.00
30415. Quan (quan_2003) 2 22.87 23.16 1 50.00
30416. Synth (quantum88) 2 86.72 93.29 0 0.00
30417. Aniket (quantom_) 2 52.97 55.08 2 100.00
30418. Andrew (quantified_null) 2 83.63 85.80 0 0.00
30419. nvmabotthat (quack_yena) 2 44.70 44.86 1 50.00
30420. q (qtyps) 2 124.06 133.05 2 100.00
30421. Audrey (pytho556) 2 89.83 92.61 2 100.00
30422. Fiel (pyel) 2 60.17 65.97 0 0.00
30423. Franco (pussay_wizard) 2 98.54 106.94 0 0.00
30424. Alex (punksalot04) 2 70.20 71.05 0 0.00
30425. Sushruth (punkin04) 2 65.55 69.75 1 50.00
30426. Cohleen (pumpkingirl) 2 73.22 73.70 1 50.00
30427. don (publicenemyxii) 2 46.51 54.68 0 0.00
30428. Suzie (psychosuzie) 2 148.89 149.66 2 100.00
30429. just bored (psychosam1337) 2 85.31 91.77 0 0.00
30430. UNTiTLED (pshy0) 2 88.95 95.24 2 100.00
30431. danny (protyperdanner) 2 88.51 89.89 0 0.00
30432. Proton (proton_rizing) 2 88.41 96.64 0 0.00
30433. ProGamerXDFTW (progamerxdftw) 2 104.85 125.47 2 100.00
30434. John (procrastinator4life) 2 59.77 61.12 0 0.00
30435. Predator (predator_01) 2 46.52 48.93 0 0.00
30436. N (precised_aim) 2 64.47 72.83 1 50.00
30437. Prakul (prax99) 2 67.30 67.92 1 50.00
30438. Prateek (prateekp987) 2 78.38 83.09 2 100.00
30439. Pranaya (pranaya989) 2 75.82 78.81 1 50.00
30440. Peter (ppeett11) 2 35.53 37.12 0 0.00
30441. Brian (powerraider064) 2 84.75 95.47 1 50.00
30442. potter (potterwastaken) 2 54.61 57.60 0 0.00
30443. Jonathan (potatowned) 2 95.25 112.00 0 0.00
30444. Ronny (poseidonhk) 2 130.43 133.66 2 100.00
30445. Pooky! (poooooky) 2 87.48 96.96 2 100.00
30446. POOKR (pookr) 2 83.13 89.41 0 0.00
30447. Big (pookpok) 2 103.60 107.76 1 50.00
30448. kannon (poobear40) 2 71.51 72.86 0 0.00
30449. Pongo (pongofant) 2 76.22 82.00 1 50.00
30450. pong (pongix) 2 100.00 107.70 2 100.00
30451. Aubergine (pomergenes) 2 95.99 96.33 2 100.00
30452. Pablo (poloniusz) 2 56.74 61.96 1 50.00
30453. Polla (pollaz1) 2 81.41 88.55 0 0.00
30454. Pogchamp (poggerchamps) 2 93.78 94.48 1 50.00
30455. Panupong (pnp__) 2 53.47 54.85 0 0.00
30456. Vein (pluflmufn) 2 101.27 119.67 1 50.00
30457. Plordpai (plordpai) 2 68.26 74.28 1 50.00
30458. Al (plnit) 2 72.33 84.10 1 50.00
30459. Dauan (plexxx) 2 69.94 74.05 0 0.00
30460. Star (playnslay69) 2 92.21 95.34 2 100.00
30461. Venus (planet_venus) 2 58.06 60.34 0 0.00
30462. 7 wpm (plaayer17) 2 129.69 132.20 1 50.00
30463. Miki (pkong001) 2 92.29 97.38 2 100.00
30464. Balazs (pkobeast) 2 92.58 96.02 0 0.00
30465. andre (pizzamista) 2 83.57 87.02 2 100.00
30466. Pirated (piratedkeyboard) 2 35.78 39.80 0 0.00
30467. bruh (pirate22) 2 36.91 37.42 0 0.00
30468. failure (pipy26) 2 69.53 78.53 2 100.00
30469. aj (pinoy_cebu7) 2 66.15 67.91 0 0.00
30470. Pink (pinkfluffyllama) 2 73.93 73.99 1 50.00
30471. Chadin (pinghuskar) 2 36.74 38.85 0 0.00
30472. Pineapple711 (pineapple711) 2 58.48 73.71 0 0.00
30473. Alejandro (pimpsogreasy) 2 95.80 98.84 0 0.00
30474. PimpSlapper (pimpslapper) 2 76.60 77.49 0 0.00
30475. Seed (pikubu) 2 82.86 92.76 1 50.00
30476. Mateo (pikksaar) 2 95.16 99.34 0 0.00
30477. Pikakid (pikakid_twitch) 2 55.71 60.76 0 0.00
30478. Pikachu (pikachutron3000) 2 135.24 142.16 2 100.00
30479. Paul (piece408) 2 71.53 75.47 0 0.00
30480. Gunner (pie621) 2 123.83 134.19 0 0.00
30481. Reuben (phyterjet) 2 82.59 85.42 0 0.00
30482. Jak (phrl) 2 83.77 84.70 1 50.00
30483. Jacob (phlid) 2 87.93 91.78 1 50.00
30484. Philos (philos_1) 2 70.99 77.50 2 100.00
30485. Phillip (phillardb) 2 103.18 112.08 2 100.00
30486. July (phi4069) 2 85.37 92.53 0 0.00
30487. pgfunny124 (pgfunny124) 2 77.68 89.32 0 0.00
30488. H.Y. (periodology) 2 58.46 61.54 1 50.00
30489. pepe (pepesaiko) 2 135.78 147.73 2 100.00
30490. PenguKeith (pengukeith) 2 60.00 64.77 1 50.00
30491. PenguJ (penguj) 2 80.60 83.73 0 0.00
30492. Penguin (penguint) 2 62.85 69.11 1 50.00
30493. PenguiNerd1000 (penguinerd1... 2 86.98 104.19 1 50.00
30494. Serhii (pemakhov) 2 47.69 48.30 0 0.00
30495. James (peeetah1) 2 66.58 71.61 1 50.00
30496. Aakash (pedulal123) 2 43.10 44.06 0 0.00
30497. Pedrocas420 (pedrocas420) 2 47.85 48.32 0 0.00
30498. pc1400 (pc1400) 2 103.16 109.01 1 50.00
30499. Aris! (pazturized) 2 105.02 109.66 1 50.00
30500. Shermill Roger (paybtawsan) 2 64.87 65.77 2 100.00
30501. paully7 (paully7) 2 75.47 76.78 0 0.00
30502. Andrew (patatoed) 2 93.35 99.47 0 0.00
30503. Antunisia (part0tet0d0) 2 53.24 53.26 1 50.00
30504. paraluman (paraluman) 2 77.13 80.80 0 0.00
30505. c (paradoxalpen) 2 117.73 126.67 2 100.00
30506. rujipas (paopeaw) 2 57.29 63.55 1 50.00
30507. blake (pandashasjoinedthegame) 2 48.37 48.93 0 0.00
30508. Justin (pancakemaster216) 2 71.43 74.35 0 0.00
30509. panagiotis (pana23161) 2 73.12 75.22 0 0.00
30510. Pavle (pajle) 2 107.02 108.22 0 0.00
30511. Eric (paiement) 2 97.77 109.09 0 0.00
30512. PacaJack (pacajack) 2 74.79 78.89 1 50.00
30513. Player (p1ayer_two) 2 98.68 103.94 1 50.00
30514. Josh (p0mm) 2 101.57 113.17 2 100.00
30515. Michael (ozquez) 2 46.76 50.87 0 0.00
30516. Kori (oxymoronictruth) 2 90.61 92.97 2 100.00
30517. Owl (owlhidepants) 2 89.51 95.97 1 50.00
30518. Owen (owen5560) 2 113.26 125.98 2 100.00
30519. 🇧🇬️(⌐■_■) ... 2 48.78 51.76 0 0.00
30520. SheepManiac (oversnyper) 2 76.14 80.93 1 50.00
30521. Ainsley (outree) 2 60.82 61.86 1 50.00
30522. typeO (otaku_ish) 2 84.56 91.26 0 0.00
30523. ossama (oss123) 2 44.03 44.57 0 0.00
30524. Stricky (oscar_foxtrot) 2 54.72 55.76 2 100.00
30525. Oromis (oromis1) 2 113.63 115.04 2 100.00
30526. OrneryCash (ornerycash) 2 57.60 60.17 1 50.00
30527. iOrange (orangec) 2 75.30 77.45 0 0.00
30528. orainchy (orainchy) 2 60.00 61.95 1 50.00
30529. Filip (opticalswitches) 2 73.69 74.43 0 0.00
30530. Alfred (opoy) 2 68.00 69.85 1 50.00
30531. Albert (oomydoomers) 2 135.25 151.67 2 100.00
30532. oomikeyboy (oomikeyboy) 2 94.93 95.72 1 50.00
30533. reda (oncelearner) 2 46.49 50.81 0 0.00
30534. Onat (onatozer) 2 57.43 57.89 1 50.00
30535. Speed (omotola2004) 2 88.59 90.75 1 50.00
30536. omejeyo (omejeyo) 2 97.79 106.50 1 50.00
30537. Hao (omegazz) 2 126.71 128.14 1 50.00
30538. Omar (omarmoralesjr810) 2 76.94 82.95 1 50.00
30539. Nacio (olivier066) 2 90.64 99.95 1 50.00
30540. Ole Bendik (olebanan) 2 60.58 62.06 0 0.00
30541. Regular Plumbus (oldplumbus) 2 76.64 78.36 0 0.00
30542. Yuklin (okinashii) 2 56.36 57.77 0 0.00
30543. Oliver (okay_google) 2 47.77 52.42 0 0.00
30544. Patrik (oishinek) 2 73.98 75.70 0 0.00
30545. K (ohkat__) 2 90.34 94.16 0 0.00
30546. Beebo (ohbeebo) 2 57.13 58.06 0 0.00
30547. Odyn (odynlol) 2 102.49 110.92 0 0.00
30548. odie (odiemoley) 2 109.00 117.05 0 0.00
30549. odelll (ode_qwerty) 2 73.15 75.09 0 0.00
30550. Octavian (octavianb) 2 49.71 51.42 0 0.00
30551. OCD (ocdonedid) 2 59.32 64.78 0 0.00
30552. Zach (obeiah) 2 71.99 84.77 0 0.00
30553. 「 n e X u s 」 ム (n_e_... 2 76.00 79.91 1 50.00
30554. (◠‿◠✿) (nyafuu) 2 101.67 101.78 2 100.00
30555. DK (nwbpwn9000) 2 60.79 62.87 1 50.00
30556. MUHD (nvzvn) 2 33.98 34.65 0 0.00
30557. nurse (nurse1) 2 123.79 124.13 2 100.00
30558. R (nuoiea) 2 113.62 118.66 1 50.00
30559. null (null_zjx) 2 74.95 79.41 1 50.00
30560. nubby (nubbydawg) 2 72.79 76.98 1 50.00
30561. Daniel (ntc1337) 2 53.00 53.80 2 100.00
30562. Karan (no_one_special) 2 61.94 66.22 1 50.00
30563. Lauri (nozlate) 2 84.62 87.54 1 50.00
30564. shieru (nowelz) 2 54.63 69.27 2 100.00
30565. Nova (nova_6178) 2 54.29 58.82 0 0.00
30566. Aaron (novacado) 2 94.96 96.72 0 0.00
30567. nougatsoup (nougatsoup) 2 85.30 86.75 0 0.00
30568. Rocco (not_that_great) 2 83.43 85.39 0 0.00
30569. Evan (notrabe) 2 85.42 86.44 0 0.00
30570. Notis (notkatsa) 2 80.21 87.97 1 50.00
30571. North (northtm) 2 64.43 75.75 0 0.00
30572. NorthernNinja (northernninj... 2 85.86 86.64 1 50.00
30573. Cinema (northernblues) 2 57.11 58.56 0 0.00
30574. Nop (nopdop) 2 55.65 56.28 1 50.00
30575. 안녕하세요 (noogie13) 2 123.39 126.41 0 0.00
30576. Noodle (noodle_master) 2 97.82 109.41 1 50.00
30577. Oliver (noodle3) 2 109.25 111.45 2 100.00
30578. Noobmau (noobmau) 2 66.90 71.70 0 0.00
30579. Vinay (noob101098) 2 44.63 45.53 1 50.00
30580. Slow (noob) 2 118.58 120.23 0 0.00
30581. Atharva (non_geniosity) 2 94.80 97.10 0 0.00
30582. MYMANIA (nongaim123) 2 48.32 55.47 0 0.00
30583. Daniel (nomnomdaniel) 2 128.54 130.25 1 50.00
30584. Nolie65 (nolie65) 2 109.27 124.05 1 50.00
30585. Mythknight (nolfwin) 2 108.53 109.11 1 50.00
30586. Nolan (nolan_f) 2 86.60 92.77 2 100.00
30587. kax (nobodyl0vesme) 2 105.79 110.55 1 50.00
30588. Noah (noah_o_n) 2 138.03 139.85 0 0.00
30589. Noah (noahebe) 2 85.61 102.36 1 50.00
30590. Nithish Kumar (nithish20) 2 63.34 64.51 0 0.00
30591. nishank (nish4nk) 2 42.46 44.56 0 0.00
30592. nirav (niravkaka) 2 47.39 53.16 0 0.00
30593. aeris (nintendou) 2 61.89 64.57 2 100.00
30594. bliss (ninjakk) 2 114.36 119.45 2 100.00
30595. Shourya (ninja1918) 2 52.83 56.19 0 0.00
30596. Nínive Letícia (ninive_le... 2 50.20 50.61 1 50.00
30597. Periwinkle (niknik2121) 2 91.83 104.99 0 0.00
30598. ✧・゚: * Kiks (nikki338) 2 46.05 46.26 0 0.00
30599. NikBlox (nikblox) 2 57.76 61.36 1 50.00
30600. Mohd (nihal2193) 2 77.45 77.79 1 50.00
30601. NightOwl (nightowl2312) 2 145.63 151.52 2 100.00
30602. Madison (nightlight17) 2 80.19 85.06 1 50.00
30603. Nicu (nicuyay) 2 51.99 57.48 0 0.00
30604. Nicole (nicolemt) 2 117.96 119.05 1 50.00
30605. Nick (nickstar96) 2 92.23 94.12 1 50.00
30606. Nick (nickoftime146) 2 122.86 127.35 1 50.00
30607. Cole (nickocado) 2 99.05 99.19 0 0.00
30608. Nick (nickh789) 2 77.72 84.68 2 100.00
30609. Nick (nick12342) 2 101.04 114.04 1 50.00
30610. Nicediceroll (nicediceroll) 2 57.71 61.65 0 0.00
30611. Nissan (ni554n) 2 68.81 70.96 1 50.00
30612. cimsunf (nhtai) 2 82.95 84.32 1 50.00
30613. ngmh (ngmh) 2 98.44 100.25 0 0.00
30614. Cogan (ngcogan) 2 121.77 130.19 2 100.00
30615. Isaac (newtion) 2 105.68 110.40 1 50.00
30616. Newtan (newtan) 2 87.38 97.50 1 50.00
30617. neuralscatted (neuralscatte... 2 96.26 100.34 1 50.00
30618. Nessie (nessie14) 2 66.55 71.30 0 0.00
30619. Hal (nerus) 2 97.88 102.71 1 50.00
30620. Dee (nerdie_) 2 64.17 70.88 0 0.00
30621. Brayden (nerbray) 2 47.18 47.69 0 0.00
30622. Steve (nepets) 2 31.41 34.90 0 0.00
30623. Neeschal (neeschal) 2 46.78 51.25 0 0.00
30624. attractive monkey (necr01337) 2 61.85 64.63 1 50.00
30625. Nave (naveboy34) 2 85.70 111.18 0 0.00
30626. Liam (nattilife) 2 114.41 121.08 2 100.00
30627. Nashpotato (nashpotat0) 2 86.02 86.63 1 50.00
30628. Hsu (naruto60509) 2 71.97 83.02 2 100.00
30629. Dejan (narandza) 2 71.42 73.76 1 50.00
30630. Billie (nappy2000) 2 88.51 97.93 0 0.00
30631. Nape (nape_) 2 82.38 84.14 0 0.00
30632. Nam (namtran1205) 2 38.72 40.98 0 0.00
30633. Namaztak (namaztak) 2 45.32 52.06 0 0.00
30634. le (nail123) 2 69.88 76.95 1 50.00
30635. alaon (nahbro123) 2 104.59 113.05 1 50.00
30636. Joseph (nagster12) 2 64.36 65.36 1 50.00
30637. Nadun (nadunys) 2 58.58 61.31 1 50.00
30638. Christian (nadesuke) 2 79.10 86.56 0 0.00
30639. Andrew (n3r3z) 2 35.94 36.93 0 0.00
30640. Sang (m_sang) 2 49.24 53.65 0 0.00
30641. James (mysticalentity) 2 76.78 77.61 0 0.00
30642. Mykola (mykolatkachuk1231) 2 45.31 47.30 0 0.00
30643. Рамеш від'я (myguy... 2 77.48 80.41 2 100.00
30644. eljugadormejor (mxntal) 2 87.43 97.49 1 50.00
30645. r.mzl (muzzzle) 2 98.55 109.67 2 100.00
30646. Musty (muysty) 2 75.48 84.18 1 50.00
30647. Lucas (mutenow) 2 92.73 101.27 1 50.00
30648. PassionPanda (mustangpanda) 2 91.45 102.26 0 0.00
30649. Mustafa (mushy_) 2 74.76 84.97 1 50.00
30650. Jamal (murrsielago) 2 111.19 113.43 0 0.00
30651. Cyka (murdocisgod2004) 2 69.92 70.96 0 0.00
30652. Meredith (murdith) 2 83.21 90.45 0 0.00
30653. Kirk (murb_) 2 107.22 111.81 2 100.00
30654. muhsenG (muhseng) 2 54.56 57.20 1 50.00
30655. Mubaarak (mubaarak_199) 2 40.78 47.92 0 0.00
30656. Déádlý (muandmj) 2 58.59 64.02 1 50.00
30657. Matthew (mttw) 2 77.68 83.43 1 50.00
30658. mtj (mtj420) 2 67.32 71.30 2 100.00
30659. MstrCoconut (mstrcoconut) 2 70.64 73.42 1 50.00
30660. TC (mstngt) 2 102.26 106.39 1 50.00
30661. M Stew (mstew354) 2 109.84 114.56 0 0.00
30662. Muhammad Shobuz (mr_uranus) 2 45.16 51.96 0 0.00
30663. Tommy (mr_max_dog) 2 64.57 71.99 2 100.00
30664. Choon (mr_krab) 2 65.84 69.98 0 0.00
30665. MrBoombastic (mr_boombaastic) 2 80.04 82.87 0 0.00
30666. white (mrwhiteee) 2 113.57 113.78 2 100.00
30667. T (mrtvigs) 2 59.34 62.13 1 50.00
30668. Kevin (mrtrololo) 2 114.17 124.42 2 100.00
30669. MrSteal (mrstealyospam) 2 78.04 87.55 1 50.00
30670. Mike (mrskopelos27) 2 73.44 77.58 1 50.00
30671. Julien (mrroy3) 2 100.97 101.79 0 0.00
30672. Joseph (mrpuffels) 2 79.19 88.15 1 50.00
30673. mrklein (mrklein) 2 81.75 91.14 2 100.00
30674. mrid13211 (mrid1321) 2 85.12 97.02 2 100.00
30675. @frn.fz (mrgumball) 2 101.70 107.13 2 100.00
30676. Mr. (mrgoldenball) 2 63.06 63.23 1 50.00
30677. Ian (mrfro) 2 69.82 77.73 1 50.00
30678. Ryder (mrdrumsuno) 2 110.71 111.73 1 50.00
30679. ur (mrchubbypancake) 2 41.84 41.90 0 0.00
30680. Michel (mraskin) 2 68.09 69.53 0 0.00
30681. Mason (mpk072) 2 53.44 55.23 1 50.00
30682. Mo. (mo_rehan24) 2 86.15 89.33 1 50.00
30683. Free Palestine (mo_dodo) 2 49.97 54.78 1 50.00
30684. Kelly Blows Doods (moyyom2) 2 121.16 127.66 1 50.00
30685. H. (mousegeek) 2 101.45 103.53 1 50.00
30686. Minn Swan (motherlovesyou) 2 115.10 117.75 0 0.00
30687. Ben (mossdeep) 2 90.32 97.49 1 50.00
30688. mosharaf (mosharaf) 2 54.27 55.01 0 0.00
30689. Biscuitised (morgan221) 2 58.07 59.85 0 0.00
30690. Josh (mophii) 2 78.63 80.11 1 50.00
30691. Warut (moowarut) 2 72.01 73.66 0 0.00
30692. Dan (moochookaboo) 2 96.09 107.91 1 50.00
30693. Montgomery (montgomery_oppe... 2 62.10 64.34 0 0.00
30694. tstats[MonsterTaco] (monste... 2 107.64 118.53 2 100.00
30695. Eldiar (monoluntik) 2 32.81 34.20 0 0.00
30696. Monkey (monkeydee) 2 94.37 105.83 1 50.00
30697. EGR (mondragon2424) 2 78.32 78.47 1 50.00
30698. smalkauzkoda (monarchist) 2 111.02 111.18 1 50.00
30699. CreepySusie (mole22) 2 82.61 83.99 2 100.00
30700. Mok (mokmoon) 2 138.35 146.30 0 0.00
30701. Margulan (mokarelol) 2 43.40 47.22 0 0.00
30702. Toon (mojohamz) 2 91.61 100.25 1 50.00
30703. Mohit (mohit_singhal) 2 60.39 65.48 0 0.00
30704. mohi (mohiri) 2 91.48 97.41 1 50.00
30705. mohammad (mohammad_aub_1_9_... 2 44.12 48.71 0 0.00
30706. Mohammad (mohammadkh) 2 47.68 49.74 0 0.00
30707. Scott (mogyoon) 2 78.42 81.01 0 0.00
30708. Ramit Inmah (moe_lester69_420) 2 99.05 101.64 0 0.00
30709. Will (mockingod) 2 113.97 120.31 0 0.00
30710. Joe (mobinman69) 2 121.90 123.62 2 100.00
30711. Type (mm66) 2 86.04 88.54 1 50.00
30712. Manthan (mkp28082003) 2 40.76 43.33 0 0.00
30713. mko908 (mko908) 2 97.57 111.04 1 50.00
30714. Matthew (mk07320) 2 99.84 111.60 2 100.00
30715. Jermaine (mj_procuber) 2 81.69 85.03 0 0.00
30716. Fearless (mjsuriya) 2 64.36 64.60 0 0.00
30717. Minh (mjnhpzo) 2 65.45 66.53 0 0.00
30718. Brown Bear (mjcortz) 2 98.47 104.24 2 100.00
30719. Mitoyaa (mitoromu_) 2 67.36 69.26 0 0.00
30720. Shaan (mitnick) 2 53.64 58.68 0 0.00
30721. Joshua (mis_hurd) 2 62.27 64.36 0 0.00
30722. Alex (mistaman10) 2 69.45 73.89 0 0.00
30723. Rey (misscypher) 2 52.04 52.85 1 50.00
30724. Cliff (misfortunes) 2 92.31 92.47 0 0.00
30725. Danny (minwoo7690) 2 78.61 80.84 1 50.00
30726. Mint (mintalchemist) 2 98.93 100.88 1 50.00
30727. Mino (minoaslowtyper) 2 65.45 68.09 1 50.00
30728. Minimatrix (minimatrix) 2 38.99 40.57 0 0.00
30729. miniman1706 (miniman1706) 2 81.49 85.05 2 100.00
30730. Samuel (minikloon) 2 133.33 141.16 1 50.00
30731. Kay (miniaturepenguin) 2 122.94 127.77 1 50.00
30732. minh huu (minhhuudoan) 2 57.35 60.58 1 50.00
30733. MinetasticAR (minetasticar) 2 66.33 74.67 0 0.00
30734. MindstormL (mindstorml) 2 95.74 106.95 1 50.00
30735. Mina (minajacob) 2 59.81 64.77 0 0.00
30736. fat ape (miltox) 2 105.13 113.06 2 100.00
30737. Tin Pham (milkshake69) 2 79.45 81.87 0 0.00
30738. Mile161 (mile161) 2 76.40 79.30 0 0.00
30739. Mikhail (mikhail0620) 2 101.87 102.62 0 0.00
30740. mikey (mikelikes) 2 85.49 98.79 0 0.00
30741. mike (mike017) 2 63.17 66.02 1 50.00
30742. midi (midija) 2 100.30 110.10 1 50.00
30743. Michelangelo (michelangeio) 2 82.23 92.07 0 0.00
30744. michael (michaelma) 2 80.47 81.20 0 0.00
30745. Michael (michaelcox) 2 63.51 66.50 0 0.00
30746. Micey (miceymyc) 2 43.19 45.11 2 100.00
30747. Reckful RIP (micbee) 2 78.79 78.94 0 0.00
30748. Mia (miadotcx) 2 101.76 102.70 0 0.00
30749. Chatchai (mhoblack) 2 33.97 36.52 0 0.00
30750. Martin (mfp02639) 2 83.48 114.22 1 50.00
30751. Destory (mexicanpikeman) 2 115.43 120.91 1 50.00
30752. Domo (mewto012) 2 78.42 80.88 1 50.00
30753. Mew. (mewddth) 2 57.84 62.00 1 50.00
30754. Meta (meta_x0) 2 15.71 23.01 1 50.00
30755. Erik (merkinmeerkats) 2 113.57 125.16 1 50.00
30756. g (merelymyself) 2 84.40 85.98 1 50.00
30757. Tsukasa@dvorak (melot) 2 139.30 141.07 2 100.00
30758. Julia (melonclementine) 2 70.05 73.84 0 0.00
30759. Mel (mel7) 2 49.51 56.10 2 100.00
30760. Mako (megy147) 2 84.63 85.78 1 50.00
30761. Megu (meguminayaya) 2 68.76 78.46 2 100.00
30762. Manny (mefinitelydanny) 2 110.18 114.89 2 100.00
30763. Peter (meffisto420) 2 95.38 97.36 2 100.00
30764. Meep (meeeep) 2 122.18 126.52 0 0.00
30765. Alex (medalions) 2 69.12 80.47 1 50.00
30766. Pang (meavel) 2 46.22 49.70 0 0.00
30767. meandblackie (meandblackie) 2 96.03 100.44 1 50.00
30768. Mohammad (mdunicorn) 2 65.22 67.04 0 0.00
30769. William (mdracer) 2 61.30 65.18 0 0.00
30770. Mcpizzaz (mcpizzaz) 2 67.66 69.58 0 0.00
30771. maya (mclo) 2 73.20 81.67 0 0.00
30772. Laurits (mclawrence) 2 90.25 94.98 0 0.00
30773. Zo (mckinnie6245) 2 47.13 49.33 0 0.00
30774. Moe (mbillah4797) 2 89.71 90.30 0 0.00
30775. mayarixx (mayarixx) 2 82.51 84.31 0 0.00
30776. Mark (max_2027_67) 2 80.68 81.15 1 50.00
30777. Max (maxkillas) 2 69.62 72.78 2 100.00
30778. maximo (maximoc04) 2 40.85 41.45 0 0.00
30779. Farhan (maximaximaxi) 2 78.35 80.62 0 0.00
30780. matyus (matyus) 2 81.63 81.76 0 0.00
30781. Matthew (matt_dj) 2 89.24 89.39 0 0.00
30782. matt (mattyyc) 2 84.28 86.58 1 50.00
30783. Matthew (mattpeles) 2 128.87 130.90 0 0.00
30784. Matthew (matt15151) 2 72.09 89.53 1 50.00
30785. Matija (matija564) 2 60.00 62.20 1 50.00
30786. matt (mathster09) 2 97.26 106.65 0 0.00
30787. Haydn (mathlobster) 2 96.48 97.28 0 0.00
30788. mathbook (mathbookpeace) 2 61.00 64.35 0 0.00
30789. . (matetea) 2 85.85 88.40 1 50.00
30790. Master (master_gossip) 2 56.79 58.82 0 0.00
30791. Sergi (maspi) 2 60.85 61.29 0 0.00
30792. marvelousman (marvelousman) 2 94.85 102.81 1 50.00
30793. Maru (maruuu) 2 96.29 100.53 0 0.00
30794. Martin (martin12249) 2 70.39 72.85 0 0.00
30795. A (martian098) 2 70.25 70.83 1 50.00
30796. Rajat (marklegan) 2 25.15 25.37 0 0.00
30797. Mark (markidak) 2 83.57 99.47 0 0.00
30798. Mark (markieisfast) 2 91.00 102.98 0 0.00
30799. Marius (mariusbucur) 2 115.15 119.76 2 100.00
30800. M (marinater) 2 70.02 73.39 1 50.00
30801. Marcus (marcuseon) 2 84.90 86.40 1 50.00
30802. Kristoffer (marcusaurelius99) 2 53.69 53.82 0 0.00
30803. Marc Owen (marcowen20) 2 92.78 95.89 0 0.00
30804. Marco (marcov641) 2 44.36 47.38 0 0.00
30805. Marcos (marcos100) 2 67.73 73.60 0 0.00
30806. Marcop (marcop_) 2 46.96 47.06 0 0.00
30807. Marcus (marcmadd15) 2 91.92 97.56 1 50.00
30808. Chutney 🏹 (marchtovalinor) 2 102.26 106.45 1 50.00
30809. Marathon (marath0ngaming) 2 125.58 137.87 2 100.00
30810. Manvir (manvir) 2 124.93 128.62 2 100.00
30811. Emmanuel (manye) 2 80.32 85.86 2 100.00
30812. Patrick (manualsearch) 2 95.77 96.58 1 50.00
30813. Anthony (mantipula) 2 118.91 120.00 0 0.00
30814. MANOJ Kumar (manoj_ku_rao) 2 27.78 31.62 0 0.00
30815. Manny (manny_rm) 2 115.17 138.62 1 50.00
30816. manikanta (manikanta35231) 2 46.95 48.58 0 0.00
30817. Alexis (mang_) 2 50.98 52.64 1 50.00
30818. gabriel (mangamole) 2 43.58 43.78 0 0.00
30819. Maks (maks244) 2 79.02 87.38 1 50.00
30820. Makküsu (makkusu) 2 40.23 42.61 1 50.00
30821. Michal (majklovich) 2 70.36 80.54 1 50.00
30822. Michael Antariksa (maikeru10) 2 49.62 53.84 0 0.00
30823. Mahmoud (mahmoud_elsaeed) 2 52.84 56.91 1 50.00
30824. Type (magicgos) 2 60.94 67.83 0 0.00
30825. Daniel (mage3214) 2 80.94 81.88 0 0.00
30826. ∞ (maely) 2 70.37 78.39 1 50.00
30827. Samuel (maduhbee) 2 95.10 110.47 1 50.00
30828. Mads (mads721i) 2 65.55 70.47 0 0.00
30829. Madi (madix00) 2 47.14 50.14 0 0.00
30830. Ronald (macaroonie) 2 109.64 110.05 1 50.00
30831. Jamie (mac785) 2 101.30 104.22 2 100.00
30832. Matthew (m9thew) 2 102.69 105.15 1 50.00
30833. Fentenal (m3ntality) 2 72.89 75.00 0 0.00
30834. Alex (m3hran80) 2 114.76 123.53 1 50.00
30835. Michael (m1cky82) 2 55.54 61.23 1 50.00
30836. Lydia (lydiag) 2 60.89 67.69 1 50.00
30837. Stammgast (lv_vl) 2 68.53 74.17 0 0.00
30838. lunarcoffee (lunarcoffee) 2 109.42 117.13 1 50.00
30839. Luna (lunamai) 2 147.77 174.55 2 100.00
30840. Dany (lunakar) 2 53.67 53.80 0 0.00
30841. Allyson (lumpylumplump) 2 89.17 91.82 1 50.00
30842. Louisa (lulu28) 2 67.65 71.13 1 50.00
30843. Lucas (luke210o) 2 38.85 40.61 0 0.00
30844. Lukáš (lukashanak) 2 80.35 83.21 2 100.00
30845. Luka (luka778) 2 26.37 26.58 0 0.00
30846. JJ (luddeus) 2 103.82 104.52 1 50.00
30847. Quacky Mac (lucky_ducky) 2 57.98 67.82 2 100.00
30848. l (luckymagex) 2 61.74 67.13 0 0.00
30849. Lucifer (lucifer97) 2 82.05 83.97 0 0.00
30850. I am dumb (lucas_number_1) 2 95.77 98.97 1 50.00
30851. River (lttriver) 2 57.37 58.71 0 0.00
30852. Lsteryoshi (lsteryoshi) 2 54.79 58.61 1 50.00
30853. Liam (lpare45) 2 29.85 33.18 1 50.00
30854. rani (lowersky) 2 91.03 92.78 1 50.00
30855. martin (lovestotype) 2 108.09 118.00 2 100.00
30856. eehoS (lovespacedreams) 2 84.30 86.11 0 0.00
30857. Louie (louise_shang) 2 64.44 65.30 0 0.00
30858. Charlie (losttaco) 2 83.05 87.81 0 0.00
30859. Brendan (lorsque) 2 88.96 90.56 1 50.00
30860. palash (loserindcoffice) 2 36.53 39.12 0 0.00
30861. lordsnivy209 (lordsnivy209) 2 50.38 53.93 0 0.00
30862. Kevin (lordofwreck) 2 69.24 71.75 0 0.00
30863. Johnny (lordquan) 2 94.29 100.37 0 0.00
30864. Andre (lordesupremo) 2 85.17 90.52 1 50.00
30865. ayyyyyy (loom2801) 2 53.81 57.77 0 0.00
30866. Miguel (long_legs_ahh) 2 42.66 43.51 0 0.00
30867. Lon (lonekawu) 2 44.14 45.26 2 100.00
30868. NaTsu879 (lonely_painter) 2 76.30 78.30 0 0.00
30869. Anna (lol_get_rekt_scrub) 2 70.51 72.78 1 50.00
30870. LolzLiamz (lolzliamz) 2 90.46 92.49 2 100.00
30871. Lolpikachu (lolpikachu45) 2 99.40 115.27 1 50.00
30872. LostIn (lol1sotkillboss) 2 40.30 41.37 0 0.00
30873. Curran (logbasepotato) 2 91.98 97.00 1 50.00
30874. Locky (lockygamer) 2 102.90 103.91 2 100.00
30875. Ayyyyyy (lmaoooooo) 2 101.73 109.44 0 0.00
30876. Quan (li_quan) 2 81.11 86.13 0 0.00
30877. Huân (lixboi) 2 63.76 64.89 0 0.00
30878. Amelia (littlebighaha) 2 134.43 136.80 2 100.00
30879. You (littlebabybear) 2 102.27 108.36 1 50.00
30880. Ryan (lionryan) 2 98.93 110.61 0 0.00
30881. lime (limelatte) 2 90.91 91.61 1 50.00
30882. Lili (lili640) 2 60.88 61.68 0 0.00
30883. Bao Han (lilhaan48) 2 45.82 46.71 2 100.00
30884. Elin (lileazi) 2 104.50 106.58 2 100.00
30885. lilbabygay_ (lilbabygay_) 2 42.65 43.32 0 0.00
30886. Enlightened (liku45) 2 73.29 78.61 0 0.00
30887. Nathan (light_mqueen) 2 74.83 89.68 1 50.00
30888. Carmelo (lightning_mctype) 2 73.61 80.40 1 50.00
30889. lightning (lightning_knight) 2 67.12 75.87 0 0.00
30890. Gavin (ligerblubber) 2 101.79 103.45 1 50.00
30891. Lidlidlid (lidlidlid) 2 92.71 93.37 0 0.00
30892. Kevin (lgloo) 2 83.35 87.56 1 50.00
30893. levi ackerman (leviackerman) 2 66.95 72.66 2 100.00
30894. tay (levelzero) 2 94.15 95.86 1 50.00
30895. LetsdothisEpic (letsdothise... 2 113.54 124.00 1 50.00
30896. Sophie (lesophie) 2 75.50 78.46 1 50.00
30897. Leonshekre (leonshekre) 2 106.26 110.19 1 50.00
30898. leo (leloukoz) 2 67.80 71.30 0 0.00
30899. Zohaib (leggoboyo) 2 96.54 108.14 2 100.00
30900. Nate (legendward) 2 75.07 79.96 1 50.00
30901. Andreas (legendmeadow) 2 118.87 119.85 1 50.00
30902. LeftHandedKatana (lefthande... 2 71.78 74.69 2 100.00
30903. Abby (leener999) 2 90.42 90.87 0 0.00
30904. Leeh (leeh2002) 2 111.94 116.12 1 50.00
30905. Akshiet (learningworm) 2 63.60 66.88 0 0.00
30906. Slice (learningcolmak2021) 2 68.02 69.11 0 0.00
30907. Leah (leah_bro) 2 72.83 76.34 0 0.00
30908. Leah (leahcarj) 2 53.35 59.67 0 0.00
30909. Jeff (lcrox) 2 72.01 73.29 1 50.00
30910. Logan (lcawesomepotato) 2 36.13 39.04 0 0.00
30911. Uku (lazzeri) 2 89.78 93.24 0 0.00
30912. GqvTypeRacer (lazer_25) 2 91.36 92.16 0 0.00
30913. Sofia (lazebrakmata) 2 62.15 64.70 0 0.00
30914. Jake (lawyer18) 2 79.57 91.44 0 0.00
30915. lav (lav01) 2 83.01 85.77 0 0.00
30916. laurens (laurensjvdb) 2 81.18 83.27 2 100.00
30917. Las (laspil) 2 47.62 48.18 2 100.00
30918. Joop (lapingvino) 2 73.09 82.98 0 0.00
30919. Nathan (lanza21) 2 108.32 121.37 0 0.00
30920. Steven (lander5) 2 117.51 129.95 1 50.00
30921. lame (lamellae) 2 87.84 93.96 0 0.00
30922. lakshmi (lakshmi__) 2 93.06 97.67 0 0.00
30923. lakshme 5ce (lakshme) 2 70.01 71.05 1 50.00
30924. Rauan (l1tos) 2 32.40 34.92 0 0.00
30925. Liz (l1gh73r) 2 88.00 92.22 2 100.00
30926. Kai (kzhou6) 2 98.87 112.53 2 100.00
30927. Yacine (kzeran) 2 69.32 72.76 1 50.00
30928. kyo (kyosenpie321) 2 72.95 77.25 1 50.00
30929. kylotastic (kylotastic) 2 102.84 104.09 0 0.00
30930. Kyle (kyle_racer) 2 90.37 97.25 1 50.00
30931. Kristin (kweeston) 2 84.26 93.51 2 100.00
30932. kman (kwangyel) 2 63.89 68.19 0 0.00
30933. Kuzel (kuzel) 2 122.68 124.30 2 100.00
30934. Kusainov (kusainov2005) 2 57.08 57.95 0 0.00
30935. Kuruto (kurut0) 2 64.45 69.79 2 100.00
30936. Kurtel (kurtel) 2 88.96 91.31 1 50.00
30937. Ken (kupperu) 2 94.67 96.99 0 0.00
30938. D.k. (kumardeep22) 2 76.76 80.27 0 0.00
30939. Fitz (kulaizki) 2 82.59 93.58 2 100.00
30940. Addiv (kuge) 2 66.10 67.25 1 50.00
30941. Emil (kuddsson69) 2 37.26 37.36 0 0.00
30942. Simon Kubica (kubica) 2 121.78 127.33 1 50.00
30943. Mark (kubfu891) 2 92.03 99.22 0 0.00
30944. Kyle (kthom925) 2 105.79 114.11 1 50.00
30945. Kyle (kstrozin) 2 90.91 104.07 1 50.00
30946. Colby (kronkler) 2 100.03 101.00 0 0.00
30947. Kelsey (krognicle) 2 77.03 84.23 0 0.00
30948. Uncle Jim (krispysox) 2 85.00 93.03 0 0.00
30949. krispycreme2012 (krispykrem... 2 47.89 50.15 0 0.00
30950. txxs (kriiue) 2 89.53 93.76 2 100.00
30951. Brian (krayons) 2 101.03 104.08 1 50.00
30952. Kraust (kraust) 2 92.32 94.23 1 50.00
30953. Karisma (kputera) 2 79.06 86.03 1 50.00
30954. jenny (kosyourmother) 2 61.86 72.99 1 50.00
30955. Thomas (koreo) 2 95.91 101.40 2 100.00
30956. Koren794 (koren794) 2 31.14 32.98 0 0.00
30957. Michael (koreanpower912) 2 95.95 96.87 1 50.00
30958. Kopatz (kopatz) 2 69.11 69.75 0 0.00
30959. Kasim (kontromusic) 2 91.37 94.12 2 100.00
30960. Kommy (kommy_boo) 2 81.49 83.08 1 50.00
30961. Kolsty (kolsty) 2 94.37 98.84 1 50.00
30962. KoD (kodz) 2 80.30 85.93 0 0.00
30963. Kobe (kobefireball) 2 80.04 80.43 0 0.00
30964. Casper (knugus) 2 71.60 72.62 1 50.00
30965. k̷̓͋̈́̒͗͋̅͌̄̈́͆̉... 2 77.88 79.48 0 0.00
30966. knives (knives1117) 2 63.39 67.08 0 0.00
30967. Megu (knightninja436) 2 98.32 99.21 1 50.00
30968. kmurbi23 (kmurbi23) 2 94.58 100.12 0 0.00
30969. Karina (kmontellano) 2 63.09 70.70 0 0.00
30970. keyjulll (klutuk) 2 43.86 49.37 0 0.00
30971. Klice (klice) 2 65.93 77.07 0 0.00
30972. dany (klaviier) 2 52.45 52.97 0 0.00
30973. kkwong (kkwong2003) 2 81.55 90.82 0 0.00
30974. taffy (kkristof97) 2 73.73 75.13 1 50.00
30975. Kimber (kjmlink) 2 87.16 94.09 0 0.00
30976. Kirua (kirua99) 2 97.10 103.85 1 50.00
30977. kinwaki (kinwaki) 2 112.70 116.21 1 50.00
30978. Kevin (kinqkevinn) 2 99.85 100.01 1 50.00
30979. Vincentius (kinikiz) 2 89.53 96.01 2 100.00
30980. King (king_gamesbr) 2 100.56 106.45 2 100.00
30981. King (king_amongthepigs) 2 90.58 92.82 1 50.00
30982. S (kingofthenerdz3) 2 61.46 68.33 1 50.00
30983. teeradon (kimcahill) 2 46.82 50.34 0 0.00
30984. Philip (killfilipok) 2 53.27 53.83 0 0.00
30985. Birdo (killersiete) 2 99.71 100.30 2 100.00
30986. Brandon (killercucumber) 2 135.24 139.17 1 50.00
30987. Kiet (kiethuynh) 2 85.50 85.76 1 50.00
30988. Kieron (kierdee) 2 56.90 60.60 0 0.00
30989. Jacob (kick0003) 2 49.07 49.93 0 0.00
30990. Kia (kiabin) 2 81.77 86.09 2 100.00
30991. Weenis (khojayongdoja) 2 68.87 73.69 0 0.00
30992. Khin (khin101) 2 103.31 106.43 2 100.00
30993. khaled (khaledmuhammad) 2 47.54 49.90 1 50.00
30994. Kevin (kgonzales2319) 2 77.77 79.26 1 50.00
30995. Keyborn (keyborn) 2 92.40 93.24 0 0.00
30996. Justin (keyboard_experience) 2 65.06 69.69 0 0.00
30997. Kev (kevwins) 2 71.40 72.73 1 50.00
30998. Kevin (kevng2) 2 90.40 90.50 1 50.00
30999. sub2 (kevlu8) 2 104.41 108.70 1 50.00
31000. Kevin (kevin_moses) 2 65.41 67.27 1 50.00
31001. TakeASui (kevinsui) 2 105.65 115.16 2 100.00
31002. Ketan (ketan_p01) 2 63.70 65.77 0 0.00
31003. Keshav (keshavisdabeast) 2 84.43 89.51 0 0.00
31004. Nathan (kenshido) 2 88.84 93.68 1 50.00
31005. kennzo (kennzo_homme) 2 79.12 86.92 1 50.00
31006. Chrys (kenielf) 2 106.12 112.58 1 50.00
31007. Kenan (kenan_) 2 83.81 84.73 0 0.00
31008. kelvin (kelvin1712) 2 69.16 76.72 0 0.00
31009. keira g (keiragg) 2 59.25 64.37 1 50.00
31010. Keenan (keenanhardy) 2 73.92 77.33 0 0.00
31011. Mohamad (kda_yamo) 2 54.05 56.77 0 0.00
31012. tehfatpanduh (kb47) 2 111.47 121.35 1 50.00
31013. Kazef (kazsuz) 2 80.56 91.73 0 0.00
31014. Kaushik (kaushikdontula) 2 56.12 61.28 2 100.00
31015. Katrina (katrina07) 2 39.13 41.20 0 0.00
31016. Kartoonpanda (kartoonpanda) 2 93.94 95.95 2 100.00
31017. Juoshi (karen_ju) 2 36.21 39.67 0 0.00
31018. kasper (kapser1) 2 106.47 113.38 0 0.00
31019. Kandinsky (kandinskie) 2 56.03 66.19 0 0.00
31020. Kanawat (kanawatt) 2 57.85 64.22 0 0.00
31021. Jason (kamesstory) 2 93.43 95.54 1 50.00
31022. kalxed_mac (kalxed_mac) 2 83.04 85.62 0 0.00
31023. Cayla (kalepark) 2 92.97 93.71 1 50.00
31024. Kaibar (kaibar) 2 76.21 104.41 1 50.00
31025. Kaholaz (kaholaz) 2 53.61 55.26 0 0.00
31026. Leon (kahelleon) 2 90.14 100.84 1 50.00
31027. Kaebin (kaebin) 2 84.19 133.79 1 50.00
31028. Kadz (kadzz) 2 73.36 77.89 0 0.00
31029. Ruben (k3y5) 2 47.55 51.63 0 0.00
31030. Julian (k1ngjulien) 2 69.32 69.57 0 0.00
31031. Bobert (k14robrad) 2 94.27 97.41 0 0.00
31032. .-. (jyuawago) 2 56.96 58.24 0 0.00
31033. Josh (jwill323) 2 66.98 68.05 0 0.00
31034. jurek (jvrvk) 2 49.73 53.77 0 0.00
31035. jeff (jvaliente) 2 50.51 57.27 1 50.00
31036. Julius (juuls_dvorak) 2 31.30 33.30 0 0.00
31037. Sidharth (just_like_you) 2 43.53 44.71 0 0.00
31038. Justin (justinsavino) 2 70.65 74.35 2 100.00
31039. Iveee (junmoon_) 2 41.71 46.45 0 0.00
31040. Julo (julo56) 2 42.29 44.81 1 50.00
31041. Jake (jujypop) 2 88.89 89.69 0 0.00
31042. Izzy B) (juicyfruit101) 2 36.21 36.87 0 0.00
31043. Alice (juicy0250) 2 52.99 53.01 1 50.00
31044. . (judger_) 2 128.85 135.34 2 100.00
31045. Jude (judead05) 2 85.15 93.78 1 50.00
31046. [jtucci] (jtucci) 2 94.62 103.53 1 50.00
31047. Jack (jtchen0528) 2 58.74 63.99 1 50.00
31048. jar jar binks (jrong97) 2 102.43 111.70 0 0.00
31049. Patrick (jpporter) 2 73.48 75.45 0 0.00
31050. Patrick (jppat) 2 79.00 86.75 0 0.00
31051. JP (jpdb) 2 51.29 55.35 0 0.00
31052. Jozef (jozef.gloncak@gmail.... 2 68.83 72.15 0 0.00
31053. Josh (joshsd) 2 111.24 115.00 2 100.00
31054. Joshua (josheevee) 2 79.08 82.24 0 0.00
31055. Josh (joshbochuan2020) 2 81.55 82.32 2 100.00
31056. Joseph (josephmestas) 2 48.67 57.71 1 50.00
31057. Jorja (jorja_o) 2 29.24 31.48 0 0.00
31058. Jorge (jorge_owo) 2 64.51 69.14 1 50.00
31059. Jordan (jordank17) 2 54.54 57.66 0 0.00
31060. Jordan (jordanguyen1) 2 82.50 82.69 2 100.00
31061. jordan (jordanaavery) 2 79.02 80.25 1 50.00
31062. Djalla (jonkoos) 2 56.53 61.74 0 0.00
31063. Jon (jonjcp) 2 87.04 99.48 1 50.00
31064. Jonathan (joniln) 2 46.38 48.76 1 50.00
31065. Joni (jonijohn) 2 108.62 114.40 2 100.00
31066. Joko (jokondo) 2 35.34 37.07 0 0.00
31067. Jonas (jokoko) 2 75.36 85.89 0 0.00
31068. Jakob (joker_ha) 2 39.34 40.70 0 0.00
31069. joker (joker72426) 2 39.43 41.38 0 0.00
31070. John (johnratchet3) 2 121.49 127.23 0 0.00
31071. sheeshsheesh (johnnyboi321) 2 113.72 116.40 1 50.00
31072. johnn2 (johnn2) 2 113.58 114.57 2 100.00
31073. John (johnmonday) 2 124.38 126.48 1 50.00
31074. Joe (joe_kazama) 2 59.69 62.18 1 50.00
31075. Joe (joeyang1962) 2 107.05 110.96 0 0.00
31076. Type (joex1011) 2 127.69 134.24 1 50.00
31077. lucas (joemama3) 2 88.65 96.96 0 0.00
31078. tstats[joelscao] (joelscao) 2 64.29 69.67 0 0.00
31079. Joel (joelhanson) 2 43.72 44.59 1 50.00
31080. Joel (joel5534) 2 95.97 101.70 1 50.00
31081. joe (joebuscus) 2 51.49 52.83 0 0.00
31082. Joao (joaofonst) 2 71.76 74.72 2 100.00
31083. Jojopup123 (joanne225) 2 81.36 90.36 0 0.00
31084. Rappe (jnr352) 2 40.75 42.22 0 0.00
31085. Jack (jman777) 2 115.22 119.12 1 50.00
31086. jluebay (jluebay) 2 58.03 59.36 0 0.00
31087. Jacob (jlucibello) 2 59.82 63.58 1 50.00
31088. JLocked (jlocked333) 2 96.75 99.71 1 50.00
31089. Chico (jlkuio) 2 64.86 66.96 1 50.00
31090. Jackson (jks0810) 2 115.14 135.70 1 50.00
31091. J (jklp69) 2 42.67 45.93 0 0.00
31092. Jonas (jjonnaas) 2 79.31 80.44 1 50.00
31093. search jiyun-pro.github.io/... 2 52.05 52.14 1 50.00
31094. Jitesh (jitesh117) 2 70.97 71.70 0 0.00
31095. jinye (jinye) 2 45.73 47.15 0 0.00
31096. Jinho (jinh0) 2 136.53 143.23 1 50.00
31097. Ben (jingler) 2 76.59 79.40 1 50.00
31098. Jimmy Nguyen (jimmytypes) 2 80.57 84.46 0 0.00
31099. Jared (jigglyj) 2 76.62 83.60 0 0.00
31100. Lil🔥💯 (jifhacks) 2 86.94 87.88 2 100.00
31101. Jiaying (jiaying) 2 93.29 93.31 0 0.00
31102. Stefan (jhus) 2 72.99 74.04 2 100.00
31103. Jeremiah (jhmyint) 2 91.73 92.05 1 50.00
31104. Aidan (jfsport) 2 80.84 84.00 0 0.00
31105. Bob (jeusushimself) 2 131.34 141.96 0 0.00
31106. JetroCuber (jetrocuber) 2 85.14 88.15 2 100.00
31107. Denton (jetray122) 2 81.08 82.82 1 50.00
31108. Jessveness (jessiveness) 2 147.27 154.89 2 100.00
31109. mcqueen (jeremyyeh) 2 95.53 105.92 0 0.00
31110. James (jepk67) 2 98.99 106.75 1 50.00
31111. jelly (jelsyfish) 2 53.90 55.83 0 0.00
31112. Josh (jellyjosh) 2 104.32 112.36 2 100.00
31113. George (jejopa) 2 41.34 43.49 0 0.00
31114. Jeff (jeff_howson) 2 116.22 126.03 1 50.00
31115. Jeffrey (jeffro1230) 2 117.02 124.82 2 100.00
31116. AM (je11ow) 2 71.89 86.72 0 0.00
31117. J (jcob123) 2 124.96 126.68 1 50.00
31118. Jason (jbourget87) 2 114.00 117.53 0 0.00
31119. Jaysson (jayyssaahn) 2 52.17 57.81 1 50.00
31120. jay (jayyelle) 2 62.88 70.29 0 0.00
31121. Jack (jayjaywatson) 2 94.06 98.61 1 50.00
31122. Jay (jayhuang123) 2 112.74 124.82 1 50.00
31123. Jaydotsun (jaydotsun) 2 83.42 84.27 0 0.00
31124. Jake (jaydez) 2 103.03 104.05 1 50.00
31125. Charles (jawlz) 2 129.27 133.73 1 50.00
31126. javiaa._ (javier_typeracer) 2 72.09 83.20 1 50.00
31127. Javago (javago) 2 67.90 71.34 1 50.00
31128. Mark (javacodeguy) 2 90.96 110.50 1 50.00
31129. Jasper (jasper_bee) 2 100.20 107.57 0 0.00
31130. Jason (jasoone) 2 113.67 119.77 1 50.00
31131. Jason (jason314) 2 90.48 93.83 1 50.00
31132. Jarco (jarcokers2) 2 106.16 108.11 0 0.00
31133. Jan (jantajov) 2 63.76 67.83 1 50.00
31134. Jenna (janengai123) 2 107.01 117.91 2 100.00
31135. James (jamesyeer) 2 83.91 87.31 0 0.00
31136. Ruben (jamessmplayer) 2 73.95 74.60 0 0.00
31137. Jameson (jamesonnizo) 2 70.73 74.08 0 0.00
31138. Alex (jalexwhitman) 2 98.33 104.41 1 50.00
31139. izzat (jakkjubiss) 2 76.87 82.11 0 0.00
31140. Jake (jake2005) 2 49.92 56.53 0 0.00
31141. kintsukuroi (jae_san) 2 133.66 138.96 1 50.00
31142. Jacob (jacobtpl) 2 95.91 98.16 0 0.00
31143. Jackson (jacksonks) 2 75.54 95.74 2 100.00
31144. Jackojacblacco (jackojablacco) 2 68.85 76.66 1 50.00
31145. kcaj (jackaylward) 2 41.72 43.05 0 0.00
31146. Jack (jack2711) 2 43.15 43.83 0 0.00
31147. Jack (jaciepierdole) 2 84.28 86.79 0 0.00
31148. Ivan (i_bantam) 2 37.95 38.34 0 0.00
31149. Isaac (iy4717) 2 109.40 109.79 0 0.00
31150. Iwo (iwoo) 2 73.07 77.17 0 0.00
31151. Dennis (iwantahug) 2 47.94 48.32 0 0.00
31152. Ivan (ivan_liang51) 2 108.50 116.38 1 50.00
31153. Iván (ivansitopart) 2 69.82 75.34 0 0.00
31154. Tyler (itztylrrtv) 2 93.16 95.71 2 100.00
31155. ItsMega (itzmega) 2 85.01 90.21 2 100.00
31156. Rick (itzgamedude) 2 98.61 98.70 1 50.00
31157. Crumb (itzcrisp_xd_yt) 2 34.28 39.04 2 100.00
31158. Pratyush (its_praty) 2 36.83 39.72 0 0.00
31159. Bahaa (its_bahaa_aea) 2 88.59 89.96 0 0.00
31160. Quinn (itsquinnmydudes) 2 99.76 107.42 2 100.00
31161. wi (itsjeho65) 2 60.76 62.81 0 0.00
31162. Ash (itsash) 2 58.73 65.96 0 0.00
31163. flo (itbeflo) 2 69.89 72.78 1 50.00
31164. ISuck (isuckettyping) 2 54.35 54.44 1 50.00
31165. Ricky (istartyper) 2 97.55 98.79 1 50.00
31166. iSchrye (ischrye) 2 74.23 80.93 1 50.00
31167. Isaah (isaahtan_21) 2 86.93 91.72 2 100.00
31168. isaacyoshimario (isaacyoshi... 2 119.86 125.58 2 100.00
31169. Isabela (isa05910) 2 69.50 76.47 0 0.00
31170. Andrew (irvie) 2 110.82 121.20 0 0.00
31171. David (irrelevantging) 2 104.62 110.58 2 100.00
31172. ㅤ (irlgoob) 2 146.79 155.93 2 100.00
31173. Irene (ireneprk) 2 91.88 92.46 2 100.00
31174. Musavi (iqbalmusavi) 2 34.48 38.47 0 0.00
31175. ipawan (ipawan) 2 67.22 69.89 1 50.00
31176. VijayaKumar (intvijay) 2 62.20 63.39 1 50.00
31177. Inter (intercash) 2 31.34 31.69 0 0.00
31178. Doge (inteldoge) 2 128.61 135.36 2 100.00
31179. Asdfg (inosol) 2 65.93 68.07 0 0.00
31180. Infinity (infinity15) 2 61.58 68.23 0 0.00
31181. Person (ineedagoodname) 2 74.21 76.33 0 0.00
31182. InDosaN (indosan) 2 67.54 69.37 0 0.00
31183. indomitable1 (indomitable1) 2 69.22 74.05 0 0.00
31184. framespersecond (indires) 2 99.33 110.21 1 50.00
31185. X (inclassstudent) 2 74.68 79.46 0 0.00
31186. Eggman (im_eggman) 2 68.15 73.17 0 0.00
31187. ISuckAtTyperacer (im_bad_at... 2 127.75 130.76 1 50.00
31188. ImSmarterOnWo_rdBomb (imsma... 2 70.33 78.54 1 50.00
31189. Logan (imoshie) 2 60.42 60.64 0 0.00
31190. TypeMaster! (imma_typing_ma... 2 36.89 40.14 0 0.00
31191. Lukas (imfluf) 2 76.68 84.46 1 50.00
31192. timoteo (imfastafboi9) 2 52.90 54.87 1 50.00
31193. Joji (imaprettyboy) 2 72.20 73.93 1 50.00
31194. Imaan (imaan_m) 2 59.98 70.86 0 0.00
31195. ILoveFelix (ilovefelix) 2 71.71 74.89 0 0.00
31196. damon (illbenascar) 2 74.20 76.31 0 0.00
31197. Ilikeracing (ilikeracing) 2 76.86 99.43 0 0.00
31198. Igor (ikrz) 2 47.11 48.01 1 50.00
31199. ikjoshh (ikjoshh) 2 161.31 173.89 2 100.00
31200. bourque (iketype) 2 119.56 126.61 1 50.00
31201. Ike (ike2001) 2 51.49 52.17 1 50.00
31202. ig : ikalzabrah (ikaoktav1697) 2 40.09 40.12 0 0.00
31203. IgrYphon (igryphon) 2 91.84 95.69 1 50.00
31204. iGodShark (igodshark) 2 101.39 102.23 2 100.00
31205. iget30wpm (iget30wpm) 2 98.64 110.23 1 50.00
31206. Genie (igenie) 2 54.66 55.02 0 0.00
31207. Igel (igelwithdeagle) 2 81.50 81.74 1 50.00
31208. a (ierfth) 2 95.72 98.39 1 50.00
31209. serdna (idfwpercs) 2 87.98 90.26 2 100.00
31210. iCursedReaper (icursedreaper) 2 87.51 105.27 1 50.00
31211. Joe (icorion) 2 70.77 76.56 0 0.00
31212. Ice794 (ice_794) 2 49.18 54.40 0 0.00
31213. Scott (icerune) 2 103.13 111.07 1 50.00
31214. Naravich (icekang) 2 60.78 62.72 0 0.00
31215. dakota (iceey) 2 82.78 83.27 1 50.00
31216. Dakota (iccerus) 2 81.95 84.46 0 0.00
31217. ib (ibvenus) 2 53.77 58.39 0 0.00
31218. Kumar (iarrive) 2 60.41 62.45 0 0.00
31219. iarezen (iarezen) 2 91.21 93.06 0 0.00
31220. Irfan (iamtester4) 2 74.53 77.08 1 50.00
31221. Tim (iamsmooth) 2 94.36 106.79 0 0.00
31222. Moin (iamrjrobin) 2 47.02 48.88 0 0.00
31223. Chiemeka (iamlordaubrey) 2 79.47 83.37 0 0.00
31224. Hytres (hytres) 2 75.95 79.94 1 50.00
31225. Nurislam (hypuclam) 2 79.69 83.88 1 50.00
31226. ryo (hyperu) 2 49.12 50.16 0 0.00
31227. Kyle (hyperionkyle89) 2 68.74 69.95 1 50.00
31228. big (hyperdoggo) 2 110.44 117.77 0 0.00
31229. Ham (hwu164) 2 75.14 75.69 0 0.00
31230. Huts (huts1) 2 97.92 101.82 2 100.00
31231. Jacob (hushdog) 2 68.54 69.49 0 0.00
31232. Husam (husam_) 2 79.55 82.58 1 50.00
31233. Key (hus9) 2 103.32 110.45 0 0.00
31234. Samuel Hong (hunterx30s) 2 77.32 78.18 0 0.00
31235. Shanna (hungrypotato) 2 65.82 69.85 0 0.00
31236. Hungb (hungb) 2 71.56 72.90 0 0.00
31237. Humphrey (humfurie) 2 82.11 83.46 1 50.00
31238. hsa (hsa_) 2 83.57 95.81 1 50.00
31239. Leonardo (hreppy) 2 146.46 160.04 2 100.00
31240. Hans-Peter (hpgurke69) 2 98.12 101.78 2 100.00
31241. Howard (howien) 2 86.29 91.03 0 0.00
31242. Sophia (hotococoa) 2 114.96 129.51 0 0.00
31243. ep1c (hololiveweeb24) 2 83.17 86.04 2 100.00
31244. Ethan (hoid) 2 91.56 92.54 1 50.00
31245. Haoming (hm_002) 2 92.77 97.03 1 50.00
31246. lerning (hmtusher) 2 68.89 69.00 1 50.00
31247. Murilo (hitmonrillo) 2 81.08 85.32 0 0.00
31248. Hitarth (hitarthk) 2 43.85 48.89 0 0.00
31249. Samui (hisself) 2 60.62 98.48 1 50.00
31250. Xavier (hillary4jail16) 2 50.54 52.09 0 0.00
31251. Hik (hikjik) 2 100.51 105.94 1 50.00
31252. kitty (hiimakitty) 2 142.51 145.56 2 100.00
31253. Highwire (highwire) 2 85.92 91.94 0 0.00
31254. Jacob (highlift) 2 89.66 95.83 1 50.00
31255. Hidispenser (hidispenser) 2 65.91 78.06 0 0.00
31256. Ben (heyyoubenji) 2 73.03 73.09 0 0.00
31257. Heyuan (heyuan) 2 76.16 78.41 1 50.00
31258. Gergo (hexa_ik) 2 49.25 52.30 0 0.00
31259. a (herecomedatb0i) 2 110.05 116.60 1 50.00
31260. henry11hei (henry11hei) 2 77.80 83.12 1 50.00
31261. Henok (henokb) 2 61.52 68.89 0 0.00
31262. HellDen (hell_den17) 2 73.59 76.97 1 50.00
31263. Hello2u (hellotwou) 2 40.66 41.51 1 50.00
31264. Daniel (hellgrown) 2 73.50 80.08 1 50.00
31265. Helder (helder_98) 2 41.71 42.24 1 50.00
31266. taco (hehehetacos) 2 87.53 87.54 1 50.00
31267. Hegsy24 (hegsy24) 2 41.85 42.77 0 0.00
31268. Joshua (hegemony_cricket) 2 53.73 56.46 0 0.00
31269. HecTiic (hectiicow) 2 110.68 116.45 1 50.00
31270. yak (hecticyak) 2 80.67 90.34 1 50.00
31271. Hector (hectic131) 2 71.55 73.35 1 50.00
31272. Andrei (headpats) 2 97.02 98.21 0 0.00
31273. HDoll (hdoll) 2 85.77 97.36 2 100.00
31274. Weber (hcehce419) 2 103.23 103.94 2 100.00
31275. Haikal (haykalsaliba) 2 76.48 78.66 1 50.00
31276. RA (hayhayhay111) 2 82.13 86.93 0 0.00
31277. Sahol (hawk_eyee) 2 58.49 61.80 0 0.00
31278. Chauncey (hauncey) 2 101.25 102.02 2 100.00
31279. haugust (haugust) 2 44.93 47.50 0 0.00
31280. hat (hatensemble) 2 103.01 109.57 1 50.00
31281. Rei (hashi_datura) 2 50.56 50.96 0 0.00
31282. Harry (harry_b0ss) 2 115.76 118.64 1 50.00
31283. Harry (harrygoatleaf) 2 72.74 79.58 1 50.00
31284. Harry (harnea) 2 75.98 81.29 1 50.00
31285. Harm (harmdebeuker) 2 94.50 97.63 1 50.00
31286. The (harit111200) 2 91.27 98.34 1 50.00
31287. HardeQ (hardeq) 2 93.74 100.70 2 100.00
31288. ... (hardadriano1) 2 74.70 75.52 0 0.00
31289. HanPlox (hanplox) 2 79.42 85.55 1 50.00
31290. Vincent (hanley51) 2 68.57 74.15 1 50.00
31291. YJ (hanguoren) 2 115.05 123.37 2 100.00
31292. handroid (handroid) 2 41.08 41.20 1 50.00
31293. HallMaster007 (hallmaster007) 2 76.74 79.67 1 50.00
31294. halfwet (halfwet) 2 100.91 102.52 2 100.00
31295. Luke (hakked) 2 97.06 109.53 1 50.00
31296. Hailey (haileyuwu) 2 52.53 57.63 0 0.00
31297. Haikuno (haikuno) 2 109.21 110.82 1 50.00
31298. Pein (haha8065) 2 118.02 120.31 1 50.00
31299. Zack (hackyzack17) 2 72.51 92.71 0 0.00
31300. Kuba (hackplack) 2 92.13 92.45 0 0.00
31301. Z (hackerpro) 2 67.71 72.08 0 0.00
31302. habhibhi (habhibhi) 2 119.99 131.08 2 100.00
31303. Harold (haac96) 2 66.60 67.44 1 50.00
31304. Kawaguchi (h7karu) 2 96.33 97.07 0 0.00
31305. gwubb (gwubb) 2 58.60 66.14 0 0.00
31306. GuzaSama (guzasama) 2 75.12 89.24 1 50.00
31307. Gustavo (gustavoythp) 2 39.24 40.76 0 0.00
31308. sn (gunshp) 2 83.29 84.79 0 0.00
31309. Trenten (guitars12) 2 109.14 115.43 2 100.00
31310. Guestwith9 (guestwith9) 2 62.03 65.71 0 0.00
31311. gubbagooba (gubbagooba) 2 91.92 93.55 0 0.00
31312. Alvex (gr_alvex) 2 93.46 104.31 1 50.00
31313. Matthew (gruzzlybear) 2 113.25 120.90 2 100.00
31314. Gri0s (grios) 2 57.20 60.61 2 100.00
31315. samuel (grimtale) 2 56.75 59.74 0 0.00
31316. Grigor (grigor) 2 93.23 95.85 2 100.00
31317. Griff (griffhero8) 2 65.45 68.99 0 0.00
31318. Grenien (grenien) 2 55.29 55.51 0 0.00
31319. gremory29 (gremory29) 2 57.33 64.71 2 100.00
31320. Andrew (greenhoodiee) 2 58.79 63.21 0 0.00
31321. Gregory (great_yarn) 2 70.56 73.24 2 100.00
31322. dane (gratedane) 2 104.58 105.52 2 100.00
31323. Graf (graf) 2 142.04 145.79 0 0.00
31324. Just (gr33nk3ys) 2 94.21 100.50 2 100.00
31325. Gozie (gozie_) 2 65.19 72.44 1 50.00
31326. bob (gongster) 2 101.01 114.57 2 100.00
31327. Jon (goneoffbread) 2 50.15 55.01 0 0.00
31328. Peter (gompose) 2 71.72 79.20 0 0.00
31329. Gomelx (gomelx) 2 46.18 47.93 0 0.00
31330. robin (golden_eggs) 2 58.77 61.08 0 0.00
31331. Dominik (goldenboi) 2 67.67 68.12 0 0.00
31332. Yoshi (gogurtpie) 2 109.83 114.02 1 50.00
31333. Chris (godocho) 2 78.69 80.11 0 0.00
31334. Chad (godchad) 2 92.08 98.88 0 0.00
31335. Goat (goatjohnson) 2 120.22 121.60 1 50.00
31336. Pepijn (goatism) 2 116.46 118.84 0 0.00
31337. Gnetyx (gnetyx) 2 96.86 100.96 1 50.00
31338. Zy (gmzydra) 2 108.54 111.55 1 50.00
31339. gavin (gmann655) 2 76.02 79.60 0 0.00
31340. Griffin (glkannberg) 2 84.02 86.60 2 100.00
31341. tstats[glebby] (glebby) 2 112.09 124.61 1 50.00
31342. glaucomer (glaucomer) 2 100.94 104.64 1 50.00
31343. Endi (glados909) 2 79.84 85.89 2 100.00
31344. David (gitgudfast) 2 93.23 95.15 0 0.00
31345. Mads (gismodyret) 2 108.34 112.60 0 0.00
31346. Xin (giorgi1123) 2 102.35 106.88 0 0.00
31347. My fingers are so damn fat ... 2 46.09 46.32 0 0.00
31348. Whitley (gingersnack) 2 134.83 148.82 2 100.00
31349. ginger (gingercat) 2 65.32 73.40 0 0.00
31350. Gilwen (gilwenmountain) 2 80.99 94.11 2 100.00
31351. ZT (gilborne) 2 69.00 70.11 1 50.00
31352. Ghxsty (ghxsty) 2 53.47 59.13 0 0.00
31353. Gh0sterino (gh0sterino) 2 126.85 135.75 2 100.00
31354. Izy (ggizy) 2 93.27 94.35 0 0.00
31355. Marcis (ggirt) 2 48.85 49.74 0 0.00
31356. Griff (gfargo) 2 76.49 79.36 1 50.00
31357. Gett (gettnumbers) 2 100.04 101.60 1 50.00
31358. R (get0ut0fmywaay) 2 83.78 90.02 0 0.00
31359. George (georgeracer1) 2 119.23 120.89 1 50.00
31360. George (geoioanid) 2 93.18 99.94 1 50.00
31361. geo (geogeo120) 2 59.68 61.19 0 0.00
31362. Nathan (gengeza) 2 59.54 60.34 1 50.00
31363. gauraav (genesisck9) 2 63.06 63.45 1 50.00
31364. Rj (generalrj) 2 65.29 65.67 0 0.00
31365. Charlie (generalfich) 2 115.09 118.02 2 100.00
31366. GedSVK (gedsvk) 2 78.87 87.63 2 100.00
31367. gchenstephen (gchenstephen) 2 92.40 109.64 1 50.00
31368. Miles (gazza111) 2 48.85 53.26 1 50.00
31369. Gary (garybryan) 2 106.38 107.30 1 50.00
31370. Tony (garutoh) 2 62.95 72.46 1 50.00
31371. Garet (garet) 2 67.72 72.13 0 0.00
31372. garagdon (garagdon) 2 94.00 98.18 1 50.00
31373. Manuel (ganilson) 2 48.48 49.74 0 0.00
31374. gaming4fun67 (gaming4fun67) 2 50.50 52.55 0 0.00
31375. Pratik (gamerpratik) 2 32.37 33.19 0 0.00
31376. Tom (gameling) 2 51.62 52.65 1 50.00
31377. Gal (galtzi1910) 2 75.97 76.03 1 50.00
31378. Bob (galacticwolf7) 2 99.82 106.90 1 50.00
31379. Gagandeep (gaggising) 2 38.62 42.07 0 0.00
31380. MellowSky (gadeleon) 2 72.34 78.86 1 50.00
31381. Gabriely (gabrielyzz) 2 86.28 99.21 1 50.00
31382. Gabe (gabrielvelarde) 2 76.27 79.21 0 0.00
31383. Gabriel (gabrielsqw) 2 96.23 97.52 2 100.00
31384. Gabriel (gabrielfear) 2 99.51 103.84 1 50.00
31385. Matt Gabriel (gaboooooo) 2 43.81 47.12 0 0.00
31386. Gabish (gabish01) 2 49.19 51.14 1 50.00
31387. Yujiro (f_zzy) 2 67.21 70.25 0 0.00
31388. Maksym (f_w_c) 2 53.35 54.30 1 50.00
31389. Rance (fxnc) 2 96.38 105.00 1 50.00
31390. Fudge (furdge) 2 110.25 112.42 2 100.00
31391. Leo (funnicat) 2 62.07 70.16 2 100.00
31392. No (funky_wins) 2 97.51 98.27 1 50.00
31393. Retro (fullretro) 2 115.64 123.26 2 100.00
31394. tstats[fty1777] (fty1777) 2 73.61 77.90 0 0.00
31395. Danny (ftm3) 2 90.55 93.56 2 100.00
31396. frank (ftguo) 2 126.20 128.31 2 100.00
31397. Hampton (frozeninthesnow) 2 82.86 84.24 0 0.00
31398. Ari Rez (frizzledizzle) 2 42.52 42.53 0 0.00
31399. Fritty (fritty) 2 69.57 69.64 0 0.00
31400. David (frilless) 2 79.55 86.94 0 0.00
31401. Reigen (freebies25) 2 98.40 102.37 2 100.00
31402. Fredrik (fredrikvorpenes) 2 71.64 80.13 0 0.00
31403. FredPerr (fredperr) 2 95.70 98.66 2 100.00
31404. Hebes (freaken_chicken) 2 68.31 71.46 0 0.00
31405. moshi (frcmjr) 2 34.30 39.57 0 0.00
31406. franiel (franiel97) 2 99.97 108.97 0 0.00
31407. Francesco (francesco_vergol... 2 74.85 75.62 0 0.00
31408. fishy (foshe) 2 127.84 130.55 1 50.00
31409. Zack (ford_festiva) 2 85.59 92.00 0 0.00
31410. Daniel (fodderotter) 2 89.06 94.63 0 0.00
31411. fmailscammer (fmailscammer) 2 112.43 123.31 1 50.00
31412. Frazier (fmacdonald) 2 58.40 60.24 0 0.00
31413. Jacob (flyingducky101) 2 97.06 100.62 0 0.00
31414. Daquavian (flygoat) 2 135.33 148.03 2 100.00
31415. Florin (florsis) 2 87.67 89.89 2 100.00
31416. Nik (florid) 2 53.94 54.64 0 0.00
31417. Safe (floorrip) 2 80.03 85.88 0 0.00
31418. Eren (flochforster) 2 64.26 64.93 0 0.00
31419. a_hsla.1 (floating_aqua_212) 2 41.06 41.32 0 0.00
31420. Ole Martin (flidrip) 2 111.07 113.34 1 50.00
31421. Eru (flatoon) 2 88.85 98.99 1 50.00
31422. Flash (flashing_) 2 70.26 71.91 2 100.00
31423. Flare (flareix) 2 83.99 96.18 2 100.00
31424. erc (flamingllamas) 2 129.63 137.82 0 0.00
31425. Adam (flamindemon) 2 78.12 87.28 0 0.00
31426. bog (flamesthecat) 2 109.44 144.65 1 50.00
31427. Shocks (fishyshocks) 2 87.54 93.21 0 0.00
31428. fish (fishoverlord) 2 107.31 111.57 1 50.00
31429. Landon (fireman_227) 2 50.36 57.61 0 0.00
31430. Firebolt (firebolt__) 2 92.01 92.11 0 0.00
31431. Finiten (finiten) 2 114.45 130.65 1 50.00
31432. Fast (fingery) 2 39.10 53.00 0 0.00
31433. Mo (filnaei) 2 83.49 84.00 1 50.00
31434. Airee (fillyharmonica) 2 130.91 133.91 2 100.00
31435. Fillmoore (fillmoore) 2 141.53 145.64 2 100.00
31436. Fiko (fikotobel) 2 53.39 56.80 0 0.00
31437. atthespeedofcheeba (figilon) 2 92.07 102.92 1 50.00
31438. Aman (fifafanz) 2 119.66 123.31 2 100.00
31439. Farzad (ferion) 2 64.58 67.60 0 0.00
31440. Ferga12345 (ferga12345) 2 102.57 104.62 1 50.00
31441. Dio Brando (fengy1747) 2 108.93 111.94 0 0.00
31442. Felix (felix0003) 2 43.85 64.46 1 50.00
31443. Felix (felfel92) 2 110.90 112.93 2 100.00
31444. brum (feetlover) 2 47.01 51.17 0 0.00
31445. magsterz (feelokay) 2 73.00 74.60 2 100.00
31446. fdd (fdd1) 2 98.12 100.18 2 100.00
31447. Francis (fccipriano) 2 63.94 70.10 0 0.00
31448. king (fawmen) 2 78.95 85.35 0 0.00
31449. Ashley (fattass) 2 123.90 132.33 1 50.00
31450. Brenndyn (fatpig69) 2 61.54 63.57 0 0.00
31451. Harrison (fathole) 2 59.76 64.90 0 0.00
31452. procrastinator (fatcatheart... 2 78.70 95.05 1 50.00
31453. Ryan (fast_typer69_420) 2 38.18 38.58 0 0.00
31454. Your Mother (fasttyper69420) 2 70.09 73.77 0 0.00
31455. The Guy (farthammer2k) 2 94.72 104.84 2 100.00
31456. Jakub (fannoth) 2 69.09 70.27 0 0.00
31457. Falisha (falisha) 2 51.72 52.04 0 0.00
31458. Falco (falconil) 2 107.02 113.01 2 100.00
31459. ig@ (fainterkitten) 2 81.54 83.49 0 0.00
31460. Jake (failura) 2 83.57 85.29 1 50.00
31461. Kevin (faelinvxd) 2 88.36 114.83 1 50.00
31462. Petar (ezscany) 2 92.26 94.88 2 100.00
31463. Rameen (expoil) 2 95.50 101.51 0 0.00
31464. Exoticz (exoticzonyt) 2 45.32 46.75 1 50.00
31465. Exeadra (exeadra) 2 100.43 106.60 2 100.00
31466. exdarku (exdarku) 2 77.66 86.20 1 50.00
31467. Evan (evon_schmidt) 2 95.21 105.56 2 100.00
31468. ataraxia (evie_0123) 2 86.80 91.07 2 100.00
31469. Evan (evan1167) 2 84.83 87.57 0 0.00
31470. eumis (eumis) 2 60.20 68.76 1 50.00
31471. euan (euanvzn) 2 66.58 68.33 0 0.00
31472. Etian (etian_) 2 95.58 96.66 1 50.00
31473. Eshen (eshenx) 2 89.76 92.79 1 50.00
31474. Yi (escapetiger) 2 60.59 61.80 0 0.00
31475. Eric (errriclee) 2 103.42 116.28 0 0.00
31476. Saruulbuyan (erozionzeal) 2 63.50 65.03 0 0.00
31477. Eric (eric_loves_adrian) 2 86.27 89.52 2 100.00
31478. Ábel (ephraimgodw) 2 72.75 75.79 0 0.00
31479. Enzie (enzapenguin) 2 42.76 48.75 0 0.00
31480. Dominik (envirel) 2 65.64 67.78 1 50.00
31481. Frank (enomooshiki) 2 99.25 114.65 1 50.00
31482. Kelvin (enexpand_23) 2 43.74 46.98 0 0.00
31483. EndlessNebulous (endlessneb... 2 123.67 130.33 1 50.00
31484. Michwael Redpants (endlessm... 2 102.47 108.42 0 0.00
31485. Mei (enchy) 2 79.50 82.29 2 100.00
31486. Emzze (emzze) 2 36.15 37.38 0 0.00
31487. Emmanouil (emzoumpo) 2 83.26 88.20 1 50.00
31488. KiddieX (emyrr) 2 69.09 71.82 0 0.00
31489. Palmer (emrysite) 2 122.63 127.27 2 100.00
31490. Moonlight (emn12) 2 47.80 51.70 0 0.00
31491. bl4ck (emil_black) 2 55.34 56.20 0 0.00
31492. La (elpapa_lapapa) 2 74.24 76.86 1 50.00
31493. ElkTF2 (elktf2) 2 101.92 107.08 2 100.00
31494. Elijah (elijahbau) 2 88.57 93.44 1 50.00
31495. Ahmed (elghrbawy) 2 62.80 64.70 1 50.00
31496. Stanciu (electronized) 2 79.08 80.42 1 50.00
31497. ivan (electro27) 2 87.72 91.53 1 50.00
31498. Jack (elbowlick) 2 101.95 102.69 0 0.00
31499. EJDush (ejdush) 2 57.89 59.67 0 0.00
31500. Stefan (eisenzelle) 2 82.62 91.92 0 0.00
31501. eggs979 (eggs979) 2 110.21 114.55 2 100.00
31502. Evan (egggyman) 2 71.86 80.75 0 0.00
31503. Poch (eezoink) 2 104.12 119.76 2 100.00
31504. Edgars (edzo34) 2 48.42 55.70 1 50.00
31505. Edward (edward54321) 2 74.51 81.75 0 0.00
31506. Edreith (edreith) 2 99.61 102.90 2 100.00
31507. Ed (eddyoungster) 2 80.91 89.64 1 50.00
31508. Elysium (eclipser) 2 102.87 104.70 0 0.00
31509. Ruben (ecerulm_kinesis) 2 70.05 71.42 1 50.00
31510. Emma (ebunny136) 2 49.86 50.15 1 50.00
31511. eBright (ebright) 2 119.05 127.29 1 50.00
31512. sanzh (easy140bpm) 2 52.19 55.70 0 0.00
31513. Eric (ealouie) 2 81.98 85.36 0 0.00
31514. Aisultan (d_jr) 2 36.30 38.98 0 0.00
31515. Dipto (d_d_d) 2 72.78 76.29 1 50.00
31516. Davit (dyeghiaz) 2 78.37 83.54 0 0.00
31517. tec (dxnny) 2 61.36 62.41 2 100.00
31518. Bo (dut227) 2 55.52 56.15 0 0.00
31519. Will (duowill) 2 111.88 113.28 0 0.00
31520. mj (dunnobru) 2 65.90 72.98 0 0.00
31521. Travis (dune_dark) 2 44.19 54.22 0 0.00
31522. DuduSensei (dudusensei) 2 39.12 54.70 1 50.00
31523. Dolan (dudey7ftw) 2 110.11 118.54 2 100.00
31524. Ryan (dudemcbroguy) 2 58.77 60.67 0 0.00
31525. 🟣⚪🟣 (duckz__) 2 84.02 84.37 1 50.00
31526. Bo (duckydigs) 2 89.13 89.32 0 0.00
31527. Duck (duckmasteral) 2 103.18 106.68 1 50.00
31528. Weston (dubax) 2 102.31 105.92 1 50.00
31529. Dustin (dtrain586) 2 89.16 98.13 1 50.00
31530. dimash (dsquared_210t93) 2 100.59 103.17 1 50.00
31531. G (dseus4) 2 99.61 103.10 1 50.00
31532. I'm slow (dryerase) 2 65.73 66.45 1 50.00
31533. Henry (drwolf) 2 116.85 123.52 1 50.00
31534. Jacob (drummerjacob) 2 124.52 139.30 2 100.00
31535. pauper (drsnuffulupacis) 2 105.59 108.73 2 100.00
31536. Ric (drrz) 2 107.79 110.37 1 50.00
31537. Ahmed (dropheart) 2 119.74 124.72 2 100.00
31538. Invictus (drokovian) 2 104.08 110.32 1 50.00
31539. Drawsten (drawsten) 2 89.99 99.20 1 50.00
31540. Kyle (dragonvids) 2 87.22 91.53 1 50.00
31541. Dragon (dragonking0712) 2 123.55 123.82 2 100.00
31542. jse (dragoncityjose) 2 129.73 153.52 1 50.00
31543. Katherine (doylesgirl73) 2 72.09 77.54 0 0.00
31544. Elizabeth (downbeat) 2 88.15 97.92 1 50.00
31545. person guy (dotta_dotta) 2 83.29 85.93 2 100.00
31546. Dolphin (dophin) 2 55.88 56.46 2 100.00
31547. Hankey (doodthenoodle) 2 47.22 50.96 1 50.00
31548. Isaac (doodle_eldood) 2 88.89 91.06 0 0.00
31549. Phillip (donutdeflector) 2 95.53 96.11 1 50.00
31550. go (donkeyblaster69) 2 113.91 118.87 2 100.00
31551. dom (domo56) 2 81.12 83.36 0 0.00
31552. Dominic (domg913) 2 56.93 62.02 2 100.00
31553. Dominique (domdknguyen26) 2 73.34 76.51 0 0.00
31554. Dog (dogtyper500) 2 99.43 110.00 1 50.00
31555. dogstreet1 (dogstreet1) 2 91.44 93.45 1 50.00
31556. max (dogman50012) 2 49.47 51.73 0 0.00
31557. PKRZ Bright Red Hats (doesi... 2 121.43 122.39 2 100.00
31558. Duong (doduong) 2 64.73 67.22 1 50.00
31559. Dorian (dodo2208) 2 76.48 79.03 0 0.00
31560. Alexu (doctoralexu) 2 98.13 103.94 2 100.00
31561. Dev (doberay) 2 83.74 85.84 1 50.00
31562. Christian (dmrunner) 2 99.04 99.78 2 100.00
31563. Kenneth (dlguswp101) 2 54.67 57.44 0 0.00
31564. Kaden (dlabguy12345) 2 95.64 96.14 1 50.00
31565. Djordje (djordjeostoic) 2 56.07 56.97 0 0.00
31566. Ro (dixirion) 2 54.06 54.78 1 50.00
31567. David (divdav) 2 122.17 130.74 0 0.00
31568. ur done, ur done (diszanne) 2 86.17 96.04 2 100.00
31569. DistractedScam (distracteds... 2 94.99 96.25 2 100.00
31570. Joe (disconnnect) 2 55.24 58.08 0 0.00
31571. alex (disappointd) 2 134.44 138.83 1 50.00
31572. Diriector (diriector_doc) 2 60.68 65.33 2 100.00
31573. Diogo Mateus (diogomateus) 2 69.25 71.28 0 0.00
31574. dio (diocccc) 2 88.37 90.49 1 50.00
31575. Dillon (dillon_p) 2 85.72 87.88 0 0.00
31576. Digs (digsdigging) 2 68.52 70.79 0 0.00
31577. Digi (digisoul4) 2 67.31 67.64 1 50.00
31578. Degoldie (digim) 2 119.05 130.84 2 100.00
31579. Take (diesieben07) 2 90.15 91.49 1 50.00
31580. Diana (dianajk) 2 52.69 52.99 0 0.00
31581. mine (diamondminer939) 2 117.91 127.89 1 50.00
31582. Lee Do-seon (diablero) 2 66.71 70.70 0 0.00
31583. Dorji (dexdom2th) 2 61.65 62.99 0 0.00
31584. dexdexdex (dexdexdex) 2 132.21 139.81 1 50.00
31585. devin (devinekadeni) 2 85.89 86.52 2 100.00
31586. Deus (deusseb) 2 94.62 102.68 2 100.00
31587. Destroyer of fruits (destro... 2 78.11 78.30 2 100.00
31588. desk (desk_wall) 2 60.38 64.40 0 0.00
31589. Desideratus (desideratus) 2 81.49 82.12 1 50.00
31590. Derek (derekcfop) 2 88.92 92.72 1 50.00
31591. Dequantrius (dequantrius) 2 107.44 116.45 0 0.00
31592. Dennis (denniskoskei) 2 47.90 48.82 1 50.00
31593. Hiro (denis_bugle) 2 95.16 103.30 1 50.00
31594. Arpit (demonnboy) 2 44.71 45.10 0 0.00
31595. deletboi.exe (deletboi_exe) 2 40.21 41.82 0 0.00
31596. DELA CRUZ (delacruzz) 2 118.28 124.10 2 100.00
31597. Riley (defectivepixel) 2 70.12 76.99 0 0.00
31598. Deep (deepp) 2 84.43 87.84 1 50.00
31599. deembun (deembun) 2 52.70 57.85 0 0.00
31600. Hehe (decahexatrix) 2 118.97 125.36 0 0.00
31601. DDarWiz (ddarwiz) 2 89.25 89.48 1 50.00
31602. Daniel (dchomtl) 2 109.38 111.60 2 100.00
31603. Anton (dchk) 2 20.87 21.50 0 0.00
31604. Dan (dcardoso12) 2 90.27 94.99 1 50.00
31605. Buba Dorj (dbuba99) 2 66.37 68.08 0 0.00
31606. Daynn_ (daynn_) 2 54.40 57.53 1 50.00
31607. Dawka (dawka0499) 2 65.90 74.40 0 0.00
31608. dawgy1 (dawgy1) 2 93.05 101.99 1 50.00
31609. David (davidrecinos41) 2 79.23 79.72 0 0.00
31610. David (daviddd1) 2 62.47 72.96 2 100.00
31611. lithiumranger (datoucai) 2 107.33 117.01 0 0.00
31612. Ryan (dathadka) 2 62.21 64.69 0 0.00
31613. Rafea (datguyrafea) 2 57.57 61.77 1 50.00
31614. Darvydas (darwyb) 2 101.99 110.50 2 100.00
31615. Darth (darth480) 2 59.48 74.31 0 0.00
31616. Darrel (darrelyap) 2 101.20 104.28 1 50.00
31617. Ahmad (darklungs) 2 56.95 59.11 1 50.00
31618. darkll (darkll) 2 93.63 101.71 1 50.00
31619. Charlie (darklemon33) 2 86.70 97.90 2 100.00
31620. Simon (darkfiremoon) 2 73.37 74.83 0 0.00
31621. Darkblask23 (darkblask23) 2 58.27 65.59 0 0.00
31622. DaRealSiri (darealsiri) 2 84.37 86.37 1 50.00
31623. Neptium (dan_neptium) 2 87.63 90.95 1 50.00
31624. Danail (dansarch) 2 82.00 85.41 1 50.00
31625. Daniel (dannye014) 2 98.11 102.35 1 50.00
31626. Dan (danmusa562) 2 89.95 93.57 2 100.00
31627. Dani (danivenk) 2 59.85 61.46 0 0.00
31628. Anish (danishanish) 2 120.43 130.74 2 100.00
31629. Danii (danii_not8) 2 43.16 47.35 0 0.00
31630. Daniel (danielwaker) 2 95.98 103.45 1 50.00
31631. duniel (danieljonghyun) 2 45.47 46.72 0 0.00
31632. Daniel (danielf55) 2 86.00 90.87 0 0.00
31633. Daniel (danex2210) 2 74.07 81.97 1 50.00
31634. da (damingwang0007) 2 52.01 53.16 0 0.00
31635. Damian (damianp123) 2 58.97 62.41 2 100.00
31636. Daman (damanwrld) 2 51.89 56.92 0 0.00
31637. Andrei (dalacul) 2 82.90 87.17 1 50.00
31638. Darko (dakiking) 2 72.44 75.56 2 100.00
31639. Mason Wasicek (daddymace) 2 53.99 55.87 2 100.00
31640. foM (da1scrub) 2 125.86 130.89 2 100.00
31641. Mvck (d3mon666) 2 122.11 139.17 1 50.00
31642. ay (d3b1) 2 127.31 143.45 1 50.00
31643. Luke (d357r0y3r) 2 130.03 138.67 1 50.00
31644. Tyme (cytokine117) 2 86.77 91.54 1 50.00
31645. Torey (cyclops13) 2 92.77 97.95 0 0.00
31646. Siddharth (cyberraptor) 2 56.91 57.27 1 50.00
31647. Kollol (cyanomax) 2 75.31 85.60 2 100.00
31648. Chase (cvcalderon) 2 65.04 68.85 0 0.00
31649. CurB (cur_b) 2 61.15 63.66 0 0.00
31650. Curse (curse10) 2 73.93 75.57 0 0.00
31651. jurre (currythedestroyer) 2 76.25 79.70 2 100.00
31652. Chris (cuntychris) 2 74.94 77.32 2 100.00
31653. Jean (cummywummy) 2 104.65 108.30 1 50.00
31654. rawr (cuddls) 2 90.03 100.27 1 50.00
31655. Sander (cubit33) 2 105.45 107.20 2 100.00
31656. Brandon (cube00) 2 104.55 118.00 1 50.00
31657. Tommy (cstommy) 2 88.53 91.22 0 0.00
31658. Type (csong03) 2 87.25 94.66 0 0.00
31659. master (cs6000pistol) 2 79.69 81.25 1 50.00
31660. Crystal (crystallyn84) 2 65.26 70.34 0 0.00
31661. megacyst (cryna) 2 112.93 116.89 2 100.00
31662. Marat (crunkz) 2 74.65 80.42 1 50.00
31663. Sam (creature_feature) 2 72.58 75.11 1 50.00
31664. Creamy Koala (creamy_koala) 2 49.93 51.96 0 0.00
31665. Piper (crazy_panda) 2 76.98 83.76 2 100.00
31666. C (crazynuf) 2 54.38 60.43 0 0.00
31667. better than you (craznevil) 2 123.84 135.85 2 100.00
31668. John Paul (crazeswag) 2 38.71 42.72 0 0.00
31669. Linda (craygirl) 2 118.71 119.62 1 50.00
31670. nothx (crassmonkey) 2 116.02 116.19 2 100.00
31671. cr0wfgt (cr0wfgt) 2 87.03 94.90 1 50.00
31672. echo (cptfryingpan) 2 74.37 77.61 0 0.00
31673. Colin (cpryan) 2 70.27 71.73 0 0.00
31674. zander (cowymcmooy) 2 34.65 36.19 1 50.00
31675. leo (cowboy_john) 2 22.78 24.24 1 50.00
31676. couchbanana (couchbanana) 2 38.34 39.02 0 0.00
31677. Corey (corkster) 2 105.82 109.56 2 100.00
31678. David (corerev) 2 51.80 53.12 0 0.00
31679. Greg (corei8) 2 55.74 58.48 1 50.00
31680. Md (copticmatic) 2 73.86 75.09 1 50.00
31681. Brae (cooride) 2 86.62 92.47 0 0.00
31682. Andrew (cookwies) 2 54.22 55.74 0 0.00
31683. Super (cookiecrusader) 2 81.70 83.54 0 0.00
31684. Abhiram (contigo) 2 55.14 57.32 0 0.00
31685. Jai (constipater) 2 26.90 28.17 0 0.00
31686. Conk (conkermilk) 2 75.59 92.15 1 50.00
31687. Connor (con1847) 2 61.05 64.42 2 100.00
31688. Commander823 (commander823) 2 90.41 108.39 1 50.00
31689. Colton (coltonj) 2 66.83 67.30 0 0.00
31690. cole (colezyyy) 2 28.63 29.45 0 0.00
31691. Cole (colemathew) 2 86.97 89.19 0 0.00
31692. tomoi (colemak_muzukashii) 2 123.46 130.40 1 50.00
31693. colemaker (colemaker) 2 60.56 63.17 0 0.00
31694. Cole (coleleighs) 2 71.43 72.38 1 50.00
31695. Cole (coleland) 2 68.88 74.14 1 50.00
31696. Matheus (coelhow) 2 62.74 65.07 0 0.00
31697. Coding (coding_riovo) 2 35.03 37.26 0 0.00
31698. Coda (coda06) 2 84.85 86.63 1 50.00
31699. Egg (cocodong) 2 93.36 97.36 2 100.00
31700. Cochu (cochuu_) 2 96.59 98.05 2 100.00
31701. PHP JMC (cmjhunneil) 2 77.30 86.33 1 50.00
31702. Colton (cmerri) 2 85.69 93.83 1 50.00
31703. Duc (cmd1293) 2 70.99 75.77 2 100.00
31704. Clown (clownius_v) 2 75.96 77.46 1 50.00
31705. Charles (cloudhaze) 2 76.47 76.67 1 50.00
31706. Luke_mcc (clonemyster) 2 55.60 57.15 1 50.00
31707. Heksinator (cleverpleb) 2 64.65 65.63 1 50.00
31708. Claudia (claudsipoo) 2 83.16 83.77 0 0.00
31709. Charles (cksabe) 2 92.00 108.50 0 0.00
31710. ckl (ckl33) 2 120.35 122.15 0 0.00
31711. Kwan (ckksimon) 2 82.44 86.35 1 50.00
31712. Lamp (cjquillen) 2 90.41 94.59 1 50.00
31713. Christian (cjlax18) 2 95.58 99.60 1 50.00
31714. ciwlx (ciwlx) 2 106.38 107.38 1 50.00
31715. cippuda (cippuda) 2 57.43 65.90 1 50.00
31716. Andrew (cinderwisp) 2 101.25 118.63 1 50.00
31717. CillerCiller (cillerciller_yt) 2 42.21 43.18 0 0.00
31718. Rango (chucknorrisauresrex) 2 127.32 128.26 1 50.00
31719. Goh (chuanhao) 2 89.57 97.99 0 0.00
31720. Mike (chuangman) 2 92.68 94.16 0 0.00
31721. Christina (chrxstina) 2 100.96 103.37 2 100.00
31722. Christine (christinezaki) 2 51.98 58.22 0 0.00
31723. chris (chrispfries) 2 102.11 103.35 0 0.00
31724. Chris (chrisdapula) 2 108.59 131.79 1 50.00
31725. Choban (chombainer) 2 98.68 102.90 0 0.00
31726. Alexander (chokoboy3) 2 109.71 115.59 2 100.00
31727. choi (choi0228) 2 34.53 35.80 0 0.00
31728. Choco (choco314) 2 116.69 127.10 2 100.00
31729. Chirpzz (chirpzzlol) 2 95.82 101.66 2 100.00
31730. Chris (chillstice) 2 90.52 95.87 0 0.00
31731. Daniel (chiknugg) 2 77.79 78.10 0 0.00
31732. Salma (chick_nugget) 2 46.69 47.05 1 50.00
31733. Essam (chickennugget665) 2 68.26 69.58 0 0.00
31734. Chichukin (chichukin) 2 102.39 121.21 1 50.00
31735. Sporak (cheeseballoon) 2 54.60 56.10 0 0.00
31736. poop (cheepb) 2 80.78 86.46 1 50.00
31737. Gabriel (cheekychicken10) 2 51.73 53.04 0 0.00
31738. Charles (chazzzle) 2 114.46 127.92 1 50.00
31739. Zerlinda (chazer) 2 110.23 116.58 2 100.00
31740. Chazador (chazador) 2 82.69 88.12 1 50.00
31741. Charleston (charlestongrays) 2 112.83 114.64 1 50.00
31742. Owen (chaostypefast) 2 82.54 90.79 0 0.00
31743. The Doofus (chalkshortage) 2 104.31 112.98 2 100.00
31744. pho (chagio) 2 87.22 97.96 1 50.00
31745. Camilo (cgiraldo_) 2 114.98 118.45 0 0.00
31746. Kai (ceteris_paribus) 2 50.04 51.84 0 0.00
31747. Certex (certex) 2 92.00 94.08 2 100.00
31748. Cele (cele0530) 2 85.71 89.62 2 100.00
31749. Cedra (cedra) 2 129.18 142.97 1 50.00
31750. Ceci (ceci_tyson) 2 54.81 57.50 0 0.00
31751. Cecilio (cecilio16) 2 106.04 117.55 0 0.00
31752. Carlo (ccatiello) 2 97.66 111.33 1 50.00
31753. catpuplover (catpuplover) 2 87.78 97.73 0 0.00
31754. Ray (castello666) 2 75.88 75.98 0 0.00
31755. Cassie (cassienae) 2 78.42 79.16 0 0.00
31756. caseyclosed (caseyclosedxd) 2 116.08 125.14 1 50.00
31757. Carlota (carlota02) 2 44.61 45.87 0 0.00
31758. Carl Emil (carlokj) 2 90.68 105.44 2 100.00
31759. Thomas (cardano007) 2 33.52 35.16 1 50.00
31760. Carbarrawr (carbarrawr) 2 104.66 106.27 1 50.00
31761. Carlos (carandrod) 2 97.40 102.30 1 50.00
31762. Captain (captainrick) 2 75.36 86.07 1 50.00
31763. CaptainPotatoes (captainpot... 2 66.64 76.63 1 50.00
31764. AJ (captainlide) 2 97.78 100.48 1 50.00
31765. Stijn (capslockstuck) 2 87.80 88.41 0 0.00
31766. Capablanca (capablanca373) 2 71.45 75.46 0 0.00
31767. Stephen (canasferatu) 2 108.52 114.22 1 50.00
31768. vincent (canadian_boi) 2 66.68 68.81 1 50.00
31769. Gabriel (camposao) 2 72.96 74.43 0 0.00
31770. Calle (calle01) 2 92.42 98.50 2 100.00
31771. CalciumCarbonate (calcium_) 2 67.97 70.61 0 0.00
31772. Enixam (caban) 2 77.47 80.09 0 0.00
31773. isaac (caasiooj) 2 82.32 82.53 1 50.00
31774. cabell ֎ (cabell) 2 46.52 50.10 0 0.00
31775. Hai Dang (c0smological) 2 104.48 105.61 2 100.00
31776. Poopy (c0hink) 2 94.48 96.34 1 50.00
31777. BytePride (bytepride) 2 101.22 108.53 1 50.00
31778. Brian (bv_225) 2 115.00 123.82 1 50.00
31779. Thomas (buttnuggetchiu) 2 85.95 87.87 1 50.00
31780. Bruce (buholaha) 2 59.85 60.57 1 50.00
31781. Mario (buggy_) 2 88.93 99.59 1 50.00
31782. buff (buffyc) 2 79.88 83.86 0 0.00
31783. r (buckage) 2 76.87 76.99 2 100.00
31784. Bryce (bs2190) 2 69.17 71.88 1 50.00
31785. B3rt4 (brz_j) 2 49.34 49.73 0 0.00
31786. Bruna (brunais) 2 37.10 38.73 0 0.00
31787. White (bruh_neighbor_moment) 2 74.47 77.94 0 0.00
31788. :) (brueashear) 2 83.40 84.46 0 0.00
31789. Brotolios (brotolios) 2 88.22 89.32 0 0.00
31790. Superior (brother_v) 2 87.86 103.90 1 50.00
31791. Brian (brian81877) 2 48.99 51.55 0 0.00
31792. Bread (breadofpower) 2 78.98 79.99 2 100.00
31793. brazil (brazilman2309) 2 88.41 88.71 2 100.00
31794. Ryan (bravefrontier) 2 103.05 106.29 1 50.00
31795. Brandon (branick) 2 123.79 130.56 2 100.00
31796. Brandon (brandonkheang) 2 98.87 103.56 2 100.00
31797. Bradley (bradleydavis) 2 98.31 109.39 1 50.00
31798. Hugo (bothugo) 2 58.00 59.08 2 100.00
31799. Max (bortie) 2 110.15 127.51 2 100.00
31800. Booty (bootykhan) 2 84.27 96.99 1 50.00
31801. Z (bootlicker1776) 2 89.49 90.63 0 0.00
31802. Anya (bonniebonbon) 2 89.25 94.73 0 0.00
31803. BonkyKayn (bonky_kayn) 2 62.88 66.50 1 50.00
31804. Sam (bonksy) 2 69.88 71.27 1 50.00
31805. Lukas (bondevik) 2 64.03 70.26 1 50.00
31806. tstats[bomb_guard] (bomb_gu... 2 79.42 79.70 0 0.00
31807. Pepsi (bombchicken) 2 88.61 92.89 1 50.00
31808. katsuna (bolt0009) 2 130.14 137.78 2 100.00
31809. Will (boi1561) 2 95.88 103.53 0 0.00
31810. Bog (bogjip) 2 104.13 110.13 0 0.00
31811. Jack (boehler66) 2 43.96 47.22 0 0.00
31812. mahmoud (boda05) 2 53.09 55.09 0 0.00
31813. BOBMAN4900tstats[bobman4900... 2 97.53 103.70 0 0.00
31814. SaclSojo (bobharley) 2 112.97 121.42 1 50.00
31815. Em (blugrassgreensky) 2 78.02 83.99 1 50.00
31816. Isaac (bluexpro) 2 41.08 41.20 0 0.00
31817. SharkThatBlue (blueshark000) 2 83.44 105.30 2 100.00
31818. BlueNerds (bluenerds) 2 75.92 84.44 1 50.00
31819. Tristan (bluekidcrazy) 2 84.00 93.98 1 50.00
31820. blu (bluberryy) 2 86.50 88.47 1 50.00
31821. Stephen (bloodwineskg) 2 84.86 91.12 0 0.00
31822. Michael (blindingfast) 2 48.02 52.76 0 0.00
31823. Nazeem (bleaful) 2 69.55 75.21 0 0.00
31824. Lan (bldymsscr) 2 57.27 60.80 0 0.00
31825. B (blazingthunder30) 2 99.30 99.79 1 50.00
31826. notsofast (blankawaii_16) 2 35.14 44.54 0 0.00
31827. Justin (blamuro) 2 112.68 121.73 2 100.00
31828. dzizuz (blakayn) 2 109.76 110.40 1 50.00
31829. stefan (bitmap48) 2 44.32 44.34 0 0.00
31830. Lara (bisharch) 2 90.32 96.91 1 50.00
31831. Birdacious (birdacious) 2 100.49 101.41 1 50.00
31832. Bird (birdiesaurus) 2 92.27 93.81 2 100.00
31833. rykuzo (binhsorrow) 2 80.36 83.92 2 100.00
31834. Area0 (bing_b0ng) 2 86.62 87.54 0 0.00
31835. Francesco (billyboe) 2 84.48 86.61 0 0.00
31836. Bika (bikaandrow) 2 62.79 67.96 0 0.00
31837. pog (big_dick_ron27) 2 46.18 50.26 0 0.00
31838. soved (biglego) 2 91.23 104.49 0 0.00
31839. Avery (bigger_chungus) 2 59.24 67.02 1 50.00
31840. Victor (bigetou) 2 87.10 89.84 0 0.00
31841. steven (bigdong696969) 2 81.20 82.48 0 0.00
31842. Matthew (bigbananakiwi) 2 80.76 86.65 1 50.00
31843. Bigakaboom (bigakaboom) 2 79.56 83.54 2 100.00
31844. Bibek (bibek_gautam) 2 46.85 48.61 2 100.00
31845. Bibba (bibba27) 2 86.40 91.28 1 50.00
31846. BibaSenpai (bibasenpai) 2 37.90 43.20 1 50.00
31847. GwenXYZ (bhuyquang1) 2 57.26 58.14 0 0.00
31848. Brofist (bhyper) 2 128.82 139.29 2 100.00
31849. Noah (bhyldir) 2 96.27 97.25 1 50.00
31850. Brandon (bhender) 2 69.08 69.22 1 50.00
31851. Chris (bgy11) 2 63.20 72.57 0 0.00
31852. Benjamin (be_jamin) 2 66.05 69.07 1 50.00
31853. Bettydaweirdo (bettydaweirdo) 2 65.29 72.56 0 0.00
31854. Best (bestgemon) 2 70.48 74.09 1 50.00
31855. besher (besher) 2 66.17 68.21 0 0.00
31856. Bertus (bertus009) 2 74.29 75.27 1 50.00
31857. Ben (bentontypesfast) 2 74.54 82.86 0 0.00
31858. Bento (bentobox9) 2 78.54 81.81 1 50.00
31859. Ben (bensolo1_chess) 2 43.49 52.17 0 0.00
31860. Ben (benlestage3) 2 56.63 58.78 0 0.00
31861. Benjamin (benjocar) 2 68.54 70.60 0 0.00
31862. Ben (benjermanloo) 2 87.24 96.33 1 50.00
31863. Belgutei (belgutei_0323) 2 71.49 75.96 0 0.00
31864. Zhantore (belayed) 2 70.38 70.54 1 50.00
31865. Ong (bebooo) 2 52.83 55.28 0 0.00
31866. ET (bearington_45) 2 86.25 90.15 1 50.00
31867. Nick (beansymcgee) 2 125.47 143.70 1 50.00
31868. beachill (beachill) 2 135.45 147.80 2 100.00
31869. Bdott (bdott_) 2 54.51 60.42 0 0.00
31870. bbro (bbro) 2 69.18 73.84 1 50.00
31871. Nick (bballnick2k2) 2 102.93 108.51 1 50.00
31872. Bazoo (bazoo) 2 64.87 65.84 0 0.00
31873. Furkan (baytak) 2 42.13 42.36 0 0.00
31874. Okan (baykalokandemir) 2 90.40 95.69 1 50.00
31875. Baush (baush) 2 104.83 109.21 1 50.00
31876. Batyrkhan (batyyr) 2 102.62 112.42 0 0.00
31877. Baslay (baslay) 2 100.83 103.56 2 100.00
31878. BareDK (baredk) 2 44.52 44.90 2 100.00
31879. Sally (barbiequeen5) 2 80.93 82.39 1 50.00
31880. yusuf (barackobunga) 2 62.98 66.58 0 0.00
31881. Deadeye (banterbry) 2 96.43 99.73 0 0.00
31882. Rodrigo (banr_) 2 86.86 89.98 0 0.00
31883. Long (bakabu12345) 2 51.96 55.68 2 100.00
31884. Baka (bakabawi) 2 50.84 58.31 1 50.00
31885. Wolferwow (baime) 2 88.95 94.72 0 0.00
31886. Jaroslav (baegus) 2 65.49 65.93 0 0.00
31887. Badger (badgerr) 2 74.00 83.05 2 100.00
31888. baboom (baboom3) 2 74.33 74.71 1 50.00
31889. Calvin (b1ack) 2 93.35 105.48 1 50.00
31890. Aryan (a_r_y_a_n) 2 79.69 82.19 0 0.00
31891. Anthony (a_rebello_type_hello) 2 112.59 116.97 0 0.00
31892. Alireza (a_ashkanipour) 2 47.96 52.29 1 50.00
31893. azuraath (azuraath) 2 91.46 96.16 1 50.00
31894. Roro (azuirith100wpm) 2 111.80 112.37 2 100.00
31895. Winnie (aznfreakwinnie) 2 69.16 83.58 0 0.00
31896. Anthony (azndeadman2001) 2 78.72 80.42 0 0.00
31897. azenia (azenia) 2 85.21 87.45 2 100.00
31898. Jumri (azarashii) 2 79.42 83.31 0 0.00
31899. Abdullah (azaidrahman13) 2 101.11 105.53 1 50.00
31900. az4521 (az4521) 2 97.37 100.95 0 0.00
31901. Anna (ayyross) 2 99.39 102.14 0 0.00
31902. danielllll! (ayyitsdan) 2 101.50 101.90 2 100.00
31903. Ayush (ayushtank) 2 50.20 51.98 0 0.00
31904. Alec (ayic) 2 80.33 82.32 0 0.00
31905. Zane (axkz) 2 54.82 55.69 0 0.00
31906. Axel (axel_ram) 2 54.70 54.82 0 0.00
31907. Axaul (axaul) 2 73.56 74.93 0 0.00
31908. Technoblade (awppenheimer) 2 112.96 122.26 0 0.00
31909. Gregory (awesome1000988) 2 111.41 119.46 2 100.00
31910. Raymond (awedragon) 2 70.34 78.64 1 50.00
31911. Eric (avocadopineapple) 2 119.02 126.74 1 50.00
31912. Avishek (avishek_) 2 30.53 33.92 1 50.00
31913. Avikam (avikam) 2 89.58 92.08 2 100.00
31914. Bulky Hulk (avg_typist) 2 88.22 94.29 1 50.00
31915. Avery (avery11821) 2 119.51 139.04 0 0.00
31916. Kei (auvere) 2 117.95 120.13 1 50.00
31917. Auto (autocats) 2 113.99 131.27 2 100.00
31918. You don't (austin101123) 2 90.72 93.70 0 0.00
31919. Auralis (auralis) 2 134.30 155.08 2 100.00
31920. Augustine (augustinec) 2 90.72 95.98 1 50.00
31921. Peter (aufbau) 2 77.59 78.87 0 0.00
31922. Nicholas (atticcraft) 2 82.50 83.91 0 0.00
31923. attemptless (attemptless) 2 94.83 97.40 2 100.00
31924. MANGESH (atom2) 2 55.92 62.17 1 50.00
31925. Egg boy (atobias28) 2 93.80 98.71 0 0.00
31926. Alex (athensguy) 2 105.12 110.55 1 50.00
31927. Marcelo Gomes (asyeok) 2 132.79 136.46 0 0.00
31928. Wazukyan (aswertgvc) 2 48.09 55.46 0 0.00
31929. Astex (astex_97) 2 59.67 62.88 0 0.00
31930. John Wick (asr123) 2 113.82 120.89 2 100.00
31931. Atul (asquare893) 2 51.28 54.99 0 0.00
31932. DELTA P (aspiron) 2 61.22 75.58 1 50.00
31933. Justin (asparaguswater) 2 82.41 84.67 1 50.00
31934. Arthur (asmv) 2 90.52 101.83 2 100.00
31935. Justin (asianplayz) 2 62.40 64.55 0 0.00
31936. ashmit (ashmit1769) 2 36.81 37.79 0 0.00
31937. Ashen (ashen12) 2 44.99 51.97 0 0.00
31938. ASG (asg1997) 2 108.22 119.51 1 50.00
31939. Aseemru (aseemru) 2 108.44 110.16 2 100.00
31940. Aseel (aseel_draz) 2 53.27 56.48 0 0.00
31941. Asado (asado) 2 87.40 88.37 1 50.00
31942. Arxidon (arxidon) 2 109.18 114.68 1 50.00
31943. Arvid (arvid220u) 2 87.69 98.41 0 0.00
31944. Andrei (artoorie312) 2 87.01 88.79 1 50.00
31945. Dr Pepper (artistp) 2 86.00 92.00 2 100.00
31946. Artin (artinmk) 2 72.45 76.41 0 0.00
31947. Case (arsonistlol) 2 102.08 104.86 0 0.00
31948. Sarthak (arseeus_not_arkius) 2 116.06 119.91 1 50.00
31949. Ar (arpratama) 2 88.56 90.87 0 0.00
31950. Arnold (arnolddddd) 2 59.04 59.11 0 0.00
31951. arnavf1 (arnavf1) 2 94.65 104.07 1 50.00
31952. hani (arkado_h) 2 42.89 43.86 0 0.00
31953. Arkajyoti (arkajyotijha) 2 63.29 67.79 1 50.00
31954. Arik (arikuu) 2 86.70 88.56 2 100.00
31955. Aries (ariesqi) 2 70.28 72.98 0 0.00
31956. Zaynah (arianagrandeyuh27) 2 55.75 59.27 0 0.00
31957. Arnold (argoat) 2 85.14 88.86 1 50.00
31958. Aryaan (argentumv) 2 70.87 85.40 1 50.00
31959. Arek (arekzaleski) 2 46.70 47.13 0 0.00
31960. Ben (archerypineapple) 2 69.40 73.55 0 0.00
31961. Arafat (arafat_hasan) 2 55.12 56.10 0 0.00
31962. Arabi's (arabisgamingyt) 2 44.45 45.93 0 0.00
31963. aqua (aqua_plays_bball) 2 94.39 98.82 1 50.00
31964. austin (apschween) 2 67.83 75.04 0 0.00
31965. a (apno) 2 92.99 94.14 0 0.00
31966. Aplukat (aplukat_69) 2 91.48 95.84 1 50.00
31967. anvildorms (anvildorms) 2 108.76 117.06 1 50.00
31968. BeaT (anutorn) 2 107.11 108.39 2 100.00
31969. feet (ant_1105) 2 63.37 67.60 0 0.00
31970. Antony819 (antony819) 2 62.51 69.28 1 50.00
31971. Antoine (antiwaniwan) 2 112.97 116.57 2 100.00
31972. Ziggy (antioch) 2 91.96 102.00 1 50.00
31973. Logan (anonymous_934) 2 71.27 72.59 2 100.00
31974. jesper (anneflank) 2 87.08 89.12 1 50.00
31975. Ankur (ankurgoel) 2 104.14 114.51 2 100.00
31976. Aniket (aniket2988) 2 74.40 85.03 0 0.00
31977. Aidan (anguyenkn) 2 92.09 98.07 0 0.00
31978. AnExoticIdiot (anexoticidiot) 2 39.45 42.73 0 0.00
31979. Ben (androminous) 2 104.51 104.96 0 0.00
31980. Andrew (andrewpalet) 2 55.59 59.56 0 0.00
31981. Andrew (andrewawsome122) 2 90.97 95.88 2 100.00
31982. Andrew (andrew69314) 2 99.23 100.39 0 0.00
31983. Andrea (andrealol) 2 97.30 113.13 0 0.00
31984. andrei (andrake) 2 56.87 59.01 0 0.00
31985. Andriy (andoroid) 2 68.80 70.07 0 0.00
31986. Rapha (anakin1178) 2 126.97 128.02 2 100.00
31987. Alix (anahlia) 2 99.48 102.77 1 50.00
31988. Andrew (an0nym0us_27) 2 67.05 69.37 1 50.00
31989. Amy (amyt11) 2 62.55 72.18 0 0.00
31990. Amy (amydakao) 2 123.96 130.34 2 100.00
31991. Amy (amyjean) 2 39.12 46.52 0 0.00
31992. amtrax (amtrax) 2 61.24 61.26 1 50.00
31993. Landon (amtreeboi) 2 65.05 66.30 0 0.00
31994. Anton (amsavchenko) 2 45.38 45.69 0 0.00
31995. Amarpreet (ampit) 2 94.79 103.03 1 50.00
31996. Dont (amosdaragon69) 2 67.40 68.58 1 50.00
31997. Amit (amitdahan) 2 99.25 119.19 2 100.00
31998. Abhishek (amishra7292) 2 63.85 67.25 1 50.00
31999. AmiLemon (amilemon) 2 59.89 61.55 0 0.00
32000. amelia (ameliality) 2 64.49 65.44 1 50.00
32001. Ádám (amegmi) 2 53.99 54.30 0 0.00
32002. Andrew (amao01) 2 86.52 91.82 0 0.00
32003. Keia (alu15) 2 50.69 52.08 0 0.00
32004. GGEZ (altris) 2 102.30 102.42 2 100.00
32005. Altynbek (altoon) 2 43.59 45.30 0 0.00
32006. Altan (altan_twitchz) 2 88.90 95.54 0 0.00
32007. Sara (alphathealpha) 2 131.86 140.13 2 100.00
32008. Alpha (alphaomegaepsilon) 2 107.06 122.68 0 0.00
32009. Allen (alphadvorak) 2 64.16 65.58 0 0.00
32010. Gheorghe (alpha0) 2 50.62 52.14 0 0.00
32011. alp atakan (alpatakan) 2 60.26 60.60 2 100.00
32012. alpaca (alpacaaviator) 2 112.45 113.49 1 50.00
32013. xǝl∀ (alnotreally) 2 53.96 54.93 2 100.00
32014. Alnas (alnasnasu) 2 60.43 65.96 0 0.00
32015. Almight (almight) 2 53.34 55.65 1 50.00
32016. june (alltoowell) 2 75.87 79.46 0 0.00
32017. J (allobubu) 2 112.69 117.41 1 50.00
32018. alldeux (alldeux) 2 95.25 97.57 2 100.00
32019. G (alldetected) 2 74.49 74.62 0 0.00
32020. Allan (allanersaj) 2 61.75 61.87 1 50.00
32021. Jonnathan (aljeak_) 2 76.98 77.30 1 50.00
32022. Alejandro (aljandro2o) 2 49.20 56.73 1 50.00
32023. ALixe (alix3) 2 88.37 89.45 1 50.00
32024. alien_super (alien_super) 2 94.03 99.15 1 50.00
32025. AlhassanTaher (alhassantaher) 2 60.12 64.07 0 0.00
32026. Alex (alexxxkachow) 2 71.82 73.90 0 0.00
32027. a (alextheman49) 2 82.86 86.45 0 0.00
32028. ayky (alexisyeo) 2 68.01 70.65 1 50.00
32029. Xander (alex0824) 2 92.45 99.67 2 100.00
32030. Ale (aleplayz) 2 51.19 52.40 0 0.00
32031. Alec (alecwest) 2 89.37 93.81 1 50.00
32032. ale (ale10212) 2 35.97 39.44 1 50.00
32033. Aldas (aldas25) 2 67.86 68.33 0 0.00
32034. Dirivial (alcade) 2 74.42 86.55 0 0.00
32035. Albert (albertthedy) 2 108.35 119.16 1 50.00
32036. Alberti (albertibass) 2 107.48 107.62 1 50.00
32037. Rodrigo (alang217) 2 87.04 95.03 1 50.00
32038. Alan (alanfortlink) 2 115.84 123.29 2 100.00
32039. Miesepeter (akizow) 2 72.62 73.40 2 100.00
32040. kaneki (akiyama_shinchi) 2 64.53 69.18 0 0.00
32041. Akhil (akhilrawat001) 2 51.90 54.58 0 0.00
32042. akelok (akelok) 2 137.07 138.76 2 100.00
32043. Akash (akashshrm02) 2 79.60 88.49 0 0.00
32044. AJ (ajk810) 2 72.41 83.15 0 0.00
32045. Jason (ajelliedonut) 2 69.29 77.27 0 0.00
32046. Ajay (ajay_sharma) 2 46.18 47.94 0 0.00
32047. alex (aj25) 2 105.38 105.87 0 0.00
32048. PrinceRemielAleks (aisakata... 2 107.47 117.03 1 50.00
32049. sudo (airpline1) 2 92.93 95.02 0 0.00
32050. ain (ainzel) 2 58.29 64.95 0 0.00
32051. aidan (aidooo) 2 55.48 57.95 0 0.00
32052. wowza (aidan3540) 2 77.65 78.49 1 50.00
32053. a (aidan2021) 2 107.33 119.89 0 0.00
32054. Ahududu (ahududuyt) 2 22.88 27.29 0 0.00
32055. MR. Nobody (ahsanakbar) 2 73.72 75.11 1 50.00
32056. Doggy (ahousecat6969) 2 68.54 69.69 0 0.00
32057. deez (ahntahrees) 2 83.60 85.95 1 50.00
32058. Ahmed (ahmedkn) 2 47.60 47.82 0 0.00
32059. Ahan (ahanmal) 2 69.40 79.30 0 0.00
32060. Joe (afromonkey) 2 89.57 93.08 0 0.00
32061. fishOil (afishoil) 2 89.50 95.20 1 50.00
32062. APA COBA!!! (afider) 2 35.87 37.71 0 0.00
32063. Alireza (afateh) 2 66.88 75.88 0 0.00
32064. Alori (aeshaefi) 2 50.70 51.19 0 0.00
32065. Kelvin (aerochow) 2 118.27 125.43 2 100.00
32066. Andrea (aerdna12) 2 71.34 72.92 0 0.00
32067. SpicyBoi (aedsman) 2 113.35 116.29 0 0.00
32068. koujakusucker (advu_) 2 84.85 85.50 0 0.00
32069. adol (adoll) 2 127.93 133.25 2 100.00
32070. Aditya (aditya_trans63) 2 45.99 46.31 0 0.00
32071. adiguna (adiguna7) 2 54.94 60.41 0 0.00
32072. Adelrik (adelrik) 2 53.98 56.80 1 50.00
32073. Adelio (adeliogaudi) 2 94.80 97.10 1 50.00
32074. .georgy (add_me_on_discord) 2 148.31 151.40 1 50.00
32075. Addison (addisondj) 2 95.28 97.28 1 50.00
32076. Adam (adamt_543) 2 68.28 68.31 2 100.00
32077. Adam (adamnordin) 2 57.95 58.19 0 0.00
32078. adam (adamcute122) 2 66.79 72.67 2 100.00
32079. Actinom (actinom) 2 101.34 107.26 1 50.00
32080. Andrew (acr21) 2 46.85 49.58 0 0.00
32081. achewytoffee (achewytoffee) 2 89.48 94.04 1 50.00
32082. John (acg55678) 2 98.93 102.50 1 50.00
32083. pomgie (achan66) 2 97.92 106.66 2 100.00
32084. zildanzabani (aceraven7) 2 51.48 58.15 1 50.00
32085. David (abush635) 2 83.22 97.66 0 0.00
32086. abukoj (abukoj) 2 87.56 87.92 0 0.00
32087. Hadiff (abubu) 2 63.59 68.06 1 50.00
32088. Abrar (abrar_al_samit) 2 89.10 90.43 0 0.00
32089. Ibrahim (aboyasser) 2 67.55 76.66 1 50.00
32090. big (aboxofkleenex) 2 103.38 104.85 1 50.00
32091. abdalkarim (aboodz) 2 55.32 59.54 0 0.00
32092. Abhishek (abhis004) 2 39.78 51.05 1 50.00
32093. Cesar I. (aberuwu) 2 74.80 78.48 1 50.00
32094. Abdullah (abdullahahmad) 2 51.27 52.98 0 0.00
32095. Appa (abdallah99) 2 61.20 67.21 0 0.00
32096. Abda (abdaishere) 2 46.92 51.69 2 100.00
32097. Abby (abbykiehlbauch) 2 91.89 98.88 2 100.00
32098. aardvark (aardvark_warrior) 2 72.39 81.97 1 50.00
32099. AAMMEERRIICCAA (aammeerriic... 2 73.03 74.96 1 50.00
32100. Tan (aalliance11) 2 55.43 57.80 1 50.00
32101. aagils (aagils) 2 55.25 59.57 2 100.00
32102. A (aa1729) 2 104.84 108.88 0 0.00
32103. BP (a227673) 2 90.78 95.48 1 50.00
32104. Esk (99tester) 2 84.26 93.02 1 50.00
32105. 🏎️Zermist(washedup) (9... 2 166.07 173.27 1 50.00
32106. Henry (7enry) 2 87.44 97.72 1 50.00
32107. 79eL (79el) 2 111.10 116.88 0 0.00
32108. ??? (5apphire) 2 100.72 100.93 0 0.00
32109. Ron (4ronse) 2 65.17 68.19 1 50.00
32110. SAM (4n0nym0us_h4ck3r) 2 71.22 75.17 1 50.00
32111. smf (4ex7) 2 60.59 65.02 0 0.00
32112. Rei (45kin) 2 63.37 73.00 0 0.00
32113. TN (47percent) 2 92.76 96.32 1 50.00
32114. Zakhar (3eldu) 2 98.87 103.50 1 50.00
32115. darryl (3dsss) 2 72.90 74.48 0 0.00
32116. alkLFG (360curve) 2 138.88 144.25 1 50.00
32117. M Ali +923104362942 (35wppm) 2 85.40 87.20 0 0.00
32118. Rajan (340900190) 2 109.97 118.42 1 50.00
32119. Andrew (2pack) 2 56.21 57.70 0 0.00
32120. Kill (2fast4yall) 2 101.48 105.38 1 50.00
32121. 2Change (2change) 2 69.88 71.92 1 50.00
32122. Rosvaldas (27god) 2 100.82 110.06 1 50.00
32123. ~~~ (2019ygao) 2 69.24 70.62 1 50.00
32124. 1t2ht (1t2ht) 2 61.14 61.56 0 0.00
32125. Peter (187streetlegends) 2 54.14 61.24 0 0.00
32126. No (11ucky) 2 67.84 69.21 0 0.00
32127. Dan (114_ddo) 2 87.47 95.63 0 0.00
32128. Phoenyx (1013482) 2 83.07 86.36 0 0.00
32129. ALL (0gets) 2 77.95 85.18 1 50.00
32130. North (0azimuth) 2 134.12 153.02 2 100.00
32131. L33T (01l33t) 2 79.79 84.52 1 50.00
32132. Liew (00hong) 2 80.25 80.58 1 50.00
32133. dhiv25 (edtyper) 2 56.26 58.23 1 50.00
32134. owokamii (owokamii) 2 54.02 58.09 2 100.00
32135. Skull Crusher (_vikhyat) 2 54.17 60.53 0 0.00
32136. monkecmonkedo (statisity) 2 96.99 107.94 1 50.00
32137. Ghita (ghostwriter007) 2 40.06 40.22 0 0.00
32138. Sebastian Fischer (basti747) 2 33.36 44.74 0 0.00
32139. z (zeessh) 2 70.99 76.02 2 100.00
32140. Ameen (takvacs) 2 62.76 64.95 2 100.00
32141. Leo (lion2005chen) 2 70.40 71.33 0 0.00
32142. Zahoark (zahoark) 2 74.06 76.77 0 0.00
32143. Skimmex (skimmex) 2 85.77 93.04 0 0.00
32144. Slyvix (slyvix) 2 68.96 74.42 0 0.00
32145. Matt (mschmize) 2 92.31 92.66 1 50.00
32146. pi_calculus (pi_calculus) 2 65.80 69.25 0 0.00
32147. UV (__uv__) 2 75.44 77.92 1 50.00
32148. Mohamed (mohamedgbreel) 2 51.89 54.46 1 50.00
32149. Kevin (kevinriccy) 2 75.78 76.09 0 0.00
32150. Aryaman (hackman23ary) 2 72.72 73.94 2 100.00
32151. Wayne (zhuw) 2 85.14 87.25 0 0.00
32152. Joshua (adu_4063) 2 117.47 123.20 2 100.00
32153. Otto (slowclapper) 2 56.06 59.62 1 50.00
32154. Isaac (soggy_duck1) 2 60.57 64.42 0 0.00
32155. VU (vvv12345) 2 38.09 41.45 0 0.00
32156. Archit (apotharazu) 2 108.13 112.15 1 50.00
32157. Meneer (meneer) 2 104.70 105.90 1 50.00
32158. Goran (ahh1) 2 39.38 39.43 1 50.00
32159. This is (literallyjerk) 2 107.40 125.11 0 0.00
32160. m (mtrizz) 2 86.37 86.86 1 50.00
32161. PSGN (nick_fury02) 2 62.70 65.38 0 0.00
32162. rex (rexorangecounty) 2 62.14 63.53 0 0.00
32163. Jaden (itzjayyx3) 2 106.84 125.59 1 50.00
32164. Evan (wddfrt) 2 79.88 80.44 1 50.00
32165. Sebastian (sleopold) 2 85.43 87.46 0 0.00
32166. med (fools_world) 2 65.34 67.90 1 50.00
32167. MOHINI (mohini_tripathi) 2 49.36 50.34 0 0.00
32168. tin (tintinbananas) 2 74.99 77.82 1 50.00
32169. Coder (m8nlight_blue) 2 32.52 32.54 0 0.00
32170. Fatih (filthyadcmain) 2 75.33 78.71 1 50.00
32171. Basti (bastizocker84) 2 28.97 29.81 1 50.00
32172. Jay (enchant) 2 81.41 82.47 1 50.00
32173. Kenyan (kenyan) 2 55.37 63.67 1 50.00
32174. Josh (frqit) 2 82.21 90.51 0 0.00
32175. extratiger (extratiger) 2 66.14 70.51 1 50.00
32176. CHiperdoodles (chiperdoodles) 2 45.81 51.33 0 0.00
32177. Yousef (yousefmagdy11) 2 49.64 51.82 0 0.00
32178. Darrin (mrnuma) 2 40.86 45.43 0 0.00
32179. bronzki (bronzki) 2 65.96 70.74 0 0.00
32180. Colin (zolohd) 2 57.15 65.77 1 50.00
32181. Azamat (cl3vn) 2 49.86 52.13 0 0.00
32182. zenitsufromph (zenitsufromph) 2 118.50 121.01 2 100.00
32183. Emad (alkamali) 2 76.17 81.73 1 50.00
32184. Cocktavian (cocktavian) 2 93.21 94.28 2 100.00
32185. batkhishig dulamsurankhor (... 2 62.53 64.54 0 0.00
32186. regnir (satyo) 2 94.91 104.58 0 0.00
32187. zshyne (zshyne) 2 93.11 98.35 2 100.00
32188. philip (philipalm) 2 51.72 54.88 0 0.00
32189. ***** (veimik) 2 107.14 114.43 1 50.00
32190. Aryan (_noob_racer_) 2 62.30 62.81 1 50.00
32191. Jade (jeido) 2 72.02 84.21 2 100.00
32192. Aviya (aviyash) 2 87.74 94.77 0 0.00
32193. Justin (pingpongpoo) 2 108.48 109.38 2 100.00
32194. soulesskunoi (soulesskunoii_) 2 70.00 73.26 1 50.00
32195. Callum (callum_wiebe14) 2 72.28 75.08 1 50.00
32196. Jannik (jbirk) 2 76.71 77.86 0 0.00
32197. Safal (safal23) 2 50.53 62.31 1 50.00
32198. James (jamshm) 2 77.46 81.17 0 0.00
32199. Evan (aeviswhy) 2 62.69 64.83 0 0.00
32200. Steven (spfabian) 2 53.63 57.51 1 50.00
32201. Panda (panda2627) 2 31.90 36.48 0 0.00
32202. Thomas (bijlenman) 2 74.99 80.02 1 50.00
32203. Amruth (thedarknight40) 2 61.40 64.48 2 100.00
32204. Devin (djspi) 2 75.64 76.58 0 0.00
32205. Raymond (bowlcutninja) 2 62.81 78.40 1 50.00
32206. Faralha (faralha) 2 64.30 67.85 2 100.00
32207. James (jamesbt365) 2 77.34 82.43 0 0.00
32208. Yassin (yy86) 2 92.22 93.75 1 50.00
32209. Xziden (xziden) 2 71.23 72.61 1 50.00
32210. Alyx (ekatya) 2 121.20 127.70 1 50.00
32211. Raymond (kp1419) 2 84.32 88.95 0 0.00
32212. Jani (jankko77) 2 73.35 79.08 0 0.00
32213. Veljko (vucko777) 2 61.92 62.65 1 50.00
32214. " " (jawnny) 2 96.53 99.14 0 0.00
32215. Gabriel (cntbstr) 2 99.71 106.76 1 50.00
32216. Alim (amanzholov8) 2 64.20 65.05 0 0.00
32217. Ammar (ammarali047) 2 52.77 55.88 1 50.00
32218. pizzlyhusk (husker144) 2 81.50 84.38 1 50.00
32219. Aither (aither) 2 82.87 91.39 2 100.00
32220. jean (jeanoodles) 2 98.32 101.14 2 100.00
32221. starwars2151 (starwars2151) 2 112.04 112.06 2 100.00
32222. AP (ittoki_gaku) 2 46.23 46.93 0 0.00
32223. Halle (halleberry77) 2 59.41 60.47 0 0.00
32224. Orange (the_opulent_orange) 2 62.24 63.79 1 50.00
32225. Wud (wud_) 2 53.20 58.44 0 0.00
32226. Shay (guest102) 2 71.34 75.34 0 0.00
32227. Muhammad (mjuwaeni25) 2 36.82 39.05 0 0.00
32228. Adam (adam_phelan) 2 53.31 62.03 1 50.00
32229. Hotaru (tanglewreck) 2 73.24 74.88 0 0.00
32230. Jeb (jcay628) 2 61.33 72.04 0 0.00
32231. Tomáš (kokias) 2 65.19 67.95 2 100.00
32232. Tim (tlin7) 2 82.08 82.33 1 50.00
32233. maia (maiaau) 2 62.93 68.98 0 0.00
32234. NotGood (nogoodtyper) 2 59.06 61.12 1 50.00
32235. Jo (dsrezza123) 2 57.90 57.92 2 100.00
32236. Lin (blusewill) 2 51.20 57.06 0 0.00
32237. Michael (warpedwords) 2 95.19 97.01 0 0.00
32238. Ethan (etuann) 2 94.89 101.13 1 50.00
32239. Gergely (goldgamer2) 2 53.77 53.85 0 0.00
32240. fatih (fatiher) 2 59.40 61.96 0 0.00
32241. felix (lusciousbun) 2 67.99 74.41 0 0.00
32242. Aaron (01100001) 2 112.93 115.53 0 0.00
32243. Jackson (judyisbaby) 2 77.92 87.55 0 0.00
32244. TheLavaMouse (first_try) 2 67.52 70.92 0 0.00
32245. Nixon (nixonyung) 2 67.44 73.59 0 0.00
32246. Nick (nickxd1) 2 71.04 72.11 0 0.00
32247. hielo (hiel0) 2 57.31 57.70 1 50.00
32248. massive (ninjamaster0324) 2 67.47 78.84 0 0.00
32249. testicles (aigis99) 2 103.22 109.92 1 50.00
32250. hubs (hub600) 2 78.22 86.66 0 0.00
32251. Max (maximedupre) 2 67.22 68.53 0 0.00
32252. will (willychang21) 2 51.64 56.97 0 0.00
32253. Nick (mizuvapor) 2 76.03 77.02 2 100.00
32254. Infern (infernql) 2 72.22 72.96 0 0.00
32255. Dallas (darknightdal) 2 86.20 95.18 1 50.00
32256. zero (0crows) 2 44.15 47.08 0 0.00
32257. luizhp (luizhp) 2 60.57 67.19 2 100.00
32258. Paul (paulsmith4561) 2 65.98 73.12 2 100.00
32259. juniel (juniel999) 2 63.69 65.35 0 0.00
32260. TypingShark (virtualclark) 2 89.81 90.86 0 0.00
32261. poopmunkey (poopmunkey) 2 75.92 83.71 1 50.00
32262. 4.41 $ (zed_zed) 2 76.71 81.32 1 50.00
32263. Γεωργια (geosaurus_rex) 2 60.88 66.45 0 0.00
32264. Weldon (coconutsip) 2 85.08 86.70 1 50.00
32265. EmbersTheLimit (fm_producti... 2 66.46 67.02 2 100.00
32266. kunal (kunal012) 2 24.59 28.49 0 0.00
32267. Jan (fruitlessjester) 2 83.99 84.98 1 50.00
32268. HitchH1k3r (hitchh1k3r) 2 47.34 50.96 0 0.00
32269. Sandra (sxndraxmo) 2 63.29 70.29 0 0.00
32270. Vosshindran (astroscape) 2 66.01 72.23 1 50.00
32271. Ryan (mkace482) 2 47.23 48.21 0 0.00
32272. anuj (yadavanuj) 2 71.11 77.66 1 50.00
32273. Amy Nguyen (anguye58) 2 54.73 54.79 0 0.00
32274. Aaron (smallerpog) 2 80.87 82.07 0 0.00
32275. Sai Arpan (notbattlestar) 2 54.65 59.87 0 0.00
32276. Hugo Roberts (hugo_speed) 2 69.55 78.33 1 50.00
32277. Michael (odorf91) 2 53.42 53.81 0 0.00
32278. ewald (ewald2137) 2 90.21 96.19 1 50.00
32279. Abhay (twoseven) 2 50.09 52.72 1 50.00
32280. calo_0 (calo_0) 2 45.44 46.73 0 0.00
32281. valerie (vaalerie) 2 99.58 100.95 2 100.00
32282. yes_indeed (halodude11728) 2 88.64 97.75 0 0.00
32283. Zip53a (zip53a) 2 37.29 37.50 0 0.00
32284. Elliot (elliotff) 2 60.73 66.15 0 0.00
32285. k (kbostan) 2 70.70 71.07 2 100.00
32286. Caleb (chickenmac) 2 55.10 61.47 0 0.00
32287. Kvn (kvn482) 2 40.34 41.66 0 0.00
32288. ShadowTrail123 (abdu327) 2 90.35 93.14 1 50.00
32289. Yes (qwertydubs) 2 64.91 70.26 1 50.00
32290. Azerux (cleoalcanzo) 2 59.95 69.50 0 0.00
32291. Rod (grimmr) 2 74.04 74.08 1 50.00
32292. Yashwanth (yashspeedy) 2 79.84 79.95 0 0.00
32293. Ramon (dreadparadox) 2 40.44 41.29 0 0.00
32294. Filip (psycholog420) 2 68.74 71.49 0 0.00
32295. Jeff (blaurg) 2 124.11 125.75 1 50.00
32296. Johannes (jpq8) 2 39.13 40.74 2 100.00
32297. Ren (joebewildman) 2 91.08 94.52 2 100.00
32298. gary (furryman84) 2 100.49 103.78 1 50.00
32299. nate (natewon) 2 63.68 76.10 1 50.00
32300. Theo (billybigboy3) 2 87.56 97.66 1 50.00
32301. Accu (accu_) 2 63.25 65.87 2 100.00
32302. AhmedAsd (keys_slayer) 2 45.28 46.06 0 0.00
32303. Robin (rlkee888) 2 44.47 47.52 0 0.00
32304. A (ahzahraee) 2 61.59 66.24 0 0.00
32305. Dyfan (mesosphere) 2 77.96 81.28 2 100.00
32306. Martins (sneez1e) 2 66.14 67.48 1 50.00
32307. peanut (spuhgetee) 2 76.98 82.60 1 50.00
32308. Heisenberg (heisenberg11119) 2 76.27 76.70 0 0.00
32309. BiggieCheese (breadstick_ba... 2 57.15 58.29 1 50.00
32310. CP Addict (cpaddict02) 2 61.06 62.00 1 50.00
32311. Poke (thechosenpoke) 2 74.71 77.84 0 0.00
32312. Karl (kagia) 2 71.62 78.89 2 100.00
32313. Demons (demonsawaked) 2 63.50 68.33 0 0.00
32314. Barry Allen (tjbarter) 2 76.43 92.02 1 50.00
32315. JustaSkin (justaskin) 2 76.34 81.12 0 0.00
32316. RegalGiant (alyssa_lee) 2 51.46 56.54 0 0.00
32317. UPENDRA SINGH (upsc1002) 2 42.34 44.28 0 0.00
32318. Ryan (ryan86me) 2 129.02 129.02 2 100.00
32319. Petar (p3taar) 2 51.05 52.41 1 50.00
32320. pikabread (pikabread) 2 35.21 36.14 1 50.00
32321. Jimmy (abcsquirrel) 2 73.74 77.96 0 0.00
32322. Guardian (darkforce097) 2 91.73 92.94 2 100.00
32323. Deandre Javier (razer_corte... 2 72.67 84.80 2 100.00
32324. hooh (cdmkk) 2 43.09 47.02 1 50.00
32325. Kimmalyn (kimmalyn) 2 68.65 71.00 0 0.00
32326. Emma (etyper987) 2 90.19 96.08 1 50.00
32327. S (omniron) 2 85.02 88.68 1 50.00
32328. AJVJ (ajvj69) 2 56.02 62.25 0 0.00
32329. Thomas (201lucario) 2 84.90 89.62 0 0.00
32330. poomonky (poomonky) 2 93.42 99.94 2 100.00
32331. Bombic (pugata) 2 52.31 54.37 0 0.00
32332. BDOG (bmagill) 2 90.92 95.53 0 0.00
32333. Najmi (tokimpoi) 2 59.24 61.46 0 0.00
32334. THICCNESS (thiccnesss) 2 60.68 65.13 0 0.00
32335. Ln (ln45) 2 92.31 95.02 2 100.00
32336. Juan (milosabogal) 2 81.71 84.10 1 50.00
32337. Kinglord (kinglord1090) 2 53.57 56.50 1 50.00
32338. Ian (nai0515) 2 68.73 70.32 1 50.00
32339. Alex (apbriggs) 2 52.93 56.94 0 0.00
32340. Blake (animeweeb1) 2 38.01 41.52 0 0.00
32341. Kim (karenkim99) 2 78.36 91.52 1 50.00
32342. Guillaine (admires) 2 105.11 105.44 2 100.00
32343. Spicy! (spicynoodlez) 2 65.30 67.85 1 50.00
32344. Kate (kdebloois) 2 96.60 102.10 1 50.00
32345. SpeedyVelcro (speedyvelcro) 2 77.23 83.17 1 50.00
32346. Amr (batatah) 2 67.68 70.93 0 0.00
32347. kyro (kyroven) 2 110.98 113.61 1 50.00
32348. biffulator (biffulator) 2 79.26 89.27 0 0.00
32349. Lublu (lublu) 2 63.36 66.77 0 0.00
32350. BWBH (bwbh) 2 78.05 78.90 1 50.00
32351. zawarudo (cyube) 2 82.95 84.19 0 0.00
32352. Shahjoo (shahjoo) 2 119.40 124.41 1 50.00
32353. BobiWan (bobiwan) 2 50.24 50.31 0 0.00
32354. Nicole (nicolyolyo) 2 94.76 97.97 1 50.00
32355. Chris (chrisyx511) 2 84.19 86.31 2 100.00
32356. Minh (daominh89) 2 58.81 59.94 2 100.00
32357. Mrs. (tomiswanson) 2 52.47 58.07 0 0.00
32358. MTABreath (mtabreath) 2 64.22 67.19 1 50.00
32359. Jorge (jemg) 2 52.11 61.67 2 100.00
32360. Marvin (kaiclc) 2 97.38 98.05 1 50.00
32361. Willie (kakkarrot) 2 75.09 89.32 0 0.00
32362. Zamiel (ikaeren) 2 107.51 119.98 0 0.00
32363. SayaBetaAku (sayabetaaku) 2 73.52 88.41 1 50.00
32364. oropon (oropon) 2 67.81 78.13 1 50.00
32365. Ry (elyr) 2 43.19 45.73 0 0.00
32366. Nyx (lunitari) 2 95.65 98.26 2 100.00
32367. Robert (caerus3) 2 59.20 61.83 1 50.00
32368. Apoorv (apoorv09) 2 63.37 66.62 0 0.00
32369. Conner (connersig) 2 73.11 82.40 1 50.00
32370. Tsifyarc (crayfist) 2 78.12 81.18 1 50.00
32371. Rajarshi (raj_arshi) 2 44.36 46.11 0 0.00
32372. EH86055 (eh86055) 2 52.58 54.47 0 0.00
32373. Sam (samb2o) 2 46.92 47.59 0 0.00
32374. Poly (polytechnix) 2 72.79 78.46 0 0.00
32375. Bertram (bertram_fink) 2 44.17 44.94 0 0.00
32376. Karan (chotuganpat) 2 76.00 88.05 0 0.00
32377. Lost (lostmail) 2 89.19 93.16 2 100.00
32378. Jonas (oat_punk) 2 75.45 75.86 0 0.00
32379. Rafael (yugnar) 2 90.05 96.07 1 50.00
32380. kitzure (kitzure) 2 68.43 80.72 1 50.00
32381. Ollieology11 (55ollie) 2 61.06 65.29 0 0.00
32382. Sebastian (typerracer2007) 2 74.52 78.83 1 50.00
32383. Yuglooc (yuglooc) 2 100.86 101.24 1 50.00
32384. Smexy Bby ♥️ (bright_lord) 2 59.71 70.38 1 50.00
32385. Djaïra (dsm_) 2 66.30 74.61 0 0.00
32386. Sigre (sigre) 2 58.57 61.34 0 0.00
32387. Noah (gleems) 2 70.13 74.28 1 50.00
32388. Chili (real_chili) 2 79.68 83.39 1 50.00
32389. Rioichi (rioichicooper) 2 71.70 74.55 0 0.00
32390. Vigilem (vigilem) 2 92.97 94.59 0 0.00
32391. MuckPie (muckpie) 2 100.93 117.36 1 50.00
32392. Ngan (nganthoiba) 2 31.18 33.54 1 50.00
32393. Abhishek (abhishek55) 2 73.03 74.20 0 0.00
32394. Justin (flowbeat) 2 62.04 67.61 1 50.00
32395. Adibov (adibov) 2 65.54 67.17 0 0.00
32396. Max (stealthytyper) 2 86.41 90.93 0 0.00
32397. James (verysoftpillows) 2 93.71 106.03 0 0.00
32398. sam (jekkooooo) 2 51.56 59.24 0 0.00
32399. AH (aasiyah_) 2 43.59 44.64 1 50.00
32400. supercoolman1000 (epicgamer... 2 83.05 83.37 2 100.00
32401. David (dfisch17) 2 109.96 118.56 1 50.00
32402. Nikola (clear_blue_night) 2 65.45 68.94 1 50.00
32403. villed3 (villed3) 2 70.87 75.80 1 50.00
32404. Bilhalva (there_is_time) 2 61.08 61.61 0 0.00
32405. matt (mattplot) 2 75.07 77.32 0 0.00
32406. jean phillipe (jean_phillipe) 2 72.69 76.13 0 0.00
32407. Rosa (rosaachen) 2 90.49 96.64 1 50.00
32408. alex (amonell) 2 49.21 54.80 0 0.00
32409. Ice (wonderpanties) 2 95.61 104.15 1 50.00
32410. nick (nick1229) 2 90.34 95.48 2 100.00
32411. Amanda (amanda1817) 2 75.34 83.62 1 50.00
32412. Josh (jmith18) 2 68.77 73.12 1 50.00
32413. HEY! slow down (maddy_1) 2 81.22 87.15 2 100.00
32414. Max (hardyb1) 2 93.36 96.42 1 50.00
32415. Adam (adammi) 2 30.11 30.51 0 0.00
32416. Johnalyn Mae (sparkle_galaxy) 2 31.19 36.08 0 0.00
32417. Kevin (kebino_) 2 106.08 117.54 0 0.00
32418. MrTree (mrtee579) 2 59.65 65.70 1 50.00
32419. Luka (lukajk) 2 91.92 95.90 0 0.00
32420. Hugo (ligu) 2 50.31 52.47 0 0.00
32421. Gummin (gummin) 2 91.21 100.66 0 0.00
32422. Dominik (wakuly) 2 50.92 57.23 0 0.00
32423. Teron (xribenx) 2 69.70 82.03 0 0.00
32424. Ecksdee (deadhim) 2 82.27 87.67 0 0.00
32425. Rushik (rushikk) 2 65.87 67.99 1 50.00
32426. ニール (adieeeee) 2 74.32 77.57 0 0.00
32427. Ati (atsngh11) 2 44.82 45.18 0 0.00
32428. DmPower (dmpower) 2 59.44 73.65 1 50.00
32429. Gl1tched (gl1tched) 2 47.05 48.91 0 0.00
32430. Kenny (kennylou) 2 34.59 38.84 1 50.00
32431. BigPhattBee (aldztypes) 2 73.64 79.29 2 100.00
32432. Alexander (edehag_wpm) 2 72.36 85.01 1 50.00
32433. BajanTravis (bajantravis) 2 40.94 47.07 0 0.00
32434. leftieloosy (leftieloosy) 2 62.32 64.56 0 0.00
32435. f (fsdafasdfasdfsa) 2 38.45 42.10 0 0.00
32436. Dylan (shark2g) 2 67.18 69.56 1 50.00
32437. Truong (tpltruong) 2 67.29 68.88 2 100.00
32438. Najmul Huda Chowdhury (krid... 2 14.26 14.76 1 50.00
32439. Charlie (charlie_teaa) 2 79.88 90.01 1 50.00
32440. Muthulakshmanan (sparks0x3) 2 27.12 29.84 0 0.00
32441. Elias Claesson (moreniceice) 2 67.03 67.05 0 0.00
32442. Naidel (naidel) 2 62.59 65.23 0 0.00
32443. lol (lollols) 2 69.77 71.11 1 50.00
32444. electro (cavegame) 2 48.97 54.37 2 100.00
32445. bucket (bucketpotato) 2 105.43 110.48 2 100.00
32446. DEVA (nandhuismyname) 2 32.35 32.46 0 0.00
32447. Victoria (toriastar) 2 84.22 85.73 1 50.00
32448. joher (joher) 2 39.64 40.17 0 0.00
32449. Andrew (drew_24) 2 56.87 61.20 0 0.00
32450. Springhunk (springhunk) 2 104.04 112.93 1 50.00
32451. caro (cvroline) 2 66.66 67.19 1 50.00
32452. Zack (zgoose013) 2 69.62 77.71 2 100.00
32453. Chuu (leichenny) 2 64.06 73.66 1 50.00
32454. roverns (roverns) 2 72.33 88.00 1 50.00
32455. Jed (hyperie) 2 79.50 80.19 1 50.00
32456. Default (defaultracer) 2 63.45 70.01 0 0.00
32457. Hero3life (herolife) 2 98.02 98.90 2 100.00
32458. FirstName (i5kxepeu) 2 76.10 81.26 0 0.00
32459. Stephen (bananapants8192) 2 90.22 91.94 0 0.00
32460. liv (livtr) 2 66.20 72.80 0 0.00
32461. Hobbestes (hobbesters) 2 50.52 52.02 0 0.00
32462. Jacob (slickserpent99) 2 84.37 90.63 0 0.00
32463. dom (domanater) 2 94.17 104.47 1 50.00
32464. Arthur (arthursgo) 2 41.04 41.96 0 0.00
32465. N (nathankai) 2 67.65 70.44 1 50.00
32466. AnimeUncovers (animeuncovers) 2 38.32 41.77 0 0.00
32467. Alex (poopyjeans) 2 93.28 96.12 1 50.00
32468. Bots (itsbots) 2 94.85 99.95 0 0.00
32469. James (sidewindersamurai) 2 75.78 79.58 0 0.00
32470. Kiril (kiril9016) 2 44.65 49.86 0 0.00
32471. Pog (djjjoris) 2 72.59 72.61 0 0.00
32472. Roshan (roshan2999) 2 103.19 104.97 2 100.00
32473. Kushagra (leafygarlic) 2 72.57 75.92 1 50.00
32474. adam (ad4m_p3arc3) 2 65.39 69.41 1 50.00
32475. Aditya (aditya_mohapatra) 2 49.32 49.81 0 0.00
32476. Levi Ackerman (atharva2007) 2 44.38 48.55 0 0.00
32477. flowstate (___flowstate) 2 121.22 135.28 1 50.00
32478. Michael (big_mike) 2 90.57 93.04 0 0.00
32479. Digby (d16by) 2 63.96 64.63 0 0.00
32480. Gbutterboy (gbutterboy) 2 42.51 45.54 0 0.00
32481. Simon (sheepkillzyu) 2 96.29 101.47 1 50.00
32482. Immanuel (nooblegends17) 2 37.29 37.54 0 0.00
32483. Nicole (lanzaneddeus) 2 66.80 67.00 0 0.00
32484. Winter (wintersylvia) 2 53.24 53.51 0 0.00
32485. Merey (typeracernomer1) 2 52.41 55.56 0 0.00
32486. Richard (dortikcz) 2 58.18 63.78 1 50.00
32487. Whitney (drxpdeadgxrgexs) 2 87.42 89.50 0 0.00
32488. Lucas (lucfig20) 2 45.24 49.04 0 0.00
32489. Robert (itsmecliffy) 2 55.09 61.47 0 0.00
32490. Cooper (chanson02) 2 70.03 92.99 1 50.00
32491. Jano (animilia) 2 39.96 41.35 1 50.00
32492. Eric (acedude) 2 85.36 89.20 2 100.00
32493. Boki (deadliestpixel) 2 96.44 108.18 1 50.00
32494. Jake (jakerevenge) 2 88.73 92.91 2 100.00
32495. cameron (camfron) 2 45.53 46.60 0 0.00
32496. Nathan (n8playsbass) 2 57.72 65.48 0 0.00
32497. Deval (nakuora) 2 46.23 47.57 0 0.00
32498. Joaquin (unorginalkiddd) 2 28.60 32.78 0 0.00
32499. Edison (azulistair) 2 53.18 57.42 0 0.00
32500. Syahrul (syharulhamdani) 2 75.21 81.45 1 50.00
32501. JJ (oldmanspeed) 2 95.80 96.73 2 100.00
32502. Guardprimo (guardprimo) 2 55.07 56.71 0 0.00
32503. Alan (lewuske) 2 65.03 69.47 1 50.00
32504. Supkym (supkym) 2 54.96 59.01 0 0.00
32505. Jose (jaag65) 2 40.15 41.12 0 0.00
32506. ethan (minimomo) 2 86.35 89.49 2 100.00
32507. Moin (momo666) 2 38.14 39.38 0 0.00
32508. Merlin (mer_lin) 2 95.48 101.66 1 50.00
32509. Destroyer152 (destroyer152) 2 53.60 59.43 0 0.00
32510. Sindre Mandelid (ewers01) 2 72.65 79.31 0 0.00
32511. Yash Raj (outl13r) 2 51.63 53.07 0 0.00
32512. Jamie (niflunar) 2 69.93 81.25 1 50.00
32513. Va (vanianita21) 2 36.00 41.64 0 0.00
32514. Liam (potneckstump) 2 76.18 78.27 0 0.00
32515. Daniel (sandmanno) 2 61.05 65.24 1 50.00
32516. Turkey2 (turkey_2) 2 44.84 49.30 1 50.00
32517. afsheen (afsheenshafayet) 2 33.34 34.73 1 50.00
32518. Boon (hunboon) 2 89.65 96.78 1 50.00
32519. Sammy (kawaiicece) 2 70.96 71.66 2 100.00
32520. Kalyan (kalyan_k) 2 50.51 52.33 0 0.00
32521. RezTrencher (rezalfn) 2 17.88 23.13 1 50.00
32522. Jimmy (deutschsc) 2 28.26 29.67 0 0.00
32523. Jochen (jochenmehlich) 2 96.47 101.89 2 100.00
32524. jjbuddyhi (jjboddyhi) 2 96.74 99.87 0 0.00
32525. Louis (louisgoldtrophy) 2 70.52 77.88 0 0.00
32526. Sneaky (sneakyturtle69420) 2 53.40 58.20 0 0.00
32527. Zhazira (29jazi) 2 41.52 41.87 0 0.00
32528. Pig (goldenpig55) 2 81.36 88.95 0 0.00
32529. Kloris (moondanc_r) 2 79.81 87.46 2 100.00
32530. Sophie (ariesmoon) 2 80.96 81.26 0 0.00
32531. blaszko14 (bulszatan14) 2 69.68 72.44 2 100.00
32532. Matan (teroxil) 2 92.97 98.41 0 0.00
32533. Justine (iamsrl1020) 2 55.17 63.62 1 50.00
32534. Diego (saucegod_rc) 2 50.26 51.33 1 50.00
32535. Zedix (_zedix_) 1 92.48 92.48 0 0.00
32536. dippyflippy (_xtremeultra_) 1 73.06 73.06 0 0.00
32537. Simon (_wolfram) 1 70.57 70.57 1 100.00
32538. WhaLeS (_whal3s) 1 72.02 72.02 0 0.00
32539. Try (_tryhard_) 1 43.66 43.66 0 0.00
32540. Sujal (_sujal_panwar_) 1 58.39 58.39 0 0.00
32541. Gustave (_stavegu_) 1 44.77 44.77 0 0.00
32542. ALi (_octopus_) 1 53.37 53.37 0 0.00
32543. mel (_melissa9_) 1 50.39 50.39 0 0.00
32544. Liv (_liiv_) 1 34.23 34.23 0 0.00
32545. Miles (_kilometers_) 1 91.95 91.95 1 100.00
32546. kelly:)) (_kelly) 1 91.68 91.68 0 0.00
32547. Jan (_jan_) 1 41.28 41.28 0 0.00
32548. donkey (_donkey) 1 105.16 105.16 1 100.00
32549. Connor (_cyber_) 1 72.30 72.30 1 100.00
32550. cyberrex aka (_cyberrex) 1 55.33 55.33 0 0.00
32551. adelina (zzzyawn) 1 111.90 111.90 0 0.00
32552. zzzr (zzzr) 1 175.47 175.47 1 100.00
32553. zulueta (zzxjoanw) 1 93.27 93.27 1 100.00
32554. Ian (zzstatixzz) 1 84.45 84.45 0 0.00
32555. Hayden (zylixer) 1 94.04 94.04 0 0.00
32556. joe (zyas) 1 69.93 69.93 0 0.00
32557. Mohammad (zxelrate) 1 93.99 93.99 1 100.00
32558. Nikolaus (zweehn) 1 74.13 74.13 0 0.00
32559. Mokhirjon (zvermafia) 1 61.32 61.32 0 0.00
32560. John (ztriplez) 1 129.14 129.14 0 0.00
32561. Daniele (zspida) 1 34.86 34.86 0 0.00
32562. Alex (zoggthefantastic) 1 52.84 52.84 0 0.00
32563. lev (zoevespa) 1 59.94 59.94 0 0.00
32564. Matthew (zoddiak) 1 99.45 99.45 1 100.00
32565. Boof (zmoney0805) 1 86.56 86.56 0 0.00
32566. zlyzah (zlyzah123) 1 120.39 120.39 1 100.00
32567. zizu08 (zizu08) 1 62.11 62.11 0 0.00
32568. Dan (zizochefe) 1 85.35 85.35 1 100.00
32569. ZIRRO (zirro7825) 1 48.86 48.86 0 0.00
32570. zion=overrated (ziongotnohops) 1 92.89 92.89 0 0.00
32571. noodle (zhyua001) 1 64.88 64.88 1 100.00
32572. Aleksandra (zhisniacova) 1 48.48 48.48 0 0.00
32573. Zhen (zhenshin) 1 61.96 61.96 0 0.00
32574. z (zhempal) 1 68.30 68.30 0 0.00
32575. zHekLeR (zhekler) 1 115.65 115.65 0 0.00
32576. Zhan (zhanzhaksylyk) 1 67.66 67.66 0 0.00
32577. Zeus (zeuseus) 1 71.02 71.02 1 100.00
32578. (zeoxsys) 1 72.36 72.36 0 0.00
32579. Zen (zen_xs) 1 67.39 67.39 0 0.00
32580. zach (zdub25) 1 45.02 45.02 0 0.00
32581. Mikhail The Greatest (zdaro... 1 34.32 34.32 1 100.00
32582. RJ (zayles) 1 49.61 49.61 0 0.00
32583. Chariko (zardula) 1 69.48 69.48 0 0.00
32584. Zan (zanimeyt) 1 23.52 23.52 1 100.00
32585. Zambrix (zambrix) 1 129.69 129.69 1 100.00
32586. zakkayyy (zakkayyy) 1 56.89 56.89 1 100.00
32587. Zain (zainali23) 1 109.56 109.56 1 100.00
32588. Zagorath (zagorath) 1 138.86 138.86 1 100.00
32589. zealody (zackrobot) 1 147.55 147.55 0 0.00
32590. zahra (zaaahra) 1 40.93 40.93 0 0.00
32591. mike (yyu2017) 1 59.26 59.26 0 0.00
32592. No (yygt777) 1 106.28 106.28 0 0.00
32593. will (ywhh) 1 114.77 114.77 1 100.00
32594. Yu Zhe (yuzhetang) 1 58.20 58.20 1 100.00
32595. Yuvraj (yuvisinghie) 1 108.28 108.28 1 100.00
32596. Yuval (yuvf) 1 62.70 62.70 1 100.00
32597. Keith (yung_hep) 1 78.22 78.22 1 100.00
32598. ultra (yurm) 1 40.14 40.14 0 0.00
32599. Ben (yungmartyb) 1 80.75 80.75 0 0.00
32600. Tommy (yungleeee) 1 92.06 92.06 0 0.00
32601. Yuh (yuhboydeath) 1 69.42 69.42 0 0.00
32602. Sebastian (yugireo) 1 103.35 103.35 0 0.00
32603. Yash (ys07) 1 19.65 19.65 0 0.00
32604. Brennen (you_arent_my_type) 1 104.85 104.85 0 0.00
32605. yt etherlol (youtube_etherlol) 1 37.04 37.04 0 0.00
32606. Avsome (youtooz_sellout) 1 55.67 55.67 0 0.00
32607. Rui (youngjaerui) 1 116.62 116.62 0 0.00
32608. Youc (youc_tagh) 1 45.23 45.23 0 0.00
32609. transcontinentalrailroad (y... 1 96.71 96.71 0 0.00
32610. Jack (yolomcswag56) 1 100.53 100.53 1 100.00
32611. YoGurt (yogurt026) 1 96.80 96.80 0 0.00
32612. Lawrence (yogaisbc) 1 80.97 80.97 1 100.00
32613. print("Desconocid0h")#0482 ... 1 81.61 81.61 1 100.00
32614. Park Shin Hye (yipaepaen) 1 89.05 89.05 0 0.00
32615. Yes (yesyesman) 1 57.05 57.05 0 0.00
32616. Yeraen (yeraen) 1 71.58 71.58 0 0.00
32617. Owen (yellzy) 1 66.92 66.92 1 100.00
32618. Bruh (yeetzy) 1 81.30 81.30 1 100.00
32619. FoundSquid (yeetpp) 1 83.07 83.07 0 0.00
32620. dukranli (yeetmen) 1 94.72 94.72 0 0.00
32621. Yeesh (yeesh) 1 82.48 82.48 0 0.00
32622. yata (yatapvd) 1 65.19 65.19 0 0.00
32623. Yasmin (yasminrusty) 1 95.21 95.21 1 100.00
32624. Yaroslav (yasi04) 1 44.76 44.76 1 100.00
32625. Yape (yape) 1 71.27 71.27 0 0.00
32626. Skathi (yangnakz) 1 41.88 41.88 0 0.00
32627. Ming (yangming) 1 128.64 128.64 1 100.00
32628. tstats[yam] (yammagar) 1 49.90 49.90 0 0.00
32629. Yambo (yamboyam) 1 65.98 65.98 0 0.00
32630. Jake (yakoubhachimi) 1 76.99 76.99 0 0.00
32631. Yakend (yakend) 1 89.28 89.28 0 0.00
32632. yahya (yahya121) 1 39.23 39.23 0 0.00
32633. YourDeath (yabeach) 1 42.64 42.64 0 0.00
32634. Yaaaawn (yaaawn) 1 36.04 36.04 0 0.00
32635. M (xyx2x) 1 75.49 75.49 0 0.00
32636. Artur (xxxartikxxx) 1 64.60 64.60 0 0.00
32637. Sam (xxdiggyxx) 1 81.17 81.17 0 0.00
32638. Nea (xurnub) 1 80.38 80.38 0 0.00
32639. Xumo (xumovoid) 1 71.17 71.17 1 100.00
32640. Sugma (xpholio) 1 81.01 81.01 0 0.00
32641. Greg (xpec824) 1 96.04 96.04 1 100.00
32642. Bryan (xoticfate) 1 62.88 62.88 1 100.00
32643. Xontez (xontez) 1 68.95 68.95 0 0.00
32644. Thomas (xnefas) 1 68.98 68.98 0 0.00
32645. Gamer (xmph) 1 90.89 90.89 1 100.00
32646. Martin (xmerticx) 1 69.80 69.80 0 0.00
32647. XLASh (xlash) 1 32.20 32.20 0 0.00
32648. matthew (xhiffer) 1 67.53 67.53 0 0.00
32649. Gustavo (xevki) 1 109.66 109.66 1 100.00
32650. Ru (xeruu) 1 65.58 65.58 0 0.00
32651. Bradley (xerius1234) 1 101.22 101.22 0 0.00
32652. Ksawery (xenzy) 1 65.54 65.54 0 0.00
32653. nyep (xd_tdm) 1 72.36 72.36 1 100.00
32654. you touch my (xdidox) 1 76.00 76.00 0 0.00
32655. Tanel (xax1) 1 88.05 88.05 0 0.00
32656. Xavier Rich (xavier_0818) 1 82.39 82.39 0 0.00
32657. XaRuXu (xaruxu) 1 91.81 91.81 0 0.00
32658. Sean (xanxusgao14) 1 106.85 106.85 1 100.00
32659. Saptarsi (xanxian) 1 31.21 31.21 0 0.00
32660. xandi (xandic) 1 74.79 74.79 0 0.00
32661. Xander (xanderthegreater) 1 66.28 66.28 0 0.00
32662. Xander (xander93) 1 74.46 74.46 0 0.00
32663. Xanafer (xanafer630) 1 102.58 102.58 1 100.00
32664. Marcus (x5starmodding) 1 103.06 103.06 0 0.00
32665. Aj (x2happy123) 1 87.61 87.61 0 0.00
32666. person (w_person) 1 29.29 29.29 0 0.00
32667. Wybie (wybiehamster) 1 103.49 103.49 1 100.00
32668. Captain Constance (wyattcs) 1 111.74 111.74 1 100.00
32669. sm (wwmon) 1 63.39 63.39 1 100.00
32670. TJ (wtfitst2daj) 1 130.44 130.44 1 100.00
32671. Will (wsger) 1 105.13 105.13 1 100.00
32672. William (wrneale) 1 84.66 84.66 0 0.00
32673. TheVictor (wrmor) 1 58.27 58.27 0 0.00
32674. Ella (wrenegadecath) 1 72.67 72.67 1 100.00
32675. candice (wotah_zonea_8) 1 48.33 48.33 0 0.00
32676. Won (wontong) 1 60.87 60.87 0 0.00
32677. Jin (wongzi) 1 81.91 81.91 0 0.00
32678. Olle (wolle) 1 53.42 53.42 0 0.00
32679. WolfTypist (wolftypist) 1 92.70 92.70 0 0.00
32680. Empurrer Meow (wolfbream) 1 109.00 109.00 0 0.00
32681. Wok (wok_e) 1 87.35 87.35 0 0.00
32682. matt (wokpikmin555) 1 76.69 76.69 1 100.00
32683. Wokboi (wokboi) 1 87.61 87.61 1 100.00
32684. William (wmpmills) 1 64.57 64.57 0 0.00
32685. Luciano (wizing) 1 87.96 87.96 1 100.00
32686. omar (wizard24h) 1 113.14 113.14 0 0.00
32687. James (withdraw) 1 96.71 96.71 0 0.00
32688. death zigoq (winzu44) 1 61.83 61.83 0 0.00
32689. Winternet (winternet) 1 52.19 52.19 0 0.00
32690. Wint3rr (wint3r) 1 104.32 104.32 0 0.00
32691. Winni (winnii26) 1 40.47 40.47 1 100.00
32692. Anne-Sophie (winniethepooh2... 1 69.39 69.39 0 0.00
32693. Mateo (winggomateo) 1 107.18 107.18 1 100.00
32694. Winged (winged_shell) 1 89.00 89.00 0 0.00
32695. aaaaaaa (windpiggy) 1 132.50 132.50 1 100.00
32696. ... (willnyeasianguy) 1 59.83 59.83 0 0.00
32697. willmtx (willmtx) 1 109.14 109.14 0 0.00
32698. William (william_wonka) 1 91.11 91.11 0 0.00
32699. William (williamyang94) 1 96.00 96.00 1 100.00
32700. William (williamxu78) 1 96.01 96.01 0 0.00
32701. William (williamjr2004) 1 70.12 70.12 0 0.00
32702. William (willhyt) 1 92.63 92.63 0 0.00
32703. Will (willchristian00) 1 70.59 70.59 0 0.00
32704. WH (will0wisp1) 1 61.87 61.87 0 0.00
32705. wcbyte (wileyc19) 1 65.33 65.33 0 0.00
32706. (wildlife) 1 154.67 154.67 0 0.00
32707. David (wiiun) 1 50.89 50.89 0 0.00
32708. William (wiigocadee) 1 81.36 81.36 0 0.00
32709. stephan (wierdio) 1 77.57 77.57 0 0.00
32710. Sha (wieng423) 1 47.38 47.38 0 0.00
32711. Emma (whyitsjustatypingsite) 1 99.65 99.65 0 0.00
32712. Sam (whotoldyouthat) 1 94.74 94.74 0 0.00
32713. Alex (whitehoundd) 1 62.84 62.84 0 0.00
32714. Lee (whaocool) 1 59.58 59.58 0 0.00
32715. Will (wgomez1025) 1 112.92 112.92 1 100.00
32716. David (westie) 1 86.20 86.20 0 0.00
32717. andrew (weirdna) 1 104.98 104.98 0 0.00
32718. Frank (weetbixkid) 1 99.26 99.26 1 100.00
32719. Jia Quan (weejiaquan) 1 90.41 90.41 0 0.00
32720. WeariedCoffee2 (weariedcoff... 1 96.02 96.02 0 0.00
32721. Jakob (wcd1) 1 59.86 59.86 0 0.00
32722. storm-gg (waytooclose) 1 81.41 81.41 0 0.00
32723. Wawa (wawa286) 1 96.30 96.30 0 0.00
32724. Matt (wavytypesfastafbrah) 1 115.70 115.70 1 100.00
32725. Watson (watson0115) 1 34.05 34.05 0 0.00
32726. 4Palestine (wassim321) 1 77.28 77.28 0 0.00
32727. Warren (warrudd) 1 95.05 95.05 1 100.00
32728. warm (warmlettuce) 1 90.52 90.52 0 0.00
32729. hoang viet (waniku) 1 87.80 87.80 1 100.00
32730. Adam (wallboy) 1 119.64 119.64 1 100.00
32731. Walker (walkerthehat) 1 81.89 81.89 0 0.00
32732. Keshav (waldotheonlyone) 1 87.83 87.83 0 0.00
32733. Big Boy Diamonds (waist) 1 83.07 83.07 1 100.00
32734. Bean (waialiki) 1 61.45 61.45 0 0.00
32735. Najmul (wahid99) 1 51.30 51.30 0 0.00
32736. LMFAOOOOOOOOOOOOOOOOOOOOOOO... 1 158.72 158.72 1 100.00
32737. Wade (wadewilson) 1 111.92 111.92 1 100.00
32738. Waddles (waddles_) 1 80.17 80.17 0 0.00
32739. Vee (v_typer) 1 53.27 53.27 0 0.00
32740. Vyom (vyomk27) 1 77.52 77.52 0 0.00
32741. i choke too much (vxnd_ttxa) 1 63.97 63.97 0 0.00
32742. vvvvvvv (vvtzvv) 1 68.83 68.83 1 100.00
32743. vurple (vurple) 1 119.90 119.90 0 0.00
32744. Mike (vual_) 1 114.91 114.91 1 100.00
32745. vtopfam (vtopfam) 1 58.64 58.64 0 0.00
32746. tstats[vrooooom1337] (vrooo... 1 97.90 97.90 0 0.00
32747. Voob (voobit) 1 77.99 77.99 0 0.00
32748. Volta (volta_xty) 1 58.05 58.05 0 0.00
32749. Arun (voidvortex) 1 67.07 67.07 0 0.00
32750. meryou (vmerv) 1 22.98 22.98 0 0.00
32751. Vlad (vlad_bizin) 1 37.39 37.39 0 0.00
32752. V (vladk0) 1 70.10 70.10 0 0.00
32753. Vlaad (vladiii) 1 58.30 58.30 0 0.00
32754. Duzzy (vladieboi) 1 111.58 111.58 1 100.00
32755. varuvaru (vividkun) 1 85.58 85.58 0 0.00
32756. Indiastopsww3 (vivekpjoshy) 1 36.44 36.44 0 0.00
32757. coen (vivalad) 1 75.07 75.07 1 100.00
32758. visual (visual9) 1 86.56 86.56 0 0.00
32759. Viraj (viruthefire) 1 70.72 70.72 1 100.00
32760. Niggo (virtualnick) 1 62.90 62.90 0 0.00
32761. Chase (viper681) 1 107.15 107.15 0 0.00
32762. Patrick (viperpat) 1 69.90 69.90 0 0.00
32763. Xx_DiwaliGaming_xX (violert) 1 98.06 98.06 0 0.00
32764. Yeoh (vinylsen) 1 31.68 31.68 0 0.00
32765. Vintus_Pancere (vintus_panc... 1 76.05 76.05 0 0.00
32766. UwU (vintiny) 1 94.85 94.85 0 0.00
32767. Vinoth (vinoth46) 1 65.96 65.96 1 100.00
32768. VinnyisEpic (vinnymason928) 1 62.11 62.11 0 0.00
32769. Vinka (vinka_anggita) 1 55.41 55.41 1 100.00
32770. 2SCucumber (vincicheung361) 1 59.27 59.27 0 0.00
32771. VinceFX (vincefx) 1 95.99 95.99 1 100.00
32772. Vincent (vinc20w) 1 53.68 53.68 0 0.00
32773. mhtnx (vim_sen) 1 77.07 77.07 0 0.00
32774. vile11s (vile11s) 1 73.19 73.19 1 100.00
32775. Viktor (viktorpisatelq) 1 53.67 53.67 0 0.00
32776. Viktordido (viktor_dido27) 1 59.80 59.80 0 0.00
32777. Viktor (viksaniksa) 1 78.56 78.56 1 100.00
32778. Erik (vike92) 1 73.26 73.26 0 0.00
32779. Vignesh (vigneshc) 1 165.79 165.79 1 100.00
32780. Ian (vidar11) 1 51.97 51.97 0 0.00
32781. Vinicius (vidal404) 1 45.49 45.49 1 100.00
32782. Victor (victors3n34) 1 51.45 51.45 0 0.00
32783. David (vicksdawg) 1 110.52 110.52 1 100.00
32784. Victoria (vghanma) 1 80.52 80.52 0 0.00
32785. Vexisu (vexisu) 1 54.45 54.45 0 0.00
32786. Toby (vestrax) 1 71.29 71.29 0 0.00
32787. Very Noob (very_noob) 1 63.86 63.86 1 100.00
32788. (veryslowracer) 1 150.63 150.63 1 100.00
32789. Greg (vertcanard) 1 140.68 140.68 1 100.00
32790. Eram (verstecken) 1 64.30 64.30 1 100.00
32791. vck3000 (vck3000) 1 137.21 137.21 1 100.00
32792. Ian but less cool (vcap36) 1 108.22 108.22 0 0.00
32793. Sambath (vatana7) 1 80.57 80.57 0 0.00
32794. Varun (varun2) 1 84.49 84.49 1 100.00
32795. varitox (varitox) 1 36.84 36.84 0 0.00
32796. Vhae (variesg25) 1 34.57 34.57 0 0.00
32797. Farbod (varbov) 1 75.40 75.40 1 100.00
32798. vaquinha (vaquinha) 1 31.07 31.07 1 100.00
32799. deicius (vantaclock) 1 100.85 100.85 0 0.00
32800. Miguel (vansterrgod) 1 109.37 109.37 0 0.00
32801. Vanq5 (vanquisher5) 1 109.03 109.03 1 100.00
32802. Vanessa (vanessad6379) 1 68.99 68.99 0 0.00
32803. J (valorantjoon) 1 43.79 43.79 0 0.00
32804. vain (vaininsanity) 1 112.01 112.01 0 0.00
32805. Vagrant Niff (vagrantniff) 1 66.59 66.59 0 0.00
32806. 🤟 Aguero 😁 (vadamulu) 1 74.27 74.27 0 0.00
32807. Roh (uzu23) 1 83.41 83.41 1 100.00
32808. Utmarteas (utmarteas) 1 78.09 78.09 0 0.00
32809. usually (usually99) 1 60.85 60.85 0 0.00
32810. Yunus (usslang) 1 79.78 79.78 1 100.00
32811. TheAcc (use_r_name) 1 104.36 104.36 1 100.00
32812. Evelyn (username0531) 1 67.85 67.85 1 100.00
32813. Carlos (user0x539) 1 74.94 74.94 1 100.00
32814. Sophie (ururunwolf) 1 119.82 119.82 0 0.00
32815. crooow (urrmomscockroach) 1 63.47 63.47 0 0.00
32816. kerokero (urechila) 1 100.68 100.68 0 0.00
32817. mak (urhg66) 1 76.51 76.51 0 0.00
32818. Kai (uploz) 1 118.76 118.76 0 0.00
32819. Josh (upaymeifixit) 1 89.24 89.24 1 100.00
32820. Uniphy (unitatoruler) 1 115.92 115.92 1 100.00
32821. DreamTheater (uniplayer) 1 75.91 75.91 0 0.00
32822. pablo (unicorngaming) 1 85.98 85.98 1 100.00
32823. Alex (unggoy2235) 1 128.16 128.16 0 0.00
32824. Laith (unclezebra) 1 64.76 64.76 1 100.00
32825. RunniNose (unbread) 1 102.16 102.16 1 100.00
32826. unboundx (unboundxzackk) 1 60.57 60.57 0 0.00
32827. albert (umibozu666) 1 41.30 41.30 1 100.00
32828. Ultra (ultra_1001) 1 26.73 26.73 0 0.00
32829. UltimaTech (ultimatech_) 1 80.03 80.03 1 100.00
32830. potatu (ulgyscptato) 1 93.87 93.87 0 0.00
32831. Yosa (uknowyosa) 1 63.65 63.65 1 100.00
32832. Ujjwal (ujjwal_choudhary) 1 43.72 43.72 0 0.00
32833. Ujjwal (ujjwal3756) 1 65.88 65.88 0 0.00
32834. ujai (ujai) 1 74.29 74.29 0 0.00
32835. Bianca (uhbia) 1 58.31 58.31 1 100.00
32836. Michael Hunt (uhohpoopies) 1 92.25 92.25 0 0.00
32837. uchka (uchka0826) 1 90.53 90.53 1 100.00
32838. Ayyoob M (ub114) 1 65.95 65.95 0 0.00
32839. Fire (tytysoeng) 1 74.46 74.46 0 0.00
32840. Bob (typocheck) 1 103.85 103.85 1 100.00
32841. aidan (typingusername) 1 109.14 109.14 0 0.00
32842. Kelvin (typingkelvin) 1 121.52 121.52 1 100.00
32843. Duy Anh (typingisgod) 1 74.00 74.00 0 0.00
32844. Yo (typin) 1 66.60 66.60 0 0.00
32845. Joshua (type_god_1466) 1 110.15 110.15 0 0.00
32846. Tom (typewritertom) 1 124.69 124.69 1 100.00
32847. Victor (typetwister) 1 40.43 40.43 1 100.00
32848. Robert (typeson) 1 88.91 88.91 0 0.00
32849. Ian (typer_goose) 1 107.83 107.83 0 0.00
32850. naraha (typer_anu_layout) 1 50.71 50.71 0 0.00
32851. Joe (typer_1_2_3) 1 39.84 39.84 0 0.00
32852. Yango (typerix) 1 120.27 120.27 1 100.00
32853. Adarax (typerax) 1 60.43 60.43 0 0.00
32854. I'm fast (typeracerboisadge) 1 91.94 91.94 0 0.00
32855. Quitalot (tylertylerooo) 1 93.84 93.84 0 0.00
32856. OSUUUUUUUUUUUUUUUUUUUUU (ty... 1 92.19 92.19 0 0.00
32857. Tony (tyin) 1 96.02 96.02 1 100.00
32858. TW (twwu) 1 106.72 106.72 1 100.00
32859. Minori (twoautumnleaf) 1 89.29 89.29 0 0.00
32860. buntly (twitch_knighthamtv) 1 76.42 76.42 0 0.00
32861. Noel (twicetzuyu) 1 118.72 118.72 0 0.00
32862. 22Raptors (twentytworaptors) 1 159.68 159.68 1 100.00
32863. Aaryan (tvirus) 1 74.98 74.98 1 100.00
32864. Moe (tux101) 1 90.48 90.48 0 0.00
32865. Tushar (tusharsingh) 1 112.17 112.17 0 0.00
32866. Kady's Tofu (turtlespeedster) 1 82.84 82.84 1 100.00
32867. Peyton (turtledude48) 1 114.06 114.06 0 0.00
32868. turtle45 (turtle45) 1 41.50 41.50 0 0.00
32869. Envy (turbo_envy) 1 116.08 116.08 1 100.00
32870. turboch4rger (turbosprezarkaa) 1 73.38 73.38 1 100.00
32871. Tumpor (tumpor) 1 67.76 67.76 0 0.00
32872. Fetoora (tuhnsoo) 1 78.40 78.40 1 100.00
32873. Victor (tucky50) 1 58.69 58.69 0 0.00
32874. anh (tuananhq9) 1 32.38 32.38 0 0.00
32875. Chinatsu (tsuremodose_jp) 1 125.67 125.67 1 100.00
32876. EJ (tsukairin) 1 94.52 94.52 1 100.00
32877. rea (trying_to_get_better) 1 46.38 46.38 0 0.00
32878. Conor (tryingtotchtype) 1 80.12 80.12 1 100.00
32879. TruwChainz (truwchainz) 1 58.63 58.63 1 100.00
32880. Christopher (truestarsense) 1 72.70 72.70 0 0.00
32881. Leo (truckerdeluxe) 1 52.49 52.49 0 0.00
32882. Troy (troyvimala) 1 134.21 134.21 1 100.00
32883. tstats[troutmaan] (troutmaan) 1 84.06 84.06 0 0.00
32884. Tristan (trist4n2005) 1 45.22 45.22 0 0.00
32885. Trinity (trinitysam) 1 98.23 98.23 0 0.00
32886. Behind (trigstur) 1 51.94 51.94 0 0.00
32887. Trey (treytech3) 1 102.96 102.96 0 0.00
32888. martin (tredecies) 1 74.85 74.85 0 0.00
32889. Travis (travis3372) 1 111.94 111.94 1 100.00
32890. Alexander (traveler_exe) 1 60.24 60.24 0 0.00
32891. David (traummann2157) 1 84.91 84.91 1 100.00
32892. - (trashmanvlogs) 1 122.02 122.02 1 100.00
32893. Jason (transcendentaltypist) 1 119.76 119.76 0 0.00
32894. 000557A (tr1pl0) 1 88.69 88.69 0 0.00
32895. Travis (tr4v1sty) 1 59.69 59.69 0 0.00
32896. timo (tpkq) 1 46.75 46.75 1 100.00
32897. Can (tpcm) 1 70.13 70.13 0 0.00
32898. Tony (tpark1218) 1 141.22 141.22 1 100.00
32899. Toxi (toxi) 1 95.99 95.99 0 0.00
32900. andrewski (toxic127) 1 76.31 76.31 0 0.00
32901. S3bas (townpregic) 1 83.96 83.96 1 100.00
32902. Jorge (toweringdoor) 1 127.34 127.34 0 0.00
32903. Vanshaj (torque_i_alpha) 1 96.25 96.25 1 100.00
32904. Tur (tops620) 1 82.25 82.25 1 100.00
32905. yong (topcool) 1 99.46 99.46 0 0.00
32906. tonymmm1 (tonymmm1) 1 90.24 90.24 0 0.00
32907. Tom (tommytuan009) 1 68.56 68.56 1 100.00
32908. Tommy (tomcrott) 1 74.16 74.16 0 0.00
32909. [YT] toby (toby_is_fluffy) 1 152.22 152.22 0 0.00
32910. Toblaz (toblaz) 1 65.05 65.05 0 0.00
32911. Daniyar (tobirama_senju) 1 56.46 56.46 0 0.00
32912. Toby (tobiasharry) 1 47.04 47.04 0 0.00
32913. Toasted (toastedsunglasses) 1 87.54 87.54 1 100.00
32914. Tony (toanie) 1 56.66 56.66 0 0.00
32915. Adam (toaadam) 1 101.36 101.36 0 0.00
32916. Warden (tmt_warden) 1 71.72 71.72 0 0.00
32917. Tony (tmor2012) 1 110.84 110.84 1 100.00
32918. ChenTK (tklife1209) 1 34.00 34.00 0 0.00
32919. Jai (tjpv) 1 57.00 57.00 0 0.00
32920. Thomas (tjavi) 1 63.70 63.70 0 0.00
32921. Angry Birds (tixwmmy) 1 135.22 135.22 1 100.00
32922. Vroom 🚗🏍️🏎️... 1 37.86 37.86 0 0.00
32923. Timothy (timothyqwerty) 1 66.61 66.61 0 0.00
32924. Alexander (timmy542) 1 133.75 133.75 1 100.00
32925. S (time_limit) 1 37.69 37.69 1 100.00
32926. Chen (timew8s4no1) 1 40.93 40.93 0 0.00
32927. Jojo (timerz) 1 50.99 50.99 0 0.00
32928. TiltClock (tiltclock) 1 95.15 95.15 1 100.00
32929. rajendra (tillaraj) 1 119.79 119.79 1 100.00
32930. Tiger_Pop (tiger_pop) 1 97.32 97.32 1 100.00
32931. alex (tieiech) 1 111.07 111.07 1 100.00
32932. Kai (tidalove) 1 113.43 113.43 0 0.00
32933. Tiantoes (tiantoes) 1 79.76 79.76 0 0.00
32934. teh (tiancheng) 1 40.91 40.91 1 100.00
32935. Rosinante D. (thusspokegappy) 1 81.37 81.37 1 100.00
32936. Chris (thunderhawk14) 1 95.51 95.51 1 100.00
32937. Thug (thugboat) 1 111.88 111.88 1 100.00
32938. Thomas (thomasconnector) 1 80.81 80.81 1 100.00
32939. Random (thisistheusername0) 1 75.94 75.94 0 0.00
32940. Ben (thisisbenmanley) 1 123.48 123.48 0 0.00
32941. Thighology (thighology) 1 54.82 54.82 1 100.00
32942. Nikita (thicc_not_thick) 1 50.04 50.04 0 0.00
32943. Nightwong (thfw00) 1 107.74 107.74 1 100.00
32944. Roman (the__one) 1 85.90 85.90 0 0.00
32945. Rick (the_rick_astley) 1 96.96 96.96 1 100.00
32946. turbos996 (the_puffduff) 1 68.90 68.90 0 0.00
32947. Gavin (the_gavin12) 1 43.62 43.62 0 0.00
32948. Evan (the_evanator) 1 73.95 73.95 0 0.00
32949. Yoel (the_dog) 1 69.90 69.90 1 100.00
32950. Yousef (the_beast_007) 1 30.66 30.66 0 0.00
32951. Bashar (theyoungthunder) 1 57.09 57.09 0 0.00
32952. Miguel (thewittywarlock) 1 107.56 107.56 1 100.00
32953. Ethan (theweirdo1924) 1 53.37 53.37 0 0.00
32954. Cat (theveryboredcat) 1 84.63 84.63 0 0.00
32955. sh4rkatt4ck (thethicckid) 1 70.74 70.74 1 100.00
32956. Marc (thespy7) 1 90.60 90.60 0 0.00
32957. _Eclipse (thesolareclipse) 1 92.58 92.58 1 100.00
32958. Keanu (thesinistershadow) 1 119.43 119.43 1 100.00
32959. Torpor (thesilliest) 1 124.39 124.39 1 100.00
32960. TheRyanatorGames (theryanat... 1 63.68 63.68 0 0.00
32961. Andrei (therain) 1 54.31 54.31 0 0.00
32962. Samuel (theodoruss) 1 42.25 42.25 1 100.00
32963. Karl (themoopavra) 1 111.54 111.54 1 100.00
32964. Tom (thekryken) 1 106.52 106.52 1 100.00
32965. William (thekraken412) 1 80.36 80.36 0 0.00
32966. The Cult Leader (thekingrises) 1 93.18 93.18 1 100.00
32967. Zero (theking410) 1 66.43 66.43 0 0.00
32968. Anderson Verajao (thekandyc... 1 106.68 106.68 1 100.00
32969. thehiep (thehiep8x) 1 58.72 58.72 0 0.00
32970. CHOO (thefuturist) 1 80.33 80.33 0 0.00
32971. thefoodboi (thefoodboi) 1 57.66 57.66 0 0.00
32972. Aritouch (theekung_69) 1 61.52 61.52 0 0.00
32973. FlamingPhoenix40 (thedoctor40) 1 93.30 93.30 0 0.00
32974. Christopher (thecybernile) 1 35.88 35.88 0 0.00
32975. TheCrazyTree (thecrazytree) 1 98.23 98.23 1 100.00
32976. Vaishnav (thecookingcardsman) 1 107.70 107.70 0 0.00
32977. Stanislav (theboystan) 1 33.64 33.64 0 0.00
32978. Chris (theavocado) 1 169.93 169.93 1 100.00
32979. Bob (theasiansherlock) 1 120.48 120.48 1 100.00
32980. Ethan (thatprogrammer) 1 98.33 98.33 0 0.00
32981. Willy (thatboywilly149) 1 66.46 66.46 0 0.00
32982. Darix (tf_light) 1 105.96 105.96 0 0.00
32983. Seif Eldin (terrascoper) 1 79.93 79.93 0 0.00
32984. Terminator (terminator_01) 1 43.01 43.01 0 0.00
32985. terdywerks (terdywerks) 1 103.72 103.72 1 100.00
32986. Moni (tentwashere) 1 70.27 70.27 1 100.00
32987. Temirlan (temirlan178) 1 44.06 44.06 0 0.00
32988. Alex (teflondon361) 1 74.17 74.17 0 0.00
32989. Tee (teegenius196) 1 72.50 72.50 0 0.00
32990. Edgey (tedge) 1 84.69 84.69 0 0.00
32991. teddy (teddyweaber) 1 75.66 75.66 0 0.00
32992. Tuffy. (teddytaffy) 1 72.83 72.83 0 0.00
32993. Ted (ted21) 1 101.54 101.54 1 100.00
32994. Techy504 (techy504) 1 76.89 76.89 0 0.00
32995. Soua (technogunn) 1 44.62 44.62 0 0.00
32996. t (teaxnuba) 1 58.24 58.24 1 100.00
32997. Mike (teamwolf11) 1 53.49 53.49 1 100.00
32998. Trystan (tdude_37) 1 57.75 57.75 0 0.00
32999. Toastify (tcatechofficial) 1 64.75 64.75 1 100.00
33000. Badr (tbadr) 1 68.41 68.41 0 0.00
33001. Tawan (tawans) 1 45.94 45.94 0 0.00
33002. Tauske (tauske) 1 79.82 79.82 0 0.00
33003. Nithish (tasten_drucker) 1 48.37 48.37 1 100.00
33004. Tara (tarav21h) 1 95.32 95.32 0 0.00
33005. tanon (tanon710s) 1 41.84 41.84 1 100.00
33006. Mushfiq (talha76) 1 49.83 49.83 0 0.00
33007. Sherman (takozuchi) 1 82.13 82.13 0 0.00
33008. Eugene (takahashi19) 1 67.23 67.23 0 0.00
33009. Taetra (taetra) 1 110.86 110.86 0 0.00
33010. Payton (taeilz) 1 76.20 76.20 0 0.00
33011. Marianne (taebvm) 1 27.95 27.95 0 0.00
33012. Heet (tadu21) 1 60.74 60.74 0 0.00
33013. Tabitha (tabi87) 1 75.64 75.64 0 0.00
33014. lukas (s_lukas) 1 48.56 48.56 0 0.00
33015. Alessio (syrius00) 1 84.30 84.30 0 0.00
33016. Ayush (syndrome_) 1 76.69 76.69 0 0.00
33017. Ba Viet (sweetweet) 1 64.40 64.40 0 0.00
33018. Ron (swavyron) 1 75.31 75.31 0 0.00
33019. Peter (swankypete) 1 61.32 61.32 0 0.00
33020. swag (swaglord1) 1 114.88 114.88 0 0.00
33021. Davinti (swaggaming) 1 63.85 63.85 0 0.00
33022. Harvey (sw99) 1 103.16 103.16 1 100.00
33023. Svan (svanstedt) 1 104.34 104.34 0 0.00
33024. Suzaku (suzakucrono) 1 23.00 23.00 0 0.00
33025. Alex (suyggyu) 1 78.13 78.13 0 0.00
33026. Harry (sutherland7321) 1 65.20 65.20 0 0.00
33027. Enrique (supraphysiological) 1 68.86 68.86 0 0.00
33028. Artem (suplexxx) 1 71.58 71.58 0 0.00
33029. bram (super_r23) 1 108.13 108.13 0 0.00
33030. Superwoedi (superwoedi) 1 94.29 94.29 1 100.00
33031. melonkng (melonkng) 1 73.64 73.64 0 0.00
33032. i am the slowest typer in t... 1 97.32 97.32 0 0.00
33033. RIP Byron (superfrik) 1 94.39 94.39 0 0.00
33034. Ccori (superfifi930970) 1 52.63 52.63 1 100.00
33035. superepic (superepicpig) 1 86.15 86.15 0 0.00
33036. scary (superdry) 1 87.84 87.84 1 100.00
33037. Harry (superdickson) 1 66.46 66.46 0 0.00
33038. Trevor (super64guy) 1 79.58 79.58 0 0.00
33039. redzic (super33) 1 132.63 132.63 1 100.00
33040. Sun_Biel (sun_biel) 1 30.34 30.34 0 0.00
33041. Alex (sunzu432) 1 105.72 105.72 0 0.00
33042. Amy (sunnyaim) 1 47.95 47.95 0 0.00
33043. Sumzar (sumzar) 1 46.59 46.59 0 0.00
33044. sultan (sultan_sasangka) 1 107.12 107.12 0 0.00
33045. nav (sugondese123) 1 83.32 83.32 0 0.00
33046. Jack (sugarryboi) 1 30.09 30.09 0 0.00
33047. Subramanya (subramanya) 1 80.89 80.89 1 100.00
33048. Subarno (subarno) 1 83.00 83.00 0 0.00
33049. 1 (su304) 1 53.71 53.71 0 0.00
33050. Striker21 (striker21) 1 55.00 55.00 0 0.00
33051. Jerry (stopgetalife) 1 79.70 79.70 1 100.00
33052. Ross (stoltay) 1 94.27 94.27 1 100.00
33053. FREE Palestine (stilllobste... 1 29.98 29.98 0 0.00
33054. Sawah :3 (sth2127) 1 108.29 108.29 1 100.00
33055. Stevie (stevie81572) 1 72.53 72.53 0 0.00
33056. dvorak64 (steveoc64) 1 77.48 77.48 0 0.00
33057. Steven (stevenxie) 1 122.08 122.08 1 100.00
33058. steven (steventran334) 1 126.27 126.27 0 0.00
33059. Steven (stevensenjaya8) 1 105.08 105.08 0 0.00
33060. Stephan (stephanvdmerwe) 1 60.25 60.25 1 100.00
33061. May (stenotbest) 1 44.37 44.37 0 0.00
33062. Pepa (stefanborca) 1 92.36 92.36 0 0.00
33063. Steel9volt (steel9volty) 1 25.82 25.82 0 0.00
33064. Milan (starzzdrak) 1 74.71 74.71 1 100.00
33065. Johnathan (starydy) 1 97.81 97.81 1 100.00
33066. Starwy (starwy) 1 68.40 68.40 1 100.00
33067. star (starstrider10) 1 90.96 90.96 0 0.00
33068. HoloCorp (starmaster) 1 52.73 52.73 0 0.00
33069. Darwin (starfosh) 1 78.17 78.17 1 100.00
33070. jojo (starboi_) 1 47.01 47.01 0 0.00
33071. emmy (stannisbaratheon) 1 83.80 83.80 1 100.00
33072. Stanislav🍆 (stanislav2000) 1 107.04 107.04 0 0.00
33073. St1ngX (st1ngx) 1 78.28 78.28 0 0.00
33074. Daniel (ssund) 1 153.11 153.11 1 100.00
33075. Shaurya (ssen12) 1 109.38 109.38 1 100.00
33076. Guido (ssawuschka) 1 65.45 65.45 0 0.00
33077. Samuel (sroh8140) 1 124.15 124.15 1 100.00
33078. Joe (srittenhouse) 1 113.19 113.19 1 100.00
33079. Spyros (spyrosmk) 1 54.57 54.57 0 0.00
33080. spudnick (spudnick47) 1 55.83 55.83 1 100.00
33081. spowell398 (spowell398) 1 97.79 97.79 1 100.00
33082. spocky (spocky_cheeto) 1 78.27 78.27 0 0.00
33083. Bemysword (spligam3r) 1 69.25 69.25 0 0.00
33084. nitewaver (spita) 1 100.55 100.55 1 100.00
33085. Spire (spire20) 1 60.49 60.49 1 100.00
33086. Fred (spicesouls) 1 90.39 90.39 1 100.00
33087. SpicyAsianBoy (spicyasianboy) 1 105.31 105.31 0 0.00
33088. Alex (sphincture) 1 147.34 147.34 1 100.00
33089. SP (spharish) 1 74.53 74.53 0 0.00
33090. Gabriel (spellingisstupid) 1 110.24 110.24 0 0.00
33091. speedy (speedy_speedster) 1 89.51 89.51 0 0.00
33092. Ben (speedysnail2005) 1 49.68 49.68 0 0.00
33093. Conor (speedyscientist) 1 103.15 103.15 0 0.00
33094. Vinay (spedman) 1 90.84 90.84 1 100.00
33095. Edward (sp4rxxx) 1 42.08 42.08 0 0.00
33096. ur mom (soysaucesparkle) 1 46.93 46.93 0 0.00
33097. 200iq man (sovietgoose) 1 97.69 97.69 0 0.00
33098. Dave (sourcreamcun) 1 29.43 29.43 0 0.00
33099. guts (soupyguts) 1 63.54 63.54 0 0.00
33100. Sultan (sosa_102) 1 81.09 81.09 0 0.00
33101. CLICKCLACKCLICKCLACK (sophi... 1 78.55 78.55 0 0.00
33102. Sophie (sophbee) 1 46.14 46.14 0 0.00
33103. Darius (soo_hoo) 1 97.80 97.80 0 0.00
33104. Oliver (soonsy) 1 112.28 112.28 1 100.00
33105. Sonny (sonny3d) 1 98.43 98.43 0 0.00
33106. Hammad (sonic_slow) 1 62.42 62.42 1 100.00
33107. Soni (soni801) 1 63.08 63.08 0 0.00
33108. Soma (soma_shirei) 1 77.33 77.33 0 0.00
33109. Solst (solst) 1 96.02 96.02 1 100.00
33110. SolidSonicTH (solidsonicth) 1 103.64 103.64 1 100.00
33111. soleus (soleusplantaris) 1 61.99 61.99 0 0.00
33112. Kawsa (sold_mom_for_rp) 1 77.76 77.76 0 0.00
33113. Sola (solaonix) 1 71.07 71.07 1 100.00
33114. Bennett (sol4rflare) 1 49.68 49.68 0 0.00
33115. Erik (soggybutter) 1 85.29 85.29 0 0.00
33116. sofy (sofym3sa) 1 36.48 36.48 0 0.00
33117. John (soegnam) 1 57.59 57.59 0 0.00
33118. enzo (sockenzo) 1 73.28 73.28 0 0.00
33119. soadsuey (soadsuey) 1 126.28 126.28 1 100.00
33120. xX-St3voNY-Xx (snuggets619) 1 82.08 82.08 1 100.00
33121. Niilo (snowyz) 1 95.80 95.80 0 0.00
33122. SNovaK (snovak) 1 55.79 55.79 0 0.00
33123. Oliver (snorkypant) 1 41.72 41.72 0 0.00
33124. Jamie (sneepdeep) 1 70.87 70.87 0 0.00
33125. Snactus (snactus) 1 119.63 119.63 1 100.00
33126. Daniel (sn1054) 1 83.58 83.58 1 100.00
33127. filthy (smargobot) 1 81.06 81.06 1 100.00
33128. Julia (smallone4130) 1 95.51 95.51 1 100.00
33129. Slyther (slyth3r_) 1 66.64 66.64 0 0.00
33130. Alex (slybilia) 1 53.55 53.55 1 100.00
33131. Dylan (slumpgod) 1 91.45 91.45 0 0.00
33132. SluggardBark444 (sluggardba... 1 51.20 51.20 0 0.00
33133. snails (slow_learner_2000) 1 79.26 79.26 0 0.00
33134. tstats[slowtyperider] (slow... 1 94.50 94.50 1 100.00
33135. APMAPMAPM (slowtyperbtw) 1 106.03 106.03 0 0.00
33136. jp (slowpractice) 1 115.37 115.37 1 100.00
33137. Colm (slowandslow22) 1 41.66 41.66 0 0.00
33138. Slicklikedat (slicklikedat) 1 69.35 69.35 0 0.00
33139. Slacky (slackyisbacky) 1 75.25 75.25 1 100.00
33140. Sprout (skyshedbloxian) 1 74.57 74.57 0 0.00
33141. Byungil (skylord418) 1 62.34 62.34 0 0.00
33142. Skullition (skullition) 1 89.79 89.79 0 0.00
33143. Skrub (skrub_bot) 1 68.61 68.61 0 0.00
33144. Alper (skroas) 1 100.84 100.84 1 100.00
33145. Zach (skoopy) 1 120.20 120.20 0 0.00
33146. Luke (skkywalker62) 1 17.74 17.74 0 0.00
33147. Xavier (skittlez11) 1 89.17 89.17 0 0.00
33148. Skinny (skinnysausage) 1 80.49 80.49 0 0.00
33149. Sabrina (skatingprincess) 1 69.01 69.01 1 100.00
33150. Karthik (skarthik01) 1 110.95 110.95 1 100.00
33151. Kevin (skarl) 1 131.29 131.29 1 100.00
33152. Paskal (skapalpaskal) 1 71.88 71.88 0 0.00
33153. Nikos (skalkoto) 1 53.55 53.55 0 0.00
33154. Sjoerd (sjoerdofferhaus) 1 88.46 88.46 0 0.00
33155. sixfalls (sixfalls) 1 105.98 105.98 1 100.00
33156. Wouter (sirwout) 1 56.92 56.92 0 0.00
33157. Luis (sirkarpador) 1 57.91 57.91 1 100.00
33158. SinglePaper (singlepaper) 1 88.43 88.43 0 0.00
33159. sinchan (sinchan_rai) 1 56.92 56.92 0 0.00
33160. Simp (simplisticbubble) 1 46.41 46.41 0 0.00
33161. Skye (simpleskye) 1 54.04 54.04 0 0.00
33162. simpull (simpl) 1 77.86 77.86 0 0.00
33163. Raffael (simonraffael) 1 92.12 92.12 0 0.00
33164. • simon • (simonnjr) 1 53.36 53.36 1 100.00
33165. Manh Nguyen Sy (simonnguyen) 1 40.48 40.48 0 0.00
33166. Siming (simingrox) 1 106.18 106.18 1 100.00
33167. Simeon08 (simeon08) 1 37.98 37.98 0 0.00
33168. Simber (simber) 1 80.49 80.49 1 100.00
33169. Nicolas (silwr) 1 87.18 87.18 0 0.00
33170. Silve (silve_) 1 69.79 69.79 1 100.00
33171. Silver (silveryue) 1 101.11 101.11 1 100.00
33172. Jayden (silvernote) 1 71.39 71.39 1 100.00
33173. Kristof (silentreveries) 1 102.32 102.32 1 100.00
33174. Shaun (silentfate) 1 63.96 63.96 0 0.00
33175. Bernard (siko_lick) 1 118.86 118.86 1 100.00
33176. Signical (signicial) 1 59.61 59.61 0 0.00
33177. Sigurdur (siggimatti) 1 80.01 80.01 0 0.00
33178. siddharta (sid_123) 1 38.15 38.15 0 0.00
33179. Sid (sidch) 1 102.62 102.62 0 0.00
33180. Siddhesh (sid20) 1 70.35 70.35 0 0.00
33181. Sid (sid121212) 1 66.80 66.80 0 0.00
33182. siceon7 (siceon7) 1 59.16 59.16 1 100.00
33183. Sarah (sh_milk) 1 95.64 95.64 1 100.00
33184. swaggin (shuutori) 1 111.70 111.70 1 100.00
33185. Xander (shuuk1) 1 107.53 107.53 1 100.00
33186. Shuncey (shuncey) 1 58.94 58.94 0 0.00
33187. 🌈 (shug_op) 1 134.04 134.04 1 100.00
33188. Tsubaki (shtoo7) 1 53.43 53.43 0 0.00
33189. Shrulk (shrulk) 1 76.49 76.49 0 0.00
33190. Shriyans (shriyanspatnaik) 1 58.93 58.93 0 0.00
33191. Shreyash (shreystar32) 1 66.68 66.68 0 0.00
33192. Shrey (shrey4869) 1 60.77 60.77 0 0.00
33193. Markus Solem (shrexy) 1 92.69 92.69 1 100.00
33194. Shrekcob (shrekcob) 1 48.85 48.85 0 0.00
33195. Shorba (shorba) 1 85.78 85.78 1 100.00
33196. Matt (shootposting) 1 70.99 70.99 0 0.00
33197. SHO (shoganeko) 1 134.01 134.01 1 100.00
33198. Kevin (shocky79420) 1 119.29 119.29 0 0.00
33199. Shoaib Sajid (shoaibsajid) 1 69.60 69.60 0 0.00
33200. shmuel (shmuel555) 1 61.06 61.06 0 0.00
33201. Alex (shmixers) 1 110.95 110.95 1 100.00
33202. Zwe (shizzlemanizzle_) 1 103.17 103.17 0 0.00
33203. Shivinder (shivindernarr) 1 88.30 88.30 1 100.00
33204. Shivansh (shivansh_up) 1 57.13 57.13 0 0.00
33205. Shivam (shivamgoyal241) 1 46.60 46.60 0 0.00
33206. Shion (shionaster) 1 115.62 115.62 0 0.00
33207. Bazingas (shinyy) 1 84.78 84.78 0 0.00
33208. Shinuki (shinukiayato) 1 63.61 63.61 0 0.00
33209. Shinixsan (shinixsan) 1 64.78 64.78 1 100.00
33210. Shiftoss (shiftoss) 1 77.44 77.44 0 0.00
33211. Shierwin (shierwin) 1 55.75 55.75 0 0.00
33212. Uhhhhhhh (shidlord) 1 70.41 70.41 0 0.00
33213. Sias (shiasu) 1 64.00 64.00 0 0.00
33214. poggers (shezzerk) 1 24.42 24.42 0 0.00
33215. Shervin (shervin_typing) 1 62.31 62.31 0 0.00
33216. Sherlock (sherlock_homies) 1 69.17 69.17 0 0.00
33217. sherimori (sherimori) 1 130.26 130.26 1 100.00
33218. Isaac (shepisaac) 1 91.22 91.22 1 100.00
33219. Cease (shellahfellah) 1 143.44 143.44 0 0.00
33220. Shehab (shehab_is_legendary) 1 76.61 76.61 0 0.00
33221. Sleepy Bob (shazamrockshake) 1 68.28 68.28 0 0.00
33222. Seamus (shaydogga) 1 59.00 59.00 0 0.00
33223. Shawdowv(Guest) (shawdowv) 1 51.50 51.50 1 100.00
33224. Shaun (shaunjohnathon) 1 105.10 105.10 1 100.00
33225. Hiro-X (shaum257) 1 76.05 76.05 1 100.00
33226. sharnice (shar_j) 1 53.87 53.87 0 0.00
33227. tai (sharpblader) 1 83.55 83.55 0 0.00
33228. Shark (sharktornado) 1 70.97 70.97 0 0.00
33229. Jack (sharku) 1 85.88 85.88 0 0.00
33230. Jim (shampoobottle14) 1 54.45 54.45 0 0.00
33231. disheyo (shakura) 1 143.94 143.94 1 100.00
33232. Brendan (shagsterrodgers) 1 58.23 58.23 0 0.00
33233. Max (shaforodowntown) 1 74.24 74.24 0 0.00
33234. ShadowTenshii (shadowtenshii) 1 118.14 118.14 1 100.00
33235. Shadow (shadowenesakif) 1 56.15 56.15 1 100.00
33236. Shader (shader_zxa) 1 33.57 33.57 0 0.00
33237. shack (shacklos) 1 133.23 133.23 1 100.00
33238. shaad (shaaad) 1 73.75 73.75 0 0.00
33239. Batuhan (sh4yn) 1 51.78 51.78 0 0.00
33240. Mackenzie (sgxserenity) 1 100.01 100.01 1 100.00
33241. Sam (sf424) 1 154.19 154.19 1 100.00
33242. Jinna (se_sean) 1 31.69 31.69 0 0.00
33243. MCowSevt (sevt) 1 78.51 78.51 1 100.00
33244. sherry (serulii) 1 139.65 139.65 1 100.00
33245. Sergio (sertheveteran) 1 74.46 74.46 0 0.00
33246. Sergio (sergi910) 1 49.77 49.77 0 0.00
33247. sun (september28) 1 88.32 88.32 0 0.00
33248. Michael (sephknowhim) 1 71.21 71.21 0 0.00
33249. seon (seon123) 1 94.68 94.68 1 100.00
33250. (senseyf) 1 117.28 117.28 0 0.00
33251. Senpai (senpaisenpai) 1 78.27 78.27 0 0.00
33252. a (semperamico) 1 49.57 49.57 0 0.00
33253. perfvil (sellected) 1 57.39 57.39 1 100.00
33254. Ed (selfe) 1 100.20 100.20 0 0.00
33255. insane (sejal) 1 94.42 94.42 0 0.00
33256. Alex (sefader) 1 73.10 73.10 1 100.00
33257. Sorbble (sebby122) 1 95.78 95.78 0 0.00
33258. Searchsr555 (searchsr555) 1 33.56 33.56 1 100.00
33259. Sean (sean33333) 1 109.73 109.73 1 100.00
33260. Angel (seal_gel) 1 81.97 81.97 0 0.00
33261. Shreyan (sdutta4) 1 46.21 46.21 0 0.00
33262. basil (screamingsavannah) 1 82.65 82.65 0 0.00
33263. Brian (scorpyyy) 1 112.35 112.35 0 0.00
33264. Scooby (scoobydoo0919) 1 82.99 82.99 0 0.00
33265. Christopher (scizsors) 1 69.85 69.85 0 0.00
33266. Nick (scienceman57) 1 75.73 75.73 0 0.00
33267. Rodrigo (schoofielddawg1476) 1 51.16 51.16 0 0.00
33268. Declan (schnup7) 1 55.68 55.68 1 100.00
33269. ⊂( ▀ ͜͞ʖ▀)つ (sch... 1 66.86 66.86 0 0.00
33270. lol (scdwcd) 1 96.39 96.39 0 0.00
33271. Scarrrz (scarrrz) 1 101.61 101.61 0 0.00
33272. LivewireHush (scarlet_static) 1 81.48 81.48 0 0.00
33273. Scalion (scalion) 1 57.42 57.42 0 0.00
33274. Scadeer (scadeer) 1 60.05 60.05 1 100.00
33275. sb (sb_unoriginal) 1 118.95 118.95 1 100.00
33276. Kyle (sbm66) 1 93.08 93.08 0 0.00
33277. Semyon (saymon211) 1 58.98 58.98 0 0.00
33278. Saynon (saynon) 1 82.74 82.74 0 0.00
33279. Cochet (saucyzzzz) 1 71.93 71.93 1 100.00
33280. Vroom (saucypringle) 1 98.87 98.87 0 0.00
33281. Andy (saucycedo) 1 88.20 88.20 1 100.00
33282. satvik (satvikp) 1 47.91 47.91 0 0.00
33283. 🪐 (saturnus3) 1 77.19 77.19 0 0.00
33284. Sabbir Ahmed Talukdar (sats... 1 10.18 10.18 0 0.00
33285. Bart (satancat) 1 59.44 59.44 0 0.00
33286. M (sasoriza) 1 113.24 113.24 1 100.00
33287. sasolisa (sasolisa) 1 21.72 21.72 1 100.00
33288. Alexandra (sashoela) 1 106.67 106.67 0 0.00
33289. Sasa (sasamaster) 1 84.02 84.02 0 0.00
33290. Sarthak (sarthak_dms) 1 45.47 45.47 0 0.00
33291. Sarp (sarpo5512) 1 51.94 51.94 1 100.00
33292. sarmasar (sarmasar) 1 61.19 61.19 1 100.00
33293. sara (sarafeizyab) 1 35.42 35.42 0 0.00
33294. Sara (saraakre) 1 94.23 94.23 0 0.00
33295. sara (saraafr) 1 29.21 29.21 0 0.00
33296. Sapnil (sapnil9) 1 65.26 65.26 0 0.00
33297. CJ (sansaic) 1 100.54 100.54 0 0.00
33298. Sannas (sannas) 1 120.89 120.89 1 100.00
33299. Sanket (sanket30016) 1 78.63 78.63 0 0.00
33300. Sanji (sanjiwatsuki) 1 143.97 143.97 1 100.00
33301. Sambhav (sam_b_hav) 1 71.74 71.74 0 0.00
33302. Sam (sam_0) 1 44.74 44.74 0 0.00
33303. SamYouL (samyoul) 1 91.92 91.92 0 0.00
33304. ZER039 (samyak039) 1 58.66 58.66 0 0.00
33305. Samuel (samuel86) 1 109.85 109.85 1 100.00
33306. Sammy (sammyaxel) 1 82.86 82.86 0 0.00
33307. sam (samb2006) 1 57.61 57.61 0 0.00
33308. Akshay (salty_nacho) 1 55.71 55.71 0 0.00
33309. shane jus like that (sally_... 1 43.95 43.95 1 100.00
33310. Sam (salinko) 1 68.33 68.33 0 0.00
33311. P (salbeitee) 1 44.32 44.32 0 0.00
33312. Sakko (sakko_) 1 45.15 45.15 0 0.00
33313. S (saifxhatem) 1 142.11 142.11 1 100.00
33314. PlanckPractice (sage_of_stu... 1 89.19 89.19 0 0.00
33315. S (saga_db) 1 63.30 63.30 0 0.00
33316. sages (sagesss) 1 76.62 76.62 1 100.00
33317. sage (sage78) 1 99.97 99.97 1 100.00
33318. sadsal12 (sadsal12) 1 27.86 27.86 0 0.00
33319. sadra (sadraaa) 1 33.64 33.64 0 0.00
33320. Sadiuh (sadiuh) 1 112.02 112.02 1 100.00
33321. Sabyasachi (sabyasachi_048) 1 55.20 55.20 0 0.00
33322. Sabrina (sabrinastangler) 1 115.51 115.51 0 0.00
33323. Saaho (saaho) 1 24.24 24.24 0 0.00
33324. j0 (s4ltys34l) 1 79.42 79.42 1 100.00
33325. S1 (s1s1s1) 1 164.65 164.65 1 100.00
33326. rylzu (rylzu) 1 106.61 106.61 1 100.00
33327. Ryan (ryguyd505) 1 102.44 102.44 1 100.00
33328. joi (ryerice) 1 42.76 42.76 0 0.00
33329. Ryder (ryderodonnell) 1 56.92 56.92 0 0.00
33330. Ryan (ryantanglikesmath) 1 108.44 108.44 0 0.00
33331. ryan (ryanleung1029) 1 80.82 80.82 0 0.00
33332. Ryan (ryanandros) 1 83.73 83.73 0 0.00
33333. Hung (rxpython) 1 85.20 85.20 0 0.00
33334. Rwu (rwu_) 1 70.69 70.69 0 0.00
33335. Rohit (rvighne) 1 100.17 100.17 0 0.00
33336. Rusty (rustyspicer) 1 70.57 70.57 0 0.00
33337. Russel (russelxxv) 1 58.09 58.09 0 0.00
33338. G (runnerbeany) 1 131.48 131.48 1 100.00
33339. Varun (runat_10) 1 74.15 74.15 1 100.00
33340. Runbo (rumboe) 1 96.14 96.14 0 0.00
33341. M (rugg0064) 1 78.14 78.14 0 0.00
33342. Peter (rudson) 1 59.11 59.11 1 100.00
33343. Kenny (rtootskie) 1 84.52 84.52 0 0.00
33344. Michael Jay (rsbluee) 1 70.92 70.92 1 100.00
33345. rozan (rozenbk) 1 57.18 57.18 0 0.00
33346. Jarod (rouleau) 1 51.05 51.05 1 100.00
33347. Roland (rothaler) 1 28.19 28.19 1 100.00
33348. roserayne (roserayne) 1 59.83 59.83 1 100.00
33349. Lin (rorarola) 1 72.14 72.14 0 0.00
33350. Atlas (ropsar) 1 89.19 89.19 0 0.00
33351. rookie (rookiespade) 1 132.73 132.73 1 100.00
33352. Rohan (ron_tesla) 1 56.55 56.55 0 0.00
33353. John (ronjohnjamesbond) 1 97.98 97.98 1 100.00
33354. Ronnie (ronierat123) 1 53.53 53.53 1 100.00
33355. Rear (rolotomassi) 1 98.40 98.40 0 0.00
33356. IHopeAndTry (rohitistyping) 1 61.32 61.32 1 100.00
33357. Rohit (rohiitt) 1 82.30 82.30 0 0.00
33358. Rohit (rogiti) 1 160.36 160.36 1 100.00
33359. Roger (rogergnay) 1 75.34 75.34 0 0.00
33360. Rogerboss (rogerboss) 1 65.09 65.09 0 0.00
33361. Roger (roger670) 1 46.97 46.97 0 0.00
33362. Aster (rodry37) 1 46.99 46.99 0 0.00
33363. Rodrigo (rodrianton) 1 56.73 56.73 0 0.00
33364. roderick (roderickang) 1 56.96 56.96 0 0.00
33365. rodals (rodals) 1 56.46 56.46 0 0.00
33366. Rock (rockfrock) 1 90.80 90.80 1 100.00
33367. rocket (rocketmantyper) 1 109.00 109.00 1 100.00
33368. Robert (robville804) 1 45.41 45.41 0 0.00
33369. Rob (robreadger) 1 49.46 49.46 1 100.00
33370. Rob (robocat) 1 99.03 99.03 0 0.00
33371. robin (robin1919) 1 65.94 65.94 1 100.00
33372. Robert (robertherrera13) 1 114.39 114.39 1 100.00
33373. RobertDeMilho (robertdm) 1 66.44 66.44 0 0.00
33374. Rovic (robecks) 1 61.74 61.74 1 100.00
33375. Robin (robdernub) 1 56.53 56.53 1 100.00
33376. Viet (robberviet) 1 58.24 58.24 0 0.00
33377. Rohan (roankar) 1 95.00 95.00 1 100.00
33378. Ryan (rmahon27) 1 104.60 104.60 0 0.00
33379. Ryan (rlee20) 1 81.60 81.60 0 0.00
33380. Rachel (rlau) 1 93.10 93.10 0 0.00
33381. Rebekah (rkatter) 1 84.69 84.69 1 100.00
33382. Joshua (rjmaligaya) 1 88.51 88.51 0 0.00
33383. RJ (rjem) 1 131.32 131.32 1 100.00
33384. Rivalnegro (rivalnegro) 1 100.88 100.88 1 100.00
33385. Yogender (ritik159) 1 58.60 58.60 0 0.00
33386. Horatius (rithkop) 1 72.13 72.13 0 0.00
33387. risu (risuto) 1 93.98 93.98 0 0.00
33388. rishi (rishiwho) 1 46.34 46.34 0 0.00
33389. Go Easy on Me (ripparian) 1 141.90 141.90 1 100.00
33390. Rin (rinthis) 1 68.88 68.88 0 0.00
33391. Rikatoariki (rikatoariki) 1 44.15 44.15 0 0.00
33392. Carter (rightwingextremist) 1 78.00 78.00 1 100.00
33393. rifath (rifath1729) 1 58.45 58.45 0 0.00
33394. Rick (rickga) 1 91.27 91.27 0 0.00
33395. RiceStealer (ricefieldstealer) 1 62.10 62.10 0 0.00
33396. Leo (ricecustomer) 1 90.92 90.92 0 0.00
33397. Riaofsantos (riaofsantos) 1 58.59 58.59 1 100.00
33398. Rezevic (rezevic) 1 100.41 100.41 1 100.00
33399. Ide (reyybruh) 1 84.98 84.98 0 0.00
33400. Rex (rexwb) 1 58.72 58.72 1 100.00
33401. Shuuin (rexvir) 1 99.17 99.17 1 100.00
33402. Ahnaf (reverse_typist) 1 96.12 96.12 1 100.00
33403. Revan (revankarma) 1 51.46 51.46 0 0.00
33404. retainerbox (retainerbox) 1 99.52 99.52 1 100.00
33405. Charlie (requiem2048) 1 118.88 118.88 0 0.00
33406. René (rene12vamrak) 1 65.94 65.94 0 0.00
33407. remz (remzhacker) 1 60.42 60.42 0 0.00
33408. Jacob (remoobekaj) 1 55.17 55.17 0 0.00
33409. Remotay (remotay) 1 124.69 124.69 1 100.00
33410. ._. (remiiix) 1 103.92 103.92 1 100.00
33411. Jacob (remence) 1 38.18 38.18 0 0.00
33412. fasterthanu (reign_az_) 1 51.32 51.32 0 0.00
33413. Regan (reginalld) 1 83.15 83.15 0 0.00
33414. Regan (regantm) 1 53.79 53.79 0 0.00
33415. d (reformatic) 1 97.49 97.49 1 100.00
33416. REE (reeeeeeeeee3) 1 99.90 99.90 1 100.00
33417. Reckt (reckt) 1 99.42 99.42 0 0.00
33418. R a c u (rebbok2002) 1 89.24 89.24 1 100.00
33419. wichael (realwichael) 1 76.12 76.12 0 0.00
33420. Manmohan (reattempt) 1 44.88 44.88 0 0.00
33421. Alex Rodriguez (realralex) 1 57.22 57.22 0 0.00
33422. Ashish (reach_aashu) 1 57.61 57.61 1 100.00
33423. Richard (rcasey88) 1 102.60 102.60 1 100.00
33424. Ryan (rbrownie) 1 64.91 64.91 0 0.00
33425. Rb (rbdota2) 1 84.35 84.35 1 100.00
33426. timko (razorsharprust) 1 102.41 102.41 1 100.00
33427. Rayyan (rayyanyusuph) 1 83.18 83.18 0 0.00
33428. raysar (raysar) 1 44.27 44.27 0 0.00
33429. Ra (rayl19) 1 40.93 40.93 0 0.00
33430. Kentson (raykaa) 1 85.85 85.85 0 0.00
33431. Bob (rayell) 1 83.64 83.64 0 0.00
33432. Ray (raycaballero) 1 73.18 73.18 0 0.00
33433. Neel (ravastar) 1 106.92 106.92 0 0.00
33434. Rahul (raul_jr3) 1 73.16 73.16 1 100.00
33435. Raul (raulziiiin) 1 48.48 48.48 0 0.00
33436. Jacob (rath130) 1 85.31 85.31 1 100.00
33437. The Fast (ratatuli) 1 95.46 95.46 0 0.00
33438. Azimjon (rasulovazimjon) 1 37.21 37.21 0 0.00
33439. Kyle (rasktastatur) 1 133.63 133.63 1 100.00
33440. Naufal (rashifff) 1 98.01 98.01 1 100.00
33441. Alex (rashicakes) 1 67.14 67.14 0 0.00
33442. Derek (rasehead) 1 80.79 80.79 0 0.00
33443. M4nk3y (raraownage) 1 90.13 90.13 0 0.00
33444. Rafiq (rapqz) 1 51.64 51.64 0 0.00
33445. Ra (rapenting) 1 45.05 45.05 0 0.00
33446. Harsh (rao_shab2000) 1 62.63 62.63 1 100.00
33447. Peter (randomperson927) 1 69.47 69.47 1 100.00
33448. giu (rand34) 1 33.07 33.07 0 0.00
33449. Santiago (ramstrykre) 1 71.89 71.89 0 0.00
33450. Jay (rampagej5) 1 92.93 92.93 1 100.00
33451. ramirozz (ramirozz) 1 94.24 94.24 0 0.00
33452. Rami (ramb_) 1 65.90 65.90 0 0.00
33453. rama (ramaseta) 1 117.57 117.57 1 100.00
33454. raman (raman123) 1 56.65 56.65 0 0.00
33455. Raledude (raledude) 1 131.69 131.69 1 100.00
33456. Rakibul (rakib195) 1 36.81 36.81 0 0.00
33457. roshan kumar paswan (rajros... 1 51.72 51.72 0 0.00
33458. you (you) (rajeevkgp) 1 64.31 64.31 0 0.00
33459. minerva (rajafathir) 1 69.31 69.31 1 100.00
33460. Ahmed (raiyan369999) 1 62.93 62.93 0 0.00
33461. Claudio (rainclaudio25) 1 54.27 54.27 0 0.00
33462. Ajit (raiajit) 1 60.92 60.92 0 0.00
33463. Rahmat (rahmatullah_anik) 1 72.58 72.58 0 0.00
33464. rafy (rafybeatskids) 1 56.14 56.14 0 0.00
33465. Rafi (rafi_levy) 1 90.04 90.04 1 100.00
33466. rafe (raffeevs) 1 76.47 76.47 0 0.00
33467. raf (raf55) 1 52.53 52.53 0 0.00
33468. Radu (radutist) 1 63.12 63.12 0 0.00
33469. RadicalMacaroni (radicalmac... 1 165.57 165.57 1 100.00
33470. dann (raclino) 1 84.70 84.70 0 0.00
33471. Kyle (rachel_camarena) 1 122.33 122.33 0 0.00
33472. RabbitFood (rabbitfood) 1 99.55 99.55 0 0.00
33473. Bill (raaydon) 1 84.26 84.26 0 0.00
33474. Raiza (raaizar) 1 59.37 59.37 0 0.00
33475. Tree (raaaaaaaku) 1 108.37 108.37 1 100.00
33476. I24FA (r4ffa) 1 69.82 69.82 1 100.00
33477. meh (qwertysux) 1 68.23 68.23 1 100.00
33478. s (qurtle) 1 93.43 93.43 0 0.00
33479. Lotad (quirkylotad) 1 107.33 107.33 1 100.00
33480. Quiq (quiqmeng) 1 84.07 84.07 0 0.00
33481. Quintes (quintez) 1 69.72 69.72 0 0.00
33482. hv21ll (quinixod) 1 83.99 83.99 0 0.00
33483. Tay (quiettoonix) 1 106.27 106.27 0 0.00
33484. Quick (quick_finger) 1 55.19 55.19 0 0.00
33485. Quick Fingers 69 (quickfing... 1 99.62 99.62 0 0.00
33486. ttoki17 (queen5213) 1 97.38 97.38 0 0.00
33487. Thierry (quatumboy) 1 71.29 71.29 0 0.00
33488. James (quangos) 1 61.23 61.23 1 100.00
33489. Quang (quang81191) 1 56.14 56.14 0 0.00
33490. Ty (quachgiaty) 1 52.81 52.81 0 0.00
33491. Krishnan (qrownora) 1 54.98 54.98 0 0.00
33492. Kenai Liam (pyro_kun) 1 93.89 93.89 1 100.00
33493. Hughie (pynfirnite) 1 72.94 72.94 0 0.00
33494. Perry (pyam0419) 1 80.01 80.01 1 100.00
33495. agent narwhal (puppyz) 1 54.95 54.95 0 0.00
33496. Josh (punyo) 1 63.34 63.34 1 100.00
33497. Ben (punkturkyy) 1 57.71 57.71 0 0.00
33498. Kevin (punch1ine) 1 36.17 36.17 1 100.00
33499. Pumpy (pumpytudors) 1 124.26 124.26 1 100.00
33500. tstats[pumabvb] (pumabvb) 1 50.15 50.15 0 0.00
33501. pulux (pulux) 1 84.31 84.31 0 0.00
33502. Pu (pulak) 1 77.28 77.28 1 100.00
33503. Pubordin (pubordin44) 1 38.14 38.14 0 0.00
33504. PsychoSaeko (psychosaeko) 1 118.97 118.97 1 100.00
33505. Pseudo (psuedo) 1 112.03 112.03 0 0.00
33506. Pranav (ps0505) 1 93.71 93.71 0 0.00
33507. Thomas (proff001) 1 46.03 46.03 0 0.00
33508. Alexandre (profenom) 1 76.34 76.34 0 0.00
33509. A (processivity) 1 111.23 111.23 0 0.00
33510. Dinmukhamed (pro005) 1 94.59 94.59 0 0.00
33511. pravanit (privinit) 1 54.34 54.34 1 100.00
33512. Ian (prince_zuko1) 1 43.96 43.96 0 0.00
33513. Preston (prestomation) 1 108.44 108.44 0 0.00
33514. premnath (premnath) 1 58.30 58.30 0 0.00
33515. Eddie (premeditate) 1 85.53 85.53 0 0.00
33516. Prem (prem6299) 1 13.40 13.40 0 0.00
33517. Harshpreet (preetikaur12) 1 71.29 71.29 0 0.00
33518. Hevesi (preeim) 1 41.72 41.72 0 0.00
33519. Precarious, (precariousgray) 1 176.93 176.93 1 100.00
33520. Prateek (prateek2112) 1 59.31 59.31 1 100.00
33521. Sadman (prant0) 1 107.88 107.88 0 0.00
33522. tstats[praneeth_07] (pranee... 1 98.06 98.06 1 100.00
33523. parks (prakerr) 1 53.22 53.22 1 100.00
33524. Pablo (praguevara) 1 87.71 87.71 0 0.00
33525. petey (pr69) 1 92.79 92.79 1 100.00
33526. Thanh (pr1metine) 1 95.84 95.84 0 0.00
33527. Chris (pr1m3) 1 79.61 79.61 0 0.00
33528. iguesspperson (ppersonas) 1 94.38 94.38 1 100.00
33529. Ethan (pottatis) 1 81.11 81.11 1 100.00
33530. Potato (potato_wink9) 1 56.75 56.75 0 0.00
33531. Joshua (potatolemon123) 1 92.11 92.11 0 0.00
33532. Oskar (postmanpott) 1 54.04 54.04 0 0.00
33533. BigPoopBoy (posit1v3) 1 105.27 105.27 1 100.00
33534. porson (porson) 1 36.77 36.77 0 0.00
33535. Poppa (poppayons) 1 69.99 69.99 1 100.00
33536. anatoly (popovanatoly) 1 81.63 81.63 1 100.00
33537. Charles (pools_closed_due_t... 1 60.72 60.72 0 0.00
33538. jj (ponygaryelow) 1 116.06 116.06 0 0.00
33539. polt (poltt) 1 112.36 112.36 1 100.00
33540. MikiX (polish_wonderboy) 1 65.63 65.63 0 0.00
33541. Police (policecow) 1 73.57 73.57 0 0.00
33542. Andrew (poler10) 1 109.17 109.17 1 100.00
33543. Pokemon (pokemonkillr) 1 74.63 74.63 0 0.00
33544. psn (poisonlance) 1 141.27 141.27 1 100.00
33545. PoisonDart (poisondart) 1 59.78 59.78 0 0.00
33546. Pocong (pocongjomblo) 1 49.96 49.96 0 0.00
33547. Xd (pm7373) 1 76.60 76.60 1 100.00
33548. arsh (plutarsh) 1 59.25 59.25 1 100.00
33549. Parth (plukhi17) 1 68.31 68.31 0 0.00
33550. miss index (plorksauce) 1 153.26 153.26 1 100.00
33551. plum (ploom) 1 90.78 90.78 0 0.00
33552. Gianmarco (plagioclasio) 1 99.43 99.43 0 0.00
33553. Cielo (pjocielo) 1 52.86 52.86 0 0.00
33554. Florian (pixhd) 1 59.19 59.19 1 100.00
33555. Carlisle (pixellexe) 1 49.91 49.91 1 100.00
33556. Jeron (pivotwind) 1 110.25 110.25 1 100.00
33557. pistil (pistilmen) 1 79.03 79.03 0 0.00
33558. PiranhaPig (piranhapig) 1 94.16 94.16 1 100.00
33559. Noname (pioustube) 1 78.13 78.13 0 0.00
33560. Stella (ping470) 1 91.24 91.24 0 0.00
33561. Fox (pineapplefun101) 1 96.84 96.84 1 100.00
33562. pillow (pillowkiller) 1 70.05 70.05 1 100.00
33563. lumpsofwheat (pileofpaper) 1 126.50 126.50 1 100.00
33564. Pikshu (pikashu02) 1 104.85 104.85 1 100.00
33565. Pika (pikalight) 1 52.22 52.22 0 0.00
33566. Tony (piiscool) 1 68.73 68.73 0 0.00
33567. Pieter Jelle (pieterjelle) 1 68.15 68.15 1 100.00
33568. Pierre (pierre15) 1 57.24 57.24 1 100.00
33569. Tauntpiersto (piercebigelow) 1 69.86 69.86 0 0.00
33570. Jacob (pieceofjake) 1 144.90 144.90 1 100.00
33571. Annabelle (pickle_jickle) 1 49.53 49.53 0 0.00
33572. pickleify (pickleify) 1 60.74 60.74 0 0.00
33573. P (pianomyn) 1 113.43 113.43 0 0.00
33574. Chuck (phreoq) 1 93.74 93.74 0 0.00
33575. Photastic (photastic) 1 79.36 79.36 0 0.00
33576. Philipp (phimaster0303) 1 47.25 47.25 0 0.00
33577. Phil (philosphyphil) 1 96.28 96.28 1 100.00
33578. PhiBi2002 (phibi2002) 1 56.36 56.36 0 0.00
33579. David (pherric0xide) 1 100.33 100.33 0 0.00
33580. abdo (phcox_hunter) 1 73.66 73.66 0 0.00
33581. akash (phantom_07) 1 102.00 102.00 1 100.00
33582. PhantasmagoricBeef (phantas... 1 73.55 73.55 0 0.00
33583. faith (phaithyy) 1 89.38 89.38 0 0.00
33584. Patrick (pgosser01) 1 81.90 81.90 0 0.00
33585. Trey (pgneal3) 1 106.11 106.11 1 100.00
33586. Peyton (peytonhm) 1 72.85 72.85 0 0.00
33587. Sander (pettersen3008) 1 53.08 53.08 1 100.00
33588. Peter (peter12253) 1 85.66 85.66 0 0.00
33589. PERO (pero_op) 1 84.61 84.61 1 100.00
33590. Félix (percevent) 1 81.39 81.39 0 0.00
33591. Colin (peppyduckling) 1 64.04 64.04 0 0.00
33592. pepino (pepinerino) 1 40.27 40.27 0 0.00
33593. Daddy (pep1) 1 55.71 55.71 0 0.00
33594. PegaS (pegas) 1 106.31 106.31 1 100.00
33595. p2 (peep0) 1 71.54 71.54 0 0.00
33596. Pectuu (pectuu_) 1 57.16 57.16 0 0.00
33597. PeckingNoob (peckingnoob) 1 54.69 54.69 0 0.00
33598. peter (pbang) 1 119.91 119.91 0 0.00
33599. marmonjen (pawnracer) 1 89.83 89.83 0 0.00
33600. Edwin (pawncastle) 1 103.27 103.27 1 100.00
33601. PaulC10333 (paul_c10333) 1 51.23 51.23 1 100.00
33602. Paul (paulinka7217) 1 42.58 42.58 0 0.00
33603. Jo (paulajoo) 1 37.53 37.53 0 0.00
33604. Patrick (patrickmcd) 1 76.17 76.17 0 0.00
33605. Pasta (pastayes) 1 65.80 65.80 1 100.00
33606. Vanser (paskerdewdz) 1 75.07 75.07 0 0.00
33607. Pasindu (pasindusandima) 1 44.46 44.46 0 0.00
33608. parteek (parteek) 1 76.38 76.38 1 100.00
33609. Tyler (pardue) 1 86.18 86.18 1 100.00
33610. basic (paperscraps) 1 137.59 137.59 0 0.00
33611. Nathan (papapapow) 1 87.85 87.85 0 0.00
33612. your (papaheav) 1 56.00 56.00 1 100.00
33613. Sumeo-Okami (paolo321) 1 128.69 128.69 1 100.00
33614. Guiguizin (paodequeijomolhado) 1 28.86 28.86 1 100.00
33615. panuto2 (panuto2) 1 91.86 91.86 1 100.00
33616. isaac (pantsmcgee) 1 70.10 70.10 0 0.00
33617. Panther (panthernerd) 1 90.73 90.73 0 0.00
33618. Pannz (pannz) 1 105.67 105.67 1 100.00
33619. Aayush (pandaayush) 1 85.84 85.84 1 100.00
33620. Pacchan (panda892) 1 77.76 77.76 0 0.00
33621. Panazios (panazios) 1 96.50 96.50 1 100.00
33622. Peter (panalis) 1 48.44 48.44 0 0.00
33623. Valtra (palap0n) 1 87.70 87.70 1 100.00
33624. Paino (painogamingyt) 1 95.43 95.43 1 100.00
33625. pagep (pagep) 1 65.60 65.60 0 0.00
33626. padoru (padoru69) 1 88.58 88.58 1 100.00
33627. Anthony (pacho_11) 1 46.47 46.47 0 0.00
33628. Pablo (pabloberwig) 1 99.72 99.72 0 0.00
33629. pablazo (pablazo) 1 73.15 73.15 1 100.00
33630. PAGAN (p4gan) 1 84.84 84.84 1 100.00
33631. p3t9a (p3t9a) 1 41.63 41.63 0 0.00
33632. Pratik (p3nx1lz) 1 54.19 54.19 0 0.00
33633. Jacob (p2kk96) 1 94.89 94.89 0 0.00
33634. p1ng_speed (p1ng_) 1 42.00 42.00 0 0.00
33635. Potato (p0tat0fri3s) 1 75.20 75.20 0 0.00
33636. Oxoxrut (oxoxrut) 1 132.38 132.38 1 100.00
33637. Raphael (oxidation) 1 75.12 75.12 0 0.00
33638. over_loadcode (over_loadcode) 1 105.55 105.55 1 100.00
33639. overlord_dude (overlord_dude) 1 51.97 51.97 0 0.00
33640. bruh (ovecko) 1 95.66 95.66 1 100.00
33641. Brian (outremonde) 1 89.91 89.91 1 100.00
33642. dank nissan (osubora) 1 122.28 122.28 1 100.00
33643. Justin (orthanek) 1 93.80 93.80 1 100.00
33644. orgilmunh (orgilmunh) 1 60.89 60.89 1 100.00
33645. Jeremy (orenthion) 1 75.28 75.28 1 100.00
33646. Igor (orderil) 1 59.69 59.69 0 0.00
33647. Beep (orange_capri_sun) 1 67.50 67.50 0 0.00
33648. Buttjuice (orangebruce) 1 101.79 101.79 0 0.00
33649. Ereal (oqutaorblx) 1 29.55 29.55 0 0.00
33650. Owen (opw3319) 1 39.69 39.69 0 0.00
33651. Optimize (optimizevfx) 1 66.65 66.65 0 0.00
33652. Owen (opio2000) 1 87.10 87.10 0 0.00
33653. Michael (onyxite) 1 129.77 129.77 0 0.00
33654. ONI (oniboo) 1 36.26 36.26 0 0.00
33655. Andrew (onetwoandyroo) 1 59.88 59.88 0 0.00
33656. Christian (oneetian) 1 82.99 82.99 0 0.00
33657. One (onebyte) 1 84.22 84.22 0 0.00
33658. Ondřej (ondrfol) 1 51.77 51.77 0 0.00
33659. Bibi (omusubee) 1 85.12 85.12 1 100.00
33660. Shubham (omnissan) 1 88.08 88.08 0 0.00
33661. Omer (omerrrr) 1 99.47 99.47 1 100.00
33662. ΩmegaMan (omegaman) 1 109.82 109.82 1 100.00
33663. omar (omarkasem) 1 77.25 77.25 0 0.00
33664. Omar (omarkalii) 1 84.08 84.08 0 0.00
33665. Omari (omari_) 1 54.43 54.43 0 0.00
33666. Oliver (olliepop04) 1 56.81 56.81 0 0.00
33667. Oliver (olliebe4r) 1 75.05 75.05 0 0.00
33668. Olivia (oliviali) 1 103.38 103.38 1 100.00
33669. Newland (oldwutter) 1 107.58 107.58 1 100.00
33670. Eli (ok_eli) 1 71.52 71.52 0 0.00
33671. lol (oknoted) 1 86.86 86.86 1 100.00
33672. okkonishi (okkonishi) 1 85.50 85.50 0 0.00
33673. Osama (ojscofield) 1 56.15 56.15 0 0.00
33674. Toby (oisklet) 1 92.46 92.46 0 0.00
33675. Brot (oh_brot) 1 50.84 50.84 0 0.00
33676. OhMyTomat (ohmytomat) 1 54.46 54.46 0 0.00
33677. Ryan (ohlegends) 1 96.98 96.98 0 0.00
33678. zuramai (ogihek1) 1 94.60 94.60 1 100.00
33679. Ody (odyxlala) 1 50.52 50.52 0 0.00
33680. Octav (octavianro) 1 81.90 81.90 1 100.00
33681. Vlad (obserrrver) 1 35.32 35.32 0 0.00
33682. Osama (obokanan) 1 101.91 101.91 0 0.00
33683. oatmilk (oatmilque) 1 73.28 73.28 0 0.00
33684. Obada (oaah) 1 52.54 52.54 0 0.00
33685. Potato (nyll) 1 59.50 59.50 0 0.00
33686. Nycto (nycto_night) 1 40.03 40.03 0 0.00
33687. Martin (nyborg) 1 84.14 84.14 1 100.00
33688. Yan (nyanyan12_1) 1 112.98 112.98 0 0.00
33689. Andy (nuudle) 1 85.30 85.30 0 0.00
33690. Pen (nutty69) 1 70.28 70.28 1 100.00
33691. Justin (nutmeg_0) 1 104.37 104.37 1 100.00
33692. Stinkbean (nutloaf) 1 97.56 97.56 0 0.00
33693. Dastan (nur_4_earth) 1 48.34 48.34 0 0.00
33694. Nurasyl (nurrrrasyl) 1 71.00 71.00 0 0.00
33695. Your (numiko) 1 45.58 45.58 0 0.00
33696. Tyler (numbermunch3r) 1 108.23 108.23 1 100.00
33697. AubReina (nta0789) 1 68.04 68.04 1 100.00
33698. N (nsortur) 1 98.28 98.28 0 0.00
33699. Alex (nr1771) 1 102.05 102.05 0 0.00
33700. Nicolas (nqber) 1 59.90 59.90 1 100.00
33701. Nate (npmaile) 1 88.89 88.89 1 100.00
33702. Nathan (nparque03) 1 104.38 104.38 1 100.00
33703. leon (notveryfast6) 1 53.87 53.87 0 0.00
33704. Dexter (notundampeddex) 1 70.58 70.58 1 100.00
33705. Not (notpeo) 1 87.58 87.58 0 0.00
33706. Edison (notmercury) 1 92.11 92.11 0 0.00
33707. Jared (notjard) 1 89.42 89.42 1 100.00
33708. Filip (normalnie) 1 89.48 89.48 1 100.00
33709. Zach (nordwez) 1 106.51 106.51 1 100.00
33710. Nurlybek (noproblem29) 1 42.91 42.91 1 100.00
33711. Chase (nootnamed) 1 112.31 112.31 1 100.00
33712. Benj (noodlicious) 1 136.36 136.36 0 0.00
33713. Crimson (noodle_fingers) 1 54.97 54.97 0 0.00
33714. spy (noobtypebuddy) 1 59.99 59.99 0 0.00
33715. Mariusz (nonton) 1 52.07 52.07 0 0.00
33716. Wilmore (nonquitchad) 1 120.84 120.84 1 100.00
33717. Nongus (nongus_42) 1 83.62 83.62 0 0.00
33718. Tony (nomind) 1 87.47 87.47 0 0.00
33719. Nomig (nomig) 1 81.53 81.53 0 0.00
33720. nolan (nolantof) 1 41.67 41.67 0 0.00
33721. luap (nocturnalzek) 1 131.01 131.01 1 100.00
33722. Noct (nocturnally_) 1 114.42 114.42 1 100.00
33723. ℕ (noctua) 1 73.21 73.21 0 0.00
33724. Noah (noah_13) 1 78.84 78.84 0 0.00
33725. KampiiTV (noahmarvin) 1 100.51 100.51 0 0.00
33726. Zen (njpwstardomfan) 1 117.68 117.68 1 100.00
33727. Nix (nix_) 1 84.17 84.17 0 0.00
33728. Nixibeaver (nixibeaver) 1 118.62 118.62 1 100.00
33729. Valentin (nivanpylte) 1 53.20 53.20 1 100.00
33730. Niuqaoj (niuqaoj_life) 1 89.57 89.57 0 0.00
33731. N (nitruo) 1 104.35 104.35 0 0.00
33732. Mohamed (nitrousgamer) 1 99.78 99.78 0 0.00
33733. Mitch (nitchmichols) 1 74.24 74.24 0 0.00
33734. NinjaTurtleDude (ninjaturtl... 1 71.98 71.98 0 0.00
33735. E (ninjanahtey) 1 66.37 66.37 0 0.00
33736. Nina (ninapez) 1 91.34 91.34 1 100.00
33737. Muhaiminul Islam (ninadgns) 1 72.43 72.43 0 0.00
33738. Liang (nimble_ngo) 1 62.10 62.10 0 0.00
33739. Becca (niknup) 1 89.52 89.52 1 100.00
33740. Nikhil (nikhilk710) 1 57.99 57.99 0 0.00
33741. Michael (niightgamez) 1 52.14 52.14 0 0.00
33742. Nihilyst (nihilyst21) 1 80.36 80.36 0 0.00
33743. tstats[nightisbad] (nightis... 1 80.91 80.91 0 0.00
33744. Nidzi (nidzi) 1 88.02 88.02 1 100.00
33745. Violet (nidtsg1113) 1 98.66 98.66 0 0.00
33746. Saif (niconyte) 1 36.08 36.08 0 0.00
33747. Nico (nicob_1212) 1 80.82 80.82 0 0.00
33748. Nick (nickstoni) 1 87.68 87.68 0 0.00
33749. Nicolas (nickolishous) 1 82.29 82.29 1 100.00
33750. Nick (nickman666) 1 68.00 68.00 1 100.00
33751. AJ-_- (nickelthemarcoman) 1 56.80 56.80 0 0.00
33752. Nícolas (nickdev) 1 95.88 95.88 1 100.00
33753. NickR (nicholasr) 1 59.65 59.65 0 0.00
33754. Nicholas (nich42) 1 95.20 95.20 1 100.00
33755. Nial (nialj618) 1 64.72 64.72 0 0.00
33756. PriesaFire (nguyentriton) 1 64.47 64.47 0 0.00
33757. Jan (nexxo) 1 60.25 60.25 0 0.00
33758. Justin (nexoloft) 1 88.76 88.76 0 0.00
33759. Neal (newbcake) 1 87.85 87.85 1 100.00
33760. Matthew (neropuncher) 1 47.09 47.09 0 0.00
33761. Nero (ner0plu3) 1 44.52 44.52 0 0.00
33762. Reylo4Evr (neqailaz) 1 79.57 79.57 0 0.00
33763. Neo (neonter) 1 51.41 51.41 0 0.00
33764. Sage (neonfuz) 1 95.98 95.98 1 100.00
33765. NELiXERY (nelixery) 1 83.47 83.47 1 100.00
33766. negev (negev_lover) 1 103.37 103.37 0 0.00
33767. Sean (nefhx3) 1 60.05 60.05 0 0.00
33768. Use an appropriate name (ne... 1 87.88 87.88 0 0.00
33769. ︎ ︎ ︎ ︎ ︎ ︎ ︎... 1 81.05 81.05 1 100.00
33770. Matthew (necroxity_2021) 1 60.52 60.52 0 0.00
33771. Kai zheng (nebs_2ge) 1 42.72 42.72 0 0.00
33772. Jpeg blue car (nebbeh) 1 102.59 102.59 0 0.00
33773. Nolwen (neb0003) 1 105.63 105.63 0 0.00
33774. Ndu (ndubizu19) 1 43.15 43.15 0 0.00
33775. Nicholas (nchlslv) 1 78.77 78.77 0 0.00
33776. Mandy (nchaiphuong) 1 78.61 78.61 1 100.00
33777. Blake (navy23rd) 1 92.72 92.72 1 100.00
33778. lee (navalta) 1 59.45 59.45 0 0.00
33779. Natte (nattel) 1 104.89 104.89 1 100.00
33780. Nat (natrose) 1 94.64 94.64 0 0.00
33781. Nat (natenat) 1 46.78 46.78 0 0.00
33782. Nason (nason420) 1 71.57 71.57 0 0.00
33783. Nash (nashsauter) 1 56.30 56.30 0 0.00
33784. Chris (nasageek) 1 90.57 90.57 0 0.00
33785. Jonski (napalleum) 1 77.75 77.75 0 0.00
33786. Rob (nanijau) 1 84.16 84.16 0 0.00
33787. name999 (name_999) 1 104.71 104.71 1 100.00
33788. Simonas (nags) 1 83.81 83.81 0 0.00
33789. nadan (nadanfrenkiel) 1 37.24 37.24 0 0.00
33790. france (nabyounab) 1 102.26 102.26 0 0.00
33791. Nex (n3x7s) 1 57.53 57.53 1 100.00
33792. Noob (n0013gam3r) 1 98.45 98.45 1 100.00
33793. smell (mytoes) 1 68.77 68.77 0 0.00
33794. Hunter (mythichunter758) 1 95.58 95.58 1 100.00
33795. Spotter (mythical_spotter) 1 60.76 60.76 1 100.00
33796. Jesse (myoga) 1 131.81 131.81 1 100.00
33797. Dave Israel (mynameisdig) 1 70.03 70.03 1 100.00
33798. yes (mymotherleftmewheniwas2) 1 77.94 77.94 0 0.00
33799. mymodded (mymodded) 1 64.37 64.37 0 0.00
33800. myle (myle_7894) 1 113.88 113.88 0 0.00
33801. Joshua (myhoohasmells) 1 73.90 73.90 0 0.00
33802. Christopher (mybudgiegus) 1 106.59 106.59 1 100.00
33803. Mustafa (muzzy750) 1 68.22 68.22 0 0.00
33804. muthukumar (muthukumarp) 1 65.33 65.33 0 0.00
33805. Amanda (musseama) 1 99.70 99.70 1 100.00
33806. Muslem (muslimomar) 1 97.27 97.27 0 0.00
33807. abdelrahman (muslim21) 1 44.41 44.41 0 0.00
33808. Musa Bedirhan (musajoker) 1 90.87 90.87 0 0.00
33809. Nawar (murci) 1 51.34 51.34 0 0.00
33810. ムラサメ (murasamechan) 1 97.36 97.36 0 0.00
33811. Will (munce) 1 112.51 112.51 0 0.00
33812. Alexander (mummenschanz) 1 41.42 41.42 0 0.00
33813. zakilegs (mulgor) 1 105.42 105.42 0 0.00
33814. Marco (msukhatme) 1 78.69 78.69 0 0.00
33815. decent (mstersierra) 1 93.87 93.87 1 100.00
33816. Morgan (mscoot) 1 58.75 58.75 1 100.00
33817. Mahmud Sajjad (msabeer) 1 52.88 52.88 0 0.00
33818. Mr (mr_otaku) 1 96.40 96.40 0 0.00
33819. Yeshua (mr_inconsistent88) 1 37.89 37.89 0 0.00
33820. Akshay (mr_dadwal) 1 66.33 66.33 1 100.00
33821. MrWaffle (mrwaffle_) 1 54.70 54.70 0 0.00
33822. Marvin (mrvn) 1 66.02 66.02 0 0.00
33823. MR (mrsystem) 1 103.02 103.02 0 0.00
33824. runicc (mrscrubbywaffle) 1 80.78 80.78 1 100.00
33825. mrob2304 (mrob2304) 1 66.05 66.05 0 0.00
33826. i like turtles (mrmlgturtle) 1 106.34 106.34 0 0.00
33827. markzeras (mrkmat) 1 90.46 90.46 0 0.00
33828. MrRidiculous (mrjacobj56) 1 58.57 58.57 1 100.00
33829. Mister (mrgraie) 1 108.74 108.74 1 100.00
33830. Dragon (mrdragonplays) 1 95.96 95.96 1 100.00
33831. Diego (mrcatisgod) 1 81.11 81.11 0 0.00
33832. Dat (mralex101) 1 82.23 82.23 0 0.00
33833. Martin (mqrtyn) 1 51.16 51.16 0 0.00
33834. Marek (mp4mero) 1 87.96 87.96 1 100.00
33835. Mottures (mottures) 1 89.32 89.32 0 0.00
33836. Moses (moses_) 1 125.43 125.43 1 100.00
33837. Vlaviano (moryoka) 1 51.38 51.38 0 0.00
33838. Morph (morpheus1008) 1 61.55 61.55 0 0.00
33839. dsfdsf (moropopi) 1 61.69 61.69 0 0.00
33840. Morgan (morgan_brooke_21) 1 25.70 25.70 1 100.00
33841. morgan (morganidk) 1 117.29 117.29 0 0.00
33842. mooshi (mooshituslo) 1 77.21 77.21 1 100.00
33843. sergio (montyzing) 1 88.46 88.46 0 0.00
33844. Florin (montecolumns) 1 66.10 66.10 0 0.00
33845. lucho (monopolyy) 1 72.53 72.53 1 100.00
33846. Feces (monkey_feces) 1 73.29 73.29 0 0.00
33847. Caleb (monkeyboy1379) 1 72.52 72.52 1 100.00
33848. saefwaqefr (monkethattypesf... 1 118.33 118.33 1 100.00
33849. Dark (monevtna) 1 87.89 87.89 0 0.00
33850. Breanna (monettheturtle) 1 92.89 92.89 0 0.00
33851. MOMO (momo_20) 1 25.75 25.75 0 0.00
33852. Chico (momothedoge) 1 55.43 55.43 0 0.00
33853. Shour (momax) 1 31.85 31.85 1 100.00
33854. Cameron (moliopp) 1 90.28 90.28 1 100.00
33855. Mojave (mojave) 1 102.03 102.03 0 0.00
33856. Mohamed (mohamedessam_52) 1 65.52 65.52 0 0.00
33857. mogi (mogspls) 1 83.89 83.89 0 0.00
33858. Boom (moeroach) 1 111.96 111.96 1 100.00
33859. maaeab (moemenahmed) 1 62.56 62.56 0 0.00
33860. Romir Basu (mod_rombus) 1 97.51 97.51 0 0.00
33861. Arman (modares) 1 61.81 61.81 0 0.00
33862. Chase (mobinn) 1 79.77 79.77 0 0.00
33863. mo (mobeats) 1 90.48 90.48 0 0.00
33864. Mnkx (mnkx) 1 74.34 74.34 0 0.00
33865. Madison (mnbutler) 1 80.03 80.03 0 0.00
33866. David (mm12345) 1 108.37 108.37 0 0.00
33867. Michal (mlvy2589) 1 62.05 62.05 1 100.00
33868. Matt (mlamm) 1 103.26 103.26 0 0.00
33869. M (ml19) 1 56.41 56.41 0 0.00
33870. Marcus (mjtsquared) 1 103.57 103.57 1 100.00
33871. Elektra (mjpaark) 1 76.40 76.40 0 0.00
33872. mizu (mizu0607) 1 59.88 59.88 0 0.00
33873. James (miztrjriii) 1 98.30 98.30 0 0.00
33874. Dennis (mizonex) 1 98.61 98.61 1 100.00
33875. Mikkel (mixmox) 1 76.84 76.84 0 0.00
33876. Paitpan (mixptp) 1 84.14 84.14 1 100.00
33877. mitchy2093 (mitchy2093) 1 66.58 66.58 0 0.00
33878. Mitch (mitchtin) 1 64.99 64.99 0 0.00
33879. Mistah (mistahd) 1 87.77 87.77 0 0.00
33880. Anna (misslua1) 1 118.56 118.56 1 100.00
33881. tstats[mishrakunal012] Kuna... 1 62.96 62.96 0 0.00
33882. Fizzman (mintyballs) 1 99.32 99.32 0 0.00
33883. Daniel (minqz) 1 71.56 71.56 0 0.00
33884. Việt Hùng (minkate) 1 91.51 91.51 0 0.00
33885. Tom (minitom) 1 85.26 85.26 1 100.00
33886. Herman (minions96) 1 40.48 40.48 0 0.00
33887. Minhon (minhon23) 1 67.54 67.54 0 0.00
33888. Henrik (minepro3004) 1 64.97 64.97 1 100.00
33889. Wyatt (millybay) 1 102.35 102.35 1 100.00
33890. milluki (milluki) 1 81.31 81.31 0 0.00
33891. hugh jass (milkyxing) 1 133.19 133.19 0 0.00
33892. brandon (milks0ck) 1 71.13 71.13 1 100.00
33893. Mike (mikespits) 1 71.59 71.59 0 0.00
33894. Michael (mikell) 1 85.14 85.14 0 0.00
33895. Mika (mikakareefu) 1 73.11 73.11 0 0.00
33896. Mihael (mihchina) 1 91.66 91.66 1 100.00
33897. Miguel (migzkulitz05) 1 84.68 84.68 0 0.00
33898. Migs (migbasilio) 1 72.51 72.51 0 0.00
33899. Ben (midnitekuro) 1 47.38 47.38 1 100.00
33900. Noman (middlero) 1 100.77 100.77 0 0.00
33901. Mid9ht (mid9ht) 1 52.36 52.36 1 100.00
33902. Microwave (microwave69420) 1 59.16 59.16 1 100.00
33903. Vallabh (micronic) 1 66.09 66.09 0 0.00
33904. m (microlmao) 1 117.50 117.50 1 100.00
33905. DOS (microdos) 1 102.73 102.73 1 100.00
33906. Mich2700 (mich2700) 1 77.97 77.97 0 0.00
33907. Michael (micecheese) 1 115.70 115.70 1 100.00
33908. Mice (micebishop) 1 67.80 67.80 0 0.00
33909. Miad (miad_hasan) 1 49.77 49.77 0 0.00
33910. noah (mhyrion) 1 21.58 21.58 1 100.00
33911. Eunmin (mgood2) 1 75.51 75.51 0 0.00
33912. Maddie (mfighter) 1 71.89 71.89 1 100.00
33913. Method (method16) 1 68.26 68.26 0 0.00
33914. Mewi (metalwihen) 1 100.62 100.62 0 0.00
33915. S (messmind) 1 70.69 70.69 1 100.00
33916. Cesar (messyces) 1 62.30 62.30 1 100.00
33917. Brn (meslowlmao) 1 84.17 84.17 0 0.00
33918. Dvorak (mesingel_dvorak) 1 95.33 95.33 1 100.00
33919. Mert (mertkasikci) 1 48.78 48.78 1 100.00
33920. ♡ (meretricious) 1 99.50 99.50 0 0.00
33921. Mephy (mephy) 1 123.47 123.47 1 100.00
33922. pietro (mepeeper) 1 28.01 28.01 0 0.00
33923. Meow (meowreaper) 1 80.98 80.98 1 100.00
33924. Ben (men_biller) 1 59.76 59.76 0 0.00
33925. carleel (menamesringo) 1 96.14 96.14 1 100.00
33926. Luke (menace13) 1 130.50 130.50 1 100.00
33927. i use membrane by the way (... 1 80.21 80.21 0 0.00
33928. Melvin (melvinhedman) 1 104.20 104.20 0 0.00
33929. mello (mellofiy) 1 59.75 59.75 0 0.00
33930. Lorenz (meincrakker) 1 34.31 34.31 0 0.00
33931. Michael (meikey) 1 83.14 83.14 1 100.00
33932. Chen (megus) 1 92.03 92.03 0 0.00
33933. goober (megumin00) 1 100.84 100.84 0 0.00
33934. C (meektaco) 1 103.03 103.03 0 0.00
33935. Mecha (mechadestroyer) 1 110.36 110.36 1 100.00
33936. MeBookJava (mebookjava) 1 42.84 42.84 0 0.00
33937. Mohd (md_shariq1) 1 63.62 63.62 0 0.00
33938. Matthew (mdsauer53) 1 68.28 68.28 0 0.00
33939. mdlu (mdlu) 1 125.47 125.47 0 0.00
33940. Kaylee (mcpie87) 1 114.47 114.47 0 0.00
33941. Brian (mcflobbergobber) 1 47.98 47.98 0 0.00
33942. (mbwins10) 1 72.21 72.21 1 100.00
33943. Maysa (maysa_27) 1 46.45 46.45 0 0.00
33944. Maydup (maydup_naim) 1 147.64 147.64 1 100.00
33945. Maya (mayam915) 1 67.65 67.65 1 100.00
33946. Maxxxi420 (maxxxi420) 1 52.51 52.51 1 100.00
33947. Max (maximusprime70) 1 82.80 82.80 1 100.00
33948. Maximillian (maximillian_) 1 62.03 62.03 0 0.00
33949. Max (maxiebond) 1 78.54 78.54 1 100.00
33950. Lucas (maxicalcio) 1 87.67 87.67 0 0.00
33951. Azar (maxentium) 1 110.03 110.03 1 100.00
33952. Max (maxattack) 1 140.70 140.70 1 100.00
33953. Marco (mauboru) 1 49.06 49.06 1 100.00
33954. 123 (matuska) 1 85.23 85.23 1 100.00
33955. Matty (mattypatty) 1 68.30 68.30 0 0.00
33956. Matt (mattyb15) 1 68.00 68.00 1 100.00
33957. Mattin (mattinpeik) 1 68.12 68.12 0 0.00
33958. Matthew (matthewmics77) 1 118.94 118.94 1 100.00
33959. Matt 🐌 (mattg54321) 1 85.60 85.60 0 0.00
33960. Matt (mattdowning91) 1 81.12 81.12 0 0.00
33961. Mats (matserbedre) 1 61.88 61.88 1 100.00
33962. Masuikai (masuikai) 1 100.78 100.78 1 100.00
33963. Arman (masterilluminati) 1 94.32 94.32 0 0.00
33964. James (mastakeyboard) 1 90.09 90.09 0 0.00
33965. Abdullah (massucksagaming) 1 96.04 96.04 1 100.00
33966. Sam (masamuel) 1 72.85 72.85 0 0.00
33967. Matt (marvinhamlisch) 1 96.58 96.58 0 0.00
33968. martinspp (martinspp) 1 70.71 70.71 1 100.00
33969. Martin (martin3099) 1 54.36 54.36 0 0.00
33970. Eric (martellen) 1 62.75 62.75 0 0.00
33971. Martin (martafiixek) 1 105.47 105.47 1 100.00
33972. marsha (marsha_socks) 1 127.40 127.40 1 100.00
33973. Marrie (marriemitsu) 1 77.07 77.07 0 0.00
33974. Bruno (marmota07) 1 63.64 63.64 1 100.00
33975. Marla Marie (marla_17) 1 29.31 29.31 0 0.00
33976. Markus (markusmanbro) 1 110.89 110.89 0 0.00
33977. Mark (markovsy) 1 37.25 37.25 0 0.00
33978. Marko (markocar22) 1 69.30 69.30 0 0.00
33979. Andrew (markinandrew) 1 84.27 84.27 1 100.00
33980. pearslice (mark42isawesome) 1 125.77 125.77 0 0.00
33981. Vroom (mariotaughtmetyping) 1 98.12 98.12 1 100.00
33982. hunter (marcyisthebestestgirl) 1 25.96 25.96 0 0.00
33983. Marc (marcp3k) 1 63.11 63.11 1 100.00
33984. Marck (marckyeee) 1 54.00 54.00 0 0.00
33985. Mooriah (marblesgalore) 1 93.36 93.36 0 0.00
33986. Jessica (marbilu) 1 54.07 54.07 0 0.00
33987. M (maqqnus) 1 54.29 54.29 0 0.00
33988. M4nu (manuqjapem) 1 37.61 37.61 0 0.00
33989. Manu (manuwu) 1 91.95 91.95 1 100.00
33990. Omar (manual_gears) 1 72.72 72.72 0 0.00
33991. Julia (mantitties) 1 76.21 76.21 0 0.00
33992. Mait (mangomaits) 1 59.64 59.64 1 100.00
33993. ihatepunc (manbanana) 1 114.33 114.33 0 0.00
33994. Malthus (malthusfb) 1 72.34 72.34 0 0.00
33995. Malthe (malthesers) 1 75.52 75.52 0 0.00
33996. Maloha (maloha7) 1 72.98 72.98 0 0.00
33997. maliwan (maliwan) 1 91.47 91.47 1 100.00
33998. maleika (maleika) 1 80.92 80.92 1 100.00
33999. Makaila (makailaxx) 1 38.12 38.12 0 0.00
34000. Alex (majorfontes) 1 100.29 100.29 0 0.00
34001. maya (maiableeds) 1 113.80 113.80 1 100.00
34002. Mahima (mahima_) 1 81.57 81.57 0 0.00
34003. Aksel (magicrex) 1 80.83 80.83 0 0.00
34004. Conor (magevonor) 1 93.27 93.27 0 0.00
34005. Niels (magerkonijn) 1 70.10 70.10 1 100.00
34006. Logan (maestrobroccoli) 1 106.60 106.60 1 100.00
34007. mael (maelstrom00) 1 83.54 83.54 0 0.00
34008. madmikexxl (madmikexxl) 1 127.08 127.08 0 0.00
34009. madhukar (madhukar00) 1 56.76 56.76 0 0.00
34010. Maday (maday) 1 92.87 92.87 1 100.00
34011. Memer (macisasandwich) 1 121.39 121.39 1 100.00
34012. Mohammad Abdul Ahad (maahad... 1 52.24 52.24 0 0.00
34013. Rohit (m5ar123) 1 83.05 83.05 0 0.00
34014. Paul (m4trixtr) 1 65.85 65.85 0 0.00
34015. Metiro (m3t1r0) 1 35.77 35.77 0 0.00
34016. M220 (m220) 1 47.79 47.79 0 0.00
34017. Neculai (m1s1) 1 61.70 61.70 0 0.00
34018. Moze (m0ze) 1 61.06 61.06 0 0.00
34019. Charlie (l_plater) 1 63.43 63.43 0 0.00
34020. Joshua (lysergicdie) 1 86.25 86.25 0 0.00
34021. Levon (lyovandra) 1 50.02 50.02 0 0.00
34022. lynn (lynno) 1 45.44 45.44 1 100.00
34023. Lynne (lynne17) 1 57.83 57.83 0 0.00
34024. Lvvy (lvvyy) 1 67.13 67.13 0 0.00
34025. Musa (lupuspark) 1 54.17 54.17 0 0.00
34026. Niels (luniejuul) 1 52.49 52.49 0 0.00
34027. Benton (lunarknight219) 1 92.29 92.29 1 100.00
34028. Luminescent (lumiines) 1 129.13 129.13 1 100.00
34029. kenjorine canon (lumibea) 1 61.08 61.08 0 0.00
34030. jr (lukrix) 1 105.76 105.76 1 100.00
34031. Anthony (lukiilegend) 1 122.60 122.60 1 100.00
34032. Lily (lukewarmwater) 1 72.10 72.10 0 0.00
34033. Luke (luketorti) 1 66.44 66.44 0 0.00
34034. lookie (lukeritos) 1 82.69 82.69 0 0.00
34035. Lukeface (lukeface) 1 91.35 91.35 0 0.00
34036. lukasz (lukaszx) 1 59.41 59.41 0 0.00
34037. Lukas (lukasdaisan) 1 80.18 80.18 1 100.00
34038. luka (lukabrlek) 1 71.90 71.90 0 0.00
34039. Lu-Wai (luhyphenwai) 1 87.34 87.34 1 100.00
34040. Lugia (lugia_) 1 55.61 55.61 0 0.00
34041. Ludicrous (ludicrouslevo) 1 105.74 105.74 1 100.00
34042. Sim (luckytosnort) 1 101.97 101.97 0 0.00
34043. Liao (luckykuy) 1 69.57 69.57 1 100.00
34044. Tiffany (luckydaboss) 1 76.65 76.65 0 0.00
34045. luckyapp (luckyapp) 1 54.68 54.68 0 0.00
34046. Luke (luckersx) 1 75.48 75.48 0 0.00
34047. Lucas (lucas_a04) 1 95.55 95.55 0 0.00
34048. Lucas (lucasmoc47) 1 69.36 69.36 1 100.00
34049. Luca (lucaro2708) 1 90.25 90.25 1 100.00
34050. Luca (lucadwong) 1 125.42 125.42 1 100.00
34051. BC (lspss99168) 1 36.29 36.29 0 0.00
34052. lquenti (lquenti) 1 83.44 83.44 1 100.00
34053. Nguyen (lqinfinity) 1 52.96 52.96 1 100.00
34054. jellio (lo_mava) 1 51.93 51.93 0 0.00
34055. ivano (lostmusician) 1 79.37 79.37 0 0.00
34056. Lost (losthalo) 1 81.53 81.53 0 0.00
34057. Louis (lorencoo) 1 59.54 59.54 0 0.00
34058. Justin (loremasterginger) 1 107.20 107.20 1 100.00
34059. Klenn C-zar (lordklenzki) 1 32.82 32.82 0 0.00
34060. Bence (lordbenczor) 1 44.02 44.02 0 0.00
34061. Ink (lordcubes) 1 111.02 111.02 0 0.00
34062. LordBanana23 (lordbanana23) 1 124.04 124.04 1 100.00
34063. JB (lookitsjb) 1 114.06 114.06 0 0.00
34064. Derick (lolman1312) 1 106.69 106.69 1 100.00
34065. Nicolas (lollipopmania) 1 99.85 99.85 0 0.00
34066. Lorenzo (lolgab) 1 71.13 71.13 1 100.00
34067. Serge (lolegend) 1 109.20 109.20 1 100.00
34068. Loki (loki5611) 1 57.04 57.04 1 100.00
34069. Nikita (loginezz) 1 86.56 86.56 1 100.00
34070. Kevin (logia) 1 96.04 96.04 0 0.00
34071. Zekus (loczx) 1 92.28 92.28 1 100.00
34072. Jacky (lo2238) 1 59.53 59.53 0 0.00
34073. Lmnoq (lmnoq) 1 63.66 63.66 1 100.00
34074. Geoff (lmaousucksobad23) 1 32.84 32.84 0 0.00
34075. lkary (lkary) 1 86.07 86.07 1 100.00
34076. Laurie (lkampster) 1 38.91 38.91 0 0.00
34077. Liz (lizzyshoe) 1 87.91 87.91 0 0.00
34078. Liwamster (liwamster15) 1 102.03 102.03 0 0.00
34079. Livacy (livacy) 1 47.21 47.21 0 0.00
34080. ben (liubenjamin) 1 114.18 114.18 0 0.00
34081. troy (little_bro) 1 74.71 74.71 0 0.00
34082. Pastasciutta (littleppig) 1 65.01 65.01 0 0.00
34083. SN (littlemaster) 1 52.60 52.60 0 0.00
34084. George (lirick) 1 77.51 77.51 0 0.00
34085. Liotom (liotom) 1 37.32 37.32 0 0.00
34086. roy (lin_ring) 1 42.28 42.28 0 0.00
34087. Lion (lionpride) 1 74.52 74.52 0 0.00
34088. LingLingAlex (linglingalex) 1 73.89 73.89 0 0.00
34089. lindee (lindee) 1 99.45 99.45 0 0.00
34090. limeslime (limeslime_) 1 65.18 65.18 1 100.00
34091. Tom (limera2nn) 1 91.16 91.16 0 0.00
34092. Bradley (lil_mayoe) 1 103.41 103.41 1 100.00
34093. Sriram (lil_india) 1 77.76 77.76 0 0.00
34094. Aaron (lil_bamboo) 1 82.15 82.15 1 100.00
34095. Alex (liltypist44) 1 89.55 89.55 0 0.00
34096. Luka (lilsmole) 1 62.47 62.47 0 0.00
34097. Gurgug (lilskrimp) 1 68.47 68.47 0 0.00
34098. Lilly (lillymallory13) 1 61.76 61.76 1 100.00
34099. Jackee (lilbully) 1 101.49 101.49 1 100.00
34100. Likhon (likhon5) 1 64.02 64.02 0 0.00
34101. Drake (likerofrisk) 1 91.42 91.42 1 100.00
34102. andy (lihanou) 1 110.43 110.43 0 0.00
34103. Light (lightpuma) 1 128.56 128.56 0 0.00
34104. Muntasir Billah (lights_on_me) 1 82.99 82.99 1 100.00
34105. lightlleaf (lightlleaf) 1 43.17 43.17 1 100.00
34106. Steven (lifeinbronze) 1 87.63 87.63 0 0.00
34107. khari (libsj) 1 59.00 59.00 0 0.00
34108. Paweł (lewapkon) 1 94.84 94.84 0 0.00
34109. levi (levi2) 1 46.34 46.34 1 100.00
34110. Tâm (letam120300) 1 62.19 62.19 0 0.00
34111. Matthew (lesterholster) 1 115.74 115.74 0 0.00
34112. Leriut (leriut) 1 84.79 84.79 1 100.00
34113. Lequim (lequim) 1 79.50 79.50 0 0.00
34114. Visiblepotato (leprechaun777) 1 78.89 78.89 1 100.00
34115. Rui (leonsuper) 1 146.49 146.49 1 100.00
34116. Leon (leonakerz) 1 85.46 85.46 1 100.00
34117. M310N (leomelonseeds) 1 133.00 133.00 0 0.00
34118. Leo (leoc) 1 99.10 99.10 0 0.00
34119. Lenny (lenny227) 1 54.97 54.97 0 0.00
34120. 🍋 (lemoncrush) 1 120.64 120.64 1 100.00
34121. Sinh (lekhanhsinhvn) 1 77.29 77.29 1 100.00
34122. Leif (leif26) 1 59.53 59.53 0 0.00
34123. Adilkhan (legolaz4ever) 1 31.03 31.03 0 0.00
34124. Ice (legacyst) 1 111.84 111.84 1 100.00
34125. fethy (lefty_dz) 1 69.71 69.71 1 100.00
34126. lebron (lebron_mccain) 1 100.68 100.68 1 100.00
34127. MrBusiness (leboii) 1 78.34 78.34 1 100.00
34128. Lea (lea_134) 1 58.04 58.04 1 100.00
34129. Prabuddha (learning2type1414) 1 43.67 43.67 0 0.00
34130. Leander (leandertaler) 1 51.58 51.58 1 100.00
34131. La Rana (la_rana_rene) 1 29.82 29.82 0 0.00
34132. Lazi (lazi) 1 35.06 35.06 0 0.00
34133. Raidon (laxprax) 1 74.55 74.55 0 0.00
34134. Harvey (lawyer001) 1 48.87 48.87 0 0.00
34135. ARGENTINA (lautixhx) 1 86.67 86.67 1 100.00
34136. Lauro (laurorehr) 1 34.39 34.39 0 0.00
34137. Laura (lauraab) 1 64.96 64.96 0 0.00
34138. Liam (laum) 1 73.03 73.03 1 100.00
34139. Laurits (laulaudk) 1 72.36 72.36 0 0.00
34140. Sam (latenightsnacks) 1 60.88 60.88 0 0.00
34141. Late Night Snack (latenight... 1 78.08 78.08 1 100.00
34142. abhilash (lash_32768) 1 81.02 81.02 0 0.00
34143. Andy (largahblarga) 1 76.43 76.43 0 0.00
34144. taste (lan9erhans) 1 69.30 69.30 0 0.00
34145. Lâm (lamisgosu11) 1 88.95 88.95 0 0.00
34146. Cenk (lambdaa) 1 119.76 119.76 1 100.00
34147. Ami (lambchop01) 1 89.93 89.93 1 100.00
34148. caplock (lalelilolu) 1 45.87 45.87 0 0.00
34149. Laith (laith_gg) 1 81.07 81.07 1 100.00
34150. Laird (lairdandrew) 1 83.71 83.71 0 0.00
34151. Lagartixa (lagartixa16) 1 34.97 34.97 0 0.00
34152. LotHtoJ (laessig) 1 65.95 65.95 0 0.00
34153. LaBond (labond123) 1 59.50 59.50 0 0.00
34154. Dust (l4sts0ul) 1 76.37 76.37 0 0.00
34155. l1gh7vel (l1gh7vel) 1 61.28 61.28 0 0.00
34156. Karl (kzlotn2) 1 121.08 121.08 0 0.00
34157. kytan (kyte11) 1 112.82 112.82 1 100.00
34158. Kyu (kyuche) 1 94.94 94.94 0 0.00
34159. Kyotz (kyotz) 1 85.77 85.77 0 0.00
34160. Vaidas (kybynas) 1 60.22 60.22 1 100.00
34161. Ken (kyberken) 1 89.60 89.60 0 0.00
34162. Katrina (kweinma) 1 76.87 76.87 1 100.00
34163. Kwait (kwait) 1 109.38 109.38 1 100.00
34164. Lucas (kuttey) 1 82.81 82.81 1 100.00
34165. Lars (kung_fu_kenny) 1 109.87 109.87 1 100.00
34166. halvard (kulsol02) 1 64.55 64.55 0 0.00
34167. kulau (kulau04) 1 82.57 82.57 1 100.00
34168. Andreas (kukkaa) 1 114.68 114.68 1 100.00
34169. hyper riper viper typer (ku... 1 83.17 83.17 0 0.00
34170. My dik is hard (kubatmoffic... 1 64.70 64.70 0 0.00
34171. Antonek (kubanczyk) 1 42.33 42.33 0 0.00
34172. Karis (ktoothman) 1 55.85 55.85 0 0.00
34173. ksilentstorm (ksilentstorm) 1 71.47 71.47 0 0.00
34174. Kieran (kshawarma) 1 101.84 101.84 1 100.00
34175. Morgan (kryptik_boogie) 1 75.81 75.81 0 0.00
34176. Kruxey (kruxey) 1 90.14 90.14 0 0.00
34177. Krona (krona_) 1 62.09 62.09 0 0.00
34178. Krisu (krisu_the_legend) 1 106.15 106.15 0 0.00
34179. krisko_bg (krisko_bg) 1 61.15 61.15 0 0.00
34180. Kriime (kriime) 1 105.72 105.72 1 100.00
34181. Muhammad Dwi (krauchelli) 1 70.81 70.81 1 100.00
34182. kralty ツ (kralty) 1 86.24 86.24 0 0.00
34183. K (kqp3) 1 60.06 60.06 0 0.00
34184. Kevin (kpark0421) 1 101.37 101.37 0 0.00
34185. Jacob (kowalski_boi) 1 73.05 73.05 0 0.00
34186. KouTypin (kou_typingood) 1 88.34 88.34 1 100.00
34187. Aaron (kountervibe) 1 79.89 79.89 0 0.00
34188. Kougrafighter (kougrafighter) 1 74.19 74.19 0 0.00
34189. koscia (koscia) 1 73.26 73.26 0 0.00
34190. Kareem (korosei) 1 95.18 95.18 0 0.00
34191. Oscar (koppernatt) 1 52.87 52.87 0 0.00
34192. ckaasfds (kopiipase) 1 77.39 77.39 0 0.00
34193. kool (koolfiger) 1 81.35 81.35 1 100.00
34194. Konstantinos (konstantop) 1 90.88 90.88 0 0.00
34195. kitipat (kong0497) 1 92.55 92.55 1 100.00
34196. Kuloa (koldou) 1 73.42 73.42 0 0.00
34197. Koji (kojji) 1 117.92 117.92 1 100.00
34198. Koga (koganeicchi) 1 121.02 121.02 0 0.00
34199. Koen (koen1) 1 76.01 76.01 1 100.00
34200. katy (koalatykaty) 1 92.53 92.53 0 0.00
34201. Jemuel (koalatea) 1 108.48 108.48 1 100.00
34202. triplealpha (knytehawke) 1 123.16 123.16 0 0.00
34203. Raadek (knr24) 1 122.17 122.17 0 0.00
34204. KnowItAllKing (knowitallking) 1 125.50 125.50 1 100.00
34205. Kukk (knightpikachu) 1 110.72 110.72 0 0.00
34206. Zerato (knaell) 1 68.45 68.45 0 0.00
34207. Kitt (kmet5) 1 82.44 82.44 0 0.00
34208. klystt (klystt) 1 116.35 116.35 1 100.00
34209. Chloe (klohwii) 1 70.16 70.16 0 0.00
34210. Keegan (klav) 1 110.60 110.60 0 0.00
34211. Keshav (kksu278) 1 69.45 69.45 0 0.00
34212. King (kjarr) 1 100.57 100.57 1 100.00
34213. kiyeo (kiyeo) 1 134.27 134.27 1 100.00
34214. Kiun (kiunkim) 1 86.71 86.71 0 0.00
34215. Martin (kitikonti) 1 57.10 57.10 0 0.00
34216. Kishan (kishan150) 1 54.54 54.54 0 0.00
34217. Jon (kiryu610) 1 125.24 125.24 1 100.00
34218. KirBei (kirbei) 1 130.27 130.27 1 100.00
34219. kira (kirayes) 1 74.81 74.81 1 100.00
34220. Henrique (kiraly2006) 1 69.47 69.47 0 0.00
34221. imtrash (kipakers) 1 45.28 45.28 0 0.00
34222. Zong (kingzong) 1 94.25 94.25 0 0.00
34223. Kingz (kingzcostz) 1 66.77 66.77 0 0.00
34224. Vincent (kingvince160) 1 68.44 68.44 0 0.00
34225. Justin (kingtempo) 1 87.90 87.90 0 0.00
34226. king (kingstealth) 1 144.95 144.95 1 100.00
34227. Kingreformed (kingreformed) 1 137.38 137.38 1 100.00
34228. Sarao Jeepney (kingoftheroad) 1 91.13 91.13 0 0.00
34229. Nicolas (kingofpandas) 1 101.37 101.37 0 0.00
34230. Justin (kinglebron23) 1 112.80 112.80 1 100.00
34231. KPS (kingkps) 1 108.87 108.87 1 100.00
34232. Mick (kingkasma24) 1 23.12 23.12 0 0.00
34233. Max (kingjahan2) 1 70.36 70.36 0 0.00
34234. King (king77) 1 94.57 94.57 1 100.00
34235. KindledCroissant (kindledcr... 1 66.02 66.02 1 100.00
34236. Sexy (kimochichinchin) 1 90.69 90.69 1 100.00
34237. jason (kimjongdos) 1 57.83 57.83 0 0.00
34238. kimi (kimix) 1 53.75 53.75 0 0.00
34239. Kimberly (kimberlame) 1 92.92 92.92 1 100.00
34240. Kill (killyourself1234) 1 115.82 115.82 0 0.00
34241. Subhabrata (kikni) 1 33.64 33.64 0 0.00
34242. Kiki (kikichan86) 1 126.42 126.42 1 100.00
34243. karina (kiinqdom) 1 100.93 100.93 1 100.00
34244. no (khomi) 1 44.54 44.54 0 0.00
34245. Khong (khong_eiei) 1 98.81 98.81 1 100.00
34246. khoa (khoa2k1) 1 31.67 31.67 0 0.00
34247. Nouman (khanusama) 1 44.06 44.06 0 0.00
34248. Khalid (khalidramadan) 1 49.17 49.17 0 0.00
34249. keziah (keziah_p) 1 35.29 35.29 0 0.00
34250. Jenny (key_board_cat) 1 62.40 62.40 1 100.00
34251. B.A.D. (keylimeshortcake) 1 86.40 86.40 1 100.00
34252. Kevin (kevinyeh) 1 92.67 92.67 0 0.00
34253. Kevin (kevinrodas) 1 65.22 65.22 0 0.00
34254. Kevin (kevinisgay) 1 115.15 115.15 1 100.00
34255. Kevin (kevin6ooo) 1 100.05 100.05 1 100.00
34256. Ketan (ketanprakash001) 1 58.73 58.73 0 0.00
34257. . (kestrel342) 1 87.93 87.93 1 100.00
34258. Marcin (keshy) 1 89.12 89.12 0 0.00
34259. keshav (keshavsarraf) 1 48.43 48.43 0 0.00
34260. Keshav (keshavjindaljp) 1 58.92 58.92 0 0.00
34261. Kerolyte (kerolyte) 1 105.82 105.82 0 0.00
34262. Sebastian (kernfusionator) 1 71.64 71.64 1 100.00
34263. kepler1729 (kepler1729) 1 124.58 124.58 0 0.00
34264. kent (kenttranle) 1 88.22 88.22 0 0.00
34265. 獣耳尻尾 (kemomimishippo) 1 103.56 103.56 0 0.00
34266. Kelly (kellyhunter03) 1 89.98 89.98 1 100.00
34267. KINA (keithisnotalive) 1 42.54 42.54 0 0.00
34268. Keira (keiramc) 1 63.53 63.53 0 0.00
34269. Keiji (keiji453) 1 71.22 71.22 1 100.00
34270. lexa (keiiko) 1 99.62 99.62 0 0.00
34271. kelvin (kefun) 1 111.93 111.93 0 0.00
34272. Kiana (keeyahnajoyce) 1 108.60 108.60 1 100.00
34273. keelsveb (keelsveb) 1 81.50 81.50 0 0.00
34274. Kendra (kcviloria) 1 89.29 89.29 1 100.00
34275. misumi (kazytypes) 1 125.66 125.66 1 100.00
34276. Kaz (kazuerdos) 1 117.97 117.97 1 100.00
34277. Kevin (kazhu) 1 77.39 77.39 0 0.00
34278. kaya (kayax) 1 58.84 58.84 0 0.00
34279. kawi (kawion) 1 84.87 84.87 0 0.00
34280. Kavi (kavit) 1 64.51 64.51 0 0.00
34281. blueberry (katie_18) 1 56.82 56.82 0 0.00
34282. katie (katieee1) 1 48.18 48.18 0 0.00
34283. kath (kath1104) 1 45.62 45.62 0 0.00
34284. Timo (karuso33) 1 81.70 81.70 1 100.00
34285. Tris (karma_nii) 1 45.43 45.43 0 0.00
34286. Karolos (kariolos) 1 80.95 80.95 1 100.00
34287. Karim (karim_ch) 1 47.76 47.76 0 0.00
34288. Kyle (kapleer) 1 130.52 130.52 0 0.00
34289. Mid Racer (kaosfear) 1 82.91 82.91 1 100.00
34290. Azatbek (kanybekov66) 1 68.63 68.63 0 0.00
34291. Benji (kannnix95) 1 35.13 35.13 0 0.00
34292. Kanish (kanish) 1 38.68 38.68 0 0.00
34293. presu (kanjotribe) 1 45.96 45.96 1 100.00
34294. Greggory (kaneki26) 1 43.11 43.11 0 0.00
34295. Brandon (kamisama_1) 1 99.63 99.63 0 0.00
34296. kamincai (kamincai) 1 71.26 71.26 1 100.00
34297. kamal nath (kamal3772) 1 69.31 69.31 1 100.00
34298. yoshiki (kalog46) 1 76.32 76.32 0 0.00
34299. Karl (kallekiwi) 1 51.25 51.25 0 0.00
34300. Kaitlyn (kaitlyam) 1 109.04 109.04 1 100.00
34301. Kaiserkaiser3 (kaiserkaiser3) 1 58.20 58.20 0 0.00
34302. K (k3nl4w) 1 93.50 93.50 0 0.00
34303. jaybird (j__j) 1 83.75 83.75 1 100.00
34304. Jordan (j_kid) 1 56.42 56.42 0 0.00
34305. HHKBest (jywh91) 1 116.90 116.90 1 100.00
34306. JY (jy82828) 1 89.79 89.79 1 100.00
34307. Jaden (jxden) 1 59.79 59.79 0 0.00
34308. Jonathan (jwoo516) 1 56.14 56.14 0 0.00
34309. juyvs (juyvss) 1 67.41 67.41 0 0.00
34310. Juuzou (juuzou__) 1 113.85 113.85 1 100.00
34311. JuaanNgemtod (juuaaaaan) 1 47.57 47.57 0 0.00
34312. tromboner (just_tromboner42... 1 50.19 50.19 0 0.00
34313. Luis (justluisb) 1 71.28 71.28 0 0.00
34314. Justin (justinpatrick1011) 1 105.17 105.17 0 0.00
34315. Justin (justinparra18) 1 65.50 65.50 0 0.00
34316. Justin (justinliu2000) 1 110.62 110.62 1 100.00
34317. JustBoyM8 (justboym8) 1 82.63 82.63 1 100.00
34318. Michael (justatyperforfun) 1 114.13 114.13 1 100.00
34319. Benjamin (justaregularnerd) 1 100.91 100.91 1 100.00
34320. jus102res (jus102res) 1 89.26 89.26 1 100.00
34321. Junch (junchoooo) 1 34.92 34.92 0 0.00
34322. Jumbo (jumbolegend) 1 79.56 79.56 0 0.00
34323. Julie (juliehuynh654252) 1 106.28 106.28 1 100.00
34324. Julia (julia22202) 1 81.40 81.40 0 0.00
34325. Julian (julbball) 1 87.91 87.91 0 0.00
34326. Julian (judaslan) 1 27.19 27.19 0 0.00
34327. Josh (jubskiko) 1 50.73 50.73 0 0.00
34328. jubaer (jubaer_maruf) 1 7.36 7.36 0 0.00
34329. Juan (juanma9191) 1 75.67 75.67 1 100.00
34330. William (jt_001) 1 85.74 85.74 0 0.00
34331. jTactics (jtactics) 1 95.43 95.43 0 0.00
34332. System (jsystem75) 1 77.83 77.83 0 0.00
34333. Jamie (jswain) 1 76.44 76.44 0 0.00
34334. John (jstokes001) 1 79.52 79.52 0 0.00
34335. Jalen (jsaucegawd) 1 58.94 58.94 0 0.00
34336. Jared (jrod44) 1 99.79 99.79 0 0.00
34337. matt (jrm8999) 1 55.73 55.73 1 100.00
34338. Christopher (jr1995) 1 54.09 54.09 0 0.00
34339. bruh (jqzz) 1 107.87 107.87 0 0.00
34340. Jqmfg (jqmfg) 1 114.72 114.72 1 100.00
34341. FJB (joyousmischief) 1 62.33 62.33 0 0.00
34342. Josiah (josiahforever) 1 162.85 162.85 1 100.00
34343. Josh (joshywashyy) 1 90.49 90.49 0 0.00
34344. Josh (joshybigmac) 1 105.12 105.12 1 100.00
34345. Joshua (joshuavtk) 1 72.70 72.70 0 0.00
34346. Joshua (joshuajerremy) 1 78.71 78.71 1 100.00
34347. Joshua (joshuagil23) 1 76.33 76.33 1 100.00
34348. Josh (joshua798) 1 58.81 58.81 0 0.00
34349. Joseph (josephyunzz) 1 110.14 110.14 1 100.00
34350. juni (jooun) 1 83.45 83.45 0 0.00
34351. Jones (jones72) 1 55.73 55.73 0 0.00
34352. Jonathan (jonathantf2) 1 85.24 85.24 1 100.00
34353. Jonas (jonasjuni) 1 47.57 47.57 0 0.00
34354. Jonas (jonasjul) 1 63.54 63.54 0 0.00
34355. Zhomart (jomakasi) 1 68.81 68.81 0 0.00
34356. kazzi (jokerivy) 1 35.67 35.67 0 0.00
34357. Jordan (jojo2ooo) 1 53.86 53.86 0 0.00
34358. Bob (john_the_racer) 1 83.85 83.85 0 0.00
34359. Keyser Söze (johnomaha) 1 73.58 73.58 0 0.00
34360. John (johnmarquez1706) 1 134.94 134.94 1 100.00
34361. Joey (joey_v) 1 100.01 100.01 0 0.00
34362. Home (joeyhockey77) 1 77.59 77.59 0 0.00
34363. Jxp (jodoe) 1 74.16 74.16 0 0.00
34364. John (jodingus) 1 102.93 102.93 1 100.00
34365. MRSICKOMODE (jodiddy) 1 90.27 90.27 0 0.00
34366. Joao Antonio (joaoagouveia) 1 63.49 63.49 1 100.00
34367. Jonas (jnshey) 1 70.77 70.77 0 0.00
34368. Johnnie (jnednh) 1 91.99 91.99 0 0.00
34369. JnanaDeep (jnana_deep8) 1 61.13 61.13 0 0.00
34370. Meade (jmkling) 1 104.50 104.50 1 100.00
34371. Jacquelin (jmillard821) 1 110.97 110.97 0 0.00
34372. James (jmesyang) 1 80.80 80.80 0 0.00
34373. jlxip (jlxip) 1 131.14 131.14 1 100.00
34374. Jeydin (jjthejetship) 1 100.81 100.81 1 100.00
34375. Jonathan (jjones0598) 1 97.59 97.59 0 0.00
34376. Julia (jjin2005) 1 82.98 82.98 0 0.00
34377. Jiten (jiten123) 1 126.02 126.02 0 0.00
34378. Jio (jioo) 1 84.19 84.19 0 0.00
34379. jin (jinyt911) 1 115.51 115.51 0 0.00
34380. Jinkas (jinkas) 1 119.32 119.32 1 100.00
34381. GodPeanut (jingtian) 1 90.46 90.46 1 100.00
34382. Mashuke Alam (jim_99) 1 55.57 55.57 0 0.00
34383. jimi (jimiwimi) 1 25.68 25.68 0 0.00
34384. jiin (jiinko11) 1 101.34 101.34 0 0.00
34385. Ramon (jick_wipe) 1 86.84 86.84 1 100.00
34386. Julz (jhullzz) 1 94.43 94.43 0 0.00
34387. Jhin (jhin4) 1 60.57 60.57 0 0.00
34388. John (jgetachew) 1 77.18 77.18 0 0.00
34389. JFuzion (jfuzion) 1 80.93 80.93 1 100.00
34390. GodHimself (jesuschristtypes) 1 50.08 50.08 0 0.00
34391. Victor (jesuschrist2003) 1 151.73 151.73 1 100.00
34392. Jessia (jessia25) 1 56.70 56.70 0 0.00
34393. Aayush (jerry_dank) 1 102.11 102.11 0 0.00
34394. Tom (jeronex) 1 99.76 99.76 1 100.00
34395. Jeriah (jeriahcariahmessiah) 1 113.51 113.51 1 100.00
34396. Jeremy (jeremytreadway) 1 80.93 80.93 0 0.00
34397. Jeoondra (jeoondra) 1 50.80 50.80 0 0.00
34398. Jens (jenspenneman) 1 50.79 50.79 0 0.00
34399. Joël (jenol) 1 85.02 85.02 1 100.00
34400. Jenn (jenn_ahn) 1 96.25 96.25 1 100.00
34401. Jenni (jenni02) 1 48.94 48.94 0 0.00
34402. Enoch (jenks12) 1 88.23 88.23 1 100.00
34403. Jenette (jenetttte) 1 86.55 86.55 0 0.00
34404. George (jempii) 1 86.03 86.03 1 100.00
34405. jelos0n (jelos) 1 45.92 45.92 1 100.00
34406. Cory (jellygoku) 1 70.46 70.46 0 0.00
34407. Jello (jellomoto) 1 83.52 83.52 0 0.00
34408. JEHADUR (jehad) 1 20.30 20.30 0 0.00
34409. Jeff (jeffzazzles) 1 83.84 83.84 0 0.00
34410. Jeffrey (jeffreedom29) 1 53.45 53.45 1 100.00
34411. Clarence (jeffdaddybezos) 1 94.54 94.54 1 100.00
34412. Jed (jedski) 1 68.88 68.88 1 100.00
34413. J (jebss) 1 83.17 83.17 1 100.00
34414. Aleksi (jeboust) 1 68.34 68.34 0 0.00
34415. nathan (jebaithan) 1 72.78 72.78 0 0.00
34416. Jonathan (jdamico) 1 82.74 82.74 0 0.00
34417. Josh (jctilton03) 1 102.12 102.12 1 100.00
34418. Jonathan (jclausen05) 1 52.67 52.67 0 0.00
34419. Joerg (jcgx) 1 38.75 38.75 0 0.00
34420. tstats[cagz] (jcagz) 1 70.32 70.32 0 0.00
34421. James (jbrain3000) 1 90.31 90.31 0 0.00
34422. Jason (jb33000) 1 99.25 99.25 1 100.00
34423. João Pedro (jaydaltro) 1 66.03 66.03 0 0.00
34424. jawnnyp (jawnnyp) 1 90.44 90.44 0 0.00
34425. J.T. (javajohn29) 1 86.62 86.62 0 0.00
34426. twitch.tv/cellytherosebush ... 1 118.06 118.06 0 0.00
34427. Jasper (jasperclemente) 1 65.43 65.43 0 0.00
34428. Jason (jason_yessir) 1 89.55 89.55 0 0.00
34429. Jason (jasongog) 1 93.31 93.31 1 100.00
34430. Jason (jasonf2001) 1 112.46 112.46 0 0.00
34431. Jason (jason1994) 1 64.54 64.54 0 0.00
34432. Jarvis (jarvistheai) 1 51.80 51.80 0 0.00
34433. fajar (jarrrr) 1 47.93 47.93 0 0.00
34434. Jarrett (jarrettedward) 1 87.66 87.66 0 0.00
34435. James (jarmez) 1 84.60 84.60 0 0.00
34436. Jappie (jappiegrappie) 1 46.49 46.49 1 100.00
34437. Matt (januality) 1 53.93 53.93 0 0.00
34438. micaela (janismine) 1 72.42 72.42 0 0.00
34439. Jarrod (jandojanderson) 1 88.87 88.87 1 100.00
34440. yavor (janb99) 1 95.74 95.74 0 0.00
34441. Jamx (jamxjam) 1 105.16 105.16 1 100.00
34442. James (james2021) 1 42.56 42.56 0 0.00
34443. Jacob (jakedup) 1 74.49 74.49 1 100.00
34444. Jared (jagunlimited81) 1 68.19 68.19 1 100.00
34445. Jagger (jagswag28) 1 102.77 102.77 1 100.00
34446. jacob (jacobshane) 1 45.50 45.50 0 0.00
34447. Jack (jack_ery) 1 62.22 62.22 0 0.00
34448. jacky (jacky32) 1 85.31 85.31 0 0.00
34449. Jack (jackwitherell) 1 73.33 73.33 1 100.00
34450. Jack (jackb1379) 1 84.43 84.43 1 100.00
34451. Jack (jackaka) 1 62.04 62.04 0 0.00
34452. jack (jack824) 1 44.01 44.01 0 0.00
34453. QHadron (jack2980) 1 82.19 82.19 1 100.00
34454. Jacob (jabub) 1 47.09 47.09 0 0.00
34455. Jaan (jaans18) 1 85.29 85.29 1 100.00
34456. James (j4mce) 1 74.14 74.14 0 0.00
34457. DiscoveryAlpha (j2997) 1 89.48 89.48 0 0.00
34458. Lea (j0s7_s0m3b0d7) 1 51.61 51.61 0 0.00
34459. . (i_need_skillz) 1 90.16 90.16 0 0.00
34460. Eugene (i_am_neo) 1 71.03 71.03 1 100.00
34461. Not a dog (i_am_learning_to... 1 83.62 83.62 1 100.00
34462. Joseph (iwsif) 1 62.07 62.07 0 0.00
34463. J (iwantmedals) 1 144.09 144.09 1 100.00
34464. Ivan (ivan_suvorov) 1 69.44 69.44 1 100.00
34465. Ivan (ivan_m21) 1 69.44 69.44 1 100.00
34466. Ivana (ivanab) 1 63.44 63.44 0 0.00
34467. Josh (itztaayoooo) 1 118.81 118.81 1 100.00
34468. SIlver (itzsilver) 1 51.48 51.48 0 0.00
34469. ItzInstinct (itzinstinct) 1 47.40 47.40 0 0.00
34470. Terrence (itzardtypes) 1 56.74 56.74 0 0.00
34471. ken (itypeslowasf) 1 58.19 58.19 0 0.00
34472. Ken (ittipat) 1 52.68 52.68 0 0.00
34473. Vee (itveve) 1 67.16 67.16 0 0.00
34474. John (ittakesavillage) 1 87.08 87.08 1 100.00
34475. Ian (its_ianj) 1 49.01 49.01 0 0.00
34476. I Be (itsthamista) 1 60.61 60.61 0 0.00
34477. Zoljargal (itsnotzoloo) 1 81.56 81.56 0 0.00
34478. Marko (itsmko) 1 79.10 79.10 1 100.00
34479. Jasper (itsjasper) 1 84.96 84.96 1 100.00
34480. ItsInsanity (itsinsanity) 1 86.74 86.74 0 0.00
34481. Chris (itseverydaybro) 1 104.76 104.76 1 100.00
34482. Kelvin (itscatsu) 1 86.37 86.37 0 0.00
34483. Blessed (itsblessedxx) 1 58.04 58.04 0 0.00
34484. Itay (itaylol) 1 84.18 84.18 1 100.00
34485. Jj (issajacob) 1 86.99 86.99 1 100.00
34486. IsMythic (ismythic) 1 70.15 70.15 0 0.00
34487. islamb20 (islamb20) 1 66.94 66.94 0 0.00
34488. Ish (ish_) 1 24.55 24.55 0 0.00
34489. Ishark (ishark) 1 152.14 152.14 1 100.00
34490. irsyad (irsyad99) 1 29.74 29.74 1 100.00
34491. ireeg (ireeggg) 1 19.84 19.84 0 0.00
34492. Islam (iotegaliyev) 1 47.74 47.74 0 0.00
34493. Ben (intenex) 1 139.29 139.29 1 100.00
34494. insxmnimaniac (insxmnimaniac) 1 60.69 60.69 0 0.00
34495. Instinct_man (instinct_man) 1 72.06 72.06 0 0.00
34496. Insight (insight) 1 99.10 99.10 0 0.00
34497. InsaneBiff (insanebiff) 1 111.77 111.77 1 100.00
34498. Akshay (ins4nity_god) 1 70.47 70.47 0 0.00
34499. InnerPotat (innerpotat) 1 94.51 94.51 1 100.00
34500. Victor (inkpiernofingla) 1 106.57 106.57 1 100.00
34501. Omar (infus3d) 1 91.59 91.59 0 0.00
34502. Shaiyaan (infinitysc) 1 85.18 85.18 0 0.00
34503. InfernoHues (infernohues) 1 77.16 77.16 0 0.00
34504. Kevin (infern0) 1 111.56 111.56 0 0.00
34505. Inderpreet (indergnps) 1 90.68 90.68 1 100.00
34506. Iñaki (inakigv) 1 79.86 79.86 0 0.00
34507. Angelo (im_quasar) 1 74.25 74.25 0 0.00
34508. Tyler (imthe13055) 1 84.01 84.01 1 100.00
34509. A7md (implore) 1 99.12 99.12 0 0.00
34510. Winston (imonlytypingwithtw... 1 96.64 96.64 0 0.00
34511. Im (imkrypton) 1 61.65 61.65 0 0.00
34512. J (imkidding) 1 71.41 71.41 0 0.00
34513. jm (imjm) 1 55.23 55.23 1 100.00
34514. Fries (imfriez) 1 64.14 64.14 1 100.00
34515. Kun (imdavidboi) 1 68.03 68.03 0 0.00
34516. Ima (ima_baka) 1 62.94 62.94 0 0.00
34517. Imambek (imambek) 1 55.27 55.27 0 0.00
34518. Ilz (ilzwalrus) 1 124.40 124.40 1 100.00
34519. pee (iluvuhi) 1 100.36 100.36 0 0.00
34520. Iluminuss (iluminuss) 1 59.63 59.63 0 0.00
34521. Austin (illumi97) 1 84.98 84.98 0 0.00
34522. ilias (iliasnik21) 1 70.92 70.92 0 0.00
34523. yali (ilayali02) 1 52.04 52.04 0 0.00
34524. Ikkue (ikkue) 1 64.17 64.17 1 100.00
34525. Ike11000 (ike11000) 1 81.22 81.22 0 0.00
34526. Ilmi (ikalam89) 1 69.34 69.34 0 0.00
34527. John (ihavebigpen15) 1 87.59 87.59 0 0.00
34528. 🎃 (igorslow) 1 89.36 89.36 0 0.00
34529. Igor (igorjosifoski) 1 119.73 119.73 1 100.00
34530. Sean (igetass) 1 103.49 103.49 1 100.00
34531. paul [nZk] (igaikaze) 1 103.43 103.43 0 0.00
34532. IFo Hancroft (ifohancroft) 1 95.27 95.27 1 100.00
34533. Sir (ieza) 1 61.81 61.81 1 100.00
34534. Idrm (idrm) 1 69.81 69.81 1 100.00
34535. (◕‿◕✿) (idkbruv) 1 98.34 98.34 0 0.00
34536. Shivam (idi_cyka) 1 90.87 90.87 1 100.00
34537. 👀👀👀 (idakk) 1 161.70 161.70 1 100.00
34538. ichbin (ichbin) 1 67.02 67.02 0 0.00
34539. Icey (iceystars99) 1 68.15 68.15 0 0.00
34540. aeriall (icebear123) 1 44.80 44.80 1 100.00
34541. MD IBRAHIM (ibrahim827) 1 30.71 30.71 0 0.00
34542. Ibo (ibosaka) 1 85.48 85.48 1 100.00
34543. Joe (ibelaxin) 1 92.32 92.32 0 0.00
34544. Anthony (ianozia) 1 100.65 100.65 1 100.00
34545. Ian (ianlofland) 1 41.50 41.50 0 0.00
34546. Laco (ian860824) 1 70.76 70.76 0 0.00
34547. Ben (iamveryslowlol) 1 88.13 88.13 0 0.00
34548. Thomas (iamstrategy) 1 64.86 64.86 1 100.00
34549. IAmSpeed (iamspeed3015) 1 85.07 85.07 1 100.00
34550. Lue (iamoofu) 1 128.99 128.99 1 100.00
34551. Colemark (iamkenzo) 1 59.74 59.74 0 0.00
34552. Denis (iamdenis03) 1 53.09 53.09 1 100.00
34553. Brodie (iambrodie) 1 87.22 87.22 1 100.00
34554. Eric (iamanormaldog) 1 61.83 61.83 1 100.00
34555. vliv (hyte) 1 44.31 44.31 0 0.00
34556. hypophrenia (hypophrenia_3) 1 69.26 69.26 0 0.00
34557. hydratedcat (hydratedcat) 1 98.85 98.85 1 100.00
34558. Houssen (huzzen) 1 52.36 52.36 0 0.00
34559. Huskiez (husky123) 1 137.24 137.24 0 0.00
34560. Husain (husain_id) 1 33.86 33.86 0 0.00
34561. Hunter (huntstyperacer) 1 97.98 97.98 1 100.00
34562. Hunter (huntercoolboi) 1 67.09 67.09 0 0.00
34563. Carly (huniee) 1 106.36 106.36 1 100.00
34564. Scott (humji) 1 80.36 80.36 0 0.00
34565. B (hulk800) 1 100.76 100.76 1 100.00
34566. Hugo (hugosaer) 1 45.49 45.49 1 100.00
34567. Huberio (huberio) 1 91.59 91.59 0 0.00
34568. Hudson (hubbons) 1 48.26 48.26 1 100.00
34569. HTD (htdbarsii) 1 86.06 86.06 1 100.00
34570. Han (hsujanet1527) 1 68.40 68.40 1 100.00
34571. CrimSurfer (hsabove) 1 97.13 97.13 0 0.00
34572. hristo (hritren) 1 43.74 43.74 0 0.00
34573. Tareq Mahmud (hridoy_089) 1 54.82 54.82 0 0.00
34574. QWERTY (howtfdoyoutype200wpm) 1 56.08 56.08 1 100.00
34575. HotZin (hotzin) 1 111.93 111.93 1 100.00
34576. foo (hotemup) 1 103.80 103.80 1 100.00
34577. akira (hoshinoakira) 1 142.69 142.69 1 100.00
34578. Horrendous (horrendousness) 1 104.60 104.60 1 100.00
34579. Tork (hork) 1 109.58 109.58 0 0.00
34580. ando (hophosho) 1 46.01 46.01 0 0.00
34581. Hope (hopefullee) 1 86.32 86.32 1 100.00
34582. hoonman (hoonman) 1 115.66 115.66 1 100.00
34583. HonorTiltProof (honortiltpr... 1 77.02 77.02 1 100.00
34584. Jan (honfi) 1 66.75 66.75 0 0.00
34585. Honey_Beef (honey_beef) 1 128.96 128.96 0 0.00
34586. homeslice (homeslic3) 1 89.29 89.29 0 0.00
34587. Runescape Spam Bot (homer_s... 1 117.44 117.44 1 100.00
34588. HolyHit (holyhit) 1 62.10 62.10 0 0.00
34589. jirka2142 (holocaus_byl_ins... 1 69.70 69.70 0 0.00
34590. Ian (hobbr) 1 99.66 99.66 1 100.00
34591. Hoang (hoang26hoang) 1 87.70 87.70 1 100.00
34592. Hkishi (hkishi) 1 101.44 101.44 0 0.00
34593. chobo (hi_im_chobo) 1 131.76 131.76 1 100.00
34594. Danel (hi_daniell) 1 82.22 82.22 0 0.00
34595. Christoffer (hivefive) 1 73.71 73.71 0 0.00
34596. hxroze (hirose1) 1 90.69 90.69 1 100.00
34597. hinotori (hinotori) 1 52.05 52.05 0 0.00
34598. ▄︻̷̿┻̿═━一 (h... 1 85.21 85.21 0 0.00
34599. Hilmoone (hilda_04) 1 34.52 34.52 0 0.00
34600. milkfoam (hiireath7654) 1 91.83 91.83 0 0.00
34601. Nate (highvoltage32) 1 46.27 46.27 0 0.00
34602. Ryder (highryder18) 1 103.62 103.62 1 100.00
34603. High (highbeach) 1 90.63 90.63 1 100.00
34604. HiFli (hifli) 1 95.75 95.75 0 0.00
34605. Hieu (hieu999) 1 52.28 52.28 1 100.00
34606. Hide (hide_on_bush_ml) 1 146.53 146.53 1 100.00
34607. Haider (hiderbider) 1 62.82 62.82 0 0.00
34608. BadMeetsEvi1 (hgrgr43g12) 1 51.18 51.18 0 0.00
34609. Hector (hg088) 1 83.41 83.41 0 0.00
34610. HiImGosu (heyimgosu) 1 71.39 71.39 0 0.00
34611. Heyhey898 (heyhey898) 1 69.22 69.22 1 100.00
34612. hector (hexbreezy) 1 55.57 55.57 0 0.00
34613. Hermione (hermione2291) 1 94.84 94.84 0 0.00
34614. Luke (herding) 1 74.53 74.53 0 0.00
34615. Zong (helpmeplsss) 1 95.15 95.15 0 0.00
34616. helpjepp (helpjepp) 1 71.39 71.39 0 0.00
34617. Helmut (helmutlang) 1 73.85 73.85 0 0.00
34618. internet asian boy (hell0_i... 1 68.40 68.40 0 0.00
34619. Helix (helixspiral) 1 128.78 128.78 1 100.00
34620. Rico (hehel3x) 1 137.73 137.73 1 100.00
34621. AerythM (hedgepenguin) 1 8.10 8.10 0 0.00
34622. HedgeLow (hedgelow) 1 88.25 88.25 0 0.00
34623. Patrick (healingtrout) 1 82.89 82.89 1 100.00
34624. Dennis (he66pro) 1 79.35 79.35 1 100.00
34625. gekyou (hbk_rain) 1 81.86 81.86 0 0.00
34626. Harrison (hbguy1234) 1 111.06 111.06 0 0.00
34627. Seph (hazedlol) 1 184.37 184.37 1 100.00
34628. Harry (hazbogga) 1 42.79 42.79 0 0.00
34629. Hayawardh (hayawardh) 1 97.98 97.98 0 0.00
34630. Haxgeed (haxgeed) 1 49.68 49.68 0 0.00
34631. Eines (hawkeines) 1 58.83 58.83 0 0.00
34632. Ken (haseo_ken) 1 57.23 57.23 1 100.00
34633. Hasen (hasen) 1 79.58 79.58 0 0.00
34634. H (harshitos) 1 80.65 80.65 0 0.00
34635. vernon (harsha90571) 1 47.41 47.41 0 0.00
34636. Haroon (haroon_shah) 1 103.39 103.39 1 100.00
34637. hariz (harizgong) 1 55.92 55.92 0 0.00
34638. Harish (harish1995) 1 59.71 59.71 1 100.00
34639. haraj (haraj) 1 70.35 70.35 0 0.00
34640. Han (hantheautist) 1 96.17 96.17 0 0.00
34641. hansvin (hans_vin) 1 61.34 61.34 0 0.00
34642. Hang (hangben) 1 76.34 76.34 0 0.00
34643. Halvor (halvornj) 1 49.41 49.41 0 0.00
34644. Halo (halo06) 1 76.25 76.25 0 0.00
34645. melina (halfxheart) 1 114.67 114.67 1 100.00
34646. Gema (hakushoddd) 1 75.61 75.61 0 0.00
34647. Hagibobo (hagibobo) 1 70.82 70.82 0 0.00
34648. Haggis (haggis) 1 93.27 93.27 0 0.00
34649. Aly UwU (h3mispher3) 1 95.58 95.58 1 100.00
34650. atlas (h1ng3) 1 71.36 71.36 0 0.00
34651. g (gvrmaine) 1 80.67 80.67 0 0.00
34652. Guy (guyprws) 1 51.78 51.78 0 0.00
34653. Adam (guynnoco) 1 79.84 79.84 0 0.00
34654. Gustavo (gust4vodev) 1 77.86 77.86 0 0.00
34655. Gunzo (gunzo_27) 1 56.03 56.03 0 0.00
34656. guitar (guitarplayer_6) 1 50.04 50.04 0 0.00
34657. andrea (guilkk) 1 69.64 69.64 0 0.00
34658. sam (guest99898) 1 68.07 68.07 1 100.00
34659. GucciHavarti (guccihavarti) 1 87.20 87.20 0 0.00
34660. Nicolas (guaro_py) 1 74.68 74.68 1 100.00
34661. Giovanni (gtrgio) 1 35.49 35.49 0 0.00
34662. GTedZ (gtedz) 1 93.70 93.70 0 0.00
34663. joe (gstakk) 1 94.71 94.71 0 0.00
34664. Uroš (grujidis) 1 90.23 90.23 0 0.00
34665. Grizzly (growling_grizzly) 1 114.30 114.30 1 100.00
34666. Yes (grovymango) 1 62.24 62.24 0 0.00
34667. Grosh (groshgoratz) 1 124.16 124.16 1 100.00
34668. Gemlingur (grommsi) 1 90.73 90.73 1 100.00
34669. Mike (groinofsteel) 1 53.11 53.11 1 100.00
34670. GRNCheetah (grncheetah) 1 76.05 76.05 1 100.00
34671. Jude (grixvous) 1 56.35 56.35 1 100.00
34672. Giridhar (griffintaimer) 1 73.53 73.53 0 0.00
34673. greytick (greytick) 1 79.98 79.98 0 0.00
34674. Andrew (gremlinbaby) 1 101.02 101.02 1 100.00
34675. Greg (greg605) 1 64.70 64.70 0 0.00
34676. deshawn (greenspringer) 1 113.22 113.22 0 0.00
34677. Liam (greensoldierman) 1 95.32 95.32 1 100.00
34678. Chris (greenbomber) 1 74.59 74.59 0 0.00
34679. Dimitri Yakovic (grazenburg_) 1 60.12 60.12 0 0.00
34680. Gray (grayorgrey) 1 66.44 66.44 0 0.00
34681. Andrew (grandpa2390) 1 92.24 92.24 1 100.00
34682. Nick (grammynugx) 1 70.12 70.12 0 0.00
34683. Graison (grais0n) 1 77.08 77.08 0 0.00
34684. George (graddiences) 1 120.94 120.94 1 100.00
34685. Graham (gracker) 1 95.67 95.67 0 0.00
34686. Marek (gpro2005) 1 55.53 55.53 1 100.00
34687. Ville (gowalski) 1 58.67 58.67 0 0.00
34688. J (goshadow) 1 80.80 80.80 0 0.00
34689. Goppo (goppo) 1 108.19 108.19 1 100.00
34690. Emanuel (google_me) 1 92.20 92.20 0 0.00
34691. Type (goodtoad) 1 68.18 68.18 1 100.00
34692. Asriel (goodgodlygaming) 1 66.97 66.97 0 0.00
34693. Trevor (goode_bag) 1 52.94 52.94 0 0.00
34694. Gooby (goobytheturtle) 1 105.35 105.35 1 100.00
34695. esther (golfetta) 1 41.96 41.96 0 0.00
34696. Cal (golemite) 1 67.99 67.99 0 0.00
34697. GoldenGamer9002 (goldengamer) 1 83.20 83.20 1 100.00
34698. Jeff (golddragon4) 1 100.36 100.36 1 100.00
34699. Nitesh (gokunik) 1 69.56 69.56 0 0.00
34700. john (goinbr0ke) 1 144.60 144.60 1 100.00
34701. Yu Chen (gohyuchen) 1 149.92 149.92 1 100.00
34702. gofpopexe (gofpopexe) 1 76.78 76.78 0 0.00
34703. Go6ko (go6koiba4a69xx) 1 65.81 65.81 0 0.00
34704. Dimitris (glumfish) 1 77.95 77.95 1 100.00
34705. J (glazingdonuts) 1 64.61 64.61 0 0.00
34706. Johnny (glassharmonica) 1 113.39 113.39 1 100.00
34707. Nathan (glanzer) 1 110.99 110.99 1 100.00
34708. NiglaciousXII (glaedrlol) 1 124.45 124.45 0 0.00
34709. Amazing (glabbss) 1 66.56 66.56 0 0.00
34710. Gitxen (gitxen) 1 120.21 120.21 0 0.00
34711. Giraffe (giraffelords36) 1 76.95 76.95 1 100.00
34712. Håkon (gipper321) 1 56.64 56.64 0 0.00
34713. Giorgio (gioac96) 1 60.32 60.32 1 100.00
34714. Matt (gimmethekeys) 1 80.91 80.91 0 0.00
34715. hugo (gikle) 1 98.28 98.28 1 100.00
34716. Lupescu (gigabite13) 1 63.55 63.55 0 0.00
34717. gia hân (giahannguyenhoang) 1 46.05 46.05 1 100.00
34718. URDI (ghotifilet49) 1 73.77 73.77 1 100.00
34719. Ghost (ghost999) 1 129.63 129.63 1 100.00
34720. Gh0st (gh0sted_oo) 1 43.21 43.21 0 0.00
34721. TheGoosinator (ggustavs) 1 66.71 66.71 1 100.00
34722. Ggg243 (ggg243) 1 45.84 45.84 0 0.00
34723. MAK (geotyper704) 1 72.31 72.31 1 100.00
34724. George (georgewang615) 1 126.95 126.95 1 100.00
34725. George (george9412) 1 81.29 81.29 0 0.00
34726. Snide (genuineburrito) 1 60.51 60.51 0 0.00
34727. Benjamin (genracemen) 1 86.50 86.50 0 0.00
34728. geniusface1234 (geniusface1... 1 111.29 111.29 1 100.00
34729. Ollie (geniegg) 1 41.53 41.53 0 0.00
34730. Luke (generalna13) 1 101.22 101.22 0 0.00
34731. Martin (generalkoski) 1 72.28 72.28 0 0.00
34732. Brownie (generalbrownie) 1 100.75 100.75 1 100.00
34733. Génesis (gen1310) 1 62.57 62.57 0 0.00
34734. A Person (gelatintypist) 1 103.19 103.19 1 100.00
34735. Matthew (gelahn) 1 87.02 87.02 1 100.00
34736. Geis (geis) 1 73.33 73.33 0 0.00
34737. GeekTek (geektek) 1 68.34 68.34 1 100.00
34738. geek's (geekstfm) 1 52.02 52.02 0 0.00
34739. Ggg (gdcomb) 1 72.42 72.42 1 100.00
34740. gcdashsj (gcdashsj) 1 50.33 50.33 0 0.00
34741. Gabriel (gbrl1) 1 72.00 72.00 1 100.00
34742. Gábor (gazuru) 1 90.08 90.08 1 100.00
34743. jay (gayjayy) 1 91.22 91.22 0 0.00
34744. derp (gavzzz) 1 87.86 87.86 0 0.00
34745. Gavin (gavinp) 1 118.54 118.54 1 100.00
34746. Nicolas (gauzy) 1 63.20 63.20 0 0.00
34747. Gaute (gaute_03) 1 57.51 57.51 0 0.00
34748. Gaurav (gauravkr442) 1 25.26 25.26 0 0.00
34749. Lemon (gauransh) 1 34.05 34.05 0 0.00
34750. Gaz (garrickgsn) 1 118.95 118.95 1 100.00
34751. Garik (garikhayrapetian) 1 32.77 32.77 1 100.00
34752. audelyn (gaminghuskies) 1 70.14 70.14 1 100.00
34753. _ (gamichan19) 1 58.31 58.31 0 0.00
34754. Satakun (game_of_charging) 1 62.21 62.21 0 0.00
34755. Bhisam (gameon617) 1 51.11 51.11 0 0.00
34756. AgentGameknight (gameknight... 1 45.71 45.71 0 0.00
34757. gamal (gamal123) 1 60.09 60.09 0 0.00
34758. Alex (galaxp1) 1 93.37 93.37 0 0.00
34759. galactic (galacticpig) 1 87.26 87.26 0 0.00
34760. GaGi (gagiiiii) 1 85.92 85.92 0 0.00
34761. Gabriel (gabrieldpg) 1 49.29 49.29 0 0.00
34762. ptrickr (gabriel7patrick) 1 86.36 86.36 1 100.00
34763. bog (gabongtenco) 1 103.25 103.25 1 100.00
34764. Gabe (gabedal) 1 93.31 93.31 0 0.00
34765. серб (gabagool__) 1 41.46 41.46 0 0.00
34766. logitech g613 sucks (g613) 1 102.28 102.28 1 100.00
34767. akisakura (fuyusakura) 1 75.33 75.33 0 0.00
34768. fusionguy100 (fusionguy200) 1 110.14 110.14 1 100.00
34769. Louis (funnyblouboi) 1 56.54 56.54 1 100.00
34770. Marco (funfulin01) 1 42.37 42.37 0 0.00
34771. Daniel (fun1905) 1 62.45 62.45 1 100.00
34772. Juan (fullmetal474) 1 55.50 55.50 1 100.00
34773. prophet muhammad (fucboi) 1 93.14 93.14 0 0.00
34774. Daniel (fsajijkt) 1 50.82 50.82 0 0.00
34775. joey (fryhyi) 1 78.45 78.45 0 0.00
34776. Lol (fryed) 1 61.65 61.65 0 0.00
34777. Raveon (frozenpriest) 1 90.73 90.73 1 100.00
34778. Frostx (frostx) 1 74.25 74.25 0 0.00
34779. sdfsdf (frogchan) 1 139.99 139.99 1 100.00
34780. Frans (frns) 1 52.87 52.87 0 0.00
34781. yi hein (friends) 1 100.41 100.41 0 0.00
34782. Diddy (friedrichzzz) 1 47.26 47.26 0 0.00
34783. Surendra (frensuren) 1 90.91 90.91 0 0.00
34784. Ashutosh (free_electron) 1 45.71 45.71 0 0.00
34785. freezefreeze (freezefreeze) 1 111.46 111.46 1 100.00
34786. anthony (freesubs) 1 85.21 85.21 0 0.00
34787. Doctor (freakahontas) 1 95.39 95.39 0 0.00
34788. eevee (frazyx) 1 67.45 67.45 0 0.00
34789. Frank (frankyfrank) 1 68.53 68.53 1 100.00
34790. Frank (franktank840) 1 84.58 84.58 0 0.00
34791. Brian (franklybrian) 1 59.27 59.27 0 0.00
34792. Fragobert (fragobert) 1 51.38 51.38 0 0.00
34793. Fr33 (fr33_wifi) 1 99.10 99.10 1 100.00
34794. chris (founduman) 1 24.53 24.53 0 0.00
34795. Forrest (forrest_p) 1 102.35 102.35 0 0.00
34796. Artis (formoned) 1 62.88 62.88 1 100.00
34797. Alex (fordalex) 1 78.30 78.30 1 100.00
34798. Jello (foolishfacade) 1 65.69 65.69 0 0.00
34799. Vincent (foolguy13) 1 99.61 99.61 1 100.00
34800. PikaChris (foforin112) 1 83.85 83.85 1 100.00
34801. Huy (fobo911) 1 150.03 150.03 1 100.00
34802. Quinn (flyinfox) 1 82.40 82.40 1 100.00
34803. Tony (fluttersparkl) 1 155.83 155.83 1 100.00
34804. llama (flulululu) 1 88.76 88.76 0 0.00
34805. Florian (florianfor3) 1 62.43 62.43 0 0.00
34806. Alan (fleekeazy) 1 94.77 94.77 0 0.00
34807. Lazy (flashinlazer) 1 75.38 75.38 0 0.00
34808. Dog (flash2victory) 1 95.26 95.26 1 100.00
34809. Cristian (flanzeta) 1 89.26 89.26 1 100.00
34810. Ash (flamingo_god) 1 72.52 72.52 1 100.00
34811. Anirudh (flaes) 1 75.56 75.56 0 0.00
34812. Fizh (fizh29) 1 65.98 65.98 0 0.00
34813. Devn (fishology) 1 94.34 94.34 1 100.00
34814. FireKing8877 (fireking8877) 1 39.11 39.11 0 0.00
34815. Joseph (fireguy1920) 1 94.04 94.04 1 100.00
34816. omar (fireclaw5) 1 53.03 53.03 0 0.00
34817. Anthony (fireant131) 1 47.52 47.52 0 0.00
34818. Finn (finnph) 1 64.54 64.54 0 0.00
34819. Minh (fingies_thingies) 1 134.41 134.41 1 100.00
34820. Filth (filthyslush) 1 49.27 49.27 0 0.00
34821. Shawn (filipinofriend) 1 55.86 55.86 0 0.00
34822. Filip (fifal) 1 86.66 86.66 0 0.00
34823. Manolo (fiendz) 1 55.55 55.55 0 0.00
34824. SambelB2P (fianjansen) 1 49.18 49.18 0 0.00
34825. falco.gs (fhoover) 1 71.67 71.67 0 0.00
34826. Tyler (fffish) 1 100.03 100.03 1 100.00
34827. Andrew (fffire) 1 63.17 63.17 0 0.00
34828. Mohammed (fermatslastaccount) 1 81.57 81.57 0 0.00
34829. fe (ferkoaa) 1 88.79 88.79 0 0.00
34830. Ill (fencing) 1 60.27 60.27 0 0.00
34831. Jack (feloniousshmuck) 1 89.19 89.19 0 0.00
34832. Steffen (fellroy) 1 66.02 66.02 0 0.00
34833. Felix (felixthefroggo) 1 70.96 70.96 0 0.00
34834. Felipe (felipegomes) 1 87.18 87.18 0 0.00
34835. Felipe (feglex) 1 50.33 50.33 1 100.00
34836. Heitor (fearlessss) 1 59.79 59.79 0 0.00
34837. Fayr (fayr) 1 114.88 114.88 1 100.00
34838. Asher (fastwack) 1 31.60 31.60 0 0.00
34839. fast (fasttyper3256) 1 45.75 45.75 0 0.00
34840. Andreee (farskyz) 1 81.34 81.34 0 0.00
34841. Farey (farey0633) 1 93.53 93.53 0 0.00
34842. FaptasticFingers (faptastic... 1 59.95 59.95 0 0.00
34843. Trixie (fantoro) 1 89.92 89.92 1 100.00
34844. Frantisek (fandaa7) 1 50.66 50.66 0 0.00
34845. falsz (falsz) 1 106.95 106.95 0 0.00
34846. huacheng (fallingfeather) 1 97.29 97.29 1 100.00
34847. sdjikalmd (falcony) 1 106.38 106.38 1 100.00
34848. Fake (fake_hooman) 1 65.21 65.21 1 100.00
34849. Timix (faketimix) 1 86.21 86.21 1 100.00
34850. Otimos (faketaxiia) 1 67.80 67.80 1 100.00
34851. Faizan (faizan1) 1 79.23 79.23 1 100.00
34852. fair (fairpixa) 1 76.38 76.38 0 0.00
34853. Matteo (fail_2000) 1 51.63 51.63 1 100.00
34854. fady (fady1) 1 27.64 27.64 0 0.00
34855. John (fadedrunner) 1 47.49 47.49 0 0.00
34856. Fabio (fabiososo) 1 82.91 82.91 1 100.00
34857. Fabio (fabiom26) 1 74.27 74.27 0 0.00
34858. Ville (f1ftw123) 1 74.11 74.11 0 0.00
34859. Emlyn (e_typist_112) 1 85.56 85.56 0 0.00
34860. Mackwein (e_p_i_c) 1 39.05 39.05 0 0.00
34861. Elif (e_gamer) 1 74.15 74.15 0 0.00
34862. Icarus (ezzeldeen_27) 1 74.01 74.01 0 0.00
34863. Ezequiel (ezequiel102) 1 70.03 70.03 1 100.00
34864. Evan (ezb2661) 1 130.80 130.80 1 100.00
34865. Eyas (eyasmodhesh) 1 123.94 123.94 1 100.00
34866. Exsuz (exsuz) 1 75.74 75.74 1 100.00
34867. Dylan (exordium) 1 82.17 82.17 1 100.00
34868. exilour (exilour) 1 76.21 76.21 1 100.00
34869. Exhessity (exhessity) 1 79.74 79.74 0 0.00
34870. Exelendary (exelendary) 1 57.04 57.04 0 0.00
34871. evsk (evsk) 1 76.17 76.17 1 100.00
34872. Evan (evndude) 1 122.38 122.38 0 0.00
34873. EvilNoodle (evilnoodle) 1 88.98 88.98 0 0.00
34874. Adam (eveve05) 1 59.20 59.20 0 0.00
34875. Evan =) (evantyper) 1 51.68 51.68 0 0.00
34876. Alex (eu_dk) 1 106.10 106.10 1 100.00
34877. ali UwU xx oWo (ethyl_ethan... 1 94.63 94.63 0 0.00
34878. Ethan (ethan_w_c) 1 71.51 71.51 0 0.00
34879. Ethan (ethanthecuber) 1 115.85 115.85 1 100.00
34880. Ikuya (eternal198) 1 85.39 85.39 0 0.00
34881. Nezih (etck) 1 54.26 54.26 0 0.00
34882. George (esvee) 1 82.00 82.00 0 0.00
34883. Kasey (estrobe) 1 115.67 115.67 1 100.00
34884. Ed (essencerato) 1 79.09 79.09 1 100.00
34885. Thomas (eshes) 1 87.06 87.06 0 0.00
34886. Ewan (erytzz) 1 76.06 76.06 0 0.00
34887. Magnus Madsen (ersti) 1 96.71 96.71 0 0.00
34888. Dave (erose524) 1 102.94 102.94 1 100.00
34889. Nacho! (ernestl_lalo) 1 100.86 100.86 0 0.00
34890. Erlan (erlansaputra) 1 49.46 49.46 0 0.00
34891. Erion (erionz) 1 107.31 107.31 0 0.00
34892. eriktarek (erikabd) 1 59.07 59.07 0 0.00
34893. Erfan (erfan_hedayati) 1 79.45 79.45 0 0.00
34894. Erdo (erdo897) 1 107.90 107.90 1 100.00
34895. Joakim (eraji) 1 87.49 87.49 0 0.00
34896. William (epwill) 1 56.30 56.30 0 0.00
34897. Barış (epokhe) 1 102.36 102.36 0 0.00
34898. ShadowBoy (epicshadowboy) 1 63.81 63.81 0 0.00
34899. epicgdog (epicgdog) 1 76.64 76.64 0 0.00
34900. Jovel (enyalio) 1 122.17 122.17 1 100.00
34901. Entrook (entrook) 1 66.36 66.36 0 0.00
34902. Nocturnal_Tofu (entity_01) 1 109.40 109.40 1 100.00
34903. Uran (enderlordyt) 1 79.84 79.84 0 0.00
34904. emule (emily2h) 1 106.85 106.85 1 100.00
34905. Osteo (emiglio) 1 124.45 124.45 1 100.00
34906. Harris (emagemag) 1 90.58 90.58 0 0.00
34907. mong (el_tecla) 1 74.00 74.00 0 0.00
34908. Will (elwoodbear7) 1 114.65 114.65 1 100.00
34909. Tomasz (elpero) 1 82.10 82.10 0 0.00
34910. Elon (elonzenub) 1 135.40 135.40 1 100.00
34911. Lks (elluki) 1 63.46 63.46 1 100.00
34912. Tingaling (ellehebe) 1 64.51 64.51 0 0.00
34913. Element (elementnl) 1 128.54 128.54 1 100.00
34914. electricas (electricas) 1 131.71 131.71 1 100.00
34915. Daniel (eldian) 1 95.72 95.72 0 0.00
34916. TGG-QIJ47NQUGA (eikomaniac) 1 182.58 182.58 1 100.00
34917. (eikig) 1 118.49 118.49 1 100.00
34918. Eiji (eijin) 1 63.73 63.73 0 0.00
34919. Jeff (eggdropsoup3) 1 82.86 82.86 1 100.00
34920. Eugenio (efrias21) 1 66.86 66.86 0 0.00
34921. Maria (efbnko) 1 53.97 53.97 0 0.00
34922. eeya (eeya) 1 87.48 87.48 0 0.00
34923. Edy (edyz) 1 97.77 97.77 1 100.00
34924. Edward (edwoodxd) 1 107.81 107.81 1 100.00
34925. edweenie (edweenie) 1 143.47 143.47 1 100.00
34926. Edward (edwardtw92) 1 69.44 69.44 0 0.00
34927. Edward (eduward0_) 1 59.93 59.93 0 0.00
34928. god (edgy14yearold) 1 91.88 91.88 0 0.00
34929. Edge (edgekaos) 1 116.51 116.51 1 100.00
34930. Eddie (eddiesn) 1 94.53 94.53 1 100.00
34931. Evan (edawg525) 1 95.58 95.58 0 0.00
34932. edamame88 (edamame88) 1 42.15 42.15 0 0.00
34933. Nick (eco_frendly) 1 112.50 112.50 1 100.00
34934. Zailent (eclipse_zailent) 1 53.90 53.90 0 0.00
34935. jason (echefcy) 1 92.51 92.51 1 100.00
34936. Eric (ec052002) 1 77.61 77.61 0 0.00
34937. bruh (easiwin2) 1 89.34 89.34 0 0.00
34938. Discord Bot: tinyurl.com/Ty... 1 157.83 157.83 1 100.00
34939. Daniel (d_nny) 1 132.48 132.48 1 100.00
34940. bjirlah (d_fathan) 1 27.16 27.16 0 0.00
34941. Dzulfikar (dzulfikaraf) 1 63.10 63.10 0 0.00
34942. Diz (dzhsck) 1 144.13 144.13 1 100.00
34943. aniM (dymek) 1 71.98 71.98 0 0.00
34944. Dylan (dyllin) 1 103.42 103.42 1 100.00
34945. Dylan (dylanthenerd) 1 84.53 84.53 0 0.00
34946. Dylan (dylanlikescake) 1 93.46 93.46 0 0.00
34947. Dwat (dwat13) 1 99.30 99.30 0 0.00
34948. Norm (dwagner8) 1 96.69 96.69 1 100.00
34949. Dux (duxviii) 1 83.76 83.76 0 0.00
34950. Dustin (dustywusty) 1 92.22 92.22 0 0.00
34951. David (dusanlp_69) 1 62.12 62.12 1 100.00
34952. Dusan (dusancar) 1 99.06 99.06 0 0.00
34953. Dusan (dusan321) 1 58.79 58.79 0 0.00
34954. Alan (durland) 1 120.72 120.72 1 100.00
34955. Grace (duriangray) 1 113.14 113.14 1 100.00
34956. Tilm (duqq) 1 109.53 109.53 1 100.00
34957. Duck (duok) 1 96.65 96.65 0 0.00
34958. Ewan (dungcatcher) 1 90.00 90.00 0 0.00
34959. Learner (dumb_waste) 1 55.69 55.69 0 0.00
34960. Ethel Cain (dumb_alec) 1 84.46 84.46 1 100.00
34961. Donovan (dudieusmaximus) 1 69.34 69.34 1 100.00
34962. Steve (duckmuscles) 1 63.32 63.32 0 0.00
34963. Duck (duckmedic) 1 85.79 85.79 1 100.00
34964. David (dtowers) 1 104.39 104.39 0 0.00
34965. Daniel (dsun23) 1 120.96 120.96 1 100.00
34966. Chad (dr_salfish) 1 119.85 119.85 1 100.00
34967. pablo (druglord) 1 90.70 90.70 0 0.00
34968. Dr. Typer (drtypergamer) 1 69.83 69.83 1 100.00
34969. Dr. (drtulung) 1 102.78 102.78 1 100.00
34970. Steven (drominar) 1 101.13 101.13 0 0.00
34971. Sniper (drjustbrick) 1 57.85 57.85 1 100.00
34972. Drizzle (drizzle671) 1 98.02 98.02 0 0.00
34973. Dri (dri96) 1 93.37 93.37 1 100.00
34974. andy (drewpickett) 1 85.52 85.52 1 100.00
34975. Chinmay (dreamscorcherx) 1 136.46 136.46 0 0.00
34976. Andrii (dreamay) 1 78.95 78.95 1 100.00
34977. Alexa (drawnblue) 1 114.60 114.60 0 0.00
34978. dramorak (dramorak) 1 98.82 98.82 0 0.00
34979. Jawad (dragonrot) 1 48.11 48.11 0 0.00
34980. DragonChasto846 (dragonchat... 1 51.15 51.15 0 0.00
34981. Chhanun (dragonasia6) 1 57.75 57.75 0 0.00
34982. A (dragon02) 1 116.97 116.97 0 0.00
34983. Drabberfox (drabberfox) 1 63.93 63.93 1 100.00
34984. Presidente (dr0g4d0) 1 68.20 68.20 1 100.00
34985. Josh (dpjoshy) 1 123.14 123.14 1 100.00
34986. Dovi (dovi1337) 1 101.41 101.41 0 0.00
34987. ange (doveyange) 1 78.32 78.32 0 0.00
34988. Doron (doron) 1 74.56 74.56 0 0.00
34989. door (door_qwerty) 1 123.28 123.28 1 100.00
34990. Thomas (door_kun) 1 60.83 60.83 0 0.00
34991. doorcrasher (doorcrasher) 1 88.79 88.79 0 0.00
34992. Mathias (doomthunder) 1 100.73 100.73 0 0.00
34993. George (dooglplex) 1 116.99 116.99 0 0.00
34994. Stephen (dondodedondi) 1 77.38 77.38 0 0.00
34995. Daniel (doctorfm3) 1 83.12 83.12 0 0.00
34996. Dobby (dobbycb) 1 76.49 76.49 0 0.00
34997. DuhMarquis (dmy3) 1 96.80 96.80 0 0.00
34998. Dev (dmookerjee) 1 85.66 85.66 1 100.00
34999. DLaiy (dlaiy) 1 70.52 70.52 0 0.00
35000. Dkoctro (dkoctro) 1 67.19 67.19 0 0.00
35001. Douglas (djwtheman) 1 89.65 89.65 0 0.00
35002. Charles (djexecutioner) 1 67.93 67.93 0 0.00
35003. DIVYANSHU (divyanshu310) 1 33.95 33.95 0 0.00
35004. D'Oracle (divinelyfearless) 1 75.99 75.99 0 0.00
35005. Divine (divine123) 1 49.27 49.27 0 0.00
35006. Divyanshu (div7s) 1 54.67 54.67 0 0.00
35007. Divyanshu (div34357) 1 48.83 48.83 0 0.00
35008. Jaden (dissolver) 1 87.60 87.60 0 0.00
35009. Gianfranco (discordes) 1 92.26 92.26 0 0.00
35010. DisclosedVector (disclosed_... 1 105.32 105.32 1 100.00
35011. the goat (disciple_yt) 1 141.28 141.28 1 100.00
35012. Disambiguous (disambiguous) 1 117.48 117.48 1 100.00
35013. Kaeble (dirtyearl) 1 123.06 123.06 1 100.00
35014. Diogo (diogob) 1 62.04 62.04 1 100.00
35015. Đức (dinhduc2601) 1 95.07 95.07 1 100.00
35016. Timothy (dingamer) 1 103.61 103.61 0 0.00
35017. rhamy (dilldoee) 1 61.39 61.39 0 0.00
35018. Dilectiss (dilektislav) 1 102.27 102.27 0 0.00
35019. Aaron (diesirae91) 1 113.38 113.38 1 100.00
35020. Muhammad (diehardboi) 1 92.39 92.39 0 0.00
35021. Diego (diego12719) 1 113.61 113.61 1 100.00
35022. Dickerlicker (dickerlicker) 1 115.69 115.69 1 100.00
35023. Diar322 (diar322) 1 65.59 65.59 0 0.00
35024. diana (dianatran) 1 112.66 112.66 0 0.00
35025. Abod (dhr_abod) 1 92.13 92.13 0 0.00
35026. Daniel (dhaaq) 1 92.61 92.61 1 100.00
35027. Daner (dferha2) 1 96.48 96.48 0 0.00
35028. dewy (dewy03) 1 53.49 53.49 0 0.00
35029. dev (devsick) 1 48.52 48.52 0 0.00
35030. D (devsaluja15) 1 70.94 70.94 0 0.00
35031. Юрий (devilvslife) 1 68.50 68.50 1 100.00
35032. Davide (deviltube98) 1 91.98 91.98 1 100.00
35033. DevChris (devchris1314) 1 64.39 64.39 0 0.00
35034. typegud (desun) 1 93.19 93.19 0 0.00
35035. Jeffrey (descraton) 1 149.94 149.94 1 100.00
35036. Gabe (derumisis) 1 122.76 122.76 0 0.00
35037. Sam (derpysquidboy) 1 57.40 57.40 0 0.00
35038. chloe (derpfacedan) 1 103.87 103.87 1 100.00
35039. dominique (derangedwedding) 1 107.28 107.28 0 0.00
35040. Solomon (deputycommissioner... 1 56.10 56.10 0 0.00
35041. Jere (depressedone) 1 74.71 74.71 1 100.00
35042. David (depgai) 1 83.24 83.24 1 100.00
35043. Damian (depek) 1 92.72 92.72 0 0.00
35044. Duh-vorak (denys_147) 1 69.38 69.38 0 0.00
35045. Wayne (dennynukes) 1 116.11 116.11 1 100.00
35046. Dennis (dennis_lehmann) 1 50.88 50.88 0 0.00
35047. Denis (denissined) 1 98.44 98.44 1 100.00
35048. Denish (denishkayastha) 1 66.12 66.12 1 100.00
35049. DemPlayz (demplayz) 1 95.86 95.86 0 0.00
35050. Diego (demo5567) 1 59.69 59.69 0 0.00
35051. Baris (demir2k) 1 64.85 64.85 1 100.00
35052. Matt (demigod2005yr) 1 81.27 81.27 0 0.00
35053. Delta (deltarl) 1 91.80 91.80 1 100.00
35054. Dibyajyoti sarkar (delex) 1 22.03 22.03 0 0.00
35055. Dekita (dekita123) 1 81.52 81.52 0 0.00
35056. Jacob (deety) 1 67.39 67.39 0 0.00
35057. deema (deema9) 1 68.87 68.87 1 100.00
35058. Dracule (deelipsingh77) 1 46.83 46.83 0 0.00
35059. Void (decusd) 1 56.48 56.48 0 0.00
35060. Declan (decmasta) 1 97.06 97.06 0 0.00
35061. Quack Werty (decadance) 1 95.54 95.54 1 100.00
35062. Debunked (debunked) 1 150.87 150.87 1 100.00
35063. shubhkarman (death_zeal) 1 58.85 58.85 0 0.00
35064. spira (ddlcld) 1 69.13 69.13 0 0.00
35065. David (ddas445) 1 79.06 79.06 0 0.00
35066. Marko (dbshard) 1 91.50 91.50 0 0.00
35067. da_B0mba (da_b0mba) 1 94.01 94.01 1 100.00
35068. Assassin (dawson19) 1 33.36 33.36 1 100.00
35069. David (davidzocker3) 1 98.00 98.00 1 100.00
35070. Dav (davidskarm) 1 48.13 48.13 0 0.00
35071. Davidsito (davidsito) 1 34.52 34.52 0 0.00
35072. david (davidisthebest48) 1 53.97 53.97 0 0.00
35073. david (davidbeshay) 1 62.79 62.79 0 0.00
35074. David (davida693) 1 90.87 90.87 1 100.00
35075. Dave (davethewave1234) 1 52.28 52.28 0 0.00
35076. Dave (davekane) 1 80.29 80.29 0 0.00
35077. Dauletbek (dauksh) 1 41.94 41.94 0 0.00
35078. utaaaa (datwuzuzerland) 1 57.36 57.36 0 0.00
35079. Salle (dating92) 1 113.11 113.11 1 100.00
35080. rtr (darxidemlg) 1 60.40 60.40 1 100.00
35081. Darth (darthbetterthanyou) 1 117.48 117.48 1 100.00
35082. Darro (darro) 1 49.17 49.17 0 0.00
35083. Tushar (dark_thunder) 1 50.78 50.78 0 0.00
35084. Dominic (dark_demon) 1 76.33 76.33 0 0.00
35085. tobiah (darktilrisen) 1 65.42 65.42 0 0.00
35086. Darko (darkec) 1 80.07 80.07 0 0.00
35087. XΣЯӨ (darius_dragon) 1 33.59 33.59 1 100.00
35088. Darius (dariussgt22) 1 41.45 41.45 0 0.00
35089. Concreap (dareapyboi) 1 67.53 67.53 0 0.00
35090. Luis (dardon) 1 43.50 43.50 0 0.00
35091. DAPAT (dapat) 1 58.48 58.48 0 0.00
35092. Dan (dan_is_garbo) 1 32.39 32.39 1 100.00
35093. Dany (dany191) 1 76.24 76.24 0 0.00
35094. Daniel (dantheman0509) 1 105.51 105.51 1 100.00
35095. Dan (danodin) 1 39.29 39.29 0 0.00
35096. Danny ak7 (dannymr28) 1 46.62 46.62 0 0.00
35097. Dallas (danki) 1 56.07 56.07 0 0.00
35098. Jed (dankravioli) 1 79.77 79.77 1 100.00
35099. Daniel (danighosyyt) 1 38.04 38.04 0 0.00
35100. Daniel (danielrk) 1 106.79 106.79 0 0.00
35101. Danee (danee929) 1 94.26 94.26 1 100.00
35102. Damien (damiien) 1 57.17 57.17 1 100.00
35103. dakszaksmom (dakszaksmom) 1 98.55 98.55 0 0.00
35104. DAJ (daj8112) 1 50.13 50.13 0 0.00
35105. Daisy (daiyu_) 1 36.02 36.02 1 100.00
35106. Grant (dahl192) 1 49.95 49.95 0 0.00
35107. Daggy (daggygod) 1 62.90 62.90 0 0.00
35108. Alec (daftpain) 1 55.06 55.06 0 0.00
35109. DaFluffyOwl (dafluffyowl) 1 60.65 60.65 0 0.00
35110. Ryan (dab_city) 1 102.88 102.88 0 0.00
35111. DABBER (dabber2) 1 45.56 45.56 0 0.00
35112. Dallin (d4llin) 1 93.43 93.43 1 100.00
35113. d1r3ct0r (d1r3ct0r) 1 47.56 47.56 0 0.00
35114. fluffy (d0nuts) 1 73.89 73.89 0 0.00
35115. Danial (d0d1ek) 1 48.15 48.15 0 0.00
35116. Kacper (czolgista007) 1 66.41 66.41 1 100.00
35117. Michael (czapka) 1 99.74 99.74 0 0.00
35118. cyriled (cyriled) 1 64.51 64.51 0 0.00
35119. Cynical (cynicalentity) 1 114.79 114.79 1 100.00
35120. M (cymiyabe) 1 104.22 104.22 0 0.00
35121. LEGO (cymiao2014) 1 97.94 97.94 0 0.00
35122. Clare (cygrnt) 1 134.10 134.10 0 0.00
35123. Martin (cydrox) 1 114.16 114.16 1 100.00
35124. Cole (cwburke) 1 76.40 76.40 0 0.00
35125. Humberto (curvekiller) 1 54.95 54.95 0 0.00
35126. Cuprian (cuprian) 1 55.12 55.12 0 0.00
35127. Brudda (cumlord57) 1 35.59 35.59 1 100.00
35128. Cam (cukelllz) 1 64.36 64.36 0 0.00
35129. Rico (cujodog09) 1 53.89 53.89 0 0.00
35130. Cauê (cue_fran) 1 36.59 36.59 0 0.00
35131. Emma (cuddleeee) 1 100.15 100.15 0 0.00
35132. CuddleCookie (cuddlecookie) 1 87.93 87.93 1 100.00
35133. Achintya (cubefreak777) 1 63.18 63.18 0 0.00
35134. Cristina (csnyder934) 1 53.41 53.41 0 0.00
35135. Cole (csl2000) 1 88.40 88.40 1 100.00
35136. seasaara (csawmer_) 1 80.26 80.26 0 0.00
35137. Rjay (crustybacon) 1 77.21 77.21 0 0.00
35138. cruderustle (cruderustle) 1 108.16 108.16 1 100.00
35139. The Bishop (crucifix_) 1 81.60 81.60 1 100.00
35140. Crowbot (crowbot) 1 91.67 91.67 0 0.00
35141. Cross (crosscarrier) 1 86.81 86.81 0 0.00
35142. Ted (crompnickton) 1 82.40 82.40 0 0.00
35143. Jared (creepywizard) 1 67.24 67.24 0 0.00
35144. Izor (creator_12) 1 53.74 53.74 1 100.00
35145. Stuart (crazystu) 1 138.34 138.34 1 100.00
35146. mahmood (crazyiv) 1 95.24 95.24 0 0.00
35147. Freddy (crazyfreddy) 1 69.51 69.51 0 0.00
35148. Blair (cratman9) 1 86.48 86.48 0 0.00
35149. Pat (cranytorso) 1 29.81 29.81 0 0.00
35150. cpt (cpt_chucky) 1 50.42 50.42 0 0.00
35151. Snipers (cozyshack) 1 124.91 124.91 0 0.00
35152. cowsaysmoo2 (cowsaysmoo1) 1 151.21 151.21 1 100.00
35153. Tommy (cowgoesbawk) 1 143.40 143.40 1 100.00
35154. cow (cowerino) 1 128.26 128.26 0 0.00
35155. Matthew (courtreporter) 1 132.01 132.01 1 100.00
35156. Cosmos (cosmosatlas) 1 82.12 82.12 0 0.00
35157. Cosmic (cosmicuser) 1 76.54 76.54 1 100.00
35158. Mohammed Afeef (cosmicpegas... 1 49.39 49.39 0 0.00
35159. Cormac (cormacdaman57) 1 65.99 65.99 1 100.00
35160. Coco (copilot17) 1 115.96 115.96 1 100.00
35161. Hakan (cooperdevi) 1 114.77 114.77 1 100.00
35162. Abraham (coolbro3451) 1 70.20 70.20 0 0.00
35163. Cookies (cookies523) 1 54.41 54.41 1 100.00
35164. sync (convictedfelon123) 1 124.74 124.74 1 100.00
35165. Connor (connorking) 1 72.05 72.05 1 100.00
35166. Connor (connorjh) 1 94.99 94.99 1 100.00
35167. Connor (connordege) 1 34.24 34.24 0 0.00
35168. Chingsung (conelead) 1 111.15 111.15 1 100.00
35169. Conor (conargh) 1 93.47 93.47 0 0.00
35170. complexcherry (complexcherry) 1 48.63 48.63 0 0.00
35171. Keen (commander_keen) 1 66.45 66.45 1 100.00
35172. Seraphine (commandernoypi) 1 43.71 43.71 0 0.00
35173. Jonathan (comeonet) 1 109.04 109.04 1 100.00
35174. arstdhneio (colemak_arst) 1 114.00 114.00 1 100.00
35175. Nemanja (coldsiemens) 1 81.24 81.24 0 0.00
35176. Coitado (coitado_man) 1 79.15 79.15 0 0.00
35177. Josh (coherentwalrus) 1 102.39 102.39 1 100.00
35178. coffeebottle (coffeebottle1) 1 83.45 83.45 0 0.00
35179. Cod Of Ages (codofages) 1 94.73 94.73 1 100.00
35180. The (codingazn) 1 86.35 86.35 0 0.00
35181. codeless (codeless) 1 63.01 63.01 0 0.00
35182. Cobri420 (cobrili420) 1 81.55 81.55 0 0.00
35183. Brendan (coalie) 1 68.29 68.29 0 0.00
35184. cn_vbs (cn_vbs) 1 75.32 75.32 0 0.00
35185. Ethan (cmfridays) 1 81.59 81.59 0 0.00
35186. Anas (cloudo) 1 63.76 63.76 0 0.00
35187. Eric (cloud99) 1 55.85 55.85 0 0.00
35188. clobre (clobro) 1 60.61 60.61 0 0.00
35189. cloasies (cloasies) 1 82.87 82.87 0 0.00
35190. Jeffrey (clickk) 1 107.75 107.75 0 0.00
35191. Chardiggity (clehmann) 1 43.40 43.40 0 0.00
35192. Joe (clauser) 1 108.65 108.65 1 100.00
35193. Claudia (claudia215) 1 98.59 98.59 0 0.00
35194. Alyssa (clarrissa) 1 87.84 87.84 1 100.00
35195. Rodolfo (clamchowder_) 1 59.89 59.89 0 0.00
35196. Chris (ckim11) 1 83.16 83.16 1 100.00
35197. Mihajlo (ckicka2005) 1 81.01 81.01 1 100.00
35198. 1,3,7-Trimethylpurine-2,6-d... 1 105.36 105.36 0 0.00
35199. jsc (cjs0712) 1 142.36 142.36 1 100.00
35200. Eli (citrus_eel) 1 42.87 42.87 0 0.00
35201. Citrus (citrus08) 1 64.59 64.59 0 0.00
35202. Eric (circador) 1 121.97 121.97 1 100.00
35203. Marcin (cinekw) 1 46.56 46.56 0 0.00
35204. Simon (cimon423) 1 69.51 69.51 0 0.00
35205. ciccox (ciccox) 1 54.32 54.32 0 0.00
35206. Chynna (chynnatown) 1 117.72 117.72 0 0.00
35207. Churr0s (churr0s) 1 79.80 79.80 1 100.00
35208. chupapi (chupapimunyanyo69420) 1 115.22 115.22 1 100.00
35209. Chun (chunni) 1 72.06 72.06 1 100.00
35210. Big (chunky_chunga) 1 73.02 73.02 0 0.00
35211. shut (chunkypeanutbutter) 1 63.83 63.83 0 0.00
35212. Isaac (chunkyipa) 1 78.54 78.54 0 0.00
35213. Christine (christinebostrom9) 1 77.25 77.25 0 0.00
35214. Chris (chriss777) 1 76.36 76.36 1 100.00
35215. Chris (chrisdave) 1 116.14 116.14 1 100.00
35216. Kaguluman (chrischaostf2) 1 98.74 98.74 1 100.00
35217. Chris (chris89233) 1 90.12 90.12 1 100.00
35218. Chris (chris4285) 1 43.08 43.08 0 0.00
35219. J'hamed (chouthe2nd) 1 102.04 102.04 0 0.00
35220. chopper (chopper111) 1 166.04 166.04 1 100.00
35221. Teddy (chookee) 1 103.21 103.21 1 100.00
35222. wonderbubble (chom_chu_) 1 77.54 77.54 1 100.00
35223. Gabriel (chocolate_dude) 1 87.35 87.35 0 0.00
35224. Chirdis (chirdis) 1 60.56 60.56 0 0.00
35225. Chip (chip_king) 1 102.45 102.45 0 0.00
35226. Kevin (chips1337) 1 62.78 62.78 1 100.00
35227. Oikawa (chillypeppermint) 1 112.84 112.84 0 0.00
35228. Chilly (chillycloth) 1 80.84 80.84 0 0.00
35229. sam (chillfilter) 1 93.61 93.61 0 0.00
35230. Tyrone (chidorimove) 1 82.41 82.41 0 0.00
35231. Chicken (chickendinnr) 1 77.66 77.66 1 100.00
35232. Chew (chewyixin99) 1 99.70 99.70 0 0.00
35233. Chewing (chewingtinfoil) 1 64.86 64.86 0 0.00
35234. Shînta (chengos) 1 89.88 89.88 1 100.00
35235. Chelsea (chelseaaaa) 1 66.36 66.36 1 100.00
35236. chefshatonyou (chefshatonyou) 1 135.53 135.53 0 0.00
35237. Ben Dover (cheeesehoe) 1 80.91 80.91 0 0.00
35238. Chester (cheddafps) 1 40.20 40.20 0 0.00
35239. Andrey (cheaterkin) 1 93.19 93.19 1 100.00
35240. Chaz (chazmus) 1 72.01 72.01 1 100.00
35241. Nicky (charskun) 1 63.36 63.36 0 0.00
35242. Charlie (charliehuang24) 1 54.01 54.01 0 0.00
35243. Wsthms (charlesseo) 1 76.58 76.58 0 0.00
35244. Charkz (charkz) 1 70.73 70.73 0 0.00
35245. Clifton (charcoalfiltered) 1 90.62 90.62 0 0.00
35246. Charles (charcharryu) 1 80.50 80.50 0 0.00
35247. chaos (chaos0312) 1 103.78 103.78 1 100.00
35248. Andrew (chanmandrew) 1 79.19 79.19 0 0.00
35249. storm trooper (chandu998) 1 73.05 73.05 1 100.00
35250. chandamandal (chandamandal) 1 76.29 76.29 1 100.00
35251. Noah (champion8795) 1 53.14 53.14 0 0.00
35252. J (chalcha) 1 59.09 59.09 0 0.00
35253. cetewyn (cetewyn_) 1 143.98 143.98 0 0.00
35254. Cessa (cessactdm) 1 96.28 96.28 1 100.00
35255. Mars (cerullo) 1 62.54 62.54 0 0.00
35256. CeriumG (ceriumg) 1 86.65 86.65 1 100.00
35257. Barack (ceo_of_communism) 1 64.07 64.07 1 100.00
35258. Celios (celios) 1 108.63 108.63 1 100.00
35259. V (celestialparfait) 1 39.56 39.56 0 0.00
35260. Ceejay (ceejay3626) 1 63.26 63.26 0 0.00
35261. Cédrik Paquin (cedpaq01) 1 82.69 82.69 0 0.00
35262. thapakazi (ceasors) 1 62.08 62.08 0 0.00
35263. cc (cclin130) 1 116.30 116.30 1 100.00
35264. Tano (ccastro123) 1 47.35 47.35 0 0.00
35265. Callum (cblake2205) 1 46.27 46.27 0 0.00
35266. David (cavestoryking64) 1 89.98 89.98 0 0.00
35267. cat (catnigga) 1 60.05 60.05 0 0.00
35268. Catia (catiarin) 1 33.53 33.53 0 0.00
35269. HandyManny (casteristic) 1 58.92 58.92 0 0.00
35270. Cary (cary2060) 1 57.15 57.15 0 0.00
35271. Carter (carter04julian) 1 64.73 64.73 1 100.00
35272. Carrot (carrotocn) 1 118.63 118.63 1 100.00
35273. Joe (carrotdrill) 1 129.29 129.29 1 100.00
35274. Carokins (carokins) 1 66.74 66.74 0 0.00
35275. Carlos (carloscruz42) 1 43.93 43.93 0 0.00
35276. Carissa (carissarks) 1 51.57 51.57 0 0.00
35277. Nicolás (carcamo) 1 93.15 93.15 0 0.00
35278. CaptainVR (captainvr) 1 48.06 48.06 0 0.00
35279. Temos (captainteemo) 1 66.01 66.01 0 0.00
35280. Akash (captaindroid) 1 68.81 68.81 1 100.00
35281. Caleb (captaincujab) 1 43.89 43.89 0 0.00
35282. Lino (captaincrack) 1 61.95 61.95 0 0.00
35283. Toan (caotoan999) 1 49.39 49.39 0 0.00
35284. Alex (cantthingofusernameyay) 1 117.62 117.62 1 100.00
35285. cam (cam_fung) 1 50.56 50.56 0 0.00
35286. Cameron (camchang) 1 110.46 110.46 1 100.00
35287. Pabo (camahthegiant) 1 38.35 38.35 1 100.00
35288. Gabriel (caluya) 1 105.13 105.13 1 100.00
35289. Weng (calmturtle) 1 66.10 66.10 1 100.00
35290. Callum (calleazyy) 1 48.56 48.56 0 0.00
35291. Calistus (calistus) 1 144.17 144.17 0 0.00
35292. caleb the twig (caleb_the_t... 1 63.40 63.40 0 0.00
35293. Cal (calbar) 1 128.53 128.53 1 100.00
35294. Caio (caiobatman) 1 84.70 84.70 0 0.00
35295. Cha (cafedossa) 1 116.39 116.39 0 0.00
35296. Caesium0810 (caesium0810) 1 112.01 112.01 0 0.00
35297. Caeden (caeden2008) 1 93.04 93.04 1 100.00
35298. Cadspen (cadspen) 1 125.22 125.22 1 100.00
35299. eri (cactus622) 1 107.14 107.14 1 100.00
35300. FortnutGamur69 (c0ck_n_ba11s) 1 90.30 90.30 1 100.00
35301. Val (bxl_vie_1212gordon) 1 74.33 74.33 0 0.00
35302. bwandyn (bwandyn) 1 115.09 115.09 1 100.00
35303. Butu (butu) 1 47.81 47.81 1 100.00
35304. Gianluca (butter_waffle) 1 62.40 62.40 0 0.00
35305. Gingy (busterchoppie) 1 73.69 73.69 0 0.00
35306. Busali (busali2008) 1 53.59 53.59 0 0.00
35307. Burhanuddin Merchant (burza) 1 45.31 45.31 0 0.00
35308. steline (burntscones) 1 91.64 91.64 0 0.00
35309. Luis (burningpsycho) 1 86.39 86.39 1 100.00
35310. Alex (burningpain) 1 63.54 63.54 0 0.00
35311. BruhBruh (burningbird999) 1 51.41 51.41 0 0.00
35312. Burger (burger_man) 1 103.55 103.55 0 0.00
35313. burgerhex (burgerhex) 1 121.00 121.00 1 100.00
35314. Glenn (burappi) 1 76.95 76.95 0 0.00
35315. Josh (bumbull) 1 98.03 98.03 1 100.00
35316. Đức (buinguyendinhduc96) 1 69.32 69.32 0 0.00
35317. becca (buhbecca) 1 69.32 69.32 0 0.00
35318. Rahul (bug_addict) 1 69.79 69.79 0 0.00
35319. Joshua (bubulone) 1 43.47 43.47 0 0.00
35320. john (bubbles_tv) 1 64.22 64.22 0 0.00
35321. David (bubberducky) 1 116.73 116.73 0 0.00
35322. Brent (btent) 1 99.72 99.72 1 100.00
35323. Brendan (btdevine) 1 91.72 91.72 0 0.00
35324. bsbs (bsbs03) 1 58.93 58.93 0 0.00
35325. Kimmie (bryan_kimmie) 1 100.05 100.05 0 0.00
35326. Bryan (bryan6734) 1 95.16 95.16 1 100.00
35327. LmaoUrTrash (bruhmoment2341... 1 107.93 107.93 1 100.00
35328. Jacob (bruh3323) 1 87.32 87.32 1 100.00
35329. Rafi (brownvitalik) 1 85.63 85.63 0 0.00
35330. brotherelric (brotherelric) 1 90.38 90.38 1 100.00
35331. John (brodros) 1 55.92 55.92 1 100.00
35332. Brocli (brocli) 1 135.68 135.68 1 100.00
35333. Anderson (broccoliman) 1 104.74 104.74 0 0.00
35334. Brill (brill85) 1 49.05 49.05 1 100.00
35335. Brie (briemobiel) 1 98.41 98.41 0 0.00
35336. Briana (briana169) 1 80.05 80.05 0 0.00
35337. brendon (brend0n) 1 71.52 71.52 1 100.00
35338. Brandon (branthrax123) 1 42.03 42.03 0 0.00
35339. Branimir (brankeros_17) 1 72.05 72.05 0 0.00
35340. Bracklet (bracklet) 1 76.42 76.42 0 0.00
35341. Bracador (bracador) 1 127.85 127.85 1 100.00
35342. Erich (br3ad) 1 88.66 88.66 0 0.00
35343. deric (bplo) 1 89.40 89.40 0 0.00
35344. Blake (bpermenter) 1 88.10 88.10 0 0.00
35345. Bpandu (bpandu) 1 88.79 88.79 1 100.00
35346. Jian Feng (bosprimigenius) 1 119.32 119.32 0 0.00
35347. Borna (borna433) 1 55.56 55.56 1 100.00
35348. Cristobal Zarco (boomer_tor... 1 96.74 96.74 1 100.00
35349. Boo_layout_noob (boolayoutn... 1 57.33 57.33 0 0.00
35350. Charlie (boogiememeboi) 1 59.88 59.88 1 100.00
35351. Bonbon (bonbontherabbit) 1 82.98 82.98 1 100.00
35352. Boltcrasher (boltcrasher) 1 92.72 92.72 0 0.00
35353. bool3max (bolemax_accuracy) 1 116.33 116.33 1 100.00
35354. Indiance (bois_sux_101) 1 127.90 127.90 1 100.00
35355. Daniel (boichoi137) 1 91.12 91.12 0 0.00
35356. Bohdan (bogdanr) 1 72.93 72.93 0 0.00
35357. Matthew (boebie) 1 94.45 94.45 0 0.00
35358. Slimesito (bodhisteel) 1 93.46 93.46 1 100.00
35359. dominic (bobomopre) 1 76.41 76.41 0 0.00
35360. Bobbie (bobbieshroom) 1 112.26 112.26 0 0.00
35361. Robert (bobbert_63) 1 62.68 62.68 0 0.00
35362. Bobae (bobaec) 1 146.70 146.70 1 100.00
35363. BlumberKid (blumberkid) 1 78.27 78.27 0 0.00
35364. == Klub (blueclub) 1 122.66 122.66 0 0.00
35365. Blox (bloxid) 1 61.03 61.03 0 0.00
35366. Juri (bloodych) 1 43.79 43.79 0 0.00
35367. Fakrul (blizzardwind) 1 76.94 76.94 0 0.00
35368. Blitz (blitzwanker) 1 54.34 54.34 0 0.00
35369. Juan (blindspot) 1 77.40 77.40 0 0.00
35370. Daniel (blazin_) 1 127.41 127.41 1 100.00
35371. Ari (blaze_adawg) 1 42.32 42.32 0 0.00
35372. Ricky (blazed_ricardo) 1 113.69 113.69 1 100.00
35373. Gabriel (blastergnc) 1 52.03 52.03 0 0.00
35374. Hello (blakeiv) 1 103.37 103.37 1 100.00
35375. astro (black_astro) 1 58.91 58.91 1 100.00
35376. nipple (blackmokeys) 1 62.36 62.36 0 0.00
35377. Brayden (blackbat1645) 1 59.63 59.63 1 100.00
35378. Björn Orri (bjornorri) 1 100.88 100.88 1 100.00
35379. Travis (bizmos) 1 53.47 53.47 0 0.00
35380. Jacob (bizarrecake) 1 133.76 133.76 1 100.00
35381. Alex (bissector) 1 77.19 77.19 1 100.00
35382. Biplob (biplob_phukan) 1 62.45 62.45 0 0.00
35383. bipin (bipin2019) 1 51.00 51.00 0 0.00
35384. Star (bintangsatwika) 1 86.70 86.70 1 100.00
35385. Bill (billxnye) 1 84.57 84.57 0 0.00
35386. Takumi (bilbobaggins440) 1 98.35 98.35 0 0.00
35387. Salvador (bigsalvador) 1 44.20 44.20 0 0.00
35388. Maidenless (bigguy12) 1 102.74 102.74 1 100.00
35389. Niklas (bigerius) 1 130.57 130.57 1 100.00
35390. Haydn (bigdickclimber5_12) 1 69.30 69.30 0 0.00
35391. Jace (bigboyjones69) 1 92.53 92.53 1 100.00
35392. kylie (bibiq) 1 100.29 100.29 1 100.00
35393. Venkata Sai Bhanu Sachin (b... 1 63.46 63.46 1 100.00
35394. Olivia (bgts) 1 33.80 33.80 0 0.00
35395. Jack (bgbfurey) 1 126.76 126.76 1 100.00
35396. Betül (betull) 1 69.84 69.84 0 0.00
35397. monkeytypebeast (bestworldw... 1 75.14 75.14 0 0.00
35398. Sophie (beta_hun) 1 53.93 53.93 1 100.00
35399. Nicola (bertucciagialla) 1 71.43 71.43 0 0.00
35400. Beryl (berrr16) 1 33.58 33.58 0 0.00
35401. Warren (berkshire) 1 91.93 91.93 0 0.00
35402. Bentusian (bentusian) 1 67.66 67.66 0 0.00
35403. Lammy (benstickobi595) 1 71.52 71.52 1 100.00
35404. Benjamin (bennegrus) 1 77.13 77.13 0 0.00
35405. Benjamin (benjaminlaptop) 1 94.11 94.11 0 0.00
35406. HK (bengal_tiger) 1 33.17 33.17 0 0.00
35407. Bella (bella_lasagna) 1 53.37 53.37 0 0.00
35408. Say1 (beenzino) 1 99.65 99.65 1 100.00
35409. ERMT (beefwong) 1 70.38 70.38 0 0.00
35410. Bearrick (bearrick) 1 65.07 65.07 0 0.00
35411. bean (bean_man123) 1 80.33 80.33 0 0.00
35412. beans (beansrandy) 1 98.68 98.68 1 100.00
35413. Jenna (beannie22) 1 90.74 90.74 0 0.00
35414. Bean (beanervibez) 1 74.55 74.55 0 0.00
35415. Adam (beakerthe1st) 1 102.38 102.38 0 0.00
35416. bdam (bdam) 1 106.49 106.49 1 100.00
35417. Brian (bchoy1994) 1 130.52 130.52 1 100.00
35418. Alfredo (bc762147) 1 52.80 52.80 0 0.00
35419. 雪 (bbgotme) 1 81.35 81.35 0 0.00
35420. bawty rippa (bbbrandon) 1 67.34 67.34 0 0.00
35421. Marek (baumeef) 1 81.97 81.97 0 0.00
35422. David - Robert (batedcrayon) 1 77.31 77.31 1 100.00
35423. Brandon (basukaviru) 1 117.28 117.28 0 0.00
35424. Bas (basoomen10) 1 69.54 69.54 0 0.00
35425. Basil (basil2077) 1 83.51 83.51 0 0.00
35426. Brendan (barefootcatfish) 1 100.92 100.92 1 100.00
35427. Benjo (barbanzo) 1 85.66 85.66 0 0.00
35428. baqazan (baqazan) 1 83.31 83.31 0 0.00
35429. Banzz (banzz05) 1 54.50 54.50 0 0.00
35430. Ryan (bankzzy) 1 81.37 81.37 0 0.00
35431. anna (bananatan) 1 53.65 53.65 1 100.00
35432. Filigree (bampy08) 1 94.30 94.30 1 100.00
35433. Amjad (baigsap) 1 36.40 36.40 0 0.00
35434. hengoat (bagnana) 1 138.65 138.65 1 100.00
35435. babi (baggymist22063) 1 76.36 76.36 0 0.00
35436. Slerpasaur (bagasfirdaus) 1 105.48 105.48 1 100.00
35437. Jaxon (baenayeon) 1 86.51 86.51 1 100.00
35438. BadScam (badscam) 1 100.90 100.90 0 0.00
35439. Juan (badluck_guan) 1 54.04 54.04 0 0.00
35440. Nobody (badd0) 1 69.48 69.48 0 0.00
35441. Mehdi (badcrc) 1 125.98 125.98 1 100.00
35442. Fra (bachoseven) 1 75.25 75.25 1 100.00
35443. Elijah (bacchus1) 1 70.45 70.45 1 100.00
35444. Babyoven (babyoven) 1 147.53 147.53 1 100.00
35445. Carlos (babageniuz007) 1 101.76 101.76 1 100.00
35446. Azure (b1izzard) 1 82.24 82.24 0 0.00
35447. AJ (a__j) 1 66.13 66.13 0 0.00
35448. Ardhendu (a_0vi) 1 54.59 54.59 1 100.00
35449. Bloodcraze (azraef) 1 35.46 35.46 0 0.00
35450. MOIST (aznboy578) 1 118.10 118.10 1 100.00
35451. Azka (azka_s) 1 72.87 72.87 0 0.00
35452. Alex (azheng) 1 96.86 96.86 1 100.00
35453. Azharly (azharlyxx) 1 43.24 43.24 0 0.00
35454. Azael (azael69) 1 79.06 79.06 0 0.00
35455. Ayush (ayush123460) 1 94.74 94.74 1 100.00
35456. Phreakyx (axsali) 1 48.58 48.58 0 0.00
35457. Geoff (axorted) 1 64.87 64.87 0 0.00
35458. Axel (axox) 1 106.79 106.79 1 100.00
35459. Marek (axolotl720) 1 39.23 39.23 0 0.00
35460. Axe (axe_bicycle) 1 76.16 76.16 0 0.00
35461. axe (axeh) 1 122.67 122.67 1 100.00
35462. Andrew (axcelcr) 1 83.18 83.18 1 100.00
35463. Stian (awpchicken) 1 50.87 50.87 1 100.00
35464. AwesomeAsian69 (awesomeasia... 1 79.83 79.83 0 0.00
35465. Misia (avolvage) 1 54.69 54.69 1 100.00
35466. panzer (avitastic) 1 83.61 83.61 0 0.00
35467. Chayanne (avila760) 1 51.00 51.00 0 0.00
35468. Slim (avietnamesedude) 1 82.00 82.00 0 0.00
35469. Avery (averyiscoolish) 1 55.09 55.09 0 0.00
35470. aveda (aveda) 1 46.49 46.49 0 0.00
35471. (avazl) 1 102.40 102.40 0 0.00
35472. Auzem (auzem) 1 45.20 45.20 0 0.00
35473. Poon (auxin001) 1 41.28 41.28 0 0.00
35474. AQ (automaticquail) 1 73.36 73.36 0 0.00
35475. Austin (austincolibaba) 1 79.99 79.99 0 0.00
35476. Noah (ausnoa) 1 72.04 72.04 1 100.00
35477. Nguyen Phuoc (aurasync) 1 26.70 26.70 0 0.00
35478. Augmas (augmas) 1 82.25 82.25 0 0.00
35479. Shikhar (at_the_shikhar) 1 48.89 48.89 0 0.00
35480. atypicallegend ahmed aziz j... 1 13.63 13.63 0 0.00
35481. StAtomic (atomicplay) 1 69.59 69.59 1 100.00
35482. AtomRong (atomrong) 1 72.51 72.51 1 100.00
35483. ONCEbot (atomiconce) 1 53.67 53.67 0 0.00
35484. Atlas (atlaskd) 1 62.99 62.99 0 0.00
35485. Arjun (atc6505) 1 119.88 119.88 0 0.00
35486. Eufil (asuna_kirito25) 1 51.57 51.57 0 0.00
35487. An Tri (astronimical) 1 73.23 73.23 0 0.00
35488. Ray (astray_ray) 1 52.69 52.69 0 0.00
35489. fiji water (astranger24) 1 71.74 71.74 1 100.00
35490. Andy (astraay) 1 74.97 74.97 1 100.00
35491. Bigass (assfart) 1 55.00 55.00 0 0.00
35492. Ethan (assassindgn) 1 93.98 93.98 0 0.00
35493. assaf297 (assaf297) 1 50.24 50.24 0 0.00
35494. . (aspens) 1 113.34 113.34 1 100.00
35495. Bagus (asparagoes) 1 104.53 104.53 0 0.00
35496. Asil (asilkhalifa) 1 51.82 51.82 0 0.00
35497. asian (asian219381) 1 74.79 74.79 1 100.00
35498. ashwin (ashwin_m) 1 31.58 31.58 0 0.00
35499. Ashwin (ashwinkey04) 1 87.15 87.15 0 0.00
35500. Ashtra (ashtra) 1 77.37 77.37 0 0.00
35501. Ashish (ashish_jnvm) 1 54.37 54.37 0 0.00
35502. Ashish (ashish4563) 1 22.37 22.37 0 0.00
35503. ashish (ashis0013shaw) 1 48.46 48.46 0 0.00
35504. Nurdaulet (ashimbekov) 1 47.85 47.85 0 0.00
35505. AshKetchup (asheketchup) 1 113.66 113.66 1 100.00
35506. asd (asdasd4) 1 58.66 58.66 0 0.00
35507. asd (asd135795jack) 1 92.90 92.90 1 100.00
35508. asburton (asburtongrove) 1 59.61 59.61 0 0.00
35509. asayla (asayla) 1 77.47 77.47 0 0.00
35510. arz (arzr) 1 81.53 81.53 0 0.00
35511. Aryan (aryanp) 1 89.99 89.99 1 100.00
35512. Arya (aryas) 1 133.21 133.21 1 100.00
35513. kian (aryanboy) 1 62.60 62.60 0 0.00
35514. Art (art_licis) 1 96.13 96.13 0 0.00
35515. gyani (arugyani) 1 114.56 114.56 1 100.00
35516. Vasja (artemis358) 1 88.67 88.67 0 0.00
35517. Alex (arslans) 1 71.75 71.75 0 0.00
35518. Skeletons (arsen4500) 1 49.74 49.74 0 0.00
35519. John (armon99) 1 71.70 71.70 0 0.00
35520. armenn (armenn) 1 122.06 122.06 1 100.00
35521. emuko (arju_12) 1 67.86 67.86 1 100.00
35522. a (ariyuse) 1 24.57 24.57 0 0.00
35523. Alice (arisuchan1) 1 83.00 83.00 0 0.00
35524. Ariel (aricori21) 1 100.72 100.72 0 0.00
35525. Gleb (ari10000krat) 1 45.68 45.68 0 0.00
35526. Spooky (argosteelshield) 1 82.49 82.49 0 0.00
35527. rmholz (aremholz) 1 51.92 51.92 1 100.00
35528. arctics (arctics) 1 93.88 93.88 1 100.00
35529. no (archerypro459) 1 68.38 68.38 0 0.00
35530. Alec (arcelock) 1 113.50 113.50 0 0.00
35531. Araite (araite) 1 74.69 74.69 0 0.00
35532. Arafat (arafat_islam) 1 30.02 30.02 0 0.00
35533. Aqua (aquablitz11) 1 145.23 145.23 0 0.00
35534. Tarek (aqertis) 1 113.96 113.96 0 0.00
35535. Abdul Qayyum (aqal1003) 1 48.08 48.08 0 0.00
35536. Artie (appskill) 1 53.87 53.87 0 0.00
35537. August (appledoor) 1 99.12 99.12 1 100.00
35538. Appel (appeltert) 1 108.67 108.67 1 100.00
35539. apple (app1esauce) 1 85.36 85.36 0 0.00
35540. M. (apolexius) 1 81.70 81.70 1 100.00
35541. Apizza (apizzabear) 1 68.98 68.98 1 100.00
35542. Apgan (apgan) 1 25.61 25.61 0 0.00
35543. Arslan (apex0096) 1 54.69 54.69 0 0.00
35544. Arjyom (apepenkov) 1 55.38 55.38 0 0.00
35545. Alex (apasanta) 1 50.46 50.46 0 0.00
35546. Abdallah (ap0lo) 1 99.01 99.01 0 0.00
35547. Alex (aorliei) 1 106.94 106.94 1 100.00
35548. Anomaly (an_anomaly) 1 83.53 83.53 0 0.00
35549. jason (anybuzzin) 1 50.41 50.41 0 0.00
35550. An (anvnh) 1 68.69 68.69 1 100.00
35551. AntPlayz (antplayz) 1 115.16 115.16 1 100.00
35552. antl_m (antl_m) 1 38.47 38.47 0 0.00
35553. J (antiduckdude24) 1 112.05 112.05 0 0.00
35554. Anshul (anshul_khangar) 1 59.97 59.97 0 0.00
35555. Shawn (anotheronebitesthedust) 1 90.66 90.66 1 100.00
35556. owlxx (anonymous1229) 1 91.82 91.82 1 100.00
35557. Daniel (annyoung) 1 59.46 59.46 0 0.00
35558. edisondotme (annuit02) 1 79.20 79.20 0 0.00
35559. Prince (annardana) 1 32.86 32.86 0 0.00
35560. annac777 (annachiang4) 1 154.12 154.12 1 100.00
35561. anjerukare (anjerukare) 1 45.71 45.71 1 100.00
35562. umun (animatedeffect) 1 41.46 41.46 0 0.00
35563. anguelo (anguelo) 1 90.56 90.56 0 0.00
35564. pail (angertyper) 1 82.87 82.87 1 100.00
35565. angelo (angeloripple) 1 83.66 83.66 0 0.00
35566. Angel (ange1zzzu) 1 68.47 68.47 0 0.00
35567. Angara (angarariver) 1 52.01 52.01 0 0.00
35568. BLitZioNiC (andyzhu68) 1 74.73 74.73 0 0.00
35569. Andrew (andrwrbnsn) 1 88.95 88.95 0 0.00
35570. RUConfuzzled (andre_raj) 1 101.98 101.98 1 100.00
35571. Andrew (andrewhey) 1 70.02 70.02 0 0.00
35572. andrew (andrew91vu) 1 81.26 81.26 1 100.00
35573. Marco (andrefan69) 1 99.57 99.57 1 100.00
35574. andrea (andreaak00) 1 161.38 161.38 1 100.00
35575. a____________s (anavadya_13) 1 65.81 65.81 1 100.00
35576. Aaron (anathanbruh) 1 39.14 39.14 0 0.00
35577. Anas (anas11) 1 87.07 87.07 0 0.00
35578. nxgraaha (amuza12) 1 46.55 46.55 1 100.00
35579. Amsyar (amsyar44447) 1 51.82 51.82 1 100.00
35580. Amos (amosbird) 1 106.29 106.29 1 100.00
35581. Ammon (ammon21110) 1 28.07 28.07 0 0.00
35582. Aaron (amares200) 1 109.82 109.82 0 0.00
35583. Aman (aman7015) 1 33.64 33.64 0 0.00
35584. amadda (amaddaps) 1 44.03 44.03 0 0.00
35585. Alytoni (alytoni) 1 73.94 73.94 0 0.00
35586. alvin (alvingogo) 1 38.16 38.16 1 100.00
35587. Alva (alvath) 1 74.24 74.24 0 0.00
35588. Alvan (alvansng) 1 75.18 75.18 0 0.00
35589. Joe (alux) 1 101.17 101.17 0 0.00
35590. Arun (alpha_mo) 1 65.48 65.48 1 100.00
35591. gtyf10 (aloserthatcanonlyty... 1 101.12 101.12 1 100.00
35592. Alonzo (alonrodrigu) 1 103.07 103.07 1 100.00
35593. Simeon (alode) 1 73.44 73.44 0 0.00
35594. Ali (aloche) 1 85.74 85.74 0 0.00
35595. cheeks (almanfh) 1 59.82 59.82 0 0.00
35596. mohammed (aljarrah) 1 33.60 33.60 0 0.00
35597. Ariel (alil) 1 54.53 54.53 1 100.00
35598. Ali (alibahrawy34) 1 53.69 53.69 0 0.00
35599. Ali (aliansari) 1 30.86 30.86 0 0.00
35600. Kelvin (algebrah) 1 80.59 80.59 0 0.00
35601. Alfman (alfman) 1 52.83 52.83 0 0.00
35602. alex (alexyan) 1 96.13 96.13 1 100.00
35603. Alex (alexvesepog) 1 130.25 130.25 1 100.00
35604. TypeTypeFox (alexsoldier122) 1 62.59 62.59 0 0.00
35605. Alexander (alexozero) 1 37.64 37.64 0 0.00
35606. Alex (alexkgarner) 1 73.18 73.18 0 0.00
35607. bruh (alexe1093) 1 83.42 83.42 0 0.00
35608. Alexdebassman (alexdebassman) 1 86.29 86.29 1 100.00
35609. Alex (alexdallama) 1 66.87 66.87 1 100.00
35610. alex (alexadimundi) 1 101.61 101.61 1 100.00
35611. Sam (aleuznelav2) 1 120.81 120.81 1 100.00
35612. Ezel (aldidoanta) 1 75.39 75.39 0 0.00
35613. Alb (albinalbin) 1 96.05 96.05 0 0.00
35614. Joseph (alatar) 1 100.71 100.71 0 0.00
35615. Alan (alany411) 1 93.97 93.97 1 100.00
35616. Alanna (alannafey) 1 87.60 87.60 0 0.00
35617. Alvin (al12611975) 1 80.08 80.08 0 0.00
35618. Claire (akward7ur7le) 1 49.23 49.23 0 0.00
35619. Ako (akoisthenamee) 1 69.44 69.44 1 100.00
35620. Mob (akmob) 1 43.27 43.27 0 0.00
35621. Andrej (akithereaper8) 1 88.08 88.08 0 0.00
35622. Tsuki (akirisakura) 1 105.84 105.84 1 100.00
35623. akiesh (akiesh) 1 80.47 80.47 0 0.00
35624. L (aka_l) 1 42.30 42.30 0 0.00
35625. akari (akari223) 1 66.37 66.37 1 100.00
35626. Aeron James (ajutzu) 1 58.50 58.50 0 0.00
35627. monkaS (ajcsphotos) 1 148.41 148.41 1 100.00
35628. Roger (aiyex) 1 83.21 83.21 1 100.00
35629. AimFaze (aimfaze) 1 37.10 37.10 0 0.00
35630. Ailton (ailtonn) 1 74.68 74.68 0 0.00
35631. aidan (aidansamson) 1 64.49 64.49 1 100.00
35632. a1dan (aidanxd) 1 55.21 55.21 0 0.00
35633. Amelia (ahmillzah) 1 95.99 95.99 0 0.00
35634. Ahmed (ahmedslayer123) 1 72.61 72.61 1 100.00
35635. ahmed (ahmedfouad) 1 106.88 106.88 1 100.00
35636. Ahmad (ahmahsen) 1 77.50 77.50 0 0.00
35637. meme (ahchai) 1 107.33 107.33 1 100.00
35638. Ahad (ahad_abd) 1 60.12 60.12 0 0.00
35639. Agustin (agusvelisone) 1 104.29 104.29 1 100.00
35640. Garfield (aguy27) 1 95.46 95.46 0 0.00
35641. anubha (agoop) 1 101.31 101.31 1 100.00
35642. S (agnimandur) 1 76.63 76.63 0 0.00
35643. tstats[agarwaltanish10] (ag... 1 74.64 74.64 0 0.00
35644. Aftiii (aftiii) 1 116.75 116.75 1 100.00
35645. Rob (aftershock7) 1 50.96 50.96 0 0.00
35646. Foyez (aflextra) 1 69.68 69.68 1 100.00
35647. Adrian (afbslacker) 1 118.03 118.03 1 100.00
35648. Averie (afbanix) 1 115.67 115.67 1 100.00
35649. el (aeeia) 1 49.26 49.26 0 0.00
35650. Zhenyu (adv000) 1 90.44 90.44 1 100.00
35651. Adrian (adrian_sliacky) 1 48.56 48.56 0 0.00
35652. Aditya (adityasood) 1 69.56 69.56 0 0.00
35653. Proud (adityaqudaedah) 1 77.57 77.57 0 0.00
35654. ade (adefiqri12) 1 65.04 65.04 0 0.00
35655. Andreas (addekallstrom) 1 105.37 105.37 0 0.00
35656. Adam (adam_sandler) 1 55.48 55.48 1 100.00
35657. Adam (adamfriska) 1 104.54 104.54 1 100.00
35658. @adamvd13 (ad13) 1 70.48 70.48 1 100.00
35659. andrew (actuallysoup) 1 128.30 128.30 0 0.00
35660. Antoni (acruz63) 1 70.21 70.21 1 100.00
35661. Alexandre (acolavin) 1 101.56 101.56 1 100.00
35662. Meor (acnolog1a) 1 91.41 91.41 1 100.00
35663. Àngela (aciutat) 1 69.71 69.71 0 0.00
35664. austin (acirelle) 1 67.67 67.67 0 0.00
35665. Achyut (achyut69) 1 81.44 81.44 0 0.00
35666. Alex (ace_alex) 1 83.42 83.42 0 0.00
35667. Brian (ace213) 1 92.28 92.28 0 0.00
35668. Angela (academicworkspace) 1 107.59 107.59 1 100.00
35669. Abi (abz135) 1 107.07 107.07 0 0.00
35670. Weiqi (abwuhd) 1 111.83 111.83 0 0.00
35671. Abu Raziel (abu_raziel) 1 39.39 39.39 0 0.00
35672. Ivy (above_averagez) 1 79.56 79.56 0 0.00
35673. Henry (ablacksmoothie) 1 138.68 138.68 1 100.00
35674. Abhi_Dvorak (abhyudaya_nair) 1 31.01 31.01 0 0.00
35675. abetheunicorn (abetheunicorn) 1 89.83 89.83 1 100.00
35676. Abdulrahman (abdulraman_q99) 1 35.71 35.71 0 0.00
35677. abdullah (abdullahomg77) 1 45.72 45.72 1 100.00
35678. الأصابع (abdoh) 1 90.41 90.41 1 100.00
35679. Abigail (abby_yobby) 1 68.21 68.21 0 0.00
35680. Alexander (abba64) 1 56.64 56.64 0 0.00
35681. Abhishek (abazaz722) 1 65.82 65.82 1 100.00
35682. ApostleOfTheLazy (aayushm8) 1 82.44 82.44 0 0.00
35683. Aaron (aaronrockindude) 1 76.96 76.96 0 0.00
35684. Aaron (aaronjeng) 1 129.83 129.83 0 0.00
35685. Aaron (aaronesc) 1 58.35 58.35 0 0.00
35686. (╯°□°)╯ (aaltra) 1 130.28 130.28 1 100.00
35687. stickyrice (aaawiiee) 1 62.32 62.32 0 0.00
35688. Atte (aaaveetee) 1 80.55 80.55 0 0.00
35689. AFourTeen (a14inc) 1 68.37 68.37 0 0.00
35690. 69wpm (a04a04283) 1 66.17 66.17 0 0.00
35691. Nejc (9likediamonds) 1 98.92 98.92 0 0.00
35692. Lucca (9fingersonly) 1 91.90 91.90 1 100.00
35693. Anurag TypeRacer (9craft_) 1 40.18 40.18 0 0.00
35694. Gordon (99m9) 1 83.81 83.81 0 0.00
35695. Lily (8o7wer) 1 92.76 92.76 0 0.00
35696. Jindřich (7xxf) 1 57.71 57.71 0 0.00
35697. Bluem (7jcs) 1 80.04 80.04 1 100.00
35698. Pooh (5i1ver1ining) 1 89.75 89.75 0 0.00
35699. Dominic (5doum) 1 79.05 79.05 1 100.00
35700. JustJie (570897055) 1 77.36 77.36 0 0.00
35701. 4n2h0ny (4n2h0ny) 1 96.83 96.83 1 100.00
35702. --------- (4itch) 1 75.08 75.08 1 100.00
35703. 4D (4d2233) 1 114.10 114.10 1 100.00
35704. Isahi (420blaziken_) 1 76.39 76.39 0 0.00
35705. forty-one hex (41hex) 1 81.75 81.75 1 100.00
35706. Judeisbad (4123) 1 114.34 114.34 0 0.00
35707. Big (3igbrain) 1 82.16 82.16 1 100.00
35708. slow (366665) 1 96.87 96.87 0 0.00
35709. Nemo (35603560) 1 122.61 122.61 0 0.00
35710. Yani (311yani) 1 88.03 88.03 0 0.00
35711. Kriisp (2krispy) 1 108.04 108.04 0 0.00
35712. Ahro (2easy) 1 111.77 111.77 1 100.00
35713. Klaus26 (26klaus) 1 82.28 82.28 1 100.00
35714. 2115 to (2115togeng) 1 77.18 77.18 0 0.00
35715. A (1s1t1r) 1 119.17 119.17 0 0.00
35716. Sparsh (1nvariant) 1 35.26 35.26 0 0.00
35717. Eldon (1ick_your_nan) 1 88.51 88.51 0 0.00
35718. 1 (1etmedie) 1 48.10 48.10 0 0.00
35719. Stacy (1dk_sara) 1 41.88 41.88 0 0.00
35720. Percaimond (1cedheroine) 1 98.77 98.77 0 0.00
35721. adm (1adm1) 1 67.41 67.41 0 0.00
35722. Borlagotch (19jonono) 1 96.44 96.44 1 100.00
35723. ali (199901) 1 95.55 95.55 1 100.00
35724. sleepyhead (1983civic) 1 86.72 86.72 0 0.00
35725. Michael (1851917) 1 103.99 103.99 0 0.00
35726. KJ (1648460) 1 55.81 55.81 0 0.00
35727. Timothy (12tqian) 1 143.45 143.45 1 100.00
35728. JersH (0zmank) 1 92.70 92.70 0 0.00
35729. Ramkrishn Rai (0typing_beast) 1 21.76 21.76 1 100.00
35730. Justin (05justino) 1 45.96 45.96 0 0.00
35731. (0018) 1 178.99 178.99 1 100.00
35732. Edward (eph91) 1 41.58 41.58 0 0.00
35733. rafi (club86) 1 71.70 71.70 0 0.00
35734. G (gffaza) 1 52.61 52.61 1 100.00
35735. RKade (rkade99) 1 59.03 59.03 0 0.00
35736. Pedro Seiji (pedroseiji) 1 60.73 60.73 1 100.00
35737. orange (plorpus) 1 65.60 65.60 0 0.00
35738. camred (camred) 1 44.84 44.84 0 0.00
35739. Ernie (radiospank) 1 61.41 61.41 0 0.00
35740. Dhiraj Kumar (thealgo) 1 51.87 51.87 0 0.00
35741. Jay (jayten010) 1 65.59 65.59 0 0.00
35742. Raymond (raymondphang) 1 50.81 50.81 0 0.00
35743. Lunato (sambuca) 1 125.16 125.16 1 100.00
35744. tstats[alfa_h2] (alfa_h2) 1 81.65 81.65 0 0.00
35745. IamUseless (uselessname) 1 54.27 54.27 0 0.00
35746. Kyrie (kyrie4215) 1 87.52 87.52 1 100.00
35747. AlexEP (alexep) 1 60.59 60.59 0 0.00
35748. Jimbo (booty_wizard) 1 59.11 59.11 0 0.00
35749. Kyle (kylejli) 1 103.15 103.15 1 100.00
35750. Matthew (mrc624) 1 60.02 60.02 0 0.00
35751. tudor (tudorbogos) 1 65.80 65.80 1 100.00
35752. Kerstin (heyitskerstin) 1 74.65 74.65 0 0.00
35753. colemak_noob (vantroy) 1 46.18 46.18 0 0.00
35754. Swaglord (swagoverlord69420) 1 81.32 81.32 1 100.00
35755. jeandry (el_matatan) 1 69.29 69.29 0 0.00
35756. Sid (sammy_sb) 1 53.69 53.69 0 0.00
35757. Kris (da_typerr) 1 69.59 69.59 0 0.00
35758. Milah (xxmgl) 1 39.46 39.46 0 0.00
35759. NNinjaFury (nninjafury) 1 63.44 63.44 1 100.00
35760. Tai (mega_weebo5) 1 33.33 33.33 0 0.00
35761. Luke (lazaround_future) 1 70.36 70.36 0 0.00
35762. Thermic (thermicfox_88864) 1 79.18 79.18 0 0.00
35763. Cool (cool_dude01) 1 20.96 20.96 0 0.00
35764. Ben (bonpopkon) 1 87.58 87.58 0 0.00
35765. Alex (alxkeda) 1 77.15 77.15 1 100.00
35766. Nolan (notnolan) 1 47.01 47.01 1 100.00
35767. Nicholas (musicaloreo) 1 115.01 115.01 1 100.00
35768. Penth (penth) 1 95.32 95.32 0 0.00
35769. Adam (mumbledore) 1 82.81 82.81 0 0.00
35770. Nick (nickster48) 1 40.83 40.83 0 0.00
35771. Maximus (kingmaximus) 1 71.01 71.01 1 100.00
35772. Arkaprobha (arkapro) 1 94.86 94.86 1 100.00
35773. alex (itsskoots) 1 114.21 114.21 1 100.00
35774. Septian (tyanpes) 1 62.71 62.71 0 0.00
35775. Typo_Typer (typo_is_in_your... 1 58.58 58.58 0 0.00
35776. Mattokaa (mattokaa) 1 66.89 66.89 1 100.00
35777. joe (xxjoe61) 1 44.71 44.71 0 0.00
35778. Arif (arif_500) 1 34.80 34.80 0 0.00
35779. Izaac (izaaciwnl) 1 67.07 67.07 0 0.00
35780. Sarah (dilpiklejelly) 1 83.05 83.05 0 0.00
35781. anonimus (vibingorsum) 1 77.75 77.75 0 0.00
35782. Jan (seberay) 1 84.27 84.27 0 0.00
35783. kty (ktylolonlaptop) 1 65.29 65.29 0 0.00
35784. Noir (noirsette) 1 64.44 64.44 0 0.00
35785. Tomas (tomielordi) 1 50.36 50.36 0 0.00
35786. Rea1Estate (rea1estate) 1 78.40 78.40 0 0.00
35787. mahipal (mahilove) 1 43.28 43.28 0 0.00
35788. Felias (felias) 1 56.26 56.26 0 0.00
35789. Squidney (hieroolz97) 1 103.80 103.80 0 0.00
35790. Texo (chocotexo) 1 45.58 45.58 0 0.00
35791. Patrick (swissjeez) 1 85.03 85.03 0 0.00
35792. Simon (boochicken) 1 109.65 109.65 0 0.00
35793. Bestian (puzzlez) 1 113.73 113.73 1 100.00
35794. Aymen (aymendn) 1 33.34 33.34 0 0.00
35795. Aryaman (aryaman2004) 1 50.44 50.44 0 0.00
35796. Tabita Morfin (tmorfin) 1 31.91 31.91 0 0.00
35797. Nikki (_nikki) 1 49.30 49.30 0 0.00
35798. andrew (andrewb3) 1 58.53 58.53 1 100.00
35799. Remco (aapje1606) 1 58.25 58.25 0 0.00
35800. Souplette (souplette) 1 95.00 95.00 1 100.00
35801. Parracho (parracho) 1 109.37 109.37 1 100.00
35802. Teenage (teenagenoob) 1 71.86 71.86 0 0.00
35803. karl (karlaustria) 1 73.20 73.20 1 100.00
35804. Lars (larsms) 1 59.58 59.58 1 100.00
35805. Omar (omarsalah) 1 43.91 43.91 0 0.00
35806. Justin (xxshompxx) 1 80.69 80.69 1 100.00
35807. rohit mahala (mahala19) 1 43.64 43.64 0 0.00
35808. Maynard (weekendtantrums) 1 106.03 106.03 0 0.00
35809. Ahmet Eren (ahmeterent27) 1 90.81 90.81 0 0.00
35810. John Hill (jhnhlldrms) 1 39.64 39.64 0 0.00
35811. EOQ (rozok) 1 23.36 23.36 0 0.00
35812. Ibrahim (cyasmix) 1 59.66 59.66 0 0.00
35813. Hideki Reiven (hidekuchan) 1 100.43 100.43 1 100.00
35814. Eliam (erg_el18) 1 34.57 34.57 0 0.00
35815. the (sawdust10) 1 74.92 74.92 0 0.00
35816. Andrej (techno1337) 1 95.85 95.85 1 100.00
35817. Alex (alex_wee_b_flyball) 1 53.46 53.46 0 0.00
35818. Luis (luis11152) 1 50.54 50.54 0 0.00
35819. Marcelioo (marcelio) 1 72.48 72.48 0 0.00
35820. Acie (syahzrie0809) 1 57.90 57.90 1 100.00
35821. Obi (obi2605) 1 75.92 75.92 1 100.00
35822. abel (abelkt) 1 63.15 63.15 0 0.00
35823. Anon (subs) 1 73.72 73.72 0 0.00
35824. Ale (ericum) 1 60.98 60.98 1 100.00
35825. Ali (ezzomania) 1 89.84 89.84 0 0.00
35826. capdee (captain_death) 1 89.92 89.92 1 100.00
35827. omar (omaralbakri) 1 23.03 23.03 1 100.00
35828. Salt (saltfactory) 1 98.87 98.87 0 0.00
35829. ken (bappomet) 1 94.96 94.96 1 100.00
35830. Daniel (zsour) 1 65.02 65.02 0 0.00
35831. Hangry (kungfuhangry) 1 80.40 80.40 0 0.00
35832. Archibald (homophobic_telet... 1 54.73 54.73 0 0.00
35833. sugoi (sugoi_ne) 1 131.38 131.38 1 100.00
35834. timebombed (timebombed) 1 106.58 106.58 0 0.00
35835. George (korol) 1 36.89 36.89 0 0.00
35836. Joaco (cacos_pl) 1 58.10 58.10 0 0.00
35837. Nibzmeister (nibzmeister) 1 110.75 110.75 1 100.00
35838. J (plumbus_typer) 1 48.50 48.50 0 0.00
35839. Ethan (mystii) 1 79.54 79.54 1 100.00
35840. Anders (andeeeers) 1 42.50 42.50 0 0.00
35841. Thomas (mrmystery100) 1 125.16 125.16 0 0.00
35842. Owolabi (esam17) 1 32.90 32.90 0 0.00
35843. Juancar (jotas) 1 43.02 43.02 0 0.00
35844. Goose (friendlygoose) 1 80.48 80.48 1 100.00
35845. Kale (kalebroth) 1 78.20 78.20 0 0.00
35846. Charlie (davee3) 1 46.87 46.87 0 0.00
35847. gabe (pxo_null) 1 77.21 77.21 0 0.00
35848. Doctor (drxionel) 1 105.52 105.52 0 0.00
35849. T (tkk64) 1 92.64 92.64 0 0.00
35850. Jerry (foxyphoton) 1 88.57 88.57 0 0.00
35851. Denel (denel) 1 70.02 70.02 0 0.00
35852. Owen (owen_type) 1 52.54 52.54 0 0.00
35853. marine (thegoatmarine) 1 73.86 73.86 1 100.00
35854. TrumpSucks (bremu) 1 43.30 43.30 0 0.00
35855. Johnnydepinguin (johnnydepi... 1 44.58 44.58 0 0.00
35856. Xin (xinzhao12345) 1 101.66 101.66 1 100.00
35857. ToverTractor (tovertractor) 1 57.23 57.23 0 0.00
35858. Nara (crazyasian640) 1 88.82 88.82 0 0.00
35859. Jari (thesadcat) 1 63.63 63.63 0 0.00
35860. Ethan (ethanxvii) 1 79.69 79.69 0 0.00
35861. -_- (trollinglobster) 1 56.96 56.96 0 0.00
35862. Mae (pinkcustard2) 1 48.85 48.85 0 0.00
35863. yes (azkuo) 1 80.79 80.79 1 100.00
35864. a (1268640026) 1 88.76 88.76 1 100.00
35865. Matt (zevikan) 1 56.19 56.19 0 0.00
35866. Luka (type_master_123) 1 88.59 88.59 1 100.00
35867. WIPEOUT (gabe112310) 1 59.12 59.12 0 0.00
35868. Kevin (xrocca) 1 106.24 106.24 1 100.00
35869. Alex (flamealex) 1 78.06 78.06 1 100.00
35870. Nahte (uhop123) 1 71.57 71.57 0 0.00
35871. jimmy (luas) 1 32.18 32.18 0 0.00
35872. Tobias (saibot148) 1 45.96 45.96 0 0.00
35873. Mayonnaise (blueraider) 1 81.90 81.90 0 0.00
35874. Vishal Teotia (vishalteotia) 1 39.75 39.75 0 0.00
35875. Royz (4noni3us) 1 74.50 74.50 0 0.00
35876. Bruv (robloxianmaster) 1 61.50 61.50 0 0.00
35877. Bro (broproguo) 1 97.51 97.51 1 100.00
35878. Nitin (nitin12384) 1 30.31 30.31 0 0.00
35879. Brett (zephron) 1 106.97 106.97 1 100.00
35880. COSMiC (cosmicojus) 1 35.69 35.69 0 0.00
35881. Leowo (dragonduelist) 1 96.96 96.96 1 100.00
35882. James (nodox) 1 80.10 80.10 1 100.00
35883. Kathi (kathipacket) 1 118.17 118.17 1 100.00
35884. Derrick (derrickjdn) 1 73.06 73.06 1 100.00
35885. dejawhoosh (dejawhoosh) 1 48.24 48.24 0 0.00
35886. Doble (bn_doble_16) 1 69.51 69.51 0 0.00
35887. Tubbo (i_like_bees_dsmp_) 1 31.68 31.68 0 0.00
35888. Allen (a5chan) 1 144.85 144.85 0 0.00
35889. Choccy (choccymolk) 1 74.58 74.58 0 0.00
35890. Daniel (dsbaule) 1 83.94 83.94 1 100.00
35891. vs-123 (vs123) 1 89.82 89.82 0 0.00
35892. Rage (ragecatalyst) 1 71.48 71.48 0 0.00
35893. Sorrow (zxcv51523) 1 141.90 141.90 0 0.00
35894. ARNA~S (arnas_07) 1 39.60 39.60 0 0.00
35895. Aimee (clefaimee) 1 92.99 92.99 0 0.00
35896. Aura (auraeevee431) 1 55.75 55.75 0 0.00
35897. Seán (blondietypes) 1 76.60 76.60 0 0.00
35898. Vincent (craatlantic7) 1 53.62 53.62 1 100.00
35899. Michał (mixss) 1 49.15 49.15 0 0.00
35900. Omar (omarhawwash) 1 141.44 141.44 1 100.00
35901. shotgun (shotgun901) 1 32.19 32.19 0 0.00
35902. Sanders (tpcsanders) 1 93.88 93.88 1 100.00
35903. Tyarel (tyarel) 1 56.27 56.27 0 0.00
35904. Drake (_sneax_) 1 59.73 59.73 0 0.00
35905. Adarsh (oblivious_paradigm) 1 66.48 66.48 1 100.00
35906. Tony (imperfects) 1 64.77 64.77 1 100.00
35907. Nuclear (nuclearmissile) 1 62.88 62.88 1 100.00
35908. KillSwitch (killswitch248) 1 73.31 73.31 0 0.00
35909. Jesse (stealthybeef) 1 69.21 69.21 0 0.00
35910. . (roriwood) 1 83.16 83.16 1 100.00
35911. Orb (orb_sans) 1 65.55 65.55 0 0.00
35912. Jack (sickplayer124) 1 36.14 36.14 0 0.00
35913. Ger (gertyper) 1 49.23 49.23 1 100.00
35914. Baraa (kholoki) 1 74.52 74.52 0 0.00
35915. AlfredPlayz (alfredplayz) 1 67.01 67.01 1 100.00
35916. ShaneezOnFire (shaneezonfire) 1 78.38 78.38 1 100.00
35917. schuii (schuii) 1 45.72 45.72 0 0.00
35918. darkness (dwu1011) 1 104.53 104.53 1 100.00
35919. Sean (itsstealthb) 1 91.10 91.10 1 100.00
35920. Michael (bubzybubs) 1 111.97 111.97 1 100.00
35921. Chrys (s4ltyweeb) 1 83.99 83.99 1 100.00
35922. Nick (nbadal) 1 106.18 106.18 1 100.00
35923. Joseph (shion264) 1 61.91 61.91 1 100.00
35924. taylor (daogwhiteboy) 1 75.79 75.79 1 100.00
35925. Conner (conn3rrrr) 1 67.54 67.54 0 0.00
35926. CopyRited (copyrited) 1 67.80 67.80 1 100.00
35927. Adam (adamfb2511) 1 57.46 57.46 1 100.00
35928. Jaimin (jimjamerplayz) 1 34.21 34.21 0 0.00
35929. Daniel (ibravedaniel24) 1 33.93 33.93 0 0.00
35930. deez (mintynitroxpresso) 1 48.72 48.72 0 0.00
35931. qboIodp (qboiodp) 1 68.48 68.48 0 0.00
35932. Ivan (ladiladia) 1 118.39 118.39 1 100.00
35933. beescoot (beescoot) 1 87.58 87.58 0 0.00
35934. ah! (tangykumquat) 1 70.62 70.62 1 100.00
35935. Rojo (rojoflash) 1 83.91 83.91 1 100.00
35936. Yugal (yugal_kishore_v) 1 27.69 27.69 0 0.00
35937. Madhav (sigma_code_monkey) 1 91.46 91.46 0 0.00
35938. lohkachu (lohkachu) 1 64.58 64.58 1 100.00
35939. Anton (antonh123) 1 140.29 140.29 1 100.00
35940. Momo (momokartofa) 1 77.56 77.56 1 100.00
35941. Adham (enkrad) 1 42.76 42.76 0 0.00
35942. Adiel (adielpf) 1 65.82 65.82 1 100.00
35943. kervin (kervinramen) 1 62.15 62.15 1 100.00
35944. Moaiad (mhm555) 1 81.35 81.35 1 100.00
35945. Baile (thebltsandwich) 1 55.59 55.59 0 0.00
35946. Chiyu (jasonkush) 1 50.09 50.09 0 0.00
35947. Blake (eastexodus) 1 93.91 93.91 1 100.00
35948. Michael (idheretic) 1 47.17 47.17 0 0.00
35949. Clinton (clintonyo) 1 55.99 55.99 0 0.00
35950. urwrstkn8mare (urwrstkn8mare) 1 73.38 73.38 0 0.00
35951. Rocketgirlygirl (rocketgirl... 1 55.27 55.27 0 0.00
35952. Sanani (sananirajabov) 1 70.06 70.06 0 0.00
35953. poexv (poex) 1 119.56 119.56 1 100.00
35954. Samantha (yellagirlswag) 1 75.59 75.59 0 0.00
35955. Zaza (urdoomishere) 1 86.14 86.14 1 100.00
35956. ok (ok_0) 1 63.40 63.40 1 100.00
35957. Alex (smartalexg) 1 78.93 78.93 1 100.00
35958. Lauren (laurenmontyyyyy) 1 82.65 82.65 1 100.00
35959. fear (fearl3ss) 1 102.21 102.21 1 100.00
35960. Merili (merkake123) 1 44.85 44.85 0 0.00
35961. Olzhas (howardat) 1 69.98 69.98 0 0.00
35962. ADM (adamzainuri01) 1 73.71 73.71 0 0.00
35963. Sam (saha_) 1 64.09 64.09 0 0.00
35964. Golgibody (golgibody) 1 39.66 39.66 0 0.00
35965. Haukur (haukur06) 1 42.88 42.88 0 0.00
35966. Tre (guysy) 1 75.73 75.73 0 0.00
35967. Lebron James (gossip_) 1 85.00 85.00 1 100.00
35968. NIKHIL (nikkkhil_16) 1 23.71 23.71 0 0.00
35969. 3phat (bosscus) 1 71.44 71.44 1 100.00
35970. Swim (swwimmingbird) 1 67.14 67.14 1 100.00
35971. alex (lxbrdly) 1 68.19 68.19 1 100.00
35972. HL (pantsguy) 1 45.96 45.96 0 0.00
35973. Slav (slavocado) 1 98.26 98.26 1 100.00
35974. Jizdan (jizdan) 1 23.76 23.76 0 0.00
35975. Allen (illintin) 1 89.24 89.24 1 100.00
35976. Gedvillllllle (geddy) 1 46.96 46.96 0 0.00
35977. New (duahautv378) 1 26.67 26.67 1 100.00
35978. Ty (dgtc99) 1 31.16 31.16 0 0.00
35979. Bharat (bharatpandey88) 1 61.95 61.95 0 0.00
35980. Daniil (demolice) 1 66.50 66.50 0 0.00
35981. MercyXTD (mercyxtd) 1 66.89 66.89 0 0.00
35982. Luke (kioa) 1 55.42 55.42 0 0.00
35983. Ammaar (ammaar_1) 1 41.61 41.61 0 0.00
35984. ccgibson (ccgibson) 1 157.36 157.36 1 100.00
35985. rendon (rendons2) 1 58.08 58.08 0 0.00
35986. Jack (draxlind) 1 93.91 93.91 1 100.00
35987. KeybrdNewbie (keyboardnewbie) 1 72.49 72.49 0 0.00
35988. kangbap (canyounott) 1 126.10 126.10 1 100.00
35989. Fatemeh (fatemeh_ek) 1 35.98 35.98 0 0.00
35990. Joe (casketer) 1 60.57 60.57 1 100.00
35991. Damax (damax) 1 64.30 64.30 0 0.00
35992. Brandon (brandong22) 1 51.82 51.82 0 0.00
35993. Warcat (thepowerofj) 1 85.02 85.02 1 100.00
35994. Minty (minty57) 1 82.64 82.64 1 100.00
35995. hawk (hawkmeeuw) 1 74.57 74.57 0 0.00
35996. incredible (incrediblelizard) 1 60.12 60.12 1 100.00
35997. Vishal (godshal) 1 106.08 106.08 1 100.00
35998. dief (dief21) 1 26.90 26.90 0 0.00
35999. Joss (jijots) 1 67.56 67.56 1 100.00
36000. D20z (ricwork88) 1 74.52 74.52 0 0.00
36001. a (magmafps_) 1 94.53 94.53 1 100.00
36002. heidi (snail_iz_slow) 1 27.27 27.27 0 0.00
36003. jason (jjasxn) 1 70.02 70.02 0 0.00
36004. maciek (macientux) 1 52.23 52.23 1 100.00
36005. Alonso (lonsoag2) 1 54.04 54.04 0 0.00
36006. 223RuDe (223rude) 1 35.05 35.05 0 0.00
36007. Random (learningtyping123) 1 73.02 73.02 0 0.00
36008. TheBlueMonarch (foul_bronze) 1 45.17 45.17 0 0.00
36009. cameron (runcam) 1 39.89 39.89 0 0.00
36010. Sidharth (dj_panda69) 1 71.74 71.74 0 0.00
36011. Sam (varga16975) 1 93.65 93.65 1 100.00
36012. Terra (terramorpher) 1 58.82 58.82 0 0.00
36013. jake (urboijacob) 1 87.83 87.83 1 100.00
36014. Fei (zerofei) 1 35.59 35.59 0 0.00
36015. Heber (ache_m) 1 86.11 86.11 0 0.00
36016. Krlja (thewebster19) 1 53.11 53.11 0 0.00
36017. Trevor (texan5) 1 75.96 75.96 1 100.00
36018. Terry (z0mmine) 1 71.83 71.83 1 100.00
36019. mish3al (mish3al) 1 66.77 66.77 0 0.00
36020. MavGoose6 (zyphalopagus) 1 40.47 40.47 0 0.00
36021. Nogen (zarkiwni) 1 51.41 51.41 0 0.00
36022. joe (revemc) 1 67.11 67.11 0 0.00
36023. EddyBer (eddyber16) 1 83.92 83.92 1 100.00
36024. PuddingSenator (fluc02) 1 117.36 117.36 1 100.00
36025. Radosław (puszkiss) 1 43.37 43.37 0 0.00
36026. buzzwuzzfuzz (buzzwuzzfuzz) 1 77.35 77.35 1 100.00
36027. Sarah (sarah36854) 1 66.60 66.60 1 100.00
36028. Airogene (qualpotato) 1 74.43 74.43 0 0.00
36029. Julie (juliach7) 1 27.78 27.78 0 0.00
36030. Joko (joko100) 1 80.42 80.42 0 0.00
36031. Adrián (adrianv45) 1 40.48 40.48 0 0.00
36032. kakeninja (kakeninja) 1 104.49 104.49 1 100.00
36033. Musa (moose_the_goose) 1 82.72 82.72 1 100.00
36034. ainun (ainunnisa) 1 32.30 32.30 0 0.00
36035. Catarina (marhc) 1 36.60 36.60 0 0.00
36036. Hussain (safaroo) 1 77.87 77.87 1 100.00
36037. Stoned (stoned_raccoon) 1 58.97 58.97 0 0.00
36038. dozent (1985dozent) 1 73.24 73.24 1 100.00
36039. Harriet (harrietjosephinemary) 1 73.53 73.53 0 0.00
36040. Breon (scowl_) 1 76.37 76.37 0 0.00
36041. ItsKevin183 (kevin183) 1 82.93 82.93 0 0.00
36042. Krisztián (kkoves) 1 92.90 92.90 1 100.00
36043. Otis (eutiss) 1 45.54 45.54 0 0.00
36044. Kevin (beaterofmeat) 1 74.34 74.34 0 0.00
36045. Sir (sireiji) 1 35.26 35.26 0 0.00
36046. Wency (wencydeng) 1 71.02 71.02 1 100.00
36047. Kartik (tenten93) 1 75.81 75.81 1 100.00
36048. MatShroom (matshroom) 1 44.53 44.53 0 0.00
36049. Name (parmak) 1 52.11 52.11 0 0.00
36050. Chadwin (apexlosers) 1 71.58 71.58 1 100.00
36051. Adam (xizall) 1 55.77 55.77 0 0.00
36052. js (searsino) 1 61.28 61.28 0 0.00
36053. Jamie (nelzen) 1 72.52 72.52 1 100.00
36054. Elmi_Moso (licenciado) 1 55.16 55.16 1 100.00
36055. MJ (ermory) 1 55.17 55.17 0 0.00
36056. Rafaella (rbarahona) 1 61.94 61.94 1 100.00
36057. Awertho (awertho) 1 87.19 87.19 0 0.00
36058. stelios (stelakisss) 1 65.87 65.87 1 100.00
36059. Sai (saifiji) 1 79.63 79.63 1 100.00
36060. KUNTAL MONGAL (kunnu420) 1 44.10 44.10 0 0.00
36061. Kevin (chivasregal18) 1 74.72 74.72 1 100.00
36062. MrMilka (mrmilka) 1 38.37 38.37 0 0.00
36063. Harshit Kumar (harshitkumar__) 1 32.40 32.40 0 0.00
36064. Neil (duckguy) 1 64.00 64.00 0 0.00
36065. Slow Boys Club 🗿 (the_ch... 1 75.89 75.89 0 0.00
36066. Liberum (freeformedto) 1 79.97 79.97 0 0.00
36067. Sven (saytama) 1 62.97 62.97 0 0.00
36068. Zom (zom_db) 1 92.37 92.37 0 0.00
36069. dspr (dspr) 1 101.78 101.78 0 0.00
36070. Werhakon (werhakon) 1 105.87 105.87 0 0.00
36071. kalle (kallew34) 1 74.77 74.77 1 100.00
36072. Tyrone (onetjw) 1 76.27 76.27 0 0.00
36073. Stef (tappelpaart) 1 53.53 53.53 0 0.00
36074. Jacob (rexiedexy) 1 63.87 63.87 1 100.00
36075. Austin (risherak) 1 59.29 59.29 0 0.00
36076. Popo (ianneee) 1 30.56 30.56 0 0.00
36077. Bence (bcheese) 1 78.04 78.04 1 100.00
36078. grah (glossslynie) 1 53.31 53.31 0 0.00
36079. Errick (errick10) 1 63.18 63.18 1 100.00
36080. shu chi (pumpkinbear) 1 85.84 85.84 1 100.00
36081. Grape (imma_grape) 1 45.19 45.19 0 0.00
36082. drain (hentaifackerman) 1 32.72 32.72 1 100.00
36083. L (saucethe2nd) 1 30.97 30.97 0 0.00
36084. sadone (sadonefn) 1 30.74 30.74 0 0.00
36085. Paul_Walker (matthew68) 1 67.41 67.41 1 100.00
36086. Johnny (jly1202) 1 73.60 73.60 0 0.00
36087. Derick (cheapdubs) 1 65.98 65.98 0 0.00
36088. Jasmine (jaassmmiinne) 1 38.03 38.03 0 0.00
36089. kai (hnkks) 1 94.88 94.88 0 0.00
36090. heyitsjshere (heyitsjshere) 1 57.47 57.47 1 100.00
36091. Drew (drew_angell) 1 89.57 89.57 0 0.00
36092. Jay (urname9999) 1 84.38 84.38 0 0.00
36093. smash (smash1231) 1 45.04 45.04 0 0.00
36094. mroreoman (mroreoman) 1 92.43 92.43 1 100.00
36095. Jordan (aphrosu) 1 107.13 107.13 0 0.00
36096. Pheakthra (psoeun_562_kpop) 1 62.52 62.52 0 0.00
36097. Pingin (peegin) 1 86.88 86.88 0 0.00
36098. Patrick (iambadatthis00) 1 61.81 61.81 0 0.00
36099. N (gummyfrog) 1 123.72 123.72 1 100.00
36100. Suzune (sxzxne) 1 87.46 87.46 1 100.00
36101. Franklin (franklinchessstar) 1 57.63 57.63 1 100.00
36102. zombiepoep (zombiepoep) 1 84.25 84.25 1 100.00
36103. Ashley (kanashirei) 1 98.55 98.55 0 0.00
36104. TypingPanther (typingpanther) 1 36.98 36.98 0 0.00
36105. noob_boy15 (anikettyper) 1 43.36 43.36 1 100.00
36106. Jon (zshadowjon) 1 105.67 105.67 1 100.00
36107. joe (joemama2020) 1 97.54 97.54 0 0.00
36108. Hank (henhentyper) 1 59.94 59.94 1 100.00
36109. Colin (nilxoc) 1 74.83 74.83 1 100.00
36110. Ryan (rmarcus19) 1 34.03 34.03 0 0.00
36111. ambersands (mnurrreza) 1 56.50 56.50 0 0.00
36112. Carlo (canuling16) 1 85.13 85.13 1 100.00
36113. Austin (hamilogre) 1 102.88 102.88 0 0.00
36114. phis_her (rikhard111) 1 59.34 59.34 0 0.00
36115. :) (painfullyless) 1 71.91 71.91 0 0.00
36116. Bartłomiej (bartox856_2) 1 24.80 24.80 0 0.00
36117. Jack (jpw142) 1 96.86 96.86 1 100.00
36118. somericeasian (somericeasian) 1 63.46 63.46 1 100.00
36119. KitKat (kitkatattackk) 1 40.44 40.44 1 100.00
36120. Maco (macoooo) 1 95.48 95.48 0 0.00
36121. yung (yungparish) 1 74.35 74.35 1 100.00
36122. Neil (annualdegree99) 1 73.97 73.97 0 0.00
36123. Henry (hendogthebomb) 1 99.52 99.52 0 0.00
36124. Icikiwir Pemula (highfatmilk) 1 32.19 32.19 0 0.00
36125. Andre (gg0andre) 1 60.25 60.25 0 0.00
36126. Someone (infinity_a) 1 102.96 102.96 1 100.00
36127. Keshav (ksavdulal) 1 62.23 62.23 0 0.00
36128. dnbull (dnbull) 1 82.11 82.11 0 0.00
36129. Big Devil (shamsulalambony) 1 27.42 27.42 0 0.00
36130. Sleepi (sleepiqueen) 1 82.12 82.12 0 0.00
36131. wyapyro (theglowingpyro) 1 115.98 115.98 1 100.00
36132. Jazz (frostfire132) 1 54.68 54.68 0 0.00
36133. Tanvir (tanvir4784) 1 26.79 26.79 0 0.00
36134. Louie (louie691471) 1 67.09 67.09 0 0.00
36135. AweSam (awesam07) 1 77.04 77.04 0 0.00
36136. Soheil__.Dh (darkhyper) 1 42.40 42.40 0 0.00
36137. Jetblade (jetblade221) 1 73.97 73.97 0 0.00
36138. Ryan (qcoldwater) 1 43.33 43.33 0 0.00
36139. Frederick (pencilrex) 1 106.75 106.75 0 0.00
36140. Hive69 (hive69) 1 101.96 101.96 0 0.00
36141. art2 (artk2) 1 76.36 76.36 0 0.00
36142. Onyx (onyxstars) 1 77.38 77.38 0 0.00
36143. Petro (petrut) 1 43.74 43.74 0 0.00
36144. a (bye_man) 1 96.52 96.52 0 0.00
36145. Seojin (sjink) 1 53.16 53.16 0 0.00
36146. Neel (neell) 1 33.32 33.32 0 0.00
36147. XM06 (xm06) 1 105.51 105.51 1 100.00
36148. mojana (mojana) 1 35.21 35.21 0 0.00
36149. Ward (editicalu) 1 74.43 74.43 1 100.00
36150. Wayne (tetrisk) 1 105.42 105.42 0 0.00
36151. Fiel (syzygy_) 1 43.08 43.08 0 0.00
36152. LackOfHobbies (lackofhobbies) 1 88.18 88.18 1 100.00
36153. kacper (sznycel) 1 50.59 50.59 1 100.00
36154. sibi (sibivel) 1 73.48 73.48 0 0.00
36155. Hala (halab) 1 21.66 21.66 0 0.00
36156. mark (markd2) 1 72.82 72.82 0 0.00
36157. john (fwoochyt) 1 73.23 73.23 0 0.00
36158. shadow (jjjshadow) 1 40.67 40.67 0 0.00
36159. Marc (moomanmarc) 1 74.65 74.65 1 100.00
36160. amber (angeljr777) 1 26.66 26.66 0 0.00
36161. Me (kermitthefrog123) 1 41.02 41.02 0 0.00
36162. Raymond (handicast) 1 83.28 83.28 1 100.00
36163. Raymond (pumpalump) 1 49.93 49.93 0 0.00
36164. Slasher (slasher_2130) 1 31.38 31.38 0 0.00
36165. Jason (jasondnguyen) 1 96.95 96.95 0 0.00
36166. Rishabh (rish1) 1 69.18 69.18 0 0.00
36167. Emils (em1lzs) 1 28.62 28.62 0 0.00
36168. xplo1t (xplo1t) 1 63.29 63.29 0 0.00
36169. Tiger (tigere) 1 33.34 33.34 0 0.00
36170. Elliot (zaperino) 1 60.79 60.79 0 0.00
36171. Cecelia (okaeyyy) 1 69.92 69.92 0 0.00
36172. jrodbatv (jrodbatv) 1 74.61 74.61 0 0.00
36173. DoDo (gloritown) 1 67.36 67.36 1 100.00
36174. laskit (laskit) 1 56.45 56.45 0 0.00
36175. Monkeytypist (pauljs) 1 103.71 103.71 0 0.00
36176. R. Shreyas (witheryleorsh) 1 55.36 55.36 0 0.00
36177. Niko (peanutbudder) 1 66.77 66.77 0 0.00
36178. Shubham (thepunisherx69) 1 39.95 39.95 0 0.00
36179. Nathan (njllanes2317) 1 49.46 49.46 0 0.00
36180. Sanchit (tichnas) 1 70.27 70.27 0 0.00
36181. Aldian (aldiandf) 1 53.31 53.31 0 0.00
36182. Jacob (jacobroumanos) 1 96.27 96.27 1 100.00
36183. TheSlowTyper (theuselessper... 1 48.77 48.77 0 0.00
36184. George (hostilereality) 1 28.70 28.70 0 0.00
36185. nilatos (nilatos13) 1 45.43 45.43 0 0.00
36186. Oliver (breolfalot) 1 47.15 47.15 0 0.00
36187. Emerson (schmiller) 1 92.17 92.17 1 100.00
36188. Sparrowman (sparowman) 1 51.89 51.89 0 0.00
36189. Sizzukie (sizzukie) 1 102.29 102.29 0 0.00
36190. Fahad (fahadthebest1) 1 46.26 46.26 1 100.00
36191. Elliot Hong (seanyup) 1 75.89 75.89 0 0.00
36192. Mike (mikerouoeuou) 1 75.27 75.27 0 0.00
36193. Commander (superhans) 1 84.92 84.92 0 0.00
36194. Blue (whyamiblue) 1 56.06 56.06 0 0.00
36195. K (wolfgorl) 1 67.21 67.21 0 0.00
36196. Lucy (lucynuhaa) 1 58.82 58.82 1 100.00
36197. Johnny (johnnybravo121) 1 97.82 97.82 0 0.00
36198. Tho (thomemes4) 1 55.52 55.52 0 0.00
36199. Ian (ianlin0719) 1 76.53 76.53 0 0.00
36200. very slowly typing... (vani... 1 103.50 103.50 0 0.00
36201. Oskar (collinary) 1 83.93 83.93 0 0.00
36202. Mike (neumatikz) 1 97.60 97.60 1 100.00
36203. SAMurai (samuelpyj) 1 96.00 96.00 1 100.00
36204. Mohit (shrestha437) 1 29.69 29.69 0 0.00
36205. STS93 (sts_93) 1 61.70 61.70 0 0.00
36206. ninosimp (ninosimp) 1 75.01 75.01 1 100.00
36207. Colin (cstew26) 1 55.72 55.72 0 0.00
36208. Jim (jimbob313) 1 96.34 96.34 1 100.00
36209. Blarghh (blarghh) 1 62.01 62.01 0 0.00
36210. Usama (usamajatala) 1 63.89 63.89 0 0.00
36211. Mayank (mayankraj) 1 86.24 86.24 0 0.00
36212. Thinam (thinam_0) 1 40.28 40.28 0 0.00
36213. shaarad (shaaraddalvi) 1 72.02 72.02 0 0.00
36214. White (whitepudding) 1 78.51 78.51 0 0.00
36215. fast (type_maste7) 1 71.47 71.47 1 100.00
36216. Zack (zackoconnor) 1 84.56 84.56 1 100.00
36217. Xperks (xperks) 1 64.57 64.57 0 0.00
36218. Harry (workisgood) 1 88.61 88.61 0 0.00
36219. Ahmado (abdoshark) 1 28.42 28.42 0 0.00
36220. Chris (chrisbender) 1 83.30 83.30 0 0.00
36221. Jimmy (brazen938) 1 59.35 59.35 0 0.00
36222. Felipe (felip6) 1 73.61 73.61 0 0.00
36223. Mystery (fisehagebriel) 1 60.64 60.64 0 0.00
36224. Alfie (pastyluveer) 1 73.81 73.81 0 0.00
36225. Dennis (th1cket) 1 57.82 57.82 0 0.00
36226. Ivan (4aner) 1 68.86 68.86 0 0.00
36227. Vasyl (n4x20n4x) 1 47.91 47.91 0 0.00
36228. Mihovil (mikroskop) 1 65.10 65.10 0 0.00
36229. allen88787 (allen88787) 1 32.66 32.66 0 0.00
36230. William (williamormous) 1 60.30 60.30 1 100.00
36231. Khaled (khaledrezk) 1 59.54 59.54 0 0.00
36232. Thomas (serbian_mafioso) 1 79.29 79.29 0 0.00
36233. Sean (rhus_rhadicans) 1 46.77 46.77 0 0.00
36234. James (chihwks13) 1 42.54 42.54 0 0.00
36235. Flappy (flappy23) 1 128.00 128.00 1 100.00
36236. Xeli (xeliexia) 1 83.25 83.25 0 0.00
36237. em :) (ratkangaroo) 1 77.94 77.94 0 0.00
36238. Andrew (trash6854) 1 55.37 55.37 1 100.00
36239. killercrafto3 (killercrafto3) 1 95.01 95.01 1 100.00
36240. 16thofApril (althome) 1 59.56 59.56 0 0.00
36241. Greg (dildno) 1 67.70 67.70 1 100.00
36242. ZakiDaBest (zakidabest) 1 64.98 64.98 0 0.00
36243. Amber (ambrealla) 1 132.62 132.62 1 100.00
36244. Aditya (adirev) 1 88.22 88.22 0 0.00
36245. Isak (isakts) 1 64.55 64.55 0 0.00
36246. Ruju (karngu) 1 109.51 109.51 0 0.00
36247. Evan (sacrigrape) 1 95.18 95.18 0 0.00
36248. Pablo (pgzimm) 1 48.98 48.98 0 0.00
36249. :) (username387545) 1 65.32 65.32 0 0.00
36250. Don (hatt730) 1 65.20 65.20 0 0.00
36251. Cherry (cherryboikwai) 1 42.70 42.70 0 0.00
36252. SwordFishArvid (swordfishar... 1 75.74 75.74 0 0.00
36253. nareik (nareik) 1 60.31 60.31 0 0.00
36254. An (chrisdolmeth) 1 78.67 78.67 0 0.00
36255. Tom (tomission) 1 53.84 53.84 0 0.00
36256. Nathan (veroah) 1 53.41 53.41 1 100.00
36257. Tambovische (vavkav) 1 45.65 45.65 0 0.00
36258. Ruspah (ruspah) 1 48.48 48.48 0 0.00
36259. Joshua (joshyexe) 1 49.22 49.22 1 100.00
36260. PainlessKarma (painlesskarma) 1 62.89 62.89 0 0.00
36261. seraph (xseraph) 1 71.69 71.69 0 0.00
36262. bass (benna_san) 1 35.18 35.18 0 0.00
36263. Pepe (pedroporro) 1 47.01 47.01 0 0.00
36264. Ayatullah (ayata_asyrafi) 1 52.82 52.82 1 100.00
36265. Anneliese (anjennin) 1 67.75 67.75 1 100.00
36266. RabbitsFoot (rabbitsfoot) 1 77.03 77.03 0 0.00
36267. snackrunner (typer54235) 1 73.13 73.13 0 0.00
36268. Abdelrahman (crb1998) 1 58.40 58.40 0 0.00
36269. Zinc (zinczinc) 1 73.62 73.62 1 100.00
36270. Stanley (itsstannnn) 1 88.60 88.60 0 0.00
36271. tourist (tourist2369) 1 36.69 36.69 0 0.00
36272. Andrea (ahasselbach) 1 83.86 83.86 0 0.00
36273. Lotsoftypos (lotsoftypos) 1 72.23 72.23 0 0.00
36274. Elias (monkeybrain) 1 82.25 82.25 1 100.00
36275. aakk (thegreatkid) 1 84.27 84.27 0 0.00
36276. Nilang (nilang333) 1 45.99 45.99 0 0.00
36277. Lore (prinssi) 1 42.69 42.69 0 0.00
36278. Riley (cringeykidriley) 1 63.69 63.69 0 0.00
36279. Bruce (brucejamesmonge) 1 72.59 72.59 0 0.00
36280. kada (kadaa) 1 66.10 66.10 0 0.00
36281. goofyahhtypist (keyzeyy) 1 105.03 105.03 1 100.00
36282. JD (jdllim) 1 82.64 82.64 1 100.00
36283. HenryTheAce (henrytheace) 1 71.25 71.25 0 0.00
36284. Michael (tomanio92) 1 52.47 52.47 0 0.00
36285. Corey (cannolis_dad) 1 85.82 85.82 0 0.00
36286. Click Clack (onyxz28) 1 100.20 100.20 1 100.00
36287. lucas (mrredam) 1 59.70 59.70 0 0.00
36288. Joy (joyshi) 1 95.87 95.87 1 100.00
36289. aki (vampireweekend) 1 79.11 79.11 1 100.00
36290. crimolf (crimolf) 1 41.16 41.16 1 100.00
36291. Giovi88 (giovi88) 1 47.30 47.30 0 0.00
36292. Pupumates (pupumates) 1 55.32 55.32 1 100.00
36293. Tim (huaishuo) 1 59.59 59.59 0 0.00
36294. Electricity (brokenskyline) 1 44.30 44.30 0 0.00
36295. Dav (ahjins) 1 81.76 81.76 0 0.00
36296. Diego (coryfax) 1 57.03 57.03 0 0.00
36297. Jeff (thejeff365) 1 34.80 34.80 0 0.00
36298. real (real346) 1 47.58 47.58 0 0.00
36299. Aleey (aleyys) 1 48.07 48.07 0 0.00
36300. Ben (magic_typer12) 1 28.89 28.89 0 0.00
36301. BraveSoul2110 (braveboi2110) 1 57.17 57.17 0 0.00