November 2021

Sorted by most races

Rank Username Races Month Best Race Wins Win %
1. -MarkVS- (mark40511) 5,686 116.91 163.77 2,084 36.65
2. (vixt) 5,134 120.93 187.30 2,738 53.33
3. noobnoob (garblovian) 4,051 101.91 143.99 1,525 37.65
4. Cole (colemakingprocess) 3,919 67.00 110.43 896 22.86
5. 🐟🐟🐟🐟hn (deliber... 3,509 132.61 171.45 2,279 64.95
6. A strange kind of beautiful... 3,453 134.69 207.30 2,183 63.22
7. Stas (tracersm) 3,332 79.46 100.16 825 24.76
8. sykelolxd (sykelolxd) 3,192 123.32 170.24 1,918 60.09
9. MS (damanthc) 3,050 93.74 128.35 1,066 34.95
10. Shashank (kingshashank12) 3,036 90.82 147.10 1,061 34.95
11. Sam Aka 😏 (sam_at_40wpm) 3,000 72.86 109.73 802 26.73
12. Christiano (christiano_rona... 2,891 60.33 91.23 578 19.99
13. paperboy ditty (wordracer888) 2,864 140.45 191.79 1,968 68.72
14. makeout (wastingtimexd) 2,795 73.94 107.97 648 23.18
15. joel (jouel1234567) 2,666 70.17 101.92 618 23.18
16. skr_j (saikiranj) 2,650 79.27 116.22 778 29.36
17. (scraex) 2,633 113.80 191.09 2,076 78.85
18. tstats[tshafer3] (tshafer3) 2,586 118.39 149.72 1,481 57.27
19. WatchDominion.org (lithox2) 2,573 149.93 207.24 1,095 42.56
20. lavé (traben) 2,569 156.92 224.33 756 29.43
21. Ghost racing medalists suck... 2,550 84.93 117.14 733 28.75
22. Diego (divarela) 2,505 84.10 111.84 730 29.14
23. k (mc0sta) 2,283 86.99 116.13 704 30.84
24. fatih (webfox) 2,281 83.50 113.09 732 32.09
25. praks (praks01) 2,233 93.70 124.74 813 36.41
26. Ramsey (tackheads) 2,221 87.10 123.05 684 30.80
27. neno (nenobid428) 2,189 95.05 129.29 956 43.67
28. chom (chomchomchomchomchom) 2,172 113.50 170.78 1,083 49.86
29. (sura5) 2,161 116.32 176.11 1,252 57.94
30. Ben (koppix) 2,154 67.83 87.41 450 20.89
31. (dawittymidget) 2,139 130.27 165.29 1,310 61.24
32. Colin (geosyog) 2,117 107.14 150.55 987 46.62
33. rilee_h443 (rilee_h443) 2,109 101.80 152.48 900 42.67
34. ¯\_(ツ)_/¯ (glandock1) 2,095 104.68 140.81 941 44.92
35. David (davelish) 2,094 54.00 76.71 280 13.37
36. Md Ubaid (mdubaid_ulllah000) 2,082 60.78 99.99 478 22.96
37. Martin (martinwong) 2,049 93.73 121.93 756 36.90
38. Kinesis (kinesis_quake) 2,032 130.27 159.09 1,331 65.50
39. Ton (2001or2) 2,023 104.03 147.28 905 44.74
40. tebond (tebond) 2,014 112.03 158.67 1,054 52.33
41. oneguardsam (oneguardsam) 2,000 84.45 120.98 526 26.30
42. tstats[joshuarose] (joshuar... 1,982 96.17 137.15 730 36.83
43. Am1n (vividus) 1,973 97.01 121.10 791 40.09
44. Wise (wiseuser) 1,952 90.79 133.60 532 27.25
45. Reaching (breakingpoint1) 1,947 73.12 106.82 508 26.09
46. Global (global_typer69) 1,930 78.16 113.55 525 27.20
47. wrists parallel (cheffray) 1,929 131.77 177.70 1,257 65.16
48. Bleedy Basket! (ninjismo) 1,921 83.36 110.71 556 28.94
49. (jasimk) 1,889 99.54 170.13 740 39.17
50. Hemant (hemu_sakunde) 1,870 71.34 102.54 490 26.20
51. StraightUpLuck¯\_(ツ)_/¯... 1,866 103.02 144.83 813 43.57
52. (mononym_jisoo) 1,862 138.50 228.44 1,803 96.83
53. sdr4wkc48 (sdr4wkc48) 1,827 69.29 97.55 431 23.59
54. Mirkhad (cmirkhad) 1,825 86.21 129.22 659 36.11
55. (flaneur) 1,822 184.67 282.30 795 43.63
56. adsfjk (jbcabintoy14) 1,818 93.31 124.85 669 36.80
57. infinite (infinite_wotah) 1,802 64.92 93.98 374 20.75
58. Cowbell (morris_l) 1,763 120.55 188.85 995 56.44
59. meow (xrelative) 1,743 145.56 202.54 1,387 79.58
60. MUPH (muphine) 1,724 81.93 119.83 470 27.26
61. Adam (adamjason804) 1,719 105.40 151.08 744 43.28
62. swapneel (swapneel_das) 1,715 57.58 85.07 258 15.04
63. Stefan (fortress_king) 1,709 94.69 130.84 609 35.63
64. Julius (solenopsis) 1,705 103.83 131.54 730 42.82
65. unnamed (unnamedflower) 1,701 85.38 110.81 515 30.28
66. Naut38 (naut38) 1,697 77.24 105.51 354 20.86
67. stalkers (stalkers0418) 1,689 81.01 126.99 516 30.55
68. Dal (astronerd) 1,688 102.36 146.26 656 38.86
69. WheelieTron3000 (wheelietro... 1,686 83.66 109.68 502 29.77
70. Stupid (stupididiot9) 1,651 85.73 121.00 525 31.80
71. Des (desl) 1,638 75.76 114.00 458 27.96
72. Tom (tomme2009) 1,632 70.65 98.99 349 21.38
73. Grandpa (thedengue) 1,628 94.86 163.03 27 1.66
74. Sumit (smtchahal2) 1,628 149.44 193.79 1,348 82.80
75. King (kingthiccness) 1,626 86.84 116.41 508 31.24
76. Christos (__christos__) 1,623 70.08 94.26 410 25.26
77. Soufiane (shinigami25) 1,598 68.22 98.18 367 22.97
78. Rachel (rmsitar) 1,597 129.15 164.89 935 58.55
79. bayu (bayurespati) 1,574 66.98 100.21 355 22.55
80. Marco (ankush12) 1,568 61.93 102.47 315 20.09
81. nilb (nilb) 1,568 72.89 97.28 362 23.09
82. Angelic (angelic_devil) 1,549 108.59 146.70 791 51.07
83. (treje) 1,535 93.23 143.68 687 44.76
84. Amit (amit__123) 1,534 54.75 92.21 259 16.88
85. James Paul (ap1ng) 1,527 53.79 75.04 206 13.49
86. Ninaad (saklas_33) 1,519 61.24 112.88 308 20.28
87. Bill Tinn (tearsinrain) 1,518 112.56 164.30 782 51.52
88. harshil (monsta_001) 1,514 69.64 96.12 372 24.57
89. qwerty (qwerty235) 1,509 84.51 105.98 461 30.55
90. Ryan (potatoz10) 1,498 102.01 137.06 700 46.73
91. oussama (oussama2000) 1,495 45.19 62.04 141 9.43
92. Elkotte (elkotte) 1,495 110.31 143.76 775 51.84
93. asdf (blackbirdsigloo) 1,494 55.12 84.64 184 12.32
94. Suikyo (suikyo) 1,491 78.65 117.51 391 26.22
95. trick20 (trick2001) 1,490 81.17 116.17 386 25.91
96. griV (griv) 1,489 82.03 117.63 384 25.79
97. Davit (sonofar) 1,472 67.25 105.98 34 2.31
98. Gabriel (tacbacjack) 1,469 89.86 134.41 516 35.13
99. n o t h i n g (whyme__) 1,461 106.98 147.95 647 44.28
100. Tyler (exilereject) 1,458 83.76 125.50 405 27.78
101. Ja-kobe (jrutz26) 1,456 85.69 119.89 413 28.37
102. Charles (charlesduran27) 1,452 114.66 144.45 731 50.34
103. bryan (bryan2010) 1,452 42.61 71.87 116 7.99
104. JP (supertyperguy2020) 1,449 57.35 74.45 202 13.94
105. monners (monners) 1,449 76.80 100.38 468 32.30
106. La Familia (xquyen) 1,442 93.24 123.99 534 37.03
107. Cosmic (aji3) 1,440 101.46 151.88 596 41.39
108. Cepheus's 🌌 (parkevan27) 1,434 131.43 175.04 881 61.44
109. Josh (cobra04) 1,434 48.66 69.06 94 6.56
110. swapneel (swapneel1121) 1,431 50.29 77.76 151 10.55
111. (charlieog) 1,428 131.92 224.05 1,052 73.67
112. (ginoo75) 1,427 137.55 249.12 1,057 74.07
113. Ad (shmldb) 1,417 50.80 70.42 122 8.61
114. Sudhir (sudhir_123) 1,414 52.06 70.54 131 9.26
115. Clarence (ha_saahn) 1,412 106.82 152.80 660 46.74
116. Nyiela (ncs1020) 1,411 68.67 100.40 346 24.52
117. Anku (gurooatwork) 1,410 60.20 81.11 263 18.65
118. Chris (chrishewson) 1,402 133.17 169.84 988 70.47
119. Anh (_azh_) 1,402 81.87 124.74 410 29.24
120. Luis (luisaes) 1,397 69.35 96.68 315 22.55
121. enminnrawr (zxcvbnm2001) 1,394 71.18 101.07 344 24.68
122. $950 kevin rudd pay packet ... 1,394 191.68 251.98 1,346 96.56
123. Mor (morti_20) 1,394 74.72 107.73 331 23.74
124. Aditya (adityapatel103) 1,393 55.42 72.33 175 12.56
125. Sagi (sagi73) 1,383 87.11 125.20 440 31.81
126. Abdulrahman karkalar (safi3... 1,375 48.30 79.45 130 9.45
127. スレトロン (slethron) 1,371 104.52 132.69 607 44.27
128. Eli Ferdinand Edralin (elfe... 1,371 98.65 132.99 564 41.14
129. A (dicktucker) 1,371 104.41 137.52 621 45.30
130. Eukalyptusbonbon (vogel_adler) 1,364 110.42 138.48 668 48.97
131. Ivan_Eagle (ivan_julia) 1,351 67.68 93.42 347 25.68
132. Claudio (tato41) 1,350 68.60 93.65 296 21.93
133. Sharif (sharif4747) 1,350 82.64 129.37 421 31.19
134. Lee (derfmongrel) 1,350 70.30 99.77 289 21.41
135. তন্ময়_2 (better_t... 1,349 104.16 139.74 635 47.07
136. Kapa (kassyk) 1,347 50.77 71.76 131 9.73
137. HD (hdcodecj) 1,347 81.54 108.18 362 26.87
138. Plinkiplonk (plinkiplonk) 1,325 111.30 156.63 610 46.04
139. Ishit soni (isrhtu_114) 1,316 57.54 84.08 257 19.53
140. yesman (yesman9527) 1,314 84.89 141.81 412 31.35
141. Shahil Suresh (roylar_range... 1,309 67.44 100.45 287 21.93
142. Elias (el_typo_jr) 1,300 74.73 109.47 302 23.23
143. Lucas (st3ezy) 1,291 76.58 102.58 318 24.63
144. Lara (chuiicdhk) 1,289 80.40 120.64 413 32.04
145. dinqissa (dinqissa) 1,287 80.46 128.64 324 25.17
146. tivo (tivotavo) 1,287 96.96 147.87 518 40.25
147. Abhisek (_typing_) 1,284 88.10 113.56 411 32.01
148. auoaeu (aoeuhe) 1,283 81.04 106.58 358 27.90
149. Can (cazzed) 1,279 87.04 124.04 388 30.34
150. Gerben05 (gerbenklapwijk) 1,273 61.02 85.18 228 17.91
151. tbj77 (tbj77) 1,270 65.30 86.93 317 24.96
152. Chen Yik (xxmlgsniperxx) 1,264 110.17 148.36 595 47.07
153. Gon (frixgon) 1,260 75.61 98.65 316 25.08
154. Sylvie (eat_my_dust_batches) 1,259 83.90 118.84 387 30.74
155. tstats[yju98039] (yju98039) 1,258 90.54 141.59 452 35.93
156. Drews (drwsmnlpg) 1,253 85.11 113.22 373 29.77
157. Benjamin (tryingtouse10fing... 1,250 97.22 131.83 487 38.96
158. Manmit (manny_the_potato) 1,247 83.36 116.64 327 26.22
159. Ra (rayap1010) 1,246 79.45 106.83 346 27.77
160. s3rez (s3rez) 1,238 140.65 186.85 967 78.11
161. صبر (morocco01) 1,231 86.60 123.33 397 32.25
162. Abdulaziz (mubailesh) 1,220 88.87 116.71 400 32.79
163. David (davidpit) 1,219 49.89 73.21 180 14.77
164. Gustaf (gusco933) 1,214 90.69 132.95 382 31.47
165. Logan (theperson60) 1,206 117.30 151.69 612 50.75
166. KIARA (atherynbane) 1,202 83.52 123.90 357 29.70
167. Deshant (djtype2124) 1,199 60.78 93.83 248 20.68
168. Dark (dark_byte) 1,198 79.92 114.42 340 28.38
169. Manol (ari3s) 1,198 81.38 111.90 329 27.46
170. WILMER (handsometomato) 1,195 63.16 94.88 222 18.58
171. Nguyen (rainfall1611) 1,187 93.64 129.59 450 37.91
172. adsf (max_m7) 1,182 101.04 144.36 467 39.51
173. Jaska (jarlewski) 1,182 73.91 103.28 295 24.96
174. Alien (half_alien) 1,181 85.60 117.04 366 30.99
175. jacktheboy211 (jacktheboy211) 1,180 106.92 144.66 547 46.36
176. Ali (ali_pro) 1,180 55.80 80.05 154 13.05
177. Ramses (boinkey) 1,179 87.63 125.10 335 28.41
178. Henry (henry_21) 1,177 43.66 63.16 96 8.16
179. trendy (strongly_typed_trendy) 1,175 59.41 90.32 215 18.30
180. AKGD (akgd) 1,170 90.75 115.09 425 36.32
181. LockStock (lockstock) 1,170 99.69 129.66 442 37.78
182. Michael (kedalg) 1,170 63.59 86.26 222 18.97
183. 雲煙成雨 (1eonardo) 1,167 75.74 108.83 302 25.88
184. Dang Hai (haidanghoang178) 1,165 78.39 104.53 301 25.84
185. ankit (ankitthegreat) 1,160 86.44 109.88 361 31.12
186. Shukuphido (shukuphido) 1,154 66.68 83.29 259 22.44
187. fdsafdsa (szesz) 1,150 77.40 103.32 283 24.61
188. 👋youtu.be/AXNeUMDP3no (o... 1,144 95.65 143.28 482 42.13
189. Zohaib (atazoa) 1,144 59.20 93.35 222 19.41
190. chopst1cksss (chopst1cksss) 1,134 118.12 147.30 660 58.20
191. arijan (arijan_dh) 1,134 130.38 189.19 775 68.34
192. pythagoras (123pythagoras123) 1,134 86.27 119.93 309 27.25
193. Richard (dicklash) 1,131 99.33 128.73 438 38.73
194. SPEXINDER (forest7) 1,129 108.91 152.46 561 49.69
195. Wayne (samehadenough) 1,128 84.00 114.53 342 30.32
196. Typeracerer (typeracerer2020) 1,120 65.47 84.73 242 21.61
197. Colemak Lost (_champ_) 1,111 121.84 175.75 622 55.99
198. Maters (maters48) 1,109 62.86 86.95 210 18.94
199. kim (kim_1409) 1,109 125.54 185.81 706 63.66
200. HudYA (hudyusuf) 1,108 69.32 95.17 250 22.56
201. 0O00O0O0O0O0O0 (bunnystacker) 1,107 79.81 111.72 304 27.46
202. Joel (joel6677) 1,103 105.01 138.08 490 44.42
203. Ritik (beast2402) 1,099 56.56 79.71 155 14.10
204. Ivan (expl1icity) 1,098 83.66 107.49 301 27.41
205. i love typing!!! (hebibuki) 1,096 104.96 142.13 454 41.42
206. Shivam Kumar (sks123_) 1,096 64.42 97.44 234 21.35
207. Erdenebat (speed8019) 1,091 65.19 93.55 259 23.74
208. Korezu (nyanuwin) 1,090 69.67 97.66 223 20.46
209. lobus (lobus_rec) 1,089 97.05 128.26 420 38.57
210. Tinumír (tinumir) 1,086 100.38 125.01 481 44.29
211. zyyy (zyyyyyyyz) 1,077 64.75 94.65 251 23.31
212. Pasta (pastashapes) 1,075 148.50 269.30 757 70.42
213. Ji (urzz4eva) 1,074 113.17 157.52 544 50.65
214. Artem (gushinartem) 1,071 87.88 135.69 364 33.99
215. Sandro🇬🇪 (jolskey) 1,069 87.02 128.17 338 31.62
216. price (prince23) 1,063 56.99 86.44 175 16.46
217. fella (fellasaurus) 1,060 60.73 78.25 171 16.13
218. glerou (tudesci) 1,058 90.04 124.52 339 32.04
219. Daniel (smartdevilno) 1,058 76.60 99.37 250 23.63
220. subham (subhamrawat) 1,054 85.59 120.22 269 25.52
221. james (awesome4aces115) 1,053 80.17 133.39 275 26.12
222. tstats[brandonisstupid] (br... 1,048 89.91 126.27 355 33.87
223. Innocent (saquelain) 1,048 68.02 98.94 222 21.18
224. Type (granwizard) 1,046 85.91 117.41 376 35.95
225. lettel (lettel) 1,037 89.07 114.84 315 30.38
226. shuffled neurons (spicytuna1) 1,036 143.75 194.81 69 6.66
227. Ramzan Mubarak 2025 (imtiaz... 1,033 97.89 127.16 427 41.34
228. Jashe (freshfastjashe) 1,029 167.66 212.33 826 80.27
229. (peaceinchrist) 1,027 120.30 160.56 577 56.18
230. Tim (timlee) 1,024 36.20 51.76 54 5.27
231. Σπύρος (asos11) 1,020 62.26 91.38 198 19.41
232. Andrè (andrree) 1,020 77.62 109.45 251 24.61
233. Typerx (newtyperx) 1,016 95.23 131.95 370 36.42
234. Carmel (m_carmel) 1,008 111.38 147.10 489 48.51
235. 🎈k (konnomon) 1,000 92.43 115.84 357 35.70
236. new kb keychron v6 (jlam555... 1,000 126.53 170.26 631 63.10
237. Matthew (kylehyde) 997 86.67 116.61 279 27.98
238. jk5621 (jk5621) 995 59.99 82.95 188 18.89
239. it rains it pours (despot) 993 154.99 222.45 755 76.03
240. shadmehr (megacrocodile) 990 71.64 101.76 221 22.32
241. Finley (blindfish) 988 77.81 112.40 233 23.58
242. hadi (hadisulfe) 988 47.30 70.68 101 10.22
243. Adarsh M A (adarshm39) 986 51.33 67.55 130 13.18
244. Orka (orka) 979 60.58 78.98 186 19.00
245. Ovidiu (ofydd) 979 111.49 136.99 469 47.91
246. Tommy (dextonjl) 978 114.92 160.00 489 50.00
247. Adrian (adrianvn789) 975 97.47 132.01 423 43.38
248. Huy (cross546) 973 55.19 74.45 116 11.92
249. (´・ω・`) (gahama) 973 126.57 172.14 643 66.08
250. Slow (giorgiv4) 972 95.50 135.17 390 40.12
251. juswawawa (juswawawawawa) 970 93.05 133.28 368 37.94
252. 💀💀💀 (gospell) 970 113.82 162.29 486 50.10
253. Om (omkashyap007) 965 58.70 85.07 170 17.62
254. Cloud (cloud_bolssom) 965 77.12 115.77 235 24.35
255. jaso (jasocanfly) 957 89.54 133.61 316 33.02
256. AJ (aayushjoshi) 957 57.46 86.20 187 19.54
257. φσ (phi_sigma) 956 62.29 81.65 191 19.98
258. Md Shamim (cseshamim47) 950 62.53 85.62 182 19.16
259. neeraj (neeraj902) 949 73.92 100.09 248 26.13
260. 144p 1998 VW Beetle (stryke... 945 111.69 156.19 467 49.42
261. (◍•ᴗ•◍) (ibi4645) 944 67.88 111.04 561 59.43
262. Birdman (birdman13) 944 79.60 104.40 314 33.26
263. TypingMaster3 (typingmaster... 938 100.68 136.27 384 40.94
264. Xi Jinping (wuhan_virus) 933 69.94 98.12 217 23.26
265. Amarjot (apandher) 933 113.77 155.82 465 49.84
266. Type like never before! (re... 932 101.36 143.82 393 42.17
267. Nyamsick Adrian (minyamisu) 932 55.12 84.26 134 14.38
268. lhdrive (kickmic) 931 63.09 85.92 189 20.30
269. Prithbiraj (prithy) 930 62.93 90.33 239 25.70
270. mamoud (__mahmoud__) 930 47.49 66.46 83 8.92
271. Paolo (invelt) 929 109.46 139.53 484 52.10
272. mohammad (the_slow_typer_14... 929 46.92 66.02 88 9.47
273. Edward (kailhreds) 924 84.99 109.75 269 29.11
274. mohan (mohan2002) 924 73.99 99.58 240 25.97
275. Mazhar Andalib (mazharandalib) 923 79.75 117.58 284 30.77
276. Ara Ara (vinhwiu) 922 74.21 106.60 239 25.92
277. Jason (jasonjohnsj27) 922 95.03 141.27 378 41.00
278. Michael (michaelch) 921 97.05 136.99 366 39.74
279. cheikh (cheikhbr) 921 59.28 84.57 158 17.16
280. Yash (yashshingade28) 921 87.40 116.14 341 37.02
281. Saucter (saucter) 920 88.03 118.87 296 32.17
282. kekw (kekwomegalul) 920 132.07 173.98 638 69.35
283. L (easymoneysniper1) 920 131.31 184.00 556 60.43
284. FoTGbigGhost (fotg_reckless) 916 103.31 130.51 388 42.36
285. jun (jun0sck) 914 79.68 112.41 228 24.95
286. onii-chan (cinnamonorange) 911 76.18 110.02 234 25.69
287. BBB (beermindnor) 910 70.49 96.06 221 24.29
288. monochrome (artemis_05) 910 101.32 132.00 361 39.67
289. sməxy (smexyflako) 910 102.52 136.70 361 39.67
290. Kevin (zhengfeilong) 908 127.07 167.55 539 59.36
291. Ricky (suthxx) 907 36.56 56.72 72 7.94
292. Anthony (goldfrog) 906 55.56 88.54 116 12.80
293. Jacobo (inztincz) 905 75.82 117.56 224 24.75
294. mrgiorgoulis (mrgiorgoulis) 904 80.97 123.10 248 27.43
295. J-Money (jacobbeaudway) 902 78.42 108.96 239 26.50
296. Lactophenol Cotton Boy (tpy... 901 103.18 140.58 389 43.17
297. Brendan (brendalandan) 900 85.95 115.72 218 24.22
298. Ez (ezpass) 897 78.48 112.82 292 32.55
299. abdullah (abdullah_ui) 897 108.58 149.91 461 51.39
300. Nick (1truelipstick) 895 111.78 161.78 436 48.72
301. The cute girl likes pink (o... 895 117.96 152.37 506 56.54
302. Leo (leotwelve) 891 79.84 101.29 223 25.03
303. (yeekidd) 889 95.81 146.01 339 38.13
304. Ankit Kumar (ankitnain) 889 87.38 119.81 612 68.84
305. account deleted (concurrent) 889 100.10 137.17 21 2.36
306. keiwpie (keikuuuu) 887 93.19 124.21 350 39.46
307. sdfg (nerus_k) 886 39.68 58.49 76 8.58
308. jello_jello (jello_jello) 885 109.20 137.06 454 51.30
309. Zak (villzzz420) 885 50.43 76.75 109 12.32
310. Abu (abu_hussain_03) 885 76.87 100.68 231 26.10
311. matan (malsonic) 883 77.87 127.21 240 27.18
312. Sayandip (sayandip199309) 883 76.60 99.45 232 26.27
313. sudheer singh (justsudheer) 882 65.50 91.00 211 23.92
314. Calvin Low (benderium_123) 881 79.94 100.19 244 27.70
315. Adarsh (krishnan7) 879 60.06 81.55 147 16.72
316. Oliver (rgroli) 878 60.84 81.20 147 16.74
317. Ravi (ravishankarr) 877 47.67 69.41 96 10.95
318. omar (omar_elsayed) 876 56.95 84.40 125 14.27
319. Carlos (carloszapata) 874 63.97 90.14 207 23.68
320. FREE PALESTINE (mohameddd) 873 49.99 71.46 95 10.88
321. (khronic) 873 119.40 154.56 522 59.79
322. Dan (cantdecidedan) 872 65.01 96.90 230 26.38
323. Vashista (vashista) 870 70.69 98.13 208 23.91
324. Densetsu (densetsunobattousai) 869 74.44 98.91 266 30.61
325. SimplyOrange (simplyorange) 867 92.85 122.47 302 34.83
326. Petar (petar17) 866 62.06 82.20 163 18.82
327. heartbeats (jack777) 864 105.91 145.75 366 42.36
328. farzan (farzanhges) 862 93.52 131.23 378 43.85
329. Thinh (thinhtr) 861 78.53 103.84 261 30.31
330. (rayer) 856 117.09 168.57 459 53.62
331. Keira (keiradawn) 856 93.41 119.94 323 37.73
332. John (happyguy2000) 855 52.12 66.38 69 8.07
333. philiplol (philiplollll) 855 65.52 91.07 164 19.18
334. Jonathon (goodstuff11) 852 101.79 148.11 347 40.73
335. dotdotdot (atuladhar1) 848 67.34 97.85 188 22.17
336. Fauggesim (fauggesim) 845 40.25 56.57 60 7.10
337. Ivan (ivannechaiev) 845 82.12 106.77 230 27.22
338. (paceyq) 845 132.77 172.58 547 64.73
339. Nightmare (zhanarbek) 844 69.06 96.29 197 23.34
340. Ahnaf (stallion1145) 844 73.97 102.60 198 23.46
341. Rishav (rishavmngo) 841 76.82 105.41 211 25.09
342. Lil Mama (ckennedy07) 839 87.95 109.80 232 27.65
343. Big k (lawda) 839 59.82 91.62 168 20.02
344. Vanshraj (vrsempire601) 837 73.13 102.11 208 24.85
345. Almaz (almazzz1) 835 64.05 91.42 225 26.95
346. Winnie (win_) 834 84.55 104.38 228 27.34
347. mahmoud shalhoub (mahmoud77) 833 35.97 52.55 83 9.96
348. Snail (kelvin_paul) 833 98.50 122.83 306 36.73
349. Cameron (sigmaimu) 832 99.40 134.70 284 34.13
350. Free Palestine 🩸🫸 (mo... 832 100.64 141.61 304 36.54
351. Sewnkin (sewnkin23gg) 827 91.43 122.05 296 35.79
352. Kerb (kerby_berby) 827 124.71 175.80 468 56.59
353. Omni (omzi) 826 72.99 116.05 214 25.91
354. Mishel (holosight) 824 76.27 113.70 190 23.06
355. Akash (swfu_akash) 821 75.47 106.67 221 26.92
356. Chrism4 (chrisman44) 818 59.72 86.15 147 17.97
357. Miccalo (miccalo_dv) 817 48.99 92.52 98 12.00
358. QwertyBaguette (smellybague... 817 98.07 121.63 330 40.39
359. Brenden (embracesc2) 812 65.34 96.19 186 22.91
360. Lara (goddess_111) 811 94.29 147.81 294 36.25
361. sugdese (sugdese) 809 69.18 97.58 179 22.13
362. big daddy (shivdatt_op) 809 64.68 98.52 170 21.01
363. Nabeel (nabeelz) 809 76.24 99.79 205 25.34
364. Josh (the_josh) 805 95.36 128.79 317 39.38
365. travdong (travdong) 800 80.52 107.92 197 24.63
366. Max (maxijazz) 799 98.93 132.55 361 45.18
367. rinas (dont_look_at_keyboard) 797 30.86 43.85 74 9.28
368. Trung (danghoangtrung) 797 54.90 82.09 95 11.92
369. Blue (terry25031069) 796 82.20 105.56 210 26.38
370. Saulius (zemfry) 793 91.84 115.31 256 32.28
371. Youssef (sec5x) 793 99.26 125.01 317 39.97
372. subham (syt03) 792 45.64 64.98 99 12.50
373. Devin (devcappy) 792 97.60 146.50 297 37.50
374. David (tintedrange) 790 79.62 110.32 216 27.34
375. Alenygam (provola23) 789 115.48 154.43 425 53.87
376. skippi (skippie) 788 130.53 175.06 490 62.18
377. sharaf (sharaf_makk) 788 62.40 80.90 137 17.39
378. Dhruv (codenta) 788 45.74 66.54 72 9.14
379. Workman (dagl200) 786 87.13 115.06 245 31.17
380. Daniel (kool_beenz) 786 66.57 95.05 158 20.10
381. अध्ययन Adhyan (... 786 50.28 74.54 95 12.09
382. John Anthony (therewere3) 785 61.48 80.92 155 19.75
383. Ramsudhan (sudhanlee) 784 58.22 75.26 115 14.67
384. An (iaman) 783 93.27 118.91 282 36.02
385. John Paul (jp_ramolete16) 782 48.21 65.69 84 10.74
386. mimi (xvni) 777 67.81 86.75 157 20.21
387. Jarod (terminuszwei) 776 102.32 149.66 323 41.62
388. NiteCyperTTV (nitecyper2) 774 137.90 180.98 555 71.71
389. ARK (qwerty account) (arkfr... 773 81.34 105.10 196 25.36
390. Andrea (andreavanderjagt) 772 91.17 128.19 250 32.38
391. ros (heyokay1234) 772 70.49 102.02 188 24.35
392. AxiomDestroyer (axiomdestro... 772 108.78 135.73 368 47.67
393. ASIAN47 (asian47) 771 90.82 131.77 284 36.84
394. uty (tisurend) 771 101.63 145.17 315 40.86
395. danniponcho (dponchos) 770 95.09 128.65 276 35.84
396. Anant (hero_shukla) 770 96.30 128.56 303 39.35
397. nauyu (nauyusimi_) 770 108.83 133.43 351 45.58
398. Filip (hummelur) 769 74.23 98.25 205 26.66
399. Gagan (gagan18) 768 90.01 132.29 269 35.03
400. liz (hamid__) 767 109.18 136.27 373 48.63
401. Tejas (crimcrim) 767 74.42 104.26 196 25.55
402. Tewtadle (tewtadledesktop) 767 91.33 123.96 263 34.29
403. SLSL (slslz) 767 74.07 116.03 185 24.12
404. ghost (theghostbehindyou) 764 56.69 83.86 111 14.53
405. tstats[barockt] (barockt) 763 95.32 119.99 279 36.57
406. (joshua728) 762 221.42 310.07 728 95.54
407. InCredH (harsh_hegishte) 762 83.08 132.63 231 30.31
408. Ayvan (dharmablade) 761 86.68 118.34 231 30.35
409. wakeupvarn (varnontyperacer) 760 101.57 133.09 302 39.74
410. Anguu (anguubeef) 760 99.23 125.22 301 39.61
411. peeush (piefkr) 760 38.67 63.72 49 6.45
412. Ahmad (ahmadmozaffar) 759 73.50 114.70 185 24.37
413. Amar (supatypaxxx) 758 89.96 123.90 273 36.02
414. Turi (haditoori) 758 78.43 109.56 235 31.00
415. Dana (danayi) 758 126.37 173.49 491 64.78
416. tstats[parth812] (parth812) 758 55.37 79.60 100 13.19
417. C (ccc123) 757 94.81 123.16 263 34.74
418. LastSlice (cezara) 756 60.19 84.84 118 15.61
419. what (hellisgood) 756 62.32 81.88 166 21.96
420. 🌹 Black Rose 🌹 (rosew... 755 149.54 184.99 600 79.47
421. Samuel (sambabzz) 754 46.34 68.51 65 8.62
422. yuupoipoi (mimicclone) 754 68.39 89.95 175 23.21
423. piconeeks (piconeeks) 752 98.76 133.71 285 37.90
424. flyaway (saltybaby) 751 69.54 102.10 294 39.15
425. run thru the finish line (p... 750 137.21 170.19 515 68.67
426. PicturingFrames (frame_abil... 750 87.51 135.92 235 31.33
427. Callum (cal_a_mari) 750 53.61 72.43 87 11.60
428. goraput (boom1749) 747 74.22 110.13 187 25.03
429. Feynex (imhidayat) 747 103.16 145.43 300 40.16
430. t̶̢̤͇̪̱̮̿̓̓̕͜ͅ... 746 95.57 132.42 273 36.60
431. arena (arenacloser204) 745 90.66 136.63 219 29.40
432. Ivan (ivantakashi) 745 90.11 138.20 243 32.62
433. Laith (chaoscontrol_jr) 744 63.69 87.44 210 28.23
434. bub (bubmaley) 742 106.29 138.33 333 44.88
435. Mr.Pemguimn (nhatltm) 741 78.10 132.09 250 33.74
436. Felix (promeneraren) 740 113.42 162.61 337 45.54
437. nonquitvinpho (nonquitrainb... 740 115.53 164.74 324 43.78
438. john (nothisisjohn) 738 170.54 205.37 687 93.09
439. Mohammad (mhmmdkholani) 738 38.66 59.58 58 7.86
440. Tang (tangvt97) 736 63.99 83.23 145 19.70
441. Rika (infric) 735 132.11 161.68 36 4.90
442. Ryan (rjbunge99) 734 81.59 105.25 190 25.89
443. Baked and Buttered (mcallen... 730 114.48 167.97 338 46.30
444. Milka (mille993) 728 50.73 67.13 66 9.07
445. anurag tara (fastest_racer) 728 52.00 74.95 85 11.68
446. Aggy (tuigovno) 728 78.78 111.19 226 31.04
447. Idris (kakashirero) 727 77.51 114.03 233 32.05
448. ⠈⠁ᵀ ᴱ ᴵ ᴸ ᴼ... 724 117.63 154.07 364 50.28
449. uzi (cray_f) 724 72.48 98.88 172 23.76
450. derusting (paradoxpigeon) 722 154.93 195.52 652 90.30
451. Aelyos learns to type (aely... 721 50.85 71.29 82 11.37
452. Tiddy (tiddytwister) 721 94.75 128.19 250 34.67
453. Tobbe (tobbedman) 720 80.30 107.01 190 26.39
454. Qwerty (qwerty80801) 720 96.16 126.22 265 36.81
455. (naturaladoption) 719 95.67 156.42 234 32.55
456. Chaddley (chadracer69) 719 94.43 129.14 240 33.38
457. Said (saidenhide) 717 91.69 129.01 260 36.26
458. szymi_gold (szymi_gold) 715 66.80 90.85 156 21.82
459. RIP BYRON (sk8terboi723) 715 145.43 187.97 540 75.52
460. ឡានប្រណាំ... 714 64.41 95.30 162 22.69
461. Luis (chapibol) 714 74.04 95.14 152 21.29
462. Ali (imtew_much) 713 81.33 106.21 192 26.93
463. Ravi (ravimajhi) 712 49.25 70.10 83 11.66
464. JCRueco (shizile) 710 83.94 113.44 223 31.41
465. LB (man_onatree) 708 104.07 139.93 324 45.76
466. Ornstein (eliggett) 708 90.16 115.10 241 34.04
467. stop! (ademke) 708 119.21 164.85 387 54.66
468. Vroom! (laptopguy) 706 96.32 137.48 271 38.39
469. Derek (derekkeiley) 706 72.92 92.32 151 21.39
470. asdfjkl; (deskripper) 704 146.26 201.84 536 76.14
471. Upmanyu (abhishek2175) 704 78.85 100.51 191 27.13
472. sir (zenzir) 704 86.80 119.30 222 31.53
473. waterismagnificent (wateris... 704 100.91 136.98 299 42.47
474. Anupam (plaanupam) 703 80.92 103.09 201 28.59
475. Nibblet (nibbletdaking) 700 57.57 79.28 83 11.86
476. Jackalope (jackalopy) 699 107.29 131.11 329 47.07
477. tstats[inbredturtle] (inbre... 699 94.94 130.63 252 36.05
478. Zhuldyzay (zhuz12) 698 64.45 90.58 156 22.35
479. Nika (tinysalmon90) 698 103.46 130.39 299 42.84
480. Billy (oatmeal417) 698 102.34 131.49 319 45.70
481. Gatsu (ace27) 696 52.58 71.68 76 10.92
482. Noah (nodigermanium) 694 89.25 118.09 207 29.83
483. JollyImpulse (jollyimpulse) 694 107.61 140.92 303 43.66
484. Lane (laneondvorak) 691 85.70 130.96 193 27.93
485. Slethron (fastslethron) 689 102.44 133.57 295 42.82
486. camelCase (saisrikantta2) 688 65.12 85.31 137 19.91
487. Vignesh (viggie) 688 77.11 100.75 191 27.76
488. Steve (stev_cubed) 688 151.84 189.63 595 86.48
489. phlofy (phlofy) 687 135.66 183.84 479 69.72
490. GiftedOtter (giftedotter) 686 106.35 144.88 298 43.44
491. David (dcohen91) 685 98.35 142.14 275 40.15
492. daksh (daksh_2106) 683 65.57 85.69 148 21.67
493. Andy (andy3j) 683 64.79 83.31 161 23.57
494. Max (tehbomb123) 681 79.94 109.36 142 20.85
495. Guddu Jaisawal (suraj_6732786) 680 47.07 70.92 65 9.56
496. Rauhan (rauhan1998) 680 64.80 92.59 160 23.53
497. Manish (mkn0079) 680 54.53 80.27 103 15.15
498. OneRandom (one_random_typer) 679 78.59 100.25 166 24.45
499. LeBaby (funnypoopyeater) 679 99.14 133.88 268 39.47
500. Juan Martín (juanma2700) 675 95.47 117.95 226 33.48
501. raghu (r_strike9437) 674 68.84 90.94 168 24.93
502. E (weihceinre) 670 150.57 202.92 558 83.28
503. Vasanth Raja (vasanthraja) 668 93.67 121.98 214 32.04
504. Gaussian (ndrous20) 668 80.36 105.39 154 23.05
505. Jay (dicknm) 667 65.58 87.64 143 21.44
506. EconEdgeLinch (linch8) 667 84.69 109.53 192 28.79
507. Aaron (liron2007) 666 38.68 58.60 53 7.96
508. Mohammed (modh_) 666 54.88 72.02 56 8.41
509. Grzesiu (grzesiubonzo) 665 73.49 102.26 151 22.71
510. mohit (madara989) 664 48.97 70.39 68 10.24
511. Kok Kun (kokkun92) 664 82.12 117.99 188 28.31
512. ayorgo (ayorgo) 664 72.32 90.79 168 25.30
513. Gabe (dyrozang) 662 115.18 158.61 335 50.60
514. J (ckfhd1234) 660 63.17 77.12 133 20.15
515. 🔰Rayster (rayster1) 660 85.51 117.06 197 29.85
516. Gerard (gerard_m_m) 659 70.57 100.46 185 28.07
517. name (anson001) 659 111.15 152.57 289 43.85
518. DrLawL (drlawc2) 658 150.74 191.10 553 84.04
519. aaaaaa (hagemanto) 658 83.20 107.44 173 26.29
520. Siri (sireon) 657 62.62 83.37 127 19.33
521. Nicholas (nicholaswong03) 657 91.45 148.10 236 35.92
522. Shaurya (shaurya2399) 656 106.67 131.36 365 55.64
523. katapi (catapie) 653 98.46 125.37 249 38.13
524. Apollo (ahollo) 651 76.86 101.33 170 26.11
525. varun (vakot) 651 55.34 74.36 98 15.05
526. Prasant (man_iac) 650 96.90 124.60 266 40.92
527. ben (benwang1) 649 80.26 108.54 175 26.96
528. tstats[medo_1010] (medo_1010) 648 79.98 116.37 171 26.39
529. tstats[siriusvega] (siriusv... 648 133.15 168.96 452 69.75
530. 👶 (a_baby) 646 128.20 159.59 417 64.55
531. jazk (axaladyx) 646 100.08 134.50 259 40.09
532. Ayan (ayan_007) 645 60.94 78.25 128 19.84
533. fratelecarol (fratelecarol) 643 76.75 110.95 185 28.77
534. Tiago (doodoo11) 643 82.06 111.89 169 26.28
535. Gerardo (sewingbunion9) 643 57.70 82.69 100 15.55
536. Karl (relentlesstyper) 643 96.16 124.88 238 37.01
537. PMC (pmcc) 642 75.78 105.79 144 22.43
538. itsmin (itsminbin) 642 83.95 112.02 182 28.35
539. Indeed (indeed001) 642 64.12 90.83 148 23.05
540. Tyler (tjking12) 641 88.55 121.87 208 32.45
541. Kevin (kevincamilo) 640 76.58 100.17 130 20.31
542. hyp (hyprix) 640 92.05 136.22 193 30.16
543. Santiago (drebexler) 640 97.79 137.88 229 35.78
544. atef (atef_7534) 640 67.10 111.47 160 25.00
545. Dvorak (blazeencryption) 639 106.89 151.58 259 40.53
546. Marvuw (hotdog1234444) 639 72.65 99.79 145 22.69
547. starry nights (iamsatanic) 638 77.58 122.36 152 23.82
548. Ryan (direwolf05) 637 103.27 131.52 227 35.64
549. Pranav (pgracer25) 636 48.06 81.39 59 9.28
550. Theo (theodosis_aga) 635 93.37 134.14 198 31.18
551. Nicolas (typekaiser) 632 70.85 101.49 165 26.11
552. Taylor (taylor_1121) 632 81.90 114.09 193 30.54
553. corrode (nothanksgiving) 632 119.05 168.51 314 49.68
554. Kabir (kabir_1234) 632 54.57 75.30 88 13.92
555. dva main (thedragonemperor) 631 149.76 209.71 486 77.02
556. a (3lim64) 627 98.54 128.37 221 35.25
557. amanullah (amanullah32) 626 85.02 115.39 208 33.23
558. Nico (monnerford) 626 69.68 85.70 138 22.04
559. MrButtersworth (flapjackstax) 626 114.33 137.22 300 47.92
560. Shivam (exergo) 626 74.18 97.88 164 26.20
561. China (dvorak_king) 625 95.70 146.30 230 36.80
562. Nobody (anhddo) 625 77.83 102.38 159 25.44
563. Habib (habibmalik) 624 83.65 111.09 189 30.29
564. Serg (drgsus) 623 115.54 156.18 305 48.96
565. Pragyan (satisfiedmagma) 623 52.44 74.96 91 14.61
566. Mrinal Anand (mrinal_anand) 623 46.93 63.65 61 9.79
567. timefaker (timeassassin) 622 79.19 109.16 151 24.28
568. Lagom (thelagom) 622 91.19 149.10 208 33.44
569. Ryo (ashida4) 621 99.72 132.69 246 39.61
570. Arash (me_races) 620 50.32 81.54 88 14.19
571. George (stamoulohta) 619 67.48 86.52 148 23.91
572. Andre (andr_ehh) 619 74.82 106.51 161 26.01
573. anty (antyboi) 618 110.17 149.30 285 46.12
574. (floofyaltaria) 618 129.92 169.97 390 63.11
575. floof (flooffy) 617 95.48 127.40 211 34.20
576. Aryav (aryav123) 617 78.67 116.81 184 29.82
577. Raja (mmahmoodh) 617 82.13 105.68 184 29.82
578. Shahbaz (thisisshahbazsb) 616 64.61 80.03 133 21.59
579. abhishek (abhi1912) 616 46.36 68.63 134 21.75
580. Don't bully me plz (dontbul... 615 77.58 114.62 165 26.83
581. Vivek (kill3rking) 615 69.64 91.84 150 24.39
582. Swifty2997 (swifty2997) 615 60.25 76.13 100 16.26
583. Moronic Typer (yong955143) 614 103.04 127.30 278 45.28
584. Charly (swagzzzzz) 613 78.06 121.71 140 22.84
585. mainto (manito7) 613 58.39 80.44 106 17.29
586. Julish (julish13) 613 45.08 59.66 58 9.46
587. kunal (kunalmachra) 612 84.49 113.10 181 29.58
588. Zi Hao (im_getting_there) 612 77.29 111.29 165 26.96
589. Nguyen (nanoforge) 612 66.29 86.18 128 20.92
590. Neodymium (neodytrium) 611 106.81 143.76 269 44.03
591. 🚀 🚀 🚀 (patrickhirsh) 610 76.25 107.91 117 19.18
592. F (lawlnoodle) 610 95.50 123.72 220 36.07
593. 初めは40wmp (hajime40) 610 92.39 118.60 212 34.75
594. Mike (mikety1) 609 49.63 66.84 47 7.72
595. Tien (thetientran) 608 114.70 181.20 331 54.44
596. hafizh (effortlesshuman) 608 47.85 70.07 51 8.39
597. Koupka (koupka) 607 76.96 108.13 168 27.68
598. rishh_ (imrishitpant) 606 65.51 113.82 148 24.42
599. Supporting Israel (zombiesw... 606 176.20 256.87 436 71.95
600. maltinyu (maltinyu) 605 64.40 94.88 136 22.48
601. Started from 3wpm (the_op_p... 603 36.89 60.08 48 7.96
602. Hassan (hamoro) 602 80.18 105.89 135 22.43
603. (e6f4e37l) 602 158.13 213.08 533 88.54
604. Helloween (tranduclocbkmail1) 601 66.77 83.92 146 24.29
605. Electronica__ (electronica__) 600 99.73 126.40 263 43.83
606. Naman (naman1601) 600 86.48 133.22 295 49.17
607. P (kwerta) 600 81.10 105.65 164 27.33
608. wil (wilruns) 599 120.92 159.14 339 56.59
609. Joe (joetelefair) 598 89.91 116.42 227 37.96
610. hilpitome (hilpitome) 598 40.75 61.77 57 9.53
611. i_type_fast_with_good_postu... 597 73.35 112.75 169 28.31
612. Dev (devgupta55) 595 70.99 94.07 134 22.52
613. Harshith (ghvsama_123) 594 55.84 77.48 103 17.34
614. Xander (xandejesus) 594 107.86 133.61 264 44.44
615. Markycuh420 (theitfactor) 594 93.22 127.83 210 35.35
616. ginginggaang (cremleme) 593 86.30 120.33 181 30.52
617. Saiyn (saiynssgssyr) 592 79.11 107.93 141 23.82
618. Lex (pyxelwolf) 592 86.22 110.97 175 29.56
619. shui (sammi76) 591 86.91 115.49 193 32.66
620. Springfield (springfield1903) 591 62.77 87.37 151 25.55
621. Jwickblack (hellwood) 591 83.86 114.22 185 31.30
622. hi (ihssm) 589 51.93 72.18 62 10.53
623. Franco (rubikute) 589 76.52 102.05 143 24.28
624. rocket (mythicalrocket) 589 178.50 222.91 516 87.61
625. Lemonade on Meth (riqlemonade) 588 81.07 116.90 170 28.91
626. CJ (bighiest) 587 99.93 139.10 266 45.32
627. Choco (choco22) 586 101.03 159.91 241 41.13
628. typeyMcTypeFace (mslib9) 586 98.65 129.78 248 42.32
629. (majernja) 585 72.96 97.57 128 21.88
630. Vincent (filtertype) 585 83.90 114.07 188 32.14
631. Nick (coyote96) 585 97.32 119.00 237 40.51
632. Juliet 3 (buckles7809) 585 78.61 104.99 158 27.01
633. Sam (imeowyou) 583 81.97 112.16 183 31.39
634. Beige (beigedaddy) 582 101.76 143.24 270 46.39
635. Fexo (fexer) 581 94.49 124.33 189 32.53
636. Chris (rykthos) 581 81.68 109.52 158 27.19
637. taylor (pastford) 581 56.57 78.50 80 13.77
638. Crooked (crookediyoung) 580 32.90 54.03 70 12.07
639. Guest (train9013c) 580 78.51 103.44 134 23.10
640. Knight_Oikos (knight_oikos) 580 128.17 166.09 320 55.17
641. Ben (bk100) 579 80.80 116.21 173 29.88
642. DF (df__) 578 73.34 102.26 174 30.10
643. Sam (maedrescher) 578 65.41 85.71 116 20.07
644. Mohamed (medsebri) 578 78.62 113.89 155 26.82
645. Vu (kroken_keyboard) 577 65.79 90.61 127 22.01
646. Abhay (abhay_hadez) 577 91.57 124.55 227 39.34
647. Chris (immortaljason) 575 25.29 41.41 110 19.13
648. Nozune (nostar) 574 126.46 178.53 353 61.50
649. Sian Caleb (promechanics) 573 121.26 151.03 336 58.64
650. touch grass (midca) 573 92.87 129.47 196 34.21
651. kaffarell (kaffarell) 573 83.22 117.51 150 26.18
652. carve (carve) 573 109.30 144.78 269 46.95
653. lhdk2712 (lhdk2712) 572 87.07 110.19 178 31.12
654. anas (qanass) 571 40.72 61.25 43 7.53
655. Fiesty (fiesty_cushion) 570 52.74 73.65 73 12.81
656. Sander (5andos) 570 82.57 103.60 146 25.61
657. vinoth0708 (vinoth0708) 570 47.82 77.10 59 10.35
658. Dr. Sector (sharkychompers) 569 77.71 99.77 139 24.43
659. Abu (kabu22) 567 86.16 113.28 154 27.16
660. raptor (raptor234) 567 68.30 92.85 127 22.40
661. Khoi (khoitran) 565 100.41 128.62 253 44.78
662. Mohammad Rizwaan (freshkebab) 565 83.21 113.21 155 27.43
663. Enxyon (enxyon) 565 123.93 150.60 361 63.89
664. Sourav (yashsaha555) 565 74.37 101.39 141 24.96
665. Pouya (pouyal) 564 57.51 77.34 79 14.01
666. Andrew (monochromeocean) 564 94.09 122.02 195 34.57
667. Marc (marcmalha) 564 83.90 102.94 167 29.61
668. utsab (utsab987) 563 62.47 82.16 104 18.47
669. Daniel (tempguan) 563 75.23 97.60 143 25.40
670. cruise control (terminator_... 562 113.55 148.85 275 48.93
671. Hyunsu (onlyu0923) 562 88.02 115.31 161 28.65
672. ChmpionL (lu_fattori) 560 60.33 75.24 5 0.89
673. zapelots (zapelots) 559 78.22 105.52 157 28.09
674. player (writer35) 558 74.64 119.79 139 24.91
675. Harshal (bitbeast18) 558 76.01 106.44 132 23.66
676. the one (qaisianas) 557 32.98 48.81 37 6.64
677. Mandip (memandip) 556 59.19 81.13 120 21.58
678. Kathryn (kathryns) 555 72.96 94.60 119 21.44
679. Hamza (hamzaalali) 555 70.16 97.05 110 19.82
680. duong (anhhungcolao) 554 81.19 101.07 145 26.17
681. ChangeS (changes99) 554 82.05 115.97 154 27.80
682. Satwik (satwik2708) 554 96.71 127.96 214 38.63
683. ThisIsHowWeRoll!! (another_... 553 111.12 134.44 279 50.45
684. Train (trainm8) 552 78.16 108.31 138 25.00
685. Shypolarbear (shypolarbear) 552 90.15 131.15 178 32.25
686. Miguel (quevangel) 550 114.40 158.59 301 54.73
687. Arararararararararagi (manaso) 550 81.45 110.97 134 24.36
688. Pongpan (pongpan) 549 55.64 69.71 77 14.03
689. huu duy (huu_duy99) 548 82.30 107.22 145 26.46
690. Harmonygrams (harmonygrams) 548 66.08 91.03 128 23.36
691. mike (captaincapitalism) 548 93.43 121.42 202 36.86
692. pavan (pavan_) 547 43.42 63.01 46 8.41
693. Jean (orangedrum) 547 90.86 119.89 178 32.54
694. Wusien (wusien) 546 88.65 120.61 172 31.50
695. Jagadeshrao (jagadeshrao) 546 56.12 80.01 83 15.20
696. doquan (doquannnn) 543 92.17 134.59 210 38.67
697. JD (ruminant_robot) 542 82.08 102.72 144 26.57
698. Joshua (paper_astronaut) 542 95.55 119.46 170 31.37
699. Ramseus (master_r) 542 92.58 113.93 180 33.21
700. Tushar (tushar23651) 541 78.29 102.15 140 25.88
701. DustySheep (smowbog) 540 86.66 120.04 150 27.78
702. Jacob (jmbreche) 540 89.10 121.49 198 36.67
703. ⁹⁻¹⁰ᵍᵐ (green910) 539 96.39 121.75 215 39.89
704. JimBob (jasperjimbob) 538 105.97 142.13 272 50.56
705. Eufalasio (eufalasio_11) 538 67.34 90.04 121 22.49
706. Miras (mirabil) 538 48.54 66.52 47 8.74
707. Ananta (anantaraha) 538 66.58 86.50 124 23.05
708. fakaped (fakaped) 537 72.56 97.01 149 27.75
709. Aviral (aviral_uchiha) 537 106.46 133.74 198 36.87
710. Away From Keyboard (AFK) (d... 536 90.70 111.32 209 38.99
711. akirasendoh07 (akirasendoh07) 536 72.26 103.37 141 26.31
712. Adzenys XR-ODT (iromuanya) 536 107.47 144.95 252 47.01
713. Nistiarius (nistiarius) 536 85.21 122.20 134 25.00
714. Alexander (dencyh) 535 70.44 96.29 140 26.17
715. jack (jackerdd) 534 89.17 113.78 166 31.09
716. Howdy (abinder) 532 115.90 160.24 318 59.77
717. michael (banane_1) 529 118.21 161.69 285 53.88
718. Tanawat (rxrmzriw) 528 38.64 61.04 49 9.28
719. Eduardo (elbodrogo1977) 527 56.85 75.80 75 14.23
720. dhikshith (dhikshith) 527 86.14 109.90 131 24.86
721. Bobby (bton) 526 88.83 121.07 192 36.50
722. Luke (lukell) 526 96.41 131.99 181 34.41
723. Luke (lukeg1209) 525 55.95 73.45 73 13.90
724. Prithvi (prithvi18) 525 48.25 69.84 104 19.81
725. Piyush (lanslord11) 524 72.48 93.05 132 25.19
726. parth (parthvaghela) 523 78.64 107.65 155 29.64
727. daniel (danieledward13) 522 89.50 131.62 165 31.61
728. Erik (vofflan) 521 71.67 89.07 119 22.84
729. Arvin (vin_ar) 520 87.72 113.94 190 36.54
730. brahmastra (brahmastra) 520 57.86 73.44 83 15.96
731. Mohit (mohit2208) 520 86.95 115.51 162 31.15
732. N (natejam) 519 120.26 182.62 347 66.86
733. Alan (erical77) 518 75.47 100.47 125 24.13
734. satwik (satwik_060) 517 89.21 127.11 175 33.85
735. BigChungus (vynzvynz) 517 100.17 142.68 223 43.13
736. Lucas (supermug) 517 100.02 138.14 208 40.23
737. Jacque (jrobyabich) 517 64.70 87.53 107 20.70
738. Mohammad (abdel3leam) 517 68.92 95.57 103 19.92
739. f1_racer (f1_racer_car) 516 92.40 112.77 223 43.22
740. EatingFromTrashcan (namtrac... 515 102.75 137.40 202 39.22
741. julsdgreat (julsdgreat) 515 68.50 92.99 127 24.66
742. Juri (jurida) 514 73.86 106.69 110 21.40
743. luz (luzyb92109) 513 48.41 76.32 62 12.09
744. Liz (liasokol) 513 132.68 189.86 328 63.94
745. penrose (penrosecat) 513 84.85 117.05 169 32.94
746. boniu (wincentbugs) 512 84.49 122.79 151 29.49
747. Nick (nicoboo) 511 61.26 76.56 91 17.81
748. laPampara (lapampara69) 511 94.20 125.71 164 32.09
749. Lance (lancelot_29) 510 89.27 128.66 139 27.25
750. yeeth (yeeth_) 510 94.86 126.17 169 33.14
751. vatsu (nify) 508 65.08 104.74 104 20.47
752. AcidSid009 (acidsid) 507 74.80 114.33 144 28.40
753. tristen (unitristen) 505 87.10 103.87 163 32.28
754. smoky_ (sahuvipul) 504 60.98 93.75 143 28.37
755. 🫐🌺Ruby (reuben_yeager) 504 91.62 121.78 158 31.35
756. Brian (vance071) 503 70.10 96.56 118 23.46
757. tstats[xoceankingx] (xocean... 502 98.68 132.58 221 44.02
758. Nishchit (mr0bn0xi0us) 502 74.71 96.85 125 24.90
759. Benjamin (fatjammin) 502 98.35 131.87 187 37.25
760. Maneeb (maneebdin) 501 64.04 92.30 111 22.16
761. Sebastian (grommonon) 501 82.31 110.37 143 28.54
762. amoz r (amoz11) 501 109.53 145.57 227 45.31
763. the ë (inconsistency) 500 189.99 233.65 448 89.60
764. humisar (humisar) 500 50.65 83.11 55 11.00
765. hereugo (hereugo) 500 91.46 125.27 177 35.40
766. M8l8th (glitchsolo) 499 107.99 149.00 225 45.09
767. Tri Dung (phantridung123) 499 85.56 119.36 124 24.85
768. adderal junkie (dari0) 499 71.89 108.06 137 27.45
769. Balmorax (balmorax) 499 75.62 101.56 141 28.26
770. nana (goomi) 498 86.55 118.31 143 28.71
771. Sim (simron_) 497 66.36 91.69 118 23.74
772. mmmagalex (nonquit4ever) 497 122.87 175.93 267 53.72
773. Jorawar (dumb_daas) 496 68.13 100.49 130 26.21
774. Razor Red Rage (ayyaz_nemesis) 496 96.44 137.75 164 33.06
775. ayush (rocky1708) 495 87.18 116.52 158 31.92
776. Carter (thecartel) 495 100.86 131.59 201 40.61
777. Shroomer (zergkiller) 494 106.84 136.90 234 47.37
778. kentlim (lsk133) 494 64.00 83.45 109 22.06
779. Jose Ortiz (jortiz1496) 492 73.34 102.32 117 23.78
780. Ҝ丨𝓝G𝕆 (hasnatahmad) 492 113.16 155.20 282 57.32
781. Maria (marlab) 492 68.26 84.60 123 25.00
782. anjumaaa (zenda254) 491 86.43 124.80 150 30.55
783. kkobuk (kkobukchipp) 490 83.09 107.87 154 31.43
784. CARDEER (cardeer) 489 107.64 136.82 229 46.83
785. Cakers (pvpcakers) 489 84.04 111.14 163 33.33
786. Sssaajj (sanjisan) 488 79.77 111.07 138 28.28
787. Évi (pinglei) 488 121.33 151.15 308 63.11
788. Mr. (dyldodyldo) 488 93.77 119.70 168 34.43
789. Jimmy (zen529) 488 105.44 138.04 408 83.61
790. Kevin (vektronic) 488 89.27 124.15 152 31.15
791. Fahad (skyclasher_24) 487 76.63 101.47 142 29.16
792. tstats[jancs] (jancs) 487 92.67 124.22 185 37.99
793. RHell (kasiarhell) 486 58.27 79.25 73 15.02
794. Duc (trungducdeptrai) 486 106.52 133.66 244 50.21
795. Priyanshu (neo_trinity) 486 77.10 111.23 142 29.22
796. sakhaprox (rportnoy) 485 104.72 151.12 167 34.43
797. Gilbert (gargoyletabbi) 485 62.28 83.90 99 20.41
798. lelgetrekt (lelgetrekt) 484 98.15 127.27 181 37.40
799. Jahed (jahed100) 484 101.44 122.47 264 54.55
800. ケニー (schnitzelbr0t) 484 81.12 103.48 122 25.21
801. Identitylessness (power_punch) 484 135.67 209.17 456 94.21
802. Patrick (monkyoo) 484 68.04 90.91 108 22.31
803. Sebstian (sedasti) 484 73.20 96.76 121 25.00
804. Lawrence (wattfox) 483 108.20 132.28 199 41.20
805. Pro (pro_01) 483 35.40 49.90 41 8.49
806. nothisisleo (leofire) 483 84.16 108.02 143 29.61
807. Naufal (naufalmahing) 482 72.63 103.64 97 20.12
808. Mato (matoxz) 482 85.76 118.25 156 32.37
809. Jayson (jayson22) 481 58.16 80.73 122 25.36
810. Carter (therealwhiterice) 481 96.24 149.81 183 38.05
811. Theo (theodoretliu) 480 122.11 158.69 257 53.54
812. fruit (special_vegetable) 480 111.18 145.79 214 44.58
813. いつき (huywee) 480 89.20 142.06 134 27.92
814. Yani (theghak) 479 58.32 84.49 86 17.95
815. Nima (eramthgin) 478 98.21 133.44 168 35.15
816. _(=.=)_ (residober) 477 163.40 213.85 260 54.51
817. inconsistent (potangina666) 477 133.64 169.88 357 74.84
818. Loc (loc_phan) 477 65.20 96.73 97 20.34
819. Roadsweeper Dropping D; (ka... 476 138.53 183.12 344 72.27
820. garry (ganesh1998) 476 75.66 95.27 134 28.15
821. Please use an appropriate n... 476 79.68 127.43 99 20.80
822. Vishal Mishra (firethunder2) 476 41.83 71.50 45 9.45
823. Aryaman (aryaman_verma) 476 46.52 62.82 37 7.77
824. Ankur (ankur94516) 476 55.32 75.25 70 14.71
825. KOSTOV (kostov) 475 59.75 87.63 87 18.32
826. los (typossarevalid) 475 61.25 90.33 229 48.21
827. csgo (professorxwing) 475 140.33 186.56 331 69.68
828. Horny (bigben223) 474 88.96 115.14 154 32.49
829. Arun (arunro45) 473 58.13 81.44 88 18.60
830. Arnold (victorvolts_123) 473 76.05 110.59 116 24.52
831. tstats[manthan_noob] (sixty... 473 52.16 77.53 252 53.28
832. Fierce (littlekitten7) 473 106.84 136.02 269 56.87
833. 🎈bm (redly) 473 108.90 136.39 223 47.15
834. Sachin Sharma (ragemodeon) 473 143.57 198.77 363 76.74
835. Rakesh (rakesh69) 472 55.40 92.05 87 18.43
836. kalmanfilter (eran_raviv) 472 69.37 91.88 89 18.86
837. (carlibou) 471 168.11 215.48 416 88.32
838. enigma_mf (enigma_mf) 470 108.29 147.65 231 49.15
839. Nick (poppyc_ck) 470 65.26 86.00 101 21.49
840. prateek (prateekdhiman) 470 54.89 72.44 55 11.70
841. Samuel (sammassam) 469 53.04 67.55 49 10.45
842. Jehar (rakhunb) 469 83.93 109.73 146 31.13
843. Liban (hujala) 469 151.52 200.60 337 71.86
844. I play tetris too (hkgwife) 469 126.36 163.71 289 61.62
845. you deserve to exist (charmx) 468 111.96 166.24 3 0.64
846. Armin (armino112) 467 48.69 62.75 40 8.57
847. Thanos (thanossonofalars) 467 68.99 99.61 105 22.48
848. Amit (amiteshore) 466 99.43 124.76 173 37.12
849. Fakieshot (fakieshot) 465 51.74 69.91 54 11.61
850. jek (jekkey) 465 71.67 98.76 95 20.43
851. Dan (danvictor321) 464 93.71 118.95 163 35.13
852. Tyler (tythal) 464 97.25 130.85 188 40.52
853. drago (drag00me) 461 74.42 92.57 117 25.38
854. CoveredInBees (coveredinbees) 461 81.93 123.19 137 29.72
855. mike (purdah1234) 461 48.40 62.78 41 8.89
856. Julian (robthephysician) 460 73.27 99.01 108 23.48
857. Mr.IF (mr_if) 460 74.32 98.33 122 26.52
858. Petruccio (lolbraumm) 460 89.76 120.39 178 38.70
859. Davis (bengalman447) 460 115.06 140.51 218 47.39
860. Enormity (enormity_op) 459 77.13 94.31 127 27.67
861. Abhay (ab_hay) 458 48.78 84.09 56 12.23
862. Giuseppe (shmebulock2) 457 84.97 123.86 171 37.42
863. Stevne (juninight29) 457 77.01 94.28 80 17.51
864. gojo (gojo9112) 457 71.52 90.00 111 24.29
865. Claudia (aaaaccdillruyz) 456 63.46 79.59 100 21.93
866. . (chocolatina) 456 135.90 190.73 297 65.13
867. zero2 (deadz) 455 33.32 47.92 40 8.79
868. Aisha (aishanick) 455 60.73 88.76 68 14.95
869. NextGoal Avg. 115WPM (redjhon) 455 87.33 123.02 162 35.60
870. Mikhail (mayham92) 454 77.14 99.85 117 25.77
871. Lin (lin_ming) 454 100.70 128.79 190 41.85
872. eric (ericliu04) 454 107.12 133.41 25 5.51
873. Bakhtiyar (bakhtiyar17) 453 58.26 72.73 75 16.56
874. satya (satya1110) 453 64.15 88.47 104 22.96
875. Ω (tunfisk) 453 124.36 169.71 250 55.19
876. Hossain (hossain95) 452 43.69 62.06 42 9.29
877. Smelly (burdturglar) 452 81.09 98.74 127 28.10
878. jia kang (awjack) 452 54.28 71.06 60 13.27
879. Diepday (linhleo372) 451 77.85 105.99 130 28.82
880. Jonatan (gustesmil) 451 104.95 148.46 198 43.90
881. kunal (kunav) 450 77.59 106.05 123 27.33
882. Jeannie (jeanniejackson) 450 63.05 86.56 102 22.67
883. James (icecrusher) 450 88.66 125.10 144 32.00
884. (royaljaat) 450 104.43 145.45 285 63.33
885. bowlingfan21317 (bowlingfan... 449 91.85 120.33 179 39.87
886. Domen (antreu) 449 99.40 139.81 246 54.79
887. abdullah (abdullah3325569) 449 47.65 68.71 50 11.14
888. Andrew (xj04129) 449 91.04 112.85 155 34.52
889. mlhhsid (mlhhsid) 448 101.52 120.29 178 39.73
890. Marlon (mgr47) 448 66.17 88.02 105 23.44
891. Brian (brainclash) 448 69.81 104.54 108 24.11
892. rrono (3an_3an) 447 67.85 97.43 149 33.33
893. Simiwag (simiwag) 447 94.52 134.21 156 34.90
894. Luigi (jorge_da_borracha) 447 101.80 152.34 218 48.77
895. Jay (kov_) 446 71.60 109.40 102 22.87
896. Charles (n6w2) 446 48.15 64.46 31 6.95
897. wilmanbarrios (wilmanbarrios) 446 67.31 90.42 88 19.73
898. taj (taj256) 445 84.46 111.75 106 23.82
899. Serjs (sedoy) 445 18.10 28.68 92 20.67
900. Radamasz (madarasz) 445 82.51 104.80 116 26.07
901. Jacob (jacob_dev) 445 51.09 66.44 36 8.09
902. Dragon99999 (dragon99999) 444 86.35 118.84 139 31.31
903. HasadBoii (hasadboii) 443 58.75 79.65 228 51.47
904. something (kaibaboi) 442 131.14 171.34 47 10.63
905. MAF1F (afif5287) 442 54.69 70.66 61 13.80
906. Vinny (bullz3y3) 442 53.14 69.73 55 12.44
907. FixioMG (fixio) 441 68.26 87.61 103 23.36
908. jataro's dolphin (i_believe... 441 67.30 104.12 110 24.94
909. Slatt. (nonquitpracticing) 441 129.96 181.44 276 62.59
910. Nanar (nanarboursal) 441 64.45 93.36 91 20.63
911. Moy (moy280) 441 102.84 134.96 159 36.05
912. nyet (slickman) 441 79.18 102.59 109 24.72
913. komi (rahul_kumayan) 440 64.53 95.31 111 25.23
914. Unique (netb) 439 73.33 108.57 102 23.23
915. Theo (mewtish) 439 81.49 108.53 115 26.20
916. MINH (shinmyou) 439 105.52 137.03 189 43.05
917. thanos (thanosmpath) 438 109.78 134.83 205 46.80
918. (c_xor) 438 131.90 179.93 293 66.89
919. Chaitanya (chaitanya608) 438 69.87 88.03 97 22.15
920. Sun (headedead) 438 96.86 124.04 170 38.81
921. Magishian (magishian) 437 61.57 103.97 117 26.77
922. Free (just_free2318) 437 63.68 89.68 93 21.28
923. Jesse (sarrod) 437 94.65 128.76 152 34.78
924. Amelia (piclo7) 437 86.08 117.08 145 33.18
925. mooshi (mooshidv) 437 58.47 78.18 61 13.96
926. Lasi (lasileuka) 436 87.57 110.10 141 32.34
927. Tovic (todave) 436 48.28 63.56 39 8.94
928. Piotr (snooppiotr) 436 81.71 104.07 93 21.33
929. andy (ajggormly) 435 79.62 105.99 112 25.75
930. Rockodile (rockodile) 435 110.11 137.95 198 45.52
931. 🌄youtube.com/watch?v=Sa5... 435 158.71 203.40 372 85.52
932. Chris (chris_p) 434 68.80 86.81 113 26.04
933. batbaven (baislow) 434 47.99 62.51 42 9.68
934. vbk (vbk_) 433 45.78 65.26 44 10.16
935. Igor (skeef79) 433 103.88 130.35 210 48.50
936. Johny (johnyt) 433 60.15 88.77 81 18.71
937. Person (improbhighnotgonnalie) 433 103.08 137.22 187 43.19
938. guy (grayeyes) 433 143.11 179.37 319 73.67
939. vamshidhar (vamshidhar18) 432 59.30 84.00 87 20.14
940. Radriar (slowtype_e) 432 57.84 78.83 62 14.35
941. Anshuman (anshu_8) 431 58.72 79.48 78 18.10
942. Pyren (pyren83) 430 89.29 113.01 136 31.63
943. (dispidi) 430 130.75 179.62 287 66.74
944. soldano (soldano) 430 106.92 139.05 205 47.67
945. Toxic (toxicbaby3000) 429 70.76 101.95 103 24.01
946. Mahmoud (sayed1) 429 85.31 106.58 106 24.71
947. Kianoosh (kia_wp) 429 82.51 107.36 121 28.21
948. Harry (harry_k) 429 80.77 118.63 110 25.64
949. hunzai (alihunzai) 429 97.20 135.81 156 36.36
950. why (believeable) 429 106.84 178.19 203 47.32
951. gaitonde (gaitonde) 428 65.79 88.42 93 21.73
952. andrei5 (mute_6) 428 78.15 107.63 110 25.70
953. reuben (reuben_elias) 427 53.50 75.62 48 11.24
954. Discord# unsalek (mustafa_r... 427 86.18 112.91 123 28.81
955. Ben (foereaper4k) 427 78.76 108.34 89 20.84
956. GodSped (falsender) 426 79.07 115.22 108 25.35
957. Ivan (blindingangel) 426 109.16 141.70 238 55.87
958. Prydae (prydae_1) 426 79.54 125.78 109 25.59
959. Mark (ziggle) 425 61.27 85.42 78 18.35
960. WhatTheHotDog (tdsar102094) 425 90.67 122.65 145 34.12
961. Jake (laketype) 425 62.73 84.26 73 17.18
962. mercado (iwanna_typefast) 424 122.33 164.47 214 50.47
963. Pablo (p1blis81) 424 77.99 113.98 97 22.88
964. Cep (alhabiblidinillah) 424 81.71 100.26 99 23.35
965. himanshu (himanshu3198) 423 50.95 71.44 51 12.06
966. JM (tuftycrayfish) 423 73.59 94.14 103 24.35
967. Nobu (nobunakamura) 423 83.54 112.28 142 33.57
968. Poo (pooopooo) 422 93.68 124.00 113 26.78
969. Alan (alan2406) 422 66.06 92.54 84 19.91
970. Dulguun (dulguun_) 422 82.25 117.37 120 28.44
971. weird_virus (imsajan) 422 64.00 89.54 86 20.38
972. Jay kay (imnoob167) 422 39.27 56.91 26 6.16
973. Senpai Z (zlashers) 422 72.53 94.19 100 23.70
974. MaxVerstappen33 (newrookie15) 421 75.40 116.69 123 29.22
975. Karrrrtik (kartikkkk) 421 54.26 79.03 112 26.60
976. Sonu (intellectualcreatures) 421 89.56 119.21 157 37.29
977. Ayush (improve_buddy) 421 55.51 76.44 84 19.95
978. Ibexus (ibexus) 421 164.27 208.60 388 92.16
979. Ladybug (lady_bug_) 420 56.34 73.43 64 15.24
980. J (yunatan) 420 80.45 106.63 141 33.57
981. Ben (thebenman7dv) 420 59.36 82.27 52 12.38
982. Shashi (shashianand230) 420 45.54 61.30 51 12.14
983. Fang (fangalpha) 420 80.15 113.36 112 26.67
984. Mohammad (mr_loooop) 420 82.96 109.89 106 25.24
985. Optimus (optimusprime98) 419 72.97 90.55 104 24.82
986. khalil (khalilfa) 419 72.55 99.04 99 23.63
987. Ahmad (vectors_master) 418 66.50 95.59 83 19.86
988. SPQR (tringuyen29) 418 79.21 108.89 99 23.68
989. Crew (crewmate_sus) 418 117.22 159.37 224 53.59
990. Guest (ksaheb) 417 30.90 44.11 36 8.63
991. Sumeru_ (kenteezyx) 417 93.48 126.43 159 38.13
992. _____ (husixu1) 417 106.91 134.04 177 42.45
993. artist (apg21092002) 417 62.26 85.03 75 17.99
994. Maria (ladymariag) 417 86.47 109.08 126 30.22
995. Mark (pap1) 416 65.19 88.03 103 24.76
996. Shriram (shrirammc55) 416 93.37 117.02 146 35.10
997. Jerry_007 (jerry_007) 415 30.54 42.91 27 6.51
998. Sian-Yang (rgnerdplayer) 415 115.13 145.78 229 55.18
999. R (tumta) 414 68.71 96.67 97 23.43
1000. Dale (livestrong12) 414 114.66 145.30 221 53.38
1001. batbold (bb__) 412 107.80 154.85 193 46.84
1002. Mandem (madem) 411 71.04 120.82 115 27.98
1003. 🅹🅰🆅🅴 (killer8hy... 411 105.94 143.49 183 44.53
1004. Zeep (zeeppt) 411 82.85 100.87 95 23.11
1005. Jiong Yang (yangfoo) 410 95.30 124.14 179 43.66
1006. Nick (cvs_nick) 410 70.04 100.42 96 23.41
1007. Weebmachine (weebmachine) 409 79.08 99.41 91 22.25
1008. पलविंदर स... 409 112.24 140.54 230 56.23
1009. (๑•﹏•)⋆* ⁑⋆* ... 408 81.12 107.74 110 26.96
1010. aman (amanrai2802) 408 62.02 87.08 107 26.23
1011. Razor (mr6pack) 408 63.88 83.35 70 17.16
1012. xd (palmate) 407 77.49 108.63 110 27.03
1013. sun (ny_dkxh) 407 72.01 98.09 124 30.47
1014. uwu (mr_mint) 407 81.26 113.39 124 30.47
1015. me_astr (me_astr) 407 59.18 78.75 79 19.41
1016. Alekva (alekva) 407 73.62 98.37 104 25.55
1017. Stop (stop__) 407 47.84 63.38 37 9.09
1018. Ngoune (tyrex1) 407 74.04 100.87 97 23.83
1019. Soirstylo (soirstylo) 407 80.19 101.00 134 32.92
1020. Vivek (vivektarun1234) 406 29.35 44.08 49 12.07
1021. Onu Kajita (torek87) 406 109.76 145.81 287 70.69
1022. sskhynix (sskhynix) 404 104.61 136.54 199 49.26
1023. Anas (anasghawanmeh) 404 33.38 44.10 21 5.20
1024. Adil (adisan_lc) 404 60.08 84.64 74 18.32
1025. Abhay Shukla (abhayshukla) 404 27.42 41.46 69 17.08
1026. sayed (sayedeesam) 404 44.72 58.89 42 10.40
1027. parham (parhamparsa) 404 43.12 66.08 46 11.39
1028. Murad (memento_mori_s) 404 53.95 75.11 51 12.62
1029. Dilan (carnage2) 403 83.91 132.76 127 31.51
1030. ♥ (boundaries) 403 148.18 222.61 5 1.24
1031. Yohannes (wintersolider) 403 62.01 90.83 91 22.58
1032. Vaj (taychee) 403 75.40 105.23 105 26.05
1033. Brian (taters613) 403 97.05 121.81 145 35.98
1034. Ayong (larrylarogapro) 403 103.03 139.09 179 44.42
1035. jeremy_bearimy (jeremy_bear... 403 92.36 114.17 147 36.48
1036. Jordan (js_jordan) 402 71.60 107.02 87 21.64
1037. Amendity (amendity) 402 80.87 103.31 104 25.87
1038. Adrem (akratic_adrem) 402 84.30 119.87 113 28.11
1039. Go (gomar3n) 402 66.94 88.79 89 22.14
1040. Munir (munirgkm) 402 88.46 116.12 135 33.58
1041. pouya (pooyamz) 401 61.37 89.60 79 19.70
1042. Pavan (pavantyperacer) 401 79.15 104.92 110 27.43
1043. Hanny (monson312) 401 84.64 111.60 128 31.92
1044. Guest (catg0ty0urlung) 401 111.00 137.13 219 54.61
1045. damList (damanthm) 400 85.28 114.45 119 29.75
1046. Allan (allandallon) 400 101.55 131.59 176 44.00
1047. Adam (adam2002) 400 88.50 112.54 104 26.00
1048. Yuji (yujixyuji) 400 72.50 95.07 109 27.25
1049. Shuyu (stevenqi) 400 94.02 129.09 149 37.25
1050. Dylan (dr_gammaray) 399 139.68 173.28 282 70.68
1051. Sami Wilf (samiwilf) 399 106.42 139.17 180 45.11
1052. Eetu (mandarilleri) 399 84.39 116.75 96 24.06
1053. Irfan (irfan_is_the_best) 399 62.99 78.00 85 21.30
1054. Cxlt (fujimaaa) 398 85.41 117.00 133 33.42
1055. a (oimanquan) 398 104.68 139.10 194 48.74
1056. Nivan (nivanr06) 398 86.47 117.26 95 23.87
1057. KnightWithSword (mishras839... 398 63.17 89.46 68 17.09
1058. John (xxcooldudexx) 398 107.26 144.22 179 44.97
1059. Pedro (pedro5370) 397 91.92 124.80 132 33.25
1060. Kotaro (kotaro_qwerty) 397 84.73 108.81 114 28.72
1061. ILOVEPALESTINE (iamslow103) 396 145.03 217.38 367 92.68
1062. Ocean (oceanlim) 396 109.58 165.26 190 47.98
1063. MavrosOplarxigos (oplarxigos) 395 74.79 91.21 137 34.68
1064. john (typeman_1234) 395 66.74 93.52 89 22.53
1065. Rakib (rakib0hasan) 394 38.27 49.24 23 5.84
1066. Luke (outlandish) 394 93.95 115.22 138 35.03
1067. Louie (lewieee) 394 114.23 147.34 228 57.87
1068. Godrod (god_of_rods) 394 87.57 111.22 111 28.17
1069. Cheechu (cheechu) 394 85.49 114.06 113 28.68
1070. Will (greggaz) 393 94.69 132.09 144 36.64
1071. Kipper (ziuncati) 393 58.87 78.11 68 17.30
1072. Dio (slado122) 392 85.80 108.63 130 33.16
1073. Lewis (lewisisabo) 392 72.77 98.70 89 22.70
1074. Hasan (hassanese) 392 56.29 80.33 51 13.01
1075. Nick (neepwithin) 392 88.28 108.08 150 38.27
1076. Ai (aibah) 392 74.98 107.26 108 27.55
1077. Glen (alabaster45) 391 46.16 60.31 34 8.70
1078. Zovi (zovi) 391 89.19 118.74 114 29.16
1079. me slow (brandon69eduardo) 390 104.61 131.78 178 45.64
1080. baby (babyshadow) 390 62.30 85.03 91 23.33
1081. Re4per (light_exe) 390 56.83 77.25 62 15.90
1082. H!P! (harsh_patel) 390 55.66 75.09 54 13.85
1083. Amaury (raymaunet) 389 52.08 66.21 30 7.71
1084. jim (pstengyawa) 388 87.20 120.04 133 34.28
1085. Mooshi (mooshiboy_dvorak) 388 89.61 118.19 104 26.80
1086. Rage (ragelad) 387 62.18 101.17 73 18.86
1087. BonTear (b0ntear) 387 68.69 94.17 88 22.74
1088. seven (seven_mark) 387 78.60 98.33 94 24.29
1089. 1_Death (1_death) 387 48.05 65.71 45 11.63
1090. Andy (djentalman) 386 90.92 124.90 129 33.42
1091. Matteo (atteo1000) 386 63.16 101.09 79 20.47
1092. Noah (lorenpike) 386 70.20 93.60 75 19.43
1093. Tom (polaricecaps) 386 69.28 98.69 103 26.68
1094. Ahead of you (wadehuangjr) 386 95.19 120.04 145 37.56
1095. Himanshu (himsingh11) 385 41.18 65.23 33 8.57
1096. sara (sara1994) 385 40.25 51.56 27 7.01
1097. (welltwell) 384 133.70 177.19 279 72.66
1098. eagle (e4gle) 384 66.33 84.30 98 25.52
1099. Jemma (jmmstvnsn) 384 84.07 106.19 93 24.22
1100. chris (fscj4raxhel) 383 70.83 93.52 77 20.10
1101. ccct (fastleopard) 383 49.80 67.92 45 11.75
1102. Betting (buffhorse_) 383 67.27 90.37 73 19.06
1103. quack (shinonin) 382 145.05 166.00 287 75.13
1104. Lei Paul (polley) 382 92.60 119.63 131 34.29
1105. meiol (olete) 382 59.78 72.14 67 17.54
1106. Ben (caaakeeey) 381 77.28 101.82 103 27.03
1107. Mukeem (bilawat) 380 90.22 119.14 155 40.79
1108. robbie (robbiemcfly) 380 90.16 120.28 132 34.74
1109. Mikaela (mikaela_e) 380 77.74 105.39 99 26.05
1110. . (apeninspaaace) 380 95.34 123.10 147 38.68
1111. an4rchy1925 (an4rchy1925) 380 90.57 130.90 137 36.05
1112. iChoke@TheEnd (vidivinci) 380 75.64 101.99 102 26.84
1113. Funeral Party (scudvirus2018) 380 65.81 83.94 76 20.00
1114. Alex (tabkc7) 379 81.09 102.66 87 22.96
1115. Aashish (albatross007) 379 64.34 87.17 83 21.90
1116. Afterlife (afterlife71) 378 40.47 52.78 31 8.20
1117. DemonKing (zxzf) 378 53.43 69.03 53 14.02
1118. Gabriel (wdarknessw) 378 80.62 103.25 103 27.25
1119. OmicronVirus (deathisnthend) 378 75.83 96.49 92 24.34
1120. (daniel598) 378 155.48 205.79 308 81.48
1121. Nick (nidzoni) 378 103.77 131.82 178 47.09
1122. George (linnypurple) 378 86.31 108.75 112 29.63
1123. PMA (huy2272) 378 82.36 110.46 118 31.22
1124. Heet (heetpatel219) 377 58.42 74.57 78 20.69
1125. raz🐢 (razman) 377 110.44 145.03 173 45.89
1126. Raffa (raffadanendraa) 377 62.67 86.98 76 20.16
1127. Peter (portiz121803) 377 80.26 114.51 77 20.42
1128. prashik0 (prashik0) 376 76.08 113.73 106 28.19
1129. Gaurav (absurd_man) 376 70.44 93.32 96 25.53
1130. Derek (thenyaz) 376 96.46 119.13 144 38.30
1131. Human (supertypergrey) 376 60.62 88.02 59 15.69
1132. han (stuckinatimezone) 376 67.35 93.54 98 26.06
1133. Kimmo (kimorasa) 376 82.82 105.76 92 24.47
1134. kaitlyn (katieostrander) 376 83.20 111.33 82 21.81
1135. khalid (khalidabououalid) 375 73.11 102.63 109 29.07
1136. Cuong (c_nguyenthien) 375 95.84 118.83 144 38.40
1137. Marko (polarbear1229) 375 100.84 132.74 147 39.20
1138. phauxy (phauxy) 375 68.32 91.33 103 27.47
1139. Nick (wugangabbot) 375 61.97 80.29 81 21.60
1140. S (suhaib_silwadi) 375 73.52 100.38 104 27.73
1141. Neon (neonman6) 374 46.68 68.65 50 13.37
1142. HotClaw (hotclaw) 373 96.72 121.41 160 42.90
1143. Demogorgon (typeracer0110) 373 67.27 98.13 91 24.40
1144. Zexceed (shorif) 372 92.57 155.25 177 47.58
1145. Arin (arinkothari) 372 67.23 90.90 76 20.43
1146. Smudge (cuteboi) 372 117.55 161.05 202 54.30
1147. It'sMe (freakinnickp) 371 109.29 141.27 173 46.63
1148. Mez69 (mezx69) 371 73.20 96.28 84 22.64
1149. Neel (jydoenwat) 371 66.17 88.00 76 20.49
1150. Dolce (dolceparadise) 370 88.53 125.77 126 34.05
1151. em (akosiem) 370 92.01 124.46 111 30.00
1152. SnopeySnope (snopeysnope) 370 63.28 91.58 86 23.24
1153. Nithin (useless_net) 369 99.80 147.25 163 44.17
1154. Isaac (newton6674) 369 83.12 101.65 94 25.47
1155. Zephyr (lay_oreo) 368 93.68 131.18 120 32.61
1156. delfan (delfaaan) 368 88.91 113.30 118 32.07
1157. Chatpisut (uwu_werkmaine) 368 85.97 113.42 113 30.71
1158. michael (slowtypist199) 368 134.61 170.94 214 58.15
1159. NickyPP (weenniecat) 367 82.49 117.47 118 32.15
1160. Mehti (lylehti) 367 84.64 113.21 96 26.16
1161. Jeremiah (wetsock625) 367 53.26 69.40 39 10.63
1162. NecroCW (necrocw) 367 81.66 109.46 107 29.16
1163. Wali (captorcarbon) 367 74.07 102.29 103 28.07
1164. david (twistybaer) 366 70.65 94.23 70 19.13
1165. Lucas (lukasyoi2) 366 71.08 103.01 121 33.06
1166. Jack (jfragg) 366 77.78 110.28 73 19.95
1167. Scopic (scopic) 366 97.95 117.10 128 34.97
1168. Puri (narthar) 365 78.26 113.10 104 28.49
1169. Mahmood Thompson (mat_i) 365 115.94 155.42 209 57.26
1170. Maneesh (silentplayz5672) 365 59.02 75.70 67 18.36
1171. 3NKRYPT (3nkrypt) 365 54.76 77.62 38 10.41
1172. kuzz (kuzz) 365 74.94 93.41 78 21.37
1173. Carlos (lufnys) 365 77.03 121.66 88 24.11
1174. Jadon (j20lardo06) 365 77.48 98.73 81 22.19
1175. Not_Stable (not_stable) 364 81.52 123.08 121 33.24
1176. Mega (mega_mushroom) 364 75.87 99.28 83 22.80
1177. Nguyễn Trần (dattran03) 363 86.39 110.96 115 31.68
1178. Curly (curly98) 363 57.37 77.64 58 15.98
1179. byron (bozzarf) 363 75.94 99.43 104 28.65
1180. Glennis (biotic_god) 362 84.65 117.43 90 24.86
1181. andrew (washedtyper) 362 93.31 116.39 150 41.44
1182. Smulca (vicker) 362 61.71 84.40 99 27.35
1183. lol (lolspedicey) 362 83.17 121.19 109 30.11
1184. Gilbernet (gilbertonava7) 362 52.48 66.62 31 8.56
1185. iglo3141 (iglo3141) 361 72.94 98.38 110 30.47
1186. v1step (v1ztep) 361 68.32 95.38 54 14.96
1187. grace (graceneufeld) 361 78.52 101.20 167 46.26
1188. Phish (phishphishphish) 361 109.30 136.14 165 45.71
1189. Mazin (mmazincham) 360 81.50 101.33 73 20.28
1190. Omer (omer_nukic) 359 59.60 81.13 70 19.50
1191. himuman (ignis_05) 359 57.11 84.67 78 21.73
1192. Connor DVORAK (deepwaterbus) 359 83.14 116.59 101 28.13
1193. Declan (dg05) 358 76.89 103.23 83 23.18
1194. Rick Astley (beardybeardy) 358 84.81 115.83 88 24.58
1195. ~ (katana4teen) 358 61.06 83.59 84 23.46
1196. Aaron (heckndarn) 357 73.38 94.06 81 22.69
1197. Curl2908 (curl2908) 357 49.01 64.90 37 10.36
1198. Benjin (benjin7) 357 71.68 101.08 71 19.89
1199. JheMee (ayyjhey) 357 63.23 87.78 68 19.05
1200. 16/f/cali (ultrashibe) 357 131.80 171.33 233 65.27
1201. George (tormanovi) 357 75.32 96.30 83 23.25
1202. An (ntan1210) 357 88.46 135.77 119 33.33
1203. Speed_Reader (nagy_ssbm) 356 84.35 110.01 92 25.84
1204. l502x (l502x) 356 108.64 136.01 160 44.94
1205. bhautik (bhautik0126) 356 40.90 60.91 29 8.15
1206. Alan (alan001) 356 75.18 101.81 82 23.03
1207. DH (deeh_c) 355 81.03 109.85 107 30.14
1208. Tom (ax99) 354 51.25 75.45 31 8.76
1209. Kacsa (kacsa_janos) 354 45.90 67.84 39 11.02
1210. つべ (tube_jp) 354 58.19 84.85 45 12.71
1211. Eric (thicc_ricc) 354 112.07 145.63 160 45.20
1212. i can't be asked (perfectio... 354 107.35 145.13 165 46.61
1213. abs0lutz3r0c007 (abs0lutz3r... 354 84.58 105.74 83 23.45
1214. Sumit (sumit_ghag) 353 91.32 130.18 122 34.56
1215. Adrian (dinfus) 353 109.18 140.43 191 54.11
1216. addy (epicshibexd) 352 102.79 131.79 154 43.75
1217. Evan (__evab__) 352 83.74 113.47 88 25.00
1218. typsterr (typsterr) 352 51.06 70.21 32 9.09
1219. tstats[timtam420] (timtam420) 352 80.67 107.20 86 24.43
1220. K (strongballs) 352 81.63 125.00 107 30.40
1221. AngelCaveGTI (angelcavegtio... 352 88.69 121.31 107 30.40
1222. Alaa Awamleh (alaa_awamleh) 351 68.29 87.28 104 29.63
1223. Ibrahim (ibrahimtyper) 351 115.12 142.41 173 49.29
1224. Ryan (ryan2723) 351 75.02 92.49 55 15.67
1225. Felix (metr_x) 350 49.89 63.73 35 10.00
1226. Sudip (donda) 350 70.82 97.84 83 23.71
1227. Daniel (danielpaanderson) 350 72.92 93.82 66 18.86
1228. Sadat (based_chungus) 350 77.05 101.30 95 27.14
1229. Arnaud (armatt) 350 81.92 106.17 104 29.71
1230. Simon (wizard_sheep) 350 90.68 127.80 116 33.14
1231. Invnty (invnty) 350 37.80 53.12 21 6.00
1232. Zakaru (gaudo1991) 350 79.07 99.87 80 22.86
1233. Marek (lypa) 349 103.78 125.50 167 47.85
1234. Andrew (holocene_learning_d... 349 46.94 70.28 38 10.89
1235. Duncan (dkbrk) 349 116.06 138.06 178 51.00
1236. D (consumption) 349 80.32 104.62 92 26.36
1237. typerinfection (z4k1n470r) 349 74.75 107.61 76 21.78
1238. xSora (xsora) 348 114.54 155.76 220 63.22
1239. Vincent (vincexodus) 348 56.51 76.11 52 14.94
1240. L (thereddone) 348 76.26 96.47 78 22.41
1241. Cray (kweikwei) 348 73.47 86.68 89 25.57
1242. Helena (helenaa_26) 348 46.92 65.21 41 11.78
1243. Taras (gavair) 348 59.35 75.10 59 16.95
1244. Aarvaan (aarvaan) 348 55.82 76.10 47 13.51
1245. Marvin (partass) 348 70.78 89.22 85 24.43
1246. 🍉 Watermelon (ergosolo) 348 110.30 171.84 283 81.32
1247. Dowon (dowon) 348 155.29 193.47 298 85.63
1248. ChimChimChim (chimchimchim) 348 124.49 150.62 208 59.77
1249. Suren (strongsuren) 347 92.44 127.36 94 27.09
1250. Mike (kb_acolite99) 347 55.42 79.45 45 12.97
1251. ニシャント (neokun) 347 60.38 81.30 66 19.02
1252. chunky (wbcracer) 346 117.42 143.58 199 57.51
1253. ravi (sravi4701) 346 77.08 100.40 78 22.54
1254. dav (candyslug) 346 115.94 148.21 160 46.24
1255. Bharat Rai (bratrai11) 346 28.91 38.73 37 10.69
1256. Salmon (pillowend) 345 110.97 151.27 181 52.46
1257. yoyokeepitup (keepitup) 345 97.10 129.84 131 37.97
1258. Evelyn (evline) 344 70.66 86.98 85 24.71
1259. Caxix (caxix) 344 63.21 81.84 72 20.93
1260. m (xxxaliaxxx) 344 87.00 106.02 94 27.33
1261. 🇲🇬 Rina (rina23) 344 104.18 154.58 177 51.45
1262. Văn (pqvan20) 344 66.68 87.03 90 26.16
1263. Son (memorrick) 343 80.86 101.31 96 27.99
1264. Gajen (techgajen) 343 48.36 66.84 40 11.66
1265. George (zorkkins) 342 64.79 82.91 69 20.18
1266. Veniax (veniax) 342 57.32 87.76 64 18.71
1267. Praggapan (silentmachine) 342 71.03 97.40 90 26.32
1268. Mudu (muduxd) 342 53.00 70.03 38 11.11
1269. Momen (momenarafa) 341 63.23 84.52 79 23.17
1270. Will (freewillie18) 341 77.64 110.09 90 26.39
1271. ahiraj (ahirajsingh) 341 19.98 32.62 43 12.61
1272. vaibhav (vaibhav6996) 341 80.17 101.41 196 57.48
1273. s'gettifingers (spaghetti_f... 340 65.19 82.46 83 24.41
1274. Jean (seawardsalmon6) 340 93.08 115.38 130 38.24
1275. Elo (eloh) 340 74.88 94.57 80 23.53
1276. :)) (brokenslowhand) 340 110.64 143.75 171 50.29
1277. Preston (prestonsteffenjr) 340 41.55 50.69 15 4.41
1278. nilansh (pralaya) 340 96.59 121.04 188 55.29
1279. Neko (pippaola) 340 91.87 126.40 108 31.76
1280. Robert (nforcer) 340 91.16 117.96 116 34.12
1281. LogicBS (logicbs) 340 62.16 84.02 72 21.18
1282. 海千山千 (hichkas_01) 339 47.53 69.09 39 11.50
1283. allan (zhangerbanger) 339 122.82 154.71 198 58.41
1284. (dragusprime) 339 117.43 152.77 178 52.51
1285. Bun (bunnypuc) 339 55.88 79.53 57 16.81
1286. Eric (ericnosarcasm) 338 75.11 99.88 82 24.26
1287. Damon (damonc89) 338 90.35 115.63 93 27.51
1288. Biggus (biggboii18) 338 87.51 117.49 94 27.81
1289. emna (em203) 337 60.60 73.33 60 17.80
1290. Timothy Tiew (timothytiew123) 337 109.80 142.59 157 46.59
1291. Sam (samandthefourdogs) 337 66.48 96.26 73 21.66
1292. ROG (roggy) 337 64.37 84.70 72 21.36
1293. R (rc_da) 336 62.61 79.40 46 13.69
1294. Ⓐⓝⓣⓞⓝ (racingisaw... 336 90.21 131.35 159 47.32
1295. Karl (xillionpro) 336 87.26 121.99 105 31.25
1296. Vilmer (vien0701) 336 83.93 108.01 104 30.95
1297. Fangio (fangio) 336 79.11 98.48 73 21.73
1298. Lei (alnadnetrox) 336 88.66 117.22 120 35.71
1299. A.H.M. (arceen) 335 82.78 102.85 83 24.78
1300. Macy (macylace) 335 71.07 95.60 81 24.18
1301. Korra (grandesonnerie) 334 96.95 142.25 130 38.92
1302. Olav (thederpygod) 334 90.27 123.20 90 26.95
1303. Guest (superman_ha_ha) 333 76.52 108.40 80 24.02
1304. Kian (kian32) 333 44.63 56.51 41 12.31
1305. nimitz (nimitzpro) 333 92.34 119.17 127 38.14
1306. Dominic (mickeyice3) 333 74.64 94.43 85 25.53
1307. alex (alex3213213) 333 94.98 134.95 127 38.14
1308. B (bsauter29) 333 89.88 118.34 109 32.73
1309. Rikki (rikki_leo) 332 86.98 118.22 101 30.42
1310. - (ndca) 332 50.53 70.75 36 10.84
1311. 🤝🤝 (joejiunn) 332 92.68 116.79 106 31.93
1312. Adrian (adrianc04) 332 93.75 120.00 89 26.81
1313. AbdulQader (abdulqader) 332 74.38 95.49 75 22.59
1314. yourfav (imyofav) 332 43.79 62.26 30 9.04
1315. tstats[totet] (totet) 331 68.83 89.30 67 20.24
1316. eric (ericpr) 331 71.92 98.26 80 24.17
1317. PEAR (enscarr) 331 149.63 231.98 244 73.72
1318. meow (catnoodles) 330 93.43 124.88 119 36.06
1319. Sam (sam77777) 330 80.52 101.75 75 22.73
1320. Austin (quanglamtran346) 330 73.10 91.16 91 27.58
1321. Blunt (blunt_machete) 330 67.66 92.10 67 20.30
1322. Keima (lereias_1) 330 67.41 89.92 77 23.33
1323. tstats[pervez1020] (pervez1... 329 47.90 62.58 39 11.85
1324. Moaz (mo3adh) 329 67.67 95.42 64 19.45
1325. Faiq (faiq_lak) 329 63.01 93.11 75 22.80
1326. Ryan (carefullyslow) 329 102.53 132.54 153 46.50
1327. Artiur (artursaliyev) 329 41.33 59.03 29 8.81
1328. Jackson (neatoburrito) 328 73.44 109.38 89 27.13
1329. Kickass (vivekvikysharma) 328 60.40 79.05 61 18.60
1330. Mostafa (m2a_nj) 328 46.51 62.79 35 10.67
1331. Zak (zak_roger) 327 88.01 109.38 113 34.56
1332. small (smalllittlesheep) 327 66.35 87.34 70 21.41
1333. Captain (scrubwrecker666) 327 83.04 107.18 95 29.05
1334. manthan (manthan123) 327 62.17 83.55 71 21.71
1335. pärskis (borje) 326 76.06 97.48 83 25.46
1336. sdagsad (asvasdba) 326 74.19 100.78 119 36.50
1337. Liu (jazzkey) 326 92.81 112.40 129 39.57
1338. Shoemaker-Levy 9 (atthetop) 325 161.64 231.45 227 69.85
1339. XanderManCan (tacticaltoast) 325 73.35 94.52 71 21.85
1340. Ridoy Chandra Dey (rkprite09) 325 63.21 82.07 64 19.69
1341. Ed (raptorofli) 325 96.48 129.30 129 39.69
1342. Iron Man (007_speed) 325 86.55 107.41 116 35.69
1343. Emma (emma_boy) 325 50.46 72.04 36 11.08
1344. Ibex (ibexdoyle) 324 34.68 44.92 25 7.72
1345. Sumanta (sumanta001) 324 54.84 75.46 45 13.89
1346. A (suleil) 324 114.68 146.08 147 45.37
1347. eric (eric8) 324 86.99 108.57 92 28.40
1348. Samandar1 (samandar1) 324 39.67 55.67 19 5.86
1349. Ian (s0ft3n) 324 104.42 138.84 143 44.14
1350. Pawan (pawanpdn) 323 72.47 97.19 83 25.70
1351. Orenji (orenji_0987) 323 58.06 80.35 32 9.91
1352. random (myrandomusername) 323 67.17 92.40 83 25.70
1353. Racer09 (__nn____ds__) 323 43.69 56.33 24 7.43
1354. Marti (ytram) 323 53.99 74.03 44 13.62
1355. kenneth (tenick) 323 92.82 116.70 109 33.75
1356. J (juuhhhstin) 323 141.41 166.88 263 81.42
1357. tambii (aid1337) 323 121.80 162.76 164 50.77
1358. Jee Hoon (jeehoonoh) 322 139.43 193.61 243 75.47
1359. Hasan (notelex) 322 88.67 111.32 97 30.12
1360. Viktor (wector77y) 322 100.33 157.78 118 36.65
1361. Hoe Hoe (yeyonghe) 321 76.90 98.46 74 23.05
1362. Person (relearner) 321 98.75 116.97 131 40.81
1363. davy (octopu5) 321 76.50 102.10 103 32.09
1364. MantisTyping (mantistyping) 321 88.56 116.00 98 30.53
1365. Jeffrey (jeff7263) 321 91.80 119.44 89 27.73
1366. 18K.ca (hunterwoodchase) 321 104.20 131.33 134 41.74
1367. Rajesh (curseraj) 321 68.07 90.70 81 25.23
1368. Lynn (pvequalsnrt) 320 82.82 105.61 99 30.94
1369. Manik2375 (manik2375) 320 66.15 94.18 89 27.81
1370. Allan (allanwchang) 320 76.08 99.54 78 24.38
1371. Smudge on megamak uwu (snudge) 320 57.33 99.57 68 21.25
1372. Yashpal (ymanju) 319 29.26 44.59 51 15.99
1373. Sahil (shahildhakre) 319 35.58 55.65 23 7.21
1374. javier (jf1442) 319 67.03 87.53 62 19.44
1375. Key (malformant) 318 80.26 106.62 91 28.62
1376. 🙃 (kryptoprocta) 318 67.25 92.30 76 23.90
1377. Jwad (jaziz) 318 114.29 146.78 171 53.77
1378. I type (carsftw) 318 107.02 137.06 160 50.31
1379. Ranak (rakibulranak) 318 61.81 85.48 66 20.75
1380. Ugnius (popcorn325) 318 95.84 119.02 126 39.62
1381. Tyler (tko42) 318 111.35 141.93 147 46.23
1382. Andy (wah_wah_wah) 317 63.39 86.97 75 23.66
1383. Dhaliwal (vishaldhaliwal) 317 69.62 94.52 76 23.97
1384. Ariful (arifulhaque24434) 317 46.11 59.56 35 11.04
1385. K (khanali2020) 317 95.26 116.17 129 40.69
1386. Sephiroth (jukethehitman) 317 63.41 94.41 61 19.24
1387. Sylwester (rex1313) 317 71.17 108.84 90 28.39
1388. how 2 type faster? (not_seg... 317 139.14 169.93 247 77.92
1389. xena (scogx3281) 316 104.97 135.36 123 38.92
1390. Russian (russianemu27) 316 105.53 141.66 130 41.14
1391. eriktoledo (pepegacharge009) 316 69.70 91.17 83 26.27
1392. Scattish (willierocknroll) 315 72.04 98.97 70 22.22
1393. Ven (v4vendetta) 314 43.81 57.95 23 7.32
1394. Timothy (timply) 314 83.87 117.01 96 30.57
1395. sgbiscuits (snailzzy) 314 85.28 98.23 111 35.35
1396. Nour Hakim (scarfc) 314 49.67 66.74 46 14.65
1397. Memming (qwerty) (memming) 314 102.65 130.16 147 46.82
1398. dayy (lordie) 314 59.28 85.17 63 20.06
1399. Lycin (smokzzzgaming) 313 68.91 96.87 73 23.32
1400. Allistare (shinryu1324alt) 313 100.60 119.41 139 44.41
1401. ChosilogRTX (chosilogrtx) 313 101.42 143.77 136 43.45
1402. Patt (rymt) 313 66.40 95.56 78 24.92
1403. Shelby (typo5) 312 92.13 121.69 95 30.45
1404. Emma (emmasmith2005) 312 89.47 113.69 84 26.92
1405. root (chroot) 312 71.36 125.93 79 25.32
1406. chinguun (chinguun_0301) 311 80.26 100.16 75 24.12
1407. Bruh (bruh_widow) 311 69.82 98.08 86 27.65
1408. c (blaf) 311 72.79 92.70 68 21.86
1409. Jakab (schttj) 311 104.31 140.58 128 41.16
1410. qMark (renvanoss) 311 88.82 112.72 91 29.26
1411. Philip (philipyoung) 311 66.45 88.12 69 22.19
1412. Ansar (paxaq) 311 63.98 87.63 69 22.19
1413. mwizard (mwizard) 311 127.55 157.21 192 61.74
1414. ADFJEWI FF (weiyd) 311 99.22 129.90 138 44.37
1415. Shendo (shend0) 311 50.71 71.03 26 8.36
1416. Oatmeal (cp_oatmeal) 310 61.39 77.60 67 21.61
1417. Berto (bertoisfast) 310 52.53 73.06 28 9.03
1418. Jason (typing_boi69) 309 76.83 105.07 71 22.98
1419. (macieje) 309 157.48 206.11 264 85.44
1420. Nolan (kiwiq1) 309 88.83 104.64 83 26.86
1421. Nikhil (nik9) 309 67.95 95.29 81 26.21
1422. ScocoPope (scocopal) 308 69.93 89.24 69 22.40
1423. PinkPepper (pinkpepper) 308 94.41 128.84 104 33.77
1424. MegaTron (megatron100101) 308 56.17 75.29 44 14.29
1425. Guest👽 (sinatraa68) 308 47.01 67.19 20 6.49
1426. Daniela (danirmz) 308 55.83 84.33 37 12.01
1427. Alex (bjartex) 308 79.38 124.45 83 26.95
1428. light (light_06) 308 46.48 63.44 29 9.42
1429. jone (jonesoldi) 308 54.77 72.48 45 14.61
1430. Hersh (hbhargava) 308 115.69 145.44 165 53.57
1431. ttv.guspenseful (gusm09) 307 88.91 116.33 86 28.01
1432. Charlie (cubez) 307 68.31 91.92 100 32.57
1433. Sav (savcaruso) 307 98.01 146.87 126 41.04
1434. the (rank1zen) 307 73.52 99.73 67 21.82
1435. Sam (sharris11) 307 74.77 94.62 51 16.61
1436. Tong (tongvu) 306 87.05 113.20 110 35.95
1437. Oxey (oxey_was_taken_smh) 306 99.29 130.39 123 40.20
1438. And (andzer0) 306 81.03 105.64 98 32.03
1439. Max (17maxklivans) 305 118.42 158.87 165 54.10
1440. zzr0t (sulj0o) 305 94.61 127.73 118 38.69
1441. Jasnam (jazzygoesomnom) 305 65.50 89.79 68 22.30
1442. b (bonkadonks) 305 91.89 118.64 102 33.44
1443. Avaneesh (avaneeshasokan) 305 67.06 86.43 76 24.92
1444. Reece Taylor (reeceybro28) 305 63.25 89.01 54 17.70
1445. sloth (mitchie98) 304 96.01 132.43 42 13.82
1446. Md. Mamun (mamun_sheikh) 304 67.47 98.83 76 25.00
1447. Lam (lamnv) 304 49.15 65.21 33 10.86
1448. Safraz (hypertyper94) 304 61.09 77.24 60 19.74
1449. York (yorkay) 304 84.91 110.84 95 31.25
1450. Thor (thorern00) 303 57.37 78.15 45 14.85
1451. kaly (klay7) 303 24.86 41.55 72 23.76
1452. Anthony (apesina) 303 53.74 72.83 26 8.58
1453. Rydia (rydia_miwita) 303 38.63 54.43 17 5.61
1454. Eddynsky (eddynsky432) 303 58.40 74.83 51 16.83
1455. I really suk (cornmaster0411) 302 92.78 117.42 100 33.11
1456. Nidhal (yagamee) 302 73.38 99.18 76 25.17
1457. TopGUN (wayhowma) 302 96.60 118.40 183 60.60
1458. sks (sks6174) 302 74.96 100.54 73 24.17
1459. Pham (iamphduc) 302 69.67 87.51 87 28.81
1460. KH (gpx2ero) 302 79.60 102.83 77 25.50
1461. Pietro (qiit) 302 79.36 114.14 57 18.87
1462. sachin (sachin986) 301 65.89 88.38 66 21.93
1463. ᴛᴀxɪ ᴅʀɪᴠᴇʀ ... 301 85.73 117.24 94 31.23
1464. yzifioapj;;;🙈🙈 (pipur) 301 91.39 123.10 93 30.90
1465. learn corne (tomgroenwoldt) 301 92.10 114.47 102 33.89
1466. Torrin (t0rr1n) 301 87.83 110.24 96 31.89
1467. Charlie (cduong04) 301 106.51 137.61 107 35.55
1468. Kiara (katherynbane) 301 89.64 117.58 107 35.55
1469. tstats[kaitokidokuroba] (ka... 301 88.78 124.02 98 32.56
1470. J (leunidus) 300 105.17 130.86 115 38.33
1471. Charon (just_you_and_me) 300 46.15 58.80 31 10.33
1472. jmzg (jmzg) 300 79.71 106.92 80 26.67
1473. 😳hotmama😫 (h0tmama) 300 142.56 185.24 229 76.33
1474. P. (psilva00) 300 84.27 108.41 96 32.00
1475. Piyush (piyush41y08h) 300 61.77 80.33 57 19.00
1476. ndr2 (ndr2) 300 105.49 128.13 131 43.67
1477. Yaroslav (nashivan) 300 36.79 48.25 21 7.00
1478. blue (bluedragon_) 300 96.97 136.91 117 39.00
1479. Fouracle (fouracle) 299 155.23 188.96 265 88.63
1480. King JF (foongtastic) 299 58.27 74.24 51 17.06
1481. Ins (insanic10) 299 72.84 101.64 71 23.75
1482. Sidharth (iamsidman17) 299 84.49 110.54 85 28.43
1483. Jhari (hyunjintinapay) 299 60.41 79.47 58 19.40
1484. Tiny Tank (anti_vax_cat) 299 98.69 127.80 106 35.45
1485. Bijji (thatboywulfric) 299 100.11 125.26 138 46.15
1486. Chuck (typer_inflation) 298 77.19 103.01 82 27.52
1487. TypeLearner21 (typelearner21) 298 100.91 124.99 141 47.32
1488. Sydney (sydholla) 298 87.62 115.41 82 27.52
1489. Neb (cyanidetoast) 298 76.13 106.29 76 25.50
1490. JACK (jackemon) 298 49.95 74.00 36 12.08
1491. Macedonian King (ijittqerr_) 298 85.89 113.04 76 25.50
1492. Silent_One (get_a_lif3) 298 133.97 170.26 219 73.49
1493. ­ ­­ (enqq) 297 71.88 99.63 75 25.25
1494. Danica (7158dandan) 297 74.34 94.79 85 28.62
1495. csl (csl11) 297 66.54 81.87 76 25.59
1496. Jc9369 (trotterspiglet) 297 70.06 90.08 67 22.56
1497. Samuel (samuel_7) 297 73.38 100.85 64 21.55
1498. MNM (mnmnour) 297 104.33 128.37 135 45.45
1499. chara (rin3) 296 94.07 125.59 113 38.18
1500. Timothy (adral) 296 85.50 121.46 84 28.38
1501. Catalin (catalinhimself) 296 71.44 97.16 70 23.65
1502. Marius (darkmarox) 296 71.37 101.58 72 24.32
1503. Sobuj (greensobuj) 296 58.16 82.93 59 19.93
1504. MK-47 (construct) 296 63.94 82.81 63 21.28
1505. Taru (tarukwon) 296 90.51 114.16 102 34.46
1506. Someone (_some_one_) 295 90.16 120.02 95 32.20
1507. (shaun022) 295 82.31 112.14 90 30.51
1508. RoadTo69(hehe) (lord_hunter) 295 68.84 91.91 72 24.41
1509. likun (likun) 295 36.98 49.28 21 7.12
1510. kamalesan (kamalesan) 295 69.96 87.80 76 25.76
1511. Ginger (ravens_loft) 295 74.04 99.14 74 25.08
1512. Dvorak 9/16/2021 (mj_dvorak) 295 61.68 82.16 51 17.29
1513. Nurasyl (black2ing) 295 49.12 62.45 30 10.17
1514. Asm (asmsaikat) 295 57.96 74.40 41 13.90
1515. Horst (feanor) 294 97.30 120.28 107 36.39
1516. Macro (macro225) 294 82.49 99.74 60 20.41
1517. inspirations (inspirations) 294 56.47 73.98 52 17.69
1518. Kai (gigadelic) 294 91.74 120.65 99 33.67
1519. Touchtyping (touchtypingpro... 294 76.49 112.79 95 32.31
1520. Suhas (suhasmaddali007) 294 102.90 126.79 112 38.10
1521. david (snobellprize) 294 88.68 114.13 98 33.33
1522. Anvar (only_aloner) 294 75.01 93.34 101 34.35
1523. Nirmith (nirmith_akash) 293 55.29 72.81 41 13.99
1524. Michael (lastobelus) 293 82.43 97.70 66 22.53
1525. prints (ichigopurin) 293 110.60 154.59 167 57.00
1526. Burint (brenolz) 293 72.41 95.11 75 25.60
1527. bondservant (arenza) 293 91.78 121.57 108 36.86
1528. Amarpreet Singh (amar123200) 293 72.10 100.16 84 28.67
1529. ajit (ajit9999) 293 65.72 88.62 85 29.01
1530. Aditya (adibhandari) 293 71.00 92.80 85 29.01
1531. Logan (36beastgod) 293 72.94 94.91 86 29.35
1532. 27thave.bandcamp.com (xxcru... 293 146.15 188.92 233 79.52
1533. Veer (the_veer) 292 84.33 108.93 79 27.05
1534. reem (bacil123) 292 109.63 139.38 132 45.21
1535. Omar (samura1) 292 65.37 92.38 69 23.63
1536. Pink (pinkbass) 292 66.95 92.34 69 23.63
1537. Ujjval (ross_specter) 291 55.17 73.45 36 12.37
1538. Jai Shri Ram (defone) 291 89.10 125.88 108 37.11
1539. zheqe (zheqe) 291 109.95 133.42 148 50.86
1540. anonym_igelkott (anonym_ige... 291 119.96 143.19 163 56.01
1541. Vanessa (abetterplace) 291 99.06 129.02 120 41.24
1542. Anthony S. (anthonyjshuey) 290 83.59 119.01 80 27.59
1543. meerkat (dr_meerkat) 290 76.39 93.80 69 23.79
1544. puthin_p2n (bugsmasher) 290 83.09 116.97 80 27.59
1545. boiax (boiax) 290 60.92 86.95 65 22.41
1546. aziz (azizkhanfar304) 290 59.86 75.53 57 19.66
1547. Loma (pbaloma) 290 99.90 123.26 104 35.86
1548. Monotarinai (monotarinai) 290 70.76 93.83 73 25.17
1549. leftovericecream (leftoveri... 290 96.14 121.75 125 43.10
1550. Hello (julius1331) 290 84.50 109.01 87 30.00
1551. a (jdlwahaha) 290 95.44 117.85 111 38.28
1552. t (zyxx) 290 93.32 129.84 115 39.66
1553. Surely (surely_) 290 55.14 74.36 36 12.41
1554. Yeldos (yeldos1) 289 26.38 43.76 48 16.61
1555. Im not a country (taiwankim) 289 88.63 114.78 93 32.18
1556. Struasz (struasz) 289 35.99 52.27 24 8.30
1557. Ross (pyramidgg) 289 109.67 146.18 125 43.25
1558. Navait (nkumar031) 289 59.08 83.48 59 20.42
1559. Angela (angela_typeracer) 289 46.82 67.20 24 8.30
1560. Kerim (keroma) 289 39.83 52.77 15 5.19
1561. Rasmus (kennystarfighter_) 289 76.38 103.76 73 25.26
1562. #1 Racist (gnadus) 289 53.83 69.93 26 9.00
1563. ramen (lightning_poliwag) 288 85.21 119.12 98 34.03
1564. Misha (ladyvander) 288 103.54 129.93 125 43.40
1565. pwp (fickypw) 288 81.54 99.24 64 22.22
1566. Ewan (ewan121) 287 83.03 111.91 78 27.18
1567. lurak (lurak2131) 287 75.17 97.18 69 24.04
1568. KC Abhinav (kcabdn) 287 55.00 78.53 42 14.63
1569. Pranjal (haanhaargaya) 287 51.52 65.06 25 8.71
1570. usagi704 (usagi704) 287 64.60 79.58 53 18.47
1571. Nilanjan (nilthedev) 287 62.49 86.02 55 19.16
1572. Abdzag (abdzag) 287 65.42 91.30 70 24.39
1573. sierra (sierra05) 286 156.11 202.05 243 84.97
1574. Reddington ツ (ericliu17) 286 118.11 155.92 173 60.49
1575. Krushna (krush111878) 286 51.72 72.17 34 11.89
1576. Jhonny (jhonny_space0ut) 286 64.37 79.65 63 22.03
1577. Danny (h4ndeye) 286 75.95 100.40 69 24.13
1578. Catalin (georgecatalin) 286 78.58 103.56 64 22.38
1579. Sampharos (sampharos) 286 49.77 66.92 24 8.39
1580. Maxim (mista7) 286 50.45 71.01 29 10.14
1581. Raj (raxoltron) 285 67.64 95.29 84 29.47
1582. Nursultan (nursultan23) 285 59.71 80.71 41 14.39
1583. mayzerto (mayzerto) 285 68.96 85.66 58 20.35
1584. Jack (jackthesnacc) 285 66.51 93.97 72 25.26
1585. speedyqwertalez (i_am_a_nooby) 285 56.35 69.17 32 11.23
1586. Zaynab (itsyou) 284 67.78 88.47 74 26.06
1587. Gopal (avengergopal) 284 34.83 53.03 25 8.80
1588. pwned (pwned1337) 284 47.20 63.14 41 14.44
1589. Bob (octopus32) 283 107.17 128.89 153 54.06
1590. James (jjhertz) 283 66.58 98.35 65 22.97
1591. butttickler (james29091998) 283 53.77 72.02 41 14.49
1592. Hayrra (hedooxx) 283 52.18 64.88 17 6.01
1593. MazzaM (typingproxyz) 283 82.26 131.52 71 25.09
1594. sly (slymaster11) 283 113.67 145.75 132 46.64
1595. 1 (shootingmonkey1) 283 67.83 89.64 66 23.32
1596. Jonah (workman04) 282 91.90 124.29 104 36.88
1597. Jethro (jetthrower) 282 77.75 103.96 80 28.37
1598. greenmantis (greenmantis) 282 111.44 145.48 154 54.61
1599. Sam (numberonemega) 282 111.74 146.05 169 59.93
1600. quite fast (edonn) 282 118.13 148.06 125 44.33
1601. AWE (awicek) 282 52.61 65.77 26 9.22
1602. Eddie (eddie_08) 281 73.15 96.94 76 27.05
1603. Michael (m1ch4el) 281 59.57 75.55 41 14.59
1604. shark (sharkpause) 281 64.41 87.15 60 21.35
1605. Nima (nimayaqmuri) 281 84.81 105.96 81 28.83
1606. butter (rtporpmal) 280 71.85 94.90 62 22.14
1607. Racer (racer_9) 280 55.41 80.13 30 10.71
1608. Eugene (ptes77) 280 152.93 192.14 240 85.71
1609. Ikenna (odogwu) 280 76.67 107.78 79 28.21
1610. notkinruyuu (notkinruyuu) 280 53.89 82.03 33 11.79
1611. Manel (mrnuke) 280 78.92 93.22 76 27.14
1612. Mohamed Sadiq (mohamed_sadi... 280 29.46 39.60 30 10.71
1613. Joe (jgizzi21) 280 74.41 98.73 60 21.43
1614. ?? (form30to100) 280 28.94 45.60 41 14.64
1615. anon (dontrun01) 280 39.41 55.21 22 7.86
1616. Chicken (chicken807) 280 91.67 123.85 98 35.00
1617. Somogyi (vincture) 280 97.98 126.12 94 33.57
1618. One last time (ubershah) 280 101.58 136.59 139 49.64
1619. Taejas (taejas) 280 90.53 107.68 101 36.07
1620. Shadow (shadow_monarch) 280 85.64 116.41 79 28.21
1621. 🧀 Chez (super_not_pro) 279 139.94 174.14 213 76.34
1622. Val (sgtvaltzu) 279 92.31 109.15 83 29.75
1623. Imperator (imperator_357) 279 60.44 70.78 46 16.49
1624. Heufy (heufy) 279 83.94 105.54 90 32.26
1625. god (god_is_here) 279 93.36 117.04 93 33.33
1626. ghaws (ghaws) 279 74.99 97.04 79 28.32
1627. henry (luckyhenry) 278 83.48 99.64 71 25.54
1628. Liam (lime_da_bestest_colemak) 278 63.40 83.34 56 20.14
1629. sukhoi su-57 (shezy) 278 41.77 63.73 29 10.43
1630. Onni (alchem) 278 82.62 121.20 65 23.38
1631. antobot (antobot) 277 55.14 73.96 52 18.77
1632. Wave (waveclipping) 277 110.51 147.56 140 50.54
1633. Yusuke (tokyoprogramming) 277 78.67 102.68 79 28.52
1634. ionut (ionut_red) 277 90.70 124.66 106 38.27
1635. aditya (yusifer_zendric) 276 105.19 130.38 130 47.10
1636. Jamal (xflash) 276 87.52 116.42 92 33.33
1637. Edwin (biggchinoxxl) 276 64.15 95.43 49 17.75
1638. Alex (delvern) 275 71.16 87.59 71 25.82
1639. Luke (luthedog) 275 77.47 103.12 66 24.00
1640. Hau (jackie1997) 275 64.96 94.14 69 25.09
1641. Aheartz (idul_aheartz06) 275 50.46 67.02 28 10.18
1642. Radek (raddzio) 275 65.68 87.49 62 22.55
1643. Chilly (racerrrrrrr) 275 59.80 76.35 44 16.00
1644. Will (williamwang) 275 109.16 140.26 120 43.64
1645. Robbie (symba369) 275 80.67 104.63 84 30.55
1646. Lark (sirhaxbard) 275 112.99 146.15 127 46.18
1647. jerry (sheep0109) 274 52.82 75.40 41 14.96
1648. Cultist (kishore0305) 274 98.00 125.95 89 32.48
1649. kd (kdrai007) 274 50.33 71.53 31 11.31
1650. Jpjt (jyrah) 274 72.85 90.92 48 17.52
1651. Grover (grover8323) 274 51.46 64.06 18 6.57
1652. Ahmad (ahmad7salah) 274 54.68 71.87 30 10.95
1653. askeladd (askeladd_619) 274 44.67 58.97 24 8.76
1654. jinay (noisy_88) 274 73.30 95.67 79 28.83
1655. Murad (murad90) 274 52.37 68.14 29 10.58
1656. razwan (razwan) 273 37.59 61.16 20 7.33
1657. Yanni (moronicmetalman) 273 106.90 127.47 118 43.22
1658. Krg (username_example125259) 273 117.07 142.63 155 56.78
1659. Stefan (fendorian) 273 92.84 116.99 107 39.19
1660. Dayna (daynarrr) 273 87.63 122.42 93 34.07
1661. Lawrence (buffoony) 273 79.30 105.10 91 33.33
1662. Andres (atv2307) 273 64.67 86.53 65 23.81
1663. Leo (asdbooh) 273 90.79 116.85 87 31.87
1664. Ambi (dank_ambi) 272 93.41 127.75 114 41.91
1665. Francisco (cdt1) 272 87.38 112.78 80 29.41
1666. Gio (banzy) 272 59.32 73.91 45 16.54
1667. guest (n1lotpal) 272 73.54 91.42 77 28.31
1668. Manuel (manuelsandoya) 272 52.65 70.76 21 7.72
1669. humberto torres (humbertoto... 272 88.60 108.76 86 31.62
1670. TheyGotAlex (harshbarger.a@... 272 118.28 164.34 142 52.21
1671. RAMs3c (xander360) 272 76.18 101.76 59 21.69
1672. Jonas (supektibol) 271 88.85 106.32 64 23.62
1673. sadsaturdays (sadsaturdays) 271 49.53 64.10 33 12.18
1674. Perceval-_- (perceval) 271 68.71 86.71 62 22.88
1675. mcga (mcga) 271 90.31 114.29 101 37.27
1676. Peaches (devastated) 271 122.95 154.23 141 52.03
1677. Mark (datboi1771) 271 94.16 140.44 93 34.32
1678. Dang Hai (dang_hai_ema) 271 36.97 51.90 15 5.54
1679. camden (camdcn) 271 126.49 176.47 183 67.53
1680. accongero (geononquit) 271 145.64 196.28 183 67.53
1681. Lil guy (littlewalken27) 270 52.06 67.30 33 12.22
1682. Hunter (hunter_da_man11) 270 88.01 112.47 81 30.00
1683. nishant (nishp19) 270 76.72 93.47 81 30.00
1684. Alfabetica (alfabetica) 270 85.95 105.95 77 28.52
1685. Okiiiieee (acharyas) 270 84.76 111.42 72 26.67
1686. frustratedtyper (frustrated... 270 94.89 119.88 95 35.19
1687. Kirin (emptomatoketchup) 270 86.36 129.62 82 30.37
1688. Bill (destroyer_2) 269 82.14 117.00 79 29.37
1689. Le (lenam12345) 269 46.74 69.89 20 7.43
1690. Scwexxy (imscreecher) 269 66.45 91.74 51 18.96
1691. Trent (tsteele07) 269 68.53 84.78 63 23.42
1692. Ben (thisisben) 268 85.91 105.82 62 23.13
1693. SURFΛCΞ (surface) 268 103.58 138.80 129 48.13
1694. Fearless Jutt (lozer098) 268 71.34 92.65 53 19.78
1695. Sandy (sandeshgowda0094) 268 30.12 42.20 34 12.69
1696. Peter (ptnguyen) 268 108.00 143.19 135 50.37
1697. Pradeep (pradeep80) 268 70.81 117.68 62 23.13
1698. Justin (dunklioscious) 268 146.23 185.85 196 73.13
1699. akzhol (atomixa) 268 86.24 111.93 89 33.21
1700. Nagai (nagaimatsuge) 267 89.33 111.87 94 35.21
1701. Bình (juliecorstarr) 267 50.46 97.36 25 9.36
1702. Jordi (jordi0lle) 267 53.83 72.75 24 8.99
1703. Matt (inedibility) 267 97.89 122.48 100 37.45
1704. Glass (glass_crys) 267 94.75 130.10 97 36.33
1705. Ali (french_baguette) 267 55.73 80.03 47 17.60
1706. Rory Gower (rxryag) 267 42.97 62.61 22 8.24
1707. Hossein (dustylamia) 266 85.77 126.90 108 40.60
1708. Robert (karayicki) 266 102.47 124.31 117 43.98
1709. Kelby (haulzy) 266 94.40 110.91 100 37.59
1710. Jo (jococonutty) 265 87.19 110.79 90 33.96
1711. zeeee (zeeebra) 265 107.71 146.21 142 53.58
1712. Typing🤯🤯🤯 (sirsoup) 265 95.23 118.96 75 28.30
1713. JP (freshlumpia) 265 81.68 112.19 79 29.81
1714. barry01xd (barry011) 265 117.27 148.10 140 52.83
1715. Enjoi (enjoisxd) 264 68.27 87.51 58 21.97
1716. gangreenie (gangreenie) 264 97.49 130.44 105 39.77
1717. Pavan (sai_pavan) 264 71.17 93.84 60 22.73
1718. Sahariar (noob_sahariar) 264 70.62 98.98 67 25.38
1719. tudorica1 (tudorel1234) 264 98.90 115.94 91 34.47
1720. Demon (thedemon54) 264 43.87 70.33 21 7.95
1721. severed (severedhand) 264 83.56 115.71 66 25.00
1722. Typer Shark (teodorrd27) 263 122.58 144.05 154 58.56
1723. Abdulelah (hansan) 263 55.16 73.03 36 13.69
1724. Hyrum (anom4001) 263 90.03 115.87 91 34.60
1725. Byron (chicken_little1) 263 59.57 72.01 40 15.21
1726. munkeontop (revvitt) 263 141.39 169.47 180 68.44
1727. Poops (poops_magee) 262 116.04 140.37 153 58.40
1728. Hans (phantomreel) 262 49.62 64.27 30 11.45
1729. Shu (shuuouma) 262 60.49 76.10 43 16.41
1730. Lightning (just_lightning_) 262 67.14 94.27 42 16.03
1731. lukman (kopimaniz) 261 87.72 104.81 87 33.33
1732. Kenway (kenway316) 261 74.00 102.42 59 22.61
1733. Timmy (timexwatch) 261 71.90 99.49 61 23.37
1734. (sputype) 261 102.70 144.79 102 39.08
1735. salem (salem_coder) 261 60.62 91.78 59 22.61
1736. Ndrew138 (ndrewewqe) 261 69.54 89.16 59 22.61
1737. Prem (merpx) 261 77.16 94.66 64 24.52
1738. Nairwick (nairwick) 260 78.30 117.19 52 20.00
1739. Nagaku (nagaku) 260 99.46 127.84 90 34.62
1740. Mers (mers_0412) 260 99.87 122.50 108 41.54
1741. Meet (meet_patel1588) 260 68.99 94.32 57 21.92
1742. Hatandriya (tiko270303) 260 110.82 142.51 126 48.46
1743. Adrian (adriangat) 260 90.84 113.69 99 38.08
1744. Adam (adamsyaq) 260 97.81 123.46 108 41.54
1745. pizza (jsoccerdude@msn.com) 260 87.45 118.20 79 30.38
1746. yixuan (ixuan) 260 80.75 104.97 87 33.46
1747. Cythrix (boment) 260 110.09 135.59 125 48.08
1748. Kade (buph_kade) 259 78.15 113.29 53 20.46
1749. Violet (ackerman_l1) 259 79.33 96.04 65 25.10
1750. RoosterDunker (roosterdunker) 259 94.18 114.32 73 28.19
1751. Richard (richard_king) 259 72.81 95.59 51 19.69
1752. matiullah (qais_007) 259 39.51 49.78 14 5.41
1753. Joe (neimad7) 259 110.31 144.78 106 40.93
1754. joe (mcmillybear) 259 74.55 98.01 70 27.03
1755. H (vigilantvillian_colemak) 259 109.67 130.65 135 52.12
1756. scuba (scuba2x) 259 72.56 111.17 61 23.55
1757. hero (iknowhtml) 259 41.63 56.15 18 6.95
1758. jonny (jlun23) 258 125.09 155.88 173 67.05
1759. Mhark (mharkmharkmhark) 258 83.94 105.77 64 24.81
1760. CornPacs (cornpacs) 258 87.58 107.48 79 30.62
1761. CHeezs (cheezs) 258 101.43 135.09 174 67.44
1762. hitham osama (hitham16) 258 27.91 45.48 29 11.24
1763. Andrew (andrewsim) 257 61.05 75.38 59 22.96
1764. veirt (exlog) 257 128.69 165.61 158 61.48
1765. E (evan_30) 257 82.93 103.25 81 31.52
1766. 원숭이 (dweaji) 257 106.15 131.30 116 45.14
1767. cignx (clamchowderco) 257 79.84 105.41 80 31.13
1768. Art (artkhl) 257 77.85 99.68 70 27.24
1769. prplx (prplx) 257 99.51 133.39 113 43.97
1770. Vi Kiet (vikiet1456) 257 60.79 77.48 60 23.35
1771. Will (slamdado) 257 72.49 95.56 50 19.46
1772. Qi (whathaha) 256 123.49 165.41 157 61.33
1773. Meow (vic12116) 256 68.08 91.86 65 25.39
1774. Severin (elmo96) 256 101.84 120.95 109 42.58
1775. Tony (complex) 256 96.11 131.84 93 36.33
1776. hackthemoon (hackthemoon) 256 81.15 104.71 63 24.61
1777. Mark (requiem__) 256 85.98 109.78 67 26.17
1778. mike (oxfordcomma) 256 94.55 116.19 105 41.02
1779. Nobody is perfect. (odareal... 256 98.21 133.95 88 34.38
1780. wpmhog (wpmhog) 255 75.77 99.93 55 21.57
1781. Triklino (triklino) 255 137.66 183.78 183 71.76
1782. Yash (thanosyash) 255 70.45 102.01 56 21.96
1783. shashank (shashaank) 255 38.33 47.50 22 8.63
1784. Ishaant (ishaant) 255 57.88 75.88 50 19.61
1785. hafidbuilds (hafidium) 254 55.64 68.63 35 13.78
1786. Saied (saied_en) 254 54.94 75.03 47 18.50
1787. Atif (atifzaheer2028) 254 93.05 116.16 103 40.55
1788. (amithps66) 254 58.64 72.68 36 14.17
1789. PR@NIT (anonymous8) 254 34.27 53.80 19 7.48
1790. Shaikh Nayeem Uddin (snayeemu) 254 41.92 52.07 20 7.87
1791. trash 22424242424 (y6_chris) 254 111.12 137.91 125 49.21
1792. Shuccer (shuccer) 254 69.52 97.88 62 24.41
1793. Xebion (xebion) 253 78.70 98.81 72 28.46
1794. Lydia (shiruzu) 253 104.32 123.05 96 37.94
1795. Math (faster_babe) 253 87.70 103.38 69 27.27
1796. heh (itno) 253 65.44 85.02 66 26.09
1797. Ankan (nc3rtainity) 253 71.12 90.25 63 24.90
1798. myshmeh (myshmeh) 253 69.01 84.91 57 22.53
1799. Anmol (anmolsaraswat) 253 82.04 121.64 87 34.39
1800. AL (alhasandude) 253 54.68 69.13 32 12.65
1801. Apu (a1p16u21) 253 37.65 53.15 13 5.14
1802. braeden (braeden312) 253 71.75 101.17 76 30.04
1803. Imagine losing (naaskee) 252 63.28 83.14 44 17.46
1804. Daniel (incognitus) 252 90.71 105.98 103 40.87
1805. Zeltraa (zeltraa) 252 77.10 101.67 68 26.98
1806. Casper (venomizedcasper) 252 78.64 101.53 66 26.19
1807. Alexander (torphon) 252 94.84 115.80 86 34.13
1808. Shadow (shadowkitten) 251 104.49 146.52 111 44.22
1809. tstats[gad2443] (gad2443) 251 112.66 140.67 120 47.81
1810. Savantik (savantik) 251 111.36 146.26 123 49.00
1811. Peter (petepp) 251 45.97 62.30 25 9.96
1812. RAAM (raam_d_prince) 250 75.74 112.07 57 22.80
1813. Free-Palestine (mohammed_id... 250 71.97 99.72 70 28.00
1814. Edmilson (milson602) 250 61.41 81.46 51 20.40
1815. McKenna (mcassady13) 250 94.89 122.24 96 38.40
1816. Ngoc (maxq42) 250 100.19 121.94 78 31.20
1817. Zoe (zhanchi) 250 56.21 69.42 31 12.40
1818. a (vanazkan) 250 68.87 87.57 53 21.20
1819. Tianchang (tcliao) 250 86.64 109.02 73 29.20
1820. Eric (sivade) 250 113.45 168.75 129 51.60
1821. Jorn (dealermedic) 250 92.96 121.12 77 30.80
1822. Bilbo (bilboballins) 250 99.86 132.19 93 37.20
1823. bendo (bendh) 250 59.59 78.89 40 16.00
1824. Illya (maldron) 250 75.59 94.95 54 21.60
1825. JT (jasonthai) 250 36.81 57.17 17 6.80
1826. Eldergod of the Universe (l... 249 117.72 157.37 118 47.39
1827. JusticeEX (justiceex) 249 101.43 149.19 97 38.96
1828. Piss Boyy (ineedanickname) 249 94.71 138.47 75 30.12
1829. ignacio (ifarias25) 249 96.54 123.78 72 28.92
1830. Jammie (typos_z) 249 203.76 273.89 245 98.39
1831. joster150 (joster150) 249 66.74 84.40 50 20.08
1832. Pintu (pintukanjia) 249 59.02 79.17 52 20.88
1833. Michael (mchu519) 249 111.05 131.80 133 53.41
1834. DMack (dmack98) 249 89.47 114.53 88 35.34
1835. czus (czus) 249 71.94 98.74 66 26.51
1836. zhata1234 (zhata) 248 83.62 111.42 57 22.98
1837. sam (samtheguy10) 248 66.48 88.11 50 20.16
1838. Mamdouh (mamdouh_75) 248 63.65 80.10 54 21.77
1839. Matthew (poobcum) 247 64.55 85.36 56 22.67
1840. Karthik (karthikkumar) 247 68.34 96.09 52 21.05
1841. GWTNess (gwtness) 247 82.86 109.27 79 31.98
1842. Kopa_Samsu (aaourav0) 247 57.88 75.43 69 27.94
1843. ajrv (aamodvarma) 247 109.86 146.08 118 47.77
1844. Heide (vnit) 247 70.73 96.53 52 21.05
1845. https://youtu.be/dQw4w9WgXc... 246 122.33 152.12 136 55.28
1846. 🦉Tenor🦉 (strigibae) 246 127.91 160.99 154 62.60
1847. Serial (serial_typer) 246 77.24 101.55 65 26.42
1848. Luda (ludavis) 246 80.68 103.51 68 27.64
1849. King (kingcrumple) 246 119.75 153.64 157 63.82
1850. Einno (einno) 246 85.68 107.64 81 32.93
1851. Chowda (chowda) 246 103.45 131.08 100 40.65
1852. Coder100 (coder_onehundred) 245 123.08 150.37 134 54.69
1853. ayushwan (ayush6203) 245 24.31 36.13 53 21.63
1854. K (ksil_surface) 245 101.72 127.98 106 43.27
1855. tstats[spyro1411] (spyro1411) 245 57.69 69.17 35 14.29
1856. Walson (wals) 244 68.49 98.93 64 26.23
1857. 𓇋𓋴𓆑𓏏𓅪 (infer... 244 85.22 122.49 78 31.97
1858. AM (freae) 244 85.46 108.13 87 35.66
1859. Sajib (dipto) 244 51.72 73.31 39 15.98
1860. pausechamp (dindondoe) 244 150.76 221.67 172 70.49
1861. CrashRAcer1 (crashracer1) 244 52.36 77.70 26 10.66
1862. Ayden (aydensonline) 244 86.53 120.83 67 27.46
1863. Richard (redjoe) 244 104.77 134.29 112 45.90
1864. norush (norush) 244 84.90 102.24 66 27.05
1865. Rahaf (rahafalahdab) 243 44.88 57.00 25 10.29
1866. Eric (pawnnub) 243 89.35 131.88 86 35.39
1867. mrbean (mrbean1) 243 87.20 104.54 95 39.09
1868. mv0 (the_oko) 243 87.45 104.09 75 30.86
1869. sk (kasem132) 243 62.87 81.56 49 20.16
1870. Crasedes (crasedes) 243 80.60 104.07 60 24.69
1871. Damian (kztryu) 242 55.40 77.34 26 10.74
1872. Shayne (shayneacasio) 242 87.85 124.52 81 33.47
1873. . (cuzto) 242 76.31 107.97 53 21.90
1874. Rabi (rabiulislam9) 242 61.47 86.22 57 23.55
1875. Lirei (lirei) 242 96.79 120.03 68 28.10
1876. jean (jhyppoli) 242 49.57 68.52 16 6.61
1877. Iqbal Ahmad (iqbal2021) 242 47.34 66.06 27 11.16
1878. Jay (eradekator) 241 94.28 116.24 72 29.88
1879. Benji (benbind1) 241 85.75 109.55 69 28.63
1880. Arschwurst (arschwurst) 241 48.67 62.81 26 10.79
1881. Anisur (anis_017) 241 77.14 99.18 43 17.84
1882. Amogh (amogh_14) 241 80.35 103.45 75 31.12
1883. Aditya (aditya2712) 241 75.28 97.27 62 25.73
1884. Stijn (stijnmeijssen) 241 77.03 105.23 48 19.92
1885. Hour (soslow_) 241 59.29 76.81 34 14.11
1886. Bijay (shresthabijay) 241 64.17 86.84 48 19.92
1887. Joaquin (wakincloset) 240 91.00 110.57 92 38.33
1888. Andrea (tinola) 240 77.11 96.22 51 21.25
1889. Alex (aleksandr797) 240 73.67 94.57 67 27.92
1890. Jonathan (insanegamerwow) 240 132.85 167.10 173 72.08
1891. DeeDee (deedee09) 240 68.04 81.17 49 20.42
1892. William (bobodahobo54) 239 88.39 105.80 65 27.20
1893. SaeedUllah (asadjani) 239 59.28 76.84 39 16.32
1894. Allen (xs_ageart) 239 106.14 131.82 109 45.61
1895. Konstantinos (sotos01) 239 43.87 61.41 160 66.95
1896. Prajwal (prajwalr) 239 56.67 75.22 38 15.90
1897. page (phrynesc) 239 73.28 86.76 66 27.62
1898. Ritesh (ritesh_98) 238 63.29 86.74 52 21.85
1899. Pedro (peter50latam) 238 53.00 80.22 22 9.24
1900. Krispy (krispytypes) 238 119.56 144.01 129 54.20
1901. Missy (lovelydy) 237 84.73 104.69 62 26.16
1902. LoneRusher (lonerusher) 237 78.70 99.87 61 25.74
1903. gabe (gabeeeeee) 237 96.06 140.01 87 36.71
1904. mostafa (eng_mustafa) 237 68.65 91.63 59 24.89
1905. Dhaval (dhaval06) 237 73.67 96.31 71 29.96
1906. Chaos (chaoszed) 237 87.29 112.28 80 33.76
1907. Caffebar kb lmao! (baccupacc) 237 142.80 172.17 182 76.79
1908. Absect (absect) 237 44.37 59.62 22 9.28
1909. Snail (type_of_a_typer) 237 57.40 70.43 27 11.39
1910. Doan (zzzhzzz) 236 60.91 83.62 47 19.92
1911. Zen (zenchan123) 236 101.60 147.96 94 39.83
1912. Matrix (ss005) 236 83.74 104.55 68 28.81
1913. Anatoli (errormaker) 236 73.65 90.04 42 17.80
1914. Pawel (el3ctron) 236 36.42 49.38 11 4.66
1915. Chronic (cheng01) 236 44.01 59.37 12 5.08
1916. Casper (bighero86) 236 67.32 88.10 59 25.00
1917. beatrace (beatrace21) 236 55.80 76.63 23 9.75
1918. Austin (_8(|) (atrain742) 236 118.35 156.30 115 48.73
1919. Inferno (mohmadrid0) 236 113.37 144.09 191 80.93
1920. be nice slunt (jokii) 236 128.12 162.13 152 64.41
1921. Jejo (jejo03) 236 60.89 83.78 45 19.07
1922. Natchanon (irmia223) 236 86.72 109.02 69 29.24
1923. Roshan (roshan_satare) 235 77.79 97.82 73 31.06
1924. Joe (__joe___mama__) 235 87.84 119.29 62 26.38
1925. djagof (zuccandsucc) 235 105.29 134.07 149 63.40
1926. Akira (s_akira) 235 55.47 72.59 34 14.47
1927. Stelister (stelister) 235 74.84 96.01 71 30.21
1928. SMoon (smoon343) 235 60.29 75.76 39 16.60
1929. Khadea (charter) 235 121.56 154.55 131 55.74
1930. Brandon (baddoodle) 235 68.30 93.63 48 20.43
1931. Daito (blucantrell) 234 87.29 112.94 65 27.78
1932. Shubham (shubham_p) 234 39.79 60.59 16 6.84
1933. Kusmir (kusmir) 234 94.80 120.97 78 33.33
1934. jeremyWINZ (jeremiah_munguia) 234 117.12 156.06 110 47.01
1935. Julius (reallyoldfart) 234 33.15 48.11 19 8.12
1936. Jan (acpehalus) 234 71.02 101.91 57 24.36
1937. Abby (aeheffington) 233 111.10 135.39 116 49.79
1938. Saptarshi (lamda_cdm_10) 233 59.88 77.26 50 21.46
1939. Jagadeeswar (jd_300) 233 76.86 103.43 66 28.33
1940. Buchock (buchok) 233 51.97 76.01 23 9.87
1941. Jamo (thewindy) 233 97.00 123.03 93 39.91
1942. Syed Sheraz (syedsherazarshad) 233 32.53 50.38 24 10.30
1943. strgn (strgn) 233 30.40 42.42 24 10.30
1944. Stanislav (stanmkh) 233 90.32 124.68 64 27.47
1945. Vishwajeet Prasad (vishwaje... 232 62.95 82.22 69 29.74
1946. Ralph Angelo (slow_penguin) 232 85.27 111.21 53 22.84
1947. Nistha Nakarmi (simply_nisu) 232 57.88 77.49 39 16.81
1948. 🇹🇼 𝑹𝒆𝒑𝒖... 232 86.29 110.21 64 27.59
1949. Chumchum (aldzia) 232 97.61 127.89 148 63.79
1950. acg (acg26) 232 86.86 118.16 63 27.16
1951. fassasin (fassasin) 232 67.55 91.95 63 27.16
1952. Kotai (kotai) 232 74.16 100.37 56 24.14
1953. Tootels (joenasha10) 232 113.12 151.52 92 39.66
1954. Harry (hai1912001) 232 56.80 72.32 18 7.76
1955. Gojou (gojou_) 232 28.02 43.03 32 13.79
1956. Jerzy (mr_avocado) 232 60.20 76.74 42 18.10
1957. Jane (sarf) 231 85.35 113.61 81 35.06
1958. RainbowDude (rainbowdudenon... 231 114.69 159.45 93 40.26
1959. projectfupagain (projectfup... 231 91.62 110.20 78 33.77
1960. Ahmed (nesbmido) 231 129.65 168.18 142 61.47
1961. Temple (mason_carlson) 231 89.44 127.78 90 38.96
1962. nice'nslow (annoyingkid) 231 129.49 159.10 141 61.04
1963. Jaime Gabriel (_jetdoza) 231 88.38 123.70 76 32.90
1964. Boba (tapiocaman) 231 84.85 110.28 71 30.74
1965. Doniyorbek (doniyorbek7376) 231 60.16 76.52 39 16.88
1966. David (dave_em) 231 97.84 120.33 45 19.48
1967. Quinn (magicsoap444) 231 42.62 64.07 34 14.72
1968. Dhayanandh (ken_adams) 231 104.41 121.91 91 39.39
1969. jamal (jamalkhan651432) 230 46.78 61.93 21 9.13
1970. galei (galei) 230 100.75 139.88 92 40.00
1971. William (willmart16) 230 112.05 134.19 120 52.17
1972. Eric (qwarts) 230 105.53 138.65 83 36.09
1973. Jude (philivey) 230 76.48 96.88 47 20.43
1974. Murat (nocs782) 230 65.56 85.93 49 21.30
1975. HATE LAG! (11fingerstypist) 230 115.23 144.48 192 83.48
1976. epic (epicrako123) 230 93.50 117.12 118 51.30
1977. throw (bomnom) 230 113.31 147.38 129 56.09
1978. H7ti guy (eternality) 229 113.46 155.26 98 42.79
1979. Emilio (emilioc) 229 84.92 118.58 54 23.58
1980. ⚡DVORAK (dvorak_mg) 229 105.31 139.59 107 46.72
1981. prashant (prashant1847) 229 59.10 77.91 41 17.90
1982. Reverend Poo Poo Bum (poopy... 229 86.31 114.32 66 28.82
1983. obada (obada_yahya) 229 98.60 127.83 83 36.24
1984. Niels (nielsjensen) 229 111.52 153.85 106 46.29
1985. Angela (mee_123) 229 39.15 51.08 9 3.93
1986. Matthew (yossarian_milo_22) 229 93.97 110.54 71 31.00
1987. Martin (watchieboy) 229 96.77 128.67 87 37.99
1988. Tutuko (tutuko) 229 50.58 60.75 20 8.73
1989. thotbox (thotb0x) 229 72.10 95.36 58 25.33
1990. M (springfield12) 229 112.36 134.83 135 58.95
1991. Brandon (aceryeung) 229 76.05 109.67 53 23.14
1992. Niket (daspacebar) 229 70.69 94.67 61 26.64
1993. Yasser (yass_mg) 229 59.49 71.83 40 17.47
1994. INDIAN (armaan25) 228 69.89 89.69 53 23.25
1995. accuracy is hard (1omar1) 228 42.41 62.17 23 10.09
1996. AdamS (adamswabel) 228 68.72 88.50 47 20.61
1997. Tuukka (sblankg) 228 89.77 110.74 83 36.40
1998. Minnie (minniemouselondon) 228 87.86 111.45 75 32.89
1999. John (kingpigeon) 228 70.92 96.62 56 24.56
2000. Killyan (killyan) 228 94.72 127.28 89 39.04
2001. Pradhumn (darkinferno) 228 52.72 72.05 34 14.91
2002. bambang (breakingkeyboards) 228 86.06 106.73 77 33.77
2003. Aaron (a_aron) 227 57.01 74.64 32 14.10
2004. Joy (joypark21) 227 77.26 118.02 55 24.23
2005. Ian (iantu) 227 75.26 92.57 51 22.47
2006. ARW🔴 (appleredwarrior) 227 117.71 152.17 132 58.15
2007. QDDFR (qddfr) 227 54.05 77.03 44 19.38
2008. Girl (piemaniac) 227 84.78 113.74 63 27.75
2009. Royce (panda_7) 227 47.79 60.49 24 10.57
2010. Jacob (nutsak) 227 81.94 110.00 60 26.43
2011. Mike (mirkzzz) 227 67.88 83.80 27 11.89
2012. Jazz (melotea) 227 77.74 108.78 52 22.91
2013. zaoad (zaoad) 227 56.33 71.43 26 11.45
2014. Drovor (wwinder) 227 108.66 143.11 110 48.46
2015. JAFFAR (thetypingfreak) 227 54.78 82.22 47 20.70
2016. Shahryar (srashid3) 227 65.03 90.08 51 22.47
2017. Christian (amici117) 226 108.45 141.44 113 50.00
2018. Rafael (fegelein1234) 226 132.02 169.54 167 73.89
2019. fares (faressonar) 226 46.39 63.08 24 10.62
2020. slow typer (imnotflamez) 226 92.48 143.48 74 32.74
2021. Someone (gluroy) 226 57.40 72.77 40 17.70
2022. Hussain (sanpilot) 226 96.46 126.39 86 38.05
2023. omid (omidhopeful) 226 69.52 87.03 48 21.24
2024. Neil Franco (neilprangko) 226 116.63 158.38 130 57.52
2025. Axel (scorchill) 225 63.76 79.16 42 18.67
2026. bruh_momentum (travis358) 225 104.24 126.13 112 49.78
2027. Flying fingers (tg_gamer) 225 41.64 58.08 15 6.67
2028. Night (anemonighteye) 225 70.98 104.02 55 24.44
2029. Jared (jaredintyper) 225 88.46 111.62 75 33.33
2030. ak1ra (liamprogamerz) 225 77.70 95.76 56 24.89
2031. Janis (janisl1993) 224 71.45 92.82 56 25.00
2032. sinc02 (sinc02) 224 82.05 104.25 71 31.70
2033. sanny (scd92318) 224 81.05 115.54 66 29.46
2034. Pontus (ponhav) 224 113.45 142.15 114 50.89
2035. mohamed (mohamed_1800) 224 48.19 61.16 16 7.14
2036. Ankh (ankhaann) 224 39.73 52.09 14 6.25
2037. aditya (aditya1003) 223 47.19 56.89 20 8.97
2038. * (000100020003) 223 73.34 95.03 56 25.11
2039. Antonio (xxaposxx) 223 52.08 73.08 27 12.11
2040. BeltBoy (singbearcar) 223 56.91 71.34 29 13.00
2041. Malaikev (fonsdal) 223 74.79 97.38 56 25.11
2042. Nick (checksind) 223 109.93 133.91 106 47.53
2043. BR (brdiesel) 223 109.73 131.32 93 41.70
2044. Bùi (blackfl_12) 223 79.87 98.80 72 32.29
2045. Khai (khaikhai2) 223 114.23 149.44 120 53.81
2046. jia-da-kong (jiadakong) 223 61.38 74.63 57 25.56
2047. phantom (hrithikhack007) 223 59.05 82.47 33 14.80
2048. mostafa (mostafa_tantawy) 223 61.56 75.65 43 19.28
2049. mbi (mbi_) 223 36.89 49.22 22 9.87
2050. Rony (ravneet_b) 222 92.25 120.73 81 36.49
2051. kyle (poyser) 222 76.46 94.26 54 24.32
2052. Darth (darthverde) 222 77.07 106.82 56 25.23
2053. August (august148) 222 46.60 59.21 29 13.06
2054. arindam (ari2007b) 222 54.45 71.91 27 12.16
2055. Andie (andieeee) 222 74.78 123.19 72 32.43
2056. tstats[alexander98] (alexan... 222 64.26 83.02 35 15.77
2057. Abubakar (abubakaravg) 222 47.32 65.58 18 8.11
2058. Zain (zainabb) 222 63.79 84.08 56 25.23
2059. Adm1n (vilius8) 222 110.69 136.11 109 49.10
2060. tris (trisywc) 222 89.23 116.94 57 25.68
2061. Hendo (slimshadylfc) 222 94.67 124.97 95 42.79
2062. Rohit (kharkongor) 222 80.09 102.96 63 28.38
2063. ktp (ktp2222) 221 56.87 78.72 27 12.22
2064. (altrocality) 221 121.19 154.58 117 52.94
2065. Jocho Muaguadabo (alezander... 221 108.33 136.99 98 44.34
2066. Cheyenne (cheyennebuchanan) 221 36.16 53.07 9 4.07
2067. Rinmawia (rinmawia) 221 69.87 90.27 53 23.98
2068. Junkie (qwert_noob) 221 69.02 98.48 46 20.81
2069. nirmit (nirmit0) 221 64.83 80.08 40 18.10
2070. Philipp (dasdrache) 221 45.29 57.92 22 9.95
2071. xiaobao (xiaobaomontgomery) 221 43.98 59.12 16 7.24
2072. bray (sexhaver25) 221 93.23 136.94 56 25.34
2073. Zeeshan (zeeshan13) 220 94.47 131.94 74 33.64
2074. Richard (tbone001) 220 84.15 105.43 57 25.91
2075. Wilson (starkeyqiu) 220 78.79 106.02 56 25.45
2076. school (modernmarauder) 220 93.24 132.42 81 36.82
2077. Božidar Grgur (marcipanko) 220 68.60 87.13 56 25.45
2078. Sky man (koolienavy) 220 99.75 135.87 91 41.36
2079. Taiwan is a country (17lingh1) 220 85.07 109.13 65 29.55
2080. jnk (joelnanakwaku) 220 81.90 104.93 64 29.09
2081. Dean (dino22) 220 59.74 71.91 94 42.73
2082. Deepesh (codingdeepesh) 220 38.88 55.79 18 8.18
2083. clgq (clgq) 220 76.79 99.89 44 20.00
2084. Bloxxer (bloxxerboi_rblx) 220 59.88 88.77 46 20.91
2085. Harmonic (blitzzzz) 220 88.42 116.35 65 29.55
2086. Bekboalt (bekbo_0) 220 38.00 47.50 11 5.00
2087. bryan (bczw) 220 135.33 162.62 173 78.64
2088. John (blazian11111) 219 103.05 143.47 81 36.99
2089. lan (lenioniali) 219 48.72 63.14 22 10.05
2090. sunny (kamal787) 219 31.67 44.09 14 6.39
2091. (timjeffery44) 219 143.55 268.06 183 83.56
2092. Sahaj (sahaj01) 219 62.15 80.34 44 20.09
2093. Robbe (robbelbobel) 219 83.25 106.91 72 32.88
2094. Guest (nherbe_3) 219 62.78 91.45 40 18.26
2095. Mohamad (mohamadasghari) 219 75.67 107.10 50 22.83
2096. Aryan (arcuh) 219 85.05 112.37 76 34.70
2097. Andy (andyrox) 219 72.15 94.51 74 33.79
2098. amanmishra (amanmishra) 218 51.42 74.25 23 10.55
2099. Jeffrey (xxpreheattheoven) 218 89.35 110.06 82 37.61
2100. diva (vampirediva) 218 90.29 123.27 55 25.23
2101. ASHISH (ashish_typer) 218 53.23 74.14 23 10.55
2102. Marcus (flowerskullbeige) 217 86.68 115.24 61 28.11
2103. chang (chang1) 217 126.46 155.13 121 55.76
2104. tayoshu (tayoshu) 217 76.14 93.51 57 26.27
2105. Jonathan (jonapedia) 217 90.85 121.23 62 28.57
2106. not (not_vidhu) 217 71.65 95.81 67 30.88
2107. MiamMiam (miammiam100) 216 60.97 76.28 43 19.91
2108. iTay (mengleten) 216 92.62 122.22 78 36.11
2109. Wasif (waxif_dad) 216 45.56 63.11 26 12.04
2110. Shibasis (ship9x) 216 82.16 104.50 73 33.80
2111. Minä (arabwinner) 216 110.06 128.48 96 44.44
2112. Tomáš (eyzi25) 216 85.72 108.09 52 24.07
2113. EnkaOsaru (enkaosaru) 216 97.89 124.45 104 48.15
2114. rocket (dk0063) 216 51.71 67.99 12 5.56
2115. Danny (lifeupsidedown) 216 70.29 87.19 47 21.76
2116. J (leathface23) 216 62.06 76.95 37 17.13
2117. Jude (jfendo) 216 81.09 109.76 63 29.17
2118. King (kingmaverick07) 215 62.10 80.35 46 21.40
2119. joann (joannyo) 215 60.38 91.45 51 23.72
2120. J (jj024) 215 54.64 74.63 20 9.30
2121. JV (jibs12) 215 83.31 98.14 61 28.37
2122. Kuro (horikta) 215 60.93 85.46 48 22.33
2123. Gautam kumar pandey (gautam... 215 42.45 54.03 16 7.44
2124. saerith (arabianghosthaunting) 215 220.94 281.09 147 68.37
2125. Aaron (aaron5457) 215 61.86 78.02 38 17.67
2126. Rohit (rawheattt) 215 50.69 67.23 18 8.37
2127. Sanket (newbie24082002) 215 72.85 99.53 59 27.44
2128. Dima (zormik) 215 74.68 97.22 67 31.16
2129. youssef (youssefuser) 215 31.43 40.98 24 11.16
2130. UNSALEK #7379 discord (unsa... 215 90.41 123.61 55 25.58
2131. Beth (creepmother) 215 92.29 114.01 71 33.02
2132. Anh (billybean__) 215 103.32 131.33 83 38.60
2133. Edmund (emmit3) 214 65.53 90.91 46 21.50
2134. Dyer_Colemak (dyer500) 214 86.07 124.41 63 29.44
2135. Lian (paullian) 214 83.63 104.78 55 25.70
2136. Nootch (nootch) 214 112.05 146.02 122 57.01
2137. Lin (ltf0501) 214 77.51 96.15 44 20.56
2138. Abudlla.Marofi04 (jonsnow21) 214 44.71 58.46 25 11.68
2139. Isra (israabosada) 214 32.23 44.05 21 9.81
2140. Viktoras (haeven) 214 84.35 113.10 69 32.24
2141. Alex (arint) 214 87.60 113.16 71 33.18
2142. Ariffin (ariffin) 214 99.67 127.89 86 40.19
2143. aerospike (aerospike) 214 59.61 83.07 43 20.09
2144. Ems (emman123) 214 52.92 70.79 22 10.28
2145. Vinayak (vinrana) 214 70.16 89.58 65 30.37
2146. Stuipedd (stuipedd) 213 82.36 106.68 62 29.11
2147. Byunghyun (stringbottle) 213 74.13 97.47 52 24.41
2148. Cue (cuewitiwat) 213 72.69 97.79 50 23.47
2149. Chimney (chimneywastaken) 213 66.45 82.42 52 24.41
2150. Shannon (caseius) 213 86.11 110.22 78 36.62
2151. Ryan (relaxin) 213 143.23 181.36 131 61.50
2152. Brian (pocket_ace) 213 78.15 94.60 56 26.29
2153. ryan (anonymousboy321) 213 128.60 154.10 149 69.95
2154. Andrew (andumpling) 213 95.82 118.37 91 42.72
2155. victor (hungry_panda) 213 43.36 59.58 12 5.63
2156. Alutic (alutic) 212 91.84 114.13 90 42.45
2157. FrozenCroissant (frozencroi... 212 100.47 126.98 100 47.17
2158. exodia (exodiaa) 212 109.24 129.60 106 50.00
2159. :^) (kyeavnign) 212 130.60 176.13 148 69.81
2160. Hazem (zomaaa23) 212 61.33 79.01 41 19.34
2161. Dog acc (vick02) 212 129.05 154.08 130 61.32
2162. noah (randylehey) 212 92.69 119.81 74 34.91
2163. Monroe (monroeshindelar) 211 87.57 111.47 53 25.12
2164. Ghulam (malikgd65) 211 47.62 70.61 20 9.48
2165. Aarni (aarnib) 211 91.01 119.36 81 38.39
2166. LA LUNA, LA BELLA LUNA (fee... 211 120.60 161.68 125 59.24
2167. 👻 (damoru) 211 115.39 158.97 102 48.34
2168. ROOZBEH (verybadboy) 211 63.02 89.59 37 17.54
2169. Scott (typist2021) 211 64.55 79.52 56 26.54
2170. Mr.Typist (typer456new) 211 60.26 78.29 27 12.80
2171. ExtraSauce (thundertyping) 211 68.78 99.72 47 22.27
2172. kbd warior (spykids3) 211 101.96 139.93 101 47.87
2173. Yuhang (yuhang0722) 210 105.51 137.06 96 45.71
2174. Grzegorz (ulxori) 210 63.74 81.66 51 24.29
2175. Benny (typervain) 210 82.60 106.18 44 20.95
2176. Tahir (tahir_iqbal) 210 100.63 129.73 88 41.90
2177. Richard (allacrity) 210 71.47 86.02 40 19.05
2178. Ayman (akwah) 210 77.09 100.36 58 27.62
2179. Samvel (samveland) 210 89.91 125.32 62 29.52
2180. Ryan (rinselmann) 210 87.99 103.57 70 33.33
2181. duglass (rahafduglass) 210 62.43 84.02 46 21.90
2182. Myil (pink_coder0518) 210 51.31 91.51 28 13.33
2183. Morin (lordgroovy) 210 83.07 106.02 67 31.90
2184. Mr. A (itsabhi01) 210 82.74 106.91 90 42.86
2185. Juanpa (gokias_1234) 210 70.11 91.70 50 23.81
2186. Dras (dras227) 210 59.06 77.90 39 18.57
2187. Kratagya (chutiyatyper) 210 77.48 98.83 40 19.05
2188. elite (beatagent) 210 54.39 69.35 19 9.05
2189. Doiv (doiv23) 209 85.99 112.45 62 29.67
2190. Dmitriy (dj1vs) 209 69.67 89.07 54 25.84
2191. Bennett (bnnttnwhk) 209 75.83 95.27 50 23.92
2192. i am (ashou) 209 100.51 141.45 82 39.23
2193. odannnnnnn (quietkid) 209 82.17 111.19 53 25.36
2194. oddblob3000 (oddblob3000) 209 106.90 134.00 98 46.89
2195. Saken (hareket) 209 36.76 53.20 14 6.70
2196. Liampbjray (liampbjray) 209 72.48 97.45 50 23.92
2197. kaloyan (kalci) 209 71.58 96.61 46 22.01
2198. kyubkubkubkubyub (kyubkubku... 208 97.89 136.78 88 42.31
2199. jw (jw_c) 208 59.97 81.28 35 16.83
2200. Esman (hedwyn_the_nomad) 208 74.42 97.71 60 28.85
2201. rt (rtizzle) 208 69.35 92.94 62 29.81
2202. rahul (rku05) 208 46.38 63.97 22 10.58
2203. 𝐱𝐨𝐦𝐞𝐧𝐢... 208 78.88 104.17 53 25.48
2204. Rui Alexandre (tapadinhas) 208 50.13 64.52 16 7.69
2205. shaun (shaunbot_123) 208 68.40 91.34 55 26.44
2206. GaN (ganthegreat) 208 50.88 75.09 36 17.31
2207. ss (aaassssss) 207 29.21 40.15 25 12.08
2208. Joe (f1rest0rm) 207 64.47 83.59 39 18.84
2209. glenn (bukseng) 207 98.85 122.09 96 46.38
2210. Bean (beansbeansbeans) 207 84.71 106.33 41 19.81
2211. zaid (xoxygenkillerx) 207 68.98 95.24 50 24.15
2212. Soyuzbek (soyuzbek) 207 67.65 91.86 47 22.71
2213. SirAlig (siralig) 207 85.37 107.31 57 27.54
2214. Omid (zerodarkshadow) 206 66.25 89.98 52 25.24
2215. Nils (snils) 206 75.12 103.87 49 23.79
2216. Conspiracy (realkingofgames) 206 91.98 112.54 65 31.55
2217. Afsal (npafsal) 206 59.75 75.39 55 26.70
2218. Uncle John Jr. the 5th (che... 206 81.49 108.86 51 24.76
2219. | (canvaslol) 206 77.33 99.52 57 27.67
2220. Ivandro (bigivel) 206 90.15 107.99 75 36.41
2221. Nope (_sav) 205 83.13 98.60 61 29.76
2222. Noob (_anto_200) 205 35.83 52.33 22 10.73
2223. Khai (superoiishi) 205 88.12 106.31 78 38.05
2224. Shaishav (shaishav) 205 55.06 73.35 41 20.00
2225. Maheriniaina tstats[kevinrs... 205 84.69 111.69 54 26.34
2226. Grant (grantly) 205 97.61 131.90 90 43.90
2227. Gnarly (gnarlydawg) 205 87.28 110.08 53 25.85
2228. Zor-Pieu (peter00151) 205 84.58 103.20 48 23.41
2229. mr (mrantik1) 205 53.46 69.72 28 13.66
2230. Neo (meoo) 205 55.41 83.19 29 14.15
2231. Mathias (mattsric) 205 72.49 89.88 56 27.32
2232. Ryan (ronethenorseman) 204 84.57 102.86 47 23.04
2233. i'm slow (pndspirit) 204 94.97 124.61 78 38.24
2234. (nnas) 204 137.39 164.68 165 80.88
2235. Ngor (nagwick) 204 63.27 80.57 55 26.96
2236. Tyler (superkai65) 204 99.49 127.42 77 37.75
2237. DP (dragonphoenix) 204 57.27 68.25 33 16.18
2238. Darren (darrensey) 204 90.14 122.16 73 35.78
2239. Bas (basawasa) 204 75.41 98.24 55 26.96
2240. Golujs2000 (avinashjs2000) 204 52.48 70.17 20 9.80
2241. Juan (vlect2) 204 70.45 89.66 56 27.45
2242. JH (hou32hou) 204 86.85 107.88 59 28.92
2243. Ali (hardstone) 204 67.26 90.58 38 18.63
2244. Gert (hansonagarrett) 204 73.45 92.08 47 23.04
2245. Gordon (gordon_ramsay) 203 87.32 106.13 63 31.03
2246. Fearo (fearowastaken) 203 82.16 107.84 64 31.53
2247. runa (dawn_89) 203 57.29 71.67 30 14.78
2248. guest (chqnges) 203 141.14 173.40 150 73.89
2249. Byron (byrontan) 203 100.19 125.81 99 48.77
2250. Đỗ (bigcatyoyo) 203 72.13 90.30 47 23.15
2251. Ranch (ranchie) 203 80.38 107.34 60 29.56
2252. Ragnar (ragnar000lothbrok) 203 67.13 80.75 46 22.66
2253. Pavan (pavan1000) 203 54.18 65.46 17 8.37
2254. Mattias (matejko203) 203 44.67 64.95 18 8.87
2255. Sadie (thotchakra) 203 82.29 108.05 70 34.48
2256. Jayson (thezeful) 203 77.65 100.03 80 39.41
2257. supermonkey (sup3rm0nk3y) 203 80.10 98.23 44 21.67
2258. Joshua (shaggymuffin23) 203 88.43 104.39 69 33.99
2259. Ta-Wei (waynetu) 202 97.18 111.64 88 43.56
2260. Trent (tdavis23540) 202 82.96 109.41 55 27.23
2261. 🤫 (semajames) 202 152.85 195.47 162 80.20
2262. Kim (rsoler) 202 67.80 88.43 35 17.33
2263. 3.14 (rom3_141592) 202 87.98 118.75 47 23.27
2264. Patrik (pbody) 202 79.22 100.66 52 25.74
2265. Mahjabin (mahjabin08) 202 31.27 40.62 17 8.42
2266. Khizer (khizlaw) 202 91.79 114.68 58 28.71
2267. Non-quit (hitman2207) 202 112.21 136.72 106 52.48
2268. harshit (harshit712) 202 73.73 102.39 54 26.73
2269. Feariscool (fearisdumb) 202 60.30 79.45 45 22.28
2270. Donovan (donovanle) 202 92.82 121.21 64 31.68
2271. bataa (batuchka) 202 60.29 83.32 49 24.26
2272. Bruno (brutal_posso1) 201 42.20 55.63 9 4.48
2273. Ismail (ismailo) 201 92.59 122.04 85 42.29
2274. Vu (vuquynghia2) 201 61.95 80.41 40 19.90
2275. Luna (vexara) 201 109.56 141.93 95 47.26
2276. Nervous (unselfishnervousha... 201 78.98 103.76 60 29.85
2277. TennisGOAT (tennislegend1234) 201 60.66 79.23 32 15.92
2278. adel (thenewb) 201 47.48 60.91 17 8.46
2279. w (shwilliam) 201 80.63 99.98 49 24.38
2280. Pokeman (poke_man) 201 86.84 113.97 64 31.84
2281. Ox (oxtookbronze) 201 83.48 103.85 59 29.35
2282. chupapi (nerve784126) 201 61.06 82.21 45 22.39
2283. Sasha (moongue) 201 59.78 78.71 34 16.92
2284. et (amogus_irl) 201 79.83 104.60 58 28.86
2285. :( (altrocality_dvorak_acc) 201 121.44 145.99 108 53.73
2286. Sean Wrona (arenasnow2) 200 183.61 226.45 182 91.00
2287. igs (x7041) 200 110.28 136.78 101 50.50
2288. Krimmson (wrk4thjkr) 200 60.00 79.12 24 12.00
2289. jawn (turtlesrule) 200 133.51 173.00 125 62.50
2290. steel (steelmax1214) 200 68.56 88.98 63 31.50
2291. RI (speedraceriyer) 200 85.52 119.92 50 25.00
2292. Luka (soleesoki) 200 75.20 102.31 58 29.00
2293. Raunak (englishassignment) 200 99.73 130.78 81 40.50
2294. Dastan (dastangosu) 200 82.77 102.99 71 35.50
2295. Drew (bigboisausage) 200 100.18 134.57 79 39.50
2296. m0nsteR (m0nsta321) 200 105.03 128.90 98 49.00
2297. Noman (khan_noman14) 200 95.13 115.12 65 32.50
2298. Jonas (jonaslabryinth) 200 89.27 113.67 72 36.00
2299. Sensei (jjxjacpot) 200 88.24 114.16 76 38.00
2300. Hussein (husseinabbas) 200 47.96 61.49 17 8.50
2301. Himanshu (himanharsh) 200 53.47 66.82 25 12.50
2302. hein (heinthant) 200 71.51 92.61 40 20.00
2303. Hal (hals11) 200 107.09 139.62 90 45.00
2304. FunkyChunkyMon (funkychunky... 200 90.04 121.03 61 30.50
2305. Deathnote (sanjay_kumar) 200 57.58 83.36 38 19.00
2306. Robert (rrobertt3137) 200 92.99 122.84 75 37.50
2307. RacerTracer (racertracer) 200 44.69 63.25 14 7.00
2308. oni (onifire) 200 79.33 100.32 47 23.50
2309. Murcury (murcury_) 200 60.33 76.85 40 20.00
2310. Ivan (sakhman) 199 59.63 80.39 32 16.08
2311. Mirjalol (mirjaloltv) 199 44.71 58.51 21 10.55
2312. Mariam (mariamgharraph) 199 54.51 80.79 28 14.07
2313. TribalAxe (darkulas) 199 76.08 96.52 50 25.13
2314. Cameron (cameronicheese) 199 101.22 137.52 81 40.70
2315. guest (okokok1234) 199 68.58 90.07 36 18.09
2316. stream census designated by... 199 82.18 113.82 56 28.14
2317. Phung (longphung151198) 199 94.99 117.37 89 44.72
2318. Liu (liusbl) 198 107.11 125.47 90 45.45
2319. Elias (eddyede) 198 73.55 97.68 38 19.19
2320. 🌸Peaches & Cream (easy_g... 198 117.75 143.53 90 45.45
2321. Dhruv (dhruvarora) 198 66.18 85.87 45 22.73
2322. kirito (boscomk3) 198 61.14 78.68 38 19.19
2323. ᕙ( ͡◉ ͜ ʖ ͡◉)ᕗ ... 198 78.94 106.93 55 27.78
2324. rohan (rohanktksu) 198 51.54 81.98 17 8.59
2325. helga (pataki29) 198 43.68 61.30 18 9.09
2326. cody (ocdy1001) 198 87.34 109.40 65 32.83
2327. medD (mistermask___) 198 92.28 132.69 74 37.37
2328. Keo (mightkeo) 198 69.85 91.39 39 19.70
2329. Amorphous (tawseef) 198 56.31 69.72 20 10.10
2330. McMac2 (sjm46) 198 108.91 134.41 97 48.99
2331. Shivanju (shivanju) 198 75.21 91.37 47 23.74
2332. yassine (yassie) 197 52.29 74.36 26 13.20
2333. toomuchads (toomuchads) 197 78.98 103.47 50 25.38
2334. Cornelius (salibzz) 197 97.09 120.56 68 34.52
2335. rohan (rohan_verma__) 197 74.73 92.87 36 18.27
2336. yuuth.shop (roadto5wpm) 197 112.78 149.72 86 43.65
2337. incendiary (returnoftheince... 197 162.81 196.84 177 89.85
2338. Pogfrog (pogfrog1) 197 112.62 137.89 92 46.70
2339. Jo (noone21) 197 90.38 134.96 84 42.64
2340. Michael (michaelchristian024) 197 96.19 131.46 76 38.58
2341. logan (lacton44) 197 84.27 110.76 70 35.53
2342. Kakini007 (kakini) 197 65.70 96.34 34 17.26
2343. Jynx (jynx__) 197 73.51 93.48 47 23.86
2344. J (jellyfiszh) 197 81.87 114.28 60 30.46
2345. Haniel (ivious) 197 75.08 100.08 45 22.84
2346. Cain (gigabite) 197 69.07 90.49 53 26.90
2347. Gibus (ghastless_gibus) 197 74.05 101.30 54 27.41
2348. Danny (dannyzzzzz) 197 101.38 128.31 76 38.58
2349. chigala (chigalakingsley) 197 47.48 74.86 19 9.64
2350. Arasu (arasu) 197 106.63 137.73 94 47.72
2351. Emperor (aranjani) 196 63.00 83.71 41 20.92
2352. Sotonation (akatrell) 196 95.17 113.40 67 34.18
2353. vishy (drdrunkstain) 196 53.94 75.89 27 13.78
2354. Leo (leo8786) 196 156.46 178.66 167 85.20
2355. tstats[kayeii] (kayeii) 196 85.87 105.89 56 28.57
2356. Juan (juanma09) 196 38.31 53.45 9 4.59
2357. Nitin (xintacious) 196 73.26 95.09 34 17.35
2358. wonder wave (wonderwave2) 196 107.55 130.46 90 45.92
2359. Sparsh (sparsh123) 196 91.58 126.74 59 30.10
2360. Mr. (serallfreedbear) 196 101.70 128.68 91 46.43
2361. Pheresint (pheresint) 196 95.89 117.26 68 34.69
2362. Peter (petejim) 196 78.39 100.60 42 21.43
2363. Patrick (ricccccckkkkkk) 195 75.08 103.73 56 28.72
2364. Technician (tech23) 195 72.67 96.23 60 30.77
2365. Shashank (shashank204) 195 86.34 102.23 43 22.05
2366. ErrorOp (error_op) 195 44.48 63.07 19 9.74
2367. cold (coldmind) 195 74.74 95.91 51 26.15
2368. Aleph (catblahfishblah) 195 73.40 103.21 58 29.74
2369. Bartłomiej (bodidogg) 195 40.74 56.56 19 9.74
2370. frank (frankpc) 194 78.74 99.97 55 28.35
2371. Anubhav (etra_567) 194 70.70 103.25 47 24.23
2372. code_brains (coderider) 194 104.25 138.57 92 47.42
2373. not rage (sadge47) 194 86.35 105.72 50 25.77
2374. qbaracerr (qbajanowski) 194 50.82 67.80 13 6.70
2375. Naha's (naha_26) 194 43.00 59.57 22 11.34
2376. Mehedi Islam (mehediislamri... 194 68.34 96.00 40 20.62
2377. marsistX (marsistx) 194 74.09 88.95 45 23.20
2378. Jujee (jujee_poo) 194 55.33 78.03 47 24.23
2379. jkdixit (jkdixit) 194 42.62 56.77 14 7.22
2380. Fuzusu (fuzusu) 194 94.42 122.97 79 40.72
2381. Zuhair (zishraq) 194 83.31 97.62 43 22.16
2382. Jackson (united9jackson) 194 91.91 129.44 75 38.66
2383. west (supernova_00) 194 63.43 87.52 32 16.49
2384. RIP Byron (sir_rebral_palsy) 194 140.36 180.69 139 71.65
2385. Stefan (_tensor) 193 99.24 122.11 94 48.70
2386. FGS (simo666) 193 91.60 121.46 63 32.64
2387. Brys (seabyzz) 193 56.78 69.19 21 10.88
2388. Thijs (qazygv) 193 44.54 63.88 18 9.33
2389. niceu (nice_u) 193 94.58 122.22 62 32.12
2390. Viktor (milkboofer) 193 62.00 78.12 37 19.17
2391. Hai (haitathoc) 193 75.00 97.12 37 19.17
2392. TTVronness_ (ronneclee) 192 96.62 119.91 63 32.81
2393. JanBa (pythonbyte) 192 96.66 127.46 68 35.42
2394. Himal (panthimal) 192 55.84 71.33 22 11.46
2395. Matt (mattymarsh) 192 103.38 126.53 89 46.35
2396. Stefan (stefanbm) 192 77.24 91.80 50 26.04
2397. Anthony (smashingted) 192 69.56 92.74 51 26.56
2398. Finally (finallyyes) 192 63.64 84.59 66 34.38
2399. erbol (erbolxac) 192 37.60 51.06 11 5.73
2400. chachasoba (chachasoba) 192 104.99 126.14 101 52.60
2401. Chetan (ch374n) 192 106.22 136.03 85 44.27
2402. A (b04501012) 192 61.48 75.43 36 18.75
2403. Farameer (farameer1) 191 99.41 123.72 69 36.13
2404. Earlvin (earlvin14) 191 124.62 146.79 111 58.12
2405. Death_Dragon (dead_beast) 191 50.47 63.61 15 7.85
2406. Chiaki (chickhiaki) 191 47.47 68.55 18 9.42
2407. Pasin (_hello_world) 191 68.53 86.91 39 20.42
2408. Weed (weeddinosaur) 191 89.41 112.39 87 45.55
2409. Troy (troy517545) 191 67.70 89.16 40 20.94
2410. new keyb who dis(k3 max) (s... 191 104.98 133.70 82 42.93
2411. Mustafa (leo_messi_) 191 60.88 80.00 38 19.90
2412. 👻 (james7890) 191 86.80 118.32 53 27.75
2413. Punit (punitsubudhi) 191 50.80 69.90 35 18.32
2414. Andreas (mangabro) 191 68.81 87.01 39 20.42
2415. Ahnaf (ahnaf75) 191 84.24 101.52 53 27.75
2416. Abdul (asalam) 191 30.80 39.84 11 5.76
2417. Polar (polar_6275) 191 67.56 90.58 49 25.65
2418. AKSHAT (akshat1234) 190 57.09 74.28 89 46.84
2419. Adrianix (adrianixx) 190 92.61 120.48 68 35.79
2420. Kenn (kenn_double_n) 190 103.36 127.01 76 40.00
2421. Iris (irxs) 190 29.12 46.53 27 14.21
2422. J (irocamora) 190 72.98 92.41 50 26.32
2423. $$$$ (for_fun) 190 83.34 107.18 49 25.79
2424. R (fjasifjaficaom) 190 55.04 70.78 27 14.21
2425. Abdul Hannan (detective_ahg) 190 65.24 85.22 36 18.95
2426. Aurel (big_boss1) 190 128.64 170.37 114 60.00
2427. Бақытжан (baqytjan) 190 51.67 65.90 21 11.05
2428. avocadoLover (avocado_lover) 190 45.48 74.11 22 11.58
2429. zen (zen181) 190 88.90 114.87 70 36.84
2430. Маершон (timeandsoul2) 190 149.41 196.34 158 83.16
2431. Octo (octophobia) 190 109.29 151.94 87 45.79
2432. Peter (metalhead2021) 190 49.04 63.15 12 6.32
2433. Danny (beegd) 189 137.62 184.50 154 81.48
2434. Bataa (bataa_cdj) 189 74.67 95.66 46 24.34
2435. Auveed (auveed) 189 92.83 110.82 65 34.39
2436. epicface (adowoable) 189 92.17 120.86 67 35.45
2437. Eli (elisped1) 189 116.35 149.36 113 59.79
2438. isekai (krimsonly) 189 78.67 101.72 54 28.57
2439. Kristoffer (koffer96) 189 68.66 94.10 41 21.69
2440. Jimmy (jimmy_voe) 189 77.35 102.55 42 22.22
2441. Gmorcad (gmorcad) 189 105.20 134.39 85 44.97
2442. Himanshu (himanshu_sahni) 188 68.08 86.14 38 20.21
2443. Gjd (gwvj) 188 58.64 77.19 33 17.55
2444. Jaxon (fusion13) 188 80.96 104.87 54 28.72
2445. yomum (ahmet_ergun) 188 57.13 72.24 23 12.23
2446. ReTiRedz (retiredz) 188 78.82 103.88 83 44.15
2447. Prithvi (psprithvi) 188 78.97 96.93 59 31.38
2448. shawty (pogchampion1969) 188 85.00 101.06 47 25.00
2449. Okh (okh10001) 188 63.29 79.24 40 21.28
2450. Roshan (noob_master9901) 188 86.66 124.71 55 29.26
2451. Ethan (etstein) 188 81.58 103.47 49 26.06
2452. ngoc huy nam (destroy_the_w... 188 102.65 133.57 79 42.02
2453. David Abdelnour (davidabdel... 188 62.02 81.16 44 23.40
2454. neverm0r (datamagi) 188 76.17 107.05 51 27.13
2455. Brrrdman (birdmanmcinnes) 188 59.13 77.24 22 11.70
2456. Banda (bandamaker) 188 70.07 90.92 51 27.13
2457. Vijay (vijays4404) 188 66.03 94.65 45 23.94
2458. Ayush (typer_ayush) 188 67.63 87.28 74 39.36
2459. StevieWonder (steviewonder69) 188 92.04 119.81 62 32.98
2460. bub (_bubble) 187 100.08 125.38 82 43.85
2461. Sassy (taingdavy) 187 60.84 83.06 35 18.72
2462. Merrick (skmq) 187 97.61 115.79 64 34.22
2463. oogy (owogy) 187 72.02 97.89 56 29.95
2464. Othman (othmanaldefer) 187 49.32 63.23 18 9.63
2465. Ron (gambling_addict_69) 187 94.11 113.82 54 28.88
2466. Aleks (aleks8) 187 71.63 87.09 52 27.81
2467. Colemak (colemaknub) 187 67.38 98.86 34 18.18
2468. Timothy (chuzzz) 187 85.96 116.62 48 25.67
2469. Chirp (chirpflewgone) 187 56.19 75.05 34 18.18
2470. Buri (buri_was_taken) 187 68.32 90.47 40 21.39
2471. Erik (erickano) 186 71.05 92.13 52 27.96
2472. EquityDeadlock (equitydeadl... 186 96.32 128.76 76 40.86
2473. Goyna (demon__rage__) 186 54.39 67.86 29 15.59
2474. Julie (codex13) 186 74.43 104.40 37 19.89
2475. Rajat (buttocks121) 186 50.65 67.17 24 12.90
2476. Beket (bayemirov) 186 103.12 126.40 66 35.48
2477. lunalululu (lunalululu) 186 95.67 115.28 74 39.78
2478. Jia (jia_desai) 186 69.76 92.05 38 20.43
2479. return NULL; (honor12) 186 82.49 100.00 47 25.27
2480. Gabe (gablikestacos) 186 94.34 120.22 69 37.10
2481. Yet (yet1208) 186 67.23 92.88 35 18.82
2482. Turtle Speed (turtle_speed31) 186 43.06 66.14 20 10.75
2483. Seth (syarb) 186 100.41 125.31 92 49.46
2484. Samer (samiralbayati) 186 47.19 60.20 21 11.29
2485. Richit (richit690) 186 62.80 87.34 37 19.89
2486. pavan kumar (pavan2406) 186 53.12 64.60 24 12.90
2487. Gene (mckuletzz) 186 136.17 164.93 141 75.81
2488. NQ (nq_neilprangko) 185 109.16 139.86 92 49.73
2489. MrSaand (mrsaand) 185 100.32 115.98 64 34.59
2490. Social Credit (usa_baby) 185 94.75 121.60 75 40.54
2491. Alex (skoda888) 185 63.47 81.13 40 21.62
2492. Sameer (firefoxqb) 185 75.31 106.14 48 25.95
2493. cole (coldmak) 185 92.78 129.16 64 34.59
2494. Chris (letring) 185 98.42 124.01 84 45.41
2495. Italo (italo_x) 185 37.33 50.70 11 5.95
2496. Abhideep (imabhideep) 185 53.31 74.40 20 10.81
2497. Aestuosi (aestuosi) 185 92.46 113.22 56 30.27
2498. douzhen (akariin) 184 76.63 97.59 56 30.43
2499. Alex (kazuma_sama) 184 45.16 56.54 21 11.41
2500. Adam (deinonysus) 184 61.28 82.81 33 17.93
2501. daZai (dazzai) 184 53.89 65.20 38 20.65
2502. Raahil (ravana09) 184 95.51 127.53 63 34.24
2503. Prashant (pra0337) 184 46.19 59.84 14 7.61
2504. MIKA (oniichan69) 184 87.18 125.42 63 34.24
2505. Fat Squirrel (neihs) 184 100.92 129.56 87 47.28
2506. punit (thakelatyper) 184 78.62 101.62 35 19.02
2507. shubham (shubham2468) 184 59.71 81.13 33 17.93
2508. mai (mai74) 184 46.60 62.15 18 9.78
2509. Mason (luvmasxn) 184 46.55 64.74 32 17.39
2510. Koki (kohki) 184 69.20 84.76 29 15.76
2511. Rishab (kamado_) 184 59.41 76.05 51 27.72
2512. Jearcan (jearcan) 184 99.19 137.28 69 37.50
2513. Sentinel (greatsentinel) 184 122.23 151.95 116 63.04
2514. Learner (learner_dawg) 183 86.76 117.86 48 26.23
2515. deep (lamborghene) 183 105.40 143.67 88 48.09
2516. Gagan (ggnbakshi38) 183 64.41 83.49 48 26.23
2517. saad (saduman) 183 87.89 111.70 67 36.61
2518. (needforaccuracy) 183 116.62 143.37 96 52.46
2519. v (vlxu) 183 91.33 115.25 66 36.07
2520. Tuong (tuong_slow) 183 75.42 104.24 59 32.24
2521. arnav (trahimam) 183 65.01 87.32 44 24.04
2522. Sinful Sam (sinfulsam) 183 87.01 108.02 61 33.33
2523. Thomas (thomas70) 182 72.78 92.60 40 21.98
2524. Limey (limeycunt) 182 47.98 65.24 19 10.44
2525. Jimmy (jimster123) 182 75.50 93.43 52 28.57
2526. Spartacus (galvarino) 182 70.43 94.14 41 22.53
2527. Danoun (danounidananou255) 182 62.93 81.40 41 22.53
2528. Calvin (calvinguy) 182 130.25 177.11 127 69.78
2529. sanjeev (sanjeev_2020) 182 21.41 35.25 38 20.88
2530. Robert (robbstark) 182 80.03 99.10 49 26.92
2531. Reg (reggg) 182 101.53 126.94 70 38.46
2532. Paige (pfernandes_) 182 72.77 95.96 40 21.98
2533. N W (niwore) 182 87.17 109.82 57 31.32
2534. ilove cheese142 (ktylol) 181 83.59 129.56 47 25.97
2535. Karan (iamkaran2) 181 81.32 104.00 40 22.10
2536. Peter (appapollo) 181 78.36 99.10 45 24.86
2537. sausage go brrr (hasini_17) 181 56.50 77.31 30 16.57
2538. sergei (youserj) 181 39.02 49.81 15 8.29
2539. Bikram (wood_cutter) 181 75.38 92.39 53 29.28
2540. Sarah (swags20) 181 90.33 117.36 66 36.46
2541. swagatron (swagatron7000) 181 141.61 169.56 123 67.96
2542. Splonk (splonk) 181 84.90 108.20 70 38.67
2543. Soul (soulsforsweet) 181 76.54 97.16 38 20.99
2544. dong (dongdong7) 181 79.89 105.06 51 28.18
2545. Tuu (cetarin) 181 77.94 102.11 35 19.34
2546. Benjamin (benjaminsanta) 181 62.65 83.80 44 24.31
2547. aruj (b0b1000) 181 78.09 110.29 64 35.36
2548. eilonshi (eilonshi) 180 47.71 63.97 28 15.56
2549. Dimo (dimofte) 180 72.18 94.27 49 27.22
2550. hekima (ashery) 180 58.54 80.96 33 18.33
2551. Aniket (aniketsanghi) 180 86.45 107.57 51 28.33
2552. tourist (amey_9) 180 56.99 72.26 26 14.44
2553. Abdelmohaymn (abdelmohaymn) 180 40.46 56.67 16 8.89
2554. Arun (pyinjector) 180 58.06 79.71 43 23.89
2555. Sanket (maskii) 180 120.48 160.69 116 64.44
2556. Dinja (insanedjoker) 180 70.43 107.33 36 20.00
2557. Ham (hammah713) 180 53.69 68.86 31 17.22
2558. Luka (the_lukec) 180 68.95 102.99 42 23.33
2559. Sufi (sufi7) 180 33.33 67.69 14 7.78
2560. Ilovegays (smintz) 180 91.42 130.58 77 42.78
2561. Suryakanta (skroy) 180 53.32 67.71 18 10.00
2562. whough (williamhough) 179 95.15 118.09 62 34.64
2563. Sandeep Kumar (sandy14k9) 179 54.20 72.41 19 10.61
2564. Brussels (brussels11) 179 124.62 146.36 113 63.13
2565. Basil (basilenthusiast) 179 69.11 116.33 53 29.61
2566. RB (rbs_) 179 66.23 84.81 36 20.11
2567. Ksairos (ksairs) 179 61.03 78.26 44 24.58
2568. Jebediah (jebediah123) 179 117.44 140.40 117 65.36
2569. NZY (janghanseok) 179 84.72 109.36 49 27.37
2570. Hong (hong41) 179 52.77 69.79 16 8.94
2571. Eugene (genedaman94) 179 67.33 98.65 38 21.23
2572. Lourd (edmund04) 178 69.80 92.58 39 21.91
2573. Chronopolize (chronopolize) 178 100.44 141.64 62 34.83
2574. b!g (b_i_g_em) 178 83.66 99.71 51 28.65
2575. Michael (buckley12) 178 91.84 123.61 44 24.72
2576. Nick (bluepenredpen) 178 84.26 112.33 43 24.16
2577. BLLA (bellaperez) 178 65.58 85.48 44 24.72
2578. Azizbek (azizbek00) 178 62.47 79.41 34 19.10
2579. Dylan (yorkingharp67) 178 46.73 65.72 28 15.73
2580. विघ्नेश (no_l... 178 55.15 70.44 23 12.92
2581. Nabeel (nobleboi10) 178 79.39 104.39 95 53.37
2582. 03496203150 (my_whatsapp_nu... 178 57.22 72.68 28 15.73
2583. arigrate (mercury80) 178 99.57 124.59 80 44.94
2584. nightingale (add4line) 178 162.62 213.93 150 84.27
2585. Mark (10100) 178 73.02 91.49 57 32.02
2586. Zakk (zakkcp) 177 79.74 99.70 35 19.77
2587. youm (youm) 177 77.07 98.06 40 22.60
2588. Trabota (trabota) 177 113.77 138.25 85 48.02
2589. Jose Manuel (slowmanl0l) 177 85.07 115.70 49 27.68
2590. Mahay (mahay316) 177 65.11 78.97 40 22.60
2591. Kimie (lil_pulsar) 177 84.86 118.73 53 29.94
2592. judo (judowrld) 177 44.02 65.59 41 23.16
2593. mobin (irmobin) 177 55.00 71.46 36 20.34
2594. Shubham (ikamthania) 177 58.44 72.12 25 14.12
2595. Leo (hogsh9862) 177 93.09 121.54 59 33.33
2596. McKay (heyitsyaboi) 177 71.63 97.28 47 26.55
2597. :) (erincur123) 177 59.94 75.84 32 18.08
2598. Court (courtmw) 177 48.22 64.02 16 9.04
2599. awabin (awabin) 177 48.13 81.11 22 12.43
2600. XD (oma3) 177 73.85 88.79 45 25.42
2601. StallmanWasRight (misterhotel) 177 121.64 151.77 93 52.54
2602. moosophy (pepperoni_cat) 176 41.53 51.71 14 7.95
2603. Duke (needdiscipline) 176 91.41 121.48 65 36.93
2604. Maksim (morysoff) 176 76.45 97.66 48 27.27
2605. Peace in world (marcog7) 176 80.25 105.47 45 25.57
2606. Nectarios (locomolotov) 176 102.24 138.66 59 33.52
2607. Akizumi (linaaron) 176 62.18 92.48 39 22.16
2608. Kinoktia (kinokita) 176 68.77 88.14 46 26.14
2609. JD (jigglyjd) 176 68.17 86.85 41 23.30
2610. Jack (jacjack) 176 70.44 90.27 27 15.34
2611. Hesh (heshg) 176 81.54 107.55 49 27.84
2612. Sadiqa (sadiqa_ansari) 176 38.35 50.52 12 6.82
2613. Zandro (zandrocraft) 176 68.37 96.44 42 23.86
2614. Evgeny (x1p234) 176 55.91 70.16 16 9.09
2615. Scyx (scyx3) 176 59.07 84.67 33 18.75
2616. Jose Ruel (braveheart143) 176 51.01 66.73 24 13.64
2617. Eveningthing (evntd) 175 76.85 98.27 43 24.57
2618. Choong Hyun (chlee) 175 66.11 91.89 44 25.14
2619. my name (calmthyself) 175 93.67 107.85 55 31.43
2620. Ryan (rdeorio) 175 83.23 101.49 47 26.86
2621. mayr (mayruwu) 175 67.12 89.65 51 29.14
2622. Mac (mac123456) 175 83.29 104.05 59 33.71
2623. ALI (legend_haddad) 175 55.58 73.03 27 15.43
2624. Julian (juliansmile) 175 86.77 105.69 51 29.14
2625. Ioannis (johndigolis) 175 69.08 83.30 43 24.57
2626. Jake (jakeowens) 175 81.02 105.93 48 27.43
2627. JiGsaW (homeboy2603) 175 105.93 134.06 77 44.00
2628. Mohammed (guitarist999) 175 65.45 89.34 44 25.14
2629. greed (greedthelazy) 175 81.65 106.85 67 38.29
2630. Victo (victo_sn) 175 102.99 144.99 81 46.29
2631. Robby (tddvorak) 175 62.50 92.18 34 19.43
2632. Wob (wobber) 174 64.28 88.08 53 30.46
2633. tstats[v415hn4v] (v415hn4v) 174 31.81 42.50 12 6.90
2634. Tarek (o_stady) 174 71.37 84.92 38 21.84
2635. Naman (namanjain) 174 43.25 52.87 20 11.49
2636. Rahim Abdur (arbijoy1717) 174 45.10 55.32 14 8.05
2637. Angelo (angelo13c) 174 78.73 93.46 50 28.74
2638. Connor (ct2019) 174 58.70 76.12 32 18.39
2639. John (beefysalad69) 174 96.17 124.10 84 48.28
2640. Itsuki1 (itsuki1) 174 58.52 79.18 42 24.14
2641. Brandon (kirbyfan107) 173 116.98 151.71 98 56.65
2642. joshua (jimpdashrimp) 173 95.51 126.13 62 35.84
2643. An Ackerman (iamvr) 173 53.39 65.81 15 8.67
2644. Abhinav :P (abhi_typist) 173 64.33 84.06 42 24.28
2645. Kyle (1cheeseisyummy5) 173 95.64 127.68 78 45.09
2646. RagingChris (ragingchris) 173 89.53 120.41 58 33.53
2647. Coder (the_coder_bro) 173 68.34 85.61 38 21.97
2648. Warren (slacker_xd) 173 96.19 117.65 71 41.04
2649. adrian (rixoner) 173 54.03 72.78 29 16.76
2650. T (raket124) 173 80.58 95.37 46 26.59
2651. Noobie (nooobie_typer) 173 63.66 84.90 41 23.70
2652. Tech (ninja_typer) 173 75.01 94.87 45 26.01
2653. Chris (mils8545) 173 63.19 77.63 31 17.92
2654. Eru (eru2) 173 83.78 110.95 48 27.75
2655. Dev (devk232) 173 50.71 72.67 16 9.25
2656. WindSlashKing (bujkata) 173 99.36 156.18 73 42.20
2657. Kirin (arya_juniko) 173 63.67 89.63 31 17.92
2658. fthe (fthe) 172 70.17 94.74 39 22.67
2659. evil007 (evil007) 172 47.08 66.58 18 10.47
2660. Anjal (deadashell) 172 66.42 85.75 35 20.35
2661. Cadmus (cadmus369) 172 65.79 87.14 40 23.26
2662. AvocadoTM (avocadotm) 172 67.89 87.86 39 22.67
2663. wenlong (wenlong) 172 51.64 69.27 12 6.98
2664. wz (taywzzzz) 172 72.59 94.27 50 29.07
2665. sumit (sumitmgr345) 172 64.57 82.26 37 21.51
2666. silvik (silvik_) 172 107.60 143.36 86 50.00
2667. Krish (krish108) 172 99.15 128.67 63 36.63
2668. Ardan (kevinardani) 172 69.75 90.59 45 26.16
2669. InNeedOfName (inneedofname) 172 96.42 133.56 56 32.56
2670. General (generalmalorn) 172 107.24 128.61 74 43.02
2671. Manoj (manjobanjo) 172 104.89 145.51 137 79.65
2672. moq (moq_) 172 89.79 112.31 65 37.79
2673. Neatrianty (neatrianty) 172 110.30 147.24 93 54.07
2674. Sayat (sayko05) 171 37.71 49.80 14 8.19
2675. Nagaro (nagaro) 171 76.65 95.66 47 27.49
2676. Marko (markodob) 171 45.23 58.88 12 7.02
2677. Jacinth (levesis) 171 73.95 103.89 45 26.32
2678. Joshua (lckjosh) 171 109.51 130.91 78 45.61
2679. paddy (kattumanidhan) 171 93.09 140.29 71 41.52
2680. Kate (kate366) 171 78.45 102.02 45 26.32
2681. Richard (jorimi) 171 82.76 119.49 47 27.49
2682. What (hunglatahb1) 171 92.43 113.13 51 29.82
2683. Heather (heannn) 171 75.02 100.65 44 25.73
2684. Cho (cho82) 171 69.09 82.44 46 26.90
2685. Ella (chawahir) 171 152.94 181.26 114 66.67
2686. Arsalan (arsalan_khan) 171 31.79 47.11 31 18.13
2687. Nyaruko (tatrz) 171 82.12 108.42 63 36.84
2688. sys (sysuser) 171 46.22 57.02 11 6.43
2689. Abdujalol (abdujalolerkinov) 171 57.42 73.89 39 22.81
2690. alv (alvdev) 170 60.02 71.50 28 16.47
2691. Rei (sleepyray) 170 65.22 86.25 45 26.47
2692. Feli (dottedladybug) 170 79.94 98.75 39 22.94
2693. Harsh Yadav (bestial) 170 59.58 81.16 32 18.82
2694. AYOUB (ayoub_dkhissi) 170 44.81 59.13 29 17.06
2695. Mateusz (mattinato21) 170 119.43 154.89 3 1.76
2696. Syed Ali (mafailure) 170 69.57 92.55 40 23.53
2697. Jørgen (jorgen1999) 170 65.43 93.01 33 19.41
2698. Jordan (invictusj) 170 72.45 93.13 43 25.29
2699. hello (imfeelingunlucky) 170 82.37 113.68 37 21.76
2700. VP (illermike) 170 67.27 82.20 40 23.53
2701. BLU (glitterblonde) 170 88.20 110.31 57 33.53
2702. Zhijian (zliangal) 170 59.10 75.41 33 19.41
2703. TheBossOfTheBoss (thebossof... 170 92.42 115.80 57 33.53
2704. Sumit (sumit0003) 170 42.36 66.81 17 10.00
2705. MTGAP | Tokimahery (tokimah... 169 79.45 105.28 60 35.50
2706. Malik (sonatabliss) 169 48.38 70.30 30 17.75
2707. Rdk (olegus) 169 71.14 90.42 47 27.81
2708. Gourav (mrgaurav2001) 169 49.24 70.68 35 20.71
2709. Martin (martinmaster) 169 71.23 84.46 44 26.04
2710. Marco (marcomilo) 169 103.47 129.32 70 41.42
2711. Lim (ac1ds) 169 72.21 91.88 40 23.67
2712. Cross (crosscategory) 169 54.87 70.99 19 11.24
2713. Ashish (ashk98) 169 55.28 78.17 30 17.75
2714. leon (leonzalion) 169 154.03 211.71 28 16.57
2715. Kiddoz (kiddoz) 169 67.93 83.31 31 18.34
2716. Toe Typer (ifingeryour) 169 61.75 81.58 34 20.12
2717. Kaloyan (kokicha120) 168 84.86 110.16 49 29.17
2718. kai (kainetic) 168 70.14 112.57 35 20.83
2719. Arjun (k9cruncher) 168 89.70 112.42 55 32.74
2720. Jacob (jwill420) 168 120.35 151.96 104 61.90
2721. Ghost (ghostdraon) 168 66.87 90.39 42 25.00
2722. Tushar (tjajodia) 168 73.18 102.66 45 26.79
2723. SPICY (spicynote) 168 83.53 101.41 56 33.33
2724. Nate (natekid11) 168 82.95 100.32 42 25.00
2725. Yu (mjtunes) 168 58.00 79.34 26 15.48
2726. ʕ·͡ᴥ·ʔ (memesis) 168 73.40 99.64 48 28.57
2727. Keith (flanneldemigod) 168 80.19 97.28 50 29.76
2728. Geeth (falsethunder) 168 68.17 99.39 32 19.05
2729. aida (cloudywithachanceofme... 168 121.82 160.09 95 56.55
2730. dumbosity (dumbosity) 167 126.75 162.99 110 65.87
2731. Gregory (contrum) 167 112.60 139.83 87 52.10
2732. CheemCreem (cheemcreem) 167 83.65 100.60 43 25.75
2733. Eli (silversweedie) 167 54.99 78.70 14 8.38
2734. Lauren (lsmithers619) 167 48.58 64.91 21 12.57
2735. josh (killer_queen_beats_hi... 167 71.82 84.13 37 22.16
2736. John (jlavelle) 167 92.46 121.13 53 31.74
2737. Halley (halxey) 167 68.52 91.47 131 78.44
2738. Abdelrahman (abdelrhaman_sh... 167 66.12 84.12 46 27.54
2739. Constantinos (488pista) 167 73.00 87.52 37 22.16
2740. Ayush (improve_type) 167 49.46 63.36 21 12.57
2741. Abdul Basit (abdul_thetypist) 167 46.26 63.74 16 9.58
2742. I am on the rise. (refined_... 167 51.95 69.42 81 48.50
2743. Pinekkone (pinekkone) 167 76.18 97.78 48 28.74
2744. Oli (piasekoli) 167 86.99 105.28 44 26.35
2745. Keagan (ngerks) 167 72.48 91.24 42 25.15
2746. Janc (psyy1234) 166 88.64 107.09 48 28.92
2747. Angkana (ployyjen) 166 82.88 102.83 38 22.89
2748. Onsterm (onsterm) 166 54.76 70.01 18 10.84
2749. Mike (mikayelb) 166 67.52 83.69 33 19.88
2750. Matthew (matt_daemond) 166 103.84 134.99 73 43.98
2751. moofasa (macywood) 166 84.56 116.59 57 34.34
2752. Lord Of Titans (lord_of_tit... 166 49.35 65.97 26 15.66
2753. Jacob (jacobascool) 166 60.05 77.46 27 16.27
2754. Lobster🦞 (itisu127) 166 79.41 105.53 73 43.98
2755. Voldemort (growthmindset) 166 95.20 114.26 63 37.95
2756. clover (fat_baby_hippo_312) 166 45.98 73.16 18 10.84
2757. 劉韋論 (evan1liu) 166 66.48 83.25 27 16.27
2758. DOO (datblakgai) 166 80.83 108.80 48 28.92
2759. Caegan (caegana) 166 121.39 158.07 87 52.41
2760. Hello (arnab_9997) 166 74.85 96.25 40 24.10
2761. Zakarya (zakarya420) 166 41.80 53.76 10 6.02
2762. Filemon (the_squad7) 166 42.82 51.87 9 5.42
2763. Alf (the_destroyer_of_worlds) 166 96.96 123.49 68 40.96
2764. Ab (abdir) 166 74.90 106.79 40 24.10
2765. Free (free_hour) 166 61.98 82.17 32 19.28
2766. Isabella (bellaa) 165 73.67 100.61 45 27.27
2767. Shane (shane_666666) 165 51.82 69.40 26 15.76
2768. David (dtnero) 165 83.65 103.73 51 30.91
2769. Dylan (dtg32148) 165 88.20 111.68 61 36.97
2770. bhanu (codingbegginer) 165 54.41 73.49 18 10.91
2771. Nick (cluelessneep) 165 87.96 101.08 46 27.88
2772. Beret (boina) 165 82.04 106.52 51 30.91
2773. Scott (scottjones25) 165 40.52 52.80 10 6.06
2774. ryu107 (ryu107) 165 59.36 79.60 28 16.97
2775. Rishi (qasz) 165 58.37 75.00 27 16.36
2776. dawid (nuclearmansnothot) 165 81.14 110.78 47 28.48
2777. Nikolai (nikovertus) 165 89.68 124.50 53 32.12
2778. Blue Alps, baby! (model_m_k... 165 84.90 111.41 60 36.36
2779. Mel (mel0214) 165 47.85 59.66 15 9.09
2780. Christos (lexmarkx) 165 60.07 81.49 33 20.00
2781. Leonardo (leo121) 165 62.82 77.03 33 20.00
2782. Matt (kirito3141) 165 88.57 126.81 43 26.06
2783. gujjar (gujjarji) 165 63.23 86.20 35 21.21
2784. bri (greased_lightning10) 165 85.36 113.05 60 36.36
2785. tade (tadessetic) 165 32.39 40.53 13 7.88
2786. Swaraj (swarajpande4) 165 91.99 119.74 52 31.52
2787. Nurlanbek (xtil_06) 164 46.04 58.91 8 4.88
2788. Kelvin (winlost2) 164 111.60 129.80 86 52.44
2789. Steve (stevie169) 164 75.35 91.97 33 20.12
2790. Colemax (sqxleaxes) 164 94.90 120.61 63 38.41
2791. bach (shuriken) 164 75.77 92.07 41 25.00
2792. shakthi (shakthi1731u) 164 74.07 98.50 34 20.73
2793. naveen (regretfulsalsa) 164 106.82 134.37 88 53.66
2794. Daggerpov (read_my_name) 164 111.06 133.77 82 50.00
2795. Preetish (preetishmajumdar) 164 76.66 96.70 38 23.17
2796. Manny (mannypack) 164 98.88 139.13 65 39.63
2797. Manjrnm (manjrnm) 164 97.98 124.87 68 41.46
2798. Enzo (enz0123) 164 97.93 120.64 72 43.90
2799. Emerald-Rose (emmarose_deleon) 164 42.71 56.25 23 14.02
2800. Dipankar (dipankarkumar275) 164 58.94 74.22 30 18.29
2801. damon (damonliv) 164 83.66 106.75 42 25.61
2802. CopiCat (copicat) 164 57.96 76.60 20 12.20
2803. Guðjón (krotari) 164 86.79 109.75 67 40.85
2804. Kenyaaa~~~ (kenzaa) 164 92.49 123.11 52 31.71
2805. kajak_CZ (kajak_cz) 164 64.36 80.99 37 22.56
2806. Hamidbek (hamidbek) 164 53.34 73.18 18 10.98
2807. Lur3t (lur3t) 163 73.13 96.84 33 20.25
2808. Mmonster (mmonsterv11) 163 68.52 97.83 38 23.31
2809. AM (amesh8301) 163 67.96 87.20 39 23.93
2810. Almighty (almightysosaakatu... 163 86.64 115.26 59 36.20
2811. Andreas (agehring) 163 25.08 33.03 41 25.15
2812. Sonix (8sonix) 163 70.22 105.90 47 28.83
2813. TOBIRAMA (sipagan90) 163 47.93 66.83 14 8.59
2814. ybf (ybflewis) 163 86.38 118.67 42 25.77
2815. Connecting... (toodey) 163 65.61 84.33 36 22.09
2816. SW1FT808 (sussyboi808) 163 42.73 59.01 16 9.82
2817. Srdjan (srle1312) 163 49.83 61.52 14 8.59
2818. SkyerZ (skyerz) 163 92.15 111.22 60 36.81
2819. Brody (echo3006) 163 75.02 112.02 36 22.09
2820. Cheyenne (cheycc) 163 79.08 112.92 40 24.54
2821. Elgamal (elgamal) 162 62.17 86.27 31 19.14
2822. Pisit (compisit) 162 88.17 112.69 48 29.63
2823. Celeste (celeste_b) 162 62.05 81.69 29 17.90
2824. Arsh (batman4ever) 162 59.13 76.64 32 19.75
2825. aditya105 (aditya105) 162 47.95 65.08 17 10.49
2826. Ivan (idjuric) 162 111.51 135.94 82 50.62
2827. Gde (gde1indra) 162 73.44 96.08 45 27.78
2828. Ruel Ryan (ruelryan) 162 71.73 87.17 41 25.31
2829. Rahul (rsrahul1000) 162 82.20 107.42 51 31.48
2830. Priyanshi (priyanshi_gupta) 162 62.42 80.17 34 20.99
2831. nw3x (nw3x) 162 128.05 160.53 110 67.90
2832. Norm (norm_guy) 162 49.55 64.09 17 10.49
2833. TheXFalcon (xavier_poh) 162 74.63 96.80 46 28.40
2834. salsa (spencer_salsa) 162 59.55 83.30 31 19.14
2835. Callum (specktome26) 162 87.65 111.02 40 24.69
2836. something (xuegalaxy) 161 65.02 95.80 33 20.50
2837. manish (typo_beginner19) 161 51.92 68.50 15 9.32
2838. Asma (speedy10123667567) 161 41.48 63.99 13 8.07
2839. scrubs (scrubs1906) 161 64.43 80.41 41 25.47
2840. Kingdomfight (kingdomfight) 161 73.01 88.19 35 21.74
2841. tstats[depsy] (depsy) 161 81.31 102.27 41 25.47
2842. RiCyber (curiouscrow) 161 70.80 83.70 52 32.30
2843. nbv (cumming4u) 161 72.04 93.91 42 26.09
2844. yong (coaleo) 161 79.31 122.20 37 22.98
2845. TYPE KITA (carracers) 161 55.10 77.27 23 14.29
2846. April (apesbang) 161 81.20 101.04 48 29.81
2847. Adam (schimoda) 161 99.10 121.29 53 32.92
2848. kraken (pronto1) 161 72.00 90.43 38 23.60
2849. Piplup (piplup_) 161 81.33 105.83 32 19.88
2850. Nicki (nickisusanalex) 161 85.65 99.13 39 24.22
2851. xdd (n1kk1) 161 52.47 77.70 22 13.66
2852. mattfus (mattfus2) 161 94.35 112.55 47 29.19
2853. SCHMURK (schmurk) 160 98.04 124.69 63 39.38
2854. Pavan (pavan_06) 160 52.80 71.46 22 13.75
2855. oukkat2 (oukkat2) 160 89.14 115.67 55 34.38
2856. oscar (oscarhinxdd) 160 73.32 91.72 39 24.38
2857. Com (neon1087) 160 84.62 100.07 48 30.00
2858. Myles (mylessucks) 160 115.32 146.62 79 49.38
2859. Meliflua (meliflua) 160 56.62 68.03 21 13.13
2860. Joshua (manch) 160 89.55 112.54 51 31.88
2861. Leonardo (finex2126) 160 47.74 65.33 18 11.25
2862. Demian Volkov (demianwolf) 160 124.06 150.14 102 63.75
2863. Chirag (chirag_2580) 160 68.21 95.05 39 24.38
2864. Yo (azurewinter) 160 89.53 124.17 59 36.88
2865. Asura (asura_yt) 160 111.23 141.19 66 41.25
2866. Arsuta (aryasuta13) 160 79.00 100.36 44 27.50
2867. Onion (x__onion__x) 160 111.57 173.99 76 47.50
2868. Luca (whitebronco) 160 53.90 77.26 16 10.00
2869. TheCaptainBuster (thecaptai... 160 83.76 136.32 90 56.25
2870. ^o^ (thasial) 160 83.28 111.19 48 30.00
2871. Shivam (sj_pro) 160 59.24 78.17 38 23.75
2872. Kurochi (kurochi_cyril) 160 81.05 100.01 54 33.75
2873. Jackie (jackiechan816) 160 82.32 110.90 47 29.38
2874. badplayer (idk213) 160 91.19 145.82 72 45.00
2875. Hafiz (huseynoff) 160 75.17 94.31 44 27.50
2876. seaweedOrca (h17unicorn) 160 73.74 96.97 34 21.25
2877. Gaurav (gaurav_38) 160 77.47 96.85 42 26.25
2878. Shaked (aes222) 160 107.84 141.06 73 45.63
2879. Ankit (ankit_10) 159 32.18 44.28 25 15.72
2880. ABM (abm150) 159 66.72 80.76 43 27.04
2881. Garotto (uselessusername) 159 94.47 116.78 60 37.74
2882. switchedtocolemak (switched... 159 120.63 144.18 75 47.17
2883. Jakub (serckle) 159 94.92 114.92 67 42.14
2884. Sam (samsrm) 159 69.68 96.84 30 18.87
2885. RRKS (rrks43) 159 89.51 112.99 55 34.59
2886. Oliwier (olix04) 159 84.33 102.75 38 23.90
2887. Erin Lanz (erinxmaligaya_) 159 41.90 60.44 13 8.18
2888. Aditya (dhruvaditya) 159 48.91 64.25 11 6.92
2889. Gabriel (dekkoz) 159 63.39 78.50 24 15.09
2890. daniel (danielphantom) 159 90.28 118.92 57 35.85
2891. Liam (bonkatronk) 159 85.77 101.76 56 35.22
2892. Dinkin (blindguy_mcsqueezy) 159 78.11 111.16 36 22.64
2893. Khanh (aygentp) 159 90.79 119.87 51 32.08
2894. tstats[madkingxxx] (madking... 159 60.00 82.12 34 21.38
2895. Lloyd (llgraves) 159 77.92 104.62 33 20.75
2896. liz (lizkebab) 159 106.43 130.83 56 35.22
2897. KC (hotdogkc) 159 118.17 160.13 39 24.53
2898. Hieu (larhral) 158 89.72 112.48 58 36.71
2899. Karl (karlpuno) 158 61.87 83.89 29 18.35
2900. Rohit (john_titor234432) 158 69.96 95.93 35 22.15
2901. Omar (omarbahgat2003) 158 77.66 99.04 36 22.78
2902. Nader (nader12) 158 53.65 66.29 17 10.76
2903. Aziyat (aziyatali) 158 46.13 65.51 18 11.39
2904. dilano (dilano55) 158 85.44 112.24 58 36.71
2905. Zaynski (zaynium) 158 106.32 128.89 74 46.84
2906. bsmith4972 (bsmith4972) 158 53.34 72.48 18 11.39
2907. ben (benwu1) 158 86.99 110.02 42 26.58
2908. Aytac (aytac_neigel27) 158 82.30 102.21 49 31.01
2909. Oskar (dailypants) 157 67.87 82.88 36 22.93
2910. khalil (credendo) 157 81.19 100.11 48 30.57
2911. Filip (l4rry99) 157 89.20 120.59 46 29.30
2912. Firelord (jetray) 157 73.85 90.26 33 21.02
2913. Sexy Mark (jay_cartwright) 157 110.38 142.76 69 43.95
2914. Jake (jake_tyler) 157 97.00 117.37 62 39.49
2915. daniel (nitezu) 157 90.38 118.56 53 33.76
2916. Feris (merelyaferis) 157 141.26 179.23 119 75.80
2917. Twis (twis23) 157 74.04 100.88 40 25.48
2918. Sundara Subramanian (sundar... 157 81.23 97.99 37 23.57
2919. w0ng (w0ng_dvorak) 156 58.66 74.69 20 12.82
2920. Verve81 (verve81) 156 111.96 136.49 89 57.05
2921. Theroarx (theroarx) 156 88.32 112.14 53 33.97
2922. Ckh (theckh) 156 88.90 108.38 48 30.77
2923. Sonwa (sonwa) 156 55.74 66.69 17 10.90
2924. Luffy-dono (luffy_dono) 156 71.18 88.70 37 23.72
2925. tstats[kvb826] (kvb826) 156 75.13 98.35 37 23.72
2926. アヒオ (knalb) 156 52.12 68.99 14 8.97
2927. Karim (karimkarim) 156 48.88 64.66 18 11.54
2928. Kieran (kahinjin) 156 127.13 164.65 119 76.28
2929. Abylaikhan (ho1den) 156 78.14 110.78 30 19.23
2930. Fidel Alberto Ramos (Perú)... 156 58.91 77.73 21 13.46
2931. Mike (fastneko) 156 92.05 132.37 55 35.26
2932. deceptiveVI (dsaldana711) 156 113.75 145.60 82 52.56
2933. Tianyi (dreamatd) 156 76.69 93.47 31 19.87
2934. RMS (sarfaraz008) 156 85.32 120.76 63 40.38
2935. percival (samuelnirina) 156 79.93 98.48 37 23.72
2936. PJR (petrosyan_jr) 156 87.70 104.82 56 35.90
2937. Kwikk (mrkwikk) 156 60.43 82.18 31 19.87
2938. JFL (mialiu0804) 156 61.04 79.19 32 20.51
2939. Trying (sakurya) 155 132.87 163.14 102 65.81
2940. John (qui505092) 155 118.55 144.55 86 55.48
2941. Aidan (kubachi) 155 83.36 106.45 48 30.97
2942. Joseph (joseph_468) 155 118.59 140.23 90 58.06
2943. John (jhakala) 155 102.97 118.58 53 34.19
2944. Jordan (jagmasta259) 155 93.97 117.53 61 39.35
2945. Hovari (hovari) 155 66.55 92.22 33 21.29
2946. (ghall) 155 153.46 209.53 64 41.29
2947. Alf (jacv_10) 155 61.89 74.57 31 20.00
2948. Zurfer (zurfer) 155 70.50 99.29 40 25.81
2949. Salted (whyisitsohardto) 155 82.57 111.59 46 29.68
2950. Uurdmandakh (uurdmandakh) 155 63.97 83.30 35 22.58
2951. typoMaster (tt_qureshi) 155 46.99 60.36 12 7.74
2952. Emily (emj9) 155 66.61 81.25 32 20.65
2953. Elliot_1980_UK (elliot_notts) 155 102.90 126.92 66 42.58
2954. calum (calousime) 155 81.77 112.56 61 39.35
2955. Avi (avitoohband) 155 59.14 86.06 33 21.29
2956. Muhammad (donnyutsman) 154 82.08 98.98 28 18.18
2957. yo (callmeford) 154 86.15 110.00 47 30.52
2958. Batteekha (batteekha) 154 68.53 83.98 39 25.32
2959. Ayyaz Sajjad (ayyazsajjad) 154 43.53 55.35 18 11.69
2960. alex (ay1259) 154 92.23 123.32 64 41.56
2961. ig=muzi.priva (muzamil69) 154 53.07 87.31 58 37.66
2962. Keyma.sh is better (ryleyx... 154 130.92 155.77 93 60.39
2963. Mohamd (mohamed_hussein) 154 31.07 42.68 23 14.94
2964. Mims (mimzi_who) 154 79.08 104.21 44 28.57
2965. Lai (laiyr) 154 109.87 136.95 67 43.51
2966. Samuel (king_anuus) 154 113.00 139.64 89 57.79
2967. Keelan (keelanf_28) 154 64.78 88.03 39 25.32
2968. Julius (juliuscl2004) 154 51.95 73.37 22 14.29
2969. Andreas Vida (johnbonham) 154 108.27 138.95 75 48.70
2970. Jonathan (ilaghardcore) 154 105.13 134.02 70 45.45
2971. Zaid (zaidnashihamin) 154 52.55 70.49 25 16.23
2972. Serenity (turkaturka) 154 83.89 103.53 43 27.92
2973. Turning 14 in 2 Weeks! (spe... 154 111.57 163.48 55 35.71
2974. ydem2nir9tag (ydem2nir9tag) 153 104.87 132.43 75 49.02
2975. Tanya (tee_85) 153 44.20 70.27 14 9.15
2976. Neko (stanoje) 153 88.89 110.81 41 26.80
2977. Sigmund (sir_renardwil) 153 87.98 109.61 49 32.03
2978. Looserrrrrrrrrrrr (rahulary... 153 28.34 52.04 70 45.75
2979. ace (pressctrlandw) 153 85.06 101.23 44 28.76
2980. pedro (pmedley) 153 46.45 61.03 10 6.54
2981. Ex (not_a_razer) 153 67.26 85.02 34 22.22
2982. vroom💤 (noprop) 153 122.12 145.40 78 50.98
2983. Minaricano (minaricano) 153 87.63 113.61 43 28.10
2984. Никита (mamaxab) 153 31.14 43.39 20 13.07
2985. declan (dekkiefish) 153 94.63 120.52 57 37.25
2986. Bento (bento420) 153 97.53 121.99 77 50.33
2987. alpha (alphawoman) 153 89.03 121.05 51 33.33
2988. killer (killerz4564) 153 60.93 78.89 40 26.14
2989. Jamie (jamietyper90) 153 85.33 110.22 45 29.41
2990. Luka (lukoloz) 152 89.46 113.47 46 30.26
2991. Laco (koomp) 152 86.47 103.84 46 30.26
2992. Nik (iiirxs) 152 80.60 113.83 37 24.34
2993. Josh (h3hat3m3) 152 93.44 112.28 41 26.97
2994. Fatnot (fatnot) 152 84.71 112.01 39 25.66
2995. Denis (deniii) 152 61.54 78.10 33 21.71
2996. ashok (ashokkasi) 152 79.66 100.74 42 27.63
2997. Stephen (s_dog2001) 152 65.06 92.50 44 28.95
2998. Splixy (splixy) 152 70.60 88.42 37 24.34
2999. Darth (rakin000) 152 78.60 94.12 28 18.42
3000. Rahul (rahuls1995) 152 51.35 64.62 15 9.87
3001. AtmoSci (noctilucent) 152 63.77 86.13 30 19.74
3002. netram88 (netram88) 152 77.07 96.55 53 34.87
3003. tstats[marin049] (marin049) 152 112.57 151.03 84 55.26
3004. Ali (alijoon) 152 58.77 74.40 18 11.84
3005. AlexopoulosC (alexopoulosc) 152 92.60 114.78 55 36.18
3006. saam4 (saam4) 152 70.63 94.34 35 23.03
3007. type_racist (the_orange) 152 83.85 108.24 44 28.95
3008. MNL48 Frances DieHardSuppor... 151 89.20 109.59 60 39.74
3009. fingerblaster (linn123321) 151 81.55 105.26 39 25.83
3010. Szektor (szektor) 151 53.75 72.21 12 7.95
3011. Drew (vegan_freedom_fighter) 151 65.62 85.30 30 19.87
3012. IllMind (lllmind) 151 48.64 65.10 24 15.89
3013. Jimmy (jimmmy193) 151 106.15 145.66 67 44.37
3014. jcm (jan500) 151 81.73 104.17 45 29.80
3015. INCOMPETENT (incompetent_co... 151 79.25 108.16 50 33.11
3016. Tom (darkusisdope) 151 47.64 59.25 14 9.27
3017. Aaron (biogence) 151 72.39 93.03 28 18.54
3018. Rasmus (rasmus_v) 151 74.55 90.96 27 17.88
3019. ahmed (puzite) 151 85.52 108.20 37 24.50
3020. Casey (novacainr) 150 90.22 112.12 61 40.67
3021. Necdet Ali (necdetaliozdur_... 150 64.14 80.31 31 20.67
3022. Nadav (nadavb9) 150 62.42 97.22 36 24.00
3023. linkai (linkailul) 150 95.94 125.50 56 37.33
3024. Kreoniz (kreoniz) 150 61.41 74.47 31 20.67
3025. jimjom (jimysucks) 150 147.98 187.38 122 81.33
3026. Lily (andisapple32) 150 67.95 86.36 33 22.00
3027. Abby (abkwreu) 150 35.96 62.70 7 4.67
3028. Sidharth (_ceres_) 150 45.53 57.20 12 8.00
3029. James (wnston) 150 92.16 134.71 54 36.00
3030. Wilson (wilsonthewinner) 150 93.55 117.14 44 29.33
3031. Whyn (why8n) 150 80.33 101.06 44 29.33
3032. ws (wdsyywd) 150 83.75 114.60 35 23.33
3033. Vishal (vishal_kr_saw) 150 74.43 90.92 61 40.67
3034. Unidentified (themunchkin3) 150 125.50 146.39 80 53.33
3035. Daniel (sea_sick) 150 86.65 102.46 53 35.33
3036. Dmitry (dmitry_turcan) 150 68.58 90.87 32 21.33
3037. David (d4v1dh) 150 103.91 131.43 62 41.33
3038. Cindy (cwycindy) 150 77.99 106.44 51 34.00
3039. Kapal Tua :v (cream777) 150 69.43 89.79 37 24.67
3040. Brian (brianhsu7476) 150 75.03 87.85 46 30.67
3041. (boy_314) 150 140.89 169.64 101 67.33
3042. Bismith (bismith) 150 76.63 93.22 33 22.00
3043. Arvind (arvindlamba454) 150 71.92 104.43 47 31.33
3044. Eaglekott (eaglekott) 149 93.54 114.39 48 32.21
3045. JesusWrite (jesus_write) 149 45.42 56.11 13 8.72
3046. Rdmm (rdmm) 149 84.60 102.30 46 30.87
3047. Moyosore (mokarios) 149 77.77 94.02 44 29.53
3048. Airbender Aang (lolmode2) 149 94.38 115.62 40 26.85
3049. Logan (laucian) 149 79.36 101.18 39 26.17
3050. Hudson (hudson_the_cat) 149 57.00 75.70 24 16.11
3051. GEMargad (gemrgd_23) 149 53.34 72.14 16 10.74
3052. John Le (zingerburgerkfc) 149 73.78 99.74 43 28.86
3053. Zaid (zaids) 149 84.92 108.42 34 22.82
3054. ♛₴𝕥o͓̽ᖇო·₴... 149 73.04 91.82 40 26.85
3055. waseem ahmad bhat (waseemraja) 149 60.40 91.39 29 19.46
3056. john (sharks445) 149 82.96 107.29 41 27.52
3057. Sebastian (sebastian070) 149 35.60 50.06 32 21.48
3058. Trent (uninterested) 148 126.29 166.70 95 64.19
3059. Adrian (thebossboi1324) 148 65.41 98.95 46 31.08
3060. ☼_☼ (temuramir) 148 106.75 132.19 56 37.84
3061. Ping Janat (ppppp5541) 148 43.81 64.95 9 6.08
3062. Wenjie (pervysama) 148 128.96 147.46 104 70.27
3063. Leona (onale) 148 125.00 153.06 95 64.19
3064. Max (max_pinc) 148 83.14 108.27 38 25.68
3065. WSY (elyx_2302) 148 93.69 111.86 64 43.24
3066. Dennetix (dennetix) 148 57.57 69.45 28 18.92
3067. Tady (concernednecron) 148 41.67 55.59 15 10.14
3068. Arian (arianrz82) 148 62.83 82.06 32 21.62
3069. Marc (andesandwich) 148 68.47 88.25 41 27.70
3070. Anchit (anchit) 148 77.04 92.45 37 25.00
3071. Jupiter8000 (jupiter8000) 148 70.41 96.21 47 31.76
3072. Jony (jonycolemak) 148 76.91 97.93 37 25.00
3073. denis (j4yz11) 148 47.63 60.64 12 8.11
3074. Isaac (inied) 148 99.58 133.35 56 37.84
3075. HiteshM (hiteshm_riptide) 148 76.42 99.36 45 30.41
3076. Habibullah (habibullahhussa... 148 50.02 71.90 19 12.84
3077. Musa (greatwarrior235) 148 83.02 103.21 39 26.35
3078. Jyotirmay (goldenguts) 148 65.32 83.62 36 24.32
3079. Geux (geux) 148 40.84 58.94 14 9.46
3080. Eugene (lilgene1) 147 88.84 114.97 45 30.61
3081. Kaden (lifeshappy) 147 62.86 83.41 37 25.17
3082. Sanji (kuroashi) 147 67.28 83.38 32 21.77
3083. Jeden Osiem L (jedenosieml) 147 99.02 117.42 57 38.78
3084. Bryan (iduhowpeopledo150wpm) 147 104.47 128.20 62 42.18
3085. Hovok (hovok) 147 108.79 148.39 69 46.94
3086. H A (hamada_ali) 147 78.71 98.61 33 22.45
3087. FA (fa00) 147 47.26 57.78 20 13.61
3088. BOTbkchod (bot_bakchod) 147 59.48 72.91 27 18.37
3089. Muruganantham (bossmuruga) 147 40.29 56.74 14 9.52
3090. Woody (woody_wins_) 147 79.55 98.33 25 17.01
3091. Manas (who_mana) 147 63.53 77.04 35 23.81
3092. Vbee (vb33) 147 96.25 121.00 63 42.86
3093. Justin (ustinj) 147 87.49 112.07 44 29.93
3094. Poly (typingpoly) 147 90.53 118.52 46 31.29
3095. tomdin0 (tomdin0) 147 32.19 43.87 9 6.12
3096. tailcatch (tailcatch) 147 122.63 158.31 92 62.59
3097. vinnii (slowvinni) 147 157.12 193.00 119 80.95
3098. RaV (rav_the_writer) 147 101.26 124.74 61 41.50
3099. Cool (mrcoolguy69) 147 111.12 138.61 72 48.98
3100. MeHdi (mehdiii8) 147 96.82 120.09 69 46.94
3101. ZedHead01 (qdedmon87) 146 98.38 123.92 56 38.36
3102. Jeon (owokunn) 146 113.88 138.74 74 50.68
3103. yoozernaim (yoozernaim) 146 92.73 108.20 49 33.56
3104. Aditya (typingspree31) 146 80.82 96.02 28 19.18
3105. pat (trikster) 146 134.05 164.96 100 68.49
3106. Tracking Time (trackingtime) 146 85.90 111.15 45 30.82
3107. sura (suraflux) 146 83.43 100.09 47 32.19
3108. AAARGH (statim) 146 87.44 111.09 54 36.99
3109. Samuel (ssesena) 146 63.65 85.03 34 23.29
3110. Thomas (loboru) 146 133.92 168.71 109 74.66
3111. JJ (jjbonta) 146 92.21 116.89 55 37.67
3112. Tide (firefly441) 146 63.20 80.67 40 27.40
3113. David (dave_h12) 146 78.80 95.38 36 24.66
3114. (clouhhd_) 146 95.44 141.96 4 2.74
3115. Lam (catposter1) 146 115.19 153.74 129 88.36
3116. Nafidz (arckngel) 146 68.36 82.47 29 19.86
3117. AouiGui (andersgrymer) 146 101.12 126.27 64 43.84
3118. Holo (aisha23__) 146 90.99 110.42 55 37.67
3119. acc (agglomeration) 146 126.28 155.93 98 67.12
3120. m1dK$9T (adepa) 146 49.37 65.26 22 15.07
3121. Hououin Kyouma (makise_kuri... 145 85.77 118.00 58 40.00
3122. Marek (ksydry) 145 105.17 126.62 59 40.69
3123. Luke (kipkat) 145 57.16 76.83 24 16.55
3124. गुरु (jokerster) 145 80.85 103.90 37 25.52
3125. Jiranimo (jiranimo) 145 32.86 52.35 19 13.10
3126. Tane (husquin) 145 112.80 142.52 74 51.03
3127. Gunner (gunner8) 145 90.96 115.49 59 40.69
3128. Gabe (grahamcracker4) 145 69.57 89.96 40 27.59
3129. FootedPear (ryanpear0) 145 75.56 99.15 40 27.59
3130. Luis (regneva17) 145 74.60 97.73 35 24.14
3131. parsa (parsa_ktz) 145 57.29 72.28 26 17.93
3132. (palpha) 145 76.03 102.57 70 48.28
3133. NessQuik (nessquik) 145 64.44 83.88 34 23.45
3134. ROCKSTAR008 (mrbest6000) 145 112.81 145.72 77 53.10
3135. IMSL (moonrabbit) 145 129.58 154.95 95 65.52
3136. masterassassin3 (masterassa... 145 65.44 79.45 27 18.62
3137. Wayne (xwang4) 145 83.93 114.96 42 28.97
3138. WinterCore (wintercore) 145 127.82 161.42 89 61.38
3139. Umair (umair121) 145 75.76 95.98 34 23.45
3140. ryleigh (thestonedpotato) 145 79.42 108.00 35 24.14
3141. De Leo (theleo) 145 58.25 76.01 22 15.17
3142. Delgerskhn (thege) 145 101.43 121.67 54 37.24
3143. OULAHBIB (suicv) 145 65.69 82.91 30 20.69
3144. spiky (spiky228) 145 101.60 119.92 69 47.59
3145. mikey (snicker861) 145 86.01 107.37 50 34.48
3146. Ћира (cira12345) 145 84.51 105.40 48 33.10
3147. Alex (atduffaut) 145 70.95 96.04 37 25.52
3148. Francis (francis_7777) 144 60.82 79.70 27 18.75
3149. fhbjnrng (fhbjnrng) 144 132.83 164.66 115 79.86
3150. Eddie_NP (eddie023) 144 102.15 123.87 69 47.92
3151. dylan (crspy) 144 85.30 118.61 29 20.14
3152. saeed (saeedhosam) 144 62.47 83.14 31 21.53
3153. Rice Chan (rice_chan) 144 108.76 131.97 103 71.53
3154. Alpine (relambrien) 144 143.20 176.50 106 73.61
3155. Paul (paul5005) 144 63.28 82.15 26 18.06
3156. Sanchi (pachi_sanchi) 144 83.74 110.65 47 32.64
3157. Nooby (noobythenoob) 144 87.32 110.70 51 35.42
3158. Gina (nannelcam) 144 89.45 113.71 54 37.50
3159. Andre (andreandreandre) 144 90.87 113.54 50 34.72
3160. Alex Jane (alex_jane) 144 40.83 54.29 15 10.42
3161. chepe (albetrash) 144 79.32 101.22 46 31.94
3162. kevin (kongdonglong32) 144 85.45 112.20 45 31.25
3163. Jubax (jubax) 144 90.01 110.57 49 34.03
3164. Jayanth (jayanththelegit) 144 46.91 64.69 12 8.33
3165. hossam (hossam_ramadan) 144 53.50 64.40 12 8.33
3166. Leeham (you_smell) 144 78.07 99.65 35 24.31
3167. Xmoonsheep (xmoonsheep) 144 99.06 125.13 65 45.14
3168. Zhu (viviora) 144 76.96 92.51 44 30.56
3169. Sushi (sushixr) 144 70.51 93.38 30 20.83
3170. Sulthan Cendikia (sulthance... 144 65.85 86.19 39 27.08
3171. MAXIM (skramt) 144 55.78 74.49 12 8.33
3172. Jo (typermac) 143 108.42 150.36 67 46.85
3173. Arees (arees) 143 77.19 97.64 39 27.27
3174. eunhyun (eunhyun) 143 113.79 145.88 73 51.05
3175. Eric (ericcand) 143 82.36 103.14 35 24.48
3176. jungkook (elizabethngg) 143 57.97 97.74 19 13.29
3177. Cartonito (cartonito) 143 74.23 98.40 45 31.47
3178. (bicycleman) 143 101.68 162.95 59 41.26
3179. aspirar (aspirar) 143 97.56 122.32 92 64.34
3180. Otto (otto_types) 143 77.30 99.20 40 27.97
3181. HuisbaasJR (ofbasecfin) 143 90.19 116.40 50 34.97
3182. Mohammad (mostat) 143 50.43 62.14 14 9.79
3183. salvation (mo7a_1913) 143 78.52 105.70 34 23.78
3184. Memperor (memeemperor) 143 66.64 89.19 31 21.68
3185. joey (joeraps) 143 119.95 139.13 102 71.33
3186. Jerviz (jerviz) 143 107.24 133.46 80 55.94
3187. Mycargoboom (hayadabest) 143 95.62 132.81 53 37.06
3188. G (goutham_k) 143 45.25 59.16 13 9.09
3189. Bruh? (funkun) 143 63.58 82.77 30 20.98
3190. Linfeng (llinfeng) 142 101.97 132.48 59 41.55
3191. Rav (impaledbison) 142 80.96 105.07 37 26.06
3192. Arnav (hyp3rn00b10) 142 57.80 77.58 21 14.79
3193. Huoi (huy_truong_le) 142 86.79 117.60 48 33.80
3194. 111 (grimiv) 142 80.07 95.86 30 21.13
3195. Chris (gatoroid37) 142 87.64 111.93 39 27.46
3196. dylan_9802 (dylan_9802) 142 120.90 155.93 73 51.41
3197. Brandon (dreonic) 142 65.88 81.96 28 19.72
3198. Appropriate (d0wny) 142 97.30 133.50 57 40.14
3199. Stanisław (bosastopaa) 142 54.09 75.08 18 12.68
3200. w (wonton2) 142 130.54 155.90 93 65.49
3201. TNT92fin (tnt92fin) 142 63.24 76.72 24 16.90
3202. Shoe (shoebox004) 142 86.60 124.31 47 33.10
3203. ArklightF0x (arklightf0x) 142 56.35 73.74 30 21.13
3204. antifragile (antifragile) 142 85.15 126.32 42 29.58
3205. Agnar (agnar) 142 80.94 100.22 46 32.39
3206. Marco (grinzosi) 142 45.59 56.67 18 12.68
3207. Andy (run_from_andy) 142 63.66 79.97 23 16.20
3208. ritesh (ritesh123) 142 53.48 71.82 18 12.68
3209. Neeraj (neeraj1) 142 58.66 77.60 22 15.49
3210. breddreamer (rasel_hasan) 141 50.19 63.16 9 6.38
3211. Just a potato (quocbinhgt3007) 141 53.50 82.16 26 18.44
3212. SirShrek69 (puffers23) 141 108.53 124.51 59 41.84
3213. Nayeem (obaydul_hasan_nayeem) 141 50.10 61.74 18 12.77
3214. Andree (ntuanson97) 141 105.81 127.04 71 50.35
3215. Nim (nim1chimpsky) 141 85.91 111.93 45 31.91
3216. anhar (_anhar) 141 104.45 127.91 51 36.17
3217. yen (yennn) 141 62.26 82.47 24 17.02
3218. the (theguy27) 141 80.31 95.69 34 24.11
3219. Tareq (tareq_2007) 141 52.09 68.23 17 12.06
3220. (lwycsrc) 141 125.92 156.81 86 60.99
3221. Michael (kame3200) 141 79.39 106.30 31 21.99
3222. (jlachney) 141 135.20 174.23 96 68.09
3223. Illumin80 (illumin80) 141 60.60 73.33 25 17.73
3224. Ethan (ethant772) 141 116.35 156.80 79 56.03
3225. bruh (diablodvorak) 141 87.49 106.53 35 24.82
3226. Dear (dearme) 141 67.03 81.48 33 23.40
3227. sally (creamdonut) 141 108.02 146.97 69 48.94
3228. (barfing) 141 134.32 168.93 96 68.09
3229. ashiq hussain wani (ashiqwani) 141 46.83 58.56 14 9.93
3230. Ar7N (ar7n) 141 70.60 98.54 31 21.99
3231. anas (ana_1s) 141 77.38 95.36 31 21.99
3232. HADI (adilmuhammadi) 141 58.77 73.52 28 19.86
3233. Abdelrahman (7gab) 141 78.12 109.15 31 21.99
3234. Abhishek (abhishek_mtb) 141 46.55 59.97 18 12.77
3235. Anis (anis22) 140 59.05 74.17 29 20.71
3236. 65best (65best) 140 106.89 134.49 61 43.57
3237. Anas (01anas) 140 55.03 72.26 18 12.86
3238. ayman (aymanzraiga) 140 35.69 51.37 9 6.43
3239. hhj (baidu123) 140 57.66 70.67 19 13.57
3240. Richrad (laci279) 140 77.46 93.26 32 22.86
3241. Hai (ky0ka) 140 83.13 107.77 34 24.29
3242. Viacheslav (krevetko) 140 68.01 85.12 26 18.57
3243. Yunusali (khakimjanovich) 140 60.96 81.15 21 15.00
3244. Jonathan (jonathan888) 140 69.67 88.84 32 22.86
3245. jittery (jittertypes) 140 83.95 105.23 45 32.14
3246. simon (i_am_simon) 140 97.51 128.09 52 37.14
3247. asdf (itz_pvp1235) 140 87.89 110.30 50 35.71
3248. Jan (hokejan_14) 140 37.51 51.11 8 5.71
3249. Alexander (greenocelot26_dv... 140 106.35 130.44 58 41.43
3250. Goldie (goldie87) 140 40.06 54.84 12 8.57
3251. saket (saket1harsh2) 140 58.49 73.53 23 16.43
3252. Aaron (rondc108) 140 62.52 81.43 39 27.86
3253. BEing VinCI (ppubalo) 140 87.46 112.12 49 35.00
3254. Dario (oodarioo) 140 49.93 65.51 17 12.14
3255. hamza (mizoxes) 140 96.28 118.55 58 41.43
3256. Souptacks (souptacks) 140 70.92 96.32 29 20.71
3257. shota.b (shotiko8) 140 90.66 119.96 51 36.43
3258. Lulu (shade_senpai) 140 116.89 150.30 77 55.00
3259. CVH (cvh_) 140 136.45 163.05 106 75.71
3260. Badri (bxdri) 140 123.66 167.54 70 50.00
3261. Joshua (busbud) 140 71.92 94.50 35 25.00
3262. SKY (avid_learner8) 140 29.64 36.69 20 14.29
3263. Soren (cuckslayer) 139 74.01 96.73 40 28.78
3264. crai (crai27) 139 91.29 110.11 43 30.94
3265. Will (carbohydra) 139 63.23 76.63 40 28.78
3266. Yakiniku (bigmeatball) 139 102.17 128.79 44 31.65
3267. rafi (sandbomber) 139 79.20 105.03 31 22.30
3268. Rem (remroid66) 139 83.59 104.89 44 31.65
3269. Randall (rdox10) 139 118.65 156.39 83 59.71
3270. Mediumsecy (mediumsecy) 139 67.84 84.20 27 19.42
3271. Ardison (arddison) 139 100.37 116.73 50 35.97
3272. lakhey (antivenene) 139 94.26 117.50 49 35.25
3273. longi (alongens) 139 95.00 107.29 40 28.78
3274. FurbyParade226 (furbyparade... 139 105.56 127.91 56 40.29
3275. V¹ҡҡʏ (littlevikky_) 139 76.57 96.00 31 22.30
3276. leo (leokkqqjj) 139 42.74 55.83 14 10.07
3277. Daniel (kimster773) 139 86.38 108.56 46 33.09
3278. Jake (jmanq) 139 66.63 97.12 38 27.34
3279. Ishaan (ishaank10) 139 67.25 86.79 32 23.02
3280. Harjot (harjot2000) 139 59.83 74.70 25 17.99
3281. Justin (ggwp_123) 139 60.88 71.69 16 11.51
3282. Sabrina (getrektttt) 139 66.92 96.43 37 26.62
3283. Le Hoang (gampingbua) 139 52.11 67.45 14 10.07
3284. The Zaffles (zaffles) 139 71.39 94.11 33 23.74
3285. Cal (wiscahhhhnsin) 139 115.70 151.88 76 54.68
3286. Vanza (vanzasetia) 139 53.14 67.42 10 7.19
3287. Ufo23 (ufo23gg) 139 90.17 112.14 55 39.57
3288. Tar (typer_noob) 139 100.58 126.19 47 33.81
3289. Welcome to Brazil (thunder02) 139 111.20 146.30 84 60.43
3290. tayyab (tayyab246) 139 48.02 62.96 18 12.95
3291. sam (swalden) 139 85.63 104.07 51 36.69
3292. (ノ◕ヮ◕)ノ*:・゚... 139 121.17 159.34 79 56.83
3293. Riddy (songridv) 139 84.96 120.42 43 30.94
3294. Zulsorai (zulsorai) 138 71.40 92.36 33 23.91
3295. Gustavo (yoosteen) 138 66.25 76.67 29 21.01
3296. Alosson (tiger6654) 138 63.87 80.56 32 23.19
3297. Laggy (thefitfatass) 138 122.59 146.03 97 70.29
3298. sidharth (sidharth_71) 138 67.25 95.07 41 29.71
3299. shantal (shantal0924) 138 69.04 98.90 31 22.46
3300. life (armaansoni) 138 76.89 96.81 40 28.99
3301. Evan can't pass the validat... 138 95.52 114.81 47 34.06
3302. Daniel (danvs60) 138 77.77 99.08 36 26.09
3303. Benjamin Martin (benjamin_m... 138 61.52 78.08 31 22.46
3304. Benjamin (banjo_) 138 59.00 75.43 25 18.12
3305. Rodney (rodneyslafuente) 138 92.20 113.50 35 25.36
3306. NOJ8 (noj8) 138 82.24 109.33 44 31.88
3307. Gemeine (nemememky) 138 76.20 99.22 37 26.81
3308. Mahdi Lotfi (mahdilotfi) 138 58.50 72.18 23 16.67
3309. jeyy (jeyy11) 138 35.22 46.29 8 5.80
3310. Liam (je1q) 138 47.77 64.13 17 12.32
3311. Lushtifer (inanutshell) 138 71.41 89.45 41 29.71
3312. hhg (hhg2) 138 60.34 73.66 34 24.64
3313. horyzen1 nq (lucknumber8) 137 87.62 119.49 44 32.12
3314. Casado con Ale (lrip) 137 118.35 145.35 59 43.07
3315. Little (littlepump1) 137 77.34 95.64 38 27.74
3316. kingsley (kings350) 137 68.78 92.82 44 32.12
3317. kacper szybki (kacper1) 137 47.55 60.56 12 8.76
3318. Harish (harish_roxx) 137 57.84 79.51 25 18.25
3319. gcc42 (gcc42) 137 91.93 112.87 51 37.23
3320. Shivanshu (cvanshu) 137 67.96 85.78 28 20.44
3321. Dylan (chrunchy) 137 91.13 117.66 44 32.12
3322. jen (chennyjen) 137 109.65 136.50 69 50.36
3323. Jacy (bohdan_danyltsiv) 137 78.37 97.40 31 22.63
3324. Arun (thenooboflegend) 137 80.99 95.93 36 26.28
3325. Aparesh (aparex) 137 69.92 87.35 34 24.82
3326. aculeasis (aculeasis) 137 81.96 117.87 37 27.01
3327. abdallah (abdallahmontaser) 137 41.83 52.70 10 7.30
3328. Cuong (qt1003) 137 62.40 83.16 24 17.52
3329. Abror (owl2023) 137 49.43 62.19 15 10.95
3330. ObiWanKeyboardobi (obiwanke... 137 84.97 119.84 36 26.28
3331. myaonfya (myaonfya) 137 72.83 107.41 29 21.17
3332. Mithun (mithu16_2001) 137 57.62 73.14 51 37.23
3333. J (mindjar) 137 27.70 37.13 23 16.79
3334. Umer (programmer_1) 136 83.92 101.79 48 35.29
3335. Ibrahim (platon) 136 95.16 124.36 52 38.24
3336. weirdo (master_guy17) 136 81.59 113.48 35 25.74
3337. Eran (umm_eran) 136 103.49 131.26 54 39.71
3338. sleepo (sleepotimer) 136 93.96 113.09 56 41.18
3339. Serv (servgd) 136 79.86 99.30 42 30.88
3340. medkit phighting (gayliquid... 136 95.25 138.80 44 32.35
3341. f2realw (f2realw) 136 67.94 85.12 48 35.29
3342. Bálint (diabolokiller) 136 82.82 102.88 30 22.06
3343. Justin (basicjc) 136 58.05 70.56 25 18.38
3344. asdsfdg (asdfgdsf) 136 76.36 101.33 34 25.00
3345. tstats[vintage_maavirup] (v... 136 57.14 69.22 25 18.38
3346. Midorinn1222 (midorin1222) 136 65.91 89.64 41 30.15
3347. Crystal (arcee143) 135 85.34 113.45 97 71.85
3348. AnasigN (anblk) 135 36.39 56.10 7 5.19
3349. ali (ali79taba) 135 71.16 84.93 46 34.07
3350. Ezad (ezad99) 135 55.62 72.76 21 15.56
3351. J (jihoomoon) 135 75.21 94.54 36 26.67
3352. ヴィエット (hsdpa365) 135 86.69 112.36 38 28.15
3353. chabe (halfu) 135 95.02 123.59 86 63.70
3354. Guggles (guggles) 135 103.60 130.08 71 52.59
3355. Reenreen (reenreen) 135 70.24 91.67 41 30.37
3356. PogChamp (raziqphantomz) 135 114.80 134.82 77 57.04
3357. Allen (onelonelyguy101) 135 64.58 89.69 30 22.22
3358. Nour (nourxcx) 135 105.50 135.10 66 48.89
3359. Mohammad (moreda1999) 135 74.31 95.54 36 26.67
3360. Michael (mihcael) 135 95.51 125.68 53 39.26
3361. Nour (micasa_ackarmen11) 135 36.86 46.70 10 7.41
3362. Zuhaib (zuhaibdam) 135 104.61 135.29 63 46.67
3363. 👺Wainie san (wxia) 135 94.30 124.37 49 36.30
3364. Hyena (wildhyena) 135 84.16 114.03 31 22.96
3365. Guest (whoyoung99) 135 85.75 113.78 37 27.41
3366. Will (w1llmcl) 135 91.95 138.79 49 36.30
3367. Uladzislau (vlad_13_borisov) 135 76.28 90.16 28 20.74
3368. Tor (tortle4444) 135 49.61 66.13 12 8.89
3369. Max (thisismydrive1997) 135 100.99 117.51 43 31.85
3370. Th3BossC (th3bossc) 135 82.41 112.55 34 25.19
3371. Taso (tas123) 135 83.85 108.49 62 45.93
3372. sliptok (sliptok) 135 87.39 115.91 38 28.15
3373. Seb (sebb7y) 135 103.73 120.46 73 54.07
3374. Manne (epicblueberry) 135 85.46 106.74 37 27.41
3375. Josh (expiredvenom) 134 98.31 116.77 52 38.81
3376. Anik (eternatus) 134 62.70 74.70 36 26.87
3377. Enrico (enricoaf) 134 93.53 133.42 58 43.28
3378. DunDun (dundunbread) 134 56.97 70.21 22 16.42
3379. cadde (cadde) 134 59.00 75.03 18 13.43
3380. Ralston (ralstonnub) 134 63.11 80.68 35 26.12
3381. Avery (purplat) 134 105.43 141.72 49 36.57
3382. Vincent (not_a_robot) 134 103.44 130.90 59 44.03
3383. muchinchai (muchinchai) 134 88.82 103.57 43 32.09
3384. Matiss (mazainwastaken) 134 37.18 47.12 5 3.73
3385. loveleen (loveleenasalia) 134 60.04 71.25 19 14.18
3386. Bram (yogurt55) 134 72.70 95.52 36 26.87
3387. 🚀 (wildreamz) 134 104.71 114.06 46 34.33
3388. thinkingds (sohandeshar) 134 74.86 90.29 30 22.39
3389. Benjamin (xlr8or) 133 94.01 112.85 38 28.57
3390. 9aswara (victorious1) 133 39.38 59.84 9 6.77
3391. Eugene (sushiwaumai) 133 77.86 97.92 37 27.82
3392. Sean Paolo (seanpaolo_22) 133 80.60 99.23 42 31.58
3393. tstats[rajveer_100] (rajvee... 133 53.27 68.16 18 13.53
3394. Stas (onixflip) 133 72.57 92.06 25 18.80
3395. Omar (omar_ziada) 133 81.54 113.59 42 31.58
3396. J (nothisisjeff) 133 81.40 102.58 30 22.56
3397. An (anhanpro2k) 133 82.52 102.76 40 30.08
3398. albert (albertos13) 133 89.74 114.61 43 32.33
3399. Admaster (admaster) 133 59.67 80.33 29 21.80
3400. mohamed (spear_dfjdklf) 133 64.94 84.80 32 24.06
3401. Cube (cubedefender) 133 84.20 111.91 37 27.82
3402. Em (cookie666) 133 88.03 111.19 93 69.92
3403. Petrus (clavigerpc) 133 62.58 83.59 32 24.06
3404. nub (buildernub) 133 66.87 87.70 33 24.81
3405. Andrei (belearau) 133 81.93 101.65 34 25.56
3406. Bauyrzhan (baurtokenov) 133 107.45 130.06 66 49.62
3407. . (lun_rix) 133 85.63 103.70 29 21.80
3408. Mamazait (kozhoev1) 133 39.92 69.99 6 4.51
3409. jakub (jakub177) 133 84.44 106.17 37 27.82
3410. JJ (jajo_00) 133 49.98 64.19 15 11.28
3411. Jacob (jacobjuras) 133 115.01 141.86 77 57.89
3412. PinkyPonky (pinky_ponky) 132 61.32 86.71 31 23.48
3413. John (whalenj) 132 55.39 69.39 16 12.12
3414. Mau (walfare_12) 132 93.52 122.64 50 37.88
3415. Gary (vision_123) 132 52.25 63.59 25 18.94
3416. Jack (user85793) 132 92.79 123.43 47 35.61
3417. Keith (touchpoint) 132 69.72 86.91 37 28.03
3418. afafaf (tkuo42) 132 113.38 139.23 79 59.85
3419. gfy (tiga6) 132 42.29 59.89 14 10.61
3420. Bùi (thundergod1311) 132 63.57 81.48 30 22.73
3421. gabriel (super_racer1) 132 68.42 88.37 25 18.94
3422. wiredShark (slamerpunch) 132 91.47 123.13 45 34.09
3423. Sam (samsmoke) 132 65.66 80.27 28 21.21
3424. Erik (rocketdog_23) 132 67.73 82.27 17 12.88
3425. Soham (okaysoham) 132 53.32 69.41 21 15.91
3426. neyo (neyoka) 132 83.64 104.49 43 32.58
3427. M (musketeertypist) 132 108.41 130.35 68 51.52
3428. John (meep_beep) 132 76.19 98.47 39 29.55
3429. 2Centuries (marwankhaled) 132 96.06 118.42 49 37.12
3430. Abhijeet (free_wanderer) 132 59.91 79.97 30 22.73
3431. Fire (fire_rice) 132 77.19 98.72 32 24.24
3432. Dishant (dishant_10) 132 46.52 62.50 11 8.33
3433. Aron (aronbk) 132 91.62 112.41 44 33.33
3434. Frara (frara) 131 43.81 61.93 10 7.63
3435. Cuthbert (cuthybert) 131 123.51 163.01 86 65.65
3436. braden (cablebox) 131 63.81 100.35 33 25.19
3437. Stefan (x2stefan) 131 57.22 78.77 23 17.56
3438. Guest (weruio) 131 72.66 98.31 36 27.48
3439. Taa (vrztaa) 131 64.17 77.04 30 22.90
3440. Dante (therealdante13) 131 58.04 71.86 19 14.50
3441. Lincoln (soupyy34) 131 81.15 110.05 35 26.72
3442. Syie (shinze) 131 110.37 139.79 59 45.04
3443. Luis (lmorales) 131 90.97 113.07 49 37.40
3444. Karan (kk11007) 131 34.02 47.04 6 4.58
3445. chuanHui (juchh) 131 37.79 46.43 10 7.63
3446. hello :) (heyimalexsmileyface) 131 105.71 134.81 51 38.93
3447. Usman (grim_09) 131 75.56 98.51 49 37.40
3448. Jayden (gancube) 131 91.99 123.60 37 28.24
3449. Alistair (futuresenator) 131 79.34 109.35 36 27.48
3450. Abdy (a7xsg) 131 50.58 63.28 11 8.40
3451. Ryan (rtyocum) 131 69.01 83.40 24 18.32
3452. Fabio (fl1410) 131 60.30 77.72 25 19.08
3453. Shnyll (shnyll10) 131 56.31 85.22 21 16.03
3454. Roman (romanzm19) 131 35.09 44.62 7 5.34
3455. RHYTHM MOTWANI (rhythm_123) 131 28.09 38.89 26 19.85
3456. Myles (pord) 131 49.94 62.45 8 6.11
3457. Aaditya Pal (ninjaadi7903) 131 86.09 114.24 31 23.66
3458. nivedh (n43527) 131 84.66 103.44 38 29.01
3459. mik (miiik) 131 76.29 93.31 39 29.77
3460. Martin (megdal02) 131 101.75 123.95 58 44.27
3461. Lucy (masterlu789) 131 77.80 97.50 24 18.32
3462. Remi (remi_11) 130 56.64 72.04 24 18.46
3463. Red (redchristian16) 130 81.57 100.60 42 32.31
3464. Pheontern (pheontern) 130 68.11 83.11 29 22.31
3465. Sriram (nvsriram) 130 83.63 99.69 40 30.77
3466. Mikey (miket349) 130 109.71 147.61 55 42.31
3467. heythisistej (lucknumber8_alt) 130 88.81 115.03 43 33.08
3468. Olexiy (lexk) 130 77.29 98.63 38 29.23
3469. Mohammed (ledger67) 130 76.95 94.65 23 17.69
3470. nakkooo (kuudere) 130 137.10 183.15 90 69.23
3471. mike (jazz_hands) 130 107.40 130.48 60 46.15
3472. laezza (inimitabile) 130 95.00 130.55 51 39.23
3473. SMdG (hyperlord) 130 67.93 80.91 34 26.15
3474. endless (dm475) 130 76.65 105.94 40 30.77
3475. Corné (corneduring) 130 73.41 88.98 34 26.15
3476. Tenzin (cleggmcmuffin) 130 90.15 120.53 45 34.62
3477. Billy (battlefieldragon) 130 101.62 119.08 50 38.46
3478. Basketbla (basketbla) 130 72.87 92.74 40 30.77
3479. Zeyad (zeyad_mohamed) 130 45.17 58.82 12 9.23
3480. GOBLIN (xgoblin) 130 106.50 146.84 60 46.15
3481. Hunter (wizardhunter11) 130 85.26 108.99 35 26.92
3482. Daehan (vitamaxdh) 130 93.45 116.83 44 33.85
3483. Md. Tarek Hasan (tarek_racer) 130 60.80 78.86 19 14.62
3484. Timofey (t1m0n) 130 81.38 95.69 39 30.00
3485. sherry (sherry4) 130 75.61 93.31 37 28.46
3486. Miguel (anckael) 130 101.43 122.90 61 46.92
3487. Akshay (akshay_c123) 130 42.15 57.12 13 10.00
3488. akash_mzp (akash04mzp) 130 34.69 47.40 9 6.92
3489. Steve (addictedtoendorphins) 130 107.32 124.01 68 52.31
3490. Abbey (abbey240901) 130 85.64 101.67 30 23.08
3491. Ni (013ni) 130 94.04 119.56 50 38.46
3492. Lucyfer666 (lucyfer666) 130 71.53 90.06 38 29.23
3493. bg (bbbggg) 130 33.41 44.12 7 5.38
3494. radish (onlyradish) 129 94.09 115.88 58 44.96
3495. Nikhil (momo7636) 129 49.06 59.85 11 8.53
3496. CHUGGITYPES (chuggitypes) 129 74.98 97.12 21 16.28
3497. Falitac (falitac) 129 78.34 103.16 46 35.66
3498. TypingSince2017 (expeditive) 129 147.70 184.96 98 75.97
3499. Person (person753) 129 72.37 96.25 42 32.56
3500. Alexander (need4speed402) 129 91.80 132.07 40 31.01
3501. Naeem (naeemsalarzai) 129 39.45 56.18 15 11.63
3502. Niue (miloszz) 129 74.24 91.13 26 20.16
3503. Kreingkrai (kengkreingkrai) 129 67.06 81.93 33 25.58
3504. Muhammad (junaidqazi) 129 57.53 73.06 19 14.73
3505. Jacob (jacobogbeide) 129 73.71 97.76 28 21.71
3506. David (hanid3) 129 76.81 98.32 37 28.68
3507. Hamza π (hamzza_) 129 104.07 125.08 55 42.64
3508. augustus (guslee) 129 106.61 130.85 57 44.19
3509. winner (winner11) 129 106.50 132.17 72 55.81
3510. Tom (tom09876) 129 53.41 65.75 11 8.53
3511. TJ (timothyjan) 129 86.95 105.65 43 33.33
3512. Pedro (timboly3) 129 98.39 131.60 61 47.29
3513. Rouven (therealr5) 129 44.49 58.46 14 10.85
3514. Wouter (wouter_kuijk) 128 87.93 106.98 40 31.25
3515. venki (venki15) 128 66.16 82.92 60 46.88
3516. Haris (undead_slayer) 128 67.96 83.43 58 45.31
3517. tje (tje04) 128 88.65 119.56 40 31.25
3518. Raymond (szlesh) 128 93.08 121.77 53 41.41
3519. saniya (supersaniya) 128 54.98 68.48 18 14.06
3520. bubbleTEA (stefsbored) 128 77.86 102.63 34 26.56
3521. 10 🆆🅿🅼 (sostdeo) 128 57.95 67.55 20 15.63
3522. Roy (sisalt) 128 99.40 123.30 47 36.72
3523. Shukhrat (shux121995) 128 70.79 87.26 28 21.88
3524. Raghav (redsondude) 128 99.24 119.91 48 37.50
3525. Ravindra (ravindrats) 128 62.42 75.49 19 14.84
3526. Phillip (phillip_kim) 128 84.00 124.64 45 35.16
3527. Caleb (miniso0987) 128 132.14 164.26 53 41.41
3528. Andrew (andrewfischr) 128 66.61 81.81 21 16.41
3529. Abstraxions (abstraxions) 128 115.66 141.64 65 50.78
3530. Gabe (zonazebra) 128 67.65 88.16 34 26.56
3531. alloine0220 (d1rtyd33d_5) 128 51.16 70.41 11 8.59
3532. BOOGIE (bobarex) 128 47.02 60.34 10 7.81
3533. blaze (blaze_012) 128 54.57 65.92 10 7.81
3534. tstats[beedi] (beedi) 128 72.41 96.51 38 29.69
3535. johnny :P (johnny234) 128 87.49 108.27 39 30.47
3536. Ivan (ivanv1997) 128 62.88 72.06 21 16.41
3537. gab (ggzl1998) 128 106.15 128.38 72 56.25
3538. AMM (gamesplaytest) 128 61.33 82.90 25 19.53
3539. KTH (kthmanish) 127 86.25 115.89 42 33.07
3540. ghoudiy (ghoudiy) 127 66.75 92.12 20 15.75
3541. Krittiphum (100508274) 127 101.36 122.35 54 42.52
3542. Peter (upsala_koy) 127 75.82 92.01 33 25.98
3543. Aren (tl8xv) 127 89.96 121.55 39 30.71
3544. sheep (theonesheep) 127 100.72 129.58 53 41.73
3545. SR (ssdel) 127 85.13 116.43 48 37.80
3546. HEMEL (sm_hemel) 127 74.20 89.27 23 18.11
3547. Cris (schmidtolini) 127 98.29 123.88 52 40.94
3548. Basti (schinken38) 127 71.79 98.09 35 27.56
3549. Mohamad (mhsyazani) 127 66.43 88.47 30 23.62
3550. mazen (mazen25287) 127 55.84 73.12 13 10.24
3551. Bat-Amgalan (mambatukaa) 127 80.67 97.79 36 28.35
3552. Kalervo (dilbodeadhorseflog... 127 66.94 81.70 23 18.11
3553. desarly (desarlymarshall) 127 64.01 87.04 32 25.20
3554. Wendy (crystalblue123) 127 56.64 70.84 21 16.54
3555. Chumba1ba (chumba1ba) 127 94.62 118.73 43 33.86
3556. Jimmy Le🇻🇳🇺🇸 (c... 127 70.91 88.72 30 23.62
3557. stained (fartunderwear) 126 170.19 200.25 0 0.00
3558. m&m (egyz) 126 84.13 101.55 43 34.13
3559. Pei Bin (cheongpeibin) 126 93.64 132.28 45 35.71
3560. Bymbadulam (boa_7515) 126 50.49 67.68 12 9.52
3561. Andrei (_son_) 126 169.89 194.72 118 93.65
3562. Pratul NHK (zer_fus) 126 56.45 71.39 20 15.87
3563. Aaron (the_bus) 126 76.67 89.91 35 27.78
3564. no (theovive) 126 101.92 128.87 60 47.62
3565. Sean (seandominic14) 126 78.45 93.72 38 30.16
3566. mackysmach (mackysmach) 126 60.64 82.05 35 27.78
3567. John (johnykenny) 126 73.32 98.23 29 23.02
3568. Miles (jetblxckwalls) 126 101.21 126.02 57 45.24
3569. Snowy (it_was_lag) 126 90.74 127.61 40 31.75
3570. Jacob (hydrogenation) 126 87.76 116.76 40 31.75
3571. Anadi vyas (anadivyas) 126 73.67 88.67 19 15.08
3572. Adam (adammomen) 126 61.44 76.63 19 15.08
3573. Nuub (1brasil) 126 102.42 131.43 51 40.48
3574. Typemasterluka (fica030) 126 56.94 73.17 16 12.70
3575. felix (sanfelix) 126 64.72 87.31 26 20.63
3576. Sam (samb11) 126 102.09 126.16 53 42.06
3577. PUO (puomaster) 126 67.43 83.55 40 31.75
3578. Daniel Mulligan (parubujotuce) 126 41.06 58.84 12 9.52
3579. Panic (panicswitch07) 126 85.86 131.07 44 34.92
3580. idell (notidell) 126 89.58 110.24 42 33.33
3581. Mauro (mauronaval) 126 52.42 68.40 15 11.90
3582. ridicolos (ridicolos) 125 79.93 96.80 37 29.60
3583. Rendi (rendi_touchtype) 125 91.60 120.60 46 36.80
3584. Perry ᗜˬᗜ (perryok) 125 125.45 151.72 77 61.60
3585. Aisha (needforspeed_) 125 52.96 76.27 14 11.20
3586. Shonade (mr_overclocked) 125 87.40 128.17 32 25.60
3587. Ujjwal (megamindx) 125 65.13 96.09 24 19.20
3588. Mayank (mayank1508) 125 71.75 85.59 24 19.20
3589. Murk (marchell0) 125 66.39 91.85 33 26.40
3590. Maninder (mani_ms1) 125 76.42 101.69 32 25.60
3591. Jessica (jeguar) 125 89.30 127.51 36 28.80
3592. Grant (gboi881) 125 65.53 80.93 28 22.40
3593. daniel (dpainter) 125 99.51 118.59 57 45.60
3594. Cuong (cuongdao) 125 78.55 99.60 32 25.60
3595. Jeff (chiefjeef) 125 109.83 136.78 75 60.00
3596. CB (cb_cabral) 125 37.36 47.44 11 8.80
3597. Wen Ree (cataclysm234) 125 79.51 103.72 37 29.60
3598. Brandon (brandon_b) 125 80.53 102.73 28 22.40
3599. Manu (basuramanu) 125 111.15 159.27 65 52.00
3600. ATRAN (atranhehe) 125 76.91 98.36 25 20.00
3601. Bob (wmwmwmwm) 125 81.26 115.25 31 24.80
3602. Tanver (tanverrupos) 125 80.54 107.40 34 27.20
3603. Stafford (staffordv) 125 84.21 111.88 29 23.20
3604. Sphynx (sphynxy) 125 80.83 103.32 32 25.60
3605. Soph (soap28) 125 43.92 57.08 6 4.80
3606. ارمغان (armaghan_ahmed) 125 56.87 71.22 17 13.60
3607. Slowpoke (amisanthropist) 125 95.14 125.73 41 32.80
3608. aman729272 (aman729272) 124 55.50 64.91 19 15.32
3609. Tony (adbaldini) 124 45.57 59.79 9 7.26
3610. Vu (3nim3) 124 85.17 108.17 31 25.00
3611. Roman (freasy) 124 59.97 77.91 21 16.94
3612. Anye (farmerfred) 124 81.93 100.57 44 35.48
3613. Edu (edlofe) 124 63.19 84.05 29 23.39
3614. Sir (dsfee) 124 66.21 82.33 33 26.61
3615. hu (crediblez) 124 143.90 190.09 89 71.77
3616. bhavesh (bhanucsgo) 124 55.60 75.51 23 18.55
3617. bangka (bangkabelitung) 124 81.42 102.82 26 20.97
3618. Scalmole (scalmole) 124 89.09 112.16 47 37.90
3619. Per (perlydersen) 124 67.31 81.15 29 23.39
3620. NickBwalley (nickbiiy) 124 97.16 122.02 52 41.94
3621. mayimbe (mayimbe194) 124 76.99 98.10 28 22.58
3622. Stitch (lostowo) 124 65.58 91.29 48 38.71
3623. Jay (jay_soh) 124 93.89 109.92 41 33.06
3624. Jason (jasonw1121) 124 106.33 134.77 80 64.52
3625. Gabriel (itsgiorno) 124 56.22 68.35 27 21.77
3626. g (georgecolin1221) 124 44.30 62.98 11 8.87
3627. araceli nicole (xrxcxlx) 124 73.28 104.45 74 59.68
3628. dude (udead1) 124 108.62 124.60 58 46.77
3629. Quan (tmquan98) 124 77.36 117.83 25 20.16
3630. Zx (zxloh) 123 72.11 89.44 25 20.33
3631. Zodi (zodi_dutoit) 123 70.63 84.61 28 22.76
3632. Yash (yash1402_) 123 85.14 108.74 28 22.76
3633. k2K (worthwhile) 123 64.48 85.47 22 17.89
3634. Julia (thejulia) 123 66.91 81.06 21 17.07
3635. sathwik_0777 (sathwik_7770) 123 58.16 73.70 18 14.63
3636. RoSchnitzel (sab_lyptical42) 123 63.53 84.00 15 12.20
3637. Logan (ronaldo_02) 123 78.45 106.21 38 30.89
3638. Novandru (novandru98) 123 68.27 87.85 23 18.70
3639. nonaem (apansi) 123 90.16 119.95 39 31.71
3640. Ankit (ankp) 123 47.61 59.30 13 10.57
3641. aero (aeroagg15) 123 84.14 110.91 38 30.89
3642. sketchy (sketchysquirrel) 123 79.02 100.30 36 29.27
3643. jclb (jclb) 123 67.15 88.43 30 24.39
3644. donald_dump. (lookin_xss) 123 58.20 74.23 24 19.51
3645. Desert (desert_eagle) 123 38.80 50.05 9 7.32
3646. isaac (darealjoemama) 123 73.68 95.49 38 30.89
3647. ousssama (cybereagle2001) 123 51.60 65.74 14 11.38
3648. Code_slayer_25 (code_slayer... 123 39.40 49.86 10 8.13
3649. bombplay1 (bombplay1) 123 78.65 102.78 35 28.46
3650. Lawrence Leones (leonnids) 123 114.52 150.73 64 52.03
3651. Juan (juanmartinez111) 123 73.25 92.70 30 24.39
3652. AKIS (harkar) 123 62.75 79.12 29 23.58
3653. Thank you, (maintrack) 122 135.72 176.94 78 63.93
3654. MAHIR (mahirlabib) 122 56.01 69.25 22 18.03
3655. Muhammad (littlememon) 122 69.19 91.91 33 27.05
3656. Laura (laurga) 122 102.35 125.82 45 36.89
3657. Homer (aerowang) 122 58.86 72.20 16 13.11
3658. adarshdhital007 (adarshdhit... 122 47.11 73.85 17 13.93
3659. Adamelvis (adamelvis) 122 73.56 92.18 27 22.13
3660. Daniel (maddan2016) 122 83.06 106.50 27 22.13
3661. yash (userthree) 122 52.87 67.12 16 13.11
3662. Golf GTI (typeracer_user_) 122 82.96 102.56 35 28.69
3663. vinh (tienvinh) 122 54.25 68.51 13 10.66
3664. Alireza (thealireza) 122 116.11 154.94 76 62.30
3665. snackmancer (snackmancer) 122 141.77 165.38 93 76.23
3666. Mikke (skrammelkonto) 122 59.54 70.20 41 33.61
3667. Sherniiaz (shero2002) 122 64.85 81.09 32 26.23
3668. pablo (pablo_rm1197) 122 82.06 109.61 31 25.41
3669. otto (ottocorrect) 122 91.98 114.45 39 31.97
3670. Phil (miss_you_reck) 122 131.79 153.07 91 74.59
3671. matin (mdmatin4) 122 43.93 58.57 6 4.92
3672. dulux23 (dulux23) 122 99.52 121.63 47 38.52
3673. Ana (druze_tito) 122 53.58 70.42 19 15.57
3674. yah-yeet (dingdong768) 122 105.40 125.98 58 47.54
3675. Andrew (dijkstra) 122 92.33 113.13 46 37.70
3676. CHEESE (chromatickhaled) 122 103.85 121.28 50 40.98
3677. twitch_NotDefense (bravedev... 122 92.21 114.26 31 25.41
3678. Blake (blake4605) 122 75.87 93.24 35 28.69
3679. Binay (binayginodia) 122 68.15 86.16 24 19.67
3680. Andrei (elpelaodank) 121 169.24 204.35 101 83.47
3681. Aloysius (dude101no) 121 95.91 114.58 42 34.71
3682. Arnab (arnab_api) 121 67.69 82.62 22 18.18
3683. Benjie (xbenjie) 121 125.82 170.31 84 69.42
3684. Eric (wernerosorio) 121 91.94 117.93 36 29.75
3685. vitvlkv (vitvlkv) 121 59.56 73.08 18 14.88
3686. Stank (stankyard) 121 60.30 78.38 33 27.27
3687. David (jabadahub25) 121 64.57 82.98 28 23.14
3688. a (im_typing_with_my_d) 121 72.19 89.85 27 22.31
3689. Andrew (honeyman) 121 129.37 159.68 79 65.29
3690. Blake (hanlentt) 121 65.27 95.25 26 21.49
3691. Gabriel (gbvicente) 121 80.91 100.96 26 21.49
3692. Abed (abed42) 121 65.46 98.65 30 24.79
3693. Sandeep (5keleton) 121 28.89 37.89 18 14.88
3694. Ryan (riceisgoodman) 121 91.80 115.72 40 33.06
3695. Putus (putusbb) 121 24.50 35.84 18 14.88
3696. Lesibana (profles) 121 64.70 87.16 25 20.66
3697. DDIR (pn10401006) 121 59.06 72.98 23 19.01
3698. PAT (pat0216) 121 75.39 93.33 31 25.62
3699. Egg (organicegg) 121 90.75 115.48 43 35.54
3700. Nungkha (nungkha) 121 58.43 81.79 22 18.18
3701. no (nomaybeyes) 121 94.22 121.67 40 33.06
3702. Sahil (sahil_sa) 120 57.16 68.32 14 11.67
3703. Rafar (rafar504) 120 62.01 79.30 16 13.33
3704. Mykhailo (pushkarov) 120 52.01 64.43 20 16.67
3705. Prosper (prosperhuang) 120 85.35 105.89 30 25.00
3706. oley (oley11) 120 50.08 65.33 10 8.33
3707. Road (oldayanisnoob) 120 55.06 71.90 25 20.83
3708. Noob (noob_racer1) 120 78.33 100.83 61 50.83
3709. Sreshta Kamya (nikitha) 120 83.55 104.52 37 30.83
3710. Narmichid (narmichid_2003) 120 59.08 76.12 25 20.83
3711. Colin (modernbonsai) 120 79.43 96.21 28 23.33
3712. Mohammad Hossein (mh1998) 120 81.45 99.89 38 31.67
3713. M (magmag00) 120 53.03 64.51 7 5.83
3714. Lord Kuro (lordkuro) 120 91.92 117.59 39 32.50
3715. chromebook user (kuxir97) 120 69.63 92.41 57 47.50
3716. KM9 (kunal2795) 120 88.32 127.09 65 54.17
3717. 光次郎 (koujiro) 120 81.61 109.93 33 27.50
3718. Alfred (junior162007) 120 63.62 87.24 26 21.67
3719. tstats[itchyhuman] (itchyhu... 120 113.72 148.03 62 51.67
3720. Invis (invis_lurker) 120 80.63 119.82 28 23.33
3721. pavle (hello_kittyy) 120 84.68 101.04 34 28.33
3722. Gamer (gamer_equine) 120 53.30 67.48 19 15.83
3723. Gajendra (gajendra_0180) 120 70.68 87.64 113 94.17
3724. Andre (dreson03) 120 85.36 114.59 36 30.00
3725. Mario (dmfz) 120 72.91 91.79 32 26.67
3726. Deltaology (deltaology) 120 48.58 66.64 9 7.50
3727. DeadpoolFromAliBaba (bruhgo... 120 60.58 79.13 22 18.33
3728. Seraphear (_seraphear) 120 73.79 85.75 31 25.83
3729. Vinni (vinnico) 120 60.01 75.13 17 14.17
3730. skyeblu7 (skyeblu7) 120 94.07 115.51 46 38.33
3731. sika (sikathenub) 120 81.85 109.22 52 43.33
3732. Shelpeck (shelpeck) 120 55.18 75.44 17 14.17
3733. serien (serien_) 120 86.00 113.62 28 23.33
3734. Aleks (alexmandev_3) 120 77.21 95.02 36 30.00
3735. click clack (albert471) 120 130.40 160.14 74 61.67
3736. Akkmaharaj (akkmaharaj) 120 67.37 87.37 24 20.00
3737. Ae (aezharhu) 120 77.48 99.77 28 23.33
3738. suhuyini (smaimoro) 120 32.70 46.08 18 15.00
3739. Bed Rock (bedhat7) 120 58.32 84.02 20 16.67
3740. Amer (amer202) 119 51.08 70.58 14 11.76
3741. albit (albit) 119 35.38 48.68 3 2.52
3742. Chen (chen_) 119 80.47 96.44 30 25.21
3743. Bharath (bharath0915) 119 50.76 65.87 9 7.56
3744. ponyo (ponyyo2323) 119 33.73 47.94 2 1.68
3745. polongas (polongas) 119 50.30 67.81 10 8.40
3746. Ben (mrjamminkearl) 119 91.69 120.85 41 34.45
3747. Timoxa (mita57) 119 101.90 122.26 51 42.86
3748. Anurag (mak42) 119 79.41 100.27 34 28.57
3749. Mark (loggsu) 119 97.94 135.32 47 39.50
3750. mkk (litt1e_ave1) 119 42.44 54.15 31 26.05
3751. bruh (lambertwp) 119 70.96 90.71 30 25.21
3752. Blaze (klblaz) 119 83.64 106.50 29 24.37
3753. buynaa (kamikaze0612) 119 85.94 109.04 26 21.85
3754. Jin Yi (jinyisim) 119 94.36 113.96 43 36.13
3755. VY (india_vikas_yadav) 119 133.58 160.68 88 73.95
3756. Speed is relative (hvan1998) 119 72.15 87.01 20 16.81
3757. CelerySticks (whatan0b) 119 101.15 123.16 47 39.50
3758. Speed (ututu222) 119 97.89 129.84 43 36.13
3759. pugman (thepugpro) 119 105.91 142.64 56 47.06
3760. Ihor (_ihor) 118 47.52 60.02 15 12.71
3761. Shubham (_anonymous) 118 50.80 66.89 10 8.47
3762. Zaid (zaid1012) 118 58.59 78.01 30 25.42
3763. TBo (tbo_) 118 84.69 110.32 30 25.42
3764. Steve (srd93) 118 89.96 106.99 42 35.59
3765. Satyam (sprayinglight0) 118 71.55 89.92 27 22.88
3766. someonewhoisntlikeyou (some... 118 99.54 119.89 57 48.31
3767. Scotf (scottgraham) 118 40.50 53.40 8 6.78
3768. Hussam (samwa7sh800) 118 65.50 80.64 29 24.58
3769. Elliot (privateplague) 118 80.64 100.26 29 24.58
3770. Shinji (nagkagrabe7) 118 96.95 118.73 42 35.59
3771. Michael (mwalter32123) 118 69.77 84.97 29 24.58
3772. matcha (matchamacchiato) 118 111.26 137.29 67 56.78
3773. 🍉 (masqueworld) 118 119.51 141.86 66 55.93
3774. Argo (argonautika) 118 84.95 108.49 30 25.42
3775. Ankush (ankush_12) 118 57.44 73.02 20 16.95
3776. Aamill (aamill) 118 91.88 117.59 34 28.81
3777. Ryan (8baller) 118 68.17 87.21 29 24.58
3778. (4lsi3w544lwi4lk) 118 129.99 155.49 78 66.10
3779. :( (notabot69) 118 64.59 80.42 23 19.49
3780. SSJ 5 :) (rak99) 118 48.49 62.83 9 7.63
3781. Exzede (exzede) 118 66.28 88.97 32 27.12
3782. 😳 (expertgeneralist) 118 87.89 111.31 35 29.66
3783. Ethan (ethan_5) 118 100.10 129.70 47 39.83
3784. cod1r (cod1r) 118 89.89 120.20 41 34.75
3785. james (chilty14) 118 76.82 105.39 33 27.97
3786. Gaurab (logan_pi) 118 60.01 79.22 25 21.19
3787. Liam (lime_da_bestest) 118 80.81 100.72 29 24.58
3788. VH (jaywild) 118 60.13 77.47 23 19.49
3789. tstats[illblowurmind] (illb... 118 102.09 131.91 43 36.44
3790. how? (haotingz) 118 105.06 129.65 57 48.31
3791. Garrett (gdiegnan147) 118 119.43 144.32 65 55.08
3792. Yevhen (m1rev) 117 38.90 57.69 9 7.69
3793. max (low_wpm) 117 49.40 60.43 11 9.40
3794. kikiki (kiki02613) 117 99.98 117.11 48 41.03
3795. laptopwinterpro (justanothe... 117 146.69 168.37 84 71.79
3796. josh (joshtypes1) 117 107.91 145.30 51 43.59
3797. Jonas (jonasj2001) 117 85.63 105.41 37 31.62
3798. jeff (jeffersongtg) 117 72.85 92.29 31 26.50
3799. 6typeR (hacker888) 117 60.51 74.92 26 22.22
3800. Micro (apm14) 117 91.61 116.19 28 23.93
3801. Abdulwahab (wahabi56) 117 25.19 34.35 22 18.80
3802. Tom (twatters) 117 75.11 102.40 31 26.50
3803. timgan (timgan) 117 104.24 126.95 51 43.59
3804. testsubject (shamushasha) 117 76.67 101.28 30 25.64
3805. Shai (shaichon) 117 84.42 102.94 37 31.62
3806. Zamami (shadaokami) 117 46.98 62.74 11 9.40
3807. magnus (robertavmagic) 117 74.41 91.66 22 18.80
3808. Chen (nyarlathoteppppp) 117 70.31 85.10 31 26.50
3809. BEECEE (nukecee) 117 107.85 131.53 63 53.85
3810. Nate (ngb125) 117 66.97 86.42 27 23.08
3811. Jester (murvayne) 117 120.32 149.46 61 52.14
3812. MithterMagma (mithtermagma) 117 92.95 112.79 43 36.75
3813. Marc (mghale_215) 117 100.52 126.40 45 38.46
3814. new account fenno4 (fennomak) 117 123.90 157.15 71 60.68
3815. Rahul (endeavour_the_one) 117 58.85 79.26 18 15.38
3816. dvorak (dvorak0211) 117 44.41 68.11 16 13.68
3817. Bea (chilichanga) 117 90.34 119.24 37 31.62
3818. Asif (asif04) 117 75.89 90.87 33 28.21
3819. Andreas (drivknuten) 116 38.92 44.93 9 7.76
3820. Divyesh (divyeshm) 116 59.86 78.23 22 18.97
3821. Bob (bob_loblawrl) 116 69.51 82.87 32 27.59
3822. Miguel (bellcros) 116 61.81 84.62 32 27.59
3823. Asad (asad104khan) 116 82.94 100.38 31 26.72
3824. G (zger) 116 90.05 119.68 40 34.48
3825. tobias (thandschin) 116 85.38 102.31 31 26.72
3826. mm (smsa5000) 116 78.26 96.20 20 17.24
3827. Daniel (scumset) 116 102.35 126.87 52 44.83
3828. Judas Escargot (looneyjuice) 116 113.23 148.90 61 52.59
3829. laZorbeamZ (lazorbeamz) 116 101.93 125.27 46 39.66
3830. Kaplana (kaplana) 116 47.77 69.91 26 22.41
3831. Jordan (jordan2380) 116 161.91 196.32 0 0.00
3832. Tru (jhake_1) 116 82.12 110.49 26 22.41
3833. Amal (amal_jyothis) 116 57.84 81.96 15 12.93
3834. Vishagh (vishagh) 116 41.55 54.68 16 13.79
3835. Ronan (ronocoolo) 116 78.72 96.45 32 27.59
3836. pilioko (pilioko) 116 77.23 107.28 38 32.76
3837. Charles (chan_cellor) 116 48.93 60.77 12 10.34
3838. sanchayay (sanchayay) 116 57.58 72.87 22 18.97
3839. Vincent (rubixon) 116 50.04 59.86 9 7.76
3840. Rohit (rohit_1706) 116 40.48 61.61 10 8.62
3841. Lia (reyi) 116 94.64 124.30 35 30.17
3842. Miłosz (refjel) 116 69.59 82.80 31 26.72
3843. Lord (planta) 116 97.08 121.94 39 33.62
3844. Nitesh (niteshtiwari) 116 64.11 92.22 28 24.14
3845. PotatoLyfe (potato_lyfe) 115 69.15 92.74 25 21.74
3846. Radwin (nosmirk) 115 90.19 122.23 51 44.35
3847. nazmul (nhasan0290) 115 69.89 87.49 30 26.09
3848. Ken (netski1400) 115 75.87 93.05 28 24.35
3849. Ḿ (m_10) 115 56.19 72.39 18 15.65
3850. Matthew (mstracy) 115 86.54 104.90 35 30.43
3851. bruh (lmnhat2002vn) 115 57.34 74.51 19 16.52
3852. tstats[learning_dvorac] (le... 115 67.38 96.32 32 27.83
3853. Florian (jordanbelfort) 115 89.89 108.87 35 30.43
3854. Jem (jemanema) 115 80.49 101.20 28 24.35
3855. jay (jaymorant) 115 60.74 77.11 21 18.26
3856. race typing (jangyeeunnie616) 115 94.11 131.49 97 84.35
3857. hypeiron (hypeiron) 115 69.62 84.78 29 25.22
3858. heyitsalec (heyitsalec) 115 115.44 140.53 75 65.22
3859. Hans (hansboi) 115 86.51 121.19 42 36.52
3860. labaalli (hajjaba) 115 28.37 39.31 15 13.04
3861. Fadosa (fadosa) 115 86.71 104.40 33 28.70
3862. erk (estalow) 115 121.40 139.61 71 61.74
3863. Ramiei (elli_y) 115 84.38 112.88 38 33.04
3864. vrum vrum (elex_) 115 41.42 55.54 9 7.83
3865. el (elanamax) 115 98.06 116.42 42 36.52
3866. Ethan (eg083) 115 66.75 86.35 30 26.09
3867. Edward (edwardw21) 115 136.32 167.24 74 64.35
3868. Donald (dhonuill) 115 111.47 134.80 53 46.09
3869. dat (datkitteh) 115 35.37 60.03 11 9.57
3870. Sonatry (danyannang) 115 100.67 116.91 43 37.39
3871. Niamh (crystalniamh) 115 105.55 135.83 41 35.65
3872. J (average_typer95) 115 98.67 124.41 42 36.52
3873. Arunreas (arunreas) 115 48.26 65.49 19 16.52
3874. Pranav (_vanarp) 115 42.10 58.37 9 7.83
3875. snake_case (_snake_case) 115 45.22 54.77 5 4.35
3876. iosif (y_o_s) 115 44.47 62.54 8 6.96
3877. Areeb (your_avg_aaa) 115 82.37 104.92 36 31.30
3878. s3yf (unclemeat) 115 74.93 95.88 33 28.70
3879. Free Palestine (tidy400) 115 82.62 103.71 28 24.35
3880. TheTIger107 (thetiger107yt) 115 97.89 144.70 51 44.35
3881. Sultan (sultanreal) 115 53.31 71.90 15 13.04
3882. Shil (shilegend) 115 54.43 68.00 12 10.43
3883. Vielle (arc_sec) 115 178.39 220.10 9 7.83
3884. angie :) (angwie) 115 88.69 117.79 33 28.70
3885. Al (al_gha23) 115 70.11 85.91 35 30.43
3886. Adam (adamhawkins) 115 122.29 151.49 73 63.48
3887. Obi-Wan (6x_ebitda) 115 80.23 94.63 32 27.83
3888. sss (1whiteblack1) 115 58.04 72.81 11 9.57
3889. Jules (layinpip_) 115 67.52 88.20 24 20.87
3890. tstats[abdul_hakeem123] (ab... 114 52.97 69.36 19 16.67
3891. 5000600 (5000600) 114 108.69 171.39 87 76.32
3892. Doniyor (doni_dev) 114 67.61 89.35 38 33.33
3893. Parik (communistcomradepv) 114 61.45 81.94 18 15.79
3894. david (chu0724) 114 43.70 59.72 19 16.67
3895. Caitlin (caitlin3) 114 98.36 117.55 53 46.49
3896. Samuel (budbeats) 114 53.01 79.01 16 14.04
3897. Joe (bubustrick) 114 60.43 75.14 24 21.05
3898. BooceJooce (boocejooce) 114 58.47 75.19 21 18.42
3899. BMO (balot2020) 114 76.82 100.44 24 21.05
3900. badtyper (badtyper_) 114 72.89 95.98 25 21.93
3901. rajnish (rajnishkumar31) 114 69.83 94.96 37 32.46
3902. RacerABM (racerabm) 114 70.79 96.05 32 28.07
3903. badgyalting (pl200834) 114 51.81 67.65 26 22.81
3904. Phil (philwinnem) 114 102.51 127.62 46 40.35
3905. Pacham (pachamcham) 114 75.86 91.54 41 35.96
3906. ogkatumus (ogkatumus) 114 90.73 121.82 46 40.35
3907. Don (odonjeque) 114 64.54 78.76 15 13.16
3908. Moye (moyoka) 114 90.91 119.21 32 28.07
3909. Michael (mercury28) 114 102.79 131.22 49 42.98
3910. Maxwell (mc2006) 114 81.64 98.64 33 28.95
3911. 樊 (krinzkolo) 114 65.99 82.97 24 21.05
3912. kum (kinararidwan) 114 79.96 102.02 37 32.46
3913. Ken (kenkenken_) 114 113.93 131.35 74 64.91
3914. Jonathan (jonyaa) 114 84.19 105.72 33 28.95
3915. Jesus (johangodinho123) 114 85.98 123.80 37 32.46
3916. William (william_david) 114 89.68 122.02 49 42.98
3917. Tai (weakmee) 114 83.54 109.52 38 33.33
3918. anonym (thefencr) 114 39.71 53.58 5 4.39
3919. Thiago (terjan) 114 77.03 105.66 38 33.33
3920. Tanvir (tanvir_025) 114 74.72 94.24 35 30.70
3921. StewieGriffin (stewiegriffi... 114 101.76 141.45 49 42.98
3922. Salah-eddine (sharrach) 114 42.64 60.14 22 19.30
3923. Zia (zia1) 113 45.28 66.04 6 5.31
3924. Xristos (xristos_gav) 113 72.32 94.03 22 19.47
3925. Andre (smallchicken) 113 84.68 113.03 40 35.40
3926. Samar Singla (samluci666) 113 68.86 91.24 29 25.66
3927. Arthur (sagman) 113 85.64 134.41 20 17.70
3928. Rachel (rffree) 113 80.25 103.17 31 27.43
3929. PreciousStats (precious_stats) 113 124.52 166.49 75 66.37
3930. Jayden (nephewjayden) 113 84.41 104.24 31 27.43
3931. Mike (miym) 113 70.96 83.42 19 16.81
3932. abigail (abigail_w) 113 133.72 151.26 71 62.83
3933. I ♥ Gym (2slow_2exist) 113 97.42 115.53 42 37.17
3934. fares (fares_esam_22) 113 36.38 44.97 4 3.54
3935. on earth, as it is in heave... 113 114.35 145.07 58 51.33
3936. Essi (essi4678) 113 52.96 68.44 24 21.24
3937. Terry (eleftheriosonic) 113 66.03 86.58 29 25.66
3938. Big Pop (broguyman) 113 87.93 110.12 26 23.01
3939. kay (bbsaltlord) 113 89.39 114.12 45 39.82
3940. ashish (ashishroka) 113 52.07 69.18 17 15.04
3941. winter (kitzy) 113 76.56 105.23 24 21.24
3942. Dyslexic_J (jamjar_) 113 79.92 98.77 23 20.35
3943. Hussein (hussein987) 113 71.46 102.45 33 29.20
3944. TheProdigyHenry (henryv70) 113 125.20 164.70 63 55.75
3945. fish and chips (heavenseer) 113 185.62 220.51 96 84.96
3946. HawksCardinals (hawkscardin... 113 102.66 129.36 52 46.02
3947. Harshit (harshitjindal) 113 68.05 96.18 23 20.35
3948. Tim (littlesprinklesjersey) 112 111.73 141.62 59 52.68
3949. Viktor (knifenoob) 112 89.78 115.46 44 39.29
3950. walid (kasemwalid) 112 52.84 67.71 13 11.61
3951. Isaac (isaacchen_cool) 112 112.81 141.64 57 50.89
3952. Hue (hue_man) 112 75.43 88.83 27 24.11
3953. gdonke (gdonke) 112 57.26 69.55 20 17.86
3954. Vibhav (vibhav_1262) 112 63.31 84.29 25 22.32
3955. typing give me depression (... 112 93.27 139.40 41 36.61
3956. Steven (stevencd) 112 83.45 102.17 34 30.36
3957. Robert (selbor) 112 74.31 99.87 31 27.68
3958. :D (scottmorrisonmp) 112 90.55 112.47 30 26.79
3959. Yu (sadochist) 112 101.16 119.90 50 44.64
3960. Jiong Liang (odliang_15) 112 60.25 76.37 21 18.75
3961. FMURTADHO (fmurtadho) 112 122.26 151.11 64 57.14
3962. Nikola (flomaster_) 112 82.73 106.83 34 30.36
3963. Exyiaevox (exyia) 112 96.30 132.03 46 41.07
3964. cvxz (cvxz) 112 58.96 80.48 22 19.64
3965. chris (chrisp03) 112 61.13 78.93 28 25.00
3966. jieun (bunnypenguin) 112 111.66 143.38 53 47.32
3967. Vincent (bhangjiwon) 112 122.56 153.53 76 67.86
3968. Balgow (balgow) 112 73.83 93.69 25 22.32
3969. Rakibul Alam (badboirakib) 112 22.83 33.34 15 13.39
3970. Ashutosh (ashutosh6997) 112 73.84 96.29 21 18.75
3971. Aditya (fire_smasher1) 111 55.98 72.06 18 16.22
3972. Felix (felixsantoso) 111 69.12 90.72 23 20.72
3973. Mordo (elmordo) 111 77.13 91.23 21 18.92
3974. Sean (drherpdederp) 111 84.38 106.59 36 32.43
3975. Demancer (demancer) 111 107.25 140.13 46 41.44
3976. ziad (ziadbensaada) 111 46.47 65.15 6 5.41
3977. DaVinky (xxlarrylegendxx) 111 70.93 89.07 38 34.23
3978. Teodoras (teoyessir) 111 113.39 141.84 57 51.35
3979. Ammar (s_ammar) 111 46.01 58.12 12 10.81
3980. Sheraz (sherazahmad720) 111 48.95 60.17 20 18.02
3981. Ahmad Fatih (afaf_tech19) 111 64.51 86.62 27 24.32
3982. Baramee (6666666666666666) 111 49.58 67.82 7 6.31
3983. Thomas (447tomtom) 111 47.18 60.62 11 9.91
3984. Radoslav (padoto07) 111 71.06 89.56 27 24.32
3985. Leonardo (zadig1789) 111 55.62 72.12 18 16.22
3986. Kevki (kevki_) 111 84.14 104.61 34 30.63
3987. Jonathan (jah_n_i) 111 85.90 113.25 45 40.54
3988. iCry (icry) 111 90.40 120.90 33 29.73
3989. @smile.hnts on twitter (hyp... 111 85.82 108.35 33 29.73
3990. Syed (hello_guest) 111 47.13 62.11 12 10.81
3991. Lun Mang (halberd237) 111 59.87 75.82 12 10.81
3992. Ricky (galvanize) 111 96.50 126.99 40 36.04
3993. Sam (sammusubi27) 111 71.05 87.34 30 27.03
3994. William (normalizejoey) 111 74.52 96.34 45 40.54
3995. MooMoo (moo_24) 111 54.35 69.62 13 11.71
3996. Master (master_2010) 111 45.20 60.91 10 9.01
3997. Joseph (schmo_) 110 101.57 129.70 48 43.64
3998. sat (sattypants) 110 77.66 104.01 31 28.18
3999. sab (sabpap) 110 65.45 83.24 25 22.73
4000. robloxyboy1212 (robloxyboy2... 110 100.78 136.54 43 39.09
4001. Ring2020 (ring2020) 110 76.46 96.84 24 21.82
4002. Raymando (raymando) 110 95.82 120.08 52 47.27
4003. Rawest_Dawg (raw_dawg) 110 65.67 84.57 24 21.82
4004. Procrastiracer (racerrob) 110 115.16 147.26 55 50.00
4005. Atif (pakistan_786) 110 81.61 109.17 22 20.00
4006. Ngita (ngita) 110 57.94 72.79 16 14.55
4007. Marek (mxrkz) 110 66.50 80.86 27 24.55
4008. Mircox (mircozen) 110 89.40 108.32 32 29.09
4009. Somto (megamined) 110 62.93 79.33 15 13.64
4010. #$# (ah_ha) 110 74.27 95.44 30 27.27
4011. Amorphic (_amorphic) 110 58.92 89.76 27 24.55
4012. Farid (faridkhan) 110 29.39 41.52 17 15.45
4013. nikhil (forceablebean6) 110 108.28 126.19 61 55.45
4014. Daniel (dreilly2231) 110 77.16 91.77 32 29.09
4015. David (dmed519) 110 69.58 82.05 26 23.64
4016. Dwiko (diorite90) 110 59.50 76.33 27 24.55
4017. Daniel (beefichor) 110 75.51 90.58 22 20.00
4018. Maximus (asso2002) 110 97.62 125.83 46 41.82
4019. aEr0 (_aero) 110 62.80 76.35 22 20.00
4020. Olivia (xlivsteer07x) 110 54.78 72.62 34 30.91
4021. Taradiddle (taradiddle) 110 77.60 92.71 24 21.82
4022. elongated (supreme10001) 110 135.84 161.43 67 60.91
4023. SRI (sr71) 110 86.89 99.82 34 30.91
4024. SpeedTrain (speedtraintyper) 110 82.09 114.90 26 23.64
4025. this quote is sh*t (slowass... 110 81.15 106.27 24 21.82
4026. skycandy (skycandy1) 110 64.40 79.11 24 21.82
4027. Irham (irhamdinataa) 110 86.79 110.28 39 35.45
4028. Gayathri (gayathri_prabhu) 110 65.99 83.77 27 24.55
4029. Banoboo (lasttry) 109 33.62 48.14 9 8.26
4030. David (king_cao1) 109 110.79 133.79 51 46.79
4031. kenneth (kennethnhan) 109 71.57 86.96 23 21.10
4032. jveee (jv223) 109 75.16 94.50 30 27.52
4033. Michael (henderslender11) 109 49.02 62.28 12 11.01
4034. Hassaan (hassaan0180) 109 70.00 92.29 40 36.70
4035. Gareton (gareton) 109 58.80 69.82 14 12.84
4036. Veteran1728 (frenzy1728) 109 97.34 116.55 35 32.11
4037. Desmond (desmond27) 109 84.37 102.03 28 25.69
4038. DeafChef (deafchefsteph) 109 58.30 72.80 16 14.68
4039. Karan (commando_typer) 109 48.26 59.18 12 11.01
4040. crip (cipti) 109 44.18 56.16 13 11.93
4041. Chubby (chubbykidseating) 109 102.38 133.89 41 37.61
4042. Nikita (chervovn04) 109 59.07 74.29 20 18.35
4043. jdyn (ayskiri) 109 78.16 128.28 29 26.61
4044. Aymscird (aymscird) 109 100.81 121.18 45 41.28
4045. Samuel (samharr) 109 66.96 84.35 19 17.43
4046. Nguyen Truong (racing_typer... 109 102.72 136.72 55 50.46
4047. q4say (q4say) 109 61.55 75.48 27 24.77
4048. boat (narwhalinz) 109 129.12 161.38 72 66.06
4049. Rizwan (mrpassionate) 109 68.24 83.82 20 18.35
4050. Max (maxcampman) 109 79.13 101.57 29 26.61
4051. Sandwich (marlonbrandoseyes) 109 56.59 72.15 18 16.51
4052. Marcos (marcosjlr) 109 75.01 88.71 19 17.43
4053. wilson ;~; (aaahrgrhh) 109 105.12 135.22 44 40.37
4054. Jacob (peanutboy) 109 64.25 85.17 27 24.77
4055. Eric (yellowblankets) 109 83.71 111.98 23 21.10
4056. I'm bad at typing (uzumakid... 109 92.53 120.77 39 35.78
4057. Kian (uls_sanch) 109 95.95 111.05 30 27.52
4058. alipboy (tragicbronson) 109 106.73 131.85 55 50.46
4059. horney (titansmakemehorney) 109 82.17 104.33 27 24.77
4060. Lily (tiptaptyping) 109 112.79 139.23 47 43.12
4061. Roberto (soniic99) 109 45.43 61.69 10 9.17
4062. shrnayvi (shrnayvi) 109 89.13 100.30 33 30.28
4063. Lakshay (shaybas) 109 97.23 123.43 36 33.03
4064. clarence (zerogly) 108 87.60 104.87 39 36.11
4065. jason (yacine77) 108 74.82 95.29 24 22.22
4066. Elijah (too_ez_) 108 97.74 126.90 49 45.37
4067. THATCHILD (thatchild) 108 103.08 125.76 98 90.74
4068. Sunny (sunny6464n) 108 50.94 61.70 11 10.19
4069. Shubham (srp3003) 108 91.07 115.55 35 32.41
4070. Rosy (rosyport) 108 121.93 159.76 55 50.93
4071. Parag (parag_gn) 108 49.08 62.97 11 10.19
4072. (onah) 108 120.27 150.72 60 55.56
4073. Json (jskfreerunner) 108 74.47 92.35 27 25.00
4074. bruh (jakubd) 108 82.37 106.92 37 34.26
4075. Itay (itzir) 108 56.14 67.00 15 13.89
4076. Jia (icecoldpillow) 108 115.74 139.23 43 39.81
4077. rip reckful (fictorian) 108 116.23 145.75 56 51.85
4078. balls (faygodreams) 108 114.92 140.98 48 44.44
4079. Osh (elvor) 108 92.36 106.17 47 43.52
4080. Joe (edwardstewart69) 108 105.73 153.37 43 39.81
4081. Davi (davi_v) 108 118.83 141.52 52 48.15
4082. Sean (crowded_keyboard) 108 93.35 119.68 52 48.15
4083. Albert (certikbertik) 108 84.89 109.43 33 30.56
4084. Bekzat (blkssmv) 108 64.80 78.97 29 26.85
4085. azu (azux) 108 83.42 111.49 47 43.52
4086. tstats[ayyaz7] (ayyaz7) 108 78.63 96.91 26 24.07
4087. 🌹パレスチナと🥀 ... 108 78.72 110.50 26 24.07
4088. Emil (awsomeemil25) 108 115.71 151.35 70 64.81
4089. bloomy (atsu) 108 89.16 114.60 38 35.19
4090. xelfeR (armez) 108 122.53 199.14 60 55.56
4091. Markus (ark_sum) 108 65.22 80.27 22 20.37
4092. Allan (allan_g) 107 68.73 88.95 27 25.23
4093. Arnold (10wpmtyper) 107 128.21 162.27 69 64.49
4094. sarampium (saripu) 107 78.62 97.66 28 26.17
4095. Nabibro007 (nabibro_007) 107 60.83 79.45 17 15.89
4096. zach (rz23222) 107 81.78 112.74 22 20.56
4097. Leonid (leosmrdljak) 107 75.15 95.88 55 51.40
4098. Izzy (izzythompson) 107 81.47 107.91 25 23.36
4099. Zev (zevaverbach) 107 104.58 146.82 51 47.66
4100. Ty (yomommafav) 107 89.11 113.40 31 28.97
4101. Surya (surya_p) 107 53.57 72.21 17 15.89
4102. Sn1kt (sn1kt) 107 55.38 74.57 17 15.89
4103. Newton (nklflips) 107 94.67 123.18 45 42.06
4104. 🏅🏅🏅 (naod_1225) 107 114.48 146.10 50 46.73
4105. Vishal (mr_sharma01) 107 53.26 65.53 17 15.89
4106. Moghit (moghit44) 107 74.54 117.63 29 27.10
4107. Sean (metrognome12) 107 84.25 105.10 40 37.38
4108. Quan (martinrockon) 107 71.01 96.20 27 25.23
4109. Emon (emonn) 107 67.88 85.64 22 20.56
4110. Dingus Fish (dingusfish) 107 84.11 101.97 35 32.71
4111. cocoju (cocoju) 107 65.74 82.06 18 16.82
4112. Yoel (chessmaster55) 107 55.40 74.37 13 12.15
4113. Harry (bonogo123) 107 90.99 114.05 28 26.17
4114. Nacho (awooo) 107 90.75 109.37 44 41.12
4115. md (duom_1432) 106 71.93 102.87 24 22.64
4116. Dan (danezu) 106 68.21 91.13 15 14.15
4117. Bruce (brucecccccc) 106 105.86 127.84 48 45.28
4118. Elden (bloab) 106 121.10 150.45 86 81.13
4119. Biza (biza) 106 74.22 86.67 24 22.64
4120. Deni (zingaraaa) 106 62.81 75.46 23 21.70
4121. Vishnu (vishnu6174) 106 76.45 94.22 22 20.75
4122. Viktor Helgi (viktorhelgi) 106 61.96 77.14 26 24.53
4123. Valeria (valeriale) 106 52.30 64.35 8 7.55
4124. Calculus (uchihalol) 106 162.20 196.11 8 7.55
4125. They Don't Know That (theyd... 106 102.81 131.71 39 36.79
4126. Subir (subir_b) 106 34.27 42.26 2 1.89
4127. feelsclapman (sprenkelz) 106 111.70 137.67 47 44.34
4128. SMhd (smhd) 106 89.44 105.64 26 24.53
4129. skitter315 (skitter315) 106 115.95 134.67 63 59.43
4130. Benga (skebengat) 106 71.29 90.26 28 26.42
4131. Simon (siarnt) 106 93.70 111.16 38 35.85
4132. shane (shanel0l) 106 68.93 84.81 29 27.36
4133. Sebastian (sebz1) 106 80.04 109.14 22 20.75
4134. Cameron (sebajun) 106 95.77 119.28 36 33.96
4135. Christian (allen2021) 106 56.52 69.24 10 9.43
4136. pnguin (pnguin_) 106 98.06 119.65 55 51.89
4137. Luan (luanxpg9) 106 68.95 79.18 35 33.02
4138. khanh (lenguyenkhanh) 106 89.48 104.05 28 26.42
4139. JD_FPS (jd_fps) 106 69.20 96.46 22 20.75
4140. J (itsjustj) 106 93.72 123.15 31 29.25
4141. Eric (insecureforsure) 106 81.36 101.87 31 29.25
4142. ihba (ihba) 106 79.14 106.61 35 33.02
4143. Samuel (samuelga) 106 91.95 115.58 44 41.51
4144. sami (sami66) 106 89.40 109.23 27 25.47
4145. Ravid (ravid37) 106 18.76 25.56 13 12.26
4146. yashwi (potato0o0) 106 74.85 103.60 30 28.30
4147. peter (peterfan) 106 70.26 93.43 33 31.13
4148. mahmoud (mzridi) 106 46.10 56.89 9 8.49
4149. Mena (mony40) 106 44.95 58.70 13 12.26
4150. Sam (monkeh_type_fast) 106 84.41 113.81 37 34.91
4151. M (mileung) 106 75.42 95.23 30 28.30
4152. Max (max_akyl) 106 52.06 67.35 11 10.38
4153. Sabari (sabari314) 105 80.81 104.15 35 33.33
4154. slow-af (rohilverma) 105 130.45 152.08 73 69.52
4155. Radmilo (radmilo) 105 96.01 114.88 40 38.10
4156. :| (peanutbutter_665) 105 72.74 111.66 22 20.95
4157. lio (osybius) 105 96.27 118.76 46 43.81
4158. OrangeKomodo (orangekomodo) 105 63.91 82.86 24 22.86
4159. 💾 PROGRESS IS NOT LINEAR... 105 86.37 104.14 29 27.62
4160. Nino (ninospvp) 105 129.65 156.97 66 62.86
4161. ninfueng (ninfueng) 105 61.16 79.26 19 18.10
4162. Eva (niejingtan) 105 77.98 98.85 32 30.48
4163. Nick (nick1236) 105 58.74 78.21 16 15.24
4164. Natsu (n4tsu_dragneel) 105 51.76 66.60 12 11.43
4165. Tien (mr_tien) 105 77.01 110.31 24 22.86
4166. apoodle_ (molltenlol) 105 69.58 91.33 24 22.86
4167. April (apping) 105 65.16 80.75 27 25.71
4168. ehe (aeronsic) 105 87.83 100.26 30 28.57
4169. Mahedi (12362) 105 71.21 92.76 29 27.62
4170. Parameshwaran (knparamesh26) 105 54.50 70.42 14 13.33
4171. Gold (goldberger) 105 80.47 107.24 40 38.10
4172. Bitcoin (sreeharshag) 105 46.16 57.84 7 6.67
4173. enes (mr_moonz) 105 51.40 62.98 10 9.52
4174. DiroDoku (dirodoku) 105 91.84 112.34 38 36.19
4175. bleh (dan1ce) 105 59.71 74.99 38 36.19
4176. Gascoigne (correctionhaha) 105 121.47 158.77 59 56.19
4177. CJ (cj2305) 105 74.09 91.63 26 24.76
4178. [FRLA] Frank Admirer (ciaer... 105 110.17 134.30 81 77.14
4179. Bbbbbbbbb (boohaw) 105 146.80 185.10 80 76.19
4180. Boo (boo42069) 105 62.35 83.38 31 29.52
4181. aymen (aymenalwh) 105 59.18 73.96 22 20.95
4182. (zealindaus) 105 132.64 164.72 87 82.86
4183. Willll (yongzew) 105 50.39 59.96 3 2.86
4184. Yanni (yannishams) 105 63.13 80.82 32 30.48
4185. Phoeniix (xiineo) 105 86.71 115.02 37 35.24
4186. Typo (wlofails) 105 112.86 148.63 72 68.57
4187. withan46 (withan46) 105 72.99 85.45 27 25.71
4188. ugga (ugga_ugga) 105 87.09 108.20 42 40.00
4189. Lucas (slappy_rgs) 105 68.26 89.22 20 19.05
4190. Madara (madara_uchihaking) 105 60.32 77.13 64 60.95
4191. Loopy (loopy_oopy) 105 65.62 81.35 24 22.86
4192. Jatin (jatin_sharma_2005) 105 77.36 92.75 21 20.00
4193. take care of ur wrists bae!... 105 122.33 154.11 63 60.00
4194. Valentina (genericwhitemale) 105 88.53 118.84 33 31.43
4195. Ahmed (gemy_amin) 105 47.74 62.50 10 9.52
4196. 2002hondaaccord (gamingboss... 105 101.83 131.47 45 42.86
4197. Kuidurgu (kuidurgu01) 104 40.91 50.60 22 21.15
4198. Karan (karansinghgi18) 104 53.78 67.03 11 10.58
4199. IanL (jeedaiian) 104 52.04 63.63 14 13.46
4200. Honza (honza2535) 104 85.57 101.78 26 25.00
4201. howdoitellherilovehersomuch... 104 71.57 94.02 26 25.00
4202. Drake (gangket) 104 58.97 75.94 13 12.50
4203. Bing (gamerbilplays) 104 96.38 133.28 45 43.27
4204. Calvin (fullrespect) 104 99.71 119.58 59 56.73
4205. femonemonemo (femonemo) 104 73.59 84.40 19 18.27
4206. Nathan (craizar) 104 82.52 99.42 29 27.88
4207. Petr (chytris) 104 54.22 65.73 12 11.54
4208. shiba inu (bamboozledshibe) 104 87.70 124.01 32 30.77
4209. Hello Layth :) (ayoubantita... 104 75.94 102.31 32 30.77
4210. PedroS235 (pedro_s235) 104 59.89 74.66 17 16.35
4211. knoppix (ninopereira) 104 53.89 66.91 10 9.62
4212. Emma (missbennett) 104 86.41 108.71 25 24.04
4213. Apollyon (mik_apollyon) 104 96.84 122.30 46 44.23
4214. Matthew (mattyhassett) 104 102.56 141.91 44 42.31
4215. Nick (headhunter_jr) 104 67.99 80.77 17 16.35
4216. Shyam (gamr7564) 104 85.18 108.30 32 30.77
4217. Pawan (fake_name) 104 58.83 76.94 15 14.42
4218. heker the kichuz (kichuz) 104 47.10 62.11 12 11.54
4219. Kevin (zuperfire1) 104 94.65 111.91 27 25.96
4220. zhizin (zhixin0220) 104 38.11 45.77 10 9.62
4221. Rezaul (vuzinga) 104 63.99 74.44 13 12.50
4222. JL (tsg03) 104 67.22 86.92 24 23.08
4223. Tómas Ingi (tomasingi) 104 66.41 80.69 25 24.04
4224. Andrew (silverdotters) 104 95.51 115.24 42 40.38
4225. Dutch (shawnseb) 104 91.20 112.61 34 32.69
4226. vminh (tvmint) 103 63.62 80.44 25 24.27
4227. Swarmy (swarmy) 103 76.26 94.01 20 19.42
4228. themommajeans (spammaam) 103 105.31 139.84 50 48.54
4229. Galih (sobig_f) 103 80.62 117.66 35 33.98
4230. love (skaldssss) 103 94.24 126.70 48 46.60
4231. Sanchit (sanchitsharma21) 103 85.98 101.95 35 33.98
4232. Mark (redblacktiger) 103 93.53 124.30 45 43.69
4233. pro (pro_napro) 103 37.54 47.99 7 6.80
4234. arun (noobtyperarun) 103 87.25 119.05 53 51.46
4235. Tom (mikeoxverylong) 103 92.42 112.47 46 44.66
4236. Midnight (midnightshadows) 103 79.60 116.27 33 32.04
4237. Midhun (midhunvmurali) 103 55.04 66.05 7 6.80
4238. Lynn (lynnhanananer1) 103 84.07 103.86 24 23.30
4239. tstats[legendarybbk] (legen... 103 87.11 109.36 38 36.89
4240. Stone (kimpors) 103 65.92 82.07 25 24.27
4241. G_4G3 (g4g3) 103 58.04 71.30 16 15.53
4242. durehuu (durehuu_123) 103 34.60 61.50 5 4.85
4243. Nikola (dudeimwhite) 103 69.64 91.65 30 29.13
4244. DINKL3B3RGG (cosmovt) 103 62.64 79.64 20 19.42
4245. clock145 (clock145) 103 74.42 93.09 29 28.16
4246. Chinmoy (chinmoy709) 103 38.56 49.37 13 12.62
4247. Caleb (calebbueckert) 103 79.33 100.90 24 23.30
4248. Tobias (bolleeer) 103 80.57 100.99 18 17.48
4249. bella (bella4088888888) 103 45.23 57.43 53 51.46
4250. Ashwani (ashwani45) 103 72.52 92.69 26 25.24
4251. Cheese (arandomasiankid) 103 73.03 102.32 34 33.01
4252. Release from the pain (abod... 103 80.71 99.86 26 25.24
4253. Abhi (abhinavsanthosh_162008) 103 64.08 83.67 23 22.33
4254. HCKB (hckb21) 103 43.63 59.00 10 9.71
4255. colemak54 (coder054) 103 32.83 41.29 9 8.74
4256. 𝕲𝖍𝖔𝖘𝖙♠️ ... 102 78.68 104.10 21 20.59
4257. Budhai (budhai_) 102 51.91 68.48 12 11.76
4258. David Lia (terraform) 102 60.06 81.47 17 16.67
4259. lin (mattlin) 102 51.11 63.40 11 10.78
4260. Lemone (lemonylemone) 102 71.40 93.48 24 23.53
4261. Just a man in a hotdog van ... 102 121.94 164.51 56 54.90
4262. 799 (khs4126428) 102 87.28 111.52 31 30.39
4263. Rest Easy Byron (keatonsmith) 102 146.73 178.11 83 81.37
4264. Jonjon (jonjonlilbas) 102 80.67 107.30 24 23.53
4265. jihoon007 (jihoon007) 102 55.44 69.05 19 18.63
4266. sg my beloved (imperfect_qu... 102 98.86 123.84 44 43.14
4267. mrrizkin (ifixlss) 102 83.83 99.42 28 27.45
4268. Mitchell (godekm) 102 111.76 147.90 44 43.14
4269. MaBec (_mabecma_) 102 61.46 82.75 16 15.69
4270. Bugs (_bunny) 102 66.76 79.04 30 29.41
4271. Jason (_bagel_) 102 78.73 97.77 31 30.39
4272. zooommm23 (zooommm23) 102 69.70 95.74 16 15.69
4273. Hamza (yamac_kocovali) 102 39.80 52.43 9 8.82
4274. Viran (viranp) 102 99.82 126.07 43 42.16
4275. V3ness (venessang) 102 72.65 104.46 21 20.59
4276. me again (urdogwateruwu) 102 111.04 145.55 49 48.04
4277. Coco (ummena) 102 72.54 88.10 34 33.33
4278. and we light up the sky (th... 102 136.97 169.28 77 75.49
4279. Theodore (theo52) 102 76.24 96.07 30 29.41
4280. XIN (tem_per) 102 84.54 109.25 18 17.65
4281. suhayb (suhayb) 102 42.76 63.37 36 35.29
4282. Madison (speedbltch) 102 70.73 93.44 24 23.53
4283. Sarah (sarahmae123) 102 85.46 116.53 31 30.39
4284. Prasoon (prkharel) 102 94.01 125.70 36 35.29
4285. AP (priyanthushara) 102 39.05 54.29 7 6.86
4286. Priyanshu (priyanshu88064) 102 67.31 80.68 20 19.61
4287. Parker (parkerfd9dy) 102 70.17 89.82 32 31.37
4288. Opmrph (opmrph) 102 91.86 124.98 48 47.06
4289. Navid Sadeghi (navid_sadeghi) 102 46.77 62.15 40 39.22
4290. Nathan (nathan_cant_type) 102 90.52 108.51 30 29.41
4291. TechHolmes (mohmmde) 102 55.27 74.15 17 16.67
4292. billie (eillib) 102 75.20 94.93 19 18.63
4293. Andrius (ciornas) 102 60.14 70.34 23 22.55
4294. Frank (fizero) 101 58.35 71.93 10 9.90
4295. Endstyle (endstylegg) 101 102.47 123.30 34 33.66
4296. come (comecurry) 101 98.76 125.09 41 40.59
4297. Mikita (byxmend) 101 55.02 68.44 13 12.87
4298. Bonu (bonu21) 101 55.35 65.06 14 13.86
4299. bean boy (binhthetyper) 101 56.20 74.30 17 16.83
4300. Bdoo (bdo0) 101 35.07 48.53 2 1.98
4301. Ryan (_rhou_) 101 108.93 144.95 60 59.41
4302. Zils (zils_) 101 87.87 101.96 29 28.71
4303. uann (uann1) 101 64.53 78.68 27 26.73
4304. hetang (typr_1) 101 62.88 76.47 33 32.67
4305. Ross (trickydick6) 101 105.42 135.11 37 36.63
4306. Welcometomycrucifixion (tim... 101 100.24 118.66 35 34.65
4307. Steve (stevegocoding) 101 60.86 77.89 18 17.82
4308. JD (snag1) 101 72.08 93.45 23 22.77
4309. Nick (slotharms) 101 73.59 89.85 16 15.84
4310. Shanti Swaroop (shanti_swar... 101 79.69 94.45 26 25.74
4311. ScreaM (scream2002) 101 58.04 81.96 12 11.88
4312. Andy (andygeo) 101 44.02 56.23 14 13.86
4313. Anavo (anavailable) 101 59.94 75.16 1 0.99
4314. James (james123wu) 101 75.70 101.56 24 23.76
4315. Leviathan (furyx) 101 106.49 157.52 26 25.74
4316. Sameer (sameercarpenter) 101 62.16 77.14 21 20.79
4317. Mac (redsmac) 101 73.01 91.46 26 25.74
4318. Aditya (prakashaditya) 101 63.35 72.65 20 19.80
4319. Chaos (numerodos) 101 131.30 161.81 70 69.31
4320. Jimmy (ratjesus) 100 82.53 110.51 27 27.00
4321. pipelined (polarilacari) 100 77.80 97.33 28 28.00
4322. chad (pokeman34) 100 123.58 144.18 49 49.00
4323. plantfan330 (plantfan330) 100 57.23 75.26 15 15.00
4324. Arnau (pestopasta) 100 66.24 85.77 24 24.00
4325. Perich (perich) 100 84.96 108.33 33 33.00
4326. Sven (paindevil07) 100 69.52 80.95 24 24.00
4327. Azar (nxp_azar) 100 60.43 76.57 51 51.00
4328. Marx (marxjp) 100 78.06 99.36 25 25.00
4329. Manish (manish_89) 100 53.47 66.48 18 18.00
4330. Anton (antonjr04) 100 78.44 104.05 27 27.00
4331. animalpsyche (animalpsyche) 100 72.52 89.83 24 24.00
4332. Ahmed (ahmeed_a) 100 29.35 37.04 10 10.00
4333. Koma5 (xultronix) 100 91.76 109.54 32 32.00
4334. K a a y (none_available) 100 65.03 84.57 32 32.00
4335. SpeedRacer (the_transporter) 100 53.12 73.43 8 8.00
4336. Filip (flameouken) 100 60.28 77.14 25 25.00
4337. ACC [99 - 100] (dinoh_sandys) 100 84.70 105.20 44 44.00
4338. Crystal (crystal_angelo) 100 88.88 116.41 33 33.00
4339. Crash (crash_complete) 100 81.39 105.41 34 34.00
4340. Ethan (conanethan) 100 91.71 114.48 30 30.00
4341. César (c3sar36) 100 79.18 113.30 28 28.00
4342. Big (boosted_ape) 100 67.88 81.52 30 30.00
4343. Marcus (boopbeepboopboop) 100 86.79 108.85 30 30.00
4344. Rashid (beats_exe) 100 73.62 101.36 28 28.00
4345. smq (_smq) 100 97.18 124.93 44 44.00
4346. Brockton (ztgstover) 100 109.28 138.83 48 48.00
4347. zoo (zoo868e) 100 65.19 77.56 25 25.00
4348. Bob (xminer99) 100 61.44 88.97 22 22.00
4349. Victor (victorzasz) 100 53.26 65.77 8 8.00
4350. FREE PALESTINE (then1g) 100 96.10 118.62 34 34.00
4351. Zoomer (somerandomkid76) 100 80.04 100.18 27 27.00
4352. Tyler (slashrage) 100 64.40 80.95 19 19.00
4353. Aidan (sirrahnadia) 100 109.73 137.79 44 44.00
4354. Lukas (lukaslechner) 100 67.37 81.90 21 21.00
4355. Kinfi4 (kinfi4) 100 79.35 100.07 21 21.00
4356. khoinhalam (khoinhalam) 100 67.27 88.86 19 19.00
4357. John (johnhemrom) 100 56.44 68.01 8 8.00
4358. rasmus (jemjoyous) 100 77.70 106.50 45 45.00
4359. idk man (ithatme) 100 51.71 71.99 8 8.00
4360. idk_hii (idk_hii) 100 87.05 108.17 28 28.00
4361. hellooooo (hk_in_london) 100 77.56 97.51 23 23.00
4362. Harry (harrycomp16) 100 77.08 98.27 29 29.00
4363. grigoar (grigoar) 100 76.87 98.92 25 25.00
4364. goombamario (goombamario) 100 39.49 53.33 12 12.00
4365. 浩丁 (kusogedane) 99 102.32 125.13 43 43.43
4366. Joy (joy_1) 99 70.25 82.13 22 22.22
4367. my fingers are slow (jay12310) 99 92.78 111.56 30 30.30
4368. Able (interstellarnova) 99 69.49 81.28 19 19.19
4369. ibrahim (ibrahiem) 99 60.48 77.42 17 17.17
4370. waifu (helpme_pls) 99 72.67 90.51 28 28.28
4371. HelioSpook (heliospook) 99 34.85 47.95 1 1.01
4372. Ducky (duckyz1) 99 73.13 93.61 23 23.23
4373. Dreamside (dreamside0010) 99 63.88 88.51 18 18.18
4374. isaac (cowwee90) 99 99.01 124.95 32 32.32
4375. David (circuitnerd) 99 64.17 79.48 24 24.24
4376. Montu (axom_shochwave) 99 85.61 104.05 22 22.22
4377. Indian hacker man (asain_du... 99 62.89 80.45 17 17.17
4378. samy (samy_mohsen) 99 56.15 73.77 14 14.14
4379. Benjamin (saltysnit) 99 95.66 113.62 39 39.39
4380. Jerm (professional_keyboard... 99 87.70 123.50 36 36.36
4381. Howard (papertofu) 99 137.01 164.59 75 75.76
4382. Nick (nirosmit) 99 58.28 74.31 14 14.14
4383. Yam (metrictensor) 99 110.51 133.98 46 46.46
4384. Meet (meet27) 99 83.09 100.61 27 27.27
4385. ArkoSammy12 (arkosammy_1208) 99 75.64 105.60 27 27.27
4386. tadej pogačar (acadiantaco) 99 119.98 162.91 53 53.54
4387. lyrxcal (4l3y) 99 116.23 148.85 58 58.59
4388. oscar (skarro) 99 61.42 78.12 24 24.24
4389. Silent (silent_c1c4d4) 99 71.76 101.24 31 31.31
4390. Suman (kissey) 99 60.46 76.02 23 23.23
4391. warya (warya) 99 64.64 89.28 77 77.78
4392. Gus (uberro) 99 96.47 121.70 40 40.40
4393. Toodles (toodles678) 99 104.77 151.44 43 43.43
4394. Smokey (smokeytheoni) 99 79.21 97.50 24 24.24
4395. Siddharth (sid_1310) 99 68.84 89.22 18 18.18
4396. Brayan (veraniego) 98 55.29 68.54 16 16.33
4397. Mark (veltzer) 98 92.05 117.94 40 40.82
4398. Vimim (tovtype) 98 81.24 96.95 20 20.41
4399. Mausam (the_witcher) 98 78.22 93.13 33 33.67
4400. JS (thenotorious619) 98 67.79 85.59 23 23.47
4401. Tharun (tharun66) 98 67.15 90.07 11 11.22
4402. Erick (smittywerben) 98 81.44 101.20 31 31.63
4403. Singh (singh_ram) 98 54.23 74.05 10 10.20
4404. myself (sakib9) 98 80.72 104.36 36 36.73
4405. robdude22 (robodude22) 98 101.81 126.07 52 53.06
4406. Pixel269 (pixeltwosixnine) 98 98.83 144.22 35 35.71
4407. Oli (oli94) 98 103.56 138.37 42 42.86
4408. elongatedsquirrel (nba_youn... 98 64.16 90.95 29 29.59
4409. Rest in peace (michaeltrayv... 98 179.97 215.41 95 96.94
4410. uhhhhhhh (membrane_ripper) 98 70.85 92.82 23 23.47
4411. Mark (mamochiro) 98 65.96 81.44 21 21.43
4412. Cody (kingbear2) 98 78.97 100.59 21 21.43
4413. grandsheber (justbagdat) 98 61.23 72.56 37 37.76
4414. jonica (jonicailagan) 98 99.54 123.00 32 32.65
4415. Jack (jackshadow) 98 81.48 101.71 25 25.51
4416. Ice (icedime) 98 88.71 107.21 34 34.69
4417. Hannah (hpelay) 98 96.62 117.72 37 37.76
4418. Freundschaft Bus (freundsch... 98 86.04 105.66 34 34.69
4419. deepak (fireyfingers) 98 46.09 60.31 6 6.12
4420. Erik (erik4) 98 83.55 102.73 31 31.63
4421. Chhavi (chhavijain1111) 98 70.49 88.20 19 19.39
4422. macura (bobbygreg) 98 85.25 122.65 36 36.73
4423. BASIL (basilps123) 98 76.37 88.86 26 26.53
4424. Aditya (aditya9219) 98 76.70 96.26 24 24.49
4425. Dahmer's (hybridtattu) 98 33.03 49.97 10 10.20
4426. Dominik (b14ucky) 98 64.47 81.83 26 26.53
4427. slow (anjal23) 97 84.90 107.48 32 32.99
4428. Raunak (aabbccdd4444) 97 81.58 97.53 25 25.77
4429. Syed Faysel (syedfaysel) 97 52.04 66.83 15 15.46
4430. Muhd Khalid (lid313) 97 75.37 95.70 25 25.77
4431. jeremiah (jeremiah12345) 97 87.72 106.98 32 32.99
4432. M (iamake) 97 75.69 93.02 24 24.74
4433. Grim (grimtorcher) 97 68.46 91.23 24 24.74
4434. Kasidit (ganadosa) 97 46.05 58.89 6 6.19
4435. Nathan (vanderha) 97 80.66 102.72 18 18.56
4436. ton (tonton31) 97 87.47 110.43 32 32.99
4437. Ceres (the445guy) 97 87.56 115.48 38 39.18
4438. Stam (stam_01) 97 79.43 106.06 32 32.99
4439. jojo (spacelion121319) 97 75.50 99.53 23 23.71
4440. Marm (slayerxy) 97 144.59 172.00 69 71.13
4441. Fork (sir_fork) 97 61.70 86.32 12 12.37
4442. Sal-Kal (sal_kal) 97 80.44 101.38 36 37.11
4443. Matt (rosettastoned) 97 93.77 113.84 39 40.21
4444. Roper (ropergames) 97 47.44 75.03 8 8.25
4445. Rany (ranystephan) 97 60.51 87.69 16 16.49
4446. Principle (principle105) 97 120.53 149.70 51 52.58
4447. typer (practise_to_type) 97 59.66 74.46 38 39.18
4448. Om (omsharma612) 97 61.39 80.97 14 14.43
4449. Rask (frederik0147) 97 66.92 77.36 16 16.49
4450. n0 (doo1222) 97 69.81 87.51 16 16.49
4451. Eri (bobtentencarracer) 97 92.51 115.87 34 35.05
4452. Benjamin (bnje1) 97 105.67 139.94 41 42.27
4453. Valentin (bg4uk) 97 57.45 73.73 16 16.49
4454. ouchies (evilemmelina) 96 113.04 147.57 47 48.96
4455. Eric (ebiman9726) 96 58.68 86.59 14 14.58
4456. Dr (drchhun) 96 58.82 76.93 15 15.63
4457. develsixteen (develsixteen) 96 94.03 112.32 26 27.08
4458. jb (deamon_214) 96 41.04 60.86 11 11.46
4459. Em (chuchu) 96 77.93 94.83 27 28.13
4460. Catman (catman847) 96 71.18 86.41 24 25.00
4461. Nathan (buddyurslow) 96 89.14 106.35 37 38.54
4462. Bryan.. XD (bryan_xd) 96 76.54 106.42 24 25.00
4463. Thomas (banone) 96 46.80 57.35 10 10.42
4464. Ikeai0515 (uanea0516) 96 88.99 111.87 33 34.38
4465. thunderbeast (thunderbeast_) 96 77.25 101.59 32 33.33
4466. Trevor (thetrevormonreal) 96 85.84 115.48 25 26.04
4467. Vu (taptyping) 96 63.89 85.16 18 18.75
4468. fingerSkate (skhmt) 96 70.52 89.55 18 18.75
4469. my fingers aint fingering (... 96 128.01 148.87 75 78.13
4470. Scryp (scryp) 96 102.24 125.66 41 42.71
4471. Areeb (areebur) 96 68.98 85.24 29 30.21
4472. Shohan (ansshohan) 96 75.41 95.52 23 23.96
4473. alaa (alaa_eddin) 96 44.75 53.13 16 16.67
4474. carina (carina05) 96 107.63 132.67 87 90.63
4475. Lukares (dulacz) 96 80.30 93.21 30 31.25
4476. average rice enjoyer (kireg... 96 141.68 190.60 33 34.38
4477. Wallapa (kefatypist) 96 47.33 56.42 11 11.46
4478. Jinf931 (jinf931) 96 86.52 108.58 31 32.29
4479. Gergő (gergo225) 96 81.20 100.46 29 30.21
4480. geras (gerastv) 96 98.57 146.89 29 30.21
4481. Steven (gamma_knife17) 96 102.14 123.55 40 41.67
4482. qwerab (qwerab) 96 67.54 79.30 19 19.79
4483. olliedudd (olliedudd) 96 67.44 88.02 15 15.63
4484. Ankur (naresh12) 96 65.26 77.79 24 25.00
4485. FOO (mintaly_unstable) 96 73.94 91.14 25 26.04
4486. Bryce (satlight) 95 82.62 107.18 30 31.58
4487. clackity (phys1cs) 95 63.37 80.85 19 20.00
4488. morty (morty_lh) 95 49.76 66.69 11 11.58
4489. George (mega_type_racer) 95 95.82 114.07 44 46.32
4490. Marsal (marsalsz) 95 77.27 100.24 30 31.58
4491. Marvin (malvolio) 95 83.69 99.39 27 28.42
4492. Aniruddh (arl17) 95 48.24 57.24 7 7.37
4493. trakovsik (beyazzenci) 95 69.68 86.49 27 28.42
4494. rexjo7 (rexjo7) 95 72.86 118.05 30 31.58
4495. Tomas (tigfiend) 95 62.30 76.48 12 12.63
4496. Amirzhan (dungeon_beast13) 95 44.70 55.07 13 13.68
4497. darthinfinix (darthinfinix) 95 77.23 106.85 26 27.37
4498. Ashley (darlavsue12) 95 93.33 114.02 28 29.47
4499. cole (cole_makker) 95 40.98 54.30 9 9.47
4500. Code (codeiii) 95 60.07 74.80 17 17.89
4501. Capivara (capivaradafarialima) 95 79.19 98.76 27 28.42
4502. Vladislav (atmsphrx) 95 94.10 121.16 35 36.84
4503. Ethan (zshooter0077) 95 57.02 74.36 18 18.95
4504. Zito (zrelova) 95 113.61 138.39 52 54.74
4505. Imagawa (yosshi) 95 79.83 97.27 20 21.05
4506. Samir (wickedl4ndo) 95 63.18 83.99 24 25.26
4507. WinG9G (vving020515) 95 68.87 85.81 16 16.84
4508. 🎈 (typing_badly) 95 133.99 162.56 55 57.89
4509. Dan (typheratrix) 95 78.74 106.76 21 22.11
4510. turbocell48 (turbocell48) 95 119.43 145.23 57 60.00
4511. Toowe (toowe) 95 73.07 96.91 20 21.05
4512. raj (the_karna) 95 60.25 77.72 21 22.11
4513. Oscar (oarr) 95 57.70 73.33 15 15.79
4514. Sriram (sriramrox) 95 56.83 78.78 30 31.58
4515. Shivam (shivy08) 95 68.13 84.06 38 40.00
4516. Alexa (lexalexa100) 95 120.94 141.71 67 70.53
4517. Leon (leon22) 95 96.68 118.06 33 34.74
4518. Samuel (knightsight) 95 118.33 154.88 68 71.58
4519. krisr17 (kk017) 95 81.71 101.16 35 36.84
4520. sam (justlikethat) 95 54.93 69.83 8 8.42
4521. John (johnrupesh) 95 80.78 101.45 25 26.32
4522. Joosh (jewsh) 95 82.40 103.13 28 29.47
4523. Jelly belly (jellybabysexys... 95 67.73 85.59 20 21.05
4524. Zephyr (introstealer) 95 76.01 96.54 25 26.32
4525. husq (husq) 95 106.70 132.36 46 48.42
4526. huddled (haraldgb) 95 89.32 106.25 27 28.42
4527. AHomieNucleus (galaxxyn1) 95 97.01 116.50 36 37.89
4528. Madiyor (madiyor) 94 72.81 96.09 30 31.91
4529. Christian (loggityloglog) 94 90.68 116.23 29 30.85
4530. Rohan B. (linuxman_linux) 94 139.79 174.64 78 82.98
4531. Lakshay (lakshay882) 94 51.10 65.68 19 20.21
4532. Koolis (koolisz) 94 92.55 110.01 38 40.43
4533. Jeffy (jeffyl) 94 119.71 150.35 57 60.64
4534. Grzegorz (jag1) 94 70.28 87.93 25 26.60
4535. rebecca (ionn) 94 94.59 114.24 33 35.11
4536. imtiaz (imtiaz12) 94 68.98 97.17 28 29.79
4537. jacob (iljain) 94 89.23 112.89 29 30.85
4538. TASHI (erehh19) 94 40.90 56.90 41 43.62
4539. Divyanshu (dev064) 94 30.25 43.24 14 14.89
4540. Casper (casperliuliuliu) 94 53.34 71.76 12 12.77
4541. Jimmy (carb0n13) 94 92.68 116.35 29 30.85
4542. caesar (caesar03) 94 54.57 68.15 12 12.77
4543. Avi (avi222) 94 29.40 42.46 9 9.57
4544. (records) 94 115.97 147.13 50 53.19
4545. Souvik (rascalam) 94 71.14 95.50 22 23.40
4546. pwxown (pwxown123) 94 64.66 79.70 21 22.34
4547. marwan_03 discord good with... 94 108.73 132.01 37 39.36
4548. pituf0 (pituf0) 94 95.36 123.92 34 36.17
4549. aaaaaaaaaaa (mintlyowo) 94 140.93 185.41 71 75.53
4550. Mark (mastopuppets) 94 61.38 84.63 21 22.34
4551. Anvesh (anveshreddy18) 94 74.72 92.00 24 25.53
4552. Tze Ning (zzzzzningd) 94 80.94 100.84 27 28.72
4553. Joe (zeppyg) 94 90.72 111.10 31 32.98
4554. z0rp (z0rp) 94 103.87 131.46 47 50.00
4555. Vivek (vivek62) 94 62.46 79.70 18 19.15
4556. lilvic (vickty) 94 102.99 125.62 45 47.87
4557. Hassan (urboyhassan) 94 77.75 96.01 19 20.21
4558. Tamás (tamas) 94 98.79 136.90 44 46.81
4559. Me (something_s) 94 110.92 144.29 42 44.68
4560. Jason (serenity47) 94 94.56 113.21 34 36.17
4561. Zak (zajawe) 93 80.08 97.50 27 29.03
4562. Yessimkhan (yess_0) 93 26.51 38.62 23 24.73
4563. Yash (yash23) 93 76.20 107.73 26 27.96
4564. gusher (wizardlordbob) 93 62.40 77.98 16 17.20
4565. venky (venkywonka) 93 73.15 97.61 20 21.51
4566. Lord (valharius) 93 94.05 112.48 37 39.78
4567. Vincent (v1ncent) 93 147.32 174.95 74 79.57
4568. tito (titoreo) 93 69.48 94.62 22 23.66
4569. memers (thememers) 93 51.39 63.72 12 12.90
4570. sagar (sgr5) 93 46.52 59.06 12 12.90
4571. Teodor (maniacth) 93 57.08 72.10 16 17.20
4572. md abdullah (mamun220) 93 39.66 51.76 9 9.68
4573. Luis (luismec90) 93 62.67 89.49 26 27.96
4574. 017 (k_chun) 93 69.03 87.83 23 24.73
4575. house (jrsp5) 93 91.46 107.59 28 30.11
4576. JoaoPauluu (joaopauluu) 93 104.05 137.39 50 53.76
4577. Miguel (jalb) 93 92.27 112.77 25 26.88
4578. Hxwk (hxwkoncrack) 93 76.04 97.73 20 21.51
4579. Herbie (hjrand1005) 93 96.85 116.52 37 39.78
4580. Felix (felizocker) 93 75.70 99.48 20 21.51
4581. honk (fallguys) 93 70.80 94.61 26 27.96
4582. Declan (deccazz) 93 93.71 112.19 40 43.01
4583. Siddhant (code_talker) 93 112.74 134.56 42 45.16
4584. Filip (churllix) 93 58.80 73.19 10 10.75
4585. Burak (burakkor434) 93 71.17 87.02 19 20.43
4586. Neo (aonixn) 93 80.80 100.94 24 25.81
4587. Alberto (angry_grandad) 93 64.84 78.67 20 21.51
4588. Elk (elkx) 93 50.96 68.17 12 12.90
4589. Johnty (boardsupremacy) 93 85.76 120.10 36 38.71
4590. Utkarsh (utkarshsarkar) 93 36.99 44.32 5 5.38
4591. alam (alamjael) 92 78.25 102.63 18 19.57
4592. Agamemnon (agamemnon_) 92 56.76 74.35 9 9.78
4593. Khulugjin (aceno) 92 89.26 115.39 37 40.22
4594. Direwolf (abdelmoezhj) 92 81.59 100.89 20 21.74
4595. Joe (2513134) 92 109.83 131.26 39 42.39
4596. Henry (taipeik9) 92 66.10 85.23 26 28.26
4597. Kevin (kevinparkit) 92 101.82 121.72 35 38.04
4598. Jack (jx34tech) 92 62.69 87.97 18 19.57
4599. Jun Kang (junkang098) 92 95.55 128.22 33 35.87
4600. Josh (josgo888) 92 60.79 78.38 19 20.65
4601. Jonathan (jontheprinter) 92 79.87 100.22 24 26.09
4602. Jason Hean (jackson95) 92 51.67 63.76 7 7.61
4603. Hawky (itshawky) 92 130.54 158.53 62 67.39
4604. Mark (inthe) 92 79.12 97.23 18 19.57
4605. Kevin (ibekevinn) 92 100.44 124.72 51 55.43
4606. HGud (hgudtk) 92 85.77 116.81 23 25.00
4607. Gerry (gl701) 92 112.15 137.96 46 50.00
4608. Jonas (zamurai88) 92 67.53 85.70 23 25.00
4609. x1300252 (x1300252) 92 40.92 49.60 9 9.78
4610. vita_melk (vita_melk) 92 73.76 93.93 28 30.43
4611. Josh (unkret) 92 60.11 77.86 23 25.00
4612. Subhajit (tumpasona) 92 51.43 64.83 11 11.96
4613. timas (timastimas) 92 82.39 98.06 30 32.61
4614. Thickspinach (thickspinach) 92 82.79 102.18 25 27.17
4615. Anna (slewa) 92 46.10 57.98 5 5.43
4616. Derry (siribackwards) 92 80.72 100.69 28 30.43
4617. Vinh (shadeomen) 92 97.95 120.17 39 42.39
4618. Rajish (rajish) 92 90.82 108.17 30 32.61
4619. Typer (pjottur) 92 62.19 76.73 17 18.48
4620. The don (photondestroyer) 92 74.52 91.86 18 19.57
4621. Nahla (na_hla) 92 25.77 37.03 19 20.65
4622. Nuno (n4n0x01) 92 78.38 96.25 30 32.61
4623. msm (mousamlimbu) 92 62.91 81.16 34 36.96
4624. Mohchih (mohchih) 92 78.25 107.79 24 26.09
4625. Melissa (mel8402) 92 70.02 94.88 14 15.22
4626. Farhan (ft10) 92 73.25 88.82 20 21.74
4627. 🥬 (freshkale_workman) 92 74.83 91.91 24 26.09
4628. Emmanuel (emmanuelmoon) 92 57.55 72.89 18 19.57
4629. Dyllan (dyllanbui) 92 92.08 118.40 38 41.30
4630. Breeze (driftbreeze) 92 108.76 126.84 44 47.83
4631. Sam (disasterlooms) 92 110.69 133.50 38 41.30
4632. demberel (demberel94) 92 73.00 89.49 31 33.70
4633. Vishnu (crazy_typeracer) 92 70.67 92.71 24 26.09
4634. choco (chocolateblocks) 92 105.94 146.75 45 48.91
4635. Pumpkin Raj (chillreksai) 92 96.63 115.98 44 47.83
4636. Bekkhan (bkun) 92 84.24 107.57 22 23.91
4637. mani (bigmeat_) 92 104.82 140.49 48 52.17
4638. Begatim Bytyqi (begatim) 92 54.54 67.76 18 19.57
4639. Hnnnnngh (frostequinox) 91 134.89 157.74 66 72.53
4640. Ritardo (ett5252) 91 120.68 152.90 48 52.75
4641. 白貓 (cutewhitecat) 91 52.64 64.64 22 24.18
4642. chom (chom2474) 91 109.06 164.41 51 56.04
4643. Clay (cduck621) 91 78.17 97.06 27 29.67
4644. ░ (_warrior_) 91 103.71 120.83 41 45.05
4645. Sven (zeverit) 91 97.65 118.18 35 38.46
4646. AlphaQ (zbooya) 91 60.25 72.02 16 17.58
4647. Yhannis (yhannis) 91 82.73 101.70 25 27.47
4648. Bartłomiej (y3v4d) 91 104.54 119.31 41 45.05
4649. Kevin (windn6) 91 96.33 123.33 33 36.26
4650. vm (vm_gojiya) 91 60.63 79.07 17 18.68
4651. Aleksandar (usernamegold) 91 99.66 119.74 38 41.76
4652. Martin (typeracist_) 91 82.27 104.54 47 51.65
4653. tsapi (tsapi) 91 102.78 129.25 31 34.07
4654. Alex (tra_pz) 91 86.83 114.38 24 26.37
4655. Harsh (todorokishotoua15) 91 49.60 70.59 71 78.02
4656. The (the_typing_train) 91 90.21 113.02 34 37.36
4657. bronze (thebronzesword) 91 105.21 130.79 52 57.14
4658. Sydney (sydneykimbell) 91 116.52 134.15 47 51.65
4659. Spam (ssspeed) 91 74.52 94.23 29 31.87
4660. Areppa (areppa) 91 75.73 92.87 12 13.19
4661. anth (ant_h) 91 71.30 86.76 23 25.27
4662. Yurii (kruason) 91 60.08 71.26 19 20.88
4663. kk (kkqu) 91 96.49 114.55 35 38.46
4664. Ken (kenzymazy) 91 82.13 99.39 28 30.77
4665. kripp (hotdoghunter) 91 85.68 120.03 29 31.87
4666. ahmad (h0gan_2020) 91 51.20 74.25 17 18.68
4667. dinker (gumbolaya) 91 145.49 170.49 14 15.38
4668. Slava (gilescope) 91 44.17 53.96 23 25.27
4669. Md Saim (saimahmad) 91 68.92 85.36 25 27.47
4670. Rabbi (rhdevil) 91 36.35 49.11 6 6.59
4671. Rex (rexcaliber_115) 91 83.37 111.23 28 30.77
4672. mashrafi (qweer) 91 44.48 58.57 9 9.89
4673. Parvez (parvez31) 91 46.60 57.86 14 15.38
4674. Andy (parkourmaster302) 91 108.85 137.31 57 62.64
4675. Mmm coffee (orchdork7926) 91 103.73 123.15 36 39.56
4676. Tyler (omni_aspect) 91 81.28 124.76 28 30.77
4677. Jannyx (nyxal) 91 88.15 111.97 31 34.07
4678. Mobinul (mobinhmmh1) 91 46.32 53.13 7 7.69
4679. nomad_valhalla (me_manas17) 91 54.76 70.61 18 19.78
4680. MasonColemak (masoncolemak) 91 92.76 114.15 26 28.57
4681. Sayu_ (sayu_) 90 53.00 63.14 7 7.78
4682. Brandon (retrogamer56) 90 115.72 138.81 54 60.00
4683. poqe8819 (poqe8819) 90 95.18 121.45 21 23.33
4684. Martin (palchone) 90 74.03 92.01 26 28.89
4685. car (nostalgiatest) 90 100.67 130.51 40 44.44
4686. Kono Dio Da (nankan6111) 90 106.75 130.09 39 43.33
4687. Nak (nakulo) 90 67.49 93.41 19 21.11
4688. Moellie (moelong1) 90 66.02 87.05 20 22.22
4689. maoam (maoamwins) 90 92.04 112.59 32 35.56
4690. Alejandro (akakmx) 90 78.33 98.39 23 25.56
4691. A (ag2718) 90 113.61 145.09 40 44.44
4692. Adrian (aeroplaneking) 90 98.32 120.70 32 35.56
4693. Sasang (aerialstunt) 90 84.17 102.22 29 32.22
4694. Lien❤️Neu(2025-03-09) (... 90 102.11 134.06 34 37.78
4695. abi19911 (abi19911) 90 63.44 87.02 15 16.67
4696. Nguyen (nguyenpa3963) 90 38.11 51.81 3 3.33
4697. lizzie-beth (lizzie_beth) 90 69.66 87.82 40 44.44
4698. DataCrusader (faruzzy) 90 64.55 74.22 28 31.11
4699. Omega (enmendurana) 90 50.55 65.74 6 6.67
4700. Shane (enahs_py) 90 97.97 119.82 39 43.33
4701. Emmy (emilyelaine) 90 93.02 112.10 31 34.44
4702. oreo (e00d) 90 105.49 135.41 47 52.22
4703. Kebab (durum_kebab) 90 91.33 116.51 33 36.67
4704. Daniel (danielsabox) 90 89.92 111.64 32 35.56
4705. dumbdwei (cringe69) 90 73.99 93.49 17 18.89
4706. Evan (crcd) 90 76.80 92.91 20 22.22
4707. . (cope_and_seethe) 90 115.19 147.17 49 54.44
4708. Venus (ching_ching) 90 69.80 86.26 29 32.22
4709. Celiakos (celiakos) 90 48.93 57.91 8 8.89
4710. Josh (belewcookies) 90 66.36 82.95 22 24.44
4711. Naimul (bangladeshi) 90 31.28 44.23 6 6.67
4712. Hi (aspenink) 90 110.87 142.96 58 64.44
4713. MAMUN (wmamunhossain) 90 55.95 70.80 15 16.67
4714. wasim (wasim7198) 90 51.84 60.60 8 8.89
4715. Ranger (turbo_99) 90 74.72 88.50 31 34.44
4716. Tuan (tuan_nguyen) 90 115.28 140.83 49 54.44
4717. fischld (tokiwa) 90 88.47 109.82 25 27.78
4718. storm (stooormmm) 90 98.97 124.15 39 43.33
4719. zyuken (spaceee) 90 100.43 143.40 35 38.89
4720. Vienna (sexystan69) 90 68.85 92.40 23 25.56
4721. Lack (lackhammer) 90 98.31 118.20 34 37.78
4722. Ksizzzzz (ksiz) 90 85.63 107.03 32 35.56
4723. Norik (kingjulian1) 90 60.66 74.38 14 15.56
4724. kj (kellydebow) 90 63.59 87.37 19 21.11
4725. Johnofan (johnofan) 90 91.57 123.15 24 26.67
4726. JBrocksfellas (jbrocksfellas) 90 56.92 70.32 30 33.33
4727. immikeylee (immikeylee) 90 108.76 126.99 49 54.44
4728. Zachary (hejukaza) 90 58.76 95.38 22 24.44
4729. gloria (glorialostthegame) 90 101.62 126.49 32 35.56
4730. G L O O M Y (gloomy24) 90 46.02 57.15 6 6.67
4731. mingi (gatangae) 90 78.89 95.67 26 28.89
4732. lone (lone17) 89 59.62 86.34 21 23.60
4733. lolitsgow (lolitsgow) 89 86.23 100.23 26 29.21
4734. Tom (krarc) 89 84.31 110.46 20 22.47
4735. iwillcomboyou (iwillcomboyou) 89 49.59 67.62 6 6.74
4736. Hamza (hamza_type) 89 58.14 74.37 16 17.98
4737. Chef Giuliano (gd27) 89 90.56 113.32 19 21.35
4738. FiB0 (fiboss) 89 95.15 119.63 68 76.40
4739. Affan (fantzy) 89 38.10 55.67 5 5.62
4740. Daedalus (dufficinetic) 89 70.68 87.90 17 19.10
4741. Tim (dreamaz) 89 83.46 99.54 26 29.21
4742. Draco (draco_the_toad) 89 67.75 92.70 29 32.58
4743. Dhruv (dhruv8601) 89 61.91 84.57 12 13.48
4744. Jason (d4tb0i) 89 77.26 93.93 17 19.10
4745. Chagil (chagil) 89 116.39 152.38 41 46.07
4746. mahdi (carpenterbrother) 89 68.63 83.12 20 22.47
4747. billypeppin (billypeppin) 89 112.48 139.43 36 40.45
4748. Long (bachthime) 89 70.89 92.99 19 21.35
4749. SalahDin (salastro) 89 69.88 86.63 21 23.60
4750. Safi (safeehalim) 89 70.42 89.21 27 30.34
4751. tofu (reversytofu) 89 119.04 150.16 54 60.67
4752. Pendejo (pendejo13) 89 53.87 64.62 7 7.87
4753. Kevin (pekkanator1) 89 100.91 124.15 39 43.82
4754. Paul (pasham999) 89 62.12 72.83 20 22.47
4755. apostolos (orou) 89 39.31 55.93 12 13.48
4756. tstats[orbitaltowel] (orbit... 89 93.15 126.41 38 42.70
4757. Mirtininkas (mirtininkas) 89 63.66 90.64 18 20.22
4758. Leo (me10250) 89 60.04 89.03 19 21.35
4759. Angeline (mangosteen18) 89 59.33 75.46 11 12.36
4760. Nick (adyingwalrus) 89 118.64 141.06 38 42.70
4761. 6226 (6226) 89 88.07 104.02 26 29.21
4762. KGHZY (kghzy) 89 44.93 65.97 7 7.87
4763. marmar (marmarmarmar) 89 93.87 121.94 31 34.83
4764. bigdoongg (bighotdogg) 89 56.52 74.28 17 19.10
4765. Kristel (speedygonzales1997) 89 45.94 58.02 6 6.74
4766. Yelxuh (yelxuh) 89 121.86 162.95 51 57.30
4767. Steve (stevestupidface) 89 104.73 124.59 44 49.44
4768. Stefan (stefanknez03) 89 36.67 51.52 6 6.74
4769. q (scullyy) 89 81.03 108.18 51 57.30
4770. Gabe (yokingszn) 88 72.36 87.43 30 34.09
4771. Tarun (tpunhani) 88 70.95 94.01 23 26.14
4772. Spritly (spritly) 88 87.65 106.65 30 34.09
4773. Tamir (recoon44) 88 49.55 67.66 8 9.09
4774. Prabh (prabh1601) 88 85.27 103.95 31 35.23
4775. Pach (pachslayer) 88 112.18 137.70 39 44.32
4776. Neo (neosteps) 88 67.25 90.16 26 29.55
4777. Jonathan (mrschubidu) 88 65.13 87.20 24 27.27
4778. Marc (maarcabiaad) 88 94.25 126.47 22 25.00
4779. Krish (krish7) 88 50.93 64.61 6 6.82
4780. Shakil Kabir (kopbdshakil) 88 66.07 81.52 23 26.14
4781. heavy (heavyshaker) 88 52.61 64.34 17 19.32
4782. Will (ghostal) 88 100.01 125.83 40 45.45
4783. fixing my (fixing_bad_habits) 88 106.98 124.44 37 42.05
4784. JK (ettanin) 88 60.96 73.11 11 12.50
4785. Erza (erza_loves_coffee) 88 59.85 73.42 9 10.23
4786. sdf (delta23) 88 105.14 132.70 42 47.73
4787. 🐸bingus🐸 (dearmr) 88 114.93 136.42 49 55.68
4788. Cat (catcatcatcatcatcatcatcat) 88 107.48 129.09 61 69.32
4789. Cammy (cammy04) 88 70.85 82.82 15 17.05
4790. Pranay (ant1sipater) 88 70.13 87.97 21 23.86
4791. Daniel (altold) 88 91.92 107.52 29 32.95
4792. Alex (alexey0) 88 67.50 81.50 25 28.41
4793. Abdullatif (ak_type_master) 88 62.87 73.73 10 11.36
4794. Adepttyper123 (adepttyper123) 88 92.13 118.09 37 42.05
4795. kumar (kumar_adity_a) 88 54.22 65.22 11 12.50
4796. asfastasurrelation (darryl11) 88 55.37 76.62 6 6.82
4797. Tyler (tylerbeep) 88 39.88 53.86 7 7.95
4798. LAVISH (lavvish) 88 44.75 63.20 18 20.45
4799. Andrej (andy144) 87 72.71 86.08 19 21.84
4800. Ali (amizan8653) 87 84.54 104.56 27 31.03
4801. Abode (abulrahman_kallas) 87 24.67 37.29 19 21.84
4802. faxer (faxer123) 87 33.74 46.96 11 12.64
4803. Tamer (tls_15) 87 56.32 75.29 11 12.64
4804. Malcolm (malcolm_) 87 89.17 109.54 38 43.68
4805. Rin (komorebi2) 87 136.26 191.51 48 55.17
4806. Kirubel (kirubelt) 87 58.21 71.02 14 16.09
4807. josca (josca) 87 75.23 92.86 32 36.78
4808. BlueOctupus 🦑 (jim_my) 87 57.29 73.85 18 20.69
4809. Snail's Pace (hardtack) 87 86.71 108.35 32 36.78
4810. Igor (zig84) 87 78.92 97.26 25 28.74
4811. random (waltersgo) 87 95.43 113.19 32 36.78
4812. Tastic (t_tastic) 87 71.30 99.59 49 56.32
4813. tomthegamer150 (tomthegamer) 87 78.26 101.82 23 26.44
4814. Marc (thehobbit6937) 87 69.15 90.73 25 28.74
4815. Jole (sliceoflife) 87 87.74 103.19 33 37.93
4816. Simon (simon_f1) 87 92.21 107.33 28 32.18
4817. Matthew (rush_a) 87 84.77 109.02 25 28.74
4818. Romi (romi14) 87 96.95 127.84 26 29.89
4819. Risheet (risheet_7) 87 64.30 81.23 25 28.74
4820. Prex (prex) 87 54.27 72.12 26 29.89
4821. Sean (polosauris) 87 79.93 102.48 22 25.29
4822. S M (plaban13) 87 42.56 54.11 7 8.05
4823. otomen (nurul_liayana) 87 82.20 104.63 29 33.33
4824. fastkid (notfastkid) 87 89.99 118.38 28 32.18
4825. Nonstoplink (nonstoplink2) 87 94.30 136.60 42 48.28
4826. omar (nightkappa73) 87 71.01 91.41 17 19.54
4827. Nigel Yul (nigelyul) 87 110.38 131.05 49 56.32
4828. Tony (naka__) 87 100.23 129.84 32 36.78
4829. NadAlaba (nadalaba) 87 54.91 79.56 16 18.39
4830. Kumar Charan (mr_kc) 87 48.71 62.51 5 5.75
4831. MH (mh_parag) 87 70.73 88.82 22 25.29
4832. Hoang (feelsdankman_1) 87 83.25 105.65 13 14.94
4833. Eric (erichamers) 87 85.90 106.76 34 39.08
4834. GOTTAGOFAST (b_200910028) 87 59.59 77.09 18 20.69
4835. Patrick (burntriceboi) 87 49.38 76.15 15 17.24
4836. Batbold (burabatbolf) 87 65.77 85.29 26 29.89
4837. Jordan (brownbox) 87 70.75 84.85 29 33.33
4838. Dvorak on (freddysg) 86 74.72 99.52 85 98.84
4839. Fishy_Types (fishy_types) 86 96.56 126.46 33 38.37
4840. Eli (e_lightning) 86 64.94 81.41 20 23.26
4841. Dong (dongggg) 86 86.54 108.41 29 33.72
4842. dalia (daliafraga) 86 78.09 92.72 21 24.42
4843. Jalen (dabesttypr) 86 90.82 111.40 25 29.07
4844. caleb (caleb123456) 86 125.48 151.84 48 55.81
4845. Adrian (bobsgotepicskills) 86 72.53 90.96 17 19.77
4846. GreatWhiteShark (black_b6969) 86 92.07 114.02 25 29.07
4847. তৌসিফুল ফ... 86 83.40 99.30 25 29.07
4848. Ayy (ayush_parihar) 86 60.27 76.90 12 13.95
4849. Asaan (asaan) 86 48.31 63.74 5 5.81
4850. Joaquin (zevolish) 86 106.27 129.98 45 52.33
4851. yeet (yeetanut) 86 114.52 159.17 37 43.02
4852. lokesh (vidhvanshak) 86 56.64 67.64 16 18.60
4853. uzu (uzuiiske) 86 106.77 135.37 47 54.65
4854. Qing En (twea) 86 53.02 69.37 14 16.28
4855. bobby (trowlazer) 86 130.14 149.72 63 73.26
4856. Bruno (tresco) 86 105.21 143.04 33 38.37
4857. treespirit (treespirit) 86 89.97 111.03 25 29.07
4858. Mony The G (skull_slayer) 86 122.45 161.09 52 60.47
4859. Shamseer (shamsu) 86 45.89 62.67 11 12.79
4860. Anunnaki (anunnaki77) 86 52.17 65.05 17 19.77
4861. Tursunali (ali_khan) 86 60.85 86.76 18 20.93
4862. ahnfnsr (ahnfnsr) 86 78.51 96.99 17 19.77
4863. Green Tea (2001186) 86 99.93 131.76 24 27.91
4864. Peter (cruzp_63_mobile) 86 37.15 52.46 2 2.33
4865. mdawg101 (mdawg10101) 86 65.07 84.29 18 20.93
4866. Ted (lucky_strike) 86 91.05 111.58 22 25.58
4867. Krystall (krystaller) 86 43.30 55.06 6 6.98
4868. Eugene (kpopgay) 86 79.70 104.00 20 23.26
4869. Kevin (kevin_zhang) 86 79.61 99.68 21 24.42
4870. Jayden (jripic137) 86 105.38 123.23 57 66.28
4871. Ashish (grimjaw7) 86 68.13 79.06 14 16.28
4872. Hehe (gagokarin) 86 114.55 158.63 46 53.49
4873. SB (sbjeans) 86 66.09 78.51 24 27.91
4874. Rain (rain_19) 86 68.27 87.65 32 37.21
4875. Jim (pokemontcg2) 86 124.68 152.34 51 59.30
4876. Palish (palish) 86 70.78 87.40 22 25.58
4877. Owen (owenxc1234) 86 119.00 160.43 49 56.98
4878. TooTired (oturan11) 86 94.18 130.42 24 27.91
4879. Nelson (nelson_typer) 86 51.21 62.08 6 6.98
4880. August (myracule) 86 54.96 68.28 8 9.30
4881. Mohaka (mohaka) 86 55.91 72.49 8 9.30
4882. Junior (mkunaji) 86 60.73 73.93 23 26.74
4883. maxwelljones14 (maxwelljones) 86 99.35 122.31 32 37.21
4884. Brett (savagesapien) 85 72.91 94.56 18 21.18
4885. Sean (qpalzm123) 85 90.12 112.82 24 28.24
4886. Harvey (precisiongoat) 85 66.75 78.73 16 18.82
4887. Matthew (noobdestroyer69) 85 98.49 120.57 48 56.47
4888. raven (mr_raven) 85 70.70 87.57 28 32.94
4889. Miky (mikymoose) 85 52.66 61.80 9 10.59
4890. Mason (mgbaird) 85 53.46 72.25 11 12.94
4891. Gobind (meri_marzi) 85 73.38 112.74 14 16.47
4892. ZanderL (mcmickeylyc) 85 79.66 95.90 27 31.76
4893. Mars (mars212163) 85 89.54 110.42 29 34.12
4894. Moritz (mango_1212) 85 49.37 66.17 13 15.29
4895. Person (ali_666_) 85 98.30 118.07 36 42.35
4896. A (akane49) 85 62.21 76.63 22 25.88
4897. B00P (aaron_sy1) 85 91.65 112.73 30 35.29
4898. Ayman (7times) 85 67.60 93.12 24 28.24
4899. Rui (raiyik) 85 69.36 83.16 23 27.06
4900. Silat (1guts_is_berserk) 85 37.41 49.07 14 16.47
4901. Artur (ester_versuch) 85 57.49 67.43 11 12.94
4902. Darrrrr (darrrrrrr) 85 97.74 114.77 33 38.82
4903. conquodS (cobraa) 85 99.51 123.47 39 45.88
4904. Chris (___chris) 85 85.05 106.74 24 28.24
4905. zyrch (zyrch) 85 71.30 89.12 26 30.59
4906. Jesse (yojesse__) 85 70.82 101.01 19 22.35
4907. wlof (wlof) 85 64.68 77.55 19 22.35
4908. Luca (tracked) 85 67.08 89.32 16 18.82
4909. TehTrooper (tehtrooper) 85 68.76 83.76 18 21.18
4910. fast_as_f*ck (techniqueee1337) 85 28.99 39.45 8 9.41
4911. Berny (syrupsandwich) 85 118.48 155.73 41 48.24
4912. Sven (sven0101) 85 57.39 72.30 16 18.82
4913. superkhau (superkhau) 85 104.49 142.57 34 40.00
4914. StevesterH (stevesterh) 85 94.83 117.24 24 28.24
4915. Jake (starbless) 85 98.30 123.66 33 38.82
4916. Saurav (srvsaha) 85 63.65 86.02 20 23.53
4917. Akash (speedy_acj) 85 86.93 104.73 32 37.65
4918. Sicoz (skyarc12) 85 98.32 120.03 30 35.29
4919. Helixsa (siam33162) 85 53.97 73.49 9 10.59
4920. Jacob (shrimploin) 85 126.54 159.24 46 54.12
4921. Kusahgra (kushagra813) 85 79.93 94.23 23 27.06
4922. king (kingkuzo) 85 91.01 111.53 30 35.29
4923. ---| (karthivi95) 85 80.04 97.90 22 25.88
4924. Jeremy (jerbear27) 85 83.03 102.97 31 36.47
4925. Bart (itwashishat) 85 49.91 73.32 11 12.94
4926. IMcRoni (imcroni) 85 91.47 123.37 26 30.59
4927. iglo31 (iglo31) 85 74.18 95.01 20 23.53
4928. iAmKaviar (iamkaviar) 85 58.74 76.60 15 17.65
4929. Gabriel (hong_kong_) 85 73.99 93.90 27 31.76
4930. (g_fruit) 85 133.21 157.55 60 70.59
4931. joey (legend_joey) 84 48.51 65.32 14 16.67
4932. Kitty (kxkixi) 84 116.91 135.95 46 54.76
4933. Paul Kenneth (kennetoy2302) 84 58.67 78.21 20 23.81
4934. Jump (jump420) 84 54.27 71.43 13 15.48
4935. JEWels (juewls) 84 58.63 76.87 16 19.05
4936. Jon (jonlivestrong) 84 83.47 106.21 32 38.10
4937. Jay (jayser6) 84 90.68 116.99 30 35.71
4938. Jason (jachian) 84 107.79 133.84 51 60.71
4939. Harshit (harshu19) 84 51.51 62.38 6 7.14
4940. Ahmed (goushaa) 84 56.74 73.59 11 13.10
4941. SilentHill (gosha666) 84 98.21 117.87 33 39.29
4942. Vikram (galvarino_) 84 49.52 58.85 5 5.95
4943. ant (fourmi) 84 40.01 47.87 3 3.57
4944. MoralCharity (ethicalgivings) 84 115.54 158.96 47 55.95
4945. Jesper (dwingx) 84 104.79 136.37 28 33.33
4946. Chetan (chetankawarkhe) 84 58.80 81.44 16 19.05
4947. carlos (carlit0) 84 96.81 121.90 25 29.76
4948. Jimbo (bugprostate) 84 81.53 101.40 26 30.95
4949. deez (biggy2) 84 104.66 121.02 30 35.71
4950. AYJayeh (ayjayeh) 84 59.91 73.78 20 23.81
4951. Saugat (saugat_regmi) 84 53.57 66.73 7 8.33
4952. Ed (recht) 84 93.34 110.33 40 47.62
4953. Nice (pranavkum123) 84 111.22 136.61 35 41.67
4954. Nasser (nass_1000) 84 53.32 67.50 5 5.95
4955. MoonSpoon (moonspoon1337) 84 47.90 63.15 5 5.95
4956. Mohammad (mohammadmc) 84 70.70 91.08 20 23.81
4957. McBurger (mcburger) 84 67.62 88.62 15 17.86
4958. Arijit (arijitgupta42) 84 71.91 91.82 28 33.33
4959. Anirudh (anirudh06) 84 74.52 88.13 37 44.05
4960. dj_sevdah (dj_sevdah) 84 63.54 83.45 27 32.14
4961. fnkl (fnkl) 84 77.43 105.66 23 27.38
4962. shinygia (shinygia) 84 65.00 82.21 20 23.81
4963. Shiba (pianolover123) 84 107.44 140.61 50 59.52
4964. Elias (mojolake) 84 72.34 100.28 22 26.19
4965. Zubair Ali (zubairali) 84 58.79 76.34 11 13.10
4966. Carlton (wizardhero) 84 82.17 96.74 18 21.43
4967. VoiceOfTheWorld (voiceofthe... 84 62.64 77.93 17 20.24
4968. ​​yosefxlr8 (vaniix_) 84 89.01 111.07 22 26.19
4969. Anu (typeradha) 84 109.36 128.27 36 42.86
4970. tourist (tourist18) 84 71.21 80.80 22 26.19
4971. sussyplayer (sussyplayer696... 84 66.95 81.79 13 15.48
4972. Shokhrukh (shokhrukh18) 84 65.59 76.66 32 38.10
4973. Kid (zenfire9001) 83 85.23 107.71 20 24.10
4974. Toko (xisderr) 83 55.58 75.68 10 12.05
4975. Pp (typerace2002) 83 57.65 70.89 14 16.87
4976. Baby Shark (toinfinity1) 83 97.67 120.18 32 38.55
4977. doctor (timelordvader) 83 48.19 60.36 7 8.43
4978. Storm (st0rm7) 83 50.31 62.57 8 9.64
4979. spider (spidergod) 83 51.09 68.94 10 12.05
4980. . (speedyant) 83 113.17 141.69 37 44.58
4981. Amo (santan_amzy) 83 89.07 101.49 26 31.33
4982. Elliott (s1ldafort) 83 75.83 95.84 23 27.71
4983. Rudolf (rutzzz) 83 94.32 119.98 33 39.76
4984. rideler (rideler) 83 66.28 79.87 19 22.89
4985. darren (raisinnbrann) 83 66.53 91.99 17 20.48
4986. Zach (qwerty1221) 83 90.55 110.30 21 25.30
4987. Jim (problemset) 83 85.40 106.37 27 32.53
4988. JJ (peppermints) 83 78.76 90.57 16 19.28
4989. Zachary (peanutbutter146) 83 69.44 84.54 21 25.30
4990. Omunyokol (omunyokol) 83 64.44 84.09 14 16.87
4991. Obatop (obatop) 83 92.49 122.31 26 31.33
4992. noah (noahruether) 83 57.09 77.52 16 19.28
4993. Noah (noah187) 83 88.97 102.61 27 32.53
4994. Ali (medtype) 83 134.87 164.68 55 66.27
4995. help (mango_mango_mango) 83 103.73 124.72 44 53.01
4996. Sky (lanprodn41) 83 91.87 110.35 28 33.73
4997. Kunal (kunaldutta) 83 40.67 55.60 10 12.05
4998. Kitchen (kitchen_operator) 83 72.38 88.51 17 20.48
4999. MAYANK (kartosbrotherinlaw) 83 57.92 71.85 14 16.87
5000. Harrison (harryblueberry) 83 118.40 158.91 51 61.45
5001. Andrews (godspeeedd) 83 70.24 96.82 20 24.10
5002. Erick (ep1ore) 83 65.59 80.51 20 24.10
5003. Emeer (emeer_macapili) 83 60.35 74.60 16 19.28
5004. Dan (dnor1313) 83 93.03 120.85 31 37.35
5005. D (darueru241) 83 54.85 66.05 13 15.66
5006. Daivat (daivatvaishnani) 83 75.39 89.09 19 22.89
5007. Donked (cyrany) 83 85.67 105.71 26 31.33
5008. chesco (chesco97) 83 73.66 91.37 27 32.53
5009. simon (chainsawteeth) 83 70.91 83.14 21 25.30
5010. Carmondai (carmondai) 83 44.78 53.04 5 6.02
5011. Sherlock (caramel1995) 83 118.25 143.37 45 54.22
5012. buhaN (buhan1337) 83 80.64 95.53 28 33.73
5013. Blade0307 (blade0307) 83 65.21 78.14 14 16.87
5014. ya BOI (beasted6969) 83 110.71 139.32 32 38.55
5015. Bartek (batek_kierownik) 83 105.79 143.15 47 56.63
5016. kes (barubelajarhehe) 83 64.63 77.86 18 21.69
5017. Alex (alexwpm) 83 62.26 81.84 15 18.07
5018. Felix (sp4cebar) 83 70.42 88.30 19 22.89
5019. Bryce (pennydog13) 83 56.09 70.47 12 14.46
5020. Abraiz (abraiz) 83 57.03 68.65 11 13.25
5021. Alpamys (a1pamys) 83 74.26 96.77 16 19.28
5022. GZ (dysonspheres) 83 97.49 112.87 22 26.51
5023. Space (spacecarrot) 83 79.07 95.63 21 25.30
5024. oscar (ansgar92314) 82 88.32 106.83 27 32.93
5025. Abhishek (abhishekxix) 82 66.58 86.62 21 25.61
5026. Abdelrahman (abdo_mano) 82 42.00 52.63 3 3.66
5027. Govind (404fixer) 82 56.51 69.93 11 13.41
5028. Leo (powerleo101) 82 81.09 114.75 25 30.49
5029. self (fzires) 82 99.82 123.29 32 39.02
5030. . (lv23) 82 82.01 106.78 20 24.39
5031. Lucas (lucasbush3) 82 74.36 94.67 34 41.46
5032. L (lpuczynski) 82 71.52 88.48 21 25.61
5033. Romit (junior12345) 82 60.62 77.28 19 23.17
5034. qwerty (jowk) 82 84.03 107.27 22 26.83
5035. FT_Zeref (iamzeref) 82 29.49 40.59 15 18.29
5036. Gaurav (gaurav2607) 82 48.88 63.59 12 14.63
5037. Lauris (toxic_bowl) 82 72.93 85.55 23 28.05
5038. Ron (rounakc18) 82 101.90 117.16 24 29.27
5039. rita (rita_mahato) 82 46.65 62.06 7 8.54
5040. Ravel (raveltan) 82 62.95 73.82 20 24.39
5041. Mayank (person_mayank) 82 77.20 94.78 19 23.17
5042. Nazarii (nazarii_z) 82 72.05 91.99 18 21.95
5043. Mike Adrian (mikeadrian) 82 74.33 86.09 15 18.29
5044. Majdi (freuud) 82 84.10 97.35 27 32.93
5045. Aldir (faway) 82 83.26 100.62 19 23.17
5046. M (faster_than_your_father_... 82 54.75 65.14 13 15.85
5047. Ezz Abuzaid (ezzabuzaid) 82 59.83 72.53 20 24.39
5048. Michael (dodus) 82 90.48 106.40 17 20.73
5049. Dipesh (dipeshm77) 82 76.78 91.55 18 21.95
5050. Aranyo (chimichenghiskhan) 82 96.35 114.45 36 43.90
5051. chekic (chekic) 82 88.79 114.60 27 32.93
5052. Ivan (bbqhehe) 82 129.14 152.00 50 60.98
5053. Amit (a_myth) 82 66.50 75.29 15 18.29
5054. Wake (awriter) 82 72.19 98.43 20 24.39
5055. Asis (asis1998) 82 47.80 66.18 11 13.41
5056. ari (aryanonye) 82 67.98 75.77 19 23.17
5057. Declan (doctordirl) 81 99.71 116.91 27 33.33
5058. Dew2118 (dew_2118) 81 68.03 79.07 15 18.52
5059. David (davidstakic) 81 58.36 77.56 13 16.05
5060. Danzcotic (danzcotic) 81 85.55 106.54 20 24.69
5061. Ranit (colemakgang) 81 99.95 132.39 32 39.51
5062. Brzzz (brzzz) 81 77.49 94.81 19 23.46
5063. Missile Input (breadlump) 81 83.67 104.08 21 25.93
5064. Ayham (ayhamgh) 81 59.30 74.04 19 23.46
5065. zach (zacc2285) 81 103.18 124.04 35 43.21
5066. Vishal Singh Adhikari (vizz... 81 68.28 88.22 21 25.93
5067. v (vinay747) 81 48.54 64.34 9 11.11
5068. Ben@ (uniconsole) 81 56.12 74.39 11 13.58
5069. Typer4e (unbreakse) 81 90.71 106.26 21 25.93
5070. vulture (typinguntilcompute... 81 111.52 133.09 45 55.56
5071. Jimothy (typeman_69_420) 81 43.87 64.60 3 3.70
5072. user_012 (tsitohaina) 81 46.73 57.43 19 23.46
5073. Tmr (tmr_sa) 81 35.61 45.90 6 7.41
5074. Jaxon Tatton (superjax101st) 81 50.66 74.88 47 58.02
5075. snipa146 (streamsniper146) 81 36.85 50.15 5 6.17
5076. Cathy (strawberrylatte) 81 78.94 101.11 15 18.52
5077. Sourav (sourav008) 81 48.30 58.60 8 9.88
5078. Nick (soltymong) 81 65.33 87.18 21 25.93
5079. sky (skymario) 81 71.85 98.21 15 18.52
5080. Shreyas (shreyastalathi) 81 72.01 88.25 14 17.28
5081. Salamander (20_minutes_per_... 81 90.50 108.41 47 58.02
5082. mcg (_mcg) 81 74.10 87.57 19 23.46
5083. Bingo Bongo (bingo_bongo_) 81 79.07 97.60 25 30.86
5084. seb (xsebzero) 81 76.74 98.73 23 28.40
5085. Bastien_race28 (bastien_rac... 81 72.88 88.50 20 24.69
5086. Pavel (pavelmirror) 81 37.90 44.35 5 6.17
5087. jyjy (jyking99) 81 75.44 101.46 19 23.46
5088. Lakshya (lakshyasharma) 81 69.76 88.47 21 25.93
5089. Tommy (kamuimaru) 81 113.75 145.12 41 50.62
5090. kajuna (kajuna) 81 90.41 123.14 30 37.04
5091. Joshua (justdatotherguy) 81 73.39 90.18 23 28.40
5092. No (jopear) 81 75.39 89.26 17 20.99
5093. Joey (joeyp123) 81 76.43 93.49 14 17.28
5094. Jason (jbb817) 81 128.39 154.54 54 66.67
5095. Baxtiyor (iotype) 81 90.35 104.71 32 39.51
5096. holsoma (holsoma) 81 82.91 97.42 26 32.10
5097. hamada (hamada377) 81 22.44 34.08 14 17.28
5098. akhil (hailk11) 81 77.55 95.64 21 25.93
5099. Håvard (haavga) 81 64.98 83.48 13 16.05
5100. ghxstly-_-kid (ghxstlykid) 81 54.57 69.56 6 7.41
5101. Skipper (samskipper) 81 29.27 39.07 17 20.99
5102. RAJIV RANJAN (rajiv_ranjan_1) 81 42.30 59.29 6 7.41
5103. Blake (raccoonswoon) 81 75.95 96.01 22 27.16
5104. Raaed (raaed_23) 81 96.05 127.39 33 40.74
5105. Jan (q1xter) 81 69.98 84.94 16 19.75
5106. Presiyan (presiyan15) 81 65.53 81.78 13 16.05
5107. Ovidiu (ovidiu0720) 81 61.25 72.17 15 18.52
5108. Omar (omarr84) 81 64.67 77.21 15 18.52
5109. Omer (om3rrr) 81 101.52 128.03 32 39.51
5110. Odo (odo_bean) 81 64.20 80.14 21 25.93
5111. Thao (ncthao) 81 75.00 98.37 31 38.27
5112. mubara (mubara) 81 37.09 49.18 8 9.88
5113. The (mrperfectionista) 81 49.66 59.15 8 9.88
5114. Schpuunk (schpuunk) 80 68.84 86.62 25 31.25
5115. Reimar (reimarpb) 80 97.15 115.44 40 50.00
5116. pprav (potato69420) 80 95.74 120.51 23 28.75
5117. Quinn (peea) 80 86.55 107.10 23 28.75
5118. MsPianomama (mspianomama) 80 93.70 121.18 28 35.00
5119. Fadil (mr_fadil48) 80 59.26 79.27 15 18.75
5120. Harry (moto1310) 80 53.72 77.87 22 27.50
5121. Bakhodir (marko_w) 80 59.73 77.02 26 32.50
5122. ambi (ambiidextrous) 80 92.79 120.58 38 47.50
5123. k (ahhhjk) 80 81.85 107.21 22 27.50
5124. AbdElazeem (abd_alazeem) 80 39.81 52.41 6 7.50
5125. Abderrahim (aaissa) 80 65.23 88.06 16 20.00
5126. Jakeyboi (00hike) 80 83.59 102.87 25 31.25
5127. Cannelle (cannelle) 80 47.17 59.09 10 12.50
5128. Dirk (treetoucher) 80 56.01 68.38 11 13.75
5129. Rice (riceinbob) 80 70.47 89.12 28 35.00
5130. x (roadtoonehundwpm) 80 76.07 93.62 22 27.50
5131. skiie (huypig11) 80 60.93 73.88 15 18.75
5132. Mo (mo7azeem) 80 94.17 107.28 25 31.25
5133. Nicolas (fruscianterules) 80 81.71 112.68 27 33.75
5134. Fernando (ferthekiller6_) 80 82.20 107.16 27 33.75
5135. fantdm4@gmail.com (evolnizark) 80 60.24 80.99 25 31.25
5136. Helena (evanalfred0817) 80 86.40 111.77 42 52.50
5137. Eli (elithesped) 80 127.72 167.40 54 67.50
5138. m_j (dontlistentome) 80 87.12 115.94 25 31.25
5139. David (davidjohnston20) 80 107.15 134.68 32 40.00
5140. Don Quixote (crunchjunkie) 80 49.55 62.57 12 15.00
5141. EJ (clarencedc) 80 83.89 114.34 30 37.50
5142. Chetan (chetanhaobijam) 80 77.46 101.48 14 17.50
5143. Bingsong (bingsongbingsong) 80 64.45 79.07 11 13.75
5144. Stepan (a_s_v) 80 82.08 94.77 25 31.25
5145. Zoltatorrez (zoltatorrez) 80 72.41 88.50 15 18.75
5146. Brandon (zombieapocalypse) 80 67.83 82.53 20 25.00
5147. Zachary (zacharide) 80 61.61 83.03 21 26.25
5148. Viet (viettp) 80 50.16 64.18 6 7.50
5149. Marcel (thiccer_marc) 80 106.42 137.36 42 52.50
5150. Logan (thewhiteowl69) 80 80.22 105.64 21 26.25
5151. Alex (snowbdd9f1) 80 80.55 97.30 26 32.50
5152. Slowman (slowman101) 80 96.67 111.04 30 37.50
5153. sharavsambuu (sharavsambuu) 80 70.95 86.67 22 27.50
5154. Shane (shane_woosh) 80 100.95 123.02 38 47.50
5155. shahan (shahanj) 80 66.66 95.57 25 31.25
5156. pen (lock3r) 80 97.15 125.46 25 31.25
5157. The Real League of Typists ... 80 51.02 64.22 16 20.00
5158. Kenzen (kenzen18) 80 70.72 87.53 23 28.75
5159. kamal (kemokingdod) 80 22.02 33.09 15 18.75
5160. KMN (kanatbekov_24) 80 54.03 65.83 6 7.50
5161. JoePuttatoe (joeputtatoe626_) 80 63.06 86.93 20 25.00
5162. Dat (jgatz) 80 91.74 107.81 29 36.25
5163. Benjamin (izno) 80 58.12 84.79 19 23.75
5164. tstats[ioannisvrynios] (ioa... 80 110.75 148.15 36 45.00
5165. Hi (hime_) 80 74.07 89.29 19 23.75
5166. Harry (harpreetsingh005) 80 74.70 97.01 16 20.00
5167. Agnes-Joker (guitarbed) 80 104.77 130.99 44 55.00
5168. Gio (gio_etche) 80 96.46 125.10 27 33.75
5169. L0G0S (logos_) 79 94.67 114.69 40 50.63
5170. Light (light655) 79 58.30 72.48 19 24.05
5171. Kasper (kaspertypes) 79 132.91 168.48 58 73.42
5172. 종지 (jonge1124) 79 98.81 120.85 31 39.24
5173. Richard (jjjxxx) 79 65.59 80.38 16 20.25
5174. Jayden (jdawwgg) 79 67.29 96.29 20 25.32
5175. Frank (jaxfrank) 79 60.08 73.33 15 18.99
5176. eugene paul (itdrmts) 79 78.60 91.60 26 32.91
5177. Aufan (icepondx) 79 88.61 106.50 22 27.85
5178. Garrett (grgarrett) 79 92.89 112.73 24 30.38
5179. abdelrahman (basyouni74) 79 35.38 44.98 4 5.06
5180. babao (babao) 79 85.06 114.66 23 29.11
5181. sawamura (sawamura) 79 52.20 65.36 12 15.19
5182. ASHIK (samael99) 79 40.58 52.49 5 6.33
5183. Roelof (roeloflucka) 79 78.03 93.32 20 25.32
5184. plip (plip) 79 57.74 69.34 15 18.99
5185. sayba (nusaiba4) 79 49.43 60.51 6 7.59
5186. Nicholson (nic8ag) 79 61.29 79.46 18 22.78
5187. typelord (nerif) 79 122.69 158.35 43 54.43
5188. Nathan (natekruger) 79 89.09 116.01 28 35.44
5189. Naomi (naomielianora) 79 70.21 87.18 20 25.32
5190. ⁦⁧Mukundan (mukundan314) 79 85.35 106.49 23 29.11
5191. md mahadie (mdmahadiehasanh... 79 71.01 88.44 21 26.58
5192. Akeisara (ake_e_e) 79 46.24 56.67 9 11.39
5193. Aespar (aespar) 79 93.72 114.27 28 35.44
5194. Aang_Guns (aang_guns) 79 59.63 73.52 13 16.46
5195. fast-typist101 (vuylsteke) 79 90.89 115.41 30 37.97
5196. Hassan (7zn5alid) 79 61.10 75.21 21 26.58
5197. SouL (s4ul) 79 58.40 72.55 16 20.25
5198. wunyan (wunyannie) 79 105.59 128.12 31 39.24
5199. Robert (wobert_) 79 130.41 165.59 52 65.82
5200. Adam (waba_waba) 79 57.52 70.61 11 13.92
5201. trqvcr (trqvcr) 79 66.99 96.27 17 21.52
5202. ThatLastWaffle (thatlastwaf... 79 89.59 117.02 31 39.24
5203. Mikołaj (sweed4life) 79 36.68 54.86 10 12.66
5204. ST (subsonic86) 79 41.41 52.36 2 2.53
5205. Noodle (stayed) 79 95.26 153.12 38 48.10
5206. sssssssssssssss (sssssnake) 79 102.56 131.47 38 48.10
5207. toudouche (seni42) 79 89.06 105.11 27 34.18
5208. z (zivry) 78 70.15 84.52 20 25.64
5209. yuh (yuhyeetyaw) 78 103.92 130.74 33 42.31
5210. Youssof (youssof10) 78 62.03 79.18 61 78.21
5211. Gurshaant Singh (waffleflau... 78 60.94 76.30 29 37.18
5212. Vala (valarn) 78 48.53 59.43 4 5.13
5213. Toni (topityper) 78 89.49 110.77 26 33.33
5214. Diego (thebeastboi__) 78 77.74 99.57 31 39.74
5215. Tendinits (tendinits) 78 65.94 93.38 27 34.62
5216. Thomas (tammis) 78 105.67 121.13 39 50.00
5217. Pizdonja (sule57) 78 97.36 115.38 22 28.21
5218. Shubham (shubham_) 78 70.90 87.93 16 20.51
5219. Glade (shogekiha) 78 111.18 134.25 58 74.36
5220. Shen301 (shen301) 78 57.58 69.38 9 11.54
5221. Shaun (shaun_c) 78 88.82 107.67 22 28.21
5222. Shai (shai15) 78 63.32 73.43 14 17.95
5223. Scer_1 (scer) 78 66.92 86.01 18 23.08
5224. Rajesh (rcham) 78 39.63 50.50 3 3.85
5225. Pranto (pranto2722) 78 86.04 103.59 23 29.49
5226. Saul (paulsaredes) 78 93.15 115.34 29 37.18
5227. Yusuf (northernbay4) 78 51.50 68.37 12 15.38
5228. Jay (noj0ke) 78 90.83 122.71 22 28.21
5229. Orion (nettle) 78 41.62 49.86 10 12.82
5230. Natalie (natcard) 78 104.62 130.00 36 46.15
5231. Marc (mwahab_) 78 104.96 137.18 39 50.00
5232. chunchunmaru (mr_mystery4896) 78 87.62 116.87 30 38.46
5233. Tangent (mrtangent) 78 69.23 92.24 16 20.51
5234. Mohamed (mohamedsameh) 78 59.79 70.64 13 16.67
5235. Adley (milf_slayer) 78 46.74 56.68 6 7.69
5236. may (maciem14) 78 66.96 93.54 20 25.64
5237. Arthur (lelface) 78 102.19 131.80 36 46.15
5238. Saba (junior6) 78 91.75 113.42 29 37.18
5239. Yuri (json223) 78 102.75 129.88 39 50.00
5240. Josh (joshjacks) 78 96.67 112.93 36 46.15
5241. PinapL (joshiedean63) 78 50.32 67.80 12 15.38
5242. Eliud (inggoodface) 78 96.77 133.10 19 24.36
5243. Hassan (hassansajjad) 78 94.80 136.72 25 32.05
5244. Gurra (halogurra) 78 81.03 111.92 19 24.36
5245. fool (geekdud) 78 94.29 114.14 21 26.92
5246. Alexeï (g4520u10) 78 37.79 51.06 3 3.85
5247. Me (emailgmailcom) 78 56.34 78.24 6 7.69
5248. Jan (elapid) 78 99.42 116.52 37 47.44
5249. Steven (eeekom) 78 79.65 108.10 22 28.21
5250. Nyora (dvorak_mode) 78 108.65 130.69 41 52.56
5251. dexterj (dexterj) 78 86.52 109.44 20 25.64
5252. Danny (danny_whal) 78 68.09 91.79 22 28.21
5253. Cres (crespear) 78 84.89 105.63 19 24.36
5254. jeff (cqyimo42) 78 114.39 133.67 34 43.59
5255. Brian (bv_altxps) 78 116.73 146.24 40 51.28
5256. toki_crush (boom_51) 78 105.99 128.68 46 58.97
5257. Axel (axeltb) 78 70.84 86.82 23 29.49
5258. Abizer (abizern) 78 80.33 98.83 24 30.77
5259. 79 Camaro (79camaro737) 78 100.18 124.31 30 38.46
5260. Shar (sharkg16) 78 119.13 138.14 32 41.03
5261. Dinah (kirbytyper) 78 90.48 114.50 25 32.05
5262. Ahmed (ahmed20) 77 44.26 55.28 6 7.79
5263. zoidburger (adamczh1) 77 127.52 149.36 49 63.64
5264. Huevonette (heavenslurp) 77 42.67 52.24 5 6.49
5265. sigit (licardi) 77 75.77 96.00 23 29.87
5266. Kyle (kuronkuu) 77 85.57 121.30 23 29.87
5267. Ng (kinkhai) 77 70.25 89.61 17 22.08
5268. Khit (khitnay) 77 96.14 117.89 35 45.45
5269. Hi (jxjx) 77 83.73 97.99 28 36.36
5270. Vincent (jvgcalites) 77 84.11 102.02 18 23.38
5271. que (jhavul) 77 119.85 153.20 48 62.34
5272. Arber (hitit) 77 50.51 71.80 3 3.90
5273. Andrew (greatfighter10) 77 97.02 110.56 27 35.06
5274. john (funkefeet) 77 43.86 57.07 8 10.39
5275. Nikk (white13) 77 101.45 123.63 34 44.16
5276. Michael (v3spula) 77 100.86 131.40 19 24.68
5277. nullchilly (tuwuna) 77 122.76 274.05 39 50.65
5278. YT (tim72) 77 57.01 73.11 8 10.39
5279. ... (the_sesquipedalienist) 77 102.27 137.30 36 46.75
5280. KirILL (spl4yce) 77 75.91 98.77 18 23.38
5281. Sparshong (sparshong) 77 78.53 98.59 24 31.17
5282. S (sima0502) 77 84.76 103.66 22 28.57
5283. ritwik (ritwik3856) 77 73.63 97.00 18 23.38
5284. Prem (premkumar12) 77 31.47 40.00 6 7.79
5285. Tiffany (potatosmeller) 77 72.88 90.90 13 16.88
5286. no (noob1720) 77 84.74 98.03 21 27.27
5287. Navdeep (navk007) 77 48.64 64.54 10 12.99
5288. Marwan (marwans) 77 49.61 61.62 6 7.79
5289. Fabian (fabii1309) 77 90.54 108.23 27 35.06
5290. Tim (eternalwind) 77 67.61 81.57 15 19.48
5291. BBIBBI (eddie110) 77 98.95 116.77 35 45.45
5292. DULAL (dulal744574) 77 39.85 52.82 7 9.09
5293. updog (danielseow) 77 99.62 118.42 25 32.47
5294. Chicken (chickenpowerftw) 77 87.49 115.77 19 24.68
5295. Yogesh (bestyogesh) 77 71.34 88.11 13 16.88
5296. YNCBearz (bear19930414) 77 71.24 85.35 16 20.78
5297. Basel (baselhatata) 77 85.09 108.70 30 38.96
5298. BobDaAsianBuilda (fortnitef... 76 115.62 134.70 32 42.11
5299. Fitive (fitive_gaming) 76 63.96 82.64 20 26.32
5300. Farhan (farhan_op) 76 94.44 113.70 40 52.63
5301. fakedpoet (fakedpoet) 76 62.34 72.34 10 13.16
5302. Emma (emmalischka) 76 56.84 65.02 13 17.11
5303. Oneness (dreamtime) 76 89.97 103.59 22 28.95
5304. Dragos (dragos_valak12) 76 55.03 79.22 8 10.53
5305. arnab (dark_morty) 76 68.86 87.26 24 31.58
5306. Andrew (completespud) 76 86.30 107.72 25 32.89
5307. Tsunami (bmo12) 76 65.53 80.85 23 30.26
5308. Matt (beano15) 76 76.34 96.46 17 22.37
5309. Braden (barbuthnot) 76 92.94 108.45 30 39.47
5310. Buyandelger (b200970010) 76 43.06 56.30 11 14.47
5311. Adam (azonite) 76 107.47 139.99 45 59.21
5312. Atomic (atomicf) 76 44.50 70.81 18 23.68
5313. Sourav (_sourav_sarkar_) 76 59.72 81.10 13 17.11
5314. Beybaris (zstorm_rd) 76 83.52 101.77 21 27.63
5315. Zitti (zittti) 76 67.10 82.79 18 23.68
5316. William (williamy34) 76 75.88 91.46 23 30.26
5317. Lucian (the_eighth_wonder) 76 73.05 92.05 13 17.11
5318. Alex (theflyestlai) 76 69.11 91.56 16 21.05
5319. william (thefastest69) 76 100.76 134.25 23 30.26
5320. KING (thecalamitousduck) 76 61.24 81.33 9 11.84
5321. swoLee (swolee) 76 94.26 116.46 27 35.53
5322. Sven (swen999) 76 80.27 94.06 25 32.89
5323. Sumit (smromuec) 76 92.85 110.12 24 31.58
5324. Slow (slow_typer111) 76 39.16 49.82 2 2.63
5325. Shingo (shingoshoji) 76 110.63 134.63 36 47.37
5326. shavalli (shavalli) 76 44.75 59.47 7 9.21
5327. Gada go FAAASST (seesawsi) 76 83.80 97.31 17 22.37
5328. Nathan (alteriffic) 76 90.95 113.46 29 38.16
5329. Jimbo (doa_jimbo) 76 66.55 85.51 19 25.00
5330. Chad (douchebagasshole) 76 71.80 84.73 19 25.00
5331. Will (lynxwill_bov) 76 75.04 103.88 14 18.42
5332. lol (luv_you) 76 124.96 150.16 50 65.79
5333. ♦☺♦ (lookdownnotjustup) 76 67.63 80.45 19 25.00
5334. Ryan (lilchicken) 76 83.89 99.38 17 22.37
5335. Lego (lamborgotii) 76 113.57 147.64 65 85.53
5336. Shahan Sanjid Khan (korosen... 76 70.59 82.86 17 22.37
5337. David (klassmagicer17) 76 89.87 111.23 24 31.58
5338. Khadiza (khadiza) 76 30.49 37.54 6 7.89
5339. kandarp (kandarp_5) 76 59.55 79.34 17 22.37
5340. Oikawa (kakashihatake1205) 76 74.14 92.12 22 28.95
5341. Jimmy (jiminator) 76 67.20 79.55 17 22.37
5342. JahJi (jahji) 76 91.85 115.21 27 35.53
5343. Dawid (ilordawid) 76 65.85 83.70 13 17.11
5344. Hoasm (hoasm_gnaba) 76 43.67 54.88 11 14.47
5345. Kevin Rendell (hankami37) 76 74.96 92.66 19 25.00
5346. Morris(life gets better) (h... 76 107.28 144.14 26 34.21
5347. Rahul (rocketiscracked) 76 59.21 82.91 22 28.95
5348. Fresca (reifresca) 76 100.53 115.84 19 25.00
5349. Isaac (psachy) 76 98.41 128.40 31 40.79
5350. Bam (phoenixthestral) 76 95.94 118.45 26 34.21
5351. Sergio (perezsergioace) 76 70.15 82.21 22 28.95
5352. Pavan (pa163361) 76 75.67 90.46 43 56.58
5353. Nitro (nitrocrate) 76 95.92 114.08 34 44.74
5354. Nave (naveleon) 76 61.31 81.54 15 19.74
5355. Mr.chops (mr_chops) 76 90.67 104.21 26 34.21
5356. Mohamed Emara (mohamed_emara) 76 47.12 59.99 7 9.21
5357. alex (mimzy1995ns) 76 78.22 95.37 20 26.32
5358. Anthony (mike916) 76 93.32 112.55 37 48.68
5359. Saurav (sauravdeore) 75 88.01 103.92 22 29.33
5360. 2fast4u (russell12345) 75 108.62 134.93 36 48.00
5361. Lloyd (rketch) 75 78.55 93.07 18 24.00
5362. Pranav (pranavsetpal) 75 60.68 82.66 11 14.67
5363. potato (potato42069) 75 101.81 132.72 46 61.33
5364. platno (platno) 75 101.90 116.72 33 44.00
5365. Plague (plaguey) 75 81.03 95.88 10 13.33
5366. nizam (nizamovicxi) 75 84.78 103.27 19 25.33
5367. nart (nartyaltchin) 75 65.06 81.93 17 22.67
5368. Nada (nadazz9) 75 31.75 39.33 6 8.00
5369. Michael (mscott3) 75 112.82 137.34 30 40.00
5370. Mostafa (moghorab) 75 41.44 54.20 10 13.33
5371. Miles (miles223) 75 153.98 185.62 62 82.67
5372. andy (andytixn) 75 146.44 194.75 55 73.33
5373. A.B.G (ahmed_burham_pro) 75 67.42 79.63 12 16.00
5374. 3ymsdet (3ymsdet) 75 121.82 160.85 54 72.00
5375. flaneur (flaneurnq) 75 171.49 203.98 71 94.67
5376. Henry (flamekata24) 75 90.78 109.08 33 44.00
5377. Seilacara (eunaosei) 75 65.38 80.23 19 25.33
5378. Rohan (dragami) 75 75.39 110.37 20 26.67
5379. Igor (disstream2) 75 63.29 72.84 16 21.33
5380. Chris (chrisjordan23) 75 82.01 102.30 22 29.33
5381. Chizi (chiziivictor) 75 51.48 61.42 10 13.33
5382. Mort (captain_fredrickson) 75 72.84 88.77 12 16.00
5383. not your dad (buthee) 75 115.38 139.38 44 58.67
5384. GabWasTaken (bored_dude) 75 66.81 89.49 10 13.33
5385. beta (betameta123) 75 89.69 106.47 19 25.33
5386. Edward (batskater1234) 75 87.84 135.94 20 26.67
5387. Kei (aznkei) 75 75.34 90.66 17 22.67
5388. 8N (_8n_) 75 57.11 75.12 14 18.67
5389. Yanterko (yanterko) 75 93.68 112.05 32 42.67
5390. Tyler (xtios) 75 111.04 130.89 36 48.00
5391. Fábio (vallkorion) 75 63.06 74.29 17 22.67
5392. Kris (tymptra) 75 60.80 73.49 14 18.67
5393. Test Project 3 (turkishtyper) 75 77.49 101.79 5 6.67
5394. Motch (treemes) 75 73.67 89.76 16 21.33
5395. Tomaz (tomaz1502) 75 92.23 108.57 25 33.33
5396. Tawalisi (tawalisi_1500) 75 76.81 92.68 18 24.00
5397. Korey (serveo21) 75 61.06 75.04 15 20.00
5398. Kiryu (kiryugozi) 75 75.11 105.19 18 24.00
5399. Khoa (khoadeptrai111) 75 78.49 113.93 21 28.00
5400. JRT (jrt829) 75 75.49 87.67 15 20.00
5401. poemich (jerkyice) 75 73.69 87.59 28 37.33
5402. Lasse (imlasse) 75 82.26 100.42 20 26.67
5403. Mohsin Ali (gillbest) 75 42.23 51.00 8 10.67
5404. Lukas (lukasprestonchow) 74 79.98 108.37 32 43.24
5405. amanogawa (lhykv) 74 151.47 186.27 60 81.08
5406. ok (laggyfeetshake123) 74 133.01 161.00 49 66.22
5407. blair:) (labercrombie36) 74 110.55 132.20 38 51.35
5408. kyoppiy (kyoppiy) 74 42.58 56.90 3 4.05
5409. mohamed (karray) 74 45.64 57.65 4 5.41
5410. silver_soul (jooeeee) 74 80.85 105.61 18 24.32
5411. Binly (inahee) 74 53.72 66.76 11 14.86
5412. Bhavya (iconic_typer) 74 57.67 69.49 7 9.46
5413. HHpotatoes (hhpotatoes) 74 80.79 101.88 17 22.97
5414. Miika (hakkerijehu) 74 69.93 85.10 15 20.27
5415. Foren (foren) 74 50.32 67.71 14 18.92
5416. Experiment 626 (eee01) 74 93.31 115.46 32 43.24
5417. Jack (ditabyte) 74 66.23 87.38 17 22.97
5418. 🥺👉👈 (daddy_mememas... 74 73.61 93.12 18 24.32
5419. Aidan (coconutwaffle) 74 74.69 93.12 21 28.38
5420. Maddie (ciderto) 74 89.39 121.19 23 31.08
5421. CurryAbalone (careycai) 74 86.64 124.36 27 36.49
5422. Bleu (bleublix) 74 73.19 88.78 20 27.03
5423. Bachiri (bachiri) 74 83.03 95.29 15 20.27
5424. Aaron (ayeayeron) 74 59.28 72.33 20 27.03
5425. Ashton (ashtonnothsa) 74 31.29 43.04 7 9.46
5426. Aryan (aryan7_king) 74 48.89 66.04 5 6.76
5427. Aryaman (aryaman04) 74 86.96 111.64 25 33.78
5428. sAnideos (sanideos) 74 81.51 97.78 15 20.27
5429. Saket (saketraj) 74 62.68 74.42 10 13.51
5430. Lettuce (rolesg) 74 88.56 133.31 25 33.78
5431. reall (reall) 74 81.88 97.36 21 28.38
5432. Quinten (qspuijman) 74 86.92 102.82 27 36.49
5433. Prathamesh (prathamesh0927) 74 60.78 78.34 10 13.51
5434. payn (paynnn_) 74 102.70 123.30 32 43.24
5435. Oscar (oscrrmrz) 74 66.64 105.52 18 24.32
5436. Mr. Fancy (mr_fancy77) 74 70.48 90.22 18 24.32
5437. PR (mrprx) 74 93.98 114.03 25 33.78
5438. Johny (mijq) 74 42.29 51.10 7 9.46
5439. Ahead (ahadwhat) 74 74.03 100.10 41 55.41
5440. Adrian (adrian_himself) 74 53.45 67.49 9 12.16
5441. aditya (adityaraj322) 74 54.15 69.19 13 17.57
5442. Abhishek (abhichauhan) 74 41.95 57.20 4 5.41
5443. aawan (aawan_viator) 74 56.05 66.59 11 14.86
5444. asdasdf (211bazooka) 74 99.78 122.23 27 36.49
5445. Mario (mariobeh) 74 52.39 71.39 6 8.11
5446. Benjamin (benjikrafter) 74 62.00 73.43 11 14.86
5447. Farrux (farruxprogg) 74 25.84 34.61 19 25.68
5448. Musa (jaydeep712) 74 74.84 85.62 20 27.03
5449. Ywq06 (ywq06) 74 93.88 122.54 26 35.14
5450. mateo (yaboimateo) 74 86.86 115.01 23 31.08
5451. Arnav (variable_seal) 74 51.00 71.05 7 9.46
5452. Nonthapat (uniq0rn) 74 48.65 60.52 6 8.11
5453. Totally Not A Cat (totallyn... 74 56.55 71.88 15 20.27
5454. Tormod (tormodfh) 74 44.98 57.24 5 6.76
5455. Toonafisch (toonafisch) 74 75.04 94.90 19 25.68
5456. van (toofasthoot) 74 86.83 103.87 13 17.57
5457. Rishabh (thomasshellby) 74 76.88 96.49 19 25.68
5458. samongcs (thesamuelong10) 74 61.88 74.72 16 21.62
5459. Tenzin (tenzinfrost) 74 40.17 54.77 6 8.11
5460. Stonebreaker (stonebreaker) 74 36.78 48.77 6 8.11
5461. u (stirlo21) 74 77.95 90.01 8 10.81
5462. Nate (somemoresmors) 74 82.96 106.63 20 27.03
5463. Sebastian (shrekbastian) 74 80.90 100.80 33 44.59
5464. veer pratap singh (_veerpra... 73 45.82 56.22 28 38.36
5465. Richard (zzzcha10) 73 107.46 128.12 38 52.05
5466. Sour (yung246) 73 59.07 70.00 12 16.44
5467. yes (yesmaybeno) 73 99.02 123.37 42 57.53
5468. Yeraly (yeraly_) 73 66.74 86.94 15 20.55
5469. Winter (winter_dawn) 73 95.94 116.60 27 36.99
5470. Malcolm (weatherman7921) 73 66.92 81.16 12 16.44
5471. Steven (vivihuang) 73 89.41 118.28 22 30.14
5472. tstats[typingsid02] (typing... 73 67.46 80.59 14 19.18
5473. Oliver (typer2947) 73 50.23 64.61 6 8.22
5474. Alex (truxior) 73 91.04 108.33 23 31.51
5475. snow leopard (truechaos) 73 120.15 157.43 39 53.42
5476. Kyozō (thegiantchip) 73 96.65 118.76 36 49.32
5477. terrace (terrace2fast) 73 121.56 169.58 35 47.95
5478. Taeyang (taeta3) 73 84.37 107.41 16 21.92
5479. Sam (samtsullivan) 73 121.17 149.61 31 42.47
5480. ROWLAND (rownet) 73 62.33 76.25 14 19.18
5481. Wayne (retroweezy) 73 87.83 105.91 29 39.73
5482. Rigno (redbubba) 73 118.44 144.70 37 50.68
5483. anntz (reaction__) 73 86.89 108.05 26 35.62
5484. skull issues (psychic7195) 73 102.66 133.30 62 84.93
5485. peaNUTS (prabeshdai) 73 64.18 80.00 15 20.55
5486. Paul (pkanas) 73 113.76 150.25 40 54.79
5487. Peshraw-Kurdi (peshraw) 73 59.24 76.67 12 16.44
5488. paveN (paven_) 73 59.13 73.67 15 20.55
5489. pasha (pasha8800) 73 61.55 74.60 25 34.25
5490. Ryan (nuigit) 73 99.11 134.57 31 42.47
5491. Nadarsha (nadarsha) 73 21.24 29.83 23 31.51
5492. musratte (musratte) 73 81.89 100.11 21 28.77
5493. Never :q! (mista_t) 73 58.06 77.11 12 16.44
5494. Madhvendra (madhvendra) 73 21.27 37.14 23 31.51
5495. Loege (loege) 73 97.35 120.44 28 38.36
5496. Lime (lizzardwizzard) 73 37.75 46.17 3 4.11
5497. leodelfo (leodelfo) 73 95.65 114.47 27 36.99
5498. Torrey (lavamob64) 73 100.17 123.80 35 47.95
5499. KilinWei (kilinwei) 73 62.39 74.09 19 26.03
5500. Kelly (kellyqin) 73 34.79 44.29 2 2.74
5501. Kapi (kapi_boi) 73 58.57 79.33 13 17.81
5502. Jerome (jerome_ctq) 73 86.63 106.52 11 15.07
5503. Jerome (jeromesiu1210) 73 90.30 105.30 26 35.62
5504. Arr (htunkyaw) 73 84.77 107.43 17 23.29
5505. Grenek (grenek) 73 102.40 122.27 30 41.10
5506. Duffy (duffylam) 73 40.95 55.51 5 6.85
5507. Booba (drakonsio) 73 94.69 115.66 22 30.14
5508. noise (dp123) 73 134.48 177.15 52 71.23
5509. davidpasion (davidpasion) 73 93.27 107.88 27 36.99
5510. Darrin (darrinj) 73 68.89 84.45 24 32.88
5511. Daniel (dark0nee) 73 84.09 96.25 20 27.40
5512. veenu (comp_typist) 73 69.86 88.61 17 23.29
5513. Anuj (coder05) 73 92.36 112.89 32 43.84
5514. Chester (chesterization) 73 71.26 82.53 12 16.44
5515. Erica (canadianhuman) 73 69.29 85.44 16 21.92
5516. tehfu (brownmilk) 73 92.28 115.78 28 38.36
5517. Anthlone (blakley) 73 93.12 115.71 24 32.88
5518. Aidan (b8its) 73 93.70 107.94 22 30.14
5519. austirol (austirol) 73 20.17 33.25 11 15.07
5520. Austin (austinmarton) 73 101.29 123.85 27 36.99
5521. ang (angelah) 73 94.42 112.37 37 50.68
5522. Adam (adamsawahgamer) 73 76.97 95.48 23 31.51
5523. abh1sh3k (abh1sh3k) 73 81.43 96.30 41 56.16
5524. don (psyfer_69) 73 72.14 92.25 14 19.18
5525. Wallace (timmaddog) 73 94.23 112.96 18 24.66
5526. Ulrich (ulrichji) 73 82.57 98.87 24 32.88
5527. joygerry (joygerry) 73 76.95 96.31 18 24.66
5528. Annwesha (annwesha) 72 56.09 66.98 8 11.11
5529. Aidan (amess92304) 72 63.23 77.48 18 25.00
5530. JD (ahiajd) 72 75.91 90.58 12 16.67
5531. Advith (advithshetty02) 72 78.33 98.03 19 26.39
5532. AsiaSeries (adeepra) 72 65.81 75.63 19 26.39
5533. Abhijeet (abhibaj007) 72 41.88 48.83 7 9.72
5534. jojojo (astrot) 72 30.69 38.79 5 6.94
5535. Chris (lumms) 72 86.46 116.02 28 38.89
5536. derrick (lewi0332) 72 49.66 64.55 4 5.56
5537. LEANG (leangsy22) 72 34.43 42.22 5 6.94
5538. Marcellus (krouthen) 72 103.15 135.31 24 33.33
5539. k1suxu (k1suxu) 72 69.56 82.14 14 19.44
5540. josh (jshg) 72 102.06 127.78 24 33.33
5541. GreatKing (greatking) 72 104.54 120.48 31 43.06
5542. Goldenpigg (goldenpigg123) 72 90.55 120.13 25 34.72
5543. gegs921 (gegs921) 72 106.65 129.69 30 41.67
5544. dayman (gangbeast_21) 72 73.47 99.43 19 26.39
5545. Darren (zincj) 72 43.14 76.38 7 9.72
5546. The Hunter (the_hunter_) 72 86.25 104.30 28 38.89
5547. Kenneth (thedas) 72 88.23 109.79 25 34.72
5548. Daniel (swietlikkielce) 72 62.18 84.78 15 20.83
5549. travman (sunshinemamba) 72 71.85 91.04 16 22.22
5550. Saurav (saurav555) 72 61.95 86.03 16 22.22
5551. Sanjeevwa (sanjeevwa) 72 79.74 96.38 20 27.78
5552. Sheldon (rooksword3393) 72 88.01 106.47 15 20.83
5553. Raakulan (raakulan_94) 72 46.15 55.56 6 8.33
5554. Pineapple (pineapple_pie1) 72 77.12 95.82 20 27.78
5555. Alvaro (patomalo) 72 49.99 64.65 8 11.11
5556. Nils (nosta_06) 72 82.21 101.43 25 34.72
5557. nishi (nishi_san) 72 67.07 80.80 16 22.22
5558. Toan (nguoichuadangki) 72 68.66 90.40 32 44.44
5559. nexro (nexro44) 72 99.13 114.57 32 44.44
5560. Melwan (melwan) 72 43.98 55.31 3 4.17
5561. FROST (frostxdemons) 72 77.56 95.16 26 36.11
5562. Faiq (faiq57) 72 83.40 101.80 28 38.89
5563. Noah (excell) 72 85.16 107.70 21 29.17
5564. Emily (ellajournal13) 72 86.60 104.45 16 22.22
5565. Ekezuke (ekezuke) 72 59.71 77.24 19 26.39
5566. Hernan (edry12) 72 53.36 72.58 15 20.83
5567. Selyaka (ddamyanov) 72 72.09 93.35 29 40.28
5568. Dario (dariovondrasek) 72 46.61 57.65 9 12.50
5569. cvs (cvs_pharmacy) 72 110.51 143.33 32 44.44
5570. Chris (cascade_) 72 75.03 95.11 14 19.44
5571. Bouba (breadbake) 72 107.82 124.47 39 54.17
5572. JC (bid4peace) 72 58.37 72.69 12 16.67
5573. barmijo (barmijo) 72 69.68 92.64 17 23.61
5574. Cameron (ballsinyourface) 72 82.37 109.35 19 26.39
5575. Alex (ask496) 72 111.56 126.42 30 41.67
5576. Asier (asierart) 72 69.38 93.17 24 33.33
5577. Reynol (arsen714) 72 78.45 103.03 13 18.06
5578. Danny (flowburst) 71 121.61 153.26 42 59.15
5579. Jacob (emptypaintbrush) 71 80.91 105.37 27 38.03
5580. Alcolopa (emilioelmurr) 71 69.27 92.64 13 18.31
5581. ㋡㋛☹ (chzeeshan) 71 88.99 104.67 29 40.85
5582. Xuanming (caoxuanming) 71 49.19 58.45 8 11.27
5583. Fabijan (bifazg) 71 109.33 132.81 38 53.52
5584. Brandon (bgrospe) 71 102.70 128.55 35 49.30
5585. Garett (assaulted) 71 117.46 140.33 39 54.93
5586. F (_ft__) 71 66.60 88.11 19 26.76
5587. har (zsbzsb) 71 86.44 106.76 26 36.62
5588. Bartek (undg) 71 55.00 69.51 17 23.94
5589. Tunmsie (tunmi_dev) 71 87.84 104.96 26 36.62
5590. Sebastian (tulanir) 71 99.83 122.67 30 42.25
5591. Johan (treeff) 71 92.77 119.30 21 29.58
5592. Sudipta Sarkar (sudipta276) 71 42.38 49.73 7 9.86
5593. Arthur (squekk) 71 39.70 50.47 28 39.44
5594. sonny (sonnysixteen) 71 89.17 111.28 27 38.03
5595. Md. Shafiul Islam (sohan110... 71 42.47 53.53 6 8.45
5596. Slice Dice (slicedice) 71 56.20 71.87 10 14.08
5597. Shahana (shahanas) 71 83.42 102.21 21 29.58
5598. R (sevenexpert) 71 86.35 99.99 26 36.62
5599. sedate (sedatekitten) 71 96.05 135.10 27 38.03
5600. Med Amine (med_amine) 71 42.87 55.92 9 12.68
5601. Mr (luke44661) 71 52.33 64.36 5 7.04
5602. Locomotion22 (locomotion22) 71 62.16 85.55 16 22.54
5603. Maserati (latitude_5a) 71 63.18 77.28 13 18.31
5604. Ashish (landxcape) 71 53.39 63.98 5 7.04
5605. Kolock (kolock) 71 100.19 123.92 28 39.44
5606. Homie (kingtrammy) 71 90.48 119.57 25 35.21
5607. Juan (juan_mo) 71 67.85 88.99 12 16.90
5608. Jessica (jesshe183) 71 86.09 102.41 12 16.90
5609. Jacob (jacobr2d3) 71 75.19 98.05 24 33.80
5610. imbad (imbad789) 71 97.49 129.84 19 26.76
5611. Helmi Abdul (helmiabdul) 71 71.47 80.29 15 21.13
5612. Ujjwal (half_blooded) 71 57.60 69.28 6 8.45
5613. BlueCar (greencar) 71 59.09 72.07 10 14.08
5614. fruitsauce (ghostspirit) 71 94.28 115.85 28 39.44
5615. G (gc3shadow) 71 101.39 126.70 38 53.52
5616. Hossen (galacticcheese1) 71 96.88 119.16 25 35.21
5617. Vedica (gairolavedica) 71 34.44 45.21 9 12.68
5618. Ravenwolf (rvenwolf) 71 84.21 101.37 22 30.99
5619. Empio (ppdodoqqq) 71 39.68 50.24 12 16.90
5620. Ponymouse (ponymous) 71 96.50 129.56 33 46.48
5621. Nail (nailail) 71 34.27 42.62 3 4.23
5622. Noah Ignacio (nachos_7575) 71 71.31 83.47 14 19.72
5623. Lutfullokh (mirzaqosimov) 71 50.58 65.36 9 12.68
5624. Md. (ranoy) 70 25.45 38.87 14 20.00
5625. Paolo (powlu) 70 76.00 95.56 23 32.86
5626. Nik (nik_farhan) 70 77.75 109.32 21 30.00
5627. Nikolino (nikolinolive) 70 65.62 84.29 40 57.14
5628. lolow (neworange999) 70 101.69 129.58 32 45.71
5629. Myka (mosin_warrior) 70 60.65 73.74 9 12.86
5630. Kevin (moffitt) 70 151.74 173.14 61 87.14
5631. mike (mikehawk12345) 70 96.50 129.78 29 41.43
5632. 5k m1chael (mihai03) 70 94.36 110.00 21 30.00
5633. mitchell (miceol) 70 76.47 105.71 9 12.86
5634. Aniket (aniket_pithadia) 70 58.35 78.86 12 17.14
5635. megatron (ahnomi) 70 68.18 83.66 18 25.71
5636. Adil (adika_r) 70 71.03 83.63 22 31.43
5637. Sanic (192378) 70 97.11 116.77 27 38.57
5638. Jakub (jakubuwu) 70 49.94 63.30 9 12.86
5639. FAITH (fjoel) 70 30.05 45.41 10 14.29
5640. Farid (faridmusayev) 70 87.75 118.17 24 34.29
5641. Evangelos (es305) 70 85.66 110.82 26 37.14
5642. erakai (erakai) 70 140.34 171.34 48 68.57
5643. EG (eg_immortal) 70 43.21 59.90 18 25.71
5644. Eli (eberger03) 70 87.53 110.01 23 32.86
5645. Charles (doubleqin) 70 122.60 145.35 40 57.14
5646. poop (dompozo) 70 66.84 88.05 23 32.86
5647. Charles (charles_good) 70 79.81 92.43 21 30.00
5648. Hadi (charaka) 70 95.95 117.81 25 35.71
5649. napkin (call_me_napkin) 70 133.51 169.54 41 58.57
5650. Kyle (break_fast) 70 53.21 73.14 9 12.86
5651. duncan (bobby29831) 70 97.78 112.17 26 37.14
5652. AD (blastoise13524) 70 74.13 116.72 26 37.14
5653. Salman (blackstrobe) 70 93.58 112.97 26 37.14
5654. Aryan (aryan_16) 70 63.09 74.93 11 15.71
5655. Arsennn (arsenn) 70 88.72 115.39 19 27.14
5656. Zosia Nicholson (zosianicho... 70 76.85 104.60 11 15.71
5657. Yehezkiel Raymundo (yehezki... 70 106.50 129.36 25 35.71
5658. Kasper (yckf2) 70 124.15 155.13 50 71.43
5659. Salman (xinvoker) 70 82.55 109.90 23 32.86
5660. Wildebeest (wildebeest1) 70 60.56 75.04 7 10.00
5661. Toyota (websitejunkie) 70 116.46 158.88 43 61.43
5662. wade (waderf) 70 39.16 53.37 5 7.14
5663. Abhishek (vbunny) 70 57.64 72.57 11 15.71
5664. Valoix (valoixgaming) 70 68.42 81.02 63 90.00
5665. tserse (tserse) 70 89.60 104.09 14 20.00
5666. tony (tony_starc303) 70 55.99 66.73 9 12.86
5667. TC Stinkey Mouse (thst4483) 70 94.05 119.24 19 27.14
5668. teraah (teraah) 70 99.56 133.44 33 47.14
5669. Md. Tarikul (tarikul_01) 70 60.71 80.32 13 18.57
5670. Bob (sydre2) 70 96.42 113.73 35 50.00
5671. victor (swegboi) 70 128.05 162.64 47 67.14
5672. Stefan (stefradjen) 70 102.22 125.99 37 52.86
5673. Stay (stayscaffolded) 70 98.04 125.17 20 28.57
5674. adil (silawatadil) 70 56.47 72.29 15 21.43
5675. Shuxuan (shuxuan) 70 58.48 75.22 13 18.57
5676. nizika (shouronpou) 70 92.52 118.80 22 31.43
5677. Shaina (shainaziza) 70 73.14 99.61 24 34.29
5678. null (sectest) 70 103.39 115.33 30 42.86
5679. Louis (loucru1) 70 87.47 106.02 21 30.00
5680. tstats[log1xmeister] (log1x... 70 88.80 113.85 26 37.14
5681. Leong (leong_ckai) 70 61.71 76.80 12 17.14
5682. Kimberly (kimboslice16) 70 95.86 120.63 36 51.43
5683. Logi K380 (kedr0n) 70 122.84 144.65 37 52.86
5684. kalisto (kalisto) 70 63.11 76.21 10 14.29
5685. Greatman (jimmy_x) 70 87.06 102.30 16 22.86
5686. kjr (jianrong2004) 70 44.15 53.45 3 4.29
5687. Jav (jav77) 70 71.71 83.14 13 18.57
5688. Jared (jaredblack) 70 98.18 117.10 56 80.00
5689. James (itsbamble) 70 95.60 113.96 25 35.71
5690. ironmk11 (ironmk11) 70 88.36 107.27 21 30.00
5691. Imad (imad_uo) 70 42.83 52.47 6 8.57
5692. Abhas (imabhas) 70 62.09 83.76 11 15.71
5693. hoangnam75 (hoagnnam75) 70 96.03 112.53 26 37.14
5694. . (hanthedude) 70 112.36 129.95 40 57.14
5695. hamza (hamza_8) 70 52.52 63.63 5 7.14
5696. mr.purpose24 (hacker51) 70 72.18 88.66 20 28.57
5697. hrsh (h3rs8) 70 91.03 117.22 20 28.57
5698. John Paulo (guehnwyvar) 70 78.35 97.79 25 35.71
5699. Jerrynick (goldenxbulletz) 70 74.28 98.94 16 22.86
5700. Isaac (ksspook) 69 43.52 62.22 4 5.80
5701. Khenh (khnhnguyen) 69 60.07 93.28 19 27.54
5702. A-Train (k4sh1zy) 69 71.41 88.39 16 23.19
5703. Jimmy (jimmy890302) 69 60.95 74.41 9 13.04
5704. Anon (jeff10) 69 141.02 173.22 63 91.30
5705. Zhamshid (Jam1lbek) (jam1lbek) 69 44.94 61.14 12 17.39
5706. Mio (i_drive_car_lol) 69 69.24 90.62 17 24.64
5707. i'm a band kid (imabandkid) 69 85.55 107.60 41 59.42
5708. Ernst (hopeofmercy) 69 90.24 117.23 27 39.13
5709. Henry (henrybutschool) 69 81.81 97.75 20 28.99
5710. Gidean (gidean) 69 81.97 98.01 15 21.74
5711. Alejandro (foreversick) 69 89.61 110.91 23 33.33
5712. Femke (fffemke) 69 64.68 80.73 19 27.54
5713. dude_BrahMan (dudebrahman) 69 104.05 131.45 36 52.17
5714. Dustin (dsthegold23) 69 95.06 117.12 23 33.33
5715. Nyxious (demonicious) 69 80.35 96.37 22 31.88
5716. Nimble fingers (deadjarus) 69 57.85 71.03 6 8.70
5717. Danny (danny1901) 69 96.26 116.94 29 42.03
5718. D A M A G E D (dama_ged) 69 107.47 129.73 28 40.58
5719. Abdi (bravenoob) 69 60.94 77.62 13 18.84
5720. Astoshan (astoshan) 69 64.17 83.24 17 24.64
5721. Avalanche (arnobel) 69 62.00 70.75 17 24.64
5722. johan (sagapam) 69 52.22 63.49 9 13.04
5723. Tadej (reyalpdab2) 69 116.12 138.26 41 59.42
5724. Renato Emeric (renatoemeric11) 69 63.58 77.77 10 14.49
5725. Ramez (ramezraymond) 69 88.51 104.72 29 42.03
5726. Prince (prince7589) 69 95.80 116.67 34 49.28
5727. Harry (pandasboob) 69 118.28 143.54 34 49.28
5728. T (omega5002) 69 83.84 98.25 19 27.54
5729. Raiden Shogun (ntd_dll) 69 92.14 111.59 23 33.33
5730. Norman (noromoon) 69 68.17 87.48 15 21.74
5731. Naomi (nmb813) 69 49.90 61.75 5 7.25
5732. naganandana (naganandana) 69 71.17 84.93 17 24.64
5733. Yiming (mymreview) 69 69.99 95.75 24 34.78
5734. moon (moon_anna) 69 67.49 84.12 23 33.33
5735. Alazar (mealazar) 69 58.68 74.71 9 13.04
5736. Arka (arkacsedu) 69 73.23 90.46 13 18.84
5737. Riley (amlockedinfridge) 69 93.61 116.41 26 37.68
5738. Akshay (akshaymkupnoor) 69 52.23 63.48 4 5.80
5739. Af (aepaef17) 69 71.18 90.75 18 26.09
5740. 0verhaul (0verhaul) 69 66.99 104.17 17 24.64
5741. Smitesh (smiteshp) 69 70.51 81.67 16 23.19
5742. Jeferson Beliber (jbyungz) 69 81.17 116.12 26 37.68
5743. Victor (dczxao) 69 74.23 91.31 15 21.74
5744. grim (gri16m) 69 89.20 116.34 25 36.23
5745. DKTang (killnoevil) 69 86.53 108.06 20 28.99
5746. Francisco (frantark) 69 45.70 69.46 5 7.25
5747. vakupen (vakupen) 69 42.13 77.56 16 23.19
5748. Aditya (zwelgop) 69 76.45 101.48 18 26.09
5749. Zecro (zecro_48) 69 39.76 53.61 2 2.90
5750. yurii (yurcifer) 69 52.64 67.57 8 11.59
5751. Voak (voak) 69 51.31 65.07 11 15.94
5752. Arief (valliante) 69 88.24 105.53 31 44.93
5753. Mike (tonz30) 69 80.52 96.27 18 26.09
5754. Daniel (throwmycage) 69 54.05 67.60 5 7.25
5755. spetterpoep (spetterpoep) 69 94.36 119.78 26 37.68
5756. Jesse (soval) 69 65.43 87.63 8 11.59
5757. Shynali Otep (shynali) 69 27.58 34.85 10 14.49
5758. Scribbled (scribbled_trashhh) 69 61.15 78.07 9 13.04
5759. Zyad (zyad0magdy) 68 65.20 84.21 15 22.06
5760. F. (yrebainahs) 68 100.42 120.45 28 41.18
5761. Wesley (wesleylong) 68 80.37 101.53 13 19.12
5762. Wael(▀̿Ĺ̯▀̿ ̿) (wa... 68 62.87 83.46 45 66.18
5763. De9mond (uniwite) 68 72.86 87.43 13 19.12
5764. Parminder (trion129) 68 44.66 56.87 5 7.35
5765. stegmarb (stegmarb) 68 68.14 95.63 16 23.53
5766. SlowBoy (slow_boy_neen) 68 86.85 109.35 17 25.00
5767. Sizzled (sizzledbeans) 68 94.92 117.09 25 36.76
5768. Russellazy (russellazy) 68 84.24 111.76 20 29.41
5769. AG (rollingpanda0) 68 68.17 81.99 15 22.06
5770. 🗿 (rjh7) 68 61.86 82.25 11 16.18
5771. Daryoush (rango__nice) 68 18.08 25.70 14 20.59
5772. pri (prinni) 68 93.16 109.50 23 33.82
5773. H J (ojinjin) 68 80.74 99.95 17 25.00
5774. touko.ursin (oikipoiki) 68 62.55 72.85 17 25.00
5775. nwieuv (nwieuv) 68 135.68 162.53 51 75.00
5776. Nischal (nischal165) 68 64.43 76.15 18 26.47
5777. Nahush (nahush28) 68 63.73 79.12 17 25.00
5778. Bob (mrgeeses) 68 90.57 114.59 25 36.76
5779. tstats[mozra3] (mozra3) 68 61.31 79.26 19 27.94
5780. Nic (matcaps) 68 66.93 81.78 16 23.53
5781. A (kmos) 68 94.88 115.53 29 42.65
5782. shaan (khem92) 68 99.45 110.39 26 38.24
5783. Jerome (jerome251998) 68 75.45 93.36 14 20.59
5784. Johnathan (jellyowar308) 68 101.39 122.61 27 39.71
5785. Diego (isqube) 68 73.98 92.41 15 22.06
5786. Ion (incode4it) 68 95.96 133.97 28 41.18
5787. Hunter (hunterwho43) 68 112.33 131.19 31 45.59
5788. Hamada (hamadasalhab) 68 74.31 93.99 17 25.00
5789. SenAlice (gokamiso) 68 73.98 90.14 14 20.59
5790. v (gamegodv) 68 61.31 75.63 18 26.47
5791. mitchell (fool1shdemxn) 68 88.45 109.59 26 38.24
5792. Tobi (fastestflash) 68 108.93 137.98 39 57.35
5793. Eboy (e_nonymous) 68 66.01 84.79 15 22.06
5794. Ethan (ethanchansk) 68 94.74 119.50 28 41.18
5795. Bray (erasleeps) 68 103.98 136.28 34 50.00
5796. elnaz (elnaznsi) 68 54.40 71.98 45 66.18
5797. Naing Htoo Aung (devii92) 68 86.49 103.50 23 33.82
5798. Dark (darkelevent) 68 74.25 91.95 13 19.12
5799. Iemand (darckshy) 68 73.47 89.53 24 35.29
5800. hanno (busterity) 68 77.88 96.33 16 23.53
5801. bouse7th (bouse7th) 68 52.76 62.77 6 8.82
5802. Bonifacijus (bonifacijus) 68 53.37 74.15 6 8.82
5803. hehe (blazeclash) 68 106.08 130.40 29 42.65
5804. Papa (big_papa69) 68 43.54 54.77 7 10.29
5805. Beata (beata111) 68 76.02 96.11 22 32.35
5806. Lane (asdfedffd) 68 93.20 107.08 15 22.06
5807. Andreas (andi_0324) 68 55.94 69.73 8 11.76
5808. ༄༊࿆Faith࿐ (adaling369) 68 85.44 106.26 16 23.53
5809. Ariscottle (ariscottle3106) 67 77.29 103.00 19 28.36
5810. Amr (amr98) 67 53.18 61.40 6 8.96
5811. Nathan (tposetime) 67 61.30 76.64 13 19.40
5812. Chino (stylish1323) 67 65.13 86.43 13 19.40
5813. Aly (aly_hussien) 67 16.13 22.04 9 13.43
5814. kenzar (kenzar) 67 43.27 52.69 3 4.48
5815. Magz (magzse7en) 67 85.49 106.77 25 37.31
5816. I lost (lxtxmx1) 67 80.09 112.37 10 14.93
5817. Ludvig (lochecho) 67 121.93 146.19 45 67.16
5818. Lộc (loccb90) 67 72.62 92.56 15 22.39
5819. Justin (liontan) 67 87.20 104.74 28 41.79
5820. Kicker (kickermasu) 67 73.39 89.17 16 23.88
5821. karimulla (karimulla12) 67 71.05 96.75 18 26.87
5822. jjjjjj (jitu8149) 67 64.64 79.78 20 29.85
5823. Jennie (jeniibearr) 67 112.93 144.88 39 58.21
5824. zxc (idcidcidcidc) 67 68.25 86.89 15 22.39
5825. SCUT-黄光积 (hy_1314) 67 59.53 76.94 5 7.46
5826. hamzah (hamzahzzs) 67 67.55 88.27 17 25.37
5827. Greg (grrg) 67 81.72 97.72 17 25.37
5828. Nawazish (ghostlead420) 67 49.12 65.26 5 7.46
5829. Ren (yirenwang) 67 61.03 80.26 13 19.40
5830. Loading.... (xbooza) 67 78.48 92.17 14 20.90
5831. wobba (wobba) 67 84.00 99.25 21 31.34
5832. Noah (typer_noah) 67 65.90 81.61 13 19.40
5833. suraj giri (surajgirioffl) 67 69.10 79.77 18 26.87
5834. Steven (stuvun) 67 101.55 118.23 35 52.24
5835. Spy (spy71) 67 39.20 90.45 4 5.97
5836. man (speedweeweeman) 67 112.92 139.02 40 59.70
5837. NeverRage (solid_raiden) 67 108.41 129.75 37 55.22
5838. Master (smartax) 67 98.38 123.59 17 25.37
5839. Tom (rubik1908) 67 79.27 103.94 18 26.87
5840. Reto (reddo) 67 85.68 104.21 21 31.34
5841. purple (purplejust) 67 56.37 72.09 17 25.37
5842. Prashant Kumar (prasha3nt) 67 30.95 38.04 5 7.46
5843. Wiphoothorn (poomws) 67 40.64 54.05 5 7.46
5844. Phong (phong1902) 67 71.59 95.44 15 22.39
5845. Dillon (peak3433) 67 83.16 108.36 12 17.91
5846. Paige (patrickwest) 67 67.59 75.71 15 22.39
5847. noob (noahc207) 67 70.18 99.66 15 22.39
5848. Jeff (navigation07) 67 67.89 84.05 14 20.90
5849. mahmoud (modokatr) 67 51.00 66.27 3 4.48
5850. Mateusz (matswiatek) 67 42.99 54.32 1 1.49
5851. Marni (marniparnie) 67 44.41 60.24 5 7.46
5852. Fedor (fshabashev) 67 90.14 103.07 17 25.37
5853. Flash (flashyflashy) 67 127.18 146.45 45 67.16
5854. filip (filko) 67 38.99 49.03 9 13.43
5855. Machmori (explainingkamui) 67 65.78 80.63 16 23.88
5856. Evelyn (evelynji) 67 77.09 92.55 20 29.85
5857. Jen (ethima) 67 110.79 132.29 33 49.25
5858. duckyful (duckydatyper) 67 74.24 103.99 9 13.43
5859. Drakka (drakkathedark) 67 68.15 85.17 18 26.87
5860. Diya (dmatulizo13) 67 56.89 75.19 15 22.39
5861. Anurag (debroglie) 67 55.53 70.62 15 22.39
5862. coolzacboy (coolzacboy) 67 97.47 116.83 23 34.33
5863. Chris (bunkieme) 67 127.90 155.44 47 70.15
5864. Brian (briansu) 67 87.03 112.70 14 20.90
5865. Brendan (brenakin) 67 83.71 104.98 23 34.33
5866. Brandon (bqn0309) 67 98.95 131.40 23 34.33
5867. Hans (b3n1s) 67 78.65 99.20 13 19.40
5868. tstats[azhy_01] (azhy_01) 67 82.38 98.71 25 37.31
5869. Bettina (awkventurer) 67 123.78 194.62 45 67.16
5870. Frosty_Speed (frosty_s_speed) 66 51.92 79.48 9 13.64
5871. jon (fishy159) 66 66.50 79.64 16 24.24
5872. FatherWood (fatherwood) 66 69.71 84.23 16 24.24
5873. Ethan (ethfer_77) 66 83.66 100.03 21 31.82
5874. Emanuel (emanuelchristo) 66 67.53 80.57 19 28.79
5875. Mr Plow (el_putino_1917) 66 65.87 84.86 16 24.24
5876. Ellie (ellieoo) 66 89.98 110.30 16 24.24
5877. Azamat (div2der) 66 75.07 98.16 18 27.27
5878. Del (dellieran) 66 81.98 99.02 19 28.79
5879. uko (darjaw) 66 79.79 97.46 29 43.94
5880. (dafler) 66 117.44 135.05 36 54.55
5881. swfan (curleyx) 66 76.31 96.83 20 30.30
5882. soda, pop, tonic ( which on... 66 80.81 99.27 16 24.24
5883. Bob (bobsvegana) 66 54.44 69.12 6 9.09
5884. Ben (benpoopy) 66 71.97 95.15 22 33.33
5885. Ko (__lo) 66 88.21 119.28 23 34.85
5886. Trai (yezurey) 66 38.89 60.11 4 6.06
5887. RyanNXD0120 (xuanduy1269) 66 87.49 109.80 27 40.91
5888. Xassie (xassie) 66 83.82 102.02 24 36.36
5889. Róbert (worder01) 66 78.47 94.60 13 19.70
5890. sam (wongy03) 66 97.33 122.83 40 60.61
5891. Williawar (williawar) 66 86.29 105.63 20 30.30
5892. Wieds (wieds) 66 65.17 80.83 16 24.24
5893. Vinayak (vinayak_7989) 66 65.61 87.99 21 31.82
5894. . (vectorale) 66 108.10 136.54 26 39.39
5895. None (v8_eatr) 66 67.51 81.96 22 33.33
5896. rahul (typer_typer) 66 37.56 45.85 9 13.64
5897. Rod (twors_colemak) 66 109.81 133.80 31 46.97
5898. Nathanael (tunahead) 66 102.94 121.45 37 56.06
5899. Wilson (tigermatos) 66 60.90 74.58 12 18.18
5900. Lewis (the_mysterium) 66 55.98 69.81 12 18.18
5901. Slamsal (slamsal) 66 74.14 92.06 27 40.91
5902. Amanda (simplesecretsauce) 66 88.07 107.94 18 27.27
5903. Luka (sercasm) 66 117.68 136.84 43 65.15
5904. Nic (scylla1) 66 104.88 129.69 30 45.45
5905. Satwik Kashyap (annhilat0r) 66 63.49 79.64 10 15.15
5906. Alexei (alexiedad) 66 85.37 109.09 13 19.70
5907. Aidar (aidar13) 66 55.43 69.99 10 15.15
5908. tamara (tyche1997) 66 39.16 52.32 4 6.06
5909. Kvothe (relarkvothe) 66 83.94 98.04 18 27.27
5910. Napasin (triplesic) 66 67.03 81.16 12 18.18
5911. speedster11 (tygamer) 66 50.61 62.25 5 7.58
5912. Ellis (sneakee) 66 77.54 93.43 15 22.73
5913. Cadmiium (cadmiium) 66 92.96 118.04 31 46.97
5914. Joe (lanolin211) 66 90.92 120.45 28 42.42
5915. Michael (kimbo1414) 66 79.77 105.45 14 21.21
5916. KetanaBlade (ketanablade) 66 104.57 125.71 9 13.64
5917. Ketan (ketan1314) 66 65.22 82.35 26 39.39
5918. Kenneth (kennethraphael) 66 75.91 94.69 21 31.82
5919. ✨MTH Insane Typer✨ (jos... 66 162.40 201.84 57 86.36
5920. Jordan (jordanlreynolds99) 66 79.24 99.33 23 34.85
5921. Craig (jitterjuicegaming) 66 88.11 104.12 18 27.27
5922. JanTheMan (jan_the_man) 66 56.87 68.25 6 9.09
5923. Marzuq (itsmarzuq) 66 47.82 55.89 3 4.55
5924. Hari (harisund) 66 120.47 164.12 44 66.67
5925. Imnatoshi (hanmayujiro) 66 65.00 78.94 9 13.64
5926. Ahmad (gmg12) 66 86.95 113.26 12 18.18
5927. Lucas (rlnb) 66 40.90 51.73 4 6.06
5928. Pema (rimuru_tempest2004) 66 29.73 39.25 10 15.15
5929. ricko (ricklo7) 66 96.44 123.48 22 33.33
5930. dead account (ribombee) 66 125.53 163.64 25 37.88
5931. Renardo (renarded) 66 145.50 188.54 34 51.52
5932. 9fingerstyle (readjust) 66 105.43 126.68 31 46.97
5933. pylori (pylori) 66 88.10 108.75 24 36.36
5934. Pouf (pouf_1) 66 53.62 67.14 18 27.27
5935. flis (philip29) 66 97.16 124.86 28 42.42
5936. Kajtebolikitica (patrik131) 66 89.25 108.16 21 31.82
5937. Jeremy (orcane) 66 80.80 106.75 15 22.73
5938. Oken (okenthelfocken) 66 63.81 85.41 14 21.21
5939. kostis (oh_yeah_go) 66 49.21 58.90 5 7.58
5940. .¿¿?epzilon?=?¿ (nekokaw... 66 127.74 152.18 49 74.24
5941. Carlos (nearbywaffle) 66 93.70 120.99 22 33.33
5942. Mythrick (mythrick) 66 100.69 122.52 27 40.91
5943. Tortle (megahentai) 66 107.57 126.61 27 40.91
5944. Rodolfo (rojunman) 65 74.89 90.30 20 30.77
5945. RMC (rmcproductions) 65 78.86 92.79 16 24.62
5946. Marc (ratshepard) 65 97.42 119.10 32 49.23
5947. Rahul (rahulburrito) 65 75.46 105.93 13 20.00
5948. Puan (puanpro) 65 63.91 75.39 14 21.54
5949. tommy bhau (pseudonetwork) 65 58.48 74.19 17 26.15
5950. ProRick2358Y (prysp) 65 48.44 61.07 5 7.69
5951. Pauli (pauli___) 65 72.88 92.75 19 29.23
5952. pastarishi (pastarishi) 65 63.59 87.94 21 32.31
5953. nil.rajmane@gmail.com (nila... 65 81.18 106.73 23 35.38
5954. Mai (napping_koala) 65 72.64 87.88 18 27.69
5955. mt005 (mt005) 65 76.65 98.86 15 23.08
5956. Mounir (mounir_typing) 65 42.88 52.12 6 9.23
5957. Miguel (migsarm) 65 79.18 88.43 12 18.46
5958. Michael (meta1) 65 104.94 135.65 28 43.08
5959. Matthew (mattisdabomb77) 65 74.10 92.88 14 21.54
5960. Alo (alooo) 65 48.04 59.26 3 4.62
5961. Akbar (akbarovi) 65 59.08 73.25 8 12.31
5962. Inesh (69420nice) 65 92.70 110.06 21 32.31
5963. Tanya (verko) 65 41.37 51.91 7 10.77
5964. Subhro (subhro_121) 65 54.40 67.73 2 3.08
5965. Ursa (ursagaming) 65 79.29 98.91 23 35.38
5966. Kyle (bloodfall90) 65 75.24 96.59 15 23.08
5967. Derek (frigorific) 65 73.04 93.62 20 30.77
5968. thocky caps (floodvalve) 65 112.24 128.89 32 49.23
5969. Spin (firesquall) 65 90.95 114.81 18 27.69
5970. Zach (encasedthought) 65 90.20 113.76 23 35.38
5971. Yosapol (eji4h) 65 90.74 102.86 16 24.62
5972. John Lizuer (dimasalangchae) 65 59.35 80.66 16 24.62
5973. Deku (dekachu) 65 51.60 66.17 5 7.69
5974. Damos (damos22) 65 51.92 61.68 7 10.77
5975. Colin (cwandell31) 65 81.21 113.46 18 27.69
5976. Todd (cooldude_69) 65 45.16 57.99 3 4.62
5977. Colin (colinn02) 65 97.85 125.06 30 46.15
5978. buruum (buruum) 65 106.34 130.68 36 55.38
5979. Edvinas (bull3tf) 65 121.84 144.56 36 55.38
5980. Ben (bennash13) 65 91.60 114.31 19 29.23
5981. seyyed sina (aseidsina) 65 45.54 55.97 5 7.69
5982. Mrinal (_tt_) 65 82.86 99.48 15 23.08
5983. Anda (_anda_) 65 83.08 104.52 21 32.31
5984. zain (zain_nawaz) 65 57.76 82.48 14 21.54
5985. yashar (yashar1) 65 55.63 67.03 8 12.31
5986. George (wiliu) 65 110.98 161.04 36 55.38
5987. Donee (volts5) 65 82.67 115.86 16 24.62
5988. Chris (tschy) 65 45.52 58.67 5 7.69
5989. Thunderstorm (thunderst0rm27) 65 115.72 137.66 51 78.46
5990. Charlie (swordmole) 65 102.22 116.90 29 44.62
5991. suddernpy (suddernpy) 65 62.43 77.90 20 30.77
5992. Edisa (snoopy34) 65 109.62 129.08 37 56.92
5993. SnakeTwix (snaketwix) 65 90.99 126.35 25 38.46
5994. Shashank (sky08) 65 31.29 46.01 5 7.69
5995. Skiddy (skiddybadoosh) 65 61.42 79.59 10 15.38
5996. Axel (sector7) 65 87.00 108.14 19 29.23
5997. Jui (laboni) 65 39.94 54.88 41 63.08
5998. Max (kinginthenorth78) 65 84.61 99.88 22 33.85
5999. Kiko (kikozz) 65 86.90 109.04 20 30.77
6000. Khusan (khusan) 65 45.76 59.99 12 18.46
6001. Karl (karl_marx_1818) 65 63.46 90.14 14 21.54
6002. Junaid (junaidahmad3) 65 75.54 96.89 9 13.85
6003. Jacob (jmbogo19) 65 67.00 86.37 17 26.15
6004. James (jhoffman1204) 65 95.10 119.43 18 27.69
6005. Daniel (irrrlrvant) 65 114.61 147.10 12 18.46
6006. HenIsTheMan (henry_lim) 65 76.25 88.43 13 20.00
6007. ILoveLofi (ginpaku) 65 71.43 94.39 15 23.08
6008. Gabriel (gabp) 65 85.45 99.62 17 26.15
6009. Trpimira (m15k0) 64 96.85 113.98 28 43.75
6010. Jack (jr9810) 64 95.18 113.88 27 42.19
6011. Steve (jack_of_all_trades) 64 87.70 103.39 23 35.94
6012. Jack (jackmcg27) 64 68.17 83.79 20 31.25
6013. Jun (jacketwithpockets) 64 94.26 126.42 21 32.81
6014. bam (iamsobald) 64 95.75 123.43 24 37.50
6015. Michael (hit2u) 64 103.78 148.42 25 39.06
6016. ▄︻̷̿┻̿═━一 (h... 64 88.47 110.74 26 40.63
6017. Nate (haploeco) 64 59.87 80.29 10 15.63
6018. Cecil (goodie1857) 64 96.79 127.35 46 71.88
6019. Gay (fujikage999) 64 91.52 109.18 31 48.44
6020. Frxntize (frxntize) 64 95.31 131.30 27 42.19
6021. Anton (foroi) 64 48.07 60.56 10 15.63
6022. HayfordHumade (flace) 64 59.99 71.74 13 20.31
6023. eren (erenisdevil) 64 56.38 71.95 9 14.06
6024. Elwin (elwin05) 64 60.90 69.70 14 21.88
6025. Xiaorui (dxr1234) 64 69.31 83.39 14 21.88
6026. Hamza (dribbble) 64 57.48 73.87 18 28.13
6027. Damn (dammmson) 64 85.88 106.04 15 23.44
6028. Ian (copywright) 64 88.88 113.34 20 31.25
6029. Andeh (calluxdapotato) 64 101.63 117.42 27 42.19
6030. Al Jade (c00k1e) 64 85.55 106.05 21 32.81
6031. Joshua (buwan) 64 107.99 128.71 31 48.44
6032. Adril (btsbiot) 64 71.53 99.21 17 26.56
6033. bryan (bryan1111) 64 87.00 122.09 23 35.94
6034. fastboi (boyfast) 64 91.72 110.08 35 54.69
6035. Bob (bobtehguy) 64 118.82 139.20 44 68.75
6036. Jonathan (bobjoni1233) 64 67.72 77.62 12 18.75
6037. BobbyWasabi (bobby_wasabi_) 64 85.23 109.33 18 28.13
6038. tstats[ayush_] (ayush_) 64 81.81 101.69 26 40.63
6039. Attila (attila1) 64 44.52 54.91 5 7.81
6040. Francisco Amat (saryon) 64 76.40 96.96 22 34.38
6041. raim (raimmillion) 64 31.31 41.25 5 7.81
6042. Priyam (priyam_raj) 64 67.94 83.35 14 21.88
6043. Nooyag (priceisright2) 64 108.10 132.53 31 48.44
6044. prgobet (prgobet) 64 75.17 97.38 26 40.63
6045. Persov (persov) 64 93.39 119.57 21 32.81
6046. Ethan (persom_) 64 77.32 97.04 14 21.88
6047. PeriodicHAiL (periodichail) 64 67.55 79.08 17 26.56
6048. Kim (ntk02) 64 73.14 96.18 16 25.00
6049. altaire (notchrubble) 64 101.11 123.13 23 35.94
6050. Mihovil (mladabobica) 64 86.08 106.40 27 42.19
6051. 💉 (milan_) 64 128.05 159.47 45 70.31
6052. Nazar (aimogenius) 64 72.28 91.22 9 14.06
6053. absor (absor) 64 89.26 113.61 24 37.50
6054. Abdou (abdoulabani1) 64 50.78 70.52 5 7.81
6055. Lim (doxel) 64 69.83 92.77 13 20.31
6056. audran bobo (audran_bobo) 64 30.12 41.41 17 26.56
6057. Dummy (resshin11) 64 56.11 72.32 43 67.19
6058. Luna (wrackspurt) 64 66.35 83.24 9 14.06
6059. Shaw (shaw_7) 64 23.26 28.41 11 17.19
6060. balint (bailnt) 64 66.17 78.60 17 26.56
6061. Zuhaer (zaszuhaer) 64 100.38 115.91 22 34.38
6062. Rika (z3us99) 64 83.95 101.85 23 35.94
6063. Virus (virusinmotion) 64 51.15 67.44 11 17.19
6064. ukimub (ukimub) 64 142.68 157.77 44 68.75
6065. Gin (tonic_gin) 64 94.05 113.36 17 26.56
6066. Tam (tam04101993) 64 73.73 93.39 18 28.13
6067. Essy (supersonics123) 64 58.80 77.23 10 15.63
6068. Marshall (stoppednile) 64 94.67 112.85 21 32.81
6069. Aakash (srinivasan41) 64 132.37 167.18 49 76.56
6070. Sophia (sophia_8) 64 74.18 89.24 12 18.75
6071. Shreesh (shreesh_racer) 64 56.22 66.89 9 14.06
6072. Joe (seph_of_joe) 64 126.47 158.93 39 60.94
6073. Everly (scribblenerd) 64 77.69 99.34 18 28.13
6074. Wooloo (_extremely_bored) 63 105.92 127.77 20 31.75
6075. Speed Cola (zdj361) 63 124.04 134.17 30 47.62
6076. yoyojuice (yoyojuice) 63 103.42 146.22 21 33.33
6077. suhai (xxrapidfirexx) 63 78.64 97.00 16 25.40
6078. oldaccforpracticing (xsdream) 63 91.43 123.17 31 49.21
6079. Matthew (wormshurm) 63 80.13 114.31 17 26.98
6080. Wilford (wilfordjason) 63 123.95 149.81 32 50.79
6081. They don't know me son (war... 63 96.55 133.65 30 47.62
6082. Vahan (vaki) 63 25.42 33.91 14 22.22
6083. Tommy (tommy_sylver) 63 69.45 90.32 28 44.44
6084. Thymme (thymme) 63 84.55 108.82 26 41.27
6085. Mark (tehone4u) 63 62.81 81.39 15 23.81
6086. Spencer (spenciepoo) 63 120.14 148.39 39 61.90
6087. 👽 (sofreakingslow) 63 76.22 93.76 16 25.40
6088. Jacob (slashingpuma) 63 97.75 114.51 26 41.27
6089. Alice (shadowsofwaxwingsslain) 63 71.84 88.86 13 20.63
6090. Kawaii (saranghoe) 63 99.90 126.73 28 44.44
6091. Rakesh Singu (rakeshsingu) 63 68.55 99.02 15 23.81
6092. Putrid (putridacid) 63 60.94 80.25 11 17.46
6093. Pierrot (pierrotplays) 63 113.03 132.39 39 61.90
6094. I'm so trash (peepolove) 63 114.94 129.41 28 44.44
6095. Corrupt (onlyicorrupt) 63 68.23 83.74 14 22.22
6096. ༼ つ ◕_◕ ༽つ (nyr... 63 54.34 72.31 12 19.05
6097. No (noman75) 63 89.69 115.98 30 47.62
6098. Neil (neilt_) 63 87.73 103.71 17 26.98
6099. Mohab Tharwat (mohab97) 63 59.68 88.49 15 23.81
6100. max (max2817max) 63 55.76 73.16 6 9.52
6101. Amar (masteramar) 63 43.76 57.07 4 6.35
6102. Marius (mariusniveri) 63 73.88 87.67 12 19.05
6103. Magzhan (mako_siaa) 63 72.34 94.20 20 31.75
6104. Max (mafab1) 63 118.94 148.45 38 60.32
6105. Thang (lhg81hc) 63 72.15 86.11 14 22.22
6106. ktzzzuuuu (ktzzz) 63 53.80 72.69 12 19.05
6107. コタ (kotasucksatyping) 63 69.56 94.61 13 20.63
6108. Kostaice (kostaice) 63 61.01 75.67 6 9.52
6109. john (kingtypemaster) 63 75.21 90.36 31 49.21
6110. Kit (kesuki) 63 125.16 149.89 42 66.67
6111. Mate (hhmate) 63 59.90 74.78 10 15.87
6112. George (gkoubbe) 63 67.65 83.45 19 30.16
6113. FlyAtNight (flyonkeyboard) 63 84.95 101.06 22 34.92
6114. Evan (elin4046) 63 102.48 123.48 22 34.92
6115. D (davmarksman) 63 47.48 57.48 4 6.35
6116. Oleksandr (c_u_b_e) 63 50.04 60.06 5 7.94
6117. Collin (collin_felter) 63 89.40 107.20 19 30.16
6118. i like to type (chuggaaconr... 63 115.80 141.01 37 58.73
6119. Chrollo (chrollo283) 63 63.76 77.11 12 19.05
6120. abhi (cheapcoder) 63 84.36 104.67 21 33.33
6121. Cel (celerity_) 63 68.64 93.52 22 34.92
6122. Danielle (bunelle) 63 44.26 64.37 8 12.70
6123. Joseph (bnnes714) 63 43.16 61.62 7 11.11
6124. Thien Nam Anh (benvu3005) 63 44.66 56.34 3 4.76
6125. Awz. (awzcubensis) 63 49.55 65.54 11 17.46
6126. Arnold (arnoldlek) 63 82.73 103.99 22 34.92
6127. Huang.zy (amwzhenyu) 63 104.58 134.70 28 44.44
6128. Von (vonjorie) 63 66.95 97.32 12 19.05
6129. Hoàng (hoangloverboy) 63 78.46 93.90 11 17.46
6130. Litefeather (litefeather) 63 57.67 69.60 10 15.87
6131. AbsurdlyBlack (absurdlyblack) 63 78.22 108.47 18 28.57
6132. Jennie (jorab) 63 50.23 62.23 7 11.11
6133. Anlun (anlun) 62 77.58 100.03 22 35.48
6134. ali (alimuhammadi) 62 38.52 56.60 1 1.61
6135. Ahmed (ahmekal) 62 71.22 84.14 13 20.97
6136. adugna (adex_22) 62 73.62 99.67 17 27.42
6137. Adam (abrokke) 62 77.39 98.47 12 19.35
6138. Abdallah (abdallah1) 62 72.21 83.46 13 20.97
6139. Kobe (kobeelijah111) 62 86.50 112.54 19 30.65
6140. Brandon (thewinterdonut) 62 70.86 93.02 25 40.32
6141. Ali (iliyati) 62 65.44 77.46 12 19.35
6142. Charles (charleswongnt) 62 82.45 108.18 19 30.65
6143. A (axenaxii) 62 59.40 70.03 18 29.03
6144. Lūkass (lukasslv) 62 76.48 100.84 14 22.58
6145. Robert (lekia) 62 51.02 64.11 8 12.90
6146. I×Blazar×I (lblazarl) 62 110.71 134.43 38 61.29
6147. kabbo (kabbo25) 62 70.96 99.11 17 27.42
6148. Youssef (jo1999) 62 84.65 99.36 15 24.19
6149. N (jaripozz) 62 81.90 94.87 19 30.65
6150. James (james702) 62 105.20 129.72 23 37.10
6151. Cameron (iliveinabox117) 62 63.64 81.42 9 14.52
6152. Gemma (gemmaaa) 62 70.60 91.83 17 27.42
6153. Zor (zor365) 62 44.10 52.23 6 9.68
6154. Daniel (zdaniel02_) 62 97.98 115.77 25 40.32
6155. Xyexs (xyexs) 62 87.05 105.23 16 25.81
6156. warm (warmthunder51) 62 68.50 88.67 15 24.19
6157. turgz (turgz) 62 91.46 112.05 20 32.26
6158. Wyman (speedy_boi420) 62 96.85 121.49 25 40.32
6159. Jawad (sixtysicks66) 62 54.33 70.75 16 25.81
6160. jm (sirpricebeach) 62 89.86 108.54 25 40.32
6161. Siddhartha (sid_tiw) 62 99.48 120.07 31 50.00
6162. alaa (salaa) 62 66.16 75.03 9 14.52
6163. Rokas (rokasa369) 62 87.82 106.82 25 40.32
6164. Redwan (redwan_360) 62 65.55 82.39 15 24.19
6165. jungle_cruser (redscorn) 62 62.25 71.72 9 14.52
6166. Jesus_thankyou (rahul_3515) 62 42.16 55.08 6 9.68
6167. Rabber (polrabber) 62 65.43 85.79 15 24.19
6168. Brendan (panikooooos) 62 121.50 148.43 33 53.23
6169. Oleg (oleg27) 62 90.96 109.84 22 35.48
6170. Nigel (nigeljames) 62 54.32 75.40 9 14.52
6171. ✔️▄◘🚀!new_luca@y... 62 108.16 134.95 32 51.61
6172. Steven (nerobot) 62 67.30 84.68 9 14.52
6173. Neeecu (neeecu) 62 72.43 90.15 14 22.58
6174. Nathan (nat179) 62 81.96 107.05 55 88.71
6175. (narzzz) 62 79.91 102.99 14 22.58
6176. typeracist (moron212) 62 124.04 149.22 41 66.13
6177. Joseph (meshram2001) 62 97.63 118.48 24 38.71
6178. Faisal (md_faisal) 62 63.68 83.04 20 32.26
6179. Márton (marcityperacer) 62 63.13 78.57 18 29.03
6180. 3ntr0py (fr3udian) 62 95.86 112.32 20 32.26
6181. Africa (ethiopian1252) 62 53.09 67.45 6 9.68
6182. Joel (easynoob) 62 105.29 124.13 22 35.48
6183. Dusan (dusanmilic95) 62 91.86 113.39 24 38.71
6184. Luis (duelistone) 62 104.32 122.92 31 50.00
6185. Biggus (drthunderface) 62 103.34 120.55 35 56.45
6186. jerk (doofenshmirtzevil_inc) 62 59.69 71.50 16 25.81
6187. Jay (dj_jay) 62 63.68 79.34 7 11.29
6188. Brian (desbrigs) 62 77.00 97.29 12 19.35
6189. dafiyoung (dafiyoung) 62 63.71 78.24 14 22.58
6190. Penguino (cspenguino) 62 147.26 168.97 50 80.65
6191. Copernicus (copernicsus) 62 81.09 112.51 22 35.48
6192. Bryce (brycetifer) 62 86.97 120.45 20 32.26
6193. BOBBY (bobbyquinn23) 62 51.41 68.45 6 9.68
6194. Blitz Anschlag (blitzanschlag) 62 62.46 79.08 12 19.35
6195. Alan (bl4n) 62 72.59 90.70 12 19.35
6196. Sumit Prasad (beyonderr) 62 86.93 102.81 27 43.55
6197. Bal (belgianwaffle) 62 115.69 144.43 35 56.45
6198. (atypicaltypist) 62 117.21 152.11 34 54.84
6199. ATHARVA (atharva07) 62 55.75 65.99 7 11.29
6200. Aries Vince (arvj9) 62 68.19 95.23 18 29.03
6201. FlameFrost (flamefrost) 61 90.39 112.56 26 42.62
6202. emily (em0p6) 61 45.46 57.24 31 50.82
6203. ekoadipg (ekoadipg) 61 106.51 135.01 23 37.70
6204. Tomaz (dragart) 61 61.21 70.29 12 19.67
6205. Tapioca (davidararipe) 61 75.58 93.62 19 31.15
6206. Darren (darrentheboi) 61 106.21 130.61 24 39.34
6207. Chloe (c_stvr) 61 89.73 111.60 26 42.62
6208. Nicholas (creamycarrots) 61 113.55 139.24 35 57.38
6209. Cowlor (cowlortyper1) 61 98.81 123.46 26 42.62
6210. Gabs (coolkidswag) 61 96.90 121.66 15 24.59
6211. Bruh (chesswithmath) 61 94.40 126.73 27 44.26
6212. UReal (chc39615) 61 83.49 100.80 15 24.59
6213. Audrey (catholicguilt) 61 80.55 102.84 17 27.87
6214. Brent (brvnt) 61 84.91 103.09 20 32.79
6215. arno (boxhill) 61 107.64 138.59 33 54.10
6216. blood (bloodripper) 61 26.19 33.65 8 13.11
6217. Nathan (axewtypes) 61 88.42 116.24 25 40.98
6218. Matthias (_matthias_) 61 65.42 83.54 15 24.59
6219. Marcus (_flipz) 61 89.89 101.95 13 21.31
6220. Tamerlan (zhanglet) 61 56.33 71.36 10 16.39
6221. Jan (zeekat) 61 87.51 118.47 16 26.23
6222. Mustakim (winterflew) 61 72.44 91.63 20 32.79
6223. Alex (wakeful_celery) 61 68.91 87.98 10 16.39
6224. oldweeb (uchiha_obito) 61 89.88 106.16 33 54.10
6225. E (typemctypeface) 61 100.13 118.95 20 32.79
6226. Jarrett (typeguy14) 61 75.85 93.35 24 39.34
6227. tylerthsss (tylerths) 61 112.23 131.21 28 45.90
6228. Tran (ttphu28) 61 42.37 51.99 5 8.20
6229. 🐵🙈🙉🙊🐒🦍... 61 117.27 151.95 33 54.10
6230. Tashrif (tashrif_shahriar) 61 89.68 109.09 24 39.34
6231. shivam (svmyadav) 61 72.09 85.85 9 14.75
6232. Chapri 👛👛 (sunilswain) 61 60.79 85.74 13 21.31
6233. Brayan (sneymo) 61 52.69 71.24 6 9.84
6234. Krishna (shinigami00) 61 64.40 79.03 18 29.51
6235. mariah (serialfriend) 61 98.94 124.75 21 34.43
6236. Andrew (andrewwin2003) 61 75.02 94.54 16 26.23
6237. Ahmed (ahmedhallool) 61 48.24 57.93 5 8.20
6238. Parsa (5barsa5seconds) 61 91.21 110.73 21 34.43
6239. Nadiah (naddyhere) 61 75.09 90.01 22 36.07
6240. Nurs (nurs_sarsenov) 61 65.40 79.90 22 36.07
6241. zeno (zeno_sama) 61 36.25 47.63 13 21.31
6242. Destroyer (destroyer101) 61 41.26 69.22 2 3.28
6243. Leukino (leukino) 61 92.91 127.78 20 32.79
6244. kunal (kunaldongre) 61 78.43 96.99 15 24.59
6245. Jethro (jethrofort) 61 76.51 101.59 20 32.79
6246. Jenna (jennafer323) 61 72.83 106.88 16 26.23
6247. Jainam (jainam123) 61 63.29 71.55 13 21.31
6248. Hrant (hrant0) 61 78.98 92.64 16 26.23
6249. SalmanMKC (hellothen) 61 135.57 177.10 9 14.75
6250. silver (gr0ff) 61 94.83 115.86 31 50.82
6251. im bored (googooalp) 61 62.22 80.26 16 26.23
6252. Satyam (satyamslow) 61 55.19 70.12 10 16.39
6253. Samiha (sammoha) 61 35.46 47.58 2 3.28
6254. Salah (salah135) 61 54.29 68.67 4 6.56
6255. RoA (romori) 61 56.57 67.65 12 19.67
6256. Foole (rizzbor) 61 75.17 87.89 15 24.59
6257. RicoBaby (ricoricoree_) 61 93.53 117.13 38 62.30
6258. Rafeeq (raf_al) 61 77.21 97.70 17 27.87
6259. Qaplan (qaplan) 61 55.71 64.73 24 39.34
6260. Punder (punderland) 61 76.33 92.25 13 21.31
6261. tstats[pumpkinsoup1] (pumpk... 61 121.94 159.47 36 59.02
6262. Bill (proepicgamer101) 61 89.18 119.37 30 49.18
6263. Said (porta_said) 61 37.74 48.48 3 4.92
6264. Plotinus (plotinusdickens) 61 126.32 154.93 40 65.57
6265. Alexander (olekpark) 61 105.56 124.46 26 42.62
6266. Nicholas Dimitrov (nickytyp... 61 84.91 131.20 20 32.79
6267. Denis (newdenispro) 61 65.54 84.82 14 22.95
6268. MysticNovaLord (mysticnoval... 61 63.07 89.59 16 26.23
6269. Mohammed (mshousha29) 61 50.69 65.12 7 11.48
6270. Mayank (mmayank74) 61 61.20 79.37 10 16.39
6271. meli (meli0604) 61 88.29 109.28 18 29.51
6272. matthew (mattchy) 61 73.56 83.49 21 34.43
6273. Mathias (mathias64) 61 72.56 99.60 13 21.31
6274. Haiden (manthetypewriter) 61 42.24 56.89 11 18.03
6275. Rasmus (sbares) 60 92.00 109.14 22 36.67
6276. Sandeep (sandeep_bhandari) 60 47.89 60.84 7 11.67
6277. 💓 (samhurwitz) 60 80.86 107.05 55 91.67
6278. Rustam (rustam687) 60 86.04 111.45 20 33.33
6279. harley (questionable0891) 60 50.13 65.93 7 11.67
6280. NitroOrb (nitroorb) 60 86.85 112.81 21 35.00
6281. Nicholas (nicholaslaw07) 60 78.84 101.20 13 21.67
6282. MH (nibir4422322321) 60 55.81 68.67 5 8.33
6283. NejcSLO (nfaca411) 60 52.62 67.34 9 15.00
6284. x (mxlxdx) 60 128.65 175.95 24 40.00
6285. Michael (ms_12) 60 77.34 98.72 13 21.67
6286. Moritz (mogottsch) 60 82.23 96.97 23 38.33
6287. Tinnaphop (mistertfy64) 60 96.44 120.46 19 31.67
6288. MD Shahadat Hossain (md_sha... 60 46.29 56.41 8 13.33
6289. Mat (mat78) 60 66.83 82.16 7 11.67
6290. Mario (mariojr16) 60 72.50 90.82 16 26.67
6291. McQueen (aquino_jk) 60 40.31 51.18 4 6.67
6292. Aibek (aosmonov) 60 80.89 99.42 24 40.00
6293. Ankit (ankit0) 60 67.43 78.74 16 26.67
6294. Marko (akagodyr) 60 43.94 54.88 6 10.00
6295. hello (ajblizzard77) 60 74.28 101.44 20 33.33
6296. Vaibhav (ahthserhsluk) 60 55.90 73.03 15 25.00
6297. ahmet (ahmetyilmaz2002) 60 72.65 95.04 13 21.67
6298. Harrison (happierwizard) 60 73.43 91.23 19 31.67
6299. Joanne (jowelch25) 60 62.74 78.35 14 23.33
6300. Urushihara (urushihara23) 60 40.64 52.36 5 8.33
6301. makenna (kenniekat) 60 67.42 76.16 12 20.00
6302. Rachelle (foolishoni) 60 66.48 83.52 8 13.33
6303. Flip (flip2theleft) 60 114.16 144.58 32 53.33
6304. IndianGuy (fastindianguy) 60 94.05 107.45 31 51.67
6305. jayden (fastest11yearoldtyp... 60 92.21 124.83 13 21.67
6306. eric (ericsy) 60 100.04 118.32 23 38.33
6307. Old Theme Rocks (dthp32776) 60 111.55 139.01 30 50.00
6308. big slo (denvr) 60 72.90 91.51 13 21.67
6309. AsadCoder (darkterror07) 60 74.40 103.10 14 23.33
6310. Cole (coles_lambo_15) 60 87.11 110.85 22 36.67
6311. Chan (cognacchan) 60 67.90 85.03 14 23.33
6312. Sheep (celibustbike) 60 66.52 84.43 19 31.67
6313. Carson (carsonting) 60 70.41 97.55 12 20.00
6314. Jonas (calmdownnnnn) 60 73.54 93.43 10 16.67
6315. Noah (bobapplepie) 60 101.78 117.34 26 43.33
6316. Chua (big_boy_pack) 60 78.62 98.35 51 85.00
6317. White (beast_5) 60 73.60 92.86 15 25.00
6318. bayarjargal (bayaraajr) 60 62.12 79.39 27 45.00
6319. Azaza (azazamaster) 60 57.64 67.70 11 18.33
6320. AstroNomix (astronomix) 60 66.45 84.54 15 25.00
6321. Aryan (aryan1504) 60 49.83 65.67 4 6.67
6322. Yzmael (yzmael156) 60 98.44 122.38 31 51.67
6323. Regulus ❄ (yo_yo_honey_si... 60 85.58 105.10 16 26.67
6324. JB (wtfhowareyousofast) 60 117.09 151.56 35 58.33
6325. Jay (wolfjay757) 60 84.33 105.30 21 35.00
6326. william (willi30124) 60 68.75 85.89 15 25.00
6327. gayman (vvvvvccvvvvv) 60 68.57 85.55 18 30.00
6328. Vil (vil_) 60 92.89 117.03 20 33.33
6329. Stefan (unknow_stef) 60 56.13 70.78 7 11.67
6330. uglyjeffrey (uglyjeffrey) 60 69.53 89.36 21 35.00
6331. Tyler (tyster02) 60 85.91 98.57 20 33.33
6332. Typer (typertyping) 60 69.32 82.00 11 18.33
6333. viv (toastexee) 60 91.19 116.60 13 21.67
6334. Sulov (sul49) 60 67.82 86.22 19 31.67
6335. spark (sparkkk) 60 81.99 121.23 19 31.67
6336. Shashank (shashu1509) 60 86.09 107.58 15 25.00
6337. Ace (semiace) 60 96.08 120.54 28 46.67
6338. Ian (llamasquad) 60 83.61 105.32 19 31.67
6339. Kiara (liptica_k) 60 70.03 85.59 10 16.67
6340. thursdays (liljuicebox491) 60 87.61 126.63 16 26.67
6341. Mark (lemon________) 60 84.24 116.00 19 31.67
6342. Lent√es (lemoninapie) 60 101.38 135.48 28 46.67
6343. fatma (khadigaz) 60 65.45 82.25 18 30.00
6344. Jynn (jynngecko) 60 50.77 66.67 18 30.00
6345. jivanf (jivan108) 60 141.79 178.93 47 78.33
6346. Mic (jesusluvr) 60 71.21 91.52 16 26.67
6347. Jenny (jenny_02) 60 84.19 107.92 13 21.67
6348. JC (invoicingkarma) 60 84.63 103.69 16 26.67
6349. Horizon (hwinangkoso) 60 69.79 83.28 16 26.67
6350. thanh (hust9x) 60 64.71 75.47 12 20.00
6351. Liban (hujala1) 60 144.19 173.54 45 75.00
6352. Xavier (gshizzahs) 60 106.01 127.62 28 46.67
6353. road to 100wpm (getoar112) 60 93.64 115.53 26 43.33
6354. hngggg (m4saki) 59 88.58 112.14 25 42.37
6355. lRaml (lsomeonel) 59 88.02 108.63 23 38.98
6356. Jusuf (kz99) 59 83.38 103.40 17 28.81
6357. JumpingPenguin (jumpingpeng... 59 85.79 103.73 23 38.98
6358. JSlyk (jslyk) 59 69.92 95.16 19 32.20
6359. Mujeeb's (jeffyglue) 59 120.48 151.67 39 66.10
6360. burrito1 (jacobef2) 59 121.46 142.15 29 49.15
6361. Jackoman (jackoman) 59 36.05 41.70 6 10.17
6362. idost (idost) 59 63.75 72.70 14 23.73
6363. ∞ (gatewaydrug) 59 111.03 125.60 29 49.15
6364. frost (frost99) 59 67.69 80.87 12 20.34
6365. ants (fr4nc3) 59 116.43 138.27 30 50.85
6366. finityfly (finity_fly) 59 113.79 131.06 26 44.07
6367. Leroy (fazecringe) 59 87.22 107.09 20 33.90
6368. Michael (ezykielue) 59 91.88 108.06 19 32.20
6369. Vagesh (don1909) 59 60.66 68.67 9 15.25
6370. Dhvanik (dj_viradiya) 59 56.39 67.67 12 20.34
6371. Daniar (dankas23) 59 37.00 45.43 1 1.69
6372. dani (daniellielikesanime) 59 67.92 82.65 10 16.95
6373. Joey (coxoncable) 59 89.56 112.69 19 32.20
6374. Connor Craig (conn_fused1) 59 86.36 102.10 13 22.03
6375. Clint (clint_kun) 59 115.32 135.10 25 42.37
6376. cheryl (cheryl08) 59 78.63 92.94 10 16.95
6377. Kai (cheongengkai) 59 89.38 109.45 15 25.42
6378. Charts (charizardpotato) 59 90.26 106.06 27 45.76
6379. ⭕⃤ (carmatain) 59 102.02 140.32 24 40.68
6380. carl (captain_deadpooooool) 59 66.15 78.04 14 23.73
6381. Viktor (c0re_dump) 59 66.11 84.70 14 23.73
6382. Narut (blowingbubbles) 59 100.59 124.78 22 37.29
6383. Joseph (bigboybo28) 59 76.04 93.30 21 35.59
6384. Caleb (balecus53) 59 77.20 91.56 9 15.25
6385. Ashray (ashraygupta1) 59 72.23 88.29 12 20.34
6386. Santiago (santiago101604) 59 71.39 99.24 15 25.42
6387. tstats[rtupps] (rtupps) 59 63.56 84.67 9 15.25
6388. Sion (retardation69) 59 46.39 55.17 5 8.47
6389. handshurt (ozzytheasian) 59 94.76 125.88 29 49.15
6390. Deimer (ogdeimer) 59 70.26 95.18 15 25.42
6391. Andrew (nosingaround) 59 121.38 142.54 29 49.15
6392. Jordan (mrkentman) 59 81.21 100.73 20 33.90
6393. m0gu (mogumogu_) 59 72.25 91.01 12 20.34
6394. Marcus (marcusmandarin) 59 105.60 132.55 29 49.15
6395. ark (arkundu) 59 87.70 111.76 41 69.49
6396. arjun (arjun_gamine) 59 54.87 70.02 7 11.86
6397. Alex (alexlea444) 59 96.25 110.45 21 35.59
6398. Feruz (akhbekdev) 59 45.31 56.41 6 10.17
6399. Arthur (ajdem) 59 104.92 125.03 29 49.15
6400. aa (aanyc) 59 59.58 71.25 9 15.25
6401. Raj Gaurav (01indian) 59 56.45 67.56 15 25.42
6402. Rageon (rageon787) 59 51.34 66.04 5 8.47
6403. xdom (xdomiino) 59 82.69 106.41 21 35.59
6404. weeAzuL (weeazul) 59 67.93 85.65 15 25.42
6405. Volxage (volxage) 59 90.84 110.32 17 28.81
6406. viper (viper3315) 59 67.21 78.35 10 16.95
6407. none_of_ur_business (underc... 59 75.02 95.70 16 27.12
6408. Miku (undeadninja) 59 83.34 96.63 15 25.42
6409. Marc (tomatenmarc) 59 62.25 80.39 11 18.64
6410. TITAN (titan_daddy) 59 55.26 73.24 12 20.34
6411. The D Legend (the_d_legend) 59 84.02 97.02 14 23.73
6412. TheZacher5645 (thezacher5645) 59 91.55 114.00 17 28.81
6413. Hamz (thehamzarocks) 59 72.83 86.93 19 32.20
6414. Tasnimul (tasnimul) 59 67.46 87.84 13 22.03
6415. Sylvester (sylvestertyper) 59 94.27 110.76 17 28.81
6416. Karina (syj4434) 59 79.22 100.26 25 42.37
6417. Md Ahad Ali (sumon_ahmmed_001) 59 26.71 31.54 9 15.25
6418. Shikhraj (shikhrajsingh) 59 107.81 129.86 25 42.37
6419. Seb (sebastiancv) 59 87.46 106.19 19 32.20
6420. Shahryar (_shahryar_pjr) 58 94.57 124.23 31 53.45
6421. 🏎️Ziad (ziad_hamdy) 58 54.82 73.70 4 6.90
6422. Steven (xuqc01) 58 101.65 122.96 24 41.38
6423. Wepeel (wepeel) 58 88.07 122.85 22 37.93
6424. Adam (vincentadam) 58 70.91 82.22 13 22.41
6425. Viki (vikiperle08) 58 65.11 88.92 15 25.86
6426. pp (urppsmolhaha) 58 77.99 93.40 15 25.86
6427. Bill (trainingb4tests) 58 96.88 127.99 22 37.93
6428. purplefr|ction (tesla_diesel) 58 115.38 149.11 28 48.28
6429. diko (sniperab3) 58 41.07 52.00 3 5.17
6430. Sk1tt (sk1tt) 58 87.02 115.22 14 24.14
6431. silver_hamburger (silver_ha... 58 33.25 44.48 6 10.34
6432. Shoaib (shoaibesam) 58 55.78 76.97 2 3.45
6433. (scaphism) 58 130.32 166.57 39 67.24
6434. Sahil (sahil21db) 58 87.01 106.76 10 17.24
6435. ryo (ryolate) 58 85.87 101.85 19 32.76
6436. (razor11223344) 58 87.78 100.28 23 39.66
6437. tango (rangotango) 58 70.94 97.78 34 58.62
6438. Rajesh (rajesh110494) 58 82.23 100.87 16 27.59
6439. Damon (pvdorginal) 58 96.23 117.74 20 34.48
6440. Sebastian (proudpole) 58 91.92 115.47 19 32.76
6441. Professional (professional_... 58 76.44 95.55 16 27.59
6442. Gohan (prasadbhoir6786) 58 76.02 111.14 13 22.41
6443. Boog (pinchejoseph) 58 46.33 59.24 13 22.41
6444. Pharrell (pharrell000000) 58 45.96 65.41 8 13.79
6445. Ronnie (onie12) 58 98.89 134.91 23 39.66
6446. Tyler (oktherefella) 58 105.98 131.93 29 50.00
6447. Chih-hai (oceansfavor) 58 63.66 72.27 10 17.24
6448. Nokzendi (nokzendi) 58 79.28 99.03 13 22.41
6449. Deepanshu (namelesswonder) 58 53.83 69.93 6 10.34
6450. zombo (midgetmigerian) 58 94.27 110.90 24 41.38
6451. i have no (miamam) 58 96.68 132.73 20 34.48
6452. Nathan (memewhat123) 58 62.69 77.17 7 12.07
6453. For_real (mailindra) 58 84.63 106.18 18 31.03
6454. Macaibay (macz1991) 58 128.03 153.35 26 44.83
6455. laljan (laljan) 58 57.92 68.66 10 17.24
6456. Krowa (krowa) 58 82.26 100.05 17 29.31
6457. Krunch (kommanderk) 58 61.81 75.27 9 15.52
6458. kemiy (kemiy) 58 115.95 139.01 30 51.72
6459. Karsen (karguy3) 58 79.41 98.34 19 32.76
6460. Kanna (kannamanna) 58 78.76 96.45 16 27.59
6461. Matthew (juanspoon) 58 110.65 135.70 39 67.24
6462. Jeff (jeformica) 58 91.78 115.38 20 34.48
6463. Wyatt (isometricman) 58 94.61 126.09 30 51.72
6464. Ishaque (ishaque) 58 75.33 88.93 12 20.69
6465. RedRashGrain (improvising_m... 58 86.98 101.13 19 32.76
6466. Highfire1 (higfire1) 58 72.78 88.41 17 29.31
6467. Tom (hes_the_fastest) 58 41.96 54.30 3 5.17
6468. Dao (heavenrefining) 58 50.56 70.17 21 36.21
6469. Glenn (glenn101107) 58 89.63 109.21 21 36.21
6470. sussybaka (fknneeow) 58 85.88 104.85 14 24.14
6471. EM_K (em_k) 58 83.98 100.82 18 31.03
6472. Drew (drew1008) 58 70.11 84.39 18 31.03
6473. Demtros (demtros) 58 91.87 115.63 25 43.10
6474. relaxx (cloudkid) 58 98.70 121.45 21 36.21
6475. Chino (chinotorres_142) 58 57.56 72.90 13 22.41
6476. Marco (chino01) 58 74.77 90.11 11 18.97
6477. Burning (burningyolo) 58 54.16 67.23 7 12.07
6478. berk (birb_v2) 58 49.89 57.95 3 5.17
6479. ㅤ (bazar397) 58 78.18 93.56 14 24.14
6480. baekos (baekos) 58 57.96 73.40 9 15.52
6481. athresh (athresh) 58 79.49 101.22 12 20.69
6482. Ashen (ashencone) 58 62.84 74.01 10 17.24
6483. ARA (araaraara2) 58 50.13 74.75 6 10.34
6484. Mar (aqancake) 58 88.24 107.34 22 37.93
6485. Alvise (anklud) 58 70.17 82.63 13 22.41
6486. Dan Jeryll (almadendj) 58 119.68 133.30 32 55.17
6487. Almas (almas016) 58 46.43 54.00 10 17.24
6488. Akhil (akhil_kunadiya) 58 39.86 51.82 2 3.45
6489. smuel (14adamssam) 58 70.32 83.66 13 22.41
6490. Dr_Sagui (drsagui) 58 63.54 82.26 5 8.62
6491. Lourens (lourens) 58 51.71 63.64 8 13.79
6492. Anshu79 (anshu79) 57 62.05 79.78 15 26.32
6493. and (andy_r8) 57 72.04 92.15 15 26.32
6494. Ella (amhaissup) 57 91.96 113.44 18 31.58
6495. Akuma (akumaayush) 57 60.24 73.22 4 7.02
6496. S J (abhi_28) 57 71.58 92.30 20 35.09
6497. Ziad (0ziadmohamed0) 57 71.25 82.89 16 28.07
6498. pearce (09mantaray) 57 111.83 150.57 31 54.39
6499. Charles (cwayne) 57 73.06 83.77 13 22.81
6500. Andres (primedope27) 57 54.67 63.68 5 8.77
6501. k. (luvmissjanet) 57 44.39 55.36 7 12.28
6502. Matias (matias2030nuevo) 57 26.79 36.46 15 26.32
6503. Michel (michelena) 57 66.54 85.50 13 22.81
6504. A (lvorg) 57 72.13 88.19 17 29.82
6505. luckylian123 (luckylian123) 57 71.20 94.04 18 31.58
6506. Ali (lembugoreng) 57 91.91 111.30 15 26.32
6507. krishan (krishan_pro) 57 60.72 76.63 14 24.56
6508. Elvis (krewe11a) 57 148.59 166.93 0 0.00
6509. Jacob (jakkbb) 57 80.38 94.07 32 56.14
6510. jaeg3r (jaeg3r) 57 84.66 99.32 14 24.56
6511. Jacob (jacobtolstrup) 57 51.37 64.43 5 8.77
6512. jack (jack815) 57 98.48 125.58 25 43.86
6513. Troy (ic3b3rg) 57 61.99 76.21 17 29.82
6514. hbomb (hbomber) 57 64.28 84.49 25 43.86
6515. Anthony (funger99) 57 85.82 101.31 10 17.54
6516. tstats[_skrt_skrt_] (_skrt_... 57 72.78 86.42 11 19.30
6517. ... (zviki) 57 68.52 80.82 17 29.82
6518. zhen (zhen_pei) 57 87.34 118.40 16 28.07
6519. Matthew (yourtrashkld) 57 90.15 106.15 20 35.09
6520. Xray (xrayburst) 57 55.22 65.11 9 15.79
6521. Wassim (wxssim) 57 67.36 91.45 19 33.33
6522. wub (wub_wub) 57 95.11 117.60 26 45.61
6523. ezza (winko_) 57 78.72 93.18 18 31.58
6524. Ako ay (walangpera) 57 106.23 128.27 18 31.58
6525. v (typer953) 57 81.01 109.00 19 33.33
6526. Pratik (trippyhob) 57 97.17 116.47 25 43.86
6527. Derp (thelol) 57 97.37 119.01 43 75.44
6528. Taylor (taylorcuber717) 57 95.26 119.06 24 42.11
6529. takenbyWine (takenbywine) 57 60.12 72.22 10 17.54
6530. Shubham (shubham409) 57 29.33 40.73 8 14.04
6531. Shiheng (sbiengo_sama) 57 72.51 86.59 21 36.84
6532. Sarah (sarah_the_slow_typer) 57 53.34 67.58 7 12.28
6533. sanayaa (sanayaa) 57 80.93 98.66 18 31.58
6534. Rocco (roccoduck) 57 78.01 100.66 12 21.05
6535. Rishi (rishipoonia) 57 36.93 53.78 6 10.53
6536. de (paradoxpigeonlaptop) 57 147.99 193.51 35 61.40
6537. Thomas (palsgod) 57 138.99 164.84 46 80.70
6538. Pacu (pacutv) 57 91.64 109.85 11 19.30
6539. Eddie (nightwing_eddie) 57 90.27 108.80 21 36.84
6540. nicole (nicoleyee_) 57 57.40 69.86 13 22.81
6541. Lemon (mrlemon) 57 73.30 104.64 13 22.81
6542. NGONO (mnae) 57 40.43 57.79 2 3.51
6543. Mark (markstone_141) 57 78.84 92.53 19 33.33
6544. mamounitor (mamounitor) 57 55.79 85.75 11 19.30
6545. F (frogliker) 57 72.98 85.65 11 19.30
6546. Fan (firesale) 57 67.30 81.33 15 26.32
6547. fesd (fesd20) 57 68.50 84.83 16 28.07
6548. Eric (edestroyer2604) 57 66.98 77.31 14 24.56
6549. Joe (dostojoe) 57 54.19 67.73 4 7.02
6550. Mayank (divine_godspeed) 57 72.45 89.99 6 10.53
6551. Ashvini (danger_anna) 57 49.76 66.80 11 19.30
6552. Cristian (crism123dm) 57 59.58 78.16 9 15.79
6553. Chinmay (chinmay26) 57 65.37 78.72 12 21.05
6554. Bob (cakesenpie) 57 113.00 138.65 28 49.12
6555. Jared (buckdancer) 57 96.47 115.20 21 36.84
6556. Joey (bpextermin8) 57 95.44 117.10 24 42.11
6557. Banzexxx (banzexxx) 57 73.32 83.01 12 21.05
6558. Avery (ba0z1) 57 94.22 120.99 35 61.40
6559. Travis (azgoalie) 57 66.10 88.17 13 22.81
6560. avighna (avighna) 57 67.79 92.03 13 22.81
6561. James (frxction) 56 98.31 119.23 18 32.14
6562. smolPixie (extraprincess) 56 86.03 105.21 18 32.14
6563. Etienne (etienne_bepo) 56 93.17 111.64 3 5.36
6564. Dave (davethreed) 56 56.11 68.03 5 8.93
6565. Sid (cynocid) 56 93.82 117.15 21 37.50
6566. Cylindian (cylindian) 56 104.53 123.73 21 37.50
6567. Parth (cracker2111) 56 44.72 61.90 7 12.50
6568. ch_tyt (ch_tyt) 56 72.86 90.96 13 23.21
6569. chubbybala (chubbybala) 56 78.18 90.73 14 25.00
6570. juggy (cannary) 56 46.10 61.48 6 10.71
6571. brutalranked (brutalranked) 56 66.42 78.12 13 23.21
6572. Jongchan (bot_chan) 56 75.94 95.03 9 16.07
6573. Tawanda (bigx) 56 54.82 69.17 11 19.64
6574. Benjamin (bigbentypes246) 56 75.61 90.98 15 26.79
6575. besto (besto) 56 57.28 72.09 13 23.21
6576. Ben (benjaminweschler) 56 80.46 107.50 18 32.14
6577. Ahmed (beet790) 56 69.44 83.37 10 17.86
6578. bananana (bana_na) 56 52.06 61.46 5 8.93
6579. June (avvieey) 56 87.04 111.21 15 26.79
6580. Atos (wolfcash) 56 87.05 100.56 15 26.79
6581. Seri (vincent_aik) 56 93.17 109.08 22 39.29
6582. Uxna (uxna) 56 103.73 127.16 26 46.43
6583. Eric (unfazedglitch) 56 102.20 118.23 25 44.64
6584. Vincent (turbovince) 56 63.76 73.14 14 25.00
6585. Tobi_Uchiha_Rama (tobi_uchi... 56 45.98 55.22 9 16.07
6586. sachin (timsixit) 56 54.87 71.89 9 16.07
6587. TastyApple (tastyapple) 56 96.41 112.68 24 42.86
6588. Svetoslav (svera) 56 54.33 64.66 6 10.71
6589. stas (stasats) 56 32.77 42.49 0 0.00
6590. Souhardya (souhardya98) 56 82.34 100.67 20 35.71
6591. Jayden (slawsome) 56 56.45 67.73 2 3.57
6592. Surya (shanky_111) 56 44.80 57.17 4 7.14
6593. Holder (arcanezer0) 56 96.80 122.33 21 37.50
6594. Andraž Gradišnik (andgrad) 56 102.96 123.32 25 44.64
6595. ali (alifat) 56 50.00 58.55 5 8.93
6596. Abhishek (abkrth) 56 78.14 93.47 15 26.79
6597. abhi (abhi_sama) 56 77.02 96.89 18 32.14
6598. 0x045f (0x045f) 56 111.70 142.33 33 58.93
6599. smooll (smoollbrain) 56 46.36 61.01 7 12.50
6600. Ben (benjib) 56 78.45 98.02 17 30.36
6601. ArcWand (arcwand) 56 79.86 101.98 13 23.21
6602. tasnim (r4f1d) 56 37.28 51.86 6 10.71
6603. tstats[kfinimizer] Kfinimiz... 56 49.11 68.18 6 10.71
6604. rex (rex_k) 56 63.59 82.54 16 28.57
6605. Gio (flordepapel) 56 88.65 108.21 16 28.57
6606. Ludvig (luddez1) 56 93.04 113.82 23 41.07
6607. ✔️▄◘🚀!new_luca@y... 56 133.95 214.36 34 60.71
6608. Santiago (londono19) 56 100.08 123.36 16 28.57
6609. Alex (laralex) 56 85.10 100.32 21 37.50
6610. Md Ibrahim Hossain (komlaka... 56 61.78 69.79 12 21.43
6611. Hùng (kenkenkiota) 56 96.93 116.28 23 41.07
6612. Andrea (kazari) 56 90.97 105.14 26 46.43
6613. Kasiourasg (kasiourasg) 56 108.62 133.06 33 58.93
6614. Kabadahija (kabadahija30) 56 59.63 72.51 3 5.36
6615. Joey (jmschrum) 56 80.10 95.99 17 30.36
6616. Jerichaux (jerichaux) 56 112.70 134.50 28 50.00
6617. Ineluctable (ineluctable) 56 107.00 141.31 27 48.21
6618. Hajun (improve_ever) 56 109.30 135.29 39 69.64
6619. Ren Hariren (hari623) 56 105.94 123.27 36 64.29
6620. KENNETH (happydino) 56 94.75 120.14 24 42.86
6621. rugbyBREAD (rugbybread4free) 56 93.59 111.03 24 42.86
6622. Radek (radecekwriter) 56 85.35 99.32 18 32.14
6623. Provocative (provocativepig... 56 90.19 112.10 20 35.71
6624. Collins (princey) 56 55.88 66.59 7 12.50
6625. Boeing (planetyper78) 56 100.02 117.84 25 44.64
6626. Khastro (peterakd) 56 108.33 144.60 26 46.43
6627. OvenHeat (ovenheat) 56 117.64 163.03 37 66.07
6628. notoverhere (notoverhere) 56 66.11 85.42 12 21.43
6629. Hamza (nerodine) 56 74.67 89.30 16 28.57
6630. narze (narze) 56 86.80 123.42 15 26.79
6631. Jay (myladyjay) 56 69.52 88.56 13 23.21
6632. MoreZigLessZag (morezig) 56 62.86 78.11 14 25.00
6633. Monjur 101 (monjur_ahmed) 56 33.76 41.70 5 8.93
6634. mataio (mataioo) 56 41.61 51.48 8 14.29
6635. Sambhalang (samkchandy) 55 81.47 101.62 19 34.55
6636. Robert (rzyao) 55 85.58 108.27 16 29.09
6637. Russ (russcoder) 55 88.14 115.91 20 36.36
6638. Ravindu (ravindu08) 55 62.38 75.68 11 20.00
6639. Jack (randomdize) 55 71.50 103.47 13 23.64
6640. Raging (ragingthunder) 55 89.65 107.19 21 38.18
6641. Xavier (qiltz) 55 70.84 86.25 15 27.27
6642. pingukalinu (pingukalinu) 55 55.76 70.78 4 7.27
6643. Nikolay (niki12120) 55 48.20 61.14 26 47.27
6644. Ying-Chen (nash_equilibrium) 55 54.16 64.73 6 10.91
6645. Nabiha (nabiha_fatima01) 55 34.76 40.98 2 3.64
6646. mellismacka (mellismacka) 55 91.21 108.15 21 38.18
6647. McKle (mckle7) 55 85.17 101.79 14 25.45
6648. Matt (mattmen) 55 46.87 68.13 3 5.45
6649. St (amirey) 55 65.40 84.57 14 25.45
6650. Alnebras04 (alnebras04) 55 63.95 91.13 9 16.36
6651. Aljaz (aljazb) 55 62.04 75.25 12 21.82
6652. Al-amin (alamin01) 55 34.25 41.20 4 7.27
6653. Andy (akapgan) 55 75.24 94.72 15 27.27
6654. nela camelia (agatha67) 55 43.95 57.62 5 9.09
6655. Afraidofthebomb (afraidofth... 55 125.16 159.29 38 69.09
6656. Adamite (adamite2k) 55 99.54 122.21 17 30.91
6657. David (actavis666) 55 69.08 83.53 19 34.55
6658. Asilbek (acilbek) 55 35.27 47.83 1 1.82
6659. John Paul (gizoru) 55 52.60 64.27 9 16.36
6660. Jez (jezmann) 55 49.85 65.77 9 16.36
6661. Jojo (jojannes1) 55 66.29 85.55 9 16.36
6662. tstats[david2444] (david2444) 55 76.24 90.75 13 23.64
6663. choe (choechoichang) 55 88.00 106.92 22 40.00
6664. Jai (jaipi) 55 40.78 57.98 6 10.91
6665. Josh (hyper_amoeba) 55 66.47 82.30 24 43.64
6666. Dylan (playboiidylan) 55 65.49 81.23 10 18.18
6667. Lucy (ldarwish) 55 63.21 78.96 11 20.00
6668. Jacob (jacob_legere) 55 80.99 96.74 16 29.09
6669. Dalia (flowhy_) 55 76.42 93.03 17 30.91
6670. Halo (fishmona) 55 57.50 74.46 8 14.55
6671. Fireworks (fireworkkss) 55 96.25 111.19 22 40.00
6672. Ficfiris (ficfiris) 55 62.38 72.94 10 18.18
6673. Cobra (devanshj) 55 83.63 98.97 16 29.09
6674. derfet (derfet) 55 53.31 66.08 6 10.91
6675. David (davidcaron) 55 70.62 90.20 15 27.27
6676. danydoo (danydoo) 55 68.36 79.40 14 25.45
6677. Daisy (daisy_sun) 55 66.42 84.75 14 25.45
6678. cool_whip (cool_whip) 55 88.91 106.04 12 21.82
6679. Joe (cobiejoe96) 55 86.12 102.87 14 25.45
6680. Ollie (cheerfulnihilist) 55 83.82 108.08 16 29.09
6681. charlene (charlenemiao) 55 59.30 72.28 7 12.73
6682. Krishna (chaithu97) 55 65.00 76.19 18 32.73
6683. carina (carina_caily) 55 47.03 77.47 17 30.91
6684. mike (brons48) 55 85.41 125.15 19 34.55
6685. Brandon (brandonzfu) 55 93.43 125.23 22 40.00
6686. Pin (bleeep) 55 70.45 82.28 16 29.09
6687. Adrian (bigbadbui) 55 91.34 119.68 18 32.73
6688. Barry (barry21) 55 75.61 90.86 9 16.36
6689. Azaro (azaroarazenka) 55 124.86 157.57 45 81.82
6690. Ethen (__ethen_03) 55 72.51 89.58 11 20.00
6691. Avi (_avi_) 55 96.38 112.36 20 36.36
6692. Zahra (zahra_a) 55 50.60 62.20 14 25.45
6693. Kaushik (yeswekey) 55 96.65 112.10 16 29.09
6694. marsh (yepeyi) 55 131.86 155.37 34 61.82
6695. Yaniv (yaniv691) 55 55.06 67.69 13 23.64
6696. danny (xsoii) 55 57.54 71.43 8 14.55
6697. Steven (xdstephano) 55 80.01 104.02 8 14.55
6698. fck you latency (whihi) 55 127.31 145.90 29 52.73
6699. VitaliK (vitalik_2961) 55 66.42 79.02 12 21.82
6700. vexx32 (vexx32) 55 49.03 62.26 7 12.73
6701. vayuputra (vayuputra) 55 50.60 67.75 9 16.36
6702. Albert (tastiermite) 55 98.06 118.36 25 45.45
6703. Phil (sticky1981) 55 69.27 83.62 17 30.91
6704. Thomas (speedbro) 55 67.89 89.07 15 27.27
6705. San (slowcatnospeed) 55 27.61 34.71 7 12.73
6706. Shadow (shadow_devil) 55 61.76 81.37 9 16.36
6707. YLime (lacua) 55 67.17 78.65 10 18.18
6708. Konrad (konradgoldammer) 55 83.78 100.95 16 29.09
6709. Victor (kizamui) 55 76.52 94.02 15 27.27
6710. Kirby (kirbyjs) 55 65.89 84.06 12 21.82
6711. fast af (josh53___) 55 94.10 112.89 23 41.82
6712. Joseph (josefmcbrosef) 55 83.68 112.11 21 38.18
6713. joseph (jmuganga544) 55 57.88 73.97 11 20.00
6714. Jasur (jasurava) 55 30.89 44.81 9 16.36
6715. Jaskirat (jaskiratsingh) 55 99.65 128.48 26 47.27
6716. Jack (jack90001) 55 115.33 139.33 28 50.91
6717. Pakko (iam_mzaa) 55 65.96 82.37 14 25.45
6718. Donald (hotdognalds) 55 110.66 151.30 30 54.55
6719. Jun Jie (lemontea387) 54 100.60 124.17 22 40.74
6720. 😳😳😳 (lanterex) 54 97.00 110.60 23 42.59
6721. Made In (kosowarner) 54 112.42 133.99 47 87.04
6722. toki (kizunajemini2205) 54 99.09 129.14 26 48.15
6723. Teeratat (kiwi2002) 54 79.07 96.85 12 22.22
6724. Alex (khanis1) 54 85.96 102.06 15 27.78
6725. Keegan (keegan9503) 54 70.68 87.83 14 25.93
6726. Basil (kaneki_k3n) 54 92.71 114.19 16 29.63
6727. Joshua (joshuawn) 54 151.28 180.63 43 79.63
6728. Jazz (jazzfunk37) 54 79.71 95.65 18 33.33
6729. Jp (j12p21) 54 88.64 110.42 11 20.37
6730. Ben (izeben) 54 100.78 122.07 17 31.48
6731. ibean (ibean) 54 69.15 81.27 15 27.78
6732. hulkari (hulkari) 54 64.13 76.81 16 29.63
6733. BreadForAll (hollowshadow) 54 103.87 126.93 20 37.04
6734. 𒅃 (hdgamez) 54 112.64 134.23 30 55.56
6735. Harjot (harjot_singh) 54 74.37 90.06 13 24.07
6736. Colemak (half_as_fizzy) 54 85.68 105.61 18 33.33
6737. Phil (gunner_shents) 54 35.39 41.95 3 5.56
6738. Boris (goat_56) 54 127.92 199.81 33 61.11
6739. Gazeekoo (gazeekoo) 54 65.59 78.26 12 22.22
6740. Amare (endmaster64) 54 60.53 75.57 53 98.15
6741. Emma (embunde7) 54 92.40 122.10 34 62.96
6742. Ducu (ducu) 54 59.89 67.96 10 18.52
6743. Douglas (douglaswaugh) 54 66.47 78.71 11 20.37
6744. Timothy (dilexed) 54 51.00 66.76 7 12.96
6745. David (davidthegreat) 54 65.99 86.81 16 29.63
6746. A (dasupakiwi) 54 65.99 83.81 13 24.07
6747. Scott (chivalrousbanana) 54 45.44 57.59 4 7.41
6748. bruh (bruhmoment8964) 54 152.60 172.84 47 87.04
6749. Armisael (brandonbro) 54 76.43 101.40 19 35.19
6750. Bone (bonepriest) 54 83.81 119.60 16 29.63
6751. 2XKO WAITING ROOM (bloodyra... 54 100.88 125.12 15 27.78
6752. RioDa (bleachinq) 54 85.32 103.50 12 22.22
6753. Amarpreet (bhangu_05) 54 55.81 68.43 4 7.41
6754. Biohazard (b10hazard_) 54 86.54 106.23 7 12.96
6755. Krishna (aurum_est_potestas) 54 71.31 86.05 15 27.78
6756. Arman (arminhammer) 54 50.91 66.58 4 7.41
6757. Reuben (reubensong) 54 97.82 136.15 26 48.15
6758. Raghavan G V (raghavangv) 54 74.83 96.79 15 27.78
6759. Pszymek (pszym) 54 77.54 109.82 16 29.63
6760. prince (prince_singh) 54 36.66 44.69 6 11.11
6761. James Wolfe (primalnacl) 54 80.03 99.85 20 37.04
6762. pranked (pranker666) 54 84.12 102.91 18 33.33
6763. Cihsa (oddlysatisfly) 54 96.79 115.65 20 37.04
6764. Dennis (ocrayat16) 54 72.07 91.36 12 22.22
6765. Nicholas (nsabadicci) 54 91.68 117.88 17 31.48
6766. Slava (not_okay) 54 74.75 83.76 9 16.67
6767. daniel (notorious13366) 54 33.76 47.73 11 20.37
6768. Kevin (noimkevin) 54 120.65 137.04 31 57.41
6769. Chad (nicwin) 54 112.10 139.29 26 48.15
6770. Nicholas (nicszerman) 54 82.12 100.65 19 35.19
6771. nguyen (nguyenanh2004) 54 61.02 75.38 9 16.67
6772. Yasir (nay_yar110) 54 56.25 79.15 5 9.26
6773. Nate (nateog) 54 103.97 134.72 23 42.59
6774. Muaj17 (muaj17) 54 88.04 110.32 36 66.67
6775. molnar (molnaredom) 54 38.99 47.17 7 12.96
6776. chapo (mnxchapo) 54 97.94 120.79 16 29.63
6777. Maynard (mftrumpet) 54 104.36 133.63 27 50.00
6778. Master (masterdvorak) 54 82.86 98.28 12 22.22
6779. Ava (argerami) 54 63.35 81.39 17 31.48
6780. V (alfredpennywrth) 54 97.88 113.98 19 35.19
6781. Alfie (alfie_op) 54 55.78 68.77 12 22.22
6782. Round (aboutaroundabout) 54 104.67 124.39 26 48.15
6783. Aaron (aarone123) 54 87.93 101.01 16 29.63
6784. Aadarsh (aadarshmani) 54 59.74 71.17 8 14.81
6785. Ravi (131raviarya) 54 78.88 91.44 11 20.37
6786. Omar (atrozyte) 54 78.68 99.74 21 38.89
6787. Alexander (ysgatora) 54 66.04 84.95 13 24.07
6788. Minh (nhminh) 54 87.36 110.09 21 38.89
6789. Simmons1 (_simmons) 54 71.89 88.11 16 29.63
6790. Wujue (wujue) 54 59.59 68.26 12 22.22
6791. SHIVA (vishu_01) 54 67.43 87.77 17 31.48
6792. Dmitrii (typescore) 54 44.89 59.06 12 22.22
6793. Talby (talby) 54 110.80 143.36 26 48.15
6794. Sujeev (sujeev) 54 53.66 70.40 7 12.96
6795. sturge (sturgee) 54 72.45 105.79 14 25.93
6796. Adam (sticknleaf) 54 105.34 129.21 28 51.85
6797. Stanley (stanleyzhang9) 54 111.58 135.86 33 61.11
6798. tstats[ssohrab] (ssohrab) 54 97.75 129.86 15 27.78
6799. e-mili (speedy_007) 54 91.71 117.01 15 27.78
6800. erty (someone8888) 54 107.72 139.67 29 53.70
6801. slayerofthend (slayerofthend) 54 112.72 144.10 35 64.81
6802. Shishcobober (shishcobober2) 54 81.38 98.73 12 22.22
6803. Rommel (seekercuriousityxx) 54 49.72 68.76 7 12.96
6804. Joel (seasmoke) 54 73.10 90.04 11 20.37
6805. Andrew (zengwendian) 53 106.39 120.56 24 45.28
6806. Yuval (yuvalalfa) 53 98.69 129.63 23 43.40
6807. :) (yuuuhhh) 53 88.88 110.23 18 33.96
6808. yazan (yazan_2000) 53 33.67 45.48 3 5.66
6809. Wwuly (wwuly) 53 51.89 74.07 5 9.43
6810. wond (wond_k_) 53 77.53 91.39 15 28.30
6811. Jimmy (user39_on_dvorak) 53 81.67 99.58 10 18.87
6812. Harald (updatin) 53 81.59 90.47 13 24.53
6813. Alexander (typelanterne) 53 115.05 134.66 21 39.62
6814. Max (triangl12) 53 107.78 132.10 24 45.28
6815. tania (tlee120) 53 111.12 123.95 22 41.51
6816. Chadwick (supasurreal) 53 48.21 61.87 6 11.32
6817. sir (sirflu) 53 48.68 59.24 6 11.32
6818. Faris (silverskied) 53 73.82 88.52 10 18.87
6819. Syimyk (sam_j5) 53 59.66 72.04 11 20.75
6820. Rikey (reycon) 53 49.41 68.63 6 11.32
6821. rdnblg (rdnblg2) 53 56.99 69.65 14 26.42
6822. rap (raprics8) 53 50.70 64.69 4 7.55
6823. Rafiul (rafiul41) 53 81.49 98.57 14 26.42
6824. Dan (radio_falcon) 53 105.77 128.97 24 45.28
6825. Matt (piza01134) 53 81.96 104.04 13 24.53
6826. AP (phea0001) 53 62.04 75.37 10 18.87
6827. Hugo (paulz_420) 53 52.82 71.52 10 18.87
6828. Chirpy (pandress) 53 102.12 128.83 25 47.17
6829. cheems (pachaczb_dvorak) 53 66.09 78.30 11 20.75
6830. Mahmoud (opssheesh) 53 85.54 110.30 11 20.75
6831. Ollie (ogreig) 53 73.14 94.76 26 49.06
6832. huh (noirblnqqq) 53 81.51 100.22 18 33.96
6833. Nabil (nabil_lam) 53 47.79 70.11 4 7.55
6834. Matthew (mmongillo) 53 63.08 74.16 12 22.64
6835. mira (mlp1214) 53 55.87 70.34 9 16.98
6836. William (michaelp_2222) 53 104.34 129.28 29 54.72
6837. Lets Gooooo!!! (mattymooo2021) 53 47.95 61.64 6 11.32
6838. mangkaw (mangkaw) 53 80.82 98.48 15 28.30
6839. LuminousEgg (luminousegg) 53 77.81 99.56 15 28.30
6840. Link (link_hyrule) 53 111.91 140.37 30 56.60
6841. Mikhail (limedimenine) 53 95.04 115.51 18 33.96
6842. k (kperez755) 53 86.84 116.22 19 35.85
6843. Gabby (kirbykirbykirby) 53 79.84 94.44 10 18.87
6844. Kash79 (kashyap79) 53 78.74 87.71 14 26.42
6845. Carlos (karldan) 53 56.92 69.23 7 13.21
6846. M (kapsa) 53 75.00 87.15 11 20.75
6847. Joy (joyjumper11) 53 92.32 115.39 23 43.40
6848. tstats[jason823] Jason (jas... 53 84.59 110.92 17 32.08
6849. Unigen (id3n) 53 111.73 133.11 30 56.60
6850. Ryan (hougs) 53 60.93 76.34 9 16.98
6851. HawkEye (hawk_eye) 53 79.20 104.88 12 22.64
6852. Rowel Abrasado (hallelujahptl) 53 46.60 61.52 7 13.21
6853. GreenUmbrella (greenumbrella) 53 77.58 94.99 16 30.19
6854. Fusionbolt (fusionbolt) 53 79.14 102.79 21 39.62
6855. fml (fmldave89) 53 77.35 111.42 13 24.53
6856. TK (filfirst) 53 86.42 100.81 17 32.08
6857. Ferricks (ferri_ks) 53 58.55 75.31 11 20.75
6858. Fedwig (fedwig) 53 102.34 125.93 23 43.40
6859. Ethan (ethanos42) 53 73.85 98.37 23 43.40
6860. ed81 (ed81) 53 46.84 55.30 6 11.32
6861. Dungus (duungus) 53 79.11 110.87 14 26.42
6862. lelle (davinkyy) 53 64.01 79.83 12 22.64
6863. Danny (danyeeast) 53 73.36 92.36 13 24.53
6864. winter (cora_) 53 92.33 112.27 22 41.51
6865. Deez (coolio458) 53 78.15 95.69 12 22.64
6866. ChurM8 (churm8) 53 92.77 125.59 38 71.70
6867. Mauro (chunkerchunk) 53 136.58 156.01 36 67.92
6868. ben (chompytheturtle) 53 115.27 141.68 37 69.81
6869. Chinmay (chinmays1999) 53 69.40 78.54 15 28.30
6870. Gabriel (cashewsoda) 53 92.71 109.24 18 33.96
6871. bueno (bueno94) 53 64.75 79.33 15 28.30
6872. ZXCRYO (btscarbon) 53 49.79 63.50 8 15.09
6873. Blue (blue_cow) 53 41.66 60.57 11 20.75
6874. beek (beekul) 53 60.43 77.01 8 15.09
6875. Bee (beejbeeabeey) 53 102.34 124.50 16 30.19
6876. Azhar (azharbhat) 53 67.76 85.16 10 18.87
6877. Atreides (atreidaus) 53 76.23 92.57 13 24.53
6878. Alessandro (asterlr) 53 105.06 130.77 13 24.53
6879. Aruzhan (arrrujjka) 53 37.20 45.69 5 9.43
6880. NoobMaster (anakwibu04) 53 105.66 121.57 36 67.92
6881. cal (achildslaughter) 53 103.93 127.60 20 37.74
6882. Rohan (rohanvit) 53 52.11 67.91 6 11.32
6883. zeyad (zeyad_yasser) 53 27.69 35.61 13 24.53
6884. Elizabeth (elizabethjulia) 53 44.25 61.65 5 9.43
6885. Anjali (lily2001) 53 63.10 79.69 20 37.74
6886. Ankit (ankit_chauhan) 52 69.04 86.35 15 28.85
6887. ali-goes (alibookie) 52 85.91 117.12 15 28.85
6888. Neanderthal (alacrity95) 52 127.41 170.60 27 51.92
6889. abindev (abindev) 52 31.78 41.86 7 13.46
6890. Julia (348753021) 52 117.41 139.09 33 63.46
6891. Duc (maitheduc2002) 52 38.86 46.84 4 7.69
6892. Ma (mahyunyi) 52 72.39 92.00 12 23.08
6893. Onii-Chan (lowtall2006) 52 98.45 116.52 22 42.31
6894. loungecore (loungecore) 52 98.76 116.52 21 40.38
6895. lior (liorlubek) 52 58.84 78.33 10 19.23
6896. LemonCatTAT (kiddie_sallie) 52 95.14 112.34 16 30.77
6897. Kermilian Nguyen (kermilian... 52 59.22 75.08 10 19.23
6898. Sadi (kandeemusic) 52 83.08 103.97 21 40.38
6899. Suntery (jennk1) 52 59.26 71.39 9 17.31
6900. Henrik (iupgrade) 52 95.94 116.15 22 42.31
6901. Icchan (icchan84) 52 73.61 92.15 13 25.00
6902. mr.hogsman (hogsman) 52 95.88 126.36 23 44.23
6903. Henrique (henri3287) 52 45.84 56.94 3 5.77
6904. Greg (gregdahwhale) 52 86.42 108.14 13 25.00
6905. God (godlevel) 52 85.32 102.04 43 82.69
6906. Elliot (girtholomew) 52 69.16 78.80 10 19.23
6907. tyenavatyen (zombiewgoku77) 52 118.05 148.84 31 59.62
6908. Zelalem (zolamk) 52 71.19 85.24 44 84.62
6909. Matthew (zannon23) 52 90.32 108.55 14 26.92
6910. Yutio (yutio) 52 48.88 58.20 3 5.77
6911. vega (xxav) 52 75.12 94.39 11 21.15
6912. Ivan (xaboff) 52 51.03 66.11 8 15.38
6913. Mawon (wonlee) 52 90.76 109.45 19 36.54
6914. ▬|═══ﺤ (vikas112) 52 56.40 69.92 4 7.69
6915. TOH (tohjh) 52 79.16 88.53 22 42.31
6916. twitter.com/jidoreuu (tfuef... 52 124.15 149.30 34 65.38
6917. TcJon (tcjon) 52 49.52 66.33 5 9.62
6918. Nicholas (t0903591) 52 82.99 98.44 10 19.23
6919. Sid (sxd_ss) 52 70.14 88.88 13 25.00
6920. a (stanrude) 52 68.41 82.05 11 21.15
6921. sfairat (sfairat) 52 55.24 63.56 6 11.54
6922. shashi (sekhar184131) 52 81.38 98.42 13 25.00
6923. Scar (scarskald) 52 66.64 88.05 15 28.85
6924. Saurabh (saurabh002) 52 61.74 68.98 12 23.08
6925. Corentin (risemu) 52 80.36 96.49 9 17.31
6926. ダル (rex_rex) 52 75.80 102.57 15 28.85
6927. John McCarthy (providerone) 52 102.83 118.87 25 48.08
6928. PickleCork (proogle_can) 52 81.82 96.34 16 30.77
6929. PracticeTouch (practicingto... 52 48.31 61.34 2 3.85
6930. J (petalss) 52 67.98 84.54 11 21.15
6931. pathhologic (pathhologic) 52 101.27 141.13 23 44.23
6932. Parsa (parsasq) 52 55.49 70.14 9 17.31
6933. atoms (overblown) 52 67.41 81.64 27 51.92
6934. nope251 (nope251) 52 60.36 72.92 5 9.62
6935. Ian (nelson_kempkey) 52 106.04 133.29 17 32.69
6936. Morgan (morgbot) 52 109.06 139.30 26 50.00
6937. Morgan (morgansoares6) 52 70.41 93.60 9 17.31
6938. Morad (morad_the_beast) 52 70.52 80.61 11 21.15
6939. Ben (meh_guy) 52 109.51 128.84 34 65.38
6940. Fionalee (fionalee) 52 90.94 107.70 16 30.77
6941. Tony (feetiswhynocaps) 52 90.09 112.37 19 36.54
6942. lillian (fartgaret) 52 80.35 127.53 20 38.46
6943. Eujean (eujean) 52 103.06 119.70 26 50.00
6944. george (doctoras) 52 98.31 121.16 26 50.00
6945. Delphie (delphie_) 52 106.44 127.60 27 51.92
6946. nhim (chikiro) 52 62.88 83.20 7 13.46
6947. max (chaxmase) 52 78.13 97.32 15 28.85
6948. Ivan (breadguru) 52 51.62 61.47 7 13.46
6949. Minh (blue002) 52 53.51 60.69 9 17.31
6950. blendin (blendin11) 52 90.65 109.48 12 23.08
6951. Batian (batiti51) 52 67.69 81.84 10 19.23
6952. BARAA (barrettshot) 52 97.50 113.90 16 30.77
6953. Ayokk (ayokk) 52 83.10 110.76 10 19.23
6954. Jongwon (aviationchief) 52 90.67 121.04 45 86.54
6955. ashalisalamdanam (ashalisal... 52 84.76 96.24 16 30.77
6956. Jako (frafdothehero) 51 76.89 93.34 10 19.61
6957. Fametime (fametime) 51 126.59 166.10 34 66.67
6958. Elie (eliepr0) 51 117.57 142.10 24 47.06
6959. Doge (dopeydoge) 51 79.99 104.19 15 29.41
6960. Daniel (dna89) 51 70.14 85.58 14 27.45
6961. Tristan (devyl) 51 83.12 95.54 13 25.49
6962. epic (densehelium) 51 72.33 84.11 16 31.37
6963. Akhil (deathstroke99) 51 64.01 75.90 9 17.65
6964. Dagger (daggerbxii) 51 66.80 86.83 12 23.53
6965. Radius (d4iry) 51 131.99 172.61 35 68.63
6966. criasier (criasier) 51 113.97 138.02 31 60.78
6967. Jason (cookja2000) 51 86.95 109.56 11 21.57
6968. Brandon (boredintern123) 51 127.60 151.95 40 78.43
6969. Blake (blaketrombone) 51 84.26 108.56 19 37.25
6970. bioboy246 (bioboy246) 51 105.35 131.73 23 45.10
6971. Bekzodbek (bekzod003) 51 44.17 63.11 12 23.53
6972. owen (beemochop) 51 67.98 83.75 6 11.76
6973. Badal Babu (bcube_nimble) 51 93.90 106.78 19 37.25
6974. leon (bangingmyheadonthewall) 51 62.65 83.51 8 15.69
6975. heck (aw_heck) 51 38.89 53.45 6 11.76
6976. Ava (ava_gina) 51 60.38 69.62 4 7.84
6977. Darkhan (zhora577) 51 44.09 68.11 3 5.88
6978. Delbert (zeckxel) 51 71.71 83.87 15 29.41
6979. Yami (yamiph) 51 108.10 145.23 33 64.71
6980. Ryan (xxhiny) 51 110.05 125.01 25 49.02
6981. Jaris (xersai) 51 98.43 123.69 21 41.18
6982. asphyxia (wylx) 51 65.44 93.04 12 23.53
6983. William (wwuhoo) 51 75.85 94.00 14 27.45
6984. Vyc (vyctor661) 51 93.70 115.49 17 33.33
6985. Isaak (verysexyman) 51 51.21 66.12 5 9.80
6986. Ernesto (venkinta) 51 86.14 103.46 21 41.18
6987. Asto (ukikunz) 51 113.19 139.74 26 50.98
6988. Teun (typingthunder) 51 48.63 57.89 2 3.92
6989. consistently inconsistent (... 51 91.54 124.48 18 35.29
6990. Kinst (swiftens) 51 89.68 110.73 16 31.37
6991. Stevie (stevie_thee_shep) 51 99.82 130.06 24 47.06
6992. Chaerity (ssamurai) 51 88.36 101.99 14 27.45
6993. Vela (somkungza) 51 78.52 99.25 15 29.41
6994. sofa (sofaaa) 51 98.39 129.19 15 29.41
6995. Chad (sixpacksexy) 51 100.92 119.79 16 31.37
6996. mosho (sidosido) 51 85.39 102.59 12 23.53
6997. Shin (shinfx) 51 87.44 106.58 20 39.22
6998. Shayan (shanoo92) 51 63.38 83.59 26 50.98
6999. MEOW (an66) 51 119.74 138.91 29 56.86
7000. Alex (alex_mingguk) 51 73.27 95.76 13 25.49
7001. aleph (alephyphen) 51 106.87 129.77 21 41.18
7002. ahmed (ahmedmadgy711) 51 61.45 77.19 15 29.41
7003. Adam (adumbsun) 51 101.63 134.43 23 45.10
7004. adrianna (adriannna) 51 84.06 115.52 8 15.69
7005. Abu Shaikh (abu_nibir) 51 67.46 78.11 11 21.57
7006. Albert (abt8601) 51 96.62 113.54 23 45.10
7007. 𝔽₃₁ (2802) 51 104.78 124.05 30 58.82
7008. Steve (lehoangkhang9) 51 76.22 89.88 15 29.41
7009. Michaiah (pig101) 51 62.93 76.66 13 25.49
7010. Jai (jaijoshi) 51 59.39 73.56 5 9.80
7011. IdkFreaky (fs_frenchfries77) 51 66.55 76.20 11 21.57
7012. Minate (minate) 51 53.24 64.44 4 7.84
7013. Zi Liang (pohziliang) 51 57.97 71.58 11 21.57
7014. Eric (mainsterr) 51 73.60 99.37 30 58.82
7015. andrea (lotta98) 51 64.73 78.07 10 19.61
7016. Kush (kushtek) 51 44.37 64.78 11 21.57
7017. Kunal (kunal299) 51 76.08 94.11 15 29.41
7018. Filip (keyboardwarrior772) 51 97.87 133.91 18 35.29
7019. Jimmy (jx297) 51 103.59 117.21 24 47.06
7020. Julian (julianalex2307) 51 92.63 129.17 21 41.18
7021. JuanimelsPH (juanimels) 51 85.92 103.86 9 17.65
7022. James (jpnjpn6) 51 87.48 109.54 22 43.14
7023. Jeff (jooffy) 51 61.42 79.18 9 17.65
7024. Melchorio (jcquints) 51 95.47 113.62 18 35.29
7025. jamilxt (jamilxt) 51 60.96 73.84 14 27.45
7026. Jamie (jamiegre) 51 114.59 141.98 25 49.02
7027. Isak (isapan) 51 92.82 110.48 18 35.29
7028. The Russian (imdarussian) 51 74.72 89.34 14 27.45
7029. Jack (hyydenjakcz) 51 80.51 99.72 12 23.53
7030. ばにらー tired goodby... 51 123.37 177.82 21 41.18
7031. Hitendra (hitendra) 51 72.68 96.01 37 72.55
7032. zhz (haohauz) 51 126.73 156.22 35 68.63
7033. shmoney (gupty_gang) 51 73.37 87.11 13 25.49
7034. nanashi (greenjohnny135) 51 76.69 101.72 9 17.65
7035. Chikin (sailestial) 51 92.33 115.78 18 35.29
7036. Safi (safiikram) 51 44.56 55.00 5 9.80
7037. beans (rlbeans) 51 86.22 106.81 19 37.25
7038. Raghav (raghavlaad) 51 70.77 91.80 13 25.49
7039. Pro (progeorge123) 51 100.13 131.70 24 47.06
7040. PoopBug (poop_bug) 51 93.80 110.58 19 37.25
7041. Phoenix (phoenixwolfer) 51 103.30 132.55 26 50.98
7042. slow account (pasta2) 51 135.47 167.58 21 41.18
7043. pepperooni (papipepperooni) 51 84.85 100.56 22 43.14
7044. Opecks! (opecks) 51 82.67 99.03 19 37.25
7045. nehal (nehal1337) 51 115.13 134.72 28 54.90
7046. Joshua (mrteeentee) 51 111.15 137.62 23 45.10
7047. Mr. (mrasp) 51 61.74 78.31 13 25.49
7048. anya (monarchunder) 51 95.90 124.26 29 56.86
7049. Tenebrific (molkri) 51 92.55 107.25 17 33.33
7050. Peetor (milleniumpoo) 51 86.04 114.36 13 25.49
7051. Paolo (mcnugget25) 51 117.05 137.82 32 62.75
7052. Max (maxma_69) 51 109.26 139.68 32 62.75
7053. matan (matanselig) 51 27.31 34.56 6 11.76
7054. Marwoleath (marwoleath) 51 76.49 90.97 7 13.73
7055. OmaR (mandoo120) 51 51.77 63.83 7 13.73
7056. SapCK (sapck) 50 99.91 122.21 21 42.00
7057. Rodrigo (rugoso) 50 96.80 113.73 22 44.00
7058. Isabella (refundmybirth_21) 50 60.97 79.86 12 24.00
7059. pulkit (pulkitb) 50 31.04 46.89 4 8.00
7060. lu (prymuslu) 50 90.70 106.76 16 32.00
7061. Mihir (plibither8) 50 82.56 95.41 20 40.00
7062. ben (panda_jellyfam) 50 97.44 117.27 25 50.00
7063. PWian racer from chennai (o... 50 38.96 62.84 6 12.00
7064. nostango (nostango) 50 79.68 93.83 16 32.00
7065. Noridomi (noridomi) 50 86.96 102.83 14 28.00
7066. ninja (ninja_op) 50 86.74 104.12 20 40.00
7067. Nick (nick_txt) 50 93.53 120.25 23 46.00
7068. TYPERACER (natem135) 50 96.73 126.65 17 34.00
7069. Naga (nagaspar) 50 56.12 81.07 14 28.00
7070. Narasimha Nadh (nadh_7) 50 70.93 86.99 15 30.00
7071. Muhammad (muhammad95959) 50 44.84 52.48 7 14.00
7072. MuffinMike (muffinmike) 50 91.06 108.87 13 26.00
7073. Martin (mpgo13) 50 86.62 110.34 15 30.00
7074. Matthew (mooncatcher) 50 73.63 96.51 9 18.00
7075. Lloyd (milanh) 50 115.19 139.21 31 62.00
7076. Steven (melkies) 50 80.94 90.94 16 32.00
7077. mats (matserino) 50 49.84 65.02 6 12.00
7078. arimauta (arimauta) 50 43.28 56.71 1 2.00
7079. Afaq (afaqkhan) 50 85.17 103.64 14 28.00
7080. :] (acision) 50 78.38 93.71 15 30.00
7081. 2Slow (2slowkevin) 50 38.96 48.24 5 10.00
7082. congrats on 1M club (23kuzn... 50 113.52 154.39 27 54.00
7083. Katherine (kat5801) 50 52.65 64.00 1 2.00
7084. SirAmateur (namelessamateur) 50 63.69 78.42 10 20.00
7085. Ahmad (dr_ahmad) 50 42.55 53.38 5 10.00
7086. Protek (protekripper) 50 38.30 48.00 5 10.00
7087. chaaruzu (toishii) 50 63.55 82.57 5 10.00
7088. Nate (jazzybanana) 50 50.19 63.92 9 18.00
7089. Yuvraj (yuvraj_sharma) 50 64.06 79.40 12 24.00
7090. DumbPeanut (dumb_peanut10) 50 45.40 56.10 4 8.00
7091. Ankur (slownsteady108) 50 54.29 64.97 9 18.00
7092. TheStyne (fixinit1) 50 87.63 120.50 17 34.00
7093. R0merol (farisfaikar_r) 50 73.40 88.74 16 32.00
7094. yossi (exseibar) 50 57.21 72.88 3 6.00
7095. Mohit (dumb_avocado) 50 51.99 65.89 5 10.00
7096. Duc (dukenhu) 50 92.60 108.83 16 32.00
7097. ddo (detdetjo) 50 81.26 94.55 15 30.00
7098. yop (desuperslayer) 50 55.21 71.98 11 22.00
7099. Name (defaultname) 50 79.63 111.87 15 30.00
7100. don (dandhi) 50 85.70 102.46 20 40.00
7101. Stoian (creep_fire97) 50 102.34 117.42 15 30.00
7102. Connor (congoman) 50 47.47 59.95 4 8.00
7103. Abhishek (coderguy1) 50 65.63 76.68 7 14.00
7104. chlovis (chlovis) 50 28.02 41.81 7 14.00
7105. Tilt (brianrk25) 50 72.05 85.73 49 98.00
7106. BOBA (bobavfett) 50 54.58 66.60 6 12.00
7107. G B (believeb) 50 27.09 37.49 33 66.00
7108. китаец (artur_) 50 74.72 86.59 13 26.00
7109. Arslan (arslan_03) 50 69.23 86.32 11 22.00
7110. Zayden (zayden_blaze) 50 91.27 121.91 18 36.00
7111. zeroguard (z3r0gu4rd) 50 46.83 55.81 7 14.00
7112. Yung (yungmyg) 50 39.36 48.94 4 8.00
7113. Mandom (xristos980) 50 69.15 80.17 10 20.00
7114. ℱ𝔯𝔢𝔢𝔡𝔬𝔪... 50 83.93 102.78 13 26.00
7115. rutvik (wanna_be_pro) 50 51.34 63.61 3 6.00
7116. Tempest (tempestreu) 50 58.07 71.47 10 20.00
7117. Harri (teddybaker) 50 53.22 63.67 7 14.00
7118. Tadas (tadasmak) 50 76.89 91.00 10 20.00
7119. Sylptic (sylptic) 50 98.74 118.60 19 38.00
7120. صنديد (sundid) 50 91.81 114.46 14 28.00
7121. DK ALONE (speed_typing) 50 47.49 62.38 4 8.00
7122. ¯\_(ツ)_/¯ (some_guy4444) 50 91.21 110.26 16 32.00
7123. Tommy (snoopyisop) 50 105.03 148.25 21 42.00
7124. slower than s2000 (slowpacito) 50 140.91 173.35 40 80.00
7125. simon (simonhor1) 50 91.04 118.59 16 32.00
7126. Shreyas (shreyas_jani) 50 74.38 93.45 15 30.00
7127. deceptive (sergisreal) 50 93.92 109.54 16 32.00
7128. ks (sempiedram) 50 87.85 108.68 11 22.00
7129. Maffin (m4ff1n) 50 83.47 98.10 13 26.00
7130. Lepry (leprykun) 50 63.99 82.98 17 34.00
7131. Y Lee (leengau) 50 58.82 77.50 7 14.00
7132. Stephen (laddlez) 50 81.56 109.76 13 26.00
7133. 𝐊 𝐑 𝐀 𝐊 𝐄 ... 50 95.77 113.20 19 38.00
7134. Kevin (kimchioncolemak) 50 96.01 109.53 21 42.00
7135. Kaushik (kaushik_nna) 50 89.65 107.14 18 36.00
7136. ジョーヨ (joeyo) 50 107.11 123.30 24 48.00
7137. joanne (joannekim63) 50 92.89 109.95 23 46.00
7138. Jose (jduran7) 50 80.34 103.63 14 28.00
7139. Jake (jdogcat1) 50 62.28 79.84 9 18.00
7140. Jai (jaideepjr) 50 105.54 122.79 16 32.00
7141. Instinct (instinct1) 50 96.16 130.93 20 40.00
7142. Enzo (hypertxters) 50 94.19 115.63 25 50.00
7143. Huy (huyho1207) 50 90.08 118.18 27 54.00
7144. hossameldien (hossam23177) 50 59.83 75.25 9 18.00
7145. haidanos (haidanos) 50 79.98 94.44 12 24.00
7146. H4ndss (h4ndss1) 50 84.38 105.87 16 32.00
7147. Gaurav (gauravvv2204) 50 51.74 64.50 4 8.00
7148. Joseph (gauntdarkness) 50 79.94 112.32 7 14.00
7149. Mach 20 (mach20) 49 63.50 80.62 10 20.41
7150. Lucifer (lucifer_kas) 49 88.36 116.04 23 46.94
7151. repyx (lordgado) 49 51.27 69.40 7 14.29
7152. Lilac (lilaclily) 49 21.91 28.51 9 18.37
7153. Learn to pro (learntopro) 49 63.26 73.66 8 16.33
7154. leaf (leafblower174) 49 103.59 139.80 32 65.31
7155. Eduardo (laloaguirre720) 49 64.65 80.95 14 28.57
7156. Q (kwhan) 49 103.38 124.09 27 55.10
7157. jz (kokosha) 49 85.34 107.02 19 38.78
7158. kiv (kivv) 49 86.85 108.88 20 40.82
7159. kazden (kazdenetienne) 49 82.92 105.86 18 36.73
7160. kalxoz (kalxoz97) 49 65.14 76.15 11 22.45
7161. Tam (josephtambmt) 49 62.03 78.99 8 16.33
7162. John (johnzeds) 49 77.38 95.20 8 16.33
7163. Job (job007) 49 104.33 122.28 22 44.90
7164. Ryan (jellyzerg) 49 90.81 105.96 21 42.86
7165. FeelsGoodMan (jeffryvanessa1) 49 60.61 74.19 17 34.69
7166. Jorge (jdominguezzz) 49 84.22 104.45 17 34.69
7167. Jakm (jahkm) 49 47.89 60.92 8 16.33
7168. Myro Bryan (iskwagong) 49 93.04 113.96 19 38.78
7169. TypingGuy (iramus) 49 97.98 121.56 16 32.65
7170. ABDELLATIF (hktitof) 49 61.26 79.90 11 22.45
7171. Himanshu (himanshukpr) 49 42.69 50.83 4 8.16
7172. haquaman_workman (haquaman_... 49 64.40 75.09 9 18.37
7173. ILikeCars07 (gruhith) 49 86.25 97.81 12 24.49
7174. baconator2685 (generic_exe) 49 81.62 95.19 16 32.65
7175. Gianni (general_patches) 49 84.34 96.13 21 42.86
7176. Non-quit acc (escri) 49 130.01 146.04 32 65.31
7177. epigee (epigee) 49 105.37 128.88 17 34.69
7178. Enclosed (enclosedletter) 49 85.02 103.09 17 34.69
7179. ellie (ellmell13) 49 44.98 58.14 4 8.16
7180. HMan (edhac) 49 98.06 123.46 16 32.65
7181. Dziobak (dziobak) 49 92.59 118.74 15 30.61
7182. Dumi (dumizeu) 49 43.92 55.47 6 12.24
7183. Dontmindme (dontmindmepls) 49 50.62 62.40 5 10.20
7184. Jay (dflkn4900s4) 49 82.99 99.21 16 32.65
7185. DegageSpoon9280 (degagespoo... 49 53.11 63.13 6 12.24
7186. Domo (dasuxosu) 49 85.71 116.49 20 40.82
7187. Jake (darkxfade240) 49 79.43 93.73 12 24.49
7188. Coru (coru12) 49 83.50 101.33 15 30.61
7189. AHHH (chuckles1357) 49 88.83 110.67 11 22.45
7190. Ryan Smith (chickenhelmet) 49 71.29 92.21 16 32.65
7191. asdasd (chaizhengwen) 49 89.86 107.73 16 32.65
7192. Celestrom (celestrom) 49 70.22 88.92 11 22.45
7193. Carly (carlytarantino) 49 80.59 100.17 11 22.45
7194. Typinator (candymn3) 49 100.75 124.45 17 34.69
7195. Sml (cactusman215) 49 96.79 109.80 18 36.73
7196. Bogoya (bogoya) 49 74.76 88.06 12 24.49
7197. bobs (bobsbee) 49 33.91 49.31 4 8.16
7198. Noah (bobothechimpanzee) 49 87.17 100.86 15 30.61
7199. MM (blunderingpeon12) 49 82.81 99.86 12 24.49
7200. Bryan (blcm123) 49 108.64 120.88 21 42.86
7201. big (bigfudge14) 49 95.17 113.86 23 46.94
7202. Beheshta (beheshta) 49 59.10 74.48 7 14.29
7203. Marikyuun (bananaking121) 49 110.29 154.91 32 65.31
7204. Pushkar (azuloto) 49 65.44 77.81 9 18.37
7205. Ayush (ayush_1511) 49 67.34 80.07 18 36.73
7206. aasdfa (awid) 49 90.29 104.59 16 32.65
7207. 𝕬𝖛𝖊𝖗𝖆𝖌... 49 83.68 111.21 41 83.67
7208. Ahnaf Shahriar (asifthegreat) 49 90.90 110.00 21 42.86
7209. sammysamm (sammysamm) 49 77.68 94.92 12 24.49
7210. Rully (rully_monas) 49 72.35 94.39 11 22.45
7211. Rachael (rachaelpoedia) 49 58.83 68.90 7 14.29
7212. zetria (primalknight) 49 143.50 169.47 33 67.35
7213. F*ck Zelenskyy (overmake) 49 82.81 99.26 18 36.73
7214. Orblil (orblil) 49 68.41 97.62 13 26.53
7215. Glenn (nnelg) 49 98.81 133.27 7 14.29
7216. FREE PALESTINE (needlepaws) 49 83.52 94.36 19 38.78
7217. Brett (mrmahn) 49 110.64 125.97 33 67.35
7218. may9 (may9) 49 60.47 71.84 12 24.49
7219. Mati🅱IKL (mati2ooo) 49 97.95 116.03 20 40.82
7220. Normal (marlon_caleb) 49 72.31 87.34 10 20.41
7221. Arlene (arlenieeweenie) 49 132.39 165.75 35 71.43
7222. Argon (argon273) 49 79.83 112.84 13 26.53
7223. John (apathy_incarnate) 49 63.30 76.19 11 22.45
7224. Antony (antonleghost) 49 89.37 116.44 15 30.61
7225. Ankit (anktwd) 49 50.12 57.62 2 4.08
7226. (altroq) 49 90.23 111.20 17 34.69
7227. Adrian (adrianlee196) 49 117.16 133.24 26 53.06
7228. Nicolas (acut3) 49 64.80 81.89 9 18.37
7229. CrazyNeighbor (5qcheng007) 49 100.78 121.85 20 40.82
7230. andrew (gorillaman9k) 49 67.28 82.64 30 61.22
7231. pratham (pratham_s_k) 49 59.31 67.07 4 8.16
7232. Kendall (fishstix_) 49 79.30 97.33 15 30.61
7233. Priyanshu (_priyanshu_) 49 56.54 67.30 10 20.41
7234. Ziad Zaki (ziadzaki) 49 90.83 133.52 23 46.94
7235. adamz (zhaanga09) 49 79.58 100.71 17 34.69
7236. Shayan (zackroos) 49 70.26 91.23 9 18.37
7237. Tuomo (ystavani_marko) 49 66.14 79.55 11 22.45
7238. Yordanes (yordanes) 49 39.14 48.74 1 2.04
7239. __8k.11Ine_ (yassine999) 49 68.59 87.49 11 22.45
7240. savannah (wiggywonka) 49 100.51 118.85 17 34.69
7241. Gil (violetgil) 49 113.18 124.64 21 42.86
7242. Venderex (venderex) 49 94.43 139.23 25 51.02
7243. Vahid (vahidmoradpour) 49 35.41 43.39 0 0.00
7244. Mason (unelevate) 49 111.79 136.11 32 65.31
7245. TypingAway (typinggggggg) 49 84.57 99.95 15 30.61
7246. tragiƘ (tragik) 49 95.80 121.53 45 91.84
7247. Fran (tippidytap) 49 74.42 94.95 14 28.57
7248. Tipper_Typer (tipper_typer) 49 77.81 100.87 13 26.53
7249. Lawrence (thunder_drain) 49 78.05 103.66 12 24.49
7250. Kerem (tearsfears) 49 67.01 81.93 8 16.33
7251. Pragyan (swordfish999) 49 76.30 101.92 7 14.29
7252. dozingoff (stopcomparing) 49 99.05 118.45 22 44.90
7253. Samuel (spiriteater) 49 84.95 96.81 15 30.61
7254. Sophia (sophianotfound) 49 66.02 93.43 8 16.33
7255. yeet to space (sn00py1310) 49 72.69 97.84 17 34.69
7256. Skyyy06 (skyyy06) 49 99.52 121.67 17 34.69
7257. SH (shrony) 49 64.60 75.41 11 22.45
7258. Shawna (shawnanic856) 49 93.97 111.89 17 34.69
7259. Sebastian (sev___) 49 104.42 136.40 20 40.82
7260. Danyl (seataco) 49 56.09 76.80 16 32.65
7261. tstats[_jamin_] (_jamin_) 48 85.27 102.65 25 52.08
7262. zatoichi (zatoishwan) 48 114.17 143.04 21 43.75
7263. Yash (yomiiiii) 48 68.18 94.89 11 22.92
7264. Jeffrey (weijini) 48 74.82 92.32 8 16.67
7265. h (vondo28) 48 82.62 108.53 9 18.75
7266. Vladislove (vladislove) 48 94.51 108.65 10 20.83
7267. Vishal (vishalsaxena) 48 50.88 63.70 4 8.33
7268. Jared (varmitz1) 48 82.19 103.45 14 29.17
7269. Vab (vaheebee) 48 93.36 104.27 15 31.25
7270. UnreliableSpare (unreliable... 48 63.49 77.75 9 18.75
7271. Pere (unbreaksee) 48 90.65 104.53 15 31.25
7272. roni raz (unbelieveable) 48 117.17 138.36 25 52.08
7273. Tom (tvdb2003) 48 54.30 65.33 3 6.25
7274. Turbo (turbo_typist) 48 90.98 142.68 15 31.25
7275. DatGG (tristanko) 48 57.61 75.52 4 8.33
7276. touchtypepracticer69 (touch... 48 85.79 97.33 12 25.00
7277. Speed (thenimblefinger) 48 120.29 166.50 22 45.83
7278. Kunal (thegamerkunal) 48 74.04 94.75 10 20.83
7279. Andy (tempestxciii) 48 74.91 92.10 29 60.42
7280. Sugeeth (sugeeth14) 48 77.91 110.96 14 29.17
7281. ssshanto (ssshanto) 48 116.03 150.32 21 43.75
7282. Srean (sreantsm) 48 34.24 46.73 3 6.25
7283. Sphage (sphage) 48 91.82 117.10 18 37.50
7284. Taslima (smita123) 48 41.17 52.87 27 56.25
7285. Skewlankus (skewlankus) 48 62.34 79.15 11 22.92
7286. SilicGK (silicgk) 48 89.76 121.79 12 25.00
7287. hehe (shindo333) 48 86.58 100.18 20 41.67
7288. SackHeadSam (sackheadsam) 48 44.07 63.52 4 8.33
7289. Ryan (ryanhz) 48 91.23 113.77 18 37.50
7290. ron (ronj23) 48 75.50 89.81 9 18.75
7291. ronaldo (ronaldo_gao) 48 100.88 131.04 18 37.50
7292. Remy (rmds_dln) 48 84.39 121.02 23 47.92
7293. Acceptance (riskirw) 48 110.90 130.05 27 56.25
7294. Rido (ridoho) 48 63.50 82.35 14 29.17
7295. Joash (raz3rdarkkill) 48 79.91 98.60 13 27.08
7296. James (raking123) 48 71.88 89.41 11 22.92
7297. Quinco (quinco) 48 45.83 61.29 5 10.42
7298. Praveen (praveen3791) 48 84.72 98.48 11 22.92
7299. Simon (plantsdragon) 48 59.25 73.54 11 22.92
7300. Chris (papadroop1) 48 119.52 144.28 23 47.92
7301. Minnot (omar10211) 48 60.66 80.63 9 18.75
7302. Ogg (ogg_) 48 75.30 89.29 16 33.33
7303. NU (nusensei) 48 103.07 133.53 26 54.17
7304. Niv (nivkapadia) 48 62.36 77.66 13 27.08
7305. Kevin (niveik) 48 94.78 126.50 17 35.42
7306. nikolas (nicknt) 48 71.32 87.21 8 16.67
7307. Amir (nao.paladin@yahoo.com) 48 102.00 121.34 24 50.00
7308. MsStPeter (msstpeter) 48 74.48 91.51 14 29.17
7309. mr (mr_pineapple069) 48 68.17 86.05 17 35.42
7310. BOB (mroglan) 48 84.51 96.49 12 25.00
7311. MRBC (mrbc) 48 57.90 76.42 6 12.50
7312. MrPoop (mother_lover) 48 63.11 77.28 10 20.83
7313. mgamble (mgamble) 48 78.73 96.41 10 20.83
7314. Mohammed (md_islam) 48 78.36 90.68 12 25.00
7315. Andrew (mcentag) 48 112.89 140.75 20 41.67
7316. Marius (mariukas_) 48 78.06 88.41 10 20.83
7317. lithium's after image (lith... 48 127.09 148.68 30 62.50
7318. Matt (lightning_mcqueef) 48 114.57 136.02 26 54.17
7319. KA (keshavgrwl96) 48 81.35 104.98 7 14.58
7320. Ken (kenrender) 48 42.21 50.38 3 6.25
7321. Kc (kchehez) 48 75.10 94.90 6 12.50
7322. June (ju_1304) 48 80.30 99.19 10 20.83
7323. suns (jesse_kim) 48 67.08 86.23 20 41.67
7324. Jam (jamtri) 48 114.19 134.91 26 54.17
7325. Winter (jamesbandit) 48 52.11 62.60 3 6.25
7326. Jai (jais) 48 83.61 99.55 12 25.00
7327. Jack (jack2905) 48 94.84 117.44 18 37.50
7328. Daniel (itypekindaquick) 48 64.71 76.29 9 18.75
7329. Invictus (invictus69) 48 97.73 108.84 15 31.25
7330. MKarma (im69d) 48 42.38 53.25 7 14.58
7331. Ilana (ilana12) 48 57.72 68.22 6 12.50
7332. hyhu (hyhy233) 48 78.12 91.45 11 22.92
7333. arache (howeyzeh) 48 73.07 105.12 15 31.25
7334. BNYKGDT (hopelessly_serious) 48 92.94 117.18 19 39.58
7335. Teng (hentaiba3) 48 74.50 90.18 24 50.00
7336. Hau (hauhauh) 48 73.54 86.29 15 31.25
7337. Hadise (hadise) 48 123.30 161.15 31 64.58
7338. Abdullah (ghadanfar) 48 96.33 119.45 17 35.42
7339. Gridcoin (gabeneweii) 48 113.33 158.10 30 62.50
7340. Leon (flopasd) 48 82.34 108.73 11 22.92
7341. Justin (flamingoed02) 48 108.30 122.62 21 43.75
7342. Fiona (fiona55) 48 88.15 104.17 13 27.08
7343. Nik (fastesttyper101) 48 70.63 95.02 7 14.58
7344. Nathan (el_cap_i_tan) 48 89.05 102.98 23 47.92
7345. Edmund (edmundtyw1) 48 115.60 146.08 39 81.25
7346. donkeysbanana (donkeysbanana) 48 83.83 105.76 18 37.50
7347. Dylan (dmc71298) 48 103.60 129.06 27 56.25
7348. Daniel (dansku01) 48 77.01 101.93 16 33.33
7349. cubeian (cubeian) 48 59.09 74.41 5 10.42
7350. CrpL (crippleed) 48 89.81 108.62 19 39.58
7351. Captain (bobispro2) 48 110.13 124.54 25 52.08
7352. Colin (blank9167) 48 114.35 141.20 26 54.17
7353. Jherome Eduard (bl4nkk) 48 56.07 73.22 5 10.42
7354. Soog (beez23) 48 93.50 105.05 11 22.92
7355. auerabreak (auera) 48 81.98 98.06 11 22.92
7356. A beautiful kind of strange... 48 57.93 74.74 8 16.67
7357. Luis Victor (anubis_9) 48 74.25 86.48 11 22.92
7358. Amritesh (anodyne12371) 48 36.07 51.13 2 4.17
7359. amin (anmiimna) 48 60.34 73.40 8 16.67
7360. Alex (amarcus0100) 48 52.65 66.83 10 20.83
7361. alfie (alfieisback) 48 73.79 90.07 15 31.25
7362. Aleksa (alexample) 48 80.08 93.30 16 33.33
7363. Aidin (aidin177) 48 110.38 129.08 21 43.75
7364. Acnologia (acnologia_123) 48 88.45 96.83 9 18.75
7365. Frederich (acerx032) 48 87.41 106.71 18 37.50
7366. tstats[0anonymous0123] (0an... 48 56.11 69.40 5 10.42
7367. C4ll Me Sir (ssidd) 48 83.10 99.74 7 14.58
7368. LaxiMax (laximax) 48 68.06 86.41 17 35.42
7369. Noah (holyrhombi) 48 67.56 80.30 13 27.08
7370. toby (tobyliekscows) 48 76.33 102.62 16 33.33
7371. Luis (luggibuggi) 48 68.55 86.57 7 14.58
7372. Apotekarne1337 (apotekarne1... 48 57.60 76.07 6 12.50
7373. Panos (panospask) 48 58.95 76.12 13 27.08
7374. Alpuds (alpuds) 47 78.09 102.76 16 34.04
7375. alis (aliss) 47 86.82 98.01 14 29.79
7376. Georgios (aktorion) 47 47.83 56.80 2 4.26
7377. J (akntmzjtj) 47 104.59 130.52 24 51.06
7378. Adam (acassidy24) 47 71.11 90.39 11 23.40
7379. Suvan (1080pixelz) 47 51.60 66.04 4 8.51
7380. alberta (albertaa) 47 68.89 83.61 13 27.66
7381. Kendii_Man (kendii_man) 47 79.04 100.04 28 59.57
7382. Swagata (bulets) 47 53.86 62.83 10 21.28
7383. Dhruv (dhruvmehta_409) 47 57.94 85.94 10 21.28
7384. Plus (mpurasu) 47 56.41 70.58 7 14.89
7385. Sagnik (shagzz_01) 47 60.82 77.90 8 17.02
7386. Lonmanbeast (lonmanbeast) 47 70.39 83.05 9 19.15
7387. Latif (lephant) 47 73.81 97.21 11 23.40
7388. Samuel (kyoka_sui) 47 73.86 91.01 6 12.77
7389. Wattsey (krwhlee15) 47 92.83 120.85 22 46.81
7390. krs (krss) 47 63.55 76.97 15 31.91
7391. KingBaby (kingzeroiii) 47 93.71 110.78 14 29.79
7392. Dawn (kidlatako) 47 39.33 50.51 5 10.64
7393. Kevin (kevzjhu) 47 107.54 131.16 18 38.30
7394. kamoo (k4moo) 47 68.38 82.15 9 19.15
7395. Jed (jedmedina) 47 81.13 112.14 11 23.40
7396. Jill (jconn00) 47 67.79 82.93 9 19.15
7397. JtG (jaylegee) 47 103.70 121.30 22 46.81
7398. Jackson (jacksonmississippi) 47 76.30 102.90 13 27.66
7399. itsKrish01 (itskrish01) 47 55.37 70.36 12 25.53
7400. gtg dinner (ijikman) 47 110.76 133.69 18 38.30
7401. Igor (igor2003) 47 70.74 88.92 11 23.40
7402. Qida (ieatpizza) 47 72.35 85.02 8 17.02
7403. Hari (hari_dev) 47 55.96 69.05 0 0.00
7404. Henrik (grimmzl) 47 60.87 73.04 12 25.53
7405. gc21 (giim_chyn) 47 92.42 115.53 17 36.17
7406. George (geogeorge456) 47 54.92 73.21 8 17.02
7407. zombie gaming (galaxybiscui... 47 83.23 105.32 17 36.17
7408. Don Kaboul (gabbaryamdak) 47 70.44 85.45 15 31.91
7409. .... (_otto_) 47 59.19 72.27 7 14.89
7410. Joy (_joy_) 47 65.94 80.34 8 17.02
7411. Nurzhan (_bakytov_) 47 68.60 85.27 13 27.66
7412. Giovanni (zombieagain) 47 56.30 67.89 3 6.38
7413. Zach (zchen717) 47 113.17 135.80 24 51.06
7414. yousuf (z3nko) 47 98.48 124.01 36 76.60
7415. Yoru (yoruu12) 47 59.34 68.29 5 10.64
7416. ♪╠¥ö§€ƒ╣♫ (ye... 47 80.89 99.01 15 31.91
7417. Garrick (yanawanas) 47 89.94 130.48 12 25.53
7418. clement (xortoise) 47 70.07 87.00 18 38.30
7419. William Vince (wvince02) 47 43.43 53.01 1 2.13
7420. Sapphire (wl23) 47 85.08 106.14 14 29.79
7421. Quibz (white_fire) 47 96.78 125.01 19 40.43
7422. weicer (weicer) 47 92.81 113.75 17 36.17
7423. WayLay (waylay17) 47 85.41 121.96 15 31.91
7424. Virt (virtue_raj) 47 68.91 78.75 10 21.28
7425. Vidit (vdop) 47 55.38 78.81 9 19.15
7426. Maw (typemaw) 47 95.82 118.29 4 8.51
7427. totaland (totaland) 47 62.97 75.38 8 17.02
7428. Chris (tomatohead21) 47 112.45 136.42 18 38.30
7429. Crackersontheshelf (taejung... 47 85.38 101.96 16 34.04
7430. HowToTypin9 (supergodnes) 47 70.78 91.14 11 23.40
7431. sprwhk (sprwhwk) 47 71.41 85.58 14 29.79
7432. Zoey (soeyzandiego) 47 101.92 126.17 19 40.43
7433. Stephen (slyspy) 47 49.54 65.64 1 2.13
7434. DuongForeverAlone (sieunhan... 47 97.16 108.80 17 36.17
7435. Joshua (shmucky) 47 122.61 137.88 24 51.06
7436. Shino (shinobami) 47 46.48 58.53 4 8.51
7437. Shiji (shiji_singh) 47 49.13 57.16 4 8.51
7438. Sherzod Nadirov (sherzod_5) 47 29.62 37.67 5 10.64
7439. Sarvang (sarlok393) 47 68.15 88.54 16 34.04
7440. Raviraj (rvrjpdhr) 47 54.35 75.26 10 21.28
7441. Jay (royjay) 47 61.56 78.11 8 17.02
7442. regen45 (regen45) 47 32.41 45.23 4 8.51
7443. Rishabh (rdmighty_i) 47 109.28 132.87 22 46.81
7444. RageRaptor (rageraptor) 47 49.28 57.18 3 6.38
7445. Kevin (popanto) 47 86.90 109.61 12 25.53
7446. naige (pnolan55) 47 46.41 56.33 4 8.51
7447. Chan (pizzx) 47 74.47 91.29 6 12.77
7448. Petar (petars) 47 147.81 192.88 30 63.83
7449. Flame (panutadk) 47 97.41 115.95 16 34.04
7450. Ore (orediamond) 47 127.41 153.94 30 63.83
7451. M (myles_jb) 47 101.78 124.37 20 42.55
7452. mw3m (mw3m) 47 55.14 68.65 4 8.51
7453. Doggy (mr_woofles) 47 73.50 113.18 14 29.79
7454. Mr_Mic (mr_mic) 47 74.88 93.92 13 27.66
7455. Priyansh (mrpriyansh) 47 61.24 71.20 7 14.89
7456. Mriganka (mriganka) 47 66.37 85.86 8 17.02
7457. Moishi (moishi) 47 84.10 102.73 14 29.79
7458. Mohammad (mohammad__) 47 68.29 90.05 15 31.91
7459. milki (milkepro) 47 59.49 85.99 9 19.15
7460. racist (milfed) 47 49.90 72.48 7 14.89
7461. Rostislav (mexanoz) 47 47.21 62.70 4 8.51
7462. Marina (marniass) 47 98.94 117.84 15 31.91
7463. Revolution (maqsoodwor) 47 21.50 33.55 8 17.02
7464. Fred (fredxster) 47 66.33 80.12 4 8.51
7465. Kamil (finessegod_) 47 78.23 100.02 12 25.53
7466. Masquerade (fidtzy) 47 47.82 58.84 6 12.77
7467. Eldritch (ficuno) 47 44.89 64.24 4 8.51
7468. nets in 4 (eridpnc) 47 99.02 125.06 20 42.55
7469. Eric (ericlauchiho) 47 62.55 79.71 8 17.02
7470. Dev (devkoli) 47 48.93 64.49 3 6.38
7471. Alyssa (destroyer090) 47 62.68 76.82 4 8.51
7472. Deepan (deepan_hacker) 47 41.96 49.96 0 0.00
7473. David (davers4) 47 78.77 110.18 13 27.66
7474. fish (danf1) 47 95.34 112.09 19 40.43
7475. chandara (chan92) 47 85.14 105.93 21 44.68
7476. Carlkristie (carlkristie) 47 41.65 56.32 7 14.89
7477. Millie (brunomarstm) 47 31.03 38.12 5 10.64
7478. Beedle (bernod) 47 58.77 76.64 8 17.02
7479. Epzilon (epzilonn) 46 137.12 163.22 38 82.61
7480. Edgar (edgarflorez) 46 38.79 48.94 3 6.52
7481. Dweeb (dweb) 46 76.30 94.48 22 47.83
7482. Eric (draydere) 46 101.48 115.04 14 30.43
7483. Accuracy (dozwolonymein) 46 80.49 98.83 11 23.91
7484. mike (doorman32) 46 95.79 117.62 20 43.48
7485. d'toe 😎😎😎😎 (det... 46 88.24 117.04 12 26.09
7486. Martin (demonakinale) 46 123.40 147.90 29 63.04
7487. Derriel (ddcj90) 46 56.61 68.83 9 19.57
7488. Need (damdebotush) 46 41.80 48.86 4 8.70
7489. Corn Philips (cornphilips) 46 81.59 101.27 15 32.61
7490. David (cmagic_f) 46 90.43 107.61 12 26.09
7491. Check (checkmunza) 46 83.02 100.23 11 23.91
7492. Steven (carnivorous_crustat... 46 31.41 43.04 3 6.52
7493. Julia (bunnimochi) 46 68.65 91.66 10 21.74
7494. Brian (brianyounq) 46 104.03 126.73 22 47.83
7495. Broll (billwong28) 46 79.89 93.43 11 23.91
7496. ARTAN (begaal97) 46 102.05 117.47 17 36.96
7497. Harshit (awpsun) 46 66.06 83.01 11 23.91
7498. Asnar (asnarsar) 46 33.94 54.33 5 10.87
7499. Ash (ashbacchus) 46 59.98 73.65 5 10.87
7500. ansendice (asendice) 46 67.51 88.62 10 21.74
7501. Pim (_pmirum) 46 92.60 108.15 18 39.13
7502. Emmy (_dadstype_) 46 83.60 103.24 12 26.09
7503. Ziobr (ziobr) 46 92.00 108.72 19 41.30
7504. Brohath (zevo100) 46 81.22 101.34 8 17.39
7505. Enzo (yujiro144) 46 53.98 67.15 6 13.04
7506. Sagar (xdronzer) 46 53.20 69.80 5 10.87
7507. xahriman (xahriman) 46 73.95 93.32 11 23.91
7508. wolfBream (wolfbream45) 46 122.41 139.13 29 63.04
7509. will_t (will_t) 46 125.05 150.82 26 56.52
7510. Wally101 (walrusboy101) 46 79.82 96.57 10 21.74
7511. Daddy D (vr00m_) 46 59.78 79.80 8 17.39
7512. Hans (ts6d) 46 77.61 94.56 13 28.26
7513. thomas (tmastri) 46 74.60 94.22 6 13.04
7514. Nathanael (tinkerer_nat) 46 82.28 102.93 12 26.09
7515. Tilly (tillyrose) 46 92.55 111.13 20 43.48
7516. Jitendra (techjittu) 46 49.86 61.77 5 10.87
7517. 誌綸 (tdog0507) 46 66.69 89.78 13 28.26
7518. Aboostedninja (talonabuser) 46 96.12 125.00 15 32.61
7519. sunil (sunilislaz) 46 46.08 74.78 6 13.04
7520. Suhas (suhaskurup) 46 87.53 101.81 13 28.26
7521. SPyofgame (spyofgame) 46 89.45 106.47 26 56.52
7522. spoon (spooderrr) 46 75.30 96.38 6 13.04
7523. Christian (speciial) 46 58.83 70.93 6 13.04
7524. BOOST~~~ (somen_chandra) 46 44.94 59.62 6 13.04
7525. Yazeed (snake69) 46 82.73 106.03 15 32.61
7526. Lexi (silentfungus) 46 30.50 48.74 10 21.74
7527. SH (shokha09) 46 53.34 62.22 5 10.87
7528. Hiraya (sheesh_24) 46 52.70 64.06 4 8.70
7529. Saurav (seldom69) 46 59.91 73.26 8 17.39
7530. Arata (aratatakeda) 46 65.67 84.28 5 10.87
7531. Annie (annie48) 46 62.98 72.91 11 23.91
7532. Alexander (alexanderbutcheeks) 46 70.13 84.10 5 10.87
7533. Aji (ajimathew) 46 50.84 66.62 11 23.91
7534. chris (aito_cornaro) 46 72.90 92.41 11 23.91
7535. Mohamed (abo4ams) 46 76.33 85.06 13 28.26
7536. Abdu (abduqodirov) 46 71.99 94.54 7 15.22
7537. Eobard (abdouhamel) 46 84.01 111.08 15 32.61
7538. J (22jcoluby) 46 50.01 61.79 3 6.52
7539. Ned (13_w) 46 60.99 78.00 5 10.87
7540. Divy (thivy) 46 58.74 81.95 8 17.39
7541. Sai (moon_toong) 46 31.03 41.03 2 4.35
7542. Ab (timaby) 46 41.14 53.21 3 6.52
7543. Naman (naman_vj) 46 65.20 82.42 11 23.91
7544. Aevaela (aevaela) 46 106.52 131.85 21 45.65
7545. Rithwik (rithwiksharma) 46 81.43 103.07 10 21.74
7546. karim (karimbdf) 46 47.26 57.98 5 10.87
7547. kim (kimblimblimz) 46 129.61 169.76 32 69.57
7548. Kimberly (kimbear_) 46 56.45 67.46 6 13.04
7549. Justin (juicet1n2) 46 130.98 155.08 27 58.70
7550. Joshua (jhsieh10) 46 88.85 105.24 16 34.78
7551. Jacob (intellectualbrick) 46 66.45 84.42 14 30.43
7552. Aaron (insertwordshere) 46 112.30 144.74 39 84.78
7553. sMarty (imrwonder2) 46 93.98 126.95 13 28.26
7554. icecreamfilling (icecreamfi... 46 89.90 105.12 14 30.43
7555. H A N S (hans_bk) 46 72.74 86.03 12 26.09
7556. guest_typist_new (guest_typ... 46 83.27 106.82 12 26.09
7557. Samir (samirissa) 46 55.13 72.45 9 19.57
7558. Jai Nepal (sajalpoudel) 46 51.58 59.75 6 13.04
7559. Ryan (ryanssd) 46 121.63 152.33 27 58.70
7560. Caspian (qashu) 46 63.57 86.43 15 32.61
7561. Pseudo (pseudo_here) 46 72.71 92.25 9 19.57
7562. Priscilla (priscillaaa) 46 86.05 107.03 10 21.74
7563. Pranav (pranav16) 46 52.19 62.95 3 6.52
7564. Sondr (pngstr) 46 75.10 88.56 11 23.91
7565. ⠀ (ploop123) 46 73.54 92.60 14 30.43
7566. chiru (phenggot200darken) 46 79.54 99.71 9 19.57
7567. Alexander (pharos) 46 44.10 64.34 15 32.61
7568. Iveth (perlybomb) 46 55.45 67.74 8 17.39
7569. PelMeni (pelmeni) 46 110.78 124.62 24 52.17
7570. Paul (paulllx) 46 70.68 94.77 10 21.74
7571. Angel (olivias69) 46 63.14 70.96 8 17.39
7572. Abhimanyue (obsidian_abhi) 46 77.78 109.26 6 13.04
7573. Nafiul (n_crypted) 46 67.50 80.70 6 13.04
7574. NO_LYF (no_lyf) 46 63.98 79.18 14 30.43
7575. barmanrahul (nothisisrahul) 46 69.72 83.74 10 21.74
7576. Patiphan (nongper) 46 57.28 78.00 11 23.91
7577. Nmn (nmn147) 46 60.52 73.44 11 23.91
7578. Neel (neel19) 46 92.61 108.86 13 28.26
7579. nadeem (nadeemgujjar) 46 67.89 80.09 10 21.74
7580. Mohsen (mohsentypo) 46 63.22 74.60 17 36.96
7581. Mayan (mayan__) 46 66.55 82.19 9 19.57
7582. Max (maxim_brown) 46 65.34 81.60 8 17.39
7583. Ross (rossmawd) 45 63.61 75.23 11 24.44
7584. Roy (rocko95) 45 72.39 87.37 8 17.78
7585. Michael (redwings20) 45 120.01 151.43 22 48.89
7586. Pryl (pryl) 45 85.79 107.65 12 26.67
7587. Poop (poopbuttpoop) 45 66.53 81.77 12 26.67
7588. B (pbhavin8584) 45 44.39 54.74 0 0.00
7589. Pastasoosi (pastasoosi) 45 49.97 60.86 3 6.67
7590. passivestar (passivestar) 45 116.04 141.98 45 100.00
7591. Zunbileg (ozbileg) 45 75.35 90.81 14 31.11
7592. Asif (orthocresol) 45 79.68 91.61 10 22.22
7593. Nrimanta (nwiziyanow) 45 45.37 63.69 12 26.67
7594. Ritesh (novathor) 45 55.51 67.50 7 15.56
7595. Nakura (nakura_sushi) 45 73.79 91.47 14 31.11
7596. Naaman (nae26) 45 86.76 113.08 16 35.56
7597. mushbert (mushbert) 45 55.60 69.40 12 26.67
7598. E (mosanbrick) 45 106.64 124.13 20 44.44
7599. k (mooneymooves) 45 69.48 88.19 5 11.11
7600. miko (mikesxan) 45 74.77 89.17 18 40.00
7601. Josiah (miitraa) 45 92.51 125.82 21 46.67
7602. aWiltedRhythm (mbh38) 45 110.92 125.84 25 55.56
7603. Max (maxube21) 45 59.46 70.51 12 26.67
7604. Mason (mason8008) 45 95.45 116.30 16 35.56
7605. Emma (aria_tran) 45 64.07 84.73 11 24.44
7606. Rajat (arakanfudo) 45 54.76 68.75 42 93.33
7607. (andyjoekool) 45 95.46 159.17 17 37.78
7608. leibniz (anamaya11) 45 63.25 75.53 9 20.00
7609. AmgdHussein (amgd_hussein) 45 46.95 55.74 5 11.11
7610. Alex (alexstrang25) 45 98.63 116.63 17 37.78
7611. Ankit (akjung478) 45 55.07 65.23 4 8.89
7612. acrymoore (acrymoore) 45 87.69 101.48 15 33.33
7613. Abbacchio (abbacchio) 45 96.62 115.66 14 31.11
7614. Spark (5parkmark) 45 84.91 102.04 15 33.33
7615. James (2janghoon) 45 119.58 152.64 24 53.33
7616. abc (1714245ctk41) 45 88.68 108.03 14 31.11
7617. 100% (100percentaccurate) 45 100.45 120.64 20 44.44
7618. REV (krevengek) 45 39.09 46.26 2 4.44
7619. sebastian (teekq) 45 102.46 120.65 12 26.67
7620. Kingpin (bahmandoor) 45 80.96 93.67 18 40.00
7621. Moazzam (qwikiquartz) 45 66.23 75.42 10 22.22
7622. Divyansh (elessar42) 45 34.58 47.38 6 13.33
7623. Cameron (cammy24) 45 90.57 118.57 26 57.78
7624. azer8 (azer8) 45 56.44 69.90 3 6.67
7625. rr (rosandy10) 45 60.28 73.20 10 22.22
7626. Vincent (supersayu) 45 105.82 123.77 21 46.67
7627. Enrico (ricodmarlon) 45 83.18 100.86 11 24.44
7628. Frosted (frosted_bruh) 45 75.24 89.17 7 15.56
7629. Luke (frag_pumpkin) 45 61.28 71.66 6 13.33
7630. fihee (fihee) 45 60.36 79.78 12 26.67
7631. fedja (fedza) 45 108.59 123.14 20 44.44
7632. ducky (duckyboy0) 45 53.80 62.97 2 4.44
7633. Solomon (donutrk) 45 148.65 187.49 34 75.56
7634. Didoff (didoff) 45 67.48 82.16 10 22.22
7635. dhara (dhara12) 45 37.80 47.15 3 6.67
7636. Cygnus (cygnuss) 45 135.57 161.12 32 71.11
7637. CTLim (ctlim02) 45 76.54 96.78 11 24.44
7638. Cool (creepycumber) 45 82.00 99.28 12 26.67
7639. Conning (conning) 45 108.58 127.67 22 48.89
7640. Chicken (chickenhide) 45 124.47 155.65 29 64.44
7641. Zyrin (captainzyrin1024) 45 85.99 106.12 15 33.33
7642. K (blue_addict) 45 60.43 81.49 9 20.00
7643. Blazian444 (blazian444) 45 108.11 129.57 14 31.11
7644. BEMZ (bemz_mc) 45 50.63 63.38 10 22.22
7645. Izanagi (baguettianmysticism) 45 179.78 210.49 45 100.00
7646. Kevinh (baconpool14) 45 98.38 129.56 17 37.78
7647. Darda (babyonbaby) 45 101.49 126.74 21 46.67
7648. Surendra (zurendra9) 45 73.52 86.32 9 20.00
7649. Sam (zoinks_sam) 45 95.93 121.16 20 44.44
7650. zin (zinzin27bs) 45 55.30 70.56 3 6.67
7651. Daniel (zebrapopcorn) 45 95.45 124.22 18 40.00
7652. Youssef (youssef_ait_bihi) 45 71.34 95.44 9 20.00
7653. Yunus Emre (yemre95) 45 62.91 81.30 6 13.33
7654. I'm_on_mobile (yeetusthyfetus) 45 99.60 126.08 23 51.11
7655. yasser (yasserhr) 45 61.63 76.44 5 11.11
7656. Varun (wolfie12) 45 56.12 65.03 4 8.89
7657. Wiktor (wivvik) 45 47.64 60.21 5 11.11
7658. Wesgar (wesgar) 45 67.82 77.78 15 33.33
7659. Vikram (vikram_) 45 58.02 71.27 7 15.56
7660. tstats[unoriginalname] (uno... 45 89.14 102.08 21 46.67
7661. Tsetsen (unknownxxx) 45 69.46 82.45 34 75.56
7662. Bray (turtlebray) 45 69.09 84.76 6 13.33
7663. Sitraka (tsukimurphy) 45 85.34 100.63 9 20.00
7664. Kennon (trainertaco) 45 67.77 80.69 10 22.22
7665. Huan (thehuan2005) 45 68.85 90.34 11 24.44
7666. Sh3y4sh (thegoldeneagle) 45 76.54 95.34 14 31.11
7667. alberto (th3biscuit) 45 46.02 59.03 6 13.33
7668. Ave (tessellatedtalent) 45 94.62 115.93 7 15.56
7669. sv (sv_1419) 45 46.75 56.05 3 6.67
7670. exqlouuebnfpgts (spitemim) 45 101.14 124.09 32 71.11
7671. Kevin (spezzytv) 45 91.11 115.90 14 31.11
7672. Bún Bò (snowk49) 45 90.48 111.07 13 28.89
7673. Diego (snkybkyloike) 45 62.56 79.76 8 17.78
7674. Sar (shift2alt) 45 59.62 70.68 13 28.89
7675. Mona (segasunset) 45 82.78 103.03 18 40.00
7676. Mahmoud (mahmoud_zaineldin) 45 63.68 80.32 8 17.78
7677. Lutful (lutful) 45 44.30 50.79 6 13.33
7678. Luciano (lucidokz) 45 72.75 99.55 9 20.00
7679. Shiva (lord_kartikey) 45 26.15 38.20 12 26.67
7680. lofr1t (lofr1t) 45 51.85 61.95 5 11.11
7681. Louzani (lk_kheir) 45 42.77 54.30 2 4.44
7682. Nicholas (legendarykeys) 45 81.36 101.45 13 28.89
7683. Sai Venkat (ksvr) 45 57.41 71.60 7 15.56
7684. KOU (koulangkaya) 45 59.89 72.75 7 15.56
7685. Justin (jubnx) 45 54.17 69.90 5 11.11
7686. Biggs (jobobhi) 45 86.52 104.73 14 31.11
7687. Jubbers (jlin526) 45 125.23 144.28 31 68.89
7688. Jeff (jeffwu1220) 45 93.41 110.12 13 28.89
7689. Aether (its_deep) 45 51.14 66.72 13 28.89
7690. ItsDuckyLol (itsduckylol) 45 77.45 91.02 9 20.00
7691. Debasmit (inmessi) 45 59.57 68.40 14 31.11
7692. XD (hphuonghehe) 45 61.31 74.68 8 17.78
7693. Hiyoshi (hiyochan) 45 155.20 182.66 40 88.89
7694. Eric (heeric) 45 110.41 123.99 19 42.22
7695. Hassan (hassanjazzy143) 45 63.17 72.98 5 11.11
7696. Halftimenerd1 (halftimenerd1) 45 52.92 64.01 7 15.56
7697. GrandMaster (grandmaster101) 45 71.43 84.29 7 15.56
7698. Ben (god0nline) 45 103.23 142.45 25 55.56
7699. Gabbie (gg13) 45 75.47 91.30 9 20.00
7700. Ganesh (gat786) 45 51.21 70.90 3 6.67
7701. lumapools (lumapools) 44 92.18 107.46 16 36.36
7702. dennis (ludennis0606) 44 89.06 107.72 11 25.00
7703. luis (lozalui004) 44 66.21 79.33 5 11.36
7704. Lord (lord_v) 44 72.12 85.07 11 25.00
7705. Кирилл (life808) 44 93.29 118.20 15 34.09
7706. Igor (kziv) 44 37.70 49.32 1 2.27
7707. KeeG9x (keeg9x) 44 80.11 103.44 17 38.64
7708. Kalin (kalin_a) 44 63.08 73.69 8 18.18
7709. John (juseonghan) 44 120.26 149.15 22 50.00
7710. Jim (jumsey) 44 82.73 106.62 13 29.55
7711. S (juicebox_27) 44 91.22 115.55 17 38.64
7712. now colemak! (jlam55555nonq... 44 125.54 145.63 32 72.73
7713. Jin (jin_an) 44 73.36 87.55 14 31.82
7714. JBK (jeyabalakrishnan) 44 44.24 53.65 3 6.82
7715. jjerry (jerry_nyae) 44 85.74 104.88 7 15.91
7716. Jake (jasala) 44 92.64 108.43 16 36.36
7717. Izhar Ali (izhar368) 44 60.52 71.40 7 15.91
7718. korn (itthikorn777) 44 49.77 59.56 5 11.36
7719. isenze (isenze) 44 70.18 79.93 20 45.45
7720. no (humeunculus) 44 124.97 146.82 24 54.55
7721. Suhel (horacio_chopin) 44 70.42 83.00 9 20.45
7722. heam (heamkream) 44 60.38 73.61 22 50.00
7723. Harvey (harveyqqq) 44 86.21 101.28 12 27.27
7724. Grey (grey2) 44 87.91 109.70 12 27.27
7725. giovane thug (giovvah) 44 134.25 147.90 29 65.91
7726. John (gakbo) 44 82.15 108.68 10 22.73
7727. Jacob (gadekaja) 44 90.45 118.42 13 29.55
7728. John (fsxsteamboss) 44 57.90 70.69 7 15.91
7729. Glen (foxdigits) 44 106.96 136.93 20 45.45
7730. Abhishek (erabh) 44 45.41 56.49 9 20.45
7731. 69 WPM andy (eerietants) 44 69.60 93.46 13 29.55
7732. tstats[easybeef] (easybeef) 44 62.42 80.11 5 11.36
7733. Calvin (doyotko) 44 106.83 134.44 18 40.91
7734. Dan (dgallerz) 44 84.88 106.43 14 31.82
7735. (dev_origami) 44 96.10 117.05 15 34.09
7736. Kshitij (desikheeda) 44 69.62 81.18 14 31.82
7737. 🇵🇸 (demo_admin) 44 121.53 143.36 21 47.73
7738. Deadman (deadrohan19) 44 43.74 55.56 3 6.82
7739. Ahmed (deadmoonsoldier) 44 66.78 79.70 9 20.45
7740. Dash (darkdash) 44 98.73 116.61 17 38.64
7741. Francis (coronadoloser76) 44 75.92 91.72 11 25.00
7742. Alexander (codec4) 44 82.49 94.72 8 18.18
7743. Sop (coachprincesssoppy) 44 67.02 80.39 11 25.00
7744. Ethan (chung_ethan) 44 72.32 142.94 8 18.18
7745. Coughingmouse (cexora) 44 63.46 84.33 3 6.82
7746. Cedric (cedrilicity) 44 85.46 126.57 15 34.09
7747. Captain (ccap) 44 39.26 50.94 37 84.09
7748. TypeNightmare (bozijovel) 44 53.64 64.85 0 0.00
7749. Blue (blueberkeley) 44 90.98 124.32 13 29.55
7750. be (besalt) 44 85.22 105.90 10 22.73
7751. k1mbap (beaned_fish) 44 107.78 129.52 29 65.91
7752. Bae (baenimbae12) 44 84.02 105.70 13 29.55
7753. bachu (bachu2020) 44 59.38 82.72 12 27.27
7754. Andres (avillarreal14) 44 87.77 99.35 8 18.18
7755. Ausar (ausar0) 44 106.92 124.00 22 50.00
7756. Braylin (atlasrising) 44 106.87 117.08 24 54.55
7757. Chatura (atakatus) 44 51.40 62.07 4 9.09
7758. Alex (aselia_azim) 44 48.40 59.10 4 9.09
7759. Ivan (s017180) 44 96.27 116.60 15 34.09
7760. Robert (rwa102455) 44 101.59 119.88 17 38.64
7761. tstats[rueo] (rueo) 44 49.16 60.77 5 11.36
7762. Rounak (rouvai) 44 85.56 102.53 12 27.27
7763. Rodrigo (rodrigoferrer) 44 87.93 101.55 17 38.64
7764. Rikesh (rikesh) 44 100.75 129.96 25 56.82
7765. Vineet (raovineet14) 44 58.01 66.38 5 11.36
7766. Qi (qitang) 44 103.12 115.91 12 27.27
7767. poobastank (poobastank) 44 76.17 93.24 7 15.91
7768. pipez (pipez) 44 99.41 116.53 16 36.36
7769. Kyle (pickles3201) 44 126.22 150.77 26 59.09
7770. prehistoriczebra (penguin45) 44 62.21 84.74 13 29.55
7771. An (pastwords) 44 75.59 93.48 16 36.36
7772. Parth (parthpsh) 44 75.89 94.56 36 81.82
7773. allie (oatmilf22) 44 62.62 83.78 11 25.00
7774. ¯\_(ツ)_/¯ (nopatno) 44 140.74 189.90 31 70.45
7775. n0neya (noneyaaa) 44 98.82 114.28 17 38.64
7776. Niraj (nirajkamat) 44 32.17 39.49 2 4.55
7777. Yung N8 (ngreene5) 44 63.81 87.45 13 29.55
7778. (nalyd_on_colemak) 44 101.29 156.07 0 0.00
7779. J (mr_wood) 44 89.64 112.44 15 34.09
7780. MrDot (mr_dot) 44 61.00 78.75 11 25.00
7781. Mo (mosidhom) 44 87.52 109.37 13 29.55
7782. aindriu (morrisa8) 44 66.24 80.89 8 18.18
7783. Mohamed (mednoun) 44 63.18 72.10 5 11.36
7784. Maybe (maybe413) 44 118.62 129.97 22 50.00
7785. Chanokchon (mantarays) 44 61.80 70.32 9 20.45
7786. Anuj (anujsharma411) 44 76.97 90.37 16 36.36
7787. Ankush (ankushchavhan7596) 44 50.88 60.17 7 15.91
7788. Ankith101 (ankith101) 44 51.93 69.48 7 15.91
7789. Amit (amitu7) 44 68.39 83.04 11 25.00
7790. Al (alriad) 44 59.47 68.28 11 25.00
7791. Alex (alexkylelee) 44 105.51 138.04 22 50.00
7792. Aero (aerosoul) 44 67.97 81.86 4 9.09
7793. 10SlowFingers (aabhas) 44 65.51 84.16 6 13.64
7794. andrew (400wpmalphamale) 44 98.58 136.16 20 45.45
7795. Ole (olenord) 44 79.53 93.77 11 25.00
7796. pudding_ (ericedge3315) 44 83.74 97.66 12 27.27
7797. Syterelic (syterelic) 44 76.52 95.06 14 31.82
7798. Yuni (yuni190) 44 79.78 99.01 11 25.00
7799. Balibari, (balibari) 44 73.51 91.13 10 22.73
7800. Wu (recharge323) 44 48.92 60.35 4 9.09
7801. Blob (blobby21) 44 62.27 84.11 6 13.64
7802. (zesty11) 44 109.68 135.33 14 31.82
7803. xain (xainq) 44 51.71 62.42 7 15.91
7804. weston (westonu) 44 97.70 121.73 20 45.45
7805. Vera (verabee9183) 44 62.15 79.52 9 20.45
7806. uled (uled) 44 71.40 98.57 18 40.91
7807. Ryan (typerace_ryan) 44 56.29 68.69 9 20.45
7808. Dog (tropicaldog17) 44 65.86 86.50 9 20.45
7809. Cornelio (tirdsaba) 44 53.66 65.54 7 15.91
7810. Tobiloba (thetobitron) 44 88.34 105.42 9 20.45
7811. John (thegangplankgod) 44 125.47 152.02 31 70.45
7812. Ivan (t3ry444y) 44 55.82 65.34 4 9.09
7813. Bailey (swagoneering) 44 103.19 122.40 14 31.82
7814. oliver (sushiboyking) 44 94.83 114.58 14 31.82
7815. chikke (srujan_chikke) 44 31.23 39.38 5 11.36
7816. beans (squirtly) 44 106.58 126.96 21 47.73
7817. Hieu (spicy888) 44 61.65 76.67 9 20.45
7818. thetacosmurgf (smurfer1121) 44 112.00 131.52 22 50.00
7819. smug (smugwise_the_brave) 44 79.71 100.87 21 47.73
7820. Zack (smagroda) 44 74.52 85.25 16 36.36
7821. po1nt (_po1nt_) 43 77.00 87.37 13 30.23
7822. Phi (ze_phi) 43 87.20 102.13 16 37.21
7823. tstats[yeunakho] (yeunakho) 43 38.49 54.04 3 6.98
7824. adrian (yeahaight) 43 52.00 75.05 5 11.63
7825. Coffee Boy (xuantungbrian) 43 45.43 53.92 1 2.33
7826. Eloona (wombatinmaison) 43 91.27 112.37 14 32.56
7827. Juan (wolf_1) 43 64.83 77.32 8 18.60
7828. Prince (wayward_prince) 43 79.88 109.68 13 30.23
7829. Allan (unknownfiles) 43 100.06 120.76 15 34.88
7830. Mihkel (tikstiks) 43 81.40 101.94 17 39.53
7831. Charles (themythicalvlad) 43 107.64 118.91 22 51.16
7832. Rafael (syrena) 43 87.96 109.14 13 30.23
7833. Great (synergy__) 43 91.99 113.97 17 39.53
7834. Steven (steventheplayer) 43 73.38 91.68 16 37.21
7835. steveleeb (steveleeb) 43 131.27 152.07 22 51.16
7836. SHRI (srinivasdokare) 43 53.41 69.96 4 9.30
7837. ☞sondv (sondv) 43 90.82 111.04 16 37.21
7838. Phinix (soaringphinix) 43 84.11 99.62 10 23.26
7839. Hieu (sn1rep) 43 58.14 70.61 6 13.95
7840. sirjan (sirwolf208) 43 60.86 67.55 15 34.88
7841. Dan (sirdanofthedirt) 43 81.61 99.37 11 25.58
7842. Sarah (shetzah) 43 78.22 99.93 8 18.60
7843. severed_toast (severedtoast) 43 102.50 140.59 15 34.88
7844. Sanwal (sanwal_junejo0007) 43 47.98 61.30 2 4.65
7845. Sangi (sangi38) 43 92.00 103.88 13 30.23
7846. Salehbin (saleh_mksd) 43 34.86 42.47 0 0.00
7847. ruby (rubymuzz) 43 61.10 85.57 8 18.60
7848. Kyle Johnson (rickharrisoncoc) 43 85.60 102.58 16 37.21
7849. Rey (reypanerz) 43 51.38 65.10 8 18.60
7850. Butchy (randomguy4ever) 43 70.42 90.17 12 27.91
7851. (quadroopl) 43 159.40 185.48 27 62.79
7852. j (potatostock) 43 72.13 94.08 11 25.58
7853. tstats[pook_dvorak] (pook_d... 43 102.35 125.57 15 34.88
7854. Philip (plip_1021) 43 85.46 94.17 12 27.91
7855. George (peposss) 43 86.40 94.96 12 27.91
7856. osso (osso94) 43 70.02 94.49 15 34.88
7857. oskar (osny19) 43 105.14 123.12 18 41.86
7858. katie (okaykatieokay) 43 80.06 94.36 8 18.60
7859. nicole (nkkicole) 43 74.94 94.36 10 23.26
7860. Aaron (nightcreators) 43 104.37 127.86 16 37.21
7861. 1234 (nemesistroy) 43 70.04 108.55 11 25.58
7862. lmao (nate11111) 43 101.19 119.32 15 34.88
7863. Napplebee (napplebee) 43 60.70 73.73 7 16.28
7864. Nabeel (nabz126) 43 52.76 64.38 6 13.95
7865. Mohammed (mohammed55555) 43 82.39 93.10 14 32.56
7866. Mikel (mikelhector) 43 78.10 96.72 19 44.19
7867. Melas (melas1) 43 98.97 117.14 12 27.91
7868. Maruberry (maruberry) 43 100.61 126.75 15 34.88
7869. Armando (mandy1339) 43 84.36 98.47 12 27.91
7870. :( (magtraxer) 43 102.29 134.71 15 34.88
7871. Trianglateral (luckyashraj) 43 61.16 69.95 7 16.28
7872. Mohamed Abdallahi (lim_elno... 43 48.33 64.18 8 18.60
7873. Harley (legendharley) 43 99.28 118.65 19 44.19
7874. Vũ (khanhyeuquan) 43 88.58 108.08 13 30.23
7875. shinkou (kashinkou) 43 57.04 75.24 23 53.49
7876. Jack (jackiechips) 43 31.13 41.66 7 16.28
7877. Sam (ie_dead) 43 72.41 101.69 9 20.93
7878. Himanshu (himanshumishra3198) 43 59.74 68.65 11 25.58
7879. hhdhwuus (hhdhwuus) 43 72.46 88.67 9 20.93
7880. Momo (helloworldwhatniceday... 43 98.35 120.89 12 27.91
7881. salad fingers (guuul) 43 117.18 138.03 20 46.51
7882. Elliot (gofire8) 43 86.32 106.30 7 16.28
7883. goe (goeeeeeeee) 43 83.16 99.75 0 0.00
7884. tameflame (gabrieljohngabri... 43 82.04 95.82 9 20.93
7885. ea (fluxheat) 43 54.37 68.09 7 16.28
7886. faith (flatypus) 43 114.16 146.48 28 65.12
7887. Tausif (fishey3) 43 63.15 81.36 8 18.60
7888. Ezzy (ezzzyz) 43 50.05 60.08 3 6.98
7889. Megaracer BTW (erkytyper) 43 83.04 95.27 14 32.56
7890. Danny (ecgab) 43 99.44 118.32 17 39.53
7891. NCCFlame (dysfunctional_dra... 43 92.43 121.21 12 27.91
7892. Disqusting (disqusting_mclo... 43 50.87 64.71 5 11.63
7893. Дидакус (didacus) 43 96.71 110.21 17 39.53
7894. Tony 🐱👤 (demon0192) 43 106.30 128.51 23 53.49
7895. meow (dalayalia) 43 66.45 82.85 10 23.26
7896. D (dabirik) 43 64.45 78.66 11 25.58
7897. CopyNinja09 (copyninja_) 43 44.02 52.03 2 4.65
7898. Christian (chrisshaw) 43 130.65 154.63 29 67.44
7899. senpai (chottomatte) 43 86.74 117.60 10 23.26
7900. Matt (chillmaster) 43 67.43 78.20 10 23.26
7901. Chase (chezit7) 43 82.09 105.34 11 25.58
7902. Cassie Lynn (cassielynz_00) 43 72.05 86.65 14 32.56
7903. Quốc (cangu07042006) 43 112.48 132.39 22 51.16
7904. typinggawd (brandon934) 43 90.42 115.00 19 44.19
7905. Nick (bopob) 43 93.62 114.99 22 51.16
7906. Bil3ygr (bil3ygr) 43 64.14 90.28 9 20.93
7907. Berty (bertybert) 43 76.93 94.02 18 41.86
7908. TypingNoob (bekarihh) 43 78.95 95.59 11 25.58
7909. BanjoBoss (banjoboss) 43 96.08 119.71 20 46.51
7910. Atom (atom_atom) 43 67.99 85.90 12 27.91
7911. QuietObedientConsent (arrow... 43 92.78 114.36 13 30.23
7912. Arda (ardat96) 43 59.82 73.44 11 25.58
7913. Ankit Sarkar (ankitsarkar) 43 49.74 65.46 40 93.02
7914. Ivan (aivan2) 43 71.97 85.96 11 25.58
7915. Armon (airtyper_11) 43 82.09 109.59 11 25.58
7916. ahmed (ahmed393) 43 68.39 76.61 4 9.30
7917. Aayam (aayam_04) 43 38.62 49.65 1 2.33
7918. MIke (3nd4u) 43 65.10 86.03 16 37.21
7919. Leinad (msdfar) 43 72.87 96.59 10 23.26
7920. iron4in2020 (iron4in2020) 43 64.56 73.71 13 30.23
7921. Abil (phr0zencr3w) 43 47.03 57.16 7 16.28
7922. Edward (smegle2) 43 53.55 67.80 4 9.30
7923. imhemantchaubey (hemantchau... 43 42.56 58.20 2 4.65
7924. Angel (angelrami003) 42 51.55 64.20 2 4.76
7925. Andrei (andyspeed) 42 72.19 89.57 13 30.95
7926. Amarant (amarant_) 42 68.27 84.99 7 16.67
7927. Ahpoo (ahpoo) 42 82.43 103.29 12 28.57
7928. Adlin (adlin_typer18) 42 69.73 87.84 15 35.71
7929. accorn (accorn279) 42 128.51 145.35 28 66.67
7930. Abe (abe299) 42 51.83 67.85 6 14.29
7931. Rafael (23woodyj) 42 89.86 108.01 13 30.95
7932. Hunter (sascroc) 42 78.62 98.22 7 16.67
7933. Fred (fgrady3) 42 60.60 72.51 4 9.52
7934. Sanjero (sanjero) 42 63.88 77.55 9 21.43
7935. Vinamr (h_e_y) 42 88.05 101.58 9 21.43
7936. Eric (kusikiwi) 42 90.12 120.92 11 26.19
7937. Cloudyrain (cloudy_rain) 42 44.78 60.40 4 9.52
7938. Hanif (hanifimaduddin) 42 50.28 71.50 6 14.29
7939. Ceus (simply_ceus) 42 67.92 79.56 12 28.57
7940. J (jbddiesel) 42 59.70 73.05 11 26.19
7941. Theo (theomorrison) 42 82.54 97.67 9 21.43
7942. Fastpoke (make_me_better) 42 69.22 86.07 11 26.19
7943. maikim (maikim) 42 74.58 90.26 12 28.57
7944. Mahatej Varma (mahatejvarma) 42 67.32 84.94 11 26.19
7945. Aman (mag1k_iwnl) 42 63.88 79.92 14 33.33
7946. Mad (mad888) 42 93.01 117.10 28 66.67
7947. Luvie (luvie1310) 42 74.73 91.75 15 35.71
7948. llameow (llameoww) 42 114.04 134.83 25 59.52
7949. MeguminQT (leonathor) 42 90.48 101.83 20 47.62
7950. Justin (leethelethal) 42 93.52 111.58 11 26.19
7951. watchdominion.com (leegunner) 42 100.76 125.28 14 33.33
7952. kanak (k_a_n_a_k) 42 44.20 58.78 3 7.14
7953. Andrei (kulturedschwein) 42 54.20 74.25 4 9.52
7954. sync (kjh2196) 42 102.63 116.28 17 40.48
7955. Kirti (kirti773) 42 49.43 76.98 3 7.14
7956. ω (kerdax) 42 79.94 97.66 8 19.05
7957. john (jpom16) 42 58.77 71.89 9 21.43
7958. Joshua (joshua172) 42 93.45 115.21 17 40.48
7959. Aleksije (jastar) 42 45.53 58.60 8 19.05
7960. Taco (i_the_sausage) 42 86.74 108.92 8 19.05
7961. ivan (ivanchok) 42 94.14 118.25 15 35.71
7962. tstats[isakooooo] (isakooooo) 42 121.50 144.23 21 50.00
7963. Isaac (hyperkids) 42 119.60 142.62 18 42.86
7964. Noah (hvon) 42 104.42 125.19 19 45.24
7965. Hussain (hussainkhan) 42 56.80 71.57 4 9.52
7966. Hreyfill Hreyfill (hreyfill) 42 144.13 180.23 35 83.33
7967. hahnur (hahnurk) 42 98.28 116.57 16 38.10
7968. sarah (hahaimsmart) 42 86.17 106.76 15 35.71
7969. gst (gsttyping) 42 40.96 49.51 4 9.52
7970. Miyamura (grapewiggler) 42 78.65 94.86 14 33.33
7971. Gooby (goobygod) 42 98.48 123.90 25 59.52
7972. Ara (goatrager) 42 64.45 89.79 10 23.81
7973. Tugssaikhan (gantsogtt) 42 53.14 69.83 9 21.43
7974. Zombie (zombiecoder) 42 39.67 50.32 3 7.14
7975. Kyle (zan9etsu) 42 58.49 73.38 12 28.57
7976. Yazan (yazan_al) 42 67.72 78.93 12 28.57
7977. Yas'-' (yaser_) 42 64.92 79.80 6 14.29
7978. Chris (wupops) 42 62.04 82.00 12 28.57
7979. MistakesWereMade (workmanty... 42 81.85 99.00 16 38.10
7980. Adrian (whyisthisnotavailable) 42 104.98 135.56 26 61.90
7981. Why (whyare) 42 78.91 132.92 10 23.81
7982. Vova (v_hg_p) 42 56.41 76.53 4 9.52
7983. vix (vrinze) 42 77.26 92.64 9 21.43
7984. usstudent101 (usstudent101) 42 107.97 140.13 22 52.38
7985. Roma (useflame) 42 88.20 103.80 12 28.57
7986. w_mb1 (trundling) 42 89.42 106.40 23 54.76
7987. Alisher (tourist671) 42 60.62 74.81 14 33.33
7988. justice (totorek) 42 39.86 51.27 2 4.76
7989. keychronk6 (theonlydvorakguy) 42 103.68 121.06 18 42.86
7990. sw0rd (sw0rd) 42 82.17 101.65 15 35.71
7991. Tomas (sumtinlazy) 42 108.11 126.92 19 45.24
7992. reever (ssamu) 42 85.59 108.09 11 26.19
7993. Ahmad (slayman19) 42 133.57 168.27 27 64.29
7994. Ludwig (simontypo) 42 68.42 86.75 15 35.71
7995. shrenik (shrenikr235) 42 90.85 128.02 16 38.10
7996. Shiv (shivam9_) 42 58.98 73.97 13 30.95
7997. Shift (shiftw) 42 77.05 94.54 14 33.33
7998. Scooby (scoobydooby) 42 53.33 65.51 2 4.76
7999. Sanyeet (sanyeet) 42 86.50 104.89 14 33.33
8000. Sam (sam3456) 42 87.01 110.61 10 23.81
8001. Ruben (rubenzhang) 42 93.46 108.15 15 35.71
8002. RjTvqH (rjtvqh) 42 68.99 84.55 7 16.67
8003. Ros (ric_ros_839) 42 41.46 48.75 5 11.90
8004. Fedor (raxker) 42 47.26 53.67 1 2.38
8005. Rain (rainy) 42 70.00 98.38 10 23.81
8006. Parv (parvmodi) 42 56.93 65.66 6 14.29
8007. omarmejiaa (omarmejiaa) 42 54.57 67.02 6 14.29
8008. Niofer (niofer) 42 77.76 98.52 8 19.05
8009. nea (neapollotan) 42 70.67 85.42 8 19.05
8010. Naulitus (naulitus) 42 69.15 79.64 11 26.19
8011. Kristijonas (nasyrke) 42 78.70 90.81 16 38.10
8012. 1step (narcindin) 42 104.88 130.93 14 33.33
8013. Dominik (monteymontey) 42 89.74 112.01 14 33.33
8014. Anonymous (mntlprblm) 42 87.52 113.60 17 40.48
8015. mt (migclare) 42 87.69 109.61 13 30.95
8016. Lőrinc (mbalazs) 42 107.93 119.31 24 57.14
8017. Mathyou (mathyou_177) 42 69.84 78.80 5 11.90
8018. Masy (masy404) 42 66.49 82.20 36 85.71
8019. ludwigg (froggg) 42 75.39 100.33 6 14.29
8020. James (fintero) 42 66.15 83.16 12 28.57
8021. Eli (elity) 42 72.37 88.07 8 19.05
8022. (egahbh) 42 134.81 153.40 28 66.67
8023. Adam (ediggity152005) 42 120.01 135.57 24 57.14
8024. Dmitriy (dimasidorenko) 42 53.68 62.39 7 16.67
8025. Talha (digitaldruglord) 42 68.36 75.84 9 21.43
8026. David (dgiddens928) 42 78.37 101.41 9 21.43
8027. Devesh (dev344) 42 81.45 92.43 12 28.57
8028. nielr (danyl) 42 61.76 81.42 6 14.29
8029. Dingo Dango (dankwanktank) 42 70.65 91.64 14 33.33
8030. Dude (damonjammin) 42 55.87 72.80 6 14.29
8031. daikonsama (daikonsama) 42 52.00 66.66 6 14.29
8032. Daniel (d123aniel) 42 95.71 118.96 18 42.86
8033. crz316 (crz316) 42 41.23 49.16 2 4.76
8034. retired, for now ᐢ.‸.... 42 91.39 104.90 16 38.10
8035. Chris (chrisk_04) 42 60.25 78.47 5 11.90
8036. Charlie (charlieeeee) 42 92.54 110.30 16 38.10
8037. Creams4 (chadzuko) 42 91.72 120.01 10 23.81
8038. Bodyguard (bxdygxard) 42 50.42 64.07 3 7.14
8039. Issaree (boranorben) 42 55.68 66.93 2 4.76
8040. Pranav (bodiez) 42 75.20 101.24 16 38.10
8041. Bobirjon (bob_pro) 42 61.00 72.84 11 26.19
8042. Gibson (better_gibby) 42 99.59 120.04 13 30.95
8043. Ben (benjals9) 42 59.61 78.49 10 23.81
8044. dean (aydeano) 42 88.19 117.73 10 23.81
8045. ariyaninj (aryaninj) 42 48.78 70.89 9 21.43
8046. frog! (froggysauce) 41 72.21 92.18 17 41.46
8047. FRATNIX (fratnix) 41 70.68 84.35 13 31.71
8048. Takumi (fractylz) 41 92.30 112.54 11 26.83
8049. flaskur (flaskur) 41 88.42 103.39 10 24.39
8050. A (fdsjaklfdsaj) 41 96.66 113.91 16 39.02
8051. Luffy (fawnful) 41 52.87 65.34 4 9.76
8052. Urolbek (faithful_1707) 41 65.48 77.01 8 19.51
8053. karovD (fablem_workman) 41 77.18 97.88 12 29.27
8054. mushykeys (exileflame282004) 41 68.87 85.60 4 9.76
8055. Reetu Raj (eternal77) 41 41.57 50.39 7 17.07
8056. Jennifer (ennyvanna) 41 18.02 22.53 7 17.07
8057. John (enhoj22) 41 75.54 84.41 8 19.51
8058. Emiesh (emiway247) 41 42.75 52.52 12 29.27
8059. Joze (el_lobe) 41 106.08 127.65 18 43.90
8060. Carrot (elelin) 41 58.03 72.36 11 26.83
8061. BiggyBallsHD (egg_plant_pete) 41 53.29 65.86 3 7.32
8062. Chris (eb_p0pe) 41 99.10 136.65 14 34.15
8063. Dunkmasta (dunkmasta) 41 93.44 114.21 21 51.22
8064. beep (doinyamom1337) 41 56.11 68.56 6 14.63
8065. Jochwa (djoshuahebert) 41 80.67 96.33 12 29.27
8066. D. (dissonvnt) 41 63.56 84.21 6 14.63
8067. Dean (de4n_whit3) 41 100.06 127.57 25 60.98
8068. colin (crustyrustonline) 41 55.67 79.48 7 17.07
8069. N (crazycalm007) 41 88.14 105.61 9 21.95
8070. CPL62Connor (cpl62_connorx) 41 53.93 68.84 9 21.95
8071. coolfission (coolfission) 41 118.84 130.70 21 51.22
8072. Confetix (confetix) 41 94.40 118.53 14 34.15
8073. Cheney (cheneyc9999) 41 81.28 104.20 16 39.02
8074. catfree (catfree) 41 116.05 130.95 21 51.22
8075. Carter (carter44502) 41 87.76 102.10 10 24.39
8076. Jasckon (camochameleon56) 41 79.18 95.06 11 26.83
8077. sixten (calvin2) 41 81.25 98.70 11 26.83
8078. b (byron911) 41 68.62 94.85 11 26.83
8079. Brock (brockbnntt) 41 84.25 110.86 15 36.59
8080. Brendan (brendanlo4) 41 93.10 109.18 19 46.34
8081. tstats[borzoian40] (borzoia... 41 87.46 106.13 18 43.90
8082. Boomer (boomer_typer) 41 88.51 111.75 9 21.95
8083. Noob (bloodylord) 41 46.17 63.67 11 26.83
8084. Bikash (bikash_grg) 41 70.29 88.20 9 21.95
8085. Mouse (atypingmouse) 41 71.65 87.41 12 29.27
8086. Karina (asapkarina) 41 74.39 102.85 13 31.71
8087. Nyx (_nyxx_) 41 27.17 31.39 13 31.71
8088. zefanya24k (zefanya24k) 41 111.80 132.29 18 43.90
8089. banvotesgames (x_adware) 41 123.34 153.41 16 39.02
8090. Bryan (xxavalonxx) 41 64.62 75.39 11 26.83
8091. Waterman304 (waterman304) 41 99.27 111.75 12 29.27
8092. Walnert (walnert) 41 96.60 115.29 24 58.54
8093. Hai (vroyibg) 41 61.00 72.31 8 19.51
8094. Pieter (umbravanlocks) 41 67.73 82.16 6 14.63
8095. Car (ufoes) 41 75.76 93.51 7 17.07
8096. Uladzislau (tumilok) 41 66.73 79.42 12 29.27
8097. AJ (theloafingone) 41 109.08 131.73 28 68.29
8098. em (thelawsofjay) 41 130.68 155.15 29 70.73
8099. Bro (termog) 41 72.68 87.45 14 34.15
8100. sean (tak32) 41 83.66 99.97 5 12.20
8101. Josh (syztyqus) 41 82.97 94.64 14 34.15
8102. Sujal (sujal_fast) 41 53.98 69.14 4 9.76
8103. Hhhh (strawbirry) 41 93.41 116.88 14 34.15
8104. Simone (simone79) 41 76.57 83.88 12 29.27
8105. Gabe (silentsnake2398) 41 72.50 85.63 9 21.95
8106. SHU (shu_ik) 41 84.80 107.25 14 34.15
8107. BAZINGA (shruthi_) 41 54.42 61.89 3 7.32
8108. Alex (servicer) 41 76.07 96.92 12 29.27
8109. SECsplitOND (secsplitond) 41 96.58 122.99 20 48.78
8110. scubtle (scrubsworth) 41 88.31 100.20 15 36.59
8111. Jack (arcinae) 41 120.42 152.31 27 65.85
8112. Amir (48u_54l1m) 41 78.46 90.37 10 24.39
8113. Denny (yoanesdenny) 41 57.54 70.73 5 12.20
8114. Periodude (rastapasta_ke) 41 61.02 72.94 9 21.95
8115. light (light_dawn) 41 55.70 67.01 5 12.20
8116. Connor (connoc) 41 54.71 71.28 4 9.76
8117. kem (krelma) 41 90.70 110.83 17 41.46
8118. MajesticBudder (majesticbud... 41 78.70 91.54 6 14.63
8119. 𝔏𝔦𝔪𝔬𝔟𝔢... 41 55.53 64.94 2 4.88
8120. Lalith Sharma (lalith_sharma7) 41 40.17 51.70 6 14.63
8121. Lelu (laku_) 41 121.76 143.02 24 58.54
8122. Kyle (kyman73) 41 99.97 127.06 16 39.02
8123. Pawan (kpawans00533) 41 66.03 78.43 5 12.20
8124. Kitzuney (kitzuney) 41 85.05 95.74 13 31.71
8125. NO (kinda_weird_bro) 41 42.86 56.04 6 14.63
8126. Sebastian (jschavesr) 41 59.82 74.99 3 7.32
8127. JC (jollibeech) 41 76.61 90.80 23 56.10
8128. Jake (jkdriven) 41 81.06 98.75 10 24.39
8129. Jiawei (jiaweilin) 41 54.96 69.59 5 12.20
8130. Jack (jack__toast) 41 81.20 96.08 9 21.95
8131. flaneur simp (inariii) 41 149.68 183.65 8 19.51
8132. kei (impeeverything) 41 129.64 165.19 25 60.98
8133. illa (iladnas) 41 54.44 68.45 6 14.63
8134. Jim (hockeyhead019) 41 96.29 110.93 14 34.15
8135. Manish (hi_son) 41 43.74 62.48 6 14.63
8136. Gunter (gunter1963) 41 47.35 58.60 5 12.20
8137. Kieran (godquack) 41 65.91 76.75 10 24.39
8138. Mr (glock19) 41 64.46 83.03 5 12.20
8139. get_on_board (get_on_board) 41 98.39 114.39 21 51.22
8140. georgebax (gbax) 41 94.51 112.69 14 34.15
8141. Andrew (fyir) 41 71.31 90.35 13 31.71
8142. Sander (s4ndert) 41 61.21 85.26 12 29.27
8143. Rubin (rubintypes) 41 81.34 95.39 12 29.27
8144. Robby (roweki21) 41 81.90 100.17 14 34.15
8145. Ripon Kumar (riponcse) 41 60.05 79.24 9 21.95
8146. Stefan (ringding) 41 102.93 122.57 12 29.27
8147. Rimuru (rim_uru) 41 54.19 64.16 3 7.32
8148. R1CZ4RD (riczard) 41 51.61 61.81 4 9.76
8149. Richie (richiemoring) 41 45.90 58.78 2 4.88
8150. Shawn (rcvroom) 41 109.02 128.62 25 60.98
8151. raymond (raymondgggg) 41 81.18 100.20 4 9.76
8152. Ravi (raviparasar1997@gmail... 41 67.90 84.08 10 24.39
8153. Renzo (raccon) 41 76.12 99.26 13 31.71
8154. person (person625) 41 108.56 121.97 18 43.90
8155. oToToT (ototot3ot) 41 68.70 80.80 10 24.39
8156. noctedie (noctedie) 41 70.28 98.35 13 31.71
8157. Nishit (nishit130) 41 60.79 77.15 9 21.95
8158. Nick (nicklong1599) 41 109.19 127.53 21 51.22
8159. Naren Manikandan (nane_m) 41 64.68 77.56 8 19.51
8160. ko (nakanidashite) 41 63.08 85.91 12 29.27
8161. Mon (m_nguyen05) 41 63.26 73.72 10 24.39
8162. Princh (mvprinch) 41 113.99 135.75 24 58.54
8163. Ricky (muffinpotato) 41 99.70 116.99 23 56.10
8164. Moola_80wpm (moola_80wpm) 41 59.96 71.36 7 17.07
8165. Kato (mkatoh) 41 87.50 108.43 15 36.59
8166. Mukul (mega_mukul) 41 56.23 63.26 6 14.63
8167. Potato (mega_juicer) 41 92.27 115.41 9 21.95
8168. thomas (maxipixels) 41 77.76 102.62 13 31.71
8169. Bojongkers (manqjayak) 41 98.90 122.33 18 43.90
8170. sarthak (sarthak14327) 40 52.95 64.00 3 7.50
8171. Rowan (rusicus) 40 72.42 93.01 10 25.00
8172. geoff_g (roy_the_gizm0) 40 51.68 63.53 6 15.00
8173. Roy (royzz) 40 87.06 108.36 16 40.00
8174. rothdu (rothdu) 40 80.52 97.55 9 22.50
8175. Zapphy (ronaldlincon) 40 88.15 114.57 27 67.50
8176. Ronak (ronakkaria) 40 101.66 138.65 20 50.00
8177. Trung (rohan86) 40 61.16 71.09 8 20.00
8178. rodaina (rodaina) 40 35.28 47.77 4 10.00
8179. Earnest (redwhirl) 40 87.88 97.91 15 37.50
8180. Razor (razor_1) 40 72.05 91.34 11 27.50
8181. Ronish Singh (razorlemon2) 40 146.36 223.70 25 62.50
8182. Matt (purple_gorilla21) 40 71.66 88.96 9 22.50
8183. Raphael (purified_salt) 40 69.45 86.39 10 25.00
8184. Bodhi$attiva (ptran) 40 84.85 107.19 11 27.50
8185. Artichoke (poofydragon) 40 74.62 93.73 11 27.50
8186. Jason (poleam) 40 86.38 112.95 15 37.50
8187. whatdoesfingerdo (piggo1228) 40 103.82 123.80 16 40.00
8188. Joel (phitsuh) 40 101.94 121.32 19 47.50
8189. Dimitri (penguinhams) 40 93.03 120.74 14 35.00
8190. Paul (obtrunco) 40 83.86 95.04 9 22.50
8191. Andy (nycnets15) 40 111.38 143.47 19 47.50
8192. Kazz (nutkazz) 40 74.72 91.56 12 30.00
8193. Norbert (norbert515) 40 93.91 113.99 15 37.50
8194. justme (nightval) 40 96.04 126.08 15 37.50
8195. Nicole (nickizard) 40 45.48 69.96 3 7.50
8196. Viktor (niandog) 40 52.96 66.25 5 12.50
8197. Nawaraj Bista (nawaking) 40 52.87 65.54 4 10.00
8198. Joe Mama (musicalsquire) 40 121.44 148.43 20 50.00
8199. Mohamed (mohamedemad13) 40 72.92 87.51 10 25.00
8200. Jack (modesties) 40 84.05 100.25 14 35.00
8201. micur (micur) 40 107.00 125.57 21 52.50
8202. Mendel (mendeljacks) 40 96.96 113.57 20 50.00
8203. Memat (memat) 40 97.98 121.18 23 57.50
8204. Mikel (meekay) 40 96.57 119.64 14 35.00
8205. medo (medocool) 40 79.00 94.62 10 25.00
8206. Nicholas (massive_nick) 40 72.74 94.89 20 50.00
8207. tstats[manuelnara] (manueln... 40 51.98 66.44 4 10.00
8208. Kieran (manawa) 40 77.39 100.48 15 37.50
8209. Ariel (arielkusnoto) 40 68.72 84.73 8 20.00
8210. Ansh (anshghosh) 40 93.24 114.88 16 40.00
8211. Aditya (anonymoose17) 40 89.91 110.91 9 22.50
8212. Daniel (akr115) 40 48.67 58.68 3 7.50
8213. AbsoluteZeroK (absolutezero... 40 88.54 105.39 15 37.50
8214. Aaron (aasworth) 40 75.05 94.35 10 25.00
8215. Aarondn34 (aarondn34) 40 82.68 98.97 6 15.00
8216. Peter (1_peter_1) 40 53.56 60.60 5 12.50
8217. Dennis (1nys) 40 76.95 100.45 12 30.00
8218. (19wpmavg) 40 87.07 104.79 16 40.00
8219. Speedy (iamspeeeeeeeed) 40 53.82 65.14 1 2.50
8220. Astolfo (astolfokawaii) 40 36.14 46.94 4 10.00
8221. Yogender Singh Jadon (yogen... 40 91.79 113.91 17 42.50
8222. champ (kalmaxz) 40 41.00 58.01 6 15.00
8223. mal (malrie) 40 55.00 66.44 6 15.00
8224. Crinum (crinum) 40 49.23 69.29 4 10.00
8225. Ahnaf (crimson_doe) 40 57.10 67.72 4 10.00
8226. Feras (frsbg) 40 92.36 118.28 13 32.50
8227. fakhry (fakhryodi) 40 67.77 87.57 10 25.00
8228. paranoid (enemy1337) 40 77.34 95.89 9 22.50
8229. dwikydd (dwikydd) 40 77.77 91.83 12 30.00
8230. ballentine (drinkitup) 40 106.14 130.07 24 60.00
8231. Tahsin (drevil13) 40 84.92 99.19 12 30.00
8232. Dorel (dorelm) 40 80.86 107.01 12 30.00
8233. David (david_nguyen21) 40 67.70 82.03 4 10.00
8234. curtavian (curtavi) 40 44.17 53.78 3 7.50
8235. CulinArki (culinarki) 40 78.25 91.98 7 17.50
8236. Blank (ct7567) 40 92.37 104.88 10 25.00
8237. chuu (chuuceae) 40 100.76 127.19 36 90.00
8238. Chet (chethus) 40 100.50 120.75 12 30.00
8239. Peter (ch9cken) 40 93.39 123.21 12 30.00
8240. Candlelight (candlelight8) 40 84.72 103.65 12 30.00
8241. Abdullah (bunajim) 40 62.84 80.58 12 30.00
8242. Braden (brad9181) 40 74.95 93.51 10 25.00
8243. Bottlecapbottom (bottlecapb... 40 57.41 67.03 4 10.00
8244. botlof (botl0f) 40 77.60 93.18 7 17.50
8245. Joe (bop1000) 40 100.84 116.67 16 40.00
8246. Emmanuel (blaez_) 40 67.73 78.58 16 40.00
8247. BJ (bjfoutz00) 40 89.25 115.49 8 20.00
8248. Bhuvanesh (bhuvaneshh) 40 35.44 43.56 3 7.50
8249. roshan (bhattaroshan) 40 81.13 89.51 11 27.50
8250. BetTheDerp (betthederp) 40 108.85 140.35 27 67.50
8251. Betelgeuse (betelgeuse2310) 40 45.81 60.24 2 5.00
8252. BakesChamp (bakes1223) 40 111.03 132.62 23 57.50
8253. Aviral (aviralbh1) 40 87.10 103.01 17 42.50
8254. Ruby (_truby) 40 66.36 91.66 9 22.50
8255. Alex (zipphys) 40 82.07 101.67 10 25.00
8256. Ja (zentojamorn) 40 80.89 106.66 12 30.00
8257. Yasser (yesserspeed) 40 64.68 78.61 12 30.00
8258. ぜんじろう (yablu) 40 57.68 68.31 16 40.00
8259. Sarves (xmemestar420) 40 98.53 122.17 13 32.50
8260. Mato (xholm) 40 57.15 66.17 7 17.50
8261. Whitecap (whitecap) 40 65.08 79.41 7 17.50
8262. Wealthycentro (wealthycentro) 40 82.54 103.51 18 45.00
8263. karina (wattisgone) 40 88.85 108.57 14 35.00
8264. Enosh (watahec) 40 83.27 101.76 13 32.50
8265. Vanessa (vanessahjp) 40 61.11 76.01 10 25.00
8266. name (username04) 40 75.58 94.66 10 25.00
8267. Uros (uroskrunic1988) 40 88.01 100.11 13 32.50
8268. Joshua (twinklestarchild) 40 65.85 82.61 13 32.50
8269. Esi (tsoob) 40 52.09 60.79 3 7.50
8270. Tsuguto (tkogamer) 40 81.16 100.12 8 20.00
8271. Doomer (thedoomer) 40 71.92 86.24 14 35.00
8272. miranda (tfond) 40 75.60 83.95 10 25.00
8273. Taco (tacobandit) 40 103.89 125.83 12 30.00
8274. Shivam (swadhwa) 40 70.59 91.93 13 32.50
8275. superss2104 (superss2104) 40 71.84 89.48 7 17.50
8276. Sravan (sravanstg) 40 54.45 64.70 8 20.00
8277. sqbaee (sqbaee) 40 41.50 47.72 5 12.50
8278. Sonase (sonase19) 40 65.25 82.62 10 25.00
8279. Joe Smith (slowtypingdino) 40 41.04 54.47 1 2.50
8280. Joe (siyyy) 40 107.83 132.28 17 42.50
8281. sir (sirhelp) 40 86.70 100.98 10 25.00
8282. Alex (silverax3) 40 87.71 101.78 13 32.50
8283. shinutsi (shinutsi) 40 89.76 104.62 17 42.50
8284. Barry (shahkulu) 40 72.01 93.19 23 57.50
8285. Soham (shadeoxide) 40 97.76 115.19 16 40.00
8286. chandra (sekhar_88) 40 69.54 81.59 9 22.50
8287. Ahadh (sedoninju) 40 53.88 63.77 9 22.50
8288. Yogeshwar (mad_steins) 40 63.43 76.81 5 12.50
8289. lolwut9001 (lolwut9001) 40 116.83 148.85 24 60.00
8290. logicism (logicism) 40 105.52 123.76 17 42.50
8291. Lil (liljuicy) 40 97.04 127.12 14 35.00
8292. Lorenzo (leroiken11) 40 76.26 97.84 6 15.00
8293. (lassolass) 40 80.65 97.62 13 32.50
8294. Landers (landersex) 40 94.15 106.61 16 40.00
8295. KronosBruh (kronosbruh) 40 63.04 86.20 7 17.50
8296. Kris (kris510) 40 54.20 61.05 4 10.00
8297. kr02lc (kreadzz) 40 81.05 109.00 17 42.50
8298. Felipe (krakon_3) 40 74.21 90.43 8 20.00
8299. Kornel (kornelt) 40 76.82 94.03 9 22.50
8300. killerman (killerman_007) 40 54.19 73.81 12 30.00
8301. Kiiryuu (kiiryuu) 40 110.57 127.39 19 47.50
8302. Marcin (kawre) 40 92.21 117.08 14 35.00
8303. Katherine (katherinekelly2012) 40 73.76 88.93 27 67.50
8304. Kamen (kamen08) 40 63.74 82.01 11 27.50
8305. Md Abdul (kader) 40 34.09 47.88 1 2.50
8306. Josh (josh_carlin) 40 63.11 78.61 8 20.00
8307. johnick44 (johnick44) 40 71.24 83.16 7 17.50
8308. Jewmo (jewmo) 40 88.37 107.20 24 60.00
8309. N o y b (jet1k) 40 105.04 120.75 19 47.50
8310. Jester (jestertyper) 40 142.46 175.43 24 60.00
8311. Jakob (jakobgran) 40 63.13 80.59 9 22.50
8312. Jack (jacknachos) 40 77.89 96.09 12 30.00
8313. J0kerJ4y (j0kerj4y) 40 106.58 124.16 18 45.00
8314. skippie (itsskippie) 40 104.65 123.50 21 52.50
8315. marvic (itsmarvic) 40 85.43 106.94 12 30.00
8316. Issam (issam_08) 40 57.11 69.35 5 12.50
8317. Ishaan (ishaanmahajan) 40 46.76 56.86 24 60.00
8318. Jan (ingenieur) 40 84.19 97.98 12 30.00
8319. Aayush (imqwerty) 40 106.82 123.26 21 52.50
8320. ihateonyou (ihateonyou) 40 126.77 156.08 27 67.50
8321. iCanBreathe (icanbreathe) 40 91.42 114.80 15 37.50
8322. hotbx (hotbxlockbx) 40 80.80 93.90 15 37.50
8323. Harry (harrycc3000) 40 87.08 100.23 16 40.00
8324. Gareth (garethlyh) 40 90.19 109.84 13 32.50
8325. lucas (lucas757) 39 86.98 104.17 9 23.08
8326. Lotus (lotus7) 39 99.91 118.74 14 35.90
8327. Locus (locus_) 39 54.47 62.33 3 7.69
8328. Fredric (lockheart456) 39 74.26 89.07 9 23.08
8329. Omik (litynity) 39 44.79 61.33 7 17.95
8330. Tiger (lilnhan) 39 79.69 92.83 6 15.38
8331. Jozef (lawalamp12) 39 88.91 101.58 20 51.28
8332. kyle (kylesch) 39 104.23 115.48 13 33.33
8333. kyasaa (kyasaa) 39 70.38 81.77 13 33.33
8334. Hehe (kumotz) 39 64.91 85.18 17 43.59
8335. Manas (kingmanas) 39 74.26 87.08 8 20.51
8336. Nathan (killzs) 39 68.69 83.40 9 23.08
8337. kila (kila_lol) 39 57.04 68.22 3 7.69
8338. kifumi (kifumi) 39 113.94 129.96 19 48.72
8339. Khawla Halim (khawla_hlm) 39 39.46 46.23 3 7.69
8340. keval (keval18) 39 70.20 84.11 10 25.64
8341. Le Kang (kangkanglw) 39 71.26 89.85 11 28.21
8342. josiah (josiah_is_weird) 39 60.87 73.25 8 20.51
8343. ジョン (johnr_) 39 110.11 150.97 21 53.85
8344. Johnny (johnnyquest30) 39 91.10 104.81 37 94.87
8345. Jen (jen_23) 39 83.09 108.86 18 46.15
8346. William (ithan) 39 64.11 85.13 9 23.08
8347. Izzy (ishey) 39 101.73 126.32 14 35.90
8348. Inrieal. (inrieal) 39 56.93 67.74 4 10.26
8349. InboxRatio (inboxratio) 39 74.67 87.59 13 33.33
8350. can we have some simple sho... 39 120.72 162.37 23 58.97
8351. . (hiradesuwu) 39 59.30 73.00 11 28.21
8352. himanshu (himanshukumar_ce) 39 47.85 60.52 4 10.26
8353. Brandon (hereisausername2) 39 150.39 178.38 19 48.72
8354. llllllllll (gndndfs) 39 61.28 74.07 10 25.64
8355. . (ggsnipes) 39 85.52 103.00 14 35.90
8356. George (geoju) 39 85.15 106.75 13 33.33
8357. Racharg (freedobby) 39 73.40 90.50 7 17.95
8358. Benny (fransiskusbenny) 39 55.10 68.73 5 12.82
8359. fen (fen10) 39 107.41 155.44 22 56.41
8360. slowboiken (fastken) 39 81.66 98.93 9 23.08
8361. Ethna (ethna) 39 86.46 103.72 11 28.21
8362. end (end_pro) 39 65.76 82.72 7 17.95
8363. EkBros (ekbros9_) 39 76.11 96.31 8 20.51
8364. kuan-yu (edisonhello) 39 78.97 90.36 5 12.82
8365. Raul (eatmydusthoe) 39 67.64 83.68 7 17.95
8366. Driew (driew) 39 88.73 113.79 14 35.90
8367. From the river to the sea (... 39 86.75 111.10 11 28.21
8368. Kuczora (drael1024) 39 99.05 123.02 19 48.72
8369. Daniele (dprimon) 39 36.62 46.38 3 7.69
8370. Robin (dontcallmenymphadora) 39 80.41 96.52 11 28.21
8371. Dongles (dongles) 39 128.11 159.88 28 71.79
8372. DONATETOWATERAID (donatetow... 39 117.94 141.04 28 71.79
8373. David (dlreed27) 39 102.06 116.07 21 53.85
8374. Danky (dankyv1) 39 60.68 71.60 11 28.21
8375. Clone (clonex1) 39 60.63 73.61 7 17.95
8376. Tomas (clickity_clark) 39 49.12 62.17 3 7.69
8377. Mike (cherryot) 39 89.49 109.17 9 23.08
8378. charlotte (charltypes) 39 64.94 75.92 16 41.03
8379. Cavid (cavid) 39 54.09 63.91 4 10.26
8380. B (bz___) 39 149.86 196.51 26 66.67
8381. Ian (bunnyian) 39 86.56 106.28 8 20.51
8382. brocco (brocollie) 39 81.42 99.88 12 30.77
8383. Soonbeom (bringu2h) 39 57.19 64.33 7 17.95
8384. UWU (blizztera) 39 77.44 89.14 15 38.46
8385. Beksultan (bexultan) 39 89.87 107.06 16 41.03
8386. _ (baoy) 39 88.68 111.98 12 30.77
8387. Chloe (bananatyper9) 39 98.00 125.69 14 35.90
8388. Alvin (ayesizzle) 39 101.47 116.01 17 43.59
8389. Arsalnovt (arsalnovt) 39 68.05 85.08 11 28.21
8390. Saphrog (saphrog) 39 69.89 87.36 8 20.51
8391. Varun (salmonwings8207) 39 59.19 72.60 10 25.64
8392. Sajal (sajal0809) 39 45.05 55.95 3 7.69
8393. ALIF (ronin98) 39 58.78 70.46 6 15.38
8394. Ricky (rickestsot) 39 96.82 118.33 19 48.72
8395. rethya (reimogi) 39 117.21 142.62 18 46.15
8396. Rehan (rehan_vibes) 39 52.60 70.22 25 64.10
8397. Ray (ray_jan) 39 32.33 39.32 1 2.56
8398. Jr (rattllingsecret) 39 60.20 74.34 26 66.67
8399. Gary (prtuc2) 39 78.36 91.13 10 25.64
8400. Allan (pronewb2325) 39 56.48 68.06 8 20.51
8401. PRANADALA (pranadala) 39 76.76 88.57 17 43.59
8402. Anar (pomegarnet) 39 57.74 74.56 7 17.95
8403. pono (pnawan) 39 88.35 115.13 17 43.59
8404. Pluufi (pluufi) 39 104.97 125.56 34 87.18
8405. Gwen (planetzero) 39 45.99 60.23 4 10.26
8406. Xhu (okxhu) 39 75.88 91.51 11 28.21
8407. Kostboss (okostas) 39 112.56 127.64 18 46.15
8408. Rami (nub_paws) 39 92.74 106.00 14 35.90
8409. Allay (noob_wrath) 39 94.81 111.10 12 30.77
8410. kdjaiel (nobody42) 39 26.60 35.42 3 7.69
8411. ni (nischalace) 39 64.08 81.41 12 30.77
8412. Angel (ninjasneak543) 39 82.67 97.77 13 33.33
8413. Nilias (nilias121) 39 79.42 92.58 11 28.21
8414. Ali (naseria1) 39 62.28 80.64 10 25.64
8415. Nabil (nabil_aldihni) 39 107.72 132.51 20 51.28
8416. Alex (mysterybox) 39 90.46 115.68 20 51.28
8417. Austin (millerlite) 39 54.24 65.94 3 7.69
8418. Christopher (milk38) 39 42.73 54.26 2 5.13
8419. Enkh-Och (mglstew) 39 84.24 110.74 26 66.67
8420. It's Davda ✅👣 (meetdavda) 39 118.84 137.59 25 64.10
8421. Louis (meenepo) 39 107.31 137.45 15 38.46
8422. maufry (maufry) 39 90.79 112.64 11 28.21
8423. ariferrari (ariferrari) 39 60.99 75.90 6 15.38
8424. Max (antmanmax) 39 122.66 141.91 24 61.54
8425. Anmulla (anmulla) 39 29.53 39.44 5 12.82
8426. Andy (andyjg47) 39 107.49 140.00 19 48.72
8427. anand (anandzzz1973) 39 64.01 81.59 15 38.46
8428. Aman (aman_7002) 39 39.87 47.18 5 12.82
8429. ALostKorean (alostkorean) 39 104.52 132.05 16 41.03
8430. Arthur (agouraptor) 39 45.13 60.46 2 5.13
8431. Jacques (acesfracked) 39 79.45 91.61 13 33.33
8432. Syam (aaasssppp) 39 43.11 56.85 10 25.64
8433. রাতুল (1415926535... 39 58.27 72.11 5 12.82
8434. Hugo (vangoulard) 39 50.18 63.76 4 10.26
8435. Elec (elecki) 39 56.65 70.95 14 35.90
8436. Narki (narkivitek) 39 62.07 78.77 4 10.26
8437. Divyansh (_divyanshwastaken) 39 24.25 33.53 9 23.08
8438. ( ͡° ͜ʖ ͡°) (zarthax69) 39 100.58 125.44 19 48.72
8439. Allison (zarfynn) 39 89.36 106.26 15 38.46
8440. Shivesh Tiwari (yuvanastra) 39 66.22 87.77 13 33.33
8441. Le (yorkist) 39 55.32 68.36 9 23.08
8442. yonatan (yonatanlib) 39 59.74 71.03 2 5.13
8443. Venus (xxvenusxx) 39 70.39 91.87 10 25.64
8444. William (williamc7879) 39 124.41 158.72 33 84.62
8445. Jason (wepanator) 39 60.83 76.15 8 20.51
8446. William (wdk5013) 39 88.87 111.65 16 41.03
8447. Roger (walki_bv) 39 47.82 54.94 3 7.69
8448. Vlad (vladdycrz) 39 90.48 112.48 11 28.21
8449. Vivek (vivekjoshi556) 39 77.90 96.07 11 28.21
8450. vee (veedoze) 39 86.09 107.14 10 25.64
8451. Tiago (tiagval) 39 57.11 75.43 7 17.95
8452. Thunder (thunder05) 39 38.19 50.26 0 0.00
8453. spoon (thrownspoon) 39 65.82 83.09 6 15.38
8454. The Medium (themedium) 39 61.57 71.27 6 15.38
8455. Bourdon 16' (thekeyofg) 39 90.86 103.39 14 35.90
8456. suff (suffy2) 39 53.80 71.86 9 23.08
8457. burgir. (sub10cuber) 39 103.45 126.27 14 35.90
8458. 0 (studdab) 39 54.82 63.38 2 5.13
8459. ya (stfudesu) 39 96.75 125.33 15 38.46
8460. Juey (spyrox) 39 66.94 79.54 6 15.38
8461. Loudy (skolchem) 39 54.11 65.03 5 12.82
8462. Kevin (siacker) 39 128.18 160.52 28 71.79
8463. Shobaik (shobaik_04) 39 49.54 60.38 6 15.38
8464. 🏎️frank (__slowtypist__) 38 110.93 128.20 14 36.84
8465. Intertial (yuvi_birdi) 38 70.47 83.08 7 18.42
8466. yuth (yuth_isme) 38 51.54 62.91 7 18.42
8467. James (youngthe) 38 45.40 55.40 4 10.53
8468. Ulises (xindrome) 38 64.49 78.34 6 15.79
8469. Xeogran (xeogran) 38 172.82 198.75 35 92.11
8470. Etalm (walter_gilbert) 38 114.43 142.09 22 57.89
8471. Wowa (vovsanka) 38 67.04 77.60 6 15.79
8472. Vmanalt (vmanalt) 38 94.07 111.99 17 44.74
8473. Viet Trung (viettrung9012) 38 93.27 106.99 18 47.37
8474. Jorryn (vicmg) 38 81.35 98.09 7 18.42
8475. Uways (uways) 38 66.04 86.43 7 18.42
8476. Charles (tyuule) 38 95.89 122.28 21 55.26
8477. Tayden (tydn12) 38 76.41 97.01 10 26.32
8478. Christian (trotuele) 38 75.14 88.13 7 18.42
8479. Triton (tritonthetrident) 38 71.71 85.72 12 31.58
8480. Thomaskov (thomas861205) 38 60.61 71.40 5 13.16
8481. Last (thelastmuffin) 38 102.12 118.05 14 36.84
8482. Dasha (thedashaier) 38 87.73 100.44 17 44.74
8483. James (th3james) 38 79.75 97.93 10 26.32
8484. sk (teslateslatesla) 38 89.09 108.60 7 18.42
8485. T (tegicupala) 38 91.66 103.05 14 36.84
8486. Tashima (tashima42) 38 83.55 109.79 13 34.21
8487. Grandjudge (talonted) 38 81.59 102.17 11 28.95
8488. Aaron (suckmeoffhoe) 38 68.63 81.94 8 21.05
8489. Professor (steveisawesomer) 38 62.10 74.28 10 26.32
8490. snowdenwald (snowdenwald) 38 80.78 97.50 9 23.68
8491. Sneha (sneha_1610) 38 35.65 46.48 3 7.89
8492. Luka (smilyee) 38 57.30 69.74 7 18.42
8493. Christ (slowasf1) 38 106.69 132.84 16 42.11
8494. Samuel (slee2) 38 63.08 81.66 4 10.53
8495. Shubham (shubham2007) 38 44.64 60.49 1 2.63
8496. shubham (shubham1999) 38 92.32 115.66 15 39.47
8497. Shlock (shlockington) 38 105.12 124.56 19 50.00
8498. Sharkbait (sharkydabnab) 38 84.27 106.53 13 34.21
8499. Shantanu (shantanugupt) 38 44.74 55.13 6 15.79
8500. Jeffrey (seedotgrass) 38 72.47 83.95 11 28.95
8501. Oscar (scarigam) 38 88.85 102.08 3 7.89
8502. Sanad (sanad) 38 33.34 42.38 7 18.42
8503. Saba (samsungexynos) 38 78.93 104.43 10 26.32
8504. Sami (sami_66) 38 49.28 56.52 3 7.89
8505. Jayseek (saltymood) 38 71.94 93.63 10 26.32
8506. sagar (sagarlama) 38 37.14 47.80 3 7.89
8507. Protein (rsandland) 38 84.77 98.75 9 23.68
8508. Roman (roman_kovalchuk) 38 57.91 67.17 2 5.26
8509. Thi (rodingersmg) 38 87.67 107.95 11 28.95
8510. Mistakes Were Made (rhino1998) 38 73.18 88.72 11 28.95
8511. Renson (renson1) 38 107.05 137.45 16 42.11
8512. 中学 (randomguyhe) 38 83.09 100.15 9 23.68
8513. Crudux-Crue (raman_rr) 38 54.37 65.22 3 7.89
8514. ragnarok (ragnarokiscomming) 38 79.51 98.60 9 23.68
8515. Quintino (quintino123) 38 94.15 109.04 8 21.05
8516. LiterallyYou (quesket) 38 74.61 97.88 8 21.05
8517. pogi (pogy) 38 47.95 69.18 9 23.68
8518. owo :3 (playtoomuchgames) 38 98.43 127.26 10 26.32
8519. Viktor (pineapple212) 38 94.30 127.46 12 31.58
8520. jayp (phrasez) 38 92.72 122.02 27 71.05
8521. не встретил бо... 38 151.56 166.12 34 89.47
8522. Tosti-ijzer (paupermongool) 38 99.14 112.80 10 26.32
8523. bat (origluun) 38 79.59 92.82 8 21.05
8524. clooverhoover (olivesandlem... 38 67.74 95.00 9 23.68
8525. nyouhas (nyouhas_) 38 90.35 112.45 20 52.63
8526. Noukarin (noukarin) 38 84.41 106.47 10 26.32
8527. Nitrogen (nitrogen_addict) 38 47.89 59.10 3 7.89
8528. Nemsi (nemsii) 38 128.77 145.52 23 60.53
8529. Arden (moo_o) 38 93.50 121.21 13 34.21
8530. kayg (miryokucolemakdh) 38 84.10 106.25 20 52.63
8531. shum (michaelshumshum) 38 84.01 101.00 12 31.58
8532. Mewn (mewn) 38 78.47 95.27 12 31.58
8533. Muhammad Amin (mast1999) 38 53.99 77.14 17 44.74
8534. Marouane (maromaro02) 38 53.48 64.09 2 5.26
8535. Mark (markachuang) 38 88.90 108.64 16 42.11
8536. Manas (manasmahanand) 38 60.43 70.92 11 28.95
8537. lin (lty2002) 38 60.33 83.67 10 26.32
8538. The Papal State (loquiera) 38 97.07 113.06 11 28.95
8539. Hitscan (loonatick_src) 38 93.12 112.79 15 39.47
8540. Marty (lagoskid) 38 71.28 91.47 17 44.74
8541. Kevin Carl (kevincarl09) 38 59.07 67.53 7 18.42
8542. Kaushik (kaushik13) 38 64.13 85.68 10 26.32
8543. karina (kar1na_) 38 53.48 66.34 5 13.16
8544. mmmmm (kamenrider345) 38 77.30 95.24 11 28.95
8545. Kagamine Len (kagamine_len) 38 97.00 120.45 9 23.68
8546. Amir (justinpaper) 38 43.23 53.12 7 18.42
8547. Joseph (jsph273) 38 106.14 124.34 21 55.26
8548. Jerry (jerryr5279) 38 94.55 124.68 13 34.21
8549. Ellie (jellylie2005) 38 67.79 79.65 6 15.79
8550. Jacob (jeepers_jake) 38 109.95 134.13 22 57.89
8551. Jan Kozaruk (jackoza) 38 22.60 32.17 21 55.26
8552. (ilikeponyz20) 38 94.55 110.44 15 39.47
8553. Vladislav (iivlad) 38 59.87 74.39 8 21.05
8554. G (hyperglide) 38 129.62 152.16 22 57.89
8555. heclord (heclord) 38 93.13 108.04 11 28.95
8556. H. (hblord) 38 96.47 110.06 21 55.26
8557. hs (hakanserce) 38 75.85 91.08 8 21.05
8558. Hajar (hajar424) 38 89.76 113.89 10 26.32
8559. Gustas (guzhazi) 38 84.29 114.28 13 34.21
8560. Ozz (gravechill) 38 98.95 129.78 15 39.47
8561. 0 (gochoo) 38 93.39 107.68 13 34.21
8562. Filthy (filthyballer) 38 55.92 66.87 5 13.16
8563. ferris (ferrisiscool) 38 82.37 100.06 13 34.21
8564. Feriiii (feriiiiiiii) 38 54.22 63.41 5 13.16
8565. EthanDennisttv (ethandennis) 38 107.63 130.94 14 36.84
8566. john (er3g10us) 38 54.38 70.00 10 26.32
8567. dox3 (dox3m) 38 61.60 75.79 12 31.58
8568. aoeu (dengzacd) 38 132.19 152.75 21 55.26
8569. DR (dekesta_) 38 114.74 144.22 28 73.68
8570. Sangyoung (ddragoons) 38 121.72 154.36 24 63.16
8571. Karthik (darthmortem) 38 60.00 73.95 6 15.79
8572. Michael (clayjar) 38 120.20 137.27 22 57.89
8573. Hello (clappy) 38 74.63 89.63 13 34.21
8574. C4MFZ (c4mfz) 38 67.48 81.72 7 18.42
8575. Kevin (busterz) 38 43.48 52.58 3 7.89
8576. Burger (burgercheese) 38 110.84 134.18 24 63.16
8577. brobie (brobie747) 38 96.31 120.45 14 36.84
8578. Bit (bitnerik) 38 66.28 77.37 6 15.79
8579. Henry (barihenry) 38 96.91 114.69 15 39.47
8580. Awkward (awkward_fruitcake) 38 90.00 100.82 9 23.68
8581. Peter (avezan) 38 95.33 127.93 14 36.84
8582. Jake (aurelias) 38 104.76 128.77 12 31.58
8583. PrairieBaron (atbaron) 38 77.29 93.98 9 23.68
8584. AspectOfTheNerd (aspectofth... 38 94.59 125.63 15 39.47
8585. Asylbek (askodzhenaliev) 38 35.10 43.55 14 36.84
8586. Arthur (art8urch3ng) 38 53.03 68.61 5 13.16
8587. abracadabra (ariunerdene) 38 35.17 43.51 11 28.95
8588. loli (annalise00) 38 76.11 91.46 9 23.68
8589. Anmol (anmoljaat_) 38 43.19 52.69 9 23.68
8590. Anha (anha05) 38 64.25 77.88 6 15.79
8591. Angelo (angelo123123) 38 124.38 149.20 26 68.42
8592. angelic (angeliccalling) 38 29.28 43.70 4 10.53
8593. Michael (anfestan) 38 29.88 40.25 5 13.16
8594. anas (anas771989) 38 51.53 61.11 3 7.89
8595. AmazingKitchen (amazingkitc... 38 86.92 100.85 10 26.32
8596. Altair (altairaltair) 38 50.98 65.80 7 18.42
8597. Juan (alcaann) 38 67.79 83.93 13 34.21
8598. Akshay (akshayxw69) 38 70.50 85.60 4 10.53
8599. Dara (adoran) 38 79.87 100.97 8 21.05
8600. Slow Typer (4rs3n1c) 38 76.60 90.14 19 50.00
8601. potato (potatoattack) 38 77.63 90.29 13 34.21
8602. Anton kenneth lee bell (m011y) 38 77.20 94.35 9 23.68
8603. Robert (robboy) 38 76.67 102.90 5 13.16
8604. dove (nach9208) 38 90.29 111.18 14 36.84
8605. BlackVerse (drako201) 38 62.74 77.80 7 18.42
8606. mangesh (muxx) 38 29.32 38.99 8 21.05
8607. tstats[ankur_123] (ankur_123) 38 63.60 79.09 9 23.68
8608. Michal (murb) 38 58.55 69.88 7 18.42
8609. WeWake (we_wake) 38 55.85 66.37 4 10.53
8610. Paulo (bibon98) 38 72.97 89.80 11 28.95
8611. Leemon (leemon_slice) 38 34.70 54.83 3 7.89
8612. vsn (miniliki) 38 90.52 109.45 14 36.84
8613. Alex (alkan137) 37 90.49 121.30 16 43.24
8614. Aeriana (aer000) 37 44.70 57.57 3 8.11
8615. GODLIKE (acrimeisnotfine) 37 71.09 93.38 13 35.14
8616. Lintang (8inx) 37 31.58 40.32 6 16.22
8617. nattapakon (63100932) 37 26.83 30.92 12 32.43
8618. Mohammad Imam (1mam) 37 70.85 85.12 13 35.14
8619. Willow (02_wl_04) 37 68.55 83.09 19 51.35
8620. bigchick (bigchickbird) 37 87.29 106.11 11 29.73
8621. AKarudwal (akarudwal) 37 47.19 63.93 5 13.51
8622. mouni (mouni90) 37 48.01 57.17 1 2.70
8623. Luke (lukedood) 37 106.48 137.71 21 56.76
8624. juliana (lilfl3shy) 37 47.32 54.72 5 13.51
8625. LightUnicorn839 (lightunico... 37 39.47 49.88 1 2.70
8626. Roast (lemonshine) 37 59.68 76.45 7 18.92
8627. RENIEL RENZ (leiner_ross15) 37 73.39 83.94 12 32.43
8628. Ali (lasthunter69) 37 61.03 78.22 7 18.92
8629. Lai (lai_) 37 80.05 94.35 11 29.73
8630. Kijurin (kijurin) 37 75.26 90.83 12 32.43
8631. Kelvin (kelvin666) 37 60.85 71.14 10 27.03
8632. Kyla (kdawg22) 37 95.16 109.56 21 56.76
8633. kamal (kamaluddin) 37 37.68 46.35 1 2.70
8634. tstats[kafuu] (kafuu) 37 104.33 140.60 20 54.05
8635. 詠璿 (justforfun0906) 37 56.78 67.11 7 18.92
8636. Justanalek (justanalek) 37 69.27 79.65 5 13.51
8637. Jimmy (jimmyr1027) 37 90.87 126.65 25 67.57
8638. Jason (jason_the_human) 37 58.16 70.65 8 21.62
8639. Jamie (jamiekwok) 37 48.19 54.99 1 2.70
8640. Justin (j98101237) 37 66.43 85.65 10 27.03
8641. 69 (i_am_better_than_u_lol) 37 66.11 85.48 27 72.97
8642. Vitres (irving1234028) 37 116.00 142.93 18 48.65
8643. Intetsu (intetsun6) 37 30.12 36.70 2 5.41
8644. Oscar (iloveveck) 37 60.99 84.20 2 5.41
8645. iks de (iksdebro) 37 92.56 117.83 13 35.14
8646. hewan (ikan_laut) 37 32.55 36.83 5 13.51
8647. Bart (hubba485) 37 117.82 136.26 17 45.95
8648. Rain (hlbentz) 37 125.33 143.54 22 59.46
8649. Max (hihello12327) 37 70.26 87.86 11 29.73
8650. gyfan10 (gyfan10) 37 75.03 93.31 8 21.62
8651. Gustav (gustavelmqvist) 37 86.31 107.77 12 32.43
8652. Grosse (grossescheisse) 37 56.96 72.20 6 16.22
8653. Grace (gracejin) 37 38.66 51.80 0 0.00
8654. Dawg (goon_goonster) 37 87.37 104.00 13 35.14
8655. Nakoa Blue (goldtiger7) 37 39.50 48.51 1 2.70
8656. WAD (_waddup_) 37 66.20 82.54 14 37.84
8657. Ian (zento_x) 37 62.35 72.81 5 13.51
8658. InHuMaN (yminag123) 37 111.41 127.49 16 43.24
8659. yessine (yessine14) 37 62.66 77.81 9 24.32
8660. Ethan (yaboinugget) 37 124.67 152.04 18 48.65
8661. FTL (xxfangtingxx) 37 72.44 86.56 8 21.62
8662. W (w_v_) 37 94.39 120.43 18 48.65
8663. Ben (wippidy) 37 75.15 91.62 9 24.32
8664. hi (watlok) 37 131.93 159.04 20 54.05
8665. Vishal (vpm911) 37 77.15 98.92 5 13.51
8666. Vatsala (vatsala) 37 60.92 71.61 7 18.92
8667. u8y7541 (u8y7541) 37 136.10 160.55 25 67.57
8668. Ball Sweat (typing_man_man) 37 76.77 89.99 8 21.62
8669. I am in school rn (typingin... 37 85.68 98.66 15 40.54
8670. Abhinav (typingcompany) 37 37.94 50.03 3 8.11
8671. Type (type_racer_15) 37 67.71 81.06 8 21.62
8672. Jack (turtlejack) 37 53.67 63.28 5 13.51
8673. TTMo1 (ttmer) 37 143.58 187.08 30 81.08
8674. Rock (trailersg) 37 68.13 77.88 9 24.32
8675. Fast (too_fast_foru) 37 63.89 73.55 5 13.51
8676. John (tmikelburg) 37 107.16 137.61 10 27.03
8677. Fae (suga_spice) 37 38.72 48.76 12 32.43
8678. Amarnath (stormprod) 37 71.93 99.10 11 29.73
8679. Andrew (sq_leonhart) 37 97.87 116.36 18 48.65
8680. Sophia (sophia2020) 37 82.57 101.88 4 10.81
8681. . (solorex_) 37 82.57 120.32 25 67.57
8682. Erick (sockeymeow) 37 92.46 110.13 7 18.92
8683. light (skepnap) 37 42.39 54.79 1 2.70
8684. Jojuh (shojubruh) 37 90.86 112.81 19 51.35
8685. shiru (shiruetto68) 37 116.07 142.18 19 51.35
8686. Shenen (shenenjump) 37 104.95 122.65 20 54.05
8687. Jason (saltybaskets) 37 90.47 106.31 10 27.03
8688. Kyle (sadkhaki) 37 53.97 64.96 3 8.11
8689. Aru (s3rikbaeva) 37 46.26 61.90 5 13.51
8690. Rold (roldmargruv) 37 66.82 82.54 22 59.46
8691. Aarsh (revolt1ng) 37 65.90 77.70 8 21.62
8692. Rekordea (rekordea) 37 85.20 113.35 13 35.14
8693. 1 (reforme) 37 76.34 89.24 9 24.32
8694. Parvez (pz1971) 37 73.45 83.35 14 37.84
8695. Yevhenii (prinzeugen) 37 85.23 100.44 14 37.84
8696. radar (pranav24) 37 59.93 71.62 13 35.14
8697. andrew (potatoh) 37 83.73 102.11 11 29.73
8698. light (pinkyhurts) 37 74.47 87.95 10 27.03
8699. PancakeDAWGZ (pancakedawgz) 37 121.02 139.42 19 51.35
8700. Liad (ozonzono) 37 74.78 93.74 6 16.22
8701. orde (orde) 37 103.03 129.43 10 27.03
8702. Omar (omarabzd) 37 86.97 106.78 15 40.54
8703. Omer (okirnap) 37 86.79 102.96 9 24.32
8704. NC3 (nickkcastaneda) 37 63.10 81.42 13 35.14
8705. Mohammad (naveedroy) 37 36.90 44.41 3 8.11
8706. nadeem (nadeemgujjar560) 37 64.50 80.02 11 29.73
8707. azaab (minsato) 37 69.10 85.07 7 18.92
8708. Matthew (mbryantms) 37 110.89 130.70 19 51.35
8709. Frostsights (frostsights) 37 100.29 119.34 11 29.73
8710. Purpl3 (froghie) 37 67.18 89.56 14 37.84
8711. Sentinel (fedayeen) 37 83.62 98.49 12 32.43
8712. Erza (ewalk91098) 37 51.99 60.30 5 13.51
8713. sky (elsecaller) 37 88.60 98.93 6 16.22
8714. Thundering (electricbiscuit) 37 121.21 139.26 16 43.24
8715. Echo (echo316) 37 78.02 103.61 7 18.92
8716. Alex (eagles1106) 37 105.95 151.99 22 59.46
8717. ZeroNine (dtrix) 37 106.86 137.44 11 29.73
8718. Diego (diegogamer0528) 37 53.47 65.44 11 29.73
8719. Diamond (diamond_desu) 37 67.40 85.76 13 35.14
8720. Joe mom (deroze) 37 92.58 106.58 9 24.32
8721. Deanna (deanna123) 37 74.02 97.24 6 16.22
8722. Shawn (cubershz) 37 114.78 137.62 19 51.35
8723. chubbypugs21 (chubbypugs21) 37 88.39 106.33 11 29.73
8724. Hugh Janus (chrispoulos) 37 74.26 85.62 11 29.73
8725. Celia (ccelo) 37 48.67 68.06 5 13.51
8726. Ivan (budabudimir) 37 86.51 102.15 12 32.43
8727. Bonzi (bonzibuddy420) 37 104.44 148.88 15 40.54
8728. Ryan (bluesquirrel) 37 87.14 109.97 12 32.43
8729. learning djorjak (blondebois) 37 87.23 110.52 14 37.84
8730. Majed (bestwifi) 37 87.58 101.64 19 51.35
8731. bbcola18 (bbcola18) 37 101.54 130.91 17 45.95
8732. Bart (bartok) 37 65.81 84.14 14 37.84
8733. barrybee789 (barrybee789) 37 58.86 70.13 4 10.81
8734. baekd (baekde) 37 83.53 110.69 10 27.03
8735. i like typing (a_hole) 37 52.05 68.57 25 67.57
8736. Aviv (avivbn263) 37 120.97 132.93 19 51.35
8737. Fiji (fijired2) 36 88.38 110.76 12 33.33
8738. Fabricio (ffontesb) 36 42.81 52.95 7 19.44
8739. Exxotix (exxotix) 36 62.30 90.93 16 44.44
8740. Eugene (entilaren) 36 99.82 121.37 21 58.33
8741. elizabeth (elizabeth1ee) 36 116.29 136.46 21 58.33
8742. Richard (elevatecrazy_yt) 36 86.46 104.02 11 30.56
8743. egg (egguard) 36 80.33 98.02 7 19.44
8744. Egbadon (egbadon) 36 52.18 61.46 7 19.44
8745. John (dyst0pia) 36 62.85 76.86 26 72.22
8746. Concomitant (dvorakdork) 36 99.17 109.62 16 44.44
8747. dissonantly (dissonantly) 36 107.10 130.99 18 50.00
8748. Cyberstrike (cyberstrike) 36 43.39 56.02 3 8.33
8749. Cucu (cucu_grey) 36 62.44 72.44 7 19.44
8750. Crehan (crayon144) 36 60.64 68.61 11 30.56
8751. scr4tchman (connerkainnerkai) 36 78.54 90.96 12 33.33
8752. 👺 (confiscar) 36 92.79 113.27 10 27.78
8753. Christopher (codaki) 36 47.81 59.99 5 13.89
8754. Kai (ckai) 36 84.89 109.76 6 16.67
8755. Finna (captfinn) 36 71.69 81.44 7 19.44
8756. Cameron (camalb02) 36 42.39 53.06 1 2.78
8757. asdftr (buhdo) 36 74.59 90.21 10 27.78
8758. Batkhishig (btkshg) 36 75.39 86.78 9 25.00
8759. bruuuh (bruhxfish) 36 101.21 120.41 12 33.33
8760. Bruno (brbeans) 36 90.49 114.29 12 33.33
8761. Bipin (bipin_emp123) 36 57.10 66.94 5 13.89
8762. abdullah (billnyezenazispy) 36 58.25 67.76 10 27.78
8763. Bernice Hee Shu Qi (bernice... 36 69.16 80.88 6 16.67
8764. Bek (bekkk) 36 52.53 61.41 7 19.44
8765. aver (aversioneer) 36 63.14 76.69 5 13.89
8766. gta (asldkfj) 36 72.80 90.31 7 19.44
8767. ashbellebsha (ashbel_g) 36 87.59 113.25 9 25.00
8768. Mateo (asetato) 36 69.26 86.32 8 22.22
8769. Arun (arun808) 36 101.98 122.81 16 44.44
8770. Arthur (arturopakastur) 36 105.82 120.88 14 38.89
8771. Zol (zoltac) 36 89.46 116.18 8 22.22
8772. Shelby (zalak_b) 36 60.98 76.07 2 5.56
8773. Vinícius (yamatano) 36 57.01 64.62 4 11.11
8774. Xavieku (xavieku) 36 68.48 80.50 14 38.89
8775. Westly (wslafleur) 36 114.69 133.06 19 52.78
8776. Ethan (wolfiedude14) 36 65.62 83.28 30 83.33
8777. chris (walchrisc) 36 80.03 92.80 15 41.67
8778. Vision (vision_of_infinity) 36 80.19 92.45 9 25.00
8779. Jack (tzak) 36 113.77 132.42 15 41.67
8780. tlbi (tla109) 36 106.41 135.72 24 66.67
8781. Evan (theworkmanmuffin) 36 77.06 88.49 11 30.56
8782. thespaghetti27 (thespaghett... 36 67.11 90.39 12 33.33
8783. thepenguinmonkey (thepengui... 36 79.28 90.02 7 19.44
8784. Tesla (teslalord) 36 92.93 112.83 16 44.44
8785. Tanvir (tanvir187) 36 87.92 110.45 9 25.00
8786. Do (tai230) 36 55.99 66.85 4 11.11
8787. Sujit (sujit2000) 36 73.65 92.42 12 33.33
8788. Guest (solovf) 36 155.36 205.65 32 88.89
8789. akum! (solargiants) 36 43.54 55.01 3 8.33
8790. KJ (snthaoeu) 36 117.46 136.94 16 44.44
8791. Levi (sniperkiller2) 36 61.73 73.39 9 25.00
8792. (slowghost) 36 201.90 242.96 34 94.44
8793. Salem (slomy0010) 36 47.93 57.16 3 8.33
8794. (slimaniimededdineabderrah... 36 55.62 66.87 5 13.89
8795. Twinkle (sirius_07) 36 51.24 59.36 1 2.78
8796. Chris Klenø - Geographer f... 36 135.33 172.14 29 80.56
8797. Kladdigt (sigius) 36 93.49 109.71 11 30.56
8798. Rajat (argentum_1807) 36 73.05 86.53 9 25.00
8799. James (arctos) 36 48.43 59.08 1 2.78
8800. 🐢🐢🐢🐢 (amogh1420) 36 93.58 109.06 16 44.44
8801. Amit (amitkarmakar13) 36 79.85 99.43 14 38.89
8802. Daniel (amai727) 36 116.19 146.70 20 55.56
8803. Joosep (aktos) 36 92.49 111.38 13 36.11
8804. akram (akrambr) 36 37.48 46.06 3 8.33
8805. Ayedread (ade15) 36 72.18 84.09 7 19.44
8806. Fuel plane (1pavanb) 36 54.78 67.90 14 38.89
8807. Happy (happy_jms) 36 69.54 87.29 15 41.67
8808. Soul (quentinlikesaot) 36 76.79 96.82 9 25.00
8809. james (jamesfarmer) 36 71.67 87.30 11 30.56
8810. Peyton (peytonk608) 36 77.92 90.55 4 11.11
8811. Henry (parrotfish) 36 101.78 119.89 15 41.67
8812. Octagonal (octagonalwalnut) 36 111.16 138.44 21 58.33
8813. arcticfox (spiky_echidna) 36 70.98 102.71 7 19.44
8814. yam (yamazakura) 36 66.64 89.51 6 16.67
8815. Harith (6krypto) 36 49.23 59.80 5 13.89
8816. Luiz (lznetorox) 36 69.26 85.33 8 22.22
8817. Luis Francisco (luifrancgom) 36 37.14 50.16 2 5.56
8818. LubedCube (lubed_cube) 36 61.01 71.97 10 27.78
8819. Leaderboard is (leaderboard... 36 94.19 139.30 10 27.78
8820. Arsen (konars_04) 36 25.60 33.86 3 8.33
8821. Necrophos (komaroffski) 36 77.70 98.40 9 25.00
8822. bob (kkgd) 36 92.51 105.43 16 44.44
8823. Asian (kiniiranai) 36 92.69 108.06 12 33.33
8824. Karimu (karimuosman) 36 107.43 122.79 21 58.33
8825. El (kandel) 36 61.28 82.47 5 13.89
8826. kabir raj (kabir26) 36 60.59 69.06 6 16.67
8827. Aria (juicyhaluja) 36 116.04 156.76 18 50.00
8828. Joshua (joshuahd) 36 81.89 98.99 14 38.89
8829. Jordan (jordatypist) 36 106.80 132.79 13 36.11
8830. Jonathan (jonathankim1999) 36 83.29 100.04 9 25.00
8831. ghostofnav (jokerhyper) 36 73.28 86.50 9 25.00
8832. Eric (joker4120) 36 63.43 79.83 8 22.22
8833. Jean (jeanerino) 36 60.18 72.11 10 27.78
8834. its_Atrap (its_atrap) 36 94.36 111.53 15 41.67
8835. itssarcazm (itssarcazm) 36 92.81 115.14 10 27.78
8836. Amdadul (imlak) 36 45.00 59.61 3 8.33
8837. Wapiro (ihatejuices) 36 68.80 79.53 6 16.67
8838. BOz (hyund0) 36 117.38 133.49 22 61.11
8839. Christine (hugowolf) 36 96.04 115.77 19 52.78
8840. Sporadic (howsporadic) 36 121.90 154.98 26 72.22
8841. Aisier (hfssma) 36 94.88 109.44 16 44.44
8842. herman (herman159) 36 93.70 109.66 9 25.00
8843. Heorhii (heorhii_hryhorov) 36 82.44 99.96 8 22.22
8844. Anthony (gphobes) 36 118.94 148.08 21 58.33
8845. Ricardo (golden_boi) 36 55.44 64.47 4 11.11
8846. gandastik (gandsatik) 36 84.70 98.82 11 30.56
8847. Damiano (fullomen) 36 83.43 93.28 6 16.67
8848. Jason (r_matey) 36 94.14 110.31 11 30.56
8849. rufus (rufi999) 36 53.03 63.74 3 8.33
8850. Raimbek (rk_avilbekov) 36 53.26 65.38 6 16.67
8851. R (renxsis) 36 98.93 136.50 11 30.56
8852. Kabera (rcdude27) 36 107.00 123.88 15 41.67
8853. Ramona (ramonaflowers101) 36 98.01 110.32 15 41.67
8854. Adam (photoequal) 36 31.41 37.67 2 5.56
8855. Persy (persy) 36 62.44 82.96 8 22.22
8856. (pepeworm_colemak) 36 148.60 217.82 10 27.78
8857. :) (pennani) 36 82.65 95.46 17 47.22
8858. P (patrickkayne) 36 74.01 94.57 4 11.11
8859. John (parallaxjedi) 36 98.11 110.13 13 36.11
8860. Napat (omakaze) 36 65.64 80.86 7 19.44
8861. caden (okaydern) 36 93.82 107.72 18 50.00
8862. odezzki (odezzki) 36 81.20 96.98 11 30.56
8863. NutMonger (nutmonger) 36 68.10 82.42 8 22.22
8864. yess (notavailabe) 36 103.17 124.76 15 41.67
8865. Mulosh (mulosh) 36 109.71 125.93 16 44.44
8866. Lawrence (mrlab) 36 74.86 90.63 7 19.44
8867. M (mostafam) 36 83.07 102.81 11 30.56
8868. willy (monvment) 36 80.63 98.14 14 38.89
8869. Mons (monstoonix) 36 82.05 94.42 11 30.56
8870. Mohib (mohib33) 36 81.36 96.23 18 50.00
8871. Mekrigen (mekrigen) 36 62.17 73.53 7 19.44
8872. MasterMind (master__mind) 36 90.96 104.25 17 47.22
8873. Marc (maroenzo) 36 89.16 106.18 13 36.11
8874. Marcel (marcelmladi) 36 30.32 37.79 9 25.00
8875. Mantis (mantisplays) 36 97.02 127.43 8 22.22
8876. Say_the (saythe) 35 63.36 80.07 6 17.14
8877. Shohidujjaman (sajib975) 35 45.26 56.39 33 94.29
8878. Saber (saberspeed777) 35 100.41 121.44 13 37.14
8879. Jay (saberon1402) 35 63.74 72.90 0 0.00
8880. K (rynetemp) 35 70.81 102.61 9 25.71
8881. amy (rose51203) 35 99.67 125.87 8 22.86
8882. رحيم (rahim06) 35 59.71 70.11 3 8.57
8883. Gavin (qwertyparty) 35 98.07 121.19 14 40.00
8884. Peter (ptrmai) 35 83.20 95.56 9 25.71
8885. Under (polish_underdog) 35 107.43 119.89 22 62.86
8886. PK (pkhou) 35 49.72 64.29 3 8.57
8887. aerisslowers (pietrucha33) 35 77.51 98.83 9 25.71
8888. 1234 (perfect_practice) 35 112.01 132.53 17 48.57
8889. PoonPounder (p00np0under) 35 63.96 76.58 12 34.29
8890. Gilbert (ooblek) 35 87.73 106.44 10 28.57
8891. Anton (noviru) 35 72.11 87.33 9 25.71
8892. Novas (novas_arcos) 35 81.88 94.14 7 20.00
8893. Ninja (ninjaacat) 35 90.09 108.48 12 34.29
8894. Neil (neilborde) 35 101.33 122.55 12 34.29
8895. Camden (mypenguinbuddy) 35 103.31 132.65 14 40.00
8896. Ryan (moseqa) 35 63.90 82.02 3 8.57
8897. Jacob (monkeybenq) 35 105.83 129.58 18 51.43
8898. misab (misabshibu) 35 20.67 31.08 14 40.00
8899. Dagareth (mindcrime) 35 86.19 105.25 8 22.86
8900. Jemo (mille_colombes) 35 78.62 96.08 11 31.43
8901. MilkhoundTTV (milkhound) 35 107.39 140.66 12 34.29
8902. MHR (mhrofficial) 35 58.47 72.91 6 17.14
8903. Ajay (metacorb) 35 56.11 66.16 4 11.43
8904. Louis 🤴🏾 (matiny) 35 51.19 61.84 2 5.71
8905. Mark (mark666) 35 67.81 96.93 16 45.71
8906. Maple (maplesyrup789) 35 83.13 101.69 17 48.57
8907. Alex (aqin24) 35 108.74 121.43 19 54.29
8908. ANDRAGOMOR (andrago_) 35 47.05 59.31 1 2.86
8909. subham (alexus78) 35 58.19 67.36 9 25.71
8910. Aelius (aelius_l) 35 120.10 146.43 16 45.71
8911. Adzeyns (adzenys) 35 97.72 118.45 16 45.71
8912. AIbek (3xter) 35 56.86 65.05 2 5.71
8913. Magieschnuller (magieschnul... 35 70.56 79.15 9 25.71
8914. aeign (eyncore) 35 70.66 85.64 6 17.14
8915. Kxngh#0001 (kingh17) 35 60.30 74.72 26 74.29
8916. safia (safia1607) 35 50.76 62.36 2 5.71
8917. Xingyu (findmealone) 35 46.54 66.30 6 17.14
8918. JSD (_jsd) 35 44.11 56.19 1 2.86
8919. Anav (dark_winter) 35 75.29 90.51 9 25.71
8920. shahidul islam (prantoislam... 35 44.90 55.32 7 20.00
8921. ahmed (mamado69) 35 51.31 62.49 5 14.29
8922. Allison (ixonic_alli) 35 38.72 50.36 0 0.00
8923. OTL (floormint) 35 63.11 69.79 7 20.00
8924. Financier (financier) 35 121.50 141.06 16 45.71
8925. Farhan M. (farhanmasud) 35 83.36 95.04 8 22.86
8926. David (fantasticdavid) 35 68.89 86.04 8 22.86
8927. 🥇 Evan C. (evancnavarro) 35 103.47 118.45 13 37.14
8928. Max (elsancho5) 35 94.06 112.56 10 28.57
8929. ahmed (elkfafy) 35 55.99 71.17 2 5.71
8930. Rob (ebqs) 35 57.16 68.45 4 11.43
8931. Daniel (dsonger20) 35 90.13 112.44 13 37.14
8932. Derek (doggish) 35 92.99 109.74 12 34.29
8933. Wasabi (distartor) 35 54.78 65.83 7 20.00
8934. Adi (diddly_doo) 35 84.13 95.31 7 20.00
8935. Deron (deronpianoplayer) 35 74.68 92.40 10 28.57
8936. dedendje (dedendje) 35 83.58 94.95 8 22.86
8937. Darian (darian_adiwarna) 35 80.84 104.45 11 31.43
8938. DanGaL2017 (dangal2017) 35 65.56 77.19 10 28.57
8939. Crayon (crayonsc) 35 81.24 98.78 9 25.71
8940. cortmarshal (cortmarshal) 35 97.59 122.44 12 34.29
8941. Comfy_Kitten (comfykitten) 35 100.58 119.53 13 37.14
8942. citrus (citrustrack) 35 111.85 131.40 21 60.00
8943. Chris (chrislowe) 35 82.27 100.06 12 34.29
8944. chalk (chalkboard) 35 78.33 91.20 11 31.43
8945. Dharma (cdharmateja) 35 78.97 95.88 20 57.14
8946. Rarely type in my job (catc... 35 85.10 106.68 14 40.00
8947. Carter (cartermanator) 35 65.63 82.45 5 14.29
8948. Cadence (cadence_workman) 35 114.99 135.64 24 68.57
8949. Caco (cacopholey) 35 85.09 111.00 11 31.43
8950. Name (buttface69) 35 128.77 151.17 18 51.43
8951. Brt (brtboi) 35 70.37 90.71 7 20.00
8952. Bread (breadandbuddha) 35 98.88 117.08 25 71.43
8953. Christian (bobbyjrrocks) 35 82.84 108.76 6 17.14
8954. shellyshellyshellyumm (blue... 35 100.35 114.97 13 37.14
8955. Dhia Eddine (bl1ndk) 35 48.10 56.94 1 2.86
8956. Anish (bira_01) 35 58.22 69.92 8 22.86
8957. big (bigfinger420) 35 103.43 122.40 13 37.14
8958. FoolSt0p (beanenthusiast) 35 89.24 114.63 12 34.29
8959. Bartłomiej (baryla69baryla69) 35 79.40 90.78 14 40.00
8960. Camel (bandar314@yahoo.com) 35 67.21 84.63 7 20.00
8961. Bridget (bahns) 35 60.83 80.96 8 22.86
8962. Ilya (azeti1) 35 52.35 58.42 6 17.14
8963. Abdelrahman (awebdo) 35 55.27 65.87 2 5.71
8964. Dalle (ash_ish) 35 76.01 100.43 9 25.71
8965. tgb524 (_yuno) 35 105.75 128.14 18 51.43
8966. devil_02 (_ebad_) 35 41.83 52.55 4 11.43
8967. yntylox (yntylox) 35 37.39 55.96 3 8.57
8968. Muhammad (xxvv) 35 74.05 89.87 8 22.86
8969. Evans (xerodo) 35 83.56 95.13 13 37.14
8970. Johannes (xcillingx) 35 56.66 68.86 5 14.29
8971. Usman (x1itachi) 35 112.96 143.34 17 48.57
8972. Wizrud (wizurd_) 35 78.33 91.31 6 17.14
8973. veryfast (veryfastxd) 35 92.30 108.76 9 25.71
8974. vekikornjaca (vekikornjaca) 35 87.41 109.11 17 48.57
8975. Taiki (vegantaiki) 35 71.03 89.24 11 31.43
8976. Michael (val_slow) 35 86.18 102.59 14 40.00
8977. typer_trainer (typer_trainer) 35 90.36 110.13 12 34.29
8978. ANUP (typekashyap) 35 68.61 83.78 9 25.71
8979. jeff (typecringe) 35 105.10 120.44 14 40.00
8980. Sergey (tsykurawork) 35 59.44 69.71 8 22.86
8981. Nazib (tony_129) 35 60.58 76.14 9 25.71
8982. doncheadle (timothyqian) 35 97.56 117.74 16 45.71
8983. Thiemo (thiemok) 35 68.21 80.50 7 20.00
8984. Eric (thiccbrick) 35 72.31 104.53 11 31.43
8985. Boipelo (the_big_bp) 35 38.47 45.83 5 14.29
8986. ∞ (technolojesus) 35 68.03 75.84 8 22.86
8987. Non (tata32000) 35 75.20 92.06 8 22.86
8988. Tardy (tardyislazy) 35 74.67 90.22 11 31.43
8989. McLovin (tappytyper) 35 103.56 121.86 11 31.43
8990. adin (tappineapple) 35 93.02 121.86 13 37.14
8991. Swastik (swastik220705) 35 56.06 66.22 6 17.14
8992. Alaska Young (soner) 35 127.62 155.63 21 60.00
8993. sol (solshad) 35 69.64 89.60 6 17.14
8994. Choco (slowest_sloth) 35 61.78 79.38 5 14.29
8995. Gabriel (slenders) 35 70.08 100.56 20 57.14
8996. roy (shote) 35 55.35 64.44 1 2.86
8997. mtn (m0untain) 35 71.54 88.19 8 22.86
8998. Hayaku (m0tt0_hayaku) 35 53.49 66.39 3 8.57
8999. lysrac (lysrac) 35 66.62 88.81 5 14.29
9000. Lux (lux_winters) 35 105.64 127.96 23 65.71
9001. Guilherme (luxidu) 35 75.60 86.45 11 31.43
9002. justin (lookitsjustin) 35 90.19 110.67 15 42.86
9003. Robert (lonewulf92) 35 120.96 156.81 19 54.29
9004. Kylie (kyky_) 35 98.86 111.56 12 34.29
9005. kpsmelvin (kpsmelvin) 35 55.50 67.04 5 14.29
9006. Kizu (kizuiyo) 35 89.08 111.26 10 28.57
9007. Kish (kisharora) 35 57.23 69.68 10 28.57
9008. Blessed (king_blessed) 35 61.78 81.10 9 25.71
9009. kilkuwu (kilkuwu) 35 79.16 93.29 9 25.71
9010. Kenny (kenny053) 35 41.17 49.69 6 17.14
9011. Shalowley (keepitcookie) 35 78.84 99.14 6 17.14
9012. KarstenPH (karstenplayz) 35 47.26 64.77 10 28.57
9013. arnav (junkbaby) 35 118.61 147.69 21 60.00
9014. Juls (juls22) 35 93.33 106.04 8 22.86
9015. Jokūbas (jokstercube) 35 74.51 91.00 14 40.00
9016. JimDeezy (jimdeezy) 35 106.25 145.37 14 40.00
9017. Jorge (jfgf11) 35 78.06 99.90 6 17.14
9018. Jeffryl (jeffryl26) 35 47.44 55.36 5 14.29
9019. jazz (jazzhand) 35 50.53 60.06 2 5.71
9020. Shiba (jasjaapdua) 35 88.15 105.05 17 48.57
9021. Simon (jangjun0901) 35 94.35 117.79 12 34.29
9022. J (jacktwamb52) 35 105.48 120.56 12 34.29
9023. Jackson (jackfast) 35 43.12 50.53 1 2.86
9024. IVAN (ivil) 35 55.90 66.31 6 17.14
9025. Muhammed (iosonoosha) 35 83.21 100.62 8 22.86
9026. Ingyou (ingsta) 35 113.21 126.20 15 42.86
9027. Hani (imonster_22) 35 83.52 109.15 16 45.71
9028. Guest (imadethisfornoreason) 35 42.83 57.07 1 2.86
9029. Jack (ikombo) 35 129.63 144.11 23 65.71
9030. |I|I|I|I|I|I| (iknowwhatimd... 35 81.88 97.84 11 31.43
9031. Ignacio 🧉 (ignatirabo) 35 69.53 87.28 9 25.71
9032. Lukas (iamlukas) 35 50.18 62.98 3 8.57
9033. Amir (iamir) 35 64.87 80.80 8 22.86
9034. Matthew (hotdawg200) 35 69.75 83.81 7 20.00
9035. Chuck (helicopter123) 35 121.45 140.37 25 71.43
9036. x0.25 speed (hazyy324) 35 95.51 113.07 12 34.29
9037. Joshua (gottajet) 35 72.50 85.28 7 20.00
9038. Jason (goosejuice) 35 84.26 98.60 6 17.14
9039. Giovanni (giosda) 35 139.36 179.94 23 65.71
9040. Martin (gibom) 35 75.28 87.30 10 28.57
9041. Emil (genjimaster) 35 82.23 93.90 13 37.14
9042. GeekThrill (geekthrill) 35 56.74 69.14 2 5.71
9043. gameing (gameing_) 35 65.50 79.51 8 22.86
9044. Salchica (machete24x) 34 90.93 117.34 9 26.47
9045. Locksley (locksng12) 34 83.74 99.40 13 38.24
9046. Lanlana (llnfriend) 34 54.26 74.15 17 50.00
9047. theerapat (lipertal) 34 62.36 81.72 8 23.53
9048. Nick (lemech) 34 55.07 71.39 6 17.65
9049. Kshitij (kshitij_srv) 34 70.17 80.42 6 17.65
9050. kosmanaut (kosmanaut) 34 90.68 107.06 10 29.41
9051. Kiran (kkdatkiran) 34 78.80 90.49 8 23.53
9052. John (kircher32245) 34 80.11 111.73 14 41.18
9053. Peter (kamikaze1336) 34 79.76 104.47 13 38.24
9054. Jacq (jvjacq) 34 61.18 79.35 8 23.53
9055. Justin (jpsmith) 34 51.79 63.86 2 5.88
9056. Jorgle (jorgleframpleton) 34 88.20 99.62 13 38.24
9057. Jon (jonc5201) 34 85.81 100.11 13 38.24
9058. Jackie (johnsonj13) 34 68.70 83.76 14 41.18
9059. ttv/J0bro (jobrocraftstep) 34 89.54 110.89 10 29.41
9060. Jha (jha94) 34 120.52 145.78 22 64.71
9061. Jetless (jetless27) 34 65.28 84.05 7 20.59
9062. jc.ekrem (jc_ekrem) 34 76.95 95.13 11 32.35
9063. JaydenPrbhd (jayden_prbhd010) 34 66.37 89.82 6 17.65
9064. +923326006034 (janan9233260... 34 57.88 72.31 6 17.65
9065. !dreamer#9577@dscrd (jaixhi... 34 63.06 77.68 8 23.53
9066. jad (jadtriestyping) 34 78.49 92.55 3 8.82
9067. Jalen (jaalen21) 34 86.33 102.57 12 35.29
9068. itbolt (itbolt) 34 95.85 128.38 17 50.00
9069. Ivan (ipenipent) 34 111.82 131.82 23 67.65
9070. Race (im_not_cheating_ur_wi... 34 90.80 107.34 13 38.24
9071. Robbie (idkloltype) 34 45.68 56.43 4 11.76
9072. ryan (hopedarklord1) 34 116.89 140.38 20 58.82
9073. Hk (hk2257853) 34 48.68 61.73 4 11.76
9074. Hikaru (hikaruk) 34 58.13 67.83 4 11.76
9075. heikrana (heikrana) 34 69.81 79.50 10 29.41
9076. Mark (haxos) 34 90.70 104.82 13 38.24
9077. Tzemis (greekjames) 34 90.41 118.03 14 41.18
9078. FurretMastr (furretmastr) 34 106.88 126.24 12 35.29
9079. ABC (funnelcake9) 34 122.69 137.00 17 50.00
9080. Justin (flamebun) 34 99.54 118.83 16 47.06
9081. Fauzan (fblues) 34 89.04 99.18 10 29.41
9082. Eryk (fatmamma) 34 91.09 102.49 8 23.53
9083. Askefise (fast_as_sanic) 34 90.72 114.99 18 52.94
9084. Marcus (fakedefulty) 34 41.40 57.26 3 8.82
9085. Fabi (fabilula) 34 43.40 57.05 3 8.82
9086. Erl (erlisgod) 34 54.36 63.01 4 11.76
9087. Skraap (elskrapo) 34 86.51 104.59 7 20.59
9088. elbert (elbert1104) 34 59.27 70.35 6 17.65
9089. harsh spacebar broke lol (d... 34 56.40 71.78 6 17.65
9090. Dileep (dileepnk) 34 87.57 117.66 11 32.35
9091. Vandy (desmaid) 34 105.13 124.53 18 52.94
9092. John (dent12) 34 53.75 67.20 7 20.59
9093. Prdel (dendritic_cell) 34 62.74 69.68 9 26.47
9094. Jay (cutecanadian) 34 57.33 69.82 8 23.53
9095. Iyanically (cryptic_cosmic) 34 80.39 96.72 10 29.41
9096. sion (crossblade06) 34 75.31 87.13 11 32.35
9097. Mehraj Mahmood (comiccypressm) 34 33.87 41.16 0 0.00
9098. Andrew Li (combatwombat123) 34 78.00 91.51 12 35.29
9099. Clement (clem_jestin) 34 48.53 55.28 2 5.88
9100. Cindy (cindy1889) 34 69.69 83.36 16 47.06
9101. Adrian (cheeseshrub) 34 74.18 98.28 8 23.53
9102. Cameron (camerong123) 34 119.11 143.68 19 55.88
9103. brindobob (brindobob) 34 138.97 160.83 27 79.41
9104. Brihoness (brihoness) 34 63.84 76.24 9 26.47
9105. Alexgiomuel (bionicmjallday... 34 56.04 72.97 4 11.76
9106. ben (bentypemaster) 34 64.30 76.00 4 11.76
9107. Benjamin (benhundos) 34 84.16 96.81 8 23.53
9108. bbygirlturtle (bbygirlturtle) 34 49.59 67.23 7 20.59
9109. Bob (baine001) 34 74.90 95.54 5 14.71
9110. loser (badatenglish) 34 88.83 113.70 12 35.29
9111. Ash (ash_ketchump) 34 49.01 65.62 4 11.76
9112. raffa (scoradian) 34 93.51 103.55 15 44.12
9113. sangay (sangay2018) 34 53.77 65.47 1 2.94
9114. Pakistan is my Love (sancbae) 34 57.44 71.80 19 55.88
9115. Sami (samitariq94) 34 125.00 142.96 27 79.41
9116. ogamiseta (samarthos) 34 119.95 129.56 12 35.29
9117. salmi (salmitot) 34 88.90 105.94 15 44.12
9118. Sadra (sadra17) 34 102.04 121.03 15 44.12
9119. Russian (russian_comrade) 34 68.68 80.59 11 32.35
9120. Ruben (ruben_ashughyan) 34 68.73 85.42 8 23.53
9121. Mike (roguecurlybracket) 34 98.11 114.51 10 29.41
9122. Robsonwp (robsonwp) 34 86.38 102.34 9 26.47
9123. Raghav (rkaushal_03) 34 39.54 47.95 2 5.88
9124. Richie (richiele_01) 34 94.53 119.92 15 44.12
9125. Lorum (rexicide) 34 105.21 136.33 14 41.18
9126. Fin (resarded) 34 63.08 85.66 10 29.41
9127. (rektbydoge21) 34 83.49 99.87 8 23.53
9128. Ricky (rcheungwtf) 34 95.71 115.68 9 26.47
9129. Wai Yon (ravesplash) 34 70.65 79.24 17 50.00
9130. Rageon (rageon718) 34 62.01 72.55 12 35.29
9131. Emad Iqbal (racer47) 34 88.89 104.01 10 29.41
9132. Racecar (racecar_lettuce) 34 125.54 137.37 22 64.71
9133. Quagsire (quagsireyaj) 34 78.35 98.72 15 44.12
9134. Aviral (programmer_typist) 34 65.52 85.78 7 20.59
9135. MD. Rashedul (porosh45) 34 58.72 75.48 5 14.71
9136. pedro (pedrovales) 34 53.88 63.93 3 8.82
9137. Pawan (pawan_kumar) 34 68.93 81.90 7 20.59
9138. Warley (patrickwarley) 34 41.71 54.24 1 2.94
9139. nocchio (nocchio) 34 100.29 119.60 10 29.41
9140. Ninth (ninth_player) 34 89.52 104.33 23 67.65
9141. go easy (nielsenco) 34 115.51 139.69 27 79.41
9142. Nam (nchu027) 34 84.00 111.22 14 41.18
9143. Nam3tA3n (nam3tak3n) 34 52.59 67.16 1 2.94
9144. Naba (naba0224) 34 95.28 106.29 15 44.12
9145. mulluch (mulluchian) 34 76.90 97.63 6 17.65
9146. mmlvx (mmlvx) 34 63.91 74.88 11 32.35
9147. grieves (mmcph36) 34 81.49 91.99 4 11.76
9148. Miz (miztypes) 34 110.23 125.64 16 47.06
9149. gradient (misaelmmorales06) 34 94.37 111.20 12 35.29
9150. ash (mikadole) 34 89.87 109.88 15 44.12
9151. Migsgd (migelawan123) 34 131.34 151.21 27 79.41
9152. Adam (merrth) 34 95.95 111.42 6 17.65
9153. Mole (mementomole) 34 51.44 68.42 8 23.53
9154. Micheal (mbroaders) 34 74.77 89.88 9 26.47
9155. Matthew (matthewdilks) 34 85.51 111.09 17 50.00
9156. Masked (masked_error) 34 60.27 72.97 11 32.35
9157. Marinos (marinosdim) 34 52.59 63.36 1 2.94
9158. appu (appu46) 34 50.52 61.25 5 14.71
9159. ApocJTL (apocjtl) 34 89.05 115.85 10 29.41
9160. Small (amaro123) 34 84.48 103.96 7 20.59
9161. Alstr (alstr) 34 90.90 118.69 15 44.12
9162. ali (alianggie) 34 48.76 61.25 3 8.82
9163. Aji (ajiwahyuw) 34 94.90 109.00 17 50.00
9164. Ahsan (ahsanhussain) 34 103.08 119.64 13 38.24
9165. Frangsinatra (addaxer) 34 83.04 105.83 10 29.41
9166. Artichamp (abhrajit_saha) 34 78.44 93.13 8 23.53
9167. Abhishek (abhi_720) 34 43.12 54.78 1 2.94
9168. Abdullah (abdullahshah_) 34 45.51 55.04 1 2.94
9169. Aadil (aadil0392) 34 68.10 86.23 10 29.41
9170. ARTHUR (4rthur) 34 85.17 107.92 12 35.29
9171. krittika (mojitroll) 34 73.19 83.47 7 20.59
9172. lerii (lerii) 34 46.47 59.86 3 8.82
9173. Matthew (mpfstudios) 34 52.23 66.38 5 14.71
9174. Aziza (meem_grfx) 34 52.50 62.55 3 8.82
9175. Neelie (neeliee) 34 101.00 115.05 15 44.12
9176. Triyanshu (triyanshu1996) 34 58.68 72.36 6 17.65
9177. Jesse (jrochefo) 34 61.13 69.42 5 14.71
9178. Elya (elyagolry) 34 43.03 58.44 8 23.53
9179. JB (chequer) 34 123.54 146.50 19 55.88
9180. Zhroon (znub) 34 81.52 103.73 9 26.47
9181. zizonesol (zizonesol) 34 63.93 75.75 10 29.41
9182. zeko (zekoo) 34 108.22 124.54 13 38.24
9183. Tyler (yppah) 34 104.24 117.27 18 52.94
9184. bofa (xxx_bofa_xxx) 34 107.48 118.74 12 35.29
9185. boop (xkeons) 34 48.41 57.88 0 0.00
9186. Dylan (xdylkay) 34 108.39 122.85 20 58.82
9187. Derek (xdirection) 34 95.80 117.24 14 41.18
9188. Wuchereria (wuchereria) 34 105.17 121.56 19 55.88
9189. wingman41 (wingman41) 34 81.99 98.53 9 26.47
9190. JEFF (wimpyjeff) 34 69.55 86.26 10 29.41
9191. unholy (virus_) 34 55.65 69.72 6 17.65
9192. Charlotte (videogame_hacker) 34 133.74 161.56 28 82.35
9193. Hey (veeceebee) 34 93.23 116.89 18 52.94
9194. Vedant (ved2254) 34 69.97 80.33 7 20.59
9195. Valeria (valeriacervel) 34 65.72 79.41 6 17.65
9196. Tyrocune (tyrocune) 34 58.94 69.64 8 23.53
9197. Jericho (typersimon) 34 86.95 98.30 10 29.41
9198. Daphne (trippyonions) 34 67.32 86.97 7 20.59
9199. Maksym (trickstermaks) 34 70.96 91.34 7 20.59
9200. Tom (tom1110) 34 65.77 90.73 8 23.53
9201. Iocus (tisabay) 34 62.46 83.61 3 8.82
9202. Timofey (timofey_s) 34 90.26 104.19 9 26.47
9203. Thunderwith (thunderwith) 34 94.54 130.13 14 41.18
9204. rae (thedarkoknight) 34 91.38 113.05 16 47.06
9205. thebeesknees (thebeesknees_) 34 83.67 104.44 16 47.06
9206. Connor (swedish_master) 34 67.17 81.52 6 17.65
9207. Cthulhu (survivcthulhu) 34 74.76 92.38 6 17.65
9208. superultimate23 (superultim... 34 57.47 73.37 6 17.65
9209. Dan (subprime) 34 114.23 143.24 21 61.76
9210. Stick (stick69) 34 59.45 71.92 6 17.65
9211. Cameron (spinnie123) 34 56.93 67.96 4 11.76
9212. an average vietnamese typis... 34 79.98 113.28 9 26.47
9213. Mitsuo (sp33d1sk3y) 34 102.19 118.46 14 41.18
9214. Sole (soleduck) 34 122.41 152.43 14 41.18
9215. ada (smdge) 34 76.16 99.45 9 26.47
9216. Smack (smack_ke) 34 60.33 69.10 6 17.65
9217. (singalong_monkey) 34 87.06 102.70 14 41.18
9218. yan (shocker142) 34 91.62 105.78 12 35.29
9219. katie (shartball) 34 57.25 70.69 5 14.71
9220. Corona Time (shamalamakiwi) 34 71.91 91.61 10 29.41
9221. Serenity (seerenityy) 34 115.84 134.37 21 61.76
9222. Zerrox (zerrox) 33 100.50 116.99 16 48.48
9223. Vilantas (zenblax) 33 44.47 49.97 7 21.21
9224. Zedrick (zedrickbr) 33 128.24 152.60 25 75.76
9225. Doyle (zdubhghaill) 33 68.28 82.14 6 18.18
9226. Zac (zactus_) 33 57.97 70.02 4 12.12
9227. Kutya (ysakovvvs) 33 42.67 52.62 4 12.12
9228. YaBoi (yab0i) 33 63.78 74.61 4 12.12
9229. (xxgamerprofunxx) 33 95.23 111.89 7 21.21
9230. Xeethra (xeethra) 33 89.14 105.31 15 45.45
9231. Santosh (wow123__) 33 50.37 60.55 4 12.12
9232. Wella (wella05) 33 61.23 75.92 24 72.73
9233. Tom (voiovinili) 33 70.54 89.53 7 21.21
9234. vamsi (vamsibharadwaj) 33 55.90 64.41 3 9.09
9235. Uziel1595 (uziel1595) 33 61.57 74.97 7 21.21
9236. Simon (unclesimon) 33 60.59 93.68 18 54.55
9237. Uddaya (uddaya) 33 61.93 77.17 8 24.24
9238. ɥsǝdǝǝᗡ (toxin_d) 33 67.61 80.77 12 36.36
9239. Scarlet (tongli10) 33 69.71 82.98 10 30.30
9240. timmy (timmy14) 33 75.81 88.63 11 33.33
9241. TIFF (tiffanytai888) 33 44.55 51.01 3 9.09
9242. Kurt (thydark) 33 104.77 124.55 19 57.58
9243. Thithiesha (thithiesha) 33 69.37 80.85 11 33.33
9244. Sam (the___sam) 33 71.65 84.52 5 15.15
9245. Ryan (theguy985) 33 87.38 119.70 14 42.42
9246. Matthew (thefinchler) 33 71.23 80.89 6 18.18
9247. Taquid (taquid) 33 70.50 85.79 12 36.36
9248. Tair (tako_01) 33 33.51 41.03 2 6.06
9249. Jake (superduperjake) 33 86.47 100.04 12 36.36
9250. sulux (sulux_14) 33 52.45 60.62 0 0.00
9251. Sylvaen (suggestedrp) 33 90.44 107.64 11 33.33
9252. Kersey (strythio) 33 107.43 125.43 23 69.70
9253. David (spurgeon) 33 82.43 107.54 4 12.12
9254. Spike (sp4rks) 33 64.51 83.90 10 30.30
9255. Socceryolo (socceryolo) 33 57.90 79.55 5 15.15
9256. Guest (slowpokest) 33 77.61 104.52 7 21.21
9257. (slowandinaccurate) 33 121.79 164.93 19 57.58
9258. Lagmybsf (sk0ttt) 33 90.36 109.44 13 39.39
9259. Gilbert (sigalingging_23) 33 88.21 102.77 7 21.21
9260. xD (shabanllokmja) 33 54.25 67.51 4 12.12
9261. Sestain (sestain) 33 76.29 91.21 9 27.27
9262. JDizzle (serinus) 33 99.27 132.74 13 39.39
9263. sasquatch (sasquatchplatypus) 33 40.63 53.57 5 15.15
9264. Andrew (sasamori) 33 92.48 110.11 12 36.36
9265. rodrigo (rodtronx) 33 74.61 86.41 4 12.12
9266. RITIK (ritik1999) 33 32.32 38.22 3 9.09
9267. Vivian Le (riru) 33 65.03 76.29 3 9.09
9268. Ridans (ridans) 33 78.22 98.63 7 21.21
9269. Rhune (rhunetro) 33 68.21 80.14 6 18.18
9270. ralf (rhalfik) 33 72.48 92.53 10 30.30
9271. Ben (random_peepsle12) 33 64.17 74.53 7 21.21
9272. ramu kumar (ramu_kumar) 33 63.43 76.93 10 30.30
9273. rambalaji (rambalaji) 33 75.54 98.37 11 33.33
9274. Rakshit_dvorak (rakshit007) 33 78.13 95.08 14 42.42
9275. rajan (rajan_singh123) 33 44.73 53.91 22 66.67
9276. raging_wolf (raging_wolf) 33 56.67 69.97 3 9.09
9277. r0hkx (r0hkx) 33 88.63 111.67 8 24.24
9278. Quang (puangpro__6969) 33 58.32 69.23 15 45.45
9279. Will (pozzpyo) 33 93.73 104.39 13 39.39
9280. PJ (pjk519) 33 64.72 80.31 8 24.24
9281. Ed (pelly1863) 33 86.29 99.87 6 18.18
9282. Pegasus X (pegasusx) 33 34.08 45.58 1 3.03
9283. Happy (paimon__) 33 70.39 86.15 7 21.21
9284. Null (nullstring) 33 91.65 106.44 11 33.33
9285. Nuan (nuan56) 33 72.06 91.79 7 21.21
9286.   (nt_chill) 33 99.88 118.27 12 36.36
9287. Luke (nsaagent115) 33 92.30 112.83 12 36.36
9288. Garbage (nerdballer) 33 127.63 151.31 22 66.67
9289. Nik (nazeki) 33 96.37 123.41 19 57.58
9290. Andrew (narchio) 33 98.45 118.93 10 30.30
9291. Yuko (naoyuko) 33 77.53 84.74 7 21.21
9292. Naomi (namtheyam) 33 98.29 116.51 16 48.48
9293. Perhs (mrbunnym) 33 64.72 85.51 7 21.21
9294. mky (mky1) 33 85.35 101.89 13 39.39
9295. ig @emkloco (mkplayz) 33 80.40 96.05 6 18.18
9296. Mitchell (mitchell721) 33 74.00 100.07 5 15.15
9297. laffytaffy (mihirsm) 33 69.49 86.36 4 12.12
9298. Mitchell (mdyer44) 33 86.53 107.17 11 33.33
9299. chaotix (mcomm7) 33 75.13 89.31 6 18.18
9300. Maxi (maxi25) 33 65.32 79.69 7 21.21
9301. Marky (mark2most) 33 69.93 85.59 4 12.12
9302. Mandeep (mani7246) 33 66.43 80.56 10 30.30
9303. Couldn't be you (malthekr) 33 83.50 95.89 29 87.88
9304. m0nst3r (m0nst3r9) 33 54.30 67.43 7 21.21
9305. Liam (lwebb167) 33 79.87 89.06 9 27.27
9306. LuciD (luci_d) 33 82.95 94.26 15 45.45
9307. tstats[lil_issam312] (lil_i... 33 31.93 39.19 1 3.03
9308. King Bygone (lil_bygone) 33 95.41 117.08 7 21.21
9309. Wen (legendxiang) 33 87.54 105.84 11 33.33
9310. Noah (l0cket) 33 61.39 75.56 4 12.12
9311. krystall (krrystall) 33 57.37 74.94 7 21.21
9312. Krish (krish_agn) 33 43.05 56.27 14 42.42
9313. Ludvig (krang) 33 60.44 73.16 9 27.27
9314. kevin (kevinstj) 33 94.53 127.61 11 33.33
9315. keb (kerringtonbridges) 33 57.64 74.94 6 18.18
9316. MOHANA (kanthetimohana) 33 59.92 70.37 0 0.00
9317. Kalin (kamarel) 33 84.93 104.81 13 39.39
9318. Yoshi (justayoshi) 33 74.27 91.65 6 18.18
9319. Guest (jun16) 33 82.80 96.27 11 33.33
9320. Ice (juicedicee) 33 73.25 92.19 9 27.27
9321. Joshua (joshuajunhee) 33 83.54 116.76 10 30.30
9322. Jonah (jonahtzy) 33 76.86 106.28 12 36.36
9323. Ron(ald) (jellybeanman) 33 97.38 114.32 20 60.61
9324. James (jameslroll) 33 114.33 134.74 19 57.58
9325. Puntlander (jamaquube) 33 76.19 87.05 8 24.24
9326. Jáky (jaky_) 33 45.45 53.33 4 12.12
9327. Aryan (jai_ho420) 33 42.56 57.11 2 6.06
9328. Ivan (ivangoh321) 33 79.35 88.46 7 21.21
9329. Lynnette (its_lynnie27) 33 111.80 173.89 19 57.58
9330. khy (itskhylmao) 33 59.91 75.57 27 81.82
9331. iterative (iterative) 33 36.76 45.44 1 3.03
9332. Insany (insanyngame) 33 64.11 73.28 17 51.52
9333. Oflu61 (ilkerb) 33 113.26 133.30 18 54.55
9334. hutab (hutab) 33 66.50 81.97 14 42.42
9335. Adam (hodowcaowiec) 33 82.38 93.37 8 24.24
9336. HK_TeddyBear (hk_teddybear) 33 39.10 52.69 4 12.12
9337. HiroHero (hirohero89) 33 100.80 121.10 13 39.39
9338. tstats[harryrich02] (harryr... 33 61.89 73.09 5 15.15
9339. hao (haoatran) 33 93.76 106.25 18 54.55
9340. Hachikachi (hachikachi) 33 105.01 123.28 18 54.55
9341. Habibur (habiburrahman_mu) 33 43.81 68.34 8 24.24
9342. G_low (g_low) 33 59.13 89.87 11 33.33
9343. Adam (goodboyadam) 33 101.39 130.26 9 27.27
9344. R (ghostboy) 33 89.58 115.28 19 57.58
9345. Bootstrap (gaurav021992) 33 66.86 86.57 19 57.58
9346. Vladimír (froggz) 33 107.11 124.04 23 69.70
9347. forever_extinct (forever_ex... 33 77.44 103.84 7 21.21
9348. umang patel (fiasty) 33 48.73 59.55 3 9.09
9349. (fbilikestotype) 33 109.97 127.47 15 45.45
9350. Jake (faljake) 33 86.51 112.38 16 48.48
9351. Esraa (esraa14) 33 17.64 28.41 10 30.30
9352. Samantha (epoxicx) 33 74.23 101.00 7 21.21
9353. Enreden (enreden) 33 74.49 95.51 11 33.33
9354. Eico (eico66) 33 75.77 90.03 11 33.33
9355. Eduardo (eduardofreitas) 33 59.84 71.35 4 12.12
9356. tstats[ebenezer13579] (eben... 33 107.44 132.69 7 21.21
9357. doniee (doniee) 33 101.14 114.70 12 36.36
9358. streetcar (dohrn1i) 33 74.67 94.43 17 51.52
9359. Jard (dogspa) 33 105.78 122.95 17 51.52
9360. Jan (de_necromancer) 33 47.49 60.21 5 15.15
9361. Deen (deenibsyed) 33 87.98 99.50 9 27.27
9362. Eric (wangjangler) 33 81.92 94.70 7 21.21
9363. Grant (datasianguy23) 33 111.13 136.03 17 51.52
9364. Daniel (danntheman21) 33 54.70 68.78 5 15.15
9365. Dankerino (dankerinohd) 33 79.43 94.15 11 33.33
9366. amalia (chowdergirl) 33 87.21 108.56 10 30.30
9367. butane (butanebutton) 33 81.09 96.80 23 69.70
9368. breadedsouth (breadedsouth) 33 69.22 101.25 4 12.12
9369. August (boxcybrawler) 33 66.59 75.12 8 24.24
9370. Emmett (bigblueyeti) 33 77.58 90.81 5 15.15
9371. binay (biany671) 33 36.80 46.06 3 9.09
9372. Bermet (bermetibr) 33 36.26 44.93 0 0.00
9373. JumboTub4 (ben_is) 33 68.75 86.78 7 21.21
9374. baker (bakervai001) 33 37.25 46.60 1 3.03
9375. Hari (baby1_jimmy) 33 121.69 145.25 17 51.52
9376. Awnvar (awnvar) 33 55.22 70.53 4 12.12
9377. adam (armorcle__) 33 110.31 132.16 15 45.45
9378. starsick (ardentauthoress) 33 103.72 122.72 18 54.55
9379. Appel (appelboer) 33 75.42 93.39 11 33.33
9380. Annie (anniesimp) 33 77.07 91.33 10 30.30
9381. Anisath Kirubakaran (anisath) 33 44.44 52.69 4 12.12
9382. AnesDZ (anes201) 33 79.72 93.98 11 33.33
9383. alex j (alexjonelis) 33 64.61 82.88 14 42.42
9384. Alexey (aleksn7) 33 68.06 82.70 5 15.15
9385. Anton (alejendaryguy) 33 104.58 121.95 1 3.03
9386. TulBott (alb3rth3nry) 33 101.29 118.77 14 42.42
9387. AGTNurat (agtnurat) 33 119.05 142.35 20 60.61
9388. abnf (abnf) 33 78.89 90.44 9 27.27
9389. Max (2zmaxx) 33 96.02 117.32 14 42.42
9390. Angel (angelbullet) 33 76.31 87.82 12 36.36
9391. macc (softiebby) 33 87.57 112.23 9 27.27
9392. shshsh (alex2003_) 33 47.36 55.76 2 6.06
9393. Julien (dadcomeback) 33 92.87 106.88 14 42.42
9394. Arun (arunkodumuru) 33 66.75 81.24 9 27.27
9395. Ajeet (stripedcat12) 33 66.36 79.79 10 30.30
9396. ARF (arf_g3) 33 72.01 87.45 11 33.33
9397. Sun (sun730) 33 105.34 121.70 14 42.42
9398. sarah (samuro) 33 114.40 136.04 18 54.55
9399. GreenMilk (greenmilk7) 33 70.57 97.55 8 24.24
9400. Arespi (arespi) 32 89.93 101.79 8 25.00
9401. Antombomb (antombomb) 32 32.36 45.83 3 9.38
9402. Anthony (anthonyjhwu) 32 47.72 56.60 2 6.25
9403. Adebayọ (annonp) 32 67.67 89.19 8 25.00
9404. milyn (alymilyn) 32 64.82 74.86 10 31.25
9405. All-Rounder_28 (allrounder28) 32 74.26 96.16 9 28.13
9406. good (afternoonracer) 32 81.80 101.02 14 43.75
9407. 🐌 (adas291) 32 77.21 86.48 12 37.50
9408. Ace (acechow) 32 91.85 113.51 10 31.25
9409. Abhishek (abhikumar98) 32 65.78 76.72 7 21.88
9410. Abdullah (abdullahbb102) 32 71.71 94.92 4 12.50
9411. Thomas (2minute) 32 68.82 76.45 9 28.13
9412. Leo (1_typer_boy_1) 32 86.91 101.78 8 25.00
9413. Nick (1chompy_) 32 79.40 90.82 11 34.38
9414. Ramakant (ramakant) 32 35.46 49.52 1 3.13
9415. Spectral (sspectral) 32 60.16 74.76 3 9.38
9416. Toni (meecoula) 32 90.54 106.34 10 31.25
9417. Joaquin (joaquino19) 32 46.45 57.39 21 65.63
9418. Matt (hoopenator) 32 62.39 79.16 7 21.88
9419. Melon (mailmelon) 32 54.98 67.17 4 12.50
9420. MAGNUS (magnus03) 32 57.01 80.73 6 18.75
9421. Lucia (lucialima) 32 47.18 56.25 2 6.25
9422. Christopher (lord_pretzel) 32 86.94 109.25 7 21.88
9423. long (longlonglong) 32 64.58 80.46 7 21.88
9424. Lojants (lojants1) 32 95.77 111.65 10 31.25
9425. Albert (lnseed) 32 77.28 96.30 6 18.75
9426. Eric (llmangoll) 32 66.10 82.09 17 53.13
9427. LAO (legendoflaohan) 32 69.92 85.76 8 25.00
9428. Brylle (latios12349) 32 55.25 64.48 1 3.13
9429. Lathoa (lathoa) 32 79.99 95.29 17 53.13
9430. Kyle (kyle_15) 32 43.36 57.37 1 3.13
9431. -_- (kxs5) 32 110.77 124.92 24 75.00
9432. Alberto Balsalm (kutaybozkurt) 32 70.56 82.63 12 37.50
9433. twitch.tv/klokkismann (klok... 32 126.39 151.08 8 25.00
9434. hyunki (kirene) 32 72.34 82.12 10 31.25
9435. Keith (keithlor) 32 127.22 147.69 18 56.25
9436. 🥴 (kangjushang) 32 50.65 61.50 1 3.13
9437. v(._.)v (justbeatya) 32 64.92 78.96 6 18.75
9438. Julian (julianeadie) 32 53.33 63.03 3 9.38
9439. Julia (juliaar) 32 56.76 70.15 7 21.88
9440. Juggernaut (jugg07) 32 96.32 112.60 11 34.38
9441. James (jrm371) 32 75.85 103.51 11 34.38
9442. Joshua (joshque) 32 92.67 110.35 4 12.50
9443. Jose (jgeer) 32 66.16 75.42 6 18.75
9444. JackBurst (jackburst) 32 107.16 125.24 12 37.50
9445. Joey (j0ash08) 32 56.37 66.32 16 50.00
9446. Hasit (invincible678) 32 59.20 87.45 5 15.63
9447. Highly unskilled (intenseag... 32 152.54 201.70 20 62.50
9448. Smitty W. (ifartfire) 32 71.42 84.18 7 21.88
9449. ICE TEA (ice_tea911) 32 59.33 70.89 5 15.63
9450. Victor (hueylouisnonews) 32 90.74 103.70 12 37.50
9451. Claire (house_cat) 32 71.14 81.98 7 21.88
9452. Hobo (hobo_rapper) 32 83.82 101.30 8 25.00
9453. AHEN (henneberg) 32 104.15 138.74 12 37.50
9454. Isaac (haidilaohotpot) 32 81.26 91.41 7 21.88
9455. Gleb (gsavchenko) 32 59.90 68.84 3 9.38
9456. Graham (grayham11) 32 85.08 99.76 9 28.13
9457. scarFace (gray25905634) 32 72.53 92.65 7 21.88
9458. Grace (gracecatan) 32 118.34 131.73 14 43.75
9459. GoldenSnitch (goldensnitch73) 32 84.96 103.83 7 21.88
9460. Glad (glad99) 32 74.68 94.57 7 21.88
9461. Giovanni (giovannigando) 32 80.27 89.92 8 25.00
9462. Graham (gfoote) 32 96.44 108.33 12 37.50
9463. Andrew (get_hyped20) 32 95.11 115.36 17 53.13
9464. Venom (_venom) 32 77.04 94.46 10 31.25
9465. AaronIsADonkey (_gg_ez_) 32 114.93 137.46 14 43.75
9466. Zenith (zenith1g) 32 43.65 54.54 1 3.13
9467. Hoang (yungrax) 32 57.50 68.37 6 18.75
9468. Yogesh (yogesh9770) 32 45.98 70.07 4 12.50
9469. MooD (xslel) 32 97.99 125.49 11 34.38
9470. tstats[xeg28] (xeg28) 32 84.39 94.88 11 34.38
9471. a (xdxdxd1234) 32 80.99 92.84 4 12.50
9472. Welame (welame) 32 82.47 96.96 0 0.00
9473. ColeMacca (weenyboi) 32 75.76 89.97 8 25.00
9474. Melissa (wally88) 32 99.28 110.54 11 34.38
9475. Vladi (wacy11) 32 89.41 113.06 10 31.25
9476. Sunil (w0rds) 32 60.18 79.30 5 15.63
9477. VYCanis (vycanis55) 32 97.03 105.75 15 46.88
9478. THE STARDUST (void07) 32 62.15 79.19 7 21.88
9479. Timo (ustimoger) 32 60.48 76.69 11 34.38
9480. Will (urbanmist) 32 80.91 94.96 13 40.63
9481. Ahmed (uproo) 32 63.08 80.86 8 25.00
9482. Uncreeperble (uncreeperble) 32 84.78 117.56 10 31.25
9483. AA (typee45) 32 44.22 54.69 6 18.75
9484. tropics (tropicswpm56) 32 75.48 88.81 11 34.38
9485. Tonchi (tonch1) 32 95.00 109.04 15 46.88
9486. Alex (titleist_pro_v1x) 32 79.70 98.94 18 56.25
9487. Jonathan (the_mechanical) 32 97.86 123.52 9 28.13
9488. Ronny (the_mandalorian) 32 42.89 56.64 2 6.25
9489. theaveragedude (the_avg_dude) 32 81.03 98.09 8 25.00
9490. Timothy (thekoreanbanana) 32 82.68 97.09 14 43.75
9491. Lightning (thecarsfan) 32 68.55 76.71 7 21.88
9492. Taybuscus (taybuscus) 32 71.57 88.24 8 25.00
9493. OnlyStanz (tanni) 32 87.00 104.98 12 37.50
9494. HASHTAG (talk_is_cheap_like... 32 121.98 141.39 17 53.13
9495. E (boop_bop) 32 47.23 57.08 0 0.00
9496. Edward (supereduardus) 32 97.94 117.04 17 53.13
9497. שפיצער (spitzer722) 32 65.51 85.56 7 21.88
9498. Saim (spirit_) 32 77.11 101.49 9 28.13
9499. slowmxbrowns (slowmxbrowns) 32 87.49 103.65 10 31.25
9500. SLEEPINGzZZ (sleepingzzz) 32 53.20 64.03 5 15.63
9501. Simeon (sim80) 32 122.38 148.29 17 53.13
9502. Shon (shonboy21) 32 63.33 75.19 4 12.50
9503. Shiasuni (shiasuni) 32 114.25 138.24 20 62.50
9504. Shaun (shaunlooi) 32 84.04 99.07 11 34.38
9505. Ahanaf Shahriar (shahriar013) 32 48.65 59.37 1 3.13
9506. Logan (shadows36) 32 69.44 93.82 10 31.25
9507. scpals (scpals) 32 79.22 102.64 10 31.25
9508. Sarafraj (sarafraj) 32 49.57 57.20 1 3.13
9509. Samadou (samadou_10) 32 80.59 102.96 12 37.50
9510. RyZe (ryzehopz) 32 62.16 80.30 10 31.25
9511. Ryan (ryanlondon) 32 57.11 72.48 6 18.75
9512. Tyler Rankin (rxnkin) 32 66.81 80.96 6 18.75
9513. ronald (ronaldalbarn) 32 87.25 105.65 7 21.88
9514. Rocks D. (rocksdxebec00) 32 58.24 69.36 6 18.75
9515. Bakugo (respiro72) 32 118.43 136.95 22 68.75
9516. Rachel (rachel85881) 32 105.30 118.79 21 65.63
9517. Anna (rabbitpickles69) 32 93.70 129.75 11 34.38
9518. Raagaception (raagaception) 32 83.33 105.41 11 34.38
9519. uzi (r3yna) 32 74.33 92.13 12 37.50
9520. brownbelly (pvthg) 32 86.92 109.81 12 37.50
9521. PRACTICE (practicecar) 32 117.33 143.37 19 59.38
9522. PropheticNPC (potencity) 32 90.79 110.76 8 25.00
9523. player (player172) 32 39.13 96.44 9 28.13
9524. Arsh (piratexx) 32 78.04 90.39 23 71.88
9525. ninii (paniini) 32 91.87 110.12 17 53.13
9526. Amine (ov4h) 32 59.26 74.26 8 25.00
9527. Lego (outboxer009) 32 44.65 51.82 3 9.38
9528. organic (organic__filter) 32 61.72 73.36 6 18.75
9529. Oscar (oguana) 32 67.44 82.83 6 18.75
9530. Nico (npvalerio8) 32 89.39 109.18 13 40.63
9531. Stalin (notdavidcameron) 32 117.89 146.39 18 56.25
9532. Aanshu (noob_typist_404) 32 68.52 79.94 12 37.50
9533. Martin (niquid) 32 76.77 90.93 9 28.13
9534. Nieid (nieid) 32 87.99 116.68 14 43.75
9535. nakkisoppa666 (nakkisoppa666) 32 98.04 131.34 9 28.13
9536. Nazarbek (na2a_) 32 111.38 125.58 15 46.88
9537. Milan (m_i_n_o) 32 56.55 71.07 4 12.50
9538. Mackenzie (music1713) 32 34.75 40.44 0 0.00
9539. mukrohin (mukrohin) 32 90.41 109.08 9 28.13
9540. muhammad (muhd99) 32 68.99 79.29 10 31.25
9541. Matt Tierney (mtierney111) 32 76.22 100.14 9 28.13
9542. Percy (mraudiodrama) 32 98.57 116.05 14 43.75
9543. Matthew (mpb0401) 32 67.64 80.40 5 15.63
9544. Tanakrit (mogoon) 32 56.34 65.62 7 21.88
9545. Mamdouh (mmdh) 32 64.44 80.67 11 34.38
9546. nah (ministermeme) 32 93.31 111.67 9 28.13
9547. Meruem (meruem1919) 32 140.92 173.02 23 71.88
9548. Kaung Pyae (meandmyfriend4) 32 57.76 70.40 6 18.75
9549. Sean (masian08) 32 90.16 105.90 5 15.63
9550. Flex (flexiblerhyme30) 32 58.01 71.49 8 25.00
9551. Chuanyao (finalconflux) 32 87.96 111.04 13 40.63
9552. Eric (envyhope) 32 87.24 103.21 9 28.13
9553. engager (engager) 32 65.41 73.88 2 6.25
9554. Emily (emilyk_3357) 32 93.47 114.49 12 37.50
9555. Elsawy (elsawy636) 32 78.48 87.78 6 18.75
9556. SirCanaanDoyle (elevayshun) 32 113.39 143.05 18 56.25
9557. SlipperySlope (eeilu) 32 77.30 88.62 10 31.25
9558. Dustin (dustindp99) 32 94.58 110.69 12 37.50
9559. Dustin (dustin099) 32 87.74 104.16 12 37.50
9560. The (dhemagicianking) 32 117.51 140.75 14 43.75
9561. (dev_rec) 32 150.31 185.43 17 53.13
9562. David (davejiggy) 32 62.52 75.09 5 15.63
9563. Darkleonard (darkleonard) 32 109.16 124.14 12 37.50
9564. Danat (danat_ayazbayev) 32 98.52 113.93 10 31.25
9565. Dammsugaren (dammsugaren) 32 81.09 95.00 11 34.38
9566. Curo (curo) 32 77.73 91.73 8 25.00
9567. Cosmin (cosmyd) 32 58.91 69.20 3 9.38
9568. cookie (cookienbo) 32 79.04 107.54 9 28.13
9569. Sai Srujan Kumar (chsrujan) 32 95.43 106.39 9 28.13
9570. Carlos (carlos_007) 32 63.56 75.91 8 25.00
9571. Espii (carlespe13) 32 69.68 82.79 14 43.75
9572. Brennan (brennanminns) 32 86.41 104.38 12 37.50
9573. Putu (boostedwrx) 32 114.72 145.23 17 53.13
9574. Gordon (boboiv) 32 87.37 114.90 8 25.00
9575. ameerah (bluecandy) 32 98.63 109.51 16 50.00
9576. Bibek (bibek_) 32 80.42 94.70 4 12.50
9577. Prem (batprem) 32 58.02 67.59 3 9.38
9578. Zack (averyackz) 32 62.71 85.23 8 25.00
9579. Morpheus14 (atilla_14) 32 81.94 95.50 13 40.63
9580. Aaron (asc_the_fighter) 32 23.57 28.75 7 21.88
9581. aron (aron25) 32 95.65 111.05 20 62.50
9582. bashar (fuddle_) 31 40.18 53.64 2 6.45
9583. Faiq Ayubi (froxt) 31 60.54 91.50 8 25.81
9584. Flying (flyingdemon) 31 50.88 67.32 6 19.35
9585. fathima (fathimaa) 31 46.92 58.17 2 6.45
9586. Erik (ezhou21) 31 94.09 116.92 13 41.94
9587. neo (eliteneo) 31 92.92 110.74 7 22.58
9588. Leif (electricronny) 31 109.64 127.83 16 51.61
9589. paul (dunzo18) 31 69.12 95.05 5 16.13
9590. Isaac (dolemitesundae) 31 88.50 109.05 7 22.58
9591. Thai (despotron) 31 95.92 115.01 7 22.58
9592. Daniel (dasno) 31 67.83 78.14 4 12.90
9593. Pascal (darm4n) 31 92.18 106.22 8 25.81
9594. Mad_Dog (darkus_dragonoid) 31 83.05 94.86 11 35.48
9595. . (darkis) 31 112.39 144.41 21 67.74
9596. Cramp (crampdg) 31 111.13 130.71 16 51.61
9597. Conor (conorwalsh1601) 31 63.68 82.96 8 25.81
9598. Chris (chris_9001) 31 87.13 107.14 19 61.29
9599. ChivalKnight (chivalknight) 31 75.32 88.79 8 25.81
9600. chillresident (chillresident) 31 95.76 109.58 8 25.81
9601. Ben (chewy_bran) 31 76.59 91.69 7 22.58
9602. Catrinet (catrinet) 31 35.90 41.85 0 0.00
9603. Schuyler (captainsky03) 31 109.90 131.60 15 48.39
9604. Bertalan (brtln) 31 69.74 86.79 15 48.39
9605. Steven (boomkat) 31 88.12 113.59 9 29.03
9606. Tom (bobtom8482) 31 86.73 109.19 12 38.71
9607. Paul (bisente006) 31 53.41 69.77 10 32.26
9608. Binamra (binamra) 31 64.89 91.97 6 19.35
9609. C (bigcdub) 31 60.82 79.98 9 29.03
9610. bader (bhilal) 31 36.62 45.93 2 6.45
9611. Bhaskar (bhaskar942) 31 59.11 73.79 3 9.68
9612. Brendan (bfay) 31 97.06 119.12 10 32.26
9613. Roberto (bertdog1995) 31 93.36 105.15 9 29.03
9614. BeastBoy (beastboykadil) 31 49.25 61.30 2 6.45
9615. Avrick (avmend) 31 73.34 91.73 11 35.48
9616. laundromatt (austen_washer) 31 90.65 116.11 12 38.71
9617. Renato (ato2000) 31 89.83 106.89 10 32.26
9618. Bruno (armitageb) 31 108.22 132.01 14 45.16
9619. Nikola (_not_) 31 47.92 54.44 1 3.23
9620. mo (yo_mo) 31 56.29 68.65 3 9.68
9621. lol (yowennnn) 31 80.55 99.53 11 35.48
9622. melon (yoonity_) 31 114.05 131.49 21 67.74
9623. Yani (yani916) 31 77.74 89.96 7 22.58
9624. marco (xqz_u) 31 65.21 74.50 9 29.03
9625. Seizoxu (xezious) 31 92.64 110.99 15 48.39
9626. fnf (whitezetra) 31 89.66 111.88 9 29.03
9627. Whelps (whelps) 31 115.37 152.09 18 58.06
9628. K (wh0mst) 31 62.91 73.50 4 12.90
9629. Virbox (web_user) 31 96.99 110.98 11 35.48
9630. Watrdos (watrdos) 31 84.52 103.12 8 25.81
9631. Jeffrey (vlasfack) 31 68.36 81.39 7 22.58
9632. Orca (virtualorca) 31 80.47 92.02 11 35.48
9633. Lux (veyro) 31 63.15 73.35 10 32.26
9634. Hah (verdaderopan) 31 102.75 119.17 11 35.48
9635. Ultimate_Coder (ultimate_co... 31 107.99 122.04 17 54.84
9636. Jammie (nonquit) (typos_zzz) 31 176.19 217.38 22 70.97
9637. Dog (typing_doggo) 31 97.14 115.16 14 45.16
9638. Turuo (turuo) 31 66.51 79.81 7 22.58
9639. Alex (tsaalex) 31 91.52 108.03 9 29.03
9640. Trevor (trevor10) 31 30.38 39.83 3 9.68
9641. 😈 (topthis) 31 94.81 111.46 8 25.81
9642. James (the_swan) 31 108.69 127.33 21 67.74
9643. Daniel (teraminx) 31 129.32 142.46 25 80.65
9644. Eugene (taiwansfinest) 31 96.05 119.95 10 32.26
9645. Mr. (superfat) 31 63.07 75.11 4 12.90
9646. Stuart (stuart000little) 31 56.44 66.17 4 12.90
9647. Rowan (spindlecreek) 31 66.82 80.48 5 16.13
9648. gixxer (somewhat_noob) 31 74.93 89.03 5 16.13
9649. Catering (sneevy) 31 116.30 131.33 14 45.16
9650. sai (smuna13) 31 80.47 96.11 5 16.13
9651. slowAf (slow_af_dvorak) 31 87.95 113.67 6 19.35
9652. Sukanya (siriros) 31 31.44 40.28 2 6.45
9653. shuaib (shuaibabrar) 31 68.97 80.48 7 22.58
9654. Shanon (shadowyshadows) 31 148.71 179.84 24 77.42
9655. Andreas (sgtreent) 31 87.81 105.61 15 48.39
9656. sev (sev4tou) 31 58.85 66.58 7 22.58
9657. Binscuit (scoutzc) 31 70.51 83.82 8 25.81
9658. No Mistakes (apsnacks) 31 92.86 114.27 7 22.58
9659. Gio (apex_shrimp) 31 71.81 80.33 6 19.35
9660. Anton (antonium) 31 77.70 102.65 12 38.71
9661. AnniK (anni_k) 31 90.77 111.53 13 41.94
9662. Amit (amitsetty) 31 125.04 144.79 11 35.48
9663. alyssa (alyyyssa) 31 98.07 113.14 9 29.03
9664. Alex (alexyoung) 31 78.30 95.77 4 12.90
9665. Andrew (ajw5196) 31 57.92 77.89 5 16.13
9666. Alasdair (aisaem) 31 106.23 121.14 15 48.39
9667. AgentGarbo (agentgarbo) 31 74.72 93.62 7 22.58
9668. Aditya (aditya_2703) 31 68.76 83.45 3 9.68
9669. abdullah (abdullah1233) 31 58.28 72.10 7 22.58
9670. Abhishek (abc_cs) 31 88.97 102.42 8 25.81
9671. asphyxia (aag3098) 31 61.25 71.52 4 12.90
9672. Igor (6eamed) 31 92.59 112.78 10 32.26
9673. 1980 (1980ops) 31 104.63 119.28 14 45.16
9674. Poul ib Uitsatikitseq (13fu... 31 33.27 44.34 1 3.23
9675. martiangnome (martiangnome) 31 71.90 78.62 8 25.81
9676. zainal (ali200276) 31 54.16 65.20 3 9.68
9677. Suwidiana (suwidhi) 31 70.54 90.76 12 38.71
9678. DolnaNaka (dolnanaka) 31 72.98 93.29 10 32.26
9679. Lost (lostviajero) 31 91.00 105.40 13 41.94
9680. Audrey (cow_rj1204) 31 49.96 83.86 9 29.03
9681. QWERTYsamuel (gottagofast1111) 31 49.98 58.90 3 9.68
9682. Julian (corpse13) 31 71.00 83.22 8 25.81
9683. screaM (scream_) 31 122.64 148.84 20 64.52
9684. Vanessa (vanoob) 31 54.25 66.40 5 16.13
9685. Yashaswe (yash_10) 31 76.54 94.44 11 35.48
9686. mgLover (mannyglover) 31 46.42 53.67 0 0.00
9687. Jacob (jacobdante) 31 68.66 79.12 7 22.58
9688. K (335469854) 31 109.02 129.18 16 51.61
9689. Mads (madsbv) 31 95.95 112.66 15 48.39
9690. Max (madmax89) 31 81.42 90.96 6 19.35
9691. Luthfi (luthfiidrus1612) 31 68.50 78.85 10 32.26
9692. June (lumierevi) 31 84.04 98.72 9 29.03
9693. lotok (lotok_14) 31 86.52 108.30 8 25.81
9694. Bob Gnarly (lobmys) 31 76.93 97.01 10 32.26
9695. LittleYun (littleyun) 31 72.96 91.74 8 25.81
9696. N (lin_snarp) 31 45.93 60.44 3 9.68
9697. Chicony osu! (leva_russian) 31 85.99 98.85 11 35.48
9698. LeTwash (letwash) 31 73.51 92.03 9 29.03
9699. Lasped (lasped) 31 91.43 109.67 7 22.58
9700. Ram (laiforever) 31 46.67 55.48 3 9.68
9701. Jacob (labotski) 31 65.89 79.97 5 16.13
9702. Benjamin (kullaaaa) 31 72.16 84.44 8 25.81
9703. nitram (kros9987) 31 62.93 74.77 4 12.90
9704. Kowalski (kowalski_) 31 109.59 129.52 15 48.39
9705. Mayumi (kogl_mieko) 31 68.56 84.33 4 12.90
9706. Kevin (kidview) 31 68.44 86.43 1 3.23
9707. Kunihiko (keuno) 31 62.72 72.90 7 22.58
9708. Ma (kenma262) 31 88.46 101.82 9 29.03
9709. Jweel (jweel_kar) 31 46.14 55.89 4 12.90
9710. Jason (jwangbang) 31 82.76 95.45 8 25.81
9711. just_tito (just_tito) 31 33.10 41.84 1 3.23
9712. Mattis (juicedrabbit) 31 77.43 94.02 9 29.03
9713. Jonathan (jonathan081) 31 95.75 117.04 12 38.71
9714. Jet (jetwinjo) 31 54.03 62.24 4 12.90
9715. javonte (javonteslow) 31 118.15 153.82 22 70.97
9716. jam (jamhill) 31 61.29 72.31 5 16.13
9717. J (jairo_113) 31 57.02 69.78 11 35.48
9718. ix4l (ix4l19) 31 68.79 79.13 8 25.81
9719. Rahul (itzrall) 31 64.86 85.59 8 25.81
9720. itypeabove130only (itypeabo... 31 134.05 157.89 19 61.29
9721. John (imsoepic) 31 96.33 109.62 10 32.26
9722. A. Moe Gus (iltg) 31 75.34 90.82 10 32.26
9723. HxntedRex (hxntedrex) 31 95.21 108.24 11 35.48
9724. Howard (howardpx2016) 31 108.04 123.93 9 29.03
9725. not (hayso) 31 110.89 130.44 15 48.39
9726. nahte (hawkzle) 31 46.78 61.20 6 19.35
9727. hamin (hamin) 31 102.80 129.19 16 51.61
9728. Hagen (hag3nl) 31 63.06 70.23 8 25.81
9729. wolff (gwolff) 31 151.40 175.67 25 80.65
9730. Gourango (gsrajeni) 31 66.92 83.64 6 19.35
9731. gre (gregoryrogel) 31 59.32 72.30 5 16.13
9732. augh (goodmint) 31 81.00 101.90 9 29.03
9733. dog (ginasmocha) 31 82.35 118.51 11 35.48
9734. Nicholas (gigamammothtyper123) 31 57.35 75.42 3 9.68
9735. Huy (giahuy7753) 31 67.89 82.99 5 16.13
9736. HUONO (gghuono) 31 83.70 95.90 13 41.94
9737. Spartan Warrior (gerogeka1111) 31 72.24 91.01 7 22.58
9738. Gautam (gbasak) 31 52.35 60.03 0 0.00
9739. Sarang (sargfromind) 31 46.32 57.91 4 12.90
9740. Samit (samitkapoor) 31 77.69 97.04 8 25.81
9741. ShyKnee (samflysure) 31 58.81 67.96 3 9.68
9742. nanoray (saliciti) 31 94.02 116.20 11 35.48
9743. sadwipe (sadwipe) 31 79.80 91.18 7 22.58
9744. Rubber (rubberduckcolemak) 31 83.35 110.28 10 32.26
9745. Raul (rromer41) 31 58.41 71.35 0 0.00
9746. Roy (royroyking) 31 89.89 113.16 10 32.26
9747. Rikka (rikka_takanashi) 31 123.04 152.90 18 58.06
9748. Rhevan (rhevan) 31 53.22 61.49 10 32.26
9749. Reyque (reyquexd) 31 107.93 129.88 10 32.26
9750. Raul (raule_maule) 31 69.52 83.88 7 22.58
9751. Raj (raj__) 31 88.12 106.16 10 32.26
9752. Rad (radandrei) 31 99.77 110.83 19 61.29
9753. prasanjith (prasanjith) 31 61.64 73.03 3 9.68
9754. Ivan (pop5a) 31 90.77 113.99 10 32.26
9755. perm (perm_typeracer) 31 62.34 72.55 3 9.68
9756. Paul (paulg2k_csgo) 31 73.53 87.80 7 22.58
9757. Geetansh (pandaculture) 31 74.25 87.42 5 16.13
9758. OMGnesststats[omgness321] (... 31 69.92 88.99 7 22.58
9759. Mudit (n___) 31 68.19 79.50 8 25.81
9760. Nyp3r (nyp3r) 31 59.96 70.85 3 9.68
9761. NoNo (nonoesimposible) 31 110.07 126.26 15 48.39
9762. nitrosquid (nitrosquid) 31 96.52 126.27 10 32.26
9763. nagz (naxumi) 31 82.96 113.98 10 32.26
9764. mustard maiden (mustardmaiden) 31 115.69 135.64 16 51.61
9765. Mukhametkali (mr_koten) 31 31.14 39.45 8 25.81
9766. Mesotelioma (mesotelioma) 31 92.08 107.17 13 41.94
9767. Max (max_6058) 31 82.06 95.36 10 32.26
9768. Markus (markustelser) 31 76.50 87.84 14 45.16
9769. Sashaw (sashaww) 30 90.43 111.33 9 30.00
9770. SiD (samueldim) 30 89.94 102.12 13 43.33
9771. Ryan (ryan3760) 30 54.26 67.48 3 10.00
9772. rum3r (rum3r) 30 69.04 78.75 6 20.00
9773. Riser (riser1) 30 60.77 74.61 8 26.67
9774. riggers (riggers) 30 62.85 81.35 6 20.00
9775. revoosh (revoosh) 30 103.80 119.42 14 46.67
9776. Rassulkhair (rassulkhair) 30 54.81 64.62 4 13.33
9777. Sapphic Llama (rare_taco) 30 51.24 68.84 2 6.67
9778. Rankoll (rankoll) 30 75.66 86.90 10 33.33
9779. RadAlienware (rad_alienware) 30 65.86 79.53 6 20.00
9780. Rich (r1hh) 30 87.19 108.99 10 33.33
9781. IwasFASTonQWERTYnowIuseDVOR... 30 78.27 95.51 7 23.33
9782. ben (prizmoasd) 30 96.10 112.97 8 26.67
9783. Caleb (prismiasma) 30 112.65 128.97 11 36.67
9784. Jakub (prism1349) 30 68.06 81.64 4 13.33
9785. Pointyepic (pointyepic) 30 97.55 118.78 13 43.33
9786. MiazMe (pmax) 30 85.57 102.28 9 30.00
9787. Jesse (pinec0ne) 30 82.55 94.40 8 26.67
9788. Petter (ph140) 30 82.44 108.59 13 43.33
9789. pewpewdevildog (pewpewdevil... 30 80.98 92.13 7 23.33
9790. Peter (petermc2007) 30 94.94 109.55 15 50.00
9791. fan de Iknash (pedrou) 30 113.19 139.72 15 50.00
9792. Patrick (patclark) 30 91.23 101.92 11 36.67
9793. Rodrigo (pacha2880) 30 71.12 81.85 7 23.33
9794. Piyush (p1yu5h) 30 59.38 67.88 7 23.33
9795. OwenF (owenf) 30 46.64 72.39 0 0.00
9796. Oliver (oviewill) 30 66.63 75.87 6 20.00
9797. Nox (nymanne) 30 99.52 117.69 16 53.33
9798. nother (nother) 30 54.95 66.47 6 20.00
9799. B (nonemorenegative) 30 100.86 144.79 12 40.00
9800. Sochi (noizi) 30 74.61 94.52 6 20.00
9801. DaddyChill (nightynine) 30 54.43 68.67 2 6.67
9802. Nicholas (nemath) 30 87.27 106.65 10 33.33
9803. Nelvin (nelvin27) 30 89.48 109.67 9 30.00
9804. Piyabuht (nekktheredsand) 30 72.83 90.63 8 26.67
9805. Naitik (naitik_lisa) 30 39.95 48.93 2 6.67
9806. muzakh (muzakkiha) 30 87.52 104.02 6 20.00
9807. Muhammad Musharaf (musharaf35) 30 59.36 74.04 8 26.67
9808. Murfy (murfychia) 30 70.17 81.58 11 36.67
9809. Aman (multiversal_aspirator) 30 64.91 70.77 6 20.00
9810. MtDewaholic (mtdewaholic) 30 103.85 123.99 8 26.67
9811. Mr (mrmindgames) 30 91.61 109.83 25 83.33
9812. MJ (mj_02) 30 93.53 107.60 15 50.00
9813. Mich (michdaevinci) 30 74.36 93.16 7 23.33
9814. Mohamad (mhmd_khlf) 30 87.44 95.75 5 16.67
9815. merlot (merlotsuma) 30 43.68 54.50 3 10.00
9816. Mayur S (mayur_chirttaragi) 30 60.57 72.35 4 13.33
9817. mike (maykqwe) 30 93.95 114.04 11 36.67
9818. stay fresh cheese bags (maw... 30 137.38 157.12 22 73.33
9819. Arif (areyf) 30 49.92 60.02 6 20.00
9820. Ayon (apaul23) 30 107.81 124.59 14 46.67
9821. angry (angryfingers) 30 65.65 76.93 8 26.67
9822. Alyan (alyanm) 30 114.36 135.84 5 16.67
9823. Alvin (alwin630) 30 96.69 116.00 11 36.67
9824. Alex (alexlizx) 30 82.54 98.45 6 20.00
9825. Axolotl (aj0l0tl) 30 69.83 79.56 3 10.00
9826. Afiq (afiqapon91) 30 52.38 64.89 2 6.67
9827. Adres (adres) 30 53.12 62.32 4 13.33
9828. sigma (adelshehadeh) 30 64.69 79.48 5 16.67
9829. Aaron (aaronfrdumb) 30 60.07 74.98 8 26.67
9830. Lars (aaberg) 30 87.20 100.60 5 16.67
9831. Bot (348866896) 30 92.61 114.57 8 26.67
9832. 2E13 (1d14) 30 69.76 83.87 13 43.33
9833. 1776 (17_abe_76) 30 56.03 71.86 4 13.33
9834. 10time (10time) 30 38.53 58.21 5 16.67
9835. 0hyeah (0hyeah) 30 55.01 67.44 4 13.33
9836. Joshua (josheems) 30 85.83 110.11 8 26.67
9837. Sup (harry_kane) 30 50.83 60.65 4 13.33
9838. big fudge (bigfudge84) 30 44.45 59.07 4 13.33
9839. Arvi (arvi4321) 30 91.04 117.07 13 43.33
9840. Yousuf (khanyousuf) 30 59.05 69.15 7 23.33
9841. Parnika:) (parnika) 30 58.53 68.58 4 13.33
9842. Magi (magi_dragon) 30 86.68 105.44 9 30.00
9843. Dalton Machart (dzmachart25) 30 56.19 71.97 4 13.33
9844. Blue (blue03) 30 74.44 102.28 14 46.67
9845. Clay Cain (fredrafferty) 30 45.26 55.43 2 6.67
9846. jonas (frallan34) 30 61.45 76.37 8 26.67
9847. Fly1nthe5ky (fly1nthe5ky) 30 85.23 100.80 9 30.00
9848. Floopy (floopy__) 30 100.89 122.19 16 53.33
9849. monster (flamewarz) 30 74.06 94.11 11 36.67
9850. Joe (fireflygrave) 30 82.66 105.98 5 16.67
9851. Kauã (fernandes10) 30 72.60 86.93 9 30.00
9852. myth (fear_ed) 30 118.48 135.71 22 73.33
9853. Anton (fantoniko) 30 52.43 56.30 1 3.33
9854. Marcus (evanitez) 30 120.04 143.45 15 50.00
9855. Eugene (eugeneteoh) 30 96.15 122.21 12 40.00
9856. Ethan (etwa) 30 98.27 115.34 16 53.33
9857. E. (esheby) 30 62.51 72.56 5 16.67
9858. Steven (engine210) 30 76.04 91.14 8 26.67
9859. neo (eliteneo_dvo) 30 87.49 101.05 8 26.67
9860. Franzvic (elbruh) 30 90.91 117.93 9 30.00
9861. typingishard (dweepers) 30 92.70 112.60 7 23.33
9862. Andrew (dodapotato) 30 44.22 58.53 2 6.67
9863. Dizzi (dizzitypes) 30 93.80 116.00 8 26.67
9864. didi (didi_pot) 30 69.83 81.25 7 23.33
9865. nah (determination_) 30 114.42 136.75 14 46.67
9866. Jeremy (definee) 30 86.80 104.16 5 16.67
9867. Shan (debayon4545) 30 104.14 139.38 16 53.33
9868. Vihas (datlightning) 30 82.83 102.74 8 26.67
9869. Siddharth (darksun27) 30 55.04 65.57 6 20.00
9870. daniel (danfinch07) 30 44.44 52.86 4 13.33
9871. Daniel (daknk) 30 56.82 65.72 6 20.00
9872. weird keyboard (cyphex) 30 100.95 118.61 9 30.00
9873. Sashreek (cygnus206) 30 75.89 94.27 11 36.67
9874. Liny (counting_star) 30 64.90 79.23 7 23.33
9875. Norman (codificat) 30 80.07 92.63 10 33.33
9876. YZZUB (chuang010896) 30 84.23 103.25 10 33.33
9877. 1myvar (chowchunfu) 30 104.31 121.99 15 50.00
9878. Chad (chadkorrea) 30 56.38 68.64 5 16.67
9879. |)are2|_eap (cepetir) 30 90.85 109.02 7 23.33
9880. cagdas (cagirtas) 30 64.45 74.85 8 26.67
9881. Brian (brian3927) 30 95.84 118.26 11 36.67
9882. bq666 (bq666) 30 66.79 88.30 6 20.00
9883. bp4dn (bp4dn) 30 100.22 121.91 11 36.67
9884. bongking (bongking) 30 87.78 115.56 8 26.67
9885. Bodie (bodejazz) 30 84.86 98.14 10 33.33
9886. BobdeThird (bobdethird) 30 95.83 136.53 12 40.00
9887. Blue (blue03yt) 30 74.44 102.28 14 46.67
9888. BlazeAries (blaze_aries) 30 75.13 87.61 8 26.67
9889. Ben (benthenoob961) 30 64.62 89.04 6 20.00
9890. sheeeeeeeeeeeeeeeeeeeeeeeee... 30 61.20 82.46 6 20.00
9891. Peter (beepseeker) 30 110.35 142.20 14 46.67
9892. be4r (be4r_) 30 63.11 71.10 3 10.00
9893. avisheek (avisheek) 30 46.30 84.29 1 3.33
9894. Asmus (asmus__) 30 59.17 75.14 6 20.00
9895. Ásþór (asibasi) 30 80.50 97.65 8 26.67
9896. Charles (armdev) 30 79.68 96.91 14 46.67
9897. samir (_samir) 30 83.75 107.13 25 83.33
9898. ArV (_arv_) 30 62.59 70.62 6 20.00
9899. Jacob (zoloto67) 30 96.95 111.58 12 40.00
9900. Hazique Mirza (ziquemirza) 30 50.67 59.09 1 3.33
9901. zeropollyvtuber (zeppi) 30 130.25 151.08 23 76.67
9902. Zear (zear5) 30 74.83 92.83 7 23.33
9903. Callum (yuihirasawa) 30 86.87 101.63 14 46.67
9904. sebi (ysebi) 30 62.95 73.01 6 20.00
9905. Yoongo (yoongo) 30 91.14 104.93 10 33.33
9906. Winson (wwang038) 30 89.70 107.27 15 50.00
9907. Arnold (wiktor172003) 30 83.19 99.28 6 20.00
9908. walid (walid1997) 30 77.74 90.60 8 26.67
9909. Derek (vonarxd) 30 90.39 98.97 6 20.00
9910. Mike (unforgotten) 30 108.35 134.75 17 56.67
9911. ayeitsme (ughg) 30 53.95 75.07 3 10.00
9912. Kameloc (twoddle2) 30 80.74 92.64 8 26.67
9913. Tops (tufeng) 30 68.83 84.90 10 33.33
9914. Translator (trnsltr) 30 95.79 112.72 12 40.00
9915. Pavel (trialtry) 30 76.87 88.17 12 40.00
9916. Aidan (trabpukcip) 30 108.04 129.04 16 53.33
9917. Tina (tprentis22) 30 61.58 70.91 4 13.33
9918. Anthony (tonymontaro) 30 74.77 84.87 5 16.67
9919. Toasted (toasted_) 30 71.91 84.30 8 26.67
9920. tnn21 (tnn21) 30 105.67 140.90 8 26.67
9921. thundr (thundr001) 30 43.71 54.01 1 3.33
9922. Theo (the_o_choked) 30 78.91 92.61 7 23.33
9923. notorioustype (thenotorious... 30 49.61 57.62 3 10.00
9924. Johan (thehutt) 30 70.72 81.34 19 63.33
9925. tesseract (tesseract1996) 30 56.48 70.51 4 13.33
9926. Ethan (terean) 30 113.21 126.72 18 60.00
9927. syz (syzzzzzzz) 30 62.29 78.08 3 10.00
9928. SWAPNIL (swapnil326) 30 81.50 94.58 12 40.00
9929. Isak (stitchy_) 30 62.73 83.31 10 33.33
9930. Starry (starsky123) 30 92.88 111.53 13 43.33
9931. Griffin (speedyboi4506) 30 101.55 129.61 14 46.67
9932. SOBO (sobo) 30 76.58 88.18 6 20.00
9933. lol (sngtx) 30 81.81 103.50 8 26.67
9934. Cassi (slowerthanmolasses) 30 59.47 73.09 4 13.33
9935. Avery (skipperbud) 30 73.43 86.16 7 23.33
9936. Josh (shrekker) 30 119.95 141.48 13 43.33
9937. sho (shoshosho1) 30 59.93 75.22 10 33.33
9938. JS (shadyshadez) 30 104.34 122.15 14 46.67
9939. Sergej (segi) 30 65.89 88.13 2 6.67
9940. x (sealnot123) 30 81.65 97.84 9 30.00
9941. King (maichen777) 30 88.64 100.11 8 26.67
9942. qwerty (longhongc) 30 80.92 94.76 6 20.00
9943. Lokinoha (lokinoha) 30 73.79 85.08 3 10.00
9944. Ivan (ljakpa) 30 95.32 104.93 10 33.33
9945. Pengu (lilpengu) 30 83.88 100.25 10 33.33
9946. chetty (lilchetty_x3) 30 86.18 95.87 11 36.67
9947. E (le_chonks) 30 82.25 102.79 21 70.00
9948. Letter (letterofpower) 30 80.73 100.93 1 3.33
9949. slow_racer (left_arm_chinaman) 30 57.46 66.57 2 6.67
9950. Leah (leahlovesjisung) 30 80.82 93.79 13 43.33
9951. khlaid (kmaf) 30 63.25 84.38 6 20.00
9952. Krish (kkrish100) 30 78.94 101.73 7 23.33
9953. kimhong01 (kimmong) 30 74.61 82.27 7 23.33
9954. Damyian (kight) 30 97.25 126.33 11 36.67
9955. Kaimetsu (kaimetsu) 30 98.88 127.08 11 36.67
9956. Ansar (kabdik) 30 35.72 43.17 2 6.67
9957. Juicedit (juicedit) 30 102.09 127.72 10 33.33
9958. Me (juicedcows) 30 93.78 117.64 5 16.67
9959. Juantonomoe (juantonomoe) 30 115.30 131.74 18 60.00
9960. John (johncha15724) 30 95.83 110.30 10 33.33
9961. Joe (joemamma121) 30 68.78 85.35 10 33.33
9962. Jacob (jkhindo64) 30 92.52 109.54 8 26.67
9963. cody (jiji247) 30 145.81 163.33 23 76.67
9964. Jasmine (jasmine5752) 30 54.43 62.52 5 16.67
9965. Ivan (ivanplaystr) 30 105.69 116.85 16 53.33
9966. Ivan (ivanh922114) 30 64.80 76.01 7 23.33
9967. Khaled (itskhaled) 30 39.70 58.31 2 6.67
9968. Joshua (insanelol) 30 83.44 99.02 9 30.00
9969. Im Hacker (im_hacker) 30 100.05 117.55 16 53.33
9970. Dana (icantthinkofausername) 30 117.19 135.51 20 66.67
9971. Mason (hyojin2k) 30 98.91 112.01 13 43.33
9972. namdo (huynhnamdo96) 30 66.16 74.23 4 13.33
9973. Hot Cross Puns (hot_cross_p... 30 97.86 112.31 29 96.67
9974. James (horjamez) 30 63.93 76.14 7 23.33
9975. Henrique (hnrqe) 30 98.69 150.82 12 40.00
9976. Richard (heferous) 30 57.35 78.52 3 10.00
9977. Hamang (hamangpincong) 30 50.05 60.76 5 16.67
9978. Alicja (gymnast2008) 30 50.88 62.59 3 10.00
9979. Guber (guberxz) 30 62.43 73.55 9 30.00
9980. Gnany (gnanyadapa) 30 48.77 65.93 5 16.67
9981. Jack (giglioroninomicon) 30 103.88 126.94 10 33.33
9982. Garamonde (garamonde) 30 75.21 90.51 10 33.33
9983. Ickooo (gamerchancer) 30 82.41 96.04 8 26.67
9984. Jakub (f_ckshit) 30 69.18 80.81 11 36.67
9985. m3d (m3dsh) 29 74.66 91.81 10 34.48
9986. Lyons (lyoons) 29 121.07 150.05 24 82.76
9987. Lush (lush_krom) 29 98.15 111.25 15 51.72
9988. smino (lucskosur420) 29 61.86 78.26 5 17.24
9989. Machine (longshort) 29 58.23 75.27 6 20.69
9990. Nate (lobdog) 29 84.66 106.23 8 27.59
9991. Lil (lil_wymn20) 29 38.90 46.32 3 10.34
9992. LadaSedan (ladasedan) 29 83.61 94.63 3 10.34
9993. Angel (kyngbui) 29 114.91 149.41 15 51.72
9994. kyletsetse (kyletsetse) 29 126.40 150.80 26 89.66
9995. kottt (kweent182) 29 97.72 107.92 9 31.03
9996. Kamiltoni (ktonig1221) 29 33.07 52.81 3 10.34
9997. E (knight250) 29 70.20 83.28 27 93.10
9998. Rae (kmacc) 29 51.08 67.51 2 6.90
9999. Kevin (kevinmeseeyou) 29 102.31 114.28 9 31.03
10000. kenneth (kenneth29) 29 65.34 77.45 3 10.34
10001. Nektarios (kapiras) 29 37.41 50.06 2 6.90
10002. Md Ziaur Rahman (juall) 29 39.92 52.35 2 6.90
10003. Jacob (jsmith182) 29 89.34 102.31 14 48.28
10004. Joshua (joshnah) 29 86.06 105.44 11 37.93
10005. Joshua (joshbenja) 29 97.33 110.35 9 31.03
10006. Jayuke (jontrask) 29 102.10 125.30 13 44.83
10007. Jokrr (jokrr7) 29 77.10 88.67 10 34.48
10008. JC (joker801) 29 44.46 49.46 2 6.90
10009. Jerod (jeroddddd) 29 109.54 129.55 14 48.28
10010. Jeev (jeevjoel) 29 70.26 92.63 7 24.14
10011. Jeemin (jeemini) 29 101.64 124.15 13 44.83
10012. Jayden (jayballr) 29 81.88 102.68 7 24.14
10013. Jacques (jacquesp) 29 85.95 104.94 3 10.34
10014. Jackelton (jackelton) 29 93.27 112.13 10 34.48
10015. tstats[jaadunath] (jaadunath) 29 74.84 90.85 8 27.59
10016. IamUrs (i_am_urs) 29 82.03 102.77 5 17.24
10017. imi (imitavor) 29 55.81 68.16 2 6.90
10018. Jeon (idnyhn) 29 94.31 117.29 12 41.38
10019. hyeonk (hyeonk) 29 99.56 122.70 12 41.38
10020. Hridoy (hridoymahmud71) 29 40.79 46.96 2 6.90
10021. Raheeb (hoenchioma) 29 57.57 71.02 2 6.90
10022. Wixxers (heyitswixx) 29 62.08 80.05 13 44.83
10023. dsc.gg/uk-train (hellomynam... 29 63.75 82.58 19 65.52
10024. haaa (h505) 29 73.73 84.84 7 24.14
10025. GMHazem (gm_hazem02) 29 72.90 90.73 5 17.24
10026. CheetahDude (ghysdd) 29 96.15 115.88 11 37.93
10027. Dum (getintherobotshinji) 29 99.55 118.62 17 58.62
10028. George (gecovin) 29 96.90 118.65 11 37.93
10029. Kowala Bear (gaverpro) 29 141.83 168.60 20 68.97
10030. loiyus (fuzxy) 29 101.53 121.95 10 34.48
10031. mrooogaboooga (foulackfoula... 29 90.90 114.56 4 13.79
10032. Mavis (firkinmugs) 29 72.22 83.97 9 31.03
10033. Henk (fattieruns) 29 74.33 86.55 8 27.59
10034. tstats[faiz_legend] (faiz_l... 29 71.60 94.41 6 20.69
10035. nootnoot (ezoid_nootnoot) 29 50.89 68.92 7 24.14
10036. vion (evions) 29 47.64 66.10 2 6.90
10037. Eder (edertyper) 29 88.13 103.04 10 34.48
10038. Ora Ora (eddyyang2003) 29 102.36 115.96 19 65.52
10039. Hektor (dr_sparkles) 29 60.15 75.88 14 48.28
10040. Zap (drdecember) 29 70.75 86.00 7 24.14
10041. Doven (doven) 29 85.36 104.01 13 44.83
10042. dev (devgiri0082) 29 66.03 76.84 0 0.00
10043. Deepak (deepakthegreat) 29 60.67 79.63 5 17.24
10044. david (davie04) 29 88.59 106.18 8 27.59
10045. davidbird764 (davidbird764) 29 106.74 125.03 13 44.83
10046. tstats[daula507] (daula507) 29 53.54 71.37 15 51.72
10047. Connor (ctw0611) 29 124.64 146.89 22 75.86
10048. Akashi (coppokim) 29 43.05 53.25 6 20.69
10049. CoolGuy (cool_guy5583) 29 72.16 85.76 12 41.38
10050. Kyjro (codertimeing) 29 66.98 85.09 6 20.69
10051. Cinari (cinari) 29 96.87 108.54 6 20.69
10052. Chris (chrisrapid) 29 50.54 57.17 5 17.24
10053. Chris (chrislh221) 29 91.33 103.66 13 44.83
10054. Chi (chiphan1993) 29 122.33 138.40 16 55.17
10055. CHIEN (chient) 29 101.29 112.36 10 34.48
10056. Cassidy (cassidyfaith) 29 90.36 129.61 12 41.38
10057. yanzhi (cakeuuuu) 29 78.40 91.18 10 34.48
10058. Ben (bv_nie) 29 87.57 112.42 8 27.59
10059. Brian (brianbanri) 29 90.98 107.98 11 37.93
10060. caden (breezynotcheezy) 29 65.98 92.27 11 37.93
10061. Brayden (braddin123) 29 94.97 114.42 11 37.93
10062. Bridget (boomsey) 29 99.48 124.37 13 44.83
10063. Suvhoraj (blazing_cuber) 29 50.49 67.66 3 10.34
10064. Bertra (bertraml) 29 81.70 93.04 8 27.59
10065. berkay (berkayyalin) 29 92.91 107.45 13 44.83
10066. Bennie (beneficial_bean) 29 71.56 89.70 9 31.03
10067. Dustin (belyea) 29 101.63 127.62 12 41.38
10068. Kaymart (barrix) 29 71.15 97.00 10 34.48
10069. Khesar (babywicker) 29 52.22 67.79 1 3.45
10070. Will (awesomeguy1427) 29 63.71 76.10 5 17.24
10071. Andy (avocadocream) 29 81.23 101.99 6 20.69
10072. Andrew (astrel) 29 107.15 123.81 10 34.48
10073. Aman (ashriv88) 29 80.26 104.84 8 27.59
10074. Namoonia (sasti_chars) 29 61.54 81.66 4 13.79
10075. Brendyy (sabtooth) 29 126.39 141.21 18 62.07
10076. Ryan (rya02) 29 61.97 77.57 7 24.14
10077. Karl (refllexz) 29 80.67 96.08 7 24.14
10078. Niklas (reeklas) 29 54.85 60.60 21 72.41
10079. Ray (ray1829) 29 114.37 144.37 18 62.07
10080. Rainbow (rainbowdudebh) 29 125.39 157.75 19 65.52
10081. Gnomeツ (raging_gnome) 29 110.72 142.00 14 48.28
10082. Romeo (r0mpan) 29 42.89 51.68 10 34.48
10083. Praise (praisehim) 29 115.05 130.41 11 37.93
10084. Peter (pklly) 29 60.39 78.07 5 17.24
10085. Pinoy (pinoytypist01) 29 83.32 99.34 3 10.34
10086. PingingCarrot16 (pingingcar... 29 67.29 89.20 7 24.14
10087. Pina (pina_pog) 29 125.50 156.11 23 79.31
10088. Pere_Gil (pere_gil) 29 77.26 89.26 3 10.34
10089. Savannah (peaches39) 29 70.82 85.20 8 27.59
10090. Chee (pcheekz) 29 50.12 67.30 7 24.14
10091. Patrick (patbl) 29 87.20 108.40 14 48.28
10092. ThePastor (pastor3974) 29 63.59 89.87 5 17.24
10093. Paracoax (paracoax) 29 106.39 128.42 13 44.83
10094. Thomas (nunu464) 29 60.48 74.57 9 31.03
10095. THE KID (nschattner) 29 94.91 118.90 10 34.48
10096. Novades (novades) 29 69.51 86.45 9 31.03
10097. ℮ (nicepal) 29 137.30 155.75 22 75.86
10098. Esmeralda (niccon) 29 83.07 97.44 5 17.24
10099. Neske (neske) 29 98.48 124.67 14 48.28
10100. (nenontank_) 29 90.05 135.08 10 34.48
10101. Nalahatra (nalahatra) 29 47.90 67.43 2 6.90
10102. Mustafa (musthelegend) 29 90.93 106.47 7 24.14
10103. MoresVance (moresvance) 29 102.82 125.22 15 51.72
10104. Bijay (moneybijay) 29 93.12 112.76 11 37.93
10105. lucas (moisturisingcream) 29 66.09 77.83 7 24.14
10106. Georgi (mitevw) 29 32.58 41.20 1 3.45
10107. Milky (milkxy) 29 96.83 115.09 19 65.52
10108. Munkhsuld (mbior) 29 74.13 82.99 8 27.59
10109. Mark (mariktypes) 29 117.56 141.94 16 55.17
10110. Apathy (apathyy) 29 87.88 103.90 8 27.59
10111. Anshit (anshitgrg) 29 51.73 68.42 3 10.34
10112. Bob (allanbarry) 29 71.56 81.63 12 41.38
10113. Cyber (alifarra) 29 72.61 91.83 11 37.93
10114. aldrigon (aldrigon) 29 93.68 120.66 18 62.07
10115. Andi (agraumann) 29 68.58 89.33 8 27.59
10116. AggieMet (aggiemet) 29 61.26 83.31 9 31.03
10117. 7amada (7amada) 29 80.80 91.86 6 20.69
10118. duy (69discombobulates) 29 61.93 72.52 12 41.38
10119. Edward (1934__) 29 89.36 116.03 12 41.38
10120. k (edhne) 29 60.40 74.07 7 24.14
10121. Lisbeth (l1sbeth_dam) 29 44.86 60.20 2 6.90
10122. Ambuj (ambujsingh) 29 56.29 68.48 6 20.69
10123. Littenator (littenator) 29 58.98 71.94 5 17.24
10124. Brur (brur) 29 62.94 77.10 8 27.59
10125. Jakub (jintax) 29 54.95 66.97 6 20.69
10126. ashley (ashleyyyuwu) 29 35.72 45.84 3 10.34
10127. Aries (notanaries) 29 93.22 108.28 13 44.83
10128. gerleva (_mr_e_) 29 65.95 74.99 5 17.24
10129. fastest (_fastest_typist) 29 75.48 96.56 11 37.93
10130. Z-Dvorak (zzdarke) 29 71.87 91.63 8 27.59
10131. zhem_ (zhem) 29 107.52 130.10 14 48.28
10132. Zharfan (zharfanadli) 29 94.03 113.62 16 55.17
10133. Zeryx (zeryx_typing) 29 72.83 83.07 5 17.24
10134. zei (zeizuta) 29 28.27 34.59 7 24.14
10135. Zakaria (zackzack1224) 29 82.35 98.31 11 37.93
10136. Sam (yaboisam_) 29 88.83 108.16 11 37.93
10137. Luna (xluna420) 29 81.38 95.01 17 58.62
10138. Andrew (wongsifu) 29 83.61 99.08 16 55.17
10139. Kelvin - Colemak (winlost) 29 108.44 122.12 14 48.28
10140. William (willteee) 29 99.74 123.77 8 27.59
10141. Jared (willetsjared) 29 73.42 90.09 7 24.14
10142. WhiteRose (whiter9se) 29 37.83 45.97 0 0.00
10143. David (wdnch) 29 76.75 91.79 9 31.03
10144. W (wbhizzle7) 29 100.71 122.04 6 20.69
10145. ( ͡° ͜ʖ ͡°) (warrine... 29 61.23 78.26 5 17.24
10146. VSF (vsf123) 29 28.36 34.47 5 17.24
10147. Victor (victorm900) 29 71.20 79.01 4 13.79
10148. Vaibhav (vibhix) 29 75.17 90.60 6 20.69
10149. Nick (vergil_00) 29 75.23 93.45 11 37.93
10150. Lucas (veraluc) 29 96.99 119.25 8 27.59
10151. Jacob (vanosgaming2014) 29 118.97 138.04 17 58.62
10152. Yupa (valleyofthewin) 29 72.08 80.06 2 6.90
10153. Umalis (umali) 29 54.85 66.59 7 24.14
10154. Fealing (typistboy) 29 88.11 104.98 6 20.69
10155. Twistees (twisteesboy) 29 79.63 98.98 15 51.72
10156. It's me! (tuppence) 29 65.31 84.15 7 24.14
10157. Justin (trudeaucooks) 29 138.37 195.76 22 75.86
10158. Troy (troydaigneau) 29 94.96 118.90 5 17.24
10159. Zkye (trestiel) 29 72.24 93.09 9 31.03
10160. Roo (trepur349) 29 100.82 123.97 11 37.93
10161. cody (tkdanimal) 29 70.15 83.74 5 17.24
10162. Majid (thetypingnerd852) 29 36.59 48.39 4 13.79
10163. swooshmcgoosh (swooshmcgoosh) 29 107.82 133.38 14 48.28
10164. owen (sushisynth12) 29 83.43 102.45 5 17.24
10165. Bertie (sunstonesharptor) 29 70.38 84.29 0 0.00
10166. Eric (sumtypaway) 29 63.32 84.41 6 20.69
10167. Suhas (suhoos) 29 103.68 125.67 16 55.17
10168. gae (subtoentaloop) 29 77.92 99.76 7 24.14
10169. stash (stash_) 29 43.16 53.76 2 6.90
10170. Teddy (stargazingteddy) 29 53.16 63.88 4 13.79
10171. tstats[sspaghettii] (sspagh... 29 92.74 108.16 9 31.03
10172. Austin (splashtime) 29 97.36 109.88 14 48.28
10173. grammy (spicybbqsauce) 29 64.64 78.51 4 13.79
10174. Pinkies (smile_typer) 29 100.43 115.66 15 51.72
10175. Regan (smalltymehero) 29 63.14 73.04 5 17.24
10176. skepsi87 (skepsi87) 29 45.16 58.23 5 17.24
10177. Priscilla (simplyscience) 29 121.78 150.53 23 79.31
10178. Silent G (silentgisback) 29 115.03 135.93 15 51.72
10179. ꧁🎧웃 ֆɨɖɖɦǟռȶ... 29 60.03 78.10 7 24.14
10180. Jhonnathan Ramirez (siaxais) 29 40.62 57.90 0 0.00
10181. yung (shwn) 29 122.29 148.27 17 58.62
10182. Sharath (sharathnirmala) 29 54.43 67.72 4 13.79
10183. shantanu (shantothegreat) 29 67.63 85.57 5 17.24
10184. o (seticl) 29 99.88 125.44 11 37.93
10185. seer23 (seer23) 29 77.05 91.69 21 72.41
10186. Stacks (_stacksqueue2) 28 62.39 77.73 6 21.43
10187. Max (_maxkoo_) 28 61.43 67.11 4 14.29
10188. Lucky (_lucky__verma__) 28 21.62 30.50 5 17.86
10189. Jalex (_jalex) 28 49.17 59.33 1 3.57
10190. Asim (_asim_) 28 83.56 94.47 10 35.71
10191. nattapakon (zudiyeah) 28 25.82 33.03 1 3.57
10192. Justin (zexcel) 28 118.30 128.91 13 46.43
10193. Youri (yourischuur) 28 100.73 125.78 9 32.14
10194. yihuididi (yihuididi) 28 54.38 65.53 3 10.71
10195. Yexsys (yexsys) 28 76.23 105.00 6 21.43
10196. e2blu (yellowe2) 28 108.93 126.84 11 39.29
10197. ((: (yeeyeehehe) 28 117.94 135.53 13 46.43
10198. (xyztcube) 28 94.60 104.91 9 32.14
10199. xhqrry has two fingers (xhq... 28 68.18 78.08 8 28.57
10200. Edward (xarvus) 28 93.86 111.93 9 32.14
10201. John (wolman511) 28 110.58 133.39 12 42.86
10202. THE JEWELL (wildhorsesthe2nd) 28 103.05 137.92 15 53.57
10203. Wiktor (wicker6) 28 78.62 98.43 6 21.43
10204. will (whitedarko) 28 94.46 114.44 12 42.86
10205. Keyser (whereskeyser) 28 92.87 116.61 11 39.29
10206. George (wavy_shakespeare) 28 72.04 88.76 12 42.86
10207. tdsar (volterxien) 28 110.00 126.69 14 50.00
10208. Andrew (viper42usa) 28 92.18 101.89 6 21.43
10209. Vinesh (vineshdodiya) 28 50.89 58.39 3 10.71
10210. Vinay (vinaynani92) 28 82.53 98.85 11 39.29
10211. Josh (vaximus) 28 85.77 100.73 7 25.00
10212. vamsi (vamsivadrevu) 28 88.02 109.34 8 28.57
10213. vakilral (vakilral) 28 85.46 99.12 7 25.00
10214. Joshua (typing_huh1) 28 99.79 120.59 14 50.00
10215. Ryo (troublecuber) 28 80.66 93.66 3 10.71
10216. Andrew (trazer) 28 103.66 112.63 8 28.57
10217. Gary (traeyoung) 28 143.78 171.50 20 71.43
10218. Tokugawa (tokugawapants) 28 131.61 152.08 17 60.71
10219. Evan (toastypoints) 28 97.57 119.97 15 53.57
10220. Harry (tls278) 28 60.18 68.78 8 28.57
10221. Daniel (theyluvdaniell) 28 73.68 89.94 5 17.86
10222. ry (therylyndshow) 28 80.40 97.18 8 28.57
10223. Totus (thepenguin183) 28 91.30 117.94 11 39.29
10224. ༼ つ ◕_◕ ༽つ (the... 28 78.38 95.76 8 28.57
10225. Themi (themis3000) 28 59.76 68.45 5 17.86
10226. Duncan (thedunco) 28 90.11 104.30 9 32.14
10227. Ethan (thatonepear) 28 106.02 117.46 10 35.71
10228. telorbuzzu (telorbusu) 28 113.40 133.37 15 53.57
10229. Justin (tacder) 28 41.09 53.07 2 7.14
10230. Abdulhadi (surebeta) 28 58.85 68.04 3 10.71
10231. Sunbites (sunbites_4610) 28 81.38 102.48 15 53.57
10232. Benjamin (strangelyroblo) 28 74.27 91.81 7 25.00
10233. Spy (spy12150) 28 103.82 118.52 13 46.43
10234. Chris P. Bacon (spicy_toast) 28 88.28 104.95 11 39.29
10235. Be At Peace (spacepajamas) 28 89.03 100.56 11 39.29
10236. Smoke (smoke91) 28 86.52 102.11 6 21.43
10237. Sludge (sludgeneedbeer) 28 48.47 58.31 4 14.29
10238. sleepy (sleepy_tf) 28 92.72 117.76 10 35.71
10239. skeleton (skeleton0) 28 101.29 117.20 13 46.43
10240. tstats[sinkingecstasies] (s... 28 105.27 128.78 10 35.71
10241. ShowMeDaWay (showmak) 28 53.51 68.49 12 42.86
10242. Shimbo (shimbobaby) 28 63.45 80.47 19 67.86
10243. sherif (sherifu3) 28 35.89 43.11 1 3.57
10244. Shadowfader (shadowfader) 28 39.09 45.19 3 10.71
10245. joshuawh (sh1nobie) 28 117.80 150.35 8 28.57
10246. Nady (serufidesu) 28 64.49 79.91 6 21.43
10247. Guillermo (schobzax) 28 123.46 154.23 21 75.00
10248. Sawill (sawill) 28 78.73 94.61 6 21.43
10249. Steve (sanptyper) 28 107.28 118.97 11 39.29
10250. Sanjar0126 (sanjar0126) 28 62.45 73.64 10 35.71
10251. spam (sammywammyllamma) 28 94.75 109.11 12 42.86
10252. Sagi (sagi_hv) 28 38.05 45.18 1 3.57
10253. Ryuu (sacreddany) 28 83.24 96.00 7 25.00
10254. RZ5D (rz5d) 28 90.21 113.32 16 57.14
10255. Gabriel (ryulzaki) 28 62.46 85.54 6 21.43
10256. Rishay (rishayg) 28 58.09 68.07 6 21.43
10257. Monica (ricefun) 28 92.78 106.46 8 28.57
10258. Reyna (reyeg4) 28 79.06 97.05 13 46.43
10259. doraemon (reazulislam) 28 60.66 71.48 5 17.86
10260. SDF (rc12chy) 28 37.27 47.21 4 14.29
10261. Ravshan (ravshan) 28 54.45 66.09 3 10.71
10262. RashidTalib123 (rashid_tali... 28 89.49 105.99 13 46.43
10263. rain (qwimnetypes) 28 79.48 100.29 10 35.71
10264. moni (pzza404) 28 68.05 97.90 7 25.00
10265. JO (pinkvelociraptor) 28 58.89 72.90 9 32.14
10266. Mona (picolee) 28 49.59 62.35 6 21.43
10267. Alan (papizene) 28 71.45 85.65 5 17.86
10268. ﹤୨♡୧﹥ (pa1ntwater) 28 56.32 68.26 2 7.14
10269. orthohalmak (orthohalmak) 28 72.42 81.88 8 28.57
10270. nyoomian (nyoomian) 28 100.24 109.45 10 35.71
10271. Nitta (nitta814) 28 85.49 96.19 7 25.00
10272. nikki (nikki0420) 28 63.36 72.05 8 28.57
10273. Niceable (niceable) 28 89.33 108.69 9 32.14
10274. Dr. NedStark (nedstark2_0) 28 34.75 41.48 3 10.71
10275. The (navya2008) 28 44.23 62.77 6 21.43
10276. Nathan (nathanbotas) 28 121.77 155.23 15 53.57
10277. Nalchee (nalchee1) 28 111.41 131.99 7 25.00
10278. Prathamesh (mystic_1) 28 71.08 82.88 9 32.14
10279. Mister (mystery_qwerty) 28 80.99 91.56 12 42.86
10280. Michael (mrk0508) 28 88.58 98.49 9 32.14
10281. Cal (mrbegon) 28 69.14 81.09 6 21.43
10282. Martin (mpenkov) 28 74.06 97.89 3 10.71
10283. John (mernst) 28 77.80 89.80 5 17.86
10284. Mehrshad (mehr74) 28 80.37 117.25 4 14.29
10285. Meeb (meeb24) 28 103.20 134.60 12 42.86
10286. Mark (maverick2455) 28 61.85 71.67 3 10.71
10287. Matt (mattserblo) 28 82.59 99.42 15 53.57
10288. Mark (markgeorge) 28 64.59 73.57 4 14.29
10289. meemw (markenmaw) 28 72.46 87.37 5 17.86
10290. Adrian (mangojuice_) 28 82.93 95.93 9 32.14
10291. Malondee (malondee) 28 93.39 107.95 8 28.57
10292. Malchez Link (malchez) 28 62.96 77.95 5 17.86
10293. sunny (maff_) 28 95.82 111.26 16 57.14
10294. lpd11 (lpd11) 28 85.39 93.21 9 32.14
10295. Roy (lordkite) 28 92.27 117.65 12 42.86
10296. (loom981) 28 121.60 145.51 13 46.43
10297. ‹/hex› (linguistic) 28 106.64 123.08 14 50.00
10298. IONIS (liaro0903) 28 98.01 109.08 5 17.86
10299. Law (law_sm) 28 74.26 93.68 9 32.14
10300. i am the best (kzara6) 28 67.37 84.81 10 35.71
10301. David (klydden) 28 103.67 115.12 10 35.71
10302. B (kinfthaderp) 28 118.59 136.09 12 42.86
10303. Kimi (kimichanga) 28 50.52 59.86 6 21.43
10304. nick (kicknenton) 28 86.56 97.76 11 39.29
10305. Kheersagar (kheersagar) 28 36.92 44.69 4 14.29
10306. Kevin (kevinfjbecker) 28 41.11 48.17 4 14.29
10307. Kayyy (kayyy99) 28 38.30 49.42 0 0.00
10308. karsten (karstensen) 28 67.42 83.26 5 17.86
10309. sparda (kamoess0) 28 86.50 101.62 8 28.57
10310. kaede (kaede1) 28 75.62 94.24 3 10.71
10311. Mac (justmac) 28 72.79 87.18 1 3.57
10312. oli (johnvenz16) 28 89.91 101.87 12 42.86
10313. Josh (jnavin54) 28 52.55 63.45 3 10.71
10314. Jmam (jmam) 28 103.40 125.90 10 35.71
10315. A (jllkii123) 28 67.65 77.16 9 32.14
10316. James (jayuplink) 28 85.07 98.82 8 28.57
10317. Jem (jampr) 28 93.53 109.67 9 32.14
10318. jake (jakez) 28 53.20 64.79 6 21.43
10319. Jack (jack8888) 28 130.20 178.00 1 3.57
10320. Nuggs (itsmenuggetz) 28 72.68 94.97 10 35.71
10321. Itay (itay4430) 28 102.05 127.04 14 50.00
10322. isaiah (isaiahturnip) 28 109.15 135.05 14 50.00
10323. Peter (ironman2711) 28 55.60 74.55 6 21.43
10324. Impulsetyper (impulsetyper) 28 78.40 90.00 7 25.00
10325. EpikPanda (imanepikpanda) 28 57.26 67.36 7 25.00
10326. Sam (idcaboutnames) 28 77.36 88.55 10 35.71
10327. Ian (ian1806) 28 132.87 150.74 15 53.57
10328. Ethan Jeff (hypernacho) 28 89.01 115.96 9 32.14
10329. Rathalos (honored1234) 28 64.83 77.41 5 17.86
10330. Hoang (hoangama) 28 58.01 67.55 3 10.71
10331. Hmjo707 (hmjo) 28 92.59 122.09 13 46.43
10332. Aldar Kose (hkoldas) 28 67.48 80.81 10 35.71
10333. Sub to spenzalo (hi_shoemaker) 28 121.59 145.52 15 53.57
10334. Hideto (hikimarun) 28 73.67 90.96 8 28.57
10335. Andrew (happie) 28 72.99 87.96 3 10.71
10336. G (gtyper123) 28 47.56 60.45 5 17.86
10337. Vaibhav (genius6) 28 62.63 84.02 11 39.29
10338. Robert (furyon700) 28 74.75 98.64 5 17.86
10339. Nando (frozgamingz) 28 98.15 121.77 12 42.86
10340. Freowy (freowy) 28 89.25 106.94 6 21.43
10341. Francisco (francisc0) 28 56.08 74.36 2 7.14
10342. Fopuy (fopuy) 28 107.80 124.49 14 50.00
10343. v (fnut) 28 79.83 97.62 21 75.00
10344. John (flyingraven) 28 97.31 116.68 11 39.29
10345. flopvx (flopvx) 28 98.47 123.70 8 28.57
10346. firxe (firxe139) 28 85.84 100.80 8 28.57
10347. Fidelity (fidelityssj) 28 107.76 119.34 11 39.29
10348. Jacob (fastjacob) 28 114.36 133.91 15 53.57
10349. tommy (err0reverafter) 28 103.97 122.15 16 57.14
10350. meteora (erokopes) 28 128.36 144.59 16 57.14
10351. Eric (ericniyigaba) 28 56.98 73.22 3 10.71
10352. Emily (emstand) 28 95.61 105.47 12 42.86
10353. Eli (elikgeneral) 28 82.00 94.11 5 17.86
10354. Gawiweu (edugg98) 28 62.86 78.32 8 28.57
10355. David (dvdtan20) 28 78.47 89.37 3 10.71
10356. David (du6e) 28 51.41 62.73 1 3.57
10357. Drowg (drowg) 28 51.49 62.32 5 17.86
10358. Donovan (donnyredzone) 28 59.85 71.22 4 14.29
10359. Dioscene (dioscene) 28 115.59 135.34 15 53.57
10360. Delvin (delvinsabrin) 28 78.30 88.74 6 21.43
10361. Delve (delve17) 28 101.91 117.42 19 67.86
10362. Lennox (datshall) 28 81.59 99.21 3 10.71
10363. Martin (datlos) 28 48.22 58.75 0 0.00
10364. Luc (darth_luc) 28 45.16 60.29 2 7.14
10365. Darlena (darlena) 28 97.67 124.57 9 32.14
10366. Gustavo Fring (cxmpy) 28 101.01 119.25 11 39.29
10367. Jon (customabilities) 28 105.92 127.12 14 50.00
10368. . (crazyhow7) 28 52.57 69.43 1 3.57
10369. sowhoami (cptsprinklez) 28 79.79 95.31 12 42.86
10370. Courtney (clc0778clc) 28 101.63 126.57 11 39.29
10371. chuck1ehead (chuck1ehead) 28 55.27 73.89 4 14.29
10372. Chris (chrissquid) 28 83.66 104.28 9 32.14
10373. Walter (chimken1234) 28 84.45 106.70 10 35.71
10374. Kritik (chaoseyy) 28 63.77 78.56 5 17.86
10375. canadavid1 (canadavid1) 28 38.43 49.95 2 7.14
10376. vjalt (bullymaguire) 28 71.20 84.40 6 21.43
10377. Bala Klava (brullsker) 28 71.81 80.60 7 25.00
10378. Bitgalle (bitgalle) 28 85.67 95.41 11 39.29
10379. Antatia (bi0hazrd_522) 28 77.21 94.53 6 21.43
10380. Anjan (beaszt_nix) 28 93.84 111.28 9 32.14
10381. Vinícius (batovs) 28 57.11 71.95 6 21.43
10382. Basone01 (basone01) 28 74.68 89.74 11 39.29
10383. Muhammed (a_mhmmd) 28 74.62 86.10 7 25.00
10384. albatross (awehiuaf) 28 97.87 120.13 15 53.57
10385. Atsubyo (atsubyo) 28 79.91 104.59 4 14.29
10386. Kartik (artist007) 28 50.87 65.19 4 14.29
10387. arthur (arthurc999) 28 55.40 69.27 4 14.29
10388. ariel (arielsoko) 28 102.43 124.20 15 53.57
10389. Archery (archeryiskey) 28 107.58 124.80 9 32.14
10390. 🚀 (aqua_desu) 28 133.79 158.94 18 64.29
10391. Anton (antonchen) 28 123.04 151.91 27 96.43
10392. Andy (andy_andy) 28 57.94 67.91 4 14.29
10393. Anceint (anceint) 28 83.04 101.10 10 35.71
10394. Ali (alishyper12) 28 86.35 105.83 15 53.57
10395. Akshay (aksseet) 28 120.43 147.47 19 67.86
10396. Adam (adxam) 28 70.49 81.07 5 17.86
10397. adarsh_rzh (adarsh_rzh) 28 59.15 75.44 8 28.57
10398. Raz (adashi) 28 83.94 107.08 12 42.86
10399. Abhinav (abhinav42) 28 53.26 61.88 3 10.71
10400. Adrian (aadoy_) 28 51.28 67.82 2 7.14
10401. index finger spacebar user ... 28 118.89 138.17 10 35.71
10402. teeto (1005sv) 28 93.37 116.87 8 28.57
10403. T (0_________0) 28 67.56 79.57 6 21.43
10404. Logan (g0atb0lt) 28 74.53 107.50 8 28.57
10405. Pat2475 (pat2475) 28 44.13 60.70 3 10.71
10406. Quinn (wind_chaser) 28 36.28 45.06 3 10.71
10407. Hexa (hexaa) 28 69.26 83.99 4 14.29
10408. Quynh (spinelsun) 28 73.94 87.02 10 35.71
10409. Angelos (mangas) 28 68.91 81.44 6 21.43
10410. Ken (twofourty) 28 77.37 89.64 11 39.29
10411. sarat (saratrajput) 28 74.59 86.51 5 17.86
10412. darkDEMISE (dark_demise) 28 72.43 84.91 5 17.86
10413. Mae (mimstermae) 28 111.71 133.40 17 60.71
10414. Philip (bigasianmidget) 28 75.86 90.18 11 39.29
10415. Zander (aok9999) 28 54.65 70.71 4 14.29
10416. arham (arham_doshi) 27 51.86 59.27 2 7.41
10417. AranKz (arankz) 27 81.82 97.26 7 25.93
10418. d1ff1cult (apysch) 27 117.08 128.54 15 55.56
10419. Ahmad (apathicss) 27 74.55 90.43 17 62.96
10420. Tran Thai Anh (anh_tran123) 27 65.66 73.83 5 18.52
10421. ana (anachokheli) 27 46.19 57.77 1 3.70
10422. Aman (amansharma10) 27 62.45 74.86 5 18.52
10423. Kelven (agentbowtie) 27 60.76 73.89 7 25.93
10424. Aecor (aecor) 27 103.06 114.74 7 25.93
10425. Adam1t (adam1t) 27 60.93 77.96 5 18.52
10426. Abonkwe (abonkwe) 27 79.94 96.83 9 33.33
10427. tstats[abhishekyeskholiya] ... 27 79.30 95.45 8 29.63
10428. Marco (abababaaaa) 27 69.96 86.13 6 22.22
10429. pwned (16wpm) 27 84.91 95.55 4 14.81
10430. Sinuro (0sty) 27 76.13 102.22 13 48.15
10431. Hifjul (hifjul) 27 57.03 70.07 2 7.41
10432. James (adamorjames) 27 61.51 74.72 7 25.93
10433. Daniel (dxnielchoo) 27 64.69 88.80 10 37.04
10434. Brandan (brandanprice) 27 56.05 70.98 4 14.81
10435. matthew (hewasnumber1) 27 65.63 83.89 6 22.22
10436. Ognian (ogihaxer) 27 56.54 69.27 20 74.07
10437. Stalast (stalast) 27 89.46 111.87 1 3.70
10438. Ivan (potatokingdom) 27 85.78 101.01 6 22.22
10439. scoutie (scoutieee) 27 77.05 92.46 6 22.22
10440. Jon (rockitman) 27 102.66 141.32 12 44.44
10441. Kevin (iuhnivek) 27 82.90 95.84 4 14.81
10442. Samin (_nimas) 27 53.58 66.14 2 7.41
10443. harsha (master_ogasaku) 27 36.31 46.15 3 11.11
10444. Stephanie (zoomer1) 27 32.80 46.09 1 3.70
10445. Arshak (arshak00) 27 56.28 64.02 5 18.52
10446. Julia (malh) 27 34.34 41.61 2 7.41
10447. Bryan (lufrewaffle) 27 60.61 70.68 5 18.52
10448. Sauce (lolplox123) 27 107.22 148.79 9 33.33
10449. boo (lolitsme) 27 75.52 88.70 6 22.22
10450. Everest (likethemountain) 27 77.16 95.76 7 25.93
10451. David (leepictrollexd) 27 108.70 126.26 16 59.26
10452. Naresh (learnrapid) 27 47.38 57.06 5 18.52
10453. Laznia (lasthomeless) 27 56.06 65.26 1 3.70
10454. tak power (langsungg) 27 85.15 96.64 7 25.93
10455. Thpp (kulaspa) 27 97.62 114.51 13 48.15
10456. kuchukas (kuchukas) 27 51.25 62.64 2 7.41
10457. Kostia (kostia) 27 52.10 63.27 4 14.81
10458. Underscores4Fun (koskos) 27 79.88 96.72 6 22.22
10459. potato (kongkan_) 27 98.75 113.49 13 48.15
10460. Kyle (kle33) 27 67.16 78.30 8 29.63
10461. Alvin (kishoarima) 27 62.32 71.27 4 14.81
10462. Shahobiddin (khusniddinov_uz1) 27 55.07 65.38 6 22.22
10463. keytiX (keyti) 27 41.62 49.69 2 7.41
10464. Kenneth (kensan73) 27 103.48 118.68 18 66.67
10465. Membrane69 (keifermatthew) 27 89.05 109.14 9 33.33
10466. Kaeso (kaeso_krupp) 27 92.70 107.69 12 44.44
10467. kaare (kaare) 27 78.35 105.45 8 29.63
10468. k3n (k3nnn) 27 138.95 152.38 20 74.07
10469. Julian72696 (julian72696) 27 93.64 119.37 7 25.93
10470. John (john_sharks) 27 78.65 85.76 5 18.52
10471. John (jimminyyy) 27 81.73 108.41 9 33.33
10472. Jonathan (jimbothegreat) 27 76.80 99.57 10 37.04
10473. JesseCarl (jessecarl) 27 72.17 85.85 6 22.22
10474. Jaz (jazwolff) 27 61.25 73.60 3 11.11
10475. Jose Antonio (jarceantonio) 27 76.80 94.80 7 25.93
10476. Jake (jakexx) 27 86.12 113.90 9 33.33
10477. Vytenis (jackeddj) 27 69.90 86.67 8 29.63
10478. Jjajangmyeon (izzu) 27 72.90 88.04 7 25.93
10479. irving (irvingnivri) 27 78.68 91.03 5 18.52
10480. 찬우 (inphinity) 27 122.11 163.87 14 51.85
10481. Ben (hurstsys) 27 52.55 62.41 1 3.70
10482. Radu (horixyt21) 27 93.87 108.65 8 29.63
10483. Scott (holyomgida) 27 101.76 118.87 10 37.04
10484. Louis (hlouis) 27 111.34 131.18 16 59.26
10485. Rotem (hi_im_rotem_2006) 27 68.45 83.53 7 25.93
10486. mashed_potato (hello_world199) 27 67.43 80.09 7 25.93
10487. Lasse Hededal (hededal) 27 70.46 86.33 7 25.93
10488. Luke (harrislp1979) 27 59.64 73.20 8 29.63
10489. ﱞﱞﱞﱞﱞﱞﱞﱞﱞ... 27 84.43 98.55 14 51.85
10490. Gabe (gsoares026) 27 111.25 143.58 22 81.48
10491. sangvar (greeker) 27 71.64 87.19 13 48.15
10492. Ainsley (giannis199) 27 69.36 83.48 6 22.22
10493. Tan (ghtann) 27 78.30 90.45 5 18.52
10494. Adam (george_williams14798) 27 109.14 131.04 14 51.85
10495. M.Verstappen (gameroubas) 27 102.55 119.64 12 44.44
10496. Gabby (gabbychan) 27 66.85 83.75 8 29.63
10497. Mohamed (_mohammed_taha_) 27 64.18 72.47 2 7.41
10498. Zega (zegadb) 27 69.45 84.44 7 25.93
10499. zeeko (zeekomeeko) 27 61.27 71.82 8 29.63
10500. Zachry (zachwn) 27 81.79 98.67 6 22.22
10501. My (z0rtzp1zku) 27 74.94 87.09 9 33.33
10502. Lance Toby (ybot28) 27 67.35 83.38 9 33.33
10503. Jayden (y4nrui) 27 106.17 125.97 14 51.85
10504. wooson (wooson) 27 69.94 81.80 6 22.22
10505. gamem (wkdgurtna) 27 69.43 92.44 8 29.63
10506. Wesley (wesleymelon) 27 116.75 145.46 13 48.15
10507. Warren (war_30) 27 59.64 76.94 5 18.52
10508. Victor (vlnash2002) 27 93.58 108.41 12 44.44
10509. Viwarrior (viwarrior) 27 80.40 95.48 7 25.93
10510. Aleksandar (virage94) 27 55.61 67.37 4 14.81
10511. bruhmoment (victorio_) 27 102.73 129.15 7 25.93
10512. Vicodin (vicodin_freeman) 27 91.02 116.81 8 29.63
10513. Exsilia Vacuarum (vfctyrant) 27 139.91 159.73 24 88.89
10514. Vedanta Sharan (vedbro) 27 40.34 58.81 3 11.11
10515. Uwu (uwudesuka) 27 79.16 91.70 12 44.44
10516. Usmon (usmonjonh) 27 50.64 70.38 14 51.85
10517. Vincent (tyt14) 27 58.04 77.77 3 11.11
10518. Tyson (tysonking33) 27 46.20 59.86 0 0.00
10519. Mack (tron__) 27 99.20 111.48 10 37.04
10520. Felix (tresflex) 27 86.70 107.76 9 33.33
10521. Jonowo (trainerjono) 27 109.15 126.95 15 55.56
10522. Elton John (tonundrum) 27 56.74 72.00 7 25.93
10523. t (tomn114) 27 132.18 154.88 16 59.26
10524. ᕙ(˵ ಠ ਊ ಠ ˵)ᕗ (... 27 79.57 99.41 9 33.33
10525. kevin (titiloka) 27 40.80 47.19 2 7.41
10526. Timothy (timothy5597) 27 64.63 79.24 4 14.81
10527. Harsh (the_slow_one_123) 27 48.38 62.29 3 11.11
10528. Thelonious (thelonious) 27 76.72 93.34 7 25.93
10529. Alfie (theaqualord) 27 106.87 134.87 19 70.37
10530. Thane (thaynt) 27 94.51 114.31 12 44.44
10531. Teodor (teo_climber) 27 65.14 77.28 5 18.52
10532. Temu (temex) 27 85.63 92.55 12 44.44
10533. StellarDoc11 (tarth15) 27 80.50 96.70 17 62.96
10534. Sunyog (sunyog) 27 43.08 65.20 5 18.52
10535. Sunny (sunnylee0123) 27 123.07 146.10 20 74.07
10536. omar (streetfighterlan123) 27 149.16 192.98 15 55.56
10537. spycow27 (spycow27) 27 95.40 105.96 26 96.30
10538. Aurora (sparrowfan101) 27 96.84 114.22 9 33.33
10539. sevgik (soranges) 27 88.48 123.64 7 25.93
10540. Snowy (snowysauce) 27 109.57 130.15 12 44.44
10541. Todor (todoriko) 27 31.29 38.52 1 3.70
10542. Bobby (slowtyper557) 27 112.83 128.22 13 48.15
10543. skywalker123 (skywalker123) 27 80.26 99.38 2 7.41
10544. Nenad (sima_car) 27 60.05 73.97 3 11.11
10545. 6969 (silky_) 27 107.48 118.55 13 48.15
10546. Silent (silent_solous) 27 108.13 129.46 20 74.07
10547. barack (shming) 27 118.31 135.06 20 74.07
10548. shahrukh (shahrukh77) 27 61.74 74.00 8 29.63
10549. Duc (setokouse) 27 75.17 91.05 11 40.74
10550. Sanjay (sanjaysins) 27 58.17 71.85 5 18.52
10551. Saif (saif_kitaz) 27 57.10 64.80 4 14.81
10552. Dr. (saddathasan) 27 67.20 79.49 6 22.22
10553. Saber (saber2756) 27 98.74 128.74 12 44.44
10554. Soumyajeet (s0umyajeet) 27 82.55 89.03 13 48.15
10555. Violet (rxviolet) 27 81.98 100.89 8 29.63
10556. Ruben (rubsi) 27 79.07 96.43 11 40.74
10557. Roger (rogerboston) 27 59.43 77.53 4 14.81
10558. robot (robotbb) 27 49.76 64.32 4 14.81
10559. Rictor (rictormidgekin) 27 94.12 114.17 8 29.63
10560. Amit (red2black) 27 65.84 78.92 8 29.63
10561. Ben (realolympian) 27 64.10 78.05 6 22.22
10562. Alikhan (realikh) 27 84.49 97.77 9 33.33
10563. randomyr (randomyr) 27 93.81 107.09 11 40.74
10564. raeraven (raeraven) 27 39.02 47.24 4 14.81
10565. Caleb (qwerty345) 27 55.16 63.69 11 40.74
10566. A (qkrdnwls6) 27 76.74 96.10 26 96.30
10567. Psalmer (psalmer) 27 73.71 91.94 10 37.04
10568. prans (prans12) 27 60.26 75.26 3 11.11
10569. Adam (pop123gyg) 27 29.82 35.90 2 7.41
10570. Himanshu (pluto_ish) 27 72.89 93.45 20 74.07
10571. pz (pingzhi) 27 77.75 87.56 4 14.81
10572. George (piehead567) 27 96.26 109.78 14 51.85
10573. Phenos (phenos) 27 102.48 126.47 10 37.04
10574. Pena (pena_perse) 27 57.29 65.58 3 11.11
10575. Chanel (pandabean) 27 88.18 109.16 6 22.22
10576. paldoo (paldoo) 27 72.78 92.21 6 22.22
10577. Nizar (oxlord) 27 77.58 93.17 8 29.63
10578. Dale (owenone) 27 113.31 127.97 20 74.07
10579. Ali (oplo) 27 99.42 122.04 9 33.33
10580. ollybollydisco (ollybollydi... 27 70.11 95.54 5 18.52
10581. NuclearBacon (nuclearbaconyt) 27 61.11 88.84 7 25.93
10582. OysterRice (notterrancehuang) 27 119.71 137.82 16 59.26
10583. BeGood (notideal) 27 85.19 106.40 6 22.22
10584. N0VA (nooova) 27 65.52 81.62 7 25.93
10585. Noobiest (noobiestmaster) 27 71.14 93.38 7 25.93
10586. Nate (nhanzel) 27 86.47 105.54 7 25.93
10587. Muhammad (muhammad_pak) 27 86.96 106.06 9 33.33
10588. Mr (mrrius99) 27 66.26 76.42 12 44.44
10589. Emre (mr3mr3) 27 109.70 126.43 17 62.96
10590. Rylan (moonraker505) 27 87.24 110.10 17 62.96
10591. ng (minhtuhay123) 27 75.09 90.87 6 22.22
10592. milop (milop) 27 71.90 85.46 9 33.33
10593. Velocitys (mikesyeet) 27 83.01 102.79 8 29.63
10594. Mike (mikereze) 27 54.26 68.54 1 3.70
10595. Darren (meodaze) 27 106.07 122.82 16 59.26
10596. Michael Loh (mclec950125) 27 75.23 84.45 7 25.93
10597. MAYANK (mayank10) 27 46.87 54.25 2 7.41
10598. M (maxopie) 27 85.41 97.79 6 22.22
10599. Max (maxarfvidsson) 27 73.44 91.78 7 25.93
10600. Max (max2004awesome) 27 102.66 119.10 9 33.33
10601. Hugh (mathimati) 27 99.29 126.17 17 62.96
10602. Mary (marymyers) 27 94.97 113.28 12 44.44
10603. folgue02 (folgue) 27 84.17 99.42 9 33.33
10604. FireGumz (firegumz) 27 56.51 74.00 4 14.81
10605. fei (feiamor) 27 63.46 84.58 6 22.22
10606. Fave (fave_22) 27 52.81 59.18 2 7.41
10607. Henry (fastypr) 27 88.00 106.38 15 55.56
10608. distopia (far_sunflower) 27 53.15 64.05 1 3.70
10609. Fabricio (fabrox) 27 68.33 87.52 7 25.93
10610. Vincent (ezbread) 27 69.79 85.89 11 40.74
10611. Evan (estarr14) 27 52.35 63.45 2 7.41
10612. Ellen (eeecp) 27 76.18 88.15 6 22.22
10613. Edilbek (edok_mal4) 27 48.77 65.67 3 11.11
10614. bum_fluff (dritt) 27 124.47 137.60 18 66.67
10615. Dylan (drink_windex) 27 69.78 82.91 4 14.81
10616. Djaenk (djaenk) 27 107.27 147.99 16 59.26
10617. Vit (denysvit) 27 84.10 94.97 12 44.44
10618. Dennis (dendendenlee) 27 61.36 73.31 6 22.22
10619. Dein (deinfreund) 27 116.63 136.95 27 100.00
10620. wet nightmare (daviddloco) 27 92.74 105.41 13 48.15
10621. Dev (darkpi) 27 71.32 85.34 3 11.11
10622. Darin (darin_ss) 27 46.12 65.96 1 3.70
10623. Daedalus (daedalusmahda) 27 87.39 98.46 14 51.85
10624. æ (c_c_c) 27 91.10 126.62 10 37.04
10625. cung (cungdongma) 27 76.54 91.42 10 37.04
10626. Craig (craiggsell) 27 68.81 77.40 5 18.52
10627. Chirath (cp_guy) 27 64.17 78.68 6 22.22
10628. Casey (covertmidget) 27 66.90 81.79 15 55.56
10629. BUS (bus12) 27 94.09 108.94 8 29.63
10630. Sahabuddin (blitzbibi) 27 51.72 59.97 4 14.81
10631. Ben (blister99) 27 110.76 126.13 19 70.37
10632. Bionodroid (bionodroid) 27 69.21 82.00 3 11.11
10633. BigBreadBaker (bigbreadbaker) 27 130.01 158.06 19 70.37
10634. bianca (bi4nc4hannah) 27 53.08 64.87 10 37.04
10635. Ethan (bewilderex63) 27 107.72 136.22 12 44.44
10636. bayu (bayun2445) 27 45.38 55.99 2 7.41
10637. bacy (bacy) 27 54.05 66.97 2 7.41
10638. Ahmed (a_h5s_h) 27 52.62 63.78 0 0.00
10639. arman (arman_types) 27 112.81 145.96 13 48.15
10640. FisH...MaN (fish_man) 26 81.69 101.21 26 100.00
10641. Fernando Morato (fernandomo... 26 72.34 86.29 4 15.38
10642. Fandom (fandom_girl) 26 58.09 72.28 7 26.92
10643. Ian (e__n) 26 102.73 120.81 8 30.77
10644. Ivan (evanmico) 26 87.46 96.71 19 73.08
10645. Andrew (entranco) 26 90.97 108.58 9 34.62
10646. emczuk (emczuk) 26 115.87 130.68 8 30.77
10647. Earth (earth_chan) 26 94.29 112.62 15 57.69
10648. Dana (dwhite84) 26 71.54 98.14 10 38.46
10649. Darren (dtwcdarren) 26 76.79 98.14 4 15.38
10650. droLnomeD (drolnomed) 26 77.98 97.47 5 19.23
10651. Jake (drjakeman) 26 118.24 133.71 21 80.77
10652. Denis Çerri (deniscerri) 26 90.62 109.04 10 38.46
10653. DD (ddcute) 26 60.98 70.77 9 34.62
10654. Dave (davidkim123) 26 106.72 123.96 14 53.85
10655. bailey (darkness04) 26 59.00 98.72 11 42.31
10656. Dan (danmarculet) 26 106.71 115.70 14 53.85
10657. Davvy (daavvyy) 26 92.87 122.59 11 42.31
10658. H (curlwurl) 26 89.97 105.32 6 23.08
10659. abhay (cs_abhay) 26 77.46 93.86 6 23.08
10660. Asrar (cruzen) 26 62.56 73.47 3 11.54
10661. Jason (cowlodger123) 26 93.18 127.93 18 69.23
10662. stranger (courage_iberg) 26 50.18 65.73 4 15.38
10663. cooper (cooperwoop) 26 73.92 95.55 10 38.46
10664. Max (convie) 26 98.11 119.20 8 30.77
10665. Cristian (cmatiasc) 26 97.16 112.43 13 50.00
10666. Ozan (clutchupmate) 26 104.55 130.95 11 42.31
10667. Sebastian (cloutimus) 26 88.66 104.95 12 46.15
10668. Sebastian (clicthekeys) 26 45.95 75.91 0 0.00
10669. Charles (chuckly) 26 81.02 95.26 5 19.23
10670. Lim (chiyennn) 26 67.07 75.89 7 26.92
10671. alex (chinese69) 26 108.75 127.44 14 53.85
10672. CelestialAmber (celestialam... 26 86.88 101.97 10 38.46
10673. mo (ceiba) 26 81.38 95.98 5 19.23
10674. Cecil (cecil_behar64) 26 89.33 96.98 5 19.23
10675. Carter (cartersaechoa92) 26 89.53 104.10 6 23.08
10676. tw0f1v3w0n (capricitor) 26 103.78 124.44 14 53.85
10677. Justin (bothon21) 26 100.93 122.88 12 46.15
10678. Blaize (bomoko) 26 73.82 85.93 8 30.77
10679. Dakota (boda69) 26 50.03 58.64 3 11.54
10680. William (bnuldun) 26 92.42 114.05 9 34.62
10681. KMMOPJ1 (blueflammednezha) 26 64.00 78.53 7 26.92
10682. Blitzgate (blitzgate) 26 77.79 92.30 6 23.08
10683. Aaron (bigfategg) 26 77.89 91.84 7 26.92
10684. Darren (baochun2) 26 94.81 115.47 11 42.31
10685. ballz (ballzbazz) 26 71.36 78.39 6 23.08
10686. Daddy (badassabd) 26 47.42 64.22 4 15.38
10687. qwe (azeem838) 26 37.03 45.04 3 11.54
10688. AxelDT (axman292) 26 81.63 93.97 6 23.08
10689. Thomas (ashryx) 26 92.19 109.96 9 34.62
10690. Arunkumar (arunkumar49) 26 72.15 87.49 12 46.15
10691. APS (arsh_aps) 26 68.65 83.22 7 26.92
10692. Greatest (_greatestever_) 26 66.41 79.48 9 34.62
10693. Emrys (zyronwhite123) 26 51.57 63.23 0 0.00
10694. will (zootzootie) 26 84.98 103.06 8 30.77
10695. Peter (zoodoo) 26 97.70 119.13 12 46.15
10696. Fyfe (zitwitcool) 26 46.88 57.80 4 15.38
10697. DY (yuyue1) 26 99.80 120.07 13 50.00
10698. Charlie (xharlie) 26 83.12 101.41 5 19.23
10699. wood warrior (wood_warrior) 26 62.95 73.98 5 19.23
10700. Seth (wongaa) 26 74.35 94.23 9 34.62
10701. Trying (whatisyourtalent) 26 55.09 72.75 5 19.23
10702. wgreenihrcorp2 (wgreenihrco... 26 52.54 64.24 8 30.77
10703. Jacob (werjac) 26 72.70 90.04 5 19.23
10704. Winson (weezy_winson) 26 81.59 120.74 11 42.31
10705. Wakil (wakil7) 26 54.77 66.89 6 23.08
10706. Vishnu Chauhan (vishnuchauhan) 26 74.18 83.78 9 34.62
10707. vicky (vickysiva007) 26 53.30 61.37 5 19.23
10708. Victoria (vicksun) 26 59.47 67.92 2 7.69
10709. Vivi (veevaa) 26 75.77 88.21 8 30.77
10710. Ved (ved_) 26 32.31 44.43 1 3.85
10711. Unai (unaiberis) 26 81.51 92.29 12 46.15
10712. Patrick (ugonnaeatthatcrois... 26 67.33 80.51 6 23.08
10713. krunal (triplekbro) 26 66.36 84.00 14 53.85
10714. LM (trashtocash) 26 63.49 76.56 3 11.54
10715. Mitch (toddlerdust) 26 134.49 149.07 0 0.00
10716. tinkureddy (tinkureddy) 26 86.13 104.35 13 50.00
10717. Timothy (timothy273) 26 63.49 75.00 7 26.92
10718. Heather (tilly_day) 26 57.00 64.98 7 26.92
10719. Christian (thermikk) 26 87.16 113.86 7 26.92
10720. (thereayou) 26 84.06 99.22 8 30.77
10721. Theo (theogv) 26 97.41 116.39 13 50.00
10722. thavin (thavinxz) 26 73.98 88.35 8 30.77
10723. Johnny (thatbigboy) 26 113.97 129.71 13 50.00
10724. Itachi (thanos_18) 26 39.95 53.90 4 15.38
10725. Terairk (terairk) 26 106.12 121.79 2 7.69
10726. Teddie (teddie37) 26 65.07 76.47 7 26.92
10727. tia (teayah) 26 58.89 71.81 9 34.62
10728. taseh (taseh) 26 117.27 129.91 14 53.85
10729. Leia (s_leia) 26 127.32 167.05 17 65.38
10730. Dragon (susuthichansushi) 26 82.74 98.26 6 23.08
10731. Linus (starhiro654) 26 92.41 115.72 9 34.62
10732. s (sqood) 26 69.34 83.12 6 23.08
10733. Speedswiper (speedswiper) 26 111.08 128.03 12 46.15
10734. SPEED (speedbear) 26 109.86 128.32 11 42.31
10735. War (sorted99) 26 54.99 64.29 3 11.54
10736. SJ (sonialj) 26 53.05 62.78 4 15.38
10737. A.A.Fouad (snkpl) 26 69.35 81.74 5 19.23
10738. Aleksei (snejink) 26 38.23 48.56 0 0.00
10739. Jeremy (slorsx89) 26 72.53 86.15 6 23.08
10740. Kendall (skeletonsinc) 26 105.14 123.79 13 50.00
10741. John (sirfightsalot) 26 77.81 92.38 7 26.92
10742. Dev (sident) 26 99.68 118.14 14 53.85
10743. Siberius (siberiusalpha) 26 63.40 76.80 7 26.92
10744. Shreyash (shreyash_he) 26 32.28 37.26 7 26.92
10745. Joe (shmooo) 26 113.22 131.36 13 50.00
10746. Alex (aralizer) 26 50.35 58.37 2 7.69
10747. applecards (applecards) 26 60.47 75.67 5 19.23
10748. Anurag (anuragbhatt) 26 69.05 87.58 1 3.85
10749. Mike (anaperius) 26 48.30 59.36 13 50.00
10750. Anas (ananzeh) 26 67.58 77.81 5 19.23
10751. Anthony (an1hony) 26 97.84 116.86 6 23.08
10752. A (amartindale) 26 43.26 54.67 2 7.69
10753. Nissan GT-R (amalyano) 26 72.27 82.02 6 23.08
10754. Jasper (ajaystr) 26 56.09 65.46 4 15.38
10755. Advik (advik123) 26 59.07 66.98 7 26.92
10756. Achuyat (achuyat) 26 38.17 48.86 2 7.69
10757. Abhirup Das (abhirupdas200) 26 72.07 99.17 8 30.77
10758. Abas (abasf14687) 26 62.20 80.39 9 34.62
10759. Ayoub (4youb) 26 36.49 44.65 10 38.46
10760. Jeff (3deer6) 26 59.55 75.12 4 15.38
10761. Wzq (3125114) 26 88.32 100.52 6 23.08
10762. Blake (25kangboyang) 26 94.73 116.77 9 34.62
10763. Ahmed Husayn (pr1vate) 26 44.90 53.92 4 15.38
10764. KURM (kurm) 26 47.03 58.64 2 7.69
10765. kyvu (kyvu) 26 89.20 113.63 5 19.23
10766. VerTue (xmarc) 26 67.33 83.37 9 34.62
10767. J (jus_t) 26 55.50 67.70 4 15.38
10768. Voldemar (voldemortenz) 26 39.97 50.32 1 3.85
10769. Dark (raynous) 26 57.32 66.60 4 15.38
10770. del (yggdrasilll) 26 78.12 89.85 7 26.92
10771. Swice (swice) 26 57.44 71.69 5 19.23
10772. Turd (turd_nugget1337) 26 50.80 63.98 2 7.69
10773. M1 (m1_englondon) 26 62.65 73.09 3 11.54
10774. Xavier (xavierboutot) 26 71.46 84.97 7 26.92
10775. Segale (barbara01) 26 86.61 102.15 8 30.77
10776. Eddie (e2damilla) 26 66.99 81.72 10 38.46
10777. Chee (pigupenguin) 26 81.31 97.66 15 57.69
10778. Nard (hackerskeyboard) 26 89.54 100.17 7 26.92
10779. Hisham (kaalan007) 26 52.55 61.03 3 11.54
10780. Stefano (stefano98) 26 33.21 44.67 1 3.85
10781. Mackyy. (mackipecko) 26 122.99 138.37 23 88.46
10782. Daan (macdann6) 26 82.77 97.00 7 26.92
10783. i am (lynx_noob) 26 32.62 40.50 5 19.23
10784. Jamliv (lvpec) 26 66.83 82.05 5 19.23
10785. Lubo (lubokkanev) 26 101.44 117.88 10 38.46
10786. zhiyu (losterzu) 26 77.91 96.71 10 38.46
10787. Tao (litao91) 26 89.51 106.59 8 30.77
10788. liperdi (liperdi) 26 53.55 59.36 2 7.69
10789. IChun (lighttodie) 26 88.89 104.44 8 30.77
10790. Lee Bing Bong (lee_bing_bong) 26 95.79 117.54 13 50.00
10791. kwonman99 (kwonman99) 26 91.15 112.54 8 30.77
10792. Kuma (kumatero1) 26 62.31 75.93 5 19.23
10793. Brandon (kosaido) 26 76.58 88.82 11 42.31
10794. kopok (kopokopok) 26 66.62 82.88 4 15.38
10795. Seth (kliney4) 26 74.38 85.33 7 26.92
10796. Khaled (khaled2252) 26 97.95 117.38 11 42.31
10797. Vince (kerokeroro) 26 68.82 82.14 4 15.38
10798. Lucia (kenyousmile) 26 57.86 69.03 2 7.69
10799. Kek_LordDvorak (kek_lorddvo... 26 80.72 101.06 6 23.08
10800. Kay (kaylakhots) 26 79.48 95.62 17 65.38
10801. Kasey (kaseshib) 26 85.13 105.36 6 23.08
10802. KirinChibi (k4nna) 26 119.76 139.44 21 80.77
10803. Jumpye (jumpye) 26 134.62 157.71 18 69.23
10804. JVY (julvi) 26 68.71 86.06 9 34.62
10805. Juggle (juggle6) 26 115.56 133.86 16 61.54
10806. Josh (jtaube) 26 84.75 97.01 7 26.92
10807. jesse (jessef_9000) 26 76.06 96.94 10 38.46
10808. JEREYO05 (jereyo05) 26 44.37 54.27 3 11.54
10809. Jay (jay_cubed22) 26 97.92 111.99 9 34.62
10810. Suh dude (jaykwon) 26 85.88 106.84 6 23.08
10811. j (jas1yne) 26 101.29 114.99 9 34.62
10812. deez (ishkena) 26 88.38 112.01 22 84.62
10813. imslowaf (imslowafuwu) 26 75.64 89.54 8 30.77
10814. Ed (illuxionist) 26 94.99 113.70 16 61.54
10815. Ian Jerome (ianjerome) 26 54.20 62.58 7 26.92
10816. Lucas (huy1804) 26 69.28 88.49 7 26.92
10817. HunTer (hunter420) 26 43.96 50.06 3 11.54
10818. arif (hmmmnotokay) 26 73.50 93.97 7 26.92
10819. hunt (hmich) 26 91.37 105.25 15 57.69
10820. Cody (hippolytus) 26 93.19 124.79 9 34.62
10821. Hien (hien1201) 26 76.25 83.82 5 19.23
10822. lane (hiddenplays) 26 29.22 34.88 0 0.00
10823. Adithiya (havlen1) 26 53.96 63.02 2 7.69
10824. ... (h01001010) 26 89.58 108.86 6 23.08
10825. Varun Goyal (govarun) 26 63.05 73.07 5 19.23
10826. Gnanendar (gnanickky) 26 57.64 64.69 3 11.54
10827. Gintoki (ginnoji) 26 67.93 84.94 6 23.08
10828. Ghislaine (ghislanemaxwell) 26 89.08 110.26 12 46.15
10829. Abdur (genway_dev) 26 37.99 52.23 4 15.38
10830. Garvežiukas (garvezinis) 26 70.04 98.75 8 30.77
10831. Gabe (gabuthebabu) 26 95.82 112.08 13 50.00
10832. scampe (scampe) 26 104.59 119.87 16 61.54
10833. asdf (rushlync) 26 79.75 92.70 6 23.08
10834. Colemak (road2work100) 26 83.15 98.16 7 26.92
10835. Zoe (riverz) 26 86.64 105.31 7 26.92
10836. Kuzma (rikoj02) 26 93.01 115.42 9 34.62
10837. R1 (richthe1kid) 26 94.33 117.46 9 34.62
10838. Ricardo (ricardo1610) 26 66.92 78.50 5 19.23
10839. repeatt (repeatt) 26 81.96 101.96 7 26.92
10840. Sir RB (rblogan3) 26 59.83 70.13 5 19.23
10841. Rajiv (rajiv_431) 26 41.26 51.78 3 11.54
10842. Raivo (raivopleika) 26 32.16 43.30 2 7.69
10843. vijay (pykethtitan) 26 91.74 111.58 10 38.46
10844. Pro (pro_talon) 26 35.02 41.13 0 0.00
10845. Preaben (preabae) 26 81.31 100.77 6 23.08
10846. Omar (postmodernpostman) 26 110.35 134.30 14 53.85
10847. Porkyy (porkyp10) 26 103.15 129.61 14 53.85
10848. Rahul (pirate_racer) 26 49.98 58.33 0 0.00
10849. Phire (phire_xic) 26 67.42 92.24 7 26.92
10850. Peppito (peppito) 26 118.34 147.12 18 69.23
10851. palisfpauul (palisfpauul) 26 96.34 107.97 11 42.31
10852. ozzyy (ozzyy_163) 26 63.75 77.18 10 38.46
10853. zero (ozero) 26 100.68 117.30 11 42.31
10854. Just (ottovon) 26 65.47 85.37 4 15.38
10855. Oscar (oscrrrrrrr) 26 61.37 84.67 9 34.62
10856. Osaji (osaji) 26 80.48 93.53 7 26.92
10857. Stuart (orihsenak) 26 70.05 83.71 8 30.77
10858. Thomas (onlyphams) 26 85.02 112.28 7 26.92
10859. Marco (oblq) 26 77.65 92.52 6 23.08
10860. hard to type (obahi) 26 36.38 42.02 2 7.69
10861. Nathan (n_tber) 26 30.53 43.81 5 19.23
10862. noahrwilly (noahrwilly) 26 87.52 99.28 9 34.62
10863. Nino (ninodoko) 26 121.66 137.50 14 53.85
10864. Niklas (niklash) 26 89.40 109.37 9 34.62
10865. Nikee (nikee25) 26 83.96 97.95 11 42.31
10866. Benji (nepzy) 26 82.51 98.96 13 50.00
10867. Niko Zhang (neko23) 26 81.53 98.14 7 26.92
10868. Daniel (nedgcb) 26 88.75 110.05 7 26.92
10869. c (nb888) 26 109.49 125.02 11 42.31
10870. Nasar (nasarlagenda) 26 60.57 75.75 6 23.08
10871. Nanashi (nanasheen) 26 98.95 128.05 9 34.62
10872. naileuX (naileux) 26 85.47 110.45 10 38.46
10873. MyBihLuhDoCocaine (mybiluhd... 26 97.65 124.05 11 42.31
10874. workmanLayout (mustelad) 26 81.64 95.42 8 30.77
10875. Mustafa (mustafaalyagoub) 26 88.16 101.69 5 19.23
10876. Fluffy (musketeer) 26 52.41 67.78 6 23.08
10877. mursh (mursh) 26 64.41 88.03 8 30.77
10878. Eicy (moreseicy) 26 77.49 87.64 7 26.92
10879. Mojo (mojo1289) 26 81.26 100.11 12 46.15
10880. Julise (mintytea) 26 42.58 54.26 4 15.38
10881. mike (mike4madness) 26 68.20 76.06 6 23.08
10882. saba (midvert) 26 71.18 83.67 14 53.85
10883. methodiical (methodiical) 26 82.44 104.61 3 11.54
10884. Matthijs (matthijsb) 26 65.73 80.99 5 19.23
10885. mart9n (mart9n) 26 108.46 120.89 17 65.38
10886. Marcus (marcustham) 26 59.44 69.46 5 19.23
10887. Darrick (mapleroasted) 26 84.40 108.73 10 38.46
10888. Saumya (saumya69) 25 66.91 75.92 6 24.00
10889. sasuke (sasukee) 25 51.40 64.01 1 4.00
10890. Sarah Bisher (sarahbisher) 25 102.55 111.72 12 48.00
10891. ara ara (sage_of_six_trees) 25 66.65 78.06 8 32.00
10892. sabian (sabiansaige) 25 59.41 75.28 4 16.00
10893. Rayleigh (r_chin) 25 93.42 115.14 8 32.00
10894. James (ryyuu) 25 99.63 120.99 13 52.00
10895. dark (rycae) 25 71.49 82.90 9 36.00
10896. Saurabh (rustie_123) 25 67.77 76.88 5 20.00
10897. I can't type!!! (roychan1) 25 100.59 129.92 12 48.00
10898. Vignesh (rosvicky) 25 54.69 65.25 5 20.00
10899. Ron (ronlaniado) 25 92.85 107.66 8 32.00
10900. Brigid (riniti) 25 102.85 115.10 15 60.00
10901. Bryce (ribit500) 25 52.83 65.53 2 8.00
10902. Sébastien (reganisgod) 25 93.49 105.50 8 32.00
10903. Gamer (reallyrandomname) 25 137.14 168.63 21 84.00
10904. Radu (rdrnd) 25 61.68 71.44 7 28.00
10905. Raiym (rayimbek) 25 74.23 89.30 7 28.00
10906. Jebaited (raizzel) 25 81.70 94.99 8 32.00
10907. sabir (rabugi) 25 25.10 34.92 4 16.00
10908. Tran (qsang) 25 62.03 78.26 6 24.00
10909. Kuaz (qaz855175b) 25 65.96 78.22 6 24.00
10910. Helmut (psyonara_dvorak) 25 50.89 61.43 3 12.00
10911. Priyanshu (psxuchiha) 25 59.44 72.99 1 4.00
10912. Suven (psuv) 25 58.48 65.17 0 0.00
10913. efthymios (poios_malphite) 25 66.34 77.36 5 20.00
10914. Shivashis (plant99) 25 94.67 111.69 5 20.00
10915. pastamath (pastalavista) 25 56.73 70.46 8 32.00
10916. password (passworder) 25 66.56 73.09 4 16.00
10917. Bella (papidiabolus) 25 60.79 74.82 3 12.00
10918. PandoraOG (pandoraog) 25 56.30 62.92 2 8.00
10919. Onionkreb (onionkreb) 25 116.04 130.43 15 60.00
10920. zr (oilyfishball123) 25 73.68 81.96 7 28.00
10921. Iwan (ocalukivan) 25 18.08 42.90 4 16.00
10922. Say My Name (notreallyasteve) 25 104.38 138.14 10 40.00
10923. Jason (nooneuknow) 25 75.22 85.66 5 20.00
10924. nolan (nolwoods) 25 52.76 60.10 2 8.00
10925. nlthebiebs (nlfthebiebs) 25 60.49 70.42 3 12.00
10926. Faizaan (nitroblast) 25 89.17 133.07 15 60.00
10927. nitrox (nitr0x) 25 99.06 117.44 14 56.00
10928. Nishant (nishantdesai1306) 25 73.42 89.86 5 20.00
10929. NHK (nhk451f) 25 61.34 74.11 8 32.00
10930. Jan (natrix_) 25 49.58 61.04 12 48.00
10931. bode (mywaifubestwaifu) 25 64.96 101.73 5 20.00
10932. Jack Pascoe (mrprotyperman69) 25 71.09 90.59 18 72.00
10933. Pickle (mrpicklebody) 25 56.86 68.81 2 8.00
10934. Secret Animals December 15 ... 25 139.76 164.00 17 68.00
10935. bryan (morenomust) 25 70.28 101.44 8 32.00
10936. Kiyo (misterkiyo) 25 84.28 100.88 5 20.00
10937. Edward (mistaek) 25 97.87 119.58 13 52.00
10938. Michelle (minspire) 25 98.42 115.84 12 48.00
10939. Michael Rostom (michaelrous... 25 58.80 65.85 3 12.00
10940. tstats[meratanak] (meratanak) 25 59.81 74.00 8 32.00
10941. Meditate (meditate) 25 94.75 113.63 6 24.00
10942. Yassin (meddyassin) 25 62.70 77.10 7 28.00
10943. ratbastard (mattbierwirth) 25 115.02 136.19 16 64.00
10944. Jeevun (masterjeev) 25 55.88 71.86 5 20.00
10945. mangya (mangya) 25 49.69 61.35 4 16.00
10946. Arjun (arjun_0004) 25 104.28 116.76 11 44.00
10947. Austin (apollo2020) 25 60.14 69.22 4 16.00
10948. Satis (angpogikotalaga123) 25 138.05 156.29 15 60.00
10949. Albert (aneuck) 25 84.75 110.62 11 44.00
10950. Andrei (andreibanc) 25 80.59 96.47 5 20.00
10951. Amin (amin_eatemad) 25 74.12 87.59 4 16.00
10952. Amelia (amelia03) 25 89.41 109.75 10 40.00
10953. Alfred (alfredsando) 25 88.44 103.26 9 36.00
10954. Alex (alex_ryan) 25 67.31 88.67 2 8.00
10955. alexjr977 (alexjr977) 25 51.37 64.88 1 4.00
10956. Akshat (akshatsingh1_) 25 76.95 99.84 6 24.00
10957. A Owadud (akash655) 25 56.93 69.73 1 4.00
10958. Aaron (ajmoore0351) 25 65.43 79.31 5 20.00
10959. Augusto (ahidalgob) 25 81.34 91.01 15 60.00
10960. André (agdf) 25 70.93 78.58 6 24.00
10961. Adrian (adrianmonaghan) 25 90.21 110.85 6 24.00
10962. Adam (adamcoch) 25 84.99 95.52 7 28.00
10963. Dvorak Klaas (acheron) 25 69.85 83.20 5 20.00
10964. ableable (ableford) 25 96.05 109.43 14 56.00
10965. Adarsh (aadi_2301) 25 38.40 48.22 0 0.00
10966. Temuun (moon50) 25 64.95 81.59 3 12.00
10967. Brendan (brendanr) 25 75.24 85.28 4 16.00
10968. Max (jhared06) 25 63.84 74.12 12 48.00
10969. mowglie (mowgliegaming) 25 67.79 79.36 8 32.00
10970. Luke (lukecooper) 25 87.38 102.40 9 36.00
10971. gregge (gregge_v2) 25 42.14 52.87 1 4.00
10972. Lane (lane2295) 25 83.52 103.31 7 28.00
10973. cameron (souregs) 25 57.07 67.18 3 12.00
10974. DonFinn (fegermitn) 25 65.19 81.12 3 12.00
10975. tteessssaa (tteessssaa) 25 62.16 78.64 8 32.00
10976. Angel (aggel333) 25 87.88 103.73 12 48.00
10977. Link (drainn) 25 60.64 75.79 7 28.00
10978. Jooshua (me_no_good_at_typing) 25 75.94 89.06 3 12.00
10979. AllCrumpledUp (stableigloo) 25 107.53 117.58 9 36.00
10980. Herrah (neiljmth) 25 100.27 117.54 11 44.00
10981. Cobi (cobidortch) 25 82.34 98.09 9 36.00
10982. Fang (fangphire) 25 59.11 67.86 4 16.00
10983. ItsAleq (itsaleq) 25 47.21 62.04 3 12.00
10984. J (nordar) 25 60.99 68.09 4 16.00
10985. Mayowa (paitin) 25 82.62 89.72 3 12.00
10986. Alex (fluffehpander) 25 98.64 111.18 14 56.00
10987. Jay (finikin) 25 86.19 99.98 6 24.00
10988. Abtin (fada1) 25 98.99 116.54 13 52.00
10989. Ezio (ezio129) 25 59.31 71.68 4 16.00
10990. Eskah (eskah) 25 74.64 91.62 5 20.00
10991. eril (eril) 25 108.69 119.51 11 44.00
10992. Srinidhi (eren_eager) 25 54.48 66.73 3 12.00
10993. Yaroslav (eloren) 25 70.91 90.81 3 12.00
10994. Elliot (elliot_cooper) 25 58.17 72.73 5 20.00
10995. Elahe (elldora) 25 44.24 58.61 1 4.00
10996. Elias (eliasy7) 25 97.90 125.05 23 92.00
10997. Edwin Salinas (edos4) 25 65.35 80.33 0 0.00
10998. edna (ednanaanaa) 25 58.61 71.78 5 20.00
10999. et (edcolemak) 25 115.35 130.77 12 48.00
11000. Dat (dvorakprodigy) 25 120.86 137.28 12 48.00
11001. Zed_Query_Base (duyanh3897) 25 51.52 78.80 0 0.00
11002. Jess (dragonfire24) 25 82.42 103.42 12 48.00
11003. Dominic (dominic2382) 25 53.00 64.69 5 20.00
11004. DogHole (doghole) 25 132.23 176.60 14 56.00
11005. Dillruba (dishadipa223) 25 37.03 48.39 7 28.00
11006. Dan (diamond98) 25 49.10 56.25 2 8.00
11007. Theo (dhm_learner) 25 21.33 36.47 3 12.00
11008. Rob (destructo91) 25 97.81 115.21 7 28.00
11009. Jay (destroyer1101) 25 60.86 73.96 6 24.00
11010. David (davidjnovak) 25 81.34 102.99 5 20.00
11011. dantheman27 (dantheman8529) 25 66.45 82.17 7 28.00
11012. Daniel (dannybot) 25 78.42 89.23 6 24.00
11013. damafps (damafps) 25 71.82 84.57 5 20.00
11014. maap_yach (crstlgo09) 25 80.25 102.51 7 28.00
11015. Crricket (crricket) 25 76.48 96.17 8 32.00
11016. crocotyper (crocotyper) 25 130.29 154.74 17 68.00
11017. ToTo (complexion) 25 87.61 106.21 9 36.00
11018. Chris (chrischu) 25 61.28 76.66 5 20.00
11019. Chris (chris979) 25 83.76 105.04 5 20.00
11020. Christoffer (chrippa01) 25 71.44 81.61 3 12.00
11021. Lucas (ceebzz) 25 107.69 118.37 10 40.00
11022. Brian (brianyosua) 25 101.71 120.60 11 44.00
11023. Brendon (brenster) 25 45.85 63.78 1 4.00
11024. Bread (breadmonkey) 25 96.98 114.94 9 36.00
11025. blob_mister (blob_mister) 25 105.08 122.74 9 36.00
11026. Cloud (blackcloud010) 25 112.26 127.79 15 60.00
11027. bino_ (bino_) 25 78.23 88.15 6 24.00
11028. B (benfield) 25 59.79 70.46 1 4.00
11029. Joshua (beastjg) 25 89.23 109.77 11 44.00
11030. earlprotyper (beamerboyy) 25 112.58 127.01 13 52.00
11031. Bala (balaboi) 25 69.10 79.88 8 32.00
11032. Joseph (baggs33) 25 102.56 125.20 10 40.00
11033. aerooo (babatunde_olatunji) 25 61.05 82.57 9 36.00
11034. Avaxar (avaxar) 25 74.66 95.61 13 52.00
11035. typing.bro26 (ashokkaji) 25 39.72 52.32 4 16.00
11036. Artorias (artorias_) 25 84.85 101.15 0 0.00
11037. N0rmL (_mee_) 25 92.91 104.64 10 40.00
11038. old layout (_darya_) 25 86.47 105.95 6 24.00
11039. allison (_allisonsun) 25 62.98 73.15 5 20.00
11040. Zonic (zonic77) 25 94.43 105.51 14 56.00
11041. zalpro (zalpro) 25 62.98 77.19 4 16.00
11042. Yaas (yaas63) 25 58.52 69.76 3 12.00
11043. Katie (xkaytea) 25 81.07 97.91 7 28.00
11044. Wynton (wyntonrude17) 25 77.29 100.57 6 24.00
11045. Saksham (wrath101) 25 78.82 98.38 6 24.00
11046. Max (winstonlisa) 25 110.94 130.31 12 48.00
11047. Will (willbo2006) 25 60.82 78.54 4 16.00
11048. Wawa (wawasc) 25 74.33 92.01 2 8.00
11049. opperhoofd (wart) 25 62.69 72.89 5 20.00
11050. BrammetjeBaas (vyx_spaghettt) 25 55.64 61.76 1 4.00
11051. Phillip (vuzula) 25 36.04 47.54 3 12.00
11052. volt (voltb) 25 72.64 90.28 5 20.00
11053. tstats[vishalvoid] (vishalv... 25 38.62 45.92 2 8.00
11054. Veedek (veedek) 25 87.91 111.31 8 32.00
11055. UzanR (uzanr) 25 55.63 64.73 2 8.00
11056. MK (uosom) 25 77.12 98.12 7 28.00
11057. VNLEASHED (unlevshed) 25 71.35 89.14 9 36.00
11058. Timo (ubulin) 25 94.24 111.36 10 40.00
11059. Txeru (txeru) 25 71.58 79.32 25 100.00
11060. Quyen (tsaiduk) 25 82.96 102.11 8 32.00
11061. Erik (trixx7) 25 74.18 91.72 7 28.00
11062. anon (triphosphate) 25 89.50 106.49 10 40.00
11063. TotalledZebra (totalledzebra) 25 109.22 129.34 17 68.00
11064. Tim (timoteo_lol) 25 93.15 109.98 9 36.00
11065. Thunderz (thunderz2016) 25 101.78 118.21 12 48.00
11066. The_rock (the_rock97) 25 47.25 61.99 2 8.00
11067. Ternimus (ternimus) 25 74.91 83.79 10 40.00
11068. TANEdos (tanedos) 25 90.93 107.96 7 28.00
11069. Syed (syedmadad) 25 58.85 77.71 2 8.00
11070. Sweater (swtr) 25 77.49 98.12 7 28.00
11071. Ethan (sweethan) 25 97.38 113.11 4 16.00
11072. Aviel (suxhe) 25 94.81 117.81 6 24.00
11073. Kasper (suttergren) 25 52.61 59.06 1 4.00
11074. Surreal (surreal_cereal) 25 72.16 83.61 8 32.00
11075. K (sunfalls) 25 101.90 116.00 13 52.00
11076. suaad (suaad) 25 46.91 56.53 2 8.00
11077. Ana (sturmshatten) 25 41.16 52.14 3 12.00
11078. Azee (speedy65) 25 64.68 70.93 9 36.00
11079. sophia (sophiacav) 25 100.69 111.74 7 28.00
11080. Praveen (solvedbiscuit71) 25 38.54 51.04 1 4.00
11081. BLURB (snowq) 25 100.56 117.44 12 48.00
11082. VaporSZN (vaporszn) 25 90.61 107.33 12 48.00
11083. Ellie (sluis9_halmak) 25 27.04 36.21 10 40.00
11084. gianni (slowasf99) 25 107.02 131.46 10 40.00
11085. siddharth (siddharthr) 25 66.61 79.20 6 24.00
11086. Ty (sick_wubs) 25 47.24 67.32 2 8.00
11087. Ahnaf (shahriarme) 25 42.73 52.76 1 4.00
11088. shahmeer (shahmeernoob) 25 54.24 62.93 3 12.00
11089. Setons (setonsgrandpa) 25 73.31 87.43 9 36.00
11090. mac☮✈ie← →k🥵 (ma... 25 88.49 98.01 9 36.00
11091. Marius (m4ryu5) 25 60.92 69.66 5 20.00
11092. jeakai (lolilo123) 25 100.46 125.39 7 28.00
11093. Mia (lkortebe) 25 128.11 164.11 18 72.00
11094. Sam (lingbing) 25 82.97 94.90 10 40.00
11095. Lily (lilell) 25 110.29 123.69 6 24.00
11096. btonkh (le_shindeplouf) 25 79.43 96.20 25 100.00
11097. abel (lessthanthirtyfive) 25 101.02 110.57 10 40.00
11098. lenux005 (lenux005) 25 65.03 88.56 5 20.00
11099. Leah (leah_is_not_available) 25 89.52 103.68 9 36.00
11100. ❤❤❤ (lavenenoz) 25 118.75 133.57 4 16.00
11101. Preston (lantzer) 25 95.67 127.84 7 28.00
11102. Nun (lackingnight) 25 65.68 83.90 3 12.00
11103. Kriss (kkright) 25 89.18 105.55 9 36.00
11104. Victor (kingofdawn) 25 72.43 94.11 8 32.00
11105. kingcokes (kingcokes) 25 75.22 89.36 3 12.00
11106. susan (kf7hdw) 25 120.10 140.31 13 52.00
11107. Keti (keti_hawk) 25 75.14 89.15 4 16.00
11108. KaloiNa (kaloina) 25 19.83 31.05 7 28.00
11109. Mohammed Julfikar Ali (julf... 25 70.57 89.74 9 36.00
11110. Josh (joshmankey7) 25 112.32 142.50 15 60.00
11111. Jose (josethomas) 25 97.40 111.38 11 44.00
11112. joon (joonleey) 25 61.58 69.72 5 20.00
11113. Joketts (joketts) 25 81.05 95.82 9 36.00
11114. Joseph (jkc7) 25 101.39 113.25 5 20.00
11115. jhairssteven (jhairssteven) 25 59.83 74.61 3 12.00
11116. Super slow (jan_war) 25 70.49 85.51 6 24.00
11117. Jakawat (jakawat) 25 73.41 88.08 6 24.00
11118. space 65 (jacob1361) 25 84.17 111.16 8 32.00
11119. Daniel (intangiblesniper) 25 135.94 167.94 18 72.00
11120. Jonathan (imprettysaxy) 25 122.74 149.46 15 60.00
11121. ikkyu (ikkyu) 25 40.75 49.04 3 12.00
11122. jimy (iceposident) 25 79.00 97.71 8 32.00
11123. joel (ibeatjoeleverytime) 25 100.83 123.26 7 28.00
11124. Ian (ianduu) 25 58.07 68.37 7 28.00
11125. Hen_r.y (h_enry) 25 47.75 55.20 3 12.00
11126. Hossein (hosseinzafari) 25 52.22 60.81 9 36.00
11127. Miles (hauskaz) 25 89.58 109.60 5 20.00
11128. Haribo (haribooo) 25 80.99 94.75 4 16.00
11129. hannah (hannahvilla) 25 98.00 118.17 15 60.00
11130. Free Palestine (halemogpa) 25 57.01 72.54 3 12.00
11131. Gevashkar (gevashkar) 25 67.25 80.89 10 40.00
11132. gDan (gdan) 25 51.27 66.77 5 20.00
11133. shravan (gammarays) 25 74.87 91.22 6 24.00
11134. Arslan (malikarslan) 24 62.27 80.47 7 29.17
11135. Bart (madhavgoyal) 24 70.52 85.06 4 16.67
11136. Macklin (macklin123) 24 92.01 100.86 8 33.33
11137. Lo_key (lo_key) 24 76.39 87.66 4 16.67
11138. LLyn (llyn) 24 88.47 110.16 7 29.17
11139. David (litening72) 24 68.07 78.79 4 16.67
11140. Markus (lil_manila) 24 53.69 65.18 2 8.33
11141. LiKeRoMaNiA (likeromania) 24 73.31 82.12 4 16.67
11142. lexi (leximeow) 24 98.77 119.99 10 41.67
11143. TinyTim (lavoiet) 24 72.46 84.98 4 16.67
11144. Andre (lapp13slaf) 24 70.60 86.02 5 20.83
11145. Laet (laet99) 24 108.03 124.61 12 50.00
11146. Jen (ladyjen) 24 38.08 46.55 0 0.00
11147. Kaiden (ksetay) 24 65.43 84.12 5 20.83
11148. Pavan (kpavankotesh) 24 75.07 92.38 11 45.83
11149. Deven (kikaliyo) 24 79.02 94.66 5 20.83
11150. Kevin (kevink1844) 24 73.16 86.49 7 29.17
11151. Kevin (kevchen0908) 24 77.57 90.92 4 16.67
11152. D4Backdoor (keskin) 24 85.35 103.85 4 16.67
11153. Kelvin (kelvinohhh) 24 64.30 78.99 6 25.00
11154. Will (karl__marx) 24 109.94 144.74 18 75.00
11155. Kaori (kaori13) 24 58.28 69.11 4 16.67
11156. Junle (junlez) 24 82.91 99.31 10 41.67
11157. Jeff (jschillr) 24 61.30 75.63 7 29.17
11158. JN (jnnnn) 24 78.36 85.25 7 29.17
11159. xX_WeiTpuXxy69!_Xx (jmsmnlpz) 24 51.51 67.69 5 20.83
11160. Jay (jaydhanani36) 24 81.39 94.88 9 37.50
11161. Stivang96 (janse122) 24 90.08 114.39 13 54.17
11162. Jan (janpaint4221) 24 88.96 106.81 6 25.00
11163. Jack (jacktheoven) 24 97.84 110.90 9 37.50
11164. Will (iyeiye_captain_) 24 85.73 102.82 5 20.83
11165. Ian (imatson9119) 24 89.60 102.90 8 33.33
11166. ibizabroker (ibizabroker) 24 66.21 73.69 5 20.83
11167. Heathe (hwhl) 24 101.06 119.39 9 37.50
11168. Josh (hsoj1) 24 79.79 87.24 5 20.83
11169. hrithik (hrithikmanoj) 24 58.52 66.37 5 20.83
11170. Henry (hongquan448) 24 62.95 74.42 5 20.83
11171. HiroM (hirom) 24 91.97 114.00 12 50.00
11172. Unknown (hikaru0628) 24 42.50 55.08 5 20.83
11173. HiHowIsYourDay (hihowisyour... 24 101.07 125.45 3 12.50
11174. Tong (hiddenbanana) 24 80.24 94.25 5 20.83
11175. Hendeen (hendeen) 24 55.76 68.23 3 12.50
11176. Daniil (hate_machine) 24 56.57 66.83 13 54.17
11177. Hasano (hasano14) 24 67.22 83.21 8 33.33
11178. Harsh (harsh_dubey) 24 34.88 46.46 1 4.17
11179. Hackai (hackai) 24 45.58 57.47 4 16.67
11180. Yuji (gugox10) 24 120.92 139.53 16 66.67
11181. Grzegorz (gorix) 24 74.15 88.36 3 12.50
11182. Adel (goldfist10) 24 112.02 127.80 11 45.83
11183. krabbygail (goldenxy) 24 81.19 97.59 12 50.00
11184. nothing (galaxiedhomerow) 24 144.83 178.11 18 75.00
11185. fr33ak (fr33ak) 24 63.77 73.96 5 20.83
11186. Chidum (flashstriker007) 24 58.61 79.08 4 16.67
11187. Alan (fireslayer1090) 24 78.51 91.78 5 20.83
11188. Filip (finicky_) 24 71.65 91.15 7 29.17
11189. fiaz (fiazmahmud) 24 48.87 57.71 4 16.67
11190. frank (fastfingersfrank) 24 116.56 137.60 12 50.00
11191. Famesh (fampatel) 24 92.74 120.96 8 33.33
11192. ExpensiveDinner (expensived... 24 113.72 131.93 8 33.33
11193. Memes (ethanlee70) 24 93.51 114.12 9 37.50
11194. Advait (epik_guy1) 24 95.25 113.41 7 29.17
11195. Matts (emzee_a) 24 73.27 86.74 8 33.33
11196. Aviv (el_duckino) 24 76.52 95.29 9 37.50
11197. Ellis (ellismk123) 24 64.40 74.17 3 12.50
11198. ELGstud (elg_stud) 24 46.02 58.15 2 8.33
11199. dxriuz_dvorak (dxriuzdvorak) 24 43.47 51.24 4 16.67
11200. dugnutt (dugnutt) 24 65.63 77.38 6 25.00
11201. DTConks (dtconks) 24 75.96 93.58 6 25.00
11202. aaron (doxxa) 24 125.72 140.91 12 50.00
11203. Mangekyou (double_mangekyou) 24 108.04 131.85 13 54.17
11204. Damn kid (dezzer_legend) 24 88.33 101.94 9 37.50
11205. Dairy (derryne) 24 76.04 88.27 9 37.50
11206. Alish (dek_u) 24 85.45 106.09 9 37.50
11207. Beaster (deeznutshagotch) 24 113.57 132.84 14 58.33
11208. Dave (davidneymar) 24 41.52 49.83 0 0.00
11209. sourabh (datikas) 24 63.67 69.33 5 20.83
11210. Darth (darthhideoustheugly) 24 74.28 82.49 6 25.00
11211. sweet chili (darinoee) 24 119.17 137.10 20 83.33
11212. Dan (danisoz12) 24 95.22 111.24 12 50.00
11213. Cyrus (cyrusnthng) 24 45.46 59.36 2 8.33
11214. Cyptre (cyptre) 24 59.10 77.64 6 25.00
11215. Jonah (cuz_im_batman) 24 66.36 86.85 5 20.83
11216. Controller Player (countarc... 24 69.97 88.66 7 29.17
11217. voopx (coopnorth) 24 67.78 87.05 5 20.83
11218. Azzy (clavanonoyes) 24 57.11 65.30 1 4.17
11219. (っ◔◡◔)っ ♥ Tyoma... 24 86.54 93.48 7 29.17
11220. Charlie (charlibre) 24 85.03 107.31 8 33.33
11221. Celest (celestialpha) 24 46.69 61.26 3 12.50
11222. Henry (ceeefore) 24 67.78 81.57 3 12.50
11223. Christian (cbc2508) 24 93.72 113.33 12 50.00
11224. Cau Be (caubelangthang) 24 93.49 111.02 10 41.67
11225. Carlo (carlofernandez) 24 72.39 86.73 5 20.83
11226. Christian (cardonacx) 24 73.01 88.45 10 41.67
11227. cam (cam69) 24 80.98 100.23 13 54.17
11228. Burr (burrasaurs) 24 76.29 97.72 10 41.67
11229. Please use an appropriate n... 24 73.46 85.63 4 16.67
11230. v0rtex- (bouraoui) 24 66.64 75.47 8 33.33
11231. Sand (bizzarehuman) 24 58.16 70.20 3 12.50
11232. bindyy (bindyy) 24 116.48 136.98 16 66.67
11233. Bill (bill_slouch) 24 95.94 118.64 11 45.83
11234. Lucky (bigowlyeyes) 24 100.16 112.93 7 29.17
11235. Benjamin (ben_jam_in_franklin) 24 79.27 95.57 3 12.50
11236. Bea (bearainbow) 24 84.38 100.32 6 25.00
11237. Brandon (bandantran) 24 105.46 128.80 12 50.00
11238. baha (bahakz) 24 89.98 101.85 9 37.50
11239. Bacte (bacte73) 24 74.87 86.26 9 37.50
11240. Aaron (ayildiztas) 24 60.19 77.03 2 8.33
11241. (aus10_) 24 125.53 142.02 18 75.00
11242. Ashraful (ashraful_alam) 24 54.63 65.51 3 12.50
11243. Dark (arunabh_kalita) 24 48.40 57.61 4 16.67
11244. scor (scorbalope) 24 72.46 84.15 4 16.67
11245. Ankit (savage_floppy) 24 56.70 68.18 18 75.00
11246. abatt (sas_1100) 24 97.85 118.70 8 33.33
11247. Santiago (santi_ooo) 24 60.99 73.81 8 33.33
11248. Salzd (salzd) 24 73.24 85.12 4 16.67
11249. salmonjerky (salmonjerky) 24 118.30 137.98 12 50.00
11250. Ryo (ryonamba) 24 75.49 94.31 3 12.50
11251. Morple (roubry) 24 52.71 61.83 5 20.83
11252. vroom (rott3n) 24 101.95 118.48 11 45.83
11253. Juan (robbyro10) 24 74.18 85.25 11 45.83
11254. Red (redhood07) 24 91.05 104.71 8 33.33
11255. Andy (realasianjesus) 24 97.65 109.93 7 29.17
11256. Randhy (randhy456) 24 86.07 99.27 7 29.17
11257. ibm model m (qpaper) 24 82.95 97.82 7 29.17
11258. elvi (puddingbb) 24 66.92 74.43 6 25.00
11259. poornoday (poornoday) 24 44.64 52.55 3 12.50
11260. Babu (pinklamborghini) 24 97.58 120.02 17 70.83
11261. Hoopty (phantommonk) 24 108.17 121.28 18 75.00
11262. Zöri (pevisa) 24 66.81 82.21 8 33.33
11263. Soumyadip (pelitza) 24 77.66 90.71 3 12.50
11264. paul (paulb20071106) 24 85.52 99.95 8 33.33
11265. PL (patrick_legrand) 24 67.67 81.32 7 29.17
11266. Parker (parqr) 24 81.75 97.38 6 25.00
11267. parasjeet (parasjeet_singh) 24 21.27 30.29 7 29.17
11268. 失败者 (palmtreeeee) 24 88.96 101.76 9 37.50
11269. sausage fingers (otterrr) 24 99.90 127.01 11 45.83
11270. Pj (orchrist) 24 85.37 106.57 2 8.33
11271. Nicholas (omzero) 24 71.25 82.80 5 20.83
11272. Chayton (omenop) 24 65.71 78.74 18 75.00
11273. lol (nutmyballs) 24 88.76 96.67 10 41.67
11274. Dave (nut4) 24 90.25 113.34 5 20.83
11275. Not_Orious (not_computer) 24 111.36 132.76 10 41.67
11276. Leung (noobie_markie) 24 77.87 92.11 4 16.67
11277. Viet (noobaxereport) 24 70.63 82.37 5 20.83
11278. Nono (nono11jp) 24 77.12 92.84 7 29.17
11279. Noah (noaboston) 24 60.80 79.31 3 12.50
11280. Nivekdood (nivekdood) 24 94.04 123.24 13 54.17
11281. Ryan (ninjacowwizard) 24 67.95 86.75 6 25.00
11282. MD Nasir Uddin (nasiruddin1... 24 33.33 45.11 1 4.17
11283. Ruufa (narwhal_cream) 24 58.31 73.16 5 20.83
11284. Nachito007 (nachito007) 24 51.58 67.15 4 16.67
11285. wendy fan (nabong) 24 106.31 129.27 20 83.33
11286. Muhammadsiddiq (muhammadsid... 24 46.34 54.97 4 16.67
11287. MrFunk (mrfunkee_) 24 57.20 68.06 6 25.00
11288. mags (moopymags) 24 113.50 143.99 21 87.50
11289. Mohsen (mohsenbing) 24 37.57 44.22 2 8.33
11290. Mohamed (mohamed5550) 24 52.12 64.16 2 8.33
11291. Michael (mkelnei) 24 74.36 90.09 7 29.17
11292. Michael (michaz) 24 61.09 68.34 4 16.67
11293. Brandon (mibbrandon) 24 68.85 78.08 4 16.67
11294. Matías (mendezmatias) 24 51.72 63.48 0 0.00
11295. Michael (mddover) 24 62.01 72.46 6 25.00
11296. Mariol (mcakalli) 24 60.04 70.31 5 20.83
11297. mayo (mayo_tp01) 24 110.16 137.78 3 12.50
11298. Matty (matty_b_raps) 24 71.53 86.84 3 12.50
11299. Matěj (mates542cz) 24 57.76 71.58 3 12.50
11300. M5 (mariahendrikx) 24 105.13 129.64 10 41.67
11301. An (an_dtr) 24 47.38 58.87 1 4.17
11302. Duy (anthonytom) 24 114.09 128.06 10 41.67
11303. Andreas (andysave) 24 78.33 94.27 7 29.17
11304. Alex (alex_ofl) 24 77.56 90.76 5 20.83
11305. Basma (airiii) 24 43.66 59.14 4 16.67
11306. icosaedru (achimia) 24 87.64 98.29 6 25.00
11307. abyl (abyl_10) 24 56.01 65.69 4 16.67
11308. Abrar Shah (abrar_shah) 24 40.80 52.55 4 16.67
11309. abdul (abdullateef4u) 24 60.71 69.87 4 16.67
11310. Dude (48023984) 24 102.90 113.97 14 58.33
11311. root (1_root_1) 24 71.87 83.63 6 25.00
11312. 1938 (1938) 24 57.04 83.79 2 8.33
11313. Saksham (0_lol_0) 24 97.92 109.86 17 70.83
11314. senneres (senneres) 24 66.92 80.69 5 20.83
11315. die (dot65436) 24 54.54 68.50 7 29.17
11316. Brady (bradychen) 24 51.06 60.67 4 16.67
11317. Jackson (yoshiproz) 24 70.82 89.09 7 29.17
11318. Cyrusssss (cyrusysleung) 24 70.96 86.44 4 16.67
11319. don't (silversnow468) 24 59.64 69.93 10 41.67
11320. jonas (jonas889) 24 79.35 94.85 6 25.00
11321. Winter (winterlem) 24 90.98 104.45 11 45.83
11322. Usotsuki (usottsuki) 24 72.88 84.87 5 20.83
11323. Arthur (s4kko_) 24 49.36 62.05 0 0.00
11324. Smac (smacpats) 24 103.33 117.70 8 33.33
11325. Sijiur (Rohingya) (sijiur) 24 33.21 41.04 4 16.67
11326. Rachel (purplerhythm) 24 52.41 61.64 6 25.00
11327. jodie (jodieodieodie) 24 45.87 64.38 0 0.00
11328. v33 (__v33__) 24 62.74 72.64 3 12.50
11329. Zint (_zint_) 24 89.69 121.84 7 29.17
11330. Irarref (_ofking) 24 59.97 73.49 4 16.67
11331. Zockie (zockie) 24 74.27 85.32 7 29.17
11332. Pretty Epic (zimbaycoleo) 24 98.80 125.18 11 45.83
11333. Zhalgas (zhalgas_04) 24 40.88 46.99 12 50.00
11334. Nicolas (yulkbbq) 24 101.20 113.42 7 29.17
11335. leo (ytxqz) 24 59.45 71.56 3 12.50
11336. Alex (your_pal_al) 24 88.58 111.47 11 45.83
11337. Juan (yosohs) 24 73.30 88.23 4 16.67
11338. haryson (xooflo) 24 121.89 140.19 8 33.33
11339. akaxls (xlsbestplayer) 24 59.73 73.11 6 25.00
11340. Wojciech (wpietron) 24 74.68 91.22 7 29.17
11341. Wafles (waflebars) 24 73.07 89.73 6 25.00
11342. whoam (w1ld13) 24 70.00 82.58 5 20.83
11343. my fingers hurt (voltwitz) 24 134.71 151.91 18 75.00
11344. Volta (vo1_ta) 24 92.59 110.97 15 62.50
11345. Vishnu (vishnu_is_goated) 24 71.77 89.48 8 33.33
11346. Vinne (vinne10) 24 98.93 127.85 6 25.00
11347. viincent (viiincent) 24 89.27 119.39 7 29.17
11348. V3RN0N (v3rn0n) 24 103.37 120.03 12 50.00
11349. Utsah (utsah470) 24 42.68 56.65 2 8.33
11350. tylgo (tylgo) 24 95.26 108.43 10 41.67
11351. Joe (tormund) 24 67.48 79.33 7 29.17
11352. Tommy (tommywiseau95) 24 32.91 39.18 1 4.17
11353. Aditya (timmyaditya) 24 65.03 82.51 13 54.17
11354. Tim (timhoxton) 24 41.53 49.70 1 4.17
11355. Mig (timenextluck) 24 47.00 58.99 4 16.67
11356. Thomas (thomasltran) 24 98.40 117.61 9 37.50
11357. TheGreatYS (thegreatys) 24 69.28 79.06 8 33.33
11358. megghraj (thegame365) 24 62.55 77.18 2 8.33
11359. thecourtneyv (thecourtneyv) 24 89.47 105.28 12 50.00
11360. Renata (thebluesavvy1) 24 71.63 87.25 3 12.50
11361. Cocoa (thatclassykid) 24 76.79 88.95 6 25.00
11362. Teh (tehtehteh) 24 121.91 135.93 16 66.67
11363. Teen (teenunicorn) 24 101.42 122.26 9 37.50
11364. Daniel (swampy28) 24 47.30 58.57 3 12.50
11365. Surya (suryathoppae) 24 69.15 99.15 5 20.83
11366. streamix (streamix) 24 76.62 89.62 9 37.50
11367. tyler (ssjtyru) 24 95.53 114.39 5 20.83
11368. Filip (sodic) 24 87.81 105.04 13 54.17
11369. Cass (sneakyperryplat) 24 116.19 141.11 11 45.83
11370. Blake (skidaddle) 24 96.82 125.39 6 25.00
11371. sircle (sircle) 24 67.25 75.73 5 20.83
11372. shot607 (shot607) 24 124.03 142.11 19 79.17
11373. shoobb (shooby28) 24 85.54 102.51 7 29.17
11374. Dankey Kang (shabooty) 24 120.61 137.05 14 58.33
11375. Sean (sfeendog) 24 74.95 86.11 1 4.17
11376. Sejer (sejert) 24 73.37 93.53 9 37.50
11377. Toby (_toblerone_) 23 78.56 97.86 5 21.74
11378. Yuudai (zilchdear) 23 46.84 54.53 2 8.70
11379. maciek (zadtrie) 23 71.42 91.85 8 34.78
11380. Yarnell (ytoei) 23 75.57 92.09 5 21.74
11381. Yelnur (ye1nur) 23 48.54 56.06 4 17.39
11382. craster (yaboiedgy) 23 82.44 96.16 11 47.83
11383. Kevin (xertheon) 23 108.57 129.11 7 30.43
11384. xCocoaCrazy (xcocoacrazy) 23 75.08 93.17 9 39.13
11385. tstats[wimbleimble] (wimble... 23 94.55 122.00 5 21.74
11386. Georgios (vlassonio) 23 53.59 64.12 5 21.74
11387. BadTyper (very_really_bad_t... 23 43.56 50.40 3 13.04
11388. Varun (varuns924) 23 82.79 105.18 6 26.09
11389. uuind (uuind) 23 117.66 134.81 11 47.83
11390. Aaron (unrealapex) 23 82.59 102.30 11 47.83
11391. andrei (uncleandre) 23 88.08 119.52 8 34.78
11392. speed420 (uhfees) 23 59.01 71.97 2 8.70
11393. Jotaro (udetha) 23 86.48 106.69 6 26.09
11394. Uddi (uddi_racer19) 23 49.63 63.28 2 8.70
11395. Sorin (tur7le0010) 23 97.38 119.31 14 60.87
11396. Tselmeg (tselmegkh) 23 101.67 126.54 15 65.22
11397. Hao (truonganhhao) 23 87.45 107.82 8 34.78
11398. Sheraz (toruowo) 23 87.39 109.15 8 34.78
11399. Aj (toppingsplease) 23 99.22 107.59 11 47.83
11400. tobia (tobiabig) 23 52.48 61.88 3 13.04
11401. Stray (tiemevanderhoek) 23 50.18 67.84 6 26.09
11402. bob (thot_slayer420) 23 90.78 107.58 3 13.04
11403. Thor (thorthegodoflightning) 23 38.96 53.92 1 4.35
11404. SenPIe (thesenpie) 23 75.24 88.77 5 21.74
11405. Natapon (tetracarboxylic) 23 75.94 84.84 4 17.39
11406. Tayyab (tayyabismail149) 23 50.60 65.69 7 30.43
11407. Tandy (tandysu) 23 107.46 134.62 12 52.17
11408. syswinh (syswinh) 23 89.95 103.65 9 39.13
11409. Steve (stevocat) 23 68.55 80.20 12 52.17
11410. Turtle (stevetheturtle) 23 76.32 86.07 5 21.74
11411. Cássio (ssscassio) 23 80.70 91.47 3 13.04
11412. Fite (squidderp) 23 90.35 107.36 7 30.43
11413. devansh (speedcuber05) 23 45.27 54.06 4 17.39
11414. spectrophobia (spectrophobia) 23 38.95 51.19 1 4.35
11415. Slim (slimkevin) 23 60.00 67.03 4 17.39
11416. Dkippy (sirdunklenutsiii) 23 92.39 108.47 6 26.09
11417. Roi (sibo532) 23 86.54 102.02 6 26.09
11418. shebaw (shebaw) 23 97.19 115.28 7 30.43
11419. Justin (shaowen) 23 118.31 131.49 12 52.17
11420. shanranran (shanranran) 23 93.91 111.23 7 30.43
11421. Shamim (shamimiqram) 23 56.86 68.83 3 13.04
11422. Mazze (shadyone) 23 74.35 86.87 10 43.48
11423. oShado (shadowwalker15) 23 87.20 108.25 6 26.09
11424. Sebastian (sfmiguez) 23 96.99 127.37 9 39.13
11425. Ellie (senimoo) 23 116.68 150.67 11 47.83
11426. Kayden (semitart) 23 49.19 59.08 4 17.39
11427. John (seaofnonsense) 23 99.40 118.28 10 43.48
11428. scsdawg (scsdawg) 23 77.75 102.55 5 21.74
11429. santi (santimcc) 23 61.44 69.22 2 8.70
11430. Sameer Gupta (sammyonswitch) 23 72.44 85.09 4 17.39
11431. Chris (s3r4ph) 23 45.49 59.01 2 8.70
11432. Lukas (s018296) 23 108.94 124.90 12 52.17
11433. NotRyan (ryantheexiled) 23 98.57 123.41 11 47.83
11434. justin (rold_jisas) 23 80.12 91.40 5 21.74
11435. richardhead (richardhed) 23 123.35 148.55 13 56.52
11436. Kyle (rexi_typed_you) 23 60.79 69.06 13 56.52
11437. Remark (remark21) 23 76.50 86.85 8 34.78
11438. Reflex1on (reflexion) 23 91.44 113.63 7 30.43
11439. RedXIII (red_xiii) 23 81.95 94.40 7 30.43
11440. ¯\_(ツ)_/¯ (raredutchkil... 23 85.05 103.87 6 26.09
11441. Rajesh (rajeshpanjiyar) 23 41.95 51.41 3 13.04
11442. R4ven (r4ven) 23 80.73 94.83 4 17.39
11443. Adrian (r3ko5) 23 81.20 98.50 4 17.39
11444. Hayden (r1plee) 23 72.21 94.04 8 34.78
11445. qtq🐇🍊🍰 (qtqtq) 23 91.16 103.48 5 21.74
11446. Jacob (q2q1wwe) 23 82.98 96.92 6 26.09
11447. Trent (priyank45) 23 83.09 109.37 14 60.87
11448. Pritom (pritom_99) 23 56.53 67.80 4 17.39
11449. Nobody (pengfire) 23 95.39 116.62 10 43.48
11450. Peanut (peanutpocket) 23 119.70 135.69 8 34.78
11451. paffy (paffy77) 23 87.75 103.31 8 34.78
11452. Paddy (paddyclohessy12) 23 68.99 81.21 7 30.43
11453. P00nsl4y3r (p00nsl4y3r) 23 64.39 76.17 4 17.39
11454. hi lol (overdosednq) 23 126.70 158.63 17 73.91
11455. Osfbro (osfbroofficial) 23 44.73 52.14 3 13.04
11456. أُمنية (omnitypewriter) 23 86.42 105.44 6 26.09
11457. Bakdauet (omir) 23 53.38 63.11 2 8.70
11458. Ojal (ojhhhal) 23 96.26 105.89 6 26.09
11459. Nicholas (nxcholas) 23 80.85 89.97 6 26.09
11460. Nuboo (nuboo) 23 117.15 142.94 14 60.87
11461. Kian (noob123af) 23 61.26 73.06 3 13.04
11462. noob (nonquitburner) 23 125.11 146.23 10 43.48
11463. Nesto (nesto2042) 23 72.44 91.45 2 8.70
11464. Tijme (nemjit) 23 70.26 83.55 4 17.39
11465. Neeraj (neeraj_kumar_coder) 23 77.32 93.18 4 17.39
11466. Stephanie (naderly) 23 76.46 85.93 4 17.39
11467. Murad (muradeliyev) 23 69.01 82.24 8 34.78
11468. Hugh (mrpiface101) 23 109.38 124.66 11 47.83
11469. Max (mpschorr) 23 94.86 111.25 2 8.70
11470. Max (mpegasus) 23 97.94 107.43 8 34.78
11471. Moy (moy231) 23 72.33 83.90 6 26.09
11472. Anton (mojo98) 23 67.63 91.28 6 26.09
11473. Tom (mlgplayer) 23 90.44 109.65 7 30.43
11474. Mimsqueeze (mimsqueeze) 23 75.56 94.60 6 26.09
11475. Mike (mike_shen) 23 96.70 115.75 10 43.48
11476. Mike (micko34) 23 86.52 116.26 5 21.74
11477. Barry Allan (messylingard) 23 69.75 80.82 3 13.04
11478. amy (mesemi) 23 98.36 115.40 12 52.17
11479. Caleb (meow4562) 23 88.75 106.76 5 21.74
11480. Faruk (megaracer_faruk17) 23 89.42 106.35 10 43.48
11481. Maestro (meessus) 23 104.19 131.62 20 86.96
11482. MaxMul (maxmul) 23 83.22 106.89 11 47.83
11483. Max (maxmeza) 23 80.63 99.01 6 26.09
11484. Matthew (matthew_hall2) 23 95.93 119.11 6 26.09
11485. Makhambet (markiz) 23 76.70 94.37 4 17.39
11486. Marcus (marcus_t) 23 68.81 78.41 5 21.74
11487. Manzood (manzood) 23 83.14 93.34 7 30.43
11488. Mangopod (mangopod_) 23 62.49 75.50 6 26.09
11489. Capricorn (mangosquirrel) 23 105.95 119.65 9 39.13
11490. Yuan (lydxlx) 23 123.54 130.87 4 17.39
11491. lunarised (lunarised) 23 62.67 71.71 7 30.43
11492. Lumberjack (lumberpython) 23 89.48 109.43 7 30.43
11493. Lucas (lucasppestana) 23 66.77 83.21 5 21.74
11494. Potato (lovlieice) 23 95.54 119.07 13 56.52
11495. sarang (lovejoy) 23 54.30 63.10 1 4.35
11496. Minwoo (lotuszero) 23 66.39 78.64 3 13.04
11497. Carlos (lagoon_monster) 23 80.47 90.44 6 26.09
11498. laamiya (laamiya) 23 43.11 49.09 2 8.70
11499. Kyle (kyleoh) 23 90.19 106.11 9 39.13
11500. krishna (krishnad) 23 74.14 86.54 2 8.70
11501. Miko (kimonoso) 23 87.61 102.17 8 34.78
11502. ye ye (kermatt3) 23 92.85 130.16 10 43.48
11503. kalirocketdev (kalirocketdev) 23 64.26 83.78 5 21.74
11504. Eman (kaido187) 23 48.47 60.13 3 13.04
11505. Jem (j_enchev) 23 78.65 91.00 5 21.74
11506. Justine (justine_02003) 23 47.42 61.22 1 4.35
11507. Foolish (justashish4556) 23 59.28 66.86 8 34.78
11508. Joel (jsandyt9) 23 91.17 111.29 5 21.74
11509. Jon (jrowephoto) 23 94.38 125.48 7 30.43
11510. Johanna (johanna9813) 23 81.65 91.67 8 34.78
11511. Jiang (jghjianghan) 23 85.73 109.53 6 26.09
11512. Jacobi (jevtrout) 23 64.82 77.03 5 21.74
11513. CommanderJiJi (jeromealmogu... 23 54.93 67.14 3 13.04
11514. McVitie’s (jdfjdghnjdjdf) 23 51.70 64.74 4 17.39
11515. Jc (jcamp0) 23 66.42 79.00 7 30.43
11516. Andre (jahraccoon69) 23 103.57 115.33 10 43.48
11517. Jahir (jahir___) 23 58.31 72.42 6 26.09
11518. Jerry (j27smith) 23 70.11 100.86 5 21.74
11519. JoY (j0y_y) 23 73.14 86.50 4 17.39
11520. ISeeRed (iseered) 23 62.59 73.92 5 21.74
11521. IRDunno (irdunno) 23 57.91 70.18 7 30.43
11522. ilman (ilmannafj) 23 35.49 40.97 1 4.35
11523. Splitslayer Chill (ikramnisar) 23 50.39 68.04 5 21.74
11524. Devanshu (iamdevanshu) 23 50.26 55.88 3 13.04
11525. WiteLightningHWD (hwds1) 23 73.98 99.26 7 30.43
11526. Michael (hulkmagnet) 23 87.96 99.42 6 26.09
11527. asian (hugeterror) 23 72.38 88.52 5 21.74
11528. Heino (hsirvio) 23 107.90 117.42 16 69.57
11529. House (houses) 23 81.79 96.42 3 13.04
11530. James (hot_panty_dropper) 23 94.74 104.77 5 21.74
11531. stand with russia (hellofki... 23 71.58 82.20 9 39.13
11532. heehee (heehee2) 23 55.06 70.12 2 8.70
11533. hau (hau1228) 23 73.30 93.59 5 21.74
11534. Hani (hanibchl) 23 73.52 88.05 9 39.13
11535. HallowSamurai (hallowsamurai) 23 32.77 38.56 1 4.35
11536. gog (guanquan) 23 80.07 96.45 12 52.17
11537. Johnny (gonzales_x_dumpy) 23 114.43 131.08 11 47.83
11538. geo (geomateyt) 23 55.13 68.85 20 86.96
11539. Geirdriful (geirdriful) 23 81.63 99.21 4 17.39
11540. GameChaos (game_chaos) 23 97.52 113.15 9 39.13
11541. Gotcha (g0tcha) 23 90.51 116.77 7 30.43
11542. G Dragon (g.w.l.griffiths@b... 23 63.08 76.97 5 21.74
11543. F u r u y á (furuya) 23 110.67 129.36 10 43.48
11544. Даниел (freewaydani) 23 99.22 122.03 13 56.52
11545. Floixman (floixman) 23 90.17 110.65 11 47.83
11546. James (fisher_man08) 23 36.10 41.98 2 8.70
11547. Dan (fireliar) 23 72.18 79.24 3 13.04
11548. Jimrey (filipinoboi) 23 82.78 108.07 8 34.78
11549. Fiha (fiha16) 23 59.01 71.53 11 47.83
11550. Mercapto (fast_typer10) 23 48.45 63.92 1 4.35
11551. wuque pink (exanta) 23 95.57 122.83 7 30.43
11552. Muhammad (exampz) 23 64.88 81.70 4 17.39
11553. Danny (evolt) 23 66.52 79.73 6 26.09
11554. Theodore (erodoeht) 23 93.59 111.28 8 34.78
11555. Eragon (eragon_kaizen) 23 29.50 44.11 4 17.39
11556. Yihoi (equation) 23 103.49 117.20 15 65.22
11557. Alex (epintus) 23 95.87 112.67 12 52.17
11558. KaoruLikesMakotoYukiTooMuch... 23 65.63 79.01 5 21.74
11559. Eliana (elianaswagmama) 23 79.74 104.01 10 43.48
11560. Michael (eilreivax) 23 101.20 117.91 4 17.39
11561. fwEWE (edward3001) 23 101.29 134.56 18 78.26
11562. D (d_4biden1) 23 95.58 107.47 4 17.39
11563. Raghupati (double_toned) 23 65.79 76.35 8 34.78
11564. kaatak_kataak (doggie0985) 23 75.82 97.69 7 30.43
11565. DFA (dj2119) 23 102.69 123.25 9 39.13
11566. Devin (distortedharmony) 23 97.36 125.34 11 47.83
11567. Dimitar (dimitar2424) 23 93.64 111.23 12 52.17
11568. Dillon (dillon147852) 23 67.18 80.28 7 30.43
11569. no ring finger (denebaltair) 23 128.61 145.74 15 65.22
11570. Lulu (def__init__) 23 84.24 101.67 6 26.09
11571. Daryll (daryll_ko) 23 96.48 110.29 13 56.52
11572. dawdad (darkschore) 23 102.26 116.38 12 52.17
11573. lalit (daredevil_5859) 23 66.23 90.40 6 26.09
11574. Dnyanendra (danyk_16) 23 68.47 80.39 6 26.09
11575. Danger Guy (dangerguy) 23 95.11 116.06 9 39.13
11576. Dan (danclevia) 23 65.70 70.93 4 17.39
11577. cynthia (cynthiween) 23 58.19 69.99 6 26.09
11578. cuong (cuongbt91) 23 84.24 92.52 8 34.78
11579. Ari (cuda_) 23 90.43 105.57 10 43.48
11580. jurc (cruj) 23 43.97 51.92 2 8.70
11581. copter28 (copter28) 23 85.82 104.20 9 39.13
11582. Rony (cleff) 23 102.14 125.57 22 95.65
11583. CHi (chiyippi) 23 41.69 54.33 3 13.04
11584. Chez (chezdude) 23 93.10 103.65 12 52.17
11585. Char (char_meleon) 23 87.21 108.28 5 21.74
11586. lixir (catjam) 23 42.68 57.23 2 8.70
11587. cathating89-dvorak (cathati... 23 92.34 116.60 7 30.43
11588. Obama (captnawesome) 23 73.34 84.29 6 26.09
11589. capo (caporv) 23 95.06 108.50 9 39.13
11590. Malupet si (bugret) 23 66.60 80.73 9 39.13
11591. Bree (briannanimal) 23 68.89 87.37 11 47.83
11592. Bread (bread_store) 23 85.55 102.27 5 21.74
11593. Bodzio (boguslav) 23 73.43 84.22 9 39.13
11594. bobaglow (boabglow) 23 75.24 94.87 3 13.04
11595. Figo (bmfc4444) 23 72.57 88.64 6 26.09
11596. Gaurav (blockcipherr) 23 50.47 62.49 1 4.35
11597. blandfoodman (blandfoodman) 23 68.48 83.20 6 26.09
11598. Blaku (blaku03) 23 64.26 75.66 10 43.48
11599. type beats (blackjack245) 23 80.31 99.10 9 39.13
11600. Sean (bigdinky) 23 123.94 145.59 13 56.52
11601. BigBoiB (bigboib) 23 63.79 70.28 5 21.74
11602. BrocK (bhagvat17) 23 47.46 55.63 0 0.00
11603. BigDiqSix9 (bernazrei69) 23 89.05 105.44 10 43.48
11604. Chicken (bbqsauceonmytitties) 23 86.85 103.33 9 39.13
11605. TheGod (bboytheqt) 23 72.07 83.34 7 30.43
11606. Rohan (barney564) 23 72.80 85.29 10 43.48
11607. bambam (bambamshazam) 23 76.06 86.53 8 34.78
11608. Grace (baddestbich69) 23 89.83 101.59 6 26.09
11609. A.S.M.777 (a_s_m_777) 23 84.39 102.56 7 30.43
11610. Ayera (ayera_04) 23 48.02 55.03 2 8.70
11611. Aubrey (awbrey) 23 44.11 59.96 2 8.70
11612. Andrew (awand0806) 23 111.45 129.11 13 56.52
11613. fast_and_curious (asimali246) 23 94.99 109.94 7 30.43
11614. asdf (asdfdsasdfdsasdf) 23 43.93 53.89 2 8.70
11615. Arif (arif224) 23 67.57 78.65 7 30.43
11616. Anduin (anduin2017) 23 85.75 97.34 6 26.09
11617. an0ma1y (an0ma1y) 23 92.59 107.97 9 39.13
11618. Asir Mosaddek (amsakib) 23 64.98 78.36 16 69.57
11619. alieb (alieb) 23 122.95 151.74 14 60.87
11620. Coolman (alibekesanov) 23 57.87 70.58 3 13.04
11621. Aiman (aiman_a) 23 97.84 110.38 10 43.48
11622. Ian (agenti23) 23 111.18 127.96 11 47.83
11623. (accelerated) 23 132.06 150.16 18 78.26
11624. Abhishek (abhi_bharti) 23 48.62 60.93 2 8.70
11625. abelrobot (abelrobot) 23 86.72 104.85 7 30.43
11626. Aarif (aarif_a) 23 85.94 99.37 5 21.74
11627. Wolfie (aaradhya10) 23 80.37 95.30 15 65.22
11628. Andrei (aandreixon) 23 81.18 95.37 6 26.09
11629. I'm stuck (666769) 23 78.54 93.34 5 21.74
11630. mm (613sadnesses) 23 143.84 171.05 15 65.22
11631. Angelo (2teletabiez) 23 66.60 78.87 3 13.04
11632. _ (2sloww) 23 62.41 72.21 4 17.39
11633. Hugo (21039) 23 62.37 73.88 4 17.39
11634. Kevin (1kevstahz) 23 98.55 118.09 16 69.57
11635. 10 (10thetypist) 23 78.44 88.28 4 17.39
11636. Ben (01ben10) 23 89.98 108.67 6 26.09
11637. Zakaria (zakariaarzoo) 23 54.60 63.85 5 21.74
11638. musavir (musa_2020) 23 43.04 49.64 3 13.04
11639. Geoffrey (cybrxt) 23 76.62 89.56 18 78.26
11640. Kevin (aightwhoshitmyself) 23 77.16 92.51 6 26.09
11641. Aldan (aldany) 23 73.83 89.01 7 30.43
11642. samarth joel (samjrin) 23 47.88 57.97 3 13.04
11643. Tommy (tomister99) 23 68.86 80.02 7 30.43
11644. Kerele (kerele) 23 90.45 104.20 12 52.17
11645. Abir (abir247) 23 57.84 79.82 4 17.39
11646. Bas (bas_hoeflaak) 23 77.02 89.55 7 30.43
11647. Jake (jake_craven) 23 57.35 69.82 4 17.39
11648. Michael (zmjcb) 23 65.76 82.11 6 26.09
11649. Spider (spidey13) 23 57.90 73.19 7 30.43
11650. Dredd (dredd20) 23 67.39 87.32 9 39.13
11651. Maltha (malthazen) 23 52.25 64.08 1 4.35
11652. Lezzgo (romsky1) 23 42.12 50.02 2 8.70
11653. Anudari (anuka01) 23 51.76 62.82 0 0.00
11654. Lesley (powerchopper) 23 81.04 99.42 7 30.43
11655. J D (2ralph2) 23 78.52 95.97 23 100.00
11656. Armaan_Gill (armaan_gill) 22 66.14 77.47 4 18.18
11657. FreeHongKong (aquaficial) 22 106.55 130.75 7 31.82
11658. Antonio (antonio_blueballs) 22 64.85 77.25 6 27.27
11659. Annabelle (annaballlzz) 22 84.39 96.57 4 18.18
11660. Anas (anas023) 22 25.22 34.36 7 31.82
11661. Ana Beatriz (anaporumtriz) 22 43.37 50.26 3 13.64
11662. tstats[an1ma] (an1ma) 22 46.13 57.44 2 9.09
11663. area_51 (amritspkt65) 22 62.35 76.13 5 22.73
11664. poorjar (amgminequality) 22 113.26 133.05 9 40.91
11665. slippedfinger (alpha_centauri) 22 68.02 78.73 4 18.18
11666. Jack (alphamale28) 22 98.20 124.58 3 13.64
11667. Jason (alfa871212) 22 47.86 57.44 5 22.73
11668. Alex (alexrichardson) 22 51.75 62.18 3 13.64
11669. Aleksa (aleksa55) 22 66.00 82.61 4 18.18
11670. Arpit (ak_31loaded) 22 43.64 50.14 2 9.09
11671. Aids (aids___) 22 98.46 107.91 5 22.73
11672. Ahnta (ahnta) 22 68.10 80.16 3 13.64
11673. MD ADNAN (adnantech17) 22 67.30 74.11 3 13.64
11674. 7tysins (acedragonheart) 22 85.62 99.25 9 40.91
11675. ABHISHEK PATEL (abhi_0601) 22 40.97 54.76 3 13.64
11676. Abhishek (abhishake12201) 22 40.09 56.72 3 13.64
11677. Ballistic (8a11istic) 22 70.81 78.96 7 31.82
11678. Juice (4804210474) 22 66.64 83.91 4 18.18
11679. Emman (3mm4n) 22 59.78 69.58 6 27.27
11680. Raggy (a11owed) 22 102.02 115.37 16 72.73
11681. vi (vipandas) 22 83.37 103.00 10 45.45
11682. tudgengthorf (tudgengthorf) 22 77.64 93.27 4 18.18
11683. John (johnwenshoe) 22 95.93 117.96 13 59.09
11684. Kuya JJ (kuya_jj) 22 48.12 59.97 3 13.64
11685. Rene (reniaraq) 22 47.20 62.00 15 68.18
11686. Bryce (bryce4) 22 87.38 105.41 9 40.91
11687. Isaac (ilikepie3) 22 48.08 60.11 2 9.09
11688. Cj (emperorblank) 22 48.69 60.44 1 4.55
11689. Koeliga (koeliga) 22 68.26 78.50 7 31.82
11690. yo (markus1012) 22 102.79 115.04 12 54.55
11691. john (joahuaj) 22 35.83 44.18 1 4.55
11692. wang (wangcai) 22 40.23 48.01 2 9.09
11693. max (vezorack) 22 53.12 60.99 3 13.64
11694. reiyashi (reiyashi) 22 108.18 119.89 9 40.91
11695. Metal09 (metal09) 22 46.62 56.15 1 4.55
11696. cring (cringeman10021) 22 62.72 76.35 6 27.27
11697. jozz (danishbun) 22 39.63 53.02 2 9.09
11698. Tobi (ohcibi) 22 84.85 105.80 8 36.36
11699. inzemamul (inzi2004) 22 47.54 57.55 3 13.64
11700. Joey (saria_calla) 22 31.74 38.45 1 4.55
11701. Mahdi (mahdiranjbar) 22 74.88 86.31 1 4.55
11702. chie (lotusimpact) 22 86.01 110.87 7 31.82
11703. John (loki83jcg) 22 93.43 111.12 8 36.36
11704. lokar (lokar123) 22 144.66 178.80 13 59.09
11705. Tu Thien (logan1912) 22 64.47 77.71 3 13.64
11706. llihcchill (llihcchill) 22 70.78 84.76 6 27.27
11707. lulu (llaurenlouise) 22 54.21 64.12 3 13.64
11708. Liz (lizfrizzle) 22 103.48 133.88 8 36.36
11709. Light (lighteous_) 22 72.29 94.98 6 27.27
11710. Licery (licery) 22 61.90 73.75 7 31.82
11711. lgwk (lgwk) 22 51.89 58.73 0 0.00
11712. Ryekane🖤 (lechepapu) 22 135.03 164.86 8 36.36
11713. Lapis (lapis_pislapis) 22 125.74 176.13 15 68.18
11714. Kumar (kumar_thapa1) 22 78.47 87.01 7 31.82
11715. krupa (krups) 22 63.68 84.15 3 13.64
11716. Daniel (korice) 22 92.92 124.00 5 22.73
11717. Adam (koltaia30) 22 65.61 79.72 8 36.36
11718. John (kobas) 22 48.14 56.56 1 4.55
11719. Annabelle (kiwi_punk) 22 64.08 80.59 5 22.73
11720. Kiki (kiki_) 22 39.86 46.78 0 0.00
11721. Tushar (kensei22) 22 49.13 54.08 1 4.55
11722. Kenewbi (kenewbi) 22 71.89 88.57 7 31.82
11723. Yakhe (ken007) 22 76.50 91.59 10 45.45
11724. (keegant) 22 152.27 180.56 4 18.18
11725. Kartavya (kartavyajain) 22 96.75 112.59 11 50.00
11726. James (karonar) 22 98.06 110.94 6 27.27
11727. George (karmatimer) 22 73.88 83.44 7 31.82
11728. Karlsen (karlsenlopez18) 22 90.34 108.98 6 27.27
11729. Jacob (karagiannis1) 22 56.34 65.64 1 4.55
11730. Kanzi (kanzi) 22 70.02 80.74 7 31.82
11731. kage (kage_bigfoot) 22 61.78 74.47 7 31.82
11732. j (jy22019) 22 55.02 63.28 0 0.00
11733. Je (jxnnele) 22 56.42 72.57 17 77.27
11734. jujufrost (jujufrost) 22 73.01 86.19 3 13.64
11735. JTD845 (jtd845) 22 94.21 107.96 15 68.18
11736. God (jpaul100) 22 71.94 86.02 6 27.27
11737. Joy (joyyang810035) 22 87.99 118.20 8 36.36
11738. Joshua (joshuamtinker) 22 62.31 87.21 3 13.64
11739. Jordan (jordy2394) 22 41.80 49.40 2 9.09
11740. Jeydin21 (jeydin21) 22 81.49 101.32 9 40.91
11741. Jess (jessnixon94) 22 106.75 129.75 7 31.82
11742. Jen (jenniferrocks07) 22 97.23 115.29 7 31.82
11743. Jenbi (jenbi) 22 75.89 89.04 3 13.64
11744. MrKK (jeldikk) 22 72.65 85.64 4 18.18
11745. J (jduncanlee) 22 106.58 132.33 11 50.00
11746. jazzy (jazzy_trojan) 22 85.39 102.61 8 36.36
11747. jantheman (jantheman21) 22 81.99 119.73 21 95.45
11748. Jack (jackripper9) 22 53.35 78.77 4 18.18
11749. JackbroDaeGamer (jackbrothe... 22 63.65 75.57 7 31.82
11750. izzy (izzyy2) 22 42.71 53.34 13 59.09
11751. Izzy (izzypistilli) 22 78.55 92.93 10 45.45
11752. kentei (itskentai) 22 67.43 80.27 7 31.82
11753. Sigh (isigh) 22 93.48 110.71 11 50.00
11754. InterLude (interlude) 22 101.61 145.49 10 45.45
11755. ooo (inout) 22 85.69 105.84 7 31.82
11756. Ignite (ignite777) 22 68.34 86.69 11 50.00
11757. jay (icantfeel) 22 59.15 70.25 5 22.73
11758. Abhijith (iabz) 22 56.09 71.82 3 13.64
11759. Muhammad (hydra_assassin) 22 61.05 71.95 6 27.27
11760. Josh (hoverdoge) 22 105.89 133.96 10 45.45
11761. Kay (hothandj) 22 90.64 110.42 4 18.18
11762. Jose (hosey_) 22 85.38 104.71 5 22.73
11763. Stefan (hollownaoya) 22 82.09 99.06 4 18.18
11764. Hekonii (hekonii) 22 82.12 95.63 2 9.09
11765. Havenix (havenix) 22 74.14 87.97 4 18.18
11766. Hasan (hasan95) 22 52.07 66.30 1 4.55
11767. Товарищ (hamkor) 22 85.26 97.15 9 40.91
11768. fun (haifiveywivey) 22 98.84 118.78 12 54.55
11769. hack89 (hack89) 22 63.50 68.59 5 22.73
11770. Michael (grumos) 22 83.06 92.24 5 22.73
11771. DaTa (good_vibes) 22 73.22 86.49 8 36.36
11772. Giorillium (goodguygio) 22 73.96 91.86 3 13.64
11773. 🇲🇳 Mazaalai (goodgodk... 22 97.66 117.30 8 36.36
11774. Jordan (godlysharky) 22 54.19 68.49 1 4.55
11775. ginteaa (ginteaa) 22 102.74 116.36 7 31.82
11776. Gijs (gijs__g) 22 72.86 89.63 7 31.82
11777. gela (gelacutie) 22 38.33 50.77 5 22.73
11778. George (gbotev) 22 91.04 101.19 8 36.36
11779. Jordi (gandalfdablack1) 22 69.90 85.23 5 22.73
11780. Gabriel (gabrielbutu) 22 86.99 102.97 8 36.36
11781. Ada (fumingadam) 22 93.98 112.64 10 45.45
11782. Yashi (_o_wobless) 22 50.47 64.30 2 9.09
11783. KIRA (_arik_) 22 43.23 49.99 4 18.18
11784. Ryley (zqroh) 22 59.68 71.13 4 18.18
11785. Zerieox (zerieox) 22 84.21 105.14 5 22.73
11786. That One Guy (zbomber21) 22 115.45 142.54 21 95.45
11787. Eric (yuurrrrr) 22 85.86 95.75 5 22.73
11788. Brody (yuumi) 22 109.20 135.14 14 63.64
11789. maro (yenic) 22 64.08 74.52 3 13.64
11790. Yegor (yegorshevchenko) 22 50.13 58.10 2 9.09
11791. Yassine (yassinejedidi) 22 69.59 94.63 13 59.09
11792. Yaroslav (yaros) 22 67.06 77.23 9 40.91
11793. momo (yaomomo) 22 79.58 94.87 9 40.91
11794. Xzereath (xzereath) 22 95.59 119.47 11 50.00
11795. Wattery (xwattery) 22 43.75 53.56 0 0.00
11796. willybear (willybear) 22 83.79 100.03 5 22.73
11797. b (whylxve) 22 69.90 84.13 3 13.64
11798. eqwt (whuhu) 22 113.08 136.02 17 77.27
11799. Jonas (whatisupyou) 22 115.18 129.92 14 63.64
11800. vyst (vystoric) 22 129.17 141.71 16 72.73
11801. Vinit (vspundir) 22 45.68 55.23 1 4.55
11802. vishnu (visshnu) 22 51.97 62.70 1 4.55
11803. VibrantVanilla (vibrantvani... 22 78.16 97.13 6 27.27
11804. Hiren (userhiren) 22 61.01 76.98 6 27.27
11805. Samay (upadsamay387) 22 77.11 93.07 3 13.64
11806. Umid (umid2000) 22 66.10 77.89 4 18.18
11807. Umair (umairkhan) 22 77.96 86.52 7 31.82
11808. typingboob (typingboob) 22 60.72 71.43 4 18.18
11809. Sub-Par (typerslower) 22 111.13 121.25 12 54.55
11810. Rajveer (typerfastboi27_) 22 62.39 85.13 5 22.73
11811. Triloluc (triloluc) 22 91.05 105.85 11 50.00
11812. Ohh (trappy24) 22 77.64 97.74 5 22.73
11813. ucsd_kid (trainermax) 22 157.18 183.32 19 86.36
11814. Theodor (thimius) 22 86.28 101.63 10 45.45
11815. Phil (themonk) 22 98.42 118.35 7 31.82
11816. Chris (themainchris) 22 78.30 90.84 9 40.91
11817. (thebob2713) 22 60.75 77.24 6 27.27
11818. temazh (temazh) 22 77.26 90.59 6 27.27
11819. Caleb (syfulis) 22 91.14 105.63 5 22.73
11820. Sumnerbean (sumnerbean) 22 60.39 80.14 6 27.27
11821. Stranger (stranger_danger1224) 22 45.73 62.99 1 4.55
11822. misty (sprainedartery) 22 95.02 113.58 9 40.91
11823. Papa (solutional) 22 100.12 122.37 11 50.00
11824. Alexander (solchild) 22 75.73 85.78 8 36.36
11825. soda (sodafortwo) 22 72.59 81.35 7 31.82
11826. RougeGod (socratic74) 22 64.73 71.35 6 27.27
11827. ki (slutsupreme) 22 103.61 127.97 6 27.27
11828. green (sleepingducksanddrag... 22 38.89 45.78 2 9.09
11829. Leah (slanted_sunlight) 22 89.68 99.22 9 40.91
11830. rai (siomaipusa) 22 83.64 109.85 12 54.55
11831. simon (simonnoin) 22 64.99 78.06 8 36.36
11832. Shunrai (shunrai1110) 22 95.27 123.25 9 40.91
11833. shorty (shortygiant) 22 53.61 65.82 4 18.18
11834. Shome (shmoe9806) 22 65.43 73.86 5 22.73
11835. catboy (sheepando) 22 111.23 123.19 7 31.82
11836. Sheel (sheel) 22 102.48 113.80 12 54.55
11837. WAKing (shashashane) 22 35.66 43.85 1 4.55
11838. Shannon (scthemonk) 22 64.65 76.23 5 22.73
11839. for reckful (savioshadow) 22 95.53 107.49 8 36.36
11840. SamSkey (samskey) 22 77.68 94.82 7 31.82
11841. Shabylkhan (saken03) 22 43.80 53.67 3 13.64
11842. saad (saad88) 22 63.69 69.51 4 18.18
11843. Felmer (rustycookieee) 22 86.72 96.63 8 36.36
11844. Vaccination (roughandtumble) 22 94.32 106.16 5 22.73
11845. Matt (robertwill) 22 53.11 65.01 2 9.09
11846. road to 100 (roadtoglobalmc) 22 89.47 110.66 6 27.27
11847. Ring (ringtack) 22 107.46 124.21 13 59.09
11848. Abdulla (rifah99) 22 79.42 89.28 2 9.09
11849. Ricky (rictsa05) 22 53.00 62.20 2 9.09
11850. Ricebowl (ricebowljohnson) 22 100.28 121.58 6 27.27
11851. rg2005 (rg2005) 22 88.34 111.94 8 36.36
11852. Dan (reddabbler) 22 63.83 83.12 4 18.18
11853. Ryan (rdem) 22 54.17 65.22 0 0.00
11854. Rare (rare_0001) 22 69.07 82.52 6 27.27
11855. Vinchenzo (qwertyuiopps) 22 94.02 112.89 11 50.00
11856. Qwerty (qwertyazerty) 22 81.74 94.82 7 31.82
11857. Saumya (quinn_1) 22 42.57 52.66 3 13.64
11858. Taksa-orn (proudpi) 22 73.44 96.63 3 13.64
11859. Parsa (pr8222) 22 50.36 59.40 1 4.55
11860. Alex (poop_guy) 22 85.08 98.32 3 13.64
11861. Polar (polishpolarbear) 22 86.60 111.42 9 40.91
11862. adr (poison_pwn) 22 74.34 86.87 2 9.09
11863. Ross (pogchammp) 22 84.13 111.07 7 31.82
11864. Pooh (po0h_) 22 35.91 41.97 1 4.55
11865. pjja (pjja) 22 115.79 145.30 14 63.64
11866. a1ways (pi___) 22 104.18 127.50 9 40.91
11867. Silver (pixel47) 22 97.76 112.47 7 31.82
11868. pinto (pintozza) 22 79.38 92.36 8 36.36
11869. Pina (pinapelzx) 22 78.50 94.66 5 22.73
11870. Pedro (pedroarcem) 22 70.23 81.52 1 4.55
11871. pebble (pebblewebble) 22 85.22 100.32 7 31.82
11872. Payu (payu_w) 22 82.76 91.26 1 4.55
11873. Paul (paul1106) 22 66.93 75.52 5 22.73
11874. Paksolek (paksolek) 22 54.11 67.12 3 13.64
11875. V (p3rplexed) 22 89.59 109.39 7 31.82
11876. Overlay1 (overlay1) 22 63.80 72.48 2 9.09
11877. rotscatpill (orangetinman) 22 65.31 74.83 7 31.82
11878. nuttendabutt (nuttendabutt) 22 33.31 37.26 2 9.09
11879. Umidjon (nouser493) 22 56.52 68.89 17 77.27
11880. wii (nobodylovesraymond) 22 85.19 98.52 7 31.82
11881. Nischay (nitrospeed2709) 22 71.94 82.60 8 36.36
11882. Nels (nels_senti) 22 74.17 91.68 9 40.91
11883. naomi (naomii_) 22 59.94 71.03 5 22.73
11884. L + (n1ckname152) 22 93.28 111.15 12 54.55
11885. MrOkapus (mrokapus) 22 61.46 72.13 7 31.82
11886. Moodrammer (moodrammer) 22 64.39 73.30 5 22.73
11887. Md. Mojnu (mojnu20) 22 38.91 43.96 2 9.09
11888. Jacquelyn (mobear06) 22 89.38 115.20 6 27.27
11889. Matthew (mmeppelink20) 22 97.84 127.06 10 45.45
11890. Maddy (mlong) 22 101.46 116.75 11 50.00
11891. Jake (mjakecarlo) 22 72.60 88.75 9 40.91
11892. Michael (michaelyang) 22 79.20 92.91 5 22.73
11893. mercy (mercy_13) 22 64.44 77.52 4 18.18
11894. carlos (mecsczek) 22 105.46 117.89 11 50.00
11895. Zia (mechatronic_beast) 22 50.46 60.44 2 9.09
11896. Paul (mcbain788) 22 95.12 111.41 18 81.82
11897. Max (maxy_boi) 22 59.54 69.60 11 50.00
11898. rohan (maverick_mind69) 22 77.67 100.86 4 18.18
11899. Martin (maniacal_martin) 22 72.57 82.83 2 9.09
11900. Leslie (mamaleslie81) 22 66.02 82.40 4 18.18
11901. Mary (frailmary) 22 83.21 94.18 6 27.27
11902. Floriaan (floriaanvb) 22 51.10 58.94 1 4.55
11903. Atticus crunch (fablesnfobb... 22 91.23 114.54 9 40.91
11904. Elijah (e___) 22 49.63 68.96 1 4.55
11905. Flusercluck (explocow) 22 78.65 99.84 6 27.27
11906. Eslam (eslamalien) 22 45.43 54.72 2 9.09
11907. erka (erkaboy) 22 76.66 92.59 5 22.73
11908. eric (eric5000) 22 112.38 136.04 16 72.73
11909. Olivia Scott Welch can run ... 22 108.28 122.26 6 27.27
11910. Efgeen (efgeen) 22 100.36 129.99 10 45.45
11911. Eeegh (eeegh) 22 54.61 69.70 2 9.09
11912. Dustan (dustank) 22 47.99 57.80 1 4.55
11913. Dullpig (dullpig) 22 70.11 85.49 4 18.18
11914. Frederik (drlambogamer) 22 76.03 86.46 12 54.55
11915. doubleplusgood (doubleplusg... 22 76.36 96.66 3 13.64
11916. Drew (dmart) 22 73.10 88.84 2 9.09
11917. A (djakl) 22 101.45 114.86 8 36.36
11918. Terence (dijkstras) 22 94.42 105.52 5 22.73
11919. Dev (devyadavv) 22 40.99 49.24 0 0.00
11920. Suktinis (destrain) 22 71.99 85.13 4 18.18
11921. Be (deathpulse) 22 113.14 133.46 9 40.91
11922. Daniel (danielyawn) 22 76.46 94.10 2 9.09
11923. Diego (daigo356) 22 60.75 69.67 6 27.27
11924. David (d8vidherrera) 22 108.67 131.91 12 54.55
11925. Could be you (cycosniper) 22 87.69 113.71 6 27.27
11926. JS (cwr_sej) 22 80.47 95.47 3 13.64
11927. Electric (cuitcuit) 22 97.38 114.19 12 54.55
11928. Stephanie (cuber155) 22 71.63 86.32 7 31.82
11929. Crims0n (crimsonnn) 22 67.18 77.18 3 13.64
11930. Martin (crimsonmartin) 22 76.09 86.37 4 18.18
11931. Roman (cosmic_mythos) 22 51.49 65.98 4 18.18
11932. a (coolguy73) 22 104.45 124.54 19 86.36
11933. Nemanja (conemanija) 22 42.20 53.90 2 9.09
11934. Clemens (cleminator) 22 59.68 66.31 5 22.73
11935. Murtaza (chichawww) 22 44.95 57.21 1 4.55
11936. Captain (captainalliance) 22 67.49 80.26 7 31.82
11937. caesthetis (caesthetis) 22 107.79 128.13 11 50.00
11938. John (caduke) 22 90.58 115.83 9 40.91
11939. LUKAS (brabomclaren) 22 76.37 87.20 6 27.27
11940. Bozsó (bozso) 22 61.75 77.13 5 22.73
11941. Bolt7911 (bolt7911) 22 52.69 70.04 6 27.27
11942. Sabba7 (bodynasser) 22 49.08 61.23 3 13.64
11943. Inferendum (bloonchipper) 22 68.66 95.63 5 22.73
11944. bo (biznessmun) 22 102.03 116.88 15 68.18
11945. Adam (bezwzglednyadas) 22 67.91 81.29 6 27.27
11946. bepis (bepis_pebis) 22 108.94 125.47 8 36.36
11947. swagb0y (beckseamons) 22 81.17 99.60 6 27.27
11948. Bailey (bbrusca98) 22 82.51 98.68 6 27.27
11949. Austin (austinkg) 22 78.85 90.68 3 13.64
11950. Kevin (ashret) 22 137.70 169.02 19 86.36
11951. ashl5t (ashl5t) 22 52.80 80.22 18 81.82
11952. w (artemisfowl3rd) 22 103.89 130.94 11 50.00
11953. Frederik (freeder1k) 21 61.67 72.48 2 9.52
11954. Frode (fr0so) 21 59.87 68.70 2 9.52
11955. Kai Wei (fortissimo) 21 108.06 132.69 12 57.14
11956. Foqsi (foqsi) 21 102.33 122.45 9 42.86
11957. Speedy (flux2k) 21 113.14 134.10 12 57.14
11958. Patty (flappypatty420) 21 66.47 89.11 5 23.81
11959. Felipe (felipet) 21 85.93 98.76 4 19.05
11960. Felipe (felipazo_06) 21 57.00 77.43 7 33.33
11961. this is feimser (feimser) 21 67.78 76.21 8 38.10
11962. Harry (feeshgang) 21 109.34 127.77 12 57.14
11963. Ali (fanstic) 21 64.72 74.96 3 14.29
11964. Fairyball (fairyballyt) 21 85.45 98.80 4 19.05
11965. Junito (exter72) 21 75.70 97.03 6 28.57
11966. Mohammed Waseemuddin (ertug... 21 57.08 67.66 5 23.81
11967. Erie (eridu) 21 76.20 101.65 6 28.57
11968. Muhammad (entamalomak) 21 69.92 79.60 7 33.33
11969. emily (emily_chwn) 21 77.13 84.14 2 9.52
11970. Elmer (elmerr) 21 95.24 105.94 7 33.33
11971. Elijah (elijahp24) 21 62.44 75.71 5 23.81
11972. Yaowee (eggyicecream) 21 70.21 82.18 6 28.57
11973. D1FFeR (ec0426) 21 60.76 77.31 2 9.52
11974. D1ck F1ngers (d_wratten18) 21 66.42 76.23 6 28.57
11975. shylingg (dyingllama) 21 109.82 125.47 11 52.38
11976. Nathanael James (dyemz) 21 87.71 98.70 7 33.33
11977. Duschi (duschi) 21 93.96 108.30 8 38.10
11978. K (duhhhhhhhhhhh) 21 87.14 106.22 8 38.10
11979. Typing (drained_typist) 21 101.27 114.27 11 52.38
11980. dq (dqmaniac) 21 123.44 139.80 14 66.67
11981. . (doomslug5) 21 82.55 91.03 4 19.05
11982. Sardar Taha (dice111) 21 107.66 123.58 9 42.86
11983. Dexter (dexter2fast) 21 87.75 105.81 8 38.10
11984. DENYS (denysesjs) 21 100.68 114.35 13 61.90
11985. Nairi (demerton) 21 78.61 95.43 3 14.29
11986. Deko (deko_moon) 21 88.57 105.54 8 38.10
11987. Manye (davemanye) 21 60.32 81.18 8 38.10
11988. Daulet (daukabase) 21 62.79 76.99 3 14.29
11989. Chris (datapointchris) 21 85.61 102.99 5 23.81
11990. balzac (dasbalzac) 21 31.63 38.12 3 14.29
11991. DarkWinterFurry (darkwinter... 21 80.50 96.63 6 28.57
11992. dannsy (dannsy) 21 101.54 115.13 8 38.10
11993. Ryan (dandaflaff) 21 45.39 58.45 2 9.52
11994. Damian (damianm8) 21 76.84 86.71 6 28.57
11995. Aishiteru (daedalus__) 21 79.16 96.03 11 52.38
11996. cuzimogni (cuzimogni) 21 67.42 76.32 1 4.76
11997. cuppajoeman.com (cuppajoeman) 21 95.25 109.17 8 38.10
11998. Clement (clement_ps) 21 107.44 129.20 6 28.57
11999. Akhil (cheetahoo7) 21 85.04 95.98 7 33.33
12000. joe (cbel3111) 21 79.73 98.67 5 23.81
12001. Casual (casualhat) 21 53.11 59.52 4 19.05
12002. Carl (carlalalala) 21 79.52 94.90 11 52.38
12003. Captain M (captain254) 21 51.15 60.53 2 9.52
12004. Mohamed (camposha) 21 63.23 73.53 3 14.29
12005. byrtolet (byrtolet) 21 78.60 92.97 8 38.10
12006. Dan (bupkisdaddy) 21 82.19 107.02 11 52.38
12007. Bram (bramdk) 21 81.82 99.02 10 47.62
12008. bok (bokk) 21 99.15 125.72 12 57.14
12009. Blu (blu_0) 21 85.31 101.64 12 57.14
12010. Zach (blurridge) 21 91.43 110.90 7 33.33
12011. Jonathan (blue_blobfish) 21 88.11 104.88 5 23.81
12012. jeff (blawalaw) 21 112.14 131.27 11 52.38
12013. Kin (binbobum12s) 21 70.49 82.74 6 28.57
12014. Petr (bigbang1112) 21 100.66 116.10 9 42.86
12015. ben (bendoverr05) 21 65.60 84.34 3 14.29
12016. You're not that slow (beast... 21 135.35 162.32 14 66.67
12017. BearJere (bearjere) 21 101.88 112.78 12 57.14
12018. KJ (barraclaw) 21 93.87 107.18 5 23.81
12019. Michael (baomoichoi122) 21 51.18 66.99 1 4.76
12020. Bis (b1s_qu1t) 21 67.11 82.41 3 14.29
12021. Azerniiiic (azernic) 21 91.31 109.40 6 28.57
12022. Typomaster (axioo123) 21 66.77 81.85 6 28.57
12023. Jack (awesomekiwi23) 21 89.63 104.01 13 61.90
12024. Avernu (avernu) 21 81.10 101.36 7 33.33
12025. Josh (auto111032) 21 90.74 107.71 10 47.62
12026. Chelsea (aurialing) 21 96.90 105.57 5 23.81
12027. Anastasya (athh97) 21 64.27 81.22 5 23.81
12028. Askhat (askhat0109) 21 35.38 45.87 0 0.00
12029. A (__a_) 21 84.75 101.27 6 28.57
12030. Sourav (_sourav_) 21 29.80 34.69 1 4.76
12031. beroo (_nwahz) 21 75.66 91.21 11 52.38
12032. zlyxx (zlyxx) 21 84.70 110.47 6 28.57
12033. Ziclue (ziclue) 21 90.25 109.52 8 38.10
12034. Zemo (zemo77) 21 110.47 124.05 9 42.86
12035. asdf (zainamjad) 21 80.37 89.28 5 23.81
12036. wpm + x (x_wpm_more) 21 47.76 56.55 1 4.76
12037. ximecat (ximecat) 21 113.44 133.08 14 66.67
12038. wrentay (wrentay) 21 107.76 140.48 6 28.57
12039. Denny (what_tf_is_up_kyle) 21 59.41 80.73 5 23.81
12040. Whats (whatsderivative) 21 92.91 104.86 10 47.62
12041. wayexzee (wayexzee) 21 71.16 80.68 5 23.81
12042. Murka (wassupbuddy) 21 81.53 100.14 13 61.90
12043. Gabriel (warbros123) 21 77.93 98.53 9 42.86
12044. Velyro (velyro) 21 86.18 96.86 7 33.33
12045. BESTYINA (vdud3) 21 146.90 165.68 17 80.95
12046. Niko (varial) 21 132.33 154.77 17 80.95
12047. nat (vanilla7) 21 75.71 94.08 9 42.86
12048. Villan (v1llan) 21 47.54 54.75 2 9.52
12049. Eli (uvafan) 21 105.73 123.51 11 52.38
12050. David (usainturtle) 21 39.49 50.24 2 9.52
12051. Unique (unique1402) 21 59.69 79.81 7 33.33
12052. // (typist215) 21 83.10 97.00 10 47.62
12053. reiden (typingreiden) 21 86.97 104.82 6 28.57
12054. Asters (typer1typer) 21 101.69 117.57 9 42.86
12055. Nabil (twin_n) 21 64.66 86.03 2 9.52
12056. TrOn (tron_691) 21 44.46 50.92 1 4.76
12057. Top (tophatjones) 21 100.70 114.45 21 100.00
12058. Le Van (tlong900) 21 71.71 82.41 8 38.10
12059. Tony (tjzhao) 21 56.87 70.88 4 19.05
12060. tjk113 (tjk113) 21 89.35 105.58 6 28.57
12061. Tim (timduh) 21 52.07 59.04 3 14.29
12062. Matsvei (tictacfruit) 21 70.52 80.96 5 23.81
12063. Thursday (thursdays) 21 106.69 123.77 9 42.86
12064. Raymond (thiccthighs) 21 67.81 81.28 1 4.76
12065. CJ (the_winner_is_here) 21 57.31 70.20 4 19.05
12066. Hayden (the_dizzler) 21 85.35 99.55 8 38.10
12067. Devids (theneo) 21 107.59 126.89 8 38.10
12068. Albert (thehacker08) 21 63.84 73.19 3 14.29
12069. budda (theblackeye) 21 102.05 120.58 9 42.86
12070. th (thanasis2002) 21 93.79 112.30 12 57.14
12071. Reanu (terrenceskill) 21 56.88 67.87 3 14.29
12072. A (taffing) 21 71.01 82.13 0 0.00
12073. Priyabrata (s_h_a_r_k) 21 47.76 53.66 2 9.52
12074. sai (syrus_dhark) 21 49.02 61.33 1 4.76
12075. sus99hant (sus99hant) 21 60.70 73.89 4 19.05
12076. Avi (suppppp) 21 72.75 83.95 5 23.81
12077. Demon (sun_voca) 21 101.55 116.09 5 23.81
12078. Krystal (sunshinenmyeyes) 21 81.49 103.02 6 28.57
12079. Subhaan (subhaan) 21 79.82 97.22 4 19.05
12080. beiluo (beiluo) 21 64.29 74.29 9 42.86
12081. Oakton (oakton) 21 42.68 60.95 2 9.52
12082. squishyiop (squishyiop) 21 44.51 62.06 1 4.76
12083. Speedwalker (speedwalker68) 21 63.56 74.65 2 9.52
12084. Soulreaper (soulreaperdeath... 21 63.96 76.14 4 19.05
12085. slow typer (slooowest_typer) 21 58.47 72.63 2 9.52
12086. Sir (sirmaax) 21 72.55 103.30 6 28.57
12087. Silvia (silvia_thenan) 21 75.10 95.89 6 28.57
12088. Shikhar (shikhar_tyagi) 21 100.45 115.02 10 47.62
12089. shau (shauwei_0510) 21 64.10 79.74 4 19.05
12090. Indian_Lad (shashank5665) 21 52.83 60.74 2 9.52
12091. shailendra (shailendraji) 21 53.33 61.89 1 4.76
12092. Shahmir (shahmirishere) 21 93.70 115.57 10 47.62
12093. Shaheer (shaheer49) 21 64.18 71.08 6 28.57
12094. scqrch (scqrch) 21 60.65 66.30 4 19.05
12095. Tala (another_ostrich) 21 84.40 95.69 7 33.33
12096. Rijey (anilarq) 21 49.68 59.05 2 9.52
12097. Aniket (aniketb97) 21 54.15 64.20 3 14.29
12098. quitting = cringe (angeio) 21 164.89 183.93 19 90.48
12099. no sweat (anduatm) 21 89.45 101.53 9 42.86
12100. Ammar (ammarthetyper) 21 106.19 120.25 9 42.86
12101. AmmarDab3an (ammardab3an) 21 72.75 84.14 5 23.81
12102. al (allizer) 21 36.20 43.86 1 4.76
12103. Aliff (aliffhakimi) 21 95.39 113.95 11 52.38
12104. Alex (alextamago) 21 104.23 125.63 7 33.33
12105. Alb (alb_themighty) 21 62.06 74.98 3 14.29
12106. Alan (alan_hsiu) 21 25.65 34.38 0 0.00
12107. Jean (akrinias) 21 111.10 126.87 11 52.38
12108. Idas (aidasas) 21 97.95 117.92 10 47.62
12109. Residential (agent_resident2) 21 91.97 102.54 8 38.10
12110. ray (afrojelly) 21 91.32 105.36 8 38.10
12111. Sam (advil) 21 115.56 128.76 12 57.14
12112. Jannatul (adon22) 21 53.58 61.97 2 9.52
12113. abhishek (abhisheksaxenasep) 21 57.13 65.40 4 19.05
12114. A7med (a7med_1) 21 41.01 50.88 1 4.76
12115. Enzo (60wpmwhat) 21 86.62 99.85 8 38.10
12116. steve (21steven_) 21 83.54 111.00 3 14.29
12117. InsertNameHere (1ns3rtn4m3h... 21 95.55 117.13 4 19.05
12118. Subikshaa (subikshaa18) 21 63.54 79.94 8 38.10
12119. Chatham (cala95) 21 89.46 105.39 10 47.62
12120. Agno3317 (agno3317) 21 53.78 61.88 1 4.76
12121. Marek (smudla) 21 54.96 63.53 4 19.05
12122. sammy (whymehere) 21 31.88 43.83 3 14.29
12123. Jezzer (60wpmbot) 21 91.29 108.98 9 42.86
12124. Robert (r0bm4c) 21 70.76 82.45 8 38.10
12125. Zaid (kaitania) 21 93.83 115.78 17 80.95
12126. Angus (director7) 21 77.78 88.39 9 42.86
12127. Quamtam (quamtam) 21 71.53 93.24 5 23.81
12128. Dennis (deadmans_22) 21 63.59 74.99 6 28.57
12129. qbit (qixotic) 21 96.52 105.57 7 33.33
12130. go_ez_plz (go_ex_plz) 21 92.44 111.79 8 38.10
12131. Mark (verysourfox) 21 62.66 78.69 7 33.33
12132. Eminem (leonard_jose) 21 63.24 73.58 2 9.52
12133. James (xiero) 21 75.69 84.36 3 14.29
12134. Holden (hrmercer) 21 67.40 79.56 5 23.81
12135. Hudodo (hudodo) 21 48.61 72.80 4 19.05
12136. On the Go (rumasud99) 21 53.20 64.42 1 4.76
12137. Bryan (gambino478) 21 77.32 92.18 6 28.57
12138. Akmentop (akmentop) 21 68.98 84.26 6 28.57
12139. V (usotsuki) 21 48.04 57.39 4 19.05
12140. Ian (mail_order_bride) 21 56.66 70.02 2 9.52
12141. Roman (madness1st) 21 51.97 60.99 2 9.52
12142. Luke (lukeatme) 21 67.55 80.97 12 57.14
12143. Luis (luismiguelcopadiaz) 21 82.16 92.75 7 33.33
12144. patrick (lucky_ninja3412) 21 69.47 92.00 5 23.81
12145. Tekin (liggrod) 21 79.11 90.39 9 42.86
12146. Leo (leo123457) 21 53.83 63.42 18 85.71
12147. Lazer (lawins) 21 102.96 114.07 3 14.29
12148. Lars (larzz_z) 21 82.13 100.31 10 47.62
12149. Kshitij (kshitij21) 21 55.65 65.01 6 28.57
12150. Sean (kokamell16_) 21 48.43 58.12 2 9.52
12151. Koby (kobyhatton) 21 95.51 115.72 8 38.10
12152. V (kiritoyang) 21 103.19 131.43 7 33.33
12153. Kaylo (kaylo060) 21 80.92 97.99 6 28.57
12154. Mouhamed (karlosalol) 21 64.83 79.28 5 23.81
12155. Karen (karent_x3) 21 70.76 83.96 5 23.81
12156. Katie (kantielope) 21 82.34 99.20 4 19.05
12157. Kamrul (kamrul_ahsan) 21 29.52 34.13 1 4.76
12158. Kai (kaitheguy_) 21 81.52 97.75 7 33.33
12159. Aidyn (justaidyn) 21 95.87 105.53 6 28.57
12160. vroom (junap) 21 96.56 116.70 8 38.10
12161. Juan (juandz) 21 44.08 51.71 4 19.05
12162. Jeffrey (jshen13) 21 88.89 101.22 8 38.10
12163. Jono (jonodvorak) 21 128.40 142.72 13 61.90
12164. Jon (jonbeka) 21 56.10 64.37 3 14.29
12165. johnballs (johnballs) 21 92.20 101.38 6 28.57
12166. Johan (johanapa) 21 97.34 117.48 19 90.48
12167. toes_n_fingers (joe_froggy) 21 72.93 90.93 1 4.76
12168. Edward (jinsye) 21 96.48 115.18 6 28.57
12169. Jason (jihoon222) 21 134.10 150.88 19 90.48
12170. Jerry24562 (jerry24562) 21 82.38 92.03 0 0.00
12171. Water (jeffersonjap) 21 106.89 117.84 14 66.67
12172. Tobe (jeeko_pogi) 21 72.14 84.97 4 19.05
12173. Jason (jasew) 21 62.75 91.63 4 19.05
12174. Jamshidbek (jamshid_4510) 21 44.72 51.70 8 38.10
12175. James (jamesks) 21 85.44 96.74 7 33.33
12176. Jake (jakeypancakey) 21 108.93 129.44 11 52.38
12177. Corey (i_dont_like_anime) 21 88.11 113.44 7 33.33
12178. I type slow (itypeslowlol1) 21 99.73 117.98 9 42.86
12179. Eric (isoh) 21 94.94 112.59 7 33.33
12180. 스티븐 (ishes) 21 101.48 109.94 9 42.86
12181. Aleksandr Ippatev (ippatev) 21 71.96 95.75 9 42.86
12182. Insulin (insulingaming) 21 74.91 85.61 7 33.33
12183. Siddhant (indianracer385) 21 68.50 88.40 0 0.00
12184. Benji (ijneb) 21 86.04 111.12 5 23.81
12185. iCheese (icheese23) 21 101.81 117.49 10 47.62
12186. Fez (iamsuperspeed) 21 101.79 110.26 9 42.86
12187. xd (huskyyy) 21 102.85 122.23 12 57.14
12188. Nate (hoopstrings) 21 105.36 118.88 9 42.86
12189. Mike (hipsterdufus) 21 95.76 106.32 12 57.14
12190. Ace (hiken_ace) 21 74.60 84.97 14 66.67
12191. Hey (heythere0) 21 74.44 84.88 3 14.29
12192. Ifat (helloitsifat) 21 76.45 89.41 4 19.05
12193. Helena (helena_mp) 21 58.69 67.44 3 14.29
12194. Hecks (hecksadecimal) 21 91.93 113.57 10 47.62
12195. Egor (hawkeg) 21 55.80 66.58 6 28.57
12196. Hahohe (hahohe3) 21 98.74 123.62 9 42.86
12197. Karina (guyrina) 21 102.62 123.44 9 42.86
12198. Grigory (gregkhan) 21 92.42 110.96 12 57.14
12199. Miguel (gheed22) 21 85.91 98.79 8 38.10
12200. Eddie (ger_eddie) 21 71.14 77.07 4 19.05
12201. AtomicSkunk (georgel8314) 21 81.07 93.04 6 28.57
12202. Evan (gemofevan) 21 117.78 145.51 8 38.10
12203. Leo (geckuchicken) 21 68.23 85.15 7 33.33
12204. elio! (gabspyz) 21 80.94 95.30 5 23.81
12205. Charles (future965) 21 63.65 72.71 1 4.76
12206. SaltyHobo (saltyhobo) 21 88.53 105.36 6 28.57
12207. Sharif (sa524402) 21 26.89 37.95 5 23.81
12208. Rylez (rylezyt) 21 65.98 78.13 7 33.33
12209. Rory (roricus) 21 72.09 84.29 5 23.81
12210. ron (ronk17) 21 66.36 73.32 4 19.05
12211. Rodrigo (rodplaying) 21 47.12 53.06 1 4.76
12212. Robert (robertgrylls) 21 70.34 83.67 8 38.10
12213. Hans (retrovibes_11) 21 91.23 105.41 11 52.38
12214. redhotdancer1821 (redhotdan... 21 97.62 114.59 6 28.57
12215. Rebekah (rebekahtomski) 21 65.13 74.34 4 19.05
12216. Rawat (rawat_shiv) 21 43.64 51.01 3 14.29
12217. Rafail (raphaelpap) 21 68.92 82.57 20 95.24
12218. Nick (rageemy) 21 102.59 114.32 14 66.67
12219. Rae (rae149) 21 61.05 79.21 5 23.81
12220. rachet 22 (rachet_22) 21 91.30 109.61 7 33.33
12221. Sebastian (racermaster_) 21 59.55 72.22 2 9.52
12222. quat (quat) 21 97.79 112.47 7 33.33
12223. Hung (qhung312) 21 77.38 86.83 4 19.05
12224. Kong (qbored) 21 47.35 53.83 1 4.76
12225. Stuart (psephos) 21 93.41 114.47 6 28.57
12226. Prashant (prashant_204) 21 70.85 92.45 4 19.05
12227. ตาแดง (pitagorus) 21 88.42 99.17 5 23.81
12228. Philip (philr12) 21 79.75 91.13 5 23.81
12229. shea (pengu1927) 21 69.49 82.01 5 23.81
12230. Peachbird (peachbird) 21 51.38 65.66 6 28.57
12231. paxuy (paxuy) 21 68.62 80.51 3 14.29
12232. Patrick (patrick_st4r) 21 65.61 75.66 9 42.86
12233. boop (owiwchu) 21 63.21 72.16 2 9.52
12234. FREE PALESTINE (os1506) 21 80.95 92.68 5 23.81
12235. orangie (orangie_) 21 47.50 57.56 2 9.52
12236. Adrian (orangebase) 21 131.34 147.57 15 71.43
12237. Omsin (omsinkrissada) 21 83.00 96.80 8 38.10
12238. S0R4 (omniores22) 21 94.80 110.64 8 38.10
12239. Nazmus (nxbot) 21 53.66 64.11 2 9.52
12240. number1 (number1racer) 21 45.99 54.31 2 9.52
12241. Evan (nullly) 21 74.79 96.62 5 23.81
12242. Noxellar (noxellar) 21 93.52 108.09 7 33.33
12243. William (not_your_username) 21 67.34 92.22 4 19.05
12244. notkailey (notkailey) 21 85.04 98.50 9 42.86
12245. noob_master (noob_master_6_9) 21 65.01 74.86 5 23.81
12246. Nicolai (nicolair222) 21 102.33 114.36 5 23.81
12247. Nick (nickbanderson) 21 85.87 111.20 12 57.14
12248. Blac (nice_tea) 21 72.50 93.12 6 28.57
12249. Narayan (narayan2002) 21 58.85 73.49 16 76.19
12250. AgniArse (n3ug13rd3) 21 79.67 89.44 5 23.81
12251. Moataz (mizosoft) 21 77.89 88.08 7 33.33
12252. Dominik (misiekwiev13) 21 56.79 66.42 2 9.52
12253. Lior (miliday) 21 42.62 52.07 3 14.29
12254. Outlaw (midnight_tuna) 21 77.79 97.52 3 14.29
12255. Michael (michael9009) 21 91.74 126.82 6 28.57
12256. Muhammad (mhasan01) 21 102.13 113.66 6 28.57
12257. meme (mememem) 21 90.62 103.78 9 42.86
12258. invader (megawutt) 21 64.37 75.30 8 38.10
12259. MZ (mbzz) 21 83.43 99.29 8 38.10
12260. Mateus (mateusmelo) 21 64.71 77.77 7 33.33
12261. roee (masterroee3) 21 64.07 80.91 5 23.81
12262. Mast (masterlyhoney14) 21 48.50 59.55 0 0.00
12263. Ammar (marsicus) 21 84.41 101.86 10 47.62
12264. Marcki (marcki) 21 76.20 84.17 4 19.05
12265. Markus (marcasrealaccount) 21 93.93 105.45 10 47.62
12266. Mark (maolson97) 21 87.98 107.89 6 28.57
12267. tstats[mannyblaze] (mannybl... 21 58.17 80.57 3 14.29
12268. MoshuFingers (scotscottie) 20 73.67 85.55 7 35.00
12269. ︻デ═一▸ (santoshmsk) 20 61.65 74.72 7 35.00
12270. Me (sandwichshop) 20 79.89 88.49 11 55.00
12271. Saikiran (sai_kiran_07) 20 56.31 72.76 3 15.00
12272. Sai Mani Raj (saimaniraj) 20 70.34 89.57 6 30.00
12273. Roy (rwfeng72) 20 93.68 114.73 7 35.00
12274. Ron (ronsar) 20 50.89 60.12 3 15.00
12275. Blue (rodtypes) 20 79.79 99.27 8 40.00
12276. student bored in school (ri... 20 62.09 69.34 4 20.00
12277. Rikka (rikkaislife) 20 38.07 45.32 8 40.00
12278. ric (ricman0) 20 70.38 89.12 3 15.00
12279. ReklessDragon (reklessdragon) 20 95.34 113.22 9 45.00
12280. Boris (redsnake07) 20 113.45 132.75 8 40.00
12281. Eugene (rawners) 20 71.77 80.27 8 40.00
12282. Randy (randonandoz) 20 93.58 107.02 12 60.00
12283. Daniel (randomgamer1017) 20 106.39 132.92 10 50.00
12284. Ricardo (rambolis) 20 66.25 75.78 2 10.00
12285. deadass (rajteezy) 20 67.18 77.23 2 10.00
12286. rain (rainnonquit) 20 154.92 178.95 18 90.00
12287. Raghav (raghav8822) 20 74.29 84.35 4 20.00
12288. Robbie (qweens) 20 76.86 89.79 8 40.00
12289. Questt (questtlee) 20 93.01 111.73 9 45.00
12290. qazaqyanke (qazaqyanke) 20 38.72 80.06 1 5.00
12291. Jumpo (purplejumpo) 20 97.78 116.16 6 30.00
12292. O]]!! (prvlg) 20 87.21 104.01 8 40.00
12293. huge (postmortem) 20 97.50 122.23 10 50.00
12294. Poochi (poochizoom) 20 125.91 153.61 13 65.00
12295. poepmannetje (poepmannetje) 20 71.15 86.19 4 20.00
12296. Pavel Kotsev (pkotsev) 20 71.31 78.87 3 15.00
12297. stop quitting (phrosnite) 20 83.60 106.42 3 15.00
12298. Peyush (peyush) 20 45.90 55.42 2 10.00
12299. David (peacehf123) 20 92.64 102.68 0 0.00
12300. The Write Tale (pchanbps1) 20 93.11 99.83 8 40.00
12301. Gibby (papimonster69) 20 84.70 94.25 7 35.00
12302. Ali (oorkade) 20 66.47 77.30 11 55.00
12303. omar (omarkarboul) 20 50.59 56.75 1 5.00
12304. Ohm (ohmstar123) 20 82.72 98.34 9 45.00
12305. Nathan (nper4lta) 20 61.60 75.32 4 20.00
12306. Not (not_cracked_) 20 104.60 120.01 6 30.00
12307. salad (notyoursalad) 20 81.38 93.49 6 30.00
12308. Molly (notevenhalf2000) 20 84.43 103.16 3 15.00
12309. Kaat (norbertathedragon) 20 61.37 79.97 2 10.00
12310. wayne (nonlimit) 20 85.64 98.87 4 20.00
12311. Alex (nobrakes58) 20 90.92 107.22 7 35.00
12312. Decent (nicokart) 20 76.29 92.04 3 15.00
12313. troi lanh uoc dc nam tay e ... 20 59.95 98.35 9 45.00
12314. luzy (neptunehoney) 20 98.27 121.70 8 40.00
12315. Necdet Ali (necdetaliozdur) 20 79.65 87.68 7 35.00
12316. Naveen Kumar (naveen_1729) 20 59.94 73.35 1 5.00
12317. ᕕ༼ ; •̀︿•́༽... 20 102.93 122.52 18 90.00
12318. Adam (musterling) 20 103.03 119.91 16 80.00
12319. mrw1 (mrw1) 20 76.95 91.52 7 35.00
12320. Friden (mrtokke) 20 63.68 77.22 5 25.00
12321. Andy (mrfoggz) 20 87.13 95.69 2 10.00
12322. Mostafah (mosty295) 20 76.19 89.70 8 40.00
12323. eric (mordor5555) 20 77.70 96.66 7 35.00
12324. G.A.F (mochillavila) 20 56.37 69.29 2 10.00
12325. mobo (mobo) 20 123.31 150.55 13 65.00
12326. Eugene (mineugene) 20 85.82 95.65 9 45.00
12327. millstypes (millstypes) 20 70.96 83.81 7 35.00
12328. Zhikouan (mikelee543) 20 87.88 101.44 7 35.00
12329. Hải (microwaveablepasta) 20 77.06 98.74 5 25.00
12330. Mia (miajasmine) 20 76.56 93.78 5 25.00
12331. mg (mgperson) 20 114.81 131.83 11 55.00
12332. memmoman (memmo) 20 74.11 96.62 7 35.00
12333. Tammy (mausaye) 20 79.29 91.70 5 25.00
12334. Matin (matin_pasargad) 20 84.18 98.41 5 25.00
12335. juzerr (markopokupecc) 20 95.93 125.79 5 25.00
12336. Mark (markmango) 20 94.07 112.28 7 35.00
12337. nah id win (aragorn_the_snake) 20 125.75 136.98 1 5.00
12338. AppleSnap (applesnap_1) 20 57.27 68.16 5 25.00
12339. Eric (appleipad556) 20 132.93 147.26 17 85.00
12340. anntaylor (anntaylorn) 20 134.77 172.29 17 85.00
12341. Anita (anita0718) 20 99.20 119.83 8 40.00
12342. anik (anikakash) 20 40.35 52.45 3 15.00
12343. Wolfie (amrkhaled09) 20 98.61 127.33 10 50.00
12344. Amin (amin_farzane) 20 73.55 80.67 4 20.00
12345. Amelia (amelia_j_s) 20 56.88 64.06 7 35.00
12346. Alper (alperiox) 20 108.08 129.26 7 35.00
12347. Alon (alon276) 20 101.91 113.72 12 60.00
12348. TSpin (all_type) 20 76.05 87.81 4 20.00
12349. Jesse (alfonz) 20 68.70 80.89 5 25.00
12350. Akbor (akbor_ab) 20 52.12 65.11 2 10.00
12351. Eduardo (airplane_cakes) 20 84.07 109.36 5 25.00
12352. Aimbot (aimbot2003) 20 66.96 77.90 7 35.00
12353. Rasmis (ahtavarasmus) 20 54.82 67.23 6 30.00
12354. Afzaal (afzaalahmad) 20 45.86 59.37 3 15.00
12355. Muhammad (afi__afi) 20 43.13 52.91 1 5.00
12356. affnah (affnah) 20 121.36 134.76 6 30.00
12357. Achyut (achyut_india) 20 76.06 90.28 5 25.00
12358. Alan (acfrost3) 20 50.89 60.32 2 10.00
12359. Abqw112 (abqw112) 20 95.42 112.34 8 40.00
12360. Syrus (abbys_sof) 20 80.23 91.80 7 35.00
12361. AA Batteries (aa_batteries) 20 80.02 91.42 3 15.00
12362. aarush_ (aarush_) 20 81.21 92.81 6 30.00
12363. Aadhi (aadhi936) 20 56.19 60.15 1 5.00
12364. Santhosh (54nth05h) 20 62.15 74.50 7 35.00
12365. Suns (49suns) 20 70.75 80.14 2 10.00
12366. Greedy (greedy_78) 20 72.90 89.27 5 25.00
12367. ThPh (thph) 20 18.72 22.86 2 10.00
12368. bence (stefler01) 20 70.94 83.37 6 30.00
12369. Senvidu (galaxy_slayer_zed) 20 56.32 67.11 0 0.00
12370. tstats[mirfattah] (mirfattah) 20 44.75 55.80 1 5.00
12371. Unknown (__unkn0wn__) 20 85.15 102.98 5 25.00
12372. Michael (mspain0729) 20 74.59 87.90 7 35.00
12373. Alex (alexm11593) 20 54.27 64.97 6 30.00
12374. Lulu (aztral) 20 58.75 68.38 6 30.00
12375. Joshua (josh3000) 20 60.13 72.86 7 35.00
12376. G (foad420) 20 74.76 97.59 6 30.00
12377. Lucas (opoutinechooo) 20 76.31 86.61 6 30.00
12378. Tony (generalbob1212) 20 90.57 109.99 8 40.00
12379. Romain (romainl456) 20 65.46 80.79 6 30.00
12380. Dana (cutie68176) 20 39.59 46.69 0 0.00
12381. YellowyLOL (seojoon) 20 81.92 93.87 7 35.00
12382. Di (qazydi) 20 64.67 75.44 13 65.00
12383. Pytist (talentoncolemak) 20 79.13 88.80 8 40.00
12384. Mike (mikechill_69) 20 56.41 70.86 4 20.00
12385. rhi (okrhi) 20 75.01 87.64 2 10.00
12386. Daniel (moixland) 20 100.34 116.07 12 60.00
12387. jlang (jlang2) 20 65.60 83.25 4 20.00
12388. Dave (dsolesvik) 20 102.24 122.71 14 70.00
12389. Hunter (midorieon) 20 57.76 71.42 3 15.00
12390. Haiku (mastahaiku) 20 82.88 96.08 9 45.00
12391. Jonas (jonstep) 20 46.84 59.71 2 10.00
12392. enrique (fugitivecloud) 20 105.59 121.62 9 45.00
12393. nathanael (flyeroscer) 20 56.10 74.40 4 20.00
12394. flourish (fl0urish) 20 81.39 112.48 8 40.00
12395. Draco (fish0228) 20 71.91 88.72 18 90.00
12396. LEB (fhgfl) 20 42.59 51.78 0 0.00
12397. fbabylemon (fbabylemon) 20 85.22 96.15 7 35.00
12398. Fvthy (fathyamer) 20 52.67 61.81 2 10.00
12399. evaqate (evaqate) 20 64.63 77.87 3 15.00
12400. Thav (epic_boyo_123) 20 56.04 66.75 2 10.00
12401. EncodedTyper (encodedtyper) 20 89.79 106.48 6 30.00
12402. Tyrell (elter) 20 53.90 73.70 6 30.00
12403. Joe (elisouthworth) 20 113.89 143.88 13 65.00
12404. Arslan (elbosynov) 20 26.40 30.86 14 70.00
12405. g (eggwen) 20 64.09 73.29 6 30.00
12406. Brian (eeyjnairb) 20 105.23 119.26 8 40.00
12407. Maskedknight (edward5958) 20 94.62 117.06 7 35.00
12408. Tajwar (dxadcircuit) 20 74.25 91.38 6 30.00
12409. DUFOUR (dufour) 20 116.76 139.05 10 50.00
12410. Drifter (drifter103) 20 120.66 133.80 8 40.00
12411. Dhananjay (dk35840) 20 54.49 62.39 5 25.00
12412. Justin (disney6) 20 106.59 136.70 13 65.00
12413. DInokyd (dinokyd) 20 74.37 91.00 6 30.00
12414. Devansh (devansh_dua) 20 39.48 47.96 2 10.00
12415. Peeter (detectiveleht) 20 49.65 58.24 6 30.00
12416. A (deoignition) 20 70.41 79.44 2 10.00
12417. Demon (demon_hunter_bd) 20 48.45 55.67 1 5.00
12418. Dicky (dcstormrage) 20 67.56 78.77 7 35.00
12419. Darjinero (darjinero) 20 88.17 99.41 9 45.00
12420. Alex (dangercomeswithalex) 20 70.14 87.26 9 45.00
12421. fingers hurt (cxyym) 20 100.69 116.49 10 50.00
12422. csAxer8 (csaxer) 20 101.94 126.48 9 45.00
12423. CRISTO (cristomathew7) 20 69.41 83.53 4 20.00
12424. Donkey (crazybraden) 20 82.69 97.28 4 20.00
12425. Nero was here (correct_fing... 20 116.13 132.59 11 55.00
12426. cana (cnry) 20 110.02 125.26 12 60.00
12427. D (chubbieveggie) 20 84.59 96.01 5 25.00
12428. Chris (christrilling) 20 115.70 128.49 15 75.00
12429. Christian (chrillzen) 20 99.26 119.49 5 25.00
12430. chez (chezzion) 20 81.38 96.16 2 10.00
12431. Chad (chad87) 20 98.04 115.80 11 55.00
12432. carpathian (carpathian) 20 83.72 103.11 5 25.00
12433. Shaan (captainshaani) 20 47.06 59.55 5 25.00
12434. Christopher (canorve) 20 53.80 63.70 1 5.00
12435. sam (candle4) 20 93.93 116.23 6 30.00
12436. Callow (callowblack) 20 56.60 67.29 4 20.00
12437. Mohamed (byfarag) 20 122.98 144.18 12 60.00
12438. Brady (bward62) 20 94.75 119.25 8 40.00
12439. Bob (bushybrows) 20 97.90 118.49 9 45.00
12440. Alicia Peas (bundt) 20 65.90 77.87 5 25.00
12441. (bummered) 20 130.52 168.87 10 50.00
12442. Brian (btong) 20 111.37 135.12 7 35.00
12443. Bruh (bruhletuce) 20 63.19 72.75 6 30.00
12444. hamger (broncos1388) 20 60.52 76.54 2 10.00
12445. Sami (britishrifleman) 20 66.45 88.52 1 5.00
12446. Random (bogdanmironov) 20 81.38 93.98 4 20.00
12447. Gregory (bobren) 20 97.35 106.42 5 25.00
12448. noms (bloopdaferd) 20 81.33 98.05 4 20.00
12449. bloncing (bloncing) 20 66.40 77.28 4 20.00
12450. Kana smurf (blackmind) 20 91.77 107.86 11 55.00
12451. Matt (bigrocku) 20 73.50 87.94 6 30.00
12452. Joe (bigboythrows) 20 100.06 113.95 9 45.00
12453. bharat (bharatcoder007) 20 52.51 64.83 4 20.00
12454. z (bazackk4) 20 79.21 97.12 9 45.00
12455. Baran (baranomania) 20 84.62 101.33 5 25.00
12456. Banun (banun) 20 55.99 68.91 2 10.00
12457. Bangerzz (bangerzz) 20 65.31 86.98 2 10.00
12458. Irsyad (azcat01) 20 66.51 77.53 4 20.00
12459. Korbin (auvvia) 20 84.36 102.42 7 35.00
12460. AUDEAMUS (audeamus) 20 61.90 79.57 1 5.00
12461. Astra (astrame) 20 77.14 89.27 4 20.00
12462. ASP00KY (aspooky) 20 57.49 77.33 8 40.00
12463. revaN (ashun) 20 101.69 114.79 6 30.00
12464. wiz (_wiz_) 20 60.86 71.40 5 25.00
12465. !! (zzzoodle) 20 83.14 103.95 3 15.00
12466. Franky (zyrefe) 20 109.33 128.60 10 50.00
12467. Zack (zqlimy) 20 77.58 90.06 4 20.00
12468. yaotly (yaotli) 20 48.15 54.06 2 10.00
12469. Yadira (yadirairiz) 20 97.01 118.74 7 35.00
12470. XzXc (xzxc4444) 20 72.79 82.97 5 25.00
12471. xtian (xtian91) 20 63.74 73.79 4 20.00
12472. XpORPID (xporpid) 20 85.94 104.79 6 30.00
12473. Xel (xelqqii) 20 77.42 93.35 6 30.00
12474. matvei (xbabushka) 20 60.24 81.32 9 45.00
12475. Bún bò Huế (wynos) 20 125.29 139.48 17 85.00
12476. w0wdead (wowdead) 20 55.27 70.12 18 90.00
12477. Lucas (wollmyth) 20 83.70 97.11 2 10.00
12478. . (wheelzaboo) 20 79.70 90.70 4 20.00
12479. Nathaniel (wetaketolong) 20 91.86 106.82 5 25.00
12480. Wes (wespiard) 20 77.20 92.99 12 60.00
12481. Erlend (weserl) 20 55.56 65.71 2 10.00
12482. Jeff (websterjs) 20 84.00 94.12 3 15.00
12483. Pat (wareem) 20 95.38 114.41 7 35.00
12484. Cedric (vlako) 20 86.72 102.77 5 25.00
12485. Visura (visuraprabod) 20 60.73 66.98 3 15.00
12486. Kranite (vg_infernozz) 20 94.88 115.29 9 45.00
12487. Varaug (varaug33) 20 100.85 110.33 11 55.00
12488. Vaibhav (vaibhav974) 20 89.61 102.56 5 25.00
12489. Sergei (unicrus) 20 63.47 70.86 4 20.00
12490. Atichon (ultraballminorz) 20 74.81 85.55 4 20.00
12491. Roman (tyronefromdetroit_7) 20 61.00 69.36 2 10.00
12492. Sebas (typingtiran) 20 78.16 93.99 6 30.00
12493. Brent (typer1987) 20 93.63 114.03 8 40.00
12494. Tristan (typeinthebox) 20 69.22 89.57 4 20.00
12495. Tycho (tychobroucke) 20 88.89 104.79 5 25.00
12496. Tyler (tybow99) 20 108.39 117.49 6 30.00
12497. Tanya (tyarbrough71) 20 75.22 89.96 4 20.00
12498. bec (twentyonepotato) 20 81.34 94.81 4 20.00
12499. Tunihorn (tunihorn) 20 100.40 131.37 11 55.00
12500. tsds (tsds) 20 67.89 85.02 4 20.00
12501. trut (trut) 20 87.60 100.61 4 20.00
12502. trex (trexwithlasereyes) 20 72.57 82.78 11 55.00
12503. Toktar (tokha) 20 35.94 42.32 0 0.00
12504. Kocsis (tisq13) 20 55.78 67.66 4 20.00
12505. DataDev (tinysingh) 20 52.91 68.36 2 10.00
12506. Ian (tinysilverfish) 20 99.99 144.27 5 25.00
12507. tiglas (tiglas) 20 71.32 80.57 4 20.00
12508. TidyTurtle (tidyturtle) 20 98.79 125.67 6 30.00
12509. Dan (themanisdan) 20 96.31 108.87 7 35.00
12510. Drew (thecomedyne04) 20 90.00 115.35 7 35.00
12511. nabileT (telibanalex) 20 94.33 108.61 9 45.00
12512. ty (tbtbtbt) 20 121.15 154.58 13 65.00
12513. Fabian (tay0w) 20 86.79 110.68 7 35.00
12514. ee (tally_dvorak) 20 93.12 103.56 10 50.00
12515. Jonas (superare) 20 78.39 103.63 3 15.00
12516. Suddenly (suddenlynothing) 20 96.50 108.43 8 40.00
12517. Squeeeeeps (squeeeeeps) 20 48.49 57.70 2 10.00
12518. Spiren (spirenz) 20 113.89 134.49 10 50.00
12519. Victoria (speedrun_dreamstyle) 20 79.33 95.19 16 80.00
12520. snipe (snipe75) 20 50.42 67.45 1 5.00
12521. Jacob (sl_jacob) 20 80.86 92.15 2 10.00
12522. Devin (slinky88) 20 67.29 80.61 6 30.00
12523. Skylos (skylos) 20 107.90 136.79 7 35.00
12524. Manal (skullcicator) 20 91.26 117.20 5 25.00
12525. sknny (sknny) 20 80.64 95.30 13 65.00
12526. sk (skkk) 20 105.77 116.94 6 30.00
12527. SIX (six_p) 20 60.11 66.78 3 15.00
12528. Hmm (sironronron) 20 105.10 123.82 11 55.00
12529. Shuraque (shuraque) 20 74.48 85.56 5 25.00
12530. Shrimpo (shrimpo) 20 82.47 98.82 7 35.00
12531. Shichibukai (shichibukai2002) 20 93.26 103.38 8 40.00
12532. Shashanka (shashankanath) 20 49.04 61.21 13 65.00
12533. Shadow (shadowrose01) 20 43.73 49.09 1 5.00
12534. Themis Evangelinos (sellak) 20 50.86 60.79 2 10.00
12535. Piccolo (makankasappa) 20 67.83 79.11 6 30.00
12536. Mahmudul (mahmudul_hhh) 20 44.95 56.64 3 15.00
12537. Matthew (m1234d) 20 122.16 146.89 12 60.00
12538. Luke (lukethepuke) 20 47.04 54.23 1 5.00
12539. Lucy (lucyd266) 20 82.28 92.52 9 45.00
12540. Louie John (loumexx12) 20 83.79 97.61 10 50.00
12541. Lilah (livymud) 20 45.69 50.64 5 25.00
12542. lex (lex_isamess) 20 103.73 134.40 12 60.00
12543. lettuce (lettuceandahalf) 20 79.25 104.07 5 25.00
12544. Artur (lepayo) 20 112.02 137.72 9 45.00
12545. Leo (leo_typing) 20 80.10 97.05 3 15.00
12546. leftmask35 (leftmask35) 20 46.51 54.27 2 10.00
12547. Darrell (lastronus) 20 98.76 116.35 9 45.00
12548. kRystal (krystal69) 20 67.95 88.79 13 65.00
12549. Kevin (kevinu) 20 112.48 126.59 8 40.00
12550. kp (kennethputra) 20 83.72 100.05 4 20.00
12551. Kaybe (kaybnde) 20 101.70 117.87 8 40.00
12552. Mr. lee's expository writin... 20 134.35 148.58 15 75.00
12553. kauko (kaukokolka) 20 79.52 97.28 17 85.00
12554. Kalash (kalz25) 20 86.18 101.63 2 10.00
12555. salah (kaltab) 20 66.88 76.47 3 15.00
12556. Leo (kakiu2000) 20 51.87 58.14 6 30.00
12557. abdelrhman (kahraba92) 20 40.18 47.43 1 5.00
12558. Eliza (kaeco_) 20 26.16 37.63 3 15.00
12559. J (jyorange) 20 119.26 154.48 12 60.00
12560. Jonathan (jyap042) 20 66.44 74.22 4 20.00
12561. Joseph (jv33zy) 20 103.41 118.82 9 45.00
12562. Joe (jqal) 20 90.32 105.39 6 30.00
12563. Josh (joshmgeorge) 20 81.46 91.80 6 30.00
12564. josh (joshahk) 20 88.90 121.58 7 35.00
12565. Sweaty (josef_stylin) 20 127.95 151.37 11 55.00
12566. 23 (jorgexdlol) 20 70.41 82.16 6 30.00
12567. Johan (joey67) 20 64.59 77.28 8 40.00
12568. Joel (joel_w2) 20 101.62 112.56 5 25.00
12569. jupiter (joaelis) 20 45.98 72.31 2 10.00
12570. John (jjov17) 20 74.01 86.42 1 5.00
12571. Jim (jim90247) 20 58.35 68.09 2 10.00
12572. jesad (jesadilvan) 20 62.87 75.20 6 30.00
12573. hmm (jerm_killer) 20 80.40 95.34 5 25.00
12574. Dominik (jazzon) 20 98.48 122.81 7 35.00
12575. Takoyaki (jayisloco) 20 51.65 59.88 2 10.00
12576. jam_xd_ (jam_xd_) 20 91.14 104.90 3 15.00
12577. Jake (jakepf00dvorak) 20 79.74 89.12 5 25.00
12578. Rahul (jakatir) 20 87.08 106.50 7 35.00
12579. Jaime (jaimeathedisco) 20 80.50 94.06 5 25.00
12580. Jahid (jahidk9) 20 42.73 53.85 5 25.00
12581. jackmaoff (jackmaoff) 20 68.53 81.63 6 30.00
12582. Jack (jackcoleero) 20 73.96 87.48 7 35.00
12583. isthislewz (isthislewz) 20 93.39 104.83 6 30.00
12584. Isaac (ipohzw) 20 87.23 111.04 8 40.00
12585. IpohGirl (ipohgirl8) 20 56.44 73.40 6 30.00
12586. Kristijan (invisibleloki) 20 110.11 118.74 11 55.00
12587. Stephen (installed) 20 126.09 167.79 9 45.00
12588. Elskrim (important) 20 114.11 138.77 12 60.00
12589. WhatIsLowkey (ihorsedyou) 20 126.67 144.83 12 60.00
12590. Pickle (iceberger17) 20 74.39 95.44 5 25.00
12591. iAmPardi (iampardi) 20 104.16 123.76 11 55.00
12592. Hynoh (hynoh) 20 95.85 116.56 4 20.00
12593. HoDaMoFoDor (hodamofodor) 20 97.57 119.63 11 55.00
12594. hissi (hissi) 20 88.97 109.90 7 35.00
12595. Hibird (hibird) 20 107.80 118.76 15 75.00
12596. Hassan (hassanalmatar) 20 61.28 70.99 3 15.00
12597. Hanica (hanicanii) 20 58.71 70.94 6 30.00
12598. Hamzah (hamzaaho7722) 20 36.13 40.56 2 10.00
12599. Erik (hadooo) 20 79.76 91.64 4 20.00
12600. Guilherme (guilhaugusto) 20 57.68 67.00 2 10.00
12601. tstats[guest_typists] (gues... 20 86.64 114.30 6 30.00
12602. Kevin (gtwatt) 20 75.18 86.56 8 40.00
12603. uhhhhhh (gtiff71) 20 94.16 106.93 9 45.00
12604. Gr0undhog_x (gr0undhog) 20 104.70 125.68 10 50.00
12605. gokewho (gokewho) 20 130.52 150.37 12 60.00
12606. Goal_200wpm (goal_200wpm) 20 53.24 62.40 3 15.00
12607. Hugo (glaucon) 20 82.18 92.54 5 25.00
12608. Yioryis (giorgis) 20 107.75 130.73 13 65.00
12609. Utkarsh (gbuckets30) 20 92.45 101.73 4 20.00
12610. Gabe (garff) 20 55.05 61.52 1 5.00
12611. garetmi (gammex) 20 80.54 97.55 3 15.00
12612. Gamer (gamer650xd) 20 91.00 110.73 9 45.00
12613. Fyter (fyter) 20 75.44 87.74 2 10.00
12614. Earl (furankuring) 20 86.90 98.00 9 45.00
12615. Segs (mahrush) 19 56.47 68.10 9 47.37
12616. Mahmoud (mahmoudalbadarin) 19 66.47 75.35 5 26.32
12617. Mack (mackimations) 19 87.73 100.76 7 36.84
12618. tomcr00se (lqszlo) 19 60.57 77.21 17 89.47
12619. Lowie (lowie_987) 19 67.36 78.19 6 31.58
12620. Jonathan (lone_lee) 19 93.49 113.93 7 36.84
12621. Elisabeth (liz4liz5) 19 98.10 121.99 9 47.37
12622. xhulio (lighting11) 19 65.47 79.97 5 26.32
12623. leonardo (leonardouwu) 19 64.90 74.78 3 15.79
12624. Lemons (lemonslmfao) 19 53.56 61.72 10 52.63
12625. Lazyteam (lazyteam) 19 73.07 87.39 4 21.05
12626. Lucas (larkluco) 19 55.97 63.86 4 21.05
12627. Larisa (larisa402) 19 74.54 91.57 4 21.05
12628. ⠀ (lain_) 19 58.53 71.36 4 21.05
12629. Solomann (kuttamma01) 19 108.22 127.85 10 52.63
12630. Jakob (kroelle_korean) 19 94.39 107.52 10 52.63
12631. Kristian (kristiandiana) 19 69.02 80.09 5 26.32
12632. Kazoo (kosu_kat) 19 72.81 79.97 6 31.58
12633. Purple (komnambongo) 19 111.67 143.82 8 42.11
12634. Ebok (kobe5623) 19 94.26 109.34 10 52.63
12635. Yesitsme (kingbee11) 19 49.49 62.49 3 15.79
12636. Tony (kevinneeraj) 19 112.44 130.81 11 57.89
12637. Kazuki (kazuki_kun) 19 88.60 99.76 6 31.58
12638. Kažkas (kazkass) 19 70.76 77.12 5 26.32
12639. Ayush (kanodiaayush) 19 93.33 111.13 5 26.32
12640. Kanazaki (kanazaki) 19 81.14 95.68 7 36.84
12641. Kagero (kagero_) 19 67.36 85.93 4 21.05
12642. bruh (k3nny11) 19 67.54 85.28 4 21.05
12643. Juniper (junipergd) 19 108.54 144.84 12 63.16
12644. Julia (juliazc) 19 88.30 101.75 4 21.05
12645. Jessica (jsilvers27) 19 74.73 85.84 5 26.32
12646. Joseba (jouelcamper555) 19 56.97 73.52 2 10.53
12647. Josiah (josiah_cw) 19 79.92 89.81 2 10.53
12648. yerimiese (johwee) 19 94.59 108.88 7 36.84
12649. Joel (joellimcy129) 19 94.11 111.97 15 78.95
12650. Jxshify (jkbestgamer) 19 106.60 138.24 18 94.74
12651. Thomas (jitensha03) 19 76.95 97.83 10 52.63
12652. Jillian (jillianbonfoeyoops... 19 55.30 67.40 10 52.63
12653. Jesse (jesser1440) 19 73.08 85.06 5 26.32
12654. JerseySlums (jerseyslums) 19 84.12 113.47 7 36.84
12655. Jerin (jerinjames) 19 54.29 63.63 5 26.32
12656. J (jdizzla) 19 121.45 149.63 8 42.11
12657. James (james_jjv) 19 72.61 87.24 7 36.84
12658. James (jameshasconnected) 19 50.01 67.16 1 5.26
12659. James (james0306) 19 79.21 95.95 2 10.53
12660. Jam (jamelele) 19 125.27 145.60 13 68.42
12661. Jax (jacksonn131) 19 84.58 107.12 4 21.05
12662. Jack (iviagicjack) 19 97.65 113.23 7 36.84
12663. ivan (ivanferraro) 19 74.57 86.42 3 15.79
12664. Tact (itstact) 19 98.73 114.36 8 42.11
12665. itsgohtime (itsgohtime) 19 125.10 134.80 13 68.42
12666. Juan (isayuno) 19 100.88 114.53 10 52.63
12667. Kylle (iomeotic) 19 73.44 91.31 6 31.58
12668. amir (ioio) 19 88.30 113.80 13 68.42
12669. Nicolas (insont) 19 78.22 90.78 7 36.84
12670. Inox (inox) 19 85.37 97.25 6 31.58
12671. alvarado (im_wilin) 19 81.86 95.99 5 26.32
12672. Lawrence (imetsia) 19 106.25 116.13 8 42.11
12673. Thomas (ilikebigtitties69) 19 67.31 74.40 7 36.84
12674. Jim (ifeelhyper) 19 114.46 134.56 11 57.89
12675. icening (icening) 19 40.88 45.93 4 21.05
12676. Ian (iango23) 19 59.97 75.34 5 26.32
12677. Skylar (iamskyhawk) 19 90.70 101.64 11 57.89
12678. Ashish (iamprogrammar) 19 66.03 73.90 5 26.32
12679. IAGamingWay (iagamingway) 19 74.86 87.68 14 73.68
12680. Randy (hype_rion) 19 62.18 83.28 3 15.79
12681. Brian (hydrobox) 19 85.30 96.46 2 10.53
12682. Hoang (huyyyyyyyyyyyyyyyyy) 19 70.28 77.67 4 21.05
12683. me (hseruslihkus) 19 49.88 59.32 2 10.53
12684. Steven (hondasivakgaming) 19 77.87 104.50 6 31.58
12685. Hol (holster) 19 92.42 107.00 9 47.37
12686. HerrBlinkenlicht (herrblink... 19 64.46 80.41 1 5.26
12687. ok (herbaltea) 19 97.80 121.03 9 47.37
12688. Hazim (hazm) 19 98.60 116.91 13 68.42
12689. Hari Chandan Das (harichand... 19 57.68 67.19 1 5.26
12690. titty (happyfaceman) 19 67.64 81.72 5 26.32
12691. IHnanah (hanahaoha) 19 134.92 176.36 16 84.21
12692. Hamlet (hamabaya) 19 102.51 115.47 5 26.32
12693. Nah (halo375) 19 58.54 69.88 5 26.32
12694. LE ANH QUAN (hacbachmaquan) 19 82.20 97.58 8 42.11
12695. Andy (gunwing54) 19 96.66 114.89 4 21.05
12696. Nelson (guaxini) 19 53.11 61.88 1 5.26
12697. Gavin (gt3ch1) 19 95.10 118.12 8 42.11
12698. Geo (godex) 19 95.48 114.43 7 36.84
12699. Daniel (gismo359) 19 82.93 92.81 8 42.11
12700. Gabi (gabitzuxxl) 19 109.49 121.68 7 36.84
12701. David (fuzzycheeks) 19 111.26 130.23 8 42.11
12702. blaine (frikker) 19 118.12 151.78 15 78.95
12703. Erika (frenzymania) 19 84.77 101.64 3 15.79
12704. Lukas (fr0stbites) 19 77.75 90.89 8 42.11
12705. fosty (fostyfog) 19 46.57 62.62 5 26.32
12706. Sakura (foreheady) 19 75.64 84.72 1 5.26
12707. fred (foop1) 19 112.20 128.19 10 52.63
12708. Ray (flexray) 19 86.94 108.85 7 36.84
12709. FlaTrix (flatrix) 19 312.06 448.52 19 100.00
12710. Filip (fifi_wilk) 19 81.60 94.37 6 31.58
12711. fergisson (fergiss) 19 65.88 76.47 6 31.58
12712. Aidan (fastflangies) 19 67.29 78.57 8 42.11
12713. Ian (fadedrobin) 19 72.78 100.95 6 31.58
12714. eyeliddy (eyeliddy) 19 99.32 119.86 11 57.89
12715. Leon (extremegamer116) 19 100.29 125.96 5 26.32
12716. Evan (evang_dvorak) 19 103.15 120.28 12 63.16
12717. EthKrae (ethkrae) 19 72.66 82.02 5 26.32
12718. equations (equationslayer12) 19 74.67 94.70 4 21.05
12719. Ahmad (eqbalshekib) 19 65.64 81.49 7 36.84
12720. Epik Dino (epikdinosaur) 19 66.22 76.67 4 21.05
12721. RIP Byron (enriquecollin) 19 131.24 155.19 11 57.89
12722. visily (enlive3) 19 72.63 96.60 6 31.58
12723. Prawny (enderduck247) 19 88.71 119.22 17 89.47
12724. eman borham (ema_burham) 19 42.77 47.67 1 5.26
12725. Emateos (emateos) 19 59.98 67.63 9 47.37
12726. Ella (ellavampyrella) 19 49.53 57.56 2 10.53
12727. elif (eliff) 19 66.57 80.99 7 36.84
12728. Elias (eliasmarcelin0) 19 80.00 103.45 6 31.58
12729. David (electro2020) 19 119.63 143.48 9 47.37
12730. ekupro (ekupro) 19 44.68 51.89 2 10.53
12731. Eifie (eifietheward) 19 62.29 88.50 2 10.53
12732. Satyam (echosatyam) 19 57.48 68.85 3 15.79
12733. Mazeppa (dynozawa) 19 93.63 103.35 4 21.05
12734. Slow Slow Slow Slow (dukka_) 19 106.81 121.46 7 36.84
12735. RIP yomps (dtfps) 19 103.24 122.17 18 94.74
12736. Sascha (dsm716) 19 39.51 45.26 2 10.53
12737. Downsouthspy (drax_) 19 78.01 92.76 7 36.84
12738. jin (dragon51221) 19 86.29 94.76 6 31.58
12739. Dookie Shoes (dookie_shoes) 19 100.54 124.57 6 31.58
12740. Arrogant (dkaocka) 19 102.68 120.91 6 31.58
12741. Steven (df1337) 19 112.93 138.38 9 47.37
12742. desa (desa7645) 19 38.31 45.86 0 0.00
12743. Guest (dbluedb) 19 68.37 92.87 1 5.26
12744. Kike (darkskyflow) 19 51.76 59.51 9 47.37
12745. Darkcryed (darkcryed) 19 90.33 106.41 5 26.32
12746. Lee (cytokid101) 19 136.80 159.07 13 68.42
12747. Cryp_ted (crypted06) 19 106.54 121.42 19 100.00
12748. Ethan (crissps) 19 74.18 92.35 5 26.32
12749. Dumby (cooh) 19 89.01 100.38 5 26.32
12750. You (console0) 19 38.00 45.35 1 5.26
12751. Blackmooer (colinluca) 19 76.86 89.94 7 36.84
12752. Jesse (cliev) 19 126.82 150.33 13 68.42
12753. Clark (clark_d) 19 52.95 70.41 1 5.26
12754. Vlad (ciorap88) 19 67.21 84.01 4 21.05
12755. mark (chuahuonga) 19 62.88 76.36 3 15.79
12756. Devon (cheeky_sneakster) 19 86.39 101.79 8 42.11
12757. Ccucumber12 (ccucumber12) 19 72.80 84.56 5 26.32
12758. Chris (cccxxxl) 19 103.73 116.44 19 100.00
12759. CarrotyLemons (carrotylemons) 19 69.48 84.49 7 36.84
12760. Carlz (carlz19) 19 89.85 105.36 5 26.32
12761. Josh (capitanwalrus) 19 74.44 91.59 3 15.79
12762. Ceramic (caleb_2000) 19 82.75 92.77 5 26.32
12763. bvk (bvkv) 19 64.11 72.09 1 5.26
12764. Arie (buenobonsai) 19 90.77 105.44 5 26.32
12765. Bede (breadstickx) 19 90.85 99.44 4 21.05
12766. Oleg (braga01) 19 83.28 92.31 7 36.84
12767. Brady (bradymoller) 19 77.12 91.29 3 15.79
12768. HUN (botyi22) 19 42.17 51.32 0 0.00
12769. boocoo (boocoo) 19 77.92 94.32 3 15.79
12770. Robert (bonsai_aus) 19 105.08 132.89 7 36.84
12771. Nolan (blerz) 19 103.84 117.38 16 84.21
12772. Blablle (blablle) 19 89.49 107.16 19 100.00
12773. bigpotato24 (bigpotato24) 19 61.94 76.92 5 26.32
12774. tirehtööri (benracer) 19 81.62 102.58 4 21.05
12775. Stefaan (befferdw) 19 92.93 140.75 10 52.63
12776. Brandon (bduick) 19 67.75 79.33 4 21.05
12777. Andy (batt) 19 88.93 100.20 5 26.32
12778. Basti (bastigga_) 19 70.35 83.16 5 26.32
12779. Bakushou (bakushou) 19 56.45 67.79 2 10.53
12780. Hoshi (b1ink) 19 75.47 90.90 6 31.58
12781. Avinash (avinash625) 19 81.68 95.29 2 10.53
12782. AuroraSpirix (auroraspirit) 19 101.08 130.84 8 42.11
12783. Haany (asterp01) 19 61.94 77.11 2 10.53
12784. Oliver (arscenic) 19 77.17 93.89 8 42.11
12785. Caro :3 (scary_carrie) 19 59.25 70.82 3 15.79
12786. Sc0rxh (sc0rxh) 19 107.95 123.16 6 31.58
12787. based_hitler_69 (sav_ru) 19 47.90 54.69 1 5.26
12788. Sapphire (sapphirexsky) 19 86.25 129.24 5 26.32
12789. Sapient (sapient) 19 85.69 106.89 4 21.05
12790. 1337 (samseks) 19 89.91 104.82 9 47.37
12791. Samantha (samantha_314) 19 99.96 117.69 10 52.63
12792. SadRoad (sadroad) 19 90.78 123.10 6 31.58
12793. Cherry (s9crs) 19 42.74 51.96 1 5.26
12794. Robin (rxb1nn) 19 75.21 93.25 4 21.05
12795. rpyx (rpyx) 19 115.39 131.24 13 68.42
12796. RPUSam (rpusam) 19 151.38 160.44 18 94.74
12797. rohit (rohitzerofour) 19 47.47 67.35 2 10.53
12798. Rishit (rishitlogar) 19 74.12 89.84 2 10.53
12799. fanatic (rijulbidhan) 19 81.07 91.36 8 42.11
12800. Rick (rick_200wpm) 19 10.83 14.09 10 52.63
12801. Themis (reitgg) 19 105.94 127.35 13 68.42
12802. FreePalestine (reda6aboob) 19 24.83 31.11 5 26.32
12803. ReconMarine (reconmarine117) 19 71.43 81.01 7 36.84
12804. Nefritees (realnefritees) 19 69.79 82.82 6 31.58
12805. rao (raonavdeep) 19 55.62 67.92 5 26.32
12806. Roope (randommaster) 19 57.38 62.82 6 31.58
12807. Rahma (rahhma) 19 69.86 78.92 10 52.63
12808. Clare (radioclare) 19 83.53 102.79 5 26.32
12809. Q3stor (q3stor) 19 35.65 44.80 3 15.79
12810. 043v897s (previouslol) 19 90.15 112.20 5 26.32
12811. Pramit (pramittt) 19 51.40 64.18 1 5.26
12812. Jason (pradogy) 19 79.73 102.33 2 10.53
12813. Playboifarti (playboifarti) 19 62.54 77.96 3 15.79
12814. PkRb21 (pkrb21) 19 65.05 73.09 5 26.32
12815. PIXI (pixipixi) 19 136.43 176.90 11 57.89
12816. PixelFog (pixelfog) 19 99.96 111.62 6 31.58
12817. Speedy (pindakaaspot123) 19 85.70 109.01 6 31.58
12818. Soós (pbaalt) 19 73.48 88.45 5 26.32
12819. Paulie (paulie_) 19 107.96 126.80 7 36.84
12820. Pasta_Devoured (pasta_devou... 19 45.44 52.68 17 89.47
12821. Parnian (parnian) 19 47.70 56.28 0 0.00
12822. Cael (paile) 19 95.51 117.19 7 36.84
12823. Jo (oyangjo) 19 71.91 92.45 4 21.05
12824. otve (otve) 19 64.41 85.98 6 31.58
12825. OranH77 (oranh77) 19 78.88 94.08 6 31.58
12826. Alex (omggitsalphaa) 19 92.06 106.80 5 26.32
12827. Ollie (olijf) 19 81.75 95.49 8 42.11
12828. Eldin (oktea) 19 100.29 118.98 8 42.11
12829. Nathan (nzhang5075) 19 77.88 89.79 4 21.05
12830. Nynnf (nynnf) 19 82.95 96.11 15 78.95
12831. Nvzhnn (nvzhnn) 19 97.54 113.19 9 47.37
12832. Youssef (nuggetdip) 19 68.20 77.01 4 21.05
12833. NRC_131_G (nrc_131_g) 19 86.08 104.15 16 84.21
12834. Nabin (npboss) 19 52.50 62.93 4 21.05
12835. xuehua (noquitnrooom) 19 120.57 144.58 12 63.16
12836. Daniel (nodasch) 19 64.90 81.91 4 21.05
12837. Jason (njasow) 19 112.17 123.39 12 63.16
12838. Jibon (ninja0x) 19 43.44 50.64 2 10.53
12839. Nicolai (nicolaifeldthaus) 19 79.83 92.38 5 26.32
12840. Jus (nicememe12) 19 97.18 111.32 9 47.37
12841. Nefko (nefko) 19 90.98 108.20 5 26.32
12842. Natan (nati_130) 19 38.97 46.37 0 0.00
12843. Nabil (nabilhuda) 19 64.70 78.06 5 26.32
12844. tstats[nabil365] (nabil365) 19 53.79 68.65 3 15.79
12845. adam (n0tracist) 19 104.77 122.42 11 57.89
12846. MUHAMMAD (m_haris676) 19 33.80 40.59 6 31.58
12847. Mike (mxtinkxm) 19 41.09 60.87 2 10.53
12848. mush (mushkatsu) 19 70.82 91.54 2 10.53
12849. Addis (mryoungaddis) 19 62.78 74.75 2 10.53
12850. lamok (mrgago) 19 96.36 123.72 13 68.42
12851. Sompang (mplegato) 19 87.42 98.32 5 26.32
12852. Mark (mose9634) 19 95.32 110.65 7 36.84
12853. Dill (monkeyman1637) 19 77.97 91.81 8 42.11
12854. Möhri (moehri) 19 72.55 88.80 15 78.95
12855. Moe (moeb1us) 19 82.59 107.02 10 52.63
12856. Nurul (mnislam) 19 86.08 93.35 8 42.11
12857. Paloma (mmmmtype) 19 69.74 80.77 6 31.58
12858. Micah (mjdomo) 19 88.72 101.04 8 42.11
12859. Vãi Trí (minhtrihard) 19 82.37 96.02 3 15.79
12860. Michael (mikenike52899) 19 94.50 110.55 6 31.58
12861. Andrew (mhayes4701) 19 89.44 96.60 6 31.58
12862. Michael (meowmeowmikey) 19 101.32 131.15 9 47.37
12863. Melioninas (melioninas) 19 70.42 83.65 6 31.58
12864. Manos (me1nos) 19 54.10 68.47 0 0.00
12865. Matthew (mcluzar) 19 104.53 127.32 10 52.63
12866. mcjohn_117 (mcjohn_117) 19 91.66 109.37 9 47.37
12867. Son (mcc_sasuke) 19 60.50 75.08 5 26.32
12868. MB (mb_the_lighting) 19 67.45 78.18 6 31.58
12869. Matin (matinkh) 19 83.16 96.89 7 36.84
12870. Martin (martinw89) 19 82.18 96.54 5 26.32
12871. Martine (martine_338) 19 59.82 72.35 14 73.68
12872. blooks (aprinter) 19 98.46 115.85 12 63.16
12873. Ansh (ansh_001) 19 66.84 82.44 7 36.84
12874. Guillermo (andragoner) 19 100.61 128.04 3 15.79
12875. Amfomy (amfomy) 19 73.15 89.66 7 36.84
12876. Amal (amalsan) 19 57.59 65.26 5 26.32
12877. Guest (alvinaruto) 19 66.27 81.23 7 36.84
12878. curious (allodic) 19 100.67 116.07 11 57.89
12879. al2qx (al2qx) 19 78.54 92.57 6 31.58
12880. tstats[aisultan] (aisultan) 19 75.30 92.89 4 21.05
12881. Aidan (aidandapenguin) 19 58.65 66.71 1 5.26
12882. lemonade (agolemonade) 19 90.24 115.86 6 31.58
12883. Atanas (aginev) 19 47.08 56.07 3 15.79
12884. Eaton (adgray09) 19 68.29 85.27 4 21.05
12885. Jacob (addthenine) 19 85.79 98.73 5 26.32
12886. blackjeseos (actuallyfadhli) 19 69.89 86.93 4 21.05
12887. Rabia (abdessalam) 19 62.27 68.83 1 5.26
12888. Aafeef (aafeef25) 19 60.20 78.86 17 89.47
12889. Nick (aaaywhatup) 19 83.55 98.76 4 21.05
12890. Eduardo (4lc1d3) 19 78.90 91.53 2 10.53
12891. rome (1ensh1) 19 80.62 92.22 4 21.05
12892. Barteritus (barteritus) 19 67.59 88.04 1 5.26
12893. saktisudarsono (saktisudars... 19 80.68 92.68 3 15.79
12894. Yusome (yusomeli) 19 59.07 71.83 5 26.32
12895. Rustyrare (rustyrare) 19 69.16 82.51 6 31.58
12896. Fábio (thefabio8000) 19 61.92 76.33 6 31.58
12897. Scimza (scimza) 19 87.58 103.41 7 36.84
12898. Bob (iamaninja66) 19 69.86 86.19 5 26.32
12899. Hawk (hawkeye7662) 19 75.08 82.96 18 94.74
12900. Ivan (boringspookycoolivan) 19 74.38 89.60 5 26.32
12901. viktor (killingnexus) 19 58.76 69.70 3 15.79
12902. Noah (trumpybear) 19 76.18 87.17 6 31.58
12903. Z40Abanob (z40abanob) 19 70.87 88.73 12 63.16
12904. hteraG (hterag) 19 78.70 100.74 5 26.32
12905. Hao (hao1110) 19 44.45 61.51 2 10.53
12906. Penguin (itsgirlgamer49) 19 36.04 46.35 0 0.00
12907. kenzo (k3nx0) 19 58.49 68.41 1 5.26
12908. shacha (shacha) 19 36.05 41.56 0 0.00
12909. leo (enrage411) 19 59.02 73.47 7 36.84
12910. Mengkuda (rakaoii) 19 46.14 50.82 1 5.26
12911. John (john_willy) 19 64.61 78.33 10 52.63
12912. Logan (18logsar) 19 68.54 78.74 8 42.11
12913. James (__james) 19 57.84 68.73 4 21.05
12914. Hannah (_hannahxr) 19 66.24 76.41 5 26.32
12915. Zakir (z_slayer) 19 68.14 78.35 8 42.11
12916. Cyrus (zombie_kid_likes_tur... 19 87.32 114.42 5 26.32
12917. Kevin (zenicide) 19 100.81 120.76 8 42.11
12918. kushkus (zefirokouz) 19 81.89 96.51 6 31.58
12919. Zamira (zamira89) 19 23.78 27.09 8 42.11
12920. zahid (zahid_hasan_sahin) 19 58.92 70.72 5 26.32
12921. Zach (zacuum) 19 85.34 105.06 5 26.32
12922. Zack (zackjwilk) 19 102.83 122.54 9 47.37
12923. Zach (zachattack8910) 19 75.23 92.82 2 10.53
12924. Shian (ytxiang1997) 19 89.20 101.87 2 10.53
12925. Liam (yourmotherguy) 19 94.60 110.55 10 52.63
12926. Regin (yoloburgerking) 19 109.99 122.59 9 47.37
12927. yaQvadrat (yaqvadrat) 19 61.05 72.86 4 21.05
12928. yang (yangtyper) 19 79.14 87.49 5 26.32
12929. Paul (yangaapaul) 19 125.98 149.66 13 68.42
12930. Marc (xmarcxx) 19 77.53 95.11 3 15.79
12931. Alex (xanderamb) 19 81.16 97.48 9 47.37
12932. wiktor (wiktoroski1995) 19 27.70 36.44 4 21.05
12933. Kevin (whatsyourtype) 19 111.75 131.84 8 42.11
12934. Weegeepootis (weegeepootis) 19 118.44 135.06 8 42.11
12935. Walter (walter1) 19 92.78 102.47 8 42.11
12936. DybVv (vuong02011996) 19 54.00 63.71 4 21.05
12937. Khoi Nguyen (vukhoinguyen8492) 19 105.47 117.36 8 42.11
12938. vormin (vormin) 19 63.00 72.46 5 26.32
12939. Vishishta (vishik_685) 19 71.83 81.02 7 36.84
12940. Dan (videogamewarriortv) 19 114.21 144.77 11 57.89
12941. Boris (vhoma) 19 55.52 60.80 1 5.26
12942. Jun (vegetto1126) 19 112.07 129.66 12 63.16
12943. Valtishqq (valti46) 19 78.93 90.25 5 26.32
12944. Michael (valibukk) 19 66.87 75.21 7 36.84
12945. Utku (utkumaden) 19 75.71 89.14 5 26.32
12946. U (uqs1) 19 63.83 74.67 2 10.53
12947. ungabunga (ungabungaoobunga) 19 87.27 110.66 4 21.05
12948. Obama (underi7) 19 92.26 105.67 10 52.63
12949. Alan (typing_alan) 19 65.28 76.68 5 26.32
12950. Turningworld (turningworld) 19 59.80 70.52 8 42.11
12951. Trey (trxtier) 19 54.21 75.98 2 10.53
12952. Truvius (truvius) 19 86.68 107.89 4 21.05
12953. Josh (tributedajerk) 19 103.69 128.82 10 52.63
12954. Tomasz (toumash) 19 71.55 84.89 8 42.11
12955. Toshi (totora) 19 42.01 54.13 1 5.26
12956. Tobias (tospon) 19 28.73 33.56 6 31.58
12957. tontin (tontinvicinta) 19 92.70 111.85 5 26.32
12958. Tibnel (tonels) 19 115.23 141.30 10 52.63
12959. chalantorn (tonchalantron) 19 71.00 86.51 14 73.68
12960. TapTapTappy (tomcolemak) 19 115.63 136.22 9 47.37
12961. Tej (tjoshi12) 19 94.71 108.84 7 36.84
12962. Faustino (tinoriffic) 19 102.15 112.77 7 36.84
12963. Tan (tim0909) 19 124.53 140.79 12 63.16
12964. Thuong (thuongle19) 19 66.45 76.38 4 21.05
12965. Ryan (thoughtpotato) 19 96.32 112.43 5 26.32
12966. pogchamp (the_frog_champ) 19 119.92 164.12 11 57.89
12967. Radu Codescu (the_eagle) 19 53.19 59.77 4 21.05
12968. Coconut (the_coconut) 19 97.09 107.15 6 31.58
12969. Anson (the_chill_templar) 19 90.32 109.31 10 52.63
12970. Luc (theshadowcuber) 19 92.31 111.84 4 21.05
12971. Aaron (theredspartan) 19 86.84 101.98 5 26.32
12972. theonesomebodey (theonesome... 19 67.52 98.84 3 15.79
12973. daniiar (thedoni) 19 43.04 55.14 1 5.26
12974. the1stpsycho (the1stpsycho) 19 76.71 93.81 6 31.58
12975. Maddy (teruteru2116) 19 113.98 152.51 12 63.16
12976. Iftakhar (tanvir021) 19 45.74 51.75 1 5.26
12977. Tan (tang_) 19 65.52 77.88 7 36.84
12978. Danny (taipmaster) 19 97.55 120.38 10 52.63
12979. Alan (taialan) 19 87.07 99.83 17 89.47
12980. Sumit (sysoutme) 19 65.32 71.25 3 15.79
12981. Maxi (swimincircles) 19 85.15 104.47 8 42.11
12982. MadsFuldGhoul (swaax) 19 139.32 160.32 17 89.47
12983. सुरेन्द्र... 19 56.55 69.09 1 5.26
12984. Joe (suqmadiqmann) 19 98.70 115.94 10 52.63
12985. Landon (sugamalia) 19 98.88 132.34 6 31.58
12986. Sue (suevang) 19 62.24 78.76 2 10.53
12987. Styo (styofox) 19 53.50 61.59 2 10.53
12988. strange (strangeeggs) 19 133.86 165.74 8 42.11
12989. stormchaserwhienne (stormch... 19 78.75 102.54 6 31.58
12990. Stevey (steveaiva) 19 56.87 67.42 2 10.53
12991. Kasey (kaseykasey) 19 48.02 56.88 3 15.79
12992. Miguel (spiritdesire) 19 79.50 88.61 5 26.32
12993. Aria (spaceface32) 19 82.59 98.42 3 15.79
12994. Tomislav (sovageng) 19 76.39 85.69 6 31.58
12995. Ler (soospooky) 19 97.67 107.05 7 36.84
12996. SoopaKhell (soopakhell) 19 109.73 129.87 14 73.68
12997. Somanos (somanos) 19 96.13 109.36 8 42.11
12998. brad (soccerboyy) 19 91.25 120.56 8 42.11
12999. Daan (skunki) 19 81.70 91.72 7 36.84
13000. tstats[sivert_ivert] (siver... 19 87.85 112.44 5 26.32
13001. Sisi (sisiamor) 19 121.49 141.02 13 68.42
13002. (sirreinz) 19 94.13 106.21 8 42.11
13003. Daniel (siichotic) 19 103.64 121.78 3 15.79
13004. Bertie (shkablameo) 19 54.91 64.61 2 10.53
13005. Shawn (shawtyper) 19 57.59 73.79 4 21.05
13006. SeldRiyo (seldriyo) 19 56.16 63.31 3 15.79
13007. v3 (_v3_) 18 166.98 187.28 16 88.89
13008. supreme (_supremes) 18 98.94 109.30 6 33.33
13009. Ionut (ztonaz) 18 61.09 69.98 4 22.22
13010. bob (zirx2) 18 87.33 100.02 3 16.67
13011. Ziffit (ziffit) 18 35.15 42.01 2 11.11
13012. Zachary (zacmanman) 18 99.24 114.50 3 16.67
13013. Josh (yummy4skin) 18 83.54 112.40 5 27.78
13014. Mike (yoshyosh) 18 55.98 66.75 0 0.00
13015. Jan (yentzeg) 18 90.92 107.46 8 44.44
13016. Yasunobu (yasunobu) 18 47.80 54.12 4 22.22
13017. Yaman (yamyoume) 18 69.51 77.42 4 22.22
13018. yabsira sisay (yabsira) 18 49.29 57.04 1 5.56
13019. I AM SPEED (xelestis) 18 96.99 114.84 6 33.33
13020. Xantrum (xantrum1) 18 77.28 96.73 7 38.89
13021. Dan (writfate) 18 68.97 89.26 4 22.22
13022. Work (worklife) 18 71.03 78.05 1 5.56
13023. a (waahello) 18 102.64 119.21 5 27.78
13024. Viniter (viniter_) 18 63.69 76.00 4 22.22
13025. vilo (viloo) 18 94.19 114.46 9 50.00
13026. valeriu (valeriu) 18 46.95 52.89 1 5.56
13027. Emmanuel (ugochuku2000) 18 87.97 105.64 9 50.00
13028. YW (tywee) 18 96.59 106.43 10 55.56
13029. unfalsent (typowriter16) 18 114.41 135.36 11 61.11
13030. Dan (typefffast) 18 76.31 86.86 5 27.78
13031. Joran (turkeyman) 18 107.78 126.42 9 50.00
13032. n8 (ttensu) 18 98.30 113.83 7 38.89
13033. Tomasz (tserbinowski) 18 47.16 53.88 1 5.56
13034. truecoatcrew (truecoatcrew) 18 102.73 118.66 12 66.67
13035. Tripp (tripptypes) 18 52.49 67.36 5 27.78
13036. Travis (travisxball) 18 99.10 115.34 10 55.56
13037. TotalTao (totaltao) 18 69.25 80.99 3 16.67
13038. TornaxO7 (tornax) 18 53.46 58.04 1 5.56
13039. tony (toeknee0) 18 82.54 95.32 4 22.22
13040. tan (tnttant) 18 85.15 98.13 8 44.44
13041. Tir8 (tir8) 18 74.90 88.75 5 27.78
13042. cookie (timecookie) 18 84.91 95.48 8 44.44
13043. Tia (tiaaakayyy) 18 114.93 131.27 9 50.00
13044. Lynan (thonlynan) 18 52.44 67.20 4 22.22
13045. thomas (thoarell) 18 90.68 107.78 1 5.56
13046. Wing (thewing_) 18 83.08 114.78 2 11.11
13047. TheUnder (theunderdoge) 18 78.67 94.26 4 22.22
13048. Stefan (thebeaver5) 18 82.57 93.64 3 16.67
13049. Thai (thaiph244) 18 90.87 108.55 7 38.89
13050. ??? (teslacia) 18 100.05 110.46 10 55.56
13051. Tean (tean) 18 110.64 141.60 17 94.44
13052. Tangguh (tangguh_) 18 76.17 95.25 5 27.78
13053. Thomas (taimeru) 18 55.01 67.73 1 5.56
13054. Tobi (t0b5) 18 74.66 86.43 1 5.56
13055. Surajit (surajit) 18 58.21 69.77 1 5.56
13056. J (superuby5) 18 95.09 107.52 7 38.89
13057. SuperGion915 (supergion915) 18 70.45 82.41 4 22.22
13058. Andy (superchickeneat) 18 88.49 109.20 11 61.11
13059. saku (sukasa) 18 127.08 148.34 10 55.56
13060. anne (strawberrybannenana) 18 82.78 104.31 10 55.56
13061. Alyssa (stewalyssa) 18 76.37 90.75 6 33.33
13062. Mr. (stealthykoalaber) 18 104.44 125.68 7 38.89
13063. stealthevan (stealthevan) 18 109.78 140.70 9 50.00
13064. Stan (stan3999) 18 71.35 84.71 3 16.67
13065. Sticky (st1ckyman) 18 67.50 78.03 4 22.22
13066. ssiKY (ssiky) 18 71.33 83.25 3 16.67
13067. Tom (spicersoanner) 18 73.36 85.77 3 16.67
13068. Soul (soulisgarb) 18 89.09 99.44 3 16.67
13069. vivi (soulace) 18 125.25 153.26 8 44.44
13070. Leonardo (sonoleo) 18 71.24 80.80 4 22.22
13071. jenga (smokythunder) 18 108.06 137.08 5 27.78
13072. jules! (smeme) 18 95.24 117.46 13 72.22
13073. meher (smc181002) 18 53.86 72.15 3 16.67
13074. Subid (slowth_369) 18 55.21 68.55 2 11.11
13075. Simon (simonlee2216) 18 93.89 118.66 11 61.11
13076. Shivam (shivam543) 18 83.79 98.69 5 27.78
13077. Davit (shartavadavit0) 18 73.61 84.05 4 22.22
13078. Sienna (sfdragon) 18 111.31 136.81 9 50.00
13079. S (sestevens) 18 117.88 131.73 6 33.33
13080. Parker (seriousnewt8) 18 71.07 87.01 4 22.22
13081. sendiri (sendiri) 18 79.90 96.20 5 27.78
13082. Seforius (seforius) 18 106.48 129.41 11 61.11
13083. SeeJay (seejay_ferraro) 18 65.57 71.64 4 22.22
13084. Sahil (sahilb7) 18 47.37 60.08 3 16.67
13085. sahani prasad (sahani) 18 47.05 53.19 2 11.11
13086. Victor (sadlad) 18 67.29 77.58 4 22.22
13087. Russell (russellsapphire) 18 99.54 117.19 7 38.89
13088. Russell (rtx420) 18 58.05 65.91 4 22.22
13089. Rodrigo (rodgodkiller) 18 63.97 78.87 4 22.22
13090. Assey (rockae) 18 89.31 109.10 9 50.00
13091. Robbie (roadcasted) 18 101.80 129.76 6 33.33
13092. Ruan (rmontelo) 18 92.65 106.50 7 38.89
13093. rmbench (rmbench) 18 94.06 107.27 5 27.78
13094. Ji (rk42745417) 18 66.00 77.48 1 5.56
13095. Riley (rileygramlich) 18 77.27 91.31 6 33.33
13096. Riley (riela_) 18 75.02 92.74 6 33.33
13097. Richard (rgoulterbm40dsk) 18 85.57 98.34 6 33.33
13098. KOCHENGOREN (renasha) 18 84.10 97.67 7 38.89
13099. Riley (rbogren) 18 76.05 91.37 2 11.11
13100. ray (raytrace) 18 55.59 69.30 0 0.00
13101. R0L3eX (r0l3ex) 18 83.72 109.01 4 22.22
13102. So Slow (quantum1) 18 117.22 137.54 9 50.00
13103. qria (qria) 18 84.67 97.91 5 27.78
13104. Qazz (qazztheqazz) 18 90.05 104.07 8 44.44
13105. Kantapat (pyro_x) 18 55.39 88.02 12 66.67
13106. pvx123 (pvx123) 18 33.37 38.19 0 0.00
13107. presto (presto3000) 18 83.02 94.49 4 22.22
13108. powerofmooogiza (powerofmoo... 18 107.83 125.10 7 38.89
13109. popsickles (popsickles) 18 90.41 102.77 12 66.67
13110. W8 4ME (pmarci9810) 18 86.43 98.50 3 16.67
13111. Jakob Kammerlander (plssnipe) 18 64.45 76.75 3 16.67
13112. paschalis (platoon132002) 18 45.08 48.92 4 22.22
13113. Piggie (piggiepoop) 18 112.59 136.34 8 44.44
13114. Peter (pieter_post) 18 95.00 116.17 14 77.78
13115. hollow knight (phoenixwleft) 18 66.78 78.17 4 22.22
13116. Pho (phobreze) 18 85.01 104.16 2 11.11
13117. Pawan (pawanmsr) 18 55.40 62.03 3 16.67
13118. Parsa (parsal) 18 81.76 92.77 5 27.78
13119. Victor (paralisity) 18 65.04 76.57 3 16.67
13120. Ozymandias (ozymandias_qc) 18 67.96 79.21 5 27.78
13121. Fauzan (ozaenzenzen) 18 109.59 122.36 6 33.33
13122. Owen (owenl131) 18 101.44 113.32 10 55.56
13123. annette (owannette) 18 96.24 109.07 9 50.00
13124. Johnny (onireves) 18 101.36 126.07 10 55.56
13125. om (om0305) 18 65.61 76.69 5 27.78
13126. Omar (oamrelhorbity) 18 55.58 61.77 3 16.67
13127. Nuteee (nutee) 18 47.97 61.56 0 0.00
13128. brayn (nmchanab) 18 80.46 86.34 8 44.44
13129. Nathan (nlaha) 18 78.45 85.88 7 38.89
13130. Nilacake (nilacake) 18 79.41 96.53 5 27.78
13131. niko (nikoooo) 18 58.33 75.13 3 16.67
13132. Nikhil (nikhil142) 18 90.02 106.58 6 33.33
13133. you (nigamot) 18 63.86 84.68 3 16.67
13134. Pratyaksh (nickpratyaksh) 18 76.30 92.12 18 100.00
13135. Bruh (nicesuu) 18 86.33 95.84 5 27.78
13136. God (nicechop) 18 63.11 71.61 2 11.11
13137. Tran (newstrung) 18 82.28 91.04 2 11.11
13138. nara (naraaa) 18 83.73 97.27 3 16.67
13139. Nafre (nafre) 18 105.55 118.92 10 55.56
13140. Jose (m_jose) 18 77.88 92.10 4 22.22
13141. Mymumswims (mymumswims) 18 88.81 106.97 6 33.33
13142. Mudmai (mudmai) 18 31.76 41.09 1 5.56
13143. Moukim (moukim) 18 74.01 83.56 2 11.11
13144. pup (mkpup) 18 73.19 86.67 5 27.78
13145. Edward (minecrafterman) 18 47.79 57.55 0 0.00
13146. Mariyan (mimo200be) 18 90.87 97.98 8 44.44
13147. mike (mikeyfromqueens) 18 94.60 106.78 9 50.00
13148. José Miguel (mikel2077) 18 84.93 101.22 6 33.33
13149. mikaelawashere (mikaelawash... 18 73.08 89.02 5 27.78
13150. midnightsimon (midnightsimon) 18 83.28 104.80 0 0.00
13151. Martin (mewix) 18 87.07 101.44 1 5.56
13152. Naisargi (mehtaphysicalfool) 18 87.11 99.48 5 27.78
13153. Mathijs (mathijsmaes) 18 92.72 108.10 7 38.89
13154. urmom (mars3000) 18 78.86 86.55 3 16.67
13155. Mari (maribun) 18 94.53 116.26 16 88.89
13156. josiah (mangofeline) 18 85.25 113.55 7 38.89
13157. Manfred (manfredxu99) 18 152.20 179.09 17 94.44
13158. Matthais (maciejosas2012) 18 100.67 116.74 5 27.78
13159. Ted (macfan) 18 105.20 115.53 9 50.00
13160. Luke (lukeov) 18 80.24 99.87 5 27.78
13161. Johnathan Walter (luciferin) 18 97.01 108.78 5 27.78
13162. Lukasz (lpodolski) 18 72.92 84.84 1 5.56
13163. lodo4ka (lodo4ka) 18 70.45 83.82 3 16.67
13164. Mr (littyzm) 18 107.27 125.48 4 22.22
13165. Rein (lilpotatopop) 18 89.48 112.50 13 72.22
13166. Klunky (liamrob) 18 85.92 107.44 11 61.11
13167. Ante (ld77) 18 91.04 104.80 9 50.00
13168. Jacob (krucinskij) 18 75.40 87.78 4 22.22
13169. Kelly (kile07) 18 49.27 65.65 2 11.11
13170. Khuslen (khyl) 18 58.41 69.39 3 16.67
13171. Tofumaster (khenglon) 18 68.35 78.49 3 16.67
13172. Kayak (kayakcanoe) 18 60.02 71.41 2 11.11
13173. Kathy (kathy_starfire) 18 72.24 96.57 3 16.67
13174. Kareem (kareemshehata) 18 42.48 53.48 0 0.00
13175. KamilJan (kamil_jan) 18 90.05 100.97 7 38.89
13176. Kacper (kacperpro) 18 99.21 124.38 13 72.22
13177. James (justjames) 18 79.43 96.08 6 33.33
13178. Julio (julio7125) 18 77.04 94.08 2 11.11
13179. jude (judepls) 18 131.14 147.02 11 61.11
13180. JSKE25 (jske25) 18 96.79 119.19 10 55.56
13181. tstats[jpatrocinio5436] (jp... 18 83.14 94.87 9 50.00
13182. JoYo (joyojo) 18 88.70 101.13 11 61.11
13183. Joshua (joshuasymes) 18 87.33 105.68 8 44.44
13184. Jonathan (jonc2002) 18 117.48 136.88 9 50.00
13185. Jonas (jonasv888) 18 74.00 83.99 7 38.89
13186. Mathew (johnnyio) 18 92.73 107.68 7 38.89
13187. Johnny (johneeeee) 18 55.39 70.04 2 11.11
13188. JKJ123 (jkj123) 18 67.18 83.98 1 5.56
13189. J (jiffan) 18 84.86 96.30 4 22.22
13190. snb (jftsnb) 18 60.11 69.69 5 27.78
13191. jewels (jewelsboyfriend) 18 123.81 139.71 11 61.11
13192. Clippy (jesspacito) 18 96.26 117.05 17 94.44
13193. Jeremy (jerms716) 18 77.93 92.87 4 22.22
13194. iquee (jeptha) 18 83.32 94.27 5 27.78
13195. jaycuaa (jaycuaa) 18 77.30 92.44 1 5.56
13196. Jawad (jawadwahmed) 18 73.44 90.04 5 27.78
13197. James (jamesjamesjamesjames... 18 77.48 89.76 6 33.33
13198. Harikrishnan R (ismashmykey... 18 52.40 59.77 4 22.22
13199. Isabelle (isabook) 18 87.44 100.53 7 38.89
13200. IntangiblePri (intangible_pri) 18 86.94 101.21 4 22.22
13201. Ba (injuredninjaz) 18 89.44 108.61 6 33.33
13202. INDO EUROPEAN (indo_europea... 18 70.24 86.45 9 50.00
13203. ImTrash (imreallytrash) 18 91.24 105.19 5 27.78
13204. SirAlhelm (iliur) 18 90.56 114.23 13 72.22
13205. KaRMa (ikillyou22) 18 73.30 84.79 9 50.00
13206. Ian (ianharold99) 18 78.32 98.71 2 11.11
13207. Yato_Gami (hrittik_brittik) 18 37.96 48.22 1 5.56
13208. Ishu (holistic_karma) 18 57.62 67.72 5 27.78
13209. Holden (holden_ford) 18 28.20 36.15 3 16.67
13210. HEMANTA (hemantahazariraipu... 18 61.05 75.25 7 38.89
13211. hello (hello_people123) 18 48.72 58.75 4 22.22
13212. Miyoko (heena_rawat) 18 42.67 49.28 1 5.56
13213. Hari (hari191197) 18 77.64 98.67 6 33.33
13214. Hola (harebrained) 18 89.31 101.28 8 44.44
13215. hannah (hannahq) 18 99.10 120.85 6 33.33
13216. Halo (halo1) 18 69.05 87.71 4 22.22
13217. Manuel (haiyaaa) 18 53.79 66.55 2 11.11
13218. Hmmm2100 (hahha2100) 18 79.96 91.86 8 44.44
13219. Nandika (gzxccalibur) 18 47.87 53.21 3 16.67
13220. no accuracy. can't type (gr... 18 122.34 158.63 9 50.00
13221. Goushique (goushique) 18 80.01 96.97 7 38.89
13222. Goop (goooop) 18 57.61 80.47 3 16.67
13223. Eric (godhand4826) 18 70.34 81.88 3 16.67
13224. gleen (gleenryan) 18 60.79 76.00 5 27.78
13225. Przemysław (girenkol) 18 67.55 81.69 2 11.11
13226. Makar (gatimoro) 18 71.30 81.28 8 44.44
13227. Garrett (garrettchu) 18 128.28 164.03 14 77.78
13228. Gabriel (gabrielfr2001) 18 88.76 102.17 5 27.78
13229. gabral (gabral123) 18 76.12 92.11 4 22.22
13230. (´▽`ʃ♡ƪ) (froggy_y) 18 106.42 128.90 10 55.56
13231. James (frodobaggins_) 18 63.42 75.84 5 27.78
13232. twitch.tv/empyr1cal (fritte... 18 97.30 116.42 9 50.00
13233. fr00t_l00ps (fr00t_l00ps) 18 91.61 99.37 8 44.44
13234. Franklin (fpstone) 18 79.97 96.83 3 16.67
13235. Alex (foxtail8000) 18 72.58 93.46 5 27.78
13236. Sadge (forebe) 18 61.81 70.05 17 94.44
13237. Bryce (flipno) 18 75.45 84.72 3 16.67
13238. Finuz (finuz) 18 51.38 59.80 1 5.56
13239. Filip (fichomaster) 18 85.08 100.42 14 77.78
13240. Jordan (feelingsreal) 18 112.95 131.82 9 50.00
13241. Jáchym (fastfingerrs) 18 74.02 82.90 7 38.89
13242. E dog (evan819) 18 95.84 118.82 8 44.44
13243. Tim (euclid221) 18 90.43 100.35 9 50.00
13244. ethan (ethanwander83) 18 75.96 97.64 3 16.67
13245. Ethan (ethanluu) 18 56.92 64.89 6 33.33
13246. Erza (erzaskill) 18 101.95 112.74 8 44.44
13247. eri :) (eri0002) 18 89.58 113.44 8 44.44
13248. Erdem (erdemhalil) 18 98.65 109.20 9 50.00
13249. epicsyrian (epicsyrian) 18 56.40 63.46 1 5.56
13250. Abraham (emptypilot) 18 90.67 102.38 3 16.67
13251. Empress Irisu (empress_irisu) 18 104.34 124.87 8 44.44
13252. elijah (elijahtheracecar) 18 72.82 90.55 2 11.11
13253. Dzlandis (dzlandis) 18 106.22 138.61 15 83.33
13254. rob (dydtaylor) 18 115.09 129.40 10 55.56
13255. Dyanel (dyanel) 18 61.59 73.40 4 22.22
13256. Draunzer (draunzer23) 18 37.72 44.38 2 11.11
13257. Drama (dramajr) 18 76.67 98.62 5 27.78
13258. Jordan (donkeywhistle) 18 90.42 101.17 7 38.89
13259. Doggo (doggocz) 18 100.17 116.20 5 27.78
13260. Dan (dncn) 18 55.56 71.74 5 27.78
13261. Ellis (disphing) 18 101.05 117.95 8 44.44
13262. DirtJohnson (dirtjohnson) 18 61.34 69.49 4 22.22
13263. dever (deverart) 18 112.96 129.98 9 50.00
13264. Deactrals (deactralsyt) 18 107.45 138.29 6 33.33
13265. dax (daxwastaken) 18 74.65 89.39 6 33.33
13266. Darijuan (darijuan) 18 70.80 83.48 7 38.89
13267. Daniel (dannyxrpm) 18 59.63 74.23 9 50.00
13268. Dan (danmurf) 18 73.27 92.78 8 44.44
13269. Daniel (dani3lju777) 18 113.84 141.89 9 50.00
13270. d (dafeiji) 18 105.68 132.57 8 44.44
13271. Danny (cyicro75366) 18 85.68 111.10 2 11.11
13272. Cade (ctw_) 18 97.27 119.72 8 44.44
13273. Kyi Phyu (crystal_emerson) 18 84.78 95.34 6 33.33
13274. Jorge (crovas) 18 72.78 80.38 3 16.67
13275. Christopher (cprice4124) 18 103.04 122.15 4 22.22
13276. Taufiq Dhanial (conradchill) 18 43.44 47.60 2 11.11
13277. Conrad (conrad7) 18 100.80 117.00 8 44.44
13278. comkichi (comkichi) 18 42.61 50.88 2 11.11
13279. (cnremilia55) 18 129.67 140.93 11 61.11
13280. V (chris_keum_9) 18 83.13 94.41 7 38.89
13281. Christina (christinacitta) 18 60.19 67.70 2 11.11
13282. Cecil (cecilw) 18 92.63 109.10 6 33.33
13283. Sam (cattheory) 18 82.59 99.87 4 22.22
13284. Captain (captainbravo579) 18 34.02 37.16 0 0.00
13285. cantfindname (cantfindname) 18 73.21 93.60 3 16.67
13286. Cammyy_ (cammyy_) 18 71.63 85.80 4 22.22
13287. Gabriel (bultaqi) 18 30.07 38.05 0 0.00
13288. Jens (bullercool) 18 91.52 108.83 8 44.44
13289. Bugz (bugzmoney) 18 68.84 98.65 16 88.89
13290. Bryce (bryceweedz) 18 91.21 102.25 9 50.00
13291. The Rainbow Dragon (broadwa... 18 89.40 97.72 4 22.22
13292. jan Mase (brasidas422) 18 104.44 114.84 7 38.89
13293. Glen Ford (boyroader) 18 35.48 42.58 1 5.56
13294. Bong (bongman48) 18 45.89 58.47 2 11.11
13295. David (bomely) 18 98.12 122.89 2 11.11
13296. bobby (bobbyo) 18 85.59 99.06 4 22.22
13297. Baba (bobabo) 18 118.76 135.94 7 38.89
13298. twitch.tv/darkmatterv4 (blo... 18 112.61 132.11 6 33.33
13299. Samyak (blk_ht_hk_r) 18 57.80 67.76 7 38.89
13300. Manny (blimps) 18 56.08 68.05 3 16.67
13301. Arman (blazzer1yr) 18 57.84 62.58 0 0.00
13302. Firefingers (birthdaykids) 18 211.50 234.71 17 94.44
13303. Bintang (bintung) 18 103.25 116.43 6 33.33
13304. Julen (bi0hazard_jck) 18 67.67 79.32 3 16.67
13305. Lemons (bhan1115) 18 106.84 122.40 10 55.56
13306. XDXDXD (benskrrt) 18 95.32 114.70 9 50.00
13307. Benjamin (benjaminjam) 18 94.68 118.51 5 27.78
13308. Lizbeth (belthiz) 18 55.18 67.98 0 0.00
13309. Beebit (beebit) 18 72.60 84.62 4 22.22
13310. Ethaan (bambamarama) 18 63.99 74.84 4 22.22
13311. BaldricLinus (baldriclinus) 18 88.29 119.02 9 50.00
13312. Victoria (azureale) 18 85.67 108.98 6 33.33
13313. Ayush (ayush08) 18 61.71 73.77 5 27.78
13314. Avery (avidavi) 18 106.16 125.54 6 33.33
13315. Tim (auticons) 18 69.14 85.22 3 16.67
13316. Atul (atzac) 18 44.10 54.99 1 5.56
13317. Aryan (aryandeore) 18 76.97 99.81 6 33.33
13318. Austin (artannenbaum) 18 117.09 145.07 10 55.56
13319. Adam (armen32cz) 18 70.69 84.31 0 0.00
13320. Ryan (arkephonic) 18 89.59 111.57 5 27.78
13321. archer (archerlkm) 18 45.06 54.93 3 16.67
13322. Abdelghani (aogino) 18 59.70 78.53 5 27.78
13323. Anthony (antoniotheslwotyper) 18 97.60 110.07 6 33.33
13324. Aniket (aniket__sharma_) 18 43.69 55.91 3 16.67
13325. anfun (anfun) 18 69.55 86.50 7 38.89
13326. Carl (andrecar002) 18 57.18 67.48 1 5.56
13327. AMG F1 (amg_gts) 18 67.59 79.05 4 22.22
13328. 205g0 (alpacav2) 18 112.35 127.06 9 50.00
13329. moon11111 (aliyuhaidaru) 18 34.91 40.32 1 5.56
13330. Alexis (alexxxisk) 18 81.64 97.19 4 22.22
13331. LDVBC (alexouou136) 18 105.73 130.03 9 50.00
13332. Alex (alexaaaaa) 18 74.89 88.16 3 16.67
13333. Alex (alex1124) 18 107.36 134.69 10 55.56
13334. akshat (akxs) 18 113.73 127.28 8 44.44
13335. Amanda (aj1111) 18 58.92 79.24 3 16.67
13336. AI (ailinda) 18 40.51 48.88 1 5.56
13337. Ahmer (ahmergondal) 18 112.79 142.58 6 33.33
13338. Killuminati (ahmedali25jan) 18 61.17 68.86 3 16.67
13339. Ahmad (ahmad770) 18 45.87 59.17 2 11.11
13340. aha (aha_aha2) 18 62.09 71.71 3 16.67
13341. AgogFox (agogfox) 18 68.10 75.90 6 33.33
13342. Justin (agent_jl) 18 135.69 149.06 11 61.11
13343. Afroz (afroz23) 18 47.50 55.85 2 11.11
13344. Aniket (aero81101) 18 63.15 75.15 2 11.11
13345. Aditya (aditya_sharma) 18 74.24 87.80 5 27.78
13346. Bruce Wayne (abhirupdas400) 18 70.20 78.77 2 11.11
13347. abfh7002 (abfh) 18 51.63 67.52 4 22.22
13348. Aidan (88its_dvorak) 18 64.19 73.41 7 38.89
13349. Wong (60484916) 18 61.17 75.15 2 11.11
13350. yooko (0ctagon) 18 55.79 62.50 3 16.67
13351. Prince (03000066106) 18 69.35 82.75 8 44.44
13352. CY Tan (slowest_typer_lol) 18 45.04 55.39 12 66.67
13353. Lydia (lydia245) 18 50.70 61.08 4 22.22
13354. Nick (propuzoficj) 18 96.80 117.09 6 33.33
13355. Zakir (drea041455) 18 76.75 95.08 9 50.00
13356. Sourabh (100rab) 18 58.86 64.80 3 16.67
13357. Max (mad_man_max11) 18 57.86 73.78 6 33.33
13358. David (hongduc1312) 18 45.38 58.41 10 55.56
13359. ABDULSALLAM (med905040) 18 19.22 22.98 3 16.67
13360. Abid (abidcsedu) 18 49.37 58.60 1 5.56
13361. Kartlez (kartlez) 18 35.77 45.78 1 5.56
13362. Rajat (rajat_2203) 18 52.39 64.52 16 88.89
13363. Charlie Crossman (iimdrowni... 18 52.78 66.72 1 5.56
13364. Jequiz (jequiz) 18 89.97 113.55 10 55.56
13365. TD (tmd33643) 18 83.02 94.73 4 22.22
13366. Angela (angie361) 18 59.43 67.54 2 11.11
13367. Araxes (boneyflesh) 18 43.12 55.09 2 11.11
13368. Gab (pawsthegabe) 18 75.78 91.84 12 66.67
13369. Manish (manish_84) 18 41.02 47.83 17 94.44
13370. ahmad (shexahmad) 18 70.11 73.85 4 22.22
13371. Unaib Syed (unaibsyed) 18 53.48 64.67 3 16.67
13372. Daniel (danrodbar) 18 42.00 48.57 3 16.67
13373. Viet (cm3rp) 18 100.75 125.81 15 83.33
13374. Keenan (keenanpanda) 18 39.76 49.04 2 11.11
13375. No you (gino455) 18 55.19 66.68 1 5.56
13376. Colby (iamzcolbz) 18 57.01 62.90 10 55.56
13377. Miha (mihabala) 18 22.70 26.22 2 11.11
13378. aialtyn (aialtyn) 18 18.11 21.33 3 16.67
13379. Sima (sima814) 18 50.02 62.97 1 5.56
13380. Ludvig (ludvig_tydanus) 18 47.74 57.11 1 5.56
13381. rob (mortal_) 18 69.61 85.66 7 38.89
13382. eyeris (eyerisheehee) 18 59.77 75.45 2 11.11
13383. Kayna (kayna16) 18 58.10 71.74 5 27.78
13384. Ekar (argetlam1) 17 92.62 101.56 4 23.53
13385. Gui (apollovx) 17 65.25 81.25 3 17.65
13386. Janindu (aokiesan) 17 88.90 104.16 6 35.29
13387. Ana (anophoo) 17 79.04 89.13 4 23.53
13388. Annie (anniesshl) 17 66.78 80.13 7 41.18
13389. ami (amisupreme) 17 110.70 130.11 9 52.94
13390. amirhossein (amirho) 17 66.81 80.25 3 17.65
13391. Ashley Harrison (amharrison15) 17 67.76 81.64 2 11.76
13392. Eric (almiightyeric) 17 57.12 69.75 2 11.76
13393. Alkinoos (alkonline66) 17 50.96 56.16 0 0.00
13394. alisha (alishalovesyou) 17 80.12 95.88 2 11.76
13395. Alinferno (alinferno) 17 70.05 87.93 15 88.24
13396. Alex (alexhell) 17 82.23 96.30 3 17.65
13397. Alexandar (alexandargrav) 17 66.77 83.11 4 23.53
13398. Tobias (akwhideki) 17 89.55 102.03 11 64.71
13399. Akela (akela123) 17 103.41 118.51 9 52.94
13400. aibek (aibek210603) 17 43.19 49.76 2 11.76
13401. ahmed (ahmed98) 17 63.36 76.22 2 11.76
13402. Ahmad (ahmad4) 17 74.78 92.88 8 47.06
13403. Louis (advguy) 17 99.00 111.28 9 52.94
13404. Jack (adc6768) 17 97.37 114.43 7 41.18
13405. ace (aceguarde) 17 99.80 118.14 16 94.12
13406. Aboxgwer (aboxthetyper) 17 73.66 89.12 2 11.76
13407. Abhijeet17o (abhijeet17o) 17 54.02 65.45 6 35.29
13408. ABe (abenms92) 17 94.98 120.62 3 17.65
13409. Iam (aaaallleen) 17 71.21 85.18 3 17.65
13410. aaaaaaaaaaaaaa (aaaaaaaaooo... 17 64.27 76.32 6 35.29
13411. 962 Pixels (962pixels) 17 79.05 90.33 8 47.06
13412. Jasper (7essek) 17 90.46 98.08 4 23.53
13413. dd (6768695865) 17 51.17 57.76 1 5.88
13414. David (2mill) 17 108.17 131.18 7 41.18
13415. Li Han (1774li) 17 35.66 48.17 1 5.88
13416. Lime (limabean60923) 17 67.94 77.78 5 29.41
13417. Mariana (marianafa) 17 54.77 68.06 6 35.29
13418. Araina (discobroccoli) 17 80.41 96.60 5 29.41
13419. Jonah (yuuya_hori) 17 71.56 86.24 10 58.82
13420. Joshua (tjosher) 17 96.19 106.61 7 41.18
13421. Kanye (viprin_6749) 17 64.20 78.43 3 17.65
13422. NICK ILARIDIS (nilaridis) 17 30.41 34.37 0 0.00
13423. Ajax (ajaxdavis) 17 83.20 109.64 10 58.82
13424. Pratyush (_darkcrow_) 17 55.39 63.39 4 23.53
13425. Gustav (rexdk123) 17 47.23 55.56 4 23.53
13426. 3Cow (kendogplayz) 17 62.13 82.51 3 17.65
13427. Mike (munduss) 17 121.36 146.77 9 52.94
13428. noyoudweeb (noyoudweeb) 17 68.53 81.11 7 41.18
13429. joe seph (loer) 17 86.40 103.74 6 35.29
13430. Havinastroke (saltyhavin) 17 61.21 80.11 4 23.53
13431. Afraaj (afraj) 17 63.31 74.28 4 23.53
13432. Akshat (nothingness_) 17 55.98 65.54 5 29.41
13433. Degeu (darius_primarul) 17 48.99 55.69 2 11.76
13434. tmurtle123 (whenindan) 17 89.89 113.02 5 29.41
13435. Cole (mechanicalmac) 17 60.26 69.60 4 23.53
13436. AbeerOP (jazztoofast) 17 65.69 75.06 2 11.76
13437. Kazu (kazu_0321) 17 43.23 50.99 4 23.53
13438. Riu (yung_sushi) 17 51.81 64.27 9 52.94
13439. jaoo (joaocunhajeronimo) 17 80.71 105.40 4 23.53
13440. anAVGtyper (mallunahi) 17 58.24 73.19 0 0.00
13441. mads (madsor) 17 57.51 73.27 7 41.18
13442. Skafi (madps) 17 53.77 64.22 2 11.76
13443. Mack (mack49) 17 59.92 83.06 4 23.53
13444. Aiden (maccraker) 17 77.27 92.27 6 35.29
13445. m3hdi (m3hdi_v1) 17 37.18 42.78 1 5.88
13446. luiz (lzcr) 17 64.82 75.95 7 41.18
13447. jonson (lyfissht) 17 78.28 98.03 5 29.41
13448. Luis (luwec) 17 88.71 103.76 6 35.29
13449. Luminer (luminerr) 17 71.46 82.06 7 41.18
13450. sky (lumihime) 17 116.36 130.91 9 52.94
13451. Lukas (lukaas506) 17 48.97 58.62 2 11.76
13452. Lucifer (lucifer179) 17 98.82 116.88 10 58.82
13453. Lucid (lucideous) 17 57.64 71.20 4 23.53
13454. LoyalPotato (loyalpotato) 17 75.54 86.17 4 23.53
13455. Lock'd (lockd) 17 88.38 102.83 6 35.29
13456. Frederick (liquidfyre) 17 84.21 100.27 5 29.41
13457. John (linkstart15) 17 75.06 98.57 3 17.65
13458. Linh (linhbo5369) 17 57.95 70.03 5 29.41
13459. YEET (lemonstate) 17 95.20 105.68 7 41.18
13460. Endy (legaljeans) 17 76.52 90.58 6 35.29
13461. Lee-Andria (leelo135) 17 52.29 67.67 0 0.00
13462. Aidan (leankirito) 17 54.66 61.51 4 23.53
13463. Dosnt (laxrpy) 17 64.49 74.15 2 11.76
13464. Lavish (lavish10) 17 62.55 75.12 3 17.65
13465. Lasey (lasey) 17 95.22 109.65 9 52.94
13466. Landon (landonthull) 17 73.54 88.77 7 41.18
13467. Gay Toyholi (l3hargav) 17 88.30 98.37 4 23.53
13468. Kypster (kypster) 17 90.86 111.69 5 29.41
13469. kx_167 (kx_167) 17 46.96 58.80 2 11.76
13470. ItsKevin (kwilz) 17 91.42 103.59 10 58.82
13471. Vipin (kumarvipin) 17 46.43 54.09 1 5.88
13472. Kristjan (krissimoney) 17 112.19 128.37 5 29.41
13473. krishna (krishnatallani) 17 32.11 37.24 0 0.00
13474. Alex (krim19) 17 108.07 120.27 11 64.71
13475. ren (krenz) 17 72.64 87.66 5 29.41
13476. codingmickey (kj_mickey) 17 54.12 66.00 3 17.65
13477. kinderblack (kinderblack) 17 95.66 106.97 2 11.76
13478. Rolf (key_fingerer) 17 38.32 44.42 0 0.00
13479. Kevin (kevinstark10) 17 87.33 103.82 5 29.41
13480. Kevin (kevgod48) 17 115.50 126.71 9 52.94
13481. brandon (kbseah) 17 118.52 133.97 7 41.18
13482. Kathryn (kathrynida) 17 94.40 104.98 8 47.06
13483. Karston (karstonjim) 17 84.02 93.11 17 100.00
13484. n (kantotoro) 17 42.98 64.59 2 11.76
13485. Niko (kale_bog_vremena) 17 51.31 68.39 0 0.00
13486. Avery (jythonscript) 17 90.03 99.44 5 29.41
13487. JustMonotone (justmonotone) 17 117.77 131.15 12 70.59
13488. Juprai (juprai) 17 126.78 155.21 10 58.82
13489. Julien (julien123) 17 38.91 44.81 1 5.88
13490. Jacob (jq231) 17 116.54 138.78 9 52.94
13491. Jonathan (john_ee) 17 58.73 66.67 4 23.53
13492. John (johnnymauser) 17 80.34 96.58 3 17.65
13493. Joe (joemama17) 17 92.86 113.57 5 29.41
13494. bryan (joebidens_son) 17 70.88 92.65 12 70.59
13495. Jorgle (jmgcito) 17 65.78 83.65 5 29.41
13496. Jimmy (jimmyceballos) 17 74.20 97.68 3 17.65
13497. The Dank Duck (jephjeff) 17 73.05 83.54 4 23.53
13498. Jacky (jclau299) 17 94.01 110.55 10 58.82
13499. jazon (jazonandes) 17 121.24 160.25 7 41.18
13500. Jaxson (jaxxxson) 17 110.79 123.81 7 41.18
13501. javoscript (javoscript) 17 83.73 90.36 6 35.29
13502. Jason (jasonliang19) 17 88.47 111.54 5 29.41
13503. Jakob (jagebuuu) 17 52.96 62.75 2 11.76
13504. Jordan (j0rdanb) 17 85.97 99.53 9 52.94
13505. Farrel (i_i_c_h_e_n_i_i) 17 95.63 115.35 5 29.41
13506. Brandon (ivantt) 17 105.62 125.86 9 52.94
13507. ITSPUJIS (itspujis) 17 67.51 89.04 2 11.76
13508. Iris (irxs_q) 17 145.02 168.48 14 82.35
13509. DooDoo (ininjashadows) 17 78.53 106.89 3 17.65
13510. Nolan (ilovebluecars_13) 17 13.71 17.01 5 29.41
13511. Iliya (iliyacloud) 17 53.99 71.22 2 11.76
13512. Imad (ikhan9059) 17 46.81 55.83 2 11.76
13513. IDK (iimarch) 17 36.66 47.60 1 5.88
13514. stef (ihasstuff) 17 71.84 80.29 7 41.18
13515. Ivan (ichauster) 17 109.09 137.19 7 41.18
13516. hwalters360 (hwalters360) 17 108.32 133.34 10 58.82
13517. jib (huwakiin) 17 71.00 79.33 10 58.82
13518. Ante (houci) 17 111.93 131.37 7 41.18
13519. tenzin (hopeful_engineer) 17 83.35 95.89 4 23.53
13520. hubbe (hoffiis) 17 68.92 75.32 4 23.53
13521. hksgiroro (hksgiroro) 17 56.15 67.76 4 23.53
13522. Gaurav (hisdudeness) 17 111.21 124.07 4 23.53
13523. Thebe (hikwon) 17 86.68 98.31 5 29.41
13524. Vinz (hexxel7) 17 105.75 115.95 8 47.06
13525. Hexishu (hexishu) 17 105.70 119.66 17 100.00
13526. Jerry (heatsflamesman) 17 128.45 149.57 14 82.35
13527. haykalive (haykalive) 17 54.97 64.35 7 41.18
13528. tstats[harveycoolestkid69] ... 17 103.34 125.94 5 29.41
13529. Hans (hansyu7) 17 85.19 92.18 6 35.29
13530. Hamza (hamzayt577) 17 66.34 77.24 1 5.88
13531. Hadge (hadgeoriginal) 17 128.08 166.42 7 41.18
13532. Davey (gujin) 17 113.45 139.35 5 29.41
13533. GpJay (gpjay) 17 56.54 63.60 3 17.65
13534. Lukas (gotorono) 17 80.12 91.94 5 29.41
13535. Connor (gothorpe) 17 65.03 75.03 7 41.18
13536. jack (golduckz) 17 110.21 131.92 8 47.06
13537. knowagh (gnoweagh) 17 96.14 105.33 2 11.76
13538. GitGawd (gitgawd) 17 88.77 104.30 10 58.82
13539. Shimon (gastronom) 17 69.22 82.66 5 29.41
13540. AttackKing (garypop) 17 47.29 53.59 3 17.65
13541. Felix (ganc56141) 17 106.79 130.87 8 47.06
13542. Gabriel (gabrielot) 17 44.63 52.55 7 41.18
13543. gabe (gabersnake) 17 84.44 92.84 4 23.53
13544. Paul (___paul___) 17 87.84 102.23 5 29.41
13545. Gagik (_the_wind) 17 68.69 78.15 4 23.53
13546. Medi (_medi) 17 109.87 127.94 6 35.29
13547. Kyle (_dukz) 17 79.33 88.09 8 47.06
13548. Zaid (zzzaid) 17 112.17 146.06 10 58.82
13549. Winston (zywinston) 17 118.41 138.79 10 58.82
13550. Free Palestine (zobad) 17 114.84 139.60 10 58.82
13551. Znypr (znypr) 17 76.17 89.49 4 23.53
13552. Oscar (zeropuu) 17 72.74 87.67 5 29.41
13553. Zenyth (zenyth) 17 70.74 74.32 3 17.65
13554. Kalap (zenithorigin) 17 135.99 160.74 14 82.35
13555. Mohammad (zargar91) 17 53.91 67.82 2 11.76
13556. Dan (yugurtz) 17 98.76 133.29 7 41.18
13557. Yuelia (yuelia) 17 110.42 126.50 13 76.47
13558. Yousuf Ali (yousuf_97) 17 47.92 55.94 5 29.41
13559. Jo/yf (yousseff) 17 74.90 86.04 7 41.18
13560. youcef (youcef_kehal011) 17 35.10 43.25 0 0.00
13561. Eddie (yogurtdan) 17 83.07 121.00 1 5.88
13562. JRD (yesjrd) 17 107.88 123.19 7 41.18
13563. Suken (x_suken_x) 17 87.69 102.04 4 23.53
13564. Sean (xslslx) 17 79.03 96.98 3 17.65
13565. Grzegorz (xreere) 17 61.36 75.94 0 0.00
13566. Justin (xpirep) 17 101.26 119.19 6 35.29
13567. Nepotism (xjqm_z) 17 89.79 107.80 3 17.65
13568. William (xenosaints) 17 108.43 125.59 7 41.18
13569. Louis (xchampionx) 17 128.38 152.00 14 82.35
13570. Riley (wulfmane) 17 86.16 122.06 5 29.41
13571. Olivier (whiskyforagrownman) 17 93.70 116.56 6 35.29
13572. Joakim (wakakins) 17 61.08 81.68 1 5.88
13573. VyPah (vypah) 17 99.03 113.82 12 70.59
13574. can't type :) (void7750) 17 112.49 126.53 10 58.82
13575. ViktorT (vitr_88) 17 76.87 85.70 7 41.18
13576. Erik (virumdreng) 17 89.55 102.66 11 64.71
13577. Vincent (vincback) 17 104.67 117.42 5 29.41
13578. Raiko (vilo1) 17 46.57 53.96 3 17.65
13579. hallelujah (veil) 17 123.66 153.37 6 35.29
13580. Vavro (vavro) 17 51.20 64.38 0 0.00
13581. Valian (valian) 17 64.98 72.90 2 11.76
13582. Vanessa (v4nv4n) 17 104.42 123.82 9 52.94
13583. yooooooongi (utlyoongs) 17 88.80 107.74 5 29.41
13584. Unicorn017 (unicorn017) 17 50.81 61.68 4 23.53
13585. Ulises (umoreno) 17 62.52 69.77 3 17.65
13586. Tyler47 (tytycrewz) 17 49.20 60.67 5 29.41
13587. tiramisu (typist786) 17 77.91 86.36 5 29.41
13588. typing chad (typing_chad) 17 74.68 97.67 0 0.00
13589. Gerald (tycholoko) 17 74.87 98.40 4 23.53
13590. Lucas (twinbros) 17 39.66 55.29 14 82.35
13591. NIETian (tushgaurav) 17 44.84 54.75 10 58.82
13592. Ryan (turtleboy1017) 17 103.35 112.65 6 35.29
13593. ttvnaaya786 (ttvnaaya786) 17 89.65 101.20 4 23.53
13594. Truong (truong_huy) 17 42.26 46.26 0 0.00
13595. Ralph (triathreat) 17 96.80 124.46 9 52.94
13596. trer10 (trer10) 17 89.57 102.86 6 35.29
13597. Benjamin Netanyahu (tp0d) 17 99.35 122.33 7 41.18
13598. Torron (torronlester) 17 48.16 57.63 1 5.88
13599. Pratik (torpido99) 17 52.94 67.84 4 23.53
13600. ㅤ (toptied) 17 101.98 133.73 7 41.18
13601. Tulaib (toolayb) 17 79.16 94.43 9 52.94
13602. tippy (tippytypo) 17 109.14 122.69 10 58.82
13603. Timothy (timothyp823) 17 82.56 89.56 2 11.76
13604. Nana (tianananana) 17 67.88 75.34 2 11.76
13605. The (the_omnivert) 17 72.91 84.03 5 29.41
13606. Theo (the_o) 17 71.89 85.31 4 23.53
13607. Jon Bob (thejonbob) 17 52.27 66.06 4 23.53
13608. Ky (thaediir) 17 82.28 98.11 6 35.29
13609. Alexandro (terribletyper0) 17 78.24 93.75 5 29.41
13610. Terra (terranavis) 17 98.86 116.53 8 47.06
13611. Carson (terminator2424) 17 81.16 105.42 5 29.41
13612. Teho (tehoo) 17 111.31 129.74 12 70.59
13613. Md. Tahsinul Anwar (tahsinu... 17 63.84 76.47 4 23.53
13614. john (tacozmanz) 17 81.98 94.05 1 5.88
13615. emily (swimmerpenguin) 17 101.22 118.35 10 58.82
13616. John (supercriticalco2) 17 43.84 57.04 4 23.53
13617. kobus (supercatspeed) 17 26.67 32.50 1 5.88
13618. hafit (streekytyper) 17 64.80 76.06 4 23.53
13619. Stefan (stephen27) 17 78.90 86.31 3 17.65
13620. spiderman (spiderman943) 17 41.35 54.61 2 11.76
13621. Rice (speedtoggled) 17 81.54 93.88 7 41.18
13622. Jeel (speedracers_brother) 17 54.72 62.20 0 0.00
13623. Tommy (sparkxd) 17 75.57 97.13 3 17.65
13624. Spanchsan (spanchsan) 17 49.59 60.26 2 11.76
13625. Young (so_many_errors) 17 92.80 112.55 7 41.18
13626. Soren (sorentypes) 17 79.31 95.54 5 29.41
13627. Soham (soham_grover) 17 46.72 60.57 3 17.65
13628. Slowpoke (slowpoketypo) 17 61.07 70.17 2 11.76
13629. Marie (slowestone) 17 31.30 39.41 1 5.88
13630. Slicky (slickyslide) 17 59.60 66.31 4 23.53
13631. Sam (sirgalahad7) 17 71.70 80.23 2 11.76
13632. Katappa (sim007) 17 92.69 123.35 13 76.47
13633. Spencer (silentfoe9) 17 63.00 71.16 7 41.18
13634. Sid (sidd31) 17 51.94 57.05 1 5.88
13635. shcal (shcal) 17 119.96 135.41 7 41.18
13636. Shane (shane_umayanga) 17 53.64 60.22 1 5.88
13637. shmz (shamyob) 17 60.58 70.22 2 11.76
13638. Serhii (sergomashina) 17 58.36 63.57 5 29.41
13639. Sepia (sepiadrunfada) 17 54.78 60.78 1 5.88
13640. SeniorMomo (seniormomo) 17 105.68 131.57 8 47.06
13641. Nathaniel (scryo) 17 70.46 94.65 3 17.65
13642. schru (schru) 17 83.37 90.75 8 47.06
13643. SantiX (santix1225) 17 71.92 91.77 7 41.18
13644. Sammy (sammykiller) 17 82.93 97.08 4 23.53
13645. Sujith (sai_sujith) 17 42.87 51.31 2 11.76
13646. Said (saidahror_2021) 17 85.73 97.57 8 47.06
13647. Leonardo (saborfaze) 17 67.84 80.34 3 17.65
13648. R (ryanteebag) 17 116.09 129.02 12 70.59
13649. Tom (rusteze) 17 66.59 76.41 3 17.65
13650. Ruslan (ruslancik97) 17 58.07 73.76 3 17.65
13651. Jessica (runningfox) 17 35.45 43.28 1 5.88
13652. T (rumikasa) 17 140.68 168.01 17 100.00
13653. Michael (rucc) 17 87.40 109.99 9 52.94
13654. Kuy (rou168) 17 98.49 111.79 9 52.94
13655. Leimondu (roshia) 17 95.37 104.80 7 41.18
13656. tstats[roselaflesh] (rosela... 17 90.70 108.84 6 35.29
13657. Roboute (robosote) 17 85.61 96.18 8 47.06
13658. Ryan (rloftus) 17 65.17 70.70 2 11.76
13659. I'm bad at this :( (rl27) 17 115.27 125.03 12 70.59
13660. spi (ririnasandasimp) 17 68.90 87.88 16 94.12
13661. Tuna (rippleshark) 17 55.76 66.02 3 17.65
13662. Rick (rickssbm) 17 89.08 96.75 6 35.29
13663. daydreamer (rhebbar) 17 29.72 37.49 2 11.76
13664. Rey (reycuadrado) 17 115.20 147.96 8 47.06
13665. Jake (relaxing) 17 57.41 68.16 3 17.65
13666. rehsur (rehsur) 17 76.30 88.43 5 29.41
13667. Regz (regz84) 17 84.70 99.49 8 47.06
13668. Josh (raybanned) 17 84.02 108.86 3 17.65
13669. forrest (rares9110) 17 50.47 57.78 3 17.65
13670. rakushun (rakushun) 17 35.72 43.52 2 11.76
13671. Rae (raedog) 17 119.09 138.95 6 35.29
13672. Joses (radcaly) 17 71.27 86.41 3 17.65
13673. Road to 90 wpm (qimichanga) 17 70.22 82.54 5 29.41
13674. Rahil (prplplay) 17 58.46 67.38 2 11.76
13675. Pradip (pradipg) 17 75.60 109.39 13 76.47
13676. พงษ์ปกรจ์... 17 32.88 40.70 11 64.71
13677. Scott (pogogunner) 17 85.28 103.09 9 52.94
13678. Punch (pognick) 17 100.03 111.93 6 35.29
13679. PNBLVN (pnblvn) 17 87.49 101.95 5 29.41
13680. Plohka (plohka) 17 75.36 89.86 6 35.29
13681. Renaldi (plbu) 17 74.46 92.40 3 17.65
13682. mati (pitoloco) 17 49.98 64.89 1 5.88
13683. PeterParker20 (piter11116) 17 78.75 94.08 6 35.29
13684. Bryan (pinkypoo) 17 69.07 77.41 3 17.65
13685. Myron (piececontrol_inq) 17 47.13 53.19 3 17.65
13686. Hans (phindy) 17 99.50 124.79 3 17.65
13687. Philluminati (philluminati) 17 81.99 95.35 5 29.41
13688. Vidu (pererav) 17 60.13 68.97 3 17.65
13689. Pelli (pellikan) 17 89.82 104.26 4 23.53
13690. Rohith (pebblepot) 17 56.35 72.16 3 17.65
13691. Paul (paultot) 17 32.80 39.35 2 11.76
13692. 🐌 (paultippt) 17 69.84 80.51 4 23.53
13693. Patryk (patryk5361) 17 73.27 86.85 5 29.41
13694. PapaCologne (papacologne1) 17 59.90 70.44 2 11.76
13695. owlsoup (owlsoup) 17 93.34 115.70 8 47.06
13696. OP (owenpatch) 17 99.21 115.02 6 35.29
13697. Otakranio (otakranio) 17 63.91 83.28 4 23.53
13698. piglet (orangepig111) 17 84.93 100.29 6 35.29
13699. Onur (onur0591) 17 83.66 99.52 8 47.06
13700. Omer (omersudo) 17 71.85 81.97 2 11.76
13701. Ascend (obaht) 17 49.44 56.41 1 5.88
13702. Nuwaisir (nuwaisir) 17 70.61 79.55 2 11.76
13703. Tom (noviamagna) 17 104.82 123.16 5 29.41
13704. noctnight (noctnight) 17 107.00 128.26 13 76.47
13705. nkunder (nkunder16) 17 50.73 60.35 2 11.76
13706. Do people have computers in... 17 75.83 91.35 1 5.88
13707. nilebr (nilebr) 17 96.69 108.73 2 11.76
13708. nikola (nikininja13) 17 63.47 79.07 4 23.53
13709. ning (niing) 17 74.38 89.55 7 41.18
13710. Nicholas (nicholaspatrick) 17 88.73 105.12 2 11.76
13711. nam (ngxnam) 17 73.31 86.36 4 23.53
13712. neville (neville_dnbh) 17 55.15 69.03 4 23.53
13713. Natalia (natalia153) 17 55.91 65.61 4 23.53
13714. MehproPlayz (mythicfx) 17 44.32 56.04 7 41.18
13715. Michael (mwik) 17 108.25 122.23 8 47.06
13716. Peter Paul "Paulie Walnuts"... 17 106.88 117.44 12 70.59
13717. Munkhzorig (munkhzorig_0918) 17 42.33 48.37 1 5.88
13718. Multi (multibala) 17 24.67 31.46 5 29.41
13719. k1p (muggz) 17 77.21 100.70 3 17.65
13720. moschisch (moschisch) 17 51.67 62.87 1 5.88
13721. Monica (moni1101) 17 63.74 73.62 4 23.53
13722. Moe (mohannd_h) 17 61.03 69.28 5 29.41
13723. Timotej (mistimmo) 17 53.38 67.53 1 5.88
13724. . (mioumioumiou) 17 53.25 62.40 2 11.76
13725. Jiarui (mike9557) 17 70.50 87.09 4 23.53
13726. mieszko (mieszkomieszko) 17 102.39 114.73 11 64.71
13727. Michael (mhmadhatter) 17 72.11 83.46 3 17.65
13728. Abdulmohsin (mhasen) 17 59.73 68.65 2 11.76
13729. Janssen (mentalpower_ada) 17 67.17 76.86 7 41.18
13730. tobias (memebigboyisbig) 17 62.00 68.54 5 29.41
13731. Maximal (maximalelder) 17 79.06 93.36 7 41.18
13732. Romping (max61090) 17 95.33 107.19 9 52.94
13733. Matthew (matthewb83) 17 91.10 106.01 9 52.94
13734. b lmao (matt16861) 17 129.39 144.72 12 70.59
13735. Tahj (mathpunsaresin) 17 73.46 84.85 5 29.41
13736. Max (marvelnoodles) 17 67.18 81.76 5 29.41
13737. Martina (martinaon) 17 115.70 140.90 12 70.59
13738. Cody (marshmink) 17 88.68 102.61 5 29.41
13739. Aleksa (mandorinaa) 17 68.88 78.70 5 29.41
13740. IAmAtomicツ (from_phlol) 17 93.28 111.95 9 52.94
13741. Jakub (frogixd) 17 69.94 80.54 2 11.76
13742. trapinch_ (fortissim2) 17 123.57 138.15 10 58.82
13743. Typo (foop101) 17 76.48 92.59 5 29.41
13744. Flash (flashlegion) 17 53.52 67.42 2 11.76
13745. Yeeet (flamestar21) 17 45.24 56.30 4 23.53
13746. Firzan (firzanarmani) 17 68.53 78.11 3 17.65
13747. Jared (filmman2k3) 17 77.38 104.35 7 41.18
13748. Francisco (fanaya2001) 17 50.65 69.94 1 5.88
13749. faf (faf222) 17 48.46 60.26 1 5.88
13750. Eshan (e_khan) 17 89.68 105.35 8 47.06
13751. Eustion (eustion) 17 89.91 103.00 7 41.18
13752. Ethan (ethankramer) 17 68.82 83.58 11 64.71
13753. Ben (essequattro) 17 101.90 116.36 12 70.59
13754. mb3awi (emptybox34) 17 100.50 111.41 7 41.18
13755. wizz (empathetic_orange) 17 48.45 57.81 2 11.76
13756. emma (emmmmmmmaaaaa) 17 75.12 86.68 1 5.88
13757. Emil (emle10) 17 98.94 118.12 3 17.65
13758. Mark (emessdoubleyou) 17 70.10 79.20 4 23.53
13759. Liz (elizabethl3_13) 17 76.68 100.50 5 29.41
13760. Someone (elderpotato) 17 88.42 104.55 6 35.29
13761. Connor (edgeburn) 17 88.67 102.77 5 29.41
13762. e (eddyhack) 17 89.46 105.81 8 47.06
13763. Benjamin (echobox) 17 54.84 65.52 1 5.88
13764. yes (easytoremember1) 17 104.41 116.65 3 17.65
13765. Luuk (dutchprojects) 17 88.76 108.99 7 41.18
13766. Megan (durvish) 17 71.83 89.24 3 17.65
13767. Huy (duchuynguyen94) 17 89.31 97.36 8 47.06
13768. Benjamin (drwumboo) 17 70.79 85.34 5 29.41
13769. Andrew JK Brown (droid2) 17 53.90 62.49 2 11.76
13770. Ghost (djinxkay) 17 116.93 146.25 10 58.82
13771. Đình (dinhhhaii51) 17 75.18 91.60 2 11.76
13772. epic gamer (dianalin2) 17 93.35 104.16 5 29.41
13773. CZ (derpiestme) 17 97.74 111.47 7 41.18
13774. Niels (dekleinekabouter) 17 83.80 99.35 2 11.76
13775. Andres (defmaxer) 17 93.33 110.14 3 17.65
13776. Deepanshu (deepanshu9) 17 66.77 79.33 7 41.18
13777. Amir (dead_developer) 17 44.15 49.57 2 11.76
13778. Cedric (ddeadz) 17 85.48 112.35 10 58.82
13779. David Roberts (davidrobertsla) 17 78.99 99.30 15 88.24
13780. Darren Goh (darrengoh_23) 17 86.72 104.44 7 41.18
13781. Bhavya (dark_knight_2914) 17 58.60 70.67 10 58.82
13782. Patrick (darkpatrick00) 17 99.30 107.26 5 29.41
13783. Dany (danypeter) 17 75.03 93.78 11 64.71
13784. nuzzlebuddy (danieldan937) 17 83.76 97.71 3 17.65
13785. Dana (dana_cardinal) 17 125.09 141.84 13 76.47
13786. dak (dakn) 17 90.48 104.13 6 35.29
13787. Dauren (d0ka) 17 52.73 65.05 1 5.88
13788. Cyrush (cyrus_h) 17 115.97 134.19 11 64.71
13789. David (cuber988) 17 93.76 100.80 11 64.71
13790. Crestyn (crestyn) 17 96.97 110.80 8 47.06
13791. C (cpandar) 17 86.06 101.40 3 17.65
13792. Rod (compangit) 17 93.66 106.37 6 35.29
13793. Cole (coleb117) 17 105.78 114.90 0 0.00
13794. SAM (clencod) 17 65.47 84.76 3 17.65
13795. Matt (choofkoof) 17 100.69 112.59 10 58.82
13796. Chessy (chescahi) 17 96.34 111.00 7 41.18
13797. cheryl (cherylkaiser) 17 66.00 72.71 4 23.53
13798. chepchombir (chepchombir) 17 68.82 77.37 6 35.29
13799. Nieves (cheezy_butter) 17 86.10 104.35 4 23.53
13800. Matija (ch4p0) 17 64.83 74.47 4 23.53
13801. Casper (casperwang) 17 68.55 82.58 4 23.53
13802. Isaac (carokann09) 17 100.58 113.60 1 5.88
13803. mickey (c2sulli) 17 105.74 116.05 9 52.94
13804. Semih (byshadow93) 17 66.88 78.09 6 35.29
13805. DeStuert (bully_hunter) 17 59.79 68.60 2 11.76
13806. deji the tank (bulgewarden) 17 66.92 83.63 7 41.18
13807. Bogart (bogartii) 17 79.90 87.55 5 29.41
13808. bobva (bobva) 17 107.02 128.74 9 52.94
13809. boris (bobi412) 17 54.01 61.83 1 5.88
13810. Bren (bnern) 17 75.34 89.60 4 23.53
13811. Ben (blob1010) 17 47.67 59.97 2 11.76
13812. Björn (bjornboss) 17 69.66 78.60 6 35.29
13813. Zicheng (bin_laggin) 17 90.06 111.93 8 47.06
13814. Finnnnnnn (bigfinsfananza) 17 84.61 101.64 6 35.29
13815. Isabella (bfbubblegum) 17 90.83 103.65 4 23.53
13816. Robert (bertazz) 17 51.27 59.81 1 5.88
13817. Ava (berry_blue) 17 77.04 97.01 3 17.65
13818. Bensie (bensie1) 17 105.05 124.32 14 82.35
13819. bstridr (bellie__) 17 78.19 93.57 5 29.41
13820. Phil (beastfromthe_east) 17 57.01 71.19 3 17.65
13821. Baizak (baizak) 17 43.26 50.86 2 11.76
13822. Austin (auzzyauger) 17 46.83 56.19 0 0.00
13823. Alex Grace (attttyila) 17 91.88 101.88 7 41.18
13824. Dre (atarez) 17 127.68 151.29 16 94.12
13825. 3 (astoria2213) 17 60.56 70.47 6 35.29
13826. Ashveck (ashveck) 17 64.06 75.90 3 17.65
13827. Muahmmad (arul2101) 17 64.09 87.76 5 29.41
13828. ArticSeries (articseries) 17 97.85 106.92 6 35.29
13829. army (armygirl123) 17 44.48 54.38 1 5.88
13830. e (freshcabbage) 16 65.33 80.76 5 31.25
13831. Alonne (freeman_1337) 16 87.63 95.44 8 50.00
13832. Connor (frantelle) 16 71.23 87.40 6 37.50
13833. hollup (frankzzzzzzz) 16 82.54 89.60 1 6.25
13834. Andrew (foruforu) 16 92.09 104.81 3 18.75
13835. Snow (forgotmypassword) 16 103.51 116.87 11 68.75
13836. Christian (flaze07) 16 113.46 136.79 7 43.75
13837. Ryan (flamepopo) 16 110.56 130.41 7 43.75
13838. c4c (firewolfrain) 16 159.90 217.71 14 87.50
13839. firealpaca1 (firealpaca1) 16 74.71 93.12 7 43.75
13840. frog (fijixt) 16 92.60 117.46 12 75.00
13841. Tyler Spruill (fightingox) 16 107.91 125.09 6 37.50
13842. gonçalo (figados) 16 95.78 106.59 3 18.75
13843. Abdullah (fe4rlesscloak) 16 100.09 119.65 8 50.00
13844. FatPanduh (fatpanduh) 16 125.40 136.50 9 56.25
13845. Vikram (fast_life) 16 44.39 51.31 2 12.50
13846. Chimaera (excalibur4212) 16 114.09 143.13 9 56.25
13847. Evelyn (evelyn_mh) 16 75.60 100.92 4 25.00
13848. EternalTempest (eternaltemp... 16 54.68 63.88 2 12.50
13849. Eren (eren_ackerman) 16 91.53 108.29 7 43.75
13850. Epoch (epochisepic) 16 87.89 104.51 4 25.00
13851. Epic (epic_gamer2834) 16 107.87 133.62 9 56.25
13852. CJ (entrity_screamr) 16 113.60 136.53 7 43.75
13853. Enea (enea) 16 66.83 79.51 1 6.25
13854. Emre (emre0) 16 75.08 85.62 3 18.75
13855. Elias (eliasjr) 16 72.43 86.45 5 31.25
13856. Eesa (eesa10) 16 75.80 88.29 4 25.00
13857. Edwin (edweezy) 16 104.95 120.12 4 25.00
13858. Edvaize (edvaize) 16 61.02 67.72 4 25.00
13859. Dennis (dwiebe) 16 45.22 55.19 3 18.75
13860. MaskDuck (duongmt) 16 51.09 61.14 6 37.50
13861. Lukas (dundis3000) 16 79.28 90.02 3 18.75
13862. Aj (drome) 16 65.78 74.61 3 18.75
13863. peace in byron (driveroncall) 16 120.53 156.84 9 56.25
13864. Drew (drewsmithworkman) 16 95.09 107.22 5 31.25
13865. Carson (dramagirl82) 16 71.62 80.60 5 31.25
13866. Dvorak Keyboard (douglasawe... 16 61.03 75.64 5 31.25
13867. not a race (donut_gublor) 16 97.77 120.02 5 31.25
13868. Dongo (dongodm) 16 91.25 129.99 5 31.25
13869. Spidget finger (djurancigan) 16 87.26 104.95 3 18.75
13870. Djordje (djo666) 16 97.31 110.20 7 43.75
13871. DiscoOrc (discoorc) 16 123.47 138.08 6 37.50
13872. Alex (dippyshere) 16 86.41 108.72 12 75.00
13873. DJ (dino_dj) 16 60.17 68.01 4 25.00
13874. Dhruv (dhruvs301) 16 83.65 91.16 5 31.25
13875. dewy (dewydh) 16 101.67 121.07 6 37.50
13876. deon (deontan) 16 111.90 124.47 9 56.25
13877. Parth (demolisher_1209) 16 79.74 97.31 7 43.75
13878. Debojoti Das (debojoti_soumya) 16 88.24 98.70 7 43.75
13879. Death (deathexploit) 16 100.79 116.71 16 100.00
13880. dayqpi (dayqpi) 16 110.50 130.36 8 50.00
13881. Davx_d (davx_d) 16 122.41 152.13 12 75.00
13882. Rooster (darkjdm) 16 118.33 142.83 11 68.75
13883. Nick (darapidninja) 16 76.47 88.79 16 100.00
13884. Justin (dainese) 16 70.69 83.07 4 25.00
13885. Christopher X Wu (cw86459) 16 85.75 112.41 1 6.25
13886. Tim (cupboard) 16 62.47 92.64 0 0.00
13887. aoxiang (cuiaoxiang) 16 82.16 98.00 6 37.50
13888. Sid (criptonate) 16 71.87 79.86 6 37.50
13889. Creepy (creepyreapy) 16 68.85 90.06 1 6.25
13890. Come (cosmeec) 16 73.23 89.68 6 37.50
13891. Mason (contourflyer2) 16 55.73 65.17 0 0.00
13892. lucho (colombimbo) 16 61.15 69.48 3 18.75
13893. Cocospeed (cocospeedy) 16 47.58 53.45 1 6.25
13894. clausrogisch (clausrogisch) 16 48.61 54.54 1 6.25
13895. Alex (chucky9022_) 16 67.69 85.49 3 18.75
13896. Christian (chrixsi) 16 80.44 95.55 6 37.50
13897. Joe (chogpamp) 16 64.80 74.06 4 25.00
13898. Chris (chink344) 16 95.09 110.21 5 31.25
13899. Mert (chineeswall) 16 61.15 75.71 3 18.75
13900. Charles (charles0420) 16 49.65 60.40 2 12.50
13901. Cesar (cesarloachamin) 16 64.28 69.29 2 12.50
13902. Tomlynn (carriganth) 16 47.15 51.63 2 12.50
13903. Carlo (carlofletcher) 16 100.51 121.99 8 50.00
13904. The Milkman (captain_noodle) 16 108.14 125.59 8 50.00
13905. Lachlan (cancer88) 16 66.24 83.27 3 18.75
13906. billy (bzmq) 16 117.24 131.02 12 75.00
13907. Bytes (bytesandbots) 16 77.07 94.58 5 31.25
13908. Mapko (buffi) 16 73.46 85.72 1 6.25
13909. budjetti (budgettypo) 16 85.44 102.27 3 18.75
13910. Kamalesh (brrrr_007) 16 85.12 105.84 4 25.00
13911. Bronze (bronzefrakk) 16 85.08 94.34 5 31.25
13912. Breadman (breadman0123) 16 85.39 96.55 5 31.25
13913. Bosco (boscorj) 16 48.18 61.48 7 43.75
13914. ahmed (borr3y) 16 52.45 59.20 2 12.50
13915. Blue._. (bluewaves54) 16 83.91 98.85 6 37.50
13916. carl (blackhole24) 16 64.15 74.82 5 31.25
13917. Matthew (binko) 16 84.44 95.56 4 25.00
13918. yuh (billbrown86) 16 53.08 64.54 2 12.50
13919. Ben Asam (bemarc) 16 91.14 107.64 6 37.50
13920. Beluga (belugabetter) 16 94.35 105.86 3 18.75
13921. Abijith (believertn) 16 53.43 64.48 2 12.50
13922. Jon (bdnoj618) 16 83.91 96.67 2 12.50
13923. Sebastian (badwine) 16 55.73 71.77 2 12.50
13924. Brian (a_job_well_done) 16 132.07 141.19 12 75.00
13925. Ayush (ayushgandhi) 16 55.93 61.41 4 25.00
13926. ayrus (ayrus01) 16 56.52 64.17 3 18.75
13927. leonidas (awsomaw) 16 166.65 190.62 5 31.25
13928. ava (ava_er) 16 41.40 56.37 2 12.50
13929. kuan-Yu (austin737) 16 73.26 91.99 4 25.00
13930. tobias (atomstodin) 16 65.68 82.78 5 31.25
13931. Askur (askur00) 16 81.14 89.99 7 43.75
13932. Prad (_rad0n_) 16 39.93 52.75 1 6.25
13933. Itai (zytell) 16 73.08 91.76 3 18.75
13934. Zond (zohend) 16 55.77 64.33 4 25.00
13935. Zogurt (zogurt) 16 69.67 84.55 0 0.00
13936. Jonte (zitrex) 16 91.17 108.37 3 18.75
13937. Alex (zimbo21003) 16 70.73 83.78 2 12.50
13938. Zai (zaibeez) 16 86.44 97.38 12 75.00
13939. Zach (zach_htet) 16 82.76 94.64 3 18.75
13940. yuts (yts1999) 16 76.51 86.39 0 0.00
13941. yourrrfattt (yourrrfattt) 16 66.24 79.56 6 37.50
13942. vaughn (youmomgae) 16 93.91 99.56 6 37.50
13943. Roy (yoruio) 16 96.73 114.35 4 25.00
13944. YoloPlayz (yoloplayz10) 16 61.52 76.33 4 25.00
13945.   (yewk) 16 85.31 101.39 8 50.00
13946. yikes (yeknom) 16 96.03 110.54 7 43.75
13947. Y (ydelirious) 16 87.42 106.82 4 25.00
13948. AloneStranger (yasdf007) 16 73.77 79.56 7 43.75
13949. xnfra (xnfra) 16 65.00 77.21 1 6.25
13950. winterml3on (winterm3lon) 16 116.90 131.08 7 43.75
13951. John (wilde1) 16 87.49 107.82 6 37.50
13952. Mike (wikemazowski) 16 109.51 139.65 6 37.50
13953. Wexxort (wexxort) 16 64.73 75.85 3 18.75
13954. Khalid (weebsensation) 16 89.02 96.86 7 43.75
13955. Teddy (wazazaby) 16 86.59 96.98 1 6.25
13956. Schakrin (wavezzx) 16 66.25 78.39 4 25.00
13957. Allison (vllisunshine) 16 72.42 85.96 3 18.75
13958. Vlad (vlasuo) 16 111.14 138.59 8 50.00
13959. Pavel (vladmrovich) 16 61.76 70.99 3 18.75
13960. GargoyleG (vitalstatistixg) 16 91.80 102.09 6 37.50
13961. viRo (virosnes) 16 116.21 143.24 7 43.75
13962. vineel (vineel) 16 87.71 102.11 4 25.00
13963. Vicente (vincetroid) 16 54.12 62.49 1 6.25
13964. Thanasis (vidani) 16 57.18 68.22 3 18.75
13965. Shawn (vglunatic) 16 79.72 98.14 6 37.50
13966. Velonik (velonik_12) 16 60.67 66.60 4 25.00
13967. Vaibhav (vaibhavvyas) 16 78.67 99.57 5 31.25
13968. Doomguy (vader_) 16 76.03 92.64 6 37.50
13969. Anoos (ushagaming) 16 77.63 97.08 4 25.00
13970. user1458 (user1458) 16 65.39 70.68 4 25.00
13971. alax (urlonglostdog) 16 65.43 74.34 2 12.50
13972. Abdullah Al (uniquesociety) 16 56.84 65.49 10 62.50
13973. YoloSwag (unicornbronie) 16 103.20 117.87 7 43.75
13974. rycechckn (ultimategammer) 16 106.09 120.29 10 62.50
13975. UberTraffic (ubertraffic) 16 73.59 85.85 3 18.75
13976. tstats[typhoid] (typhoid) 16 124.08 147.07 10 62.50
13977. Tyler (tyler3143) 16 94.82 115.82 6 37.50
13978. TuffTofu (tufftofu) 16 97.17 115.19 9 56.25
13979. Noemi (tsunommi) 16 87.94 119.76 0 0.00
13980. Traviz (traviz) 16 78.95 102.56 10 62.50
13981. Zelymm (toxicmyles) 16 84.46 124.71 14 87.50
13982. nevergiveup (touristlevelis... 16 80.13 97.26 4 25.00
13983. Tohru (tohruu) 16 71.43 90.78 3 18.75
13984. tochidoh (tochidoh) 16 77.87 85.93 3 18.75
13985. Jump (toadjump) 16 95.57 107.51 5 31.25
13986. querty (thisiscamelcase) 16 65.51 79.53 2 12.50
13987. Semanta (the_who) 16 73.73 90.55 4 25.00
13988. The (theking2007) 16 28.21 32.89 4 25.00
13989. hal (theemak) 16 49.10 59.67 1 6.25
13990. teyedix (teyedix) 16 50.69 56.15 2 12.50
13991. tenxone (tenxone) 16 34.52 45.02 2 12.50
13992. Collin (temposchool) 16 91.12 113.20 6 37.50
13993. Balazs (templomos51) 16 72.33 87.23 5 31.25
13994. Julien (taxes_) 16 60.00 72.28 6 37.50
13995. Taran (tarankloty) 16 128.87 148.23 7 43.75
13996. tamjid (tamjid_hasnat) 16 48.73 52.93 1 6.25
13997. V (tall_in_spirit) 16 141.07 158.97 12 75.00
13998. Nicholas (swissbanklord) 16 59.33 76.21 3 18.75
13999. ahmed (sw7ezztyper) 16 72.66 85.21 8 50.00
14000. Marco (superquack10) 16 52.25 65.21 3 18.75
14001. Sumona (sumona) 16 38.57 43.68 3 18.75
14002. Sultan (sultanbro) 16 45.50 52.54 2 12.50
14003. Hopeless (styrix358) 16 78.40 97.33 2 12.50
14004. vikas (steady_tortoise) 16 42.35 53.68 1 6.25
14005. Mirage (starry_mirage) 16 93.48 104.99 6 37.50
14006. stacie (stackieeeee) 16 77.54 91.73 4 25.00
14007. Srinivas (srini_iitkgp) 16 99.61 114.28 8 50.00
14008. sretsaM (sretsam) 16 106.40 126.97 5 31.25
14009. T-Bird (spartakick) 16 111.51 125.07 6 37.50
14010. Spadger (spadgerr) 16 115.49 128.23 15 93.75
14011. Space (spacedandy) 16 95.02 111.90 7 43.75
14012. Anthony (sp333dy) 16 93.87 115.64 9 56.25
14013. Sora (sosora) 16 43.03 51.62 3 18.75
14014. Josh (sorry_typeracer) 16 75.54 94.59 5 31.25
14015. Hafma (somaliangirl) 16 153.60 169.53 14 87.50
14016. Ben (softaco) 16 126.34 142.89 4 25.00
14017. fea (sofea_m) 16 41.50 52.66 2 12.50
14018. Michal (snowykey) 16 60.76 74.55 4 25.00
14019. Snouto (snoutowo) 16 98.90 116.57 10 62.50
14020. Sergey (snich) 16 108.92 116.17 8 50.00
14021. smowat (smowat) 16 65.26 78.31 2 12.50
14022. Ernesto (smoking_kills) 16 64.87 80.72 2 12.50
14023. SmiIe (smiie) 16 104.22 115.28 6 37.50
14024. Kriss (smashingpinkey) 16 46.87 56.34 2 12.50
14025. Slok (slokregmi___) 16 47.44 53.82 4 25.00
14026. Simon (slimsonkysreformed) 16 78.62 92.41 5 31.25
14027. TianHao (skydrag0n) 16 88.70 99.27 11 68.75
14028. SIlvester (silvesterfake) 16 81.10 92.59 2 12.50
14029. Pitt@_____ (shubhamshinde) 16 26.75 32.72 1 6.25
14030. Shub (shub01) 16 79.50 90.94 2 12.50
14031. Lee (shriveledegg) 16 94.68 116.48 6 37.50
14032. Cheg (sheedipants) 16 57.82 66.81 5 31.25
14033. shumkar (shbarpiev) 16 75.16 92.56 2 12.50
14034. Severin (sevo4a) 16 106.49 132.97 6 37.50
14035. Daniel (semashe) 16 90.03 114.73 8 50.00
14036. segun (segun99) 16 46.65 54.38 1 6.25
14037. Aridia (aridia) 16 88.39 98.26 7 43.75
14038. arichnad (arichnad) 16 80.51 103.64 2 12.50
14039. aorer (aorer) 16 110.01 133.44 9 56.25
14040. Ritu (anritu) 16 63.79 75.69 4 25.00
14041. Luke (angelsfan) 16 89.83 105.57 15 93.75
14042. candyyyyyyy (andewa_05) 16 103.22 121.01 13 81.25
14043. Anderson (andarson) 16 85.84 96.60 5 31.25
14044. Anaru (anaru797) 16 82.56 92.37 2 12.50
14045. Amir (amirtrex) 16 58.06 70.86 3 18.75
14046. Amir (amirb101) 16 88.71 110.71 13 81.25
14047. Maccy (amaccy) 16 66.22 74.11 6 37.50
14048. Ariel :) (alyas94) 16 71.71 85.48 4 25.00
14049. Alles (allesboem) 16 100.14 118.53 6 37.50
14050. alex (alexjimma) 16 26.42 31.45 3 18.75
14051. Karibas (albiones) 16 76.44 89.10 4 25.00
14052. Mohammad (alamin_typist) 16 84.51 98.83 6 37.50
14053. Akribes (akribes) 16 92.33 106.94 6 37.50
14054. Aidan (aidsiskindagoated) 16 67.68 78.03 2 12.50
14055. ahmed saif (ahmedsaif) 16 69.46 76.54 2 12.50
14056. ahmed (ahmedfoad246) 16 63.20 73.12 3 18.75
14057. Harlis (ahk_master) 16 57.41 69.80 1 6.25
14058. Aviram (adsherun) 16 87.78 107.68 4 25.00
14059. Adrian (adrian4k_) 16 74.72 83.52 5 31.25
14060. Karol (adobonimama) 16 83.48 99.08 3 18.75
14061. Adil (adilmamed0v) 16 86.08 101.23 6 37.50
14062. Adham2024 (adham2002) 16 60.57 78.39 3 18.75
14063. Adamowich (adamowich) 16 84.31 102.65 3 18.75
14064. æ (ac343) 16 100.47 118.13 7 43.75
14065. Abhinav (abhinav28061) 16 38.97 44.36 2 12.50
14066. Antoni (aachh) 16 108.91 128.50 8 50.00
14067. Hisham (7ommus) 16 59.68 75.97 3 18.75
14068. Brenda (6renda) 16 72.21 88.25 4 25.00
14069. Mat (3nlist) 16 91.67 108.45 9 56.25
14070. Donovan (24aad) 16 70.55 81.63 2 12.50
14071. Haley (21stcenturyasian) 16 47.40 57.95 0 0.00
14072. ray (rayearly2) 16 74.97 82.07 7 43.75
14073. Anish (anish592) 16 54.62 63.52 1 6.25
14074. Delphin (delmasgdp7) 16 45.59 55.31 0 0.00
14075. Kian (kianhidayat) 16 70.86 84.41 5 31.25
14076. Lucy (moca_lucy) 16 52.37 61.12 3 18.75
14077. Adriane (cordzingerr) 16 73.83 94.23 7 43.75
14078. Bemin (bemin) 16 44.76 63.04 1 6.25
14079. Matthew (matt5671110) 16 93.68 101.01 5 31.25
14080. Alijah (user_504) 16 49.78 57.01 2 12.50
14081. GoldenKoopa (goldenkoopa) 16 60.10 70.79 4 25.00
14082. toshi (toshi2135) 16 79.67 92.03 3 18.75
14083. nicholas (xxxtexascion) 16 45.19 54.30 0 0.00
14084. Sakibul (sakib62) 16 46.27 52.72 5 31.25
14085. Alden (bibbedtoaster) 16 61.61 77.25 6 37.50
14086. Julle (aikarauta) 16 94.85 108.73 10 62.50
14087. tushar mathpal (tmathpal25) 16 49.48 54.69 2 12.50
14088. NatanTopKek (abrn200) 16 48.25 56.98 1 6.25
14089. sys3 (neporian) 16 91.34 118.82 4 25.00
14090. Strattuss (strattuss) 16 101.80 117.40 8 50.00
14091. Lemon (raymond_p21) 16 86.64 132.09 6 37.50
14092. Zach (malkyie) 16 87.34 110.30 6 37.50
14093. maher (maherbmf) 16 46.49 59.05 2 12.50
14094. Lord (mafiosnik) 16 48.29 55.35 2 12.50
14095. Macrene (macrene) 16 102.56 118.82 8 50.00
14096. Mike (m1kep) 16 74.17 97.26 6 37.50
14097. karen (lvl100karen) 16 101.10 111.96 9 56.25
14098. Val (luv2swimv) 16 118.93 148.05 10 62.50
14099. Konstantine (luke_erdman) 16 88.27 96.56 5 31.25
14100. Louis (lodero) 16 95.86 115.19 10 62.50
14101. Abdallah (lno_namel) 16 27.39 32.21 1 6.25
14102. Leo (ljrobispado) 16 68.40 75.88 4 25.00
14103. Rosen (littlepero) 16 43.70 51.18 2 12.50
14104. Zhen Qing (lim0721lim) 16 85.62 98.34 3 18.75
14105. Leon (likarii) 16 88.75 108.00 6 37.50
14106. Liam (liamc2) 16 62.42 74.73 2 12.50
14107. lency (lencyb21) 16 47.68 55.06 2 12.50
14108. Lecailloux (lecailloux) 16 66.49 78.15 5 31.25
14109. Joash (lastassassin1) 16 77.57 91.54 5 31.25
14110. Kate (larleek) 16 78.59 92.43 6 37.50
14111. Kirito (laksh_4uh) 16 65.78 85.19 1 6.25
14112. Kūfuku (kufuku) 16 68.56 83.08 7 43.75
14113. Krzyś (kszysio) 16 85.07 103.15 6 37.50
14114. YAS62kbdfans5 (ksydry6) 16 108.70 119.22 11 68.75
14115. Kraven (kraven_lupei) 16 125.64 143.02 6 37.50
14116. Artur (korfey) 16 35.42 40.43 0 0.00
14117. nick (koot) 16 66.08 82.26 4 25.00
14118. grace (koald) 16 90.13 103.63 4 25.00
14119. Koala (koalazoo) 16 125.71 145.49 12 75.00
14120. (klaritix) 16 137.58 167.33 12 75.00
14121. Kitkat (kitkatt77) 16 64.25 77.33 2 12.50
14122. kit (kitkatpaddywack) 16 97.24 110.89 5 31.25
14123. KimsterH (kimsterh) 16 90.16 110.11 3 18.75
14124. Lazar (kh00m4) 16 57.35 66.84 3 18.75
14125. Ken (kgnishere) 16 83.76 92.33 7 43.75
14126. Kevin (keviniskevy) 16 84.76 101.07 4 25.00
14127. Keihlan (keihlan) 16 45.00 52.82 0 0.00
14128. muhammed (katsh) 16 63.40 80.33 4 25.00
14129. katrina mae (katrinamae_cru... 16 53.87 67.65 11 68.75
14130. Oscar (karos_uchiha) 16 90.11 105.00 4 25.00
14131. Karim Alaswad (karim_alaswa... 16 73.42 88.89 5 31.25
14132. Johan (kankertypen) 16 114.65 137.40 7 43.75
14133. KachoriJalebi (kachori_jalebi) 16 55.87 68.90 3 18.75
14134. Kentaro (k3n74r0) 16 116.04 127.59 6 37.50
14135. Saso McDaso (justtypefast) 16 137.64 161.47 13 81.25
14136. Im slow (justmecha) 16 63.65 84.48 6 37.50
14137. Justin (justbh) 16 97.19 110.95 3 18.75
14138. tesseractive (jupyter) 16 73.73 87.07 2 12.50
14139. Beilvert (jubeilvert) 16 72.48 87.99 1 6.25
14140. Kimchi (jrhee) 16 100.39 125.25 6 37.50
14141. Josh (joshuazhu516) 16 136.50 165.95 6 37.50
14142. Joshua (joshuac_47) 16 67.77 92.72 8 50.00
14143. GoneRogue (josephlee) 16 71.10 82.98 5 31.25
14144. Jordan (jorjorg11) 16 53.27 59.14 3 18.75
14145. Jordi (jordityper) 16 110.42 126.60 9 56.25
14146. john mat (john_mat) 16 44.92 57.52 0 0.00
14147. TypeRacerKid (johnsonbongo) 16 70.46 85.42 4 25.00
14148. Johir (johir) 16 120.30 133.41 10 62.50
14149. Johnny (jnguyen732) 16 90.84 101.61 7 43.75
14150. faster (jjzxc1) 16 75.52 81.13 3 18.75
14151. B (jixlimmy) 16 112.16 133.80 12 75.00
14152. TeddY (jirayut) 16 60.03 70.89 6 37.50
14153. Jezrael (jezjwv) 16 51.63 61.91 5 31.25
14154. jfiewogh (jfiewogh) 16 92.22 121.19 12 75.00
14155. jfkdlsaeng (jfkdlsaeng) 16 81.21 103.47 3 18.75
14156. Mike (jewunit) 16 105.06 131.60 4 25.00
14157. Jesus (jesus08) 16 62.52 72.14 5 31.25
14158. Jaffri (jeffli2000) 16 90.71 103.54 9 56.25
14159. Joseph (jdog_ld) 16 77.35 93.51 5 31.25
14160. Jay Jo (jay20051209) 16 91.83 112.33 6 37.50
14161. Jimbo (jarrydschray) 16 49.73 56.49 1 6.25
14162. Jake (jakesk) 16 97.20 112.21 4 25.00
14163. G (jaden) 16 83.65 93.91 6 37.50
14164. Jack_potta (jack_potta) 16 68.36 79.53 4 25.00
14165. Joerg (jabra11) 16 103.99 115.17 5 31.25
14166. Parker (i_hunger101) 16 58.21 64.72 3 18.75
14167. Victor (its_shadow) 16 108.82 127.36 10 62.50
14168. YT (inverxted) 16 93.56 125.60 9 56.25
14169. huessy (independencyy) 16 129.82 149.98 10 62.50
14170. Jason (illumathottie) 16 97.00 116.33 12 75.00
14171. abdulkhakim (ihkim) 16 65.30 80.25 3 18.75
14172. wakolabot (idc_0306) 16 40.42 45.20 4 25.00
14173. Ian (iancook) 16 95.30 112.66 5 31.25
14174. AlexiaWasFound (iam_selc) 16 52.99 66.04 0 0.00
14175. Raju (iamrajukhan) 16 52.36 60.58 1 6.25
14176. David (hybridlikesrice) 16 124.72 133.70 7 43.75
14177. Hania (hrychania) 16 43.57 54.40 0 0.00
14178. Hrm_710 (hrmmm) 16 69.46 82.29 2 12.50
14179. No one (howardog0707) 16 110.57 132.96 4 25.00
14180. HJ (hjteq) 16 51.91 58.80 1 6.25
14181. Henry (henry2) 16 107.74 116.29 9 56.25
14182. hahah (hahahahahahaaaaa) 16 141.12 156.61 15 93.75
14183. The killer (haaassan) 16 57.46 69.64 2 12.50
14184. guhard (guhardos) 16 71.70 79.95 3 18.75
14185. Chris (guffar) 16 103.57 120.70 5 31.25
14186. Gnany (gnanickky1) 16 53.45 70.07 3 18.75
14187. grace (girlalmighty) 16 80.18 95.98 1 6.25
14188. Christian (gergoss) 16 95.94 117.24 11 68.75
14189. Gavin (gavtoaster) 16 92.89 107.49 5 31.25
14190. Garv (garv1908) 16 66.80 75.57 3 18.75
14191. Galil (galil35) 16 90.16 111.41 7 43.75
14192. Faaris (fxzz) 16 53.56 66.41 0 0.00
14193. Swarnim (futuretonystark) 16 55.82 68.88 4 25.00
14194. Baibars (sazin_me) 16 62.84 70.92 7 43.75
14195. Jason (samuraishinobi) 16 63.49 72.14 3 18.75
14196. siri (sag339) 16 102.81 135.23 5 31.25
14197. karrar (saffa990) 16 60.90 72.01 5 31.25
14198. Ryan (rya_nly) 16 119.87 145.86 11 68.75
14199. Ryan (ryantam279) 16 68.86 80.26 7 43.75
14200. Rustem (rus101) 16 108.82 125.69 6 37.50
14201. Abdurrachman (rrachman) 16 68.11 81.75 6 37.50
14202. Herve Tran (royale81) 16 77.70 90.70 8 50.00
14203. Andrew (ronioz) 16 79.58 91.93 6 37.50
14204. রিফাত (rifat_072) 16 74.52 89.88 6 37.50
14205. LacticMilk (richardios275) 16 73.43 87.53 2 12.50
14206. Yah (reveri) 16 80.23 91.94 5 31.25
14207. OREO (reocraft) 16 108.15 138.98 9 56.25
14208. Shaggy (remrem0) 16 84.97 100.30 3 18.75
14209. Morris (reinheart) 16 114.51 124.60 7 43.75
14210. Robertas (rebutis) 16 69.91 76.43 6 37.50
14211. Preet (rahal) 16 58.80 71.89 4 25.00
14212. My (qwertytheuiop) 16 53.65 61.79 5 31.25
14213. Kim (qwerko) 16 78.77 95.21 6 37.50
14214. Harry (qqwwddvv852) 16 63.13 75.62 3 18.75
14215. Qianxu Guo (qianxug) 16 94.44 112.39 10 62.50
14216. Puppet (puppetsfingers) 16 90.39 114.61 6 37.50
14217. Xingyu (pumpkinlighter) 16 56.79 67.13 3 18.75
14218. PraWin (praveenapk) 16 56.47 63.73 3 18.75
14219. Murphy (pouyacr72) 16 60.05 75.64 2 12.50
14220. PotatoMike (potatomike) 16 89.41 111.48 4 25.00
14221. 21337R (poptart128) 16 109.92 131.56 10 62.50
14222. ahmed (ponochio_) 16 52.92 60.51 4 25.00
14223. PizzaPortal (pizzaportal) 16 77.76 107.24 7 43.75
14224. chimp (phucktyping) 16 106.31 131.82 7 43.75
14225. ph (phmi) 16 85.22 103.23 6 37.50
14226. peppy (peppersteaku) 16 96.22 120.21 4 25.00
14227. Philip (pengzz) 16 81.91 95.23 5 31.25
14228. Farm (pandamkii) 16 99.82 115.63 9 56.25
14229. Polly (pajberman) 16 114.12 134.28 8 50.00
14230. Pablo (pablurp) 16 104.04 133.30 10 62.50
14231. p055am (p055am) 16 55.41 70.01 6 37.50
14232. oriom (orionrw) 16 119.99 138.57 11 68.75
14233. OobertsTyping (oobertstyping) 16 106.38 124.11 7 43.75
14234. Apple (omnipotential_magic) 16 70.82 80.22 1 6.25
14235. Christopher (omicronexe) 16 77.04 94.87 7 43.75
14236. Omar (omarkhair) 16 62.14 70.09 3 18.75
14237. Olan (olan10001) 16 71.05 87.13 4 25.00
14238. Noam (okahama) 16 71.53 86.41 3 18.75
14239. Oink (oinklmao) 16 67.30 80.08 5 31.25
14240. David (nunyobusiness) 16 123.26 142.17 9 56.25
14241. vignesh (noob_typer16) 16 50.62 57.65 2 12.50
14242. noob_slayer (noob_slayer) 16 98.83 111.37 7 43.75
14243. tstats[n0body] (nobody01) 16 108.31 122.11 7 43.75
14244. Akimoto (noble_addiction) 16 75.62 94.11 5 31.25
14245. nitesh (nkpcpr) 16 37.46 42.75 1 6.25
14246. Fluoride Action Network (nize) 16 112.69 146.74 6 37.50
14247. me (ninjagamer0060) 16 61.12 72.74 2 12.50
14248. Nikki (niksta95) 16 124.62 154.84 13 81.25
14249. marc (nightowl) 16 86.57 102.19 5 31.25
14250. Desmond (night9sky) 16 65.19 76.91 4 25.00
14251. nico yes nico (nic_o_nic) 16 103.02 140.12 5 31.25
14252. Nick (nick1347) 16 89.42 102.84 8 50.00
14253. Lucy (nemurinemuri) 16 103.52 112.55 8 50.00
14254. Nathan (nayteo) 16 71.17 84.45 0 0.00
14255. naviman (naviman) 16 94.98 114.02 7 43.75
14256. natc (natc2) 16 84.99 97.86 7 43.75
14257. tuffghost (namtap) 16 106.84 117.14 7 43.75
14258. Milan (nalim) 16 72.90 78.94 2 12.50
14259. Amila (n0wtype) 16 84.01 90.37 8 50.00
14260. MyNameIsGodzLol (mynameisgo... 16 81.97 97.31 7 43.75
14261. Joseph (mwita7) 16 59.88 73.55 0 0.00
14262. Joshua (mr_mushroom_stew) 16 93.18 101.28 2 12.50
14263. Mon (monmcgt) 16 73.29 86.12 3 18.75
14264. Bryce (molohov) 16 90.77 116.36 5 31.25
14265. medham (mohemedham) 16 51.81 61.48 0 0.00
14266. youknow (moelesteronyakids) 16 24.12 28.38 4 25.00
14267. Edwin (minsil) 16 87.72 104.94 8 50.00
14268. ◯__ MAX __◯ (minilaytr) 16 79.55 94.68 4 25.00
14269. TheCuber (mine_star2046) 16 54.56 65.77 5 31.25
14270. WhySoSlow (milktea_1999) 16 70.41 77.77 3 18.75
14271. DaturdMig (migueldathird) 16 82.16 91.11 5 31.25
14272. Emily (miffily) 16 98.22 109.64 12 75.00
14273. Michał (michal_miszcz_123) 16 52.51 62.38 3 18.75
14274. Kael (michael_deleon) 16 69.61 80.45 3 18.75
14275. Garry (megatroop) 16 102.09 108.94 5 31.25
14276. MD Imran (md_imran_hosen) 16 37.36 44.03 2 12.50
14277. Boltedツ (mchackerz) 16 89.86 102.58 6 37.50
14278. matuush (matuush) 16 61.49 70.01 12 75.00
14279. mathemage (mathemage) 16 78.84 86.38 3 18.75
14280. Lindsay (math314) 16 108.54 125.96 14 87.50
14281. tstats[massive_man4] (massi... 16 113.21 144.84 6 37.50
14282. Syed Ashfaq (satmath) 15 41.45 46.08 2 13.33
14283. Michael (sano459) 15 89.37 95.06 3 20.00
14284. samsolt (samsolt) 15 51.36 62.87 3 20.00
14285. Anuar (sagidollaev_) 15 49.29 57.08 13 86.67
14286. Sagar (sagarcool) 15 48.35 56.00 2 13.33
14287. George (ryallanrya) 15 108.64 127.06 9 60.00
14288. Ruff (roofy2004) 15 81.38 92.97 4 26.67
14289. ROAD TO 100!!! (ronkoe) 15 43.20 49.68 2 13.33
14290. romo (romokom) 15 30.55 36.19 1 6.67
14291. Rod_Regus (rod_regus) 15 78.47 87.83 1 6.67
14292. Rick (rickthetyper) 15 107.66 141.38 4 26.67
14293. Yuzu (rice_senpai) 15 89.77 102.46 4 26.67
14294. RiceBOI111 (riceboi111) 15 103.98 128.26 9 60.00
14295. Ren (renrob13) 15 115.47 132.15 12 80.00
14296. Rashad (rashad19) 15 64.22 76.51 4 26.67
14297. wy (randumbtyper) 15 141.49 160.75 13 86.67
14298. Ryan (raisonfire) 15 97.84 112.90 9 60.00
14299. nic (rainbowarsenal) 15 104.51 130.97 6 40.00
14300. Type (racer4587) 15 62.05 92.43 4 26.67
14301. Cute (rabbit4549) 15 82.22 99.80 4 26.67
14302. R1ng (r1ng) 15 85.23 103.94 4 26.67
14303. 一向 (quan72io) 15 90.39 99.81 7 46.67
14304. Fadhil (qazsxdcfv) 15 89.52 111.85 7 46.67
14305. Pustinek (pustinek) 15 44.39 50.07 1 6.67
14306. punished buster (punishedbu... 15 78.65 89.42 4 26.67
14307. pemba (pttpemba) 15 51.69 65.83 2 13.33
14308. Psychism (psychism) 15 95.19 128.84 7 46.67
14309. Gregory (prosher) 15 52.33 57.16 1 6.67
14310. Yut (poominb) 15 83.04 94.71 3 20.00
14311. Doug (pontiacbandit) 15 73.75 83.23 3 20.00
14312. Pomochko (pomochko) 15 66.75 83.92 1 6.67
14313. Tommy (pnkflwrs) 15 88.32 102.25 6 40.00
14314. Phillip (pjeong3120) 15 96.52 108.72 5 33.33
14315. Pirapat (pirapatqwe) 15 95.03 114.25 5 33.33
14316. pintoa (pintoa) 15 85.29 98.73 5 33.33
14317. Arjun (pikabell) 15 61.46 80.30 3 20.00
14318. Pieces (pieces08) 15 70.49 76.77 7 46.67
14319. Hugo (phudgestuff) 15 61.95 72.18 3 20.00
14320. Phoebo (phooboo) 15 69.57 88.31 4 26.67
14321. Pearl (pearlescent) 15 121.59 137.60 10 66.67
14322. patztablook22 (patztablook22) 15 83.83 95.97 5 33.33
14323. panacotta (panacotta) 15 101.58 114.35 6 40.00
14324. Olaf (p1stachiofurioso) 15 124.79 137.77 7 46.67
14325. B (p1geonkid) 15 49.35 56.50 2 13.33
14326. Krisjanis (overcastace332) 15 88.50 104.05 5 33.33
14327. fastboi (ooofooo) 15 85.07 96.79 3 20.00
14328. Isla (oodley) 15 64.83 75.61 5 33.33
14329. Muhammad Omar (omar_farooq) 15 68.40 80.53 3 20.00
14330. Omar El-Farouk (omarelfarou... 15 51.00 60.30 4 26.67
14331. ollir (ollir) 15 99.70 107.53 9 60.00
14332. Oleg (oleg20111511) 15 77.84 91.21 3 20.00
14333. m (ogtong) 15 92.81 101.85 4 26.67
14334. Ogatinasu (ogatinasu) 15 56.73 71.25 5 33.33
14335. obsidianical (obsidianical) 15 70.17 95.54 3 20.00
14336. Tobi (obiaas) 15 96.46 108.49 6 40.00
14337. Zoya (noximy) 15 37.44 49.61 1 6.67
14338. Nini (notthedestroyer) 15 58.39 69.36 2 13.33
14339. (nonquit) 15 148.28 166.20 13 86.67
14340. noman (noman121) 15 39.03 52.42 5 33.33
14341. Ashraful (noid621376) 15 70.79 86.65 5 33.33
14342. Noah (noahc3) 15 108.36 119.54 4 26.67
14343. Nift (niviman) 15 107.36 120.40 7 46.67
14344. Vinh (ninjapro) 15 75.90 92.57 7 46.67
14345. Nicolas (nick4652) 15 97.41 113.93 10 66.67
14346. Zoran (newslowkeyboard) 15 129.48 148.30 11 73.33
14347. Neko (nekonekokneecaps) 15 93.31 104.32 9 60.00
14348. Nathan (nathanv) 15 96.62 113.67 4 26.67
14349. Miracle- (nakatsumiuchiha) 15 70.62 83.42 2 13.33
14350. Nabil (nabilmuafa) 15 71.26 84.26 4 26.67
14351. MusicSounds (musicsounds) 15 103.96 125.62 5 33.33
14352. Mubashar (mubashar_javed) 15 69.37 85.27 5 33.33
14353. Kirill (mr_beer) 15 46.95 49.72 0 0.00
14354. פלסטין חופשית (... 15 102.60 114.75 6 40.00
14355. Marc (mrives) 15 49.99 56.43 2 13.33
14356. Mr. (mrdayton) 15 61.91 72.87 11 73.33
14357. Gaurav (moodcode) 15 56.17 68.33 3 20.00
14358. mt. (monthon993) 15 64.41 70.75 4 26.67
14359. Justin (moneybagg) 15 67.48 76.20 4 26.67
14360. Joshua (mochi0607) 15 94.64 121.34 8 53.33
14361. foenem (mkmares_qwerty) 15 80.99 96.05 3 20.00
14362. Mistey (mistey) 15 124.86 145.31 14 93.33
14363. mir (mir_rahat) 15 43.79 50.13 3 20.00
14364. mirlan (mirlanbek) 15 23.89 30.07 1 6.67
14365. James (mirdan) 15 81.78 101.64 3 20.00
14366. Mipow (mipow_kun) 15 62.09 70.62 6 40.00
14367. Pisser (minsuk7) 15 98.01 110.97 7 46.67
14368. Deepta (mind_palace) 15 73.12 82.66 2 13.33
14369. miles (milesgreensmith) 15 82.69 92.83 3 20.00
14370. Miles (milesgendreau) 15 87.38 108.00 5 33.33
14371. milan (milansep27) 15 100.59 115.28 14 93.33
14372. lou (mikubeez) 15 108.65 120.68 3 20.00
14373. Miguel (miguelkristian) 15 92.78 101.84 3 20.00
14374. Melvin (melvinmelgar) 15 53.84 60.90 0 0.00
14375. Erik (mcmanerik) 15 53.63 60.87 1 6.67
14376. Mateusz (matusz019) 15 67.05 80.46 6 40.00
14377. tstats[mattinaglass] (matti... 15 68.19 89.61 4 26.67
14378. Marshall (marshallmaofr) 15 108.39 127.06 8 53.33
14379. Zheng_Dao (marmot0814) 15 87.22 104.07 5 33.33
14380. Marlon (marlondestroyer) 15 92.44 101.71 4 26.67
14381. Marley (marley) 15 99.27 105.63 6 40.00
14382. Aria (aria_3_) 15 51.16 65.06 3 20.00
14383. Arian (ariankazemi) 15 35.99 40.97 0 0.00
14384. arachnodactyly (arachnodact... 15 72.91 82.82 0 0.00
14385. Chris (angoril) 15 56.82 67.46 4 26.67
14386. Ele (anemoia) 15 105.68 119.62 5 33.33
14387. Anel (anelbeads) 15 87.26 104.19 6 40.00
14388. André (andrepascoa) 15 102.35 111.19 8 53.33
14389. Anna (ana2007) 15 49.25 60.41 2 13.33
14390. Amr (amrstien) 15 63.08 74.55 3 20.00
14391. Ameen (ameen_a21) 15 66.31 80.24 2 13.33
14392. LolipopAlexx (amazingskep_1) 15 63.89 75.35 3 20.00
14393. AL1 (al1_16) 15 93.96 109.87 5 33.33
14394. Akshy (akshy) 15 67.30 81.54 5 33.33
14395. AjTopper (ajtopper) 15 40.19 47.31 0 0.00
14396. AJamal31 (ajamal31) 15 79.43 107.30 5 33.33
14397. austin (aiven) 15 72.52 79.62 5 33.33
14398. Aidan (aidanmccomsey) 15 108.00 129.23 6 40.00
14399. joe (aidanbbm) 15 59.08 72.05 0 0.00
14400. yan (ahugedistraction) 15 88.51 104.30 7 46.67
14401. Aeiphera (aeiphera) 15 107.33 120.90 6 40.00
14402. Adam (adamrocks21) 15 56.67 62.33 2 13.33
14403. Abu (abushakeeb) 15 93.99 108.19 5 33.33
14404. Abe (abefqy) 15 83.74 116.82 6 40.00
14405. Abdul Rafay (abdulpak) 15 39.64 47.44 2 13.33
14406. Eric (20wpmboi) 15 63.31 74.55 3 20.00
14407. Free Israel (1ocaltechsuppor1) 15 44.28 50.02 2 13.33
14408. Gabe (115162382) 15 91.64 105.36 7 46.67
14409. LilJabari (yesitsngo) 15 54.56 65.41 2 13.33
14410. Sorrow (sorrow_da) 15 45.86 57.47 3 20.00
14411. Julius (jus_kidding) 15 57.31 73.38 2 13.33
14412. Brian (brianprs) 15 85.49 98.13 4 26.67
14413. Gandalf (gandalfthefast) 15 58.89 68.53 2 13.33
14414. Loan (loanvx) 15 96.33 120.43 5 33.33
14415. Adam (ska_) 15 81.42 92.89 3 20.00
14416. Nymeria (nymeria37) 15 93.15 114.05 4 26.67
14417. David (completedark) 15 84.33 95.74 9 60.00
14418. Zalabany (zalabany) 15 41.47 51.35 1 6.67
14419. Yo (yo111) 15 60.15 75.55 4 26.67
14420. Sam (samr7x7) 15 83.72 95.19 8 53.33
14421. Rohit (roohitdagar) 15 40.60 48.06 1 6.67
14422. 近平 (trash_game) 15 34.56 40.11 0 0.00
14423. Jul (happypig2) 15 87.95 104.04 5 33.33
14424. Dr.Gliscor (drgliscor) 15 56.98 70.53 13 86.67
14425. ketchup (rawmeatball) 15 104.41 128.96 8 53.33
14426. captain (fegit) 15 82.87 93.20 3 20.00
14427. VixenxD (vixenxd) 15 77.80 96.27 5 33.33
14428. David (chopstick88) 15 73.01 96.13 2 13.33
14429. josef (cthulhuz) 15 83.08 100.72 7 46.67
14430. Matthew (mattscabrera) 15 106.64 129.01 9 60.00
14431. irfan (irfankia) 15 44.50 59.88 7 46.67
14432. Maddie (massivetrash) 15 73.08 91.05 7 46.67
14433. Abass (abassali092) 15 52.64 62.25 3 20.00
14434. Ollie (sherwoodoj) 15 77.47 96.15 3 20.00
14435. Wenexx (wenexx) 15 75.70 100.13 5 33.33
14436. Kipen (kipenjago) 15 68.28 78.18 7 46.67
14437. Dhia (dhiadbh) 15 43.25 57.90 1 6.67
14438. jlordo (jlordo) 15 91.36 105.98 5 33.33
14439. Oscar (kull) 15 49.25 58.74 2 13.33
14440. Laurence (beala_) 15 40.10 51.53 0 0.00
14441. Andrew (andrew_00) 15 76.24 89.18 4 26.67
14442. Fudl (fudl) 15 53.11 65.49 2 13.33
14443. veryfatman (frankknight23) 15 84.06 101.27 5 33.33
14444. Forehead (foreheadq) 15 81.56 96.02 7 46.67
14445. flashy (flashy1996) 15 80.60 90.19 6 40.00
14446. J (fingerbanger96) 15 64.86 75.83 6 40.00
14447. Matyi (filepmatyi) 15 71.40 83.46 3 20.00
14448. Madi (fastcoder05) 15 47.12 53.16 0 0.00
14449. farzi (farzi) 15 27.95 33.76 0 0.00
14450. J (falsekrakk808) 15 101.84 119.18 7 46.67
14451. sasd (fallenlarry) 15 84.76 104.10 7 46.67
14452. Faizan Ali (faizanii) 15 45.20 58.41 2 13.33
14453. facenne (facenne) 15 92.64 110.25 7 46.67
14454. Ezektor (ezecktor) 15 91.70 110.60 4 26.67
14455. Exab (exab) 15 54.28 65.26 6 40.00
14456. Evan (evang12) 15 108.35 127.03 6 40.00
14457. Juhair (error6251) 15 58.40 64.62 0 0.00
14458. Erekle (erekle7) 15 53.75 63.12 1 6.67
14459. Tran (envyriviere) 15 83.63 91.60 3 20.00
14460. ben (enivre) 15 57.54 73.46 2 13.33
14461. Paula (ems1324) 15 51.61 59.01 4 26.67
14462. emre (emrevlog) 15 72.35 82.38 4 26.67
14463. Matthew (emen_) 15 79.66 96.68 14 93.33
14464. ElVash (elvash) 15 72.27 86.84 6 40.00
14465. good (elquines4) 15 104.31 127.97 7 46.67
14466. Ellie (ellie_mp3) 15 57.09 65.26 1 6.67
14467. Lise (elishevah) 15 91.86 104.53 9 60.00
14468. Eli (elijahbu) 15 86.67 97.68 5 33.33
14469. Elgrekost (elgrekost) 15 68.17 81.63 13 86.67
14470. elaine (elainezhu) 15 117.72 130.56 10 66.67
14471. Ethan (ecannoy) 15 105.65 115.28 8 53.33
14472. aurora (e4monn) 15 114.26 132.85 11 73.33
14473. drew (drewg2009) 15 87.41 103.29 5 33.33
14474. DreamCat04 (dreamcat04) 15 43.47 50.37 3 20.00
14475. dbarr (drbarr) 15 44.04 52.90 2 13.33
14476. Vincent (doogley) 15 56.90 64.03 5 33.33
14477. Ali (donlafi) 15 57.18 62.64 3 20.00
14478. I really like lettuce (domi... 15 99.42 117.13 8 53.33
14479. dom (domaniquepham) 15 79.52 96.00 6 40.00
14480. Eddie (diettea) 15 93.84 122.22 4 26.67
14481. Geraldine (dendenmuushi) 15 40.23 49.05 1 6.67
14482. Dankman (dedankman) 15 99.76 112.53 5 33.33
14483. Davis (davis10) 15 61.09 76.07 4 26.67
14484. David (davidliu323) 15 117.62 135.93 7 46.67
14485. tstats[darkhat13] (darkhat13) 15 91.96 114.60 6 40.00
14486. dapho (dapho) 15 73.07 98.05 12 80.00
14487. Daniel (danrike22) 15 58.88 70.13 0 0.00
14488. Dan (dankarnus) 15 67.82 79.85 2 13.33
14489. Dawid (dadik) 15 64.35 75.96 5 33.33
14490. Daniel (d4mage2k) 15 94.12 108.68 9 60.00
14491. Ethan (creamycanoli) 15 98.92 126.26 6 40.00
14492. Peter (crazynumnums) 15 95.17 109.38 9 60.00
14493. Chris (craastad) 15 82.01 93.16 4 26.67
14494. Konrad (cornyflakez) 15 93.88 105.85 8 53.33
14495. Matías (colocolo91) 15 85.24 94.37 4 26.67
14496. Thomas (coasterman) 15 86.46 100.56 5 33.33
14497. sheik (clubs_) 15 82.29 104.20 7 46.67
14498. Alex (citricdolphin) 15 102.34 115.84 7 46.67
14499. christian (chriz411) 15 85.72 97.46 6 40.00
14500. Christian (christian_oudard) 15 98.57 117.46 6 40.00
14501. Chinsetgel (chinsetgel_mgl_3) 15 62.89 72.51 1 6.67
14502. Chili (chilichonga) 15 63.67 73.30 2 13.33
14503. Caine (cainegt) 15 78.83 88.48 3 20.00
14504. Ivan (cactus9800) 15 47.98 53.65 0 0.00
14505. Meme Page (butsuky) 15 106.06 117.46 11 73.33
14506. B (btype123) 15 121.53 135.16 10 66.67
14507. Bryan (bryan675) 15 123.99 145.33 12 80.00
14508. Bruno (brunokoppel) 15 76.52 94.22 5 33.33
14509. Bruh (bruh432) 15 104.37 117.80 9 60.00
14510. brainuser5705 (brainuser5705) 15 89.72 101.72 4 26.67
14511. Ash (boyfromindia) 15 69.88 88.55 7 46.67
14512. E (boxofpaints) 15 68.84 73.20 6 40.00
14513. Joe (bot_joe) 15 85.22 92.19 4 26.67
14514. BobTuring (bobturing) 15 81.43 106.07 10 66.67
14515. Bob (bobtyping) 15 78.09 83.84 2 13.33
14516. Black (blackt) 15 63.33 69.68 7 46.67
14517. chan (blackstarnova) 15 119.99 136.45 11 73.33
14518. Krissz (bish1k) 15 91.64 102.81 5 33.33
14519. Bean (benchen123) 15 91.31 101.10 7 46.67
14520. bella (beliss08) 15 55.47 63.96 1 6.67
14521. bee (bee0) 15 112.76 138.95 14 93.33
14522. bart (bartfart) 15 84.88 92.08 3 20.00
14523. bantan (bantan) 15 94.79 103.12 9 60.00
14524. AJ (bacon_is_life) 15 89.07 102.50 6 40.00
14525. Jacob (a_cheesy_wotsit) 15 85.86 114.16 5 33.33
14526. Aztixz (aztix) 15 71.04 79.30 4 26.67
14527. ayumu (ayumuxe) 15 82.22 94.62 12 80.00
14528. Alex (aymlus) 15 91.36 105.05 6 40.00
14529. Sean (axelsandrods) 15 64.69 78.91 4 26.67
14530. awalvie (awalvie) 15 80.32 94.93 4 26.67
14531. Asif ur rahman (asif_ur_rah... 15 44.83 56.60 2 13.33
14532. Rimuru (ashborn_tempest) 15 75.66 88.56 3 20.00
14533. Chris (aschlar) 15 88.09 119.53 3 20.00
14534. Arzenith (arzou) 15 75.16 91.02 9 60.00
14535. Reggie (_fast_car_noises_) 15 48.77 55.87 1 6.67
14536. Zozvo (zozvo) 15 45.95 60.35 1 6.67
14537. Ugnius (zorgas) 15 77.30 91.65 5 33.33
14538. Zzzzzz (zokey) 15 82.88 90.68 4 26.67
14539. Varyemez✍️ (ziperz_the_... 15 94.23 103.40 5 33.33
14540. Kaiden (zentacle) 15 86.56 97.07 4 26.67
14541. Secre (zenmt) 15 69.98 84.90 7 46.67
14542. Zane (za_schu) 15 65.66 81.82 3 20.00
14543. Javin (zakurukito) 15 67.24 77.60 3 20.00
14544. z1lo (z1lo) 15 62.05 71.65 2 13.33
14545. ( ͡° ͜ʖ ͡°)🖕 (your... 15 95.15 111.89 4 26.67
14546. yogesh (yogipapu15) 15 60.72 69.48 3 20.00
14547. Yellow (yellowleaf) 15 78.82 106.30 6 40.00
14548. Emmett (yamaicewing) 15 68.57 75.73 3 20.00
14549. Xyhop (xyhop) 15 78.29 92.72 8 53.33
14550. JJ (xvitrix) 15 98.06 115.40 6 40.00
14551. Ricards (xricheeh) 15 50.12 57.84 0 0.00
14552. jie (xonjiex) 15 98.62 113.71 5 33.33
14553. xcz (xcz05) 15 99.82 109.62 4 26.67
14554. enfonius (wssh) 15 136.68 162.85 0 0.00
14555. Mateusz (wirelesss) 15 53.15 60.94 4 26.67
14556. William (will_exe) 15 48.98 55.17 2 13.33
14557. WooshWoosh (wiertsmenator) 15 60.79 71.51 4 26.67
14558. whaterman (whaterman) 15 63.47 78.50 8 53.33
14559. Mikel (wellthatwasfun) 15 98.00 114.07 11 73.33
14560. anousa (weebwithadog67) 15 108.00 123.71 9 60.00
14561. Mark (waybeyondhope) 15 39.29 52.66 2 13.33
14562. ivanchrome (watonearth) 15 103.96 119.73 7 46.67
14563. Ken (waterlemon48) 15 88.79 106.11 7 46.67
14564. Waseem (was11) 15 49.47 52.75 2 13.33
14565. aleX (waisa) 15 67.31 88.72 3 20.00
14566. w8 (w8lkinusa) 15 72.48 82.39 4 26.67
14567. Vodon (vodon) 15 80.56 90.56 2 13.33
14568. Vito (vito_t) 15 44.09 54.98 3 20.00
14569. vioco (vioco) 15 74.96 85.06 1 6.67
14570. Vasi (vasi1333) 15 85.74 95.75 6 40.00
14571. Utkarsh (utkarsh_n) 15 58.91 70.75 3 20.00
14572. Usmon (usmon_h) 15 56.38 61.23 13 86.67
14573. Usman (usmanayubkhan) 15 63.55 76.46 1 6.67
14574. user (user199012) 15 139.21 190.97 11 73.33
14575. Gustav (ultragurkatv) 15 61.38 71.73 2 13.33
14576. uggs (ugo_alo) 15 58.29 71.36 1 6.67
14577. Brennen (uglyer) 15 108.96 120.27 7 46.67
14578. uday (uday12381) 15 84.07 99.02 2 13.33
14579. t_lea (t_lea) 15 87.01 104.62 3 20.00
14580. Hamlet (typing__words) 15 103.07 130.29 9 60.00
14581. Mayank (typingbadal) 15 39.53 47.50 1 6.67
14582. Type (typespeed2020_) 15 87.00 107.07 5 33.33
14583. Jacqueline (typegozoom) 15 44.36 52.21 1 6.67
14584. Krzysztof (tygryz) 15 85.18 102.49 4 26.67
14585. Harry (txharry) 15 96.09 106.71 3 20.00
14586. Rachel (tweetybirdbird) 15 50.92 64.90 2 13.33
14587. Tuan (tuan) 15 71.38 79.85 2 13.33
14588. TryingToBeHooman (tryingtob... 15 63.71 79.15 5 33.33
14589. trip (triphereon) 15 75.97 84.35 6 40.00
14590. trailmix (trialtest) 15 103.85 117.29 10 66.67
14591. Logan (toast_scrubber) 15 87.34 104.49 4 26.67
14592. try (tipewriter123) 15 85.53 103.31 7 46.67
14593. Tristan (timmychikin) 15 103.87 115.71 7 46.67
14594. Justin (thisjustinj) 15 38.93 47.26 0 0.00
14595. dakshesh (the_teslafan) 15 59.18 78.72 9 60.00
14596. theunnoticable (theunnotica... 15 116.34 138.53 8 53.33
14597. Brian (thepinkelephantcar) 15 96.82 124.73 3 20.00
14598. Jeandre (theopgamer) 15 70.39 84.66 15 100.00
14599. Abdullah (thegamerx20) 15 103.16 116.81 7 46.67
14600. the (thebaneet) 15 89.89 108.47 5 33.33
14601. sash (thatguysash) 15 102.39 118.86 7 46.67
14602. TGNYC (tgnyc) 15 118.51 128.45 7 46.67
14603. Temur (temurmannonov) 15 67.20 73.33 4 26.67
14604. 𝕃𝕦𝕗𝕗𝕪 (techon) 15 101.77 113.52 8 53.33
14605. Tarun (tarun6119) 15 45.85 53.58 2 13.33
14606. Dreeows (tanziomee) 15 58.72 72.73 3 20.00
14607. Tanner (tannercraytor) 15 56.64 66.81 5 33.33
14608. Alex (t3dr) 15 73.01 83.83 3 20.00
14609. edyn (sylvyn) 15 51.02 60.10 1 6.67
14610. Alex (swobe) 15 69.50 78.23 4 26.67
14611. Suttikoon (suttikoonpp) 15 62.90 78.18 3 20.00
14612. Surya (suryasunkari) 15 99.11 122.52 15 100.00
14613. Mehmet (superfasttyper_0102) 15 60.94 76.74 3 20.00
14614. Nuts (sumguy69) 15 112.53 125.23 8 53.33
14615. dvorshark 🦈 (strongly_ty... 15 114.06 140.93 4 26.67
14616. StantheAsian90 (stantheasia... 15 84.79 99.35 4 26.67
14617. Stalking (stalkingdog) 15 86.30 103.51 1 6.67
14618. Jeff (st1m) 15 50.93 56.63 1 6.67
14619. George (ssbatch) 15 122.52 136.55 8 53.33
14620. Chris (splixerr) 15 68.78 83.10 4 26.67
14621. Brayden (soygoblin) 15 42.23 49.86 0 0.00
14622. Soxi (soxi_colemak) 15 80.97 101.82 5 33.33
14623. Toasty (somewhat_toasty) 15 67.88 80.30 3 20.00
14624. Some1uknow (some1uknow) 15 58.38 66.62 2 13.33
14625. Sofia (sofia_anical) 15 51.15 58.12 3 20.00
14626. kowi (smoothfingers) 15 57.00 63.71 1 6.67
14627. Prasanta (skyline049) 15 47.84 56.81 3 20.00
14628. Isra-to-Hell (skyarchbeast) 15 101.89 113.33 7 46.67
14629. Dastan (skitllz) 15 40.02 44.09 0 0.00
14630. sk (skdreams) 15 87.24 97.31 5 33.33
14631. simmi (simmi999777) 15 55.73 68.89 3 20.00
14632. TruffleJr (silvqrfrost) 15 44.40 49.69 1 6.67
14633. Nedi (silencion) 15 43.44 49.61 2 13.33
14634. Siddharth (siddharthrajpal) 15 71.55 78.09 4 26.67
14635. Shrubber (shrubber) 15 67.92 77.28 3 20.00
14636. Shriram (shri_baj) 15 37.43 44.14 1 6.67
14637. Zachary (showmanthemoney) 15 82.93 89.94 3 20.00
14638. Shashank (shashniq) 15 77.51 83.58 6 40.00
14639. Senin (senin8pagi) 15 102.48 110.91 7 46.67
14640. Malik (madx) 15 71.33 78.46 5 33.33
14641. MrDiRamio (madiramio) 15 97.27 108.46 9 60.00
14642. racemaster (madcodez) 15 47.42 53.74 0 0.00
14643. Jose (lupi1) 15 64.95 72.81 2 13.33
14644. RJ (lufulu) 15 105.81 130.68 8 53.33
14645. lucktale (lucktale) 15 92.04 127.67 3 20.00
14646. Good Vibe Tribe (lucas_lm) 15 86.30 101.09 7 46.67
14647. _l.y.m.y_ (loyehmoyeh) 15 64.09 75.44 4 26.67
14648. loow (loowt) 15 59.47 72.54 2 13.33
14649. lorenzo (lolloz98) 15 69.51 77.39 3 20.00
14650. Shan (liushanen) 15 87.38 97.44 4 26.67
14651. Lisa (lissandra) 15 72.39 88.48 11 73.33
14652. andrey (linus01) 15 33.48 42.38 0 0.00
14653. Joel (lil_wheeelz) 15 65.85 78.92 15 100.00
14654. Isaac (libstwo) 15 60.30 73.62 3 20.00
14655. Liam (liamzammit) 15 56.40 66.78 0 0.00
14656. Leith (leith_) 15 75.38 95.65 12 80.00
14657. Kai (leavelux) 15 88.23 99.67 8 53.33
14658. Dylan (lavafxlx) 15 61.52 80.05 12 80.00
14659. ♠️ lastofspades (lastof... 15 137.26 150.45 11 73.33
14660. Wade (larrage) 15 95.06 114.71 4 26.67
14661. kym (kym2006) 15 104.97 123.81 12 80.00
14662. kward937 (kward937) 15 80.34 95.99 4 26.67
14663. Kellan (krusher7) 15 62.41 71.72 2 13.33
14664. Kris (kris_z) 15 119.57 141.02 6 40.00
14665. kostasss (kostasss) 15 43.12 54.86 2 13.33
14666. KOOKOWACKYDUCK (kookowackyd... 15 83.86 101.48 6 40.00
14667. Keziah (kookiru) 15 100.89 116.46 7 46.67
14668. Honda (konradowtf) 15 63.08 72.29 3 20.00
14669. Katherine (kleesaunders) 15 101.41 127.75 3 20.00
14670. Chris (kiousaras13) 15 73.83 92.21 6 40.00
14671. Phillip (kinkking123) 15 70.99 92.41 6 40.00
14672. Wil (kingwilyn) 15 56.33 68.50 3 20.00
14673. Dominik (killersshark) 15 57.29 65.49 4 26.67
14674. bc (kilk3) 15 88.52 105.55 4 26.67
14675. Ian (kfcdonutsandwich) 15 93.61 112.84 4 26.67
14676. Edwin (keyhem_) 15 65.48 75.19 4 26.67
14677. Kevin (kev011701) 15 110.86 126.85 10 66.67
14678. Ken (keni98) 15 84.82 99.92 5 33.33
14679. Kelsey (kelseysd) 15 82.21 111.16 7 46.67
14680. kelian (kekelian) 15 62.25 68.11 3 20.00
14681. Justin (keehyu) 15 102.20 113.59 9 60.00
14682. kynght (kd1157) 15 83.49 102.90 4 26.67
14683. kchou (kchou0907) 15 73.20 87.02 0 0.00
14684. grace (katrvey) 15 81.41 95.61 2 13.33
14685. John (karmetier) 15 89.03 108.25 5 33.33
14686. Weeee (k1ngsman) 15 104.67 123.31 6 40.00
14687. Jão (jumamjir) 15 42.56 50.04 1 6.67
14688. jserv23 (jserv23) 15 106.71 115.91 9 60.00
14689. poopy (joyuri) 15 99.23 125.37 7 46.67
14690. Josh (joshcantypefast) 15 112.65 140.89 13 86.67
14691. qqingcheng! 3 (jorjoresp) 15 95.56 109.29 5 33.33
14692. josh (jojothebear03) 15 52.98 62.29 4 26.67
14693. Joe (joe_1) 15 114.15 128.02 9 60.00
14694. Joel (joelthesuperior) 15 128.21 150.94 6 40.00
14695. jlsyber (jlsyber) 15 84.90 98.26 6 40.00
14696. James (jlightning) 15 91.11 100.22 5 33.33
14697. Joshua (jkm711) 15 70.66 86.53 3 20.00
14698. Jim (jimvang8790) 15 72.70 79.05 4 26.67
14699. Logan (jimmybiscuit39) 15 56.25 68.32 3 20.00
14700. Jiezlin (jiezlin) 15 61.00 68.52 3 20.00
14701. jeshen (jeshencx) 15 78.43 93.04 4 26.67
14702. Jelmer (jelmerevers) 15 92.79 107.77 5 33.33
14703. Jamie (jelly_jam_pudding) 15 75.75 94.00 4 26.67
14704. Jeff (jeff_1107) 15 70.32 84.71 2 13.33
14705. Jay (jayl2303) 15 103.23 122.89 6 40.00
14706. BigJuicySlimy (javewave) 15 79.12 89.09 4 26.67
14707. Jason (jasonpike) 15 90.26 98.80 1 6.67
14708. poon (jamiepoon2003) 15 78.25 85.76 5 33.33
14709. James (jamesmz_101) 15 28.16 35.49 0 0.00
14710. JKerb (jakerb19) 15 77.43 97.77 5 33.33
14711. `jakeeee_ (jakee_) 15 99.94 123.41 7 46.67
14712. Long Double E.T. (jackje) 15 96.31 116.62 6 40.00
14713. not (j097) 15 70.68 86.55 3 20.00
14714. iStealCatNips (i_steal_cat_... 15 64.24 84.66 1 6.67
14715. Joey (itzjoeyz) 15 93.56 114.66 5 33.33
14716. Its (itslexemic) 15 61.72 75.78 10 66.67
14717. justin (itsjustinz) 15 81.80 94.75 6 40.00
14718. Brandon (itsbarn) 15 74.66 90.19 1 6.67
14719. John (ionas22) 15 33.56 38.67 2 13.33
14720. banana (intrepid_banana) 15 101.12 119.10 8 53.33
14721. Laughing Fox (inkeet) 15 73.61 82.93 6 40.00
14722. Its Me (infinityyt) 15 87.35 107.34 8 53.33
14723. Inactiv (inactivak) 15 93.55 105.06 4 26.67
14724. [SCC] Ignis (ignis_sphaera) 15 108.78 120.83 7 46.67
14725. Robby (icybot) 15 92.04 106.11 7 46.67
14726. Salvador (ick1salvado) 15 61.88 71.80 3 20.00
14727. iamyellowhead (iamyellowhead) 15 65.68 81.44 8 53.33
14728. H_24 (h_24) 15 81.80 105.70 3 20.00
14729. uy (hygienic) 15 74.20 81.17 1 6.67
14730. Howard (hwd15508) 15 113.25 134.39 11 73.33
14731. Nothing (humblepikachu) 15 76.59 94.32 7 46.67
14732. ben (hobomojo) 15 70.42 82.91 5 33.33
14733. d (hirundinidae) 15 122.08 138.62 12 80.00
14734. Abood (hirotto) 15 49.40 59.27 1 6.67
14735. Henry (henry88k) 15 67.03 76.77 3 20.00
14736. Henrricos (henrricos) 15 88.67 102.35 3 20.00
14737. henlojav (henlojav) 15 93.97 111.40 8 53.33
14738. Harrisandman (harrisandman) 15 66.27 81.69 8 53.33
14739. Hannah (hann5h) 15 138.88 157.75 10 66.67
14740. Jack (handsomejam) 15 100.79 114.51 6 40.00
14741. Haley (halllw) 15 59.10 72.13 6 40.00
14742. Habib (habibjajawie) 15 105.94 125.85 9 60.00
14743. h1b80xwl0g1c (h1b80xwl0g1c) 15 47.64 51.18 1 6.67
14744. Gustavo da Cruz (gustavodac... 15 94.93 123.27 6 40.00
14745. s (gurub) 15 78.41 109.93 5 33.33
14746. typingmonster (greenmonster... 15 95.78 107.97 8 53.33
14747. Vitor (graysheep) 15 54.52 69.52 1 6.67
14748. Jake (gooserman) 15 73.54 86.44 3 20.00
14749. Sishir (goon72) 15 83.65 88.36 4 26.67
14750. Cameron (goldenpenguin) 15 65.77 77.11 3 20.00
14751. giann (giannperez123) 15 115.00 124.24 7 46.67
14752. Bahador (ghostnod) 15 104.65 115.18 8 53.33
14753. Aasish (ghisingo) 15 48.12 56.37 6 40.00
14754. Siegward (ghin) 15 91.20 112.18 13 86.67
14755. Marius (ghebu) 15 107.31 131.63 9 60.00
14756. Genius (genius0teacher) 15 49.32 63.60 12 80.00
14757. Meagan (gazzoo) 15 103.96 129.02 8 53.33
14758. peepee (gamerlegion) 15 97.55 112.48 8 53.33
14759. Gabriel (gabrielvi111) 15 69.87 80.28 1 6.67
14760. Xuan Thong (fxcvs) 15 59.27 71.21 6 40.00
14761. funss (funss) 15 71.61 85.11 1 6.67
14762. Funday (funday11best) 15 71.79 87.42 12 80.00
14763. Mahmoud (mahmoud_12) 14 38.67 42.95 3 21.43
14764. Mahbub (mahbubdev) 14 44.72 54.29 0 0.00
14765. Mystik (magic_mystik) 14 64.77 77.07 6 42.86
14766. mafia (mafia207) 14 59.16 74.02 3 21.43
14767. Mac (macthemountain) 14 91.45 115.08 8 57.14
14768. Μάξιμε (macmo) 14 117.70 129.27 8 57.14
14769. Luminious (luminious) 14 81.70 95.13 2 14.29
14770. Luke (lukechevy) 14 74.96 84.94 2 14.29
14771. j (luckyslayer) 14 73.99 88.54 3 21.43
14772. LubO_o (lub0_o) 14 69.39 84.07 6 42.86
14773. Lokyin (lqkii) 14 109.93 138.81 4 28.57
14774. Aryan (lost_arrow) 14 72.18 85.15 1 7.14
14775. JR (lordjoshyy) 14 95.84 103.61 4 28.57
14776. Cookrieme (lonarexiz) 14 80.97 93.41 5 35.71
14777. Slobky (lmaoxdlolrofl) 14 101.04 121.76 5 35.71
14778. decadent movement (lkmatter) 14 58.77 64.66 1 7.14
14779. Sticky (littletea) 14 48.50 56.36 3 21.43
14780. lil_lobster (lil_lobster) 14 67.79 75.32 2 14.29
14781. Likkon (likkon_maddik) 14 71.25 84.31 6 42.86
14782. Lik (lik007) 14 60.87 76.98 5 35.71
14783. levani (levanacixo) 14 91.47 105.73 7 50.00
14784. Eric (leftlaneeric) 14 88.77 100.43 12 85.71
14785. jonathon (laptoptouchpad) 14 67.78 82.46 0 0.00
14786. Landi (landiepileptic) 14 54.14 71.27 1 7.14
14787. Cait (lamby17_) 14 76.32 85.02 4 28.57
14788. Jake (lakejund) 14 105.65 126.08 6 42.86
14789. Jatin (kumar_jatin) 14 67.55 80.78 3 21.43
14790. Krish (krish2882005) 14 63.16 81.51 4 28.57
14791. David (koreanboy) 14 93.21 115.90 3 21.43
14792. Kirtaph (kirtaph) 14 88.96 115.18 4 28.57
14793. Ryan (kingdr) 14 59.28 75.19 4 28.57
14794. Alec (killjoy722) 14 78.62 93.61 4 28.57
14795. Kifah (kifahthespartan) 14 62.14 78.34 2 14.29
14796. Eric (keywe) 14 79.62 89.57 5 35.71
14797. Tomek (kemor) 14 86.48 105.26 4 28.57
14798. Keks (keksfromnextdoor) 14 61.15 67.80 4 28.57
14799. . (keelanlambert) 14 57.97 69.44 5 35.71
14800. Rai (kaythox) 14 108.80 125.70 5 35.71
14801. nunya (karlremarks) 14 72.62 83.55 5 35.71
14802. Johnny (k5kk) 14 108.05 142.62 9 64.29
14803. Bektas (k1ngst0ne) 14 59.36 75.37 3 21.43
14804. Samuel (justanotherasianont... 14 80.28 96.12 5 35.71
14805. junior (junior2000) 14 55.89 67.02 4 28.57
14806. jono (jonohubbard) 14 76.53 95.38 5 35.71
14807. Jon (jonnylauws) 14 97.47 104.53 4 28.57
14808. Jon (jon56) 14 82.22 98.58 7 50.00
14809. John (johnphan05) 14 125.54 144.56 8 57.14
14810. joe (joe_mam101) 14 59.72 72.27 3 21.43
14811. Joe (joe_exotic6969) 14 63.03 72.57 1 7.14
14812. Joey (joeykuo) 14 57.56 70.30 6 42.86
14813. Jman (jkarlik22) 14 55.97 81.36 3 21.43
14814. jjpjimmy (jjpjimmy) 14 81.21 98.59 6 42.86
14815. jithin (jithinjoseph) 14 58.77 69.50 0 0.00
14816. Jim (jimnguyen) 14 82.57 97.80 5 35.71
14817. Rohith (jikki) 14 55.79 67.63 4 28.57
14818. Jerwin (jherwynne) 14 72.08 87.29 3 21.43
14819. JD (jhaaydee) 14 49.85 62.89 1 7.14
14820. Imponed (jg814867) 14 74.24 88.90 3 21.43
14821. JeiJei (jemjem09) 14 62.75 77.99 4 28.57
14822. Jeffrey (jeffreyfeng) 14 95.86 115.79 5 35.71
14823. Harry (jeeeerrrpop) 14 75.51 87.90 8 57.14
14824. joshua (jawwshuaa) 14 99.68 116.47 6 42.86
14825. Daniel (jansson) 14 93.31 105.69 6 42.86
14826. James (jamessmurray) 14 53.53 60.11 1 7.14
14827. James (james494) 14 101.46 112.99 8 57.14
14828. Jakaria (jakaria_sami) 14 56.63 67.65 5 35.71
14829. Barrett (jahspp) 14 70.88 81.45 4 28.57
14830. Jacob (jacob643) 14 81.61 90.57 4 28.57
14831. Isak (izzeww) 14 92.16 108.62 5 35.71
14832. Elias (itzner) 14 45.04 59.21 3 21.43
14833. deydey (iskalaberkberk0427) 14 76.94 88.34 4 28.57
14834. iron (iron_pickaxe) 14 75.68 90.47 3 21.43
14835. Nhaatj (iopaosi) 14 50.82 77.90 2 14.29
14836. qwq (iomeow) 14 47.47 51.77 0 0.00
14837. Simon (imp4l3r) 14 94.41 121.23 7 50.00
14838. kian (imkian) 14 56.82 63.34 0 0.00
14839. impostor (ilikepotatoesixty... 14 92.50 103.50 3 21.43
14840. Igor (ikarus9393) 14 88.52 100.84 5 35.71
14841. ignatius (ig_gy) 14 57.48 66.97 1 7.14
14842. Hugi (hugi97) 14 89.28 100.07 5 35.71
14843. Hezekiah (htplayz2107) 14 82.83 93.69 1 7.14
14844. jburd (htimseiluj) 14 78.32 90.79 5 35.71
14845. Jacob (horenzo) 14 102.72 117.13 7 50.00
14846. Hisham (hisham_m) 14 53.06 67.24 4 28.57
14847. .zyf (hinglect) 14 96.64 110.43 6 42.86
14848. Rohit Singh (himynameisrohi... 14 136.08 156.85 10 71.43
14849. himanshu (himanshu_giri) 14 56.50 68.15 4 28.57
14850. hieser (hieser) 14 32.33 36.57 2 14.29
14851. David (hiddenpants10) 14 94.03 104.33 4 28.57
14852. SomeGuy (hexadecimal101) 14 95.51 118.05 7 50.00
14853. Henry Ruggs (henryruggs) 14 171.65 188.95 13 92.86
14854. hegde_atri (hegde_atri) 14 74.49 89.64 2 14.29
14855. Harsh (harsh1924) 14 55.06 63.78 2 14.29
14856. Andrew (harris75098) 14 68.54 87.73 5 35.71
14857. Bruh (hannibanani) 14 63.64 77.28 3 21.43
14858. Teuku (hahasrul) 14 75.33 91.06 4 28.57
14859. Habib (habib7777) 14 57.22 65.14 2 14.29
14860. gummy (gummysheep) 14 105.34 116.97 7 50.00
14861. tek it (guidryy) 14 37.99 53.19 0 0.00
14862. mikey (grenadejumper) 14 65.86 84.01 3 21.43
14863. Gourav (gourav001) 14 54.81 59.37 1 7.14
14864. kiwiwi (gothickiwi) 14 49.28 61.10 1 7.14
14865. Alh (gotank) 14 49.93 58.71 2 14.29
14866. Maidul (goal100wpm) 14 36.26 43.79 2 14.29
14867. Glen (glennnnn) 14 62.99 69.32 1 7.14
14868. Anonymous (ghajik) 14 84.93 101.58 13 92.86
14869. Last (galya_88) 14 68.43 77.39 3 21.43
14870. Colin (galaxyytr) 14 81.99 94.31 4 28.57
14871. Inic (gadomane) 14 73.08 89.15 4 28.57
14872. Nick (frogd) 14 88.66 105.54 2 14.29
14873. Bob (frenchburrito) 14 78.28 93.62 4 28.57
14874. William (freewille) 14 96.82 115.99 6 42.86
14875. fred777i (fred777i) 14 71.22 98.19 2 14.29
14876. fongof (fongof) 14 89.35 100.03 3 21.43
14877. Flowless (flowlessrusher) 14 64.25 71.24 14 100.00
14878. Landon (floont) 14 120.00 127.79 6 42.86
14879. Fineson (fineson) 14 107.40 138.13 7 50.00
14880. ronan (fibbit) 14 82.26 94.06 3 21.43
14881. Fesak10Fingers (fesak8) 14 60.77 73.05 7 50.00
14882. Fathan (fathanpathurijal) 14 70.47 80.28 4 28.57
14883. Farhan Osman (farhan16) 14 40.28 44.01 0 0.00
14884. Fanturn (fanturn) 14 31.25 44.00 1 7.14
14885. Thomas (f0x169) 14 78.84 90.96 3 21.43
14886. Lucas (excorpse) 14 96.53 115.83 5 35.71
14887. Esophose (esophose) 14 135.36 157.28 9 64.29
14888. Esketitutu (esketitutu) 14 65.80 81.17 8 57.14
14889. Derpy Stingray (ernchenghoo) 14 109.72 131.73 8 57.14
14890. Khanh (erile) 14 59.01 66.74 0 0.00
14891. Enzoo (enderboyx200) 14 131.27 140.68 11 78.57
14892. Emily (emerrin) 14 98.60 106.09 5 35.71
14893. aa (elk111) 14 75.54 91.55 3 21.43
14894. luca (einsluca) 14 83.65 97.07 1 7.14
14895. ⓔⓓⓐⓝⓘ (edaniguy90) 14 75.50 90.57 7 50.00
14896. Lewis (eatass123) 14 68.66 76.87 2 14.29
14897. ear (earmold) 14 108.52 121.65 7 50.00
14898. Dylan (dylearn) 14 63.38 72.86 0 0.00
14899. dylan52528 (dylan52528) 14 70.59 85.89 4 28.57
14900. Drizzy (dreazy) 14 83.16 104.71 5 35.71
14901. dree (dre3) 14 76.85 92.75 3 21.43
14902. Goomba (dragoomba) 14 148.16 166.18 7 50.00
14903. Marcus Armstrong (down_with... 14 87.76 101.08 2 14.29
14904. Daniel (dninja96) 14 102.13 116.79 4 28.57
14905. Dylan (dkonquerer) 14 104.98 118.53 2 14.29
14906. Hafizuddin (dinios_) 14 30.00 34.26 0 0.00
14907. Dikshit (dikshitupadhya) 14 60.55 68.94 1 7.14
14908. DerpVos (derpvos) 14 83.57 103.12 6 42.86
14909. Nicholas (denicholas) 14 62.17 73.16 5 35.71
14910. Radioactive (denharsh) 14 115.05 134.52 11 78.57
14911. Dele (delenit0r) 14 77.00 88.65 2 14.29
14912. Deiru (deiru) 14 101.76 121.54 3 21.43
14913. Bob (deinosor) 14 105.69 123.84 5 35.71
14914. Jody (deekif) 14 89.15 102.81 8 57.14
14915. Deamon (deamontyper) 14 67.73 81.94 4 28.57
14916. David (davecoolkid) 14 112.21 135.94 7 50.00
14917. Dan (danwest124) 14 60.62 69.92 1 7.14
14918. Dave (dachalco) 14 90.06 99.40 2 14.29
14919. tstats[daball] (daball) 14 104.87 127.48 6 42.86
14920. Czar (czarlol) 14 107.77 124.78 6 42.86
14921. cython (cython) 14 63.72 74.83 2 14.29
14922. Cavit Mert (cvtmrt) 14 64.91 77.65 13 92.86
14923. Crystalrep (crystalrep) 14 55.95 77.32 14 100.00
14924. John (cryptx_) 14 93.73 117.81 8 57.14
14925. kj (crioyri) 14 99.47 115.05 8 57.14
14926. coolror (coolroru) 14 84.30 105.01 4 28.57
14927. Josh (complex_j) 14 48.99 56.83 1 7.14
14928. Jon (coltirl) 14 67.32 88.69 1 7.14
14929. Jordan (coffeeaddict99) 14 79.28 87.97 5 35.71
14930. coen (coencidence) 14 106.92 132.61 3 21.43
14931. Michael (clutch69master69) 14 122.41 135.03 11 78.57
14932. Aicez (cluelessbruh) 14 48.86 57.72 0 0.00
14933. Cloudios (cloudios) 14 68.34 84.57 4 28.57
14934. Clfong (clfong) 14 60.46 74.27 1 7.14
14935. CHT (cht64) 14 114.91 139.55 11 78.57
14936. Chocorion (chocorion) 14 67.29 79.93 3 21.43
14937. Timothy (chicken174) 14 21.46 27.87 3 21.43
14938. I don't know (chessbro) 14 43.65 59.57 0 0.00
14939. andygreg (chelloh) 14 62.09 77.69 4 28.57
14940. Cheesetoast (cheesetoastman) 14 57.95 75.78 2 14.29
14941. cha (chachu007) 14 73.51 87.04 2 14.29
14942. celes (celescastro) 14 82.34 97.53 5 35.71
14943. Ceb (cebq) 14 72.34 94.40 4 28.57
14944. Chase (ccummins) 14 85.21 103.73 4 28.57
14945. Talon (cclaww) 14 64.45 81.97 3 21.43
14946. Matty (cannotdivideby0) 14 96.92 115.27 7 50.00
14947. Cancyr (cancyr) 14 96.84 105.98 5 35.71
14948. luis (bumfuzzled) 14 69.27 84.14 4 28.57
14949. Mario (bujmar) 14 60.20 68.93 0 0.00
14950. Anton (bujjaa) 14 68.24 75.23 1 7.14
14951. Bruce (bruceboy1985) 14 116.16 131.86 8 57.14
14952. David (bpsccheney) 14 78.61 86.04 5 35.71
14953. jom (borezu) 14 128.89 145.31 11 78.57
14954. Yoda (booya51) 14 98.63 114.33 5 35.71
14955. Andrew (bonusducky) 14 99.70 115.36 1 7.14
14956. Bob (bobjesus) 14 68.48 80.73 7 50.00
14957. Blub (blub0) 14 86.45 106.36 8 57.14
14958. Ramen (blazingramen) 14 99.84 110.32 6 42.86
14959. Christler (blastydog) 14 120.86 140.91 10 71.43
14960. Valk (blankfox) 14 80.06 94.68 4 28.57
14961. Asma Azim (blackpanther_1) 14 63.35 70.42 4 28.57
14962. Long (bizkidngo) 14 104.14 133.86 10 71.43
14963. Trilo (bishh_27) 14 41.87 45.67 0 0.00
14964. Brandon (birdysofly) 14 108.91 134.94 11 78.57
14965. Bill (billsquare) 14 62.09 71.04 3 21.43
14966. biady (biadyy) 14 96.04 101.54 5 35.71
14967. bhuvi (bhuvi1606) 14 58.77 69.81 3 21.43
14968. beepbeep (beep__beep) 14 71.38 83.19 2 14.29
14969. beehah (beehahem) 14 100.96 115.92 7 50.00
14970. beebooboop (beebooboop) 14 96.23 107.43 3 21.43
14971. Big (beanbeanbean123) 14 44.41 50.10 0 0.00
14972. Kutay (batselot) 14 62.80 72.14 3 21.43
14973. Bailey (baileyeet) 14 73.37 101.71 2 14.29
14974. badfaith (badfaith) 14 81.57 95.22 3 21.43
14975. Gaus (azamku09) 14 57.20 64.60 2 14.29
14976. Axurio (axurio) 14 68.36 80.57 6 42.86
14977. Axel (axei) 14 60.30 71.97 0 0.00
14978. avg (avgr) 14 16.78 22.67 1 7.14
14979. Griffin (avalanchovy) 14 55.03 61.97 1 7.14
14980. Aurel (aurelganteng) 14 79.21 94.24 6 42.86
14981. Ath (athuu) 14 92.00 109.48 5 35.71
14982. Yu (astridjin) 14 50.82 59.93 3 21.43
14983. Adam (assassinbred) 14 97.46 105.67 2 14.29
14984. Ibnu (asqallani) 14 56.91 69.74 3 21.43
14985. Aiden (asiangarlic) 14 64.58 76.07 9 64.29
14986. ashley (ashleyybbae) 14 101.27 113.53 10 71.43
14987. asdf (asdf3) 14 84.44 92.33 2 14.29
14988. Ascyt (ascyt) 14 60.80 75.36 4 28.57
14989. Aruji (aruji) 14 77.30 86.27 0 0.00
14990. uwos (artuist) 14 97.03 107.13 7 50.00
14991. ArthasEdit (arthasedit) 14 44.50 55.99 0 0.00
14992. arryacc (arryacc) 14 45.17 49.87 2 14.29
14993. . (scorae) 14 70.57 82.44 2 14.29
14994. gamig (schleepy_boye) 14 68.88 82.06 2 14.29
14995. Savv (savvey) 14 64.75 70.45 2 14.29
14996. samy (samy_) 14 63.38 70.66 2 14.29
14997. Salad (saladspoon) 14 90.99 102.84 6 42.86
14998. Sajed (saji652) 14 74.08 88.00 2 14.29
14999. Safwan (safwanislam111) 14 73.17 80.91 3 21.43
15000. saba (saba_on_mentos) 14 51.83 66.27 1 7.14
15001. Saad (saad_mohammed7) 14 67.24 81.95 4 28.57
15002. Saad (saadahmed12858) 14 55.57 63.93 2 14.29
15003. Will (r_u_sure) 14 101.49 113.88 5 35.71
15004. Ryusei (ryu_525) 14 52.54 63.11 2 14.29
15005. SheLuvRui (rushabh161) 14 109.39 118.57 7 50.00
15006. rachel (rsimonton94) 14 97.15 114.78 4 28.57
15007. rozetina (rozetina) 14 108.46 139.41 7 50.00
15008. Roman (romaje_) 14 97.81 116.62 7 50.00
15009. Roi (roi1255) 14 62.42 69.74 3 21.43
15010. Robin (robaxtom) 14 74.03 86.61 5 35.71
15011. RIJU (rijuthetyper) 14 65.82 74.91 4 28.57
15012. Ryan (ricenoodles01) 14 88.75 125.63 4 28.57
15013. Rexoblob (rexoblob) 14 76.75 85.95 2 14.29
15014. rengmain (rengmain) 14 111.67 129.03 13 92.86
15015. itypeforbyron (remez) 14 82.84 95.44 2 14.29
15016. Reigina (reiginayari) 14 88.49 105.06 4 28.57
15017. Redsteel (redsteel87) 14 83.25 105.24 2 14.29
15018. Alex (rednaxt) 14 114.07 129.29 4 28.57
15019. Caal (recumbent) 14 84.11 97.48 2 14.29
15020. rdx (rdxx) 14 78.69 89.55 5 35.71
15021. Raphael (razmataz99) 14 125.46 168.56 6 42.86
15022. raymond (raymondrazer) 14 88.26 107.88 3 21.43
15023. ray16k (ray16k) 14 133.09 146.29 10 71.43
15024. Jona (ravioli_cheesecake12) 14 59.96 72.73 0 0.00
15025. Rany (rany_games) 14 61.27 76.12 6 42.86
15026. ramennoodles924 (ramennoodl... 14 87.19 108.40 3 21.43
15027. reactor2 (rakesh_singh) 14 89.36 105.61 6 42.86
15028. tstats[rajendra_thakur] (ra... 14 51.62 60.27 0 0.00
15029. rk2699 (radhu) 14 74.04 87.00 2 14.29
15030. Michael (raczcar) 14 92.98 110.39 6 42.86
15031. Yeji (racket_21) 14 58.69 68.31 4 28.57
15032. Patrick (pzuknome) 14 123.80 140.23 6 42.86
15033. Puymieyches (puymieyches) 14 82.23 94.20 3 21.43
15034. Iliyan (proto0o) 14 82.64 93.69 3 21.43
15035. praxZ (praxz) 14 114.30 131.11 6 42.86
15036. Mae (practice_type) 14 60.75 71.19 2 14.29
15037. ptt (potatodogg) 14 111.20 126.51 8 57.14
15038. Logan (postlogan) 14 90.57 109.04 6 42.86
15039. Nameless (plot_da_pro) 14 56.55 66.67 8 57.14
15040. Phle (plegethas) 14 67.05 73.91 1 7.14
15041. Mike (pit820) 14 81.30 101.90 7 50.00
15042. Pidguit (pidguit) 14 97.23 112.03 5 35.71
15043. TypeBot (phycer) 14 96.91 110.97 5 35.71
15044. Martynas (peepeeman42069) 14 81.81 94.51 10 71.43
15045. Pana (pana_miguel) 14 83.27 100.01 5 35.71
15046. paco (pacowaco) 14 73.40 80.99 8 57.14
15047. i cant type (o_o_f) 14 110.28 136.86 8 57.14
15048. Clicky (ottoble) 14 66.75 77.79 1 7.14
15049. James (otes10) 14 63.36 71.53 1 7.14
15050. Will (orketscience) 14 40.16 45.21 0 0.00
15051. Justin (orccrusher99) 14 75.25 91.81 1 7.14
15052. hayde (oofba) 14 101.40 118.87 8 57.14
15053. Omkar (omkardalvi001) 14 67.06 77.26 1 7.14
15054. hi (notarock) 14 115.21 130.38 8 57.14
15055. ammu (notammu) 14 47.38 57.88 3 21.43
15056. Josh (nocase) 14 113.17 139.80 11 78.57
15057. Njord (njord19) 14 78.34 95.75 4 28.57
15058. Nithin (nithinsanjey) 14 50.56 64.28 1 7.14
15059. Jaynul A (nishatme) 14 61.26 70.82 2 14.29
15060. Lightning (nirajp) 14 100.45 109.62 5 35.71
15061. Nina (nina_lopes) 14 52.60 60.17 6 42.86
15062. skye (nilumi) 14 39.38 47.23 1 7.14
15063. Luffy (niloy2k76) 14 78.09 88.07 5 35.71
15064. Nicholas (nikorosu) 14 55.40 62.39 2 14.29
15065. Niftski (niftski) 14 88.78 109.74 9 64.29
15066. neromantic (neromantic) 14 77.85 89.09 4 28.57
15067. Mukhtar (nejaiski) 14 55.15 66.18 3 21.43
15068. Sophia (need_to_run) 14 59.29 64.64 0 0.00
15069. Rupesh (nedlog_rupesh) 14 79.13 94.25 5 35.71
15070. Antonin (nebula__) 14 58.78 70.98 6 42.86
15071. nazmush (nazmushsayadat) 14 58.33 70.14 0 0.00
15072. Mew (mw46) 14 117.57 137.64 6 42.86
15073. Muhsin (muhsinaldoori) 14 59.73 73.30 3 21.43
15074. Muffin™ (muffintm) 14 77.50 100.88 7 50.00
15075. Tristan (muffinheadtris) 14 40.88 51.95 1 7.14
15076. mt (mtutunchi) 14 83.66 93.01 6 42.86
15077. Guus (mr_leepel_) 14 92.55 102.57 7 50.00
15078. david (mrriceeater) 14 104.43 123.95 5 35.71
15079. Shahaf (mrpoopydoopy) 14 64.61 77.15 5 35.71
15080. Mr.John (mrjohnwick) 14 55.90 67.63 5 35.71
15081. Moulik (morocks) 14 98.58 116.77 2 14.29
15082. Mooles (mooles) 14 125.42 139.39 10 71.43
15083. Mohit Justin (mohitjustintudu) 14 39.29 51.02 2 14.29
15084. Jeremy (mlgquikscopebruh) 14 92.87 127.49 6 42.86
15085. Victor (mlad) 14 50.85 56.38 0 0.00
15086. Mihai (mizaqe) 14 54.08 62.61 1 7.14
15087. Mitchel (mitchthebaker) 14 99.07 116.95 7 50.00
15088. Mipsy (mipsytheblue) 14 88.80 122.57 11 78.57
15089. Miguel (miguel_leadersarena) 14 60.34 71.96 0 0.00
15090. midayis (midayis) 14 56.77 80.76 4 28.57
15091. Matthew Froehlick (mfro) 14 61.93 75.36 4 28.57
15092. Meysam (meysam1231) 14 65.09 77.31 3 21.43
15093. McNeal (mcnealgwapo) 14 68.96 76.62 3 21.43
15094. Max (maxshaw2411) 14 90.36 102.70 12 85.71
15095. Matt (mattsmouse) 14 93.27 118.31 4 28.57
15096. Matthew (matthewarous) 14 129.84 147.29 14 100.00
15097. Massimo (massir) 14 86.64 95.87 2 14.29
15098. Blade_s0567 (mar_s) 14 63.03 77.25 3 21.43
15099. 1ntellectualL10n (martinledl) 14 79.86 88.19 6 42.86
15100. Fardin (manzif) 14 89.81 102.34 8 57.14
15101. manstick (manstick) 14 90.01 107.53 5 35.71
15102. Maluck (maluck) 14 72.39 83.91 3 21.43
15103. Ashvik (ardude566) 14 76.86 99.77 5 35.71
15104. ArcticWoof (arcticwoof) 14 57.84 63.12 2 14.29
15105. Tabs (aptex) 14 94.83 106.69 5 35.71
15106. Mario (applie_turnover) 14 42.31 54.34 2 14.29
15107. Alperen (apleren) 14 55.64 63.54 2 14.29
15108. ibayanto (antichronic) 14 86.39 111.40 8 57.14
15109. qwerty (anoop208) 14 112.74 131.85 11 78.57
15110. Anh Khoa (anhkhoa218) 14 49.40 57.38 2 14.29
15111. Nate (angularblade) 14 71.83 91.98 4 28.57
15112. Andy (andykim18) 14 95.99 110.08 4 28.57
15113. Andrew (andrewlllee) 14 83.17 100.21 4 28.57
15114. Andrew (andrewlwm) 14 78.87 96.84 5 35.71
15115. _Nasta_ (anas_hamrouni) 14 65.87 80.54 7 50.00
15116. Amar (amardhaliwal7) 14 54.40 69.89 1 7.14
15117. Alec (alxiang) 14 100.43 123.94 2 14.29
15118. Alexandros (ale_pouroulllis) 14 93.88 111.88 9 64.29
15119. Alexa (alexa72) 14 105.24 126.98 6 42.86
15120. Alex (alex7r360) 14 111.24 133.00 8 57.14
15121. Aldreich (aldreich) 14 99.77 121.66 8 57.14
15122. Arrtea (akrx) 14 39.53 46.25 0 0.00
15123. asgfd (akjghaf) 14 70.23 77.97 2 14.29
15124. bbbbbbbbbbbbbbbbbbbbbbbbbbb... 14 71.88 83.14 3 21.43
15125. Eddie (agzastrgath) 14 91.20 101.75 5 35.71
15126. Fluff (afluffyflamingo) 14 102.64 133.27 5 35.71
15127. Julio (aero_jb) 14 61.86 70.74 4 28.57
15128. Adnan (adnanasn) 14 51.39 55.75 0 0.00
15129. Lavell (adenda2) 14 68.14 77.63 1 7.14
15130. costin (acostin643) 14 102.24 116.31 3 21.43
15131. Acke (ackehjarn) 14 89.07 104.37 3 21.43
15132. Alyssa (abm10) 14 44.04 57.29 0 0.00
15133. Abdullahi (abdullahi_samiir) 14 77.08 86.44 2 14.29
15134. AK (a2526) 14 77.85 90.30 4 28.57
15135. Andy (6arb) 14 101.36 115.57 7 50.00
15136. 白起小哥哥 (45989871) 14 46.41 60.91 2 14.29
15137. Rebecca (221btimelord) 14 88.30 102.26 4 28.57
15138. Camden (1848910) 14 69.80 86.76 5 35.71
15139. Mohammad (11osos11) 14 78.57 93.47 6 42.86
15140. shudawg (1122) 14 78.18 87.79 3 21.43
15141. Angelo (ruly_2002) 14 76.98 95.23 2 14.29
15142. Euan (euansuba) 14 69.84 82.51 14 100.00
15143. Aaran (ninjatai) 14 43.44 51.46 0 0.00
15144. Nathan (rockthecraft) 14 85.21 91.12 4 28.57
15145. Ian (sirbossk) 14 82.16 93.60 2 14.29
15146. Aniket (ani_ket_kmr) 14 89.37 104.55 5 35.71
15147. ethan (1epyt) 14 76.45 87.98 5 35.71
15148. Saheb (iamsahebgiri) 14 42.47 57.92 1 7.14
15149. Josiah (instantnoodlez) 14 82.75 116.34 6 42.86
15150. John (lilrecci3) 14 40.95 47.73 2 14.29
15151. robin (mountainburger) 14 102.51 120.86 4 28.57
15152. ahmed (ahmedraslan28) 14 43.75 52.31 3 21.43
15153. Toad (toad2six) 14 95.97 127.50 6 42.86
15154. Daniel (iskrowy) 14 74.35 87.58 5 35.71
15155. Abdul Rafay (rafay_angle) 14 43.70 49.19 2 14.29
15156. Prabesh (itsprabesh) 14 60.57 75.14 2 14.29
15157. Victoria (victoria_05) 14 48.52 59.87 1 7.14
15158. rome (zombielols) 14 98.23 114.30 4 28.57
15159. TerrorLlama (terrorllama) 14 73.48 85.14 2 14.29
15160. John (john19221) 14 49.80 53.70 0 0.00
15161. Mohammed (_police_) 14 75.37 87.68 3 21.43
15162. John (omnirabbit) 14 103.23 115.30 8 57.14
15163. Bob (didwin) 14 87.69 103.40 5 35.71
15164. Aniket (theaniketdas) 14 89.04 121.75 5 35.71
15165. Aaron (hertzzy) 14 51.27 55.29 3 21.43
15166. Lee (dinotrooper) 14 78.22 111.69 4 28.57
15167. wes (fckhomerow) 14 117.00 133.45 10 71.43
15168. Bethany (thelegendarybethboii) 14 95.64 106.29 6 42.86
15169. PLUTO (p1luto) 14 66.34 80.72 9 64.29
15170. Anthony (adenn915) 14 76.82 102.05 2 14.29
15171. Tag (terataj) 14 74.57 97.34 6 42.86
15172. . (thediamond_35) 14 82.35 94.66 2 14.29
15173. Emir (kasubukuro) 14 52.58 65.27 2 14.29
15174. iverybadattyping (iverybada... 14 91.50 103.10 4 28.57
15175. sky (forgottensky) 14 60.21 71.42 1 7.14
15176. Arian (alatus_arian) 14 77.25 98.32 2 14.29
15177. Md Abu Torab (torab_0123) 14 47.18 57.90 4 28.57
15178. John (john8999) 14 49.52 57.65 0 0.00
15179. Septrev (septrev) 14 50.28 56.15 1 7.14
15180. Brian (britchkid) 14 103.73 124.69 10 71.43
15181. Tren (_tren) 14 76.78 89.28 4 28.57
15182. Rishi (_slow_typer) 14 72.26 87.07 3 21.43
15183. zreem (zreem) 14 57.46 90.96 0 0.00
15184. Zoe (zoi77) 14 79.36 98.83 4 28.57
15185. slow stinky balls (znerwill... 14 118.18 127.84 4 28.57
15186. Zhavokhir (zhav0kh1r) 14 59.14 74.62 8 57.14
15187. Zeraphim (zeraphim) 14 97.74 109.31 3 21.43
15188. Zephyr (zephyrkai) 14 111.48 121.24 8 57.14
15189. Zachary (zachary3352) 14 102.65 119.61 9 64.29
15190. yal (yyal) 14 95.71 118.89 6 42.86
15191. Yousef (yusopro) 14 64.35 69.72 7 50.00
15192. PeteJai (yupuiho) 14 47.47 57.47 0 0.00
15193. Justin (yummy_spin05) 14 58.51 67.48 2 14.29
15194. *You're (yourmumlikesmytyping) 14 49.49 57.54 0 0.00
15195. Nikki (yip14) 14 47.61 52.15 2 14.29
15196. QLONA 🥵 (yeyas) 14 100.86 126.92 5 35.71
15197. Jordan White (yepple_) 14 67.86 86.94 4 28.57
15198. Ossi (xyeet) 14 123.84 138.78 8 57.14
15199. Charles (xx_white_racer_xx) 14 102.21 117.92 6 42.86
15200. Adam (xuxiym) 14 134.62 158.63 12 85.71
15201. juicebox (xsolstice) 14 93.83 111.36 4 28.57
15202. xinhui (xinhuixu) 14 46.69 50.57 4 28.57
15203. bigman (xdbigman) 14 73.82 86.91 7 50.00
15204. Jast (xcess0000) 14 34.88 44.40 3 21.43
15205. Kael (wshuwshuwshi) 14 87.19 97.01 4 28.57
15206. wRadion (wradion) 14 109.63 129.61 6 42.86
15207. Wonder (wonderjaxe) 14 49.60 60.57 1 7.14
15208. XOR_ (wisetoad) 14 96.52 114.87 7 50.00
15209. willy (willywongker69) 14 86.17 99.23 3 21.43
15210. WIll (wiillikeer) 14 62.54 70.44 12 85.71
15211. whuwxl (whuwxl) 14 55.27 60.98 2 14.29
15212. wantingpawer (wantingpawer) 14 100.81 120.30 8 57.14
15213. vylnf (vylnf213) 14 48.07 53.60 0 0.00
15214. Cary Zhang (vrozone) 14 99.06 120.67 8 57.14
15215. Hasibuan (voyager28) 14 63.01 75.61 4 28.57
15216. Ray (viruz789) 14 110.02 125.55 7 50.00
15217. Virgin (virginchimp) 14 114.37 147.02 7 50.00
15218. Vidhu Shikhar (vidhu_joshi) 14 61.65 76.79 3 21.43
15219. Jodye (vice_pat) 14 63.09 73.20 3 21.43
15220. vincentius (vgpabm) 14 71.35 83.20 11 78.57
15221. Vernnamae (vernnamae03) 14 50.54 54.91 1 7.14
15222. Allergic to (vanillahamster) 14 86.93 111.93 7 50.00
15223. Van (vanberen) 14 71.18 81.55 6 42.86
15224. kevin (uwupork) 14 96.23 113.88 8 57.14
15225. typist (typist149) 14 53.22 64.25 1 7.14
15226. Diana (typinglover1023) 14 102.98 116.39 8 57.14
15227. Tom (twrig144) 14 89.38 106.46 5 35.71
15228. Two (two_toned_69) 14 50.63 57.31 1 7.14
15229. Trent (twesley20) 14 75.89 82.77 3 21.43
15230. Charlotte (truest) 14 86.75 101.72 5 35.71
15231. TripleMean (triplemean) 14 86.48 101.66 8 57.14
15232. 12Ethan! (towelette) 14 93.09 110.14 4 28.57
15233. Heh (tophatheh) 14 76.65 85.82 3 21.43
15234. Tom (tomshilling) 14 76.63 100.33 3 21.43
15235. Tommy (tom441) 14 95.61 107.77 5 35.71
15236. cock and (tmolls312) 14 83.03 94.81 8 57.14
15237. Timothy (timothylee) 14 99.48 112.05 5 35.71
15238. Tilly (tilly14) 14 72.96 88.14 2 14.29
15239. Karta (thundermoon_911) 14 73.09 85.37 3 21.43
15240. Ron (thtguyovrthr) 14 104.14 115.39 7 50.00
15241. Cody (thoutravesty) 14 68.71 78.42 3 21.43
15242. Thomas (thms_andrsn) 14 56.36 66.63 3 21.43
15243. NongKao (thisiskao09) 14 44.60 51.80 2 14.29
15244. the ayo (the_one_and_only_l... 14 64.11 77.97 5 35.71
15245. Simo (thespeedoflight) 14 106.75 121.83 8 57.14
15246. David (thedaveed) 14 102.28 124.43 10 71.43
15247. Alberto (thearod5) 14 78.16 93.92 4 28.57
15248. Kai (testphylean) 14 100.26 115.06 6 42.86
15249. Nikolaus (testingcolemak) 14 66.27 78.24 3 21.43
15250. bob (termina_112) 14 68.97 84.76 8 57.14
15251. Terence (terence1234567) 14 91.78 104.61 6 42.86
15252. John (tempocount) 14 110.37 126.93 6 42.86
15253. Technetium (technetium_) 14 80.34 91.89 5 35.71
15254. Harry (taytayalldaytay) 14 77.81 88.24 4 28.57
15255. Taxx (taxx) 14 114.07 133.41 5 35.71
15256. Tahbro (tahbro) 14 86.22 100.23 5 35.71
15257. Taco Master (taco989) 14 61.70 69.95 5 35.71
15258. Jasper (t3sted) 14 78.18 99.78 6 42.86
15259. t2fast4u (t2fast4u) 14 97.10 122.86 4 28.57
15260. Shynggyskhan (s_bazarbay) 14 70.05 77.31 4 28.57
15261. syrianii (syrianii) 14 67.35 77.07 2 14.29
15262. Sung (sungsangthesong) 14 106.71 125.27 14 100.00
15263. guy (submer) 14 111.35 133.03 5 35.71
15264. Kirk (lil_laker) 14 48.06 61.15 3 21.43
15265. gautam (stupendous_man) 14 38.02 41.02 0 0.00
15266. stuff423 (stuff423) 14 112.26 126.77 4 28.57
15267. Sawyer (stmcpherso) 14 68.11 73.44 6 42.86
15268. G (squasy) 14 92.04 106.02 3 21.43
15269. Ava (spyder_) 14 56.80 71.70 1 7.14
15270. Speeder (speeder99) 14 37.87 52.96 0 0.00
15271. A (spectre_zero) 14 61.60 70.94 2 14.29
15272. SPACE (spacegamer428) 14 44.58 54.05 2 14.29
15273. Sour (sourbar) 14 55.71 64.40 2 14.29
15274. Mitheelesh (sophomania2803) 14 80.41 91.65 7 50.00
15275. cheruiyot (son_of_man) 14 106.46 122.63 3 21.43
15276. Burger (somental) 14 63.74 75.80 2 14.29
15277. Solo (solohan) 14 68.50 78.24 6 42.86
15278. Simon (soinom) 14 67.45 75.51 7 50.00
15279. Rahul (snickrdodle) 14 60.65 76.71 1 7.14
15280. Lenni (smoldepressedboi) 14 61.48 68.65 1 7.14
15281. Typing (slow_seizure_man) 14 55.44 70.04 3 21.43
15282. Ben (slouchingstork) 14 60.58 65.30 2 14.29
15283. chillin (slekap) 14 177.62 218.43 10 71.43
15284. sleepy (sleeeepy_) 14 62.11 67.65 3 21.43
15285. Slavic (slavicfedora) 14 102.69 124.13 3 21.43
15286. A (sir_riot) 14 84.64 97.03 11 78.57
15287. Isabella (sinnamonroll21) 14 92.31 106.18 6 42.86
15288. Harpreet (singh_is_king) 14 31.42 38.05 1 7.14
15289. Smaran (simpilly05) 14 67.30 83.22 3 21.43
15290. 真好玩 (simonhre) 14 69.57 81.40 3 21.43
15291. David (sidrid) 14 50.50 58.78 1 7.14
15292. shubham (shubham0007) 14 82.99 97.02 2 14.29
15293. Shubhi (shoebee) 14 65.59 79.00 6 42.86
15294. deadend (shiroku) 14 118.13 133.33 9 64.29
15295. Mister (shiriou) 14 109.13 138.23 9 64.29
15296. Mouse (shenx) 14 102.50 113.12 8 57.14
15297. harold (sha_man) 14 47.99 53.10 1 7.14
15298. Shannen (shannen_04) 14 95.97 107.94 6 42.86
15299. shakk (shakk612) 14 79.95 97.70 5 35.71
15300. Slow мΘşħΞ alt (shadow... 14 113.60 133.21 9 64.29
15301. Donn (seabase) 14 39.38 50.03 0 0.00
15302. Dustin (sdustink) 14 87.17 100.05 7 50.00
15303. sdatta (sdatta) 14 73.40 86.28 3 21.43
15304. Jeronimo (_slowmotion_) 13 113.70 125.63 5 38.46
15305. Paka (_paka) 13 92.48 100.89 3 23.08
15306. falling down (_nirvana) 13 118.74 124.74 6 46.15
15307. Zakk (z_boi) 13 103.28 119.10 4 30.77
15308. amer (zx_iii) 13 54.09 60.29 1 7.69
15309. ଘ(੭ˊᵕˋ)੭* ੈ✩... 13 120.96 133.01 12 92.31
15310. Zero (zerolelouch) 13 54.07 65.77 2 15.38
15311. logan (zelo_0348) 13 37.63 43.08 0 0.00
15312. Lawrence (zekaeski) 13 52.26 67.67 3 23.08
15313. Yan (zeezyy) 13 48.62 56.88 12 92.31
15314. Yuuto (yuutofood) 13 77.91 95.80 4 30.77
15315. Yohan (yoyo65) 13 32.47 35.84 0 0.00
15316. Lenny (yourboylenny) 13 78.30 92.04 9 69.23
15317. Markus (yoshicp) 13 75.52 92.36 6 46.15
15318. Yoav (yoav24681) 13 63.22 71.62 2 15.38
15319. yjuk (yjuk) 13 79.05 90.37 6 46.15
15320. yinlor (yinlor) 13 75.14 99.66 5 38.46
15321. V (xgerr) 13 76.04 87.99 6 46.15
15322. Darren (xdeclipseee) 13 93.43 114.22 5 38.46
15323. Mintful (worst_typist11) 13 65.97 74.52 2 15.38
15324. Jeff (witlessbox) 13 88.24 94.78 0 0.00
15325. Wil$on (wilsonlee123) 13 103.74 123.18 4 30.77
15326. NotAn0boe (whackygrub) 13 113.79 129.09 9 69.23
15327. wenxers (wenxers) 13 94.46 102.06 1 7.69
15328. weddies (weddies) 13 85.55 95.84 3 23.08
15329. Daniel (weabutakku) 13 64.48 82.18 4 30.77
15330. Tony (watery_tony) 13 40.97 49.03 0 0.00
15331. Nathan (watameelon) 13 38.81 45.78 1 7.69
15332. waryburger (waryburger) 13 81.41 94.80 4 30.77
15333. Waleed (waleedminer) 13 113.72 138.81 4 30.77
15334. WaFik (wafik) 13 66.06 78.01 3 23.08
15335. Nazariy (vyleet) 13 73.37 90.29 6 46.15
15336. AJ (vvatti@gmail.com) 13 82.79 92.11 1 7.69
15337. Casper (volvoracer87) 13 44.21 51.63 1 7.69
15338. Daniel (voiss) 13 94.49 109.50 7 53.85
15339. vocal (vocal) 13 72.84 97.74 3 23.08
15340. Vanellope (vio_melancholy) 13 69.70 84.53 2 15.38
15341. Vikram (vikram031) 13 104.44 120.78 5 38.46
15342. Viggi (viggi_002) 13 39.79 47.24 0 0.00
15343. vibhu (vibhuviv) 13 37.24 44.36 0 0.00
15344. Liny (veronasie) 13 64.79 76.08 3 23.08
15345. Blaise (veresb14) 13 91.06 112.12 6 46.15
15346. ℑ𝔫𝔢𝔵𝔢𝔠𝔯... 13 71.40 78.73 4 30.77
15347. Alex (veifario) 13 29.09 35.68 3 23.08
15348. Marcin (vaster_then_you) 13 69.74 79.24 0 0.00
15349. Vasil (vasito123) 13 86.99 99.08 2 15.38
15350. André (valp) 13 77.09 87.81 3 23.08
15351. randall (valleyy) 13 90.09 103.65 5 38.46
15352. Valdo (valdo_) 13 79.37 93.09 0 0.00
15353. vid (usernem) 13 94.74 117.45 4 30.77
15354. Samuel (upgraded_skilly) 13 72.48 83.88 3 23.08
15355. cooler (unpluged) 13 85.33 95.68 3 23.08
15356. umer (umer901) 13 74.07 96.04 2 15.38
15357. Umbi (umbe10) 13 75.32 87.85 7 53.85
15358. Bat-Ulzii (ulziibox) 13 66.22 79.15 12 92.31
15359. Uno (typesmacker) 13 69.70 80.69 5 38.46
15360. bob (typemaster512) 13 87.10 99.29 4 30.77
15361. Tukanoo (tukano) 13 62.60 71.68 2 15.38
15362. Petros (trakis_pe) 13 53.00 69.23 6 46.15
15363. Noob (touchhyper) 13 87.13 120.50 5 38.46
15364. byronze (toqoz) 13 107.54 115.32 4 30.77
15365. J (tooeasyeh) 13 122.87 139.71 5 38.46
15366. Race (tomatoripper) 13 45.31 50.79 4 30.77
15367. Tree (tmoh) 13 100.73 121.31 12 92.31
15368. Tippy (tippytaptyper) 13 100.41 126.30 3 23.08
15369. nht- (tiny20061) 13 112.21 149.77 4 30.77
15370. Martin (the_martin) 13 86.27 115.21 8 61.54
15371. maple (the_maple_syrup) 13 107.03 118.56 5 38.46
15372. Marlo (the_law_ph) 13 73.30 84.36 3 23.08
15373. Brian (the_bc) 13 70.75 80.04 5 38.46
15374. Evan (thewhailure) 13 75.16 85.95 3 23.08
15375. Bryan (thesilican) 13 93.33 107.78 6 46.15
15376. Nobody (therealtrudeau) 13 113.63 135.05 6 46.15
15377. Talos (therealtalos21) 13 83.21 93.99 3 23.08
15378. TheProperAsian (theproperas... 13 74.01 86.30 7 53.85
15379. - (thegoldentiger) 13 96.32 110.06 4 30.77
15380. Jack (theboakey) 13 72.48 82.02 3 23.08
15381. Iason (thebabo) 13 66.00 76.03 7 53.85
15382. Fox (that_fox) 13 90.40 104.25 2 15.38
15383. Davis (thatrednismo) 13 100.59 118.93 4 30.77
15384. Th3Frog (th3frog) 13 48.68 55.40 3 23.08
15385. tempo (tempoxyz) 13 88.39 109.89 6 46.15
15386. Tehb (tehbb) 13 41.60 51.87 1 7.69
15387. Calvin (teddycom1) 13 66.22 73.30 3 23.08
15388. Ted (ted3x) 13 62.58 71.51 6 46.15
15389. Yếm Hồng (tdinh33) 13 64.78 76.37 1 7.69
15390. Ryan (tazayuki) 13 108.42 117.02 7 53.85
15391. na (syncix) 13 91.64 111.96 9 69.23
15392. sriram (svb1) 13 68.66 74.00 3 23.08
15393. tstats[suraj_hs] (suraj_hs) 13 54.41 66.78 0 0.00
15394. slowpoke (wpm4life) 13 46.29 55.27 2 15.38
15395. Ethan (summerpizza5508) 13 90.03 107.47 7 53.85
15396. Suhan (suhan_pradhan) 13 71.27 85.49 2 15.38
15397. Duirky (sublollipop) 13 64.45 73.22 4 30.77
15398. Rapunzel (subash_) 13 67.85 74.34 2 15.38
15399. Scott (stxiii) 13 79.21 88.43 5 38.46
15400. fries (spotifries) 13 80.11 89.57 3 23.08
15401. Alvin M. (spoderman2100) 13 55.37 65.27 3 23.08
15402. spiros (spiros_gal) 13 91.33 109.29 3 23.08
15403. William (speier70) 13 78.76 84.82 3 23.08
15404. Riyad (spectrumftw) 13 89.78 107.24 8 61.54
15405. ellie (spaghellie) 13 112.65 136.50 8 61.54
15406. Jacob (spacelamar) 13 84.87 96.05 3 23.08
15407. Pavel (sonaru) 13 65.96 72.84 7 53.85
15408. Mevious (someguy) 13 119.00 129.41 5 38.46
15409. GG (smrndmgy) 13 80.99 100.57 9 69.23
15410. stinkass (smitopot) 13 113.33 142.50 6 46.15
15411. pingu (slowpokeboy) 13 104.14 122.03 5 38.46
15412. skydoi (skydoi) 13 69.10 87.80 3 23.08
15413. Hien (skrubtical) 13 115.88 129.87 8 61.54
15414. P (skoop8) 13 104.09 117.68 7 53.85
15415. Kareememe (skerolt) 13 78.60 95.62 7 53.85
15416. Loser (sisyphus_69) 13 84.26 92.56 3 23.08
15417. JIS filco stingray (sigel) 13 149.07 171.38 12 92.31
15418. eden (shoutynubs) 13 83.51 91.18 4 30.77
15419. Hamster (shmex_hamster) 13 89.93 99.81 8 61.54
15420. かりつた (shizuyoru) 13 67.01 73.74 2 15.38
15421. Shirito (shirito) 13 70.54 79.82 2 15.38
15422. Top (sheilsarda) 13 89.10 102.88 6 46.15
15423. Sheenu (sheenz) 13 113.38 130.83 7 53.85
15424. Bauyrzhan (shaykan) 13 61.17 77.26 7 53.85
15425. Shawn (shawnyw) 13 93.42 105.36 4 30.77
15426. shamol (shamolali) 13 47.96 56.89 3 23.08
15427. Shafy (shafy) 13 71.49 83.43 2 15.38
15428. Petar (sevihasanidjos) 13 42.60 50.92 1 7.69
15429. iza (servoracc) 13 117.48 143.33 6 46.15
15430. se (secw) 13 90.24 107.21 5 38.46
15431. Sandra (sbs96) 13 116.07 136.37 7 53.85
15432. Sarah (sarahday) 13 100.45 117.75 7 53.85
15433. S (sarahac) 13 100.89 119.16 8 61.54
15434. Sara (sarachespara) 13 60.32 69.77 5 38.46
15435. Saad (saadeldeen) 13 91.41 102.52 3 23.08
15436. Xi (rozaana) 13 86.65 93.34 6 46.15
15437. Roy (roylee0912) 13 123.73 158.29 6 46.15
15438. rory (roryinnit) 13 82.00 96.40 2 15.38
15439. Rocky (rocky_whale) 13 84.04 111.66 7 53.85
15440. robert (robertford) 13 52.75 60.62 1 7.69
15441. Gabe (roastedleather) 13 73.79 88.67 4 30.77
15442. RB3 (rlbryant1982) 13 63.48 70.94 1 7.69
15443. Ralo (rindt_) 13 76.18 84.63 3 23.08
15444. Riggy (rigorodolico) 13 88.76 100.45 6 46.15
15445. Chris (rialac) 13 91.10 111.96 4 30.77
15446. Rennard (rennard) 13 80.85 93.38 5 38.46
15447. Joshua (redscool) 13 102.89 115.96 5 38.46
15448. Redking344 (redking344) 13 64.27 77.27 13 100.00
15449. Xavier (redanky) 13 62.82 69.36 3 23.08
15450. Juudge (reburm) 13 135.01 152.28 10 76.92
15451. Gio (raskid) 13 71.85 93.26 3 23.08
15452. Paul (randomnoob1) 13 124.39 149.25 8 61.54
15453. random (randomnoob07) 13 51.43 63.13 3 23.08
15454. Ramdizzle (ramdizzle) 13 59.79 69.14 5 38.46
15455. Ralph John (ralph_saintaugu... 13 53.99 63.37 2 15.38
15456. rajus (rajusthedarklord) 13 66.82 71.70 2 15.38
15457. Rainfluff (rainfluff) 13 74.35 84.86 7 53.85
15458. kaedyn (rainbowdad) 13 82.61 101.70 3 23.08
15459. Rahil (rahil3108) 13 69.02 77.45 5 38.46
15460. Hunter (ragingtimebomb) 13 66.51 79.48 2 15.38
15461. Olivier (racoon9009) 13 46.84 51.10 2 15.38
15462. Rab (rabuhana) 13 71.85 76.09 3 23.08
15463. Viktor (quicksorting) 13 73.69 87.08 2 15.38
15464. Al (quicksilver95) 13 112.01 131.81 11 84.62
15465. Qualified (qualified98) 13 98.11 111.73 6 46.15
15466. Theodor (prospitianknightma... 13 88.00 106.00 7 53.85
15467. Prizy (prizypower) 13 54.74 67.99 8 61.54
15468. aiden (poscowsm) 13 86.03 96.87 7 53.85
15469. Posa2000 (posa2000) 13 63.51 74.50 0 0.00
15470. Kelsey (pokewolf) 13 61.38 75.16 3 23.08
15471. Jade (pokemonluv98) 13 86.72 104.05 3 23.08
15472. Myles (pixelen) 13 81.26 99.86 3 23.08
15473. PISSPAINTING (pisspainting) 13 82.48 94.83 6 46.15
15474. miko (pisleo) 13 70.83 81.82 1 7.69
15475. rey (pieri) 13 121.70 146.25 4 30.77
15476. bacon (peter_1860) 13 59.77 71.72 5 38.46
15477. Petr (petajupik) 13 38.52 42.54 1 7.69
15478. bruh (peplee_) 13 87.43 105.78 2 15.38
15479. Pear (pear_smo) 13 64.33 75.18 2 15.38
15480. pb64 (pb64) 13 71.94 78.38 12 92.31
15481. Pavlo (pavelko) 13 45.63 53.63 3 23.08
15482. Paddy (paddyl) 13 76.89 85.30 4 30.77
15483. Owen (owenecollins) 13 84.74 96.24 3 23.08
15484. Cezar (outstanding29wpm) 13 84.19 89.72 4 30.77
15485. oribiya-chan (oribiya) 13 50.90 58.97 1 7.69
15486. ☔️ (orella) 13 88.56 106.74 3 23.08
15487. ayush (orange_master) 13 77.23 88.57 3 23.08
15488. Oobi (oobixyz) 13 85.18 103.29 5 38.46
15489. Chris (ohkaychris) 13 95.85 114.48 5 38.46
15490. Nuge (nugemcgee) 13 106.89 120.44 8 61.54
15491. Norps (norps) 13 70.94 80.82 2 15.38
15492. Nolan (nolanporty) 13 68.81 84.85 1 7.69
15493. nadav (nmcat) 13 19.20 24.70 4 30.77
15494. Nikolas (nkaiser) 13 82.50 97.15 4 30.77
15495. NJ (njc99) 13 69.26 83.05 5 38.46
15496. nikax (nixa202) 13 105.09 118.07 5 38.46
15497. Nivalis (nivalis11) 13 92.24 105.02 3 23.08
15498. Nishal (nishalns) 13 43.95 54.06 1 7.69
15499. Vegard (ninjawegard) 13 59.92 67.88 3 23.08
15500. niko (nikuruuuuu) 13 92.39 100.87 6 46.15
15501. Nikhil Sharma (nikhil_bolt) 13 86.97 93.36 3 23.08
15502. Bash (nidaljaafar1) 13 58.01 71.52 3 23.08
15503. Nick (nickpat) 13 94.52 117.70 4 30.77
15504. nick (nickpanda44) 13 97.19 108.49 8 61.54
15505. Abdul (netf121212) 13 45.29 52.81 2 15.38
15506. Nazmin (naz_1212) 13 72.29 98.19 2 15.38
15507. п8 ʅ(。◔‸◔。)ʃ ... 13 95.42 131.06 5 38.46
15508. Nathaniel (nathaniel999) 13 58.48 64.92 4 30.77
15509. Fran (narfornothing) 13 103.19 146.78 3 23.08
15510. Chamnann (nannostar) 13 62.19 74.09 4 30.77
15511. vinicius (nagahori) 13 70.78 79.14 3 23.08
15512. RED (naga30) 13 29.42 45.73 1 7.69
15513. Daulet (m_daulet) 13 45.34 54.88 2 15.38
15514. Mubtasim (mubtasim91) 13 67.67 83.87 2 15.38
15515. Spencer (mr_rigid) 13 67.81 80.76 4 30.77
15516. Jakob (mrsuperhorse) 13 41.30 46.20 1 7.69
15517. power (mrpowerstudiesyt) 13 86.31 105.22 4 30.77
15518. Matt (mplumado) 13 67.89 80.38 3 23.08
15519. mousie (mousiecandy) 13 73.33 87.29 2 15.38
15520. muhammad (moulizax) 13 57.91 69.42 1 7.69
15521. Gareth (morpen8) 13 110.28 126.83 6 46.15
15522. Petar (monkeypants274) 13 62.91 68.32 3 23.08
15523. MO$$ (monilyn) 13 84.82 96.79 5 38.46
15524. Molly (molgreen) 13 94.71 111.20 10 76.92
15525. Mohammad (mohammadkhosravi) 13 50.17 54.27 0 0.00
15526. Mohamed (mohamedsobhi777) 13 72.88 87.88 3 23.08
15527. Mike (mmiller_52) 13 55.77 63.65 1 7.69
15528. MLGIN (mlgin) 13 86.96 122.81 9 69.23
15529. Anon (mklegend) 13 123.10 143.98 11 84.62
15530. Matt (misterc) 13 105.42 121.12 5 38.46
15531. Mischa (mischapotter) 13 88.80 106.34 5 38.46
15532. Miko (mikofinland) 13 65.53 74.90 3 23.08
15533. Mikechun (mikechun) 13 89.23 107.40 3 23.08
15534. mike1808 (mike1808) 13 93.77 106.87 6 46.15
15535. Michael (mike1232b) 13 93.63 116.06 5 38.46
15536. Maggie (migggggie) 13 110.14 121.51 4 30.77
15537. Sofia (michael_bjordy) 13 81.58 91.72 4 30.77
15538. MewX (mewx) 13 78.62 104.09 10 76.92
15539. Samar (mesam22) 13 52.80 61.53 1 7.69
15540. naser (memel0rd420) 13 72.27 86.80 3 23.08
15541. Nur (mehedyhassan865) 13 44.05 59.49 2 15.38
15542. ollie (mech_typer) 13 94.76 105.07 9 69.23
15543. MD Gaziur Rahman Noor (mdga... 13 77.33 96.84 6 46.15
15544. Maven (mavenz) 13 95.69 105.57 5 38.46
15545. Matt (mattlo) 13 107.39 125.03 9 69.23
15546. killerkoli (mattiemb) 13 63.87 75.90 2 15.38
15547. Matan (matan_ati) 13 87.28 99.25 7 53.85
15548. FunkyChicken (mastalampe) 13 73.39 80.82 4 30.77
15549. Mark (markparadise) 13 49.76 58.13 1 7.69
15550. marciano (marcboss06) 13 41.22 48.94 2 15.38
15551. Marcago (marcago) 13 81.49 94.53 3 23.08
15552. mapieko (mapieko) 13 45.00 52.55 1 7.69
15553. Rushikesh (manwatkar) 13 43.24 50.75 0 0.00
15554. Manikkavel (manikkavel_s) 13 70.47 79.85 2 15.38
15555. [Bl4nk] (mahneymchef) 13 84.37 90.18 6 46.15
15556. Mahir (mahirafnan) 13 46.45 52.94 2 15.38
15557. Mad Lad (madlad1) 13 61.12 75.27 0 0.00
15558. Migs (m1gs) 13 50.56 57.45 3 23.08
15559. JA (l_ja) 13 54.87 70.36 11 84.62
15560. lyu (lyurisu) 13 100.09 117.94 9 69.23
15561. Larry (lunchspecial) 13 81.38 100.32 5 38.46
15562. luca (luc_vr_04) 13 98.91 128.97 7 53.85
15563. Buddy (lucedes27) 13 109.34 122.13 8 61.54
15564. Vijay S (lord_viju) 13 45.66 53.24 1 7.69
15565. Logiq (logiqq) 13 61.61 73.55 1 7.69
15566. Joshua Peirce (lodgevirus) 13 90.67 110.87 8 61.54
15567. Ajeje (locreee) 13 56.22 75.48 4 30.77
15568. Andres (lobosolitario) 13 82.84 108.57 8 61.54
15569. Liz (lizard117) 13 69.01 82.68 2 15.38
15570. Joe (littlejoeward) 13 67.41 78.05 2 15.38
15571. Kacper (lilfridge69) 13 60.87 71.86 2 15.38
15572. Travis (lightningslow) 13 68.12 95.23 3 23.08
15573. Liban (liban711) 13 91.91 102.89 6 46.15
15574. Marco (leungtc20001124) 13 87.91 96.30 3 23.08
15575. Lestro-+) (lestroboy) 13 28.98 36.85 1 7.69
15576. Leonard (lentan) 13 119.61 135.15 7 53.85
15577. Barel (lenshom) 13 64.99 79.09 9 69.23
15578. Laxman (laxman_) 13 72.15 80.25 8 61.54
15579. Jake (kyrien) 13 115.71 127.15 9 69.23
15580. Kyle (kyles0610) 13 113.04 124.22 4 30.77
15581. James (kuznecoff) 13 76.69 90.62 2 15.38
15582. Kuba (kubzas) 13 42.00 46.55 3 23.08
15583. guest (ks3rr) 13 76.17 83.50 4 30.77
15584. Kristin (krisis7) 13 65.81 73.89 2 15.38
15585. Justin (krakken858) 13 106.82 121.39 5 38.46
15586. Stephen (korankye) 13 98.29 119.89 11 84.62
15587. Dakota (kodaworms) 13 97.72 110.10 8 61.54
15588. Kritim (kkr_) 13 77.52 87.83 5 38.46
15589. Kanha (kjewels) 13 69.85 83.96 1 7.69
15590. kit (kitsinc11) 13 94.17 116.47 2 15.38
15591. Brando (kingozymandias2) 13 88.31 98.78 6 46.15
15592. Kif (kifm) 13 51.03 57.81 0 0.00
15593. Khoa (khoa1811) 13 96.24 107.19 3 23.08
15594. Raven (kfaulk1216) 13 96.45 107.78 6 46.15
15595. Quick Fox (key_of_boards) 13 79.21 90.87 1 7.69
15596. Kenley (kenfunky32) 13 93.55 109.17 4 30.77
15597. kenestrophic (kenestrophic) 13 63.66 78.12 3 23.08
15598. kevin (kelvinscale) 13 51.94 60.85 3 23.08
15599. kelonline (kelonline) 13 55.38 60.60 0 0.00
15600. Kedolind (kedolind) 13 82.14 93.92 4 30.77
15601. Kamron (kbegmatov96) 13 67.10 76.24 5 38.46
15602. Luna (kavuko_) 13 56.40 65.72 3 23.08
15603. James (kasprovy) 13 56.47 62.01 0 0.00
15604. Karcinogen (karsenj05) 13 73.55 82.67 3 23.08
15605. Kalybay (kalybai) 13 54.54 59.02 2 15.38
15606. Kaleeyse (kaleeysem) 13 61.67 70.94 2 15.38
15607. Eyrton (kalaxee) 13 98.63 112.90 7 53.85
15608. Khadija (kaijaaa) 13 34.63 42.90 3 23.08
15609. kadyn (kadynnn) 13 52.38 62.29 4 30.77
15610. Angel (kablockacha) 13 48.79 59.98 2 15.38
15611. K4_keyChan_ (k4_keychan_) 13 89.51 112.89 6 46.15
15612. Justin (justintam556) 13 85.70 106.00 5 38.46
15613. justinhylee (justinhylee) 13 109.09 130.57 13 100.00
15614. Julio Jose (julioisdaman) 13 68.18 94.06 3 23.08
15615. JudgementCole (judgementcole) 13 48.40 55.99 2 15.38
15616. juan (juanjaho) 13 75.70 91.69 2 15.38
15617. KookyMonster🍪🍪🍪 (j... 13 111.41 131.48 9 69.23
15618. Jellybean (jojo00vvv) 13 104.51 121.24 6 46.15
15619. Joe (joejoeparen) 13 70.60 95.76 9 69.23
15620. James (jimmyt50) 13 79.84 95.11 1 7.69
15621. Dim (jimmylei) 13 88.89 104.80 3 23.08
15622. jim (jimmyl02) 13 113.91 129.08 9 69.23
15623. Alex (jigglytophat) 13 55.92 64.94 2 15.38
15624. patoo (jiahao8) 13 104.55 116.42 6 46.15
15625. JCGP (jgcp) 13 79.09 88.83 5 38.46
15626. Jeritens (jensrichter) 13 82.35 94.34 3 23.08
15627. JDSpark (jdspark) 13 87.89 111.01 4 30.77
15628. Jamie (jcpopp) 13 111.26 125.91 7 53.85
15629. JayGMZ (jaygmz) 13 39.08 47.93 2 15.38
15630. Javla (javlafan) 13 87.76 106.19 5 38.46
15631. Chukwuka (javalon007) 13 71.43 85.21 5 38.46
15632. Jaunty (jaunty_jalopy) 13 88.70 96.64 5 38.46
15633. Jared (jarbarw) 13 96.07 111.62 7 53.85
15634. Sayauriee (japanese_maple_l... 13 93.01 103.02 6 46.15
15635. Jandre (jandre1028) 13 122.32 152.23 8 61.54
15636. Jan (jan3112) 13 61.52 71.74 3 23.08
15637. Jafer (jafer2000) 13 62.85 78.09 1 7.69
15638. Jack (jackwhitten238) 13 82.05 96.47 3 23.08
15639. JJJ (jaakko1) 13 106.64 127.78 8 61.54
15640. Vraj (i_type_really_slow_ok) 13 97.31 107.09 3 23.08
15641. Timothy (iyamdeanser) 13 78.88 90.54 4 30.77
15642. Apithat Sombatsiri (itsmek4nz) 13 92.91 109.05 4 30.77
15643. Itscol (itscol) 13 69.43 82.14 4 30.77
15644. ok nerd (irumpelstiltskin) 13 78.28 91.59 6 46.15
15645. Ronan (ironan) 13 140.55 179.95 11 84.62
15646. Im kinda cute (im_kinda_cut... 13 89.65 103.64 3 23.08
15647. Nawaf (iinkz) 13 76.24 83.79 3 23.08
15648. Shino (id_acey) 13 81.84 107.06 1 7.69
15649. Samuel (ichigancs) 13 85.51 98.51 5 38.46
15650. IBRAIM5URFER (ibrahimpro) 13 86.44 103.27 4 30.77
15651. Robert (hypersnitch) 13 75.28 95.13 2 15.38
15652. Huy (huygtran123) 13 76.23 81.73 5 38.46
15653. Nguyen (hungnguyen2912) 13 36.37 43.03 1 7.69
15654. Hugh (hughmarch) 13 103.59 134.62 7 53.85
15655. David (hugger69) 13 80.71 87.96 3 23.08
15656. Putra (hoodedproxy) 13 71.01 81.07 4 30.77
15657. Lingxun (hommieinuw) 13 91.32 101.85 5 38.46
15658. Eduard (holykill) 13 102.17 120.24 5 38.46
15659. Holden (holdcop) 13 91.32 105.67 7 53.85
15660. Muhamed (hjewdjsdjsdjs) 13 45.66 50.38 1 7.69
15661. Hi3rra (hi3rra) 13 40.96 47.74 0 0.00
15662. Jake (hero7785) 13 79.81 88.50 4 30.77
15663. script/script (henville12) 13 102.34 115.54 6 46.15
15664. Hehsbb (hehsbb) 13 72.35 91.82 3 23.08
15665. Phan (hed_wig) 13 90.20 101.46 5 38.46
15666. cat (hecknolol2) 13 73.64 102.17 3 23.08
15667. POCARI (hdpocari) 13 76.03 87.72 6 46.15
15668. haytch (haytch) 13 42.91 58.66 1 7.69
15669. Hans5958 (hans5958) 13 80.77 99.43 4 30.77
15670. Halifay (halifay) 13 80.01 88.26 1 7.69
15671. Haduu (hadiysd) 13 98.94 103.27 7 53.85
15672. GrimRaven26 (grim_raven26) 13 56.31 63.56 1 7.69
15673. amber (gremlinx8) 13 101.55 112.83 8 61.54
15674. Kevin (greenleafy) 13 131.59 152.44 8 61.54
15675. Patryk (grayek) 13 83.97 89.76 0 0.00
15676. Brad (godspeed99) 13 86.12 91.93 4 30.77
15677. Kenneth (godfetus) 13 104.78 117.83 6 46.15
15678. glucose (glucose) 13 111.95 137.51 9 69.23
15679. Robert (glixzor) 13 105.94 115.21 5 38.46
15680. tunisian_cat73 (gianthetaco) 13 160.27 173.69 11 84.62
15681. Josh (ghostrider5346) 13 54.72 62.87 3 23.08
15682. TMGAMING (ggatorade) 13 71.57 81.81 4 30.77
15683. Gary (ggaarryy12340) 13 65.96 76.03 3 23.08
15684. George (georgepj) 13 58.03 67.45 1 7.69
15685. gian (geefuco) 13 79.75 96.84 3 23.08
15686. Газиз (gazizaskar_) 13 47.45 56.19 0 0.00
15687. Garv (garvgopalia) 13 45.62 52.92 2 15.38
15688. Garrett (garrettn1899) 13 60.09 67.62 2 15.38
15689. TypeLX (gamerleelxo) 13 123.49 135.39 6 46.15
15690. Gabe (gabrielbj29) 13 64.19 83.31 4 30.77
15691. oof (fyestrietser101) 13 125.36 145.57 9 69.23
15692. ^_^ (fuuje) 13 79.57 94.16 5 38.46
15693. Albert (frequentflyer123) 13 100.18 108.17 5 38.46
15694. jurj (fredkag) 13 98.63 115.99 3 23.08
15695. Fedrick (freddybofte) 13 65.10 83.39 0 0.00
15696. Saleh (foxtheonly) 13 50.91 65.86 1 7.69
15697. foveacapitus (foveacapitus) 13 26.63 54.50 8 61.54
15698. Ford Mustang (ford_mustang) 13 38.68 48.34 1 7.69
15699. Dante (flukierclient) 13 70.92 84.30 4 30.77
15700. Ivan (floki12_) 13 62.13 78.83 6 46.15
15701. m (flashyyy) 13 104.09 123.15 13 100.00
15702. fishy15 (fishy15) 13 115.48 138.64 6 46.15
15703. Filipo (filipomarcel) 13 98.07 109.76 8 61.54
15704. Fernando (fer_8888) 13 56.44 67.73 2 15.38
15705. Luao (fencerperson) 13 76.13 88.62 3 23.08
15706. Femosis (femosis) 13 103.45 123.63 6 46.15
15707. Tim (fast_but_not_the_fastest) 13 101.62 117.33 6 46.15
15708. Basil (falaedor) 13 85.00 95.00 4 30.77
15709. m3dou_ (faheemmeharaj123) 13 46.49 84.24 6 46.15
15710. Eva (evyrose2008) 13 55.97 70.18 1 7.69
15711. Ethan (ethanxiaoful) 13 98.08 108.49 5 38.46
15712. Eskooty (eskooty) 13 94.93 105.58 4 30.77
15713. LilCup (epoli0319) 13 60.30 70.53 3 23.08
15714. Epic (epicgamesceo) 13 85.18 102.89 5 38.46
15715. Emilyyyy (emilyyyy26) 13 46.53 58.56 2 15.38
15716. mle (emilyliz) 13 129.23 150.17 8 61.54
15717. Elxius (elxius) 13 81.83 103.07 2 15.38
15718. El (elnotelanor) 13 55.15 61.23 1 7.69
15719. elay (elaytyping) 13 32.59 36.44 1 7.69
15720. Elandaleb (elandaleb) 13 37.08 43.84 0 0.00
15721. Glooberson (eifersucht) 13 82.02 93.90 3 23.08
15722. efradagod (efradagod) 13 86.53 101.75 11 84.62
15723. matu (eepilinemangur1) 13 128.77 174.03 5 38.46
15724. zvgz (eclfppcmommarsuwof) 13 76.38 83.94 5 38.46
15725. Ronnie (ebedebeds) 13 118.51 128.10 6 46.15
15726. Drei (dy539) 13 78.64 85.29 2 15.38
15727. darius (dxriuzs) 13 96.03 107.46 8 61.54
15728. Chuck (dvorakmrcharles) 13 58.20 66.18 1 7.69
15729. Anthony (duragsensei) 13 103.93 117.66 6 46.15
15730. Martin (drudi1902) 13 64.32 73.50 3 23.08
15731. DrPoppyseed (drpoppyseed) 13 81.84 90.50 3 23.08
15732. Nikola (dropndrag) 13 61.55 72.51 2 15.38
15733. Carrot (dreamsode) 13 108.17 116.62 6 46.15
15734. Dream (dreamsnake) 13 96.93 125.37 5 38.46
15735. DrDynamic (drdynamic) 13 82.69 100.98 1 7.69
15736. dqwlol (dqwlol) 13 77.75 89.56 4 30.77
15737. Perfection (doxxx) 13 133.28 159.55 11 84.62
15738. Austin (dorrzun) 13 107.37 135.05 5 38.46
15739. doodezpz (doodezpz) 13 93.59 111.47 5 38.46
15740. Donnkey (donnkey) 13 103.55 119.67 5 38.46
15741. nhentai (dongpo_pork) 13 98.81 113.21 7 53.85
15742. Xian (doggy2021) 13 88.85 100.31 3 23.08
15743. Troy (dogepowers) 13 89.80 102.53 2 15.38
15744. Pisti (doctorstave) 13 100.31 110.87 8 61.54
15745. DoctorN0gloff (doctorn0gloff) 13 134.38 156.19 9 69.23
15746. David (dlefarth) 13 60.31 68.44 2 15.38
15747. Do-Hyun (dkim00) 13 89.30 101.32 6 46.15
15748. dirtydan (dirtyjdan) 13 67.19 71.63 4 30.77
15749. Digo (digocorbellini) 13 81.62 94.34 4 30.77
15750. Nash (digitalnash) 13 127.34 144.25 10 76.92
15751. Diego (diego190401) 13 68.92 84.56 2 15.38
15752. Diaa (diaa001) 13 55.58 73.80 2 15.38
15753. Jacob (destroyer183) 13 75.06 90.90 4 30.77
15754. Delviurge (delviurge) 13 102.58 110.24 7 53.85
15755. JR (deltav) 13 98.75 112.00 4 30.77
15756. Bang (dbgt0008) 13 91.03 106.12 8 61.54
15757. Jepps (dazzle919) 13 117.86 149.79 6 46.15
15758. david (davtet1) 13 88.39 109.42 6 46.15
15759. Bebo (dark__knight_pro) 13 51.52 59.49 3 23.08
15760. DarkLight (darklight17) 13 76.79 89.70 1 7.69
15761. SWAPAN (dapana610) 13 45.30 53.35 1 7.69
15762. Dan (danslaps) 13 84.49 98.58 3 23.08
15763. Daniel (danielstep65) 13 93.19 108.37 3 23.08
15764. Eric (dango499) 13 121.65 136.25 8 61.54
15765. Adam (damadamadamm) 13 76.45 81.23 3 23.08
15766. Matthew (d3f1n3d) 13 113.96 132.83 6 46.15
15767. Nana (cypher404) 13 87.61 109.59 4 30.77
15768. Cynthia (cynthiaparkk) 13 74.68 93.23 5 38.46
15769. ethxn (cxntrxl) 13 88.01 99.79 4 30.77
15770. cupnode (cupnode) 13 51.74 69.65 1 7.69
15771. ymdsji (crostovik) 13 86.58 95.24 5 38.46
15772. Himanshu (crestfalln) 13 54.40 58.65 2 15.38
15773. Craig (craigo76) 13 60.95 72.70 1 7.69
15774. coolslowboy (coolslowboy) 13 67.69 75.14 4 30.77
15775. CoolGuyConnor (coolguyconnor) 13 81.76 91.61 3 23.08
15776. Abrar (computernerdgenius) 13 64.70 75.47 4 30.77
15777. RIP Zyzz (codecub) 13 159.43 187.60 10 76.92
15778. Mike Oxlong (cmc_05) 13 43.77 50.10 4 30.77
15779. Claire (claire_t_bear) 13 75.06 95.21 4 30.77
15780. Mike (chomeror) 13 64.00 74.22 0 0.00
15781. Chirag (chirag2907) 13 49.44 54.35 2 15.38
15782. chipotle06 (chipotle06) 13 96.94 106.80 8 61.54
15783. Chewing (chewing_bever) 13 98.84 118.01 7 53.85
15784. slow typer (chessbobble) 13 85.40 104.26 6 46.15
15785. Charles (charlesdickson1) 13 124.84 136.88 11 84.62
15786. Charlie (chardlz) 13 100.54 118.24 6 46.15
15787. Chandler (chandlerbing123) 13 72.93 82.38 4 30.77
15788. chander (chanderpal) 13 49.40 54.75 0 0.00
15789. Yuri (ceaseless_melon) 13 88.00 104.21 6 46.15
15790. Charlie (cdicey) 13 85.15 103.93 4 30.77
15791. Ententente (carousell) 13 88.43 99.89 6 46.15
15792. Captain (captainrich) 13 69.88 83.92 4 30.77
15793. canwithbeans (canikomaniko1) 13 59.28 72.87 2 15.38
15794. cake (cake0) 13 142.24 163.49 13 100.00
15795. Busky (buskyhusk) 13 94.03 105.56 7 53.85
15796. Minh Kiet (buimonkey) 13 102.66 124.55 4 30.77
15797. Bucky (buhcky) 13 96.70 123.39 5 38.46
15798. Jacky (bubberducky209) 13 94.65 109.74 5 38.46
15799. Ali (bronzor16) 13 95.10 105.99 1 7.69
15800. Brecken (breckenmueller) 13 63.55 72.29 3 23.08
15801. Bosco (bqscopog) 13 93.62 109.18 6 46.15
15802. Borislav (borko_panterata) 13 73.10 85.99 3 23.08
15803. boom (boompotato123) 13 79.20 93.78 3 23.08
15804. serg (bobanuts) 13 81.39 93.33 7 53.85
15805. Bernard's (bmadayag) 13 100.66 118.59 6 46.15
15806. Mary (bloody_mary) 13 69.99 85.40 3 23.08
15807. 🤠👌🏿 (blackclaw) 13 96.85 108.05 6 46.15
15808. bl731mang (bl731mang) 13 93.63 125.60 6 46.15
15809. Hassan (bipedalfrog) 13 39.21 48.49 1 7.69
15810. ed (bigponpon) 13 88.15 102.64 1 7.69
15811. Slobodan (bekca) 13 96.48 111.74 4 30.77
15812. Matthew (befurl) 13 75.52 97.63 5 38.46
15813. Bedilbek (bedilbek) 13 58.52 66.75 4 30.77
15814. Quang (baoquanggogreen) 13 58.03 73.96 2 15.38
15815. NeverLucky (bambooaxe) 13 83.34 94.10 4 30.77
15816. Balka (balka) 13 77.83 91.39 1 7.69
15817. Dulguun (b180950039) 13 52.50 56.00 2 15.38
15818. Aziz (azizxushvaqtov07) 13 53.68 66.45 4 30.77
15819. John (avantegarden) 13 81.53 102.73 4 30.77
15820. Ast (astrxse) 13 85.37 107.56 3 23.08
15821. Ashish (ashish_m) 13 45.45 49.79 3 23.08
15822. B A L O CH (ashfaq4730) 13 100.40 124.31 5 38.46
15823. Arti (artifictional) 13 117.14 129.05 6 46.15
15824. Arissa (arissahsu) 13 101.95 117.19 8 61.54
15825. Arevilov (arevilov_3) 13 77.46 87.21 3 23.08
15826. Aquatic (aquache) 13 84.36 101.05 1 7.69
15827. Mr.Pickles (ap_ultra) 13 93.28 116.72 4 30.77
15828. Andy (andym04) 13 116.29 139.85 9 69.23
15829. Andrew (andvorak) 13 60.50 65.81 3 23.08
15830. Ridge (anawesomefry) 13 85.84 104.82 6 46.15
15831. Allen (analogaio) 13 112.25 139.19 6 46.15
15832. amr (amr_el7afy) 13 33.98 38.98 1 7.69
15833. AmirrezA (amirrezase7en) 13 92.80 106.89 5 38.46
15834. Amiro (amiro74) 13 47.60 52.70 7 53.85
15835. aluminae (aluminae) 13 99.41 113.80 5 38.46
15836. h3llo (alowqo) 13 49.67 57.54 3 23.08
15837. Abdulaziz (aligonijr) 13 59.45 73.40 3 23.08
15838. AKW (alice1120) 13 77.12 86.74 3 23.08
15839. AlexAustria (alexaustria) 13 81.69 88.06 5 38.46
15840. Ayush (akushwaha11) 13 54.92 65.68 1 7.69
15841. Akram (akrammiru) 13 53.00 59.55 1 7.69
15842. akmal (akmalhisyam) 13 42.18 45.43 2 15.38
15843. Akhil (akhillasrado) 13 82.01 96.98 3 23.08
15844. Aidan (aidan9500) 13 84.38 94.46 3 23.08
15845. Alan (affectedmelon) 13 91.60 106.27 4 30.77
15846. Aye (aexerz) 13 69.52 89.08 3 23.08
15847. Adam (aeoff72) 13 84.04 110.68 4 30.77
15848. Adhitya (adhityanugraha96) 13 61.70 69.17 1 7.69
15849. Adedhuman (adedhuman) 13 77.79 86.45 3 23.08
15850. Marco (acopazzo) 13 81.33 91.74 8 61.54
15851. Ace (ace_dragonheart) 13 79.00 103.32 2 15.38
15852. abdullakh (abdullakh) 13 39.67 45.82 5 38.46
15853. Tchaqazbilla (abdesslam47) 13 74.61 81.75 2 15.38
15854. Issaranuwat (aatsaranuwis) 13 60.38 78.48 4 30.77
15855. Danial (6reload) 13 50.07 55.97 4 30.77
15856. Danillo (60ppm) 13 104.89 118.71 4 30.77
15857. Esso (3sso) 13 85.81 104.02 0 0.00
15858. itchyaminoacid (335080673) 13 89.93 98.40 3 23.08
15859. 1time (1time4da1time) 13 95.75 105.68 4 30.77
15860. 173adrimor (173adrimor) 13 55.76 69.79 4 30.77
15861. Amanda (111_amanda_111) 13 45.06 59.62 0 0.00
15862. ekrem. (100percentnonquit) 13 123.55 150.38 6 46.15
15863. Dominic (dominic127) 13 83.64 94.70 5 38.46
15864. Maizzie (maizzie) 13 109.94 133.04 4 30.77
15865. QcDaark (qcdaark) 13 59.45 71.61 4 30.77
15866. Harishan (hari1111) 13 98.34 113.50 5 38.46
15867. brendan (brendan4t) 13 61.63 70.27 3 23.08
15868. Metallic Pea (cooler420) 13 87.15 97.30 3 23.08
15869. Keith (fingers_skills) 13 70.91 77.66 4 30.77
15870. Gonen (gonengazit) 13 78.60 96.60 1 7.69
15871. JSU (mr_funiman) 13 68.69 85.03 5 38.46
15872. Matt (dabagraham) 13 84.69 102.39 2 15.38
15873. Knight (knightbedo) 13 59.19 70.44 2 15.38
15874. vasu (vasu021191) 13 75.66 86.67 6 46.15
15875. granola (granolagobbler) 13 67.88 74.76 1 7.69
15876. Kong (denusklo) 13 47.19 51.55 2 15.38
15877. kaden (hobby273broken) 13 39.60 56.70 9 69.23
15878. Rasmus (seglats) 13 48.31 56.65 0 0.00
15879. AyK3r (junior_mlg12) 13 49.76 60.32 1 7.69
15880. Kritika (phoenix_1307) 13 51.42 60.90 1 7.69
15881. Jorge (sheparddow) 13 59.10 68.44 3 23.08
15882. Welton (wxavier) 13 73.88 84.54 3 23.08
15883. Shin (overgeared_god_grid) 13 71.08 80.88 1 7.69
15884. CrayonMuncher (shanejefferson) 13 91.00 99.99 4 30.77
15885. Zeph (zeph_) 13 74.89 92.66 13 100.00
15886. forCodeIns (synowcode) 13 44.80 56.76 3 23.08
15887. Marco (makoko) 13 39.81 45.73 4 30.77
15888. Castlekeepers (castlekeepers) 13 86.68 98.30 2 15.38
15889. Demon (demon_rocrip) 13 69.51 78.58 2 15.38
15890. Alonso (lazerblade14) 13 60.81 80.25 1 7.69
15891. Sigma.Driver (thotslayerron) 13 62.24 72.37 3 23.08
15892. sunil (sunil1990) 13 51.14 57.45 2 15.38
15893. Sophie (sophienguyen2004) 13 65.46 83.49 4 30.77
15894. Gabriel (gabo16quito) 13 62.10 68.07 2 15.38
15895. Adler (adlerbrin) 13 50.54 64.87 1 7.69
15896. Typing_King (typing_king_123) 13 91.22 111.67 8 61.54
15897. wooksen. (wooksen) 13 75.24 86.95 7 53.85
15898. Simon (simon1293) 13 93.03 109.94 3 23.08
15899. josesi (nuevetails) 13 56.75 76.96 2 15.38
15900. Morsbøl (morsboel) 13 83.94 103.84 2 15.38
15901. Marcie (dinkteam) 13 80.82 109.74 6 46.15
15902. arrathore (arrathore) 13 95.57 120.72 4 30.77
15903. jym (jjimjjam) 13 91.92 102.53 3 23.08
15904. Max (rebel_dog) 13 47.88 56.44 0 0.00
15905. Franco (franco404) 13 47.66 56.07 1 7.69
15906. Tachy_Bunker (lo23co7mcpe) 13 90.54 99.66 8 61.54
15907. Roronoa (roronoa_zoro007) 13 51.56 60.45 1 7.69
15908. Alfonso (aagtyperacer) 13 47.98 61.58 2 15.38
15909. Boy Wonder (coding_ninja) 13 54.05 67.96 4 30.77
15910. Arath (arathjz) 12 87.59 98.17 5 41.67
15911. Apple Magic (applemagic4life) 12 127.45 149.73 8 66.67
15912. Anugrah (anugrahdwikusuma) 12 92.68 116.31 4 33.33
15913. tstats[anotherbandkid] (ano... 12 80.81 91.66 3 25.00
15914. Anit (anit2007) 12 75.54 87.36 5 41.67
15915. angel (angelllfoo) 12 86.07 103.03 4 33.33
15916. Andrew (andrewfbr) 12 101.38 121.86 6 50.00
15917. Andrew (andrewdvorak) 12 96.12 106.30 6 50.00
15918. Abdullah (anarkhos) 12 95.25 101.73 4 33.33
15919. 陳 (amybmy) 12 59.88 73.50 2 16.67
15920. Nafiul (aminafi) 12 82.16 89.77 4 33.33
15921. alex (alexllc) 12 70.10 125.48 6 50.00
15922. Alex (alexlava) 12 78.85 90.18 2 16.67
15923. Al (alexkjenkins) 12 67.26 78.04 1 8.33
15924. Albion (albionthegreat) 12 85.25 96.46 1 8.33
15925. Mohammed (alazzouny) 12 52.53 65.41 1 8.33
15926. Alarming (alarmngracer) 12 72.15 88.97 4 33.33
15927. aka49 (aka49) 12 95.90 114.39 5 41.67
15928. AJspeedy (ajspeedy5) 12 87.08 98.11 5 41.67
15929. Aishuak (aishonnnn) 12 50.90 57.67 9 75.00
15930. hadi (airsmite) 12 78.35 91.25 11 91.67
15931. lelo (aie1900) 12 72.14 84.86 2 16.67
15932. Aggro (aggro_typer) 12 106.92 121.03 5 41.67
15933. The (afsanster) 12 41.56 47.57 3 25.00
15934. Ajitesh (adji2057) 12 61.24 71.33 4 33.33
15935. adibhehe (adibhehe) 12 67.08 81.21 12 100.00
15936. henryk (adeczek) 12 113.85 141.77 2 16.67
15937. Adarsh (adarshkr) 12 76.60 85.31 4 33.33
15938. Ezra (account_name) 12 117.84 128.04 4 33.33
15939. Abhiram (abhiramravi) 12 107.30 120.45 6 50.00
15940. Abdallah (abdallah7) 12 73.04 93.08 3 25.00
15941. Aakash (aakash3697) 12 79.14 92.07 4 33.33
15942. Andy (a1i3n0) 12 108.85 129.46 7 58.33
15943. meme (7fingers) 12 94.00 121.66 5 41.67
15944. swagfish (4thunion) 12 90.56 104.94 5 41.67
15945. Osyrs (3556) 12 66.77 76.57 2 16.67
15946. 2qbingxuan (2qbingxuan) 12 68.62 82.92 1 8.33
15947. 2dnas (2dnas) 12 76.40 86.96 2 16.67
15948. MD (123onick) 12 35.98 42.97 3 25.00
15949. Owen (123ojb) 12 101.26 109.43 0 0.00
15950. Arne (11bricks) 12 86.25 102.59 3 25.00
15951. Jason (j93_quinn) 12 81.14 102.08 3 25.00
15952. Batman (wellin) 12 76.37 87.25 4 33.33
15953. Allen (livehappily16) 12 59.72 76.85 2 16.67
15954. Caboj (dvoraklearner123) 12 86.46 104.00 6 50.00
15955. Triet (triet228) 12 66.16 81.54 1 8.33
15956. Yūgen (yugenamane) 12 76.48 87.47 3 25.00
15957. Rogue_Panda (sanchit___) 12 49.76 60.15 2 16.67
15958. Ja (jarenmatthew) 12 70.34 81.30 4 33.33
15959. soft (shattered_lens) 12 88.35 111.38 6 50.00
15960. matcha (matchanapkin) 12 96.71 112.01 4 33.33
15961. Sagun (sagunmdr) 12 60.23 71.06 4 33.33
15962. Kyle (akilies2401) 12 63.41 72.64 6 50.00
15963. kushal (cheesecakebtw) 12 67.92 76.64 0 0.00
15964. Allen (enigma_801) 12 125.24 135.88 11 91.67
15965. Elias (elreylocro) 12 59.47 71.37 6 50.00
15966. Erik (erhuht) 12 73.79 86.34 2 16.67
15967. kryeohs (kryeohs) 12 50.29 59.75 3 25.00
15968. Tantai (tantai115) 12 56.26 62.47 3 25.00
15969. Mr. (pedley) 12 76.12 85.60 7 58.33
15970. Cesar (lentil_salad) 12 47.97 52.83 1 8.33
15971. london (londonxxx) 12 73.63 88.07 4 33.33
15972. Muhammad (wakype) 12 46.46 51.99 3 25.00
15973. isniffsharpies (isniffsharp... 12 83.19 99.92 3 25.00
15974. Phelix (phelix23) 12 102.14 117.35 9 75.00
15975. Nathalie (larreanathalie) 12 59.18 72.30 1 8.33
15976. lj (yzthesimp) 12 46.36 55.56 3 25.00
15977. spongebob (royalespongebob) 12 86.49 102.73 4 33.33
15978. John (bonsaifarm) 12 89.95 108.77 2 16.67
15979. Nguyen (nguyenminhtri) 12 37.31 48.31 0 0.00
15980. chloe (musical_kittycat) 12 98.10 112.24 2 16.67
15981. Edd (christenlanger) 12 94.37 117.14 5 41.67
15982. bibney (bibney) 12 88.84 98.33 4 33.33
15983. ryan (ambush_) 12 73.75 89.93 4 33.33
15984. Kenshee (knshnsrz) 12 73.58 86.79 4 33.33
15985. Chris (c4fernandez) 12 82.40 97.97 4 33.33
15986. novice (kai1234567890) 12 34.69 37.95 0 0.00
15987. airkool (airkool) 12 57.49 68.36 2 16.67
15988. Ricardo Aguilar (agira) 12 36.21 61.76 0 0.00
15989. John (khoryl) 12 88.85 100.89 2 16.67
15990. Rafi (sirtheo) 12 48.59 56.33 3 25.00
15991. Hunter (htrautz) 12 67.77 76.63 1 8.33
15992. Dianne (diannutella) 12 86.27 101.56 12 100.00
15993. Joel (joelitoelisha) 12 71.57 86.94 5 41.67
15994. An Existing Person (technon... 12 102.25 117.15 9 75.00
15995. Son Nguyen (xpinpin) 12 70.23 79.38 8 66.67
15996. Lexie (lexie120) 12 72.16 82.91 2 16.67
15997. Callum (lemurple) 12 59.71 70.40 0 0.00
15998. Trying to get to 75wmp (in_... 12 88.74 98.71 5 41.67
15999. Elizabeth (theatribeth) 12 65.35 73.68 3 25.00
16000. Jack (jackkaranjan) 12 81.73 94.01 2 16.67
16001. Prakash (prakash_18) 12 24.03 30.38 4 33.33
16002. Allee (hayyallee) 12 63.79 95.08 10 83.33
16003. Kyunghwan (mallardk0h) 12 84.37 100.22 2 16.67
16004. M (maddyjune) 12 86.11 104.51 2 16.67
16005. Mada (mada_) 12 94.57 106.51 1 8.33
16006. Manoj (m00npie) 12 55.65 62.73 3 25.00
16007. Lucien (lulugaming_da_proty... 12 79.78 88.35 7 58.33
16008. LUka (lukazmaj) 12 54.74 62.67 3 25.00
16009. (luclukiluc) 12 82.23 94.99 3 25.00
16010. lubi222 (lubi222) 12 124.09 140.97 6 50.00
16011. LordxChongo (lordxchongo) 12 47.86 62.71 7 58.33
16012. Locklyn (locky_) 12 84.08 102.31 2 16.67
16013. Lori (ljflute) 12 95.72 119.38 4 33.33
16014. Lizard (lizardk99) 12 95.42 108.46 4 33.33
16015. fusaishi (litaoge) 12 81.11 93.13 7 58.33
16016. Le Linh (linhkhanhslee) 12 46.29 55.39 1 8.33
16017. Lily (lilythemc) 12 63.14 73.81 0 0.00
16018. Nandies (lilnandies) 12 64.93 73.44 3 25.00
16019. Hisoka (lev872) 12 30.98 35.61 2 16.67
16020. Lila_lut (lei_ruth) 12 73.36 84.32 4 33.33
16021. 𝕷𝖊𝖌𝖊𝖓𝖉... 12 57.61 65.15 7 58.33
16022. Leang (leangsopoar) 12 48.69 55.53 0 0.00
16023. leah (leah8jean) 12 47.68 62.05 2 16.67
16024. Jan (latino_dino) 12 47.18 54.15 0 0.00
16025. cyamon (kuthiphenchodi) 12 92.39 109.87 5 41.67
16026. Christian (kunuc) 12 89.37 102.39 5 41.67
16027. Krutik (krutikp) 12 66.51 74.50 3 25.00
16028. kovi (kovizzz) 12 100.88 121.63 4 33.33
16029. Koshi (koshigaming) 12 94.69 110.80 5 41.67
16030. Knot (knotcj) 12 69.81 85.89 4 33.33
16031. Klog (klog53) 12 104.94 122.64 5 41.67
16032. matt (kingspyfox) 12 60.34 68.35 3 25.00
16033. BingBong (kingcaiden66) 12 99.10 110.18 5 41.67
16034. Orban (killhorizon23) 12 73.32 87.90 2 16.67
16035. Kebee (kevwickz) 12 92.10 100.49 7 58.33
16036. Herb (kellzer) 12 82.23 99.03 4 33.33
16037. Kean (kean_saneki) 12 71.48 89.26 2 16.67
16038. Kunal (kc596) 12 69.64 75.23 1 8.33
16039. John (kasi95) 12 68.28 78.22 4 33.33
16040. Kanav (kanav__trying) 12 55.41 64.20 0 0.00
16041. Chris Jozef Cad (kamireign) 12 98.72 112.05 5 41.67
16042. Kacper (kacpix2000) 12 109.17 145.07 8 66.67
16043. Lev (kaberan) 12 34.27 39.64 0 0.00
16044. 🤜🏻 (k1s_darya) 12 89.14 101.98 2 16.67
16045. Joe (jych0) 12 83.20 95.53 6 50.00
16046. jwt4517 (jwt4517) 12 99.82 111.07 8 66.67
16047. L (just_a_random_guy_123) 12 71.39 83.11 2 16.67
16048. isaac (justisaac5) 12 76.17 87.24 0 0.00
16049. Julian (julianjelfs) 12 59.49 69.87 1 8.33
16050. JuanDeag111 (juandeag111) 12 83.82 94.58 3 25.00
16051. n (jtrondy) 12 90.49 103.76 6 50.00
16052. Flank (jtall4747) 12 81.07 99.94 1 8.33
16053. JOSH (jo_dpe) 12 82.15 96.48 3 25.00
16054. jonathan (joschio_o) 12 66.32 79.17 1 8.33
16055. Jonathan (jon_daub) 12 82.43 105.17 2 16.67
16056. Esketit (jony1525) 12 95.47 112.09 7 58.33
16057. Johnny (johnnytct) 12 73.89 87.05 6 50.00
16058. Joel (joel10) 12 48.79 54.87 3 25.00
16059. Joseph (joegoldman) 12 105.40 115.18 8 66.67
16060. Jared (jm1289) 12 58.36 66.30 3 25.00
16061. jimi (jimi79) 12 92.85 108.58 10 83.33
16062. Jay (jgupta) 12 98.32 116.83 6 50.00
16063. asldjf (jfulle3518) 12 111.62 132.32 6 50.00
16064. Jess (jessnguy) 12 58.42 72.71 1 8.33
16065. A (jenniesana) 12 74.03 91.46 5 41.67
16066. Triết (jean2002) 12 40.42 47.63 4 33.33
16067. Jd (jdthebeanbag) 12 58.85 67.14 1 8.33
16068. Jatin (jcsteelbender) 12 95.83 106.89 6 50.00
16069. Michael (javamorris) 12 101.73 114.63 6 50.00
16070. Debbie (jaedee_debbie) 12 68.42 82.96 4 33.33
16071. Tim (jackychan564) 12 100.98 129.47 4 33.33
16072. Jackson (jacksons123) 12 94.99 109.82 2 16.67
16073. jachym (jachymneumipsat) 12 41.89 48.44 0 0.00
16074. Justin (iukekini) 12 105.57 115.53 6 50.00
16075. Bryle (itsbrytastic) 12 100.16 114.74 7 58.33
16076. sasuke_uchihha (ironman1123) 12 61.57 67.97 0 0.00
16077. Duy (invinduy) 12 82.24 100.94 10 83.33
16078. Intesar (intesar) 12 61.83 71.13 3 25.00
16079. InfiniteCows (infinitecows) 12 98.50 113.08 8 66.67
16080. Azer (imranovazer) 12 38.50 53.02 0 0.00
16081. tstats[ilyadancshp] (ilyada... 12 66.42 72.36 3 25.00
16082. Alonso (igoalonso) 12 63.20 75.70 3 25.00
16083. Moatasem (idolzy_123) 12 104.84 119.14 5 41.67
16084. Erin (iceflake) 12 84.59 101.62 3 25.00
16085. Daniel (ibedacaptainofdaship) 12 103.05 121.60 4 33.33
16086. VPK (iamvpk) 12 87.11 103.12 6 50.00
16087. Adam (iadam368) 12 72.36 81.95 10 83.33
16088. yoyo (i0y0) 12 53.17 60.04 0 0.00
16089. Andrew (hurricaneandrewbs) 12 85.44 96.96 2 16.67
16090. Hunter (hunterschool22) 12 103.35 116.33 8 66.67
16091. Hramich (hramich) 12 57.22 64.07 2 16.67
16092. Name (housewren) 12 112.40 140.47 8 66.67
16093. houka (houka) 12 79.15 97.01 6 50.00
16094. Peter (hoopla27) 12 75.09 89.49 3 25.00
16095. Juan Raphael (homonovus97) 12 51.72 56.83 1 8.33
16096. awesome (hobo223) 12 91.43 101.80 5 41.67
16097. I_will_not_tell (hitme1111) 12 24.34 28.31 1 8.33
16098. doubt (hightness) 12 86.25 95.30 3 25.00
16099. xi (highrizery) 12 70.30 78.21 2 16.67
16100. hhh (hhhaaahhhaa) 12 74.95 89.15 3 25.00
16101. Alex (heikale) 12 59.56 75.92 1 8.33
16102. Afifu (healme) 12 60.81 74.00 4 33.33
16103. Henry (hchen1021) 12 79.60 92.97 3 25.00
16104. Janet (hasuhime) 12 70.31 85.99 4 33.33
16105. Hashrin (hashrin) 12 75.83 94.51 4 33.33
16106. Harsha (harshatalla) 12 64.98 79.11 3 25.00
16107. Ahsan (haris_ahmed) 12 95.76 106.06 11 91.67
16108. harcipulyka (harcipulyka) 12 71.02 79.90 3 25.00
16109. Haotian (haotianxu) 12 106.70 120.85 4 33.33
16110. j (hanjam) 12 81.19 88.20 4 33.33
16111. Maurice (halpibad) 12 49.23 60.22 1 8.33
16112. cleve. (haipong) 12 123.17 137.28 8 66.67
16113. Kevin (hadoukevin) 12 90.48 101.56 4 33.33
16114. Joseph (gov_issued) 12 97.35 108.56 0 0.00
16115. Zack (goodguyzack) 12 79.52 94.65 9 75.00
16116. GIMLY98 (gimly98) 12 88.01 111.61 5 41.67
16117. Giancarlo (giancarlo_sturla7) 12 97.75 108.17 5 41.67
16118. George (georgedmi) 12 74.83 83.00 0 0.00
16119. Deepak (gdn_td) 12 77.74 92.49 5 41.67
16120. Jayden (gaminglz) 12 85.41 101.85 3 25.00
16121. Michel (gamerz026) 12 93.80 108.63 5 41.67
16122. Ahmed (__ahmed__) 12 80.03 87.58 6 50.00
16123. Zoniax (_zephr) 12 87.77 111.96 4 33.33
16124. Rodrigo (zurrion) 12 101.43 118.53 12 100.00
16125. Zuhes (zuhes7) 12 81.14 89.96 5 41.67
16126. zach (zinfinte57) 12 58.10 62.94 3 25.00
16127. InVerse (zenmonkinverse) 12 90.34 101.06 5 41.67
16128. zehvvu (zehvvu) 12 72.89 77.47 6 50.00
16129. Zeerox (zeerox) 12 61.77 73.61 1 8.33
16130. William (yuwan1) 12 52.70 77.01 2 16.67
16131. Josh (yungjosh) 12 117.69 132.51 6 50.00
16132. APPLE (ytfox_roller) 12 68.59 90.86 5 41.67
16133. andy (yourmumgey) 12 100.25 128.97 5 41.67
16134. Johannes (yoshgasm) 12 48.13 54.04 0 0.00
16135. yellow (yellow00) 12 42.58 51.61 2 16.67
16136. Ayaan Iftikhar YT (yeet_ayaan) 12 39.63 46.20 3 25.00
16137. Yakti (yaktithewise) 12 91.10 104.10 8 66.67
16138. Lorenzo (xxx69420xxx) 12 60.99 77.93 7 58.33
16139. XXV6 (xxv6) 12 54.99 61.17 2 16.67
16140. Hassan (xxhassanixx) 12 93.18 112.44 4 33.33
16141. Erik (xuj1) 12 73.67 78.63 2 16.67
16142. xLukeAzade (xlukeazade123) 12 57.70 67.27 1 8.33
16143. xelopan (xelopan) 12 92.75 104.82 4 33.33
16144. Xbeeft (xbeeft) 12 79.01 95.87 9 75.00
16145. Jakub (xaneth) 12 100.80 115.61 4 33.33
16146. レンゾ (wrenji) 12 81.74 92.88 2 16.67
16147. Ryan (wow963) 12 146.26 164.67 11 91.67
16148. David (wookiewarrior07) 12 85.79 100.54 3 25.00
16149. Willie (williecubed) 12 104.27 116.34 4 33.33
16150. William (willezur) 12 99.30 127.88 5 41.67
16151. Wildan (wildan_fachriz24) 12 67.22 81.35 4 33.33
16152. John (wegelius) 12 77.75 102.18 3 25.00
16153. Arvid (warpzep) 12 51.29 68.22 0 0.00
16154. Eric the Topre King (wanger... 12 130.59 155.96 9 75.00
16155. Walfel (walfel) 12 83.54 97.39 3 25.00
16156. Wahid (wahidhamidi707) 12 51.94 63.58 1 8.33
16157. Dorime (vojing) 12 112.59 123.22 6 50.00
16158. Vlad (vlados_shikos) 12 73.28 91.62 0 0.00
16159. Viper (viper04) 12 74.65 89.52 5 41.67
16160. Vigeous (vigeous) 12 38.24 51.93 2 16.67
16161. Vin (vibnarcus) 12 72.33 80.35 4 33.33
16162. Kyle (vertwon) 12 60.42 68.26 2 16.67
16163. Steven (venste_) 12 72.17 79.59 1 8.33
16164. Alexander (vennor) 12 81.58 95.82 3 25.00
16165. Josh (velocity92c) 12 121.23 140.43 7 58.33
16166. Javi (vatojavier) 12 42.78 54.57 2 16.67
16167. violet (validfingers) 12 95.95 106.56 12 100.00
16168. uxvb (uxvb) 12 109.36 143.83 5 41.67
16169. Unknownbean (unknownbean) 12 67.85 84.27 0 0.00
16170. Bojack (uberjoe) 12 110.99 133.12 7 58.33
16171. in (uaqlover) 12 36.33 43.17 1 8.33
16172. default car (typingslowly) 12 99.12 112.92 6 50.00
16173. Typing (typinglegend16) 12 76.95 88.29 3 25.00
16174. karl (type_of_all_types) 12 67.49 76.69 5 41.67
16175. S (typer78) 12 28.90 32.21 2 16.67
16176. Tom (twmc) 12 99.92 128.89 8 66.67
16177. (tulasaeueng) 12 92.33 101.58 2 16.67
16178. Zoomies (tthuang1998) 12 98.73 116.31 5 41.67
16179. Rudolf (trudo) 12 71.18 78.48 4 33.33
16180. TroulM (troulm) 12 88.06 102.85 4 33.33
16181. TrainTrains (traintrains) 12 71.73 89.48 4 33.33
16182. Arthur Toppenberg (tpperware) 12 49.18 57.57 7 58.33
16183. Eric (toniseo) 12 73.60 81.10 6 50.00
16184. Nadhim (tnadhim) 12 58.71 75.78 1 8.33
16185. Alex B (tisan05) 12 69.28 87.33 6 50.00
16186. Stifmeister (the_stifmeister) 12 107.67 133.41 8 66.67
16187. . (the_ohioan) 12 90.98 100.23 2 16.67
16188. yoshi (themune) 12 84.49 95.79 1 8.33
16189. Seth (thefoxarmy) 12 77.35 90.64 4 33.33
16190. Daan (thedr3aded) 12 78.57 96.17 4 33.33
16191. Amy (thedoctastardis) 12 51.45 64.22 1 8.33
16192. cring (thatguyyoudontknow) 12 69.17 86.43 4 33.33
16193. A (terrible_penguin) 12 56.35 68.76 1 8.33
16194. Terkozz (terkozz) 12 67.85 88.89 3 25.00
16195. Tom (tcrman) 12 70.41 82.95 1 8.33
16196. tangjm5 (tangjm5) 12 107.36 117.43 8 66.67
16197. TacticalTux (tacticaltux) 12 119.20 130.15 9 75.00
16198. Tosic (t0sic) 12 86.94 95.09 6 50.00
16199. Arles (synthicalarles) 12 61.38 73.45 12 100.00
16200. swxh89 (swxh89) 12 109.35 124.45 8 66.67
16201. Sweefty (sweefty) 12 71.76 79.31 2 16.67
16202. Allen (swaggerinooo) 12 112.18 135.99 11 91.67
16203. Benjie (superbench03) 12 76.98 92.94 2 16.67
16204. Duc (sungjinwoo2001) 12 48.47 56.11 1 8.33
16205. sungit2g (sungit2g) 12 80.75 96.03 3 25.00
16206. May (suddy) 12 52.24 60.03 2 16.67
16207. Josh (cuddlysamurai) 12 46.52 56.58 0 0.00
16208. Strudle (strudlepoodel) 12 102.98 113.01 8 66.67
16209. frog (strawfrog) 12 86.49 94.62 5 41.67
16210. Manuel (stonesitter) 12 70.11 79.12 2 16.67
16211. Stewhog (stewhog) 12 55.94 76.50 2 16.67
16212. Steve (steve5731) 12 84.63 95.64 4 33.33
16213. Stella (stellaoctangula) 12 80.60 99.24 1 8.33
16214. Sergey (steelassasin) 12 68.54 77.77 1 8.33
16215. Marshall (stackattack14) 12 100.80 118.15 7 58.33
16216. 📵 (sstormwolf22) 12 105.66 123.30 2 16.67
16217. u slow (spyie) 12 37.62 44.36 3 25.00
16218. Splash (splashcc) 12 108.27 119.15 7 58.33
16219. Faleye Slaven (speedhell) 12 30.04 35.12 2 16.67
16220. Spafa (spafa) 12 93.66 110.95 5 41.67
16221. spacehrt (spacebop) 12 73.52 90.84 2 16.67
16222. Ui (so_ta) 12 83.25 96.75 7 58.33
16223. Soul (soul_eater22) 12 77.10 98.34 2 16.67
16224. soopasoop (soopasoop) 12 48.16 54.91 1 8.33
16225. sompur (sompurkrz) 12 86.85 95.24 4 33.33
16226. (solov) 12 168.86 215.13 11 91.67
16227. Daniel (smurfzilla) 12 76.26 101.05 5 41.67
16228. Stacie (slyfoxxli) 12 72.27 88.64 4 33.33
16229. shams (slo_shams) 12 29.44 34.82 1 8.33
16230. MrBoombastic (sloth_express) 12 60.39 66.59 0 0.00
16231. sanic (sleepmoar) 12 118.63 141.66 11 91.67
16232. Pau (skuhls) 12 58.29 63.18 1 8.33
16233. Nicolas (skinny13timmy) 12 90.68 98.98 2 16.67
16234. taichi (sjwsl) 12 59.41 68.42 2 16.67
16235. Ofir (sipthesoup) 12 86.30 99.05 4 33.33
16236. Simmons2 (simmonsgarbageacc... 12 72.26 91.07 9 75.00
16237. Chris (silentshot64) 12 89.97 99.38 6 50.00
16238. Sierra (sierrasetliff) 12 62.12 73.14 3 25.00
16239. Siddarth (siddthekid1) 12 41.74 50.66 2 16.67
16240. Justin (shouganai_1243) 12 63.69 79.47 1 8.33
16241. Oscar (shopsketch) 12 59.79 65.19 1 8.33
16242. Shoden (shoden) 12 69.63 77.54 4 33.33
16243. Shilo (shilomazouz) 12 72.08 78.43 4 33.33
16244. Shayaan (shayaan206) 12 52.64 65.44 0 0.00
16245. Shantanu (shatanu) 12 58.18 70.27 1 8.33
16246. Sharon (sharon102) 12 42.97 49.98 1 8.33
16247. Aran (sharon032588) 12 96.54 122.38 5 41.67
16248. Big Booty T (sexy_dino) 12 87.42 95.92 2 16.67
16249. sen (senoryx) 12 47.24 55.93 4 33.33
16250. Sendy (sendyakbar) 12 79.93 88.87 3 25.00
16251. SAIF (sci_fi_saif) 12 59.07 66.34 2 16.67
16252. ScanCode (scancode8) 12 59.72 74.49 1 8.33
16253. solsol (scakes) 12 72.18 83.36 2 16.67
16254. Sam (sbush) 12 57.09 69.86 1 8.33
16255. Sausage (sausage_person) 12 77.39 89.43 3 25.00
16256. Saruwatori (saruwatori) 12 81.49 87.18 4 33.33
16257. sara (saramcr) 12 44.16 49.02 0 0.00
16258. Indic (sanatanify) 12 73.33 81.29 4 33.33
16259. Sajal (sajald77) 12 79.65 92.69 1 8.33
16260. sacresful (sacresful) 12 86.21 94.95 3 25.00
16261. btst (sabelle_) 12 129.72 145.29 5 41.67
16262. sıןʌɥɹ (s1lvhr) 12 88.52 95.56 3 25.00
16263. Vali (ryuzul) 12 100.03 129.08 9 75.00
16264. Jeremy (ryusaki626) 12 80.28 93.91 7 58.33
16265. Rudra (ryder_on_the_storm) 12 96.72 112.66 9 75.00
16266. R (ry20) 12 93.30 101.85 7 58.33
16267. Run (runring) 12 63.51 74.68 3 25.00
16268. runnamok (runnamok) 12 61.28 67.08 5 41.67
16269. Ralph (rotifer_) 12 47.40 65.63 2 16.67
16270. Shamsuddin (rony0092) 12 43.88 49.68 1 8.33
16271. Tí cần không bạn (ron... 12 59.27 74.33 2 16.67
16272. Hi (rom_s) 12 56.47 64.92 1 8.33
16273. Sergi (rolodophone) 12 74.01 86.62 4 33.33
16274. Jem (rollingapple) 12 101.51 123.10 8 66.67
16275. Rokuazery (rokuazery) 12 83.90 92.04 2 16.67
16276. Rohan (rohan625) 12 54.45 63.51 0 0.00
16277. Julian (rocky_succ) 12 82.66 94.01 2 16.67
16278. robby (robby27) 12 71.86 82.56 4 33.33
16279. Arminda (rmnduhh) 12 93.04 109.23 5 41.67
16280. Jim (rl_magikz) 12 55.28 68.01 4 33.33
16281. John (rlawldjs) 12 64.96 72.23 2 16.67
16282. Ritam (ritam_123) 12 79.23 87.23 6 50.00
16283. Rikos99 (rikos_omegalul) 12 68.44 80.83 4 33.33
16284. e (revengepug) 12 102.07 123.96 8 66.67
16285. George (relaxed_20) 12 58.75 69.93 1 8.33
16286. gabe (rasalguhl) 12 99.53 106.76 2 16.67
16287. Yokaii (rartiko) 12 63.10 75.81 0 0.00
16288. Caio (raposo) 12 62.19 70.93 3 25.00
16289. Alex (ramini0000) 12 62.71 68.95 2 16.67
16290. Grant (ragecandybar) 12 86.97 102.86 5 41.67
16291. aerar (raale) 12 82.18 102.49 5 41.67
16292. Attican (r4ne) 12 76.82 86.53 2 16.67
16293. rocky (r0ckyy) 12 61.53 71.32 1 8.33
16294. Desh (quickzero) 12 106.92 121.52 3 25.00
16295. julian (quasiker) 12 84.08 104.05 4 33.33
16296. punj (punj) 12 76.80 87.62 2 16.67
16297. cockn (pugzip) 12 59.59 71.73 4 33.33
16298. oleg (prot64) 12 76.76 92.01 3 25.00
16299. Pratham (pratham522) 12 43.90 49.01 1 8.33
16300. gb (practicegb) 12 92.37 110.48 4 33.33
16301. Prabhu (prabhusengal) 12 85.06 97.14 4 33.33
16302. Param (pparam5241) 12 77.95 89.41 6 50.00
16303. posaidon (posaidon0802) 12 86.34 97.37 4 33.33
16304. poparaliais (poparaliais) 12 80.15 95.19 4 33.33
16305. Jared (pizzj) 12 74.63 85.20 3 25.00
16306. pizzapablo (pizzapablo) 12 71.87 82.45 12 100.00
16307. Pine (pinechristmas) 12 68.57 79.11 4 33.33
16308. pigeon (pigeon_kun) 12 90.08 108.60 2 16.67
16309. Phobic (phobic21) 12 65.71 81.82 7 58.33
16310. Duy (phamanhduy1990) 12 72.38 80.25 0 0.00
16311. petnob (petnob1987) 12 57.65 65.15 2 16.67
16312. Vicky (person4115) 12 99.10 122.86 2 16.67
16313. Andrew (penguingm1) 12 114.55 129.62 8 66.67
16314. Pika (paxn) 12 89.83 104.69 4 33.33
16315. PAW (paw_sensei) 12 62.53 71.78 2 16.67
16316. Paulian (paulian7) 12 90.39 117.59 2 16.67
16317. Arttu (patu556) 12 57.07 63.03 0 0.00
16318. Parag (paranolverizer) 12 50.82 61.17 4 33.33
16319. Dejan (paranoid112122) 12 44.78 52.58 2 16.67
16320. Pan con Palta (panconpalta123) 12 70.42 91.34 2 16.67
16321. Padwes (padz_kurawa) 12 79.39 96.53 5 41.67
16322. Owen (owentemp) 12 40.26 50.02 1 8.33
16323. Osso (ossobuko) 12 61.42 66.17 2 16.67
16324. HM (opwpahfohuaehiodbfaiwvb... 12 67.15 76.08 2 16.67
16325. omnomnomnom (omnomnomnomnom... 12 68.97 79.26 3 25.00
16326. Omar (omar_letaief) 12 81.85 92.54 2 16.67
16327. Nathan (oliblish) 12 82.42 100.42 1 8.33
16328. twin (oiaao) 12 55.65 63.02 2 16.67
16329. prince (ohnoheisgoodxd) 12 78.09 87.80 12 100.00
16330. ochko (ochkofficial) 12 72.45 85.87 6 50.00
16331. Pepper (ocean_orca) 12 51.35 56.35 2 16.67
16332. VietCoffee (nytrogen99) 12 117.63 134.00 10 83.33
16333. Nyle (nyle_14) 12 80.47 87.87 4 33.33
16334. Nghia (ntn20112006) 12 87.16 102.93 3 25.00
16335. spoon (noyoureaspoon) 12 88.43 101.69 5 41.67
16336. not a typerace account (not... 12 49.01 59.35 4 33.33
16337. Aaron (noobschizz) 12 64.73 72.41 2 16.67
16338. Andrew (noobhunter) 12 124.72 143.32 4 33.33
16339. Nicholas (nkaechele) 12 80.21 89.26 3 25.00
16340. ninguart (ninguart) 12 102.79 126.68 6 50.00
16341. Much (nikitin) 12 86.27 92.06 4 33.33
16342. Liema (nidoc) 12 77.07 86.73 12 100.00
16343. Nick (nickjj) 12 66.59 83.92 3 25.00
16344. Van (nickislit14) 12 77.99 87.63 7 58.33
16345. Niaz (niaztypist) 12 36.34 43.80 0 0.00
16346. Phuc (nholoinhoi) 12 85.42 97.66 5 41.67
16347. Qwerty (nhaye23) 12 58.55 69.03 0 0.00
16348. wen (neverwen) 12 96.38 116.49 5 41.67
16349. Serena (nerdyjoker) 12 108.08 122.70 6 50.00
16350. Neil (neilprime16) 12 84.25 106.10 4 33.33
16351. Vickus (natowns24) 12 81.22 96.81 3 25.00
16352. Nils Backman (naip12) 12 63.54 87.15 4 33.33
16353. Krombaa (nadergharsallah) 12 54.67 64.51 4 33.33
16354. Midhun (mythicalun) 12 112.51 132.93 8 66.67
16355. Blake (mysticz8) 12 59.78 71.07 2 16.67
16356. Mike (mybroom10) 12 85.86 112.61 3 25.00
16357. Rohit (murphy053) 12 64.21 71.45 0 0.00
16358. Mason (mtyperxd) 12 66.84 79.98 5 41.67
16359. Slowpez (mr_slowpez) 12 98.31 110.93 1 8.33
16360. barrack (mr_sandwich1871) 12 105.97 128.25 6 50.00
16361. Marc (mrthegreattypist) 12 55.62 64.08 1 8.33
16362. lhagvaag0d (mr4thousands_) 12 36.67 44.30 5 41.67
16363. Anton (mountainhills) 12 77.38 96.28 2 16.67
16364. austin (monkey648) 12 103.11 119.17 5 41.67
16365. Moniba (moniba) 12 52.39 58.81 0 0.00
16366. mohamed (mohamed_rekaya) 12 57.85 75.60 2 16.67
16367. Steven (misterpear) 12 117.04 128.88 4 33.33
16368. migueles (miqriba) 12 61.78 69.03 3 25.00
16369. Peter (minend) 12 104.07 127.43 9 75.00
16370. jhon (millkman) 12 35.21 40.15 1 8.33
16371. mildlyaggressivecherry (mil... 12 101.87 112.28 6 50.00
16372. Mike (mikystevan) 12 81.37 91.93 3 25.00
16373. Mike (mike6) 12 54.16 64.34 0 0.00
16374. Mikayla (mikaylahumphrey) 12 107.79 128.47 6 50.00
16375. Micah (micahnical) 12 82.19 107.52 1 8.33
16376. Nikolaj (mexination) 12 52.88 65.16 0 0.00
16377. Mexero (mexero) 12 37.40 41.43 1 8.33
16378. Prakhar (menate) 12 64.49 81.58 4 33.33
16379. Melo (melolem) 12 67.48 75.52 4 33.33
16380. bokonet (mehrshadk05) 12 66.23 74.85 7 58.33
16381. platnot (mega2053) 12 86.92 103.35 8 66.67
16382. Mbenga (mbenga) 12 80.01 100.05 2 16.67
16383. Sofia (mayi_o4) 12 70.49 87.51 7 58.33
16384. Julian (mataleao) 12 64.98 71.78 2 16.67
16385. patrick (mastercraft33) 12 58.01 67.78 3 25.00
16386. Magister (masterbert02) 12 60.39 66.97 6 50.00
16387. Perestoronina (mashavtnke) 12 54.17 65.45 1 8.33
16388. Martin (martin_juan) 12 75.41 85.51 3 25.00
16389. Martin (martinthebest) 12 103.41 121.64 6 50.00
16390. Kayla (martina1155) 12 30.41 36.54 1 8.33
16391. Marie (marsiepatootie) 12 77.96 99.61 4 33.33
16392. TyperRacer (marccraft) 12 86.73 100.84 3 25.00
16393. Manraj (man_123lama) 12 78.18 90.53 3 25.00
16394. Manish (manishspot) 12 56.44 62.18 2 16.67
16395. Manguy McPersonface (manguy... 12 66.43 79.78 3 25.00
16396. Friz64 (friz64) 12 78.36 95.91 0 0.00
16397. FrankSauve (franksauve) 12 67.65 80.68 4 33.33
16398. Foxrumor (foxrumor) 12 67.18 81.98 5 41.67
16399. Joel (fonke) 12 80.04 100.64 4 33.33
16400. Matt (flamingbear) 12 79.98 89.80 7 58.33
16401. Filip (filipge) 12 47.53 54.71 1 8.33
16402. Finch (ficxjo) 12 117.93 146.31 6 50.00
16403. fetix (feticks) 12 93.82 121.63 2 16.67
16404. Hien (feederchuluc96) 12 50.59 58.26 1 8.33
16405. Fangxing (fangoling) 12 56.85 64.79 3 25.00
16406. A (fancy_potato) 12 61.59 85.97 3 25.00
16407. Fabian (fabiangomez) 12 94.60 100.93 4 33.33
16408. etienne (etiennne) 12 113.02 122.45 6 50.00
16409. Ethan (ethantai) 12 110.88 125.60 8 66.67
16410. Robert (ert00034) 12 114.90 128.85 4 33.33
16411. Eric (ericplayz132) 12 122.99 133.87 7 58.33
16412. Elvar (elvar333) 12 71.39 89.57 2 16.67
16413. Mohamed (elhedeq) 12 35.60 38.65 0 0.00
16414. Cristian (electpit) 12 57.95 65.71 0 0.00
16415. Ekshore (ekshore) 12 75.81 92.10 3 25.00
16416. Faquarl (ekrpat) 12 93.98 111.49 6 50.00
16417. Eichi (eichitenshouin) 12 100.26 120.58 5 41.67
16418. Egyptian (egyptianlion) 12 105.79 114.46 7 58.33
16419. Zac (eastunder) 12 70.03 90.83 7 58.33
16420. dylan (dywan) 12 85.80 98.00 5 41.67
16421. Daniel (dxnielz) 12 94.70 109.15 12 100.00
16422. David (dwang05) 12 102.53 117.43 4 33.33
16423. Durga (durga32670) 12 47.57 56.48 2 16.67
16424. Adrianus (dungonmahshoe) 12 93.93 116.48 4 33.33
16425. duncs (duncs) 12 89.21 103.95 9 75.00
16426. Duke (dukemagnum) 12 80.68 94.56 1 8.33
16427. D (ducktypist) 12 104.02 116.06 5 41.67
16428. Insub (dskumpf) 12 99.00 110.10 7 58.33
16429. Ariel (drofniarg) 12 101.03 120.51 7 58.33
16430. D1eg8 (drm86) 12 74.85 86.61 5 41.67
16431. Dennis (doxalite) 12 61.95 80.44 4 33.33
16432. Ian (doughs) 12 102.48 125.26 5 41.67
16433. Doug (dougdimmadan) 12 102.07 114.00 6 50.00
16434. DosU (dosu) 12 40.23 44.69 0 0.00
16435. Kevin (dostoyevksy) 12 28.83 36.73 3 25.00
16436. Dodi (dodic) 12 100.89 108.01 5 41.67
16437. David (djtm) 12 70.48 76.98 4 33.33
16438. Dexter (dextergamer) 12 61.71 68.56 4 33.33
16439. something (destroyer27777) 12 81.05 92.11 1 8.33
16440. Deron (deron_09) 12 48.17 66.68 3 25.00
16441. Derek (derekyeh) 12 44.24 53.35 0 0.00
16442. denzel (dennzzz) 12 73.39 79.80 2 16.67
16443. DenDu (dendu_respekt) 12 50.81 61.92 6 50.00
16444. deej (deej195) 12 86.26 96.76 1 8.33
16445. Declan (dec13) 12 52.64 61.24 6 50.00
16446. not_that (darkmaster_30) 12 71.51 82.43 7 58.33
16447. Daniel (danoco) 12 46.37 53.78 0 0.00
16448. dankerkys (dankerkys) 12 59.02 79.64 7 58.33
16449. Dani (danivideda) 12 74.27 91.47 4 33.33
16450. Daniel (dalord) 12 61.61 70.51 2 16.67
16451. Dakize (dakice) 12 90.18 102.49 5 41.67
16452. daebro (daebro) 12 80.87 95.02 6 50.00
16453. CybrZero (cybrzero) 12 53.43 65.98 2 16.67
16454. Curtis (curtisz) 12 85.90 97.64 3 25.00
16455. Zxar (cubercubed) 12 72.37 82.10 4 33.33
16456. Nico (cuber) 12 117.67 148.73 4 33.33
16457. JP (cryoblivious) 12 83.90 97.12 5 41.67
16458. Crescendo (crescendot) 12 97.38 115.50 6 50.00
16459. CrazyhourXD (crazyhourxd) 12 72.11 79.77 3 25.00
16460. gaoshan (crazydonkehhhhh) 12 77.15 92.17 3 25.00
16461. Crafty (craftywastaken) 12 92.45 113.34 6 50.00
16462. aziz (cornea) 12 50.33 55.42 1 8.33
16463. Bean (cornbreadman) 12 81.02 106.92 9 75.00
16464. Eric (cool_armadillo) 12 85.35 100.25 5 41.67
16465. Tyson (cooldude1800) 12 68.23 76.51 4 33.33
16466. Val (codehacker707) 12 98.69 113.89 6 50.00
16467. clout (clouted) 12 80.25 97.03 3 25.00
16468. Clarissa (clarissaclaa) 12 68.30 75.16 1 8.33
16469. Citizen404 (citizen404) 12 89.07 97.79 6 50.00
16470. StickInMyButt (chungi) 12 104.01 116.08 5 41.67
16471. CHRISTIAN (chris7ka) 12 87.65 107.84 4 33.33
16472. choppery (choppery) 12 74.00 82.39 3 25.00
16473. Chipper (chipperdiglett) 12 79.61 91.71 7 58.33
16474. chino (chino69) 12 68.44 77.35 3 25.00
16475. ching (chingchongchangchink) 12 63.87 85.01 1 8.33
16476. Danh (chetdanh) 12 97.51 112.73 2 16.67
16477. 50wpm (chengyangz) 12 83.16 89.65 2 16.67
16478. Sangga (chemicalchaos291) 12 67.91 77.48 2 16.67
16479. chasing (chasingfastpoker9995) 12 103.74 120.10 2 16.67
16480. ChaosNuggets (chaosnuggets) 12 97.81 114.68 3 25.00
16481. chanon (chanonlatt) 12 50.48 54.81 3 25.00
16482. cathy (cathyyyyy) 12 54.37 63.02 1 8.33
16483. Carson (carson_a_r) 12 65.70 74.98 7 58.33
16484. William (caraxd) 12 105.53 118.93 6 50.00
16485. captain357 (captaincool357) 12 88.26 111.57 7 58.33
16486. Candace (candacefumeh) 12 39.52 45.60 10 83.33
16487. CALICO (calllicco) 12 111.85 129.29 5 41.67
16488. Cactus (cactus_jones) 12 95.16 106.08 8 66.67
16489. Connor (c42855) 12 87.61 101.10 4 33.33
16490. Bumsu (bumsu) 12 62.03 74.68 3 25.00
16491. Joshua (brothersquid123) 12 84.81 100.59 2 16.67
16492. Bob (bromanswagboy) 12 92.95 118.20 3 25.00
16493. cuki 🍪 (brewlux) 12 107.02 120.42 6 50.00
16494. Rafael (brafs165) 12 63.60 74.44 3 25.00
16495. Anthony (boxa) 12 74.82 87.84 6 50.00
16496. allie (bokutobro) 12 69.92 85.31 3 25.00
16497. tstats[bobfish] (bobfish) 12 32.84 48.64 0 0.00
16498. Narwal (bnarwal) 12 50.22 66.76 4 33.33
16499. BlueTrip (bluetrip) 12 107.94 126.38 8 66.67
16500. Bluefire (bluefire828) 12 95.75 107.40 5 41.67
16501. Sujay (bluebeetle) 12 58.27 66.64 1 8.33
16502. ok (biscuitalex) 12 95.87 114.40 4 33.33
16503. ol (billturbo) 12 82.29 97.99 6 50.00
16504. Chris (bigzaddy) 12 78.39 96.94 0 0.00
16505. cameron (bigmoon) 12 28.91 38.12 3 25.00
16506. mrbasts10000dollarrefrigera... 12 99.54 111.08 5 41.67
16507. Gabor (bgabor) 12 79.39 90.01 5 41.67
16508. Berny (bernyboi) 12 73.81 79.65 3 25.00
16509. Dennis (bejdenn) 12 65.86 78.17 3 25.00
16510. Bayu (bayufajariyanto) 12 50.86 60.25 1 8.33
16511. Rizky (battle_hooks12) 12 82.02 98.34 6 50.00
16512. Balloon (balloon75) 12 47.57 55.91 2 16.67
16513. Ben (bakchansoo) 12 77.53 100.28 5 41.67
16514. Aziron (aziron) 12 122.91 135.91 4 33.33
16515. azhi (azhi_i) 12 28.89 32.84 1 8.33
16516. Avy (avygorg) 12 34.69 47.45 0 0.00
16517. George (ausp1c1ous) 12 93.84 103.92 3 25.00
16518. AUpSideDownCup (aupsidedown... 12 54.88 63.74 7 58.33
16519. AtticusB (atticusb) 12 85.46 98.34 3 25.00
16520. Accuracy (attempts_at_accur... 12 84.13 94.08 6 50.00
16521. Brian (atrospecter) 12 94.69 115.15 6 50.00
16522. ashtunu (ashtunu) 12 64.43 72.57 5 41.67
16523. Ashraya (ashrayas) 12 59.74 68.86 2 16.67
16524. Ashish (ashishpatel0720) 12 69.53 84.02 4 33.33
16525. ASHISH YADAV (ashish001) 12 28.68 32.92 0 0.00
16526. Sherzod (asdfgh5889) 12 79.57 104.19 6 50.00
16527. Fromitz (fromitz) 11 94.25 111.14 1 9.09
16528. Wilson (friwilly) 11 72.60 85.46 3 27.27
16529. Frat (fratios) 11 113.67 139.61 6 54.55
16530. Lank (franklank) 11 76.14 84.40 1 9.09
16531. Forsegle (forsegle) 11 54.41 59.54 3 27.27
16532. Pog (fooooood) 11 105.56 136.14 6 54.55
16533. Cody (foggen) 11 95.64 113.96 5 45.45
16534. Michal (fly_you_fools) 11 75.15 85.18 6 54.55
16535. Marky (flytower69) 11 118.65 140.41 9 81.82
16536. Benson (flowery_robot) 11 71.83 88.55 6 54.55
16537. hi (florzie_101) 11 73.52 91.20 4 36.36
16538. floffy (floffyunicorn) 11 100.18 116.69 4 36.36
16539. saar (flappy_dude) 11 66.08 79.26 1 9.09
16540. NotFlame (flameon0703) 11 60.21 65.97 1 9.09
16541. Michael (fkafkaneko) 11 80.11 99.04 4 36.36
16542. Rishabh (fire_tornado3) 11 72.34 80.86 2 18.18
16543. Ferresmash (ferdinandohrn) 11 65.85 81.88 5 45.45
16544. Sasan (farnasirim) 11 107.13 120.43 7 63.64
16545. tuan (fajerso) 11 78.85 97.62 1 9.09
16546. Faded (fadedcrown95) 11 54.00 65.66 3 27.27
16547. Faded7 (faded7) 11 85.11 98.58 3 27.27
16548. Fabrizio (fab_) 11 81.01 99.69 4 36.36
16549. Grant (eyz11327) 11 108.02 116.83 6 54.55
16550. Evan (eyatri) 11 91.43 101.15 4 36.36
16551. sudden (explosionsarenice) 11 75.65 87.12 3 27.27
16552. Pepeg (evolvingpepeg) 11 101.79 123.42 6 54.55
16553. Steeferino (evlpacman) 11 113.55 136.51 7 63.64
16554. Evan250250 (evan250250) 11 97.51 130.91 3 27.27
16555. Eugene (eugene1) 11 73.53 93.31 4 36.36
16556. Roland (errur) 11 90.53 110.90 4 36.36
16557. Champion (error404_winner) 11 59.86 69.21 2 18.18
16558. Not Fast (ernmanke) 11 65.16 71.85 4 36.36
16559. Erim (erimmos) 11 65.49 72.94 6 54.55
16560. Eric (eric_05) 11 76.73 88.25 6 54.55
16561. Alex (equidorian) 11 110.30 116.86 5 45.45
16562. a (eqnzio) 11 100.53 115.31 5 45.45
16563. Eoghan (eoghanshox420) 11 56.81 63.23 3 27.27
16564. emon (emonemoemo) 11 107.96 125.57 3 27.27
16565. Liam (emissions) 11 110.28 136.40 7 63.64
16566. elnino (elnio2803) 11 87.29 104.24 2 18.18
16567. Elibay (elibay98) 11 72.91 79.15 5 45.45
16568. Electro (electrotech17) 11 58.24 67.01 2 18.18
16569. victor (einzu) 11 46.44 56.55 0 0.00
16570. asdfhuiosdfgshiodfhji (efrd... 11 116.06 131.87 10 90.91
16571. eenterr (eenterr) 11 81.27 88.20 2 18.18
16572. Bob (echonex) 11 74.98 85.88 6 54.55
16573. Dekaj (d_kaj) 11 69.73 82.56 11 100.00
16574. dtn (dvdn) 11 106.28 117.93 6 54.55
16575. Davi (dusk_09) 11 137.41 152.87 7 63.64
16576. Daulet (dtk6) 11 48.86 62.58 4 36.36
16577. dsa8 (dsa8) 11 91.00 98.21 2 18.18
16578. Máté (drunkendegroot) 11 84.25 93.99 4 36.36
16579. Hugh (drhugh) 11 68.16 77.81 3 27.27
16580. drew (drewthejedi) 11 75.95 82.44 4 36.36
16581. ha (drchill) 11 90.64 103.58 1 9.09
16582. Deric Lewis (dragon760) 11 24.40 36.49 3 27.27
16583. Jan (draggonnfs) 11 81.42 97.90 2 18.18
16584. Shrig (dracon7260) 11 101.73 116.98 4 36.36
16585. dorj (dorjoo) 11 64.42 76.18 2 18.18
16586. doremy (doremypuyotet) 11 152.03 180.08 9 81.82
16587. dom (domxrare) 11 57.61 68.66 2 18.18
16588. Carl (doctorkohaku) 11 104.75 118.50 4 36.36
16589. ttvdivertingwhale (divertin... 11 116.18 137.66 10 90.91
16590. Dio (dio_b_) 11 73.13 81.35 11 100.00
16591. Diogo (diogosilva) 11 45.58 51.08 1 9.09
16592. Benedikt (dikt73) 11 79.04 93.16 6 54.55
16593. Dennis (dheitinga) 11 78.38 91.00 7 63.64
16594. Dev (devparkk) 11 63.25 73.30 4 36.36
16595. devendra (devendra303) 11 36.48 48.45 0 0.00
16596. Derhein (derhein24) 11 51.97 68.52 2 18.18
16597. Yoshimitsu (deep_impact) 11 64.62 71.69 3 27.27
16598. Deathwish (death_wish) 11 86.53 94.15 2 18.18
16599. Ahmed (dd3x) 11 69.70 78.90 1 9.09
16600. Aman Daudung (daudung_5) 11 43.02 47.92 1 9.09
16601. Anthony (daslayer05) 11 73.30 81.53 2 18.18
16602. Poop (danukas155) 11 91.30 115.60 4 36.36
16603. Daniel (danucu22) 11 37.10 52.04 2 18.18
16604. Salzpanik (daniely1160) 11 86.00 132.61 5 45.45
16605. Spavid (dadkos34) 11 81.34 115.73 7 63.64
16606. Jay (cyber_ace) 11 50.30 58.69 1 9.09
16607. Cris (ctietsort) 11 107.86 121.79 4 36.36
16608. albert (csnake) 11 99.79 106.64 5 45.45
16609. csgo (csaddict) 11 61.71 73.47 1 9.09
16610. Charlie (crystal_gamer) 11 67.12 75.96 3 27.27
16611. Vincent (cruhm) 11 98.49 131.80 3 27.27
16612. HKER (crafting112) 11 99.43 115.91 3 27.27
16613. CPawx (cpawx) 11 102.32 118.71 2 18.18
16614. Cow (cowscantype) 11 103.44 113.26 4 36.36
16615. Hugo (cortexior) 11 75.95 82.43 3 27.27
16616. Jose (cornjose877) 11 82.48 97.85 2 18.18
16617. CoolMan14 (coolman14) 11 71.27 83.27 8 72.73
16618. Converto (converto) 11 69.20 78.99 3 27.27
16619. ocean man (clickbaitt) 11 89.41 97.74 2 18.18
16620. ㅤ (clarified) 11 131.02 145.38 4 36.36
16621. lord (cintrixity) 11 83.95 97.12 7 63.64
16622. clicky (cinadeeye) 11 114.69 129.14 6 54.55
16623. Christian (christianwells) 11 72.56 85.43 4 36.36
16624. Hyx (christianmoises) 11 88.19 96.78 0 0.00
16625. Luis (chiklay) 11 100.08 123.09 1 9.09
16626. Jason (cherryitbruhnarutojizz) 11 103.38 117.90 4 36.36
16627. Nurbek (cheburekkek) 11 62.87 72.12 2 18.18
16628. Sahil (chazos) 11 46.44 51.71 3 27.27
16629. Wei (charles2007) 11 79.79 94.12 10 90.91
16630. Vei (cengi) 11 97.79 123.29 5 45.45
16631. Cel (celad0n) 11 104.50 118.85 5 45.45
16632. *** (ccccalvinn) 11 73.38 89.03 2 18.18
16633. Carlos (carloshdelreal) 11 55.42 62.57 1 9.09
16634. Cameron (camma) 11 69.10 82.30 1 9.09
16635. c4th0d3 (c4th0d3) 11 97.98 121.30 2 18.18
16636. Heriberto (c4rt4sbarajas) 11 54.12 68.73 2 18.18
16637. Marcus (byteeater) 11 93.96 107.39 7 63.64
16638. ByamB4 (byamb4) 11 81.91 95.61 6 54.55
16639. Benjamin (bxrivx) 11 106.33 125.89 2 18.18
16640. mikey (buzzpmikey) 11 101.24 123.45 7 63.64
16641. Andrew (buttmann64) 11 102.89 126.59 6 54.55
16642. bunkered (bunkeredgame) 11 90.83 109.38 6 54.55
16643. Nicholas (bsg8) 11 55.83 65.16 2 18.18
16644. Bryce (bryce_verberne) 11 76.86 93.82 7 63.64
16645. Marko (bru_) 11 63.90 72.94 1 9.09
16646. Brian (briannstiven) 11 51.77 55.70 5 45.45
16647. brady (bradyone) 11 79.20 92.22 2 18.18
16648. Bradley (bradley_brown) 11 94.94 105.48 1 9.09
16649. Hannah (bored_hannah) 11 53.18 63.25 1 9.09
16650. Not as fast as Reckful (bol... 11 93.92 104.09 6 54.55
16651. bob (bobobb) 11 142.93 169.74 10 90.91
16652. m (bluesiren) 11 96.41 120.45 5 45.45
16653. Richard (blitzd2020) 11 91.19 100.04 3 27.27
16654. Bucecean (blaskowiscz) 11 144.46 189.80 7 63.64
16655. Black (black_pineapple) 11 64.98 76.86 3 27.27
16656. bitte (bitteschnell) 11 85.40 106.22 8 72.73
16657. bishwash (bishwash_patel) 11 42.02 62.78 2 18.18
16658. Bishwash (bishwashadhikari) 11 58.92 75.13 3 27.27
16659. bill (bill_hunt22) 11 29.01 32.41 0 0.00
16660. Brian (bgan) 11 93.49 100.79 6 54.55
16661. Musharaf (benthorzm) 11 86.39 100.82 3 27.27
16662. Ben (bendoman_) 11 107.93 119.29 6 54.55
16663. Borky (beckysingasong) 11 104.20 122.71 6 54.55
16664. Grayson (beanbagman) 11 57.67 70.21 8 72.73
16665. Bdog (bdogblue) 11 50.90 56.78 2 18.18
16666. Batuhan (batuhan_tbb) 11 61.24 74.25 4 36.36
16667. voidtab (battini) 11 68.17 74.50 3 27.27
16668. Bogdan (bartfast42) 11 46.30 51.02 1 9.09
16669. Bartek (barteker19) 11 69.79 80.29 1 9.09
16670. brendan (barnold2) 11 97.31 114.78 4 36.36
16671. li (badplayer970) 11 97.71 118.29 4 36.36
16672. Kyle (badadc) 11 92.70 112.81 5 45.45
16673. Baby (babyfacedassassin) 11 79.15 97.84 1 9.09
16674. Bryan (b27i5n) 11 111.95 129.52 5 45.45
16675. Nany (a_nany) 11 43.09 48.62 1 9.09
16676. ayy (ayy_cocotype17) 11 56.44 69.27 10 90.91
16677. Caleb (awsumbabysnarl) 11 86.55 100.30 2 18.18
16678. Avlotis (avlotis) 11 106.81 114.95 4 36.36
16679. Turbo (avash101) 11 64.56 75.66 1 9.09
16680. Auiyin (auiyin) 11 89.27 99.72 6 54.55
16681. choi (ateezofficial) 11 71.82 83.52 2 18.18
16682. Ahmad (asz13) 11 99.75 109.87 5 45.45
16683. AC (astralcalamity) 11 96.24 107.48 3 27.27
16684. Panagiotis (asifo) 11 47.14 59.28 0 0.00
16685. Living (asianliving) 11 92.14 100.35 2 18.18
16686. Thuan (asianboiii) 11 61.00 81.28 0 0.00
16687. Ashiquzzaman (ashiquzzaman33) 11 70.98 78.21 1 9.09
16688. Buster (artistinthehoodie) 11 48.78 61.22 0 0.00
16689. Artur (arthurisit) 11 86.23 100.30 4 36.36
16690. Adam (armorcle) 11 108.97 122.99 7 63.64
16691. Tonkata (_tonkata_) 11 53.24 63.97 2 18.18
16692. bruh (_sidnair2003_) 11 107.38 130.59 11 100.00
16693. guitrstrngscr (_resh_) 11 66.09 80.60 2 18.18
16694. Pendi (_pendi) 11 120.63 131.72 8 72.73
16695. Daniela (_noodleynoodles_) 11 114.29 131.76 6 54.55
16696. Nilesh (_nex_) 11 76.47 85.69 1 9.09
16697. Mick (_mickey_) 11 69.76 83.82 1 9.09
16698. Jeff (_jeff_) 11 54.02 59.42 1 9.09
16699. MrClumzzy (zxgod) 11 68.80 85.94 4 36.36
16700. Josh (zumoariri) 11 59.00 67.80 2 18.18
16701. Ronnie (zoroaki) 11 51.24 70.59 2 18.18
16702. Zuja (zoojah) 11 95.21 108.76 5 45.45
16703. Zmiester0828 (zmeister0828) 11 76.96 100.75 3 27.27
16704. zoey (zjskating) 11 72.61 83.33 3 27.27
16705. jorje (zhonti) 11 51.97 67.79 4 36.36
16706. ZapSlow (zapadobo) 11 102.26 123.97 5 45.45
16707. tstats[zanies07] (zanies07) 11 48.29 52.62 2 18.18
16708. Jonathan (z33nine) 11 49.12 54.47 0 0.00
16709. lixiang (yuan_yuan) 11 97.55 107.85 5 45.45
16710. yuan (yuanyangty) 11 111.08 122.62 4 36.36
16711. R. (yeetertheskeeter) 11 113.49 146.91 1 9.09
16712. YeetedOrca (yeetedorca) 11 66.87 78.91 1 9.09
16713. Zalvy (ydnav) 11 97.09 116.23 4 36.36
16714. Husain (yahyahusain) 11 87.22 102.47 9 81.82
16715. Dan (x_danma) 11 70.87 82.87 2 18.18
16716. XXRobzz (xxr0bzz) 11 80.51 91.83 5 45.45
16717. OOF (xpinoyx) 11 98.29 111.55 4 36.36
16718. Gunn (xg88) 11 90.34 129.16 7 63.64
16719. Kyle (xdestroyer83) 11 88.98 99.67 4 36.36
16720. Alex (xanfan01) 11 117.46 133.76 7 63.64
16721. oTk (wulongi) 11 86.68 103.71 6 54.55
16722. Khaled (wtcherr) 11 54.03 58.00 0 0.00
16723. wowzaa (wowzaa1) 11 70.57 85.53 1 9.09
16724. kellogg's (wnluqmnn) 11 87.78 109.92 4 36.36
16725. lee (wndnjs4389) 11 59.47 71.56 2 18.18
16726. wlitchw (wlitchw) 11 52.59 63.68 3 27.27
16727. Will (윌) (willwang) 11 91.93 104.42 4 36.36
16728. william (williamivandy) 11 79.62 91.90 2 18.18
16729. wigglyworm (wigglyworm) 11 75.04 92.04 2 18.18
16730. whynottt (whynottt) 11 74.84 98.81 4 36.36
16731. Tray (whitefalcon684) 11 88.29 102.25 3 27.27
16732. WhaleVomit (whalevomit) 11 123.29 129.60 9 81.82
16733. Hoang (wertyboy) 11 91.84 103.24 6 54.55
16734. weidel (weidel) 11 58.41 70.42 1 9.09
16735. jasmin (wawfles) 11 81.25 93.03 3 27.27
16736. wango (wango) 11 94.11 119.47 7 63.64
16737. Walden (walnutwaldo20) 11 75.81 122.35 3 27.27
16738. Wakeel (wakeel_ahmed) 11 36.68 45.52 1 9.09
16739. wael (wael2) 11 58.65 67.80 1 9.09
16740. Chalach (waddee) 11 89.12 103.93 1 9.09
16741. Omar (v_omar11) 11 88.49 94.30 2 18.18
16742. Ayesha (vogue212) 11 83.73 93.65 2 18.18
16743. Visa (visatron) 11 91.63 119.18 4 36.36
16744. Aashrya (virtualvector) 11 85.97 101.12 10 90.91
16745. Vihaan (vilecn2609) 11 20.52 24.16 10 90.91
16746. V (viktiro) 11 109.72 132.25 8 72.73
16747. Gravity (vgravity) 11 74.46 86.75 0 0.00
16748. Ritika Garg (ve_ronica) 11 40.07 44.80 1 9.09
16749. Vanu (vanu88) 11 56.99 68.98 2 18.18
16750. Sonia (vannvilla) 11 97.03 106.55 8 72.73
16751. Dard (vaderking) 11 69.34 79.72 11 100.00
16752. Vadacurry (vadacurry) 11 74.53 86.71 3 27.27
16753. v1ruso (v1ruso) 11 101.70 110.57 7 63.64
16754. ivᅠonᅠutube (unreaii) 11 117.70 135.11 7 63.64
16755. unowildcard (unowildcard) 11 101.41 112.47 6 54.55
16756. Trevor (uneasythrower24) 11 59.88 65.69 1 9.09
16757. Mythical (ultrabow) 11 73.84 88.39 2 18.18
16758. Tzo (tzoatplay) 11 59.94 66.31 2 18.18
16759. Tys0100 (tys0100) 11 67.58 74.94 0 0.00
16760. matthew (typeredemption) 11 30.09 36.12 3 27.27
16761. Jesse Klaver (typeracernoob... 11 78.39 93.18 4 36.36
16762. typeracer (typeracer550) 11 73.46 82.87 3 27.27
16763. Colin (typeofwhey) 11 87.14 101.16 3 27.27
16764. Miles (txlore) 11 83.65 99.57 6 54.55
16765. turutupa (turutupa) 11 96.07 110.66 6 54.55
16766. Turtley (turtleyjk) 11 89.54 105.84 6 54.55
16767. Tu (tuawesome) 11 81.48 96.84 5 45.45
16768. T (tt147) 11 100.46 113.00 5 45.45
16769. MoDX (trollcannon) 11 84.94 92.93 2 18.18
16770. Thomas (trinitymeister) 11 54.31 64.41 2 18.18
16771. Travis (travis4d) 11 67.83 78.73 5 45.45
16772. T (toompaxd) 11 83.70 92.55 0 0.00
16773. Toast (toastmaster127) 11 85.87 116.65 4 36.36
16774. professor (tm_professor) 11 64.81 72.98 8 72.73
16775. Dinmarc (tmlololol) 11 53.71 62.56 0 0.00
16776. Scaught (tiktoks) 11 91.91 104.11 4 36.36
16777. Asd (thinedes) 11 101.51 132.88 5 45.45
16778. Captn (the_nobody3786) 11 60.38 80.89 2 18.18
16779. The (the_learning_savage) 11 82.21 104.96 2 18.18
16780. Ayush (the_dealer) 11 75.06 89.50 2 18.18
16781. The Try (thetryhardguy01_) 11 57.31 67.01 3 27.27
16782. Undisclosed (thetechnicalfox) 11 108.24 129.67 3 27.27
16783. Ryan (theryanshan) 11 65.87 72.83 1 9.09
16784. Shreshth (thefoxwithanelytra) 11 93.75 100.26 4 36.36
16785. TheFoodMan52 (thefoodman52) 11 90.44 111.04 7 63.64
16786. steelmonkey (thecornhobble) 11 124.84 149.12 3 27.27
16787. THATGUYtm (thatguytm) 11 79.60 96.61 6 54.55
16788. butterfingers (th3panda) 11 82.47 97.20 2 18.18
16789. Tejas (tejasfarera) 11 64.54 74.75 3 27.27
16790. Teerapat (teerapatlaongdee) 11 69.68 85.94 3 27.27
16791. Joseph (techvideomaster) 11 89.02 103.44 4 36.36
16792. Andy (teaestaye) 11 90.09 108.13 3 27.27
16793. Mocha (tdrewek) 11 81.66 90.83 1 9.09
16794. Tasnimul Hasan Rafid (tasni... 11 48.80 56.60 0 0.00
16795. Nishant (tarzanjunior) 11 63.51 73.05 4 36.36
16796. Tarun (tarun_valasa) 11 54.23 71.25 2 18.18
16797. Tarashankar (tarashankar) 11 50.61 59.65 0 0.00
16798. Jay (taragine) 11 98.71 111.63 5 45.45
16799. Owen (taenguar) 11 106.90 124.38 5 45.45
16800. Patrik (tacticalnuke) 11 86.78 103.16 3 27.27
16801. Ben (tabman) 11 92.29 104.67 9 81.82
16802. taylor (taayloor) 11 125.82 140.41 5 45.45
16803. ស៊ីថេ (sythe_net) 11 38.04 47.70 2 18.18
16804. Malik (sweetbubblegum_50) 11 85.23 98.80 2 18.18
16805. Swati (swati0609) 11 53.52 63.87 1 9.09
16806. SuperDucky1875 (superducky1... 11 48.45 58.20 2 18.18
16807. a (suk_) 11 97.04 126.01 8 72.73
16808. Suchit (suchit_reddi) 11 48.62 57.44 3 27.27
16809. Filip (sucicf7) 11 93.69 105.34 1 9.09
16810. steven (styper3030) 11 46.85 60.78 1 9.09
16811. Stuart (sturay) 11 99.55 111.77 6 54.55
16812. flyingcakes (strx_) 11 78.93 93.42 2 18.18
16813. #EndCars (stratmann) 11 96.70 102.56 5 45.45
16814. Storm (stormheezen) 11 56.84 61.01 3 27.27
16815. Hayden (stoptake) 11 79.95 96.38 5 45.45
16816. Dan (stefanstef) 11 99.42 114.15 7 63.64
16817. Rong Liew (springbaron) 11 129.63 141.02 8 72.73
16818. Peter (spinbot) 11 63.77 75.08 3 27.27
16819. Shivam (sorcerer626) 11 89.54 107.50 6 54.55
16820. Sophie (sophie0413) 11 87.65 102.92 2 18.18
16821. Travis (sonicspeed06) 11 64.39 71.09 5 45.45
16822. Prosper Solomon (solomontz) 11 53.03 60.65 2 18.18
16823. bjonk (sojho) 11 121.80 133.00 6 54.55
16824. Zoom Zoom (soccerman12345) 11 106.97 124.28 7 63.64
16825. smmbam (smmbam) 11 79.53 88.35 3 27.27
16826. Tamer (smartlead) 11 36.89 42.45 4 36.36
16827. kek (slongdongbong) 11 62.17 68.98 2 18.18
16828. tim (slipperyreptile) 11 106.67 131.41 9 81.82
16829. Ilias (skysrex) 11 78.45 95.94 5 45.45
16830. Skreemmy (skreemmy) 11 56.22 63.71 2 18.18
16831. Aditya (skaarfacee) 11 54.52 59.44 1 9.09
16832. Tyler (silver_typer) 11 103.01 114.24 5 45.45
16833. busshyzDRill (silvercrow0) 11 50.51 54.85 2 18.18
16834. Anthony (sildreon) 11 81.78 94.05 1 9.09
16835. Suienish (sikoesch) 11 69.14 74.55 2 18.18
16836. Nicola (shougt) 11 61.18 71.48 2 18.18
16837. Sharos (sharos) 11 53.66 60.31 2 18.18
16838. hello (sharkyboy) 11 124.91 134.90 6 54.55
16839. Shark (sharkbeargator) 11 92.17 104.85 3 27.27
16840. Shafiq (shafiq7911) 11 78.21 88.78 1 9.09
16841. Andrew (sertria) 11 93.49 100.08 3 27.27
16842. sergieric (sergieric) 11 58.71 68.94 3 27.27
16843. SjåDæmSjøgølls (seethem... 11 63.76 76.19 2 18.18
16844. SeCre (secre13) 11 72.45 84.37 2 18.18
16845. long bus (sealegs) 11 141.36 154.43 9 81.82
16846. Corrin (scynth) 11 98.60 105.44 4 36.36
16847. Arjuna (arjuna_) 11 84.63 95.21 3 27.27
16848. NewKeyboardDontLaugh (arisk... 11 86.71 102.38 6 54.55
16849. Ariful (ariful_farhad) 11 52.79 59.37 0 0.00
16850. ayu (areyouayu) 11 91.72 107.20 4 36.36
16851. null (apstamp45) 11 58.80 65.36 1 9.09
16852. DC (applespammer) 11 74.80 89.84 0 0.00
16853. Abhinay (apasunuri) 11 86.04 94.80 0 0.00
16854. Anthony (anthony_787) 11 83.99 99.74 1 9.09
16855. Anthony (ant333man) 11 75.33 83.16 3 27.27
16856. anoniman (anoniman_0001) 11 102.18 117.96 1 9.09
16857. Andrewb (andrewbb) 11 89.42 97.02 7 63.64
16858. Leroy (ancientnoodles) 11 78.17 84.74 7 63.64
16859. Ahmet (amutlugun) 11 75.39 83.73 2 18.18
16860. Aman (amanminerulez) 11 67.63 75.29 2 18.18
16861. Bryo (alta1r) 11 47.85 70.23 7 63.64
16862. AJ (alquinso_) 11 87.43 100.61 3 27.27
16863. alisa (alisalmao) 11 76.27 89.83 5 45.45
16864. Alexander (alexanderfzz) 11 69.53 81.17 4 36.36
16865. Alaa (alaaalmasri00) 11 75.38 84.42 3 27.27
16866. Akitolight (akitolight) 11 106.91 113.86 6 54.55
16867. aki (akiiiwashere) 11 79.68 98.76 5 45.45
16868. Gabriel (akgabe) 11 63.76 69.70 4 36.36
16869. Aidan (aidan605) 11 70.64 78.33 2 18.18
16870. Ahmad (ahmad_a_0) 11 86.22 104.28 2 18.18
16871. ahgirl (ahgirl123) 11 74.29 90.03 2 18.18
16872. Aubrey (ahensley) 11 83.32 95.49 1 9.09
16873. Vincent (aetherxd) 11 94.91 115.81 4 36.36
16874. Aedrick (aedrick) 11 69.19 83.49 1 9.09
16875. Advaanture (advaanture) 11 60.17 71.62 2 18.18
16876. (adma) 11 153.99 186.35 11 100.00
16877. Adam (adam1101) 11 79.14 95.26 5 45.45
16878. Marc (ackermanick) 11 67.46 76.19 2 18.18
16879. Ace (aceofcaps) 11 74.37 89.36 2 18.18
16880. Abyo (abyo) 11 60.68 69.98 1 9.09
16881. Mahmudul Hasan🕋🕌 (abo... 11 62.76 76.06 0 0.00
16882. Dominique - Axl (able_04) 11 54.08 61.96 0 0.00
16883. Fyroo (abelkarbel) 11 60.41 68.47 5 45.45
16884. Homieboy (abcjohnabdjohn) 11 48.20 58.06 2 18.18
16885. TTTT (aa7608327) 11 56.64 65.96 3 27.27
16886. Vikas (a4atom) 11 83.98 94.00 3 27.27
16887. Zak (7zephyr) 11 104.30 117.19 6 54.55
16888. yanna (7yanna) 11 115.49 132.08 4 36.36
16889. Random (65h1000) 11 104.57 111.26 5 45.45
16890. Cody (5niffles) 11 87.78 100.34 4 36.36
16891. Pixel (2pixles) 11 61.99 76.25 4 36.36
16892. Liam (2020lhall) 11 67.81 78.57 2 18.18
16893. Afik (afikrazanafi) 11 33.74 38.78 0 0.00
16894. MeeM (memepolice) 11 73.50 86.96 8 72.73
16895. Amit (_amit_) 11 75.16 84.49 2 18.18
16896. joefromfamilyguy (joefromfa... 11 91.40 111.61 7 63.64
16897. Chris (kringlepringle) 11 85.24 99.34 1 9.09
16898. Alex (yettibvc) 11 41.16 48.33 0 0.00
16899. Kitzia (kavila7) 11 56.11 76.16 0 0.00
16900. ITZZAC (itzzac_youtube) 11 44.20 57.78 2 18.18
16901. Tim (twitchanbumaniac) 11 52.48 65.24 5 45.45
16902. salah (salah1406) 11 66.96 77.88 1 9.09
16903. Phindoll (philosopher_phun) 11 71.35 87.03 4 36.36
16904. Tissue (tissuenoob) 11 55.84 61.56 2 18.18
16905. Typist_1 (_chethan18) 11 55.80 62.71 4 36.36
16906. JMoneyThug (jthugmoney) 11 77.84 92.86 2 18.18
16907. Ryyn (ryyn_isr) 11 71.24 78.30 2 18.18
16908. Firestar162 (firestar162) 11 45.57 61.54 3 27.27
16909. Christian (campi) 11 100.13 122.09 6 54.55
16910. rin (rieiode) 11 65.49 79.40 2 18.18
16911. Ronin (ronin_1) 11 63.07 71.11 3 27.27
16912. Jiyon (johnrhey324) 11 36.21 46.20 0 0.00
16913. Falin (falin224) 11 49.74 59.24 5 45.45
16914. Luke (sirlukeoiv) 11 61.39 70.19 4 36.36
16915. Guillaume (bilaptor) 11 51.39 55.81 0 0.00
16916. AJ (applepie314) 11 66.19 80.74 1 9.09
16917. nht (nhtonmoy) 11 58.53 64.48 5 45.45
16918. Jachin (optimal_husky) 11 85.20 94.15 5 45.45
16919. Dave (jungolo) 11 80.78 90.20 2 18.18
16920. Jason (jpbascon) 11 87.29 95.28 4 36.36
16921. Morgen (germansdfsd) 11 58.46 69.83 2 18.18
16922. Vilgot (fido_mandem) 11 73.35 87.04 4 36.36
16923. Matus (zlatovlasko) 11 67.62 79.36 3 27.27
16924. Steph (stephsim) 11 55.76 65.05 1 9.09
16925. BurntBac0n (burnt_bacon08) 11 91.35 105.66 6 54.55
16926. AcroniX (acronix_iom) 11 83.50 92.33 4 36.36
16927. Rain (ghetsis) 11 66.77 72.26 0 0.00
16928. EdmiszTheProto (edmisz1000) 11 62.85 74.49 1 9.09
16929. Grant (grant_types) 11 66.01 78.26 2 18.18
16930. Philip (philipisawesome4) 11 76.64 91.91 1 9.09
16931. Saif (littleboy291) 11 42.28 48.69 0 0.00
16932. Sam (caldeen) 11 73.42 84.40 3 27.27
16933. Axel (axless) 11 32.49 35.46 1 9.09
16934. hououin (hououinkyouma10) 11 61.43 68.99 2 18.18
16935. Jackson (saintpepsi) 11 44.00 55.47 0 0.00
16936. cameron (cammyteo) 11 99.78 114.25 6 54.55
16937. Ammar (shaikh_ammar) 11 89.97 97.04 6 54.55
16938. Eduard Felipe (efmorab) 11 67.11 75.91 2 18.18
16939. Edris (babyheaven) 11 80.24 101.26 5 45.45
16940. Ehm (doubleuehm) 11 84.13 108.04 2 18.18
16941. Nitesh (malster) 11 61.21 65.03 3 27.27
16942. Malo (malodrome) 11 43.73 50.29 2 18.18
16943. Adam (maldoren) 11 103.81 126.82 0 0.00
16944. Max (macksx) 11 68.19 80.97 3 27.27
16945. maciej (maciek3290) 11 59.80 66.69 2 18.18
16946. Daniel (macguffinstv) 11 94.67 108.87 3 27.27
16947. Peerawitch (maaaai) 11 57.72 62.67 0 0.00
16948. Tyler (m4rshm4) 11 110.93 131.10 10 90.91
16949. Luxson (luxsonx) 11 40.16 50.54 1 9.09
16950. Luthriel (luthriel) 11 101.53 110.31 8 72.73
16951. Luis (luis_vs_the_world) 11 60.82 71.17 2 18.18
16952. Luis (luisyt) 11 76.17 88.39 3 27.27
16953. jason (luckiestluckster) 11 95.12 105.93 8 72.73
16954. Luke (ltuite) 11 82.09 94.67 6 54.55
16955. Louie (louie4825) 11 101.20 119.26 8 72.73
16956. Louai (louai_zahran) 11 46.60 51.98 0 0.00
16957. No (loisk1) 11 78.48 90.18 6 54.55
16958. Little (littlesailor123) 11 74.15 89.09 1 9.09
16959. Lior (liorg225) 11 66.51 77.57 4 36.36
16960. Lilly (lilly713) 11 105.68 122.20 6 54.55
16961. 🤑 (liljasonmoney) 11 74.77 81.68 4 36.36
16962. Lilikoi (lilikoiv) 11 70.18 92.10 4 36.36
16963. IllIllIllIll (liliiilil) 11 123.47 136.20 5 45.45
16964. Lucius (lightwastaken) 11 91.57 110.97 2 18.18
16965. Christina (libermay) 11 73.28 79.37 2 18.18
16966. Thomas (ldsg99999) 11 56.41 64.43 2 18.18
16967. Flame On Me (lamtrinhan1503) 11 51.70 58.03 1 9.09
16968. Laiyon (laiyon) 11 58.16 63.98 2 18.18
16969. Luke (laaa) 11 105.47 114.56 4 36.36
16970. l0gically (l0gically) 11 73.19 80.82 5 45.45
16971. Alish (kzmadcat) 11 70.46 84.59 0 0.00
16972. Kaptain K (kxdang) 11 82.63 104.52 5 45.45
16973. atlas (kuuym) 11 93.13 113.74 6 54.55
16974. Speedy (kuulex) 11 71.92 82.73 2 18.18
16975. Lukas (kukess) 11 77.98 84.74 7 63.64
16976. ktns (ktns) 11 71.53 77.39 3 27.27
16977. lai (krylite) 11 82.27 89.49 0 0.00
16978. yes but (krosis2706) 11 70.10 85.72 5 45.45
16979. Derek (kroni) 11 61.48 75.12 1 9.09
16980. Eren (krishi__) 11 50.89 57.46 1 9.09
16981. Ali (kraken_wrath) 11 62.20 76.04 2 18.18
16982. KOROCO (koroconotu) 11 88.79 108.38 1 9.09
16983. Andrew (kooey_u) 11 48.35 53.86 3 27.27
16984. KIXK (kixk) 11 69.71 76.53 3 27.27
16985. Kivon (kivonsclipz) 11 76.86 91.87 3 27.27
16986. cat (kitkat79) 11 62.04 73.21 2 18.18
16987. Dimas (kirito_69) 11 43.62 50.84 0 0.00
16988. Ayden (king_nedya) 11 88.24 102.11 3 27.27
16989. Ferret (kingko) 11 47.40 55.87 1 9.09
16990. MA1T8 (kingking540) 11 91.68 99.43 4 36.36
16991. bo (kibums) 11 86.24 104.75 3 27.27
16992. Kent (kfreezen) 11 98.87 113.59 4 36.36
16993. Kevin (kevinliu050505) 11 93.01 102.71 4 36.36
16994. Kevin (kevindkao) 11 100.17 118.18 4 36.36
16995. Kev (kev9933) 11 106.44 117.78 4 36.36
16996. KenDvorak (kensan73dvorak) 11 67.83 83.35 1 9.09
16997. Kenny (kenny1232) 11 68.00 86.22 3 27.27
16998. Kennedy (kennedykozak) 11 72.51 88.09 4 36.36
16999. fover (keitotrash) 11 108.12 127.08 8 72.73
17000. Kate (kate_haha) 11 54.50 62.95 5 45.45
17001. kasra (kasra44) 11 69.15 80.61 1 9.09
17002. Kasra (kasra15) 11 59.30 69.25 1 9.09
17003. kaelan (kae1) 11 110.17 128.14 5 45.45
17004. James (jvlasak) 11 70.12 78.89 2 18.18
17005. Justin (justin000) 11 93.00 103.09 4 36.36
17006. Justa (justaboss101) 11 60.90 69.75 2 18.18
17007. jumpscarez the fox (jumpsca... 11 39.62 50.22 1 9.09
17008. Juan (juanpadoodle) 11 74.55 85.11 3 27.27
17009. Joshua (joshuajoshuak) 11 121.70 133.12 8 72.73
17010. Jonathan (jonathanatx) 11 73.02 86.93 5 45.45
17011. Jo (jojoey21) 11 109.08 125.92 7 63.64
17012. johny2021 (johny2021) 11 48.23 55.17 2 18.18
17013. JohnsDog (johnsdog) 11 114.49 131.45 3 27.27
17014. Johnnybib (johnnybib) 11 103.72 127.20 5 45.45
17015. John (johndzxu) 11 62.64 71.05 2 18.18
17016. Joey (joeygetthedoughy) 11 86.18 99.96 8 72.73
17017. Jonathan (jnybo) 11 72.66 88.55 4 36.36
17018. Jacob (jlagarespo) 11 106.85 122.31 9 81.82
17019. Jeff (jjj11x) 11 93.14 107.04 4 36.36
17020. JTL (jimthelegend) 11 82.45 87.52 3 27.27
17021. jimmhealer (jimmyhealer) 11 60.38 74.08 2 18.18
17022. Jim (jimdavia99) 11 62.93 69.59 2 18.18
17023. jiirrarr (jiirrarr) 11 58.24 67.54 3 27.27
17024. JeffJeff (jeffjeffgames) 11 51.31 59.72 0 0.00
17025. Pierce (jedipierce) 11 102.71 123.72 6 54.55
17026. Jakob (jdwalburger) 11 87.36 104.42 7 63.64
17027. John (jctad) 11 89.69 101.69 5 45.45
17028. Shlim (javah1) 11 80.44 93.36 1 9.09
17029. Jared (jaredtypist) 11 95.77 113.08 6 54.55
17030. Z (jaredezane) 11 102.21 116.20 7 63.64
17031. Hikaru (japism) 11 82.16 104.44 5 45.45
17032. Clive (jadenm770) 11 13.45 18.63 2 18.18
17033. Jacky (jackyjac) 11 72.73 85.78 4 36.36
17034. John (jacks3141) 11 64.42 74.66 2 18.18
17035. Jack (jackkieny) 11 59.92 68.80 3 27.27
17036. i (ivantse2) 11 100.12 111.79 7 63.64
17037. Taken (itztaken) 11 101.37 115.39 6 54.55
17038. Games (itzbond) 11 86.41 101.01 5 45.45
17039. jay! (its_jay_) 11 108.82 117.20 0 0.00
17040. NewbPianist (instantnoodles... 11 111.54 126.39 7 63.64
17041. s3lec (inputselec) 11 64.06 75.39 1 9.09
17042. started from 50 now we here... 11 120.38 146.76 7 63.64
17043. Owen (innitbruv) 11 54.33 64.21 3 27.27
17044. John (infzer0) 11 78.05 88.10 3 27.27
17045. Jayden (infamousphoenix) 11 110.64 134.65 11 100.00
17046. Indiana Mitko (indianamitko) 11 34.61 42.97 1 9.09
17047. Farzad (impulsion) 11 70.10 83.00 4 36.36
17048. Mr. Qwerty (imnotawimpykid) 11 86.22 94.93 4 36.36
17049. DW (immortal_tree) 11 98.78 107.08 6 54.55
17050. Richard (iliveinthexu) 11 147.55 158.38 9 81.82
17051. Michael (idobemikey) 11 63.99 73.06 4 36.36
17052. idkwhojamesis (idkwhojamesis) 11 87.14 99.92 1 9.09
17053. Moko (iamspeedkachiga) 11 83.60 98.05 4 36.36
17054. Player_II (iamplayer) 11 86.52 92.20 4 36.36
17055. Hxrry (hxrry) 11 65.76 93.48 4 36.36
17056. Pady (hundertzwoelf) 11 87.68 104.13 1 9.09
17057. Max (hooterr) 11 83.26 90.09 6 54.55
17058. seanghong (hongracer) 11 87.55 100.47 3 27.27
17059. Dominic (hobomonkey5) 11 76.98 93.29 3 27.27
17060. minnie (hiitzmemini) 11 63.85 76.15 2 18.18
17061. Hessel (hessel_s) 11 80.09 87.86 3 27.27
17062. Santiago (helix_02) 11 80.88 101.02 4 36.36
17063. Skyler (hausky) 11 96.40 109.75 6 54.55
17064. Nayan (hatke42) 11 60.39 71.07 4 36.36
17065. harambe (harambetypes) 11 43.18 57.80 1 9.09
17066. UE (hanue) 11 40.76 53.32 0 0.00
17067. Hana (hanatf2) 11 104.18 118.41 4 36.36
17068. Han (han3) 11 93.14 109.55 3 27.27
17069. Jason (haisaru) 11 76.64 90.30 5 45.45
17070. Haiden (haidenb10) 11 91.73 103.94 4 36.36
17071. Aldrich (gwaldrich) 11 97.00 112.03 3 27.27
17072. gegg (guy_sama) 11 73.63 85.42 3 27.27
17073. vinnie (gun_xox) 11 58.23 78.34 2 18.18
17074. Guest (guest002) 11 79.70 86.69 2 18.18
17075. grossdesign (grossdesign) 11 114.74 129.30 9 81.82
17076. Colin (grolxe_1) 11 91.75 107.52 3 27.27
17077. Clayton (grizzleybear62) 11 57.56 67.18 2 18.18
17078. Grifit (grifit) 11 47.99 61.03 3 27.27
17079. Griffin (grider1) 11 91.97 102.35 2 18.18
17080. GreatLama (greatlama) 11 80.31 93.50 4 36.36
17081. Vin (gracien) 11 62.19 69.47 2 18.18
17082. George (gpa138) 11 93.66 112.81 7 63.64
17083. Hcaz (gosuperzach) 11 46.38 55.27 3 27.27
17084. Cheap (gorid) 11 64.52 77.33 1 9.09
17085. Mar (gonefishing123) 11 94.36 109.68 5 45.45
17086. Jared (going2prison) 11 66.43 81.00 2 18.18
17087. William (godliam) 11 51.13 62.24 4 36.36
17088. godaberi (godaberi) 11 67.26 76.93 4 36.36
17089. Virtuoso™ (gkarthick) 11 93.87 100.39 3 27.27
17090. gi (gi_prim) 11 44.29 53.95 1 9.09
17091. Willy (gfif01) 11 72.60 82.65 5 45.45
17092. alem (gewaltxd) 11 75.63 91.61 7 63.64
17093. Get Racc'd (getraccd_) 11 58.70 67.67 2 18.18
17094. GerDi (gerdii) 11 61.75 80.20 5 45.45
17095. Genie (genielee) 11 111.77 137.01 6 54.55
17096. Griffin (gdawg_10) 11 70.58 81.07 7 63.64
17097. Sam (garuda1221) 11 86.23 98.47 8 72.73
17098. Gaphnix (gaphnix) 11 63.68 66.80 4 36.36
17099. Galib (galib2051) 11 70.49 77.81 4 36.36
17100. Gabber (gabbergandalf) 11 62.84 67.87 3 27.27
17101. Gochu (g0inginsqne) 11 108.43 116.69 5 45.45
17102. UppedFusion (fusion_) 11 110.27 119.53 6 54.55
17103. FusionHimSelf (fusionraider1) 11 53.87 66.54 2 18.18
17104. Kurtis (sauceypubes) 11 104.45 123.40 4 36.36
17105. Sargis (sargispro) 11 77.43 90.66 1 9.09
17106. Sarah (sarahnivans) 11 66.77 75.36 1 9.09
17107. Alix (sarahallisa) 11 66.34 73.78 3 27.27
17108. Sargis (saqo1997) 11 52.31 57.47 0 0.00
17109. Samdo (sammematt) 11 122.10 134.74 6 54.55
17110. Sajan (sajancpatel) 11 91.99 105.72 5 45.45
17111. Saffron (saffronayy) 11 92.21 118.29 10 90.91
17112. Saea (saeamak) 11 86.29 96.53 3 27.27
17113. Sans (s4nsx) 11 62.98 73.17 4 36.36
17114. Shannon (s0lanum) 11 53.02 59.06 2 18.18
17115. James (ryandaryno) 11 63.35 75.88 3 27.27
17116. Raven (rvnfx) 11 71.17 90.00 9 81.82
17117. Ruslan (ruslan_osmanov) 11 93.64 105.18 3 27.27
17118. Panagiotis (rulisogeranoulis) 11 83.22 97.54 6 54.55
17119. Ron (ronald2) 11 81.42 99.70 6 54.55
17120. Free Palestine (rollno14) 11 103.90 125.89 4 36.36
17121. Rolandas (rolandas) 11 24.91 32.26 0 0.00
17122. Roko (rokoroks) 11 79.80 89.47 3 27.27
17123. pentti (rocket_boi) 11 43.82 50.60 3 27.27
17124. Robbie (robbietrimble) 11 104.68 134.38 6 54.55
17125. Absolut (rluyen) 11 82.79 99.44 0 0.00
17126. Ridge (ritzchu) 11 92.40 101.35 11 100.00
17127. Kenny (riggedcontingency) 11 100.61 110.49 5 45.45
17128. ninja (riddickbr) 11 95.04 121.16 4 36.36
17129. Ricky (rickyyeung) 11 83.89 93.13 4 36.36
17130. Rickith (rickith) 11 58.23 63.72 0 0.00
17131. Jeremy (rice_cream) 11 96.18 107.97 5 45.45
17132. ango (rfthefinal) 11 73.00 86.16 4 36.36
17133. red (redwastaken) 11 95.35 104.86 2 18.18
17134. ReddyIsHere (reddy_is_here) 11 58.19 66.40 1 9.09
17135. Rebel (rebelaj) 11 92.81 99.78 2 18.18
17136. D A R K Z (reaching130wpm) 11 56.45 66.84 0 0.00
17137. Rodrigo (rdcmdev) 11 81.67 93.77 2 18.18
17138. Ray (ray_mond) 11 83.78 95.10 3 27.27
17139. RAWs (raws) 11 95.06 108.25 4 36.36
17140. guts (ramosjoshua214) 11 72.67 85.27 3 27.27
17141. Ajwad Hameem (rajin100000) 11 69.33 81.13 1 9.09
17142. Exquisition (raimi) 11 98.84 140.33 5 45.45
17143. Rahmen (rahmennoodles) 11 105.77 136.93 6 54.55
17144. qweasdyxc (qweasdyxc) 11 64.12 73.23 1 9.09
17145. Papa (quamthebomb) 11 97.29 114.43 5 45.45
17146. Pyro (pyromaniac_from_the_sun) 11 78.97 92.43 2 18.18
17147. tapan (psydelix) 11 71.23 79.97 2 18.18
17148. Psycho (psychobrainman) 11 78.36 85.98 3 27.27
17149. Mike (primike) 11 85.69 94.79 6 54.55
17150. Vorakan (ppaaul_) 11 67.86 81.65 2 18.18
17151. Hoang (poulet0306) 11 74.22 85.22 4 36.36
17152. Patric (potric) 11 68.46 88.98 2 18.18
17153. Potato (potatooe) 11 43.82 59.47 0 0.00
17154. PenTest-duck (pokemontypist) 11 114.61 128.35 4 36.36
17155. Cookies (poeannn) 11 70.59 80.58 5 45.45
17156. Nick (pletlibo) 11 104.51 128.68 7 63.64
17157. tstats[pkmkb] (pkmkb) 11 63.75 70.73 0 0.00
17158. Jacob (pinpoint) 11 63.57 74.22 5 45.45
17159. Phungtastic (phungtastic) 11 73.53 78.86 2 18.18
17160. Alex (pheudo) 11 72.90 90.30 6 54.55
17161. nah (phamhuyhuy2005) 11 91.61 108.92 2 18.18
17162. Peter (petero) 11 87.19 96.06 2 18.18
17163. Gavin (perfectgavinator) 11 106.97 124.27 6 54.55
17164. Matous (pelisek16) 11 75.06 85.32 4 36.36
17165. ama (pcfcace) 11 75.39 83.51 2 18.18
17166. Phillip (pc15pdx) 11 51.19 59.15 2 18.18
17167. Payette (payette420) 11 92.78 108.64 1 9.09
17168. paul (paularoni) 11 64.35 77.32 1 9.09
17169. Connor (paintrain23) 11 70.26 88.50 3 27.27
17170. Pinny (p1nny_) 11 65.51 73.05 8 72.73
17171. ozzy (ozzyk) 11 56.30 70.90 1 9.09
17172. Squeak (oweozz) 11 78.03 95.34 2 18.18
17173. Omar (oshnatour) 11 84.73 107.29 2 18.18
17174. opal (opalisbored) 11 53.30 61.93 2 18.18
17175. Lou (onyok2010) 11 60.85 71.22 11 100.00
17176. John (omster83) 11 93.45 111.06 5 45.45
17177. Saul (old_grandma) 11 104.81 124.11 4 36.36
17178. officialpm (officialpm) 11 111.79 131.70 3 27.27
17179. ocodile (ocodile) 11 114.03 132.18 6 54.55
17180. Gabi (ockra_) 11 55.45 69.33 3 27.27
17181. np80658 (np80658) 11 68.96 79.11 2 18.18
17182. Erdal (notasingleduck) 11 58.41 65.39 3 27.27
17183. Vladimir (nolmegar) 11 124.16 145.61 9 81.82
17184. Nobu (nobuhiro777) 11 72.12 86.47 3 27.27
17185. NK (nkpathak1) 11 36.79 51.42 2 18.18
17186. niven (niven_11) 11 74.08 86.80 4 36.36
17187. soraya (nilanjona) 11 36.16 42.76 1 9.09
17188. notjustmetal (nightway11) 11 86.24 95.46 5 45.45
17189. Nick (nickxz) 11 128.64 143.48 6 54.55
17190. Nicholas (nicholas_r) 11 98.30 111.36 7 63.64
17191. Jusuf (nerdtyper) 11 92.29 106.65 7 63.64
17192. Neptune (neptune_22) 11 85.47 98.08 3 27.27
17193. Just (needhelpintyping) 11 96.39 112.93 4 36.36
17194. Jonathan (nebulium) 11 59.21 70.68 2 18.18
17195. Nathan (nbx3k) 11 101.12 114.88 5 45.45
17196. Nathan (nathanpg) 11 93.71 108.44 5 45.45
17197. Nasir (nasir_hussain) 11 62.33 73.65 3 27.27
17198. narqo (narqo) 11 101.53 122.65 8 72.73
17199. Night Fury (naimur_rahman) 11 79.08 84.74 3 27.27
17200. RS (nahor) 11 107.30 129.17 8 72.73
17201. Nada (nada2004) 11 50.53 58.89 1 9.09
17202. MZA (mzakm) 11 98.76 120.68 8 72.73
17203. Mytx (mythflashx) 11 69.39 75.72 3 27.27
17204. diana (mxclfld) 11 84.25 94.38 5 45.45
17205. Muntazar (muntazer1) 11 69.63 78.11 6 54.55
17206. Matthew (msloehr) 11 75.53 84.88 2 18.18
17207. kailh pinks (mrdooks) 11 104.03 132.76 8 72.73
17208. Thiemen (mohouzeg) 11 95.14 108.39 9 81.82
17209. Mohammed (mohammedamarnah) 11 91.80 113.28 4 36.36
17210. mohammadreza (mohammadrezae... 11 71.81 79.62 0 0.00
17211. Kacper (mlociak) 11 58.04 63.38 2 18.18
17212. manjeet (mjydv4548) 11 61.76 69.53 1 9.09
17213. Mr.GrayBoi (mistergrayboi) 11 77.50 89.76 3 27.27
17214. Felzii (missartemis_97) 11 63.92 74.53 2 18.18
17215. mire (mire_kr) 11 88.90 113.26 2 18.18
17216. gannicus (milaikilaiki) 11 108.16 123.06 5 45.45
17217. Mohamed (midoukl) 11 50.55 53.40 0 0.00
17218. Michael Angelo (micky15) 11 101.45 111.12 6 54.55
17219. Michal (micha13) 11 85.05 96.29 2 18.18
17220. Matt (mhorsfield) 11 55.66 67.88 3 27.27
17221. Bob (metsandcavs) 11 77.81 87.78 2 18.18
17222. Aashish kumar (messy84) 11 39.15 43.07 3 27.27
17223. Memresable (memresable) 11 66.98 78.90 3 27.27
17224. Mark Jonathan (max_peterson10) 11 102.79 113.80 4 36.36
17225. Max (max_evans) 11 86.70 100.65 1 9.09
17226. john (maxwelllllllllll) 11 66.25 81.59 4 36.36
17227. Mathias (mattitheguy) 11 77.04 98.32 6 54.55
17228. Matt3k (matt3k) 11 84.49 108.69 5 45.45
17229. matex72 (matex72) 11 74.49 85.32 1 9.09
17230. Marc (marxotkin) 11 98.31 110.15 5 45.45
17231. Marcus (marqueshark) 11 89.81 137.77 10 90.91
17232. Jordan (marceless) 11 131.19 140.70 9 81.82
17233. TOP (man_stop) 11 105.64 115.68 5 45.45
17234. Manuel (mansrz) 11 76.53 87.52 3 27.27
17235. Sean (manbeervark) 11 78.85 91.44 3 27.27
17236. Summer (sccb_14) 10 46.89 54.56 8 80.00
17237. Acetaminophen (savirbaas) 10 108.32 128.24 2 20.00
17238. Saurus (saurus) 10 77.64 86.30 4 40.00
17239. princeton (santabiii) 10 55.99 62.80 2 20.00
17240. Sanmeel (sanmeel) 10 70.31 85.01 4 40.00
17241. Samz (samzgm) 10 86.70 98.70 6 60.00
17242. Sam (samh410) 10 86.25 101.18 4 40.00
17243. Ezona (sambumbuslayer) 10 67.42 91.04 5 50.00
17244. Rose (salemluna) 10 68.98 74.28 4 40.00
17245. Sadaq (sadaq) 10 59.91 66.25 2 20.00
17246. Saagster (saagster) 10 73.79 86.21 3 30.00
17247. David (ryzeros) 10 94.27 111.16 3 30.00
17248. Ricky (ryckler) 10 87.68 100.95 5 50.00
17249. Rem (ryanz778) 10 117.40 129.51 5 50.00
17250. Robert (rwschuster) 10 122.74 147.40 6 60.00
17251. Antti (rustling) 10 81.53 94.06 4 40.00
17252. Russell (russell_t3ap) 10 98.44 113.24 4 40.00
17253. IMZA (runawayse) 10 71.26 79.33 1 10.00
17254. Yash (rubikstyper) 10 69.76 84.41 1 10.00
17255. Rsijlowpez (rsijlowpez) 10 120.08 131.44 6 60.00
17256. Maroy (roymaaa) 10 107.23 127.22 3 30.00
17257. lap (roeloflucka2) 10 74.99 85.86 2 20.00
17258. Mohammad (robin420024) 10 16.03 19.82 2 20.00
17259. Thint (rma251209) 10 58.41 69.25 2 20.00
17260. Rafi (rkyum) 10 71.88 79.04 2 20.00
17261. hplr (rkg0612) 10 105.27 119.21 3 30.00
17262. Ricky (riyu22) 10 90.37 108.13 3 30.00
17263. Rinat (rinatzh) 10 64.82 77.10 1 10.00
17264. Rim (rimkyul) 10 59.66 69.25 7 70.00
17265. Riggles (riggles) 10 89.74 103.38 1 10.00
17266. ridan (ridanrekas) 10 67.81 75.92 2 20.00
17267. Ricky (rickythedude) 10 61.55 68.54 1 10.00
17268. Rickard (rickyspr) 10 69.67 84.42 4 40.00
17269. I am cool (ribombee_mobile) 10 82.09 104.05 1 10.00
17270. Removeris (removeris) 10 78.83 92.67 1 10.00
17271. Relletro (relletro) 10 65.69 77.66 3 30.00
17272. Relja Bulat (relja0804) 10 48.39 56.28 2 20.00
17273. Krsman (rektix) 10 85.80 93.21 1 10.00
17274. Simon (rehy) 10 41.78 46.28 2 20.00
17275. Regan (regank1) 10 67.02 74.49 2 20.00
17276. Raynei (raynei) 10 90.04 107.34 4 40.00
17277. Ravindi (rav2525) 10 71.95 89.92 4 40.00
17278. Zain (rasnouk) 10 76.14 86.30 2 20.00
17279. Rania (rania_mostafak) 10 40.61 45.85 0 0.00
17280. Rana (rana2706) 10 49.39 57.20 1 10.00
17281. Teddy (rampagingteddy) 10 62.78 69.10 1 10.00
17282. Ramson (rammun) 10 69.27 80.89 0 0.00
17283. Ralph (ralphcyrus0015) 10 68.85 80.67 2 20.00
17284. MD ASHIQUL (rajib470) 10 58.94 66.19 0 0.00
17285. weiss (rag_penguin) 10 107.08 135.37 3 30.00
17286. t (raccoon_emoji) 10 57.76 71.48 4 40.00
17287. Giovanni (qwertyg01) 10 66.18 75.37 3 30.00
17288. tadeo (qwerm) 10 74.58 87.66 3 30.00
17289. Eequla (quintaboy) 10 105.36 120.60 4 40.00
17290. Lucas (pythonvx) 10 84.62 93.26 6 60.00
17291. phasawat (puppaprubchok) 10 46.89 52.78 3 30.00
17292. pun (punoar) 10 65.96 76.07 1 10.00
17293. PulseAD (pulsead) 10 96.75 109.70 7 70.00
17294. ProBlasters (pro_blasters) 10 63.06 76.56 4 40.00
17295. Alexander (prayforwinter) 10 96.59 114.63 5 50.00
17296. Prajwal10s (prajwal10s) 10 49.24 60.50 2 20.00
17297. Molasses (practice12_3) 10 89.22 95.90 3 30.00
17298. Mish (powerpuffgirl23) 10 57.04 66.98 5 50.00
17299. Pouya (pouyav) 10 66.28 79.53 2 20.00
17300. Nick (potatoshavings) 10 104.43 131.26 9 90.00
17301. kyle (popedude22) 10 106.51 127.90 4 40.00
17302. krisztofer (poofartmaster) 10 59.35 65.80 1 10.00
17303. Jakis (polishboy12221) 10 74.07 78.86 2 20.00
17304. Matt (pointlesspostulate) 10 84.60 90.94 7 70.00
17305. podolsero (podolsero) 10 57.92 67.14 4 40.00
17306. Grape (plrplrplr12345) 10 82.19 96.82 4 40.00
17307. Kailh BOX Jade (plixxreeb) 10 101.52 119.95 5 50.00
17308. Joe (playspout) 10 98.11 106.64 3 30.00
17309. Gustavo (pizza_water) 10 68.32 75.34 2 20.00
17310. P (pizzapita) 10 79.71 85.24 2 20.00
17311. Daredevil (piyush_123) 10 66.93 71.86 3 30.00
17312. Piyush (piyushc) 10 71.75 78.77 1 10.00
17313. Phantom (phantomzamber) 10 56.38 67.12 2 20.00
17314. Tim (penguins178) 10 81.76 100.58 3 30.00
17315. peedmypants420 (peedmypants... 10 80.98 95.32 4 40.00
17316. RIP Byron ❤ (pdnegreiros) 10 93.77 105.58 1 10.00
17317. Willy (paxson2008) 10 87.28 96.04 4 40.00
17318. Blagoj (pauc_99) 10 89.23 96.50 1 10.00
17319. Francisco (patleitao) 10 93.37 109.07 7 70.00
17320. Baki (p4n7r0n1c) 10 56.40 63.13 0 0.00
17321. Alex (p08r) 10 86.21 95.15 3 30.00
17322. oTTo (otto43) 10 67.20 83.26 1 10.00
17323. Martin (ostlangarn) 10 62.88 68.66 2 20.00
17324. Josh (orceun) 10 94.98 101.56 3 30.00
17325. hyungjin (optimizion) 10 72.70 80.84 3 30.00
17326. Drapanji (onedrapo) 10 74.75 83.68 1 10.00
17327. Kenneth (omgkenken) 10 104.95 121.10 5 50.00
17328. Olivia (olivisthecow) 10 97.42 112.02 6 60.00
17329. Erwin (oldskoollogik) 10 80.11 94.16 4 40.00
17330. Andy (okiandy) 10 106.40 125.70 6 60.00
17331. Nush (nush98) 10 92.27 108.47 4 40.00
17332. nurmyrza (nurzoik) 10 58.03 68.49 4 40.00
17333. Numpunk (numpunk) 10 75.21 89.86 4 40.00
17334. numdegased (numdegased) 10 96.37 102.96 3 30.00
17335. I'm Bad (nssv101) 10 124.71 143.55 3 30.00
17336. Tintallë (nparadigm) 10 68.96 73.79 2 20.00
17337. Note (note_r) 10 89.86 113.95 5 50.00
17338. kevin (noob98) 10 60.43 66.98 4 40.00
17339. noniino (noniino) 10 53.41 57.38 2 20.00
17340. DirtyDan.jpeg (nomar_76) 10 64.93 84.43 3 30.00
17341. NoFace (nofacecastle) 10 52.07 68.97 1 10.00
17342. Bryan (noddlersnorm) 10 97.08 105.17 4 40.00
17343. Noah (noahbradderz) 10 75.01 90.58 1 10.00
17344. Nitin (nitinaturdsk) 10 60.70 66.78 0 0.00
17345. Sef (niktarera) 10 95.18 122.14 5 50.00
17346. Nightmare (nightmare_foxy) 10 64.67 79.04 2 20.00
17347. Nicholas (nicshoe13) 10 90.99 104.88 1 10.00
17348. Nicholas (nichbillcliff) 10 90.84 93.57 3 30.00
17349. BountifulFever5 (nguyenanhn... 10 47.38 50.27 1 10.00
17350. NeVMiku (nevmiku) 10 67.23 81.07 3 30.00
17351. mat (netman) 10 85.96 99.03 3 30.00
17352. Neil (neil3110) 10 35.53 38.45 2 20.00
17353. aaron (naruto2141) 10 92.08 103.96 2 20.00
17354. nyaa~ (nakkooo) 10 131.02 173.70 6 60.00
17355. Cát Gia (nahidk) 10 67.24 77.31 2 20.00
17356. Nadia Gonzalez (nadiaig) 10 82.94 94.92 5 50.00
17357. danielwolf (n3kro) 10 89.14 103.47 2 20.00
17358. Louay (n0break) 10 36.50 42.85 0 0.00
17359. Michael (m_soutar3) 10 108.35 122.09 6 60.00
17360. Angela (mytypingskillsarent... 10 74.17 85.14 2 20.00
17361. Michael (myki21) 10 70.18 84.68 3 30.00
17362. Mustang (mustangmaster) 10 54.14 62.65 0 0.00
17363. Mukul (mukul27wno) 10 41.53 47.22 0 0.00
17364. M (mttt001) 10 80.94 90.24 4 40.00
17365. Martin (mr_pandabear) 10 92.31 100.75 5 50.00
17366. mr. (mr_maam) 10 91.37 107.29 4 40.00
17367. Cara (mrsham) 10 81.91 104.28 9 90.00
17368. MrLolu (mrlolux) 10 54.95 62.36 1 10.00
17369. Michael (mrgryph0n) 10 104.48 114.33 2 20.00
17370. Jordan (mrempyrean) 10 113.14 125.37 9 90.00
17371. Jack (mopex) 10 63.66 75.95 2 20.00
17372. Light (moory5) 10 86.95 93.18 1 10.00
17373. tstats[montedeu] (montedeu) 10 61.55 69.85 1 10.00
17374. Free Palestine (mohamad01) 10 58.24 66.06 1 10.00
17375. TheScientist (mixalocyber) 10 67.24 79.98 2 20.00
17376. Mistermanfith (mistermanfith) 10 35.31 40.73 0 0.00
17377. Aidana (missboss77) 10 27.51 34.67 0 0.00
17378. Wong (mioky) 10 33.11 38.21 1 10.00
17379. mingw (mingw) 10 105.19 111.82 6 60.00
17380. Mikael (mikael_abe) 10 61.37 71.25 1 10.00
17381. Miday (miday) 10 106.31 118.04 4 40.00
17382. Michael (michaell018) 10 63.28 74.19 3 30.00
17383. SeeStarz (mfahrim) 10 94.22 115.43 4 40.00
17384. Mentafind (mentafind) 10 79.73 93.59 5 50.00
17385. XFootballManX (meme_licker_21) 10 45.30 53.26 0 0.00
17386. Lil (memebigboy69xx) 10 79.03 86.52 5 50.00
17387. Zsombor (melidon) 10 41.43 54.56 1 10.00
17388. melau (melau) 10 105.46 125.84 5 50.00
17389. Laisvidas (meizind) 10 55.14 59.71 1 10.00
17390. Caba (megiorr69) 10 57.96 64.52 3 30.00
17391. Meeze (meeze) 10 98.14 117.00 2 20.00
17392. slow. (meeper24) 10 97.95 109.55 5 50.00
17393. Max (mcm20) 10 94.68 102.52 0 0.00
17394. Max (max_adagio) 10 104.11 121.32 1 10.00
17395. Max (maxies) 10 57.63 65.60 3 30.00
17396. Max (maxbro) 10 85.05 100.12 5 50.00
17397. Matthew (mawalker66) 10 81.90 90.90 9 90.00
17398. Groot (marcogroot) 10 106.35 122.64 4 40.00
17399. bbl_drizzy (marcofia) 10 78.87 89.46 3 30.00
17400. Marvin (marbinelyo) 10 65.49 74.64 3 30.00
17401. Manuel (mannymnz) 10 80.52 96.89 4 40.00
17402. Anonymous (argong1) 10 100.81 127.62 5 50.00
17403. syed (areeb290805) 10 66.53 86.01 4 40.00
17404. rumi (archsun) 10 94.84 108.34 3 30.00
17405. Aravinthan (aravinthan) 10 47.00 60.79 2 20.00
17406. Aravind (aravindsreeram) 10 100.47 115.86 6 60.00
17407. Aqib (aqib1990) 10 64.55 73.11 1 10.00
17408. TERT (antonhsu) 10 101.45 118.99 5 50.00
17409. anpan (anpann) 10 44.80 55.90 3 30.00
17410. Another (anotherkaneki) 10 88.89 109.66 3 30.00
17411. ANKIT (ankit_2002) 10 22.80 27.29 3 30.00
17412. Rachel (animitz) 10 101.74 114.22 3 30.00
17413. Animal (animalracional) 10 105.33 114.54 2 20.00
17414. Anil (anil1631988) 10 46.29 57.44 2 20.00
17415. Angelo (angeloanan) 10 86.51 102.51 2 20.00
17416. Angel (angeldavinci) 10 107.71 125.72 4 40.00
17417. andrucc (andrucc) 10 124.90 137.56 7 70.00
17418. Andrea (andrea_oboe) 10 56.90 70.35 2 20.00
17419. Anastacia (anastaciagurina) 10 43.99 50.57 0 0.00
17420. manizman (amznima) 10 46.88 58.82 1 10.00
17421. Amirun (amumrzmh) 10 49.23 55.98 1 10.00
17422. Amr (amr_alnas) 10 63.57 75.60 2 20.00
17423. chi (amaz1n) 10 122.68 137.95 4 40.00
17424. Amaru (amaruescalante) 10 73.70 86.36 2 20.00
17425. Nux (amades) 10 82.24 93.43 4 40.00
17426. allLuck (allluck) 10 51.71 63.43 0 0.00
17427. M (allinnn) 10 70.00 84.05 4 40.00
17428. Alistair (alistairmross) 10 49.91 56.06 1 10.00
17429. Alif (aliftheruslan) 10 64.30 72.04 2 20.00
17430. Alfie (alfiefogg) 10 68.46 76.79 1 10.00
17431. Aryan (alemantrix) 10 80.47 97.33 1 10.00
17432. Alec Gian (alecgian) 10 59.96 74.87 2 20.00
17433. Ajay (ajaygunacr7) 10 82.83 97.64 1 10.00
17434. noneov (aidentypefast) 10 64.38 72.27 7 70.00
17435. Ahmad (ah_abualrob) 10 39.15 45.42 1 10.00
17436. Ahnaf (ahnaf_habib) 10 72.62 82.00 4 40.00
17437. Annette (ahhooah) 10 53.37 57.11 0 0.00
17438. Diana (agent_artemis) 10 84.30 104.84 2 20.00
17439. Keenan (agentk9) 10 72.52 77.13 4 40.00
17440. muhammad afiq (afiq101) 10 77.69 84.78 3 30.00
17441. Tim (afferin_) 10 127.97 151.63 7 70.00
17442. Fher (aether78) 10 28.93 36.77 3 30.00
17443. Eric (aerran) 10 105.47 113.92 8 80.00
17444. Adhyay (adyr_152) 10 43.35 56.80 1 10.00
17445. Adromrial (adromrial) 10 94.00 103.21 5 50.00
17446. Percy (adladd) 10 78.94 89.23 1 10.00
17447. acidxburn87 (acidxburn87) 10 49.97 56.93 2 20.00
17448. Dr_ (abrarsikder_123) 10 50.19 66.71 2 20.00
17449. primrose (abigaillll) 10 56.10 62.15 2 20.00
17450. gwen (abcdbga) 10 107.73 119.09 4 40.00
17451. Aaryan sharma (aaryan21) 10 54.40 61.02 1 10.00
17452. Mani (93z9a) 10 59.36 68.10 1 10.00
17453. Jason (921jason921) 10 79.21 104.20 3 30.00
17454. Jack (666jack) 10 39.20 47.99 0 0.00
17455. Shalin (29wpm) 10 60.71 65.34 0 0.00
17456. skies (17phantom) 10 103.77 124.70 3 30.00
17457. 1015634 (1015634) 10 103.28 121.34 5 50.00
17458. Masood (004993) 10 74.33 88.86 10 100.00
17459. Alinoo (alinooo) 10 34.19 40.77 0 0.00
17460. i (iiooddaa) 10 67.57 73.94 3 30.00
17461. Avijeet (avijeet_03) 10 46.57 51.59 2 20.00
17462. Colby (kerble) 10 107.38 140.65 6 60.00
17463. JC (alicawj) 10 87.28 96.66 3 30.00
17464. Allen (applausingallen) 10 58.80 73.35 2 20.00
17465. Dante (drogers279) 10 89.42 99.00 5 50.00
17466. Harmony (harms) 10 73.79 88.69 0 0.00
17467. Aito (aitogod) 10 52.85 61.08 1 10.00
17468. Joksa (joksa_19) 10 59.06 65.74 2 20.00
17469. paper (paperhead) 10 65.50 72.42 4 40.00
17470. Daksh (daksh_10) 10 47.21 51.41 0 0.00
17471. matt (skizxo) 10 88.32 106.36 5 50.00
17472. Ryan (cryptopulse) 10 89.04 102.56 4 40.00
17473. Kamshat (jklsyk) 10 36.49 40.58 3 30.00
17474. Leo (leonidas_) 10 89.78 104.85 2 20.00
17475. Terry (terry77) 10 70.37 81.93 10 100.00
17476. phoenix (phoenix_mint) 10 67.76 75.91 2 20.00
17477. _ (ovorampage) 10 81.92 94.75 3 30.00
17478. Aayan (aayanali808) 10 82.24 98.40 3 30.00
17479. Abdelrahman (abdelrahman247... 10 39.49 49.00 0 0.00
17480. john (scholarbackmarathanee) 10 103.34 110.19 8 80.00
17481. Slayer (slayerontwitch) 10 108.23 122.97 5 50.00
17482. mado (mado_sam) 10 29.25 38.25 0 0.00
17483. Tomaz (mali_frodo) 10 53.06 58.54 1 10.00
17484. Fynn (fynn__) 10 86.79 96.39 3 30.00
17485. Sh0t.0 (sudhanshu8302) 10 54.33 61.49 3 30.00
17486. Eric (vulbex) 10 54.75 79.16 1 10.00
17487. 50wpm (verynoob) 10 114.44 139.50 6 60.00
17488. Álvaro (ashsan98) 10 83.41 92.40 6 60.00
17489. Nacca (nacca47) 10 73.74 83.22 4 40.00
17490. Darkn (darkn_yt) 10 120.59 160.37 8 80.00
17491. Mary (maryxo) 10 84.29 98.76 8 80.00
17492. : (lazering_death) 10 74.91 96.09 1 10.00
17493. Someone (arilaro) 10 62.86 68.30 5 50.00
17494. cool cat! (kid_apollo) 10 45.25 50.50 0 0.00
17495. Ronak (raun707) 10 52.14 60.75 0 0.00
17496. Nicholas (nicocook) 10 91.24 103.51 2 20.00
17497. BC190 (bc190) 10 65.08 70.66 3 30.00
17498. Synplet (synplet) 10 79.04 103.57 8 80.00
17499. DADE (dad_ee) 10 71.23 83.45 1 10.00
17500. Leon (dutchwarrior) 10 57.20 62.32 1 10.00
17501. Sul (mrsul_) 10 82.90 92.14 8 80.00
17502. Lorenzo (gr8monk3ys) 10 87.69 95.23 3 30.00
17503. Chapman (sevenagueroes) 10 53.56 57.77 1 10.00
17504. yens_ (jens8732) 10 72.52 79.29 3 30.00
17505. Jonten (jrpx9) 10 43.83 61.77 1 10.00
17506. Brendan (typingtops) 10 65.67 78.87 2 20.00
17507. Vicki (vickil) 10 62.13 72.52 4 40.00
17508. Hamilton (hammer3000) 10 69.46 85.72 1 10.00
17509. Michelle (chickzor) 10 51.09 56.88 1 10.00
17510. tstats[mmh49] (mmh49) 10 55.83 67.23 0 0.00
17511. Brugarin (brugarin) 10 67.50 78.98 4 40.00
17512. Ayberk (ayberkt) 10 101.41 119.10 5 50.00
17513. Pavel (fugives) 10 62.92 77.97 7 70.00
17514. Franz (franzl_fang) 10 48.41 56.11 1 10.00
17515. Force (foce3954) 10 41.38 45.94 1 10.00
17516. Jacob (floodedcodeboy) 10 69.15 77.93 4 40.00
17517. sgfd (fish_speckle) 10 61.78 73.27 3 30.00
17518. Fifi (fififishcake) 10 76.80 87.30 3 30.00
17519. Felipe (felipekde) 10 60.51 69.68 1 10.00
17520. Felipe (felipeav2) 10 27.37 34.51 1 10.00
17521. Elio (fcasper) 10 69.24 76.63 5 50.00
17522. Alan (faux_ray) 10 97.73 121.10 6 60.00
17523. Eric (fastestfatfingers) 10 102.40 115.57 6 60.00
17524. IlhanKhayru (fangian) 10 85.14 103.71 2 20.00
17525. Х. (falcon0338) 10 75.82 86.27 5 50.00
17526. FadedSpirits (fadedspirits) 10 87.29 100.25 2 20.00
17527. Cece (e_m_p_t_y) 10 79.64 91.52 1 10.00
17528. igig (eztau) 10 56.62 61.33 1 10.00
17529. Ezra (ezratyping) 10 89.78 103.39 5 50.00
17530. eyedin (eyedin) 10 115.21 132.12 5 50.00
17531. Eve (evehelin) 10 85.50 96.81 2 20.00
17532. Adrian (evadetoxinz) 10 44.52 55.32 2 20.00
17533. Ethan (ethro) 10 56.44 76.27 1 10.00
17534. Walter (eskaytee) 10 52.55 64.00 0 0.00
17535. Ashfaque (eshan_) 10 59.83 64.80 9 90.00
17536. typing (errors_intesify) 10 82.87 95.78 3 30.00
17537. Eric (erictie) 10 80.54 107.49 2 20.00
17538. Eric (ericboyce) 10 103.60 115.56 6 60.00
17539. eRFoRever (erforever) 10 110.79 135.13 9 90.00
17540. Henri (enzzzx) 10 112.20 131.47 5 50.00
17541. Renz (enriqatron52) 10 99.77 109.99 5 50.00
17542. Lior (endlease) 10 91.40 103.24 5 50.00
17543. i am Dog (endi_69) 10 66.26 77.61 4 40.00
17544. Sky (elucentx) 10 103.55 116.33 7 70.00
17545. Aron (ellipsoul) 10 111.48 121.77 4 40.00
17546. Elias (elias_17) 10 62.68 76.26 3 30.00
17547. Elias (eliasura) 10 110.99 129.28 8 80.00
17548. el (elchupo) 10 37.35 60.87 2 20.00
17549. ahmed (elberawy) 10 23.72 27.94 1 10.00
17550. Evan (eh30) 10 55.79 62.67 1 10.00
17551. 愛する (ecstxsy) 10 93.99 112.48 0 0.00
17552. Shamil (echonaut) 10 97.00 103.34 4 40.00
17553. Ori (echoloche) 10 56.56 63.57 4 40.00
17554. P. Leboid (eccentricpleboid) 10 44.91 56.60 0 0.00
17555. Dennis (dya26) 10 116.21 134.19 4 40.00
17556. mazen (dweedar) 10 74.71 84.17 2 20.00
17557. Diana (dustystar96) 10 60.21 69.18 0 0.00
17558. Aashish (dunsman) 10 43.74 50.15 1 10.00
17559. speed (druggedrice) 10 121.63 136.81 2 20.00
17560. j (droozyayayaya) 10 143.83 161.89 8 80.00
17561. Matthew (drogoton) 10 63.40 75.90 3 30.00
17562. José (dqcheetqh) 10 67.58 75.03 4 40.00
17563. Dinesh (dineshkandy) 10 77.39 98.37 1 10.00
17564. Dimitris (dimgag) 10 63.63 72.21 2 20.00
17565. Dimfred (dimfred) 10 83.03 98.18 3 30.00
17566. diamond (diamond) 10 22.41 30.47 5 50.00
17567. Dylan (dhatx13) 10 97.43 117.67 4 40.00
17568. 1 (desser2) 10 88.75 96.90 3 30.00
17569. despaciko (despaciko) 10 81.66 90.12 4 40.00
17570. deniz (dendiz) 10 75.50 91.80 2 20.00
17571. Tom (demarini) 10 104.95 117.71 4 40.00
17572. rudraksh (delusionaloptimist) 10 60.76 70.58 2 20.00
17573. Do (dekul1205) 10 79.54 92.60 1 10.00
17574. Osama (default_1011) 10 71.20 81.14 4 40.00
17575. Rui (deathnight1234) 10 73.11 83.53 8 80.00
17576. asdfasdf (ddgg007) 10 73.89 94.26 2 20.00
17577. David (dchoboy) 10 74.37 85.77 2 20.00
17578. Đejms (db007) 10 72.10 87.18 4 40.00
17579. Luyene (dauxsis) 10 103.82 120.41 1 10.00
17580. DatMoonGamer (datmoongamer) 10 115.74 139.38 7 70.00
17581. Khaeran S. (dark_ze7en) 10 56.83 69.45 0 0.00
17582. DarkZplays (darkzplays_qwerty) 10 88.60 96.90 5 50.00
17583. Kadie (darkskies0107) 10 80.32 86.44 3 30.00
17584. DarkPrinceGandalf (darkprin... 10 91.81 103.95 5 50.00
17585. stabby stab (darkholdwizerd) 10 78.93 95.12 3 30.00
17586. Dannica (danni_bear_) 10 48.41 56.20 1 10.00
17587. Daniel (dankasu) 10 34.45 40.06 1 10.00
17588. Daniel (daniel1212) 10 75.25 80.90 2 20.00
17589. Danchik (danchikg) 10 73.09 82.78 3 30.00
17590. Can't (daddaaddad) 10 105.94 118.19 2 20.00
17591. Cyrus (cyrus19) 10 76.98 92.04 5 50.00
17592. Cyden (cyden) 10 58.26 99.51 3 30.00
17593. Adrian (cui3e) 10 99.61 111.93 9 90.00
17594. Colby (ctgap) 10 140.01 152.06 8 80.00
17595. Wall (csgoscam) 10 66.55 88.01 2 20.00
17596. CatToTheFour (cryptica) 10 97.46 112.20 4 40.00
17597. Lau (cryptextinct) 10 83.77 96.70 3 30.00
17598. Crossland (crossjbeer) 10 102.70 122.77 6 60.00
17599. Michael (crecious) 10 99.98 128.13 6 60.00
17600. Cream Of (creamofroach) 10 102.00 113.85 8 80.00
17601. cozy (cozy_c) 10 65.32 85.84 6 60.00
17602. Corin (corlexc) 10 76.72 93.20 0 0.00
17603. rsdigital.com.au (cooper1289) 10 131.18 143.88 5 50.00
17604. C (cmmg1) 10 78.70 89.17 2 20.00
17605. Connor (cmcl) 10 60.82 68.27 2 20.00
17606. Cole (cmacd) 10 87.84 97.88 2 20.00
17607. e (cjasonp) 10 106.38 119.02 3 30.00
17608. unit (chuwii) 10 74.28 82.53 1 10.00
17609. Darkchuby (chubyxdxd) 10 47.13 60.03 2 20.00
17610. Chris... (chrishollow7) 10 98.78 108.92 4 40.00
17611. Chris (chrishene) 10 71.26 80.98 2 20.00
17612. Cyrus (chonky_garfield) 10 48.83 58.08 4 40.00
17613. Chiggas (chinesecodingmaster) 10 59.02 66.03 1 10.00
17614. chetanya (cheti) 10 67.32 76.32 2 20.00
17615. han (chenhan) 10 46.69 51.66 0 0.00
17616. Bruce Mang (cheeseburger_98) 10 93.35 118.59 2 20.00
17617. Chatic (chatic) 10 79.77 92.56 1 10.00
17618. Person (chaon7) 10 80.45 93.79 8 80.00
17619. JOn (chaomeister986) 10 121.06 143.79 6 60.00
17620. Chad (chadley69) 10 53.45 64.49 1 10.00
17621. Cefe (cefe_origol) 10 64.10 68.13 4 40.00
17622. Cat (cat_tanks_mod_maker) 10 68.62 78.82 2 20.00
17623. BigBoss (catalin2522) 10 57.65 63.67 0 0.00
17624. Josh (cantmakemoney) 10 90.34 99.56 2 20.00
17625. Californium (californium) 10 65.32 75.11 2 20.00
17626. Caddar (caddar) 10 117.74 147.15 5 50.00
17627. crowdofworkmen (bu_te) 10 87.22 96.34 5 50.00
17628. Butter (butterfingers_) 10 95.61 105.75 4 40.00
17629. burritorolls-royce (burrito... 10 82.09 96.89 2 20.00
17630. Budder40 (budder40) 10 49.06 55.03 1 10.00
17631. Saran (bssarankumar) 10 66.56 77.50 0 0.00
17632. Bra Steve (bra_steve) 10 66.29 74.10 3 30.00
17633. Brandon (brandonsg) 10 87.19 100.23 2 20.00
17634. Joël (bongo13) 10 94.23 103.06 4 40.00
17635. Bobby (bobnfuz) 10 64.57 78.62 1 10.00
17636. Ezra 🖤⛓ (blurr_yfa_ce) 10 46.77 51.09 1 10.00
17637. Ekko (blue9995566) 10 60.90 65.76 0 0.00
17638. blekekok (blekekok) 10 80.42 118.74 1 10.00
17639. blademagic (blademagic) 10 107.64 115.22 6 60.00
17640. Bruh (blackbacon08) 10 96.75 105.76 5 50.00
17641. bingcheng45 (bingcheng45) 10 93.78 108.87 5 50.00
17642. Hoa (billybobstuff) 10 69.24 73.58 3 30.00
17643. Bharat Kumar (bharat12345) 10 47.48 53.78 1 10.00
17644. Brian (bgriffeth) 10 61.15 76.62 3 30.00
17645. berserker02 (berserker02) 10 61.47 73.12 3 30.00
17646. Daniele (berdelicious) 10 77.45 86.86 1 10.00
17647. benny (bennythecow) 10 69.07 80.10 3 30.00
17648. Benny (bennyni101) 10 62.97 70.58 1 10.00
17649. Benko (benkay) 10 78.00 96.20 6 60.00
17650. Bob (benjiboy970) 10 84.54 90.58 1 10.00
17651. beefchow (beefchow) 10 67.52 79.17 2 20.00
17652. Austin (bear666) 10 61.94 70.19 5 50.00
17653. Kevin (baven) 10 57.33 69.97 3 30.00
17654. :) (bavadin) 10 118.62 129.59 4 40.00
17655. Gus (battm4n) 10 62.68 75.55 2 20.00
17656. Baris (baris23) 10 94.79 104.60 0 0.00
17657. _ (baga_rashy) 10 37.79 43.20 0 0.00
17658. Kaelyn (badpun56) 10 94.35 106.46 2 20.00
17659. Bad (badminton87) 10 47.34 65.76 2 20.00
17660. bachira (bachira) 10 59.55 65.03 2 20.00
17661. Babon (babonbunting) 10 56.27 68.82 2 20.00
17662. Anto (babafroga) 10 75.43 82.58 6 60.00
17663. Robert (b0ssofthisgym) 10 63.65 70.73 3 30.00
17664. Cootsynanus (a_yellow_evan) 10 87.16 100.35 3 30.00
17665. Michael (azumifan) 10 81.39 88.88 4 40.00
17666. Never (azasal) 10 93.15 109.57 2 20.00
17667. matcha (aydenkm) 10 87.46 109.44 2 20.00
17668. Mudit (awesomenessmax) 10 69.92 81.44 7 70.00
17669. Anthony (avald30) 10 75.41 86.72 3 30.00
17670. 🐐 (auaomamm) 10 96.91 108.41 5 50.00
17671. BigMan (attel) 10 80.03 89.70 4 40.00
17672. Isse (attalion) 10 74.81 83.32 3 30.00
17673. MAFiA BOSS (athrnls) 10 128.04 150.66 4 40.00
17674. Atakan (atakannguven) 10 54.59 70.02 4 40.00
17675. Jairo (asophiel) 10 63.89 80.53 2 20.00
17676. David (asian_masterium) 10 77.82 92.39 0 0.00
17677. Destiny (asaak) 10 46.72 55.39 0 0.00
17678. Arul (arulseth1998) 10 70.51 83.86 2 20.00
17679. Daniel (arpsteid) 10 83.73 98.08 5 50.00
17680. arman_ferdous (arman_ferdous) 10 85.30 92.64 2 20.00
17681. tstats[armanto] (armanto) 10 80.17 91.01 4 40.00
17682. i write code (_yay) 10 84.83 105.36 8 80.00
17683. Mr.Buttons (_tanuuuu) 10 85.05 93.72 3 30.00
17684. Megatypist (_megatypist_) 10 120.16 138.55 7 70.00
17685. Eoyzyc (_eoyzyc_) 10 34.94 46.27 2 20.00
17686. Fabian (zyzyx) 10 80.93 88.70 4 40.00
17687. Marz (zuchan) 10 94.41 109.12 6 60.00
17688. zoomrickyyy (zoomricky) 10 75.97 87.21 5 50.00
17689. Zachary (zjroote) 10 79.09 89.99 1 10.00
17690. Zir0 (ziiro) 10 93.75 105.60 4 40.00
17691. Tony (zhukant) 10 109.46 121.48 5 50.00
17692. Zen (zencreepz) 10 91.79 110.60 4 40.00
17693. zanydruid (zanydruid) 10 72.35 85.14 2 20.00
17694. Zak (zak1388) 10 73.24 96.74 5 50.00
17695. Cojo (zagoat) 10 62.27 70.51 1 10.00
17696. Tim (yutuyt) 10 112.35 132.08 8 80.00
17697. Zach (yo_zs) 10 58.60 73.16 1 10.00
17698. Aleksandar (yoursis) 10 53.68 62.93 3 30.00
17699. Yothin (yothinix) 10 60.75 66.75 0 0.00
17700. Kevin (yolonce) 10 50.65 57.92 2 20.00
17701. Yerkegul (yerkesha) 10 41.44 45.16 2 20.00
17702. Yelzhan (yelzhansky) 10 36.92 39.88 0 0.00
17703. yamrawr (yamrawr) 10 148.98 167.45 7 70.00
17704. yoshiking (y05h1k1ng) 10 57.82 70.64 2 20.00
17705. huge (xxxtentaciontrippiere... 10 46.31 58.45 2 20.00
17706. Ted (xted) 10 111.56 131.99 6 60.00
17707. Noah (xsonorous) 10 92.38 103.55 2 20.00
17708. xsharawi (xsharawi) 10 64.10 84.60 2 20.00
17709. Nick (xogtwo) 10 49.53 63.35 2 20.00
17710. xLikely (xlikely1) 10 113.72 124.99 7 70.00
17711. Lian (xlian) 10 84.26 106.87 4 40.00
17712. Zach (xachg) 10 70.92 79.00 4 40.00
17713. Hoesmad (woshinidie123) 10 74.32 86.93 2 20.00
17714. Fluffster (wlmao) 10 74.76 105.39 2 20.00
17715. Witre (witred) 10 74.31 91.50 6 60.00
17716. William (willkosasih) 10 66.58 71.19 1 10.00
17717. Nathaniel (wiiman) 10 59.41 68.13 4 40.00
17718. Walter (whunt5757) 10 93.70 115.67 4 40.00
17719. what (what_what_what) 10 97.06 114.98 4 40.00
17720. 50 Year Old Girl (whatsthis) 10 83.47 108.09 3 30.00
17721. Zachary (weiser) 10 83.35 97.23 4 40.00
17722. Wanizame (wanizame) 10 76.44 92.92 2 20.00
17723. TheDecentPretender (wamsly) 10 90.50 99.97 2 20.00
17724. Dean (wahrheit) 10 84.12 102.85 3 30.00
17725. V (vy171) 10 100.35 130.17 1 10.00
17726. Average (vuzid) 10 92.14 119.27 10 100.00
17727. Vojtěch (vojtar) 10 72.44 85.03 1 10.00
17728. Vic (vicjen) 10 99.60 114.09 6 60.00
17729. han (vapour_) 10 106.13 116.04 5 50.00
17730. van (van8878) 10 45.29 54.38 0 0.00
17731. Kevin (v3rmillian) 10 82.26 96.98 0 0.00
17732. Mats (uxorialrook) 10 85.40 94.79 3 30.00
17733. uska95 (uska95) 10 55.56 67.71 1 10.00
17734. Denni (uramazing) 10 102.08 114.44 7 70.00
17735. Smooth (undeadplayer) 10 49.55 54.41 1 10.00
17736. Orlando (ultraonlinexd) 10 46.47 61.79 0 0.00
17737. Esther (ueatmypoop) 10 58.68 70.63 1 10.00
17738. Typing (typotyper1738) 10 59.69 80.18 1 10.00
17739. Rider (typerrider) 10 116.04 132.79 6 60.00
17740. Andrew (typegad) 10 54.25 63.49 4 40.00
17741. Matthew (twixinator) 10 96.81 110.68 2 20.00
17742. Felix (twiizy) 10 71.51 82.27 4 40.00
17743. Daniel (turnercommadan) 10 66.83 71.80 3 30.00
17744. Jim (turkeyfetish) 10 90.03 103.33 5 50.00
17745. Mike (tsunami21) 10 93.91 105.94 1 10.00
17746. Taush (tsampley) 10 85.62 103.19 4 40.00
17747. TREMAINE (tremaine_m) 10 67.97 83.15 1 10.00
17748. Tour2738 (tour2738) 10 42.08 46.69 1 10.00
17749. ToncaIlPunta (toncailpunta) 10 77.57 89.05 4 40.00
17750. Token (token_typer) 10 77.47 91.63 3 30.00
17751. Isaac (tkdwarrior) 10 63.51 70.53 3 30.00
17752. hihihi (tjddb123456) 10 137.77 149.04 7 70.00
17753. Timmy (tjdaroya1) 10 99.07 115.95 9 90.00
17754. Tinky (tinkywinkyy) 10 82.77 94.14 2 20.00
17755. TinklyBell (tinklybell1608) 10 77.21 85.94 4 40.00
17756. Stewart (timberland9x) 10 63.05 83.95 0 0.00
17757. tilen (tilen219) 10 51.07 61.54 2 20.00
17758. Ella (tigger1854) 10 76.37 98.85 4 40.00
17759. TRUMP (tiepin) 10 93.01 102.01 2 20.00
17760. Mrigank (tickatron) 10 40.03 53.52 1 10.00
17761. @itz_ramy (thugsheep) 10 82.12 94.94 3 30.00
17762. Thooq (thooq) 10 57.53 61.23 2 20.00
17763. Lan (thien_hai13) 10 56.25 66.09 1 10.00
17764. Nikolas (the_sleepy) 10 75.89 79.36 1 10.00
17765. the_redcar (the_redcar) 10 93.67 123.69 6 60.00
17766. themar (themar) 10 57.26 66.13 1 10.00
17767. not_inte2 (theinte) 10 93.97 105.12 4 40.00
17768. Thang (thangvu7) 10 83.26 102.39 4 40.00
17769. Patrick (tepill) 10 100.76 116.87 4 40.00
17770. Teo (teotheterminator) 10 56.76 65.88 3 30.00
17771. Sean (tensai888) 10 80.92 97.21 3 30.00
17772. Templeton (templetontsai) 10 63.50 68.46 0 0.00
17773. funky (teletubbystan) 10 59.22 65.18 3 30.00
17774. Caleb (tekksic) 10 61.68 76.23 3 30.00
17775. Harshit (techallbyharshit) 10 67.15 80.30 2 20.00
17776. Tcoman (tcoman1) 10 67.27 72.54 6 60.00
17777. Luke (tbsky92) 10 93.15 110.75 9 90.00
17778. Tavora (tavora) 10 108.41 127.19 6 60.00
17779. Tatsky (tatskynuki) 10 151.19 191.75 6 60.00
17780. Andrew (taroth) 10 101.23 119.97 4 40.00
17781. Talbiya (talbiya) 10 37.12 43.09 4 40.00
17782. takeoutfoo (takeoutfoo) 10 102.43 121.23 6 60.00
17783. Andy (tactilegangriseup) 10 109.47 134.41 5 50.00
17784. Tasman (t4sm4n) 10 66.82 73.75 1 10.00
17785. Sybetron (sybetron) 10 34.21 43.97 1 10.00
17786. Sweeter (sweetervanilla) 10 96.29 112.21 5 50.00
17787. swat (swatxian) 10 64.59 74.83 5 50.00
17788. Sushanth (sushanthgeorgesur... 10 54.02 67.00 3 30.00
17789. Huy (xthyax) 10 58.98 68.01 3 30.00
17790. Sultan (sultanai) 10 92.68 109.64 4 40.00
17791. me (suited4hike) 10 126.04 143.15 10 100.00
17792. lior (sudden_lee) 10 57.22 66.57 0 0.00
17793. deegl0rd (stimoze) 10 93.61 100.85 4 40.00
17794. Sticfigure (sticfigure) 10 45.19 50.61 1 10.00
17795. Starmaster (starmasterx) 10 63.52 71.88 7 70.00
17796. Venice (starbucks272) 10 99.48 107.79 4 40.00
17797. StaliaN (stalian) 10 77.50 88.68 0 0.00
17798. Ok (ss__) 10 69.11 82.56 1 10.00
17799. Soph (sssoooppphhh) 10 85.18 98.02 1 10.00
17800. ssofia (ssofia_bas) 10 28.29 33.91 2 20.00
17801. speed (speed_boiiii) 10 64.70 76.25 3 30.00
17802. Speed (speedarmstrong) 10 95.73 119.65 3 30.00
17803. Specter (spectergrrim) 10 99.12 112.11 2 20.00
17804. Spammer (spammerforlife) 10 100.47 112.48 7 70.00
17805. K. (spacewalker) 10 111.10 128.77 5 50.00
17806. ejay (spacebars_) 10 79.53 86.11 2 20.00
17807. Moz (soul3n) 10 98.47 114.00 4 40.00
17808. mooth (sooruva) 10 80.87 90.19 4 40.00
17809. Sonic (sonicaks) 10 83.87 90.68 1 10.00
17810. bruh (sojucravings) 10 92.60 109.15 4 40.00
17811. Soggy (soggydog) 10 93.02 106.75 2 20.00
17812. SockYeh (sockyeh) 10 84.99 97.81 5 50.00
17813. void (soberr) 10 75.10 84.99 3 30.00
17814. saumitra (smtrd3) 10 38.89 44.76 0 0.00
17815. tiffany (skipperdee) 10 76.90 94.64 3 30.00
17816. Chris P. (sirjean_pepper) 10 97.28 109.39 4 40.00
17817. Sidveed (sidveed) 10 96.63 116.44 2 20.00
17818. shxvnk (shxvnk) 10 80.55 87.17 3 30.00
17819. Shivam Kumar (shivam51) 10 71.23 84.01 3 30.00
17820. (shinobukocho) 10 126.55 167.48 7 70.00
17821. TWICE Dahyun (sheenic) 10 83.58 100.25 5 50.00
17822. quit=trash (shatapfajjat69) 10 82.41 100.21 3 30.00
17823. Shashank (shanky92) 10 82.23 92.25 2 20.00
17824. Shania (shaniacans) 10 57.49 66.15 1 10.00
17825. Alan (sexillamasexi) 10 84.22 98.33 6 60.00
17826. sebastian (seviago) 10 48.51 54.96 2 20.00
17827. I_love_seulgi (seulgischurro) 10 94.57 103.17 1 10.00
17828. Sergio (sergio96c) 10 91.70 102.53 5 50.00
17829. Madhusudan (mainali449) 10 56.01 63.04 2 20.00
17830. RoyMcGround (maggyroyrowins... 10 25.99 28.60 1 10.00
17831. Orion (maggiea718) 10 73.58 82.82 3 30.00
17832. Mae (maeeeeee) 10 143.25 168.65 10 100.00
17833. Nagy (lurgul) 10 49.45 58.65 3 30.00
17834. Luke (lukep421) 10 82.94 94.89 1 10.00
17835. Gabe (lukeimyourdaddy) 10 76.45 82.42 6 60.00
17836. Lucite (lucite) 10 103.77 111.64 5 50.00
17837. Lucifer (lucifer_96) 10 47.04 55.74 2 20.00
17838. Lucas (lucaz_) 10 57.71 64.45 2 20.00
17839. Lowell (lowellfailingenglish) 10 95.59 120.25 3 30.00
17840. Loukas (loukatar) 10 77.81 86.97 1 10.00
17841. Lorky (lorkylav) 10 63.14 71.86 4 40.00
17842. ju (lordofthecoochie) 10 52.19 56.78 0 0.00
17843. 最靚嘅仔 (lookingdepres... 10 82.89 92.44 2 20.00
17844. Doc (lolnice) 10 97.78 125.18 6 60.00
17845. Stephen (lollidude) 10 81.66 94.58 1 10.00
17846. Lluna (lluna) 10 80.55 89.98 1 10.00
17847. lluis (lluissuros) 10 25.73 28.15 1 10.00
17848. simsimhae yagi (ljd1) 10 122.08 137.10 5 50.00
17849. liv (livlyf_) 10 62.58 68.75 1 10.00
17850. lisa (lisa99116) 10 79.07 106.05 1 10.00
17851. Linda (lindaslabbert) 10 31.42 38.61 0 0.00
17852. Youngbin (limesoda14) 10 74.71 80.37 1 10.00
17853. Giannis (lil_spani) 10 74.65 89.88 6 60.00
17854. boomer (lightaway) 10 51.13 62.66 0 0.00
17855. lea (leyley01) 10 37.13 41.61 0 0.00
17856. Francesco (lews_) 10 109.63 120.81 5 50.00
17857. Justin (leslav) 10 114.99 144.04 6 60.00
17858. leakcentral (leakcentral) 10 100.67 112.41 4 40.00
17859. always_choking (leadmen4y) 10 131.65 145.12 9 90.00
17860. Jason (laysonchillz) 10 73.61 83.60 3 30.00
17861. Veronica (latenightpizza) 10 97.51 111.20 6 60.00
17862. LastStar (laststar) 10 71.49 88.90 4 40.00
17863. Larry (larryquartz) 10 100.91 116.63 7 70.00
17864. Logan (larmack) 10 111.70 129.13 7 70.00
17865. Chris (kyoriosity) 10 99.24 114.65 10 100.00
17866. Sunny (kukie5) 10 90.00 97.39 4 40.00
17867. Chris (kryss_404) 10 63.75 72.70 2 20.00
17868. You're Slow (kronosxfleet) 10 69.01 79.82 2 20.00
17869. Christian (krisco) 10 136.47 156.38 4 40.00
17870. Big (kralefegaming) 10 62.39 72.87 2 20.00
17871. Koiysn (koiysn) 10 59.62 75.71 1 10.00
17872. Koii (koii2003) 10 80.97 89.35 5 50.00
17873. Richard (killerscotchy) 10 73.29 94.07 5 50.00
17874. kiki (kikifrederique) 10 37.05 41.82 3 30.00
17875. KickBull (kickbull) 10 89.99 106.69 3 30.00
17876. 🏎️t.me/abdulhamidsulto... 10 59.38 70.55 3 30.00
17877. Not telling (kevinveinein) 10 105.76 120.63 3 30.00
17878. Kevin (kevinchang823) 10 53.78 60.36 1 10.00
17879. Kevin (kevinator314) 10 91.26 95.74 5 50.00
17880. Kenshin (kenshin47) 10 96.10 110.85 7 70.00
17881. Kei 100 (kei100) 10 83.01 95.03 4 40.00
17882. bean (keenheen) 10 94.03 106.32 3 30.00
17883. Keanu (keanu72) 10 88.66 101.26 4 40.00
17884. Kyle (kbuschy) 10 89.16 104.87 1 10.00
17885. Kaz (kaz_the_kuz) 10 90.42 103.73 1 10.00
17886. Dennis (kavalier) 10 108.28 131.66 8 80.00
17887. kang (kasusuwowo) 10 86.52 104.14 6 60.00
17888. karim (karimkohel) 10 75.93 79.71 2 20.00
17889. kamikadze (kamikadze009) 10 69.94 76.05 1 10.00
17890. King of Pirates (kaizokuouu... 10 67.79 72.49 1 10.00
17891. Minh (kaishj91) 10 70.45 77.99 2 20.00
17892. Ka (kafong_0123) 10 39.09 45.10 0 0.00
17893. kae (kaelul) 10 52.52 63.96 5 50.00
17894. Joseph (jwkeating99) 10 98.84 108.93 5 50.00
17895. Just (justdandy_) 10 117.85 141.63 5 50.00
17896. lucy (justarat90) 10 73.84 84.60 4 40.00
17897. Jure (jujecat) 10 87.79 103.05 1 10.00
17898. Sid (judgementdey) 10 74.64 82.74 3 30.00
17899. Judd (judd123) 10 86.70 100.55 1 10.00
17900. jsve (jsve) 10 82.66 97.43 3 30.00
17901. Josh (jrc23) 10 83.11 96.44 4 40.00
17902. Jason (jpngfile) 10 99.99 113.57 4 40.00
17903. Josh (joshtegart) 10 112.08 145.91 3 30.00
17904. Nicholas (joshjoshjoshjosh) 10 107.75 145.27 5 50.00
17905. joey (josephb20252) 10 103.67 115.00 4 40.00
17906. bonsii (jorhlo) 10 88.39 99.19 3 30.00
17907. Jonathan (joni1234) 10 61.63 82.52 3 30.00
17908. Jonathan (jonathan_200605) 10 80.18 94.41 8 80.00
17909. Jonathan Justin (jonathanjw05) 10 96.91 102.67 4 40.00
17910. jolene (jolenech) 10 73.25 85.18 2 20.00
17911. Gamer (joksb2k) 10 44.27 47.89 2 20.00
17912. Sanjay (joker979) 10 62.11 78.00 3 30.00
17913. Ivan (john_the_unigoat) 10 51.11 64.19 0 0.00
17914. Garrett (joejoefriez) 10 79.31 98.91 2 20.00
17915. Kev (joebob1235) 10 90.70 106.24 5 50.00
17916. Antonio (joancoma05) 10 41.74 45.85 1 10.00
17917. Sep (jltariman) 10 63.53 71.43 1 10.00
17918. J (jkim55k) 10 64.57 72.18 5 50.00
17919. I can't type anymore (jjwiz... 10 77.73 95.37 5 50.00
17920. Josh (jjrandle1013) 10 63.92 72.34 1 10.00
17921. Joey (jj4ster) 10 104.42 129.76 6 60.00
17922. Jin (jinjohn) 10 50.41 55.92 2 20.00
17923. Jwarchild (jimmyhaffaren) 10 76.17 93.27 3 30.00
17924. Tim (jimbo112) 10 91.23 111.91 4 40.00
17925. Josh (jgeoppo) 10 59.19 68.05 2 20.00
17926. Joosep (jet_e) 10 80.51 88.84 2 20.00
17927. TheLegend27 (jethro2003) 10 99.95 107.66 6 60.00
17928. Jv (jemish_variya) 10 43.76 48.84 0 0.00
17929. KaptainFroggy_YT (jellybean... 10 74.92 86.08 1 10.00
17930. Jo (jelli017) 10 50.89 60.38 2 20.00
17931. jedishong (jedishong) 10 85.80 114.03 6 60.00
17932. Jon (jcrossley) 10 84.35 93.39 4 40.00
17933. Jin (jchoi1994) 10 134.88 152.29 9 90.00
17934. jboog (jboog) 10 79.87 91.88 8 80.00
17935. Bubbz (jaydenfiesta) 10 61.61 70.96 3 30.00
17936. Tom (javor) 10 76.74 83.89 5 50.00
17937. e (javascriptdude) 10 131.29 156.50 6 60.00
17938. Jamiel (jamiel_exe) 10 71.61 81.78 1 10.00
17939. Jamie (jam8554) 10 68.78 80.90 2 20.00
17940. Johann (jalohann) 10 111.07 136.35 8 80.00
17941. Jacob (jacobru) 10 54.58 66.40 0 0.00
17942. Jack (jack_tran04) 10 93.90 100.62 6 60.00
17943. M (izzyissad) 10 68.69 79.71 2 20.00
17944. neverbreaking170 (ivan28283) 10 140.80 161.28 6 60.00
17945. its_zaaid (its_zaaid) 10 42.63 48.50 0 0.00
17946. Tony (itsonlytony) 10 71.52 82.11 1 10.00
17947. kat (itskat_boba) 10 54.74 59.60 0 0.00
17948. Islam (islam_anwer) 10 47.14 55.32 1 10.00
17949. isaacgoe (isaacgoe) 10 97.45 118.71 3 30.00
17950. Instynkt (instynkt) 10 101.97 120.98 5 50.00
17951. InSaein (insaein) 10 49.26 56.55 1 10.00
17952. Kat (inoobo) 10 67.06 79.48 1 10.00
17953. Inferno2332 (inferno2332) 10 105.27 132.41 8 80.00
17954. Il Capitano (ilcapitano) 10 93.13 103.39 3 30.00
17955. creative (idoofus123) 10 144.74 158.69 5 50.00
17956. Ido (idodobird) 10 83.90 100.63 4 40.00
17957. Alexander (idkwhatimdoin9) 10 59.57 71.31 1 10.00
17958. icy (icyxo) 10 75.00 84.26 4 40.00
17959. hi (ibadattyping) 10 105.97 121.16 2 20.00
17960. Smith (iamhablo) 10 59.50 62.24 1 10.00
17961. Daniel (hyunholee13) 10 102.93 123.62 4 40.00
17962. Icy_Istanbul (hypzx_x) 10 82.00 95.95 0 0.00
17963. hydroPUMP (hydropump) 10 58.88 68.14 1 10.00
17964. kvin (hwkhoa) 10 82.04 93.97 5 50.00
17965. Howbtard (howbtard) 10 113.92 147.90 5 50.00
17966. HotTubStream (hottubstream) 10 88.49 97.80 4 40.00
17967. Patrick (hongkongfui) 10 90.03 107.85 2 20.00
17968. HK_BAKA (hkuzumaki) 10 50.52 60.59 2 20.00
17969. Henry (henrytidholm) 10 65.72 72.10 5 50.00
17970. hello1900 (hello1900) 10 18.77 20.99 4 40.00
17971. haylie (hayizme) 10 44.21 53.93 0 0.00
17972. Jan (hautix) 10 53.31 63.27 0 0.00
17973. Kakashi (hatakeclan) 10 87.93 112.81 4 40.00
17974. hasan (hasan2000) 10 75.98 85.32 2 20.00
17975. Zach (hardtoki11) 10 99.13 126.66 3 30.00
17976. Wellington (happydonut) 10 104.28 134.45 5 50.00
17977. Hannah (hannityyy) 10 98.45 117.13 3 30.00
17978. Harry (hajohlay) 10 110.67 130.13 4 40.00
17979. HeMAN (h3m4n) 10 37.31 44.26 0 0.00
17980. Gurman (gurmns) 10 83.82 99.71 1 10.00
17981. Gunel (gunel12) 10 41.96 46.67 1 10.00
17982. Gurveer (gundo_1) 10 64.60 76.70 0 0.00
17983. Smoto (grozmot) 10 57.45 62.65 2 20.00
17984. Godstime (gozi3) 10 51.44 60.81 4 40.00
17985. Robert (gorilla710) 10 92.43 103.15 6 60.00
17986. Gongster (gongster1) 10 95.01 109.13 5 50.00
17987. ishan (gmd_cuber) 10 60.68 66.53 3 30.00
17988. OblivionGlisor (gliscor2004) 10 86.32 100.85 6 60.00
17989. WHEN THE IMPOSTER IS SUS SU... 10 29.39 30.66 0 0.00
17990. Gino (gino758) 10 61.25 69.78 2 20.00
17991. Gianmarco (gianma) 10 63.02 75.96 0 0.00
17992. Superfast (ghoststop) 10 126.97 143.68 7 70.00
17993. GGanon (gganon) 10 88.49 97.85 5 50.00
17994. tian (gfriend) 10 90.23 99.62 5 50.00
17995. GeeBee_29 (geebee29) 10 60.33 71.57 1 10.00
17996. Jacob (gaycob) 10 75.69 83.48 1 10.00
17997. Gat (gatmonke) 10 62.63 69.69 0 0.00
17998. Gary (gary_dahmer) 10 75.04 86.38 2 20.00
17999. garin (garinholiyana) 10 57.29 60.52 0 0.00
18000. garbyal ✌(-‿-)✌ (garb... 10 104.05 115.62 7 70.00
18001. GamersFTV (gamersftv) 10 38.64 45.32 0 0.00
18002. Funnier04 (funnier04) 10 71.79 82.51 5 50.00
18003. Lauto (fuji_puji) 10 98.54 109.35 3 30.00
18004. freelo (majoreuphoria) 9 89.80 94.96 4 44.44
18005. siti (mahmudahsiti) 9 94.76 107.84 4 44.44
18006. mahmud (mahmoudtahaa111) 9 27.37 31.27 3 33.33
18007. Donovan (maggigorengayam) 9 71.78 79.00 2 22.22
18008. Max (maexxx) 9 88.31 93.30 2 22.22
18009. Lycarions (lycarions) 9 93.86 102.32 5 55.56
18010. Luther (luthermanhole) 9 111.09 133.20 4 44.44
18011. poopycock17 (luigi65536) 9 86.12 95.60 2 22.22
18012. Dhruv (loneninja__) 9 70.62 79.54 2 22.22
18013. Hunter (lokitypingusa) 9 91.28 103.40 3 33.33
18014. Ioishi (loishi) 9 59.04 64.67 3 33.33
18015. Logan (loganthewizkid) 9 49.52 56.04 3 33.33
18016. lockheed (lock_heed) 9 78.06 87.35 2 22.22
18017. Lochan (lochanr) 9 68.98 80.18 4 44.44
18018. Misael (llillill) 9 70.74 80.59 3 33.33
18019. liwmus (liwmu) 9 95.38 104.57 4 44.44
18020. Victor (liucow) 9 103.28 129.44 1 11.11
18021. Sam (litesam) 9 79.30 89.82 1 11.11
18022. Óskar (lillibilli) 9 69.52 82.91 0 0.00
18023. Lilith (lilith333) 9 97.17 103.44 8 88.89
18024. redragonnnnnnnnnn (liech) 9 107.74 114.69 5 55.56
18025. Your (lftam319) 9 67.61 72.18 1 11.11
18026. Ramsha (lexi25) 9 37.58 49.10 0 0.00
18027. tstats[levo2001] (levo2001) 9 58.71 68.94 3 33.33
18028. Levi (levimeijer) 9 57.12 63.73 1 11.11
18029. luce (leuvis) 9 54.87 61.26 1 11.11
18030. (leunn) 9 70.73 81.49 3 33.33
18031. lemon (lemongrabbb) 9 61.17 74.87 1 11.11
18032. FleshEyes (lejitt) 9 95.14 101.02 4 44.44
18033. Legacy (legacylegacy) 9 96.81 111.54 3 33.33
18034. Learning Bone (learning_bone) 9 66.73 71.89 4 44.44
18035. Lewis (lcole) 9 71.90 88.28 1 11.11
18036. chandu (lavinyoutube) 9 32.06 41.84 1 11.11
18037. James Ethan (laszerbeam) 9 91.41 105.22 6 66.67
18038. alex (larrythesnail82) 9 55.24 64.03 2 22.22
18039. laptop (laptopsakti) 9 44.72 46.66 2 22.22
18040. tstats[lapakatapulta] (lapa... 9 120.36 133.32 3 33.33
18041. lahmacun (lahmacun228) 9 61.56 67.50 2 22.22
18042. Sandesh (labradoodle) 9 74.35 82.33 1 11.11
18043. Denis (l2p200iqplays) 9 100.28 110.25 3 33.33
18044. KonoKono (kzunderscoresamao... 9 101.58 114.24 5 55.56
18045. Kyle (kyjasa88) 9 96.78 110.03 3 33.33
18046. Charles (kyaw12) 9 62.11 75.40 4 44.44
18047. kweg (kweg) 9 131.43 148.79 4 44.44
18048. Kai (kulturekiah) 9 56.27 64.13 2 22.22
18049. kuino, (kuino) 9 103.97 124.18 9 100.00
18050. ×͜×KRISHNA _ (krishna00) 9 48.72 54.87 1 11.11
18051. Jano (kossvk) 9 92.03 100.85 4 44.44
18052. Kyle (koshu) 9 64.37 77.50 0 0.00
18053. konvay (konvay) 9 124.85 140.92 9 100.00
18054. Koji (kojinb) 9 90.05 99.46 3 33.33
18055. Luca (kodzack) 9 84.43 98.71 3 33.33
18056. kodzy (kodzy) 9 88.53 101.89 2 22.22
18057. Allen (kochengoren) 9 72.48 83.08 1 11.11
18058. Kleuz (kleuz) 9 64.45 75.81 3 33.33
18059. Aly (kixiris) 9 55.66 68.66 9 100.00
18060. sigma shmoo (kingshmoo) 9 75.16 91.79 2 22.22
18061. Kai (kingkaikster) 9 69.08 76.25 1 11.11
18062. thia (kingbarney) 9 65.00 81.63 2 22.22
18063. kiara (kia_via_dia_arara) 9 50.97 66.15 2 22.22
18064. kiannu (kiannaj) 9 68.95 84.09 2 22.22
18065. Khende (khende) 9 64.07 71.29 9 100.00
18066. ionlytype60wpm (keyboardssl... 9 99.10 111.57 5 55.56
18067. Kevin (kevbobbly) 9 83.57 97.22 2 22.22
18068. hmmm (kesh______) 9 108.45 119.33 5 55.56
18069. k (ker1ne) 9 72.02 82.34 3 33.33
18070. Ken (kennoji) 9 83.27 117.87 8 88.89
18071. William (keneth10) 9 65.65 79.01 1 11.11
18072. Kempo (kempochinois) 9 55.10 63.60 0 0.00
18073. Kelopio (kelopio) 9 127.15 149.49 4 44.44
18074. Please use an appropriate n... 9 77.09 87.22 4 44.44
18075. Kin (kccchiu) 9 87.65 93.20 2 22.22
18076. kb (kbaccam) 9 94.78 110.08 4 44.44
18077. Katie (kaytay0111) 9 100.69 123.25 1 11.11
18078. kensen (kawatashi) 9 66.25 74.89 1 11.11
18079. Kavita (kavita_chaubey) 9 45.48 50.76 0 0.00
18080. Xero (kataclysm) 9 91.38 102.59 3 33.33
18081. ben (kashikura) 9 49.56 56.28 0 0.00
18082. kap (kappow) 9 107.99 121.44 5 55.56
18083. MySpaceBarIsBroken (kanto) 9 117.10 128.74 6 66.67
18084. kanacurry (kanacurry) 9 104.70 116.92 7 77.78
18085. Kamiye (kamiye) 9 91.75 101.05 2 22.22
18086. kamea (kamea) 9 95.58 111.27 2 22.22
18087. kaka (kakaburra) 9 89.44 102.81 4 44.44
18088. joy (jyyjng) 9 77.63 88.30 3 33.33
18089. Ben (jynn7) 9 107.38 127.64 5 55.56
18090. christine (just_trying_to_g... 9 62.59 77.94 1 11.11
18091. Justin (justin_ephemeral) 9 101.14 112.54 8 88.89
18092. John (jspar) 9 92.30 104.97 2 22.22
18093. jasmine (jsmine) 9 100.76 117.23 1 11.11
18094. j (jrdib57) 9 105.92 121.59 5 55.56
18095. Barokah (jowotulen) 9 94.56 102.40 3 33.33
18096. Josh (joshindahood) 9 92.86 102.89 2 22.22
18097. José (josehenrique91) 9 61.39 77.13 1 11.11
18098. joris (jorisss) 9 86.63 96.08 5 55.56
18099. Jordan (jordansmithnz) 9 81.29 99.18 2 22.22
18100. Jordi (joorrrrrrrr) 9 58.22 68.81 4 44.44
18101. Jon (jonlee17) 9 70.51 81.22 3 33.33
18102. Johann (jona_die_jood) 9 60.50 69.16 0 0.00
18103. John (jolomaho) 9 59.58 63.47 1 11.11
18104. Jo (joemamma_38) 9 125.99 144.88 3 33.33
18105. jnnwn (jnnwn) 9 101.37 108.01 6 66.67
18106. Jordan (jmoneymyer) 9 67.88 75.83 0 0.00
18107. Jeremy (jmetzger55) 9 75.99 94.88 1 11.11
18108. Matin (jivago) 9 63.71 73.39 2 22.22
18109. Jennifer (jinglebingo) 9 92.53 102.49 3 33.33
18110. jimmy (jimnish) 9 44.62 49.44 1 11.11
18111. JIHAD (jihad_14) 9 63.91 68.29 4 44.44
18112. Jerry (jerry_licious) 9 107.24 114.24 5 55.56
18113. Jerry (jerry300) 9 77.28 82.85 1 11.11
18114. jeans (jelowo) 9 72.95 95.07 2 22.22
18115. Jed (jed_) 9 69.46 78.42 1 11.11
18116. Jay (jaysalvi) 9 94.18 108.54 2 22.22
18117. Jayden (jaydensar) 9 96.25 113.87 3 33.33
18118. jawes (jawes123) 9 97.79 114.78 6 66.67
18119. jasmine (jasminneee) 9 68.07 73.03 2 22.22
18120. Jan (janm2001) 9 76.08 87.25 2 22.22
18121. jam (jamola) 9 101.22 113.25 5 55.56
18122. James (james000) 9 71.21 80.42 0 0.00
18123. Jamie (jalaymie) 9 74.28 83.95 3 33.33
18124. jaemy (jaemywest) 9 50.65 57.32 0 0.00
18125. acjk (jackolant199) 9 69.38 80.23 1 11.11
18126. Jack (j4ck6643) 9 75.54 82.97 5 55.56
18127. I3B (i_3b) 9 56.39 62.30 8 88.89
18128. Eren Yeager (itzadit) 9 65.06 73.43 1 11.11
18129. Kevin Jeonghun (itskevinjeong) 9 71.94 77.38 5 55.56
18130. ir4un (ir4un) 9 53.48 67.08 2 22.22
18131. IQ1537 (iq1537) 9 131.41 146.28 7 77.78
18132. Libby (inkgenious) 9 68.29 74.25 2 22.22
18133. Vincent (indronna) 9 82.07 90.70 4 44.44
18134. imsynthex (imsynthex) 9 77.92 96.36 5 55.56
18135. aerora (imqyuu) 9 140.41 157.78 9 100.00
18136. Sam (ilikeyourcutghee) 9 86.16 99.33 2 22.22
18137. Reece (iifuze) 9 104.45 122.73 4 44.44
18138. IGO (igo_) 9 65.32 77.18 3 33.33
18139. Igor (igotim) 9 72.58 80.97 2 22.22
18140. Icecuber (icecuber) 9 102.37 112.78 3 33.33
18141. ICANNOTLOSE (icannotlose) 9 134.63 169.24 6 66.67
18142. konnie (ibeatonwhitewomen) 9 76.58 84.53 3 33.33
18143. pillows (hyluu) 9 149.61 167.97 8 88.89
18144. John (hylkinator) 9 108.96 128.62 5 55.56
18145. HY (hygh) 9 33.02 37.45 0 0.00
18146. Hunter (hunterup) 9 98.79 106.96 4 44.44
18147. hunter (hunter667) 9 75.57 86.09 4 44.44
18148. Vlad (hunter4858) 9 80.93 94.16 1 11.11
18149. HUng (hunggnuh0407) 9 78.69 93.25 2 22.22
18150. Who (hunatank) 9 79.83 97.18 1 11.11
18151. Roni (human_ro) 9 85.21 93.70 7 77.78
18152. Shohid (humangod) 9 87.06 112.97 2 22.22
18153. hoku✨ (hokuyato) 9 89.45 96.01 2 22.22
18154. Van Hoang (hoangelec) 9 92.71 106.70 3 33.33
18155. Hmed (hmed_belgassem) 9 34.52 38.20 1 11.11
18156. HiDa (hiida) 9 111.03 129.89 4 44.44
18157. The (hermaninator) 9 64.91 72.20 4 44.44
18158. Adrian (hellfi_18) 9 50.07 55.41 3 33.33
18159. hela (helabwr) 9 49.23 52.41 2 22.22
18160. healy (healy1453) 9 88.82 101.70 3 33.33
18161. headtr1p (headtr1p) 9 100.16 118.12 6 66.67
18162. Typer (haydyn49) 9 77.03 83.65 1 11.11
18163. Kevin (havek) 9 107.76 119.43 5 55.56
18164. Taika (hariyoshi41) 9 84.93 92.65 4 44.44
18165. HARI (hariom_01) 9 49.78 54.01 1 11.11
18166. harbeanger (harbeanger) 9 97.64 102.42 4 44.44
18167. Torben (hansi36) 9 62.88 71.73 7 77.78
18168. Hansel (hansels) 9 65.95 73.11 2 22.22
18169. Hannah (hannahwagner) 9 82.80 92.61 3 33.33
18170. Hannah Mei (hannahmei_steury) 9 52.08 64.05 2 22.22
18171. Michael (hangene92) 9 108.98 128.88 9 100.00
18172. Hamburgahh (hamburgahh) 9 91.93 108.91 2 22.22
18173. Gabriel (halamawala) 9 109.15 118.68 5 55.56
18174. HackzPlayz (hackzplayz) 9 71.99 79.63 3 33.33
18175. Turkey (habibiturkey) 9 84.09 104.57 5 55.56
18176. Anakin (gunmoon) 9 97.60 104.53 5 55.56
18177. Gum (gumwrapper) 9 80.23 85.30 3 33.33
18178. Kevin (gudern) 9 95.59 119.75 6 66.67
18179. ed sheeran (guccigangtae) 9 61.50 73.34 0 0.00
18180. John (gryndal) 9 81.57 88.55 5 55.56
18181. Alexander Grill (grill__alex) 9 57.13 64.94 1 11.11
18182. Gribbit (gribbit) 9 60.39 69.26 2 22.22
18183. Gaby (grebliale) 9 90.58 106.62 3 33.33
18184. Pandaru (grancrackerr) 9 87.79 97.68 5 55.56
18185. Vamsi Krishna (gordongecko) 9 71.72 78.42 4 44.44
18186. Josh (goldfingerer) 9 87.52 98.80 5 55.56
18187. Nguyen (gohweiz) 9 50.87 70.08 6 66.67
18188. mike (godlykanadian) 9 81.60 86.07 2 22.22
18189. GM (gmbao) 9 94.98 104.53 4 44.44
18190. Letsy (glitchyletsy) 9 70.89 95.09 4 44.44
18191. glenn (glenneroo) 9 104.33 119.98 7 77.78
18192. Ghost (gh0st3423) 9 73.09 91.53 2 22.22
18193. Tamjid (getrektfab) 9 47.59 54.10 2 22.22
18194. Max (getmackt) 9 80.22 88.06 6 66.67
18195. Greg (gecko231) 9 89.89 108.17 3 33.33
18196. Gauley (gauley) 9 70.21 77.94 6 66.67
18197. Gansukh (gansuh) 9 40.95 48.44 2 22.22
18198. gamesgant313 (gamesgant313) 9 91.57 112.00 9 100.00
18199. Gallagher (gallaghercat11) 9 60.49 70.36 1 11.11
18200. Owen (furyng) 9 65.30 71.37 9 100.00
18201. Furaha (furfur_beast) 9 71.25 78.95 1 11.11
18202. Mike (fuccuppo) 9 75.26 88.22 1 11.11
18203. Pink Mutt (frugalmussel) 9 70.13 83.31 1 11.11
18204. Adimas (frostyslr) 9 100.43 117.67 7 77.78
18205. Freddo (freddo7) 9 97.82 110.25 3 33.33
18206. Freddie (freddiesanchez) 9 92.55 106.87 2 22.22
18207. Ferrari (fluidcoder) 9 70.62 76.95 4 44.44
18208. Ruth (flirtatiouswizard) 9 90.79 100.16 2 22.22
18209. FlippLoki (flipploki) 9 94.69 114.83 4 44.44
18210. Franklin (flipfloppm) 9 122.47 149.35 7 77.78
18211. 297 (flightsim297) 9 132.29 161.89 8 88.89
18212. Kuldip (flash007) 9 69.22 74.44 3 33.33
18213. Flappy (flappysnake) 9 47.57 54.12 0 0.00
18214. Slow_AF (flaming_gladius) 9 77.42 85.15 1 11.11
18215. Jeremiah (fiveminus1) 9 101.73 129.45 3 33.33
18216. fintelia (fintelia) 9 79.08 85.71 2 22.22
18217. Oliwer (financialojay) 9 46.88 52.64 3 33.33
18218. Fred (fcbsd) 9 45.81 55.29 3 33.33
18219. Farkhan (farkhann) 9 56.75 72.20 0 0.00
18220. Kai حيادي (famboy32) 9 92.41 111.00 5 55.56
18221. Levi (fajpaj) 9 96.29 113.61 2 22.22
18222. Amaranth (fadingamaranth) 9 93.06 110.89 3 33.33
18223. EXT YOYO (ext_yoyo) 9 41.78 59.87 2 22.22
18224. Nathan (exodus_king) 9 82.32 89.43 4 44.44
18225. Fingerkart sweat (exford0) 9 110.26 115.59 5 55.56
18226. daddy (evilaristotle) 9 61.23 66.51 2 22.22
18227. John (everderp) 9 93.64 115.67 4 44.44
18228. Evanz (evanzyt) 9 70.44 78.16 4 44.44
18229. espo (espooooo) 9 86.12 105.37 3 33.33
18230. Nick (escalt) 9 104.43 125.88 6 66.67
18231. (erny2) 9 105.42 115.30 5 55.56
18232. epicgamer412 (epicgamer412) 9 109.23 124.34 5 55.56
18233. Endku (endku) 9 75.43 85.21 1 11.11
18234. Mohammed (enchantful) 9 90.75 99.95 2 22.22
18235. Elvy (elvy_) 9 48.93 57.40 3 33.33
18236. Elemental (elementl) 9 99.68 116.69 3 33.33
18237. Eldin (eldin_) 9 59.86 74.36 2 22.22
18238. Elaine (elainehuang) 9 53.83 63.11 0 0.00
18239. Ethan (egoldman) 9 99.80 122.89 5 55.56
18240. Edward (edwmai18) 9 75.64 98.80 3 33.33
18241. Eduard (eduard20) 9 102.88 116.06 4 44.44
18242. engie (edrian_a) 9 106.12 126.44 3 33.33
18243. EddieVonShmeddie (eddievons... 9 84.17 102.75 2 22.22
18244. Ecila246 (ecila246) 9 47.14 50.78 0 0.00
18245. Echo (echoet) 9 65.59 81.47 4 44.44
18246. DZ_no (dzeano) 9 83.26 91.09 3 33.33
18247. Dylan (dyl0e) 9 96.31 101.90 3 33.33
18248. Drake (dunkchai) 9 83.34 97.78 4 44.44
18249. Sam Luke (ducksako) 9 82.32 95.95 2 22.22
18250. Shamit (dr_neshmitz) 9 88.28 96.80 3 33.33
18251. Drixppy (drixppy) 9 49.75 57.11 2 22.22
18252. John (driftan) 9 103.20 115.61 3 33.33
18253. Dries (driesvanspauwen) 9 91.16 101.75 4 44.44
18254. John (drchase) 9 106.53 114.90 3 33.33
18255. Kris (doyouthink) 9 92.81 108.90 4 44.44
18256. DottyShark31762 (dottyshark... 9 52.74 64.56 2 22.22
18257. Juan (dostoevsky) 9 64.14 73.59 1 11.11
18258. Sophie Feldman (doodlefinny) 9 96.19 114.65 4 44.44
18259. Kyle (donttouchmyrice) 9 90.05 110.61 6 66.67
18260. Dominikus (dnk_dom) 9 36.33 43.04 2 22.22
18261. Keegan (djkeegs) 9 84.51 96.04 2 22.22
18262. Ian (disnailandd) 9 107.33 133.79 6 66.67
18263. Velislav (disaster_veli) 9 45.01 49.39 1 11.11
18264. J (dingkid) 9 117.45 125.49 5 55.56
18265. Alan (dick_licker666) 9 90.00 116.87 2 22.22
18266. DewWhite (dewwhite) 9 68.70 75.98 6 66.67
18267. Devin (devingalway) 9 107.27 123.56 2 22.22
18268. Deux (deuxgrosman) 9 94.51 105.34 2 22.22
18269. joanna (deulseobs) 9 120.97 137.00 6 66.67
18270. Domenic (denenfx) 9 110.88 127.07 3 33.33
18271. Tobi (demizu_) 9 110.75 122.39 4 44.44
18272. delfador42 (delfador42) 9 80.34 86.20 4 44.44
18273. Roxx III (deathsoul117004) 9 58.37 66.05 2 22.22
18274. Samson (deathreturns) 9 43.31 49.54 1 11.11
18275. David (davidt585) 9 97.34 108.11 1 11.11
18276. David (davidsayshello) 9 80.25 92.81 3 33.33
18277. DavidFinlForm (davidfinalform) 9 49.17 55.02 0 0.00
18278. DankAlzein (dankalzein) 9 121.93 140.08 6 66.67
18279. arin (dakotubbs) 9 51.07 65.90 0 0.00
18280. nunya (daintyfawn) 9 82.09 111.87 9 100.00
18281. Dauniverse (daimabao2003) 9 60.49 67.96 3 33.33
18282. D (daikuri) 9 103.76 117.24 4 44.44
18283. Mark (cyclingguy536) 9 80.26 92.96 1 11.11
18284. Nid (cyanid_) 9 81.45 97.80 2 22.22
18285. tyler (cyanamethyst) 9 95.11 113.83 3 33.33
18286. Christian (cwoo) 9 93.67 107.64 6 66.67
18287. O (cvxnjopsad) 9 86.62 98.82 2 22.22
18288. Ryan (cuoituoi1996) 9 92.33 114.57 4 44.44
18289. Cody (cuday) 9 91.07 104.44 4 44.44
18290. halloo (crystaalsnow) 9 57.34 66.08 2 22.22
18291. shoop (crimmsy) 9 87.53 98.64 4 44.44
18292. Oual (crankcrash) 9 71.65 90.64 3 33.33
18293. Charly (cpn29) 9 43.98 51.26 1 11.11
18294. Edvin (cowsmacker69) 9 64.44 79.56 4 44.44
18295. Cotle (cotle) 9 53.48 66.33 2 22.22
18296. Fast (cooloppo) 9 88.40 96.81 4 44.44
18297. Ian (coocooman3) 9 84.60 93.28 2 22.22
18298. Wilko (colacake84) 9 83.94 92.95 3 33.33
18299. Cole (cmrrockstar85) 9 106.09 121.38 5 55.56
18300. Bassim. (cmpleteidiot) 9 94.30 113.83 3 33.33
18301. Clit (cliffcatastrophe) 9 146.20 161.46 4 44.44
18302. Xenomorph (claygnot10) 9 88.86 104.48 1 11.11
18303. charlie (cl23456) 9 86.68 101.74 2 22.22
18304. Classical (cl123) 9 47.53 56.91 1 11.11
18305. Cole (ckoehler) 9 77.42 93.98 3 33.33
18306. Cijarot (cijarot) 9 70.86 81.09 2 22.22
18307. Chub (chubbyhands) 9 67.47 80.70 3 33.33
18308. Christian (christian9182) 9 72.74 78.95 4 44.44
18309. Chris (chrisbones) 9 70.86 83.97 2 22.22
18310. Christopher (chrisaua) 9 83.18 101.31 5 55.56
18311. Kevin (chqu7424) 9 91.83 104.08 6 66.67
18312. Chlebíček (chlebicek) 9 36.31 42.49 0 0.00
18313. Lii4 (chjh21005) 9 71.67 79.78 2 22.22
18314. tstats[chihayafuru] (chihay... 9 123.78 134.07 6 66.67
18315. Kachika (chickhicks_) 9 112.09 137.74 4 44.44
18316. cherub (cherub) 9 111.89 126.79 4 44.44
18317. Eduardo (chekedu) 9 47.38 63.29 0 0.00
18318. Jordan (cheetoburritoes) 9 88.22 95.72 3 33.33
18319. LOL (cheesecakeisgud) 9 117.74 129.25 5 55.56
18320. chedted (chedted) 9 78.93 91.73 2 22.22
18321. Chaws5 (chaws5) 9 111.36 120.37 6 66.67
18322. Manos (chatzakes) 9 68.39 77.44 2 22.22
18323. Charmen (charmen) 9 56.03 64.20 3 33.33
18324. charles (charles1106) 9 60.34 70.96 2 22.22
18325. chakuch (chakuch) 9 62.90 84.18 1 11.11
18326. Cian (ceol93) 9 110.76 123.00 6 66.67
18327. Ce (celineusa) 9 86.45 100.96 3 33.33
18328. Carl (cbho73) 9 105.52 112.55 2 22.22
18329. Tika (catluvr543) 9 124.67 146.60 7 77.78
18330. Jason (cathayjason) 9 104.97 115.34 6 66.67
18331. Cassius (cassius_vlok) 9 53.82 62.37 0 0.00
18332. Carbon (carbon28) 9 69.28 80.51 3 33.33
18333. Cao Sy Hai (caosyhailong99) 9 95.29 110.17 2 22.22
18334. Sniffff (can_i_sniffff) 9 67.05 81.71 4 44.44
18335. Cameron (cameron__) 9 78.78 91.76 4 44.44
18336. Lia (calumhood_) 9 76.38 90.15 4 44.44
18337. Calsuis (calsuis) 9 86.29 98.13 3 33.33
18338. mechanical (cakesogood) 9 95.11 132.97 4 44.44
18339. Type (cainvelasquez) 9 75.01 87.46 6 66.67
18340. LongGone (byejack123) 9 64.72 72.28 0 0.00
18341. BWho? (bwho) 9 90.91 97.48 3 33.33
18342. Alex (buttonmeister) 9 75.73 88.94 4 44.44
18343. Topher (burritopher) 9 70.28 82.76 3 33.33
18344. Burner (burnerburner) 9 78.43 89.24 4 44.44
18345. Bucketboi (bucketheadmit13) 9 81.99 94.34 3 33.33
18346. Jason (buckbuck5646) 9 113.50 133.74 7 77.78
18347. brian (bsill) 9 56.65 68.00 2 22.22
18348. Bruce (bs99) 9 54.51 59.89 1 11.11
18349. Bryan (bryangne) 9 75.80 92.70 2 22.22
18350. aaron (brwnmn6) 9 92.35 109.24 3 33.33
18351. bronts (brontus) 9 86.86 103.34 2 22.22
18352. Matt (britzkrieg) 9 91.66 105.60 3 33.33
18353. Brekzit (brekzit__) 9 73.13 86.55 2 22.22
18354. Brandon (brandongva) 9 63.86 70.24 4 44.44
18355. Francisca (borg58hd) 9 65.61 76.23 3 33.33
18356. Tristan (bombomb) 9 57.38 80.13 5 55.56
18357. Max (bolognacolonel) 9 84.16 90.25 5 55.56
18358. dead (bob_mcbobberbob) 9 71.57 81.53 3 33.33
18359. Borislav (bobun) 9 83.91 94.33 1 11.11
18360. Bobby (bobbydhiman69) 9 92.90 104.62 3 33.33
18361. BlueSlimeX (blueslimex) 9 85.02 94.74 8 88.89
18362. blues (blues856) 9 110.14 127.86 3 33.33
18363. blublueagle (blublueagle) 9 58.83 66.49 2 22.22
18364. Bilguun (blgn94) 9 57.30 63.92 2 22.22
18365. Jesse (bleedobsidian) 9 73.46 91.01 4 44.44
18366. Eejay (blazesfolife) 9 80.50 87.33 4 44.44
18367. Daniel (blastanks) 9 100.53 117.49 2 22.22
18368. Saul Goodman (blarg_23) 9 74.44 82.07 2 22.22
18369. frederik (birgerbrosa) 9 90.27 105.17 3 33.33
18370. biotox (biotoxz) 9 112.61 134.34 5 55.56
18371. bincent (bincentlife) 9 85.66 103.39 6 66.67
18372. emmanuel (bigginer20) 9 25.54 29.23 2 22.22
18373. Big Bird (bigbird61) 9 34.39 38.47 0 0.00
18374. bido (bidoteima) 9 97.94 121.84 7 77.78
18375. batmunkh (batmunkh) 9 56.13 61.46 0 0.00
18376. Son (baby_hanz) 9 95.57 109.26 3 33.33
18377. ¯\_(ツ)_/¯ (babanin) 9 73.46 82.31 5 55.56
18378. A Newbie (a_newbie_a) 9 55.38 62.64 1 11.11
18379. Azhar (azhartyper123) 9 43.80 52.03 2 22.22
18380. envy (ayytsklmao) 9 103.06 117.62 1 11.11
18381. AyuAnchor (ayu_anchor) 9 28.25 33.97 3 33.33
18382. Emilio (ayasesenpai) 9 75.94 85.47 4 44.44
18383. Paul (axxmodeus) 9 69.89 80.52 4 44.44
18384. Abigayle (awesomeness2470) 9 42.39 53.24 0 0.00
18385. Alex (awb101) 9 81.75 95.16 3 33.33
18386. Blyon (avocado_punched) 9 78.41 88.34 2 22.22
18387. Vignesh (avkvignesh) 9 68.25 73.88 2 22.22
18388. Avil (avilvineko) 9 55.40 60.77 0 0.00
18389. au_hermit (au_hermit) 9 72.53 85.28 4 44.44
18390. Hugh (atticush99) 9 86.37 96.13 4 44.44
18391. [][][][] (atomskk) 9 116.09 141.12 5 55.56
18392. Blitz (athul) 9 112.43 124.12 4 44.44
18393. Dustin (athleticsaddict) 9 95.38 108.03 5 55.56
18394. Atabek (atabekarapov14) 9 73.22 91.25 2 22.22
18395. Samit (astro_0) 9 69.62 84.19 3 33.33
18396. Andre (astrothetypist) 9 96.93 107.09 3 33.33
18397. panda bear (astronicus) 9 137.42 147.81 6 66.67
18398. cody (astro8192) 9 65.97 69.41 3 33.33
18399. Alex (aspectings) 9 96.74 123.99 9 100.00
18400. あしくさい (asikusai) 9 77.09 86.21 2 22.22
18401. Asian (asiansupremacy) 9 102.95 119.02 7 77.78
18402. 😷 (ashraaf_k) 9 59.64 71.64 2 22.22
18403. Arvid (arvid_a) 9 54.16 60.78 0 0.00
18404. aiman (armm) 9 27.96 33.26 1 11.11
18405. Scotty (scoma) 9 104.29 124.69 2 22.22
18406. Samantha (sbscruton) 9 50.92 59.48 0 0.00
18407. Kittatro (saysikerightnow) 9 71.67 79.31 2 22.22
18408. NEM0 (saybloo) 9 97.75 113.64 6 66.67
18409. grubres (saveall) 9 117.89 128.94 1 11.11
18410. Saugat (saugat2003) 9 41.90 47.18 0 0.00
18411. saturn (sat3rns) 9 62.02 79.21 9 100.00
18412. sasmit_qwerty (sasmit_neogi) 9 83.95 120.35 3 33.33
18413. Sasha (sasha_satanenko) 9 67.88 80.08 3 33.33
18414. IDK (sarpain) 9 59.21 64.14 2 22.22
18415. Phrog (sargent_frog) 9 86.74 138.49 7 77.78
18416. ChlamydiaHaver (sarcasmx) 9 130.08 137.71 6 66.67
18417. Saph (saphie) 9 85.38 98.76 4 44.44
18418. Jose (sand62) 9 65.70 78.27 3 33.33
18419. sam (samx90s) 9 45.05 53.84 1 11.11
18420. mikduc (samurai_dodo) 9 76.41 90.47 2 22.22
18421. sammito1 (sammito1) 9 106.47 115.74 3 33.33
18422. Samuel (sambg) 9 100.49 109.81 6 66.67
18423. ahmed (sakakill) 9 48.93 53.72 0 0.00
18424. sahil (sahil9057) 9 57.70 68.34 1 11.11
18425. Sahil (sahilmandoliya) 9 45.37 53.15 0 0.00
18426. James (sagpro_23) 9 73.62 80.70 2 22.22
18427. Saeed (saeed247) 9 70.17 83.12 2 22.22
18428. suki (sackclothandashes) 9 99.51 110.88 2 22.22
18429. Guo (s9723) 9 58.50 66.42 1 11.11
18430. siddhanth (s1ddhxnth) 9 69.08 79.43 2 22.22
18431. A (russ1anrock3t) 9 84.38 95.63 9 100.00
18432. Roi (rugh) 9 65.92 72.25 2 22.22
18433. Ethan (rtdrtd) 9 117.42 132.54 3 33.33
18434. Robert (rpmulligan) 9 86.65 105.40 1 11.11
18435. Yash (royal_ralhi) 9 28.17 33.08 2 22.22
18436. Changnam (rotoflemf) 9 55.50 60.24 1 11.11
18437. Roshan (roshan_) 9 73.57 88.07 4 44.44
18438. Ultralord (ronelijahruiz) 9 98.31 119.82 2 22.22
18439. Callum (rockwallaby) 9 51.39 59.32 0 0.00
18440. Alessandro (rocchia) 9 80.82 94.54 2 22.22
18441. Ronald (roanlds12345) 9 91.50 102.23 3 33.33
18442. Quang Trung (rikateamovt1) 9 69.27 76.74 3 33.33
18443. Richard (richyk1) 9 95.96 111.11 3 33.33
18444. Rice (rice363) 9 86.16 92.56 3 33.33
18445. rhyno3d (rhyno3d) 9 92.50 110.80 6 66.67
18446. Randy (rhomusic) 9 96.62 104.47 4 44.44
18447. Tyler (rhodetyl000) 9 79.18 82.95 5 55.56
18448. rhinoracer (rhinoracer) 9 46.84 51.71 1 11.11
18449. Keyan (rezor) 9 95.16 110.85 6 66.67
18450. Zhaparka (retsinnal) 9 47.80 57.95 0 0.00
18451. Red (redsharp) 9 69.27 85.58 3 33.33
18452. Redox (redox_p) 9 96.58 109.27 2 22.22
18453. Raostrich (raostrich) 9 87.82 98.57 2 22.22
18454. Rafa (rafimm) 9 41.68 50.41 2 22.22
18455. S3LVA (r06ramanat) 9 76.74 81.92 4 44.44
18456. qwerty443 (qwerty443) 9 46.58 54.27 1 11.11
18457. Quzrin (quzrin) 9 99.10 107.09 2 22.22
18458. qusdty (qusdty) 9 36.51 43.04 1 11.11
18459. Quer (queroin) 9 61.91 83.24 0 0.00
18460. hand (quarterpastnine) 9 119.33 129.45 5 55.56
18461. quackstuff (quackstuff) 9 84.67 87.80 3 33.33
18462. Riley (qpixel) 9 92.24 101.64 3 33.33
18463. Pupill (pupill) 9 63.64 71.95 7 77.78
18464. Puleva (puleva) 9 77.33 93.73 2 22.22
18465. Tom (pugsay) 9 92.57 101.92 2 22.22
18466. pudge (pudge_phatt) 9 90.53 100.48 4 44.44
18467. Proxima (proxima009) 9 62.27 66.39 4 44.44
18468. Protik (protiknag) 9 59.13 67.77 0 0.00
18469. David (prosic723) 9 49.56 53.39 0 0.00
18470. Project (project_racer) 9 103.99 121.45 6 66.67
18471. Kasper (probablykasper) 9 95.43 104.78 4 44.44
18472. Powerid (poweriddd) 9 85.93 97.13 3 33.33
18473. Matthew (potqto) 9 87.28 102.53 1 11.11
18474. Potate (potatocloud) 9 64.00 69.77 2 22.22
18475. bill nye (pokepo6) 9 91.52 103.48 2 22.22
18476. (poke1) 9 153.24 171.45 9 100.00
18477. plupl (pluppypluplplupus) 9 72.13 88.91 1 11.11
18478. Plommon (plommon) 9 98.81 108.22 4 44.44
18479. PKDDDroid (pkdddroid) 9 79.21 88.71 3 33.33
18480. egg (pipidozer) 9 63.86 76.25 2 22.22
18481. Nathan (pimpleton) 9 106.14 127.60 2 22.22
18482. pigeonistic (pigeonistic) 9 121.98 133.64 6 66.67
18483. K (phua8686) 9 50.39 54.70 0 0.00
18484. Amangus (phsycomonkek1) 9 81.66 91.47 3 33.33
18485. Phoebe (phoebek99) 9 91.79 113.15 5 55.56
18486. Peyton (peytondk) 9 102.21 112.74 9 100.00
18487. Pernesz (pery) 9 81.24 95.08 5 55.56
18488. penguiny2001 (penguiny2001) 9 98.61 106.98 4 44.44
18489. Peak (peak_dvorak) 9 114.77 139.35 9 100.00
18490. Pcgnome (pcgnome) 9 95.14 115.51 5 55.56
18491. Tappy_333 (pat29403) 9 65.96 73.36 2 22.22
18492. Brendan (partyhipster) 9 108.85 127.06 6 66.67
18493. Gaurav (parthbudds) 9 68.18 76.20 2 22.22
18494. Parhy (parhy) 9 94.45 108.99 3 33.33
18495. Max (parabalt) 9 99.12 120.18 6 66.67
18496. JazzyP (pandawarrior101) 9 92.35 109.71 0 0.00
18497. Gabriel Owen (owen2) 9 40.64 48.23 2 22.22
18498. OMG (omgawannabe) 9 92.45 103.01 6 66.67
18499. Daniel (omegadan_) 9 78.89 89.95 2 22.22
18500. Paolo (oloapss) 9 78.26 95.17 5 55.56
18501. Oliver (oliver_22_11) 9 42.50 46.92 3 33.33
18502. 🦈 (okamiro) 9 55.77 63.11 2 22.22
18503. Ohad (ohadshwartzman) 9 94.91 114.46 2 22.22
18504. totnamjoon (off_the_page) 9 81.30 90.70 2 22.22
18505. yellow car (oddsorcery) 9 99.55 109.44 9 100.00
18506. iGeo (oddhampton) 9 76.54 81.87 1 11.11
18507. Plato (observer_02) 9 103.20 114.06 5 55.56
18508. XxBairyHallsxX (nwalker1129) 9 113.63 135.62 3 33.33
18509. Tushar (nutzingfork) 9 28.72 39.76 0 0.00
18510. Riley (nulll) 9 91.82 105.29 4 44.44
18511. Nullius (nullius) 9 58.93 63.36 2 22.22
18512. Anh (nta1207) 9 92.77 99.75 4 44.44
18513. Novotny (novynevi) 9 63.66 75.49 2 22.22
18514. Minideez (novadeez) 9 50.22 58.49 1 11.11
18515. Nour (nourokbi) 9 44.63 54.69 2 22.22
18516. Elvis (noratic) 9 108.39 128.23 3 33.33
18517. brendi (noobgodbrendi) 9 59.61 75.59 2 22.22
18518. Noober (noobest_noober) 9 103.85 129.11 4 44.44
18519. (nonquitwarrior) 9 114.25 146.90 3 33.33
18520. whutthiphon (nongmai) 9 26.95 31.02 0 0.00
18521. nikole (nmkxos) 9 46.03 53.71 2 22.22
18522. Nicholas (nkt8256) 9 113.08 130.31 3 33.33
18523. njwn (njwnsr) 9 73.71 80.62 2 22.22
18524. Nikolaj (nikolaj808) 9 88.68 95.72 2 22.22
18525. Roberto (neowolf) 9 79.26 89.16 4 44.44
18526. Neo-lap (neolaptop) 9 80.36 100.56 1 11.11
18527. Roland (nemvagyokolyangyors) 9 70.20 80.93 2 22.22
18528. NEKROME2.0 (nekrometwo) 9 60.66 69.28 4 44.44
18529. Name (needevidence) 9 114.72 134.44 2 22.22
18530. Nawfox (nawfox) 9 72.60 76.53 3 33.33
18531. cryptid (naturalcryptid) 9 145.91 174.37 8 88.89
18532. Existential Explorer (natmac4) 9 91.62 110.65 3 33.33
18533. Natalie (natatat48) 9 73.30 87.92 0 0.00
18534. nat2980 (nat2980) 9 65.32 76.01 1 11.11
18535. Nasos (nasos2311) 9 76.86 88.92 2 22.22
18536. Nan (nantuzi) 9 88.35 96.68 3 33.33
18537. naman (naman14) 9 60.78 71.23 1 11.11
18538. Nabalazs (nabalazs) 9 68.39 78.04 3 33.33
18539. Mystree (mystree) 9 86.20 96.90 4 44.44
18540. Cyberbullet (mstfelq) 9 83.06 98.49 4 44.44
18541. Mr (mrghost_yes) 9 65.82 71.83 3 33.33
18542. Amar (mrfartboss) 9 80.11 96.47 7 77.78
18543. Simon (mosie) 9 45.20 53.26 3 33.33
18544. Morshedul (morshedul) 9 36.48 40.19 0 0.00
18545. sadaf (morphinefather) 9 88.59 117.71 4 44.44
18546. Rosewill RK-9000V2 (morphin... 9 111.91 128.04 3 33.33
18547. moonlight (moonlight_21) 9 87.94 103.69 5 55.56
18548. monster (monster) 9 115.57 134.20 5 55.56
18549. Monotype2 (monotype2) 9 83.31 101.23 7 77.78
18550. Fickle (mongolo123) 9 104.96 119.91 2 22.22
18551. Nate (mmmcac) 9 59.89 68.24 1 11.11
18552. mllm (mllm1771) 9 57.42 75.24 0 0.00
18553. Michelle (mktsoprano2) 9 103.87 111.62 6 66.67
18554. Muhammed Murad (mkmusafir) 9 49.51 56.04 1 11.11
18555. diya (mixxanber) 9 134.14 167.32 6 66.67
18556. SystemOfAKitty (mischi334) 9 84.72 95.01 1 11.11
18557. Mis (miscellaneous) 9 74.27 100.99 1 11.11
18558. Miranite (Dvorak) (miranite) 9 105.06 125.42 9 100.00
18559. Kaan (mirackhle) 9 53.54 64.81 2 22.22
18560. Mayank (minkk777) 9 87.71 99.60 3 33.33
18561. Jonathan (minifoke) 9 55.09 63.01 0 0.00
18562. Miki (miki888) 9 89.58 93.47 2 22.22
18563. Michael (michaeleh_colemak) 9 69.06 77.07 3 33.33
18564. Hai (michaeldp) 9 77.76 84.77 3 33.33
18565. Mevin (mevinn) 9 75.37 87.74 3 33.33
18566. metrodous (metrodous_yt_6) 9 72.42 89.79 3 33.33
18567. biggestkrug139 (mentalpatient) 9 129.52 145.36 6 66.67
18568. melvynAIDS (melvynaids) 9 92.76 104.00 5 55.56
18569. Matthew (meloooche) 9 82.79 92.65 4 44.44
18570. Oleg (meidebshy) 9 31.40 36.86 1 11.11
18571. Mohit (meeoww) 9 53.90 65.82 1 11.11
18572. Michael (mdstumpfy123) 9 84.59 91.61 4 44.44
18573. Marcus (mckhaann) 9 78.58 88.93 2 22.22
18574. M (mchang416) 9 92.14 103.23 2 22.22
18575. maxigus (maxigus_mcfly) 9 99.46 109.39 6 66.67
18576. maxf (maxf8) 9 87.51 100.12 5 55.56
18577. Alex (maveriiic) 9 67.25 72.41 1 11.11
18578. Matthew (matty_venus) 9 75.69 88.12 2 22.22
18579. Mat (matrix303) 9 74.34 84.46 2 22.22
18580. Henry (matrixial) 9 103.27 123.43 5 55.56
18581. Made Dandy (mathzie) 9 65.31 77.06 3 33.33
18582. harih (masterharish) 9 57.17 64.92 4 44.44
18583. Oyo (marauder316) 9 64.47 71.11 2 22.22
18584. MangalicA (mangalica) 9 64.99 78.08 1 11.11
18585. Cam (archlinuxuser) 9 71.92 81.60 3 33.33
18586. Aqualuma (aqualuma1) 9 97.17 114.43 3 33.33
18587. APR (apr_fernando) 9 39.01 48.84 2 22.22
18588. Alexandre (apeloquin) 9 50.28 55.18 0 0.00
18589. Anthony (anto_onwuka) 9 87.36 92.89 1 11.11
18590. Anton (antonidas) 9 66.98 73.92 3 33.33
18591. Benedek (antokben) 9 78.04 89.53 4 44.44
18592. ante321 (ante321) 9 43.87 48.62 1 11.11
18593. Anoop (anooprajreddym) 9 49.42 62.38 1 11.11
18594. Anmol (anmolmb) 9 37.76 47.07 1 11.11
18595. Aniket (aniiket) 9 66.55 69.93 3 33.33
18596. jon (angbunehneh) 9 71.18 79.16 3 33.33
18597. anepik (anepik) 9 84.90 101.51 7 77.78
18598. 𝐃𝐫𝐞𝐰 (andreanfi... 9 65.91 78.16 3 33.33
18599. Andi (andi_m) 9 47.48 54.84 2 22.22
18600. Someone (anamedplayer) 9 92.43 99.23 4 44.44
18601. zzzzz (amzzzz771) 9 75.58 91.75 0 0.00
18602. Amy (amy159) 9 94.55 109.66 6 66.67
18603. Seeker (amer1996) 9 28.96 31.71 2 22.22
18604. AmbrosiA (ambrosialeeann) 9 62.39 70.58 2 22.22
18605. Amazing (amazinghedgehog) 9 115.15 137.85 7 77.78
18606. Amal (amal_ronak) 9 81.72 97.50 6 66.67
18607. Aluumina (aluumina) 9 73.48 84.41 1 11.11
18608. Jason (altaria13) 9 102.03 114.65 3 33.33
18609. František (alphabettt) 9 61.16 73.38 1 11.11
18610. Nelson (alkatzer) 9 85.85 98.98 2 22.22
18611. alixsch (alixsch) 9 62.77 76.70 5 55.56
18612. Ali (alimann) 9 39.43 48.29 6 66.67
18613. Alfredo (alfredosojr) 9 77.07 96.34 0 0.00
18614. Alex (alextheo) 9 59.94 66.13 1 11.11
18615. Alek (alexno) 9 54.47 58.19 0 0.00
18616. Alex (alexdaguy) 9 89.49 105.29 1 11.11
18617. Hadi (alcatroz) 9 98.91 107.61 6 66.67
18618. ALAKI (alaki_uka) 9 54.03 68.52 1 11.11
18619. Akshay (akshay2604) 9 62.13 78.22 3 33.33
18620. Pash (akratics) 9 54.41 68.42 1 11.11
18621. Sheeky (akiyoto) 9 69.29 80.79 3 33.33
18622. Akshay (ak63) 9 34.58 43.64 2 22.22
18623. aj (ajpingol) 9 94.63 118.95 8 88.89
18624. Ajim (ajimgram) 9 24.64 30.69 1 11.11
18625. Sinon (ajey_de_shadow) 9 88.02 94.17 3 33.33
18626. Corgious (aiwoon) 9 58.98 65.71 1 11.11
18627. Airree (airree) 9 75.81 81.59 4 44.44
18628. aidil (aidilqayyim) 9 81.42 91.31 0 0.00
18629. Agah (agah) 9 52.13 56.95 1 11.11
18630. Becz (adosz_56) 9 43.41 52.12 0 0.00
18631. Shadab (acclr8) 9 77.43 86.85 4 44.44
18632. Alex (abohac99) 9 57.09 63.74 2 22.22
18633. ab (abhi800) 9 55.74 67.88 0 0.00
18634. Aarohi (aarohi24) 9 50.30 59.76 2 22.22
18635. Alex (aalleexx1) 9 46.38 56.81 0 0.00
18636. Ocean (975miles) 9 81.04 87.61 0 0.00
18637. Parikshit (7767064953) 9 64.27 73.04 2 22.22
18638. 74R45 (74r45) 9 112.46 139.83 4 44.44
18639. AJ (5onn) 9 84.75 96.37 2 22.22
18640. WeiChen (50wpmbtw) 9 80.51 92.35 4 44.44
18641. jck (404jmre) 9 99.17 108.03 6 66.67
18642. 3DegreeK (3degreek) 9 82.04 87.24 2 22.22
18643. 32587 (32587cj) 9 78.13 85.48 2 22.22
18644. Amelia (2sidedpolygon) 9 111.51 126.33 6 66.67
18645. mike (1749mike) 9 66.50 84.60 3 33.33
18646. Andrew (10001k) 9 79.57 91.21 2 22.22
18647. Rory (typertypertyping) 9 62.40 75.19 3 33.33
18648. shmuck (devrajwashereyt) 9 72.52 90.81 8 88.89
18649. Sophie (milk8080) 9 62.81 75.51 2 22.22
18650. woken (lofineedmint) 9 92.28 116.98 1 11.11
18651. Sadge (sadge_da_amateur) 9 89.60 100.50 3 33.33
18652. plusp (plusp) 9 45.95 52.61 2 22.22
18653. marshal (marshalstrakencz) 9 44.13 55.50 4 44.44
18654. harith (hrthtypo_310) 9 47.91 56.71 1 11.11
18655. Nick (flakesflakes) 9 77.25 89.21 7 77.78
18656. Red. (yesbutactuallyno21) 9 78.96 105.33 3 33.33
18657. A (traplordadan) 9 118.83 132.24 6 66.67
18658. tstats[annapal_9288] (annap... 9 60.31 78.70 9 100.00
18659. Speeps (keyzkieidan) 9 74.65 86.29 5 55.56
18660. bry400 (andromeda64) 9 80.91 93.00 2 22.22
18661. Petrowl (rainspringwell) 9 45.95 49.96 0 0.00
18662. Paige (twtvpaigelol) 9 149.65 168.04 5 55.56
18663. Michał (michal2287) 9 79.50 92.87 3 33.33
18664. Jason (hhheeeelllpppp) 9 74.97 84.89 4 44.44
18665. Manish (manish_17) 9 81.20 99.02 0 0.00
18666. Shokhrukhbek (incredible_sy) 9 60.25 66.15 1 11.11
18667. Mellow (mellophor) 9 81.48 91.67 2 22.22
18668. Yiyang (applehuner) 9 102.03 112.22 3 33.33
18669. Variares (variares) 9 59.45 64.76 0 0.00
18670. RyderWxnted#5380 (ryderwxnted) 9 84.58 106.36 2 22.22
18671. Madeline (madee0325) 9 98.94 118.86 5 55.56
18672. elliellielliellie (eventual... 9 69.56 79.34 2 22.22
18673. Taki (patini) 9 62.30 71.21 2 22.22
18674. junhan (junhanlee) 9 52.93 59.38 0 0.00
18675. Elah (elaaaaah) 9 66.01 74.52 1 11.11
18676. Justin Thomas (justin_bijoy) 9 56.50 62.13 1 11.11
18677. Jonathan (leadsaf11) 9 98.19 118.77 4 44.44
18678. Pco (pcorow) 9 66.43 74.67 3 33.33
18679. masderryl (masderryl) 9 50.04 57.95 1 11.11
18680. Rūdolfs (rudolfs_w) 9 34.86 37.27 0 0.00
18681. EpikHerolol (epikherolol) 9 57.15 63.77 4 44.44
18682. Isaac (iceman8083) 9 60.14 71.66 3 33.33
18683. Chandramouli (chandramoulig) 9 44.47 55.35 1 11.11
18684. ChoweeXCookie1879 (dojapusa... 9 44.72 49.55 1 11.11
18685. lol (moto31005) 9 76.00 88.57 3 33.33
18686. Jupp (cryt4x) 9 52.14 58.27 2 22.22
18687. Upsideman (upsideman) 9 73.09 85.99 2 22.22
18688. Saleh (salahiano) 9 53.91 60.99 0 0.00
18689. lieky (liekyw) 9 69.19 76.86 0 0.00
18690. Tudor (lad23) 9 67.02 78.82 1 11.11
18691. Wouter (walterdankers) 9 84.03 96.06 1 11.11
18692. Donn (dickies1) 9 49.39 57.72 1 11.11
18693. Zack (kazsz) 9 90.81 101.78 3 33.33
18694. Aaditys (aadityagiri_bis) 9 57.98 64.83 1 11.11
18695. svetina (hotxpuns) 9 81.14 98.30 4 44.44
18696. BQ (bayanda) 9 47.53 62.65 4 44.44
18697. Robert (robmal1) 9 73.10 79.43 2 22.22
18698. Blabbermouth (blabbermouth_) 9 74.74 88.71 3 33.33
18699. Ryan (rns86) 9 89.46 111.38 3 33.33
18700. Sherwin (sherwin_24) 9 39.35 46.80 3 33.33
18701. Mary (kassywithac) 9 57.31 64.90 0 0.00
18702. Amisently (amisently) 9 106.80 127.99 6 66.67
18703. b1nga (b1nga) 9 75.03 94.37 3 33.33
18704. johnlex1k (dark_eclipse) 9 57.91 70.37 1 11.11
18705. Brandon (2fasteyes) 9 78.89 86.87 2 22.22
18706. Bloppy (smurfy_03) 9 47.21 51.08 0 0.00
18707. Antoine (loser3172) 9 75.32 93.00 2 22.22
18708. Kazzzi (kazzzi) 9 26.58 31.18 1 11.11
18709. Joey (lashawna) 9 77.95 89.61 2 22.22
18710. Yeah (donojang) 9 126.68 139.17 5 55.56
18711. Alec (alec935) 9 84.43 93.06 2 22.22
18712. coastal (coastalrookie) 9 78.91 96.56 4 44.44
18713. Washdude7 (yashvarde) 9 80.15 90.40 5 55.56
18714. Blue (blueballerz) 9 62.78 76.24 4 44.44
18715. Noobbkour (noobbykour) 9 72.05 81.74 2 22.22
18716. Hooward (hooward) 9 49.04 55.47 0 0.00
18717. Atomic_Typh00n (star_gaming... 9 111.08 143.43 6 66.67
18718. Peter (pitabreadd) 9 92.78 106.68 1 11.11
18719. steff (_stuf) 9 114.16 129.16 5 55.56
18720. Iftekharul (_sayeed) 9 66.07 88.91 2 22.22
18721. Kuna (_kuna) 9 85.54 96.44 2 22.22
18722. Adam (_adam_bomb) 9 60.48 66.79 1 11.11
18723. Zven (zven69) 9 109.96 135.73 6 66.67
18724. Daniel (zuse90) 9 61.38 67.11 2 22.22
18725. Violet (znn7) 9 56.76 64.14 2 22.22
18726. adam (zingerbox460) 9 92.88 106.40 4 44.44
18727. zien (ziensoo) 9 50.06 54.64 2 22.22
18728. zenzurie (zenzurie) 9 58.53 65.35 2 22.22
18729. Stefan (zekan) 9 100.55 112.93 3 33.33
18730. boris (zekaida) 9 98.71 106.91 1 11.11
18731. Zia (zeeya) 9 115.44 139.04 4 44.44
18732. Zed (zed_op) 9 29.98 33.93 2 22.22
18733. Naz (zdkraner) 9 77.21 93.95 1 11.11
18734. Yxjou (yxjou) 9 44.13 51.90 0 0.00
18735. 💎 (yx3_darya) 9 83.02 96.36 3 33.33
18736. Alan (yuzhi) 9 84.90 99.45 1 11.11
18737. Yuki (yukisitu) 9 88.45 111.39 5 55.56
18738. Yuich (yuichi123) 9 67.71 80.79 2 22.22
18739. Ryan (ysys9) 9 83.18 93.44 5 55.56
18740. Jarek (yorrickus) 9 77.96 85.98 5 55.56
18741. Yuvraj (yoowee) 9 47.89 52.61 3 33.33
18742. zahra (yoonoh) 9 73.93 85.12 6 66.67
18743. Yo (yongb) 9 68.86 82.26 2 22.22
18744. Yash (yomat) 9 75.98 84.35 2 22.22
18745. ben (yngtwbabd) 9 94.56 100.70 2 22.22
18746. STONES (yiminggg) 9 90.71 103.38 3 33.33
18747. Andrew (yertssbm) 9 123.44 135.13 6 66.67
18748. Korey (yellowdozer) 9 105.45 116.58 2 22.22
18749. Yams (yams_) 9 56.25 62.87 1 11.11
18750. Yamajac (yamajac) 9 153.74 166.82 0 0.00
18751. yaeda (yaeda) 9 100.09 110.97 4 44.44
18752. Josh (xxldaddy69) 9 132.97 139.32 9 100.00
18753. cope (xucolite) 9 90.05 105.69 3 33.33
18754. John (xtrospective) 9 54.54 63.01 1 11.11
18755. Evan (xtremeelectrix) 9 109.03 128.53 4 44.44
18756. Ray (xray2) 9 109.62 118.72 1 11.11
18757. Swaggy (xiarnaq) 9 134.08 172.10 8 88.89
18758. Tony (xiao_hong) 9 61.82 70.94 0 0.00
18759. Xetin (xetin) 9 100.58 117.42 1 11.11
18760. xavier (xavieregan) 9 49.24 53.80 5 55.56
18761. Turtle (xarenox) 9 94.94 109.38 8 88.89
18762. Willem (woosterum) 9 40.55 53.05 0 0.00
18763. Woffy (woffy888) 9 83.42 110.18 6 66.67
18764. William (wmilberry) 9 81.30 90.18 0 0.00
18765. M&W (wmichaelwhitlock) 9 108.99 129.85 4 44.44
18766. Tate (wizard5) 9 56.73 65.88 2 22.22
18767. 48%SuicideRate (wint4r) 9 120.22 144.87 9 100.00
18768. Ryan (wilderrw) 9 84.98 105.01 2 22.22
18769. wiku (wiku025) 9 64.15 73.00 4 44.44
18770. Victor (whitenecro21) 9 93.10 100.26 2 22.22
18771. samantha (whalieninluv) 9 104.84 112.79 6 66.67
18772. Jake (wetfart1738) 9 63.58 71.90 4 44.44
18773. werdnalliw (werdnalliw) 9 80.71 97.37 3 33.33
18774. William (wei9798) 9 73.47 79.52 1 11.11
18775. William (wazambelina) 9 77.33 83.45 2 22.22
18776. wabdeali (wabdeali) 9 99.11 116.19 2 22.22
18777. Vyas (vyas_123) 9 105.88 125.94 4 44.44
18778. Vrum (vrumvrum56) 9 65.28 73.57 0 0.00
18779. dunno (vokunsahvoz) 9 36.44 40.66 1 11.11
18780. Viktor (vixtorr) 9 65.62 76.38 6 66.67
18781. Vipul (vipulr) 9 80.01 100.98 4 44.44
18782. Vinson (vinsonbudiman) 9 76.07 92.56 1 11.11
18783. Victor (victorfaarvang) 9 100.62 121.34 1 11.11
18784. Peter (vettel_) 9 69.61 73.17 4 44.44
18785. Vertennn (vertennn_) 9 100.02 112.50 6 66.67
18786. d'un vecchio caminetto inga... 9 119.41 134.34 5 55.56
18787. Vitalie (veeveeoh) 9 43.27 53.45 1 11.11
18788. Giovanni (vecchiogio) 9 58.14 67.38 1 11.11
18789. BJ (unusualgoose) 9 69.56 82.01 1 11.11
18790. James (unbranded) 9 127.86 142.50 8 88.89
18791. ultraXD (ultragamersss) 9 99.44 109.42 2 22.22
18792. Ultraa (ultrabladez) 9 59.75 73.02 2 22.22
18793. UltimaticCatz (ultimaticcatz) 9 78.20 97.07 6 66.67
18794. Jason (ultimatehumungousaur) 9 89.93 96.32 5 55.56
18795. Toby (ueue_) 9 84.40 102.87 6 66.67
18796. Ucheely (ucheely) 9 124.10 134.89 4 44.44
18797. McClout (type_69_master) 9 96.84 117.44 6 66.67
18798. Johannes (typerjojo) 9 70.83 83.59 0 0.00
18799. TyperDood (typerdoodz) 9 103.60 113.13 2 22.22
18800. Steven (txp2037) 9 65.38 78.27 3 33.33
18801. tuvumba (tuvumba) 9 61.07 66.94 7 77.78
18802. Tubby (tubbsters) 9 141.61 160.84 8 88.89
18803. Joshua (ttemingyu) 9 111.78 138.65 4 44.44
18804. Meinte (trinityy6) 9 61.11 69.72 3 33.33
18805. Trial (trial_name) 9 69.09 84.44 2 22.22
18806. Trevor (trev_23) 9 72.47 90.02 0 0.00
18807. shashank (trash_typer_74) 9 64.28 73.35 2 22.22
18808. Antonín (toniczech) 9 59.90 65.92 2 22.22
18809. Tom (tom020900) 9 91.79 99.17 3 33.33
18810. Tode (todengaard) 9 126.07 146.45 8 88.89
18811. Tinh (tinh1000000) 9 89.54 97.70 4 44.44
18812. Tina (tinangu272) 9 89.48 97.19 3 33.33
18813. Tino (timppara) 9 77.22 92.41 1 11.11
18814. Edwin Chiriboga (tilt_ed) 9 61.23 72.37 0 0.00
18815. trash (thiccumthebig) 9 52.68 64.20 0 0.00
18816. ReRo (the_rero) 9 72.45 92.42 3 33.33
18817. Max (the_maxinater) 9 63.79 72.65 2 22.22
18818. Brandon (theyimi) 9 101.56 112.39 4 44.44
18819. Emery (thetruffinmuffin) 9 53.73 61.37 1 11.11
18820. Henri (therealkanyeeast) 9 113.08 129.45 3 33.33
18821. pbj (thepbj) 9 59.65 75.79 2 22.22
18822. TheMates (themates) 9 43.33 52.72 0 0.00
18823. M (thefastlightningtyper) 9 78.25 89.43 4 44.44
18824. ThatCoolCoder (thatcoolcoder) 9 91.73 104.25 2 22.22
18825. Ethan (thandrew) 9 68.39 84.41 2 22.22
18826. Leo (teslaomega) 9 71.91 83.98 3 33.33
18827. Teriyaki (teriyaki03) 9 92.49 104.13 0 0.00
18828. taramysh (tentech) 9 49.66 55.46 3 33.33
18829. Afanasiy (tenseimaa) 9 90.91 100.79 1 11.11
18830. tasha (tbrown_89) 9 98.63 115.30 4 44.44
18831. Sebastian (tbgseb) 9 70.92 80.55 3 33.33
18832. Eren Yeager (tarzan_19) 9 53.60 62.16 2 22.22
18833. Kevin (taow) 9 102.84 108.55 4 44.44
18834. Tanuj (tanuj23) 9 105.30 114.20 4 44.44
18835. Tanamr (tanamr) 9 99.71 106.19 5 55.56
18836. Kevin (tactictorn) 9 111.81 122.55 6 66.67
18837. S Aditya (s_aditya) 9 60.40 63.90 2 22.22
18838. Vroom (synphade) 9 85.87 96.27 2 22.22
18839. ok doinb (superex23) 9 85.24 89.81 3 33.33
18840. supe (supe56) 9 83.20 93.63 5 55.56
18841. Jordan (sugarytaco) 9 82.39 99.03 8 88.89
18842. NO ONE (subhroxeon) 9 86.74 103.14 1 11.11
18843. Sterling (stvrling) 9 89.38 103.97 5 55.56
18844. Ahri (strylas) 9 104.01 125.85 4 44.44
18845. Strike (strike_elite) 9 103.08 116.86 3 33.33
18846. JL (strikewolfgg) 9 116.34 134.28 5 55.56
18847. Stretch (stretch_flex) 9 77.88 87.90 2 22.22
18848. stream (stream_cipher) 9 48.16 61.11 1 11.11
18849. Stefarno (stefarno) 9 48.32 58.00 1 11.11
18850. Stefan (stefan_t) 9 117.11 128.66 7 77.78
18851. Steel (steeltissue) 9 80.74 92.51 2 22.22
18852. Steady (steady32) 9 80.61 90.08 2 22.22
18853. Stanley (stanley_gogo) 9 56.14 68.06 1 11.11
18854. Josh (standedjoshh) 9 80.65 99.62 8 88.89
18855. St1nk (st1nkk) 9 63.29 78.74 4 44.44
18856. joni (squire2264) 9 86.17 92.80 2 22.22
18857. Kimikazee (squalo101) 9 102.93 121.14 4 44.44
18858. Rafael (spyhard12) 9 114.84 132.90 6 66.67
18859. Jim (sprinks41) 9 80.55 93.60 2 22.22
18860. shaq$ (springrollgod) 9 82.82 93.87 4 44.44
18861. Ayush Hazarika (ayush_hazar... 9 42.55 49.71 0 0.00
18862. Peter (speedyboi95) 9 91.97 115.19 5 55.56
18863. John (speedking456) 9 86.76 102.05 3 33.33
18864. Sourav (souravdey_1) 9 32.78 37.54 1 11.11
18865. xy (soox0001) 9 86.47 113.42 3 33.33
18866. Someone (someonetyping) 9 90.51 101.64 1 11.11
18867. UnoriginalName (someguywhoh... 9 100.91 121.82 8 88.89
18868. Marcus (snuskbulle) 9 87.36 97.23 2 22.22
18869. Snafu (snafudk) 9 92.25 104.17 3 33.33
18870. Sam (smtype100) 9 94.40 104.50 4 44.44
18871. spoon (smallspoon) 9 85.95 109.88 4 44.44
18872. Phuong Anh (smallcat2020) 9 45.14 50.55 6 66.67
18873. smakkacow (smakkacow) 9 70.71 77.11 0 0.00
18874. Slow Spider (slow_spider) 9 58.08 64.00 0 0.00
18875. ur (slowtyperfromcz) 9 59.04 65.63 3 33.33
18876. snail_twin_turbo (sloth_99) 9 54.73 59.47 1 11.11
18877. Simonas (slapukas321) 9 55.81 66.77 1 11.11
18878. Shadow (skyronman) 9 71.79 82.75 3 33.33
18879. SkillfulRheyme4 (skillfulrh... 9 55.88 71.53 2 22.22
18880. Luis (siulul) 9 60.73 71.15 2 22.22
18881. René (sirrene) 9 76.93 90.16 9 100.00
18882. $ (sirenss) 9 124.44 134.81 3 33.33
18883. Sioun (sioun) 9 94.99 102.81 4 44.44
18884. Sindre| (sinros01) 9 63.87 71.75 5 55.56
18885. Sindri (sindri300) 9 72.91 81.04 4 44.44
18886. Silk (silkdragon) 9 50.79 58.69 2 22.22
18887. ⁶⁶⁶ (siign) 9 93.48 98.48 3 33.33
18888. Siddharth28 (siddharth28) 9 49.75 71.43 1 11.11
18889. Shubham (shubham_112013) 9 61.53 65.26 0 0.00
18890. Glenn (shroom_slice) 9 73.26 92.67 3 33.33
18891. shrimp (shrimpcraackers) 9 64.52 69.11 2 22.22
18892. Nate (shortysama) 9 63.38 70.06 3 33.33
18893. Marcus (shock598x) 9 85.68 106.34 3 33.33
18894. Ab (shk_faysal) 9 57.91 66.70 3 33.33
18895. sarthak (shivasarthak) 9 48.28 61.59 0 0.00
18896. karim (shinobikarim) 9 44.35 51.56 2 22.22
18897. Nathan (sharkking487) 9 81.45 95.08 6 66.67
18898. Khalilur (shafiq_02) 9 41.05 50.25 1 11.11
18899. Luke (sfv_) 9 88.99 95.80 3 33.33
18900. Shay (sewer_rat) 9 103.76 111.01 4 44.44
18901. Accuracy (servesh) 9 67.74 84.12 1 11.11
18902. Sergio (sergiorbuge) 9 115.34 129.98 7 77.78
18903. Serenitea (serenitea) 9 91.19 102.50 3 33.33
18904. Patrick (senseiblaze) 9 78.79 94.77 0 0.00
18905. Bobby (senseibets) 9 86.17 103.15 4 44.44
18906. Player (sellnox) 9 71.41 77.53 2 22.22
18907. see you dont bump his head ... 9 86.53 96.00 5 55.56
18908. Ginger (seanwho42) 9 68.93 84.94 2 22.22
18909. Sean (seanshawn198) 9 132.20 146.32 8 88.89
18910. Saral (scrummaster) 9 71.49 78.66 2 22.22
18911. Reynaldi (script303) 9 103.33 120.34 3 33.33
18912. Nate (scourse) 9 65.15 78.22 0 0.00
18913. Eric (__eric__f__) 8 81.84 90.34 1 12.50
18914. zensei (_zensei_) 8 75.30 82.15 0 0.00
18915. sexyman (_may_) 8 64.30 78.92 2 25.00
18916. Eternap (_eternal_) 8 76.28 87.02 6 75.00
18917. Chris (_c3a) 8 82.45 98.61 0 0.00
18918. zuritor (zuritor) 8 53.47 73.04 8 100.00
18919. Michael (zoyp) 8 84.69 117.43 0 0.00
18920. Kevin (zolt4r) 8 103.30 109.37 2 25.00
18921. Jillian (zolemnx) 8 51.25 59.15 0 0.00
18922. Dwarf (znagol) 8 69.06 72.66 1 12.50
18923. Sanity (zjhaun) 8 61.28 67.37 3 37.50
18924. ZiyanTheZink (ziyan_the_zink) 8 79.73 87.71 8 100.00
18925. Ziron (ziron) 8 86.42 102.86 0 0.00
18926. Zilla1218 (zilla1218) 8 74.28 81.82 2 25.00
18927. Zia (zia__) 8 31.87 35.61 5 62.50
18928. Zeta (zetanegativeone) 8 96.33 109.51 5 62.50
18929. todayis_WanD (zeropatience) 8 84.87 107.43 2 25.00
18930. zerg (zerggirl) 8 110.98 140.14 6 75.00
18931. zenyatta (zenyattamondatta) 8 79.50 95.48 2 25.00
18932. Zekken (zekken12345) 8 89.03 105.94 6 75.00
18933. Jack (zbroooksy) 8 102.35 126.77 2 25.00
18934. ZAKARIAAAAAAAAAAAAAAAAAAAAA... 8 52.20 60.56 0 0.00
18935. Zach (zachtepp) 8 114.85 125.75 5 62.50
18936. Zach (zachninjakiller6) 8 48.80 56.09 1 12.50
18937. Yuuki (yuukiy) 8 75.78 86.79 3 37.50
18938. Yuliana (yuli_a) 8 73.35 83.05 0 0.00
18939. CHONG YU JIE (yujie_is_typing) 8 80.46 88.27 1 12.50
18940. y (ys26908) 8 58.72 67.24 0 0.00
18941. YowzaH (yowzah) 8 131.38 146.23 6 75.00
18942. Jack (yourmomahhahaahaha) 8 106.55 126.79 3 37.50
18943. your mom (yourmother369) 8 114.15 129.26 4 50.00
18944. Yomie (yomie) 8 71.30 82.02 7 87.50
18945. yinho (yinhotype) 8 58.11 74.04 2 25.00
18946. Yimin (yimindvorak) 8 124.97 139.37 5 62.50
18947. Yi-Chen (yichenlo) 8 58.41 72.91 1 12.50
18948. Yasif (yasif345) 8 65.45 71.95 1 12.50
18949. Greg (yaohan) 8 117.51 136.77 8 100.00
18950. yannick (yannickbaze) 8 57.80 62.95 1 12.50
18951. Time (yaboiiiwill) 8 104.20 111.59 3 37.50
18952. six (y33t3r) 8 72.91 86.79 2 25.00
18953. XYZ (xyzabc1799) 8 77.09 83.44 1 12.50
18954. Fabian (xylia_fabian) 8 70.23 77.20 3 37.50
18955. xxxodarap (xxxodarap) 8 40.76 48.25 1 12.50
18956. RelaxCozy (xxodus999) 8 89.77 95.95 3 37.50
18957. Moritz (xp0s31d0nx99) 8 69.88 76.74 2 25.00
18958. jonny (xjboix) 8 93.48 115.36 3 37.50
18959. Rohit (xdeadly) 8 51.20 60.89 2 25.00
18960. charli (xdbiscuits) 8 61.98 70.96 2 25.00
18961. Jeffrey (xcjeffrey) 8 50.21 60.42 0 0.00
18962. Bryan (xarga) 8 103.87 117.26 8 100.00
18963. Jason (xaraer) 8 69.74 78.38 2 25.00
18964. Will (wwwong) 8 97.51 111.79 4 50.00
18965. Fabio (wrist_strength) 8 82.08 89.54 3 37.50
18966. Nicky (wownickywow) 8 75.37 83.30 3 37.50
18967. parker (withouthue) 8 44.95 55.55 0 0.00
18968. C (windyreed) 8 115.71 130.55 3 37.50
18969. Wilson (wilson_ang) 8 74.78 81.57 2 25.00
18970. Tjerk (whiz_nl) 8 102.26 113.59 5 62.50
18971. Hunter (whdahl) 8 94.56 103.93 5 62.50
18972. Erik (whatafuas) 8 94.94 106.61 1 12.50
18973. Michael (whalee) 8 93.14 97.70 2 25.00
18974. Owen (wertls) 8 69.55 82.07 7 87.50
18975. w (wenjun) 8 127.12 144.75 4 50.00
18976. Leonardo (wenjiedrick) 8 93.88 111.36 4 50.00
18977. Jay (wenisknees) 8 88.37 109.67 1 12.50
18978. Shantanu (wckd1) 8 47.41 51.30 1 12.50
18979. James (waterpuree) 8 70.04 80.53 3 37.50
18980. Waterghosteus (waterghosteus) 8 82.03 96.10 3 37.50
18981. Ethan (waitblock) 8 103.17 109.96 0 0.00
18982. Adam (waffelele) 8 71.28 79.81 8 100.00
18983. Cuong (vucuong21) 8 76.46 83.94 2 25.00
18984. vslip (vslipyt) 8 57.64 64.28 3 37.50
18985. Van Philip (vppexis) 8 89.52 97.18 2 25.00
18986. VK (vk_7) 8 41.47 56.71 5 62.50
18987. Visionss (visionss) 8 89.56 108.91 3 37.50
18988. Forrest (verybigpenguin) 8 112.06 128.90 4 50.00
18989. Looking For GF (veiven) 8 113.63 129.48 4 50.00
18990. Vedang (vedang1312) 8 38.52 43.28 2 25.00
18991. Doug (vastvincent) 8 93.25 107.52 6 75.00
18992. josh (vapeypoo) 8 80.36 88.94 1 12.50
18993. Philip (vanp) 8 121.78 138.16 7 87.50
18994. Peter (vajco) 8 66.13 71.40 1 12.50
18995. Hiyam (v1ctor1x) 8 99.43 109.21 4 50.00
18996. v0lkoff (v0lkoff) 8 101.29 119.61 4 50.00
18997. Aya (uwub) 8 108.68 117.48 7 87.50
18998. Prakhar (username_copied) 8 52.73 65.56 2 25.00
18999. 999 WPM (usedarktheme) 8 67.32 77.84 0 0.00
19000. Daniel (unreal_beam) 8 65.78 72.61 1 12.50
19001. unpr0gr4mm3d (unpr0gr4mm3d) 8 91.83 101.90 1 12.50
19002. unnat (unnat) 8 85.55 98.23 2 25.00
19003. Ulugbek (ulugbek0602) 8 70.17 82.16 2 25.00
19004. K Sooraj (ultron_ksk) 8 39.98 47.39 0 0.00
19005. Ultrabooby (ultranooby) 8 125.94 136.62 4 50.00
19006. Ivan Richard (ugololeivan) 8 58.18 64.31 1 12.50
19007. ⌨️🖱️ (t_0nio) 8 116.53 137.06 8 100.00
19008. Split keeeeeb (tzbob) 8 112.45 122.74 6 75.00
19009. Chris (typistgod14) 8 51.38 65.34 3 37.50
19010. typing pro (typingze) 8 38.53 44.27 2 25.00
19011. typing (typingmr) 8 82.88 89.13 2 25.00
19012. bob (typer_bob) 8 100.72 114.41 2 25.00
19013. bhrigu (typer_21) 8 70.24 80.19 6 75.00
19014. Tyler (tylermsmith199) 8 89.89 103.12 2 25.00
19015. TUwU (tuwu) 8 108.84 115.83 1 12.50
19016. Andrej (tunas1337) 8 104.03 120.00 4 50.00
19017. Thomas (tszkoda) 8 48.67 52.40 3 37.50
19018. Grayson (troydenite) 8 86.02 94.62 3 37.50
19019. tay (trongaus) 8 110.90 121.31 4 50.00
19020. MIr (triple_mmm) 8 41.62 47.02 0 0.00
19021. 🇵🇸 (' _ゝ') (trickroom) 8 117.94 126.35 3 37.50
19022. Towbie (towbie) 8 94.34 111.14 3 37.50
19023. Touhid (touhid23du) 8 45.55 52.03 0 0.00
19024. Ofek (too_slow_to_go) 8 81.20 88.83 2 25.00
19025. Toni (tony_playz) 8 79.57 98.36 8 100.00
19026. Tony (tonyngu) 8 95.59 112.14 1 12.50
19027. Antonio (tonibudal) 8 50.46 54.72 1 12.50
19028. TommiTMX (tommitmx) 8 99.43 110.75 5 62.50
19029. Thomas (tmsopogi) 8 90.28 102.85 3 37.50
19030. Tahar (tmasmaliyev) 8 35.56 50.80 0 0.00
19031. tken (tken_tokyo) 8 58.20 66.17 0 0.00
19032. Tyler (tinss619) 8 85.36 91.65 3 37.50
19033. Meeper (timelysaucer) 8 97.99 102.20 1 12.50
19034. Tim (timbob5380) 8 77.20 89.26 4 50.00
19035. testo (tillman1981) 8 79.42 91.89 3 37.50
19036. tilko (tilko) 8 97.09 105.31 3 37.50
19037. Tiberius (tiberiusceter) 8 101.50 121.55 5 62.50
19038. Joshua (the_rockstar) 8 57.92 61.96 3 37.50
19039. The (the_phoenix) 8 46.92 52.48 0 0.00
19040. Sabrina (the_ice_within) 8 119.47 148.60 8 100.00
19041. perky (theperkiestpotato) 8 87.18 96.22 2 25.00
19042. ThePCJakub (thepcjakub) 8 103.07 113.63 5 62.50
19043. Svetlin (thepb) 8 54.35 64.09 1 12.50
19044. 0rz0rz (thenine) 8 99.25 104.58 3 37.50
19045. ­ (thelurkerman) 8 112.37 138.14 2 25.00
19046. Theo (thelogdude) 8 88.65 98.42 2 25.00
19047. JJ (thejapie) 8 100.69 107.24 5 62.50
19048. Michael (thedoctor506) 8 81.16 88.77 1 12.50
19049. bee (tggb) 8 43.92 46.47 0 0.00
19050. Nhat Anh (texward) 8 90.77 98.97 5 62.50
19051. Tor (temyrvang) 8 82.89 89.55 2 25.00
19052. temmo (temmo) 8 121.23 141.89 4 50.00
19053. Benjamin (telekinesis) 8 74.05 90.41 5 62.50
19054. teenpro (teenpro) 8 59.64 76.47 4 50.00
19055. Ted (tednation) 8 86.88 96.54 1 12.50
19056. Alex (tec9rushb) 8 80.59 89.70 2 25.00
19057. Logan (tcalogan) 8 95.31 102.89 5 62.50
19058. mati (taux) 8 95.85 107.35 4 50.00
19059. Umair (tastyorange) 8 68.26 83.37 1 12.50
19060. Tasty (tastytomato) 8 75.97 81.83 5 62.50
19061. TasteOfCancer (tasteofcancer) 8 91.31 107.65 2 25.00
19062. Tam (tamlee573) 8 86.99 95.87 2 25.00
19063. Luis (tallwhitestck) 8 100.13 107.71 7 87.50
19064. Mikasa (tahabashar11) 8 71.92 86.20 3 37.50
19065. Tom (tacocatdeboss) 8 100.34 115.50 2 25.00
19066. swim (swammmy) 8 83.50 100.43 5 62.50
19067. Swah (swahaha) 8 61.26 76.45 1 12.50
19068. Ryan (suzerainy) 8 97.62 109.94 2 25.00
19069. Kachow (suvigya) 8 61.62 70.75 1 12.50
19070. sussy (sussybaka11) 8 58.97 65.35 0 0.00
19071. surdyyy (surdyyy) 8 52.21 57.70 1 12.50
19072. koen (super_stinky) 8 44.20 55.33 1 12.50
19073. eurobeats (super0) 8 75.66 103.85 1 12.50
19074. Suigikawa (suigikawa) 8 85.14 95.97 4 50.00
19075. subhojeet (subho12134) 8 61.59 69.23 0 0.00
19076. Pui (suaingam) 8 47.57 61.61 0 0.00
19077. Stuge (stugefin) 8 58.55 64.99 0 0.00
19078. George (stoptheads) 8 114.25 122.47 4 50.00
19079. Stephy (stephy2202) 8 74.75 86.71 0 0.00
19080. stepbrother69 (stepbrother69) 8 101.68 124.57 4 50.00
19081. Suraj (st1ck14) 8 62.07 70.68 3 37.50
19082. sszebrat (sszebrat) 8 78.67 92.96 4 50.00
19083. Sukh Singh (ssothegreat) 8 62.62 77.47 8 100.00
19084. squirrelslow (squirrelslow) 8 94.47 114.35 2 25.00
19085. Michael (infinity34) 8 64.92 74.16 5 62.50
19086. Maximus (sprachzarathustra) 8 96.26 110.52 2 25.00
19087. Brandon (spookybees) 8 86.26 104.31 3 37.50
19088. Wayne (spollox) 8 88.37 97.55 3 37.50
19089. Tim (speedy_neutron) 8 60.53 65.61 1 12.50
19090. Lul (spammeh) 8 93.96 106.60 3 37.50
19091. Macaroni (spacial_macaroni) 8 77.25 82.60 1 12.50
19092. spacebagel (spacebagel) 8 107.50 132.70 3 37.50
19093. SoupThyme (soupthyme) 8 74.88 88.17 6 75.00
19094. soufiane (soufianebth) 8 42.05 47.20 4 50.00
19095. Sophie (sophiebrown6) 8 56.44 62.10 0 0.00
19096. Redugo (somebodyelse) 8 84.69 99.11 5 62.50
19097. anonRED (somebody_red) 8 46.49 54.12 1 12.50
19098. Barry (somalisam) 8 101.19 114.59 4 50.00
19099. Snek (snekking) 8 89.17 93.85 2 25.00
19100. Anders (snazzy) 8 76.44 86.72 1 12.50
19101. SmokR (smokeydbear) 8 89.84 105.39 1 12.50
19102. Shane (smokedbread) 8 68.37 77.59 4 50.00
19103. Nafeez (smileywee) 8 84.62 97.21 4 50.00
19104. kaydence (smhkaydence) 8 45.66 51.97 1 12.50
19105. Mel (smelons) 8 104.67 117.57 0 0.00
19106. Slow (slow_keyboard) 8 53.61 61.35 1 12.50
19107. I am speed (slowhand18) 8 95.16 111.07 4 50.00
19108. Sam (slimwhit) 8 63.63 66.68 1 12.50
19109. Karthik (slickfalcon) 8 63.74 71.56 3 37.50
19110. Edwin (skitargduva) 8 66.46 77.75 1 12.50
19111. Skillet (skillet18) 8 125.21 136.42 7 87.50
19112. Nhan (skhylines) 8 85.53 109.55 3 37.50
19113. SJ (sjmoon110718) 8 47.72 55.17 0 0.00
19114. Sir (sirnoodles05) 8 93.23 103.52 2 25.00
19115. Gal (sirdouchebag) 8 73.56 92.70 0 0.00
19116. Sinan (sinan) 8 121.62 148.27 4 50.00
19117. Pedro (simplypedro) 8 76.24 90.72 3 37.50
19118. Simas (simgint) 8 77.42 88.72 3 37.50
19119. Josh (shwahhh) 8 111.83 122.70 4 50.00
19120. Shub (shubhamgoel352) 8 69.30 75.60 1 12.50
19121. Denny (shizkr) 8 86.42 98.56 4 50.00
19122. Rey x MountainStride (shinr... 8 83.03 95.82 0 0.00
19123. Mubarak (sgtcuredpanda) 8 48.86 52.03 0 0.00
19124. クローエ (seyasoya) 8 84.33 92.63 2 25.00
19125. Seth (sethbangerter) 8 115.42 127.14 2 25.00
19126. Serji (serji) 8 57.40 65.22 2 25.00
19127. Senseiparks (senseiparks) 8 100.67 111.55 3 37.50
19128. kayla (senlin) 8 72.35 86.69 5 62.50
19129. senara (senara124) 8 91.99 100.10 3 37.50
19130. George (sellers1234) 8 63.87 70.09 1 12.50
19131. seb (sebbbbbbb) 8 82.05 92.54 3 37.50
19132. Bastian (sebastianovoam) 8 71.87 77.67 2 25.00
19133. Shane (sdoyle4499) 8 64.68 78.52 1 12.50
19134. Scorbutsale (scorbutsale) 8 78.13 85.23 1 12.50
19135. BoiledAir7 (sawt) 8 79.91 90.67 0 0.00
19136. Sagar (saucy_d) 8 70.30 80.95 3 37.50
19137. Sarvottam (sarvottampriyada... 8 95.94 112.10 1 12.50
19138. Sarah (sara_g) 8 124.44 132.05 7 87.50
19139. Sara (sarasmile) 8 30.78 45.61 2 25.00
19140. Santiago (santpp85) 8 31.17 35.22 0 0.00
19141. Santosh (santoshm33) 8 58.00 68.89 2 25.00
19142. Sander (sander5151) 8 86.15 93.40 2 25.00
19143. (samuraipie) 8 122.12 144.36 5 62.50
19144. Sam (samschreibt) 8 100.18 112.68 4 50.00
19145. Sami (samihasaspine) 8 102.43 123.84 3 37.50
19146. Patrick (saboe) 8 71.99 82.65 3 37.50
19147. اعجاذ حسين (s183ds... 8 61.89 70.76 2 25.00
19148. Ryley (r_sand11) 8 48.61 63.35 0 0.00
19149. Ryan (ryanmc99) 8 112.00 125.67 3 37.50
19150. Aditya (rust_eze) 8 54.36 67.70 1 12.50
19151. tomul tsot (rushildhar) 8 40.30 44.99 4 50.00
19152. Rushil (rushil13579) 8 68.89 83.54 2 25.00
19153. Joe (rufu) 8 131.46 158.41 7 87.50
19154. Ruben (rubennijhuis) 8 64.25 98.57 2 25.00
19155. RSCArne (rscarne) 8 68.68 81.69 2 25.00
19156. roywastaken (roywastaken) 8 37.25 41.76 1 12.50
19157. Rotem (rotemsela) 8 102.55 124.70 4 50.00
19158. xRoshx (roshdip) 8 60.51 68.25 2 25.00
19159. Ron (ron107) 8 31.25 40.21 0 0.00
19160. Romin (rominpasa) 8 63.18 70.54 1 12.50
19161. Yessir (romans828) 8 111.10 136.56 3 37.50
19162. Viki (roastedice) 8 99.94 121.66 6 75.00
19163. 6fingers (rktspcr) 8 72.87 89.26 2 25.00
19164. Sadia (riyan_sadia) 8 54.90 64.09 0 0.00
19165. RISE (riseee) 8 57.16 73.20 1 12.50
19166. rickythedino (rickythedino) 8 96.12 115.32 3 37.50
19167. Ricky (rickyb663) 8 89.70 100.14 5 62.50
19168. garry (richgarry) 8 82.12 100.81 4 50.00
19169. ★ d (retronub) 8 125.87 145.37 5 62.50
19170. Islam ❤ (respectedfeeds) 8 102.54 107.54 3 37.50
19171. Yangyang (renasceim) 8 78.77 87.42 2 25.00
19172. Josh (remember000this) 8 80.44 87.38 1 12.50
19173. Reed (reedhaffner) 8 99.63 114.12 2 25.00
19174. Brendo (rebelx) 8 75.01 82.25 0 0.00
19175. real (realscav) 8 111.64 125.61 4 50.00
19176. Roman (rdprice) 8 84.13 95.19 3 37.50
19177. Mikey (rctyogo) 8 72.38 77.07 0 0.00
19178. Heem (rayhim) 8 58.87 64.19 2 25.00
19179. pogron (rawhnald) 8 97.90 113.05 3 37.50
19180. Ian (raveian) 8 49.00 58.79 1 12.50
19181. Rall (raullll) 8 84.73 97.68 2 25.00
19182. Jefferson (rasmus06) 8 109.13 127.46 4 50.00
19183. too_slow (rakki7) 8 76.82 83.32 2 25.00
19184. Prathamesh (rajputprathames... 8 56.46 62.47 3 37.50
19185. rai_10101 (rai_10101) 8 81.62 101.30 5 62.50
19186. Ayuxh (raix29) 8 41.40 45.76 2 25.00
19187. rainmaker (rainmaker6) 8 62.72 70.53 0 0.00
19188. Fred (raijinpanda) 8 103.88 114.91 5 62.50
19189. Quang (quanglc00) 8 52.92 56.00 4 50.00
19190. Pieter (pvanuffelen) 8 66.70 78.27 3 37.50
19191. Angela (purplehalo3) 8 81.63 93.81 0 0.00
19192. Dave (punskilled) 8 117.34 128.92 3 37.50
19193. Jedidiah (puisanberg) 8 102.08 116.63 8 100.00
19194. Puffone (puffone) 8 28.18 32.27 2 25.00
19195. Smith (pucymae) 8 84.33 93.67 2 25.00
19196. Ben (pro_benny) 8 90.55 106.89 1 12.50
19197. blue (primaryblu) 8 125.52 158.22 2 25.00
19198. Connor (pressurr) 8 94.56 103.15 2 25.00
19199. PRANJAL (pranjalgogoi1999) 8 51.13 56.26 0 0.00
19200. Jeremy (potrainer) 8 102.66 123.84 3 37.50
19201. potato_pig12 (potato_pig12) 8 106.74 118.89 6 75.00
19202. potato0329 (potato0329) 8 66.25 70.44 5 62.50
19203. Eric (potatcs) 8 84.71 99.01 4 50.00
19204. PossiblyRandom (possiblyran... 8 104.68 118.50 4 50.00
19205. Porsit (porsit) 8 68.33 83.04 2 25.00
19206. Dai ca (porrydeptrai) 8 62.73 83.67 7 87.50
19207. . (popdon990) 8 70.16 85.74 3 37.50
19208. Poopy4757 (poopy4757) 8 56.74 69.62 1 12.50
19209. Kom (poobscoob) 8 95.78 113.51 2 25.00
19210. Polyatomic (polyatomic) 8 113.14 126.18 6 75.00
19211. Sid (pokecrater1) 8 99.76 108.81 3 37.50
19212. Lee (pohsien) 8 30.64 39.85 0 0.00
19213. podlesk (podlesk) 8 64.29 74.83 2 25.00
19214. Patrick (pmurfdesign) 8 54.68 61.91 0 0.00
19215. Mads (planntt) 8 53.54 59.53 2 25.00
19216. Patrick (pjawesomegaming) 8 80.20 104.78 4 50.00
19217. Sciencio (pinkdiam0nd) 8 72.11 84.67 0 0.00
19218. Jonas (piglin) 8 67.36 76.75 2 25.00
19219. Goal: 70wpm average (pietpo... 8 28.01 31.29 0 0.00
19220. Pichu (pichu_pals) 8 76.45 89.63 8 100.00
19221. Tim (phuc131) 8 71.96 80.07 0 0.00
19222. Philip (philiplu7777) 8 98.92 109.62 2 25.00
19223. Joseph (phantom5k) 8 75.83 82.85 4 50.00
19224. Patrik (pgdth) 8 62.88 70.45 3 37.50
19225. fastfingas (petryk21) 8 80.09 91.38 0 0.00
19226. Petit (petitjuju) 8 104.89 126.64 3 37.50
19227. alex (peopel) 8 69.89 78.43 0 0.00
19228. Kaleb (penguinunreal) 8 85.57 90.64 3 37.50
19229. black google (peeperin) 8 83.94 105.64 3 37.50
19230. paul (peazie) 8 114.22 122.24 5 62.50
19231. lit (paul615) 8 57.56 64.58 2 25.00
19232. patembe (patembe) 8 72.29 82.45 4 50.00
19233. Brandon (pastaneko) 8 87.24 95.54 1 12.50
19234. Adem (paramone) 8 89.33 102.20 5 62.50
19235. Paper (paperstache) 8 84.57 89.97 1 12.50
19236. Zephaniah (pandu11) 8 79.01 92.13 5 62.50
19237. Palta (palta_hass05) 8 70.38 79.93 1 12.50
19238. Andy (paingle) 8 93.73 104.79 3 37.50
19239. Stelios (paff) 8 103.14 126.46 3 37.50
19240. Speedo (pacmaniac) 8 68.19 76.34 2 25.00
19241. Bill (p0werc0rd0fjustice) 8 83.21 97.00 2 25.00
19242. Barbo (o_mon) 8 117.98 132.50 4 50.00
19243. Ozark (ozarkian) 8 117.78 137.75 7 87.50
19244. Chelsea (oxfordkarma) 8 74.69 84.46 4 50.00
19245. Rick (outrunwolf) 8 82.47 86.41 0 0.00
19246. ONRAGE (onrage) 8 94.12 103.51 2 25.00
19247. onel (onel11) 8 76.54 88.84 2 25.00
19248. omajez (omajez) 8 71.84 86.98 5 62.50
19249. 𝖔𝖑𝖎𝖜𝖆𝖗... 8 121.79 139.65 6 75.00
19250. Okhelloandhi (okhelloandhi) 8 61.96 73.06 2 25.00
19251. rai (ohrai) 8 103.51 128.91 8 100.00
19252. ohad (ohad8353) 8 64.12 82.33 3 37.50
19253. OG3G (og3g) 8 76.12 91.46 0 0.00
19254. Sophia (officialsophiagarman) 8 69.50 72.49 2 25.00
19255. sul (ofb_hunted) 8 42.46 46.61 0 0.00
19256. Arshad (o0arshad0o) 8 46.25 50.76 0 0.00
19257. Kucing (nyandesuyo) 8 56.43 67.79 1 12.50
19258. Hugo (nuvions) 8 54.78 61.70 0 0.00
19259. NukeADS (nukeads101) 8 26.06 31.23 0 0.00
19260. Shanks (nuggetxd) 8 102.13 118.68 4 50.00
19261. Noz (nozz) 8 119.78 132.19 7 87.50
19262. nousmh (nousmh) 8 91.76 106.29 3 37.50
19263. namie (notyournamie) 8 57.99 64.04 1 12.50
19264. SchizoKami (notaniki) 8 74.90 80.70 2 25.00
19265. Jorden (nostera) 8 65.59 71.12 1 12.50
19266. Henry (noodles10) 8 77.28 90.74 2 25.00
19267. Noah (noahboa1234) 8 71.99 82.40 2 25.00
19268. Nneeku (nneeku) 8 80.86 95.55 2 25.00
19269. b1shop (nnebsi) 8 67.13 80.40 1 12.50
19270. nitro (nitrocircus) 8 62.39 71.19 2 25.00
19271. H (nin9zer0) 8 55.73 63.56 1 12.50
19272. Viktor (niktor76) 8 45.31 53.59 1 12.50
19273. Niko (nikolearnstotype) 8 102.22 123.40 4 50.00
19274. Late (nikolaholmes) 8 77.44 88.48 1 12.50
19275. nikita (nikitapelagecha) 8 74.45 87.92 4 50.00
19276. Niheee (niheee) 8 91.01 108.38 8 100.00
19277. ♛ Nick... 8 103.98 118.18 3 37.50
19278. Phuc (nhphucqt) 8 60.94 67.42 2 25.00
19279. Nerret (nerr3t) 8 58.50 67.27 4 50.00
19280. NeoX (neoxbit) 8 72.43 84.81 0 0.00
19281. Rowan (neonowlbar) 8 60.54 66.98 2 25.00
19282. Bendegúz (negyzetracs) 8 40.87 50.07 1 12.50
19283. Adam (nefrepitou) 8 71.21 80.53 6 75.00
19284. Cin_min (needs_alife) 8 74.40 81.97 1 12.50
19285. Hoo (navvvz) 8 82.88 100.38 2 25.00
19286. nathan (nathanfrenzel) 8 104.14 123.72 5 62.50
19287. Matheus (narrogai) 8 57.81 65.51 4 50.00
19288. Narix (narix) 8 88.50 98.33 4 50.00
19289. nailfc (nailfc) 8 75.86 80.54 3 37.50
19290. Nadia (nadiapun) 8 46.78 57.72 1 12.50
19291. Nacho (nachofry) 8 113.98 127.86 4 50.00
19292. Vuh (n00bmaster_69_) 8 61.24 66.70 0 0.00
19293. Kevin (mystified) 8 92.27 106.94 3 37.50
19294. draven (mutable) 8 111.26 127.88 4 50.00
19295. Jasmine (mustardsucks) 8 113.63 140.10 4 50.00
19296. mushi (musfiq) 8 61.40 68.23 1 12.50
19297. Leo (murkymurky) 8 83.85 89.13 3 37.50
19298. Munta (munta) 8 59.55 73.23 2 25.00
19299. Mukhamejan (mukhamejan) 8 48.86 54.17 1 12.50
19300. Marios (mr_kk13) 8 61.83 70.13 4 50.00
19301. Iboo (mriboo) 8 90.64 104.50 2 25.00
19302. Cayke (mrcayke) 8 89.71 99.22 1 12.50
19303. Bara (mrbobby) 8 104.67 125.01 3 37.50
19304. Extreme Bass Tester (mrbass... 8 96.44 110.99 5 62.50
19305. Trevor (mouspe) 8 68.83 83.37 2 25.00
19306. Ike (mouseandkeyboard) 8 97.81 104.87 2 25.00
19307. Motan (motanrobert) 8 52.07 63.52 1 12.50
19308. Mostafa (mostafadelgouda) 8 60.16 69.22 4 50.00
19309. K (mosspath16) 8 97.13 111.19 6 75.00
19310. Koneko (moon_l1ght) 8 65.20 73.77 2 25.00
19311. Petr (monsterkick123) 8 70.18 78.54 2 25.00
19312. Dan (monkyman12) 8 76.73 88.56 2 25.00
19313. Moogii (mongoljan) 8 70.27 72.70 0 0.00
19314. Shiyue (molllllllly) 8 54.78 62.52 2 25.00
19315. Nikita (mohwai) 8 73.12 86.14 2 25.00
19316. محمد (mohammed_mourad) 8 36.03 43.63 0 0.00
19317. Foxes (moazkhaled) 8 51.78 54.48 1 12.50
19318. Mo (moahmed0987) 8 65.36 77.42 8 100.00
19319. Brandon (mo0nfire) 8 69.18 80.56 0 0.00
19320. Matthew (mmcjoynt) 8 84.86 99.79 4 50.00
19321. Miro7543 (miro7543) 8 47.54 56.35 1 12.50
19322. Mindjolt (mindjolt) 8 93.39 105.49 2 25.00
19323. Mik (miks1) 8 92.30 111.71 3 37.50
19324. Mike (mikethompsontech) 8 98.59 106.99 4 50.00
19325. at my own pace (mijacim) 8 129.22 153.46 5 62.50
19326. Midas Gold (midasgold) 8 99.73 131.65 5 62.50
19327. Michael (michaelskyba) 8 135.44 149.16 3 37.50
19328. Michael (michaelshahin2) 8 124.34 159.15 5 62.50
19329. fynn (metallicbow) 8 65.20 73.53 2 25.00
19330. Stanislaw (mestreponas) 8 93.89 100.08 1 12.50
19331. Meppou (meppou) 8 82.55 96.10 3 37.50
19332. Mendyng (mendyng) 8 73.52 85.40 3 37.50
19333. A (melori) 8 49.47 62.82 1 12.50
19334. Melvin (mellikyun) 8 89.72 100.67 1 12.50
19335. mason (meezusxd) 8 82.14 92.61 2 25.00
19336. Subahan (mdsubahan) 8 28.89 33.99 2 25.00
19337. uwu (mdby_enn) 8 68.49 76.33 1 12.50
19338. jumpingjilligan (maxy97322) 8 80.81 101.56 4 50.00
19339. Max (maxstacks) 8 43.02 48.25 2 25.00
19340. Max (maxlau09) 8 100.16 104.42 5 62.50
19341. Mathias (mathi2912) 8 93.20 102.10 3 37.50
19342. mathan (mathanha) 8 111.81 133.04 6 75.00
19343. Marco (marquouo) 8 63.36 69.56 2 25.00
19344. Cream (marom) 8 63.83 78.03 4 50.00
19345. Tiffany (mangles) 8 82.40 94.09 1 12.50
19346. Josue (mangalarge) 8 56.75 73.75 1 12.50
19347. Mohammed (manchi) 8 47.98 53.35 0 0.00
19348. Maxim (malincik) 8 66.70 74.99 5 62.50
19349. Mikhail (maklaya) 8 105.23 117.24 6 75.00
19350. marvin (magnimarve) 8 125.98 147.93 3 37.50
19351. maestro (maestro2048) 8 62.29 69.90 3 37.50
19352. Taison (lyraxh) 8 80.48 92.54 2 25.00
19353. LULU (luluthecow) 8 101.55 119.44 5 62.50
19354. Luke (lukejr0123) 8 61.73 70.77 3 37.50
19355. Luisovc1812 (luisovc1812) 8 59.57 70.10 0 0.00
19356. Luin (luingear) 8 66.64 78.72 1 12.50
19357. Jacob (lugia1572) 8 65.90 72.20 1 12.50
19358. Tachanka (lordtachankatm) 8 102.66 112.19 5 62.50
19359. Guest (lolteamtroll) 8 59.76 70.84 4 50.00
19360. Lachlan (lochstar) 8 51.42 57.58 2 25.00
19361. ellyboycott (localhinatakin... 8 105.16 120.81 4 50.00
19362. liu (liuluil) 8 105.15 114.58 6 75.00
19363. Andrew (littlefleece) 8 108.81 120.14 8 100.00
19364. Litevex (litevvx) 8 133.00 150.02 5 62.50
19365. nic (limpehordlo) 8 98.97 110.58 3 37.50
19366. limdaepicpber (limdaepicpber) 8 59.56 67.50 4 50.00
19367. Erdnaxela (lil_toogood) 8 52.34 62.00 2 25.00
19368. LilTexan (lil_texan) 8 79.07 85.81 3 37.50
19369. Cameron (lilcamwin) 8 46.69 54.35 0 0.00
19370. Liko (likofortino) 8 62.75 75.78 5 62.50
19371. Sam An (liasss) 8 47.43 53.44 0 0.00
19372. Fabian (lgtrushzhm) 8 113.78 130.38 4 50.00
19373. Le' (letyper_) 8 72.68 84.41 2 25.00
19374. NIcola (lenh) 8 84.27 92.20 2 25.00
19375. Itsbuddy⌨ (legendarybeast... 8 35.70 45.72 1 12.50
19376. Lefos (lefos357) 8 44.79 49.90 1 12.50
19377. Dvorak (learningdvorak101) 8 67.47 72.03 2 25.00
19378. Laz (lazzo) 8 71.21 79.05 1 12.50
19379. randint (lawlombie) 8 92.18 103.20 4 50.00
19380. nina (lavendee) 8 94.14 98.09 3 37.50
19381. Laurence (laurencee_desu) 8 80.52 89.34 1 12.50
19382. Jackie (laserelite) 8 115.51 126.20 6 75.00
19383. laobiz (laobiz) 8 88.38 103.29 5 62.50
19384. La (lanumu) 8 78.62 97.21 4 50.00
19385. Malcolm (lampshadess) 8 82.13 91.82 4 50.00
19386. Slow Typist (lammian) 8 98.54 105.07 1 12.50
19387. IckyPixel (kyoneoran) 8 70.18 88.59 4 50.00
19388. Pro (kvis) 8 55.97 60.53 1 12.50
19389. KJ (kushagra_j) 8 55.64 73.52 1 12.50
19390. Kurt (kurtv13) 8 80.49 87.66 1 12.50
19391. kati (ktiisler) 8 52.41 59.32 3 37.50
19392. Rohit (krullun) 8 59.45 64.83 0 0.00
19393. kristjon (kristjon) 8 77.13 81.04 0 0.00
19394. idkhi (krisstesink) 8 74.61 83.99 8 100.00
19395. Krishan Pal (kris987) 8 47.06 52.15 1 12.50
19396. Sandpiper (krafty) 8 113.35 130.01 6 75.00
19397. котакбассик (kot... 8 99.44 113.18 8 100.00
19398. klima7 (klima7) 8 82.65 91.23 1 12.50
19399. Jon (kixoidiot) 8 49.41 59.15 1 12.50
19400. kingcabrams (kingcabrams) 8 103.60 106.82 2 25.00
19401. kimi (kimboli) 8 86.78 116.64 7 87.50
19402. kie (kieret25) 8 95.57 108.13 4 50.00
19403. Christian (kickstyping4thewin) 8 80.33 89.03 3 37.50
19404. khye (khyelerk) 8 100.82 129.55 3 37.50
19405. khem (khemsadon) 8 69.52 76.49 3 37.50
19406. khadie (khadiekun) 8 77.81 90.53 4 50.00
19407. Khabibkhanov (khabibkhanov) 8 43.93 48.86 1 12.50
19408. Kushagra (kgtypes) 8 72.93 84.36 2 25.00
19409. kev2k (kev2k) 8 92.99 110.05 4 50.00
19410. Kenny (kenjeo) 8 103.30 116.46 3 37.50
19411. Keigo (keigo_yoshiura) 8 73.16 81.53 2 25.00
19412. KC (kc2002) 8 95.29 107.30 2 25.00
19413. Katie (katielemaster) 8 79.54 96.49 2 25.00
19414. Katie (kat41911) 8 106.23 117.39 7 87.50
19415. 🍁 (kaspars) 8 105.85 120.86 4 50.00
19416. ryan jason (kapsutka) 8 45.12 53.59 0 0.00
19417. Jonathan (kamikazecupcake) 8 99.70 111.58 4 50.00
19418. kalvin (kalvin2171) 8 40.33 54.57 0 0.00
19419. Daniel (kald3s) 8 93.66 109.88 5 62.50
19420. holymoly (kajohnny) 8 104.91 112.68 5 62.50
19421. abdul (kaium55) 8 49.53 71.85 1 12.50
19422. Kaijou (kaijou) 8 72.01 87.79 6 75.00
19423. skrtskrt (kad832000) 8 103.08 116.94 6 75.00
19424. khai (kaariee) 8 82.20 97.57 4 50.00
19425. Jayshil (just_chillll) 8 49.21 54.26 1 12.50
19426. Jurre (jurrevonk) 8 101.42 131.85 6 75.00
19427. Josh (jshearer34) 8 62.72 72.81 1 12.50
19428. Jorge (jquiroz728) 8 78.19 89.73 2 25.00
19429. jpow (jpowwow) 8 82.73 97.24 3 37.50
19430. Jacob (jpoopy) 8 100.41 108.05 4 50.00
19431. Jimmy (jphan98) 8 104.69 120.40 2 25.00
19432. sakuraphael (joseraphael) 8 67.21 85.28 2 25.00
19433. Jorunn (jorunn) 8 109.60 115.92 5 62.50
19434. JJ (joojoob1004) 8 104.57 121.30 4 50.00
19435. victor (jontakenols) 8 69.52 89.51 0 0.00
19436. jonathanirvings (jonathanir... 8 104.49 124.52 2 25.00
19437. John (johnmanga) 8 78.52 84.30 1 12.50
19438. J0hn (johnjonez23) 8 100.21 107.31 2 25.00
19439. Jomama (johanwashere) 8 110.66 123.18 4 50.00
19440. Johannes (jogameshd) 8 82.26 97.47 2 25.00
19441. Joesph (joecool3) 8 62.89 74.02 1 12.50
19442. Jake (jmp2814) 8 77.82 87.63 1 12.50
19443. jf (jkkl) 8 102.15 122.61 4 50.00
19444. jawad (jiqlsh) 8 50.46 58.64 1 12.50
19445. jip (jipgg) 8 37.05 42.94 0 0.00
19446. Azriel (jing_long) 8 47.65 54.03 1 12.50
19447. guan (jgbiggy96) 8 88.71 98.10 2 25.00
19448. Joe (jfratello) 8 82.21 100.09 3 37.50
19449. Yulia (jewels04) 8 36.17 39.76 0 0.00
19450. Jerry (jernjej) 8 82.36 91.01 3 37.50
19451. Jedwidz (jedwidz) 8 101.81 113.07 4 50.00
19452. Jayden (jay62) 8 85.14 101.12 5 62.50
19453. Jason (jasonledrika) 8 102.50 119.94 4 50.00
19454. Andrew (jargazes) 8 108.56 115.49 5 62.50
19455. JJ (japie4life) 8 106.05 124.82 5 62.50
19456. James (jamvng) 8 127.42 137.77 3 37.50
19457. J (jakobam) 8 132.40 144.90 6 75.00
19458. JackSparrow (jack__sparrow) 8 66.62 74.43 0 0.00
19459. Jack (jacktypeman) 8 68.00 79.52 4 50.00
19460. Jack (jackthehuman) 8 88.73 92.75 4 50.00
19461. EddyEndo (jackpoteddie) 8 56.04 63.51 1 12.50
19462. jackn11 (jackn11) 8 94.30 103.88 2 25.00
19463. Sonny (j3dmosly) 8 90.09 94.74 1 12.50
19464. Jeff (i_bad) 8 40.31 47.83 0 0.00
19465. Elizabeth (i_am_piece_of_tr... 8 54.52 62.50 2 25.00
19466. iwannabebee (iwannabebee) 8 16.65 21.56 1 12.50
19467. honey (ivan_avr) 8 90.03 103.01 4 50.00
19468. BadAtTyping (itzsecretive) 8 83.28 91.09 2 25.00
19469. Khushal (its_warhead) 8 52.79 59.54 1 12.50
19470. forg (itsmetimwastaken) 8 114.75 129.57 5 62.50
19471. Average (isuckattypoing) 8 64.88 69.93 5 62.50
19472. Tobias (iseeicetea) 8 44.35 54.29 0 0.00
19473. Incognito (im_incognito) 8 83.29 92.95 2 25.00
19474. David (imdaveed) 8 51.57 59.76 1 12.50
19475. ilyassq (illiazo) 8 60.13 71.24 2 25.00
19476. Illayne (illayne) 8 71.47 89.95 0 0.00
19477. Zudio (ildosrel) 8 83.08 90.09 3 37.50
19478. Kennie (ikentalk) 8 50.91 59.56 3 37.50
19479. Shut (ihavekillaura) 8 113.45 123.58 6 75.00
19480. oshan (ice_cold) 8 73.99 83.66 1 12.50
19481. glizzy (icecreamgoblin) 8 99.05 121.51 7 87.50
19482. Ibrokhimjon (ibrokhimjon23) 8 30.67 35.55 2 25.00
19483. Ivan (iamiam) 8 78.83 84.94 0 0.00
19484. Daniel (hylianwarrior) 8 111.50 142.52 8 100.00
19485. Hydrix (hydrix03) 8 71.03 79.63 2 25.00
19486. Khanh Hung (hungnkuon) 8 86.45 96.57 2 25.00
19487. Teddy (hulksgreenass) 8 109.47 117.17 6 75.00
19488. Hermogenes (hrivas) 8 41.88 52.28 0 0.00
19489. chubby (hoocub) 8 36.55 45.60 1 12.50
19490. Rionil (holyshock) 8 104.38 134.83 5 62.50
19491. HoldShift (holdshift) 8 69.46 80.32 1 12.50
19492. AAAAAAAAAAAAAAAAAAAAAAAAAAA... 8 84.50 92.14 4 50.00
19493. AZNDAD (hmoth84) 8 94.32 104.22 0 0.00
19494. Hjalte (hjaltebuch) 8 89.97 107.50 4 50.00
19495. Hit360D (hit360d) 8 57.45 73.98 5 62.50
19496. Mari (hisokaslave) 8 78.64 96.98 0 0.00
19497. Anshul (hindu_123) 8 84.18 92.18 4 50.00
19498. henry 🎩 (henzolo) 8 104.03 110.87 3 37.50
19499. Heaven (heavenx) 8 74.17 82.09 4 50.00
19500. Lan (heatblaze) 8 93.44 103.61 3 37.50
19501. Haven (havenjd) 8 85.82 98.84 4 50.00
19502. Mufassir (hashtag_pro) 8 63.32 72.68 0 0.00
19503. Roy (harlos9090) 8 66.17 72.42 2 25.00
19504. coc (han_duo) 8 92.08 111.52 3 37.50
19505. 2Lenne (hannaloresa) 8 67.63 75.08 3 37.50
19506. HamsterSales (hamstersales) 8 75.01 88.02 2 25.00
19507. Khai (haikhaiphan) 8 70.14 79.99 2 25.00
19508. han (hahhan) 8 23.36 26.23 1 12.50
19509. Hashmia (haaashmiah) 8 56.10 67.50 3 37.50
19510. Nicolas (ha27) 8 80.02 84.55 4 50.00
19511. Yifan (gyyy1995) 8 70.98 80.34 3 37.50
19512. :Talpiie (gwaporosh) 8 73.41 87.51 3 37.50
19513. Gusklipsch (gusklipsch) 8 54.41 58.33 0 0.00
19514. gurzil (gurzil) 8 63.15 72.90 0 0.00
19515. Dan (gunpowdergolem) 8 95.64 103.75 7 87.50
19516. gunga (gungafarts) 8 79.98 87.75 1 12.50
19517. guy (guius) 8 80.56 85.80 4 50.00
19518. La (guinea_peeg_1234) 8 93.10 99.65 1 12.50
19519. guid (guid07) 8 74.73 95.01 5 62.50
19520. grantgoosten (grantgoosten22) 8 82.60 93.78 2 25.00
19521. Marko (gragole) 8 94.68 104.44 1 12.50
19522. grac (gracthegrac) 8 63.00 77.21 4 50.00
19523. Yellow (gracet_b) 8 49.50 57.33 1 12.50
19524. Eddie (goombah1) 8 107.83 112.88 4 50.00
19525. dheeraj (goldsnort) 8 68.63 75.03 4 50.00
19526. Leloush (goal9871231st) 8 36.01 41.57 2 25.00
19527. glip (glip014) 8 91.73 102.52 3 37.50
19528. Jack (ginganinjajack) 8 115.15 120.57 4 50.00
19529. Connor Gil (gillionayre) 8 57.35 64.39 2 25.00
19530. Giich (giich) 8 88.95 96.60 2 25.00
19531. Judah (ghostboyjude) 8 48.85 56.79 1 12.50
19532. Bonne (ggraznpv) 8 28.30 30.09 1 12.50
19533. Jaden (ggjaden) 8 75.01 88.57 1 12.50
19534. Geo (geojumper) 8 67.12 72.43 2 25.00
19535. Ray (gelastical) 8 85.37 95.68 2 25.00
19536. Artemida (gayswordfish) 8 87.80 104.77 3 37.50
19537. Gareth (gathlic) 8 57.85 66.68 4 50.00
19538. Garfield (garfield_fluff_jr) 8 78.18 83.92 1 12.50
19539. gamer (gamer_2002) 8 31.91 37.37 0 0.00
19540. Gabryel John (gabryeljison) 8 67.81 81.97 4 50.00
19541. Kevin (fvnction) 8 73.47 89.17 2 25.00
19542. Poop_57 (fuzzydestroyer) 8 55.25 72.68 2 25.00
19543. fuzzed (fuzionite) 8 91.35 116.92 5 62.50
19544. Kenneth (furball728) 8 110.01 122.91 3 37.50
19545. Ronald (funnyturtles) 8 54.76 59.50 3 37.50
19546. f (fulmerformal) 8 101.12 109.90 4 50.00
19547. fuadul (fuadul) 8 38.73 42.20 2 25.00
19548. FruityCigar (fruitycigar) 8 60.22 71.49 3 37.50
19549. Frozen_Robot (frozen_robot) 8 80.27 90.84 1 12.50
19550. Determined (frosty_flame) 8 94.62 99.82 2 25.00
19551. Freshanatha (freshanatha) 8 61.92 68.83 4 50.00
19552. Fran (frannyg) 8 46.76 60.90 1 12.50
19553. rose (fr0gspawnn) 8 108.87 115.68 2 25.00
19554. Fowwer (fowwer) 8 78.34 96.78 2 25.00
19555. Foofmeister (foofmeister) 8 117.45 137.42 3 37.50
19556. Cole (fluke1890) 8 80.68 89.23 1 12.50
19557. flora (flora1111) 8 123.70 144.91 6 75.00
19558. Elvis (flareblu_workman) 8 67.40 81.95 3 37.50
19559. bigdad (fillmeupdaddy) 8 81.90 89.99 2 25.00
19560. El Psy Kongroo (fiive_starboy) 8 67.42 91.53 3 37.50
19561. fffd (fffd) 8 82.89 98.33 5 62.50
19562. Ferris (ferrisprimanugraha) 8 88.49 94.87 4 50.00
19563. Fernando (fedevegili) 8 102.17 115.14 5 62.50
19564. Feakl (feakl) 8 41.73 51.64 1 12.50
19565. Diego (faustian_nero) 8 55.09 61.86 0 0.00
19566. FastTypist448 (fast_typist448) 8 57.00 67.21 2 25.00
19567. Aminul (fardin1bd) 8 55.85 63.03 0 0.00
19568. Austin (fallow64) 8 107.29 124.23 4 50.00
19569. Regent (fagol) 8 74.03 86.91 3 37.50
19570. Danial (fadyboi) 8 87.24 92.22 3 37.50
19571. ChiBai (f0rg0tten) 8 68.55 87.19 1 12.50
19572. Eyal (eyalnir7) 8 58.54 72.15 4 50.00
19573. e (evzh) 8 35.01 42.05 0 0.00
19574. Morgan (evirabbi) 8 100.53 115.46 1 12.50
19575. Sidewalk (euantis) 8 77.05 87.09 3 37.50
19576. Evan (etiger) 8 66.09 77.21 0 0.00
19577. Eternal (eternai) 8 84.47 125.48 3 37.50
19578. Erna (ernasolberg69) 8 80.55 96.66 0 0.00
19579. Erik (eriklvalentin) 8 97.31 111.27 3 37.50
19580. bruh (erik2405_) 8 104.92 115.21 6 75.00
19581. Epsile (epsilian) 8 124.83 149.06 7 87.50
19582. Owen (epic_own_gamer) 8 69.57 78.08 2 25.00
19583. Enamul (enamul) 8 32.31 38.06 2 25.00
19584. Elrohir (elrohirtypo) 8 71.28 78.21 0 0.00
19585. ellowell (ellowell) 8 125.79 150.31 4 50.00
19586. Elius H Himel (eliushhimel) 8 45.91 52.79 0 0.00
19587. Adridri (eidorian) 8 83.07 133.33 4 50.00
19588. Eric (ehshark) 8 108.49 120.03 5 62.50
19589. mrspaghettimeatballs (ehreg... 8 84.00 91.23 2 25.00
19590. Snowbear (ehj1258) 8 90.27 103.86 3 37.50
19591. edward (edwardkarra) 8 47.70 66.00 5 62.50
19592. Ed (ed2005) 8 65.40 74.19 2 25.00
19593. Fee (dylanfee) 8 127.42 137.84 5 62.50
19594. Isa (dxnamic_) 8 70.23 78.77 1 12.50
19595. areyouagirloraguymonkey (dw... 8 151.90 166.24 8 100.00
19596. gale (dwah) 8 86.69 103.85 3 37.50
19597. AAA (duraszess) 8 91.18 99.15 5 62.50
19598. Tung (dungtang) 8 112.38 130.06 3 37.50
19599. 🔖. (dumplinling) 8 52.61 59.24 0 0.00
19600. teethmc (dudeboi63589) 8 85.49 110.97 3 37.50
19601. Per (dubgeiser) 8 81.20 84.91 1 12.50
19602. Sasha (dtelesman1) 8 75.24 86.18 1 12.50
19603. Kristof (driftydifty) 8 53.70 56.53 2 25.00
19604. droo (drew215) 8 112.11 128.22 5 62.50
19605. Dregni (dregni) 8 61.25 66.52 1 12.50
19606. Khondokar (draenor06) 8 70.84 90.06 4 50.00
19607. Manan (dpmanan) 8 57.64 64.80 2 25.00
19608. Kris (doubleace5747) 8 98.16 104.21 3 37.50
19609. 1337 (dotnet) 8 74.91 83.01 3 37.50
19610. Aang (dorjeaang) 8 62.01 71.21 1 12.50
19611. Doodle (doodle_doot) 8 67.83 79.27 4 50.00
19612. sam_sep10l (don_simon) 8 69.26 80.62 1 12.50
19613. Donzelle (donnie12) 8 78.42 85.42 0 0.00
19614. Danish (donish) 8 61.59 65.09 3 37.50
19615. dongster (dongster) 8 96.34 121.51 1 12.50
19616. Dominik (domynig) 8 65.35 79.25 3 37.50
19617. ziomek (dombrol) 8 77.35 88.43 1 12.50
19618. Doctorgreenyou (doctorgreen... 8 88.72 102.66 5 62.50
19619. Daniel (dkincorperated) 8 52.06 61.59 2 25.00
19620. djole (djole) 8 60.26 64.04 2 25.00
19621. Dylan (dillyv) 8 86.07 93.84 3 37.50
19622. Nick (diggle) 8 121.25 146.89 6 75.00
19623. DaRealZubyy (dexisnothome) 8 37.08 48.48 2 25.00
19624. Mart (devli) 8 18.16 19.86 0 0.00
19625. Detha (detha_) 8 63.36 70.97 2 25.00
19626. Neil Adrian (destroyer_46) 8 109.75 119.03 4 50.00
19627. Desmond (desmondspeedy) 8 90.94 107.19 6 75.00
19628. twitch.tv/YasuoNA (denigratez) 8 98.26 110.61 3 37.50
19629. Jack (delysid) 8 100.80 119.46 3 37.50
19630. DeltaDraco (delta_draco) 8 100.90 108.01 3 37.50
19631. Dan (deltaenergy) 8 73.21 78.37 0 0.00
19632. sugi (dea_agent) 8 106.95 119.70 5 62.50
19633. Jeaffffffffffffff (deadvull) 8 66.81 78.62 0 0.00
19634. David (davylern) 8 104.12 114.36 5 62.50
19635. Davin (davinnnnn) 8 78.01 86.51 0 0.00
19636. David (davidm_2020) 8 125.02 138.03 4 50.00
19637. Brian (dataslayer) 8 107.03 122.57 5 62.50
19638. Darkplayer3 (darkplayer3) 8 89.02 97.34 5 62.50
19639. darkestrevolt (darkestrevolt) 8 85.25 92.99 3 37.50
19640. Darapsas (darapsas) 8 84.48 97.03 5 62.50
19641. TIN (daons) 8 85.51 88.53 2 25.00
19642. Daniel (danyu1) 8 86.18 96.88 2 25.00
19643. Jack (dante17) 8 75.08 82.12 1 12.50
19644. danny (dannyvokje) 8 86.14 96.59 3 37.50
19645. Daniel (danielstebbins) 8 68.17 74.75 3 37.50
19646. Russell (dalenu) 8 120.94 138.45 3 37.50
19647. da (dahanci) 8 118.37 127.75 7 87.50
19648. BathTime (daddysbathtime) 8 58.49 71.26 1 12.50
19649. ab (dabglob) 8 99.85 110.67 3 37.50
19650. D3LTA (d3lta) 8 98.10 101.28 4 50.00
19651. G (cyutie__g) 8 91.37 107.47 8 100.00
19652. Cyan (cyan_cloud) 8 66.67 78.62 3 37.50
19653. cyan (cyanaspect) 8 91.08 97.99 2 25.00
19654. Colin (cwreath43) 8 89.69 102.53 3 37.50
19655. curtythurty (curtythurty) 8 45.09 51.56 1 12.50
19656. cursedgandhi (cursedgandhi) 8 93.03 100.32 4 50.00
19657. ravi (culdesaccer) 8 60.51 80.93 1 12.50
19658. Andrew (cuetime) 8 39.88 43.97 1 12.50
19659. cse_kyle (cse_kyle) 8 71.73 85.69 2 25.00
19660. Hoppy (crunchydog) 8 70.91 77.43 1 12.50
19661. Dran (creyon) 8 74.28 78.86 1 12.50
19662. Campbell (cphalen) 8 97.28 120.36 2 25.00
19663. rashawn (corthas) 8 103.14 121.98 3 37.50
19664. Corey (corrreyjay) 8 123.72 147.82 7 87.50
19665. Rainnier (corrby) 8 108.82 166.75 5 62.50
19666. Timothy (cornmono) 8 83.79 95.40 1 12.50
19667. Lorenzo (cool_and_good) 8 62.52 67.34 1 12.50
19668. Helena (coolister3) 8 102.27 119.77 6 75.00
19669. Emmet (contrambulance) 8 92.12 106.25 1 12.50
19670. Alice (communistbean) 8 71.48 84.65 4 50.00
19671. Cole (cole_denson) 8 84.80 90.34 5 62.50
19672. Colemak User (colemak_behbear) 8 92.31 111.37 3 37.50
19673. wEN (coldblacktea) 8 83.53 95.00 3 37.50
19674. ここ (coco_jumbo) 8 72.76 80.08 6 75.00
19675. Coalpi (coalpi) 8 79.82 94.02 3 37.50
19676. CMcK (cmck) 8 89.17 94.95 3 37.50
19677. Clever (cleverdom) 8 61.59 65.90 0 0.00
19678. Clare (clareb31) 8 77.00 89.86 3 37.50
19679. Charles (ckypros) 8 74.46 87.07 4 50.00
19680. Christina (cjkoikara) 8 64.05 66.55 0 0.00
19681. Simon (ciscomalware) 8 67.71 76.06 6 75.00
19682. Bryjeen (chronoalpha) 8 85.35 92.98 4 50.00
19683. koen (chromoplast) 8 84.88 94.54 0 0.00
19684. Chong Shan (chong_shan) 8 69.12 77.89 1 12.50
19685. Oluwatomi (chidori21) 8 42.56 51.56 0 0.00
19686. Calvin (cheekuan321) 8 100.67 121.60 5 62.50
19687. Chayse (chaysegr) 8 90.56 100.62 3 37.50
19688. SpongeBob (cerealkila) 8 67.94 76.72 1 12.50
19689. Athos (cdelafere) 8 74.93 83.14 1 12.50
19690. Jam (cayajam) 8 72.80 86.99 1 12.50
19691. s (caustlc) 8 96.47 110.54 5 62.50
19692. Alex (carrot_ironfoundersson) 8 54.17 59.41 1 12.50
19693. Rystian (cap_redhawk) 8 58.61 65.51 2 25.00
19694. Captain2 (captain_) 8 58.35 66.17 8 100.00
19695. s. (capslooock) 8 91.53 106.68 4 50.00
19696. Cam (camtain) 8 52.29 63.81 2 25.00
19697. Cade (cadelanktree) 8 74.41 94.52 4 50.00
19698. Cache (cachemonet) 8 87.58 95.61 2 25.00
19699. b (b_rabbit019) 8 58.34 71.40 0 0.00
19700. buzz (buzzdale2) 8 80.62 88.17 2 25.00
19701. punk (bulatefishballs) 8 92.53 103.35 2 25.00
19702. Bubbles (bubbles81833) 8 124.80 145.87 6 75.00
19703. Brian (btgrant76) 8 69.31 87.74 3 37.50
19704. AJ (bsptc) 8 105.46 117.64 5 62.50
19705. Brett (brettshaw) 8 85.44 112.11 2 25.00
19706. Brenden (brenden_2021) 8 57.76 68.21 2 25.00
19707. Myth (brendanlai1999) 8 61.19 71.81 2 25.00
19708. Brecken (breck1234) 8 95.91 117.44 3 37.50
19709. boxxibis (boxxibis) 8 102.70 122.70 3 37.50
19710. Bovinova (bovinovain) 8 72.08 82.86 3 37.50
19711. Adhitya (borakx007) 8 90.31 95.59 4 50.00
19712. Alias (boinkus) 8 124.05 145.98 6 75.00
19713. boby (bobybomby) 8 59.97 77.34 3 37.50
19714. Bob (bobanton02) 8 113.36 129.87 4 50.00
19715. Minleg (bminleg) 8 67.03 77.46 2 25.00
19716. Billy (blipdip) 8 59.92 71.11 3 37.50
19717. blitter (blitter56) 8 60.69 72.16 2 25.00
19718. Joshua (blink180dude) 8 81.14 95.14 1 12.50
19719. camille (bleuish) 8 94.77 106.19 5 62.50
19720. Black (blacksiderino) 8 91.79 100.97 3 37.50
19721. Sean (blackandwhitemuppet) 8 142.09 155.35 5 62.50
19722. Christian (bl0btypes) 8 82.78 98.86 1 12.50
19723. bitter (bitternightmares100) 8 100.55 112.57 4 50.00
19724. Bertil (bingobertil) 8 98.53 109.60 3 37.50
19725. Mack (bigmack10) 8 82.25 91.73 1 12.50
19726. bigburd (bigburd) 8 99.23 104.96 4 50.00
19727. Marshall (bigboycold) 8 78.50 88.30 3 37.50
19728. BIdi (bidi) 8 100.67 109.33 4 50.00
19729. Bibek (bibek77) 8 42.56 49.39 0 0.00
19730. Bheta (bheta) 8 122.97 149.14 5 62.50
19731. bhavya (bhav_) 8 50.74 58.27 4 50.00
19732. Kevin (besnier) 8 82.20 87.44 2 25.00
19733. Azerty 0w0 (benz_) 8 94.23 100.95 3 37.50
19734. ben (benlee27) 8 56.79 68.79 3 37.50
19735. Ben (bencyi) 8 122.27 151.75 6 75.00
19736. bench (bench0) 8 101.75 114.50 1 12.50
19737. Bempe (bempe) 8 96.72 106.03 3 37.50
19738. Bektur (bektur8888) 8 31.82 37.47 3 37.50
19739. Tristan (beckonez) 8 92.26 101.51 3 37.50
19740. Elizabeth (bebecam) 8 115.28 129.70 6 75.00
19741. beastboy (beastboy1787) 8 57.09 68.76 0 0.00
19742. batwayne1 (batwayne1) 8 71.57 79.54 4 50.00
19743. Bartacus (bartacus) 8 72.37 79.63 3 37.50
19744. Joseph (barcaftw05) 8 102.33 110.19 6 75.00
19745. Balint (balint2004) 8 79.69 92.34 2 25.00
19746. Bagel (baegirl) 8 122.87 131.75 3 37.50
19747. Baby (baby3am) 8 49.74 62.94 1 12.50
19748. Felix (babford) 8 69.74 73.92 1 12.50
19749. xtian (babbageclunk) 8 48.48 54.31 1 12.50
19750. Zheng Hao (a_random_slow_ty... 8 49.48 61.31 1 12.50
19751. Anubhav (a_a_pandey) 8 52.24 64.04 2 25.00
19752. Ayush (ayushnanda14) 8 82.31 88.96 2 25.00
19753. ayumiii (ayumiii) 8 55.07 70.19 1 12.50
19754. A (axeborn) 8 48.98 56.06 0 0.00
19755. awesomedude1440 (awesomedud... 8 85.04 116.53 5 62.50
19756. Avi (avi_130) 8 95.43 119.89 4 50.00
19757. AvD (avd3369) 8 58.57 67.07 1 12.50
19758. Vladimir (av1ty) 8 69.09 77.19 2 25.00
19759. Austin (austinwc) 8 82.49 97.10 0 0.00
19760. Daniel (aussiegrillgamr) 8 65.06 71.39 2 25.00
19761. Aureus (aureuswastaken) 8 113.08 130.32 5 62.50
19762. Ambrose (astrealix) 8 95.57 105.18 3 37.50
19763. Jason (ason6678) 8 56.29 65.87 6 75.00
19764. Shahariar (ashikkkkk) 8 71.84 90.08 1 12.50
19765. Asher (asher_xxi) 8 52.33 58.09 0 0.00
19766. arti (artiarti) 8 73.02 79.65 1 12.50
19767. Acwyg (arjung0055) 8 39.21 48.40 0 0.00
19768. apexstrada (apexstrada) 8 91.12 118.51 4 50.00
19769. Anzac (anxan) 8 82.24 91.78 3 37.50
19770. Anush Rao (anushrao) 8 40.21 48.49 0 0.00
19771. Anthony (anthonydsr) 8 75.75 87.91 3 37.50
19772. Aniq (aniq_asd) 8 67.91 73.26 1 12.50
19773. Andrius (andriusius) 8 78.51 87.19 1 12.50
19774. Andrew (andmarek) 8 119.37 129.35 5 62.50
19775. jay (anakanjay) 8 74.74 86.20 0 0.00
19776. Amr (amr_emara) 8 48.03 54.59 0 0.00
19777. Amir (amir_bc) 8 71.21 84.87 2 25.00
19778. Amanda (amandaaaa_) 8 71.47 87.00 0 0.00
19779. Altra (altra) 8 86.54 111.43 6 75.00
19780. Alpha (alpha_atk) 8 72.37 89.76 5 62.50
19781. CaccMann (aloned) 8 109.44 139.12 2 25.00
19782. Almonds (almonds_and_nutella) 8 43.10 51.67 1 12.50
19783. Allen (allen8811) 8 56.40 63.85 2 25.00
19784. Alan (allanafdn) 8 136.62 153.43 3 37.50
19785. Alfian (alfianzv) 8 83.86 112.21 2 25.00
19786. Alex (alexk123) 8 58.41 66.35 0 0.00
19787. Aleksandar (alexg2003) 8 87.84 101.49 2 25.00
19788. Alejandra (alejandrabruh29) 8 31.70 38.65 3 37.50
19789. Osama (aldemeery) 8 72.65 79.15 1 12.50
19790. alan (alanthebest1212) 8 74.03 86.16 5 62.50
19791. Alamgir (alamgirvigu) 8 51.77 61.15 1 12.50
19792. Alvin (al04) 8 114.28 126.08 7 87.50
19793. Aaron (akuch32) 8 63.13 68.59 2 25.00
19794. Jun (akiboard) 8 110.91 129.44 7 87.50
19795. AK (ak24) 8 61.69 72.46 4 50.00
19796. Tryin to make a change :-\ ... 8 115.03 131.62 4 50.00
19797. fdgojasfd (ajaypokharel) 8 39.63 46.76 2 25.00
19798. Romil (aidag) 8 93.12 101.29 3 37.50
19799. DevGuyAhnaf (ahnafzamil) 8 101.23 120.12 8 100.00
19800. Arnel II (agujathis) 8 98.77 110.48 5 62.50
19801. Fretzeldurmf (agent_gametur... 8 102.13 115.30 2 25.00
19802. Ahmad Gamal (agazzaz) 8 62.88 68.58 1 12.50
19803. Advit Upadhyay (advit0708) 8 56.18 60.59 2 25.00
19804. Adora (adorablebanana) 8 131.86 145.81 7 87.50
19805. adithedon (adithedon) 8 32.82 36.11 1 12.50
19806. Adhy (adhy) 8 81.43 94.29 0 0.00
19807. Adfrian (adfrianrais) 8 52.81 56.34 0 0.00
19808. Adam (adamxlofaro) 8 88.14 100.30 3 37.50
19809. Adam (adamisspeed) 8 100.32 133.51 3 37.50
19810. Adaephon (adaephon) 8 111.53 120.41 6 75.00
19811. acewiz (acewiz) 8 94.16 98.14 1 12.50
19812. Raiyantstats[accursed_] (ac... 8 82.94 95.76 1 12.50
19813. Abuela (abuela) 8 65.15 74.33 1 12.50
19814. Alex (abrown516) 8 113.04 125.44 8 100.00
19815. Aarya (aaryatambe) 8 58.15 70.37 0 0.00
19816. Aakash (aakash_rp_621) 8 70.32 75.38 4 50.00
19817. Aaron (aaaronnguyen) 8 83.22 93.86 2 25.00
19818. a3533 (a3533) 8 85.41 93.80 1 12.50
19819. jordan (7jrdn) 8 65.17 73.99 3 37.50
19820. Ren (6cdh) 8 72.40 85.76 1 12.50
19821. K (4pple) 8 60.37 77.79 2 25.00
19822. ariel (44tech_) 8 57.22 66.09 0 0.00
19823. Naresh (303nash) 8 100.22 105.30 3 37.50
19824. Ivan (1v4n) 8 60.07 69.24 3 37.50
19825. Zero (0gundam) 8 145.45 169.58 7 87.50
19826. Giuseppe Bottazzi (051znn) 8 66.35 79.92 1 12.50
19827. emanuel (emumu) 8 78.70 91.68 5 62.50
19828. Olivier (opet) 8 90.39 105.69 2 25.00
19829. Yash (kumar02) 8 48.52 59.68 1 12.50
19830. Bluee (blueegamer) 8 128.86 151.91 8 100.00
19831. D2 (dtsu) 8 94.81 117.98 8 100.00
19832. Pulkit (dinodude17) 8 62.81 80.28 1 12.50
19833. Philo (philophobic) 8 65.79 77.01 3 37.50
19834. Nic (nchlsh) 8 80.19 91.39 0 0.00
19835. Ace (acedawg123) 8 72.33 79.41 1 12.50
19836. peepee (gamerman2000) 8 92.47 100.07 4 50.00
19837. brm (brmstr) 8 75.94 85.33 3 37.50
19838. Lucifer (lucifermorningstar... 8 60.69 66.84 0 0.00
19839. longshot (longshot19) 8 37.22 43.52 0 0.00
19840. Tony (dnacid) 8 66.83 88.31 3 37.50
19841. André (aistcold) 8 89.32 103.73 5 62.50
19842. olivia (oliviadance) 8 56.59 64.54 2 25.00
19843. Sretnik (vedran3) 8 99.26 116.38 4 50.00
19844. Hackyeah (hackyeah) 8 69.19 94.64 3 37.50
19845. Yehonatan (yonac) 8 55.77 63.44 0 0.00
19846. Raven (veintan23) 8 62.19 69.92 2 25.00
19847. Bakhtiyar (baha123) 8 30.89 33.62 0 0.00
19848. Longlegdog (longlegdog) 8 103.84 117.53 5 62.50
19849. Jack (wapow811_official) 8 30.65 35.19 4 50.00
19850. Thanh (ncthanh2000) 8 74.13 85.96 5 62.50
19851. Neeraj (nerdarrow) 8 73.47 87.35 3 37.50
19852. raVen (raven01) 8 74.74 81.53 2 25.00
19853. WishICouldLiveLongerThanMyW... 8 70.29 85.79 4 50.00
19854. Matthew (sharen0904) 8 37.59 42.19 0 0.00
19855. Alex (2abc6) 8 66.85 73.54 3 37.50
19856. SP (spider_swing) 8 46.07 48.94 0 0.00
19857. Jacob (wooperking) 8 85.03 94.18 4 50.00
19858. Space (space_bound) 8 60.57 64.67 0 0.00
19859. Evan (alien_lover) 8 132.32 138.57 5 62.50
19860. Nikkulet (nikkulet) 8 70.63 78.03 3 37.50
19861. William (donwee88) 8 59.77 70.47 3 37.50
19862. Gambit (zereth09) 8 82.48 94.42 3 37.50
19863. Alexis (alunesp15) 8 61.29 68.16 1 12.50
19864. LONESTAR (lone_star) 8 49.51 59.85 2 25.00
19865. jisoo (jisoooleee) 8 90.10 117.73 3 37.50
19866. Sky (skyking1484) 8 59.09 65.67 7 87.50
19867. Thanakrit (mnchtnk) 8 46.08 50.39 1 12.50
19868. Mecin Man (mecin_man3011) 8 51.51 56.88 0 0.00
19869. Alexander (sheeplordz) 8 61.19 67.44 0 0.00
19870. Snowman (snowmanisgood) 8 77.23 84.63 0 0.00
19871. Hriju (hriju) 8 55.10 62.96 3 37.50
19872. Sukrit (arskiir) 8 74.42 86.27 2 25.00
19873. Menace (menace101) 8 102.18 107.11 4 50.00
19874. fida (ferarida) 8 82.20 94.65 7 87.50
19875. Winda (windamrtrn) 8 59.23 69.58 8 100.00
19876. Speky (speky) 8 46.28 55.01 1 12.50
19877. Master (medo2006) 8 77.37 95.17 3 37.50
19878. لركيد (lorchid) 8 68.59 74.81 5 62.50
19879. Andrew (thekirkendall) 8 89.90 101.73 7 87.50
19880. Milos (kaoss14) 8 72.13 86.05 3 37.50
19881. Barfo (barfo) 8 80.00 89.96 2 25.00
19882. Dominic (dominicp97) 8 75.53 81.75 1 12.50
19883. Seth (sandwichseth) 8 62.27 81.15 2 25.00
19884. Mikrit (mickey035) 8 92.40 103.38 1 12.50
19885. Jessica (jessi_p3) 8 74.58 87.33 2 25.00
19886. Anlanther (anlanther) 8 81.59 89.58 4 50.00
19887. Sergio (dallmyt) 8 36.87 48.89 0 0.00
19888. Andrew (andrewawesome04) 8 113.01 132.13 7 87.50
19889. axari (axari) 8 70.78 82.70 1 12.50
19890. Arkinator (arkinator) 7 101.07 117.82 5 71.43
19891. Argon (argon11110) 7 111.41 126.28 3 42.86
19892. rommyarb (arbantas) 7 75.19 84.28 1 14.29
19893. artahian (aram90) 7 130.61 148.08 4 57.14
19894. AtM5 (araconda) 7 90.91 101.71 2 28.57
19895. hi (appleeee) 7 64.89 69.68 1 14.29
19896. Deceime (applebabycare) 7 106.81 115.02 4 57.14
19897. Anuvrat (anuvrat) 7 94.40 100.45 3 42.86
19898. antloflow (antloflow) 7 39.60 47.14 0 0.00
19899. Antlocwe (antlocwe) 7 83.00 106.41 0 0.00
19900. Raisin (annielam) 7 71.81 82.58 1 14.29
19901. Anmol (anmol_786) 7 38.53 44.30 0 0.00
19902. Connor (animegorl2000) 7 67.80 83.61 0 0.00
19903. Tu (anhtu96) 7 103.93 122.11 2 28.57
19904. angie (angelow) 7 52.20 65.76 0 0.00
19905. Andrew (andrewmosey) 7 71.65 77.13 5 71.43
19906. Andrew (andrew03) 7 73.00 87.01 0 0.00
19907. anavel (anavel03) 7 79.69 94.15 2 28.57
19908. K N (ananthan2k) 7 72.30 76.00 0 0.00
19909. Amy (amytypes123) 7 123.38 134.86 5 71.43
19910. Amr (amrhachicho) 7 90.34 101.38 4 57.14
19911. T2DR (amogussus) 7 53.79 59.66 4 57.14
19912. amine (aminerdene17) 7 44.86 50.51 0 0.00
19913. John (amhacking) 7 82.17 86.54 1 14.29
19914. a (aly394) 7 97.39 115.43 2 28.57
19915. al (alpasto) 7 60.29 73.04 1 14.29
19916. Eva (allyve) 7 56.19 65.43 3 42.86
19917. Matthew (allotec) 7 62.60 73.17 1 14.29
19918. a (allorang) 7 113.80 134.36 4 57.14
19919. Alif (alif_) 7 50.25 55.41 0 0.00
19920. Alex (alexthegamer281) 7 88.98 100.09 4 57.14
19921. Alex (alexkyo) 7 85.44 102.28 2 28.57
19922. Alex (alexbananex) 7 55.43 62.05 2 28.57
19923. Tiger (alcatrazx) 7 68.78 80.58 4 57.14
19924. Alan (alansanchez) 7 105.95 118.36 4 57.14
19925. Alaa (alaasultan) 7 27.43 30.41 1 14.29
19926. Veedora (akuyepe) 7 95.46 103.41 7 100.00
19927. Peter (akr0nik) 7 104.07 115.23 6 85.71
19928. Squall (akaisquall) 7 107.61 126.48 5 71.43
19929. Roberto (ajaxlord28) 7 83.72 99.91 3 42.86
19930. Rob (airgo32) 7 82.88 94.37 3 42.86
19931. Ahmed (ahmed_elamory) 7 66.85 73.96 2 28.57
19932. niz (ahegao_hunter) 7 76.06 93.55 1 14.29
19933. I_like_Billie_Eilish (agiun... 7 63.91 71.88 0 0.00
19934. reyal171_ (agdplayer64x) 7 75.57 91.94 3 42.86
19935. Muh. Habibi (agemagi) 7 93.10 101.12 1 14.29
19936. afq984 (afq984) 7 73.58 79.62 3 42.86
19937. Rui (adranos) 7 100.98 108.05 4 57.14
19938. aditya (addy2001) 7 52.25 54.27 1 14.29
19939. Ace (ace_axk) 7 57.31 69.44 5 71.43
19940. iquitwhenimakemistake (ace_... 7 92.08 102.15 5 71.43
19941. Abum (abum) 7 62.59 76.36 1 14.29
19942. ac (abpqjbdhsj) 7 61.86 75.31 0 0.00
19943. Abdurrahman (abood_abu_jawad) 7 51.13 55.89 1 14.29
19944. ABIZABI (abizabi) 7 61.19 69.52 1 14.29
19945. Abdulwahab (abdulwahabksa) 7 95.94 114.80 5 71.43
19946. زياد (aatrox0_0) 7 90.01 105.44 3 42.86
19947. Tony (aarup) 7 114.99 140.07 5 71.43
19948. Aaron (aaronoct) 7 46.38 55.11 0 0.00
19949. Anthony (aantho) 7 98.69 108.33 7 100.00
19950. Elias (9elias) 7 103.86 112.31 4 57.14
19951. Akira (8amb1) 7 64.09 72.13 4 57.14
19952. 86hawks (86hawks) 7 85.51 94.48 2 28.57
19953. G00N (600n) 7 45.85 51.56 0 0.00
19954. Dj (4tonystanit) 7 90.96 106.82 0 0.00
19955. artie (4rtie) 7 73.07 92.15 2 28.57
19956. 4aeon (4aeon) 7 98.60 109.53 1 14.29
19957. Adam (420adam) 7 60.02 70.34 1 14.29
19958. Rachin (33rachin) 7 76.05 84.62 3 42.86
19959. Omar (22omar) 7 42.48 50.36 0 0.00
19960. Tomazio99 (tomazio99) 7 52.28 54.90 0 0.00
19961. Primez (tff_primez) 7 88.00 101.85 1 14.29
19962. Emmanuel (manu_0717) 7 45.02 50.90 0 0.00
19963. Lazer (lazer_michael68) 7 87.69 99.56 4 57.14
19964. Charles (snarls_charles) 7 60.08 69.81 1 14.29
19965. Alan (cabinbeaver) 7 95.14 102.81 4 57.14
19966. neec (neec) 7 58.05 62.92 0 0.00
19967. haziq (gleam467) 7 47.43 55.14 0 0.00
19968. Ed (edddddddie) 7 72.29 77.66 3 42.86
19969. Abdulkader (abdulkader_safi) 7 26.41 29.75 2 28.57
19970. Long (tphl) 7 43.81 57.70 2 28.57
19971. shine (shinepagne) 7 77.60 83.08 4 57.14
19972. Tyron (cerebral_sustenance) 7 66.07 72.39 6 85.71
19973. Ohze (ohze) 7 113.79 133.41 4 57.14
19974. agz (xagz) 7 87.43 92.98 3 42.86
19975. Nathan (yourhomienate) 7 90.85 102.69 2 28.57
19976. Sawad (myrstival) 7 83.42 96.83 1 14.29
19977. Matt (hadot) 7 91.18 105.78 3 42.86
19978. Cat (littlecaaat) 7 76.97 84.09 4 57.14
19979. Felix (kirken) 7 56.73 67.27 2 28.57
19980. rainy (rainypay) 7 40.25 55.81 0 0.00
19981. Reagan (bigsquidwardmomma) 7 50.78 55.55 2 28.57
19982. SHAHIN (shahin98) 7 52.79 64.07 3 42.86
19983. Mykailah (mykailahk) 7 85.32 96.90 5 71.43
19984. PleasedPanda (pleasedpanda) 7 53.20 61.16 1 14.29
19985. Ian (burgerleadr) 7 72.00 79.10 2 28.57
19986. Jahns (lewflo) 7 84.79 98.99 3 42.86
19987. Jimbo toot n fart (shakenfake) 7 84.66 88.71 2 28.57
19988. Whitsy (driedss) 7 87.09 105.03 2 28.57
19989. BleaKrytE (bleakryte) 7 80.18 86.11 1 14.29
19990. Luke (itscrucial) 7 72.67 82.58 1 14.29
19991. Ben (benthedink8) 7 106.92 116.21 1 14.29
19992. Neil Cyril (cycy501) 7 69.77 84.12 1 14.29
19993. 40wpm beta (tenseworthy) 7 74.93 82.78 5 71.43
19994. Nicolas (anicolas26) 7 95.44 105.66 1 14.29
19995. Ákos (mrazakos05) 7 51.95 55.73 0 0.00
19996. sammie (sammiethelamest) 7 80.93 98.09 3 42.86
19997. Samuel (cornymovie) 7 32.95 44.92 0 0.00
19998. Elis (speedyboio) 7 37.67 43.98 1 14.29
19999. Alex (imalexorange) 7 88.72 109.47 1 14.29
20000. Caleb (caleb2099) 7 79.57 96.33 0 0.00
20001. Angela (midnitelady1889) 7 81.94 90.80 4 57.14
20002. FIFI (fi_fi) 7 48.35 56.18 6 85.71
20003. nathan (muskratz) 7 98.60 133.70 1 14.29
20004. Nivedit (_nivedit_) 7 67.43 75.50 0 0.00
20005. tacohiro (tacohiro) 7 83.68 98.31 2 28.57
20006. VictorOTrumper1 (apulh1) 7 44.60 53.54 0 0.00
20007. test (eratest) 7 42.99 55.64 2 28.57
20008. Sean (minutoh) 7 112.80 127.28 5 71.43
20009. Cahetel (hyperkevenau) 7 57.94 65.72 1 14.29
20010. Pawsom (pawsom) 7 35.29 42.49 0 0.00
20011. Satya (jordge) 7 74.42 94.88 2 28.57
20012. seennotheard (seennotheard) 7 106.21 116.49 3 42.86
20013. Lucas (brenkie) 7 73.81 82.14 4 57.14
20014. James (pooman111) 7 79.23 85.31 5 71.43
20015. Darren (chem_notebook) 7 89.30 100.96 6 85.71
20016. lila (t4rtagl1a_) 7 55.78 82.20 0 0.00
20017. Suvarchas (suvarchas) 7 69.47 81.94 3 42.86
20018. នាគអាស៊ី (s... 7 71.98 88.35 3 42.86
20019. Link (crimson_mecha) 7 64.18 70.46 1 14.29
20020. Mamnoon (mamnoon7264) 7 49.12 59.02 2 28.57
20021. WkwK (halwiy76) 7 54.86 59.85 1 14.29
20022. LowSpecGaming (afif87123) 7 61.36 68.94 1 14.29
20023. Nguyen (_longnguyen) 7 60.40 63.87 0 0.00
20024. Jacob (dajacob2335) 7 65.98 81.47 0 0.00
20025. Xang (xangszane) 7 122.82 137.88 4 57.14
20026. Rohan (bobzy) 7 78.06 85.25 0 0.00
20027. rumman (rumman_sust) 7 56.09 71.64 0 0.00
20028. Verde (verdezapo) 7 100.18 111.07 7 100.00
20029. Rogin (robogin123) 7 75.61 84.59 3 42.86
20030. or (ordol) 7 66.82 75.82 5 71.43
20031. DcThaGoat (crxxzz11) 7 73.95 82.56 7 100.00
20032. Tony (diceruler) 7 107.18 115.95 7 100.00
20033. Zach (zachmeikle) 7 60.44 63.92 1 14.29
20034. Jia En (jiaennn) 7 61.46 79.45 1 14.29
20035. Henry (flexion) 7 70.83 78.91 4 57.14
20036. Maliir (maliir) 7 56.09 62.33 1 14.29
20037. Maks (makso02) 7 60.10 71.42 7 100.00
20038. mairzydoats_mason (mairzydo... 7 86.55 98.15 1 14.29
20039. Sakib (mahmud1) 7 88.08 102.66 2 28.57
20040. mahdy (mahdy7) 7 62.78 72.73 1 14.29
20041. Shane (maggiepie) 7 66.80 91.98 2 28.57
20042. Madsin (madsin) 7 49.54 54.25 1 14.29
20043. Elad (madror1) 7 40.36 48.77 7 100.00
20044. Dan (maddolis) 7 122.00 139.12 6 85.71
20045. Mayank (maaynx) 7 67.60 92.71 4 57.14
20046. LYF (lyf_) 7 55.02 73.20 1 14.29
20047. Tyler (lydes) 7 91.65 103.18 2 28.57
20048. Alexis (lxsmndl) 7 77.84 98.72 4 57.14
20049. Yumzy (lusileven) 7 66.56 75.43 0 0.00
20050. cade (lunacy_) 7 101.29 108.30 3 42.86
20051. Luklein (luklein) 7 53.22 58.46 7 100.00
20052. Dat (ltdat1618) 7 81.10 90.69 6 85.71
20053. andrei (loomit) 7 77.98 98.36 1 14.29
20054. Long (longgho) 7 62.69 75.29 2 28.57
20055. KILLA (longhin_mark) 7 110.53 122.49 3 42.86
20056. Löncswing (loncswing) 7 69.66 84.84 1 14.29
20057. Lovro (lolvrol) 7 63.95 72.16 1 14.29
20058. Lokizypresse_902 (lokizypre... 7 90.07 118.07 4 57.14
20059. Lluis (lluisteixido) 7 74.48 86.87 2 28.57
20060. Ashvik (llamma) 7 63.25 81.13 4 57.14
20061. Paul (llamaking86) 7 86.45 101.94 2 28.57
20062. LionMane (lion_mane_jellyfish) 7 104.46 122.17 3 42.86
20063. Daddy (liondj7) 7 78.21 84.24 1 14.29
20064. lil_vince (lil_vince) 7 81.46 91.67 1 14.29
20065. liv (lilolive) 7 76.73 86.36 0 0.00
20066. lili (lilihsu) 7 59.55 65.12 0 0.00
20067. Liam (liamdaman) 7 52.98 62.90 1 14.29
20068. UnsaidFred (leophidian) 7 82.78 88.47 4 57.14
20069. Lê Hùng Luận (lehungluan) 7 59.32 65.57 1 14.29
20070. Lego (legogurke) 7 53.42 60.28 1 14.29
20071. Reese (leeseree) 7 90.28 107.29 7 100.00
20072. benihana (ledecade) 7 117.35 120.82 4 57.14
20073. Lucas (ldahmm) 7 78.71 89.34 3 42.86
20074. Wahh (lazydude1) 7 83.30 103.27 2 28.57
20075. Lazar (lazer123) 7 71.36 82.15 3 42.86
20076. Catherine (lautherine) 7 67.61 84.84 2 28.57
20077. Hamza (lasthamzastanding) 7 65.56 70.42 2 28.57
20078. Lanz (lanz22) 7 92.00 111.05 1 14.29
20079. Sean (laggermc) 7 89.01 96.54 0 0.00
20080. Labib (l4bib) 7 92.15 106.53 0 0.00
20081. George (kyrite) 7 102.93 119.15 4 57.14
20082. Louise (kyarakutaa) 7 81.26 93.40 3 42.86
20083. nully (kuwurakkuheddo_) 7 72.38 96.01 0 0.00
20084. Kushal (kushaltrivedi5) 7 83.68 89.77 2 28.57
20085. Kushal (kushalkumar) 7 67.15 74.01 2 28.57
20086. Adam RIP Byron (kurfew) 7 105.58 111.22 2 28.57
20087. Kurai (kuraiflame) 7 70.17 76.08 1 14.29
20088. Kuerbiskosar (kuerbiskosar) 7 57.91 64.88 3 42.86
20089. Only typing will save the w... 7 100.09 106.25 2 28.57
20090. Kuanysh (kuanyshby) 7 41.91 50.46 2 28.57
20091. Kristoffer (krioxia) 7 84.60 97.12 5 71.43
20092. supernoob (krcellucci) 7 86.19 90.76 3 42.86
20093. Mateusz (krakeusz) 7 84.33 94.43 2 28.57
20094. Adam (kolcow) 7 52.16 61.32 3 42.86
20095. Ella (kokookie) 7 60.97 69.76 4 57.14
20096. Buo YU (koh100) 7 105.68 117.30 4 57.14
20097. Koco (koco001) 7 36.74 46.69 1 14.29
20098. Knight (knight_shadow) 7 49.70 52.80 2 28.57
20099. Knight (knightfury18) 7 45.92 55.04 1 14.29
20100. Klash (klashghost) 7 89.57 95.81 3 42.86
20101. kizzgotnorest (kizznorest) 7 44.99 51.53 2 28.57
20102. Ika (kitkatslr) 7 60.13 63.17 1 14.29
20103. Toru (kir6meki) 7 86.48 99.26 4 57.14
20104. Kilty (kilty) 7 96.65 108.20 5 71.43
20105. Filip (kicklets) 7 81.01 96.69 2 28.57
20106. Khen (khen2003) 7 90.17 96.41 1 14.29
20107. Khairosh (khairosh) 7 75.64 87.50 3 42.86
20108. Keyser (keyserrr) 7 89.18 94.13 2 28.57
20109. Kevin (kevinm162) 7 73.21 87.71 4 57.14
20110. Kevin (kevinity) 7 132.62 141.05 7 100.00
20111. Brett (kermin) 7 110.10 133.03 5 71.43
20112. h (kenthios) 7 105.62 122.29 2 28.57
20113. Kelton (kelkidman) 7 58.04 60.80 0 0.00
20114. kektor (kektorkuan) 7 76.48 93.22 2 28.57
20115. Anvar (kekstroke) 7 51.17 56.33 0 0.00
20116. Keith (keith_qwerty) 7 53.72 60.65 0 0.00
20117. Jeff (keeperofbees) 7 80.13 87.33 4 57.14
20118. Gábor (kecske116) 7 65.41 75.69 0 0.00
20119. Keagan (keagonian_16) 7 40.71 51.08 0 0.00
20120. Kawasaki (kawasaki_314) 7 66.99 79.73 3 42.86
20121. Ghribi (kaspersaif) 7 50.91 59.63 1 14.29
20122. Sebastian (karuispa) 7 55.43 65.63 1 14.29
20123. Caroline (karialyn) 7 108.94 119.95 5 71.43
20124. Karel (kareldang) 7 81.57 86.83 2 28.57
20125. Kaphran (kaphran) 7 112.23 126.12 6 85.71
20126. marc (kangdashman) 7 71.81 83.39 4 57.14
20127. Jyotirmoy (jyotirmoy_halder) 7 102.53 114.20 4 57.14
20128. James (jynx0) 7 62.31 68.19 2 28.57
20129. Joey (jxmp) 7 62.06 74.59 3 42.86
20130. Jv (jv_2002) 7 79.70 86.93 2 28.57
20131. Ser (juzser) 7 62.84 66.60 2 28.57
20132. Alex (just_alex) 7 74.02 94.29 2 28.57
20133. Rodney (justrodneylee) 7 98.19 102.20 2 28.57
20134. Joke (justjokeing) 7 109.51 117.11 5 71.43
20135. Jens (justjens) 7 82.81 95.11 0 0.00
20136. Nick (justintolerable) 7 66.39 71.65 0 0.00
20137. Justin (justinjd) 7 131.66 146.02 5 71.43
20138. Justienz (justienz) 7 92.10 99.04 1 14.29
20139. justavg (justavg) 7 92.90 99.87 2 28.57
20140. Jr (jrlynn) 7 28.50 30.38 2 28.57
20141. JRey (jreyranoco) 7 96.27 102.15 3 42.86
20142. J (jrazn) 7 77.41 86.84 3 42.86
20143. JQuez (jquez) 7 103.98 115.87 5 71.43
20144. Joy (joyisawesome) 7 114.81 127.60 4 57.14
20145. Jude (joodels) 7 75.20 78.92 3 42.86
20146. Jon (jon_ackbar) 7 92.29 101.78 2 28.57
20147. Jons (jonserino) 7 72.79 79.11 4 57.14
20148. Jon (jonlauws) 7 98.40 106.06 3 42.86
20149. Jonwin (jonawi) 7 38.86 43.90 0 0.00
20150. Jonas (jonasbalante123) 7 62.14 65.93 3 42.86
20151. Jonas (joltux) 7 97.14 100.75 3 42.86
20152. John (johhpreston) 7 53.21 60.15 2 28.57
20153. jody (jody10) 7 64.98 79.75 1 14.29
20154. Jon-Michael (jm_george99) 7 49.99 58.27 2 28.57
20155. Justin (jmgrim16) 7 73.79 88.96 3 42.86
20156. jkrkvld (jkrkvld) 7 71.81 83.46 1 14.29
20157. Joshua (jkim0206) 7 106.77 124.38 7 100.00
20158. Jamie (jkelly21) 7 98.26 111.95 1 14.29
20159. Jun (jjjun) 7 99.77 125.09 6 85.71
20160. Justin (jjallday13) 7 109.46 123.84 5 71.43
20161. Christopher (jingping) 7 96.92 112.45 2 28.57
20162. jim (jimbosenior) 7 88.81 100.56 2 28.57
20163. Jimbo (jimboolio) 7 38.52 40.42 0 0.00
20164. Jessica (jessicapeng) 7 114.37 125.38 4 57.14
20165. Jenerikk (jenerikk) 7 89.72 104.51 1 14.29
20166. jeff (jeffdujon) 7 103.26 120.64 2 28.57
20167. Jecong (jecong) 7 83.49 100.89 2 28.57
20168. Jeffrey (jebbythepanda) 7 112.92 126.00 3 42.86
20169. Jay (jdpthota) 7 92.80 101.39 2 28.57
20170. jA_eur0 (ja_eur0) 7 105.05 119.46 4 57.14
20171. Jay (jay_rush) 7 80.00 89.08 5 71.43
20172. Jayden (jayden_1) 7 62.36 72.11 1 14.29
20173. Jhun Chester (jaycel19) 7 76.33 94.15 1 14.29
20174. Jason (jasonfong06) 7 80.76 91.70 3 42.86
20175. Jasdeep (jasdeepp21) 7 40.43 45.52 0 0.00
20176. Jake (jarljake) 7 74.02 80.88 0 0.00
20177. James (jamesvereen) 7 69.55 75.68 2 28.57
20178. Jakob (jakob170201) 7 57.16 63.22 0 0.00
20179. Nirav Jain (jainnirav88) 7 65.98 70.70 2 28.57
20180. Hello (jadensmith7) 7 102.80 114.86 1 14.29
20181. jacie (jackieblackie3) 7 44.63 49.30 0 0.00
20182. Conner (jabronee) 7 105.43 111.55 1 14.29
20183. Bad (iwillgetbetterattyping) 7 70.47 79.13 2 28.57
20184. Ivo (ivosu_10) 7 64.42 74.63 2 28.57
20185. Ivan (ivansucksattyping) 7 108.85 130.11 4 57.14
20186. zn (ittahb) 7 100.56 117.45 3 42.86
20187. Ichirou (itskotami) 7 69.34 78.03 2 28.57
20188. Jay-Ar (itsjerr) 7 78.97 99.77 2 28.57
20189. Allan (itsgam3tyme) 7 98.06 105.41 3 42.86
20190. Everett (istorm_light) 7 101.98 110.42 6 85.71
20191. iStealthy (istealthy) 7 115.03 138.84 6 85.71
20192. Tyler (isharity) 7 86.03 92.62 3 42.86
20193. Isc (isc30) 7 71.31 80.56 2 28.57
20194. ironjill (ironjill) 7 89.05 98.59 4 57.14
20195. iRqx (irex_) 7 101.02 108.75 5 71.43
20196. Aidan (ireallylovehockey) 7 88.27 99.05 1 14.29
20197. Matt (iproz) 7 90.22 98.41 2 28.57
20198. Quang (ionlyvayne) 7 83.83 101.67 4 57.14
20199. Invincibolos (invincibolos) 7 70.10 82.53 2 28.57
20200. David (inspectahmellow) 7 81.08 96.02 3 42.86
20201. indian_lad365 (indian_lad365) 7 60.65 67.10 1 14.29
20202. Eli (incarnis1) 7 103.57 113.66 2 28.57
20203. Anshorullah (imugetsu6) 7 86.05 102.25 2 28.57
20204. Imme (immevdb) 7 78.03 81.23 3 42.86
20205. Your Mom (imgonnalose69) 7 132.60 141.30 6 85.71
20206. iluvv (iluvv) 7 90.95 94.30 0 0.00
20207. Waaa (iiblazed) 7 59.85 64.50 1 14.29
20208. fuc (ihumpdogs) 7 75.85 80.47 3 42.86
20209. Kenneth (iflippy) 7 114.74 134.16 3 42.86
20210. Bob (ieatyou1) 7 71.44 91.82 0 0.00
20211. Benjamin (idioticben05) 7 103.08 114.05 4 57.14
20212. icon (iconicck) 7 81.43 93.08 1 14.29
20213. Stella (iceeigloo) 7 76.53 91.08 2 28.57
20214. iaxx (iaxx) 7 114.95 131.69 3 42.86
20215. Ian (ian_k_john) 7 70.62 89.96 0 0.00
20216. Helen (iamhelenkeller) 7 74.28 78.59 1 14.29
20217. Ben (hutben) 7 91.65 107.36 4 57.14
20218. Hunt (huntzhang) 7 81.51 96.84 5 71.43
20219. Trần Khải Hưng (hunglc... 7 52.77 58.18 2 28.57
20220. Hossein (hossein_nas) 7 89.19 103.81 4 57.14
20221. air (hopeberries) 7 81.81 103.18 4 57.14
20222. Pham (hitpointsss) 7 95.87 112.23 1 14.29
20223. himanshu (himanshukamani) 7 27.00 30.95 3 42.86
20224. himaji (himaji) 7 70.91 81.64 2 28.57
20225. DvorakRacer (higginsishere) 7 103.46 120.27 3 42.86
20226. Hamza (hhaammzzaa) 7 49.59 60.56 1 14.29
20227. Henry (hezzmasterflash) 7 42.50 53.06 0 0.00
20228. HennesseyDrew (hennydrew) 7 89.51 104.09 2 28.57
20229. Henry (henburger) 7 86.41 99.17 0 0.00
20230. deckard (hell_bovine) 7 104.32 112.37 4 57.14
20231. Victor (helixidron) 7 117.87 137.34 3 42.86
20232. helios (helios69) 7 62.55 72.28 0 0.00
20233. John (helion_) 7 65.84 69.52 2 28.57
20234. Kushagr (heavenclaw) 7 34.43 36.78 0 0.00
20235. vineet (headspace_men) 7 76.98 87.41 3 42.86
20236. Hazem (hazemmy) 7 73.66 80.34 1 14.29
20237. Hatcheco (hatcheco) 7 67.41 77.32 2 28.57
20238. Mehedi Hasan Emo (hasanemo654) 7 71.61 79.77 2 28.57
20239. Harrius (harrius) 7 95.30 109.00 1 14.29
20240. Ignas (harord) 7 49.61 55.01 3 42.86
20241. HARN0LD (harn0ld) 7 80.01 87.39 1 14.29
20242. Harm (harm_) 7 79.75 84.91 6 85.71
20243. Hari (hari_prasath_25) 7 55.42 61.37 2 28.57
20244. Xcentrick (hardiksince1987) 7 46.21 56.73 0 0.00
20245. benhalfpap (happypappy21) 7 123.53 131.53 3 42.86
20246. Harrison (happyg) 7 110.69 124.54 4 57.14
20247. Bish (haogy101) 7 80.76 93.31 4 57.14
20248. HASG (hamzaelgarhy) 7 30.56 34.64 1 14.29
20249. Hamschi (hamschi) 7 74.81 82.02 3 42.86
20250. hahaha (hahaha6969) 7 85.21 101.09 2 28.57
20251. Harry (h3h3pul4t0r) 7 133.87 139.02 4 57.14
20252. Tájpolósch (gunnhallur) 7 84.00 90.48 3 42.86
20253. Jamie (gumboll) 7 78.62 87.82 6 85.71
20254. jeremy (grrmee) 7 87.19 94.18 3 42.86
20255. Gray (grayhollow) 7 82.56 94.82 3 42.86
20256. Siddhartha (gravito12345) 7 94.43 108.93 3 42.86
20257. Rocco (grapefruit95) 7 73.66 80.40 0 0.00
20258. Gracie (graciemyers123) 7 78.22 88.73 4 57.14
20259. Elias (gottabefast) 7 125.26 137.17 4 57.14
20260. Tylor (goofy_goober2006) 7 54.29 67.30 0 0.00
20261. Gonzalo (gonzalocl1024) 7 49.96 59.91 0 0.00
20262. Gold_Borg (gold_borg) 7 44.46 58.14 5 71.43
20263. Konnie (goldentiny) 7 52.91 61.67 1 14.29
20264. lucas (godofthegods111) 7 53.19 58.04 1 14.29
20265. godofpainTR (godofpaintr) 7 85.16 99.10 7 100.00
20266. Gmlord (gmlord) 7 66.88 83.75 1 14.29
20267. Tiago (glinski) 7 67.47 79.50 2 28.57
20268. johnni (gleaned) 7 83.80 93.60 1 14.29
20269. Gislaa (gislaaa) 7 96.00 103.33 3 42.86
20270. Gio (giniguy) 7 88.34 98.66 3 42.86
20271. NinjR (gingerninjr) 7 105.98 115.99 1 14.29
20272. Gilson (gilsoncav) 7 53.42 58.53 1 14.29
20273. GidbinN (gidbinn) 7 82.31 88.95 3 42.86
20274. Gaby's (ggaby) 7 38.60 44.05 0 0.00
20275. gabriel (gfox66) 7 96.38 104.54 6 85.71
20276. George (georgecook) 7 51.82 62.61 0 0.00
20277. C:\cmd (geodev) 7 52.57 62.27 3 42.86
20278. James (gemvoo) 7 95.10 109.62 4 57.14
20279. Gerry (gchenfc) 7 98.18 103.49 3 42.86
20280. Grant (gbuff) 7 87.24 94.80 1 14.29
20281. gavin (gavyoung) 7 30.85 35.86 2 28.57
20282. Gav (gav576) 7 123.26 141.02 4 57.14
20283. Dennis (gardpm) 7 90.14 106.67 5 71.43
20284. Gabboxl (gabboxl) 7 60.15 61.71 1 14.29
20285. D (g1ddriver) 7 70.16 75.84 0 0.00
20286. Vaeciar (fusionn) 7 101.34 115.63 3 42.86
20287. furzoz (furzoz) 7 95.95 105.95 3 42.86
20288. funny (funnybus) 7 81.93 100.71 3 42.86
20289. Anh (fujiwarakazuki) 7 93.37 105.06 0 0.00
20290. . (__random__) 7 92.20 103.03 2 28.57
20291. damn (_victor667_) 7 55.93 65.76 0 0.00
20292. Dewey (_dewey) 7 108.43 114.06 2 28.57
20293. Federico (_cali) 7 99.78 112.45 4 57.14
20294. Alex (_alwang_) 7 77.83 89.12 2 28.57
20295. Ales (_ales) 7 103.05 111.37 4 57.14
20296. Zimri (zygnus) 7 111.24 133.26 4 57.14
20297. Zyan25 (zyan2525) 7 78.27 84.26 6 85.71
20298. Hans (zozo800) 7 70.36 76.21 0 0.00
20299. joe (zoybls) 7 63.07 75.77 0 0.00
20300. zoomfrog (zoomfrog) 7 95.54 104.62 3 42.86
20301. HollowAri (zokkuu) 7 65.03 70.72 1 14.29
20302. ziolson (ziolo1) 7 66.16 81.41 2 28.57
20303. e (zimboboys) 7 96.91 103.31 3 42.86
20304. jack (zero18) 7 73.99 79.36 1 14.29
20305. Khanon (zero1010_) 7 61.53 69.61 2 28.57
20306. Hopelezz (zerloth) 7 85.98 97.59 1 14.29
20307. Loong (zenloong) 7 94.58 100.84 3 42.86
20308. Zed (zedhabibi) 7 59.44 64.52 6 85.71
20309. Zeddy (zeddyx) 7 90.15 99.18 4 57.14
20310. Zchob (zchob) 7 70.82 77.31 5 71.43
20311. Neeraj (zapidox) 7 42.35 48.05 1 14.29
20312. Zajd (zajd36) 7 105.34 114.52 3 42.86
20313. Zaid (zaid_ansari) 7 47.99 54.72 1 14.29
20314. Ho (zahid11704023) 7 43.05 49.77 1 14.29
20315. Dwi (yvbinjk) 7 77.39 95.27 3 42.86
20316. Rataro (yuugokku) 7 79.86 97.29 1 14.29
20317. Michael (yt_m1gamer2020) 7 65.59 71.76 3 42.86
20318. Aaron (yoyoyonono) 7 106.82 120.28 3 42.86
20319. Sasuke (yosasuke) 7 103.89 120.84 4 57.14
20320. yian (yian31415) 7 68.98 74.87 3 42.86
20321. Yenthe (yenthefromghent) 7 43.94 47.18 2 28.57
20322. Yeldos (yeldosmanap) 7 76.44 80.53 2 28.57
20323. Rohan (yeetarted) 7 103.44 109.45 4 57.14
20324. Sam (ye3et) 7 64.96 67.42 1 14.29
20325. Yaye (yaye2002) 7 29.52 34.47 2 28.57
20326. Yatin (yatin18) 7 53.85 58.46 2 28.57
20327. Yashvir (yashvir_kothari) 7 36.89 41.83 2 28.57
20328. XxDarkSIdexX (xxdarksidexx) 7 30.67 42.46 2 28.57
20329. Eli (xutt) 7 74.13 85.84 6 85.71
20330. reduce (xreduce) 7 150.44 163.72 7 100.00
20331. Steve (xenoxinius) 7 104.09 114.56 5 71.43
20332. Barton (xbarton) 7 101.12 107.24 0 0.00
20333. Jacob (xavior_x) 7 93.81 100.00 4 57.14
20334. Jake (wyol) 7 71.74 77.83 2 28.57
20335. Alex (wu2481632) 7 124.21 134.39 4 57.14
20336. Gerlat (wtcher1066) 7 53.21 57.79 1 14.29
20337. yung (woahthereyungman) 7 67.27 88.61 0 0.00
20338. Wo1v3r (wo1v3r) 7 113.37 120.62 3 42.86
20339. Wissa (wissaa) 7 36.33 47.37 2 28.57
20340. wabi (wisabi) 7 109.43 123.80 7 100.00
20341. Willie (williewho) 7 77.83 89.60 0 0.00
20342. Wikedtik (wikedtik) 7 101.88 107.37 1 14.29
20343. glo (whytho_) 7 92.84 102.78 1 14.29
20344. Llihcon (whoflayslikeme) 7 84.97 89.42 2 28.57
20345. Sarp (whitechocolatee) 7 69.65 75.99 3 42.86
20346. Dots (wheremydots) 7 85.20 101.81 1 14.29
20347. N3gativeZero (whatsupbrandon) 7 85.03 106.44 3 42.86
20348. Wesley (wesilii) 7 103.14 115.49 3 42.86
20349. Warren (warlover94) 7 93.58 101.12 0 0.00
20350. Damian (waninggibbous) 7 70.76 73.86 3 42.86
20351. Wallace (wallacetwo) 7 99.12 104.72 4 57.14
20352. Walker (walkersutton) 7 91.06 116.01 3 42.86
20353. Wacky (wakcy) 7 84.69 101.41 4 57.14
20354. SRW (waifuthebest) 7 36.37 43.20 0 0.00
20355. WaffleAbs (waffleabs) 7 88.64 105.28 1 14.29
20356. Chris (w1ndow) 7 115.14 130.51 3 42.86
20357. Varun (vslala) 7 83.45 94.94 2 28.57
20358. ​ (vonunov) 7 144.33 164.03 2 28.57
20359. thach (vngoct1) 7 68.98 79.18 0 0.00
20360. Vlada (vlaki) 7 74.30 82.40 4 57.14
20361. Patrick (violaissimmo) 7 94.20 104.66 3 42.86
20362. Villads (vilmk) 7 35.96 42.64 0 0.00
20363. Viktor (viktro_touch_type) 7 86.03 95.44 1 14.29
20364. Vivek (viivek) 7 114.71 131.04 5 71.43
20365. NO (veryaveragetyper) 7 59.44 63.19 2 28.57
20366. Hello (venox11) 7 50.03 57.26 3 42.86
20367. Darcy (vendus13) 7 60.55 70.42 1 14.29
20368. Dias (vdios) 7 65.47 70.89 3 42.86
20369. Revil (vasat401) 7 43.28 48.83 0 0.00
20370. Amara (vainguardian29) 7 45.69 53.44 0 0.00
20371. Eva (vagabionda) 7 64.37 70.41 1 14.29
20372. Narkotik (vacban) 7 83.22 96.84 1 14.29
20373. Ikhbayar (u_mad_bruh_ikhee) 7 66.22 69.75 1 14.29
20374. uwunation (uwunation) 7 99.29 109.24 3 42.86
20375. Usurious (usurious_disc730) 7 88.58 99.43 6 85.71
20376. usu (usufails) 7 65.77 75.78 1 14.29
20377. datmeko (uralbeking) 7 80.60 86.83 2 28.57
20378. undeclared (undeclared) 7 104.71 130.83 6 85.71
20379. Ultrabars- (ultrabars) 7 65.90 94.79 0 0.00
20380. Uksza (uksza) 7 74.54 93.15 1 14.29
20381. Tomo (tzxb018) 7 84.36 92.88 1 14.29
20382. Mohaimenul (typun) 7 31.20 37.67 0 0.00
20383. typo11 (typo11) 7 58.04 67.57 2 28.57
20384. mu (typetypetypetypetype) 7 48.66 56.53 0 0.00
20385. Nibir (typer_de_random) 7 94.76 99.43 2 28.57
20386. Christian (typeger) 7 116.20 132.72 5 71.43
20387. kyel (txkyel) 7 87.24 91.33 1 14.29
20388. TuxKnight (tuxknight) 7 64.39 73.77 1 14.29
20389. Tuomas (tumaas) 7 84.34 93.45 3 42.86
20390. yuan (ttkomalake) 7 34.31 37.41 0 0.00
20391. Tom (ttaffy) 7 97.77 112.93 2 28.57
20392. Tycho (tspider4) 7 94.09 114.46 2 28.57
20393. Ahmad (truemagix) 7 49.51 53.77 1 14.29
20394. Always (tromin) 7 103.01 120.73 3 42.86
20395. Triz (triz) 7 111.87 125.87 6 85.71
20396. _trillbits_ (trillbits) 7 62.36 66.87 1 14.29
20397. tran (tranwantdie) 7 92.79 105.74 3 42.86
20398. Tomas (tomas_649) 7 52.72 61.73 0 0.00
20399. Tumarbek (tom4ke) 7 58.53 67.92 1 14.29
20400. János (tokumeikun) 7 64.73 77.99 1 14.29
20401. Michael (todfelton) 7 59.60 64.53 0 0.00
20402. Tj0027 (tj0027) 7 39.14 43.81 0 0.00
20403. Tim (timmaayyt) 7 71.10 86.30 0 0.00
20404. Tim (tigothy) 7 95.89 111.92 2 28.57
20405. PianOreo (thunderoreoz) 7 105.25 122.36 6 85.71
20406. Thunder (thunder2910) 7 74.30 83.17 2 28.57
20407. thummachart (thummachart) 7 55.76 61.91 0 0.00
20408. Thomas (thomastran02) 7 73.90 84.27 0 0.00
20409. Virginia (thomas11) 7 76.53 88.27 2 28.57
20410. The Ro Driver (the_ro_driver) 7 76.87 92.27 2 28.57
20411. David (the_pursuit) 7 102.72 118.36 7 100.00
20412. Willow (the_kirin_master) 7 106.09 132.64 6 85.71
20413. Hali (the_holy_hali) 7 61.18 67.79 7 100.00
20414. Elias (the_dovah) 7 63.95 70.04 0 0.00
20415. Derek (thewarrior_13th) 7 71.91 84.58 1 14.29
20416. Joe (therunner09) 7 98.37 107.42 3 42.86
20417. Alex (therodge) 7 63.62 76.47 1 14.29
20418. Jesse (thepaperman) 7 48.95 57.55 4 57.14
20419. Nam (thenewdawn97) 7 46.49 55.32 1 14.29
20420. thelegendary08 (thelegendar... 7 77.81 85.36 4 57.14
20421. Andrew (thedeathlyhallows) 7 122.77 142.17 4 57.14
20422. TheDasher (thedasherz) 7 54.02 61.00 1 14.29
20423. thatguy (thatguy577) 7 53.73 59.78 1 14.29
20424. thatchipz (thatchipz) 7 77.53 90.88 4 57.14
20425. BEST 54 wpm (terass) 7 33.18 37.55 2 28.57
20426. Tentic (tentic) 7 99.02 108.18 5 71.43
20427. Tellenar (tellenar) 7 82.36 100.00 2 28.57
20428. moyu (teledodol) 7 70.27 86.32 3 42.86
20429. Tea (teawee) 7 63.59 73.30 2 28.57
20430. Troy (tdserapio) 7 100.62 108.22 5 71.43
20431. Nurlan (tasmaev) 7 27.05 30.54 1 14.29
20432. venus (taroxtaroxtaro) 7 101.89 127.88 5 71.43
20433. Tarneem (tarneem) 7 73.38 85.76 3 42.86
20434. Cory (tarisant) 7 136.49 148.05 7 100.00
20435. Tanwa (tanwa) 7 71.42 83.53 1 14.29
20436. tanami (tanami) 7 130.19 154.79 7 100.00
20437. Tamuna (tamuna314) 7 58.30 61.79 1 14.29
20438. Slow (tal4565) 7 49.02 59.93 0 0.00
20439. B (tajooki) 7 87.16 105.37 3 42.86
20440. Ahmed (taftaf) 7 69.68 80.93 2 28.57
20441. Tachibana (tachibanayui) 7 60.83 79.17 2 28.57
20442. Ruiji (taburnalluigi) 7 49.66 65.68 4 57.14
20443. TeeCee (taboka) 7 36.80 44.45 1 14.29
20444. Tom (t0mas_colemak) 7 77.85 90.98 2 28.57
20445. Luke (synthsequence) 7 97.74 105.93 3 42.86
20446. Symawi (symawi) 7 73.11 82.84 1 14.29
20447. ed (sxxos) 7 79.35 88.26 3 42.86
20448. sentim3ntal1 (sweet_malaak) 7 84.88 97.78 1 14.29
20449. Sway (swaycuisway) 7 106.54 122.22 2 28.57
20450. Zihaku (swarmfirehd) 7 62.94 74.83 5 71.43
20451. Maggie (swagmag) 7 85.26 96.60 2 28.57
20452. Kartswag (swagkid) 7 100.40 109.29 5 71.43
20453. svime (svime) 7 87.48 111.91 3 42.86
20454. Chibichan (supersam317) 7 100.77 110.70 4 57.14
20455. Ashish (superman_11) 7 58.08 63.14 1 14.29
20456. Drew (supercoolgamer2) 7 31.64 45.15 0 0.00
20457. sirloc (sunsinghny19) 7 90.91 96.34 5 71.43
20458. sumukha_puranik (sumukha) 7 62.00 73.24 0 0.00
20459. suleman (suleman33) 7 101.30 126.05 5 71.43
20460. Subeesh (subeesh18) 7 70.84 76.99 2 28.57
20461. EMILYMYGODDESS (crlsh_) 7 88.75 102.60 5 71.43
20462. Struedelcat (struedelcat) 7 119.39 131.99 4 57.14
20463. Martin (stroj) 7 71.93 92.01 2 28.57
20464. stoozy (stoozy) 7 90.46 96.92 2 28.57
20465. rat (stinkypissboy) 7 93.40 112.05 6 85.71
20466. Steven (stevie03) 7 108.49 127.12 3 42.86
20467. Stephanie (stephycatz69) 7 51.45 64.50 0 0.00
20468. Adriel (stephencarry) 7 94.70 113.70 1 14.29
20469. steli2 (steli2) 7 111.26 127.07 5 71.43
20470. Ben (steamhawk) 7 44.15 57.42 1 14.29
20471. Star (star_sailorx) 7 112.46 133.25 4 57.14
20472. starscr3am (starscr3am) 7 45.02 50.24 0 0.00
20473. Robin (stapler8) 7 107.22 124.52 4 57.14
20474. Sourav (srax) 7 97.96 114.80 3 42.86
20475. squidite (squidite) 7 59.45 74.20 1 14.29
20476. Tom (spritelad) 7 86.94 95.91 3 42.86
20477. oliver (spou) 7 113.95 122.31 4 57.14
20478. Lucius (spirituslucius) 7 44.45 53.26 0 0.00
20479. Krystin (spetz) 7 75.13 83.69 2 28.57
20480. Martin (speedonthestreet) 7 83.29 89.86 7 100.00
20481. speedguy1 (speedguy1) 7 83.92 89.35 4 57.14
20482. Spanner (spanner77) 7 107.52 112.93 2 28.57
20483. Daniel (spades_syn) 7 59.01 66.50 2 28.57
20484. Jacob (soolseem) 7 93.16 105.03 1 14.29
20485. dhoanqa (sombowde) 7 72.90 80.88 0 0.00
20486. Soham (sohammukherjee2011) 7 79.54 93.22 2 28.57
20487. Soerth (soerth) 7 61.99 65.39 0 0.00
20488. Snow (snowjack) 7 81.40 91.98 2 28.57
20489. Carlos (snorlax7652) 7 52.18 78.27 4 57.14
20490. tstats[sneakyturtle333634] ... 7 72.75 77.12 2 28.57
20491. Jan (smilingjan) 7 84.23 96.91 1 14.29
20492. carti not dropping (slownoo... 7 123.27 138.12 4 57.14
20493. 77 (slithernoah) 7 63.35 77.05 1 14.29
20494. Aidan (slippp3r) 7 75.76 83.61 1 14.29
20495. Peter (slapchop18) 7 127.96 134.92 5 71.43
20496. Sklort (skl0rt) 7 76.52 90.80 2 28.57
20497. Kevin (skillz9600) 7 72.90 84.57 2 28.57
20498. Bubly (skelpadderidderen) 7 55.16 72.81 0 0.00
20499. SG Keyboard Warrior (singap... 7 100.44 120.56 3 42.86
20500. Silas (silvanus) 7 70.77 74.59 2 28.57
20501. Timmy (sillytimmy) 7 98.87 113.46 4 57.14
20502. Silly (sillygeeses) 7 77.20 84.99 2 28.57
20503. 516 (sig_sauers) 7 85.47 99.28 4 57.14
20504. Chara (sig_num) 7 83.45 89.94 3 42.86
20505. SighingSlider (sighingslider) 7 80.86 90.84 3 42.86
20506. Sigurdur (siggi84) 7 62.84 69.10 5 71.43
20507. Jed (shreyasgm) 7 109.68 118.85 4 57.14
20508. Shrek Of Justice (shrek_of_... 7 113.81 127.95 4 57.14
20509. . (shrekenberg) 7 122.72 137.22 3 42.86
20510. Jonathan (shoopdasoup) 7 97.09 133.50 6 85.71
20511. a (shibss) 7 87.85 100.10 3 42.86
20512. Shelyn (shelynxj) 7 79.55 84.81 3 42.86
20513. Shaleen (shaleenx) 7 91.26 97.49 1 14.29
20514. shaik (shahul_shaik) 7 78.95 88.30 2 28.57
20515. Shahriar (shahriar_shojib) 7 50.96 59.36 0 0.00
20516. Nick (serpuns) 7 53.00 60.25 2 28.57
20517. Daniel (sergiogahyrof) 7 81.26 91.69 4 57.14
20518. Enrico (serafino89) 7 63.49 71.39 2 28.57
20519. Klein (senserox) 7 64.47 71.18 2 28.57
20520. sedney (sedneyl) 7 55.16 62.94 0 0.00
20521. Screen (screendoor) 7 79.46 87.53 0 0.00
20522. Joshua (scpectre) 7 110.00 123.17 3 42.86
20523. DrCharlesS (scpdrcs) 7 59.17 64.65 2 28.57
20524. pi (schi678) 7 110.19 119.55 4 57.14
20525. Sawyer (sawyer_) 7 75.73 84.67 4 57.14
20526. Saniya (sashimisan_) 7 72.40 79.03 1 14.29
20527. Sang Sabil (sangsabil217) 7 59.09 67.01 1 14.29
20528. Sam (sandwhales) 7 56.74 65.24 3 42.86
20529. Olof (sammipk) 7 97.56 116.87 5 71.43
20530. Sam (samhsmith) 7 79.47 86.29 3 42.86
20531. sameer (sameerlol) 7 118.30 129.28 4 57.14
20532. Samo (sakra) 7 56.38 69.37 1 14.29
20533. Saeed (saeedfx) 7 55.90 65.90 0 0.00
20534. sachin (sachin1234502) 7 42.80 46.07 0 0.00
20535. Sabyasachi (saba10000) 7 48.75 56.54 0 0.00
20536. ryouinuma (ryouinuma) 7 75.01 82.12 0 0.00
20537. ryderrt (ryderrt) 7 55.48 76.31 0 0.00
20538. Ryan (ryanm42) 7 96.00 115.87 3 42.86
20539. Holly (runningnurse) 7 72.39 86.88 2 28.57
20540. Sourav (rubberboa) 7 94.99 99.63 1 14.29
20541. Rex (rrrreeexx) 7 80.64 94.30 2 28.57
20542. Rotala (rotala_macrandra) 7 96.19 106.34 3 42.86
20543. rota (rota22) 7 75.66 80.79 1 14.29
20544. rosina (rosina_24) 7 82.73 90.24 1 14.29
20545. Ozan Can (romuyloyloy) 7 58.70 65.89 1 14.29
20546. Craving (romboowner) 7 93.50 100.25 2 28.57
20547. Justin (rogreat) 7 102.97 117.10 4 57.14
20548. Rockfeller (rock_messi) 7 49.39 56.39 0 0.00
20549. Jan (robi21mlg) 7 83.66 97.21 5 71.43
20550. road_to_150wpm (road_2_150wpm) 7 136.73 147.45 5 71.43
20551. Redox (riyaushino) 7 91.85 101.67 2 28.57
20552. riswan (riswan_1212) 7 37.26 41.58 0 0.00
20553. Riptide (riptidetheta) 7 91.07 107.47 3 42.86
20554. Ri (rijizin) 7 63.57 69.93 1 14.29
20555. Loz (rightytypey) 7 92.18 108.69 2 28.57
20556. R Dizzle (ridzilla) 7 109.27 126.14 2 28.57
20557. Patrick (rick_pat) 7 85.96 96.45 5 71.43
20558. Radu (rhadoo611) 7 70.59 83.19 2 28.57
20559. Derek (rexyoda) 7 49.92 59.75 2 28.57
20560. Paul (retropixel99) 7 96.85 107.34 1 14.29
20561. Rex (redrex) 7 85.45 96.29 1 14.29
20562. RedEye (redeye) 7 96.99 112.63 3 42.86
20563. Lam (rebmal101) 7 71.11 78.45 4 57.14
20564. Matthew (realmtd) 7 66.74 80.11 2 28.57
20565. Harold (realmagilla) 7 81.55 102.04 6 85.71
20566. Griz (realgrizzle123) 7 97.38 107.46 1 14.29
20567. Aaron Martin (reala) 7 37.55 39.14 1 14.29
20568. Reagan (reagss) 7 71.63 85.39 3 42.86
20569. Jeff (rcmaximus) 7 66.50 76.45 1 14.29
20570. M (razorneck) 7 65.10 73.64 2 28.57
20571. RAPdawg (rapdawg530) 7 111.55 128.78 3 42.86
20572. Komol Kunty Rajib (rajib_ra... 7 49.47 54.31 0 0.00
20573. roadto120 (raiyan2423) 7 99.38 109.36 3 42.86
20574. Rain (rainliofficial) 7 95.08 108.87 3 42.86
20575. raider (raider93) 7 48.30 57.16 0 0.00
20576. Rahil (rahilu14) 7 104.13 118.09 6 85.71
20577. youtube.com/TechieDheeraj (... 7 68.19 72.01 1 14.29
20578. really cute ;) (qwnnnnnnn) 7 64.53 74.50 2 28.57
20579. Joshuasdf (qwertoid) 7 115.23 122.30 5 71.43
20580. Type (quic_qwerty) 7 85.12 93.38 2 28.57
20581. QuicoDel8 (quico) 7 71.91 77.65 1 14.29
20582. Qubz (qubz) 7 73.22 83.15 1 14.29
20583. Martina (qkmartina) 7 82.09 99.53 1 14.29
20584. Pyrouge (pyrouge) 7 105.79 117.22 5 71.43
20585. Putte (puttepowertyper) 7 43.14 53.09 0 0.00
20586. putss (putssimply) 7 97.79 110.24 3 42.86
20587. Puss (pussboi) 7 94.18 118.75 4 57.14
20588. the solution to pollution i... 7 127.93 184.40 5 71.43
20589. Ian (pugami) 7 63.98 76.88 3 42.86
20590. ptsd (ptsd92) 7 70.24 79.18 1 14.29
20591. ulreich (prozeal_) 7 77.31 88.18 1 14.29
20592. Omar (prospart) 7 73.20 76.35 2 28.57
20593. Sahil (prosahil) 7 59.05 77.11 1 14.29
20594. Abir (proabir) 7 54.81 62.09 0 0.00
20595. Pranav (preyneyv) 7 108.57 133.32 5 71.43
20596. lukas (preston_frag) 7 47.88 55.34 0 0.00
20597. precarious (preciousgravy) 7 175.62 191.68 4 57.14
20598. Prasad (prasad1999) 7 50.43 56.63 1 14.29
20599. Pranman (pranman123) 7 90.32 94.69 6 85.71
20600. M A T I A S (praise_duarte) 7 147.33 178.53 5 71.43
20601. Bear (pr0d19y) 7 84.84 89.43 1 14.29
20602. tstats[potlid43] (potlid43) 7 76.47 91.57 2 28.57
20603. POZ (poooz) 7 44.95 49.30 0 0.00
20604. Nigerian (poobear_) 7 100.26 125.97 3 42.86
20605. Slueben (poijn) 7 97.68 117.80 6 85.71
20606. pogfatherz (pogfatherz) 7 93.04 98.73 3 42.86
20607. Patrick (pjtimmon) 7 65.69 72.08 2 28.57
20608. Parker (pistolpeterulez) 7 44.35 51.33 1 14.29
20609. Lidia (pinguinthecity) 7 65.06 117.56 6 85.71
20610. Ryan (pingu51472) 7 112.18 124.08 3 42.86
20611. pineapple (pineappleink) 7 84.94 96.30 5 71.43
20612. Mathias (pijaye) 7 76.66 90.03 2 28.57
20613. Kercy (phoenixgod213) 7 65.92 75.33 5 71.43
20614. Arnav (phoenixcrusher369) 7 93.71 105.77 3 42.86
20615. Philip (philip79) 7 34.90 37.22 0 0.00
20616. pheck (pheck_) 7 52.35 59.14 2 28.57
20617. Anish (phantom2201) 7 51.58 57.63 2 28.57
20618. Eli (peytoneli) 7 106.87 114.22 2 28.57
20619. Petersoon (peterson_brasil) 7 53.04 61.74 1 14.29
20620. prison mate pete (petermh) 7 118.48 152.98 5 71.43
20621. Davids (petally) 7 96.54 108.32 4 57.14
20622. ( ' - ' ) (pengun) 7 71.07 79.26 4 57.14
20623. Keqings Left Pinky (penguin... 7 106.54 120.26 4 57.14
20624. pear (pearuchiha) 7 55.65 63.90 1 14.29
20625. Pawaox (pawaox) 7 117.33 135.84 4 57.14
20626. Colin (pathetic_worm) 7 69.57 75.73 2 28.57
20627. Pavel (patcm) 7 94.54 106.66 0 0.00
20628. Nathaniel (pastafarianjew) 7 71.24 83.38 1 14.29
20629. pastabooth (pastabooth) 7 97.03 115.68 5 71.43
20630. Papa (papawadee) 7 106.63 113.25 2 28.57
20631. Pan (pan_grammoun) 7 52.98 58.63 1 14.29
20632. Denys (owlydesigner) 7 73.50 81.86 1 14.29
20633. Ovidiu (ov_ant) 7 67.35 82.40 3 42.86
20634. Overpriced (overpriced) 7 98.72 104.14 1 14.29
20635. Oussama (oussamanh) 7 76.13 81.06 3 42.86
20636. eye8 (othereye) 7 71.68 85.06 1 14.29
20637. Jack (orka_qwerty) 7 99.80 122.40 1 14.29
20638. Gene (orange_oldfish) 7 134.99 153.78 6 85.71
20639. Meredith (onemoremerry) 7 92.63 104.53 1 14.29
20640. omegadeath88 (omegadeath88) 7 93.59 110.02 1 14.29
20641. papryczan (olgi69) 7 82.33 91.55 3 42.86
20642. Owen (ojt_11) 7 53.35 57.37 2 28.57
20643. Wx (oh_hi) 7 78.92 92.84 2 28.57
20644. OhmFreeTime (ohmmeejaa25) 7 58.36 68.11 2 28.57
20645. David (ogwoohoo) 7 86.69 96.30 1 14.29
20646. Ognjennad (ognjennad) 7 95.65 104.79 3 42.86
20647. DIego (ogeid) 7 68.68 72.77 1 14.29
20648. oddrationale (oddrationale) 7 70.70 82.87 1 14.29
20649. S (nyansyde) 7 80.68 90.91 0 0.00
20650. Nyambat (nyambat) 7 75.30 81.84 2 28.57
20651. Nuwan (nuwang69) 7 66.40 78.52 0 0.00
20652. Noxcoma (noxcoma_) 7 67.66 79.50 4 57.14
20653. Victor (notvector) 7 129.66 145.40 5 71.43
20654. Noriphe (noriphe) 7 81.51 92.10 2 28.57
20655. Chad (noodlestrings) 7 71.64 92.70 1 14.29
20656. din (nonquitdondoe) 7 113.77 138.15 7 100.00
20657. toni (noilly) 7 97.60 121.93 2 28.57
20658. Vi (nocivi38) 7 64.31 67.65 6 85.71
20659. Stig (no1irishstig) 7 71.16 93.29 5 71.43
20660. Vanja (njavex) 7 50.82 59.97 2 28.57
20661. Nishanth (nishanth_s) 7 63.52 71.25 1 14.29
20662. Nil (niljovanovic) 7 60.17 68.39 1 14.29
20663. Nikhil (niks_2012) 7 53.10 60.84 1 14.29
20664. Nikki (niknak13) 7 95.17 117.43 1 14.29
20665. Daniel (niggusted) 7 123.56 135.68 7 100.00
20666. Nico (nico_e) 7 92.32 114.61 4 57.14
20667. Niconii (nicopai_) 7 72.51 80.62 3 42.86
20668. Nicole (nicoleogden) 7 106.95 114.03 5 71.43
20669. Sebastian (nichtmonti) 7 81.71 101.71 1 14.29
20670. Jason (nhtiger) 7 87.53 105.42 2 28.57
20671. * (ngong19) 7 105.92 125.61 1 14.29
20672. Himanshu (neutron_star) 7 64.46 69.47 0 0.00
20673. nether (nethersynth) 7 128.47 158.21 3 42.86
20674. makaio (neosifr) 7 107.62 135.36 3 42.86
20675. Joseph (neonjc) 7 126.43 143.06 5 71.43
20676. Nehal (nehaldamania) 7 76.66 83.83 4 57.14
20677. Nechmo (nechmo111) 7 56.01 63.94 0 0.00
20678. Nathaniel (nebuejin) 7 80.18 87.04 1 14.29
20679. Nebula (nebakki) 7 85.09 104.04 4 57.14
20680. jeffery (nctu_jeffery) 7 51.57 54.91 0 0.00
20681. Naziman (naziman) 7 57.48 62.98 2 28.57
20682. Nazar Berkimbay (nazar1005) 7 65.08 74.36 2 28.57
20683. Ryan (nayrx14) 7 92.96 110.29 3 42.86
20684. Nayely (nayelytyperacer) 7 74.96 96.47 1 14.29
20685. nayan (nayan268) 7 56.74 60.79 2 28.57
20686. Joseph (naughtyboy1337) 7 91.19 101.29 1 14.29
20687. Nate (nate11) 7 104.95 113.94 3 42.86
20688. Temirlan (nalrimet) 7 59.08 67.01 1 14.29
20689. Nahin (nahin_r) 7 53.19 55.77 0 0.00
20690. miyu (naevis) 7 77.62 87.40 0 0.00
20691. nabil (nabl) 7 94.37 108.49 2 28.57
20692. Mickey (m_qwerty) 7 101.13 109.32 2 28.57
20693. Sagar (mystic0570) 7 46.77 54.53 0 0.00
20694. Hải (mymomismad) 7 105.95 118.97 4 57.14
20695. moca (mxca) 7 48.50 56.63 1 14.29
20696. Joshua (mvpalmighty) 7 84.70 94.24 1 14.29
20697. MustardNuts (mustardnuts) 7 61.61 76.90 2 28.57
20698. Museum (museum25) 7 81.82 92.56 1 14.29
20699. Murphy (murphsmurf) 7 81.71 87.54 3 42.86
20700. Munyoudoum (munyoudoum) 7 84.07 93.88 1 14.29
20701. Muffin (muffinboi5) 7 71.20 85.58 7 100.00
20702. Muffin (mufff) 7 53.69 72.70 3 42.86
20703. Peter (mubida23) 7 67.63 77.99 2 28.57
20704. Mike (mtwomey) 7 61.91 71.88 2 28.57
20705. M$NEYMAIZE (msneymaize) 7 87.08 105.97 3 42.86
20706. ur boy (msinghh) 7 108.54 125.00 2 28.57
20707. matthew (mshau) 7 108.52 124.73 5 71.43
20708. brian (mr_ritz) 7 40.97 45.28 1 14.29
20709. Mrs.lechuga (mrslechuga) 7 103.22 121.61 6 85.71
20710. BigRocks (mrpluto23) 7 58.15 65.68 2 28.57
20711. Roar (raor) (mrmcmurple) 7 80.76 97.86 2 28.57
20712. Richard (mrm3man) 7 87.77 97.74 2 28.57
20713. Lovre (mrlovre) 7 72.47 77.93 1 14.29
20714. Ronalds (mrbonis) 7 94.53 101.10 4 57.14
20715. Jimmy (motivatorman) 7 91.22 98.14 3 42.86
20716. Mokegang420 (mokegang420) 7 120.15 130.28 4 57.14
20717. Moghazi (moghaazi) 7 54.52 57.47 0 0.00
20718. Moe (moetez1) 7 75.58 82.91 3 42.86
20719. M (mma05) 7 62.01 76.14 1 14.29
20720. k (mkoo) 7 85.69 97.31 3 42.86
20721. Dimitar (mitronix) 7 45.83 58.62 1 14.29
20722. mithilesh (mithilesh3110) 7 75.31 82.42 2 28.57
20723. Mitchell (mitchell807273) 7 93.90 113.03 2 28.57
20724. 🚗💨 (miredirex) 7 126.76 143.55 4 57.14
20725. spectating (minhxuan2507) 7 150.77 187.12 7 100.00
20726. Ming (mings7) 7 78.74 93.41 3 42.86
20727. milord (milordbruh) 7 64.87 76.22 5 71.43
20728. MikeB (mikebfromdk) 7 88.98 107.44 1 14.29
20729. Lux (miintyonyt) 7 64.20 67.53 2 28.57
20730. Miilo (miilo_) 7 64.69 80.96 4 57.14
20731. Mighty (mighty_kurac) 7 95.41 106.72 6 85.71
20732. micah (mickeylmao) 7 86.36 102.57 3 42.86
20733. Mike (mhaimowitz) 7 87.35 91.89 2 28.57
20734. Muaz (mfone) 7 51.08 66.08 1 14.29
20735. Mark (mesm) 7 96.93 114.34 2 28.57
20736. Lauren (merpling) 7 101.25 113.31 5 71.43
20737. Ribub (mercury_millpond) 7 102.03 110.44 3 42.86
20738. Dragon (menacingdragon) 7 108.07 118.27 6 85.71
20739. Melody (melody313) 7 106.52 111.76 3 42.86
20740. Salman (meistr) 7 67.43 83.15 0 0.00
20741. Mehmed (mehmed_) 7 45.62 54.48 1 14.29
20742. Mees (meeszon) 7 82.20 89.61 2 28.57
20743. Seny (mdeekay) 7 99.10 112.81 3 42.86
20744. mcshizney (mcshizney) 7 76.41 91.63 1 14.29
20745. ꧁༒☬刀Ξ℣ł₦ ☬... 7 87.08 104.07 3 42.86
20746. Josef (mcblyat2) 7 93.06 103.77 2 28.57
20747. mazer (mazer706) 7 107.09 116.10 4 57.14
20748. Mayreel (mayreel) 7 130.00 151.62 7 100.00
20749. Bilal (maxty) 7 44.57 56.16 1 14.29
20750. S (mavzero) 7 42.68 48.99 0 0.00
20751. Matt (mattyice445) 7 94.94 102.35 3 42.86
20752. Matt (mattsanruk) 7 77.37 89.41 2 28.57
20753. Matt (mattrmel) 7 90.50 117.89 3 42.86
20754. Justin (maticulous) 7 89.72 106.16 4 57.14
20755. Mathfeli (mathfeli) 7 42.67 45.75 0 0.00
20756. SparklMastr (mastrsparkl) 7 111.08 124.96 3 42.86
20757. Manvik (mastikhorgamer) 7 80.68 89.74 2 28.57
20758. Daniel (masterfiregg) 7 101.66 125.37 7 100.00
20759. Andre (mastergamernerd) 7 92.26 101.84 1 14.29
20760. Massi (massi_goat) 7 107.37 119.52 3 42.86
20761. Masquerade (masq_uerade) 7 60.91 78.23 2 28.57
20762. Martin (martinmadis) 7 80.99 92.53 2 28.57
20763. Mark (markisimo) 7 64.99 74.27 1 14.29
20764. Mark (mark69420) 7 60.96 68.18 1 14.29
20765. Marissa (marissalim) 7 80.87 93.73 2 28.57
20766. Mardon (mapukhuanna) 7 56.13 60.84 1 14.29
20767. mandryx (mandryx) 7 55.33 63.62 1 14.29
20768. mandar (mandar139) 7 61.44 70.05 0 0.00
20769. MamyPoko (mamypoko) 7 106.71 113.62 6 85.71
20770. jaacouub (fsnxward) 7 111.06 123.22 3 42.86
20771. Pedrovski (frosteye) 7 51.00 60.31 5 71.43
20772. Frisk00 (frisk00) 7 85.88 105.93 2 28.57
20773. Weeb (fredfaye) 7 76.33 84.20 0 0.00
20774. Vlad (foxonwave) 7 70.07 76.67 2 28.57
20775. hola (foocaaat) 7 80.34 94.51 3 42.86
20776. Georgia (fobpatdmcr) 7 54.57 63.01 1 14.29
20777. Fliqqr (fliqqr) 7 89.25 95.17 2 28.57
20778. fajar (fjr123) 7 19.51 32.42 0 0.00
20779. FireHydra (firehydra) 7 51.09 52.86 1 14.29
20780. Winsharp (fimannax) 7 68.54 82.63 3 42.86
20781. Vishal (fieryhydra) 7 86.02 102.50 4 57.14
20782. Fideon (fideon) 7 113.84 133.33 4 57.14
20783. FHVirus (fhvirus) 7 73.58 87.81 1 14.29
20784. Few (fewhakko) 7 81.42 93.06 1 14.29
20785. untechno (fersist) 7 120.42 134.31 3 42.86
20786. Ferc (ferco) 7 53.44 66.24 2 28.57
20787. FeN11x (fen11x) 7 112.81 125.04 4 57.14
20788. Felix (feliksen) 7 80.00 88.60 2 28.57
20789. Feela (feela) 7 53.83 59.97 0 0.00
20790. Steve (feedthejoe) 7 78.58 85.42 1 14.29
20791. FEDERICO (fedecochi) 7 68.20 71.13 3 42.86
20792. Tyrone (fastesthackertyper) 7 115.64 132.63 4 57.14
20793. Farzaan (farzaan) 7 45.07 48.74 1 14.29
20794. FartESport (fartesport) 7 58.29 69.57 3 42.86
20795. Free Palestine (farmahorro) 7 105.41 119.43 2 28.57
20796. @fahmi_2504 (fahmiramadhan) 7 80.65 87.89 0 0.00
20797. Dave (fadedave) 7 79.80 88.63 5 71.43
20798. Ian (exeboi) 7 72.37 81.54 1 14.29
20799. e (ex21424) 7 99.33 108.35 3 42.86
20800. Teez (evofury) 7 81.47 89.43 3 42.86
20801. E (etyperacer) 7 78.98 88.92 2 28.57
20802. Erly (erlynorbel) 7 78.82 86.03 5 71.43
20803. irand (eppyprime) 7 69.69 78.22 2 28.57
20804. deez (epicguy69) 7 51.97 57.61 0 0.00
20805. Ramya (envisage) 7 62.74 70.31 1 14.29
20806. Dusa (enjdusan) 7 85.13 95.77 1 14.29
20807. Jason (energetichay) 7 116.63 136.38 3 42.86
20808. Emin (eminspeedtyper) 7 91.47 108.61 3 42.86
20809. Francis (emeritusninoy) 7 108.72 117.53 4 57.14
20810. Emek (emekc) 7 81.07 97.40 3 42.86
20811. Diego (el_villas) 7 74.00 82.95 1 14.29
20812. Elmo (elmotlk) 7 76.04 83.37 1 14.29
20813. ekoth (ekoth) 7 89.09 98.97 3 42.86
20814. Striker09125 (eiren233) 7 71.58 77.32 2 28.57
20815. Miles (eightmiles27) 7 89.36 103.69 3 42.86
20816. Hsu (eh643027) 7 76.09 84.75 1 14.29
20817. EenPotjeMetJam (eenpotjemet... 7 79.72 87.81 2 28.57
20818. Marcia (eedoit) 7 73.95 79.23 3 42.86
20819. Ed (edwinl707) 7 74.46 84.49 3 42.86
20820. Raf (edorableraf) 7 74.31 84.72 3 42.86
20821. Edigar (edigar) 7 48.68 55.06 0 0.00
20822. Ed (edfed) 7 60.20 82.46 2 28.57
20823. Liz (easwans) 7 97.03 119.14 1 14.29
20824. Suyog (earthisflat) 7 92.27 104.73 0 0.00
20825. Luis (ealjkl) 7 58.64 65.38 3 42.86
20826. anagolr (eagle0523) 7 127.62 136.94 6 85.71
20827. Dylan Smith (dylanfromwinni... 7 105.39 119.66 4 57.14
20828. Duong (duong_n) 7 89.59 117.32 1 14.29
20829. andrew (duncan01) 7 70.39 77.11 4 57.14
20830. Dulappy (dulappy) 7 83.11 89.25 2 28.57
20831. Jason (duckyboi) 7 92.24 100.94 4 57.14
20832. daniel (dsong56) 7 100.89 113.23 2 28.57
20833. Terminator (dr_nefarious) 7 97.44 111.06 5 71.43
20834. Samad (dr_drakonix) 7 89.17 98.19 2 28.57
20835. drowez1 (drowez1) 7 96.56 109.11 2 28.57
20836. Eshelmen (drguru) 7 102.44 112.79 4 57.14
20837. light (drawyeh) 7 86.42 94.69 3 42.86
20838. Joakim (draghman) 7 74.25 107.32 6 85.71
20839. Ali (dracius16) 7 100.85 115.26 2 28.57
20840. Andrea (dr3vv) 7 66.67 75.03 3 42.86
20841. Don (dpease7894) 7 139.14 149.05 5 71.43
20842. Do (dothanhtungnb602) 7 56.61 58.93 0 0.00
20843. Dr.D (donghuh601) 7 84.47 99.24 2 28.57
20844. Dominus (dominuslucifer) 7 101.95 111.97 5 71.43
20845. Dominic (dominiccarroll) 7 132.77 151.08 3 42.86
20846. Guy (doge_btw) 7 91.28 103.09 3 42.86
20847. Peter (doc_chungles) 7 91.82 108.04 1 14.29
20848. Dman27 (dman27) 7 68.26 73.26 4 57.14
20849. djchicken (djchicken) 7 64.39 74.42 1 14.29
20850. Ali (divine_typer) 7 59.34 69.82 1 14.29
20851. Dilhan (disgruntled_lemon) 7 68.63 77.57 4 57.14
20852. soup (dirtsoup) 7 73.62 85.25 0 0.00
20853. dimcho (dimisoma12) 7 46.00 51.92 0 0.00
20854. Dewi (dibdabdebby) 7 57.85 64.25 7 100.00
20855. Alaa (diamondtda) 7 78.91 87.99 2 28.57
20856. māvi (dhsnxz) 7 68.89 73.80 1 14.29
20857. Dexter (dexterkun16) 7 63.37 79.79 2 28.57
20858. yo (demailman) 7 115.46 131.05 4 57.14
20859. follow (deleonhle) 7 132.74 145.94 4 57.14
20860. Riley (dedalus) 7 42.09 53.39 1 14.29
20861. debois (debois) 7 84.21 96.43 3 42.86
20862. Veros (deadtwinkz) 7 48.85 57.41 3 42.86
20863. Dylan (dddking) 7 107.96 119.34 4 57.14
20864. Davr (davr) 7 68.54 75.67 2 28.57
20865. David (davgoeck) 7 66.08 73.70 3 42.86
20866. Darkmacsek9 (darkmacsek9) 7 61.64 78.43 0 0.00
20867. John (danred12344) 7 84.17 96.93 5 71.43
20868. daniel (daniel8028) 7 89.83 104.06 4 57.14
20869. Daniel (danguydudebro) 7 96.59 108.14 7 100.00
20870. Danyal (danazeem) 7 65.50 76.85 5 71.43
20871. Deyl (daleaparejado) 7 83.39 94.28 3 42.86
20872. Dakeku (dakeku123) 7 110.06 120.76 5 71.43
20873. dag (dagweg) 7 56.71 64.66 0 0.00
20874. Daffa (daffagusmara31) 7 84.64 90.19 2 28.57
20875. Jeremy (daddystravinsky) 7 108.30 132.03 3 42.86
20876. Elia (d0inky) 7 76.10 85.91 1 14.29
20877. d0bu (d0bucookie) 7 92.34 111.39 3 42.86
20878. David (cydmium) 7 84.40 92.97 3 42.86
20879. nixon (cxboy) 7 74.52 83.36 7 100.00
20880. 🍓 (crustyyy) 7 38.23 41.01 0 0.00
20881. Matthew (crucifix13) 7 104.92 116.16 3 42.86
20882. Daniel (crossfittypist) 7 128.43 140.59 4 57.14
20883. Joseph (cronul) 7 84.63 96.14 4 57.14
20884. Oliver (crocell) 7 68.15 78.91 2 28.57
20885. Cristian (cristian0017) 7 76.35 82.74 1 14.29
20886. crisna (crisnaxx) 7 41.33 46.13 1 14.29
20887. Tony (creampuffy) 7 99.43 123.38 3 42.86
20888. Raphael (crazydrmad) 7 64.85 81.98 2 28.57
20889. CrazyConrad (crazyconrad) 7 72.15 82.64 5 71.43
20890. Kayli (crackerjap) 7 93.69 98.46 6 85.71
20891. Nima (cosmocrat) 7 113.74 129.92 3 42.86
20892. coraline (coraline19) 7 73.38 83.91 2 28.57
20893. day (const_bored) 7 55.44 73.18 4 57.14
20894. conjae (conjae) 7 95.70 106.14 4 57.14
20895. Colt (coltthenark) 7 93.88 107.73 3 42.86
20896. ⁤ (collin_) 7 56.14 62.88 3 42.86
20897. Collie (collie321) 7 72.12 98.28 4 57.14
20898. cold_blood (cold_blood) 7 49.84 52.51 0 0.00
20899. Collin (code_gs) 7 94.69 102.42 4 57.14
20900. Henry (codaassasin) 7 128.44 141.20 3 42.86
20901. Cobra (cobra03) 7 101.28 115.45 3 42.86
20902. sand (cloudth) 7 69.30 80.99 1 14.29
20903. Clickau (clickau) 7 87.28 90.88 1 14.29
20904. George (cleaves) 7 71.37 78.71 1 14.29
20905. Clarb (clarb) 7 75.99 86.98 2 28.57
20906. CK (ckokobean) 7 99.22 120.75 6 85.71
20907. tstats[Cisco516] (cisco516) 7 74.58 82.53 1 14.29
20908. Chuse (chuse) 7 80.73 86.41 2 28.57
20909. chumchumlol (chumchumlol) 7 85.23 90.24 3 42.86
20910. Chuby_j (chuby_j) 7 76.89 86.03 7 100.00
20911. Chronical (chronical_) 7 131.61 142.34 4 57.14
20912. (chromehearts) 7 125.68 135.58 6 85.71
20913. Chris (chriss_maoo) 7 79.74 98.75 5 71.43
20914. Choosecake (choosecake) 7 77.97 87.56 1 14.29
20915. stephen (chonky_boi) 7 60.14 68.16 1 14.29
20916. CHKR (chkr) 7 87.21 94.53 2 28.57
20917. Harishraj (chintubro) 7 85.42 92.36 1 14.29
20918. Chezhiyan (chezhiyan) 7 76.61 86.48 2 28.57
20919. Chris (chee_ms) 7 97.30 106.97 1 14.29
20920. mew (cheeboard) 7 103.24 110.14 4 57.14
20921. Cory (chamblin) 7 109.87 116.98 3 42.86
20922. ASAP LiL Fat Chalsy (chalscc) 7 71.32 79.18 1 14.29
20923. Chadgoomba (chadgoomba) 7 71.04 89.42 1 14.29
20924. cbdm (cbdm) 7 78.72 95.08 0 0.00
20925. CARL (carlkwan) 7 102.01 113.55 4 57.14
20926. Kamjue (camweb_01) 7 43.58 46.51 1 14.29
20927. Calen (calen64) 7 89.02 96.87 5 71.43
20928. Caleb (caleb1243) 7 99.26 109.72 1 14.29
20929. van (cakeblanket) 7 102.70 110.40 2 28.57
20930. Caffeine (caffeinereptile) 7 53.96 59.59 1 14.29
20931. Wesley (c3tangies) 7 89.04 97.23 2 28.57
20932. by (by_law) 7 56.56 64.55 3 42.86
20933. David (butterdawg) 7 83.27 86.98 2 28.57
20934. Maun (bubblojoe) 7 71.48 77.11 0 0.00
20935. Julia (bskdjewels) 7 93.93 108.10 3 42.86
20936. Ben (brokenace) 7 68.63 83.74 6 85.71
20937. Brojo (brojokm) 7 55.29 59.84 0 0.00
20938. Brian (briankusuma) 7 53.23 61.68 2 28.57
20939. Luca (brentspiner) 7 61.02 68.52 3 42.86
20940. Brennan (brennanfisher) 7 69.50 82.18 1 14.29
20941. Brandon (brandondodododo) 7 95.18 102.61 1 14.29
20942. Brandon (brandoncc) 7 61.33 78.87 2 28.57
20943. Wayne (boucherwayne78) 7 75.24 87.88 6 85.71
20944. bowei (botheburp) 7 63.80 70.46 1 14.29
20945. Boshi (boshiwastaken) 7 89.93 102.69 7 100.00
20946. 0902bo (boowie27) 7 44.16 47.85 0 0.00
20947. Space Cowboy (booqueefius69... 7 108.67 135.16 5 71.43
20948. Bongos (bongos_h2o) 7 51.67 61.99 0 0.00
20949. Boncho (bochl1n) 7 98.51 114.12 5 71.43
20950. Bluey (blu_ey) 7 87.72 97.46 1 14.29
20951. Christopher Szabo (bluepizza2) 7 56.04 68.96 1 14.29
20952. Alex (blueninja11103) 7 86.08 102.51 1 14.29
20953. 晴 (blorfo) 7 44.47 46.30 0 0.00
20954. blobfish (blobfishk) 7 85.20 94.16 1 14.29
20955. Cdrc (blo5) 7 68.58 85.51 0 0.00
20956. Aakash (blaze_type) 7 49.83 54.99 1 14.29
20957. Blast (blast_craft) 7 72.24 78.63 2 28.57
20958. tstats[blannk] (blannk) 7 41.57 56.84 0 0.00
20959. Bladehunter (bladeyz) 7 57.15 67.24 1 14.29
20960. BK (bk21) 7 80.59 88.69 1 14.29
20961. ⠀⠀⠀ (bioluminescent) 7 89.33 99.67 2 28.57
20962. Alex (bigbrian123) 7 74.14 78.12 0 0.00
20963. Aidan (biccythiccy) 7 117.39 124.07 5 71.43
20964. Bhumika (bhumika111) 7 25.32 27.27 2 28.57
20965. betterscramblelikeanegg (be... 7 89.44 99.68 2 28.57
20966. Alfred (bestluxeu) 7 83.98 88.85 2 28.57
20967. Brutale (benvan) 7 82.26 91.53 4 57.14
20968. (benkemal) 7 78.29 83.55 3 42.86
20969. Beksultan (beksultan2001) 7 55.49 65.69 0 0.00
20970. William (beholder92) 7 82.63 99.48 2 28.57
20971. Brad (beardedbradtv) 7 106.28 116.52 7 100.00
20972. beansnboges (beansnboges) 7 81.78 97.15 2 28.57
20973. Blake (bcdelrey) 7 83.71 91.84 2 28.57
20974. Keong (baygonstroberi) 7 73.37 85.13 3 42.86
20975. baxis (baxis) 7 61.97 66.80 0 0.00
20976. Jonathan (baldunker1) 7 73.10 79.71 1 14.29
20977. mohammad (ballisticfpz) 7 66.49 71.37 0 0.00
20978. Dario (baldoius) 7 97.49 113.25 7 100.00
20979. Badral (badralz) 7 84.50 90.14 6 85.71
20980. Ahmed (backslashero) 7 85.53 95.45 3 42.86
20981. ai fachri (a_ifachri) 7 60.19 67.16 2 28.57
20982. azef (azef) 7 65.89 70.09 3 42.86
20983. John (azaza909) 7 130.25 147.14 5 71.43
20984. ayoub50 (ayoub50) 7 82.06 89.97 3 42.86
20985. Andrew (axi_andrew) 7 79.68 88.11 1 14.29
20986. CapooLife (awesomevincent) 7 70.74 89.72 1 14.29
20987. B (awadf) 7 40.15 45.67 1 14.29
20988. Andre (avmoura) 7 74.16 96.49 1 14.29
20989. Avinash (avee_nash) 7 62.25 73.06 1 14.29
20990. Austin (austins350) 7 129.04 142.17 3 42.86
20991. Aidan (attan090) 7 70.28 79.41 1 14.29
20992. Atlasov (atlasnik) 7 21.42 23.78 1 14.29
20993. Atira (atirakun) 7 94.58 106.65 4 57.14
20994. Atiqur (atiqrr) 7 40.06 44.65 1 14.29
20995. Aaron (atg2142) 7 96.37 114.41 1 14.29
20996. astrid (astridtherat) 7 60.47 76.33 1 14.29
20997. Asta (astadweller) 7 80.03 105.85 4 57.14
20998. Aslan (aslanchan7) 7 78.42 87.15 1 14.29
20999. TheChosenOne (askthewizard) 7 104.49 119.80 3 42.86
21000. askryuzaki (askryuzaki) 7 92.03 112.84 5 71.43
21001. Ashot (ashotmovsisyan) 7 37.30 41.21 0 0.00
21002. Ashish (ashish14) 7 62.55 71.79 1 14.29
21003. Rohan (ashavijaysukne) 7 64.47 72.68 1 14.29
21004. Heemy (asdfm) 7 86.90 106.61 3 42.86
21005. ArtyGaming (artygaming) 7 104.52 116.99 7 100.00
21006. Arthur (arthur_007) 7 67.25 79.15 1 14.29
21007. Artemis (artemyx) 7 77.65 86.21 5 71.43
21008. arrantfox (arrantfox) 7 42.50 48.79 2 28.57
21009. fuad036 (fuad036) 6 75.16 78.77 6 100.00
21010. Radek (fssx) 6 100.86 116.57 2 33.33
21011. fre (fre_24) 6 67.11 76.99 2 33.33
21012. Ryan (fretmo) 6 94.61 107.26 1 16.67
21013. James (freetheguy2) 6 93.09 96.98 1 16.67
21014. keeganchan (forcherie3) 6 129.82 150.15 2 33.33
21015. Fogli (fogli) 6 58.26 66.27 2 33.33
21016. Micah (flyinmnkys) 6 67.19 76.58 0 0.00
21017. Felix (flashy123) 6 111.17 119.39 1 16.67
21018. godofchin (fiyet) 6 89.41 96.86 1 16.67
21019. Fish (fishtent) 6 121.47 132.59 4 66.67
21020. Simon (fishmango) 6 77.75 90.70 3 50.00
21021. Fishcat (fishcat) 6 82.45 93.69 2 33.33
21022. Y (firewatermelon) 6 66.11 78.10 0 0.00
21023. dewgong (fingerlocked) 6 86.69 97.60 1 16.67
21024. Jory (filkyjory) 6 74.47 80.20 2 33.33
21025. Filip (filiplass) 6 107.56 114.53 6 100.00
21026. deohanz (fierywormz) 6 102.39 109.44 3 50.00
21027. Felipe (felipflop) 6 75.99 78.41 3 50.00
21028. SpleF (felipeadn) 6 82.48 92.07 3 50.00
21029. Fat (fattyfatboi) 6 76.74 85.96 3 50.00
21030. Phoexv (fathih) 6 61.31 74.58 0 0.00
21031. Jonas (fanibu) 6 73.33 78.99 1 16.67
21032. FangAbi (fangabi) 6 70.00 79.79 1 16.67
21033. Jason (falminfingaz) 6 114.19 127.33 1 16.67
21034. John (fakelicense) 6 71.76 77.55 2 33.33
21035. Fahrin (fahrin93) 6 53.71 58.29 6 100.00
21036. Ahmad (fadedxtc) 6 59.51 67.85 0 0.00
21037. Francisco (faac98) 6 84.26 87.21 2 33.33
21038. Mars (ezfastboi) 6 67.13 78.10 1 16.67
21039. Alex (extreme360) 6 104.99 113.76 3 50.00
21040. Mark (exec_prod) 6 75.51 82.70 1 16.67
21041. Jared (excline) 6 79.66 84.53 2 33.33
21042. Hadriel (evo_echo) 6 45.37 54.66 1 16.67
21043. (evestay) 6 130.98 147.14 4 66.67
21044. Evan (evanr10190) 6 86.06 92.87 3 50.00
21045. Anthony (euthanasia_) 6 88.68 98.16 1 16.67
21046. Eunice (eunice20) 6 75.37 80.66 3 50.00
21047. Ilya (ethar) 6 64.85 68.82 2 33.33
21048. Ethan (ethaaaaaaaaaan) 6 93.20 111.34 2 33.33
21049. suchir (eternalzx) 6 68.48 75.87 2 33.33
21050. Esther (esthersanti1600) 6 120.09 148.13 5 83.33
21051. Eshwar Reddy (eshwar_god) 6 69.92 76.25 1 16.67
21052. Juver (escoltajuverf) 6 65.07 77.15 1 16.67
21053. Erwin (erwinisgoodenough) 6 110.21 122.68 6 100.00
21054. fast (ersontio) 6 69.18 72.31 1 16.67
21055. No quitting mid race (ersatz) 6 138.45 144.41 5 83.33
21056. Ernie (ernievc) 6 67.99 74.25 2 33.33
21057. eric (erictheass3) 6 78.87 85.99 1 16.67
21058. undefined (epsylon) 6 66.45 99.50 0 0.00
21059. Epoi (epoi_311) 6 56.17 66.81 0 0.00
21060. Joe (eoj05) 6 82.88 95.50 2 33.33
21061. Bleh (entropian) 6 98.36 110.15 4 66.67
21062. Emir (emirthetyper) 6 109.58 114.14 5 83.33
21063. EmiNation | (emingamer) 6 116.55 134.02 4 66.67
21064. Eli (emeyer9) 6 88.76 101.85 3 50.00
21065. Elvis (elvisnator) 6 98.84 111.96 2 33.33
21066. Elo (elovvv) 6 128.16 152.52 6 100.00
21067. ellie (elllllzzz) 6 43.05 48.68 0 0.00
21068. Proximo (elliotkoh) 6 99.69 113.35 3 50.00
21069. Elizur Daniel (elizur_daniel) 6 56.18 64.12 2 33.33
21070. Robert (elitists) 6 73.38 99.84 1 16.67
21071. Elisa (elisac00) 6 99.96 111.87 3 50.00
21072. Elfuun (elfuun) 6 104.50 119.63 4 66.67
21073. SBD (eleets) 6 51.26 60.46 0 0.00
21074. Ariana (electorch) 6 79.87 86.73 1 16.67
21075. eiphosa (eiphosa) 6 64.81 72.54 3 50.00
21076. ninja (ehsaas) 6 64.60 70.76 2 33.33
21077. Evan (eflem32) 6 87.81 100.24 2 33.33
21078. Eduardo (eduojeda55) 6 51.75 58.17 0 0.00
21079. Edison (eddie_boy) 6 68.42 82.33 0 0.00
21080. wuz (echang95) 6 113.98 138.46 2 33.33
21081. Adi (ech0star) 6 106.15 118.12 0 0.00
21082. Evan (ebilton) 6 62.11 72.12 1 16.67
21083. Darnell (dw_doc) 6 54.23 60.59 1 16.67
21084. dnwin (duukki) 6 75.08 93.65 2 33.33
21085. Du (dukuch) 6 98.82 115.47 2 33.33
21086. Ben (dukedukeduke) 6 56.46 64.01 5 83.33
21087. Þorsteinn (duddij) 6 82.79 94.65 2 33.33
21088. Duck (ducklist) 6 62.87 77.49 3 50.00
21089. Osian (dubzzy0) 6 72.82 85.94 2 33.33
21090. Rudy III (dther99) 6 86.62 95.57 4 66.67
21091. Dhruv (droxx76) 6 83.10 109.82 2 33.33
21092. Kobe (dreamer21) 6 53.56 56.84 0 0.00
21093. Drewski (drdrewski) 6 110.60 137.95 2 33.33
21094. Travis (drather) 6 62.48 66.85 3 50.00
21095. Micah (dramaticpineapple47) 6 83.55 94.07 2 33.33
21096. drakcorian (drakcorian) 6 85.44 98.62 3 50.00
21097. YosuaFranly (dragonunik18) 6 52.66 61.22 1 16.67
21098. Eric (doze11) 6 80.55 92.12 4 66.67
21099. Spencer (doucwhatic) 6 56.35 61.54 1 16.67
21100. Donton (donton) 6 79.21 85.96 2 33.33
21101. Dongwoo (dongwoo0504) 6 95.84 102.85 5 83.33
21102. Pyraq (dokson) 6 95.95 106.75 1 16.67
21103. Benjamin (dokdo_korea) 6 101.86 111.91 3 50.00
21104. babe (doggosnutsack) 6 80.28 92.03 2 33.33
21105. Dodoli (dodoli) 6 50.20 58.98 0 0.00
21106. Doctor (doctorina) 6 77.97 91.20 0 0.00
21107. Rose (dkranzberg) 6 97.65 109.34 1 16.67
21108. DJPIXEL (dj_pixel_) 6 80.81 94.11 1 16.67
21109. Tyler (djfjt93) 6 87.98 103.48 0 0.00
21110. dorianmodemusic (djdorian1) 6 114.71 124.57 4 66.67
21111. Diva (divaoxhd) 6 83.95 90.38 1 16.67
21112. Boi (disnoob) 6 112.91 125.22 3 50.00
21113. Dingus (dingus2000) 6 103.34 107.89 2 33.33
21114. Dimitar (dimitard) 6 122.93 140.97 4 66.67
21115. Elias (dillenn) 6 79.33 84.88 2 33.33
21116. Digital (digitalrico) 6 102.22 123.99 4 66.67
21117. digimastersp (digimastersp) 6 75.39 81.68 5 83.33
21118. James Li (diffkey) 6 82.24 97.75 3 50.00
21119. Slick Willy (dick_snapper) 6 80.18 84.99 2 33.33
21120. Dhwaj (dhwxj) 6 59.56 67.16 4 66.67
21121. Dhiva (dhivaa) 6 88.46 95.04 2 33.33
21122. dhia (dhia1) 6 37.07 45.00 0 0.00
21123. Dharma (dharmatycoon) 6 86.74 98.10 1 16.67
21124. dey (deyy) 6 54.52 66.97 1 16.67
21125. Davis (dey1234) 6 91.69 106.04 1 16.67
21126. ronaldo (devildodo) 6 64.46 69.38 2 33.33
21127. Dominc (devdominic) 6 76.02 95.00 1 16.67
21128. Riley (detectiverocket) 6 61.42 68.04 1 16.67
21129. Desmond (desmond012) 6 90.58 97.97 3 50.00
21130. Jonas Heitz (der_junker) 6 64.87 78.16 1 16.67
21131. derftastic (derftastic) 6 89.96 102.51 2 33.33
21132. dennerrr (dennymin) 6 106.36 124.67 5 83.33
21133. Denis (denisjames) 6 59.17 65.44 0 0.00
21134. Pog (deftst) 6 105.30 145.78 1 16.67
21135. Decent (decent_dvorak) 6 33.51 45.76 1 16.67
21136. Noah (dead_dogs) 6 77.18 89.22 0 0.00
21137. Deadlocz (deadlocz) 6 65.27 77.91 1 16.67
21138. David (daychow) 6 70.27 86.51 2 33.33
21139. Jack (dasher11) 6 89.21 98.84 0 0.00
21140. Darren (darren) 6 37.01 41.32 0 0.00
21141. Darkos (darkoser0) 6 64.72 73.03 3 50.00
21142. Darkness_ (darkness_) 6 59.28 65.42 2 33.33
21143. Swapnil (darklonewolf) 6 53.80 56.81 1 16.67
21144. intermediate 2029 (darkis99) 6 130.83 147.02 3 50.00
21145. Rikrish (dardbador) 6 77.15 83.47 1 16.67
21146. Daniel (danyroza) 6 76.68 91.84 1 16.67
21147. Danya (danya_z) 6 56.81 63.64 4 66.67
21148. Daniel (danielnmr) 6 105.67 123.79 6 100.00
21149. Dani (dani321456) 6 52.51 57.55 4 66.67
21150. Charlie (dangdude) 6 56.80 60.78 0 0.00
21151. Mr (dacookieboy) 6 106.05 116.13 4 66.67
21152. den (d3niska) 6 118.69 131.94 2 33.33
21153. Bruce (cybwong) 6 82.30 90.13 4 66.67
21154. Chan (cy0309) 6 32.07 34.48 0 0.00
21155. Marek (cxmu03) 6 70.98 79.05 0 0.00
21156. abhimanyu (cvfz) 6 101.32 114.29 2 33.33
21157. cuddly (cuddly_poetatoe) 6 66.38 72.36 0 0.00
21158. GodIsGood (cruz989) 6 71.63 81.27 1 16.67
21159. Alan (creamedpants) 6 56.15 67.28 5 83.33
21160. Tristan (crazy_bisket) 6 76.04 84.65 3 50.00
21161. Trivendram (crazyzoker) 6 40.98 55.13 0 0.00
21162. eileen (crazyteal1) 6 65.07 73.65 1 16.67
21163. Sam (crapslock) 6 108.05 113.67 3 50.00
21164. Junior (corpseslayer) 6 62.46 66.85 3 50.00
21165. Conner (conmanb) 6 92.81 108.28 4 66.67
21166. Conner (conbrad33) 6 52.20 65.92 2 33.33
21167. Melisa (colorsunimaginable) 6 66.20 72.84 3 50.00
21168. sofL (colemak_is_poggers) 6 106.11 113.25 3 50.00
21169. Danny (colby_brian) 6 114.37 121.31 4 66.67
21170. colaclanth (colaclanth) 6 107.77 118.37 1 16.67
21171. Coeburn (coeburn) 6 64.50 69.36 3 50.00
21172. Code (codename47) 6 90.31 96.55 3 50.00
21173. cmyang (cmyang) 6 54.22 67.37 2 33.33
21174. Josh (cloudworks) 6 103.23 124.34 2 33.33
21175. tstats[clob1414] (clob1414) 6 85.45 95.72 1 16.67
21176. Clement (clementid) 6 55.29 59.39 2 33.33
21177. ciber (cibernike) 6 71.08 74.67 3 50.00
21178. vroom (ch_alex) 6 75.05 91.35 2 33.33
21179. Kyle (chynkii) 6 83.54 97.02 3 50.00
21180. Christopher (chrizopaz) 6 75.99 87.13 2 33.33
21181. Chris (chrdex789) 6 85.17 97.37 1 16.67
21182. chopsueyrice (chopsueyrice) 6 101.23 109.21 2 33.33
21183. Lamonte (chinpo) 6 83.57 97.74 1 16.67
21184. ChiefSec (chiefsec) 6 83.62 104.65 5 83.33
21185. Judah (chewyglue) 6 61.66 72.09 0 0.00
21186. lyrehcsings (cherylsings) 6 65.94 75.45 2 33.33
21187. Che (cherry3330) 6 87.67 97.24 4 66.67
21188. Big Daddy (chef_yeet) 6 75.49 82.76 2 33.33
21189. Pro (cheater_0) 6 102.42 110.99 3 50.00
21190. Charlotte (chazish) 6 87.02 93.01 2 33.33
21191. Juan (chayanneofficial) 6 67.86 73.04 1 16.67
21192. Chawin (chawintree) 6 116.61 127.58 4 66.67
21193. 四百二十 (chapuix) 6 89.71 102.91 4 66.67
21194. ChaosRelik (chaosrelik) 6 47.31 51.03 1 16.67
21195. chanden (chanden) 6 133.48 144.92 5 83.33
21196. kevqiii (chairccc) 6 61.68 73.60 4 66.67
21197. Chaicow (chaicow) 6 124.59 140.97 1 16.67
21198. CF (cfoodc) 6 70.27 79.24 3 50.00
21199. emma (certifiedberries) 6 51.26 55.55 1 16.67
21200. Charlie (celzuk) 6 97.64 114.67 3 50.00
21201. Claudia (cdnnnn) 6 52.73 65.36 0 0.00
21202. Connor (cbec32) 6 83.85 91.90 3 50.00
21203. Gaurab (catinpajamas) 6 85.79 99.86 2 33.33
21204. Isabelle (catgirl_007) 6 46.48 48.95 0 0.00
21205. Annie (caroullri6) 6 45.55 53.07 0 0.00
21206. Austin (captan535) 6 58.66 67.87 2 33.33
21207. Joemama (captainpj) 6 88.00 108.08 2 33.33
21208. Caothu (caothunet) 6 60.18 66.90 1 16.67
21209. Charles (candydaniel) 6 110.09 132.42 3 50.00
21210. Cameron (camicazz475) 6 97.10 102.41 3 50.00
21211. Noah (cadhp) 6 98.62 118.61 2 33.33
21212. Byran (byran_tech) 6 101.26 121.67 4 66.67
21213. BusinessMan (businessman4) 6 67.78 72.40 5 83.33
21214. bullyjuice (bullyjuice) 6 93.00 116.05 2 33.33
21215. Hiroshi (buhiroshi0205) 6 89.33 102.06 3 50.00
21216. bbb (bugbearbey) 6 55.36 62.80 0 0.00
21217. NOkia (bruhmomemtum) 6 72.84 78.20 2 33.33
21218. bruhlollol (bruhlollol) 6 95.79 102.46 3 50.00
21219. bruhhhelpla (bruhhhelpla) 6 89.77 104.95 2 33.33
21220. bwian (brianschao) 6 119.79 131.46 4 66.67
21221. bRIAn (brianlebrian) 6 96.40 108.86 0 0.00
21222. Bremerton (bremerton) 6 97.07 111.43 6 100.00
21223. Klobásník (boumex) 6 53.26 61.03 0 0.00
21224. my mom (botmon99) 6 72.31 82.30 3 50.00
21225. Gina (borbinon) 6 82.66 92.12 3 50.00
21226. K3VIN (bootunstoppable) 6 98.29 103.36 1 16.67
21227. BootleDootle (bootledootle) 6 68.85 81.14 1 16.67
21228. Jonah (booshie) 6 95.74 117.78 4 66.67
21229. . (boop_69) 6 64.12 78.64 3 50.00
21230. Bone (bonezybeats) 6 101.53 119.55 3 50.00
21231. Bom (bom_dia) 6 60.30 72.66 4 66.67
21232. BOKATHINGYMABOB (bokathingy... 6 68.94 84.81 2 33.33
21233. Boikom (boikom) 6 66.12 70.60 0 0.00
21234. Hampus (bogge_) 6 59.58 61.98 1 16.67
21235. bmwsauber (bmwsauber) 6 25.06 27.53 0 0.00
21236. Ben (bmj774) 6 71.13 79.72 0 0.00
21237. Jayden (bluuser) 6 45.08 52.59 0 0.00
21238. Benjamin (blaptypes) 6 108.90 119.25 5 83.33
21239. Luke (blame_luke) 6 66.25 89.08 2 33.33
21240. Vu Huy (blaccod) 6 59.90 66.43 0 0.00
21241. Bla (blablabla_) 6 63.77 73.04 0 0.00
21242. Brandon (bkavanaugh6) 6 65.98 75.66 1 16.67
21243. Biswajit (biswajit_maity) 6 50.47 55.38 0 0.00
21244. Big (big_peen_budhai) 6 45.09 49.75 1 16.67
21245. Abhinav (bigweeb69) 6 73.34 79.48 0 0.00
21246. Hung (biggestahung) 6 50.06 55.56 0 0.00
21247. Bibek (bibek_khyaju) 6 52.20 63.40 0 0.00
21248. Bendik (bibben) 6 88.55 93.27 3 50.00
21249. Edbert (berted) 6 92.56 100.45 0 0.00
21250. Ben (benwarner) 6 59.12 65.60 2 33.33
21251. Johnnieboy (bently5102) 6 97.36 114.29 5 83.33
21252. Ben (benjikimchi) 6 88.81 98.38 3 50.00
21253. ben (benaiah8) 6 37.53 45.64 0 0.00
21254. BEGMB (begmb) 6 49.86 59.67 6 100.00
21255. Yoshi (beegyoshifan) 6 92.65 101.40 1 16.67
21256. Ryan (beefsoup) 6 92.35 103.92 3 50.00
21257. TardPancake (beastowner69) 6 77.87 90.01 2 33.33
21258. OMEGALUL (bearingsea) 6 89.55 97.81 2 33.33
21259. Bayu (bayoudra) 6 62.48 73.24 3 50.00
21260. bayarhuu (bayarhuu14) 6 38.50 45.85 0 0.00
21261. Almat (bassaroff) 6 37.98 44.94 0 0.00
21262. Cog (baritune) 6 101.07 107.35 3 50.00
21263. Brandon (bardnon) 6 104.36 108.60 4 66.67
21264. Cooper (bannanaman9000) 6 83.97 88.87 1 16.67
21265. Michael (bannable_) 6 109.92 116.14 0 0.00
21266. BadxX (badxx) 6 71.36 79.99 3 50.00
21267. bacon (bacnv) 6 31.68 40.43 0 0.00
21268. Blake (backflip25) 6 103.49 110.92 1 16.67
21269. Babblecat (babblecat) 6 52.12 59.67 0 0.00
21270. aztiokir (aztiokir) 6 111.93 128.74 6 100.00
21271. Clayton (azpinballer) 6 82.45 96.13 2 33.33
21272. ayush (ayush_raj) 6 51.35 57.77 1 16.67
21273. Ayush (ayush729p) 6 74.31 78.57 4 66.67
21274. Saeasd (axol578) 6 90.43 101.09 2 33.33
21275. hock siong (axiang2000) 6 53.45 64.64 1 16.67
21276. lex (axemzo) 6 98.66 110.17 1 16.67
21277. Mister_ (axad007) 6 73.13 85.54