TypeRacer Data Leaders Texts Months Universes Import About

View profile:

November 2021

Sorted by most races

<

Rank	Username	Races	Month	Best Race	Wins	Win %
1.	-MarkVS- (mark40511)	5,686	116.91	163.77	2,084	36.65
2.	(vixt)	5,134	120.93	187.30	2,738	53.33
3.	noobnoob (garblovian)	4,051	101.91	143.99	1,525	37.65
4.	Cole (colemakingprocess)	3,919	67.00	110.43	896	22.86
5.	🐟🐟🐟🐟hn (deliber...	3,509	132.61	171.45	2,279	64.95
6.	(poem)	3,453	134.69	207.30	2,183	63.22
7.	Stas (tracersm)	3,332	79.46	100.16	825	24.76
8.	sykelolxd (sykelolxd)	3,192	123.32	170.24	1,918	60.09
9.	MS (damanthc)	3,050	93.74	128.35	1,066	34.95
10.	Shashank (kingshashank12)	3,036	90.82	147.10	1,061	34.95
11.	Sam Aka 😏 (sam_at_40wpm)	3,000	72.86	109.73	802	26.73
12.	Cristiano (christiano_ronaldo)	2,891	60.33	91.23	578	19.99
13.	paperboy ditty (wordracer888)	2,864	140.45	191.79	1,968	68.72
14.	makeout (wastingtimexd)	2,795	73.94	107.97	648	23.18
15.	joel (jouel1234567)	2,666	70.17	101.92	618	23.18
16.	skr_j (saikiranj)	2,650	79.27	116.22	778	29.36
17.	(scraex)	2,633	113.80	191.09	2,076	78.85
18.	tstats[tshafer3] (tshafer3)	2,586	118.39	149.72	1,481	57.27
19.	WatchDominion.org (lithox2)	2,573	149.93	207.24	1,095	42.56
20.	lavé (traben)	2,569	156.92	224.33	756	29.43
21.	Ghost racing medalists suck...	2,550	84.93	117.14	733	28.75
22.	Diego (divarela)	2,505	84.10	111.84	730	29.14
23.	k (mc0sta)	2,283	86.99	116.13	704	30.84
24.	fatih (webfox)	2,281	83.50	113.09	732	32.09
25.	praks (praks01)	2,233	93.70	124.74	813	36.41
26.	Ramsey (tackheads)	2,221	87.10	123.05	684	30.80
27.	neno (nenobid428)	2,189	95.05	129.29	956	43.67
28.	chom (chomchomchomchomchom)	2,172	113.50	170.78	1,083	49.86
29.	(sura5)	2,161	116.32	176.11	1,252	57.94
30.	Ben (koppix)	2,154	67.83	87.41	450	20.89
31.	(dawittymidget)	2,139	130.27	165.29	1,310	61.24
32.	Colin (geosyog)	2,117	107.14	150.55	987	46.62
33.	rilee_h443 (rilee_h443)	2,109	101.80	152.48	900	42.67
34.	¯\_(ツ)_/¯ (glandock1)	2,095	104.68	140.81	941	44.92
35.	David (davelish)	2,094	54.00	76.71	280	13.37
36.	Md Ubaid (mdubaid_ulllah000)	2,082	60.78	99.99	478	22.96
37.	Martin (martinwong)	2,049	93.73	121.93	756	36.90
38.	Kinesis (kinesis_quake)	2,032	130.27	159.09	1,331	65.50
39.	Ton (2001or2)	2,023	104.03	147.28	905	44.74
40.	tebond (tebond)	2,014	112.03	158.67	1,054	52.33
41.	oneguardsam (oneguardsam)	2,000	84.45	120.98	526	26.30
42.	joshua rose 🇵🇸 (joshu...	1,982	96.17	137.15	730	36.83
43.	Am1n (vividus)	1,973	97.01	121.10	791	40.09
44.	Wise (wiseuser)	1,952	90.79	133.60	532	27.25
45.	Reaching (breakingpoint1)	1,947	73.12	106.82	508	26.09
46.	Global (global_typer69)	1,930	78.16	113.55	525	27.20
47.	wrists parallel (cheffray)	1,929	131.77	177.70	1,257	65.16
48.	Bleedy Basket! (ninjismo)	1,921	83.36	110.71	556	28.94
49.	(jasimk)	1,889	99.54	170.13	740	39.17
50.	Hemant (hemu_sakunde)	1,870	71.34	102.54	490	26.20
51.	StraightUpLuck ¯\_(ツ)_/�...	1,866	103.02	144.83	813	43.57
52.	(mononym_jisoo)	1,862	138.50	228.44	1,803	96.83
53.	sdr4wkc48 (sdr4wkc48)	1,827	69.29	97.55	431	23.59
54.	Mirkhad (cmirkhad)	1,825	86.21	129.22	659	36.11
55.	hi (flaneur)	1,822	184.67	282.30	795	43.63
56.	adsfjk (jbcabintoy14)	1,818	93.31	124.85	669	36.80
57.	infinite (infinite_wotah)	1,802	64.92	93.98	374	20.75
58.	Cowbell (morris_l)	1,763	120.55	188.85	995	56.44
59.	meow (xrelative)	1,743	145.56	202.54	1,387	79.58
60.	MUPH (muphine)	1,724	81.93	119.83	470	27.26
61.	Adam (adamjason804)	1,719	105.40	151.08	744	43.28
62.	swapneel (swapneel_das)	1,715	57.58	85.07	258	15.04
63.	Stefan (fortress_king)	1,709	94.69	130.84	609	35.63
64.	Julius (solenopsis)	1,705	103.83	131.54	730	42.82
65.	unnamed (unnamedflower)	1,701	85.38	110.81	515	30.28
66.	Naut38 (naut38)	1,697	77.24	105.51	354	20.86
67.	stalkers (stalkers0418)	1,689	81.01	126.99	516	30.55
68.	Dal (astronerd)	1,688	102.36	146.26	656	38.86
69.	WheelieTron3000 (wheelietro...	1,686	83.66	109.68	502	29.77
70.	Stupid (stupididiot9)	1,651	85.73	121.00	525	31.80
71.	Des (desl)	1,638	75.76	114.00	458	27.96
72.	Tom (tomme2009)	1,632	70.65	98.99	349	21.38
73.	Grandpa (thedengue)	1,628	94.86	163.03	27	1.66
74.	Sumit (smtchahal2)	1,628	149.44	193.79	1,348	82.80
75.	King (kingthiccness)	1,626	86.84	116.41	508	31.24
76.	Christos (__christos__)	1,623	70.08	94.26	410	25.26
77.	Soufiane (shinigami25)	1,598	68.22	98.18	367	22.97
78.	Rachel (rmsitar)	1,597	129.15	164.89	935	58.55
79.	bayu (bayurespati)	1,574	66.98	100.21	355	22.55
80.	nilb (nilb)	1,568	72.89	97.28	362	23.09
81.	Marco (ankush12)	1,568	61.93	102.47	315	20.09
82.	Angelic (angelic_devil)	1,549	108.59	146.70	791	51.07
83.	(treje)	1,535	93.23	143.68	687	44.76
84.	Amit (amit__123)	1,534	54.75	92.21	259	16.88
85.	James Paul (ap1ng)	1,527	53.79	75.04	206	13.49
86.	Ninaad (saklas_33)	1,519	61.24	112.88	308	20.28
87.	(tearsinrain)	1,518	112.56	164.30	782	51.52
88.	harshil (monsta_001)	1,514	69.64	96.12	372	24.57
89.	qwerty (qwerty235)	1,509	84.51	105.98	461	30.55
90.	Ryan (potatoz10)	1,498	102.01	137.06	700	46.73
91.	oussama (oussama2000)	1,495	45.19	62.04	141	9.43
92.	Elkotte (elkotte)	1,495	110.31	143.76	775	51.84
93.	asdf (blackbirdsigloo)	1,494	55.12	84.64	184	12.32
94.	Suikyo (suikyo)	1,491	78.65	117.51	391	26.22
95.	trick20 (trick2001)	1,490	81.17	116.17	386	25.91
96.	griV (griv)	1,489	82.03	117.63	384	25.79
97.	Davit (sonofar)	1,472	67.25	105.98	34	2.31
98.	Gabriel (tacbacjack)	1,469	89.86	134.41	516	35.13
99.	n o t h i n g (whyme__)	1,461	106.98	147.95	647	44.28
100.	Tyler (exilereject)	1,458	83.76	125.50	405	27.78
101.	Ja-kobe (jrutz26)	1,456	85.69	119.89	413	28.37
102.	Ashish (almessi10)	1,454	72.39	98.37	386	26.55
103.	Charles (charlesduran27)	1,452	114.66	144.45	731	50.34
104.	bryan (bryan2010)	1,452	42.61	71.87	116	7.99
105.	JP (supertyperguy2020)	1,449	57.35	74.45	202	13.94
106.	monners (monners)	1,449	76.80	100.38	468	32.30
107.	a sad story🎬 (xquyen)	1,442	93.24	123.99	534	37.03
108.	Cosmic (aji3)	1,440	101.46	151.88	596	41.39
109.	Cepheus's 🌌 (parkevan27)	1,434	131.43	175.04	881	61.44
110.	Josh (cobra04)	1,434	48.66	69.06	94	6.56
111.	swapneel (swapneel1121)	1,431	50.29	77.76	151	10.55
112.	(charlieog)	1,428	131.92	224.05	1,052	73.67
113.	(ginoo75)	1,427	137.55	249.12	1,057	74.07
114.	Ad (shmldb)	1,417	50.80	70.42	122	8.61
115.	Sudhir (sudhir_123)	1,414	52.06	70.54	131	9.26
116.	Angel does it again (ha_saahn)	1,412	106.82	152.80	660	46.74
117.	Nyiela (ncs1020)	1,411	68.67	100.40	346	24.52
118.	Anku (gurooatwork)	1,410	60.20	81.11	263	18.65
119.	Anh (_azh_)	1,402	81.87	124.74	410	29.24
120.	Chris (chrishewson)	1,402	133.17	169.84	988	70.47
121.	Luis (luisaes)	1,397	69.35	96.68	315	22.55
122.	enminnrawr (zxcvbnm2001)	1,394	71.18	101.07	344	24.68
123.	DOES KEVIN RUDD HAVE THAT I...	1,394	191.68	251.98	1,346	96.56
124.	Mor (morti_20)	1,394	74.72	107.73	331	23.74
125.	Aditya (adityapatel103)	1,393	55.42	72.33	175	12.56
126.	Sagi (sagi73)	1,383	87.11	125.20	440	31.81
127.	Abdulrahman karkalar (safi3...	1,375	48.30	79.45	130	9.45
128.	スレトロン (slethron)	1,371	104.52	132.69	607	44.27
129.	Eli Ferdinand Edralin (elfe...	1,371	98.65	132.99	564	41.14
130.	A (dicktucker)	1,371	104.41	137.52	621	45.30
131.	Eukalyptusbonbon (vogel_adler)	1,364	110.42	138.48	668	48.97
132.	Ivan_Eagle (ivan_julia)	1,351	67.68	93.42	347	25.68
133.	Claudio (tato41)	1,350	68.60	93.65	296	21.93
134.	Sharif (sharif4747)	1,350	82.64	129.37	421	31.19
135.	Derf (derfmongrel)	1,350	70.30	99.77	289	21.41
136.	তন্ময়_2 (better_t...	1,349	104.16	139.74	635	47.07
137.	Kapa (kassyk)	1,347	50.77	71.76	131	9.73
138.	HD (hdcodecj)	1,347	81.54	108.18	362	26.87
139.	Plinkiplonk (plinkiplonk)	1,325	111.30	156.63	610	46.04
140.	Ishit soni (isrhtu_114)	1,316	57.54	84.08	257	19.53
141.	yesman (yesman9527)	1,314	84.89	141.81	412	31.35
142.	Shahil Suresh (roylar_range...	1,309	67.44	100.45	287	21.93
143.	Elias (el_typo_jr)	1,300	74.73	109.47	302	23.23
144.	Lucas (st3ezy)	1,291	76.58	102.58	318	24.63
145.	Lara (chuiicdhk)	1,289	80.40	120.64	413	32.04
146.	tivo (tivotavo)	1,287	96.96	147.87	518	40.25
147.	dinqissa (dinqissa)	1,287	80.46	128.64	324	25.17
148.	Abhisek (_typing_)	1,284	88.10	113.56	411	32.01
149.	auoaeu (aoeuhe)	1,283	81.04	106.58	358	27.90
150.	Can (cazzed)	1,279	87.04	124.04	388	30.34
151.	Gerben05 (gerbenklapwijk)	1,273	61.02	85.18	228	17.91
152.	tbj77 (tbj77)	1,270	65.30	86.93	317	24.96
153.	Chen Yik (xxmlgsniperxx)	1,264	110.17	148.36	595	47.07
154.	Gon (frixgon)	1,260	75.61	98.65	316	25.08
155.	Sylvie (eat_my_dust_batches)	1,259	83.90	118.84	387	30.74
156.	tstats[yju98039] (yju98039)	1,258	90.54	141.59	452	35.93
157.	Drews (drwsmnlpg)	1,253	85.11	113.22	373	29.77
158.	Benjamin (tryingtouse10fing...	1,250	97.22	131.83	487	38.96
159.	Manmit (manny_the_potato)	1,247	83.36	116.64	327	26.22
160.	Ra (rayap1010)	1,246	79.45	106.83	346	27.77
161.	s3rez (s3rez)	1,238	140.65	186.85	967	78.11
162.	صبر (morocco01)	1,231	86.60	123.33	397	32.25
163.	Abdulaziz (mubailesh)	1,220	88.87	116.71	400	32.79
164.	David (davidpit)	1,219	49.89	73.21	180	14.77
165.	Gustaf (gusco933)	1,214	90.69	132.95	382	31.47
166.	Logan (theperson60)	1,206	117.30	151.69	612	50.75
167.	KIARA (atherynbane)	1,202	83.52	123.90	357	29.70
168.	Deshant (djtype2124)	1,199	60.78	93.83	248	20.68
169.	Dark (dark_byte)	1,198	79.92	114.42	340	28.38
170.	Manol (ari3s)	1,198	81.38	111.90	329	27.46
171.	WILMER (handsometomato)	1,195	63.16	94.88	222	18.58
172.	Nguyen (rainfall1611)	1,187	93.64	129.59	450	37.91
173.	adsf (max_m7)	1,182	101.04	144.36	467	39.51
174.	Jaska (jarlewski)	1,182	73.91	103.28	295	24.96
175.	Alien (half_alien)	1,181	85.60	117.04	366	30.99
176.	jacktheboy211 (jacktheboy211)	1,180	106.92	144.66	547	46.36
177.	Ali (ali_pro)	1,180	55.80	80.05	154	13.05
178.	Ramses (boinkey)	1,179	87.63	125.10	335	28.41
179.	Henry (henry_21)	1,177	43.66	63.16	96	8.16
180.	trendy (strongly_typed_trendy)	1,175	59.41	90.32	215	18.30
181.	LockStock (lockstock)	1,170	99.69	129.66	442	37.78
182.	Michael (kedalg)	1,170	63.59	86.26	222	18.97
183.	AKGD (akgd)	1,170	90.75	115.09	425	36.32
184.	雲煙成雨 (1eonardo)	1,167	75.74	108.83	302	25.88
185.	Dang Hai (haidanghoang178)	1,165	78.39	104.53	301	25.84
186.	ankit (ankitthegreat)	1,160	86.44	109.88	361	31.12
187.	Shukuphido (shukuphido)	1,154	66.68	83.29	259	22.44
188.	fdsafdsa (szesz)	1,150	77.40	103.32	283	24.61
189.	👋youtu.be/AXNeUMDP3no (o...	1,144	95.65	143.28	482	42.13
190.	Zohaib (atazoa)	1,144	59.20	93.35	222	19.41
191.	chopst1cksss (chopst1cksss)	1,134	118.12	147.30	660	58.20
192.	arijan (arijan_dh)	1,134	130.38	189.19	775	68.34
193.	pythagoras (123pythagoras123)	1,134	86.27	119.93	309	27.25
194.	Richard (dicklash)	1,131	99.33	128.73	438	38.73
195.	SPEXINDER (forest7)	1,129	108.91	152.46	561	49.69
196.	Wayne (samehadenough)	1,128	84.00	114.53	342	30.32
197.	Typeracerer (typeracerer2020)	1,120	65.47	84.73	242	21.61
198.	Colemak Lost (_champ_)	1,111	121.84	175.75	622	55.99
199.	Maters (maters48)	1,109	62.86	86.95	210	18.94
200.	kim (kim_1409)	1,109	125.54	185.81	706	63.66
201.	HudYA (hudyusuf)	1,108	69.32	95.17	250	22.56
202.	0O00O0O0O0O0O0 (bunnystacker)	1,107	79.81	111.72	304	27.46
203.	Joel (joel6677)	1,103	105.01	138.08	490	44.42
204.	Ritik (beast2402)	1,099	56.56	79.71	155	14.10
205.	Ivan (expl1icity)	1,098	83.66	107.49	301	27.41
206.	Shivam Kumar (sks123_)	1,096	64.42	97.44	234	21.35
207.	i love typing!!! (hebibuki)	1,096	104.96	142.13	454	41.42
208.	Erdenebat (speed8019)	1,091	65.19	93.55	259	23.74
209.	Korezu (nyanuwin)	1,090	69.67	97.66	223	20.46
210.	lobus (lobus_rec)	1,089	97.05	128.26	420	38.57
211.	Tinumír (tinumir)	1,086	100.38	125.01	481	44.29
212.	zyyy (zyyyyyyyz)	1,077	64.75	94.65	251	23.31
213.	i talk to the wind (pastash...	1,075	148.50	269.30	757	70.42
214.	Ji (urzz4eva)	1,074	113.17	157.52	544	50.65
215.	Artem (gushinartem)	1,071	87.88	135.69	364	33.99
216.	Sandro🇬🇪 (jolskey)	1,069	87.02	128.17	338	31.62
217.	Operation Sindoor Rocks (pr...	1,063	56.99	86.44	175	16.46
218.	fella (fellasaurus)	1,060	60.73	78.25	171	16.13
219.	glerou (tudesci)	1,058	90.04	124.52	339	32.04
220.	Daniel (smartdevilno)	1,058	76.60	99.37	250	23.63
221.	subham (subhamrawat)	1,054	85.59	120.22	269	25.52
222.	james (awesome4aces115)	1,053	80.17	133.39	275	26.12
223.	Innocent (saquelain)	1,048	68.02	98.94	222	21.18
224.	tstats[brandonisstupid] (br...	1,048	89.91	126.27	355	33.87
225.	Type (granwizard)	1,046	85.91	117.41	376	35.95
226.	lettel (lettel)	1,037	89.07	114.84	315	30.38
227.	shuffled neurons (spicytuna1)	1,036	143.75	194.81	69	6.66
228.	Ramzan Mubarak All World Be...	1,033	97.89	127.16	427	41.34
229.	Jashe (freshfastjashe)	1,029	167.66	212.33	826	80.27
230.	(peaceinchrist)	1,027	120.30	160.56	577	56.18
231.	Tim (timlee)	1,024	36.20	51.76	54	5.27
232.	Σπύρος (asos11)	1,020	62.26	91.38	198	19.41
233.	Andrè (andrree)	1,020	77.62	109.45	251	24.61
234.	Typerx (newtyperx)	1,016	95.23	131.95	370	36.42
235.	Carmel (m_carmel)	1,008	111.38	147.10	489	48.51
236.	🎈k (konnomon)	1,000	92.43	115.84	357	35.70
237.	(jlam55555colemak)	1,000	126.53	170.26	631	63.10
238.	Matthew (kylehyde)	997	86.67	116.61	279	27.98
239.	jk5621 (jk5621)	995	59.99	82.95	188	18.89
240.	🐍🐍🐍 (despot)	993	154.99	222.45	755	76.03
241.	shadmehr (megacrocodile)	990	71.64	101.76	221	22.32
242.	alshbalasle (hadisulfe)	988	47.30	70.68	101	10.22
243.	Finley (blindfish)	988	77.81	112.40	233	23.58
244.	Adarsh M A (adarshm39)	986	51.33	67.55	130	13.18
245.	Orka (orka)	979	60.58	78.98	186	19.00
246.	Ovidiu (ofydd)	979	111.49	136.99	469	47.91
247.	Tommy (dextonjl)	978	114.92	160.00	489	50.00
248.	Adrian (adrianvn789)	975	97.47	132.01	423	43.38
249.	(´・ω・｀) (gahama)	973	126.57	172.14	643	66.08
250.	Huy (cross546)	973	55.19	74.45	116	11.92
251.	Fallen (giorgiv4)	972	95.50	135.17	390	40.12
252.	juswawawa (juswawawawawa)	970	93.05	133.28	368	37.94
253.	💀💀💀 (gospell)	970	113.82	162.29	486	50.10
254.	Om (omkashyap007)	965	58.70	85.07	170	17.62
255.	Cloud (cloud_bolssom)	965	77.12	115.77	235	24.35
256.	jaso (jasocanfly)	957	89.54	133.61	316	33.02
257.	AJ (aayushjoshi)	957	57.46	86.20	187	19.54
258.	φσ (phi_sigma)	956	62.29	81.65	191	19.98
259.	Md Shamim (cseshamim47)	950	62.53	85.62	182	19.16
260.	neeraj (neeraj902)	949	73.92	100.09	248	26.13
261.	144p 1998 VW Beetle (stryke...	945	111.69	156.19	467	49.42
262.	(◍•ᴗ•◍) (ibi4645)	944	67.88	111.04	561	59.43
263.	Birdman (birdman13)	944	79.60	104.40	314	33.26
264.	TypingMaster3 (typingmaster...	938	100.68	136.27	384	40.94
265.	Xi Jinping (wuhan_virus)	933	69.94	98.12	217	23.26
266.	Amarjot (apandher)	933	113.77	155.82	465	49.84
267.	Type like never before! (re...	932	101.36	143.82	393	42.17
268.	Nyamsick Adrian (minyamisu)	932	55.12	84.26	134	14.38
269.	lhdrive (kickmic)	931	63.09	85.92	189	20.30
270.	mamoud (__mahmoud__)	930	47.49	66.46	83	8.92
271.	Prithbiraj (prithy)	930	62.93	90.33	239	25.70
272.	Paolo (invelt)	929	109.46	139.53	484	52.10
273.	fazel (the_slow_typer_14wpm)	929	46.92	66.02	88	9.47
274.	mohan (mohan2002)	924	73.99	99.58	240	25.97
275.	Edward (kailhreds)	924	84.99	109.75	269	29.11
276.	Mazhar Andalib (mazharandalib)	923	79.75	117.58	284	30.77
277.	Ara Ara (vinhwiu)	922	74.21	106.60	239	25.92
278.	Jason (jasonjohnsj27)	922	95.03	141.27	378	41.00
279.	Yash (yashshingade28)	921	87.40	116.14	341	37.02
280.	Michael (michaelch)	921	97.05	136.99	366	39.74
281.	cheikh (cheikhbr)	921	59.28	84.57	158	17.16
282.	Saucter (saucter)	920	88.03	118.87	296	32.17
283.	kekw (kekwomegalul)	920	132.07	173.98	638	69.35
284.	L (easymoneysniper1)	920	131.31	184.00	556	60.43
285.	FoTGbigGhost (fotg_reckless)	916	103.31	130.51	388	42.36
286.	jun (jun0sck)	914	79.68	112.41	228	24.95
287.	onii-chan (cinnamonorange)	911	76.18	110.02	234	25.69
288.	sməxy (smexyflako)	910	102.52	136.70	361	39.67
289.	BBB (beermindnor)	910	70.49	96.06	221	24.29
290.	monochrome (artemis_05)	910	101.32	132.00	361	39.67
291.	Kevin (zhengfeilong)	908	127.07	167.55	539	59.36
292.	Ricky (suthxx)	907	36.56	56.72	72	7.94
293.	Anthony (goldfrog)	906	55.56	88.54	116	12.80
294.	Surya (maurice_mordor)	906	43.22	64.03	60	6.62
295.	Jacobo (inztincz)	905	75.82	117.56	224	24.75
296.	mrgiorgoulis (mrgiorgoulis)	904	80.97	123.10	248	27.43
297.	J-Money (jacobbeaudway)	902	78.42	108.96	239	26.50
298.	Lactophenol Cotton Boy (tpy...	901	103.18	140.58	389	43.17
299.	Brendan (brendalandan)	900	85.95	115.72	218	24.22
300.	Ez (ezpass)	897	78.48	112.82	292	32.55
301.	abdullah (abdullah_ui)	897	108.58	149.91	461	51.39
302.	The cute girl likes pink (o...	895	117.96	152.37	506	56.54
303.	Nick (1truelipstick)	895	111.78	161.78	436	48.72
304.	Leo (leotwelve)	891	79.84	101.29	223	25.03
305.	(yeekidd)	889	95.81	146.01	339	38.13
306.	account deleted (concurrent)	889	100.10	137.17	21	2.36
307.	Ankit Kumar (ankitnain)	889	87.38	119.81	612	68.84
308.	keiwpie (keikuuuu)	887	93.19	124.21	350	39.46
309.	sdfg (nerus_k)	886	39.68	58.49	76	8.58
310.	Zak (villzzz420)	885	50.43	76.75	109	12.32
311.	jello_jello (jello_jello)	885	109.20	137.06	454	51.30
312.	Abu (abu_hussain_03)	885	76.87	100.68	231	26.10
313.	Sayandip (sayandip199309)	883	76.60	99.45	232	26.27
314.	matan (malsonic)	883	77.87	127.21	240	27.18
315.	sudheer singh (justsudheer)	882	65.50	91.00	211	23.92
316.	Calvin Low (benderium_123)	881	79.94	100.19	244	27.70
317.	Adarsh (krishnan7)	879	60.06	81.55	147	16.72
318.	Oliver (rgroli)	878	60.84	81.20	147	16.74
319.	Ravi (ravishankarr)	877	47.67	69.41	96	10.95
320.	omar (omar_elsayed)	876	56.95	84.40	125	14.27
321.	Carlos (carloszapata)	874	63.97	90.14	207	23.68
322.	Please use an appropriate n...	873	49.99	71.46	95	10.88
323.	(khronic)	873	119.40	154.56	522	59.79
324.	Dan (cantdecidedan)	872	65.01	96.90	230	26.38
325.	Vashista (vashista)	870	70.69	98.13	208	23.91
326.	Densetsu (densetsunobattousai)	869	74.44	98.91	266	30.61
327.	SimplyOrange (simplyorange)	867	92.85	122.47	302	34.83
328.	Petar (petar17)	866	62.06	82.20	163	18.82
329.	heartbeats (jack777)	864	105.91	145.75	366	42.36
330.	farzan (farzanhges)	862	93.52	131.23	378	43.85
331.	Thinh (thinhtr)	861	78.53	103.84	261	30.31
332.	(rayer)	856	117.09	168.57	459	53.62
333.	Keira (keiradawn)	856	93.41	119.94	323	37.73
334.	philiplol (philiplollll)	855	65.52	91.07	164	19.18
335.	John (happyguy2000)	855	52.12	66.38	69	8.07
336.	Jonathon (goodstuff11)	852	101.79	148.11	347	40.73
337.	dotdotdot (atuladhar1)	848	67.34	97.85	188	22.17
338.	(paceyq)	845	132.77	172.58	547	64.73
339.	Ivan (ivannechaiev)	845	82.12	106.77	230	27.22
340.	Fauggesim (fauggesim)	845	40.25	56.57	60	7.10
341.	Kyrgyzstan (zhanarbek)	844	69.06	96.29	197	23.34
342.	Ahnaf (stallion1145)	844	73.97	102.60	198	23.46
343.	Rishav (rishavmngo)	841	76.82	105.41	211	25.09
344.	Big k (lawda)	839	59.82	91.62	168	20.02
345.	Lil Mama (ckennedy07)	839	87.95	109.80	232	27.65
346.	Vanshraj (vrsempire601)	837	73.13	102.11	208	24.85
347.	Almaz (almazzz1)	835	64.05	91.42	225	26.95
348.	Winnie (win_)	834	84.55	104.38	228	27.34
349.	mahmoud shalhoub (mahmoud77)	833	35.97	52.55	83	9.96
350.	The Real Snail (kelvin_paul)	833	98.50	122.83	306	36.73
351.	Cameron (sigmaimu)	832	99.40	134.70	284	34.13
352.	Free Palestine 🩸🫸 (mo...	832	100.64	141.61	304	36.54
353.	Sewnkin (sewnkin23gg)	827	91.43	122.05	296	35.79
354.	Kerb (kerby_berby)	827	124.71	175.80	468	56.59
355.	Omni (omzi)	826	72.99	116.05	214	25.91
356.	Mishel (holosight)	824	76.27	113.70	190	23.06
357.	Akash (swfu_akash)	821	75.47	106.67	221	26.92
358.	Chrism4 (chrisman44)	818	59.72	86.15	147	17.97
359.	QwertyBaguette (smellybague...	817	98.07	121.63	330	40.39
360.	Miccalo (miccalo_dv)	817	48.99	92.52	98	12.00
361.	Brenden (embracesc2)	812	65.34	96.19	186	22.91
362.	Lara (goddess_111)	811	94.29	147.81	294	36.25
363.	sugdese (sugdese)	809	69.18	97.58	179	22.13
364.	big daddy (shivdatt_op)	809	64.68	98.52	170	21.01
365.	Nabeel (nabeelz)	809	76.24	99.79	205	25.34
366.	Josh (the_josh)	805	95.36	128.79	317	39.38
367.	travdong (travdong)	800	80.52	107.92	197	24.63
368.	Max (maxijazz)	799	98.93	132.55	361	45.18
369.	rinas (dont_look_at_keyboard)	797	30.86	43.85	74	9.28
370.	Trung (danghoangtrung)	797	54.90	82.09	95	11.92
371.	Blue (terry25031069)	796	82.20	105.56	210	26.38
372.	Saulius (zemfry)	793	91.84	115.31	256	32.28
373.	Youssef (sec5x)	793	99.26	125.01	317	39.97
374.	subham (syt03)	792	45.64	64.98	99	12.50
375.	bleh (devcappy)	792	97.60	146.50	297	37.50
376.	David (tintedrange)	790	79.62	110.32	216	27.34
377.	Alenygam (provola23)	789	115.48	154.43	425	53.87
378.	skippi (skippie)	788	130.53	175.06	490	62.18
379.	sharaf (sharaf_makk)	788	62.40	80.90	137	17.39
380.	Dhruv (codenta)	788	45.74	66.54	72	9.14
381.	Daniel (kool_beenz)	786	66.57	95.05	158	20.10
382.	Workman (dagl200)	786	87.13	115.06	245	31.17
383.	अध्ययन Adhyan (...	786	50.28	74.54	95	12.09
384.	John Anthony (therewere3)	785	61.48	80.92	155	19.75
385.	Ramsudhan (sudhanlee)	784	58.22	75.26	115	14.67
386.	An (iaman)	783	93.27	118.91	282	36.02
387.	John Paul (jp_ramolete16)	782	48.21	65.69	84	10.74
388.	mimi (xvni)	777	67.81	86.75	157	20.21
389.	Jarod (terminuszwei)	776	102.32	149.66	323	41.62
390.	NiteCyperTTV (nitecyper2)	774	137.90	180.98	555	71.71
391.	ARK (qwerty account) (arkfr...	773	81.34	105.10	196	25.36
392.	ros (heyokay1234)	772	70.49	102.02	188	24.35
393.	AxiomDestroyer (axiomdestro...	772	108.78	135.73	368	47.67
394.	Andrea (andreavanderjagt)	772	91.17	128.19	250	32.38
395.	uty (tisurend)	771	101.63	145.17	315	40.86
396.	ASIAN47 (asian47)	771	90.82	131.77	284	36.84
397.	nauyu (nauyusimi_)	770	108.83	133.43	351	45.58
398.	Anant (hero_shukla)	770	96.30	128.56	303	39.35
399.	danniponcho (dponchos)	770	95.09	128.65	276	35.84
400.	Filip (hummelur)	769	74.23	98.25	205	26.66
401.	Gagan (gagan18)	768	90.01	132.29	269	35.03
402.	Tewtadle (tewtadledesktop)	767	91.33	123.96	263	34.29
403.	SLSL (slslz)	767	74.07	116.03	185	24.12
404.	liz (hamid__)	767	109.18	136.27	373	48.63
405.	Tejas (crimcrim)	767	74.42	104.26	196	25.55
406.	ghost (theghostbehindyou)	764	56.69	83.86	111	14.53
407.	tstats[barockt] (barockt)	763	95.32	119.99	279	36.57
408.	fasttyperLoading (fast_type...	763	37.41	55.04	58	7.60
409.	(joshua728)	762	221.42	310.07	728	95.54
410.	InCredH (harsh_hegishte)	762	83.08	132.63	231	30.31
411.	Ayvan (dharmablade)	761	86.68	118.34	231	30.35
412.	wakeupvarn (varnontyperacer)	760	101.57	133.09	302	39.74
413.	peeush (piefkr)	760	38.67	63.72	49	6.45
414.	Anguu (anguubeef)	760	99.23	125.22	301	39.61
415.	Ahmad (ahmadmozaffar)	759	73.50	114.70	185	24.37
416.	Amar (supatypaxxx)	758	89.96	123.90	273	36.02
417.	tstats[parth812] (parth812)	758	55.37	79.60	100	13.19
418.	HadiToori (haditoori)	758	78.43	109.56	235	31.00
419.	Dana (danayi)	758	126.37	173.49	491	64.78
420.	C (ccc123)	757	94.81	123.16	263	34.74
421.	hellisgood (hellisgood)	756	62.32	81.88	166	21.96
422.	LastSlice (cezara)	756	60.19	84.84	118	15.61
423.	🌹 Black Rose 🌹 (rosew...	755	149.54	184.99	600	79.47
424.	Samuel (sambabzz)	754	46.34	68.51	65	8.62
425.	yuupoipoi (mimicclone)	754	68.39	89.95	175	23.21
426.	piconeeks (piconeeks)	752	98.76	133.71	285	37.90
427.	flyaway (saltybaby)	751	69.54	102.10	294	39.15
428.	run thru the finish line (p...	750	137.21	170.19	515	68.67
429.	PicturingFrames (frame_abil...	750	87.51	135.92	235	31.33
430.	Callum (cal_a_mari)	750	53.61	72.43	87	11.60
431.	Feynex (imhidayat)	747	103.16	145.43	300	40.16
432.	goraput (boom1749)	747	74.22	110.13	187	25.03
433.	t̶̢̤͇̪̱̮̿̓̓̕͜ͅ...	746	95.57	132.42	273	36.60
434.	Ivan (ivantakashi)	745	90.11	138.20	243	32.62
435.	arena (arenacloser204)	745	90.66	136.63	219	29.40
436.	Laith (chaoscontrol_jr)	744	63.69	87.44	210	28.23
437.	bub (bubmaley)	742	106.29	138.33	333	44.88
438.	Mr.Pemguimn (nhatltm)	741	78.10	132.09	250	33.74
439.	Felix (promeneraren)	740	113.42	162.61	337	45.54
440.	nonquitvinpho (nonquitrainb...	740	115.53	164.74	324	43.78
441.	john (nothisisjohn)	738	170.54	205.37	687	93.09
442.	Mohammad (mhmmdkholani)	738	38.66	59.58	58	7.86
443.	Tang (tangvt97)	736	63.99	83.23	145	19.70
444.	Rika (infric)	735	132.11	161.68	36	4.90
445.	Ryan (rjbunge99)	734	81.59	105.25	190	25.89
446.	Baked and Buttered (mcallen...	730	114.48	167.97	338	46.30
447.	Aggy (tuigovno)	728	78.78	111.19	226	31.04
448.	Milka (mille993)	728	50.73	67.13	66	9.07
449.	anurag tara (fastest_racer)	728	52.00	74.95	85	11.68
450.	Idris (kakashirero)	727	77.51	114.03	233	32.05
451.	⠈⠁ᵀ ᴱ ᴵ ᴸ ᴼ�...	724	117.63	154.07	364	50.28
452.	uzi (cray_f)	724	72.48	98.88	172	23.76
453.	derusting (paradoxpigeon)	722	154.93	195.52	652	90.30
454.	Tiddy (tiddytwister)	721	94.75	128.19	250	34.67
455.	Aelyos learns to type (aely...	721	50.85	71.29	82	11.37
456.	Tobbe (tobbedman)	720	80.30	107.01	190	26.39
457.	Qwerty (qwerty80801)	720	96.16	126.22	265	36.81
458.	(naturaladoption)	719	95.67	156.42	234	32.55
459.	Chaddley (chadracer69)	719	94.43	129.14	240	33.38
460.	Said (saidenhide)	717	91.69	129.01	260	36.26
461.	szymi_gold (szymi_gold)	715	66.80	90.85	156	21.82
462.	RIP BYRON (sk8terboi723)	715	145.43	187.97	540	75.52
463.	ឡានប្រណាំ...	714	64.41	95.30	162	22.69
464.	Luis (chapibol)	714	74.04	95.14	152	21.29
465.	akash (akash_sharma)	714	53.23	69.71	120	16.81
466.	Ali (imtew_much)	713	81.33	106.21	192	26.93
467.	Ravi (ravimajhi)	712	49.25	70.10	83	11.66
468.	JCRueco (shizile)	710	83.94	113.44	223	31.41
469.	LB (man_onatree)	708	104.07	139.93	324	45.76
470.	Ornstein (eliggett)	708	90.16	115.10	241	34.04
471.	stop! (ademke)	708	119.21	164.85	387	54.66
472.	maxbaldy (maxbaldy)	708	40.47	56.76	44	6.21
473.	Vroom! (laptopguy)	706	96.32	137.48	271	38.39
474.	Derek (derekkeiley)	706	72.92	92.32	151	21.39
475.	sir (zenzir)	704	86.80	119.30	222	31.53
476.	waterismagnificent (wateris...	704	100.91	136.98	299	42.47
477.	asdfjkl; (deskripper)	704	146.26	201.84	536	76.14
478.	Upmanyu (abhishek2175)	704	78.85	100.51	191	27.13
479.	Anupam (plaanupam)	703	80.92	103.09	201	28.59
480.	Nibblet (nibbletdaking)	700	57.57	79.28	83	11.86
481.	Jackalope (jackalopy)	699	107.29	131.11	329	47.07
482.	tstats[inbredturtle] (inbre...	699	94.94	130.63	252	36.05
483.	Zhuldyzay (zhuz12)	698	64.45	90.58	156	22.35
484.	Nika (tinysalmon90)	698	103.46	130.39	299	42.84
485.	Billy (oatmeal417)	698	102.34	131.49	319	45.70
486.	Gatsu (ace27)	696	52.58	71.68	76	10.92
487.	Noah (nodigermanium)	694	89.25	118.09	207	29.83
488.	JollyImpulse (jollyimpulse)	694	107.61	140.92	303	43.66
489.	Jun Sheng (my40789)	692	71.23	95.36	184	26.59
490.	Lane (laneondvorak)	691	85.70	130.96	193	27.93
491.	Slethron (fastslethron)	689	102.44	133.57	295	42.82
492.	Vignesh (viggie)	688	77.11	100.75	191	27.76
493.	Steve (stev_cubed)	688	151.84	189.63	595	86.48
494.	camelCase (saisrikantta2)	688	65.12	85.31	137	19.91
495.	phlofy (phlofy)	687	135.66	183.84	479	69.72
496.	GiftedOtter (giftedotter)	686	106.35	144.88	298	43.44
497.	David (dcohen91)	685	98.35	142.14	275	40.15
498.	daksh (daksh_2106)	683	65.57	85.69	148	21.67
499.	Andy (andy3j)	683	64.79	83.31	161	23.57
500.	Max (tehbomb123)	681	79.94	109.36	142	20.85
501.	Guddu Jaisawal (suraj_6732786)	680	47.07	70.92	65	9.56
502.	Rauhan (rauhan1998)	680	64.80	92.59	160	23.53
503.	Manish (mkn0079)	680	54.53	80.27	103	15.15
504.	OneRandom (one_random_typer)	679	78.59	100.25	166	24.45
505.	LeBaby (funnypoopyeater)	679	99.14	133.88	268	39.47
506.	Juan Martín (juanma2700)	675	95.47	117.95	226	33.48
507.	raghu (r_strike9437)	674	68.84	90.94	168	24.93
508.	E (weihceinre)	670	150.57	202.92	558	83.28
509.	Vasanth Raja (vasanthraja)	668	93.67	121.98	214	32.04
510.	Gaussian (ndrous20)	668	80.36	105.39	154	23.05
511.	John (jakw93)	668	61.02	78.21	134	20.06
512.	EconEdgeLinch (linch8)	667	84.69	109.53	192	28.79
513.	Jay (dicknm)	667	65.58	87.64	143	21.44
514.	Mohammed (modh_)	666	54.88	72.02	56	8.41
515.	Aaron (liron2007)	666	38.68	58.60	53	7.96
516.	Grzesiu (grzesiubonzo)	665	73.49	102.26	151	22.71
517.	mohit (madara989)	664	48.97	70.39	68	10.24
518.	Kok Kun (kokkun92)	664	82.12	117.99	188	28.31
519.	ayorgo (ayorgo)	664	72.32	90.79	168	25.30
520.	Gabe (dyrozang)	662	115.18	158.61	335	50.60
521.	🔰Rayster (rayster1)	660	85.51	117.06	197	29.85
522.	J (ckfhd1234)	660	63.17	77.12	133	20.15
523.	Gerard (gerard_m_m)	659	70.57	100.46	185	28.07
524.	name (anson001)	659	111.15	152.57	289	43.85
525.	aaaaaa (hagemanto)	658	83.20	107.44	173	26.29
526.	DrLawL (drlawc2)	658	150.74	191.10	553	84.04
527.	Nicholas (nicholaswong03)	657	91.45	148.10	236	35.92
528.	Siri (sireon)	657	62.62	83.37	127	19.33
529.	Shaurya (shaurya2399)	656	106.67	131.36	365	55.64
530.	katapi (catapie)	653	98.46	125.37	249	38.13
531.	varun (vakot)	651	55.34	74.36	98	15.05
532.	Apollo (ahollo)	651	76.86	101.33	170	26.11
533.	Prasant (man_iac)	650	96.90	124.60	266	40.92
534.	ben (benwang1)	649	80.26	108.54	175	26.96
535.	tstats[siriusvega] (siriusv...	648	133.15	168.96	452	69.75
536.	tstats[medo_1010] (medo_1010)	648	79.98	116.37	171	26.39
537.	👶 (a_baby)	646	128.20	159.59	417	64.55
538.	jazk (axaladyx)	646	100.08	134.50	259	40.09
539.	Ayan (ayan_007)	645	60.94	78.25	128	19.84
540.	Gerardo (sewingbunion9)	643	57.70	82.69	100	15.55
541.	Karl (relentlesstyper)	643	96.16	124.88	238	37.01
542.	fratelecarol (fratelecarol)	643	76.75	110.95	185	28.77
543.	Tiago (doodoo11)	643	82.06	111.89	169	26.28
544.	PMC (pmcc)	642	75.78	105.79	144	22.43
545.	itsmin (itsminbin)	642	83.95	112.02	182	28.35
546.	Indeed (indeed001)	642	64.12	90.83	148	23.05
547.	Tyler (tjking12)	641	88.55	121.87	208	32.45
548.	Kevin (kevincamilo)	640	76.58	100.17	130	20.31
549.	hyp (hyprix)	640	92.05	136.22	193	30.16
550.	Santiago (drebexler)	640	97.79	137.88	229	35.78
551.	atef (atef_7534)	640	67.10	111.47	160	25.00
552.	Marvuw (hotdog1234444)	639	72.65	99.79	145	22.69
553.	Dvorak (blazeencryption)	639	106.89	151.58	259	40.53
554.	starry nights (iamsatanic)	638	77.58	122.36	152	23.82
555.	Ryan (direwolf05)	637	103.27	131.52	227	35.64
556.	Pranav (pgracer25)	636	48.06	81.39	59	9.28
557.	Theo (theodosis_aga)	635	93.37	134.14	198	31.18
558.	Nicolas (typekaiser)	632	70.85	101.49	165	26.11
559.	Taylor (taylor_1121)	632	81.90	114.09	193	30.54
560.	corrode (nothanksgiving)	632	119.05	168.51	314	49.68
561.	Kabir (kabir_1234)	632	54.57	75.30	88	13.92
562.	dva main (thedragonemperor)	631	149.76	209.71	486	77.02
563.	a (3lim64)	627	98.54	128.37	221	35.25
564.	MrButtersworth (flapjackstax)	626	114.33	137.22	300	47.92
565.	Shivam (exergo)	626	74.18	97.88	164	26.20
566.	amanullah (amanullah32)	626	85.02	115.39	208	33.23
567.	Nico (monnerford)	626	69.68	85.70	138	22.04
568.	China (dvorak_king)	625	95.70	146.30	230	36.80
569.	Nobody (anhddo)	625	77.83	102.38	159	25.44
570.	Habib (habibmalik)	624	83.65	111.09	189	30.29
571.	Pragyan (satisfiedmagma)	623	52.44	74.96	91	14.61
572.	Mrinal Anand (mrinal_anand)	623	46.93	63.65	61	9.79
573.	Serg (drgsus)	623	115.54	156.18	305	48.96
574.	timefaker (timeassassin)	622	79.19	109.16	151	24.28
575.	Lagom (thelagom)	622	91.19	149.10	208	33.44
576.	Ryo (ashida4)	621	99.72	132.69	246	39.61
577.	Arash (me_races)	620	50.32	81.54	88	14.19
578.	George (stamoulohta)	619	67.48	86.52	148	23.91
579.	Andre (andr_ehh)	619	74.82	106.51	161	26.01
580.	(floofyaltaria)	618	129.92	169.97	390	63.11
581.	anty (antyboi)	618	110.17	149.30	285	46.12
582.	Raja (mmahmoodh)	617	82.13	105.68	184	29.82
583.	floof (flooffy)	617	95.48	127.40	211	34.20
584.	Aryav (aryav123)	617	78.67	116.81	184	29.82
585.	Shahbaz (thisisshahbazsb)	616	64.61	80.03	133	21.59
586.	abhishek (abhi1912)	616	46.36	68.63	134	21.75
587.	Swifty2997 (swifty2997)	615	60.25	76.13	100	16.26
588.	Vivek (kill3rking)	615	69.64	91.84	150	24.39
589.	Don't bully me plz (dontbul...	615	77.58	114.62	165	26.83
590.	Moronic Typer (yong955143)	614	103.04	127.30	278	45.28
591.	Charly (swagzzzzz)	613	78.06	121.71	140	22.84
592.	mainto (manito7)	613	58.39	80.44	106	17.29
593.	Julish (julish13)	613	45.08	59.66	58	9.46
594.	Nguyen (nanoforge)	612	66.29	86.18	128	20.92
595.	kunal (kunalmachra)	612	84.49	113.10	181	29.58
596.	Zi Hao (im_getting_there)	612	77.29	111.29	165	26.96
597.	Neodymium (neodytrium)	611	106.81	143.76	269	44.03
598.	🚀 🚀 🚀 (patrickhirsh)	610	76.25	107.91	117	19.18
599.	F (lawlnoodle)	610	95.50	123.72	220	36.07
600.	初めは40wmp (hajime40)	610	92.39	118.60	212	34.75
601.	Mike (mikety1)	609	49.63	66.84	47	7.72
602.	Tien (thetientran)	608	114.70	181.20	331	54.44
603.	hafizh (effortlesshuman)	608	47.85	70.07	51	8.39
604.	Koupka (koupka)	607	76.96	108.13	168	27.68
605.	Supporting Israel (zombiesw...	606	176.20	256.87	436	71.95
606.	rishh_ (imrishitpant)	606	65.51	113.82	148	24.42
607.	maltinyu (maltinyu)	605	64.40	94.88	136	22.48
608.	Started from 3wpm (the_op_p...	603	36.89	60.08	48	7.96
609.	Hassan (hamoro)	602	80.18	105.89	135	22.43
610.	(e6f4e37l)	602	158.13	213.08	533	88.54
611.	Helloween (tranduclocbkmail1)	601	66.77	83.92	146	24.29
612.	Naman (naman1601)	600	86.48	133.22	295	49.17
613.	P (kwerta)	600	81.10	105.65	164	27.33
614.	Electronica__ (electronica__)	600	99.73	126.40	263	43.83
615.	wil (wilruns)	599	120.92	159.14	339	56.59
616.	Joe (joetelefair)	598	89.91	116.42	227	37.96
617.	hilpitome (hilpitome)	598	40.75	61.77	57	9.53
618.	i_type_fast_with_good_postu...	597	73.35	112.75	169	28.31
619.	Dev (devgupta55)	595	70.99	94.07	134	22.52
620.	Xander (xandejesus)	594	107.86	133.61	264	44.44
621.	Markycuh420 (theitfactor)	594	93.22	127.83	210	35.35
622.	Harshith (ghvsama_123)	594	55.84	77.48	103	17.34
623.	ginginggaang (cremleme)	593	86.30	120.33	181	30.52
624.	Saiyn (saiynssgssyr)	592	79.11	107.93	141	23.82
625.	Lex (pyxelwolf)	592	86.22	110.97	175	29.56
626.	Springfield (springfield1903)	591	62.77	87.37	151	25.55
627.	shui (sammi76)	591	86.91	115.49	193	32.66
628.	Jwickblack (hellwood)	591	83.86	114.22	185	31.30
629.	Franco (rubikute)	589	76.52	102.05	143	24.28
630.	rocket (mythicalrocket)	589	178.50	222.91	516	87.61
631.	hi (ihssm)	589	51.93	72.18	62	10.53
632.	Lemonade on Meth (riqlemonade)	588	81.07	116.90	170	28.91
633.	CJ (bighiest)	587	99.93	139.10	266	45.32
634.	typeyMcTypeFace (mslib9)	586	98.65	129.78	248	42.32
635.	Choco (choco22)	586	101.03	159.91	241	41.13
636.	(majernja)	585	72.96	97.57	128	21.88
637.	Vincent (filtertype)	585	83.90	114.07	188	32.14
638.	Nick (coyote96)	585	97.32	119.00	237	40.51
639.	Juliet 3 (buckles7809)	585	78.61	104.99	158	27.01
640.	Sam (imeowyou)	583	81.97	112.16	183	31.39
641.	Beige (beigedaddy)	582	101.76	143.24	270	46.39
642.	Chris (rykthos)	581	81.68	109.52	158	27.19
643.	taylor (pastford)	581	56.57	78.50	80	13.77
644.	Fexo (fexer)	581	94.49	124.33	189	32.53
645.	Guest (train9013c)	580	78.51	103.44	134	23.10
646.	Knight_Oikos (knight_oikos)	580	128.17	166.09	320	55.17
647.	Crooked (crookediyoung)	580	32.90	54.03	70	12.07
648.	Ben (bk100)	579	80.80	116.21	173	29.88
649.	Mo (medsebri)	578	78.62	113.89	155	26.82
650.	Sam (maedrescher)	578	65.41	85.71	116	20.07
651.	DF (df__)	578	73.34	102.26	174	30.10
652.	Vu (kroken_keyboard)	577	65.79	90.61	127	22.01
653.	Abhay (abhay_hadez)	577	91.57	124.55	227	39.34
654.	tofe (tofetofe)	577	52.30	72.50	67	11.61
655.	Chris (immortaljason)	575	25.29	41.41	110	19.13
656.	Nozune (nostar)	574	126.46	178.53	353	61.50
657.	Sian Caleb (promechanics)	573	121.26	151.03	336	58.64
658.	touch grass (midca)	573	92.87	129.47	196	34.21
659.	kaffarell (kaffarell)	573	83.22	117.51	150	26.18
660.	carve (carve)	573	109.30	144.78	269	46.95
661.	lhdk2712 (lhdk2712)	572	87.07	110.19	178	31.12
662.	anas (qanass)	571	40.72	61.25	43	7.53
663.	vinoth0708 (vinoth0708)	570	47.82	77.10	59	10.35
664.	Fiesty (fiesty_cushion)	570	52.74	73.65	73	12.81
665.	Sander (5andos)	570	82.57	103.60	146	25.61
666.	Dr. Sector (sharkychompers)	569	77.71	99.77	139	24.43
667.	raptor (raptor234)	567	68.30	92.85	127	22.40
668.	Abu (kabu22)	567	86.16	113.28	154	27.16
669.	Sourav (yashsaha555)	565	74.37	101.39	141	24.96
670.	Khoi (khoitran)	565	100.41	128.62	253	44.78
671.	Mohammad Rizwaan (freshkebab)	565	83.21	113.21	155	27.43
672.	Enxyon (enxyon)	565	123.93	150.60	361	63.89
673.	Pouya (pouyal)	564	57.51	77.34	79	14.01
674.	Andrew (monochromeocean)	564	94.09	122.02	195	34.57
675.	Marc (marcmalha)	564	83.90	102.94	167	29.61
676.	utsab (utsab987)	563	62.47	82.16	104	18.47
677.	Daniel (tempguan)	563	75.23	97.60	143	25.40
678.	cruise control (terminator_...	562	113.55	148.85	275	48.93
679.	Hyunsu (onlyu0923)	562	88.02	115.31	161	28.65
680.	ChmpionL (lu_fattori)	560	60.33	75.24	5	0.89
681.	zapelots (zapelots)	559	78.22	105.52	157	28.09
682.	player (writer35)	558	74.64	119.79	139	24.91
683.	Harshal (bitbeast18)	558	76.01	106.44	132	23.66
684.	Naved (naved_razi)	558	39.92	62.68	46	8.24
685.	the one (qaisianas)	557	32.98	48.81	37	6.64
686.	Mandip (memandip)	556	59.19	81.13	120	21.58
687.	Kathryn (kathryns)	555	72.96	94.60	119	21.44
688.	Hamza (hamzaalali)	555	70.16	97.05	110	19.82
689.	Satwik (satwik2708)	554	96.71	127.96	214	38.63
690.	ChangeS (changes99)	554	82.05	115.97	154	27.80
691.	duong (anhhungcolao)	554	81.19	101.07	145	26.17
692.	ThisIsHowWeRoll!! (another_...	553	111.12	134.44	279	50.45
693.	Train (trainm8)	552	78.16	108.31	138	25.00
694.	Shypolarbear (shypolarbear)	552	90.15	131.15	178	32.25
695.	Miguel (quevangel)	550	114.40	158.59	301	54.73
696.	Arararararararararagi (manaso)	550	81.45	110.97	134	24.36
697.	Pongpan (pongpan)	549	55.64	69.71	77	14.03
698.	huu duy (huu_duy99)	548	82.30	107.22	145	26.46
699.	mike (captaincapitalism)	548	93.43	121.42	202	36.86
700.	Harmonygrams (harmonygrams)	548	66.08	91.03	128	23.36
701.	pavan (pavan_)	547	43.42	63.01	46	8.41
702.	Jean (orangedrum)	547	90.86	119.89	178	32.54
703.	Wusien (wusien)	546	88.65	120.61	172	31.50
704.	Jagadeshrao (jagadeshrao)	546	56.12	80.01	83	15.20
705.	doquan (doquannnn)	543	92.17	134.59	210	38.67
706.	JD (ruminant_robot)	542	82.08	102.72	144	26.57
707.	Joshua (paper_astronaut)	542	95.55	119.46	170	31.37
708.	Ramseus (master_r)	542	92.58	113.93	180	33.21
709.	Tushar (tushar23651)	541	78.29	102.15	140	25.88
710.	DustySheep (smowbog)	540	86.66	120.04	150	27.78
711.	Jacob (jmbreche)	540	89.10	121.49	198	36.67
712.	⁹⁻¹⁰ᵍᵐ (green910)	539	96.39	121.75	215	39.89
713.	Miras (mirabil)	538	48.54	66.52	47	8.74
714.	JimBob (jasperjimbob)	538	105.97	142.13	272	50.56
715.	Eufalasio (eufalasio_11)	538	67.34	90.04	121	22.49
716.	Ananta (anantaraha)	538	66.58	86.50	124	23.05
717.	Chiradeep (chiradeep)	538	68.34	107.43	132	24.54
718.	fakaped (fakaped)	537	72.56	97.01	149	27.75
719.	Aviral (aviral_uchiha)	537	106.46	133.74	198	36.87
720.	Nistiarius (nistiarius)	536	85.21	122.20	134	25.00
721.	Adzenys XR-ODT (iromuanya)	536	107.47	144.95	252	47.01
722.	Away From Keyboard (AFK) (d...	536	90.70	111.32	209	38.99
723.	akirasendoh07 (akirasendoh07)	536	72.26	103.37	141	26.31
724.	Alexander (dencyh)	535	70.44	96.29	140	26.17
725.	jack (jackerdd)	534	89.17	113.78	166	31.09
726.	Howdy (abinder)	532	115.90	160.24	318	59.77
727.	michael (banane_1)	529	118.21	161.69	285	53.88
728.	Tanawat (rxrmzriw)	528	38.64	61.04	49	9.28
729.	yassin mohamed (yassin123)	528	69.57	90.63	122	23.11
730.	Eduardo (elbodrogo1977)	527	56.85	75.80	75	14.23
731.	dhikshith (dhikshith)	527	86.14	109.90	131	24.86
732.	Luke (lukell)	526	96.41	131.99	181	34.41
733.	Bobby (bton)	526	88.83	121.07	192	36.50
734.	Prithvi (prithvi18)	525	48.25	69.84	104	19.81
735.	Luke (lukeg1209)	525	55.95	73.45	73	13.90
736.	Piyush (lanslord11)	524	72.48	93.05	132	25.19
737.	parth (parthvaghela)	523	78.64	107.65	155	29.64
738.	daniel (danieledward13)	522	89.50	131.62	165	31.61
739.	Erik (vofflan)	521	71.67	89.07	119	22.84
740.	Arvin (vin_ar)	520	87.72	113.94	190	36.54
741.	Mohit (mohit2208)	520	86.95	115.51	162	31.15
742.	brahmastra (brahmastra)	520	57.86	73.44	83	15.96
743.	N (natejam)	519	120.26	182.62	347	66.86
744.	Alan (erical77)	518	75.47	100.47	125	24.13
745.	BigChungus (vynzvynz)	517	100.17	142.68	223	43.13
746.	Lucas (supermug)	517	100.02	138.14	208	40.23
747.	satwik (satwik_060)	517	89.21	127.11	175	33.85
748.	Jacque (jrobyabich)	517	64.70	87.53	107	20.70
749.	Mohammad (abdel3leam)	517	68.92	95.57	103	19.92
750.	f1_racer (f1_racer_car)	516	92.40	112.77	223	43.22
751.	AJ (jaded_aj)	516	81.82	117.90	161	31.20
752.	EatingFromTrashcan (namtrac...	515	102.75	137.40	202	39.22
753.	julsdgreat (julsdgreat)	515	68.50	92.99	127	24.66
754.	Juri (jurida)	514	73.86	106.69	110	21.40
755.	penrose (penrosecat)	513	84.85	117.05	169	32.94
756.	luz (luzyb92109)	513	48.41	76.32	62	12.09
757.	Liz (liasokol)	513	132.68	189.86	328	63.94
758.	boniu (wincentbugs)	512	84.49	122.79	151	29.49
759.	Nick (nicoboo)	511	61.26	76.56	91	17.81
760.	laPampara (lapampara69)	511	94.20	125.71	164	32.09
761.	yeeth (yeeth_)	510	94.86	126.17	169	33.14
762.	Lance (lancelot_29)	510	89.27	128.66	139	27.25
763.	Symoun (sim1ong)	510	62.05	79.45	104	20.39
764.	vatsu (nify)	508	65.08	104.74	104	20.47
765.	AcidSid009 (acidsid)	507	74.80	114.33	144	28.40
766.	tristen (unitristen)	505	87.10	103.87	163	32.28
767.	smoky_ (sahuvipul)	504	60.98	93.75	143	28.37
768.	🫐🌺Ruby (reuben_yeager)	504	91.62	121.78	158	31.35
769.	Brian (vance071)	503	70.10	96.56	118	23.46
770.	xoceankingx (xoceankingx)	502	98.68	132.58	221	44.02
771.	Nishchit (mr0bn0xi0us)	502	74.71	96.85	125	24.90
772.	Benjamin (fatjammin)	502	98.35	131.87	187	37.25
773.	Maneeb (maneebdin)	501	64.04	92.30	111	22.16
774.	Sebastian (grommonon)	501	82.31	110.37	143	28.54
775.	amoz r (amoz11)	501	109.53	145.57	227	45.31
776.	the ë (inconsistency)	500	189.99	233.65	448	89.60
777.	humisar (humisar)	500	50.65	83.11	55	11.00
778.	hereugo (hereugo)	500	91.46	125.27	177	35.40
779.	Kishan (69_420_ez)	500	43.32	69.47	92	18.40
780.	Tri Dung (phantridung123)	499	85.56	119.36	124	24.85
781.	M8l8th (glitchsolo)	499	107.99	149.00	225	45.09
782.	adderal junkie (dari0)	499	71.89	108.06	137	27.45
783.	Balmorax (balmorax)	499	75.62	101.56	141	28.26
784.	nana (goomi)	498	86.55	118.31	143	28.71
785.	aswanathck.ramesh (aswanath...	498	46.39	62.65	46	9.24
786.	Sim (simron_)	497	66.36	91.69	118	23.74
787.	mmmagalex (nonquit4ever)	497	122.87	175.93	267	53.72
788.	Jorawar (dumb_daas)	496	68.13	100.49	130	26.21
789.	Razor Red Rage (ayyaz_nemesis)	496	96.44	137.75	164	33.06
790.	Carter (thecartel)	495	100.86	131.59	201	40.61
791.	ayush (rocky1708)	495	87.18	116.52	158	31.92
792.	Shroomer (zergkiller)	494	106.84	136.90	234	47.37
793.	kentlim (lsk133)	494	64.00	83.45	109	22.06
794.	Tea (naoto7010)	494	65.84	80.97	109	22.06
795.	Maria (marlab)	492	68.26	84.60	123	25.00
796.	Jose Ortiz (jortiz1496)	492	73.34	102.32	117	23.78
797.	ⓀⒾⓃⒼⓄ (hasnatahmad)	492	113.16	155.20	282	57.32
798.	anjumaaa (zenda254)	491	86.43	124.80	150	30.55
799.	kkobuk (kkobukchipp)	490	83.09	107.87	154	31.43
800.	Cakers (pvpcakers)	489	84.04	111.14	163	33.33
801.	CARDEER (cardeer)	489	107.64	136.82	229	46.83
802.	Jimmy (zen529)	488	105.44	138.04	408	83.61
803.	Kevin (vektronic)	488	89.27	124.15	152	31.15
804.	Sssaajj (sanjisan)	488	79.77	111.07	138	28.28
805.	Évi (pinglei)	488	121.33	151.15	308	63.11
806.	Mr. (dyldodyldo)	488	93.77	119.70	168	34.43
807.	Fahad (skyclasher_24)	487	76.63	101.47	142	29.16
808.	tstats[jancs] (jancs)	487	92.67	124.22	185	37.99
809.	Duc (trungducdeptrai)	486	106.52	133.66	244	50.21
810.	Priyanshu (neo_trinity)	486	77.10	111.23	142	29.22
811.	RHell (kasiarhell)	486	58.27	79.25	73	15.02
812.	Acer (core_viper)	486	45.35	63.50	49	10.08
813.	sakhaprox (rportnoy)	485	104.72	151.12	167	34.43
814.	Gilbert (gargoyletabbi)	485	62.28	83.90	99	20.41
815.	Sebstian (sedasti)	484	73.20	96.76	121	25.00
816.	ケニー (schnitzelbr0t)	484	81.12	103.48	122	25.21
817.	Identitylessness (power_punch)	484	135.67	209.17	456	94.21
818.	Patrick (monkyoo)	484	68.04	90.91	108	22.31
819.	lelgetrekt (lelgetrekt)	484	98.15	127.27	181	37.40
820.	Jahed (jahed100)	484	101.44	122.47	264	54.55
821.	Lawrence (wattfox)	483	108.20	132.28	199	41.20
822.	Pro (pro_01)	483	35.40	49.90	41	8.49
823.	nothisisleo (leofire)	483	84.16	108.02	143	29.61
824.	Naufal (naufalmahing)	482	72.63	103.64	97	20.12
825.	Mato (matoxz)	482	85.76	118.25	156	32.37
826.	Carter (therealwhiterice)	481	96.24	149.81	183	38.05
827.	Jayson (jayson22)	481	58.16	80.73	122	25.36
828.	Theo (theodoretliu)	480	122.11	158.69	257	53.54
829.	fruit (special_vegetable)	480	111.18	145.79	214	44.58
830.	いつき (huywee)	480	89.20	142.06	134	27.92
831.	Yani (theghak)	479	58.32	84.49	86	17.95
832.	Nima (eramthgin)	478	98.21	133.44	168	35.15
833.	i'm baked af (residober)	477	163.40	213.85	260	54.51
834.	I'm slower than before :sku...	477	133.64	169.88	357	74.84
835.	Loc (loc_phan)	477	65.20	96.73	97	20.34
836.	Roadsweeper Dropping D; (ka...	476	138.53	183.12	344	72.27
837.	garry (ganesh1998)	476	75.66	95.27	134	28.15
838.	Please use an appropriate n...	476	79.68	127.43	99	20.80
839.	Vishal Mishra (firethunder2)	476	41.83	71.50	45	9.45
840.	Aryaman (aryaman_verma)	476	46.52	62.82	37	7.77
841.	Ankur (ankur94516)	476	55.32	75.25	70	14.71
842.	los (typossarevalid)	475	61.25	90.33	229	48.21
843.	csgo (professorxwing)	475	140.33	186.56	331	69.68
844.	KOSTOV (kostov)	475	59.75	87.63	87	18.32
845.	Horny (bigben223)	474	88.96	115.14	154	32.49
846.	Arnold (victorvolts_123)	473	76.05	110.59	116	24.52
847.	manthan (sixtynine_wpm)	473	52.16	77.53	252	53.28
848.	🎈bm (redly)	473	108.90	136.39	223	47.15
849.	Sachin Sharma (ragemodeon)	473	143.57	198.77	363	76.74
850.	Fierce (littlekitten7)	473	106.84	136.02	269	56.87
851.	Arun (arunro45)	473	58.13	81.44	88	18.60
852.	Rakesh (rakesh69)	472	55.40	92.05	87	18.43
853.	kalmanfilter (eran_raviv)	472	69.37	91.88	89	18.86
854.	(carlibou)	471	168.11	215.48	416	88.32
855.	enigma_mf (enigma_mf)	470	108.29	147.65	231	49.15
856.	Nick (poppyc_ck)	470	65.26	86.00	101	21.49
857.	prateek (prateekdhiman)	470	54.89	72.44	55	11.70
858.	Samuel (sammassam)	469	53.04	67.55	49	10.45
859.	Jehar (rakhunb)	469	83.93	109.73	146	31.13
860.	Liban (hujala)	469	151.52	200.60	337	71.86
861.	I play tetris too (hkgwife)	469	126.36	163.71	289	61.62
862.	you deserve to exist (charmx)	468	111.96	166.24	3	0.64
863.	Thanos (thanossonofalars)	467	68.99	99.61	105	22.48
864.	Armin (armino112)	467	48.69	62.75	40	8.57
865.	Amit (amiteshore)	466	99.43	124.76	173	37.12
866.	jek (jekkey)	465	71.67	98.76	95	20.43
867.	Fakieshot (fakieshot)	465	51.74	69.91	54	11.61
868.	Tyler (tythal)	464	97.25	130.85	188	40.52
869.	Dan (danvictor321)	464	93.71	118.95	163	35.13
870.	Sapto (saptopriyono)	462	86.53	113.79	155	33.55
871.	mike (purdah1234)	461	48.40	62.78	41	8.89
872.	drago (drag00me)	461	74.42	92.57	117	25.38
873.	CoveredInBees (coveredinbees)	461	81.93	123.19	137	29.72
874.	Julian (robthephysician)	460	73.27	99.01	108	23.48
875.	Mr.IF (mr_if)	460	74.32	98.33	122	26.52
876.	Petruccio (lolbraumm)	460	89.76	120.39	178	38.70
877.	Davis (bengalman447)	460	115.06	140.51	218	47.39
878.	Enormity (enormity_op)	459	77.13	94.31	127	27.67
879.	furci (furci)	459	71.71	97.87	105	22.88
880.	Abhay (ab_hay)	458	48.78	84.09	56	12.23
881.	Giuseppe (shmebulock2)	457	84.97	123.86	171	37.42
882.	Stevne (juninight29)	457	77.01	94.28	80	17.51
883.	gojo (gojo9112)	457	71.52	90.00	111	24.29
884.	. (chocolatina)	456	135.90	190.73	297	65.13
885.	Claudia (aaaaccdillruyz)	456	63.46	79.59	100	21.93
886.	NextGoal Avg. 115WPM (redjhon)	455	87.33	123.02	162	35.60
887.	zero2 (deadz)	455	33.32	47.92	40	8.79
888.	Aisha (aishanick)	455	60.73	88.76	68	14.95
889.	Mikhail (mayham92)	454	77.14	99.85	117	25.77
890.	Lin (lin_ming)	454	100.70	128.79	190	41.85
891.	eric (ericliu04)	454	107.12	133.41	25	5.51
892.	Ω (tunfisk)	453	124.36	169.71	250	55.19
893.	satya (satya1110)	453	64.15	88.47	104	22.96
894.	Bakhtiyar (bakhtiyar17)	453	58.26	72.73	75	16.56
895.	Hossain (hossain95)	452	43.69	62.06	42	9.29
896.	Smelly (burdturglar)	452	81.09	98.74	127	28.10
897.	jia kang (awjack)	452	54.28	71.06	60	13.27
898.	Diepday (linhleo372)	451	77.85	105.99	130	28.82
899.	Jonatan (gustesmil)	451	104.95	148.46	198	43.90
900.	road to 170WPM (royaljaat)	450	104.43	145.45	285	63.33
901.	kunal (kunav)	450	77.59	106.05	123	27.33
902.	Jeannie (jeanniejackson)	450	63.05	86.56	102	22.67
903.	James (icecrusher)	450	88.66	125.10	144	32.00
904.	Andrew (xj04129)	449	91.04	112.85	155	34.52
905.	bowlingfan21317 (bowlingfan...	449	91.85	120.33	179	39.87
906.	Domen (antreu)	449	99.40	139.81	246	54.79
907.	abdullah (abdullah3325569)	449	47.65	68.71	50	11.14
908.	mlhhsid (mlhhsid)	448	101.52	120.29	178	39.73
909.	Marlon (mgr47)	448	66.17	88.02	105	23.44
910.	Brian (brainclash)	448	69.81	104.54	108	24.11
911.	Simiwag (simiwag)	447	94.52	134.21	156	34.90
912.	Luigi (jorge_da_borracha)	447	101.80	152.34	218	48.77
913.	rrono (3an_3an)	447	67.85	97.43	149	33.33
914.	wilmanbarrios (wilmanbarrios)	446	67.31	90.42	88	19.73
915.	Jay (kov_)	446	71.60	109.40	102	22.87
916.	Charles (n6w2)	446	48.15	64.46	31	6.95
917.	taj (taj256)	445	84.46	111.75	106	23.82
918.	Serjs (sedoy)	445	18.10	28.68	92	20.67
919.	Radamasz (madarasz)	445	82.51	104.80	116	26.07
920.	Jacob (jacob_dev)	445	51.09	66.44	36	8.09
921.	Dragon99999 (dragon99999)	444	86.35	118.84	139	31.31
922.	HasadBoii (hasadboii)	443	58.75	79.65	228	51.47
923.	something (kaibaboi)	442	131.14	171.34	47	10.63
924.	Vinny (bullz3y3)	442	53.14	69.73	55	12.44
925.	MAF1F (afif5287)	442	54.69	70.66	61	13.80
926.	nyet (slickman)	441	79.18	102.59	109	24.72
927.	Slatt. (nonquitpracticing)	441	129.96	181.44	276	62.59
928.	Nanar (nanarboursal)	441	64.45	93.36	91	20.63
929.	Moy (moy280)	441	102.84	134.96	159	36.05
930.	Me (i_believe_i_can_type20)	441	67.30	104.12	110	24.94
931.	FixioMG (fixio)	441	68.26	87.61	103	23.36
932.	komi (rahul_kumayan)	440	64.53	95.31	111	25.23
933.	MINH (shinmyou)	439	105.52	137.03	189	43.05
934.	Unique (netb)	439	73.33	108.57	102	23.23
935.	theo (mewtish)	439	81.49	108.53	115	26.20
936.	thanos (thanosmpath)	438	109.78	134.83	205	46.80
937.	Sun (headedead)	438	96.86	124.04	170	38.81
938.	(c_xor)	438	131.90	179.93	293	66.89
939.	Chaitanya (chaitanya608)	438	69.87	88.03	97	22.15
940.	Jesse (sarrod)	437	94.65	128.76	152	34.78
941.	Amelia (piclo7)	437	86.08	117.08	145	33.18
942.	Magishian (magishian)	437	61.57	103.97	117	26.77
943.	Free (just_free2318)	437	63.68	89.68	93	21.28
944.	mooshi (mooshidv)	437	58.47	78.18	61	13.96
945.	Tovic (todave)	436	48.28	63.56	39	8.94
946.	Piotr (snooppiotr)	436	81.71	104.07	93	21.33
947.	Lasi (lasileuka)	436	87.57	110.10	141	32.34
948.	Rockodile (rockodile)	435	110.11	137.95	198	45.52
949.	🌄youtube.com/watch?v=Sa5...	435	158.71	203.40	372	85.52
950.	andy (ajggormly)	435	79.62	105.99	112	25.75
951.	Chris (chris_p)	434	68.80	86.81	113	26.04
952.	batbaven (baislow)	434	47.99	62.51	42	9.68
953.	vbk (vbk_)	433	45.78	65.26	44	10.16
954.	Igor (skeef79)	433	103.88	130.35	210	48.50
955.	Johny (johnyt)	433	60.15	88.77	81	18.71
956.	Person (improbhighnotgonnalie)	433	103.08	137.22	187	43.19
957.	guy (grayeyes)	433	143.11	179.37	319	73.67
958.	vamshidhar (vamshidhar18)	432	59.30	84.00	87	20.14
959.	Radriar (slowtype_e)	432	57.84	78.83	62	14.35
960.	Anshuman (anshu_8)	431	58.72	79.48	78	18.10
961.	soldano (soldano)	430	106.92	139.05	205	47.67
962.	Pyren (pyren83)	430	89.29	113.01	136	31.63
963.	(dispidi)	430	130.75	179.62	287	66.74
964.	Toxic (toxicbaby3000)	429	70.76	101.95	103	24.01
965.	Mahmoud (sayed1)	429	85.31	106.58	106	24.71
966.	Kianoosh (kia_wp)	429	82.51	107.36	121	28.21
967.	Harry (harry_k)	429	80.77	118.63	110	25.64
968.	why (believeable)	429	106.84	178.19	203	47.32
969.	hunzai (alihunzai)	429	97.20	135.81	156	36.36
970.	andrei5 (mute_6)	428	78.15	107.63	110	25.70
971.	gaitonde (gaitonde)	428	65.79	88.42	93	21.73
972.	reuben (reuben_elias)	427	53.50	75.62	48	11.24
973.	discord# unsalek (mustafa_r...	427	86.18	112.91	123	28.81
974.	Ben (foereaper4k)	427	78.76	108.34	89	20.84
975.	Prydae (prydae_1)	426	79.54	125.78	109	25.59
976.	GodSped (falsender)	426	79.07	115.22	108	25.35
977.	Ivan (blindingangel)	426	109.16	141.70	238	55.87
978.	mr (buabaiban)	426	39.30	52.21	33	7.75
979.	Mark (ziggle)	425	61.27	85.42	78	18.35
980.	WhatTheHotDog (tdsar102094)	425	90.67	122.65	145	34.12
981.	Jake (laketype)	425	62.73	84.26	73	17.18
982.	Pablo (p1blis81)	424	77.99	113.98	97	22.88
983.	how to type (iwanna_typefast)	424	122.33	164.47	214	50.47
984.	Cep (alhabiblidinillah)	424	81.71	100.26	99	23.35
985.	JM (tuftycrayfish)	423	73.59	94.14	103	24.35
986.	Nobu (nobunakamura)	423	83.54	112.28	142	33.57
987.	himanshu (himanshu3198)	423	50.95	71.44	51	12.06
988.	Senpai Z (zlashers)	422	72.53	94.19	100	23.70
989.	Poo (pooopooo)	422	93.68	124.00	113	26.78
990.	weird_virus (imsajan)	422	64.00	89.54	86	20.38
991.	Jay kay (imnoob167)	422	39.27	56.91	26	6.16
992.	Dulguun (dulguun_)	422	82.25	117.37	120	28.44
993.	Alan (alan2406)	422	66.06	92.54	84	19.91
994.	MaxVerstappen33 (newrookie15)	421	75.40	116.69	123	29.22
995.	Karrrrtik (kartikkkk)	421	54.26	79.03	112	26.60
996.	Sonu (intellectualcreatures)	421	89.56	119.21	157	37.29
997.	Ayush (improve_buddy)	421	55.51	76.44	84	19.95
998.	Ibexus (ibexus)	421	164.27	208.60	388	92.16
999.	J (yunatan)	420	80.45	106.63	141	33.57
1000.	Ben (thebenman7dv)	420	59.36	82.27	52	12.38
1001.	Shashi (shashianand230)	420	45.54	61.30	51	12.14
1002.	Mohammad (mr_loooop)	420	82.96	109.89	106	25.24
1003.	Ladybug (lady_bug_)	420	56.34	73.43	64	15.24
1004.	Fang (fangalpha)	420	80.15	113.36	112	26.67
1005.	Optimus (optimusprime98)	419	72.97	90.55	104	24.82
1006.	khalil (khalilfa)	419	72.55	99.04	99	23.63
1007.	Ahmad (vectors_master)	418	66.50	95.59	83	19.86
1008.	SPQR (tringuyen29)	418	79.21	108.89	99	23.68
1009.	Crew (crewmate_sus)	418	117.22	159.37	224	53.59
1010.	Guest (ksaheb)	417	30.90	44.11	36	8.63
1011.	Sumeru_ (kenteezyx)	417	93.48	126.43	159	38.13
1012.	_____ (husixu1)	417	106.91	134.04	177	42.45
1013.	artist (apg21092002)	417	62.26	85.03	75	17.99
1014.	Maria (ladymariag)	417	86.47	109.08	126	30.22
1015.	Shriram (shrirammc55)	416	93.37	117.02	146	35.10
1016.	Mark (pap1)	416	65.19	88.03	103	24.76
1017.	Sian-Yang (rgnerdplayer)	415	115.13	145.78	229	55.18
1018.	Jerry_007 (jerry_007)	415	30.54	42.91	27	6.51
1019.	R (tumta)	414	68.71	96.67	97	23.43
1020.	Dale (livestrong12)	414	114.66	145.30	221	53.38
1021.	batbold (bb__)	412	107.80	154.85	193	46.84
1022.	Zeep (zeeppt)	411	82.85	100.87	95	23.11
1023.	Mandem (madem)	411	71.04	120.82	115	27.98
1024.	🅹🅰🆅🅴 (killer8hy...	411	105.94	143.49	183	44.53
1025.	Jiong Yang (yangfoo)	410	95.30	124.14	179	43.66
1026.	Nick (cvs_nick)	410	70.04	100.42	96	23.41
1027.	Weebmachine (weebmachine)	409	79.08	99.41	91	22.25
1028.	पलविंदर स�...	409	112.24	140.54	230	56.23
1029.	(๑•﹏•)⋆* ⁑⋆* ...	408	81.12	107.74	110	26.96
1030.	Razor (mr6pack)	408	63.88	83.35	70	17.16
1031.	aman (amanrai2802)	408	62.02	87.08	107	26.23
1032.	Ngoune (tyrex1)	407	74.04	100.87	97	23.83
1033.	Soirstylo (soirstylo)	407	80.19	101.00	134	32.92
1034.	xd (palmate)	407	77.49	108.63	110	27.03
1035.	sun (ny_dkxh)	407	72.01	98.09	124	30.47
1036.	uwu (mr_mint)	407	81.26	113.39	124	30.47
1037.	me_astr (me_astr)	407	59.18	78.75	79	19.41
1038.	Alekva (alekva)	407	73.62	98.37	104	25.55
1039.	Stop (stop__)	407	47.84	63.38	37	9.09
1040.	Vivek (vivektarun1234)	406	29.35	44.08	49	12.07
1041.	Onu Kajita (torek87)	406	109.76	145.81	287	70.69
1042.	sskhynix (sskhynix)	404	104.61	136.54	199	49.26
1043.	sayed (sayedeesam)	404	44.72	58.89	42	10.40
1044.	parham (parhamparsa)	404	43.12	66.08	46	11.39
1045.	Murad (memento_mori_s)	404	53.95	75.11	51	12.62
1046.	Anas (anasghawanmeh)	404	33.38	44.10	21	5.20
1047.	Adil (adisan_lc)	404	60.08	84.64	74	18.32
1048.	Abhay Shukla (abhayshukla)	404	27.42	41.46	69	17.08
1049.	Yohannes (wintersolider)	403	62.01	90.83	91	22.58
1050.	Vaj (taychee)	403	75.40	105.23	105	26.05
1051.	Brian (taters613)	403	97.05	121.81	145	35.98
1052.	Ayong (larrylarogapro)	403	103.03	139.09	179	44.42
1053.	jeremy_bearimy (jeremy_bear...	403	92.36	114.17	147	36.48
1054.	Dilan (carnage2)	403	83.91	132.76	127	31.51
1055.	♥ W typegg.io (boundaries)	403	148.18	222.61	5	1.24
1056.	Munir (munirgkm)	402	88.46	116.12	135	33.58
1057.	Jordan (js_jordan)	402	71.60	107.02	87	21.64
1058.	Amendity (amendity)	402	80.87	103.31	104	25.87
1059.	Adrem (akratic_adrem)	402	84.30	119.87	113	28.11
1060.	Go (gomar3n)	402	66.94	88.79	89	22.14
1061.	D (javieday)	402	40.27	61.33	33	8.21
1062.	pouya (pooyamz)	401	61.37	89.60	79	19.70
1063.	Pavan (pavantyperacer)	401	79.15	104.92	110	27.43
1064.	Hanny (monson312)	401	84.64	111.60	128	31.92
1065.	Guest (catg0ty0urlung)	401	111.00	137.13	219	54.61
1066.	Yuji (yujixyuji)	400	72.50	95.07	109	27.25
1067.	Shuyu (stevenqi)	400	94.02	129.09	149	37.25
1068.	damList (damanthm)	400	85.28	114.45	119	29.75
1069.	Allan (allandallon)	400	101.55	131.59	176	44.00
1070.	Adam (adam2002)	400	88.50	112.54	104	26.00
1071.	Sami Wilf (samiwilf)	399	106.42	139.17	180	45.11
1072.	Eetu (mandarilleri)	399	84.39	116.75	96	24.06
1073.	Irfan (irfan_is_the_best)	399	62.99	78.00	85	21.30
1074.	Dylan (dr_gammaray)	399	139.68	173.28	282	70.68
1075.	John (xxcooldudexx)	398	107.26	144.22	179	44.97
1076.	a (oimanquan)	398	104.68	139.10	194	48.74
1077.	Nivan (nivanr06)	398	86.47	117.26	95	23.87
1078.	KnightWithSword (mishras839...	398	63.17	89.46	68	17.09
1079.	Cxlt (fujimaaa)	398	85.41	117.00	133	33.42
1080.	Pedro (pedro5370)	397	91.92	124.80	132	33.25
1081.	Kotaro (kotaro_qwerty)	397	84.73	108.81	114	28.72
1082.	Ocean (oceanlim)	396	109.58	165.26	190	47.98
1083.	ILOVEPALESTINE (iamslow103)	396	145.03	217.38	367	92.68
1084.	john (typeman_1234)	395	66.74	93.52	89	22.53
1085.	MavrosOplarxigos (oplarxigos)	395	74.79	91.21	137	34.68
1086.	Rakib (rakib0hasan)	394	38.27	49.24	23	5.84
1087.	Luke (outlandish)	394	93.95	115.22	138	35.03
1088.	Louie (lewieee)	394	114.23	147.34	228	57.87
1089.	Godrod (god_of_rods)	394	87.57	111.22	111	28.17
1090.	Cheechu (cheechu)	394	85.49	114.06	113	28.68
1091.	MasterZero (mastrzero)	394	35.67	54.41	26	6.60
1092.	Ryzen (ryzen___)	394	38.16	49.71	20	5.08
1093.	Kipper (ziuncati)	393	58.87	78.11	68	17.30
1094.	Will (greggaz)	393	94.69	132.09	144	36.64
1095.	Dio (slado122)	392	85.80	108.63	130	33.16
1096.	Nick (neepwithin)	392	88.28	108.08	150	38.27
1097.	Lewis (lewisisabo)	392	72.77	98.70	89	22.70
1098.	Wanderer (hassanese)	392	56.29	80.33	51	13.01
1099.	Ai (aibah)	392	74.98	107.26	108	27.55
1100.	Zovi (zovi)	391	89.19	118.74	114	29.16
1101.	Glen (alabaster45)	391	46.16	60.31	34	8.70
1102.	Re4per (light_exe)	390	56.83	77.25	62	15.90
1103.	H!P! (harsh_patel)	390	55.66	75.09	54	13.85
1104.	me slow (brandon69eduardo)	390	104.61	131.78	178	45.64
1105.	baby (babyshadow)	390	62.30	85.03	91	23.33
1106.	Amaury (raymaunet)	389	52.08	66.21	30	7.71
1107.	jim (pstengyawa)	388	87.20	120.04	133	34.28
1108.	Mooshi (mooshiboy_dvorak)	388	89.61	118.19	104	26.80
1109.	Ian (iyaan)	388	68.45	89.20	101	26.03
1110.	seven (seven_mark)	387	78.60	98.33	94	24.29
1111.	Rage (ragelad)	387	62.18	101.17	73	18.86
1112.	BonTear (b0ntear)	387	68.69	94.17	88	22.74
1113.	1_Death (1_death)	387	48.05	65.71	45	11.63
1114.	Ahead of you (wadehuangjr)	386	95.19	120.04	145	37.56
1115.	Tom (polaricecaps)	386	69.28	98.69	103	26.68
1116.	Noah (lorenpike)	386	70.20	93.60	75	19.43
1117.	Andy (djentalman)	386	90.92	124.90	129	33.42
1118.	Matteo (atteo1000)	386	63.16	101.09	79	20.47
1119.	sara (sara1994)	385	40.25	51.56	27	7.01
1120.	Himanshu (himsingh11)	385	41.18	65.23	33	8.57
1121.	(welltwell)	384	133.70	177.19	279	72.66
1122.	Jemma (jmmstvnsn)	384	84.07	106.19	93	24.22
1123.	eagle (e4gle)	384	66.33	84.30	98	25.52
1124.	chris (fscj4raxhel)	383	70.83	93.52	77	20.10
1125.	ccct (fastleopard)	383	49.80	67.92	45	11.75
1126.	Betting (buffhorse_)	383	67.27	90.37	73	19.06
1127.	quack (shinonin)	382	145.05	166.00	287	75.13
1128.	Lei Paul (polley)	382	92.60	119.63	131	34.29
1129.	meiol (olete)	382	59.78	72.14	67	17.54
1130.	Ben (caaakeeey)	381	77.28	101.82	103	27.03
1131.	iChoke@TheEnd (vidivinci)	380	75.64	101.99	102	26.84
1132.	Funeral Party (scudvirus2018)	380	65.81	83.94	76	20.00
1133.	robbie (robbiemcfly)	380	90.16	120.28	132	34.74
1134.	Mikaela (mikaela_e)	380	77.74	105.39	99	26.05
1135.	Mukeem (bilawat)	380	90.22	119.14	155	40.79
1136.	. (apeninspaaace)	380	95.34	123.10	147	38.68
1137.	an4rchy1925 (an4rchy1925)	380	90.57	130.90	137	36.05
1138.	Alex (tabkc7)	379	81.09	102.66	87	22.96
1139.	Aashish (albatross007)	379	64.34	87.17	83	21.90
1140.	DemonKing (zxzf)	378	53.43	69.03	53	14.02
1141.	Gabriel (wdarknessw)	378	80.62	103.25	103	27.25
1142.	Nick (nidzoni)	378	103.77	131.82	178	47.09
1143.	George (linnypurple)	378	86.31	108.75	112	29.63
1144.	PMA (huy2272)	378	82.36	110.46	118	31.22
1145.	OmicronVirus (deathisnthend)	378	75.83	96.49	92	24.34
1146.	(daniel598)	378	155.48	205.79	308	81.48
1147.	Afterlife (afterlife71)	378	40.47	52.78	31	8.20
1148.	raz🐢 (razman)	377	110.44	145.03	173	45.89
1149.	Raffa (raffadanendraa)	377	62.67	86.98	76	20.16
1150.	Peter (portiz121803)	377	80.26	114.51	77	20.42
1151.	Heet (heetpatel219)	377	58.42	74.57	78	20.69
1152.	Derek (thenyaz)	376	96.46	119.13	144	38.30
1153.	Human (supertypergrey)	376	60.62	88.02	59	15.69
1154.	han (stuckinatimezone)	376	67.35	93.54	98	26.06
1155.	prashik0 (prashik0)	376	76.08	113.73	106	28.19
1156.	Kimmo (kimorasa)	376	82.82	105.76	92	24.47
1157.	kaitlyn (katieostrander)	376	83.20	111.33	82	21.81
1158.	Gaurav (absurd_man)	376	70.44	93.32	96	25.53
1159.	Nick (wugangabbot)	375	61.97	80.29	81	21.60
1160.	S (suhaib_silwadi)	375	73.52	100.38	104	27.73
1161.	Marko (polarbear1229)	375	100.84	132.74	147	39.20
1162.	phauxy (phauxy)	375	68.32	91.33	103	27.47
1163.	khalid (khalidabououalid)	375	73.11	102.63	109	29.07
1164.	Cuong (c_nguyenthien)	375	95.84	118.83	144	38.40
1165.	Neon (neonman6)	374	46.68	68.65	50	13.37
1166.	Demogorgon (typeracer0110)	373	67.27	98.13	91	24.40
1167.	HotClaw (hotclaw)	373	96.72	121.41	160	42.90
1168.	Zexceed (shorif)	372	92.57	155.25	177	47.58
1169.	Smudge (cuteboi)	372	117.55	161.05	202	54.30
1170.	Arin (arinkothari)	372	67.23	90.90	76	20.43
1171.	Mez69 (mezx69)	371	73.20	96.28	84	22.64
1172.	Neel (jydoenwat)	371	66.17	88.00	76	20.49
1173.	It'sMe (freakinnickp)	371	109.29	141.27	173	46.63
1174.	SnopeySnope (snopeysnope)	370	63.28	91.58	86	23.24
1175.	Dolce (dolceparadise)	370	88.53	125.77	126	34.05
1176.	em (akosiem)	370	92.01	124.46	111	30.00
1177.	Nithin (useless_net)	369	99.80	147.25	163	44.17
1178.	Isaac (newton6674)	369	83.12	101.65	94	25.47
1179.	Chatpisut (uwu_werkmaine)	368	85.97	113.42	113	30.71
1180.	alostman (slowtypist199)	368	134.61	170.94	214	58.15
1181.	Zephyr (lay_oreo)	368	93.68	131.18	120	32.61
1182.	delfan (delfaaan)	368	88.91	113.30	118	32.07
1183.	NickyPP (weenniecat)	367	82.49	117.47	118	32.15
1184.	NecroCW (necrocw)	367	81.66	109.46	107	29.16
1185.	Mehti (lylehti)	367	84.64	113.21	96	26.16
1186.	Wali (captorcarbon)	367	74.07	102.29	103	28.07
1187.	Jeremiah (wetsock625)	367	53.26	69.40	39	10.63
1188.	david (twistybaer)	366	70.65	94.23	70	19.13
1189.	Scopic (scopic)	366	97.95	117.10	128	34.97
1190.	Lucas (lukasyoi2)	366	71.08	103.01	121	33.06
1191.	Jack (jfragg)	366	77.78	110.28	73	19.95
1192.	Maneesh (silentplayz5672)	365	59.02	75.70	67	18.36
1193.	Puri (narthar)	365	78.26	113.10	104	28.49
1194.	Mahmood Thompson (mat_i)	365	115.94	155.42	209	57.26
1195.	Carlos (lufnys)	365	77.03	121.66	88	24.11
1196.	Jadon (j20lardo06)	365	77.48	98.73	81	22.19
1197.	3NKRYPT (3nkrypt)	365	54.76	77.62	38	10.41
1198.	kuzz (kuzz)	365	74.94	93.41	78	21.37
1199.	Not_Stable (not_stable)	364	81.52	123.08	121	33.24
1200.	Mega (mega_mushroom)	364	75.87	99.28	83	22.80
1201.	Nguyễn Trần (dattran03)	363	86.39	110.96	115	31.68
1202.	Curly (curly98)	363	57.37	77.64	58	15.98
1203.	byron (bozzarf)	363	75.94	99.43	104	28.65
1204.	andrew (washedtyper)	362	93.31	116.39	150	41.44
1205.	Smulca (vicker)	362	61.71	84.40	99	27.35
1206.	lol (lolspedicey)	362	83.17	121.19	109	30.11
1207.	Gilbernet (gilbertonava7)	362	52.48	66.62	31	8.56
1208.	Glennis (biotic_god)	362	84.65	117.43	90	24.86
1209.	Jae (jaeha99)	362	64.01	94.10	84	23.20
1210.	v1step (v1ztep)	361	68.32	95.38	54	14.96
1211.	Phish (phishphishphish)	361	109.30	136.14	165	45.71
1212.	iglo3141 (iglo3141)	361	72.94	98.38	110	30.47
1213.	grace (graceneufeld)	361	78.52	101.20	167	46.26
1214.	Mazin (mmazincham)	360	81.50	101.33	73	20.28
1215.	Omer (omer_nukic)	359	59.60	81.13	70	19.50
1216.	himuman (ignis_05)	359	57.11	84.67	78	21.73
1217.	Connor DVORAK (deepwaterbus)	359	83.14	116.59	101	28.13
1218.	~ (katana4teen)	358	61.06	83.59	84	23.46
1219.	Declan (dg05)	358	76.89	103.23	83	23.18
1220.	Rick Astley (beardybeardy)	358	84.81	115.83	88	24.58
1221.	16/f/cali (ultrashibe)	357	131.80	171.33	233	65.27
1222.	George (tormanovi)	357	75.32	96.30	83	23.25
1223.	An (ntan1210)	357	88.46	135.77	119	33.33
1224.	Aaron (heckndarn)	357	73.38	94.06	81	22.69
1225.	Curl2908 (curl2908)	357	49.01	64.90	37	10.36
1226.	Benjin (benjin7)	357	71.68	101.08	71	19.89
1227.	JheMee (ayyjhey)	357	63.23	87.78	68	19.05
1228.	Speed_Reader (nagy_ssbm)	356	84.35	110.01	92	25.84
1229.	l502x (l502x)	356	108.64	136.01	160	44.94
1230.	bhautik (bhautik0126)	356	40.90	60.91	29	8.15
1231.	Alan (alan001)	356	75.18	101.81	82	23.03
1232.	DH (deeh_c)	355	81.03	109.85	107	30.14
1233.	つべ (tube_jp)	354	58.19	84.85	45	12.71
1234.	Eric (thicc_ricc)	354	112.07	145.63	160	45.20
1235.	i can't be asked (perfectio...	354	107.35	145.13	165	46.61
1236.	Kacsa (kacsa_janos)	354	45.90	67.84	39	11.02
1237.	Tom (ax99)	354	51.25	75.45	31	8.76
1238.	abs0lutz3r0c007 (abs0lutz3r...	354	84.58	105.74	83	23.45
1239.	Sumit (sumit_ghag)	353	91.32	130.18	122	34.56
1240.	Adrian (dinfus)	353	109.18	140.43	191	54.11
1241.	Evan (__evab__)	352	83.74	113.47	88	25.00
1242.	typsterr (typsterr)	352	51.06	70.21	32	9.09
1243.	timtam420 (timtam420)	352	80.67	107.20	86	24.43
1244.	K (strongballs)	352	81.63	125.00	107	30.40
1245.	addy (epicshibexd)	352	102.79	131.79	154	43.75
1246.	AngelCaveGTI (angelcavegtio...	352	88.69	121.31	107	30.40
1247.	Ryan (ryan2723)	351	75.02	92.49	55	15.67
1248.	Ibrahim (ibrahimtyper)	351	115.12	142.41	173	49.29
1249.	Alaa Awamleh (alaa_awamleh)	351	68.29	87.28	104	29.63
1250.	Simon (wizard_sheep)	350	90.68	127.80	116	33.14
1251.	Felix (metr_x)	350	49.89	63.73	35	10.00
1252.	Invnty (invnty)	350	37.80	53.12	21	6.00
1253.	Zakaru (gaudo1991)	350	79.07	99.87	80	22.86
1254.	Sudip (donda)	350	70.82	97.84	83	23.71
1255.	Daniel (danielpaanderson)	350	72.92	93.82	66	18.86
1256.	Sadat (based_chungus)	350	77.05	101.30	95	27.14
1257.	Arnaud (armatt)	350	81.92	106.17	104	29.71
1258.	Dusan (dusan01)	350	59.47	84.12	65	18.57
1259.	typerinfection (z4k1n470r)	349	74.75	107.61	76	21.78
1260.	Marek (lypa)	349	103.78	125.50	167	47.85
1261.	Andrew (holocene_learning_d...	349	46.94	70.28	38	10.89
1262.	Duncan (dkbrk)	349	116.06	138.06	178	51.00
1263.	D (consumption)	349	80.32	104.62	92	26.36
1264.	xSora (xsora)	348	114.54	155.76	220	63.22
1265.	Vincent (vincexodus)	348	56.51	76.11	52	14.94
1266.	L (thereddone)	348	76.26	96.47	78	22.41
1267.	Marvin (partass)	348	70.78	89.22	85	24.43
1268.	Cray (kweikwei)	348	73.47	86.68	89	25.57
1269.	Helena (helenaa_26)	348	46.92	65.21	41	11.78
1270.	Taras (gavair)	348	59.35	75.10	59	16.95
1271.	🍉 Palestine Will be Free...	348	110.30	171.84	283	81.32
1272.	Dowon (dowon)	348	155.29	193.47	298	85.63
1273.	ChimChimChim (chimchimchim)	348	124.49	150.62	208	59.77
1274.	Aarvaan (aarvaan)	348	55.82	76.10	47	13.51
1275.	Sarvjot (sarvjot42)	348	73.85	97.36	86	24.71
1276.	Suren (strongsuren)	347	92.44	127.36	94	27.09
1277.	ニシャント (neokun)	347	60.38	81.30	66	19.02
1278.	Mike (kb_acolite99)	347	55.42	79.45	45	12.97
1279.	chunky (wbcracer)	346	117.42	143.58	199	57.51
1280.	ravi (sravi4701)	346	77.08	100.40	78	22.54
1281.	dav (candyslug)	346	115.94	148.21	160	46.24
1282.	Bharat Rai (bratrai11)	346	28.91	38.73	37	10.69
1283.	Salmon (pillowend)	345	110.97	151.27	181	52.46
1284.	yoyokeepitup (keepitup)	345	97.10	129.84	131	37.97
1285.	m (xxxaliaxxx)	344	87.00	106.02	94	27.33
1286.	🇲🇬 Rina (rina23)	344	104.18	154.58	177	51.45
1287.	Văn (pqvan20)	344	66.68	87.03	90	26.16
1288.	Evelyn (evline)	344	70.66	86.98	85	24.71
1289.	Caxix (caxix)	344	63.21	81.84	72	20.93
1290.	Gajendra (techgajen)	343	48.36	66.84	40	11.66
1291.	Son (memorrick)	343	80.86	101.31	96	27.99
1292.	George (zorkkins)	342	64.79	82.91	69	20.18
1293.	Veniax (veniax)	342	57.32	87.76	64	18.71
1294.	Praggapan (silentmachine)	342	71.03	97.40	90	26.32
1295.	Mudu (muduxd)	342	53.00	70.03	38	11.11
1296.	vaibhav (vaibhav6996)	341	80.17	101.41	196	57.48
1297.	Momen (momenarafa)	341	63.23	84.52	79	23.17
1298.	Will (freewillie18)	341	77.64	110.09	90	26.39
1299.	ahiraj (ahirajsingh)	341	19.98	32.62	43	12.61
1300.	s'gettifingers (spaghetti_f...	340	65.19	82.46	83	24.41
1301.	Jean (seawardsalmon6)	340	93.08	115.38	130	38.24
1302.	Preston (prestonsteffenjr)	340	41.55	50.69	15	4.41
1303.	nilansh (pralaya)	340	96.59	121.04	188	55.29
1304.	Neko (pippaola)	340	91.87	126.40	108	31.76
1305.	Robert (nforcer)	340	91.16	117.96	116	34.12
1306.	LogicBS (logicbs)	340	62.16	84.02	72	21.18
1307.	Elo (eloh)	340	74.88	94.57	80	23.53
1308.	:)) (brokenslowhand)	340	110.64	143.75	171	50.29
1309.	allan (zhangerbanger)	339	122.82	154.71	198	58.41
1310.	Iliya (hichkas_01)	339	47.53	69.09	39	11.50
1311.	(dragusprime)	339	117.43	152.77	178	52.51
1312.	Bun (bunnypuc)	339	55.88	79.53	57	16.81
1313.	Eric (ericnosarcasm)	338	75.11	99.88	82	24.26
1314.	Damon (damonc89)	338	90.35	115.63	93	27.51
1315.	Biggus (biggboii18)	338	87.51	117.49	94	27.81
1316.	Timothy Tiew (timothytiew123)	337	109.80	142.59	157	46.59
1317.	Sam (samandthefourdogs)	337	66.48	96.26	73	21.66
1318.	ROG (roggy)	337	64.37	84.70	72	21.36
1319.	emna (em203)	337	60.60	73.33	60	17.80
1320.	khalid (khalidoo17)	337	51.25	70.65	39	11.57
1321.	Karl (xillionpro)	336	87.26	121.99	105	31.25
1322.	Vilmer (vien0701)	336	83.93	108.01	104	30.95
1323.	R (rc_da)	336	62.61	79.40	46	13.69
1324.	Ⓐⓝⓣⓞⓝ (racingisaw...	336	90.21	131.35	159	47.32
1325.	Fangio (fangio)	336	79.11	98.48	73	21.73
1326.	Lei (alnadnetrox)	336	88.66	117.22	120	35.71
1327.	Macy (macylace)	335	71.07	95.60	81	24.18
1328.	A.H.M. (arceen)	335	82.78	102.85	83	24.78
1329.	Olav (thederpygod)	334	90.27	123.20	90	26.95
1330.	Chathur (grandesonnerie)	334	96.95	142.25	130	38.92
1331.	Guest (superman_ha_ha)	333	76.52	108.40	80	24.02
1332.	nimitz (nimitzpro)	333	92.34	119.17	127	38.14
1333.	Dominic (mickeyice3)	333	74.64	94.43	85	25.53
1334.	Kian (kian32)	333	44.63	56.51	41	12.31
1335.	B (bsauter29)	333	89.88	118.34	109	32.73
1336.	alex (alex3213213)	333	94.98	134.95	127	38.14
1337.	Rikki (rikki_leo)	332	86.98	118.22	101	30.42
1338.	- (ndca)	332	50.53	70.75	36	10.84
1339.	🤝🤝 (joejiunn)	332	92.68	116.79	106	31.93
1340.	Adrian (adrianc04)	332	93.75	120.00	89	26.81
1341.	AbdulQader (abdulqader)	332	74.38	95.49	75	22.59
1342.	yourfav (imyofav)	332	43.79	62.26	30	9.04
1343.	tstats[totet] (totet)	331	68.83	89.30	67	20.24
1344.	eric (ericpr)	331	71.92	98.26	80	24.17
1345.	I love my thicc girlfriend ...	331	149.63	231.98	244	73.72
1346.	Sam (sam77777)	330	80.52	101.75	75	22.73
1347.	Austin (quanglamtran346)	330	73.10	91.16	91	27.58
1348.	Keima (lereias_1)	330	67.41	89.92	77	23.33
1349.	meow (catnoodles)	330	93.43	124.88	119	36.06
1350.	Blunt (blunt_machete)	330	67.66	92.10	67	20.30
1351.	tstats[pervez1020] (pervez1...	329	47.90	62.58	39	11.85
1352.	Moaz (mo3adh)	329	67.67	95.42	64	19.45
1353.	Faiq (faiq_lak)	329	63.01	93.11	75	22.80
1354.	Ryan (carefullyslow)	329	102.53	132.54	153	46.50
1355.	Artiur (artursaliyev)	329	41.33	59.03	29	8.81
1356.	Kickass (vivekvikysharma)	328	60.40	79.05	61	18.60
1357.	Jackson (neatoburrito)	328	73.44	109.38	89	27.13
1358.	Mostafa (m2a_nj)	328	46.51	62.79	35	10.67
1359.	Zak (zak_roger)	327	88.01	109.38	113	34.56
1360.	small (smalllittlesheep)	327	66.35	87.34	70	21.41
1361.	Captain (scrubwrecker666)	327	83.04	107.18	95	29.05
1362.	manthan (manthan123)	327	62.17	83.55	71	21.71
1363.	Liu (jazzkey)	326	92.81	112.40	129	39.57
1364.	pärskis (borje)	326	76.06	97.48	83	25.46
1365.	sdagsad (asvasdba)	326	74.19	100.78	119	36.50
1366.	XanderManCan (tacticaltoast)	325	73.35	94.52	71	21.85
1367.	Ridoy Chandra Dey (rkprite09)	325	63.21	82.07	64	19.69
1368.	Ed (raptorofli)	325	96.48	129.30	129	39.69
1369.	Shoemaker-Levy 9 (atthetop)	325	161.64	231.45	227	69.85
1370.	Iron Man (007_speed)	325	86.55	107.41	116	35.69
1371.	Emma (emma_boy)	325	50.46	72.04	36	11.08
1372.	Sumanta (sumanta001)	324	54.84	75.46	45	13.89
1373.	A (suleil)	324	114.68	146.08	147	45.37
1374.	Samandar1 (samandar1)	324	39.67	55.67	19	5.86
1375.	Ian (s0ft3n)	324	104.42	138.84	143	44.14
1376.	eric (eric8)	324	86.99	108.57	92	28.40
1377.	Ibex (ibexdoyle)	324	34.68	44.92	25	7.72
1378.	Racer09 (__nn____ds__)	323	43.69	56.33	24	7.43
1379.	Marti (ytram)	323	53.99	74.03	44	13.62
1380.	kenneth (tenick)	323	92.82	116.70	109	33.75
1381.	Pawan (pawanpdn)	323	72.47	97.19	83	25.70
1382.	Orenji (orenji_0987)	323	58.06	80.35	32	9.91
1383.	random (myrandomusername)	323	67.17	92.40	83	25.70
1384.	J (juuhhhstin)	323	141.41	166.88	263	81.42
1385.	tambii (aid1337)	323	121.80	162.76	164	50.77
1386.	Viktor (wector77y)	322	100.33	157.78	118	36.65
1387.	Hasan (notelex)	322	88.67	111.32	97	30.12
1388.	Jee Hoon (jeehoonoh)	322	139.43	193.61	243	75.47
1389.	Hoe Hoe (yeyonghe)	321	76.90	98.46	74	23.05
1390.	Person (relearner)	321	98.75	116.97	131	40.81
1391.	davy (octopu5)	321	76.50	102.10	103	32.09
1392.	MantisTyping (mantistyping)	321	88.56	116.00	98	30.53
1393.	Jeffrey (jeff7263)	321	91.80	119.44	89	27.73
1394.	18K.ca (hunterwoodchase)	321	104.20	131.33	134	41.74
1395.	Rajesh (curseraj)	321	68.07	90.70	81	25.23
1396.	Smudge on megamak uwu (snudge)	320	57.33	99.57	68	21.25
1397.	Lynn (pvequalsnrt)	320	82.82	105.61	99	30.94
1398.	Manik2375 (manik2375)	320	66.15	94.18	89	27.81
1399.	Allan (allanwchang)	320	76.08	99.54	78	24.38
1400.	Yashpal (ymanju)	319	29.26	44.59	51	15.99
1401.	Sahil (shahildhakre)	319	35.58	55.65	23	7.21
1402.	javier (jf1442)	319	67.03	87.53	62	19.44
1403.	Tyler (tko42)	318	111.35	141.93	147	46.23
1404.	Ranak (rakibulranak)	318	61.81	85.48	66	20.75
1405.	Ugnius (popcorn325)	318	95.84	119.02	126	39.62
1406.	Key (malformant)	318	80.26	106.62	91	28.62
1407.	🙃 (kryptoprocta)	318	67.25	92.30	76	23.90
1408.	Jwad (jaziz)	318	114.29	146.78	171	53.77
1409.	I type (carsftw)	318	107.02	137.06	160	50.31
1410.	Andy (wah_wah_wah)	317	63.39	86.97	75	23.66
1411.	Dhaliwal (vishaldhaliwal)	317	69.62	94.52	76	23.97
1412.	Sylwester (rex1313)	317	71.17	108.84	90	28.39
1413.	how 2 type faster? (not_seg...	317	139.14	169.93	247	77.92
1414.	K (khanali2020)	317	95.26	116.17	129	40.69
1415.	Sephiroth (jukethehitman)	317	63.41	94.41	61	19.24
1416.	Ariful (arifulhaque24434)	317	46.11	59.56	35	11.04
1417.	xena (scogx3281)	316	104.97	135.36	123	38.92
1418.	Russian (russianemu27)	316	105.53	141.66	130	41.14
1419.	ig: erik_toledoo (pepegacha...	316	69.70	91.17	83	26.27
1420.	ef (fankan1997)	316	43.64	55.33	33	10.44
1421.	Scattish (willierocknroll)	315	72.04	98.97	70	22.22
1422.	Ven (v4vendetta)	314	43.81	57.95	23	7.32
1423.	Timothy (timply)	314	83.87	117.01	96	30.57
1424.	sgbiscuits (snailzzy)	314	85.28	98.23	111	35.35
1425.	Nour Hakim (scarfc)	314	49.67	66.74	46	14.65
1426.	Memming (qwerty) (memming)	314	102.65	130.16	147	46.82
1427.	dayy (lordie)	314	59.28	85.17	63	20.06
1428.	Lycin (smokzzzgaming)	313	68.91	96.87	73	23.32
1429.	Allistare (shinryu1324alt)	313	100.60	119.41	139	44.41
1430.	Patt (rymt)	313	66.40	95.56	78	24.92
1431.	ChosilogRTX (chosilogrtx)	313	101.42	143.77	136	43.45
1432.	Tony (alpha_911)	313	46.84	64.71	37	11.82
1433.	Shelby (typo5)	312	92.13	121.69	95	30.45
1434.	Emma (emmasmith2005)	312	89.47	113.69	84	26.92
1435.	root (chroot)	312	71.36	125.93	79	25.32
1436.	Emad (emadgsamy)	312	38.02	59.50	23	7.37
1437.	ADFJEWI FF (weiyd)	311	99.22	129.90	138	44.37
1438.	Shendo (shend0)	311	50.71	71.03	26	8.36
1439.	Jakab (schttj)	311	104.31	140.58	128	41.16
1440.	qMark (renvanoss)	311	88.82	112.72	91	29.26
1441.	F3lix (philipyoung)	311	66.45	88.12	69	22.19
1442.	Ansar (paxaq)	311	63.98	87.63	69	22.19
1443.	mwizard (mwizard)	311	127.55	157.21	192	61.74
1444.	chinguun (chinguun_0301)	311	80.26	100.16	75	24.12
1445.	Bruh (bruh_widow)	311	69.82	98.08	86	27.65
1446.	c (blaf)	311	72.79	92.70	68	21.86
1447.	Hari (thor_03)	311	45.72	69.07	33	10.61
1448.	Oatmeal (cp_oatmeal)	310	61.39	77.60	67	21.61
1449.	Berto (bertoisfast)	310	52.53	73.06	28	9.03
1450.	Jason (typing_boi69)	309	76.83	105.07	71	22.98
1451.	Nikhil (nik9)	309	67.95	95.29	81	26.21
1452.	(macieje)	309	157.48	206.11	264	85.44
1453.	Nolan (kiwiq1)	309	88.83	104.64	83	26.86
1454.	Lasse (lemlo)	309	82.10	112.52	82	26.54
1455.	Guest👽 (sinatraa68)	308	47.01	67.19	20	6.49
1456.	ScocoPope (scocopal)	308	69.93	89.24	69	22.40
1457.	PinkPepper (pinkpepper)	308	94.41	128.84	104	33.77
1458.	MegaTron (megatron100101)	308	56.17	75.29	44	14.29
1459.	Hersh (hbhargava)	308	115.69	145.44	165	53.57
1460.	Daniela (danirmz)	308	55.83	84.33	37	12.01
1461.	Alex (bjartex)	308	79.38	124.45	83	26.95
1462.	light (light_06)	308	46.48	63.44	29	9.42
1463.	jone (jonesoldi)	308	54.77	72.48	45	14.61
1464.	Sam (sharris11)	307	74.77	94.62	51	16.61
1465.	Sav (savcaruso)	307	98.01	146.87	126	41.04
1466.	the (rank1zen)	307	73.52	99.73	67	21.82
1467.	ttv.guspenseful (gusm09)	307	88.91	116.33	86	28.01
1468.	Charlie (cubez)	307	68.31	91.92	100	32.57
1469.	Tong (tongvu)	306	87.05	113.20	110	35.95
1470.	Oxey (oxey_was_taken_smh)	306	99.29	130.39	123	40.20
1471.	And (andzer0)	306	81.03	105.64	98	32.03
1472.	mahamad (mahamad017)	306	45.72	62.58	32	10.46
1473.	zzr0t (sulj0o)	305	94.61	127.73	118	38.69
1474.	Reece Taylor (reeceybro28)	305	63.25	89.01	54	17.70
1475.	Jasnam (jazzygoesomnom)	305	65.50	89.79	68	22.30
1476.	b (bonkadonks)	305	91.89	118.64	102	33.44
1477.	Avaneesh (avaneeshasokan)	305	67.06	86.43	76	24.92
1478.	Max (17maxklivans)	305	118.42	158.87	165	54.10
1479.	York (yorkay)	304	84.91	110.84	95	31.25
1480.	sloth (mitchie98)	304	96.01	132.43	42	13.82
1481.	Md. Mamun (mamun_sheikh)	304	67.47	98.83	76	25.00
1482.	Lam (lamnv)	304	49.15	65.21	33	10.86
1483.	Safraz (hypertyper94)	304	61.09	77.24	60	19.74
1484.	Thor (thorern00)	303	57.37	78.15	45	14.85
1485.	Rydia (rydia_miwita)	303	38.63	54.43	17	5.61
1486.	kaly (klay7)	303	24.86	41.55	72	23.76
1487.	Eddynsky (eddynsky432)	303	58.40	74.83	51	16.83
1488.	Anthony (apesina)	303	53.74	72.83	26	8.58
1489.	Nidhal (yagamee)	302	73.38	99.18	76	25.17
1490.	TopGUN (wayhowma)	302	96.60	118.40	183	60.60
1491.	sks (sks6174)	302	74.96	100.54	73	24.17
1492.	Pietro (qiit)	302	79.36	114.14	57	18.87
1493.	Duc (iamphduc)	302	69.67	87.51	87	28.81
1494.	KH (gpx2ero)	302	79.60	102.83	77	25.50
1495.	I really suk (cornmaster0411)	302	92.78	117.42	100	33.11
1496.	MAYANK (mayank_017)	302	31.66	43.11	37	12.25
1497.	learn corne (tomgroenwoldt)	301	92.10	114.47	102	33.89
1498.	Torrin (t0rr1n)	301	87.83	110.24	96	31.89
1499.	sachin (sachin986)	301	65.89	88.38	66	21.93
1500.	Noodles (road2_120wpm)	301	85.73	117.24	94	31.23
1501.	yzifioapj;;;🙈🙈 (pipur)	301	91.39	123.10	93	30.90
1502.	Kiara (katherynbane)	301	89.64	117.58	107	35.55
1503.	tstats[kaitokidokuroba] (ka...	301	88.78	124.02	98	32.56
1504.	Charlie (cduong04)	301	106.51	137.61	107	35.55
1505.	P. (psilva00)	300	84.27	108.41	96	32.00
1506.	Piyush (piyush41y08h)	300	61.77	80.33	57	19.00
1507.	ndr2 (ndr2)	300	105.49	128.13	131	43.67
1508.	Yaroslav (nashivan)	300	36.79	48.25	21	7.00
1509.	J (leunidus)	300	105.17	130.86	115	38.33
1510.	Charon (just_you_and_me)	300	46.15	58.80	31	10.33
1511.	jmzg (jmzg)	300	79.71	106.92	80	26.67
1512.	😳hotmama😫 (h0tmama)	300	142.56	185.24	229	76.33
1513.	blue (bluedragon_)	300	96.97	136.91	117	39.00
1514.	Bijji (thatboywulfric)	299	100.11	125.26	138	46.15
1515.	Ins (insanic10)	299	72.84	101.64	71	23.75
1516.	Sidharth (iamsidman17)	299	84.49	110.54	85	28.43
1517.	Jhari (hyunjintinapay)	299	60.41	79.47	58	19.40
1518.	Fouracle (fouracle)	299	155.23	188.96	265	88.63
1519.	King JF (foongtastic)	299	58.27	74.24	51	17.06
1520.	Tiny Tank (anti_vax_cat)	299	98.69	127.80	106	35.45
1521.	Chuck (typer_inflation)	298	77.19	103.01	82	27.52
1522.	TypeLearner21 (typelearner21)	298	100.91	124.99	141	47.32
1523.	Sydney (sydholla)	298	87.62	115.41	82	27.52
1524.	JACK (jackemon)	298	49.95	74.00	36	12.08
1525.	Macedonian King (ijittqerr_)	298	85.89	113.04	76	25.50
1526.	Silent_One (get_a_lif3)	298	133.97	170.26	219	73.49
1527.	Neb (cyanidetoast)	298	76.13	106.29	76	25.50
1528.	Jc9369 (trotterspiglet)	297	70.06	90.08	67	22.56
1529.	Samuel (samuel_7)	297	73.38	100.85	64	21.55
1530.	MNM (mnmnour)	297	104.33	128.37	135	45.45
1531.	­ ­­ (enqq)	297	71.88	99.63	75	25.25
1532.	Danica (7158dandan)	297	74.34	94.79	85	28.62
1533.	csl (csl11)	297	66.54	81.87	76	25.59
1534.	Taru (tarukwon)	296	90.51	114.16	102	34.46
1535.	chara (rin3)	296	94.07	125.59	113	38.18
1536.	Sobuj (greensobuj)	296	58.16	82.93	59	19.93
1537.	MK-47 (construct)	296	63.94	82.81	63	21.28
1538.	Timothy (adral)	296	85.50	121.46	84	28.38
1539.	Catalin (catalinhimself)	296	71.44	97.16	70	23.65
1540.	Marius (darkmarox)	296	71.37	101.58	72	24.32
1541.	Someone (_some_one_)	295	90.16	120.02	95	32.20
1542.	(shaun022)	295	82.31	112.14	90	30.51
1543.	Raven (ravens_loft)	295	74.04	99.14	74	25.08
1544.	Dvorak 9/16/2021 (mj_dvorak)	295	61.68	82.16	51	17.29
1545.	RoadTo69(hehe) (lord_hunter)	295	68.84	91.91	72	24.41
1546.	likun (likun)	295	36.98	49.28	21	7.12
1547.	kamalesan (kamalesan)	295	69.96	87.80	76	25.76
1548.	Nurasyl (black2ing)	295	49.12	62.45	30	10.17
1549.	Asm (asmsaikat)	295	57.96	74.40	41	13.90
1550.	Touchtyping (touchtypingpro...	294	76.49	112.79	95	32.31
1551.	Suhas (suhasmaddali007)	294	102.90	126.79	112	38.10
1552.	david (snobellprize)	294	88.68	114.13	98	33.33
1553.	Anvar (only_aloner)	294	75.01	93.34	101	34.35
1554.	Macro (macro225)	294	82.49	99.74	60	20.41
1555.	inspirations (inspirations)	294	56.47	73.98	52	17.69
1556.	Kai (gigadelic)	294	91.74	120.65	99	33.67
1557.	Horst (feanor)	294	97.30	120.28	107	36.39
1558.	:D (rathorr)	294	39.78	56.28	23	7.82
1559.	27thave.bandcamp.com (xxcru...	293	146.15	188.92	233	79.52
1560.	Nirmith (nirmith_akash)	293	55.29	72.81	41	13.99
1561.	Michael (lastobelus)	293	82.43	97.70	66	22.53
1562.	prints (ichigopurin)	293	110.60	154.59	167	57.00
1563.	Burint (brenolz)	293	72.41	95.11	75	25.60
1564.	bondservant (arenza)	293	91.78	121.57	108	36.86
1565.	Amarpreet Singh (amar123200)	293	72.10	100.16	84	28.67
1566.	ajit (ajit9999)	293	65.72	88.62	85	29.01
1567.	Aditya (adibhandari)	293	71.00	92.80	85	29.01
1568.	Logan (36beastgod)	293	72.94	94.91	86	29.35
1569.	Veer (the_veer)	292	84.33	108.93	79	27.05
1570.	Omar (samura1)	292	65.37	92.38	69	23.63
1571.	Pink (pinkbass)	292	66.95	92.34	69	23.63
1572.	reem (bacil123)	292	109.63	139.38	132	45.21
1573.	zheqe (zheqe)	291	109.95	133.42	148	50.86
1574.	Ujjval (ross_specter)	291	55.17	73.45	36	12.37
1575.	Operation Sindoor 🇮🇳 ...	291	89.10	125.88	108	37.11
1576.	anonym_igelkott (anonym_ige...	291	119.96	143.19	163	56.01
1577.	Vanessa (abetterplace)	291	99.06	129.02	120	41.24
1578.	carrie (charmed4002)	291	42.97	58.79	22	7.56
1579.	t (zyxx)	290	93.32	129.84	115	39.66
1580.	Surely (surely_)	290	55.14	74.36	36	12.41
1581.	Loma (pbaloma)	290	99.90	123.26	104	35.86
1582.	Monotarinai (monotarinai)	290	70.76	93.83	73	25.17
1583.	leftovericecream (leftoveri...	290	96.14	121.75	125	43.10
1584.	Hello (julius1331)	290	84.50	109.01	87	30.00
1585.	a (jdlwahaha)	290	95.44	117.85	111	38.28
1586.	meerkat (dr_meerkat)	290	76.39	93.80	69	23.79
1587.	puthin_p2n (bugsmasher)	290	83.09	116.97	80	27.59
1588.	boiax (boiax)	290	60.92	86.95	65	22.41
1589.	aziz (azizkhanfar304)	290	59.86	75.53	57	19.66
1590.	Anthony S. (anthonyjshuey)	290	83.59	119.01	80	27.59
1591.	wdMahbub (wdmahbub)	290	32.27	44.49	23	7.93
1592.	Yeldos (yeldos1)	289	26.38	43.76	48	16.61
1593.	Im not a country (taiwankim)	289	88.63	114.78	93	32.18
1594.	Struasz (struasz)	289	35.99	52.27	24	8.30
1595.	Ross (pyramidgg)	289	109.67	146.18	125	43.25
1596.	Navait (nkumar031)	289	59.08	83.48	59	20.42
1597.	Rasmus (kennystarfighter_)	289	76.38	103.76	73	25.26
1598.	#1 Racist (gnadus)	289	53.83	69.93	26	9.00
1599.	Angela (angela_typeracer)	289	46.82	67.20	24	8.30
1600.	Kerim (keroma)	289	39.83	52.77	15	5.19
1601.	ramen (lightning_poliwag)	288	85.21	119.12	98	34.03
1602.	Misha (ladyvander)	288	103.54	129.93	125	43.40
1603.	pwp (fickypw)	288	81.54	99.24	64	22.22
1604.	usagi704 (usagi704)	287	64.60	79.58	53	18.47
1605.	Nilanjan (nilthedev)	287	62.49	86.02	55	19.16
1606.	lurak (lurak2131)	287	75.17	97.18	69	24.04
1607.	KC Abhinav (kcabdn)	287	55.00	78.53	42	14.63
1608.	Pranjal (haanhaargaya)	287	51.52	65.06	25	8.71
1609.	Ewan (ewan121)	287	83.03	111.91	78	27.18
1610.	Abdzag (abdzag)	287	65.42	91.30	70	24.39
1611.	sierra (sierra05)	286	156.11	202.05	243	84.97
1612.	Sampharos (sampharos)	286	49.77	66.92	24	8.39
1613.	Maxim (mista7)	286	50.45	71.01	29	10.14
1614.	Krushna (krush111878)	286	51.72	72.17	34	11.89
1615.	Jhonny (jhonny_space0ut)	286	64.37	79.65	63	22.03
1616.	Danny (h4ndeye)	286	75.95	100.40	69	24.13
1617.	Catalin (georgecatalin)	286	78.58	103.56	64	22.38
1618.	Reddington ツ (ericliu17)	286	118.11	155.92	173	60.49
1619.	Raj (raxoltron)	285	67.64	95.29	84	29.47
1620.	Nursultan (nursultan23)	285	59.71	80.71	41	14.39
1621.	mayzerto (mayzerto)	285	68.96	85.66	58	20.35
1622.	Jack (jackthesnacc)	285	66.51	93.97	72	25.26
1623.	speedyqwertalez (i_am_a_nooby)	285	56.35	69.17	32	11.23
1624.	Joe (show_some_moe_joe)	285	57.63	74.61	33	11.58
1625.	Jandar (jandar)	285	70.96	91.76	69	24.21
1626.	pwned (pwned1337)	284	47.20	63.14	41	14.44
1627.	Zaynab (itsyou)	284	67.78	88.47	74	26.06
1628.	Gopal (avengergopal)	284	34.83	53.03	25	8.80
1629.	ObiJuaan (obijuaan)	284	69.48	102.95	76	26.76
1630.	MazzaM (typingproxyz)	283	82.26	131.52	71	25.09
1631.	sly (slymaster11)	283	113.67	145.75	132	46.64
1632.	1 (shootingmonkey1)	283	67.83	89.64	66	23.32
1633.	Bob (octopus32)	283	107.17	128.89	153	54.06
1634.	James (jjhertz)	283	66.58	98.35	65	22.97
1635.	butttickler (james29091998)	283	53.77	72.02	41	14.49
1636.	Hayrra (hedooxx)	283	52.18	64.88	17	6.01
1637.	Jonah (workman04)	282	91.90	124.29	104	36.88
1638.	Sam (numberonemega)	282	111.74	146.05	169	59.93
1639.	Jethro (jetthrower)	282	77.75	103.96	80	28.37
1640.	greenmantis (greenmantis)	282	111.44	145.48	154	54.61
1641.	quite fast (edonn)	282	118.13	148.06	125	44.33
1642.	AWE (awicek)	282	52.61	65.77	26	9.22
1643.	shark (sharkpause)	281	64.41	87.15	60	21.35
1644.	Nima (nimayaqmuri)	281	84.81	105.96	81	28.83
1645.	Michael (m1ch4el)	281	59.57	75.55	41	14.59
1646.	Eddie (eddie_08)	281	73.15	96.94	76	27.05
1647.	Somogyi (vincture)	280	97.98	126.12	94	33.57
1648.	One last time (ubershah)	280	101.58	136.59	139	49.64
1649.	Taejas (taejas)	280	90.53	107.68	101	36.07
1650.	Shadow (shadow_monarch)	280	85.64	116.41	79	28.21
1651.	butter (rtporpmal)	280	71.85	94.90	62	22.14
1652.	Racer (racer_9)	280	55.41	80.13	30	10.71
1653.	Eugene (ptes77)	280	152.93	192.14	240	85.71
1654.	Ikenna (odogwu)	280	76.67	107.78	79	28.21
1655.	notkinruyuu (notkinruyuu)	280	53.89	82.03	33	11.79
1656.	Manel (mrnuke)	280	78.92	93.22	76	27.14
1657.	Mohamed Sadiq (mohamed_sadi...	280	29.46	39.60	30	10.71
1658.	Joe (jgizzi21)	280	74.41	98.73	60	21.43
1659.	?? (form30to100)	280	28.94	45.60	41	14.64
1660.	anon (dontrun01)	280	39.41	55.21	22	7.86
1661.	Chicken (chicken807)	280	91.67	123.85	98	35.00
1662.	Anson (ansonso042802)	280	69.31	95.48	50	17.86
1663.	PURPLE_MAGE (grokestray)	280	71.21	95.89	72	25.71
1664.	🧀 Chez (super_not_pro)	279	139.94	174.14	213	76.34
1665.	Val (sgtvaltzu)	279	92.31	109.15	83	29.75
1666.	Imperator (imperator_357)	279	60.44	70.78	46	16.49
1667.	Heufy (heufy)	279	83.94	105.54	90	32.26
1668.	god (god_is_here)	279	93.36	117.04	93	33.33
1669.	ghaws (ghaws)	279	74.99	97.04	79	28.32
1670.	sukhoi su-57 (shezy)	278	41.77	63.73	29	10.43
1671.	henry (luckyhenry)	278	83.48	99.64	71	25.54
1672.	Liam (lime_da_bestest_colemak)	278	63.40	83.34	56	20.14
1673.	Onni (alchem)	278	82.62	121.20	65	23.38
1674.	Wave (waveclipping)	277	110.51	147.56	140	50.54
1675.	Yusuke (tokyoprogramming)	277	78.67	102.68	79	28.52
1676.	ionut (ionut_red)	277	90.70	124.66	106	38.27
1677.	antobot (antobot)	277	55.14	73.96	52	18.77
1678.	aditya (yusifer_zendric)	276	105.19	130.38	130	47.10
1679.	Jamal (xflash)	276	87.52	116.42	92	33.33
1680.	Edwin (biggchinoxxl)	276	64.15	95.43	49	17.75
1681.	Will (williamwang)	275	109.16	140.26	120	43.64
1682.	Robbie (symba369)	275	80.67	104.63	84	30.55
1683.	Lark (sirhaxbard)	275	112.99	146.15	127	46.18
1684.	Radek (raddzio)	275	65.68	87.49	62	22.55
1685.	Chilly (racerrrrrrr)	275	59.80	76.35	44	16.00
1686.	Luke (luthedog)	275	77.47	103.12	66	24.00
1687.	Hau (jackie1997)	275	64.96	94.14	69	25.09
1688.	Aheartz (idul_aheartz06)	275	50.46	67.02	28	10.18
1689.	Alex (delvern)	275	71.16	87.59	71	25.82
1690.	jerry (sheep0109)	274	52.82	75.40	41	14.96
1691.	jinay (noisy_88)	274	73.30	95.67	79	28.83
1692.	Murad (murad90)	274	52.37	68.14	29	10.58
1693.	Cultist (kishore0305)	274	98.00	125.95	89	32.48
1694.	kd (kdrai007)	274	50.33	71.53	31	11.31
1695.	Jpjt (jyrah)	274	72.85	90.92	48	17.52
1696.	Grover (grover8323)	274	51.46	64.06	18	6.57
1697.	askeladd (askeladd_619)	274	44.67	58.97	24	8.76
1698.	Ahmad (ahmad7salah)	274	54.68	71.87	30	10.95
1699.	Krg (username_example125259)	273	117.07	142.63	155	56.78
1700.	razwan (razwan)	273	37.59	61.16	20	7.33
1701.	Yanni (moronicmetalman)	273	106.90	127.47	118	43.22
1702.	Stefan (fendorian)	273	92.84	116.99	107	39.19
1703.	Dayna (daynarrr)	273	87.63	122.42	93	34.07
1704.	Lawrence (buffoony)	273	79.30	105.10	91	33.33
1705.	Andres (atv2307)	273	64.67	86.53	65	23.81
1706.	Leo (asdbooh)	273	90.79	116.85	87	31.87
1707.	gabi (g_i_g)	273	51.43	73.44	32	11.72
1708.	RAMs3c (xander360)	272	76.18	101.76	59	21.69
1709.	fast (n1lotpal)	272	73.54	91.42	77	28.31
1710.	Manuel (manuelsandoya)	272	52.65	70.76	21	7.72
1711.	humberto torres (humbertoto...	272	88.60	108.76	86	31.62
1712.	TheyGotAlex (harshbarger.a@...	272	118.28	164.34	142	52.21
1713.	Ambi (dank_ambi)	272	93.41	127.75	114	41.91
1714.	Francisco (cdt1)	272	87.38	112.78	80	29.41
1715.	Gio (banzy)	272	59.32	73.91	45	16.54
1716.	Jonas (supektibol)	271	88.85	106.32	64	23.62
1717.	sadsaturdays (sadsaturdays)	271	49.53	64.10	33	12.18
1718.	Perceval-_- (perceval)	271	68.71	86.71	62	22.88
1719.	mcga (mcga)	271	90.31	114.29	101	37.27
1720.	accongero (geononquit)	271	145.64	196.28	183	67.53
1721.	Peaches (devastated)	271	122.95	154.23	141	52.03
1722.	Mark (datboi1771)	271	94.16	140.44	93	34.32
1723.	Dang Hai (dang_hai_ema)	271	36.97	51.90	15	5.54
1724.	camden (camdcn)	271	126.49	176.47	183	67.53
1725.	Aman (amanengineer)	271	72.70	106.28	65	23.99
1726.	nishant (nishp19)	270	76.72	93.47	81	30.00
1727.	Lil guy (littlewalken27)	270	52.06	67.30	33	12.22
1728.	Hunter (hunter_da_man11)	270	88.01	112.47	81	30.00
1729.	frustratedtyper (frustrated...	270	94.89	119.88	95	35.19
1730.	Kirin (emptomatoketchup)	270	86.36	129.62	82	30.37
1731.	Alfabetica (alfabetica)	270	85.95	105.95	77	28.52
1732.	Okiiiieee (acharyas)	270	84.76	111.42	72	26.67
1733.	fishfingers (fastfinger5669)	270	69.48	88.18	66	24.44
1734.	logan (logannnc)	270	53.20	71.55	20	7.41
1735.	Trent (tsteele07)	269	68.53	84.78	63	23.42
1736.	Le (lenam12345)	269	46.74	69.89	20	7.43
1737.	imscreecher (imscreecher)	269	66.45	91.74	51	18.96
1738.	Bill (destroyer_2)	269	82.14	117.00	79	29.37
1739.	Ben (thisisben)	268	85.91	105.82	62	23.13
1740.	SURFΛCΞ (surface)	268	103.58	138.80	129	48.13
1741.	Sandy (sandeshgowda0094)	268	30.12	42.20	34	12.69
1742.	Peter (ptnguyen)	268	108.00	143.19	135	50.37
1743.	Pradeep (pradeep80)	268	70.81	117.68	62	23.13
1744.	Fearless Jutt (lozer098)	268	71.34	92.65	53	19.78
1745.	Fraze (dunklioscious)	268	146.23	185.85	196	73.13
1746.	akzhol (atomixa)	268	86.24	111.93	89	33.21
1747.	Nagai (nagaimatsuge)	267	89.33	111.87	94	35.21
1748.	Bình (juliecorstarr)	267	50.46	97.36	25	9.36
1749.	Jordi (jordi0lle)	267	53.83	72.75	24	8.99
1750.	Matt (inedibility)	267	97.89	122.48	100	37.45
1751.	Glass (glass_crys)	267	94.75	130.10	97	36.33
1752.	Ali (french_baguette)	267	55.73	80.03	47	17.60
1753.	Rory Gower (rxryag)	267	42.97	62.61	22	8.24
1754.	Robert (karayicki)	266	102.47	124.31	117	43.98
1755.	Kelby (haulzy)	266	94.40	110.91	100	37.59
1756.	Hossein (dustylamia)	266	85.77	126.90	108	40.60
1757.	zeeee (zeeebra)	265	107.71	146.21	142	53.58
1758.	Typing🤯🤯🤯 (sirsoup)	265	95.23	118.96	75	28.30
1759.	Jo (jococonutty)	265	87.19	110.79	90	33.96
1760.	JP (freshlumpia)	265	81.68	112.19	79	29.81
1761.	barry01xd (barry011)	265	117.27	148.10	140	52.83
1762.	tudorica1 (tudorel1234)	264	98.90	115.94	91	34.47
1763.	Demon (thedemon54)	264	43.87	70.33	21	7.95
1764.	severed (severedhand)	264	83.56	115.71	66	25.00
1765.	Pavan (sai_pavan)	264	71.17	93.84	60	22.73
1766.	Sahariar (noob_sahariar)	264	70.62	98.98	67	25.38
1767.	gangreenie (gangreenie)	264	97.49	130.44	105	39.77
1768.	Enjoi (enjoisxd)	264	68.27	87.51	58	21.97
1769.	Typer Shark (teodorrd27)	263	122.58	144.05	154	58.56
1770.	munkeontop (revvitt)	263	141.39	169.47	180	68.44
1771.	Abdulelah (hansan)	263	55.16	73.03	36	13.69
1772.	Byron (chicken_little1)	263	59.57	72.01	40	15.21
1773.	Hyrum (anom4001)	263	90.03	115.87	91	34.60
1774.	Shu (shuuouma)	262	60.49	76.10	43	16.41
1775.	Poops (poops_magee)	262	116.04	140.37	153	58.40
1776.	Hans (phantomreel)	262	49.62	64.27	30	11.45
1777.	Lightning (just_lightning_)	262	67.14	94.27	42	16.03
1778.	Nigel (nigelhaha)	262	34.20	51.09	11	4.20
1779.	Timmy (timexwatch)	261	71.90	99.49	61	23.37
1780.	(sputype)	261	102.70	144.79	102	39.08
1781.	salem (salem_coder)	261	60.62	91.78	59	22.61
1782.	Ndrew138 (ndrewewqe)	261	69.54	89.16	59	22.61
1783.	Prem (merpx)	261	77.16	94.66	64	24.52
1784.	lukman (kopimaniz)	261	87.72	104.81	87	33.33
1785.	Kenway (kenway316)	261	74.00	102.42	59	22.61
1786.	Hatandriya (tiko270303)	260	110.82	142.51	126	48.46
1787.	Nairwick (nairwick)	260	78.30	117.19	52	20.00
1788.	Nagaku (nagaku)	260	99.46	127.84	90	34.62
1789.	Mers (mers_0412)	260	99.87	122.50	108	41.54
1790.	Meet (meet_patel1588)	260	68.99	94.32	57	21.92
1791.	Stormy (jsoccerdude@msn.com)	260	87.45	118.20	79	30.38
1792.	yixuan (ixuan)	260	80.75	104.97	87	33.46
1793.	Cythrix (boment)	260	110.09	135.59	125	48.08
1794.	Adrian (adriangat)	260	90.84	113.69	99	38.08
1795.	Adam (adamsyaq)	260	97.81	123.46	108	41.54
1796.	H (vigilantvillian_colemak)	259	109.67	130.65	135	52.12
1797.	scuba (scuba2x)	259	72.56	111.17	61	23.55
1798.	RoosterDunker (roosterdunker)	259	94.18	114.32	73	28.19
1799.	Richard (richard_king)	259	72.81	95.59	51	19.69
1800.	matiullah (qais_007)	259	39.51	49.78	14	5.41
1801.	Joe (neimad7)	259	110.31	144.78	106	40.93
1802.	joe (mcmillybear)	259	74.55	98.01	70	27.03
1803.	hero (iknowhtml)	259	41.63	56.15	18	6.95
1804.	Kade (buph_kade)	259	78.15	113.29	53	20.46
1805.	Violet (ackerman_l1)	259	79.33	96.04	65	25.10
1806.	Mhark (mharkmharkmhark)	258	83.94	105.77	64	24.81
1807.	jonny (jlun23)	258	125.09	155.88	173	67.05
1808.	CornPacs (cornpacs)	258	87.58	107.48	79	30.62
1809.	CHeezs (cheezs)	258	101.43	135.09	174	67.44
1810.	hitham osama (hitham16)	258	27.91	45.48	29	11.24
1811.	Vi Kiet (vikiet1456)	257	60.79	77.48	60	23.35
1812.	Will (slamdado)	257	72.49	95.56	50	19.46
1813.	prplx (prplx)	257	99.51	133.39	113	43.97
1814.	veirt (exlog)	257	128.69	165.61	158	61.48
1815.	E (evan_30)	257	82.93	103.25	81	31.52
1816.	원숭이 (dweaji)	257	106.15	131.30	116	45.14
1817.	craw (clamchowderco)	257	79.84	105.41	80	31.13
1818.	Art (artkhl)	257	77.85	99.68	70	27.24
1819.	Andrew (andrewsim)	257	61.05	75.38	59	22.96
1820.	Mooyodauh (mooyodauh)	257	91.57	127.04	76	29.57
1821.	Qi (whathaha)	256	123.49	165.41	157	61.33
1822.	Meow (vic12116)	256	68.08	91.86	65	25.39
1823.	Mark (requiem__)	256	85.98	109.78	67	26.17
1824.	mike (oxfordcomma)	256	94.55	116.19	105	41.02
1825.	Vietnamese Typist (odarealp...	256	98.21	133.95	88	34.38
1826.	hackthemoon (hackthemoon)	256	81.15	104.71	63	24.61
1827.	Severin (elmo96)	256	101.84	120.95	109	42.58
1828.	Tony (complex)	256	96.11	131.84	93	36.33
1829.	wpmhog (wpmhog)	255	75.77	99.93	55	21.57
1830.	Triklino (triklino)	255	137.66	183.78	183	71.76
1831.	Yash (thanosyash)	255	70.45	102.01	56	21.96
1832.	shashank (shashaank)	255	38.33	47.50	22	8.63
1833.	Ishaant (ishaant)	255	57.88	75.88	50	19.61
1834.	trash 22424242424 (y6_chris)	254	111.12	137.91	125	49.21
1835.	Shuccer (shuccer)	254	69.52	97.88	62	24.41
1836.	Saied (saied_en)	254	54.94	75.03	47	18.50
1837.	hafidbuilds (hafidium)	254	55.64	68.63	35	13.78
1838.	Atif (atifzaheer2028)	254	93.05	116.16	103	40.55
1839.	(amithps66)	254	58.64	72.68	36	14.17
1840.	PR@NIT (anonymous8)	254	34.27	53.80	19	7.48
1841.	Shaikh Nayeem Uddin (snayeemu)	254	41.92	52.07	20	7.87
1842.	abhiraj (abhirajzzz)	254	24.79	36.64	42	16.54
1843.	Xebion (xebion)	253	78.70	98.81	72	28.46
1844.	Lydia (shiruzu)	253	104.32	123.05	96	37.94
1845.	Ankan (nc3rtainity)	253	71.12	90.25	63	24.90
1846.	myshmeh (myshmeh)	253	69.01	84.91	57	22.53
1847.	heh (itno)	253	65.44	85.02	66	26.09
1848.	Math (faster_babe)	253	87.70	103.38	69	27.27
1849.	Anmol (anmolsaraswat)	253	82.04	121.64	87	34.39
1850.	AL (alhasandude)	253	54.68	69.13	32	12.65
1851.	Apu (a1p16u21)	253	37.65	53.15	13	5.14
1852.	braeden (braeden312)	253	71.75	101.17	76	30.04
1853.	Zeltraa (zeltraa)	252	77.10	101.67	68	26.98
1854.	Casper (venomizedcasper)	252	78.64	101.53	66	26.19
1855.	Alexander (torphon)	252	94.84	115.80	86	34.13
1856.	Daniel (incognitus)	252	90.71	105.98	103	40.87
1857.	Imagine losing (naaskee)	252	63.28	83.14	44	17.46
1858.	Shadow (shadowkitten)	251	104.49	146.52	111	44.22
1859.	Savantik (savantik)	251	111.36	146.26	123	49.00
1860.	Peter (petepp)	251	45.97	62.30	25	9.96
1861.	tstats[gad2443] (gad2443)	251	112.66	140.67	120	47.81
1862.	Mohammad (qwertland123)	251	58.22	82.68	48	19.12
1863.	Zoe (zhanchi)	250	56.21	69.42	31	12.40
1864.	a (vanazkan)	250	68.87	87.57	53	21.20
1865.	Tianchang (tcliao)	250	86.64	109.02	73	29.20
1866.	Eric (sivade)	250	113.45	168.75	129	51.60
1867.	RAAM (raam_d_prince)	250	75.74	112.07	57	22.80
1868.	Free-Palestine (mohammed_id...	250	71.97	99.72	70	28.00
1869.	Edmilson (milson602)	250	61.41	81.46	51	20.40
1870.	McKenna (mcassady13)	250	94.89	122.24	96	38.40
1871.	Ngoc (maxq42)	250	100.19	121.94	78	31.20
1872.	Illya (maldron)	250	75.59	94.95	54	21.60
1873.	JT (jasonthai)	250	36.81	57.17	17	6.80
1874.	Jorn (dealermedic)	250	92.96	121.12	77	30.80
1875.	Bilbo (bilboballins)	250	99.86	132.19	93	37.20
1876.	bendo (bendh)	250	59.59	78.89	40	16.00
1877.	Jammie (typos_z)	249	203.76	273.89	245	98.39
1878.	Pintu (pintukanjia)	249	59.02	79.17	52	20.88
1879.	Michael (mchu519)	249	111.05	131.80	133	53.41
1880.	Eldergod of the Universe (l...	249	117.72	157.37	118	47.39
1881.	JusticeEX (justiceex)	249	101.43	149.19	97	38.96
1882.	Piss Boyy (ineedanickname)	249	94.71	138.47	75	30.12
1883.	ignacio (ifarias25)	249	96.54	123.78	72	28.92
1884.	DMack (dmack98)	249	89.47	114.53	88	35.34
1885.	czus (czus)	249	71.94	98.74	66	26.51
1886.	joster150 (joster150)	249	66.74	84.40	50	20.08
1887.	zhata1234 (zhata)	248	83.62	111.42	57	22.98
1888.	sam (samtheguy10)	248	66.48	88.11	50	20.16
1889.	Mamdouh (mamdouh_75)	248	63.65	80.10	54	21.77
1890.	Heide (vnit)	247	70.73	96.53	52	21.05
1891.	Matthew (poobcum)	247	64.55	85.36	56	22.67
1892.	Karthik (karthikkumar)	247	68.34	96.09	52	21.05
1893.	GWTNess (gwtness)	247	82.86	109.27	79	31.98
1894.	Kopa_Samsu (aaourav0)	247	57.88	75.43	69	27.94
1895.	ajrv (aamodvarma)	247	109.86	146.08	118	47.77
1896.	https://youtu.be/dQw4w9WgXc...	246	122.33	152.12	136	55.28
1897.	🦉Tenor🦉 (strigibae)	246	127.91	160.99	154	62.60
1898.	Serial (serial_typer)	246	77.24	101.55	65	26.42
1899.	Luda (ludavis)	246	80.68	103.51	68	27.64
1900.	King (kingcrumple)	246	119.75	153.64	157	63.82
1901.	Einno (einno)	246	85.68	107.64	81	32.93
1902.	Chowda (chowda)	246	103.45	131.08	100	40.65
1903.	tstats[spyro1411] (spyro1411)	245	57.69	69.17	35	14.29
1904.	K (ksil_surface)	245	101.72	127.98	106	43.27
1905.	Coder100 (coder_onehundred)	245	123.08	150.37	134	54.69
1906.	ayushwan (ayush6203)	245	24.31	36.13	53	21.63
1907.	H (macca619)	245	69.80	86.36	61	24.90
1908.	Walson (wals)	244	68.49	98.93	64	26.23
1909.	Richard (redjoe)	244	104.77	134.29	112	45.90
1910.	norush (norush)	244	84.90	102.24	66	27.05
1911.	V01D (inferno888)	244	85.22	122.49	78	31.97
1912.	AM (freae)	244	85.46	108.13	87	35.66
1913.	Sajib (dipto)	244	51.72	73.31	39	15.98
1914.	unseasoned lawyer (dindondoe)	244	150.76	221.67	172	70.49
1915.	CrashRAcer1 (crashracer1)	244	52.36	77.70	26	10.66
1916.	Ayden (aydensonline)	244	86.53	120.83	67	27.46
1917.	mv0 (the_oko)	243	87.45	104.09	75	30.86
1918.	Rahaf (rahafalahdab)	243	44.88	57.00	25	10.29
1919.	Eric (pawnnub)	243	89.35	131.88	86	35.39
1920.	mrbean (mrbean1)	243	87.20	104.54	95	39.09
1921.	sk (kasem132)	243	62.87	81.56	49	20.16
1922.	Crasedes (crasedes)	243	80.60	104.07	60	24.69
1923.	himansh.u7 (mou5etrap)	243	55.91	80.74	27	11.11
1924.	Sweats Money (digital_dankie_)	243	49.86	66.00	30	12.35
1925.	Shayne (shayneacasio)	242	87.85	124.52	81	33.47
1926.	Rabi (rabiulislam9)	242	61.47	86.22	57	23.55
1927.	Lirei (lirei)	242	96.79	120.03	68	28.10
1928.	jean (jhyppoli)	242	49.57	68.52	16	6.61
1929.	Iqbal Ahmad (iqbal2021)	242	47.34	66.06	27	11.16
1930.	. (cuzto)	242	76.31	107.97	53	21.90
1931.	Damian (kztryu)	242	55.40	77.34	26	10.74
1932.	Stijn (stijnmeijssen)	241	77.03	105.23	48	19.92
1933.	Hour (soslow_)	241	59.29	76.81	34	14.11
1934.	Bijay (shresthabijay)	241	64.17	86.84	48	19.92
1935.	Jay (eradekator)	241	94.28	116.24	72	29.88
1936.	Benji (benbind1)	241	85.75	109.55	69	28.63
1937.	Arschwurst (arschwurst)	241	48.67	62.81	26	10.79
1938.	Anisur (anis_017)	241	77.14	99.18	43	17.84
1939.	Amogh (amogh_14)	241	80.35	103.45	75	31.12
1940.	Aditya (aditya2712)	241	75.28	97.27	62	25.73
1941.	Joaquin (wakincloset)	240	91.00	110.57	92	38.33
1942.	Andrea (tinola)	240	77.11	96.22	51	21.25
1943.	Jonathan (insanegamerwow)	240	132.85	167.10	173	72.08
1944.	DeeDee (deedee09)	240	68.04	81.17	49	20.42
1945.	Alex (aleksandr797)	240	73.67	94.57	67	27.92
1946.	Allen (xs_ageart)	239	106.14	131.82	109	45.61
1947.	Konstantinos (sotos01)	239	43.87	61.41	160	66.95
1948.	Prajwal (prajwalr)	239	56.67	75.22	38	15.90
1949.	page (phrynesc)	239	73.28	86.76	66	27.62
1950.	William (bobodahobo54)	239	88.39	105.80	65	27.20
1951.	SaeedUllah (asadjani)	239	59.28	76.84	39	16.32
1952.	Ritesh (ritesh_98)	238	63.29	86.74	52	21.85
1953.	Peter (peter50latam)	238	53.00	80.22	22	9.24
1954.	Krispy (krispytypes)	238	119.56	144.01	129	54.20
1955.	Snail (type_of_a_typer)	237	57.40	70.43	27	11.39
1956.	Missy (lovelydy)	237	84.73	104.69	62	26.16
1957.	LoneRusher (lonerusher)	237	78.70	99.87	61	25.74
1958.	gabe (gabeeeeee)	237	96.06	140.01	87	36.71
1959.	mostafa (eng_mustafa)	237	68.65	91.63	59	24.89
1960.	Dhaval (dhaval06)	237	73.67	96.31	71	29.96
1961.	Chaos (chaoszed)	237	87.29	112.28	80	33.76
1962.	Apple Tragic (baccupacc)	237	142.80	172.17	182	76.79
1963.	Absect (absect)	237	44.37	59.62	22	9.28
1964.	Noobtyper (noobtyper96)	237	54.71	70.63	30	12.66
1965.	Juan (juanmachuca95)	237	58.93	71.47	34	14.35
1966.	Doan (zzzhzzz)	236	60.91	83.62	47	19.92
1967.	Zen (zenchan123)	236	101.60	147.96	94	39.83
1968.	Matrix (ss005)	236	83.74	104.55	68	28.81
1969.	Inferno (mohmadrid0)	236	113.37	144.09	191	80.93
1970.	be nice slunt (jokii)	236	128.12	162.13	152	64.41
1971.	Jejo (jejo03)	236	60.89	83.78	45	19.07
1972.	Natchanon (irmia223)	236	86.72	109.02	69	29.24
1973.	Anatoli (errormaker)	236	73.65	90.04	42	17.80
1974.	Pawel (el3ctron)	236	36.42	49.38	11	4.66
1975.	Chronic (cheng01)	236	44.01	59.37	12	5.08
1976.	Casper (bighero86)	236	67.32	88.10	59	25.00
1977.	beatrace (beatrace21)	236	55.80	76.63	23	9.75
1978.	Austin (_8(|) (atrain742)	236	118.35	156.30	115	48.73
1979.	ThorNMR (thor_nmr)	236	33.42	47.05	13	5.51
1980.	Joe (__joe___mama__)	235	87.84	119.29	62	26.38
1981.	dingdong (zuccandsucc)	235	105.29	134.07	149	63.40
1982.	Akira (s_akira)	235	55.47	72.59	34	14.47
1983.	Stelister (stelister)	235	74.84	96.01	71	30.21
1984.	SMoon (smoon343)	235	60.29	75.76	39	16.60
1985.	Roshan (roshan_satare)	235	77.79	97.82	73	31.06
1986.	Khadea (charter)	235	121.56	154.55	131	55.74
1987.	Brandon (baddoodle)	235	68.30	93.63	48	20.43
1988.	Shubham (shubham_p)	234	39.79	60.59	16	6.84
1989.	Julius (reallyoldfart)	234	33.15	48.11	19	8.12
1990.	Kusmir (kusmir)	234	94.80	120.97	78	33.33
1991.	jeremyWINZ (jeremiah_munguia)	234	117.12	156.06	110	47.01
1992.	Daito (blucantrell)	234	87.29	112.94	65	27.78
1993.	Jan (acpehalus)	234	71.02	101.91	57	24.36
1994.	Jamo (thewindy)	233	97.00	123.03	93	39.91
1995.	Syed Sheraz (syedsherazarshad)	233	32.53	50.38	24	10.30
1996.	strgn (strgn)	233	30.40	42.42	24	10.30
1997.	Stanislav (stanmkh)	233	90.32	124.68	64	27.47
1998.	Saptarshi (lamda_cdm_10)	233	59.88	77.26	50	21.46
1999.	Jagadeeswar (jd_300)	233	76.86	103.43	66	28.33
2000.	Buchock (buchok)	233	51.97	76.01	23	9.87
2001.	Abby (aeheffington)	233	111.10	135.39	116	49.79
2002.	Sushant (sushant09)	233	72.82	88.35	58	24.89
2003.	Vishwajeet Prasad (vishwaje...	232	62.95	82.22	69	29.74
2004.	Ralph Angelo (slow_penguin)	232	85.27	111.21	53	22.84
2005.	Nistha Nakarmi (simply_nisu)	232	57.88	77.49	39	16.81
2006.	Jerzy (mr_avocado)	232	60.20	76.74	42	18.10
2007.	Kotai (kotai)	232	74.16	100.37	56	24.14
2008.	Tootels (joenasha10)	232	113.12	151.52	92	39.66
2009.	Harry (hai1912001)	232	56.80	72.32	18	7.76
2010.	Gojou (gojou_)	232	28.02	43.03	32	13.79
2011.	🧋origin = 𝐓𝐚𝐢�...	232	86.29	110.21	64	27.59
2012.	Chumchum (aldzia)	232	97.61	127.89	148	63.79
2013.	acg (acg26)	232	86.86	118.16	63	27.16
2014.	fassasin (fassasin)	232	67.55	91.95	63	27.16
2015.	aryan (_ar__yan_)	232	50.31	68.12	57	24.57
2016.	Jaime Gabriel (_jetdoza)	231	88.38	123.70	76	32.90
2017.	Boba (tapiocaman)	231	84.85	110.28	71	30.74
2018.	Jane (sarf)	231	85.35	113.61	81	35.06
2019.	RainbowDude (rainbowdudenon...	231	114.69	159.45	93	40.26
2020.	projectfupagain (projectfup...	231	91.62	110.20	78	33.77
2021.	Ahmed (nesbmido)	231	129.65	168.18	142	61.47
2022.	Temple (mason_carlson)	231	89.44	127.78	90	38.96
2023.	Quinn (magicsoap444)	231	42.62	64.07	34	14.72
2024.	Dhayanandh (ken_adams)	231	104.41	121.91	91	39.39
2025.	Doniyorbek (doniyorbek7376)	231	60.16	76.52	39	16.88
2026.	David (dave_em)	231	97.84	120.33	45	19.48
2027.	nice'nslow (annoyingkid)	231	129.49	159.10	141	61.04
2028.	William (willmart16)	230	112.05	134.19	120	52.17
2029.	Eric (qwarts)	230	105.53	138.65	83	36.09
2030.	Jude (philivey)	230	76.48	96.88	47	20.43
2031.	Murat (nocs782)	230	65.56	85.93	49	21.30
2032.	jamal (jamalkhan651432)	230	46.78	61.93	21	9.13
2033.	galei (galei)	230	100.75	139.88	92	40.00
2034.	epic (epicrako123)	230	93.50	117.12	118	51.30
2035.	throw (bomnom)	230	113.31	147.38	129	56.09
2036.	HATE LAG! (11fingerstypist)	230	115.23	144.48	192	83.48
2037.	Matthew (yossarian_milo_22)	229	93.97	110.54	71	31.00
2038.	Martin (watchieboy)	229	96.77	128.67	87	37.99
2039.	Tutuko (tutuko)	229	50.58	60.75	20	8.73
2040.	thotbox (thotb0x)	229	72.10	95.36	58	25.33
2041.	M (springfield12)	229	112.36	134.83	135	58.95
2042.	prashant (prashant1847)	229	59.10	77.91	41	17.90
2043.	Reverend Poo Poo Bum (poopy...	229	86.31	114.32	66	28.82
2044.	obada (obada_yahya)	229	98.60	127.83	83	36.24
2045.	Niels (nielsjensen)	229	111.52	153.85	106	46.29
2046.	Angela (mee_123)	229	39.15	51.08	9	3.93
2047.	H7ti guy (eternality)	229	113.46	155.26	98	42.79
2048.	Emilio (emilioc)	229	84.92	118.58	54	23.58
2049.	⚡DVORAK (dvorak_mg)	229	105.31	139.59	107	46.72
2050.	Brandon (aceryeung)	229	76.05	109.67	53	23.14
2051.	Niket (daspacebar)	229	70.69	94.67	61	26.64
2052.	Yasser (yass_mg)	229	59.49	71.83	40	17.47
2053.	Tuukka (sblankg)	228	89.77	110.74	83	36.40
2054.	Minnie (minniemouselondon)	228	87.86	111.45	75	32.89
2055.	John (kingpigeon)	228	70.92	96.62	56	24.56
2056.	Killyan (killyan)	228	94.72	127.28	89	39.04
2057.	Pradhumn (darkinferno)	228	52.72	72.05	34	14.91
2058.	bambang (breakingkeyboards)	228	86.06	106.73	77	33.77
2059.	INDIAN (armaan25)	228	69.89	89.69	53	23.25
2060.	E150D (1omar1)	228	42.41	62.17	23	10.09
2061.	AdamS (adamswabel)	228	68.72	88.50	47	20.61
2062.	zaoad (zaoad)	227	56.33	71.43	26	11.45
2063.	Drovor (wwinder)	227	108.66	143.11	110	48.46
2064.	JAFFAR (thetypingfreak)	227	54.78	82.22	47	20.70
2065.	Shahryar (srashid3)	227	65.03	90.08	51	22.47
2066.	Girl (piemaniac)	227	84.78	113.74	63	27.75
2067.	Royce (panda_7)	227	47.79	60.49	24	10.57
2068.	Jacob (nutsak)	227	81.94	110.00	60	26.43
2069.	Mike (mirkzzz)	227	67.88	83.80	27	11.89
2070.	Jazz (melotea)	227	77.74	108.78	52	22.91
2071.	Joy (joypark21)	227	77.26	118.02	55	24.23
2072.	Ian (iantu)	227	75.26	92.57	51	22.47
2073.	Aaron (a_aron)	227	57.01	74.64	32	14.10
2074.	ARW🔴 (appleredwarrior)	227	117.71	152.17	132	58.15
2075.	QDDFR (qddfr)	227	54.05	77.03	44	19.38
2076.	Hussain (sanpilot)	226	96.46	126.39	86	38.05
2077.	omid (omidhopeful)	226	69.52	87.03	48	21.24
2078.	Neil Franco (neilprangko)	226	116.63	158.38	130	57.52
2079.	kemp (imnotflamez)	226	92.48	143.48	74	32.74
2080.	Someone (gluroy)	226	57.40	72.77	40	17.70
2081.	Rafael (fegelein1234)	226	132.02	169.54	167	73.89
2082.	fares (faressonar)	226	46.39	63.08	24	10.62
2083.	Christian (amici117)	226	108.45	141.44	113	50.00
2084.	bruh_momentum (travis358)	225	104.24	126.13	112	49.78
2085.	Flying fingers (tg_gamer)	225	41.64	58.08	15	6.67
2086.	Axel (scorchill)	225	63.76	79.16	42	18.67
2087.	ak1ra (liamprogamerz)	225	77.70	95.76	56	24.89
2088.	Night (anemonighteye)	225	70.98	104.02	55	24.44
2089.	Jared (jaredintyper)	225	88.46	111.62	75	33.33
2090.	sinc02 (sinc02)	224	82.05	104.25	71	31.70
2091.	sanny (scd92318)	224	81.05	115.54	66	29.46
2092.	Pontus (ponhav)	224	113.45	142.15	114	50.89
2093.	mohamed (mohamed_1800)	224	48.19	61.16	16	7.14
2094.	Janis (janisl1993)	224	71.45	92.82	56	25.00
2095.	Ankh (ankhaann)	224	39.73	52.09	14	6.25
2096.	Ghazi (lynnackerman)	224	65.58	82.47	46	20.54
2097.	Antonio (xxaposxx)	223	52.08	73.08	27	12.11
2098.	BeltBoy (singbearcar)	223	56.91	71.34	29	13.00
2099.	mostafa (mostafa_tantawy)	223	61.56	75.65	43	19.28
2100.	mbi (mbi_)	223	36.89	49.22	22	9.87
2101.	Khai (khaikhai2)	223	114.23	149.44	120	53.81
2102.	jia-da-kong (jiadakong)	223	61.38	74.63	57	25.56
2103.	phantom (hrithikhack007)	223	59.05	82.47	33	14.80
2104.	Jonathan (fonsdal)	223	74.79	97.38	56	25.11
2105.	Nick (checksind)	223	109.93	133.91	106	47.53
2106.	BR (brdiesel)	223	109.73	131.32	93	41.70
2107.	Bùi (blackfl_12)	223	79.87	98.80	72	32.29
2108.	aditya (aditya1003)	223	47.19	56.89	20	8.97
2109.	* (000100020003)	223	73.34	95.03	56	25.11
2110.	soenke (stinkfuhl)	223	51.91	68.11	24	10.76
2111.	Zain (zainabb)	222	63.79	84.08	56	25.23
2112.	Adm1n (vilius8)	222	110.69	136.11	109	49.10
2113.	tris (trisywc)	222	89.23	116.94	57	25.68
2114.	Hendo (slimshadylfc)	222	94.67	124.97	95	42.79
2115.	Rony (ravneet_b)	222	92.25	120.73	81	36.49
2116.	kyle (poyser)	222	76.46	94.26	54	24.32
2117.	mini (kharkongor)	222	80.09	102.96	63	28.38
2118.	Darth (darthverde)	222	77.07	106.82	56	25.23
2119.	August (august148)	222	46.60	59.21	29	13.06
2120.	arindam (ari2007b)	222	54.45	71.91	27	12.16
2121.	Andie (andieeee)	222	74.78	123.19	72	32.43
2122.	tstats[alexander98] (alexan...	222	64.26	83.02	35	15.77
2123.	Abubakar (abubakaravg)	222	47.32	65.58	18	8.11
2124.	tstats[cartax] (cartax)	222	51.76	66.93	24	10.81
2125.	xiaobao (xiaobaomontgomery)	221	43.98	59.12	16	7.24
2126.	quantum (sexhaver25)	221	93.23	136.94	56	25.34
2127.	Rinmawia (rinmawia)	221	69.87	90.27	53	23.98
2128.	Junkie (qwert_noob)	221	69.02	98.48	46	20.81
2129.	nirmit (nirmit0)	221	64.83	80.08	40	18.10
2130.	NikoArc (ktp2222)	221	56.87	78.72	27	12.22
2131.	Philipp (dasdrache)	221	45.29	57.92	22	9.95
2132.	(altrocality)	221	121.19	154.58	117	52.94
2133.	Jocho Muaguadabo (alezander...	221	108.33	136.99	98	44.34
2134.	Cheyenne (cheyennebuchanan)	221	36.16	53.07	9	4.07
2135.	Zeeshan (zeeshan13)	220	94.47	131.94	74	33.64
2136.	Richard (tbone001)	220	84.15	105.43	57	25.91
2137.	Wilson (starkeyqiu)	220	78.79	106.02	56	25.45
2138.	school (modernmarauder)	220	93.24	132.42	81	36.82
2139.	Božidar Grgur (marcipanko)	220	68.60	87.13	56	25.45
2140.	Sky man (koolienavy)	220	99.75	135.87	91	41.36
2141.	Dean (dino22)	220	59.74	71.91	94	42.73
2142.	Deepesh (codingdeepesh)	220	38.88	55.79	18	8.18
2143.	clgq (clgq)	220	76.79	99.89	44	20.00
2144.	Bloxxer (bloxxerboi_rblx)	220	59.88	88.77	46	20.91
2145.	Harmonic (blitzzzz)	220	88.42	116.35	65	29.55
2146.	Bekboalt (bekbo_0)	220	38.00	47.50	11	5.00
2147.	bryan (bczw)	220	135.33	162.62	173	78.64
2148.	Taiwan is a country (17lingh1)	220	85.07	109.13	65	29.55
2149.	jnk (joelnanakwaku)	220	81.90	104.93	64	29.09
2150.	Yash (mitrapandit)	220	55.92	75.26	43	19.55
2151.	(timjeffery44)	219	143.55	268.06	183	83.56
2152.	Sahaj (sahaj01)	219	62.15	80.34	44	20.09
2153.	Robbe (robbelbobel)	219	83.25	106.91	72	32.88
2154.	Guest (nherbe_3)	219	62.78	91.45	40	18.26
2155.	Mohamad (mohamadasghari)	219	75.67	107.10	50	22.83
2156.	lan (lenioniali)	219	48.72	63.14	22	10.05
2157.	sunny (kamal787)	219	31.67	44.09	14	6.39
2158.	John (blazian11111)	219	103.05	143.47	81	36.99
2159.	Aryan (arcuh)	219	85.05	112.37	76	34.70
2160.	Andy (andyrox)	219	72.15	94.51	74	33.79
2161.	Jeffrey (xxpreheattheoven)	218	89.35	110.06	82	37.61
2162.	diva (vampirediva)	218	90.29	123.27	55	25.23
2163.	ASHISH (ashish_typer)	218	53.23	74.14	23	10.55
2164.	amanmishra (amanmishra)	218	51.42	74.25	23	10.55
2165.	Wan Iskandar (wanis02)	218	50.79	68.37	28	12.84
2166.	tayoshu (tayoshu)	217	76.14	93.51	57	26.27
2167.	not (not_vidhu)	217	71.65	95.81	67	30.88
2168.	Jonathan (jonapedia)	217	90.85	121.23	62	28.57
2169.	Marcus (flowerskullbeige)	217	86.68	115.24	61	28.11
2170.	chang (chang1)	217	126.46	155.13	121	55.76
2171.	Wasif (waxif_dad)	216	45.56	63.11	26	12.04
2172.	Shibasis (ship9x)	216	82.16	104.50	73	33.80
2173.	MiamMiam (miammiam100)	216	60.97	76.28	43	19.91
2174.	iTay (mengleten)	216	92.62	122.22	78	36.11
2175.	Danny (lifeupsidedown)	216	70.29	87.19	47	21.76
2176.	J (leathface23)	216	62.06	76.95	37	17.13
2177.	Jude (jfendo)	216	81.09	109.76	63	29.17
2178.	Tomáš (eyzi25)	216	85.72	108.09	52	24.07
2179.	EnkaOsaru (enkaosaru)	216	97.89	124.45	104	48.15
2180.	rocket (dk0063)	216	51.71	67.99	12	5.56
2181.	Minä (arabwinner)	216	110.06	128.48	96	44.44
2182.	Jarred (reed_19)	216	40.34	55.05	15	6.94
2183.	Dima (zormik)	215	74.68	97.22	67	31.16
2184.	youssef (youssefuser)	215	31.43	40.98	24	11.16
2185.	UNSALEK #7379 discord (unsa...	215	90.41	123.61	55	25.58
2186.	Sanket (newbie24082002)	215	72.85	99.53	59	27.44
2187.	King (kingmaverick07)	215	62.10	80.35	46	21.40
2188.	joann (joannyo)	215	60.38	91.45	51	23.72
2189.	J (jj024)	215	54.64	74.63	20	9.30
2190.	JV (jibs12)	215	83.31	98.14	61	28.37
2191.	Kuro (horikta)	215	60.93	85.46	48	22.33
2192.	Gautam kumar pandey (gautam...	215	42.45	54.03	16	7.44
2193.	Beth (creepmother)	215	92.29	114.01	71	33.02
2194.	Anh (billybean__)	215	103.32	131.33	83	38.60
2195.	saerith (arabianghosthaunting)	215	220.94	281.09	147	68.37
2196.	Aaron (aaron5457)	215	61.86	78.02	38	17.67
2197.	Rohit (rawheattt)	215	50.69	67.23	18	8.37
2198.	Gulam Mustafa (mr_x003_)	215	30.10	44.92	19	8.84
2199.	Spencer (noctis0923)	215	78.84	106.33	67	31.16
2200.	Vinayak (vinrana)	214	70.16	89.58	65	30.37
2201.	Lian (paullian)	214	83.63	104.78	55	25.70
2202.	Nootch (nootch)	214	112.05	146.02	122	57.01
2203.	Lin (ltf0501)	214	77.51	96.15	44	20.56
2204.	Abudlla.Marofi04 (jonsnow21)	214	44.71	58.46	25	11.68
2205.	Isra (israabosada)	214	32.23	44.05	21	9.81
2206.	Viktoras (haeven)	214	84.35	113.10	69	32.24
2207.	Edmund (emmit3)	214	65.53	90.91	46	21.50
2208.	Dyer_Colemak (dyer500)	214	86.07	124.41	63	29.44
2209.	Alex (arint)	214	87.60	113.16	71	33.18
2210.	Ariffin (ariffin)	214	99.67	127.89	86	40.19
2211.	aerospike (aerospike)	214	59.61	83.07	43	20.09
2212.	Ems (emman123)	214	52.92	70.79	22	10.28
2213.	Stuipedd (stuipedd)	213	82.36	106.68	62	29.11
2214.	Byunghyun (stringbottle)	213	74.13	97.47	52	24.41
2215.	Ryan (relaxin)	213	143.23	181.36	131	61.50
2216.	Brian (pocket_ace)	213	78.15	94.60	56	26.29
2217.	Cue (cuewitiwat)	213	72.69	97.79	50	23.47
2218.	Chimney (chimneywastaken)	213	66.45	82.42	52	24.41
2219.	Shannon (caseius)	213	86.11	110.22	78	36.62
2220.	ryan (anonymousboy321)	213	128.60	154.10	149	69.95
2221.	Andrew (andumpling)	213	95.82	118.37	91	42.72
2222.	victor (hungry_panda)	213	43.36	59.58	12	5.63
2223.	Hazem (zomaaa23)	212	61.33	79.01	41	19.34
2224.	Dog acc (vick02)	212	129.05	154.08	130	61.32
2225.	noah (randylehey)	212	92.69	119.81	74	34.91
2226.	:^) (kyeavnign)	212	130.60	176.13	148	69.81
2227.	FrozenCroissant (frozencroi...	212	100.47	126.98	100	47.17
2228.	exodia (exodiaa)	212	109.24	129.60	106	50.00
2229.	Alutic (alutic)	212	91.84	114.13	90	42.45
2230.	ROOZBEH (verybadboy)	211	63.02	89.59	37	17.54
2231.	Scott (typist2021)	211	64.55	79.52	56	26.54
2232.	Mr.Typist (typer456new)	211	60.26	78.29	27	12.80
2233.	ExtraSauce (thundertyping)	211	68.78	99.72	47	22.27
2234.	kbd warior (spykids3)	211	101.96	139.93	101	47.87
2235.	Monroe (monroeshindelar)	211	87.57	111.47	53	25.12
2236.	Ghulam (malikgd65)	211	47.62	70.61	20	9.48
2237.	LA LUNA, LA BELLA LUNA (fee...	211	120.60	161.68	125	59.24
2238.	👻 (damoru)	211	115.39	158.97	102	48.34
2239.	Aarni (aarnib)	211	91.01	119.36	81	38.39
2240.	Arun (arunbastola)	211	58.25	71.88	52	24.64
2241.	Yuhang (yuhang0722)	210	105.51	137.06	96	45.71
2242.	Grzegorz (ulxori)	210	63.74	81.66	51	24.29
2243.	Benny (typervain)	210	82.60	106.18	44	20.95
2244.	Tahir (tahir_iqbal)	210	100.63	129.73	88	41.90
2245.	Samvel (samveland)	210	89.91	125.32	62	29.52
2246.	Ryan (rinselmann)	210	87.99	103.57	70	33.33
2247.	duglass (rahafduglass)	210	62.43	84.02	46	21.90
2248.	Myil (pink_coder0518)	210	51.31	91.51	28	13.33
2249.	Morin (lordgroovy)	210	83.07	106.02	67	31.90
2250.	Mr. A (itsabhi01)	210	82.74	106.91	90	42.86
2251.	Juanpa (gokias_1234)	210	70.11	91.70	50	23.81
2252.	Dras (dras227)	210	59.06	77.90	39	18.57
2253.	Kratagya (chutiyatyper)	210	77.48	98.83	40	19.05
2254.	elite (beatagent)	210	54.39	69.35	19	9.05
2255.	Richard (allacrity)	210	71.47	86.02	40	19.05
2256.	Ayman (akwah)	210	77.09	100.36	58	27.62
2257.	odannnnnnn (quietkid)	209	82.17	111.19	53	25.36
2258.	oddblob3000 (oddblob3000)	209	106.90	134.00	98	46.89
2259.	Liampbjray (liampbjray)	209	72.48	97.45	50	23.92
2260.	kaloyan (kalci)	209	71.58	96.61	46	22.01
2261.	Doiv (doiv23)	209	85.99	112.45	62	29.67
2262.	Dmitriy (dj1vs)	209	69.67	89.07	54	25.84
2263.	Bennett (bnnttnwhk)	209	75.83	95.27	50	23.92
2264.	i am (ashou)	209	100.51	141.45	82	39.23
2265.	Saken (hareket)	209	36.76	53.20	14	6.70
2266.	zetrorectar (zetrorectar)	209	48.11	62.24	25	11.96
2267.	Rui Alexandre (tapadinhas)	208	50.13	64.52	16	7.69
2268.	shaun (shaunbot_123)	208	68.40	91.34	55	26.44
2269.	rt (rtizzle)	208	69.35	92.94	62	29.81
2270.	rahul (rku05)	208	46.38	63.97	22	10.58
2271.	𝐱𝐨𝐦𝐞𝐧𝐢�...	208	78.88	104.17	53	25.48
2272.	kyubkubkubkubyub (kyubkubku...	208	97.89	136.78	88	42.31
2273.	jw (jw_c)	208	59.97	81.28	35	16.83
2274.	Esman (hedwyn_the_nomad)	208	74.42	97.71	60	28.85
2275.	GaN (ganthegreat)	208	50.88	75.09	36	17.31
2276.	Dalia (snoppy366)	208	49.07	64.11	27	12.98
2277.	zaid (xoxygenkillerx)	207	68.98	95.24	50	24.15
2278.	Soyuzbek (soyuzbek)	207	67.65	91.86	47	22.71
2279.	SirAlig (siralig)	207	85.37	107.31	57	27.54
2280.	Joe (f1rest0rm)	207	64.47	83.59	39	18.84
2281.	glenn (bukseng)	207	98.85	122.09	96	46.38
2282.	Bean (beansbeansbeans)	207	84.71	106.33	41	19.81
2283.	ss (aaassssss)	207	29.21	40.15	25	12.08
2284.	Omid (zerodarkshadow)	206	66.25	89.98	52	25.24
2285.	Nils (snils)	206	75.12	103.87	49	23.79
2286.	Conspiracy (realkingofgames)	206	91.98	112.54	65	31.55
2287.	Afsal (npafsal)	206	59.75	75.39	55	26.70
2288.	Uncle John Jr. the 5th (che...	206	81.49	108.86	51	24.76
2289.	| (canvaslol)	206	77.33	99.52	57	27.67
2290.	Ivandro (bigivel)	206	90.15	107.99	75	36.41
2291.	God (godalmighty_)	206	26.37	41.74	38	18.45
2292.	Nope (_sav)	205	83.13	98.60	61	29.76
2293.	Noob (_anto_200)	205	35.83	52.33	22	10.73
2294.	Khai (superoiishi)	205	88.12	106.31	78	38.05
2295.	Shaishav (shaishav)	205	55.06	73.35	41	20.00
2296.	Zor-Pieu (POJUN-Mechanic) (...	205	84.58	103.20	48	23.41
2297.	mr (mrantik1)	205	53.46	69.72	28	13.66
2298.	Neo (meoo)	205	55.41	83.19	29	14.15
2299.	Mathias (mattsric)	205	72.49	89.88	56	27.32
2300.	Maheriniaina tstats[kevinrs...	205	84.69	111.69	54	26.34
2301.	Grant (grantly)	205	97.61	131.90	90	43.90
2302.	Gnarly (gnarlydawg)	205	87.28	110.08	53	25.85
2303.	Reiner Rekado Bisara (reine...	205	48.72	65.58	33	16.10
2304.	raj bardhan singh rathore (...	205	42.87	55.74	24	11.71
2305.	Tyler (superkai65)	204	99.49	127.42	77	37.75
2306.	Ryan (ronethenorseman)	204	84.57	102.86	47	23.04
2307.	i'm slow (pndspirit)	204	94.97	124.61	78	38.24
2308.	(nnas)	204	137.39	164.68	165	80.88
2309.	Ngor (nagwick)	204	63.27	80.57	55	26.96
2310.	JH (hou32hou)	204	86.85	107.88	59	28.92
2311.	Ali (hardstone)	204	67.26	90.58	38	18.63
2312.	Gert (hansonagarrett)	204	73.45	92.08	47	23.04
2313.	DP (dragonphoenix)	204	57.27	68.25	33	16.18
2314.	Darren (darrensey)	204	90.14	122.16	73	35.78
2315.	Bas (basawasa)	204	75.41	98.24	55	26.96
2316.	Golujs2000 (avinashjs2000)	204	52.48	70.17	20	9.80
2317.	Juan (vlect2)	204	70.45	89.66	56	27.45
2318.	Sadie (thotchakra)	203	82.29	108.05	70	34.48
2319.	Jayson (thezeful)	203	77.65	100.03	80	39.41
2320.	supermonkey (sup3rm0nk3y)	203	80.10	98.23	44	21.67
2321.	Joshua (shaggymuffin23)	203	88.43	104.39	69	33.99
2322.	Ranch (ranchie)	203	80.38	107.34	60	29.56
2323.	Ragnar (ragnar000lothbrok)	203	67.13	80.75	46	22.66
2324.	Pavan (pavan1000)	203	54.18	65.46	17	8.37
2325.	Mattias (matejko203)	203	44.67	64.95	18	8.87
2326.	Gordon (gordon_ramsay)	203	87.32	106.13	63	31.03
2327.	Fearo (fearowastaken)	203	82.16	107.84	64	31.53
2328.	runa (dawn_89)	203	57.29	71.67	30	14.78
2329.	EpsteinRN (chqnges)	203	141.14	173.40	150	73.89
2330.	Byron (byrontan)	203	100.19	125.81	99	48.77
2331.	Đỗ (bigcatyoyo)	203	72.13	90.30	47	23.15
2332.	Ta-Wei (waynetu)	202	97.18	111.64	88	43.56
2333.	Trent (tdavis23540)	202	82.96	109.41	55	27.23
2334.	🤫 (semajames)	202	152.85	195.47	162	80.20
2335.	Kim (rsoler)	202	67.80	88.43	35	17.33
2336.	3.14 (rom3_141592)	202	87.98	118.75	47	23.27
2337.	Patrik (pbody)	202	79.22	100.66	52	25.74
2338.	Mahjabin (mahjabin08)	202	31.27	40.62	17	8.42
2339.	Khizer (khizlaw)	202	91.79	114.68	58	28.71
2340.	Non-quit (hitman2207)	202	112.21	136.72	106	52.48
2341.	harshit (harshit712)	202	73.73	102.39	54	26.73
2342.	Feariscool (fearisdumb)	202	60.30	79.45	45	22.28
2343.	Donovan (donovanle)	202	92.82	121.21	64	31.68
2344.	bataa (batuchka)	202	60.29	83.32	49	24.26
2345.	ben (benji2k)	202	90.79	114.79	80	39.60
2346.	Vu (vuquynghia2)	201	61.95	80.41	40	19.90
2347.	Luna (vexara)	201	109.56	141.93	95	47.26
2348.	Nervous (unselfishnervousha...	201	78.98	103.76	60	29.85
2349.	TennisGOAT (tennislegend1234)	201	60.66	79.23	32	15.92
2350.	adel (thenewb)	201	47.48	60.91	17	8.46
2351.	w (shwilliam)	201	80.63	99.98	49	24.38
2352.	Pokeman (poke_man)	201	86.84	113.97	64	31.84
2353.	Ox (oxtookbronze)	201	83.48	103.85	59	29.35
2354.	chupapi (nerve784126)	201	61.06	82.21	45	22.39
2355.	Sasha (moongue)	201	59.78	78.71	34	16.92
2356.	Ismail (ismailo)	201	92.59	122.04	85	42.29
2357.	Bruno (brutal_posso1)	201	42.20	55.63	9	4.48
2358.	et (amogus_irl)	201	79.83	104.60	58	28.86
2359.	:( (altrocality_dvorak_acc)	201	121.44	145.99	108	53.73
2360.	igs (x7041)	200	110.28	136.78	101	50.50
2361.	Krimmson (wrk4thjkr)	200	60.00	79.12	24	12.00
2362.	turtlesrule (turtlesrule)	200	133.51	173.00	125	62.50
2363.	steel (steelmax1214)	200	68.56	88.98	63	31.50
2364.	RI (speedraceriyer)	200	85.52	119.92	50	25.00
2365.	Luka (soleesoki)	200	75.20	102.31	58	29.00
2366.	Deathnote (sanjay_kumar)	200	57.58	83.36	38	19.00
2367.	Robert (rrobertt3137)	200	92.99	122.84	75	37.50
2368.	RacerTracer (racertracer)	200	44.69	63.25	14	7.00
2369.	oni (onifire)	200	79.33	100.32	47	23.50
2370.	Murcury (murcury_)	200	60.33	76.85	40	20.00
2371.	m0nsteR (m0nsta321)	200	105.03	128.90	98	49.00
2372.	Noman (khan_noman14)	200	95.13	115.12	65	32.50
2373.	jerome (jonaslabryinth)	200	89.27	113.67	72	36.00
2374.	Sensei (jjxjacpot)	200	88.24	114.16	76	38.00
2375.	Hussein (husseinabbas)	200	47.96	61.49	17	8.50
2376.	Himanshu (himanharsh)	200	53.47	66.82	25	12.50
2377.	hein (heinthant)	200	71.51	92.61	40	20.00
2378.	Hal (hals11)	200	107.09	139.62	90	45.00
2379.	FunkyChunkyMon (funkychunky...	200	90.04	121.03	61	30.50
2380.	Raunak (englishassignment)	200	99.73	130.78	81	40.50
2381.	Dastan (dastangosu)	200	82.77	102.99	71	35.50
2382.	Drew (bigboisausage)	200	100.18	134.57	79	39.50
2383.	Sean Wrona (arenasnow2)	200	183.61	226.45	182	91.00
2384.	javaMiddle (java_coder)	200	37.91	55.95	11	5.50
2385.	Ivan (sakhman)	199	59.63	80.39	32	16.08
2386.	Mirjalol (mirjaloltv)	199	44.71	58.51	21	10.55
2387.	Mariam (mariamgharraph)	199	54.51	80.79	28	14.07
2388.	Phung (longphung151198)	199	94.99	117.37	89	44.72
2389.	TribalAxe (darkulas)	199	76.08	96.52	50	25.13
2390.	Cameron (cameronicheese)	199	101.22	137.52	81	40.70
2391.	guest (okokok1234)	199	68.58	90.07	36	18.09
2392.	J (jdubc)	199	82.18	113.82	56	28.14
2393.	Manami (manami_kun)	199	61.69	85.75	28	14.07
2394.	Amorphous (tawseef)	198	56.31	69.72	20	10.10
2395.	McMac2 (sjm46)	198	108.91	134.41	97	48.99
2396.	Shivanju (shivanju)	198	75.21	91.37	47	23.74
2397.	rohan (rohanktksu)	198	51.54	81.98	17	8.59
2398.	helga (pataki29)	198	43.68	61.30	18	9.09
2399.	cody (ocdy1001)	198	87.34	109.40	65	32.83
2400.	medD (mistermask___)	198	92.28	132.69	74	37.37
2401.	Keo (mightkeo)	198	69.85	91.39	39	19.70
2402.	Liu (liusbl)	198	107.11	125.47	90	45.45
2403.	Elias (eddyede)	198	73.55	97.68	38	19.19
2404.	🌸Peaches & Cream (easy_g...	198	117.75	143.53	90	45.45
2405.	Dhruv (dhruvarora)	198	66.18	85.87	45	22.73
2406.	kirito (boscomk3)	198	61.14	78.68	38	19.19
2407.	ᕙ( ͡◉ ͜ ʖ ͡◉)ᕗ ...	198	78.94	106.93	55	27.78
2408.	yassine (yassie)	197	52.29	74.36	26	13.20
2409.	toomuchads (toomuchads)	197	78.98	103.47	50	25.38
2410.	Cornelius (salibzz)	197	97.09	120.56	68	34.52
2411.	rohan (rohan_verma__)	197	74.73	92.87	36	18.27
2412.	yuuth.com (roadto5wpm)	197	112.78	149.72	86	43.65
2413.	incendiary (returnoftheince...	197	162.81	196.84	177	89.85
2414.	Pogfrog (pogfrog1)	197	112.62	137.89	92	46.70
2415.	Jo (noone21)	197	90.38	134.96	84	42.64
2416.	Michael (michaelchristian024)	197	96.19	131.46	76	38.58
2417.	logan (lacton44)	197	84.27	110.76	70	35.53
2418.	Kakini007 (kakini)	197	65.70	96.34	34	17.26
2419.	Jynx (jynx__)	197	73.51	93.48	47	23.86
2420.	J (jellyfiszh)	197	81.87	114.28	60	30.46
2421.	haniel monki (ivious)	197	75.08	100.08	45	22.84
2422.	Cain (gigabite)	197	69.07	90.49	53	26.90
2423.	Robyn (ghastless_gibus)	197	74.05	101.30	54	27.41
2424.	Danny (dannyzzzzz)	197	101.38	128.31	76	38.58
2425.	chigala (chigalakingsley)	197	47.48	74.86	19	9.64
2426.	Arasu (arasu)	197	106.63	137.73	94	47.72
2427.	Nitin (xintacious)	196	73.26	95.09	34	17.35
2428.	wonder wave (wonderwave2)	196	107.55	130.46	90	45.92
2429.	Sparsh (sparsh123)	196	91.58	126.74	59	30.10
2430.	Mr. (serallfreedbear)	196	101.70	128.68	91	46.43
2431.	Pheresint (pheresint)	196	95.89	117.26	68	34.69
2432.	Peter (petejim)	196	78.39	100.60	42	21.43
2433.	Leo (leo8786)	196	156.46	178.66	167	85.20
2434.	tstats[kayeii] (kayeii)	196	85.87	105.89	56	28.57
2435.	Juan (juanma09)	196	38.31	53.45	9	4.59
2436.	Emperor (aranjani)	196	63.00	83.71	41	20.92
2437.	Sotonation (akatrell)	196	95.17	113.40	67	34.18
2438.	vishy (drdrunkstain)	196	53.94	75.89	27	13.78
2439.	Jairdan (twin_turbo_two)	196	61.28	84.89	64	32.65
2440.	Ben (wolfson)	196	156.46	178.66	167	85.20
2441.	Technician (tech23)	195	72.67	96.23	60	30.77
2442.	Shashank (shashank204)	195	86.34	102.23	43	22.05
2443.	Patrick (ricccccckkkkkk)	195	75.08	103.73	56	28.72
2444.	ErrorOp (error_op)	195	44.48	63.07	19	9.74
2445.	cold (coldmind)	195	74.74	95.91	51	26.15
2446.	Aleph (catblahfishblah)	195	73.40	103.21	58	29.74
2447.	Bartłomiej (bodidogg)	195	40.74	56.56	19	9.74
2448.	keyvan (fayazsoleymani)	195	61.53	79.11	33	16.92
2449.	Zuhair (zishraq)	194	83.31	97.62	43	22.16
2450.	Jackson (united9jackson)	194	91.91	129.44	75	38.66
2451.	west (supernova_00)	194	63.43	87.52	32	16.49
2452.	RIP Byron (sir_rebral_palsy)	194	140.36	180.69	139	71.65
2453.	not rage (sadge47)	194	86.35	105.72	50	25.77
2454.	qbaracerr (qbajanowski)	194	50.82	67.80	13	6.70
2455.	Naha's (naha_26)	194	43.00	59.57	22	11.34
2456.	Mehedi Islam (mehediislamri...	194	68.34	96.00	40	20.62
2457.	marsistX (marsistx)	194	74.09	88.95	45	23.20
2458.	Jujee (jujee_poo)	194	55.33	78.03	47	24.23
2459.	jkdixit (jkdixit)	194	42.62	56.77	14	7.22
2460.	Fuzusu (fuzusu)	194	94.42	122.97	79	40.72
2461.	frank (frankpc)	194	78.74	99.97	55	28.35
2462.	Anubhav4813 (etra_567)	194	70.70	103.25	47	24.23
2463.	code_brains (coderider)	194	104.25	138.57	92	47.42
2464.	Ren (landonren)	194	31.48	45.43	11	5.67
2465.	Stefan (_tensor)	193	99.24	122.11	94	48.70
2466.	FGS (simo666)	193	91.60	121.46	63	32.64
2467.	Brys (seabyzz)	193	56.78	69.19	21	10.88
2468.	Thijs (qazygv)	193	44.54	63.88	18	9.33
2469.	niceu (nice_u)	193	94.58	122.22	62	32.12
2470.	Hai (haitathoc)	193	75.00	97.12	37	19.17
2471.	Viktor (milkboofer)	193	62.00	78.12	37	19.17
2472.	stt (soulert)	193	63.81	85.00	42	21.76
2473.	Bo (combobombo)	193	40.68	58.80	10	5.18
2474.	Stefan (stefanbm)	192	77.24	91.80	50	26.04
2475.	Anthony (smashingted)	192	69.56	92.74	51	26.56
2476.	TTVronness_ (ronneclee)	192	96.62	119.91	63	32.81
2477.	JanBa (pythonbyte)	192	96.66	127.46	68	35.42
2478.	Himal (panthimal)	192	55.84	71.33	22	11.46
2479.	Matt (mattymarsh)	192	103.38	126.53	89	46.35
2480.	Finally (finallyyes)	192	63.64	84.59	66	34.38
2481.	erbol (erbolxac)	192	37.60	51.06	11	5.73
2482.	chachasoba (chachasoba)	192	104.99	126.14	101	52.60
2483.	Chetan (ch374n)	192	106.22	136.03	85	44.27
2484.	A (b04501012)	192	61.48	75.43	36	18.75
2485.	Pasin (_hello_world)	191	68.53	86.91	39	20.42
2486.	Weed (weeddinosaur)	191	89.41	112.39	87	45.55
2487.	Troy (troy517545)	191	67.70	89.16	40	20.94
2488.	new keyb who dis(k3 max) (s...	191	104.98	133.70	82	42.93
2489.	Punit (punitsubudhi)	191	50.80	69.90	35	18.32
2490.	Andreas (mangabro)	191	68.81	87.01	39	20.42
2491.	Mustafa (leo_messi_)	191	60.88	80.00	38	19.90
2492.	👻 (james7890)	191	86.80	118.32	53	27.75
2493.	Farameer (farameer1)	191	99.41	123.72	69	36.13
2494.	Earlvin (earlvin14)	191	124.62	146.79	111	58.12
2495.	Death_Dragon (dead_beast)	191	50.47	63.61	15	7.85
2496.	Chiaki (chickhiaki)	191	47.47	68.55	18	9.42
2497.	Ahnaf (ahnaf75)	191	84.24	101.52	53	27.75
2498.	Abdul (asalam)	191	30.80	39.84	11	5.76
2499.	Polar (polar_6275)	191	67.56	90.58	49	25.65
2500.	zen (zen181)	190	88.90	114.87	70	36.84
2501.	Маершон (timeandsoul2)	190	149.41	196.34	158	83.16
2502.	Octo (octophobia)	190	109.29	151.94	87	45.79
2503.	Peter (metalhead2021)	190	49.04	63.15	12	6.32
2504.	Kenn (kenn_double_n)	190	103.36	127.01	76	40.00
2505.	Iris (irxs)	190	29.12	46.53	27	14.21
2506.	J (irocamora)	190	72.98	92.41	50	26.32
2507.	$$$$ (for_fun)	190	83.34	107.18	49	25.79
2508.	R (fjasifjaficaom)	190	55.04	70.78	27	14.21
2509.	Abdul Hannan (detective_ahg)	190	65.24	85.22	36	18.95
2510.	Aurel (big_boss1)	190	128.64	170.37	114	60.00
2511.	Бақытжан (baqytjan)	190	51.67	65.90	21	11.05
2512.	avocadoLover (avocado_lover)	190	45.48	74.11	22	11.58
2513.	AKSHAT (akshat1234)	190	57.09	74.28	89	46.84
2514.	Adrianix (adrianixx)	190	92.61	120.48	68	35.79
2515.	alaw (its_alaw)	190	67.36	92.27	59	31.05
2516.	isekai (krimsonly)	189	78.67	101.72	54	28.57
2517.	Kristoffer (koffer96)	189	68.66	94.10	41	21.69
2518.	Jimmy (jimmy_voe)	189	77.35	102.55	42	22.22
2519.	Gmorcad (gmorcad)	189	105.20	134.39	85	44.97
2520.	Danny (beegd)	189	137.62	184.50	154	81.48
2521.	Bataa (bataa_cdj)	189	74.67	95.66	46	24.34
2522.	Auveed (auveed)	189	92.83	110.82	65	34.39
2523.	epicface (adowoable)	189	92.17	120.86	67	35.45
2524.	Eli (elisped1)	189	116.35	149.36	113	59.79
2525.	Sam (sam12436)	189	48.65	61.56	28	14.81
2526.	Spourgon (mattt_hias)	189	35.77	50.77	9	4.76
2527.	Vijay (vijays4404)	188	66.03	94.65	45	23.94
2528.	Ayush (typer_ayush)	188	67.63	87.28	74	39.36
2529.	StevieWonder (steviewonder69)	188	92.04	119.81	62	32.98
2530.	Prithvi (psprithvi)	188	78.97	96.93	59	31.38
2531.	shawty (pogchampion1969)	188	85.00	101.06	47	25.00
2532.	Okh (okh10001)	188	63.29	79.24	40	21.28
2533.	OfficerBalls (noob_master9901)	188	86.66	124.71	55	29.26
2534.	Himanshu (himanshu_sahni)	188	68.08	86.14	38	20.21
2535.	Gjd (gwvj)	188	58.64	77.19	33	17.55
2536.	Jaxon (fusion13)	188	80.96	104.87	54	28.72
2537.	Ethan (etstein)	188	81.58	103.47	49	26.06
2538.	ngoc huy nam (destroy_the_w...	188	102.65	133.57	79	42.02
2539.	David Abdelnour (davidabdel...	188	62.02	81.16	44	23.40
2540.	neverm0r (datamagi)	188	76.17	107.05	51	27.13
2541.	Brrrdman (birdmanmcinnes)	188	59.13	77.24	22	11.70
2542.	Banda (bandamaker)	188	70.07	90.92	51	27.13
2543.	yomum (ahmet_ergun)	188	57.13	72.24	23	12.23
2544.	ReTiRedz (retiredz)	188	78.82	103.88	83	44.15
2545.	Julian (jgbuka12)	188	87.13	119.15	55	29.26
2546.	bub (_bubble)	187	100.08	125.38	82	43.85
2547.	Sassy (taingdavy)	187	60.84	83.06	35	18.72
2548.	Merrick (skmq)	187	97.61	115.79	64	34.22
2549.	oogy (owogy)	187	72.02	97.89	56	29.95
2550.	Othman (othmanaldefer)	187	49.32	63.23	18	9.63
2551.	Ron (gambling_addict_69)	187	94.11	113.82	54	28.88
2552.	Colemak (colemaknub)	187	67.38	98.86	34	18.18
2553.	Timothy (chuzzz)	187	85.96	116.62	48	25.67
2554.	Chirp (chirpflewgone)	187	56.19	75.05	34	18.18
2555.	Buri (buri_was_taken)	187	68.32	90.47	40	21.39
2556.	Aleks (aleks8)	187	71.63	87.09	52	27.81
2557.	Yet (yet1208)	186	67.23	92.88	35	18.82
2558.	Turtle Speed (turtle_speed31)	186	43.06	66.14	20	10.75
2559.	Seth (syarb)	186	100.41	125.31	92	49.46
2560.	Samer (samiralbayati)	186	47.19	60.20	21	11.29
2561.	Richit (richit690)	186	62.80	87.34	37	19.89
2562.	pavan kumar (pavan2406)	186	53.12	64.60	24	12.90
2563.	Gene (mckuletzz)	186	136.17	164.93	141	75.81
2564.	lunalululu (lunalululu)	186	95.67	115.28	74	39.78
2565.	Jia (jia_desai)	186	69.76	92.05	38	20.43
2566.	return NULL; (honor12)	186	82.49	100.00	47	25.27
2567.	Gabe (gablikestacos)	186	94.34	120.22	69	37.10
2568.	Erik (erickano)	186	71.05	92.13	52	27.96
2569.	EquityDeadlock (equitydeadl...	186	96.32	128.76	76	40.86
2570.	Goyna (demon__rage__)	186	54.39	67.86	29	15.59
2571.	Julie (codex13)	186	74.43	104.40	37	19.89
2572.	Rajat (buttocks121)	186	50.65	67.17	24	12.90
2573.	Beket (bayemirov)	186	103.12	126.40	66	35.48
2574.	Social Credit (usa_baby)	185	94.75	121.60	75	40.54
2575.	Alex (skoda888)	185	63.47	81.13	40	21.62
2576.	NQ (nq_neilprangko)	185	109.16	139.86	92	49.73
2577.	MrSaand (mrsaand)	185	100.32	115.98	64	34.59
2578.	Chris (letring)	185	98.42	124.01	84	45.41
2579.	Italo (italo_x)	185	37.33	50.70	11	5.95
2580.	Abhideep (imabhideep)	185	53.31	74.40	20	10.81
2581.	Sameer (firefoxqb)	185	75.31	106.14	48	25.95
2582.	cole (coldmak)	185	92.78	129.16	64	34.59
2583.	Aestuosi (aestuosi)	185	92.46	113.22	56	30.27
2584.	jan (toxicwasabi)	185	71.19	94.15	76	41.08
2585.	punit (thakelatyper)	184	78.62	101.62	35	19.02
2586.	shubham (shubham2468)	184	59.71	81.13	33	17.93
2587.	Raahil (ravana09)	184	95.51	127.53	63	34.24
2588.	Prashant (pra0337)	184	46.19	59.84	14	7.61
2589.	MIKA (oniichan69)	184	87.18	125.42	63	34.24
2590.	Fat Squirrel (neihs)	184	100.92	129.56	87	47.28
2591.	mai (mai74)	184	46.60	62.15	18	9.78
2592.	Mason (luvmasxn)	184	46.55	64.74	32	17.39
2593.	Koki (kohki)	184	69.20	84.76	29	15.76
2594.	Rishab (kamado_)	184	59.41	76.05	51	27.72
2595.	Jearcan (jearcan)	184	99.19	137.28	69	37.50
2596.	Sentinel (greatsentinel)	184	122.23	151.95	116	63.04
2597.	Adam (deinonysus)	184	61.28	82.81	33	17.93
2598.	daZai (dazzai)	184	53.89	65.20	38	20.65
2599.	douzhen (akariin)	184	76.63	97.59	56	30.43
2600.	Alex (kazuma_sama)	184	45.16	56.54	21	11.41
2601.	Rashed (rshod)	184	55.04	71.08	20	10.87
2602.	v (vlxu)	183	91.33	115.25	66	36.07
2603.	Tuong (tuong_slow)	183	75.42	104.24	59	32.24
2604.	arnav (trahimam)	183	65.01	87.32	44	24.04
2605.	Sinful Sam (sinfulsam)	183	87.01	108.02	61	33.33
2606.	saad (saduman)	183	87.89	111.70	67	36.61
2607.	(needforaccuracy)	183	116.62	143.37	96	52.46
2608.	Learner (learner_dawg)	183	86.76	117.86	48	26.23
2609.	deep (lamborghene)	183	105.40	143.67	88	48.09
2610.	Gagan (ggnbakshi38)	183	64.41	83.49	48	26.23
2611.	breezy (breezybre)	183	64.89	93.79	37	20.22
2612.	Thomas (thomas70)	182	72.78	92.60	40	21.98
2613.	sanjeev (sanjeev_2020)	182	21.41	35.25	38	20.88
2614.	Robert (robbstark)	182	80.03	99.10	49	26.92
2615.	Reg (reggg)	182	101.53	126.94	70	38.46
2616.	Paige (pfernandes_)	182	72.77	95.96	40	21.98
2617.	N W (niwore)	182	87.17	109.82	57	31.32
2618.	Limey (limeycunt)	182	47.98	65.24	19	10.44
2619.	Jimmy (jimster123)	182	75.50	93.43	52	28.57
2620.	Spartacus (galvarino)	182	70.43	94.14	41	22.53
2621.	Danoun (danounidananou255)	182	62.93	81.40	41	22.53
2622.	Calvin (calvinguy)	182	130.25	177.11	127	69.78
2623.	sergei (youserj)	181	39.02	49.81	15	8.29
2624.	Bikram (wood_cutter)	181	75.38	92.39	53	29.28
2625.	Sarah (swags20)	181	90.33	117.36	66	36.46
2626.	swagatron (swagatron7000)	181	141.61	169.56	123	67.96
2627.	Splonk (splonk)	181	84.90	108.20	70	38.67
2628.	Soul (soulsforsweet)	181	76.54	97.16	38	20.99
2629.	ilove cheese142 (ktylol)	181	83.59	129.56	47	25.97
2630.	Karan (iamkaran2)	181	81.32	104.00	40	22.10
2631.	dong (dongdong7)	181	79.89	105.06	51	28.18
2632.	Tuu (cetarin)	181	77.94	102.11	35	19.34
2633.	Benjamin (benjaminsanta)	181	62.65	83.80	44	24.31
2634.	aruj (b0b1000)	181	78.09	110.29	64	35.36
2635.	Peter (appapollo)	181	78.36	99.10	45	24.86
2636.	sausage go brrr (hasini_17)	181	56.50	77.31	30	16.57
2637.	Luka (the_lukec)	180	68.95	102.99	42	23.33
2638.	Sufi (sufi7)	180	33.33	67.69	14	7.78
2639.	Tempepper (smintz)	180	91.42	130.58	77	42.78
2640.	Suryakanta (skroy)	180	53.32	67.71	18	10.00
2641.	Sanket (maskii)	180	120.48	160.69	116	64.44
2642.	Dinja (insanedjoker)	180	70.43	107.33	36	20.00
2643.	Ham (hammah713)	180	53.69	68.86	31	17.22
2644.	eilonshi (eilonshi)	180	47.71	63.97	28	15.56
2645.	Dimo (dimofte)	180	72.18	94.27	49	27.22
2646.	hekima (ashery)	180	58.54	80.96	33	18.33
2647.	Aniket (aniketsanghi)	180	86.45	107.57	51	28.33
2648.	tourist (amey_9)	180	56.99	72.26	26	14.44
2649.	Abdelmohaymn (abdelmohaymn)	180	40.46	56.67	16	8.89
2650.	Arun (pyinjector)	180	58.06	79.71	43	23.89
2651.	whough (williamhough)	179	95.15	118.09	62	34.64
2652.	Sandeep Kumar (sandy14k9)	179	54.20	72.41	19	10.61
2653.	Ksairos (ksairs)	179	61.03	78.26	44	24.58
2654.	Jebediah (jebediah123)	179	117.44	140.40	117	65.36
2655.	NZY (janghanseok)	179	84.72	109.36	49	27.37
2656.	Hong (hong41)	179	52.77	69.79	16	8.94
2657.	Eugene (genedaman94)	179	67.33	98.65	38	21.23
2658.	Brussels (brussels11)	179	124.62	146.36	113	63.13
2659.	Basil (basilenthusiast)	179	69.11	116.33	53	29.61
2660.	RB (rbs_)	179	66.23	84.81	36	20.11
2661.	Dylan (yorkingharp67)	178	46.73	65.72	28	15.73
2662.	विघ्नेश (no_l...	178	55.15	70.44	23	12.92
2663.	Nabeel (nobleboi10)	178	79.39	104.39	95	53.37
2664.	03496203150 (my_whatsapp_nu...	178	57.22	72.68	28	15.73
2665.	arigrate (mercury80)	178	99.57	124.59	80	44.94
2666.	Lourd (edmund04)	178	69.80	92.58	39	21.91
2667.	Chronopolize (chronopolize)	178	100.44	141.64	62	34.83
2668.	b!g (b_i_g_em)	178	83.66	99.71	51	28.65
2669.	Michael (buckley12)	178	91.84	123.61	44	24.72
2670.	Nick (bluepenredpen)	178	84.26	112.33	43	24.16
2671.	BLLA (bellaperez)	178	65.58	85.48	44	24.72
2672.	Azizbek (azizbek00)	178	62.47	79.41	34	19.10
2673.	nightingale (add4line)	178	162.62	213.93	150	84.27
2674.	Mark (10100)	178	73.02	91.49	57	32.02
2675.	gamer gamer (changishfool)	178	70.35	90.89	42	23.60
2676.	Zakk (zakkcp)	177	79.74	99.70	35	19.77
2677.	youm (youm)	177	77.07	98.06	40	22.60
2678.	Trabota (trabota)	177	113.77	138.25	85	48.02
2679.	Jose Manuel (slowmanl0l)	177	85.07	115.70	49	27.68
2680.	XD (oma3)	177	73.85	88.79	45	25.42
2681.	StallmanWasRight (misterhotel)	177	121.64	151.77	93	52.54
2682.	Mahay (mahay316)	177	65.11	78.97	40	22.60
2683.	Kimie (lil_pulsar)	177	84.86	118.73	53	29.94
2684.	judo (judowrld)	177	44.02	65.59	41	23.16
2685.	mobin (irmobin)	177	55.00	71.46	36	20.34
2686.	Shubham (ikamthania)	177	58.44	72.12	25	14.12
2687.	Leo (hogsh9862)	177	93.09	121.54	59	33.33
2688.	McKay (heyitsyaboi)	177	71.63	97.28	47	26.55
2689.	:) (erincur123)	177	59.94	75.84	32	18.08
2690.	Court (courtmw)	177	48.22	64.02	16	9.04
2691.	awabin (awabin)	177	48.13	81.11	22	12.43
2692.	Zandro (zandrocraft)	176	68.37	96.44	42	23.86
2693.	Evgeny (x1p234)	176	55.91	70.16	16	9.09
2694.	Scyx (scyx3)	176	59.07	84.67	33	18.75
2695.	moosophy (pepperoni_cat)	176	41.53	51.71	14	7.95
2696.	Duke (needdiscipline)	176	91.41	121.48	65	36.93
2697.	Maksim (morysoff)	176	76.45	97.66	48	27.27
2698.	Peace in world (marcog7)	176	80.25	105.47	45	25.57
2699.	Nectarios (locomolotov)	176	102.24	138.66	59	33.52
2700.	Akizumi (linaaron)	176	62.18	92.48	39	22.16
2701.	Kinoktia (kinokita)	176	68.77	88.14	46	26.14
2702.	JD (jigglyjd)	176	68.17	86.85	41	23.30
2703.	Jack (jacjack)	176	70.44	90.27	27	15.34
2704.	Hesh (heshg)	176	81.54	107.55	49	27.84
2705.	Jose Ruel (braveheart143)	176	51.01	66.73	24	13.64
2706.	Sadiqa (sadiqa_ansari)	176	38.35	50.52	12	6.82
2707.	Victo (victo_sn)	175	102.99	144.99	81	46.29
2708.	Robby (tddvorak)	175	62.50	92.18	34	19.43
2709.	Ryan (rdeorio)	175	83.23	101.49	47	26.86
2710.	mayr (mayruwu)	175	67.12	89.65	51	29.14
2711.	Mac (mac123456)	175	83.29	104.05	59	33.71
2712.	ALI (legend_haddad)	175	55.58	73.03	27	15.43
2713.	Julian (juliansmile)	175	86.77	105.69	51	29.14
2714.	Ioannis (johndigolis)	175	69.08	83.30	43	24.57
2715.	Jake (jakeowens)	175	81.02	105.93	48	27.43
2716.	JiGsaW (homeboy2603)	175	105.93	134.06	77	44.00
2717.	Mohammed (guitarist999)	175	65.45	89.34	44	25.14
2718.	greed (greedthelazy)	175	81.65	106.85	67	38.29
2719.	Eveningthing (evntd)	175	76.85	98.27	43	24.57
2720.	Choong Hyun (chlee)	175	66.11	91.89	44	25.14
2721.	my name (calmthyself)	175	93.67	107.85	55	31.43
2722.	Wob (wobber)	174	64.28	88.08	53	30.46
2723.	tstats[v415hn4v] (v415hn4v)	174	31.81	42.50	12	6.90
2724.	Tarek (o_stady)	174	71.37	84.92	38	21.84
2725.	Naman (namanjain)	174	43.25	52.87	20	11.49
2726.	Itsuki1 (itsuki1)	174	58.52	79.18	42	24.14
2727.	Connor (ct2019)	174	58.70	76.12	32	18.39
2728.	John (beefysalad69)	174	96.17	124.10	84	48.28
2729.	Rahim Abdur (arbijoy1717)	174	45.10	55.32	14	8.05
2730.	Angelo (angelo13c)	174	78.73	93.46	50	28.74
2731.	Ian sparks (sparksian)	174	61.47	79.96	38	21.84
2732.	Coder (the_coder_bro)	173	68.34	85.61	38	21.97
2733.	Warren (slacker_xd)	173	96.19	117.65	71	41.04
2734.	adrian (rixoner)	173	54.03	72.78	29	16.76
2735.	T (raket124)	173	80.58	95.37	46	26.59
2736.	Noobie (nooobie_typer)	173	63.66	84.90	41	23.70
2737.	Tech (ninja_typer)	173	75.01	94.87	45	26.01
2738.	Chris (mils8545)	173	63.19	77.63	31	17.92
2739.	Brandon (kirbyfan107)	173	116.98	151.71	98	56.65
2740.	joshua (jimpdashrimp)	173	95.51	126.13	62	35.84
2741.	An Ackerman (iamvr)	173	53.39	65.81	15	8.67
2742.	Eru (eru2)	173	83.78	110.95	48	27.75
2743.	Dev (devk232)	173	50.71	72.67	16	9.25
2744.	WindSlashKing (bujkata)	173	99.36	156.18	73	42.20
2745.	Kirin (arya_juniko)	173	63.67	89.63	31	17.92
2746.	Abhinav :P (abhi_typist)	173	64.33	84.06	42	24.28
2747.	Kyle (1cheeseisyummy5)	173	95.64	127.68	78	45.09
2748.	RagingChris (ragingchris)	173	89.53	120.41	58	33.53
2749.	Prof (profklapz)	173	76.44	102.48	56	32.37
2750.	wenlong (wenlong)	172	51.64	69.27	12	6.98
2751.	wz (taywzzzz)	172	72.59	94.27	50	29.07
2752.	sumit (sumitmgr345)	172	64.57	82.26	37	21.51
2753.	silvik (silvik_)	172	107.60	143.36	86	50.00
2754.	Neatrianty (neatrianty)	172	110.30	147.24	93	54.07
2755.	Krish (krish108)	172	99.15	128.67	63	36.63
2756.	Ardan (kevinardani)	172	69.75	90.59	45	26.16
2757.	InNeedOfName (inneedofname)	172	96.42	133.56	56	32.56
2758.	General (generalmalorn)	172	107.24	128.61	74	43.02
2759.	fthe (fthe)	172	70.17	94.74	39	22.67
2760.	evil007 (evil007)	172	47.08	66.58	18	10.47
2761.	Anjal (deadashell)	172	66.42	85.75	35	20.35
2762.	Cadmus (cadmus369)	172	65.79	87.14	40	23.26
2763.	AvocadoTM (avocadotm)	172	67.89	87.86	39	22.67
2764.	Manoj (manjobanjo)	172	104.89	145.51	137	79.65
2765.	moq (moq_)	172	89.79	112.31	65	37.79
2766.	Akash (akashshewale)	172	57.80	72.84	29	16.86
2767.	Matty (mattyman)	172	52.76	63.11	22	12.79
2768.	Nyaruko (tatrz)	171	82.12	108.42	63	36.84
2769.	sys (sysuser)	171	46.22	57.02	11	6.43
2770.	Sayat (sayko05)	171	37.71	49.80	14	8.19
2771.	Nagaro (nagaro)	171	76.65	95.66	47	27.49
2772.	Marko (markodob)	171	45.23	58.88	12	7.02
2773.	Jacinth (levesis)	171	73.95	103.89	45	26.32
2774.	Joshua (lckjosh)	171	109.51	130.91	78	45.61
2775.	paddy (kattumanidhan)	171	93.09	140.29	71	41.52
2776.	Kate (kate366)	171	78.45	102.02	45	26.32
2777.	Richard (jorimi)	171	82.76	119.49	47	27.49
2778.	Whatever (hunglatahb1)	171	92.43	113.13	51	29.82
2779.	Heather (heannn)	171	75.02	100.65	44	25.73
2780.	Cho (cho82)	171	69.09	82.44	46	26.90
2781.	Ella (chawahir)	171	152.94	181.26	114	66.67
2782.	Arsalan (arsalan_khan)	171	31.79	47.11	31	18.13
2783.	Abdujalol (abdujalolerkinov)	171	57.42	73.89	39	22.81
2784.	Zhijian (zliangal)	170	59.10	75.41	33	19.41
2785.	TheBossOfTheBoss (thebossof...	170	92.42	115.80	57	33.53
2786.	Sumit (sumit0003)	170	42.36	66.81	17	10.00
2787.	Mateusz (mattinato21)	170	119.43	154.89	3	1.76
2788.	Syed Ali (mafailure)	170	69.57	92.55	40	23.53
2789.	Jørgen (jorgen1999)	170	65.43	93.01	33	19.41
2790.	Jordan (invictusj)	170	72.45	93.13	43	25.29
2791.	hello (imfeelingunlucky)	170	82.37	113.68	37	21.76
2792.	VP (illermike)	170	67.27	82.20	40	23.53
2793.	BLU (glitterblonde)	170	88.20	110.31	57	33.53
2794.	Feli (dottedladybug)	170	79.94	98.75	39	22.94
2795.	Harsh Yadav (bestial)	170	59.58	81.16	32	18.82
2796.	AYOUB (ayoub_dkhissi)	170	44.81	59.13	29	17.06
2797.	alv (alvdev)	170	60.02	71.50	28	16.47
2798.	Rei (sleepyray)	170	65.22	86.25	45	26.47
2799.	Sheen (mercurial_spod)	170	43.48	62.44	22	12.94
2800.	Derwin (dwu123)	170	82.30	100.36	43	25.29
2801.	4pf (mawienmawien123)	170	63.48	81.35	35	20.59
2802.	MTGAP | Tokimahery (tokimah...	169	79.45	105.28	60	35.50
2803.	Malik (sonatabliss)	169	48.38	70.30	30	17.75
2804.	Rdk (olegus)	169	71.14	90.42	47	27.81
2805.	Gourav (mrgaurav2001)	169	49.24	70.68	35	20.71
2806.	Martin (martinmaster)	169	71.23	84.46	44	26.04
2807.	Marco (marcomilo)	169	103.47	129.32	70	41.42
2808.	leon (leonzalion)	169	154.03	211.71	28	16.57
2809.	Kiddoz (kiddoz)	169	67.93	83.31	31	18.34
2810.	Toe Typer (ifingeryour)	169	61.75	81.58	34	20.12
2811.	Ashish (ashk98)	169	55.28	78.17	30	17.75
2812.	Lim (ac1ds)	169	72.21	91.88	40	23.67
2813.	Cross (crosscategory)	169	54.87	70.99	19	11.24
2814.	Tushar (tjajodia)	168	73.18	102.66	45	26.79
2815.	SPICY (spicynote)	168	83.53	101.41	56	33.33
2816.	Nate (natekid11)	168	82.95	100.32	42	25.00
2817.	Yu (mjtunes)	168	58.00	79.34	26	15.48
2818.	ʕ·͡ᴥ·ʔ (memesis)	168	73.40	99.64	48	28.57
2819.	Kaloyan (kokicha120)	168	84.86	110.16	49	29.17
2820.	kai (kainetic)	168	70.14	112.57	35	20.83
2821.	Arjun (k9cruncher)	168	89.70	112.42	55	32.74
2822.	Jacob (jwill420)	168	120.35	151.96	104	61.90
2823.	Keith (flanneldemigod)	168	80.19	97.28	50	29.76
2824.	Geeth (falsethunder)	168	68.17	99.39	32	19.05
2825.	aida (cloudywithachanceofme...	168	121.82	160.09	95	56.55
2826.	Ghost (ghostdraon)	168	66.87	90.39	42	25.00
2827.	Kabi (kabizzare)	168	41.65	67.23	15	8.93
2828.	Eli (silversweedie)	167	54.99	78.70	14	8.38
2829.	I am on the rise. (refined_...	167	51.95	69.42	81	48.50
2830.	Pinekkone (pinekkone)	167	76.18	97.78	48	28.74
2831.	Oli (piasekoli)	167	86.99	105.28	44	26.35
2832.	Keagan (ngerks)	167	72.48	91.24	42	25.15
2833.	Lauren (lsmithers619)	167	48.58	64.91	21	12.57
2834.	josh (killer_queen_beats_hi...	167	71.82	84.13	37	22.16
2835.	John (jlavelle)	167	92.46	121.13	53	31.74
2836.	Halley (halxey)	167	68.52	91.47	131	78.44
2837.	dumbosity (dumbosity)	167	126.75	162.99	110	65.87
2838.	Gregory (contrum)	167	112.60	139.83	87	52.10
2839.	CheemCreem (cheemcreem)	167	83.65	100.60	43	25.75
2840.	Abdelrahman (abdelrhaman_sh...	167	66.12	84.12	46	27.54
2841.	Constantinos (488pista)	167	73.00	87.52	37	22.16
2842.	Ayush (improve_type)	167	49.46	63.36	21	12.57
2843.	Abdul Basit (abdul_thetypist)	167	46.26	63.74	16	9.58
2844.	joaoabismado (joaoabismado)	167	60.64	92.81	39	23.35
2845.	Zakarya (zakarya420)	166	41.80	53.76	10	6.02
2846.	Filemon (the_squad7)	166	42.82	51.87	9	5.42
2847.	Alf (the_destroyer_of_worlds)	166	96.96	123.49	68	40.96
2848.	Janc (psyy1234)	166	88.64	107.09	48	28.92
2849.	Angkana (ployyjen)	166	82.88	102.83	38	22.89
2850.	Onsterm (onsterm)	166	54.76	70.01	18	10.84
2851.	Mike (mikayelb)	166	67.52	83.69	33	19.88
2852.	Matthew (matt_daemond)	166	103.84	134.99	73	43.98
2853.	moofasa (macywood)	166	84.56	116.59	57	34.34
2854.	Lord Of Titans (lord_of_tit...	166	49.35	65.97	26	15.66
2855.	Jacob (jacobascool)	166	60.05	77.46	27	16.27
2856.	Lobster🦞 (itisu127)	166	79.41	105.53	73	43.98
2857.	Voldemort (growthmindset)	166	95.20	114.26	63	37.95
2858.	clover (fat_baby_hippo_312)	166	45.98	73.16	18	10.84
2859.	劉韋論 (evan1liu)	166	66.48	83.25	27	16.27
2860.	DOO (datblakgai)	166	80.83	108.80	48	28.92
2861.	Caegan (caegana)	166	121.39	158.07	87	52.41
2862.	Hello (arnab_9997)	166	74.85	96.25	40	24.10
2863.	Ab (abdir)	166	74.90	106.79	40	24.10
2864.	Free (free_hour)	166	61.98	82.17	32	19.28
2865.	Tomas (elanunciadordedoom)	166	65.82	93.43	38	22.89
2866.	tade (tadessetic)	165	32.39	40.53	13	7.88
2867.	Swaraj (swarajpande4)	165	91.99	119.74	52	31.52
2868.	Scott (scottjones25)	165	40.52	52.80	10	6.06
2869.	ryu107 (ryu107)	165	59.36	79.60	28	16.97
2870.	Rishi (qasz)	165	58.37	75.00	27	16.36
2871.	dawid (nuclearmansnothot)	165	81.14	110.78	47	28.48
2872.	Nikolai (nikovertus)	165	89.68	124.50	53	32.12
2873.	Blue Alps, baby! (model_m_k...	165	84.90	111.41	60	36.36
2874.	Mel (mel0214)	165	47.85	59.66	15	9.09
2875.	Christos (lexmarkx)	165	60.07	81.49	33	20.00
2876.	Leonardo (leo121)	165	62.82	77.03	33	20.00
2877.	Matt (kirito3141)	165	88.57	126.81	43	26.06
2878.	gujjar (gujjarji)	165	63.23	86.20	35	21.21
2879.	bri (greased_lightning10)	165	85.36	113.05	60	36.36
2880.	David (dtnero)	165	83.65	103.73	51	30.91
2881.	Dylan (dtg32148)	165	88.20	111.68	61	36.97
2882.	bhanu (codingbegginer)	165	54.41	73.49	18	10.91
2883.	Nick (cluelessneep)	165	87.96	101.08	46	27.88
2884.	Beret (boina)	165	82.04	106.52	51	30.91
2885.	Isabella (bellaa)	165	73.67	100.61	45	27.27
2886.	Shane (shane_666666)	165	51.82	69.40	26	15.76
2887.	Shadi (shzdi)	165	88.03	110.34	149	90.30
2888.	Nurlanbek (xtil_06)	164	46.04	58.91	8	4.88
2889.	Kelvin (winlost2)	164	111.60	129.80	86	52.44
2890.	Steve (stevie169)	164	75.35	91.97	33	20.12
2891.	Colemax (sqxleaxes)	164	94.90	120.61	63	38.41
2892.	bach (shuriken)	164	75.77	92.07	41	25.00
2893.	shakthi (shakthi1731u)	164	74.07	98.50	34	20.73
2894.	naveen (regretfulsalsa)	164	106.82	134.37	88	53.66
2895.	Daggerpov (read_my_name)	164	111.06	133.77	82	50.00
2896.	Preetish (preetishmajumdar)	164	76.66	96.70	38	23.17
2897.	Manny (mannypack)	164	98.88	139.13	65	39.63
2898.	Manjrnm (manjrnm)	164	97.98	124.87	68	41.46
2899.	Guðjón (krotari)	164	86.79	109.75	67	40.85
2900.	Kenyaaa~~~ (kenzaa)	164	92.49	123.11	52	31.71
2901.	kajak_CZ (kajak_cz)	164	64.36	80.99	37	22.56
2902.	Hamidbek (hamidbek)	164	53.34	73.18	18	10.98
2903.	Enzo (enz0123)	164	97.93	120.64	72	43.90
2904.	Emerald-Rose (emmarose_deleon)	164	42.71	56.25	23	14.02
2905.	Dipankar (dipankarkumar275)	164	58.94	74.22	30	18.29
2906.	damon (damonliv)	164	83.66	106.75	42	25.61
2907.	CopiCat (copicat)	164	57.96	76.60	20	12.20
2908.	ybf (ybflewis)	163	86.38	118.67	42	25.77
2909.	Connecting... (toodey)	163	65.61	84.33	36	22.09
2910.	SW1FT808 (sussyboi808)	163	42.73	59.01	16	9.82
2911.	Srdjan (srle1312)	163	49.83	61.52	14	8.59
2912.	SkyerZ (skyerz)	163	92.15	111.22	60	36.81
2913.	Mmonster (mmonsterv11)	163	68.52	97.83	38	23.31
2914.	Lur3t (lur3t)	163	73.13	96.84	33	20.25
2915.	Brody (echo3006)	163	75.02	112.02	36	22.09
2916.	Cheyenne (cheycc)	163	79.08	112.92	40	24.54
2917.	AM (amesh8301)	163	67.96	87.20	39	23.93
2918.	Almighty (almightysosaakatu...	163	86.64	115.26	59	36.20
2919.	Andreas (agehring)	163	25.08	33.03	41	25.15
2920.	Sonix (8sonix)	163	70.22	105.90	47	28.83
2921.	TOBIRAMA (sipagan90)	163	47.93	66.83	14	8.59
2922.	Dominus (dominusreal574)	163	136.04	162.11	112	68.71
2923.	TheXFalcon (xavier_poh)	162	74.63	96.80	46	28.40
2924.	salsa (spencer_salsa)	162	59.55	83.30	31	19.14
2925.	Callum (specktome26)	162	87.65	111.02	40	24.69
2926.	Ruel Ryan (ruelryan)	162	71.73	87.17	41	25.31
2927.	Rahul (rsrahul1000)	162	82.20	107.42	51	31.48
2928.	Priyanshi (priyanshi_gupta)	162	62.42	80.17	34	20.99
2929.	nw3x (nw3x)	162	128.05	160.53	110	67.90
2930.	Norm (norm_guy)	162	49.55	64.09	17	10.49
2931.	Ivan (idjuric)	162	111.51	135.94	82	50.62
2932.	Gde (gde1indra)	162	73.44	96.08	45	27.78
2933.	Elgamal (elgamal)	162	62.17	86.27	31	19.14
2934.	Pisit (compisit)	162	88.17	112.69	48	29.63
2935.	Celeste (celeste_b)	162	62.05	81.69	29	17.90
2936.	Arsh (batman4ever)	162	59.13	76.64	32	19.75
2937.	aditya105 (aditya105)	162	47.95	65.08	17	10.49
2938.	something (xuegalaxy)	161	65.02	95.80	33	20.50
2939.	manish (typo_beginner19)	161	51.92	68.50	15	9.32
2940.	Asma (speedy10123667567)	161	41.48	63.99	13	8.07
2941.	scrubs (scrubs1906)	161	64.43	80.41	41	25.47
2942.	Adam (schimoda)	161	99.10	121.29	53	32.92
2943.	kraken (pronto1)	161	72.00	90.43	38	23.60
2944.	Piplup (piplup_)	161	81.33	105.83	32	19.88
2945.	Nicki (nickisusanalex)	161	85.65	99.13	39	24.22
2946.	xdd (n1kk1)	161	52.47	77.70	22	13.66
2947.	mattfus (mattfus2)	161	94.35	112.55	47	29.19
2948.	Kingdomfight (kingdomfight)	161	73.01	88.19	35	21.74
2949.	tstats[depsy] (depsy)	161	81.31	102.27	41	25.47
2950.	RiCyber (curiouscrow)	161	70.80	83.70	52	32.30
2951.	nbv (cumming4u)	161	72.04	93.91	42	26.09
2952.	yong (coaleo)	161	79.31	122.20	37	22.98
2953.	TYPE KITA (carracers)	161	55.10	77.27	23	14.29
2954.	April (apesbang)	161	81.20	101.04	48	29.81
2955.	Onion (x__onion__x)	160	111.57	173.99	76	47.50
2956.	Luca (whitebronco)	160	53.90	77.26	16	10.00
2957.	TheCaptainBuster (thecaptai...	160	83.76	136.32	90	56.25
2958.	^o^ (thasial)	160	83.28	111.19	48	30.00
2959.	Shivam (sj_pro)	160	59.24	78.17	38	23.75
2960.	SCHMURK (schmurk)	160	98.04	124.69	63	39.38
2961.	Pavan (pavan_06)	160	52.80	71.46	22	13.75
2962.	oukkat2 (oukkat2)	160	89.14	115.67	55	34.38
2963.	oscar (oscarhinxdd)	160	73.32	91.72	39	24.38
2964.	Com (neon1087)	160	84.62	100.07	48	30.00
2965.	Myles (mylessucks)	160	115.32	146.62	79	49.38
2966.	Meliflua (meliflua)	160	56.62	68.03	21	13.13
2967.	Joshua (manch)	160	89.55	112.54	51	31.88
2968.	Kurochi (kurochi_cyril)	160	81.05	100.01	54	33.75
2969.	Jackie (jackiechan816)	160	82.32	110.90	47	29.38
2970.	badplayer (idk213)	160	91.19	145.82	72	45.00
2971.	Hafiz (huseynoff)	160	75.17	94.31	44	27.50
2972.	seaweedOrca (h17unicorn)	160	73.74	96.97	34	21.25
2973.	Gaurav (gaurav_38)	160	77.47	96.85	42	26.25
2974.	Leonardo (finex2126)	160	47.74	65.33	18	11.25
2975.	Demian Volkov (demianwolf)	160	124.06	150.14	102	63.75
2976.	Chirag (chirag_2580)	160	68.21	95.05	39	24.38
2977.	Yo (azurewinter)	160	89.53	124.17	59	36.88
2978.	Asura (asura_yt)	160	111.23	141.19	66	41.25
2979.	Arsuta (aryasuta13)	160	79.00	100.36	44	27.50
2980.	Shaked (aes222)	160	107.84	141.06	73	45.63
2981.	Nikita (andriievskyi_2)	160	64.70	84.97	30	18.75
2982.	gar (dagmarski)	160	68.69	87.11	37	23.13
2983.	Chourrage (chourrage)	160	73.86	93.44	38	23.75
2984.	Max (eggrollccc)	160	86.38	105.80	77	48.13
2985.	Garotto (uselessusername)	159	94.47	116.78	60	37.74
2986.	switchedtocolemak (switched...	159	120.63	144.18	75	47.17
2987.	Jakub (serckle)	159	94.92	114.92	67	42.14
2988.	Sam (samsrm)	159	69.68	96.84	30	18.87
2989.	RRKS (rrks43)	159	89.51	112.99	55	34.59
2990.	Oliwier (olix04)	159	84.33	102.75	38	23.90
2991.	tstats[madkingxxx] (madking...	159	60.00	82.12	34	21.38
2992.	Lloyd (llgraves)	159	77.92	104.62	33	20.75
2993.	liz (lizkebab)	159	106.43	130.83	56	35.22
2994.	KC (hotdogkc)	159	118.17	160.13	39	24.53
2995.	Erin Lanz (erinxmaligaya_)	159	41.90	60.44	13	8.18
2996.	Aditya (dhruvaditya)	159	48.91	64.25	11	6.92
2997.	Gabriel (dekkoz)	159	63.39	78.50	24	15.09
2998.	daniel (danielphantom)	159	90.28	118.92	57	35.85
2999.	Liam (bonkatronk)	159	85.77	101.76	56	35.22
3000.	Dinkin (blindguy_mcsqueezy)	159	78.11	111.16	36	22.64
3001.	Khanh (aygentp)	159	90.79	119.87	51	32.08
3002.	Ankit (ankit_10)	159	32.18	44.28	25	15.72
3003.	ABM (abm150)	159	66.72	80.76	43	27.04
3004.	Zaynski (zaynium)	158	106.32	128.89	74	46.84
3005.	Omar (omarbahgat2003)	158	77.66	99.04	36	22.78
3006.	Nader (nader12)	158	53.65	66.29	17	10.76
3007.	Hieu (larhral)	158	89.72	112.48	58	36.71
3008.	Karl (karlpuno)	158	61.87	83.89	29	18.35
3009.	Rohit (john_titor234432)	158	69.96	95.93	35	22.15
3010.	bsmith4972 (bsmith4972)	158	53.34	72.48	18	11.39
3011.	ben (benwu1)	158	86.99	110.02	42	26.58
3012.	Aytac (aytac_neigel27)	158	82.30	102.21	49	31.01
3013.	Aziyat (aziyatali)	158	46.13	65.51	18	11.39
3014.	dilano (dilano55)	158	85.44	112.24	58	36.71
3015.	Alpha (unseenalpha)	158	54.88	75.09	15	9.49
3016.	Twis (twis23)	157	74.04	100.88	40	25.48
3017.	Sundara Subramanian (sundar...	157	81.23	97.99	37	23.57
3018.	daniel (nitezu)	157	90.38	118.56	53	33.76
3019.	Feris (merelyaferis)	157	141.26	179.23	119	75.80
3020.	Filip (l4rry99)	157	89.20	120.59	46	29.30
3021.	Firelord (jetray)	157	73.85	90.26	33	21.02
3022.	Jay Cartwright (jay_cartwri...	157	110.38	142.76	69	43.95
3023.	Jake (jake_tyler)	157	97.00	117.37	62	39.49
3024.	Oskar (dailypants)	157	67.87	82.88	36	22.93
3025.	khalil (credendo)	157	81.19	100.11	48	30.57
3026.	aya (aya1994)	157	48.92	58.23	17	10.83
3027.	w0ng (w0ng_dvorak)	156	58.66	74.69	20	12.82
3028.	Verve81 (verve81)	156	111.96	136.49	89	57.05
3029.	Theroarx (theroarx)	156	88.32	112.14	53	33.97
3030.	Ckh (theckh)	156	88.90	108.38	48	30.77
3031.	Sonwa (sonwa)	156	55.74	66.69	17	10.90
3032.	RMS (sarfaraz008)	156	85.32	120.76	63	40.38
3033.	percival (samuelnirina)	156	79.93	98.48	37	23.72
3034.	PJR (petrosyan_jr)	156	87.70	104.82	56	35.90
3035.	Kwikk (mrkwikk)	156	60.43	82.18	31	19.87
3036.	JFL (mialiu0804)	156	61.04	79.19	32	20.51
3037.	Luffy-dono (luffy_dono)	156	71.18	88.70	37	23.72
3038.	deroche make me 220 nq plea...	156	75.13	98.35	37	23.72
3039.	アヒオ (knalb)	156	52.12	68.99	14	8.97
3040.	Karim (karimkarim)	156	48.88	64.66	18	11.54
3041.	Kieran (kahinjin)	156	127.13	164.65	119	76.28
3042.	Abylaikhan (ho1den)	156	78.14	110.78	30	19.23
3043.	Fidel Alberto Ramos (Perú)...	156	58.91	77.73	21	13.46
3044.	Mike (fastneko)	156	92.05	132.37	55	35.26
3045.	deceptiveVI (dsaldana711)	156	113.75	145.60	82	52.56
3046.	Tianyi (dreamatd)	156	76.69	93.47	31	19.87
3047.	Zurfer (zurfer)	155	70.50	99.29	40	25.81
3048.	Salted (whyisitsohardto)	155	82.57	111.59	46	29.68
3049.	Uurdmandakh (uurdmandakh)	155	63.97	83.30	35	22.58
3050.	typoMaster (tt_qureshi)	155	46.99	60.36	12	7.74
3051.	Trying (sakurya)	155	132.87	163.14	102	65.81
3052.	John (qui505092)	155	118.55	144.55	86	55.48
3053.	Aidan (kubachi)	155	83.36	106.45	48	30.97
3054.	Joseph (joseph_468)	155	118.59	140.23	90	58.06
3055.	John (jhakala)	155	102.97	118.58	53	34.19
3056.	Jordan (jagmasta259)	155	93.97	117.53	61	39.35
3057.	Hovari (hovari)	155	66.55	92.22	33	21.29
3058.	(ghall)	155	153.46	209.53	64	41.29
3059.	Emily (emj9)	155	66.61	81.25	32	20.65
3060.	Elliot_1980_UK (elliot_notts)	155	102.90	126.92	66	42.58
3061.	calum (calousime)	155	81.77	112.56	61	39.35
3062.	Avi (avitoohband)	155	59.14	86.06	33	21.29
3063.	Alf (jacv_10)	155	61.89	74.57	31	20.00
3064.	Casper (casper_001)	155	70.86	94.94	31	20.00
3065.	Zaid (zaidnashihamin)	154	52.55	70.49	25	16.23
3066.	Serenity (turkaturka)	154	83.89	103.53	43	27.92
3067.	Turning 14 in 2 Weeks! (spe...	154	111.57	163.48	55	35.71
3068.	Keyma.sh is better (ryleyx...	154	130.92	155.77	93	60.39
3069.	Mohamd (mohamed_hussein)	154	31.07	42.68	23	14.94
3070.	Mims (mimzi_who)	154	79.08	104.21	44	28.57
3071.	Lai (laiyr)	154	109.87	136.95	67	43.51
3072.	Samuel (king_anuus)	154	113.00	139.64	89	57.79
3073.	Keelan (keelanf_28)	154	64.78	88.03	39	25.32
3074.	Julius (juliuscl2004)	154	51.95	73.37	22	14.29
3075.	Andreas Vida (johnbonham)	154	108.27	138.95	75	48.70
3076.	tstats[ilaghardcore] (ilagh...	154	105.13	134.02	70	45.45
3077.	Muhammad (donnyutsman)	154	82.08	98.98	28	18.18
3078.	yo (callmeford)	154	86.15	110.00	47	30.52
3079.	Batteekha (batteekha)	154	68.53	83.98	39	25.32
3080.	Ayyaz Sajjad (ayyazsajjad)	154	43.53	55.35	18	11.69
3081.	alex (ay1259)	154	92.23	123.32	64	41.56
3082.	ig=muzi.priva (muzamil69)	154	53.07	87.31	58	37.66
3083.	johnny (jdmalcolm)	154	74.00	93.60	47	30.52
3084.	ydem2nir9tag (ydem2nir9tag)	153	104.87	132.43	75	49.02
3085.	Tanya (tee_85)	153	44.20	70.27	14	9.15
3086.	Neko (stanoje)	153	88.89	110.81	41	26.80
3087.	Sigmund (sir_renardwil)	153	87.98	109.61	49	32.03
3088.	Looserrrrrrrrrrrr (rahulary...	153	28.34	52.04	70	45.75
3089.	ace (pressctrlandw)	153	85.06	101.23	44	28.76
3090.	pedro (pmedley)	153	46.45	61.03	10	6.54
3091.	Ex (not_a_razer)	153	67.26	85.02	34	22.22
3092.	vroom💤 (noprop)	153	122.12	145.40	78	50.98
3093.	Vito Scaletta (minaricano)	153	87.63	113.61	43	28.10
3094.	Никита (mamaxab)	153	31.14	43.39	20	13.07
3095.	killer (killerz4564)	153	60.93	78.89	40	26.14
3096.	Jamie (jamietyper90)	153	85.33	110.22	45	29.41
3097.	declan (dekkiefish)	153	94.63	120.52	57	37.25
3098.	Bento (bento420)	153	97.53	121.99	77	50.33
3099.	alpha (alphawoman)	153	89.03	121.05	51	33.33
3100.	Stephen (s_dog2001)	152	65.06	92.50	44	28.95
3101.	Splixy (splixy)	152	70.60	88.42	37	24.34
3102.	Darth (rakin000)	152	78.60	94.12	28	18.42
3103.	Rahul (rahuls1995)	152	51.35	64.62	15	9.87
3104.	AtmoSci (noctilucent)	152	63.77	86.13	30	19.74
3105.	netram88 (netram88)	152	77.07	96.55	53	34.87
3106.	tstats[marin049] (marin049)	152	112.57	151.03	84	55.26
3107.	Luka (lukoloz)	152	89.46	113.47	46	30.26
3108.	Laco (koomp)	152	86.47	103.84	46	30.26
3109.	Nik (iiirxs)	152	80.60	113.83	37	24.34
3110.	Josh (h3hat3m3)	152	93.44	112.28	41	26.97
3111.	Fatnot (fatnot)	152	84.71	112.01	39	25.66
3112.	Denis (deniii)	152	61.54	78.10	33	21.71
3113.	ashok (ashokkasi)	152	79.66	100.74	42	27.63
3114.	Ali (alijoon)	152	58.77	74.40	18	11.84
3115.	AlexopoulosC (alexopoulosc)	152	92.60	114.78	55	36.18
3116.	saam4 (saam4)	152	70.63	94.34	35	23.03
3117.	type_racist (the_orange)	152	83.85	108.24	44	28.95
3118.	Drew (vegan_freedom_fighter)	151	65.62	85.30	30	19.87
3119.	Rasmus (rasmus_v)	151	74.55	90.96	27	17.88
3120.	ahmed (puzite)	151	85.52	108.20	37	24.50
3121.	IllMind (lllmind)	151	48.64	65.10	24	15.89
3122.	Jimmy (jimmmy193)	151	106.15	145.66	67	44.37
3123.	jcm (jan500)	151	81.73	104.17	45	29.80
3124.	INCOMPETENT (incompetent_co...	151	79.25	108.16	50	33.11
3125.	Tom (darkusisdope)	151	47.64	59.25	14	9.27
3126.	Aaron (biogence)	151	72.39	93.03	28	18.54
3127.	MNL48 Frances DieHardSuppor...	151	89.20	109.59	60	39.74
3128.	fingerblaster (linn123321)	151	81.55	105.26	39	25.83
3129.	Szektor (szektor)	151	53.75	72.21	12	7.95
3130.	Mohanad (mohanad3302)	151	29.84	41.28	18	11.92
3131.	Laura (lauraisgreatattypera...	151	61.23	77.20	29	19.21
3132.	Sidharth (_ceres_)	150	45.53	57.20	12	8.00
3133.	James (wnston)	150	92.16	134.71	54	36.00
3134.	Wilson (wilsonthewinner)	150	93.55	117.14	44	29.33
3135.	Whyn (why8n)	150	80.33	101.06	44	29.33
3136.	ws (wdsyywd)	150	83.75	114.60	35	23.33
3137.	Vishal (vishal_kr_saw)	150	74.43	90.92	61	40.67
3138.	Unidentified (themunchkin3)	150	125.50	146.39	80	53.33
3139.	Daniel (sea_sick)	150	86.65	102.46	53	35.33
3140.	Casey (novacainr)	150	90.22	112.12	61	40.67
3141.	Necdet Ali (necdetaliozdur_...	150	64.14	80.31	31	20.67
3142.	Nadav (nadavb9)	150	62.42	97.22	36	24.00
3143.	linkai (linkailul)	150	95.94	125.50	56	37.33
3144.	Kreoniz (kreoniz)	150	61.41	74.47	31	20.67
3145.	jimjom (jimysucks)	150	147.98	187.38	122	81.33
3146.	Dmitry (dmitry_turcan)	150	68.58	90.87	32	21.33
3147.	David (d4v1dh)	150	103.91	131.43	62	41.33
3148.	Cindy (cwycindy)	150	77.99	106.44	51	34.00
3149.	Kapal Tua :v (cream777)	150	69.43	89.79	37	24.67
3150.	Brian (brianhsu7476)	150	75.03	87.85	46	30.67
3151.	(boy_314)	150	140.89	169.64	101	67.33
3152.	Bismith (bismith)	150	76.63	93.22	33	22.00
3153.	Arvind (arvindlamba454)	150	71.92	104.43	47	31.33
3154.	Lily (andisapple32)	150	67.95	86.36	33	22.00
3155.	Abby (abkwreu)	150	35.96	62.70	7	4.67
3156.	John Le (zingerburgerkfc)	149	73.78	99.74	43	28.86
3157.	Zaid (zaids)	149	84.92	108.42	34	22.82
3158.	♛₴𝕥o͓̽ᖇო·₴�...	149	73.04	91.82	40	26.85
3159.	waseem ahmad bhat (waseemraja)	149	60.40	91.39	29	19.46
3160.	john (sharks445)	149	82.96	107.29	41	27.52
3161.	Sebastian (sebastian070)	149	35.60	50.06	32	21.48
3162.	Rdmm (rdmm)	149	84.60	102.30	46	30.87
3163.	Moyosore (mokarios)	149	77.77	94.02	44	29.53
3164.	Airbender Aang (lolmode2)	149	94.38	115.62	40	26.85
3165.	Logan (laucian)	149	79.36	101.18	39	26.17
3166.	Hudson (hudson_the_cat)	149	57.00	75.70	24	16.11
3167.	GEMargad (gemrgd_23)	149	53.34	72.14	16	10.74
3168.	Eaglekott (eaglekott)	149	93.54	114.39	48	32.21
3169.	JesusWrite (jesus_write)	149	45.42	56.11	13	8.72
3170.	Connor (cellingson)	149	47.21	59.78	8	5.37
3171.	vardhman (vardhman)	149	57.18	83.13	23	15.44
3172.	Trent (uninterested)	148	126.29	166.70	95	64.19
3173.	Adrian (thebossboi1324)	148	65.41	98.95	46	31.08
3174.	☼_☼ (temuramir)	148	106.75	132.19	56	37.84
3175.	Ping Janat (ppppp5541)	148	43.81	64.95	9	6.08
3176.	Wenjie (pervysama)	148	128.96	147.46	104	70.27
3177.	Leona (onale)	148	125.00	153.06	95	64.19
3178.	Max (max_pinc)	148	83.14	108.27	38	25.68
3179.	Jupiter8000 (jupiter8000)	148	70.41	96.21	47	31.76
3180.	Jony (jonycolemak)	148	76.91	97.93	37	25.00
3181.	denis (j4yz11)	148	47.63	60.64	12	8.11
3182.	Isaac (inied)	148	99.58	133.35	56	37.84
3183.	HiteshM (hiteshm_riptide)	148	76.42	99.36	45	30.41
3184.	Habibullah (habibullahhussa...	148	50.02	71.90	19	12.84
3185.	Musa (greatwarrior235)	148	83.02	103.21	39	26.35
3186.	Jyotirmay (goldenguts)	148	65.32	83.62	36	24.32
3187.	Geux (geux)	148	40.84	58.94	14	9.46
3188.	WSY (elyx_2302)	148	93.69	111.86	64	43.24
3189.	Dennetix (dennetix)	148	57.57	69.45	28	18.92
3190.	Tady (concernednecron)	148	41.67	55.59	15	10.14
3191.	Arian (arianrz82)	148	62.83	82.06	32	21.62
3192.	Marc (andesandwich)	148	68.47	88.25	41	27.70
3193.	Anchit (anchit)	148	77.04	92.45	37	25.00
3194.	Priyam (priyam_anand)	148	54.33	71.43	9	6.08
3195.	Shally (shallybroken)	148	53.00	67.99	26	17.57
3196.	Woody (woody_wins_)	147	79.55	98.33	25	17.01
3197.	Manas (who_mana)	147	63.53	77.04	35	23.81
3198.	Vbee (vb33)	147	96.25	121.00	63	42.86
3199.	Justin (ustinj)	147	87.49	112.07	44	29.93
3200.	Poly (typingpoly)	147	90.53	118.52	46	31.29
3201.	tomdin0 (tomdin0)	147	32.19	43.87	9	6.12
3202.	tailcatch (tailcatch)	147	122.63	158.31	92	62.59
3203.	vinnii (slowvinni)	147	157.12	193.00	119	80.95
3204.	RaV (rav_the_writer)	147	101.26	124.74	61	41.50
3205.	Cool (mrcoolguy69)	147	111.12	138.61	72	48.98
3206.	MeHdi (mehdiii8)	147	96.82	120.09	69	46.94
3207.	Eugene (lilgene1)	147	88.84	114.97	45	30.61
3208.	Kaden (lifeshappy)	147	62.86	83.41	37	25.17
3209.	Sanji (kuroashi)	147	67.28	83.38	32	21.77
3210.	Jeden Osiem L (jedenosieml)	147	99.02	117.42	57	38.78
3211.	Bryan (iduhowpeopledo150wpm)	147	104.47	128.20	62	42.18
3212.	Hovok (hovok)	147	108.79	148.39	69	46.94
3213.	H A (hamada_ali)	147	78.71	98.61	33	22.45
3214.	FA (fa00)	147	47.26	57.78	20	13.61
3215.	BOTbkchod (bot_bakchod)	147	59.48	72.91	27	18.37
3216.	Muruganantham (bossmuruga)	147	40.29	56.74	14	9.52
3217.	Mehedi (mehedihasan)	147	61.62	76.27	34	23.13
3218.	yoozernaim (yoozernaim)	146	92.73	108.20	49	33.56
3219.	Aditya (typingspree31)	146	80.82	96.02	28	19.18
3220.	pat (trikster)	146	134.05	164.96	100	68.49
3221.	Tracking Time (trackingtime)	146	85.90	111.15	45	30.82
3222.	sura (suraflux)	146	83.43	100.09	47	32.19
3223.	AAARGH (statim)	146	87.44	111.09	54	36.99
3224.	Samuel (ssesena)	146	63.65	85.03	34	23.29
3225.	ZedHead01 (qdedmon87)	146	98.38	123.92	56	38.36
3226.	Jeon (owokunn)	146	113.88	138.74	74	50.68
3227.	Thomas (loboru)	146	133.92	168.71	109	74.66
3228.	JJ (jjbonta)	146	92.21	116.89	55	37.67
3229.	Tide (firefly441)	146	63.20	80.67	40	27.40
3230.	David (dave_h12)	146	78.80	95.38	36	24.66
3231.	(clouhhd_)	146	95.44	141.96	4	2.74
3232.	Lam (catposter1)	146	115.19	153.74	129	88.36
3233.	Nafidz (arckngel)	146	68.36	82.47	29	19.86
3234.	AouiGui (andersgrymer)	146	101.12	126.27	64	43.84
3235.	Holo (aisha23__)	146	90.99	110.42	55	37.67
3236.	acc (agglomeration)	146	126.28	155.93	98	67.12
3237.	m1dK$9T (adepa)	146	49.37	65.26	22	15.07
3238.	Lazy (lazy_gamer322)	146	56.17	68.91	17	11.64
3239.	Rocky (rockyparks)	146	72.88	83.84	27	18.49
3240.	Wayne (xwang4)	145	83.93	114.96	42	28.97
3241.	WinterCore (wintercore)	145	127.82	161.42	89	61.38
3242.	Umair (umair121)	145	75.76	95.98	34	23.45
3243.	ryleigh (thestonedpotato)	145	79.42	108.00	35	24.14
3244.	De Leo (theleo)	145	58.25	76.01	22	15.17
3245.	Delgerskhn (thege)	145	101.43	121.67	54	37.24
3246.	OULAHBIB (suicv)	145	65.69	82.91	30	20.69
3247.	spiky (spiky228)	145	101.60	119.92	69	47.59
3248.	mikey (snicker861)	145	86.01	107.37	50	34.48
3249.	FootedPear (ryanpear0)	145	75.56	99.15	40	27.59
3250.	Luis (regneva17)	145	74.60	97.73	35	24.14
3251.	parsa (parsa_ktz)	145	57.29	72.28	26	17.93
3252.	(palpha)	145	76.03	102.57	70	48.28
3253.	NessQuik (nessquik)	145	64.44	83.88	34	23.45
3254.	ROCKSTAR008 (mrbest6000)	145	112.81	145.72	77	53.10
3255.	IMSL (moonrabbit)	145	129.58	154.95	95	65.52
3256.	masterassassin3 (masterassa...	145	65.44	79.45	27	18.62
3257.	Hououin Kyouma (makise_kuri...	145	85.77	118.00	58	40.00
3258.	Marek (ksydry)	145	105.17	126.62	59	40.69
3259.	Luke (kipkat)	145	57.16	76.83	24	16.55
3260.	गुरु (jokerster)	145	80.85	103.90	37	25.52
3261.	Jiranimo (jiranimo)	145	32.86	52.35	19	13.10
3262.	Tane (husquin)	145	112.80	142.52	74	51.03
3263.	Gunner (gunner8)	145	90.96	115.49	59	40.69
3264.	Gabe (grahamcracker4)	145	69.57	89.96	40	27.59
3265.	Ћира (cira12345)	145	84.51	105.40	48	33.10
3266.	Alex (atduffaut)	145	70.95	96.04	37	25.52
3267.	Leeham (you_smell)	144	78.07	99.65	35	24.31
3268.	Xmoonsheep (xmoonsheep)	144	99.06	125.13	65	45.14
3269.	Zhu (viviora)	144	76.96	92.51	44	30.56
3270.	Sushi (sushixr)	144	70.51	93.38	30	20.83
3271.	Sulthan Cendikia (sulthance...	144	65.85	86.19	39	27.08
3272.	MAXIM (skramt)	144	55.78	74.49	12	8.33
3273.	saeed (saeedhosam)	144	62.47	83.14	31	21.53
3274.	Rice Chan (rice_chan)	144	108.76	131.97	103	71.53
3275.	Alpine (relambrien)	144	143.20	176.50	106	73.61
3276.	Paul (paul5005)	144	63.28	82.15	26	18.06
3277.	Sanchi (pachi_sanchi)	144	83.74	110.65	47	32.64
3278.	Nooby (noobythenoob)	144	87.32	110.70	51	35.42
3279.	Gina (nannelcam)	144	89.45	113.71	54	37.50
3280.	kevin (kongdonglong32)	144	85.45	112.20	45	31.25
3281.	Jubax (jubax)	144	90.01	110.57	49	34.03
3282.	Jayanth (jayanththelegit)	144	46.91	64.69	12	8.33
3283.	hossam (hossam_ramadan)	144	53.50	64.40	12	8.33
3284.	Francis (francis_7777)	144	60.82	79.70	27	18.75
3285.	fhbjnrng (fhbjnrng)	144	132.83	164.66	115	79.86
3286.	Eddie_NP (eddie023)	144	102.15	123.87	69	47.92
3287.	dylan (crspy)	144	85.30	118.61	29	20.14
3288.	Andre (andreandreandre)	144	90.87	113.54	50	34.72
3289.	Alex Jane (alex_jane)	144	40.83	54.29	15	10.42
3290.	chepe (albetrash)	144	79.32	101.22	46	31.94
3291.	Jo (typermac)	143	108.42	150.36	67	46.85
3292.	Otto (otto_types)	143	77.30	99.20	40	27.97
3293.	HuisbaasJR (ofbasecfin)	143	90.19	116.40	50	34.97
3294.	Mohammad (mostat)	143	50.43	62.14	14	9.79
3295.	salvation (mo7a_1913)	143	78.52	105.70	34	23.78
3296.	Memperor (memeemperor)	143	66.64	89.19	31	21.68
3297.	joey (joeraps)	143	119.95	139.13	102	71.33
3298.	Jerviz (jerviz)	143	107.24	133.46	80	55.94
3299.	Mycargoboom (hayadabest)	143	95.62	132.81	53	37.06
3300.	G (goutham_k)	143	45.25	59.16	13	9.09
3301.	Bruh? (funkun)	143	63.58	82.77	30	20.98
3302.	eunhyun (eunhyun)	143	113.79	145.88	73	51.05
3303.	Eric (ericcand)	143	82.36	103.14	35	24.48
3304.	jungkook (elizabethngg)	143	57.97	97.74	19	13.29
3305.	Notaleksandr (cartonito)	143	74.23	98.40	45	31.47
3306.	(bicycleman)	143	101.68	162.95	59	41.26
3307.	aspirar (aspirar)	143	97.56	122.32	92	64.34
3308.	Arees (arees)	143	77.19	97.64	39	27.27
3309.	Ahmad (aawwad172)	143	62.12	76.86	27	18.88
3310.	Bumble (rowantheboat)	143	52.17	73.53	17	11.89
3311.	w (wonton2)	142	130.54	155.90	93	65.49
3312.	TNT92fin (tnt92fin)	142	63.24	76.72	24	16.90
3313.	Shoe (shoebox004)	142	86.60	124.31	47	33.10
3314.	Andy (run_from_andy)	142	63.66	79.97	23	16.20
3315.	ritesh (ritesh123)	142	53.48	71.82	18	12.68
3316.	Neeraj (neeraj1)	142	58.66	77.60	22	15.49
3317.	Linfeng (llinfeng)	142	101.97	132.48	59	41.55
3318.	Rav (impaledbison)	142	80.96	105.07	37	26.06
3319.	Arnav (hyp3rn00b10)	142	57.80	77.58	21	14.79
3320.	Huoi (huy_truong_le)	142	86.79	117.60	48	33.80
3321.	111 (grimiv)	142	80.07	95.86	30	21.13
3322.	Chris (gatoroid37)	142	87.64	111.93	39	27.46
3323.	dylan_9802 (dylan_9802)	142	120.90	155.93	73	51.41
3324.	Brandon (dreonic)	142	65.88	81.96	28	19.72
3325.	Appropriate (d0wny)	142	97.30	133.50	57	40.14
3326.	Stanisław (bosastopaa)	142	54.09	75.08	18	12.68
3327.	ArklightF0x (arklightf0x)	142	56.35	73.74	30	21.13
3328.	antifragile (antifragile)	142	85.15	126.32	42	29.58
3329.	Agnar (agnar)	142	80.94	100.22	46	32.39
3330.	Marco (grinzosi)	142	45.59	56.67	18	12.68
3331.	tanvir (tanvir42)	142	53.75	73.90	24	16.90
3332.	anhar (_anhar)	141	104.45	127.91	51	36.17
3333.	yen (yennn)	141	62.26	82.47	24	17.02
3334.	the (theguy27)	141	80.31	95.69	34	24.11
3335.	Tareq (tareq_2007)	141	52.09	68.23	17	12.06
3336.	breddreamer (rasel_hasan)	141	50.19	63.16	9	6.38
3337.	Just a potato (quocbinhgt3007)	141	53.50	82.16	26	18.44
3338.	SirShrek69 (puffers23)	141	108.53	124.51	59	41.84
3339.	Nayeem (obaydul_hasan_nayeem)	141	50.10	61.74	18	12.77
3340.	Andree (ntuanson97)	141	105.81	127.04	71	50.35
3341.	Nim (nim1chimpsky)	141	85.91	111.93	45	31.91
3342.	(lwycsrc)	141	125.92	156.81	86	60.99
3343.	Michael (kame3200)	141	79.39	106.30	31	21.99
3344.	(jlachney)	141	135.20	174.23	96	68.09
3345.	Illumin80 (illumin80)	141	60.60	73.33	25	17.73
3346.	Ethan (ethant772)	141	116.35	156.80	79	56.03
3347.	bruh (diablodvorak)	141	87.49	106.53	35	24.82
3348.	Dear (dearme)	141	67.03	81.48	33	23.40
3349.	sally (creamdonut)	141	108.02	146.97	69	48.94
3350.	(barfing)	141	134.32	168.93	96	68.09
3351.	ashiq hussain wani (ashiqwani)	141	46.83	58.56	14	9.93
3352.	Ar7N (ar7n)	141	70.60	98.54	31	21.99
3353.	anas (ana_1s)	141	77.38	95.36	31	21.99
3354.	HADI (adilmuhammadi)	141	58.77	73.52	28	19.86
3355.	Abdelrahman (7gab)	141	78.12	109.15	31	21.99
3356.	Abhishek (abhishek_mtb)	141	46.55	59.97	18	12.77
3357.	Souptacks (souptacks)	140	70.92	96.32	29	20.71
3358.	shota.b (shotiko8)	140	90.66	119.96	51	36.43
3359.	Lulu (shade_senpai)	140	116.89	150.30	77	55.00
3360.	saket (saket1harsh2)	140	58.49	73.53	23	16.43
3361.	Aaron (rondc108)	140	62.52	81.43	39	27.86
3362.	BEing VinCI (ppubalo)	140	87.46	112.12	49	35.00
3363.	Dario (oodarioo)	140	49.93	65.51	17	12.14
3364.	hamza (mizoxes)	140	96.28	118.55	58	41.43
3365.	Richrad (laci279)	140	77.46	93.26	32	22.86
3366.	Hai (ky0ka)	140	83.13	107.77	34	24.29
3367.	Viacheslav (krevetko)	140	68.01	85.12	26	18.57
3368.	Yunusali (khakimjanovich)	140	60.96	81.15	21	15.00
3369.	Jonathan (jonathan888)	140	69.67	88.84	32	22.86
3370.	jittery (jittertypes)	140	83.95	105.23	45	32.14
3371.	simon (i_am_simon)	140	97.51	128.09	52	37.14
3372.	asdf (itz_pvp1235)	140	87.89	110.30	50	35.71
3373.	Jan (hokejan_14)	140	37.51	51.11	8	5.71
3374.	Alexander (greenocelot26_dv...	140	106.35	130.44	58	41.43
3375.	Goldie (goldie87)	140	40.06	54.84	12	8.57
3376.	CVH (cvh_)	140	136.45	163.05	106	75.71
3377.	Badri (bxdri)	140	123.66	167.54	70	50.00
3378.	Joshua (busbud)	140	71.92	94.50	35	25.00
3379.	SKY (avid_learner8)	140	29.64	36.69	20	14.29
3380.	Anis (anis22)	140	59.05	74.17	29	20.71
3381.	65best (65best)	140	106.89	134.49	61	43.57
3382.	Anas (01anas)	140	55.03	72.26	18	12.86
3383.	ayman (aymanzraiga)	140	35.69	51.37	9	6.43
3384.	hhj (baidu123)	140	57.66	70.67	19	13.57
3385.	Indian (typelife2)	140	56.08	70.50	24	17.14
3386.	Negatory (saltedslug)	140	64.70	77.95	29	20.71
3387.	FREE PALESTINE (zaffles)	139	71.39	94.11	33	23.74
3388.	Cal (wiscahhhhnsin)	139	115.70	151.88	76	54.68
3389.	Vanza (vanzasetia)	139	53.14	67.42	10	7.19
3390.	Ufo23 (ufo23gg)	139	90.17	112.14	55	39.57
3391.	Tar (typer_noob)	139	100.58	126.19	47	33.81
3392.	Welcome to Brazil (thunder02)	139	111.20	146.30	84	60.43
3393.	tayyab (tayyab246)	139	48.02	62.96	18	12.95
3394.	sam (swalden)	139	85.63	104.07	51	36.69
3395.	(ﾉ◕ヮ◕)ﾉ*:･ﾟ�...	139	121.17	159.34	79	56.83
3396.	Riddy (songridv)	139	84.96	120.42	43	30.94
3397.	rafi (sandbomber)	139	79.20	105.03	31	22.30
3398.	Rem (remroid66)	139	83.59	104.89	44	31.65
3399.	Randall (rdox10)	139	118.65	156.39	83	59.71
3400.	Mediumsecy (mediumsecy)	139	67.84	84.20	27	19.42
3401.	V¹ҡҡʏ (littlevikky_)	139	76.57	96.00	31	22.30
3402.	leo (leokkqqjj)	139	42.74	55.83	14	10.07
3403.	Daniel (kimster773)	139	86.38	108.56	46	33.09
3404.	Jake (jmanq)	139	66.63	97.12	38	27.34
3405.	Ishaan (ishaank10)	139	67.25	86.79	32	23.02
3406.	Harjot (harjot2000)	139	59.83	74.70	25	17.99
3407.	Justin (ggwp_123)	139	60.88	71.69	16	11.51
3408.	Sabrina (getrektttt)	139	66.92	96.43	37	26.62
3409.	Le Hoang (gampingbua)	139	52.11	67.45	14	10.07
3410.	Soren (cuckslayer)	139	74.01	96.73	40	28.78
3411.	crai (crai27)	139	91.29	110.11	43	30.94
3412.	Will (carbohydra)	139	63.23	76.63	40	28.78
3413.	Yakiniku (bigmeatball)	139	102.17	128.79	44	31.65
3414.	Ardison (arddison)	139	100.37	116.73	50	35.97
3415.	lakhey (antivenene)	139	94.26	117.50	49	35.25
3416.	longi (alongens)	139	95.00	107.29	40	28.78
3417.	Nick S. (furbyparade226)	139	105.56	127.91	56	40.29
3418.	dlvhdr (dlvhdr)	139	78.71	101.87	32	23.02
3419.	a-s-a (kaustiflat)	139	45.01	59.01	34	24.46
3420.	Zulsorai (zulsorai)	138	71.40	92.36	33	23.91
3421.	Gustavo (yoosteen)	138	66.25	76.67	29	21.01
3422.	Alosson (tiger6654)	138	63.87	80.56	32	23.19
3423.	Laggy (thefitfatass)	138	122.59	146.03	97	70.29
3424.	sidharth (sidharth_71)	138	67.25	95.07	41	29.71
3425.	shantal (shantal0924)	138	69.04	98.90	31	22.46
3426.	Rodney (rodneyslafuente)	138	92.20	113.50	35	25.36
3427.	NOJ8 (noj8)	138	82.24	109.33	44	31.88
3428.	Gemeine (nemememky)	138	76.20	99.22	37	26.81
3429.	Mahdi Lotfi (mahdilotfi)	138	58.50	72.18	23	16.67
3430.	jeyy (jeyy11)	138	35.22	46.29	8	5.80
3431.	Liam (je1q)	138	47.77	64.13	17	12.32
3432.	Lushtifer (inanutshell)	138	71.41	89.45	41	29.71
3433.	hhg (hhg2)	138	60.34	73.66	34	24.64
3434.	Evan can't pass the validat...	138	95.52	114.81	47	34.06
3435.	Daniel (danvs60)	138	77.77	99.08	36	26.09
3436.	Benjamin Martin (benjamin_m...	138	61.52	78.08	31	22.46
3437.	Benjamin (banjo_)	138	59.00	75.43	25	18.12
3438.	life (armaansoni)	138	76.89	96.81	40	28.99
3439.	Arun (thenooboflegend)	137	80.99	95.93	36	26.28
3440.	Cuong (qt1003)	137	62.40	83.16	24	17.52
3441.	Abror (owl2023)	137	49.43	62.19	15	10.95
3442.	ObiWanKeyboardobi (obiwanke...	137	84.97	119.84	36	26.28
3443.	myaonfya (myaonfya)	137	72.83	107.41	29	21.17
3444.	Mithun (mithu16_2001)	137	57.62	73.14	51	37.23
3445.	J (mindjar)	137	27.70	37.13	23	16.79
3446.	horyzen1 nq (lucknumber8)	137	87.62	119.49	44	32.12
3447.	Casado con Ale (lrip)	137	118.35	145.35	59	43.07
3448.	Little (littlepump1)	137	77.34	95.64	38	27.74
3449.	kingsley (kings350)	137	68.78	92.82	44	32.12
3450.	kacper szybki (kacper1)	137	47.55	60.56	12	8.76
3451.	Harish (harish_roxx)	137	57.84	79.51	25	18.25
3452.	gcc42 (gcc42)	137	91.93	112.87	51	37.23
3453.	Shivanshu (cvanshu)	137	67.96	85.78	28	20.44
3454.	Dylan (chrunchy)	137	91.13	117.66	44	32.12
3455.	jen (chennyjen)	137	109.65	136.50	69	50.36
3456.	Jacy (bohdan_danyltsiv)	137	78.37	97.40	31	22.63
3457.	Aparesh (aparex)	137	69.92	87.35	34	24.82
3458.	aculeasis (aculeasis)	137	81.96	117.87	37	27.01
3459.	abdallah (abdallahmontaser)	137	41.83	52.70	10	7.30
3460.	Lorenzo (lolohardy)	137	71.87	92.95	32	23.36
3461.	Eran (umm_eran)	136	103.49	131.26	54	39.71
3462.	sleepo (sleepotimer)	136	93.96	113.09	56	41.18
3463.	Serv (servgd)	136	79.86	99.30	42	30.88
3464.	Umer (programmer_1)	136	83.92	101.79	48	35.29
3465.	Ibrahim (platon)	136	95.16	124.36	52	38.24
3466.	weirdo (master_guy17)	136	81.59	113.48	35	25.74
3467.	medkit phighting (gayliquid...	136	95.25	138.80	44	32.35
3468.	f2realw (f2realw)	136	67.94	85.12	48	35.29
3469.	Bálint (diabolokiller)	136	82.82	102.88	30	22.06
3470.	Justin (basicjc)	136	58.05	70.56	25	18.38
3471.	asdsfdg (asdfgdsf)	136	76.36	101.33	34	25.00
3472.	tstats[vintage_maavirup] (v...	136	57.14	69.22	25	18.38
3473.	Midorinn1222 (midorin1222)	136	65.91	89.64	41	30.15
3474.	Tayler (tay_bae11)	136	58.05	84.98	35	25.74
3475.	Yurii (yura198)	136	66.78	89.34	32	23.53
3476.	Zuhaib (zuhaibdam)	135	104.61	135.29	63	46.67
3477.	👺Wainie san (wxia)	135	94.30	124.37	49	36.30
3478.	Hyena (wildhyena)	135	84.16	114.03	31	22.96
3479.	Guest (whoyoung99)	135	85.75	113.78	37	27.41
3480.	Will (w1llmcl)	135	91.95	138.79	49	36.30
3481.	Uladzislau (vlad_13_borisov)	135	76.28	90.16	28	20.74
3482.	Tor (tortle4444)	135	49.61	66.13	12	8.89
3483.	Max (thisismydrive1997)	135	100.99	117.51	43	31.85
3484.	Th3BossC (th3bossc)	135	82.41	112.55	34	25.19
3485.	Taso (tas123)	135	83.85	108.49	62	45.93
3486.	sliptok (sliptok)	135	87.39	115.91	38	28.15
3487.	Seb (sebb7y)	135	103.73	120.46	73	54.07
3488.	Reenreen (reenreen)	135	70.24	91.67	41	30.37
3489.	PogChamp (raziqphantomz)	135	114.80	134.82	77	57.04
3490.	Allen (onelonelyguy101)	135	64.58	89.69	30	22.22
3491.	Nour (nourxcx)	135	105.50	135.10	66	48.89
3492.	Mohammad (moreda1999)	135	74.31	95.54	36	26.67
3493.	Michael (mihcael)	135	95.51	125.68	53	39.26
3494.	Nour (micasa_ackarmen11)	135	36.86	46.70	10	7.41
3495.	J (jihoomoon)	135	75.21	94.54	36	26.67
3496.	ヴィエット (hsdpa365)	135	86.69	112.36	38	28.15
3497.	chabe (halfu)	135	95.02	123.59	86	63.70
3498.	Guggles (guggles)	135	103.60	130.08	71	52.59
3499.	Manne (epicblueberry)	135	85.46	106.74	37	27.41
3500.	Crystal (arcee143)	135	85.34	113.45	97	71.85
3501.	AnasigN (anblk)	135	36.39	56.10	7	5.19
3502.	ali (ali79taba)	135	71.16	84.93	46	34.07
3503.	Ezad (ezad99)	135	55.62	72.76	21	15.56
3504.	Bram (yogurt55)	134	72.70	95.52	36	26.87
3505.	🚀 (wildreamz)	134	104.71	114.06	46	34.33
3506.	thinkingds (sohandeshar)	134	74.86	90.29	30	22.39
3507.	Ralston (ralstonnub)	134	63.11	80.68	35	26.12
3508.	Avery (purplat)	134	105.43	141.72	49	36.57
3509.	Vincent (not_a_robot)	134	103.44	130.90	59	44.03
3510.	muchinchai (muchinchai)	134	88.82	103.57	43	32.09
3511.	Matiss (mazainwastaken)	134	37.18	47.12	5	3.73
3512.	loveleen (loveleenasalia)	134	60.04	71.25	19	14.18
3513.	Josh (expiredvenom)	134	98.31	116.77	52	38.81
3514.	Anik (eternatus)	134	62.70	74.70	36	26.87
3515.	Enrico (enricoaf)	134	93.53	133.42	58	43.28
3516.	DunDun (dundunbread)	134	56.97	70.21	22	16.42
3517.	cadde (cadde)	134	59.00	75.03	18	13.43
3518.	morsetyper (typing_with_morse)	134	13.52	21.40	27	20.15
3519.	Benjamin (xlr8or)	133	94.01	112.85	38	28.57
3520.	9aswara (victorious1)	133	39.38	59.84	9	6.77
3521.	Eugene (sushiwaumai)	133	77.86	97.92	37	27.82
3522.	Sean Paolo (seanpaolo_22)	133	80.60	99.23	42	31.58
3523.	tstats[rajveer_100] (rajvee...	133	53.27	68.16	18	13.53
3524.	Stas (onixflip)	133	72.57	92.06	25	18.80
3525.	Omar (omar_ziada)	133	81.54	113.59	42	31.58
3526.	J (nothisisjeff)	133	81.40	102.58	30	22.56
3527.	. (lun_rix)	133	85.63	103.70	29	21.80
3528.	Mamazait (kozhoev1)	133	39.92	69.99	6	4.51
3529.	jakub (jakub177)	133	84.44	106.17	37	27.82
3530.	JJ (jajo_00)	133	49.98	64.19	15	11.28
3531.	Jacob (jacobjuras)	133	115.01	141.86	77	57.89
3532.	Cube (cubedefender)	133	84.20	111.91	37	27.82
3533.	Em (cookie666)	133	88.03	111.19	93	69.92
3534.	Petrus (clavigerpc)	133	62.58	83.59	32	24.06
3535.	nub (buildernub)	133	66.87	87.70	33	24.81
3536.	Andrei (belearau)	133	81.93	101.65	34	25.56
3537.	Bauyrzhan (baurtokenov)	133	107.45	130.06	66	49.62
3538.	An (anhanpro2k)	133	82.52	102.76	40	30.08
3539.	albert (albertos13)	133	89.74	114.61	43	32.33
3540.	Admaster (admaster)	133	59.67	80.33	29	21.80
3541.	mohamed (spear_dfjdklf)	133	64.94	84.80	32	24.06
3542.	Eryk (erykeryk1998)	133	40.91	59.30	16	12.03
3543.	John (whalenj)	132	55.39	69.39	16	12.12
3544.	Mau (walfare_12)	132	93.52	122.64	50	37.88
3545.	Gary (vision_123)	132	52.25	63.59	25	18.94
3546.	Jack (user85793)	132	92.79	123.43	47	35.61
3547.	Keith (touchpoint)	132	69.72	86.91	37	28.03
3548.	afafaf (tkuo42)	132	113.38	139.23	79	59.85
3549.	gfy (tiga6)	132	42.29	59.89	14	10.61
3550.	Bùi (thundergod1311)	132	63.57	81.48	30	22.73
3551.	gabriel (super_racer1)	132	68.42	88.37	25	18.94
3552.	wiredShark (slamerpunch)	132	91.47	123.13	45	34.09
3553.	Sam (samsmoke)	132	65.66	80.27	28	21.21
3554.	Erik (rocketdog_23)	132	67.73	82.27	17	12.88
3555.	Soham (okaysoham)	132	53.32	69.41	21	15.91
3556.	trimmtrabb (neyoka)	132	83.64	104.49	43	32.58
3557.	M (musketeertypist)	132	108.41	130.35	68	51.52
3558.	John (meep_beep)	132	76.19	98.47	39	29.55
3559.	2Centuries (marwankhaled)	132	96.06	118.42	49	37.12
3560.	Abhijeet (free_wanderer)	132	59.91	79.97	30	22.73
3561.	Fire (fire_rice)	132	77.19	98.72	32	24.24
3562.	Dishant (dishant_10)	132	46.52	62.50	11	8.33
3563.	Aron (aronbk)	132	91.62	112.41	44	33.33
3564.	PinkyPonky (pinky_ponky)	132	61.32	86.71	31	23.48
3565.	Shreya (shreya02)	132	36.21	45.05	6	4.55
3566.	Dat (dat_amazon)	132	23.42	72.97	21	15.91
3567.	Stefan (x2stefan)	131	57.22	78.77	23	17.56
3568.	Guest (weruio)	131	72.66	98.31	36	27.48
3569.	vrz (vrztaa)	131	64.17	77.04	30	22.90
3570.	Dante (therealdante13)	131	58.04	71.86	19	14.50
3571.	Lincoln (soupyy34)	131	81.15	110.05	35	26.72
3572.	Syie (shinze)	131	110.37	139.79	59	45.04
3573.	Roman (romanzm19)	131	35.09	44.62	7	5.34
3574.	RHYTHM MOTWANI (rhythm_123)	131	28.09	38.89	26	19.85
3575.	Myles (pord)	131	49.94	62.45	8	6.11
3576.	Aaditya Pal (ninjaadi7903)	131	86.09	114.24	31	23.66
3577.	nivedh (n43527)	131	84.66	103.44	38	29.01
3578.	mik (miiik)	131	76.29	93.31	39	29.77
3579.	Martin (megdal02)	131	101.75	123.95	58	44.27
3580.	Lucy (masterlu789)	131	77.80	97.50	24	18.32
3581.	Luis (lmorales)	131	90.97	113.07	49	37.40
3582.	Karan (kk11007)	131	34.02	47.04	6	4.58
3583.	chuanHui (juchh)	131	37.79	46.43	10	7.63
3584.	hello :) (heyimalexsmileyface)	131	105.71	134.81	51	38.93
3585.	Usman (grim_09)	131	75.56	98.51	49	37.40
3586.	Jayden (gancube)	131	91.99	123.60	37	28.24
3587.	Alistair (futuresenator)	131	79.34	109.35	36	27.48
3588.	Frara (frara)	131	43.81	61.93	10	7.63
3589.	Cuthbert (cuthybert)	131	123.51	163.01	86	65.65
3590.	braden (cablebox)	131	63.81	100.35	33	25.19
3591.	Abdy (a7xsg)	131	50.58	63.28	11	8.40
3592.	Ryan (rtyocum)	131	69.01	83.40	24	18.32
3593.	Fabio (fl1410)	131	60.30	77.72	25	19.08
3594.	Shnyll (shnyll10)	131	56.31	85.22	21	16.03
3595.	bozo (erengunaydin_)	131	78.70	98.61	37	28.24
3596.	Zeyad (zeyad_mohamed)	130	45.17	58.82	12	9.23
3597.	GOBLIN (xgoblin)	130	106.50	146.84	60	46.15
3598.	Hunter (wizardhunter11)	130	85.26	108.99	35	26.92
3599.	Daehan (vitamaxdh)	130	93.45	116.83	44	33.85
3600.	Md. Tarek Hasan (tarek_racer)	130	60.80	78.86	19	14.62
3601.	Timofey (t1m0n)	130	81.38	95.69	39	30.00
3602.	sherry (sherry4)	130	75.61	93.31	37	28.46
3603.	Remi (remi_11)	130	56.64	72.04	24	18.46
3604.	Red (redchristian16)	130	81.57	100.60	42	32.31
3605.	Pheontern (pheontern)	130	68.11	83.11	29	22.31
3606.	Sriram (nvsriram)	130	83.63	99.69	40	30.77
3607.	Mikey (miket349)	130	109.71	147.61	55	42.31
3608.	heythisistej (lucknumber8_alt)	130	88.81	115.03	43	33.08
3609.	Olexiy (lexk)	130	77.29	98.63	38	29.23
3610.	Mohammed (ledger67)	130	76.95	94.65	23	17.69
3611.	nakkooo (kuudere)	130	137.10	183.15	90	69.23
3612.	mike (jazz_hands)	130	107.40	130.48	60	46.15
3613.	laezza (inimitabile)	130	95.00	130.55	51	39.23
3614.	SMdG (hyperlord)	130	67.93	80.91	34	26.15
3615.	endless (dm475)	130	76.65	105.94	40	30.77
3616.	Corné (corneduring)	130	73.41	88.98	34	26.15
3617.	Tenzin (cleggmcmuffin)	130	90.15	120.53	45	34.62
3618.	Billy (battlefieldragon)	130	101.62	119.08	50	38.46
3619.	Basketbla (basketbla)	130	72.87	92.74	40	30.77
3620.	Miguel (anckael)	130	101.43	122.90	61	46.92
3621.	Akshay (akshay_c123)	130	42.15	57.12	13	10.00
3622.	akash_mzp (akash04mzp)	130	34.69	47.40	9	6.92
3623.	Steve (addictedtoendorphins)	130	107.32	124.01	68	52.31
3624.	Abbey (abbey240901)	130	85.64	101.67	30	23.08
3625.	Ni (013ni)	130	94.04	119.56	50	38.46
3626.	Lucyfer666 (lucyfer666)	130	71.53	90.06	38	29.23
3627.	bg (bbbggg)	130	33.41	44.12	7	5.38
3628.	David (nesor)	130	61.88	88.43	32	24.62
3629.	winner (winner11)	129	106.50	132.17	72	55.81
3630.	Tom (tom09876)	129	53.41	65.75	11	8.53
3631.	TJ (timothyjan)	129	86.95	105.65	43	33.33
3632.	Pedro (timboly3)	129	98.39	131.60	61	47.29
3633.	Rouven (therealr5)	129	44.49	58.46	14	10.85
3634.	Person (person753)	129	72.37	96.25	42	32.56
3635.	Alexander (need4speed402)	129	91.80	132.07	40	31.01
3636.	Naeem (naeemsalarzai)	129	39.45	56.18	15	11.63
3637.	Niue (miloszz)	129	74.24	91.13	26	20.16
3638.	Kreingkrai (kengkreingkrai)	129	67.06	81.93	33	25.58
3639.	Muhammad (junaidqazi)	129	57.53	73.06	19	14.73
3640.	Jacob (jacobogbeide)	129	73.71	97.76	28	21.71
3641.	David (hanid3)	129	76.81	98.32	37	28.68
3642.	Hamza π (hamzza_)	129	104.07	125.08	55	42.64
3643.	augustus (guslee)	129	106.61	130.85	57	44.19
3644.	Falitac (falitac)	129	78.34	103.16	46	35.66
3645.	TypingSince2017 (expeditive)	129	147.70	184.96	98	75.97
3646.	radish (onlyradish)	129	94.09	115.88	58	44.96
3647.	Nikhil (momo7636)	129	49.06	59.85	11	8.53
3648.	CHUGGITYPES (chuggitypes)	129	74.98	97.12	21	16.28
3649.	Decent (coolgamerplayer124)	129	73.99	94.61	30	23.26
3650.	Wouter (wouter_kuijk)	128	87.93	106.98	40	31.25
3651.	venki (venki15)	128	66.16	82.92	60	46.88
3652.	Haris (undead_slayer)	128	67.96	83.43	58	45.31
3653.	tje (tje04)	128	88.65	119.56	40	31.25
3654.	Raymond (szlesh)	128	93.08	121.77	53	41.41
3655.	saniya (supersaniya)	128	54.98	68.48	18	14.06
3656.	bubbleTEA (stefsbored)	128	77.86	102.63	34	26.56
3657.	10 🆆🅿🅼 (sostdeo)	128	57.95	67.55	20	15.63
3658.	Roy (sisalt)	128	99.40	123.30	47	36.72
3659.	Shukhrat (shux121995)	128	70.79	87.26	28	21.88
3660.	Raghav (redsondude)	128	99.24	119.91	48	37.50
3661.	Ravindra (ravindrats)	128	62.42	75.49	19	14.84
3662.	Phillip (phillip_kim)	128	84.00	124.64	45	35.16
3663.	Caleb (miniso0987)	128	132.14	164.26	53	41.41
3664.	johnny :P (johnny234)	128	87.49	108.27	39	30.47
3665.	Ivan (ivanv1997)	128	62.88	72.06	21	16.41
3666.	gab (ggzl1998)	128	106.15	128.38	72	56.25
3667.	AMM (gamesplaytest)	128	61.33	82.90	25	19.53
3668.	alloine0220 (d1rtyd33d_5)	128	51.16	70.41	11	8.59
3669.	BOOGIE (bobarex)	128	47.02	60.34	10	7.81
3670.	blaze (blaze_012)	128	54.57	65.92	10	7.81
3671.	tstats[beedi] (beedi)	128	72.41	96.51	38	29.69
3672.	Andrew (andrewfischr)	128	66.61	81.81	21	16.41
3673.	Abstraxions (abstraxions)	128	115.66	141.64	65	50.78
3674.	Gabe (zonazebra)	128	67.65	88.16	34	26.56
3675.	shishir_karanth (shishira1203)	128	90.50	112.60	46	35.94
3676.	Peter (upsala_koy)	127	75.82	92.01	33	25.98
3677.	Aren (tl8xv)	127	89.96	121.55	39	30.71
3678.	sheep (theonesheep)	127	100.72	129.58	53	41.73
3679.	SR (ssdel)	127	85.13	116.43	48	37.80
3680.	HEMEL (sm_hemel)	127	74.20	89.27	23	18.11
3681.	Cris (schmidtolini)	127	98.29	123.88	52	40.94
3682.	Basti (schinken38)	127	71.79	98.09	35	27.56
3683.	Mohamad (mhsyazani)	127	66.43	88.47	30	23.62
3684.	mazen (mazen25287)	127	55.84	73.12	13	10.24
3685.	Bat-Amgalan (mambatukaa)	127	80.67	97.79	36	28.35
3686.	KTH (kthmanish)	127	86.25	115.89	42	33.07
3687.	ghoudiy (ghoudiy)	127	66.75	92.12	20	15.75
3688.	Kalervo (dilbodeadhorseflog...	127	66.94	81.70	23	18.11
3689.	desarly (desarlymarshall)	127	64.01	87.04	32	25.20
3690.	Wendy (crystalblue123)	127	56.64	70.84	21	16.54
3691.	Chumba1ba (chumba1ba)	127	94.62	118.73	43	33.86
3692.	Jimmy Le🇻🇳🇺🇸 (c...	127	70.91	88.72	30	23.62
3693.	Krittiphum (100508274)	127	101.36	122.35	54	42.52
3694.	Ryan (barnes12)	127	64.10	83.71	30	23.62
3695.	Andrei (_son_)	126	169.89	194.72	118	93.65
3696.	Pratul NHK (zer_fus)	126	56.45	71.39	20	15.87
3697.	Aaron (the_bus)	126	76.67	89.91	35	27.78
3698.	no (theovive)	126	101.92	128.87	60	47.62
3699.	Sean (seandominic14)	126	78.45	93.72	38	30.16
3700.	felix (sanfelix)	126	64.72	87.31	26	20.63
3701.	Sam (samb11)	126	102.09	126.16	53	42.06
3702.	PUO (puomaster)	126	67.43	83.55	40	31.75
3703.	Daniel Mulligan (parubujotuce)	126	41.06	58.84	12	9.52
3704.	Panic (panicswitch07)	126	85.86	131.07	44	34.92
3705.	idell (notidell)	126	89.58	110.24	42	33.33
3706.	Mauro (mauronaval)	126	52.42	68.40	15	11.90
3707.	mackysmach (mackysmach)	126	60.64	82.05	35	27.78
3708.	John (johnykenny)	126	73.32	98.23	29	23.02
3709.	Miles (jetblxckwalls)	126	101.21	126.02	57	45.24
3710.	Snowy (it_was_lag)	126	90.74	127.61	40	31.75
3711.	Jacob (hydrogenation)	126	87.76	116.76	40	31.75
3712.	stained (fartunderwear)	126	170.19	200.25	0	0.00
3713.	m&m (egyz)	126	84.13	101.55	43	34.13
3714.	Pei Bin (cheongpeibin)	126	93.64	132.28	45	35.71
3715.	Bymbadulam (boa_7515)	126	50.49	67.68	12	9.52
3716.	Anadi vyas (anadivyas)	126	73.67	88.67	19	15.08
3717.	Adam (adammomen)	126	61.44	76.63	19	15.08
3718.	Nuub (1brasil)	126	102.42	131.43	51	40.48
3719.	Typemasterluka (fica030)	126	56.94	73.17	16	12.70
3720.	Bob (wmwmwmwm)	125	81.26	115.25	31	24.80
3721.	Tanver (tanverrupos)	125	80.54	107.40	34	27.20
3722.	Stafford (staffordv)	125	84.21	111.88	29	23.20
3723.	Sphynx (sphynxy)	125	80.83	103.32	32	25.60
3724.	Soph (soap28)	125	43.92	57.08	6	4.80
3725.	ridicolos (ridicolos)	125	79.93	96.80	37	29.60
3726.	Rendi (rendi_touchtype)	125	91.60	120.60	46	36.80
3727.	Perry ᗜˬᗜ (perryok)	125	125.45	151.72	77	61.60
3728.	Aisha (needforspeed_)	125	52.96	76.27	14	11.20
3729.	Shonade (mr_overclocked)	125	87.40	128.17	32	25.60
3730.	Ujjwal (megamindx)	125	65.13	96.09	24	19.20
3731.	Mayank (mayank1508)	125	71.75	85.59	24	19.20
3732.	Murk (marchell0)	125	66.39	91.85	33	26.40
3733.	Maninder (mani_ms1)	125	76.42	101.69	32	25.60
3734.	Jessica (jeguar)	125	89.30	127.51	36	28.80
3735.	Grant (gboi881)	125	65.53	80.93	28	22.40
3736.	daniel (dpainter)	125	99.51	118.59	57	45.60
3737.	Cuong (cuongdao)	125	78.55	99.60	32	25.60
3738.	Jeff (chiefjeef)	125	109.83	136.78	75	60.00
3739.	CB (cb_cabral)	125	37.36	47.44	11	8.80
3740.	Wen Ree (cataclysm234)	125	79.51	103.72	37	29.60
3741.	Brandon (brandon_b)	125	80.53	102.73	28	22.40
3742.	Manu (basuramanu)	125	111.15	159.27	65	52.00
3743.	ATRAN (atranhehe)	125	76.91	98.36	25	20.00
3744.	ارمغان (armaghan_ahmed)	125	56.87	71.22	17	13.60
3745.	Slowpoke (amisanthropist)	125	95.14	125.73	41	32.80
3746.	araceli nicole (xrxcxlx)	124	73.28	104.45	74	59.68
3747.	dude (udead1)	124	108.62	124.60	58	46.77
3748.	Quan (tmquan98)	124	77.36	117.83	25	20.16
3749.	Scalmole (scalmole)	124	89.09	112.16	47	37.90
3750.	Per (perlydersen)	124	67.31	81.15	29	23.39
3751.	NickBwalley (nickbiiy)	124	97.16	122.02	52	41.94
3752.	mayimbe (mayimbe194)	124	76.99	98.10	28	22.58
3753.	Stitch (lostowo)	124	65.58	91.29	48	38.71
3754.	Jay (jay_soh)	124	93.89	109.92	41	33.06
3755.	Jason (jasonw1121)	124	106.33	134.77	80	64.52
3756.	Gabriel (itsgiorno)	124	56.22	68.35	27	21.77
3757.	g (georgecolin1221)	124	44.30	62.98	11	8.87
3758.	Roman (freasy)	124	59.97	77.91	21	16.94
3759.	Anye (farmerfred)	124	81.93	100.57	44	35.48
3760.	Edu (edlofe)	124	63.19	84.05	29	23.39
3761.	Sir (dsfee)	124	66.21	82.33	33	26.61
3762.	hu (crediblez)	124	143.90	190.09	89	71.77
3763.	bhavesh (bhanucsgo)	124	55.60	75.51	23	18.55
3764.	bangka (bangkabelitung)	124	81.42	102.82	26	20.97
3765.	aman729272 (aman729272)	124	55.50	64.91	19	15.32
3766.	Tony (adbaldini)	124	45.57	59.79	9	7.26
3767.	Vu (3nim3)	124	85.17	108.17	31	25.00
3768.	Zx (zxloh)	123	72.11	89.44	25	20.33
3769.	Zodi (zodi_dutoit)	123	70.63	84.61	28	22.76
3770.	Yash (yash1402_)	123	85.14	108.74	28	22.76
3771.	k2K (worthwhile)	123	64.48	85.47	22	17.89
3772.	Julia (thejulia)	123	66.91	81.06	21	17.07
3773.	sathwik (sathwik_7770)	123	58.16	73.70	18	14.63
3774.	RoSchnitzel (sab_lyptical42)	123	63.53	84.00	15	12.20
3775.	Logan (ronaldo_02)	123	78.45	106.21	38	30.89
3776.	Novandru (novandru98)	123	68.27	87.85	23	18.70
3777.	Lawrence Leones (leonnids)	123	114.52	150.73	64	52.03
3778.	JuanDa (juanmartinez111)	123	73.25	92.70	30	24.39
3779.	AKIS (harkar)	123	62.75	79.12	29	23.58
3780.	Desert (desert_eagle)	123	38.80	50.05	9	7.32
3781.	isaac (darealjoemama)	123	73.68	95.49	38	30.89
3782.	ousssama (cybereagle2001)	123	51.60	65.74	14	11.38
3783.	Code_slayer_25 (code_slayer...	123	39.40	49.86	10	8.13
3784.	bombplay1 (bombplay1)	123	78.65	102.78	35	28.46
3785.	nonaem (apansi)	123	90.16	119.95	39	31.71
3786.	Ankit (ankp)	123	47.61	59.30	13	10.57
3787.	aero (aeroagg15)	123	84.14	110.91	38	30.89
3788.	sketchy (sketchysquirrel)	123	79.02	100.30	36	29.27
3789.	jclb (jclb)	123	67.15	88.43	30	24.39
3790.	donald_dump. (lookin_xss)	123	58.20	74.23	24	19.51
3791.	Alan (alanzim)	123	67.03	90.42	31	25.20
3792.	yash (userthree)	122	52.87	67.12	16	13.11
3793.	Golf GTI (typeracer_user_)	122	82.96	102.56	35	28.69
3794.	vinh (tienvinh)	122	54.25	68.51	13	10.66
3795.	Alireza (thealireza)	122	116.11	154.94	76	62.30
3796.	snackmancer (snackmancer)	122	141.77	165.38	93	76.23
3797.	Mikke (skrammelkonto)	122	59.54	70.20	41	33.61
3798.	Sherniiaz (shero2002)	122	64.85	81.09	32	26.23
3799.	pablo (pablo_rm1197)	122	82.06	109.61	31	25.41
3800.	otto (ottocorrect)	122	91.98	114.45	39	31.97
3801.	Phil (miss_you_reck)	122	131.79	153.07	91	74.59
3802.	matin (mdmatin4)	122	43.93	58.57	6	4.92
3803.	Thank you, (maintrack)	122	135.72	176.94	78	63.93
3804.	MAHIR (mahirlabib)	122	56.01	69.25	22	18.03
3805.	Muhammad (littlememon)	122	69.19	91.91	33	27.05
3806.	Laura (laurga)	122	102.35	125.82	45	36.89
3807.	dulux23 (dulux23)	122	99.52	121.63	47	38.52
3808.	Ana (druze_tito)	122	53.58	70.42	19	15.57
3809.	yah-yeet (dingdong768)	122	105.40	125.98	58	47.54
3810.	Andrew (dijkstra)	122	92.33	113.13	46	37.70
3811.	CHEESE (chromatickhaled)	122	103.85	121.28	50	40.98
3812.	twitch_NotDefense (bravedev...	122	92.21	114.26	31	25.41
3813.	Blake (blake4605)	122	75.87	93.24	35	28.69
3814.	Binay (binayginodia)	122	68.15	86.16	24	19.67
3815.	Homer (aerowang)	122	58.86	72.20	16	13.11
3816.	adarshdhital007 (adarshdhit...	122	47.11	73.85	17	13.93
3817.	Adamelvis (adamelvis)	122	73.56	92.18	27	22.13
3818.	Daniel (maddan2016)	122	83.06	106.50	27	22.13
3819.	Benjie (xbenjie)	121	125.82	170.31	84	69.42
3820.	Eric (wernerosorio)	121	91.94	117.93	36	29.75
3821.	vitvlkv (vitvlkv)	121	59.56	73.08	18	14.88
3822.	Stank (stankyard)	121	60.30	78.38	33	27.27
3823.	Ryan (riceisgoodman)	121	91.80	115.72	40	33.06
3824.	Putus (putusbb)	121	24.50	35.84	18	14.88
3825.	Lesibana (profles)	121	64.70	87.16	25	20.66
3826.	DDIR (pn10401006)	121	59.06	72.98	23	19.01
3827.	PAT (pat0216)	121	75.39	93.33	31	25.62
3828.	Egg (organicegg)	121	90.75	115.48	43	35.54
3829.	Nungkha (nungkha)	121	58.43	81.79	22	18.18
3830.	no (nomaybeyes)	121	94.22	121.67	40	33.06
3831.	David (jabadahub25)	121	64.57	82.98	28	23.14
3832.	a (im_typing_with_my_d)	121	72.19	89.85	27	22.31
3833.	Andrew (honeyman)	121	129.37	159.68	79	65.29
3834.	Blake (hanlentt)	121	65.27	95.25	26	21.49
3835.	Gabriel (gbvicente)	121	80.91	100.96	26	21.49
3836.	Andrei (elpelaodank)	121	169.24	204.35	101	83.47
3837.	Aloysius (dude101no)	121	95.91	114.58	42	34.71
3838.	Arnab (arnab_api)	121	67.69	82.62	22	18.18
3839.	Abed (abed42)	121	65.46	98.65	30	24.79
3840.	Sandeep (5keleton)	121	28.89	37.89	18	14.88
3841.	chi (naviqq)	121	71.27	84.46	35	28.93
3842.	Seraphear (_seraphear)	120	73.79	85.75	31	25.83
3843.	Vinni (vinnico)	120	60.01	75.13	17	14.17
3844.	skyeblu7 (skyeblu7)	120	94.07	115.51	46	38.33
3845.	sika (sikathenub)	120	81.85	109.22	52	43.33
3846.	Shelpeck (shelpeck)	120	55.18	75.44	17	14.17
3847.	serien (serien_)	120	86.00	113.62	28	23.33
3848.	Sahil (sahil_sa)	120	57.16	68.32	14	11.67
3849.	Rafar (rafar504)	120	62.01	79.30	16	13.33
3850.	Mykhailo (pushkarov)	120	52.01	64.43	20	16.67
3851.	Prosper (prosperhuang)	120	85.35	105.89	30	25.00
3852.	oley (oley11)	120	50.08	65.33	10	8.33
3853.	Road (oldayanisnoob)	120	55.06	71.90	25	20.83
3854.	Noob (noob_racer1)	120	78.33	100.83	61	50.83
3855.	Sreshta Kamya (nikitha)	120	83.55	104.52	37	30.83
3856.	Narmichid (narmichid_2003)	120	59.08	76.12	25	20.83
3857.	Colin (modernbonsai)	120	79.43	96.21	28	23.33
3858.	Mohammad Hossein (mh1998)	120	81.45	99.89	38	31.67
3859.	M (magmag00)	120	53.03	64.51	7	5.83
3860.	Lord Kuro (lordkuro)	120	91.92	117.59	39	32.50
3861.	chromebook user (kuxir97)	120	69.63	92.41	57	47.50
3862.	KM9 (kunal2795)	120	88.32	127.09	65	54.17
3863.	光次郎 (koujiro)	120	81.61	109.93	33	27.50
3864.	Alfred (junior162007)	120	63.62	87.24	26	21.67
3865.	tstats[itchyhuman] (itchyhu...	120	113.72	148.03	62	51.67
3866.	Used Notebook (invis_lurker)	120	80.63	119.82	28	23.33
3867.	pavle (hello_kittyy)	120	84.68	101.04	34	28.33
3868.	Gamer (gamer_equine)	120	53.30	67.48	19	15.83
3869.	Gajendra (gajendra_0180)	120	70.68	87.64	113	94.17
3870.	Andre (dreson03)	120	85.36	114.59	36	30.00
3871.	Mario (dmfz)	120	72.91	91.79	32	26.67
3872.	Deltaology (deltaology)	120	48.58	66.64	9	7.50
3873.	DeadpoolFromAliBaba (bruhgo...	120	60.58	79.13	22	18.33
3874.	Aleks (alexmandev_3)	120	77.21	95.02	36	30.00
3875.	click clack (albert471)	120	130.40	160.14	74	61.67
3876.	Akkmaharaj (akkmaharaj)	120	67.37	87.37	24	20.00
3877.	Ae (aezharhu)	120	77.48	99.77	28	23.33
3878.	suhuyini (smaimoro)	120	32.70	46.08	18	15.00
3879.	Bed Rock (bedhat7)	120	58.32	84.02	20	16.67
3880.	aedan (aedanbinoy)	120	27.65	36.26	27	22.50
3881.	jitin (jitinharyana)	120	98.72	119.71	35	29.17
3882.	Chad (chad_nuckolls)	120	62.04	74.33	21	17.50
3883.	Leo (leoroy7x7)	120	68.19	86.11	31	25.83
3884.	Rochtark (rochtark)	120	48.25	61.77	8	6.67
3885.	CelerySticks (whatan0b)	119	101.15	123.16	47	39.50
3886.	Speed (ututu222)	119	97.89	129.84	43	36.13
3887.	pugman (thepugpro)	119	105.91	142.64	56	47.06
3888.	ponyo (ponyyo2323)	119	33.73	47.94	2	1.68
3889.	polongas (polongas)	119	50.30	67.81	10	8.40
3890.	Ben (mrjamminkearl)	119	91.69	120.85	41	34.45
3891.	Tralalero Tralala (mita57)	119	101.90	122.26	51	42.86
3892.	Anurag (mak42)	119	79.41	100.27	34	28.57
3893.	Mark (loggsu)	119	97.94	135.32	47	39.50
3894.	mkk (litt1e_ave1)	119	42.44	54.15	31	26.05
3895.	bruh (lambertwp)	119	70.96	90.71	30	25.21
3896.	Blaze (klblaz)	119	83.64	106.50	29	24.37
3897.	buynaa (kamikaze0612)	119	85.94	109.04	26	21.85
3898.	Jin Yi (jinyisim)	119	94.36	113.96	43	36.13
3899.	VY (india_vikas_yadav)	119	133.58	160.68	88	73.95
3900.	Speed is relative (hvan1998)	119	72.15	87.01	20	16.81
3901.	Chen (chen_)	119	80.47	96.44	30	25.21
3902.	Bharath (bharath0915)	119	50.76	65.87	9	7.56
3903.	Amer (amer202)	119	51.08	70.58	14	11.76
3904.	albit (albit)	119	35.38	48.68	3	2.52
3905.	Ihor (_ihor)	118	47.52	60.02	15	12.71
3906.	Shubham (_anonymous)	118	50.80	66.89	10	8.47
3907.	Zaid (zaid1012)	118	58.59	78.01	30	25.42
3908.	TBo (tbo_)	118	84.69	110.32	30	25.42
3909.	Steve (srd93)	118	89.96	106.99	42	35.59
3910.	Satyam (sprayinglight0)	118	71.55	89.92	27	22.88
3911.	someonewhoisntlikeyou (some...	118	99.54	119.89	57	48.31
3912.	Scotf (scottgraham)	118	40.50	53.40	8	6.78
3913.	Hussam (samwa7sh800)	118	65.50	80.64	29	24.58
3914.	Elliot (privateplague)	118	80.64	100.26	29	24.58
3915.	Shinji (nagkagrabe7)	118	96.95	118.73	42	35.59
3916.	Michael (mwalter32123)	118	69.77	84.97	29	24.58
3917.	matcha (matchamacchiato)	118	111.26	137.29	67	56.78
3918.	🍉 (masqueworld)	118	119.51	141.86	66	55.93
3919.	Gaurab (logan_pi)	118	60.01	79.22	25	21.19
3920.	Liam (lime_da_bestest)	118	80.81	100.72	29	24.58
3921.	VH (jaywild)	118	60.13	77.47	23	19.49
3922.	lav (illblowurmind)	118	102.09	131.91	43	36.44
3923.	how? (haotingz)	118	105.06	129.65	57	48.31
3924.	Garrett (gdiegnan147)	118	119.43	144.32	65	55.08
3925.	Exzede (exzede)	118	66.28	88.97	32	27.12
3926.	😳 (expertgeneralist)	118	87.89	111.31	35	29.66
3927.	Ethan (ethan_5)	118	100.10	129.70	47	39.83
3928.	cod1r (cod1r)	118	89.89	120.20	41	34.75
3929.	james (chilty14)	118	76.82	105.39	33	27.97
3930.	Argo (argonautika)	118	84.95	108.49	30	25.42
3931.	Ankush (ankush_12)	118	57.44	73.02	20	16.95
3932.	Aamill (aamill)	118	91.88	117.59	34	28.81
3933.	Ryan (8baller)	118	68.17	87.21	29	24.58
3934.	(4lsi3w544lwi4lk)	118	129.99	155.49	78	66.10
3935.	:( (notabot69)	118	64.59	80.42	23	19.49
3936.	SSJ 5 :) (rak99)	118	48.49	62.83	9	7.63
3937.	n1tro (n1tro)	118	70.38	90.80	38	32.20
3938.	Sam (sambibiriz)	118	51.59	91.55	20	16.95
3939.	Safi (_safi_)	118	70.68	87.29	26	22.03
3940.	Tom (twatters)	117	75.11	102.40	31	26.50
3941.	timgan (timgan)	117	104.24	126.95	51	43.59
3942.	testsubject (shamushasha)	117	76.67	101.28	30	25.64
3943.	Shai (shaichon)	117	84.42	102.94	37	31.62
3944.	Zamami (shadaokami)	117	46.98	62.74	11	9.40
3945.	magnus (robertavmagic)	117	74.41	91.66	22	18.80
3946.	Chen (nyarlathoteppppp)	117	70.31	85.10	31	26.50
3947.	BEECEE (nukecee)	117	107.85	131.53	63	53.85
3948.	Nate (ngb125)	117	66.97	86.42	27	23.08
3949.	Jester (murvayne)	117	120.32	149.46	61	52.14
3950.	MithterMagma (mithtermagma)	117	92.95	112.79	43	36.75
3951.	Marc (mghale_215)	117	100.52	126.40	45	38.46
3952.	Yevhen (m1rev)	117	38.90	57.69	9	7.69
3953.	max (low_wpm)	117	49.40	60.43	11	9.40
3954.	kikiki (kiki02613)	117	99.98	117.11	48	41.03
3955.	laptopwinterpro (justanothe...	117	146.69	168.37	84	71.79
3956.	josh (joshtypes1)	117	107.91	145.30	51	43.59
3957.	Jonas (jonasj2001)	117	85.63	105.41	37	31.62
3958.	jeff (jeffersongtg)	117	72.85	92.29	31	26.50
3959.	6typeR (hacker888)	117	60.51	74.92	26	22.22
3960.	new account fenno4 (fennomak)	117	123.90	157.15	71	60.68
3961.	Rahul (endeavour_the_one)	117	58.85	79.26	18	15.38
3962.	dvorak (dvorak0211)	117	44.41	68.11	16	13.68
3963.	Bea (chilichanga)	117	90.34	119.24	37	31.62
3964.	Asif (asif04)	117	75.89	90.87	33	28.21
3965.	Micro (apm14)	117	91.61	116.19	28	23.93
3966.	Abdulwahab (wahabi56)	117	25.19	34.35	22	18.80
3967.	G (zger)	116	90.05	119.68	40	34.48
3968.	tobias (thandschin)	116	85.38	102.31	31	26.72
3969.	mm (smsa5000)	116	78.26	96.20	20	17.24
3970.	Daniel (scumset)	116	102.35	126.87	52	44.83
3971.	sanchayay (sanchayay)	116	57.58	72.87	22	18.97
3972.	Vincent (rubixon)	116	50.04	59.86	9	7.76
3973.	Rohit (rohit_1706)	116	40.48	61.61	10	8.62
3974.	Lia (reyi)	116	94.64	124.30	35	30.17
3975.	Miłosz (refjel)	116	69.59	82.80	31	26.72
3976.	Lord (planta)	116	97.08	121.94	39	33.62
3977.	Nitesh (niteshtiwari)	116	64.11	92.22	28	24.14
3978.	Judas Escargot (looneyjuice)	116	113.23	148.90	61	52.59
3979.	laZorbeamZ (lazorbeamz)	116	101.93	125.27	46	39.66
3980.	Kaplana (kaplana)	116	47.77	69.91	26	22.41
3981.	Jordan (jordan2380)	116	161.91	196.32	0	0.00
3982.	Tru (jhake_1)	116	82.12	110.49	26	22.41
3983.	Andreas (drivknuten)	116	38.92	44.93	9	7.76
3984.	Divyesh (divyeshm)	116	59.86	78.23	22	18.97
3985.	Bob (bob_loblawrl)	116	69.51	82.87	32	27.59
3986.	Miguel (bellcros)	116	61.81	84.62	32	27.59
3987.	Asad (asad104khan)	116	82.94	100.38	31	26.72
3988.	Amal (amal_jyothis)	116	57.84	81.96	15	12.93
3989.	Vishagh (vishagh)	116	41.55	54.68	16	13.79
3990.	Ronan (ronocoolo)	116	78.72	96.45	32	27.59
3991.	pilioko (pilioko)	116	77.23	107.28	38	32.76
3992.	Charles (chan_cellor)	116	48.93	60.77	12	10.34
3993.	Alden (alden_s)	116	59.33	71.14	16	13.79
3994.	Pranav (_vanarp)	115	42.10	58.37	9	7.83
3995.	snake_case (_snake_case)	115	45.22	54.77	5	4.35
3996.	iosif (y_o_s)	115	44.47	62.54	8	6.96
3997.	Areeb (your_avg_aaa)	115	82.37	104.92	36	31.30
3998.	s3yf (unclemeat)	115	74.93	95.88	33	28.70
3999.	Free Palestine (tidy400)	115	82.62	103.71	28	24.35
4000.	TheTIger107 (thetiger107yt)	115	97.89	144.70	51	44.35
4001.	Sultan (sultanreal)	115	53.31	71.90	15	13.04
4002.	Shil (shilegend)	115	54.43	68.00	12	10.43
4003.	PotatoLyfe (potato_lyfe)	115	69.15	92.74	25	21.74
4004.	Radwin (nosmirk)	115	90.19	122.23	51	44.35
4005.	nazmul (nhasan0290)	115	69.89	87.49	30	26.09
4006.	Ken (netski1400)	115	75.87	93.05	28	24.35
4007.	Ḿ (m_10)	115	56.19	72.39	18	15.65
4008.	Matthew (mstracy)	115	86.54	104.90	35	30.43
4009.	bruh (lmnhat2002vn)	115	57.34	74.51	19	16.52
4010.	tstats[learning_dvorac] (le...	115	67.38	96.32	32	27.83
4011.	Florian (jordanbelfort)	115	89.89	108.87	35	30.43
4012.	Jem (jemanema)	115	80.49	101.20	28	24.35
4013.	jay (jaymorant)	115	60.74	77.11	21	18.26
4014.	race typing (jangyeeunnie616)	115	94.11	131.49	97	84.35
4015.	hypeiron (hypeiron)	115	69.62	84.78	29	25.22
4016.	heyitsalec (heyitsalec)	115	115.44	140.53	75	65.22
4017.	Hans (hansboi)	115	86.51	121.19	42	36.52
4018.	labaalli (hajjaba)	115	28.37	39.31	15	13.04
4019.	Fadosa (fadosa)	115	86.71	104.40	33	28.70
4020.	erk (estalow)	115	121.40	139.61	71	61.74
4021.	Ramiei (elli_y)	115	84.38	112.88	38	33.04
4022.	vrum vrum (elex_)	115	41.42	55.54	9	7.83
4023.	el (elanamax)	115	98.06	116.42	42	36.52
4024.	Ethan (eg083)	115	66.75	86.35	30	26.09
4025.	Edward (edwardw21)	115	136.32	167.24	74	64.35
4026.	Donald (dhonuill)	115	111.47	134.80	53	46.09
4027.	dat (datkitteh)	115	35.37	60.03	11	9.57
4028.	Sonatry (danyannang)	115	100.67	116.91	43	37.39
4029.	Niamh (crystalniamh)	115	105.55	135.83	41	35.65
4030.	J (average_typer95)	115	98.67	124.41	42	36.52
4031.	Arunreas (arunreas)	115	48.26	65.49	19	16.52
4032.	Vielle (arc_sec)	115	178.39	220.10	9	7.83
4033.	angie :) (angwie)	115	88.69	117.79	33	28.70
4034.	Al (al_gha23)	115	70.11	85.91	35	30.43
4035.	Adam (adamhawkins)	115	122.29	151.49	73	63.48
4036.	Obi-Wan (6x_ebitda)	115	80.23	94.63	32	27.83
4037.	sss (1whiteblack1)	115	58.04	72.81	11	9.57
4038.	Jules (layinpip_)	115	67.52	88.20	24	20.87
4039.	Isaiah (zayhoncho)	115	44.25	62.20	10	8.70
4040.	Jeremy (jeremyperdok)	115	69.13	91.69	24	20.87
4041.	William (william_david)	114	89.68	122.02	49	42.98
4042.	Tai (weakmee)	114	83.54	109.52	38	33.33
4043.	anonym (thefencr)	114	39.71	53.58	5	4.39
4044.	Thiago (terjan)	114	77.03	105.66	38	33.33
4045.	Tanvir (tanvir_025)	114	74.72	94.24	35	30.70
4046.	StewieGriffin (stewiegriffi...	114	101.76	141.45	49	42.98
4047.	Salah-eddine (sharrach)	114	42.64	60.14	22	19.30
4048.	RAJNISH (rajnishkumar31)	114	69.83	94.96	37	32.46
4049.	RacerABM (racerabm)	114	70.79	96.05	32	28.07
4050.	badgyalting (pl200834)	114	51.81	67.65	26	22.81
4051.	Phil (philwinnem)	114	102.51	127.62	46	40.35
4052.	Pacham (pachamcham)	114	75.86	91.54	41	35.96
4053.	ogkatumus (ogkatumus)	114	90.73	121.82	46	40.35
4054.	Don (odonjeque)	114	64.54	78.76	15	13.16
4055.	Moye (moyoka)	114	90.91	119.21	32	28.07
4056.	Michael (mercury28)	114	102.79	131.22	49	42.98
4057.	Maxwell (mc2006)	114	81.64	98.64	33	28.95
4058.	樊 (krinzkolo)	114	65.99	82.97	24	21.05
4059.	kum (kinararidwan)	114	79.96	102.02	37	32.46
4060.	Ken (kenkenken_)	114	113.93	131.35	74	64.91
4061.	Jonathan (jonyaa)	114	84.19	105.72	33	28.95
4062.	Jesus (johangodinho123)	114	85.98	123.80	37	32.46
4063.	Doniyor (doni_dev)	114	67.61	89.35	38	33.33
4064.	Parik (communistcomradepv)	114	61.45	81.94	18	15.79
4065.	david (chu0724)	114	43.70	59.72	19	16.67
4066.	Caitlin (caitlin3)	114	98.36	117.55	53	46.49
4067.	Samuel (budbeats)	114	53.01	79.01	16	14.04
4068.	Joe (bubustrick)	114	60.43	75.14	24	21.05
4069.	BooceJooce (boocejooce)	114	58.47	75.19	21	18.42
4070.	BMO (balot2020)	114	76.82	100.44	24	21.05
4071.	badtyper (badtyper_)	114	72.89	95.98	25	21.93
4072.	tstats[abdul_hakeem123] (ab...	114	52.97	69.36	19	16.67
4073.	5000600 (5000600)	114	108.69	171.39	87	76.32
4074.	Zia (zia1)	113	45.28	66.04	6	5.31
4075.	Xristos (xristos_gav)	113	72.32	94.03	22	19.47
4076.	Andre (smallchicken)	113	84.68	113.03	40	35.40
4077.	Samar Singla (samluci666)	113	68.86	91.24	29	25.66
4078.	Arthur (sagman)	113	85.64	134.41	20	17.70
4079.	Rachel (rffree)	113	80.25	103.17	31	27.43
4080.	PreciousStats (precious_stats)	113	124.52	166.49	75	66.37
4081.	Jayden (nephewjayden)	113	84.41	104.24	31	27.43
4082.	Mike (miym)	113	70.96	83.42	19	16.81
4083.	winter (kitzy)	113	76.56	105.23	24	21.24
4084.	Dyslexic_J (jamjar_)	113	79.92	98.77	23	20.35
4085.	Hussein (hussein987)	113	71.46	102.45	33	29.20
4086.	TheProdigyHenry (henryv70)	113	125.20	164.70	63	55.75
4087.	fish and chips (heavenseer)	113	185.62	220.51	96	84.96
4088.	HawksCardinals (hawkscardin...	113	102.66	129.36	52	46.02
4089.	Harshit (harshitjindal)	113	68.05	96.18	23	20.35
4090.	fares (fares_esam_22)	113	36.38	44.97	4	3.54
4091.	on earth, as it is in heave...	113	114.35	145.07	58	51.33
4092.	Essi (essi4678)	113	52.96	68.44	24	21.24
4093.	Terry (eleftheriosonic)	113	66.03	86.58	29	25.66
4094.	Big Pop (broguyman)	113	87.93	110.12	26	23.01
4095.	kay (bbsaltlord)	113	89.39	114.12	45	39.82
4096.	ashish (ashishroka)	113	52.07	69.18	17	15.04
4097.	ghoul (abigail_w)	113	133.72	151.26	71	62.83
4098.	I ♥ Gym (2slow_2exist)	113	97.42	115.53	42	37.17
4099.	Vibhav (vibhav_1262)	112	63.31	84.29	25	22.32
4100.	ican tpye fwtf (sup_chief)	112	93.27	139.40	41	36.61
4101.	Steven (stevencd)	112	83.45	102.17	34	30.36
4102.	Robert (selbor)	112	74.31	99.87	31	27.68
4103.	:D (scottmorrisonmp)	112	90.55	112.47	30	26.79
4104.	Yu (sadochist)	112	101.16	119.90	50	44.64
4105.	Jiong Liang (odliang_15)	112	60.25	76.37	21	18.75
4106.	Tim (littlesprinklesjersey)	112	111.73	141.62	59	52.68
4107.	Viktor (knifenoob)	112	89.78	115.46	44	39.29
4108.	walid (kasemwalid)	112	52.84	67.71	13	11.61
4109.	Isaac (isaacchen_cool)	112	112.81	141.64	57	50.89
4110.	Hue (hue_man)	112	75.43	88.83	27	24.11
4111.	gdonke (gdonke)	112	57.26	69.55	20	17.86
4112.	FMURTADHO (fmurtadho)	112	122.26	151.11	64	57.14
4113.	Nikola (flomaster_)	112	82.73	106.83	34	30.36
4114.	Exyiaevox (exyia)	112	96.30	132.03	46	41.07
4115.	cvxz (cvxz)	112	58.96	80.48	22	19.64
4116.	chris (chrisp03)	112	61.13	78.93	28	25.00
4117.	jieun (bunnypenguin)	112	111.66	143.38	53	47.32
4118.	Vincent (bhangjiwon)	112	122.56	153.53	76	67.86
4119.	Balgow (balgow)	112	73.83	93.69	25	22.32
4120.	Rakibul Alam (badboirakib)	112	22.83	33.34	15	13.39
4121.	Ashutosh (ashutosh6997)	112	73.84	96.29	21	18.75
4122.	ziad (ziadbensaada)	111	46.47	65.15	6	5.41
4123.	DaVinky (xxlarrylegendxx)	111	70.93	89.07	38	34.23
4124.	Teodoras (teoyessir)	111	113.39	141.84	57	51.35
4125.	Ammar (s_ammar)	111	46.01	58.12	12	10.81
4126.	Sheraz (sherazahmad720)	111	48.95	60.17	20	18.02
4127.	Sam (sammusubi27)	111	71.05	87.34	30	27.03
4128.	William (normalizejoey)	111	74.52	96.34	45	40.54
4129.	MooMoo (moo_24)	111	54.35	69.62	13	11.71
4130.	Master (master_2010)	111	45.20	60.91	10	9.01
4131.	Kevki (kevki_)	111	84.14	104.61	34	30.63
4132.	Jonathan (jah_n_i)	111	85.90	113.25	45	40.54
4133.	iCry (icry)	111	90.40	120.90	33	29.73
4134.	@smile.hnts on twitter (hyp...	111	85.82	108.35	33	29.73
4135.	Syed (hello_guest)	111	47.13	62.11	12	10.81
4136.	Lun Mang (halberd237)	111	59.87	75.82	12	10.81
4137.	Ricky (galvanize)	111	96.50	126.99	40	36.04
4138.	Aditya (fire_smasher1)	111	55.98	72.06	18	16.22
4139.	Felix (felixsantoso)	111	69.12	90.72	23	20.72
4140.	Mordo (elmordo)	111	77.13	91.23	21	18.92
4141.	Sean (drherpdederp)	111	84.38	106.59	36	32.43
4142.	Demancer (demancer)	111	107.25	140.13	46	41.44
4143.	Ahmad Fatih (afaf_tech19)	111	64.51	86.62	27	24.32
4144.	Baramee (6666666666666666)	111	49.58	67.82	7	6.31
4145.	Thomas (447tomtom)	111	47.18	60.62	11	9.91
4146.	Radoslav (padoto07)	111	71.06	89.56	27	24.32
4147.	Leonardo (zadig1789)	111	55.62	72.12	18	16.22
4148.	Ester (torreset321)	111	63.39	78.73	19	17.12
4149.	Ɓritishyobro (britishyobro)	111	80.25	100.90	24	21.62
4150.	aEr0 (_aero)	110	62.80	76.35	22	20.00
4151.	Olivia (xlivsteer07x)	110	54.78	72.62	34	30.91
4152.	Taradiddle (taradiddle)	110	77.60	92.71	24	21.82
4153.	elongated (supreme10001)	110	135.84	161.43	67	60.91
4154.	SRI (sr71)	110	86.89	99.82	34	30.91
4155.	SpeedTrain (speedtraintyper)	110	82.09	114.90	26	23.64
4156.	this quote is sh*t (slowass...	110	81.15	106.27	24	21.82
4157.	skycandy (skycandy1)	110	64.40	79.11	24	21.82
4158.	Joseph (schmo_)	110	101.57	129.70	48	43.64
4159.	sat (sattypants)	110	77.66	104.01	31	28.18
4160.	sab (sabpap)	110	65.45	83.24	25	22.73
4161.	robloxyboy1212 (robloxyboy2...	110	100.78	136.54	43	39.09
4162.	Ring2020 (ring2020)	110	76.46	96.84	24	21.82
4163.	Raymando (raymando)	110	95.82	120.08	52	47.27
4164.	Rawest_Dawg (raw_dawg)	110	65.67	84.57	24	21.82
4165.	Procrastiracer (racerrob)	110	115.16	147.26	55	50.00
4166.	Atif (pakistan_786)	110	81.61	109.17	22	20.00
4167.	Ngita (ngita)	110	57.94	72.79	16	14.55
4168.	Marek (mxrkz)	110	66.50	80.86	27	24.55
4169.	Mircox (mircozen)	110	89.40	108.32	32	29.09
4170.	Somto (megamined)	110	62.93	79.33	15	13.64
4171.	Irham (irhamdinataa)	110	86.79	110.28	39	35.45
4172.	Gayathri (gayathri_prabhu)	110	65.99	83.77	27	24.55
4173.	nikhil (forceablebean6)	110	108.28	126.19	61	55.45
4174.	Daniel (dreilly2231)	110	77.16	91.77	32	29.09
4175.	David (dmed519)	110	69.58	82.05	26	23.64
4176.	Dwiko (diorite90)	110	59.50	76.33	27	24.55
4177.	Daniel (beefichor)	110	75.51	90.58	22	20.00
4178.	Maximus (asso2002)	110	97.62	125.83	46	41.82
4179.	#$# (ah_ha)	110	74.27	95.44	30	27.27
4180.	Amorphic (_amorphic)	110	58.92	89.76	27	24.55
4181.	Farid (faridkhan)	110	29.39	41.52	17	15.45
4182.	Eric (yellowblankets)	109	83.71	111.98	23	21.10
4183.	I'm bad at typing (uzumakid...	109	92.53	120.77	39	35.78
4184.	Kian (uls_sanch)	109	95.95	111.05	30	27.52
4185.	alipboy (tragicbronson)	109	106.73	131.85	55	50.46
4186.	horney (titansmakemehorney)	109	82.17	104.33	27	24.77
4187.	Lily (tiptaptyping)	109	112.79	139.23	47	43.12
4188.	Roberto (soniic99)	109	45.43	61.69	10	9.17
4189.	shrnayvi (shrnayvi)	109	89.13	100.30	33	30.28
4190.	Lakshay (shaybas)	109	97.23	123.43	36	33.03
4191.	Samuel (samharr)	109	66.96	84.35	19	17.43
4192.	Nguyen Truong (racing_typer...	109	102.72	136.72	55	50.46
4193.	q4say (q4say)	109	61.55	75.48	27	24.77
4194.	boat (narwhalinz)	109	129.12	161.38	72	66.06
4195.	Rizwan (mrpassionate)	109	68.24	83.82	20	18.35
4196.	Max (maxcampman)	109	79.13	101.57	29	26.61
4197.	Sandwich (marlonbrandoseyes)	109	56.59	72.15	18	16.51
4198.	Marcos (marcosjlr)	109	75.01	88.71	19	17.43
4199.	Banoboo (lasttry)	109	33.62	48.14	9	8.26
4200.	David (king_cao1)	109	110.79	133.79	51	46.79
4201.	kenneth (kennethnhan)	109	71.57	86.96	23	21.10
4202.	jveee (jv223)	109	75.16	94.50	30	27.52
4203.	Michael (henderslender11)	109	49.02	62.28	12	11.01
4204.	Hassaan (hassaan0180)	109	70.00	92.29	40	36.70
4205.	Gareton (gareton)	109	58.80	69.82	14	12.84
4206.	Veteran1728 (frenzy1728)	109	97.34	116.55	35	32.11
4207.	Desmond (desmond27)	109	84.37	102.03	28	25.69
4208.	DeafChef (deafchefsteph)	109	58.30	72.80	16	14.68
4209.	Karan (commando_typer)	109	48.26	59.18	12	11.01
4210.	crip (cipti)	109	44.18	56.16	13	11.93
4211.	Chubby (chubbykidseating)	109	102.38	133.89	41	37.61
4212.	Nikita (chervovn04)	109	59.07	74.29	20	18.35
4213.	jdyn (ayskiri)	109	78.16	128.28	29	26.61
4214.	Aymscird (aymscird)	109	100.81	121.18	45	41.28
4215.	www (aaahrgrhh)	109	105.12	135.22	44	40.37
4216.	Jacob (peanutboy)	109	64.25	85.17	27	24.77
4217.	clarence (zerogly)	108	87.60	104.87	39	36.11
4218.	jason (yacine77)	108	74.82	95.29	24	22.22
4219.	Elijah (too_ez_)	108	97.74	126.90	49	45.37
4220.	THATCHILD (thatchild)	108	103.08	125.76	98	90.74
4221.	Sunny (sunny6464n)	108	50.94	61.70	11	10.19
4222.	Shubham (srp3003)	108	91.07	115.55	35	32.41
4223.	Rosy (rosyport)	108	121.93	159.76	55	50.93
4224.	Parag (parag_gn)	108	49.08	62.97	11	10.19
4225.	(onah)	108	120.27	150.72	60	55.56
4226.	Json (jskfreerunner)	108	74.47	92.35	27	25.00
4227.	bruh (jakubd)	108	82.37	106.92	37	34.26
4228.	Itay (itzir)	108	56.14	67.00	15	13.89
4229.	Jia (icecoldpillow)	108	115.74	139.23	43	39.81
4230.	rip reckful (fictorian)	108	116.23	145.75	56	51.85
4231.	balls (faygodreams)	108	114.92	140.98	48	44.44
4232.	Osh (elvor)	108	92.36	106.17	47	43.52
4233.	Joe (edwardstewart69)	108	105.73	153.37	43	39.81
4234.	Davi (davi_v)	108	118.83	141.52	52	48.15
4235.	Sean (crowded_keyboard)	108	93.35	119.68	52	48.15
4236.	Albert (certikbertik)	108	84.89	109.43	33	30.56
4237.	Bekzat (blkssmv)	108	64.80	78.97	29	26.85
4238.	azu (azux)	108	83.42	111.49	47	43.52
4239.	tstats[ayyaz7] (ayyaz7)	108	78.63	96.91	26	24.07
4240.	🌹Ayra (ayraa)	108	78.72	110.50	26	24.07
4241.	Emil (awsomeemil25)	108	115.71	151.35	70	64.81
4242.	bloomy (atsu)	108	89.16	114.60	38	35.19
4243.	xelfeR (armez)	108	122.53	199.14	60	55.56
4244.	Markus (ark_sum)	108	65.22	80.27	22	20.37
4245.	Amirey (st_amirey)	108	72.84	94.18	24	22.22
4246.	Zev (zevaverbach)	107	104.58	146.82	51	47.66
4247.	Ty (yomommafav)	107	89.11	113.40	31	28.97
4248.	Surya (surya_p)	107	53.57	72.21	17	15.89
4249.	Sn1kt (sn1kt)	107	55.38	74.57	17	15.89
4250.	Newton (nklflips)	107	94.67	123.18	45	42.06
4251.	🏅🏅🏅 (naod_1225)	107	114.48	146.10	50	46.73
4252.	Vishal (mr_sharma01)	107	53.26	65.53	17	15.89
4253.	Moghit (moghit44)	107	74.54	117.63	29	27.10
4254.	Sean (metrognome12)	107	84.25	105.10	40	37.38
4255.	Quan (martinrockon)	107	71.01	96.20	27	25.23
4256.	Leonid (leosmrdljak)	107	75.15	95.88	55	51.40
4257.	Izzy (izzythompson)	107	81.47	107.91	25	23.36
4258.	Emon (emonn)	107	67.88	85.64	22	20.56
4259.	Dingus Fish (dingusfish)	107	84.11	101.97	35	32.71
4260.	cocoju (cocoju)	107	65.74	82.06	18	16.82
4261.	Yoel (chessmaster55)	107	55.40	74.37	13	12.15
4262.	Harry (bonogo123)	107	90.99	114.05	28	26.17
4263.	Nacho (awooo)	107	90.75	109.37	44	41.12
4264.	Allan (allan_g)	107	68.73	88.95	27	25.23
4265.	Arnold (10wpmtyper)	107	128.21	162.27	69	64.49
4266.	sarampium (saripu)	107	78.62	97.66	28	26.17
4267.	Nabibro007 (nabibro_007)	107	60.83	79.45	17	15.89
4268.	zach (rz23222)	107	81.78	112.74	22	20.56
4269.	RixZorro (rixzorro)	107	70.69	83.97	28	26.17
4270.	kartheek (kartheek542)	107	54.55	71.96	29	27.10
4271.	Maciey (maciey_ff)	107	71.70	87.66	33	30.84
4272.	Deni (zingaraaa)	106	62.81	75.46	23	21.70
4273.	Vishnu (vishnu6174)	106	76.45	94.22	22	20.75
4274.	Viktor Helgi (viktorhelgi)	106	61.96	77.14	26	24.53
4275.	Valeria (valeriale)	106	52.30	64.35	8	7.55
4276.	Calculus (uchihalol)	106	162.20	196.11	8	7.55
4277.	They Don't Know That (theyd...	106	102.81	131.71	39	36.79
4278.	Subir (subir_b)	106	34.27	42.26	2	1.89
4279.	feelsclapman (sprenkelz)	106	111.70	137.67	47	44.34
4280.	SMhd (smhd)	106	89.44	105.64	26	24.53
4281.	skitter315 (skitter315)	106	115.95	134.67	63	59.43
4282.	Benga (skebengat)	106	71.29	90.26	28	26.42
4283.	Simon (siarnt)	106	93.70	111.16	38	35.85
4284.	shane (shanel0l)	106	68.93	84.81	29	27.36
4285.	Sebastian (sebz1)	106	80.04	109.14	22	20.75
4286.	Cameron (sebajun)	106	95.77	119.28	36	33.96
4287.	Samuel (samuelga)	106	91.95	115.58	44	41.51
4288.	sami (sami66)	106	89.40	109.23	27	25.47
4289.	Ravid (ravid37)	106	18.76	25.56	13	12.26
4290.	yashwi (potato0o0)	106	74.85	103.60	30	28.30
4291.	peter (peterfan)	106	70.26	93.43	33	31.13
4292.	mahmoud (mzridi)	106	46.10	56.89	9	8.49
4293.	Mena (mony40)	106	44.95	58.70	13	12.26
4294.	Sam (monkeh_type_fast)	106	84.41	113.81	37	34.91
4295.	M (mileung)	106	75.42	95.23	30	28.30
4296.	Max (max_akyl)	106	52.06	67.35	11	10.38
4297.	Luan (luanxpg9)	106	68.95	79.18	35	33.02
4298.	khanh (lenguyenkhanh)	106	89.48	104.05	28	26.42
4299.	JD_FPS (jd_fps)	106	69.20	96.46	22	20.75
4300.	J (itsjustj)	106	93.72	123.15	31	29.25
4301.	Eric (insecureforsure)	106	81.36	101.87	31	29.25
4302.	ihba (ihba)	106	79.14	106.61	35	33.02
4303.	md (duom_1432)	106	71.93	102.87	24	22.64
4304.	Dan (danezu)	106	68.21	91.13	15	14.15
4305.	Bruce (brucecccccc)	106	105.86	127.84	48	45.28
4306.	Elden (bloab)	106	121.10	150.45	86	81.13
4307.	Biza (biza)	106	74.22	86.67	24	22.64
4308.	Christian (allen2021)	106	56.52	69.24	10	9.43
4309.	pnguin (pnguin_)	106	98.06	119.65	55	51.89
4310.	Ahjashi (jnguyen21)	106	64.19	78.02	19	17.92
4311.	Hayley (hayleylafontaine)	106	71.58	93.99	24	22.64
4312.	Caleb (powelcb)	106	52.24	67.91	7	6.60
4313.	(zealindaus)	105	132.64	164.72	87	82.86
4314.	Willll (yongzew)	105	50.39	59.96	3	2.86
4315.	Yanni (yannishams)	105	63.13	80.82	32	30.48
4316.	Phoeniix (xiineo)	105	86.71	115.02	37	35.24
4317.	Typo (wlofails)	105	112.86	148.63	72	68.57
4318.	withan46 (withan46)	105	72.99	85.45	27	25.71
4319.	ugga (ugga_ugga)	105	87.09	108.20	42	40.00
4320.	Lucas (slappy_rgs)	105	68.26	89.22	20	19.05
4321.	Sabari (sabari314)	105	80.81	104.15	35	33.33
4322.	slow-af (rohilverma)	105	130.45	152.08	73	69.52
4323.	Radmilo (radmilo)	105	96.01	114.88	40	38.10
4324.	:| (peanutbutter_665)	105	72.74	111.66	22	20.95
4325.	lio (osybius)	105	96.27	118.76	46	43.81
4326.	OrangeKomodo (orangekomodo)	105	63.91	82.86	24	22.86
4327.	💾 PROGRESS IS NOT LINEAR...	105	86.37	104.14	29	27.62
4328.	Nino (ninospvp)	105	129.65	156.97	66	62.86
4329.	ninfueng (ninfueng)	105	61.16	79.26	19	18.10
4330.	Eva (niejingtan)	105	77.98	98.85	32	30.48
4331.	Nick (nick1236)	105	58.74	78.21	16	15.24
4332.	Natsu (n4tsu_dragneel)	105	51.76	66.60	12	11.43
4333.	Tien (mr_tien)	105	77.01	110.31	24	22.86
4334.	apoodle_ (molltenlol)	105	69.58	91.33	24	22.86
4335.	Madara (madara_uchihaking)	105	60.32	77.13	64	60.95
4336.	Loopy (loopy_oopy)	105	65.62	81.35	24	22.86
4337.	Jatin (jatin_sharma_2005)	105	77.36	92.75	21	20.00
4338.	Ctrl + Alt + K (infolepsy)	105	122.33	154.11	63	60.00
4339.	Valentina (genericwhitemale)	105	88.53	118.84	33	31.43
4340.	Ahmed (gemy_amin)	105	47.74	62.50	10	9.52
4341.	2002hondaaccord (gamingboss...	105	101.83	131.47	45	42.86
4342.	DiroDoku (dirodoku)	105	91.84	112.34	38	36.19
4343.	bleh (dan1ce)	105	59.71	74.99	38	36.19
4344.	Gascoigne (correctionhaha)	105	121.47	158.77	59	56.19
4345.	CJ (cj2305)	105	74.09	91.63	26	24.76
4346.	[FRLA] Frank Admirer (ciaer...	105	110.17	134.30	81	77.14
4347.	Bbbbbbbbb (boohaw)	105	146.80	185.10	80	76.19
4348.	Boo (boo42069)	105	62.35	83.38	31	29.52
4349.	aymen (aymenalwh)	105	59.18	73.96	22	20.95
4350.	April (apping)	105	65.16	80.75	27	25.71
4351.	ehe (aeronsic)	105	87.83	100.26	30	28.57
4352.	Mahedi (12362)	105	71.21	92.76	29	27.62
4353.	Parameshwaran (knparamesh26)	105	54.50	70.42	14	13.33
4354.	Gold (goldberger)	105	80.47	107.24	40	38.10
4355.	Bitcoin (sreeharshag)	105	46.16	57.84	7	6.67
4356.	enes (mr_moonz)	105	51.40	62.98	10	9.52
4357.	Kevin (zuperfire1)	104	94.65	111.91	27	25.96
4358.	zhizin (zhixin0220)	104	38.11	45.77	10	9.62
4359.	Rezaul (vuzinga)	104	63.99	74.44	13	12.50
4360.	JL (tsg03)	104	67.22	86.92	24	23.08
4361.	Tómas Ingi (tomasingi)	104	66.41	80.69	25	24.04
4362.	Andrew (silverdotters)	104	95.51	115.24	42	40.38
4363.	Dutch (shawnseb)	104	91.20	112.61	34	32.69
4364.	PedroS235 (pedro_s235)	104	59.89	74.66	17	16.35
4365.	knoppix (ninopereira)	104	53.89	66.91	10	9.62
4366.	Emma (missbennett)	104	86.41	108.71	25	24.04
4367.	Apollyon (mik_apollyon)	104	96.84	122.30	46	44.23
4368.	Matthew (mattyhassett)	104	102.56	141.91	44	42.31
4369.	Kuidurgu (kuidurgu01)	104	40.91	50.60	22	21.15
4370.	Karan (karansinghgi18)	104	53.78	67.03	11	10.58
4371.	IanL (jeedaiian)	104	52.04	63.63	14	13.46
4372.	Honza (honza2535)	104	85.57	101.78	26	25.00
4373.	howdoitellherilovehersomuch...	104	71.57	94.02	26	25.00
4374.	Drake (gangket)	104	58.97	75.94	13	12.50
4375.	Bing (gamerbilplays)	104	96.38	133.28	45	43.27
4376.	Calvin (fullrespect)	104	99.71	119.58	59	56.73
4377.	femonemonemo (femonemo)	104	73.59	84.40	19	18.27
4378.	Nathan (craizar)	104	82.52	99.42	29	27.88
4379.	Petr (chytris)	104	54.22	65.73	12	11.54
4380.	shiba inu (bamboozledshibe)	104	87.70	124.01	32	30.77
4381.	Hello Layth :) (ayoubantita...	104	75.94	102.31	32	30.77
4382.	Nick (headhunter_jr)	104	67.99	80.77	17	16.35
4383.	Shyam (gamr7564)	104	85.18	108.30	32	30.77
4384.	Pawan (fake_name)	104	58.83	76.94	15	14.42
4385.	heker the kichuz (kichuz)	104	47.10	62.11	12	11.54
4386.	vminh (tvmint)	103	63.62	80.44	25	24.27
4387.	Swarmy (swarmy)	103	76.26	94.01	20	19.42
4388.	themommajeans (spammaam)	103	105.31	139.84	50	48.54
4389.	Galih (sobig_f)	103	80.62	117.66	35	33.98
4390.	love (skaldssss)	103	94.24	126.70	48	46.60
4391.	Sanchit (sanchitsharma21)	103	85.98	101.95	35	33.98
4392.	Mark (redblacktiger)	103	93.53	124.30	45	43.69
4393.	pro (pro_napro)	103	37.54	47.99	7	6.80
4394.	arun (noobtyperarun)	103	87.25	119.05	53	51.46
4395.	Tom (mikeoxverylong)	103	92.42	112.47	46	44.66
4396.	Midnight (midnightshadows)	103	79.60	116.27	33	32.04
4397.	Midhun (midhunvmurali)	103	55.04	66.05	7	6.80
4398.	Lynn (lynnhanananer1)	103	84.07	103.86	24	23.30
4399.	tstats[legendarybbk] (legen...	103	87.11	109.36	38	36.89
4400.	Stone (kimpors)	103	65.92	82.07	25	24.27
4401.	G_4G3 (g4g3)	103	58.04	71.30	16	15.53
4402.	durehuu (durehuu_123)	103	34.60	61.50	5	4.85
4403.	Nikola (dudeimwhite)	103	69.64	91.65	30	29.13
4404.	DINKL3B3RGG (cosmovt)	103	62.64	79.64	20	19.42
4405.	clock145 (clock145)	103	74.42	93.09	29	28.16
4406.	Chinmoy (chinmoy709)	103	38.56	49.37	13	12.62
4407.	Caleb (calebbueckert)	103	79.33	100.90	24	23.30
4408.	Tobias (bolleeer)	103	80.57	100.99	18	17.48
4409.	bella (bella4088888888)	103	45.23	57.43	53	51.46
4410.	Ashwani (ashwani45)	103	72.52	92.69	26	25.24
4411.	Cheese (arandomasiankid)	103	73.03	102.32	34	33.01
4412.	Release from the pain (abod...	103	80.71	99.86	26	25.24
4413.	Abhi (abhinavsanthosh_162008)	103	64.08	83.67	23	22.33
4414.	HCKB (hckb21)	103	43.63	59.00	10	9.71
4415.	colemak54 (coder054)	103	32.83	41.29	9	8.74
4416.	abdullah (aslan19)	103	35.27	42.43	3	2.91
4417.	MaBec (_mabecma_)	102	61.46	82.75	16	15.69
4418.	Bugs (_bunny)	102	66.76	79.04	30	29.41
4419.	Jason (_bagel_)	102	78.73	97.77	31	30.39
4420.	zooommm23 (zooommm23)	102	69.70	95.74	16	15.69
4421.	Hamza (yamac_kocovali)	102	39.80	52.43	9	8.82
4422.	Viran (viranp)	102	99.82	126.07	43	42.16
4423.	V3ness (venessang)	102	72.65	104.46	21	20.59
4424.	me again (urdogwateruwu)	102	111.04	145.55	49	48.04
4425.	Coco (ummena)	102	72.54	88.10	34	33.33
4426.	instruments of torture (the...	102	136.97	169.28	77	75.49
4427.	Theodore (theo52)	102	76.24	96.07	30	29.41
4428.	XIN (tem_per)	102	84.54	109.25	18	17.65
4429.	suhayb (suhayb)	102	42.76	63.37	36	35.29
4430.	Madison (speedbltch)	102	70.73	93.44	24	23.53
4431.	Sarah (sarahmae123)	102	85.46	116.53	31	30.39
4432.	Prasoon (prkharel)	102	94.01	125.70	36	35.29
4433.	AP (priyanthushara)	102	39.05	54.29	7	6.86
4434.	Priyanshu (priyanshu88064)	102	67.31	80.68	20	19.61
4435.	Parker (parkerfd9dy)	102	70.17	89.82	32	31.37
4436.	Opmrph (opmrph)	102	91.86	124.98	48	47.06
4437.	Navid Sadeghi (navid_sadeghi)	102	46.77	62.15	40	39.22
4438.	Nathan (nathan_cant_type)	102	90.52	108.51	30	29.41
4439.	TechHolmes (mohmmde)	102	55.27	74.15	17	16.67
4440.	Lemone (lemonylemone)	102	71.40	93.48	24	23.53
4441.	Just a man in a hotdog van ...	102	121.94	164.51	56	54.90
4442.	799 (khs4126428)	102	87.28	111.52	31	30.39
4443.	Rest Easy Byron (keatonsmith)	102	146.73	178.11	83	81.37
4444.	Jonjon (jonjonlilbas)	102	80.67	107.30	24	23.53
4445.	jihoon007 (jihoon007)	102	55.44	69.05	19	18.63
4446.	sg my beloved (imperfect_qu...	102	98.86	123.84	44	43.14
4447.	mrrizkin (ifixlss)	102	83.83	99.42	28	27.45
4448.	Mitchell (godekm)	102	111.76	147.90	44	43.14
4449.	billie (eillib)	102	75.20	94.93	19	18.63
4450.	Andrius (ciornas)	102	60.14	70.34	23	22.55
4451.	𝕲𝖍𝖔𝖘𝖙♠️ ...	102	78.68	104.10	21	20.59
4452.	Budhai (budhai_)	102	51.91	68.48	12	11.76
4453.	David Lia (terraform)	102	60.06	81.47	17	16.67
4454.	lin (mattlin)	102	51.11	63.40	11	10.78
4455.	Varun (purplevarun)	102	55.94	71.44	23	22.55
4456.	Anxiietyx (anxiietyx)	102	61.14	74.34	16	15.69
4457.	big (bigdesch)	102	63.19	76.26	25	24.51
4458.	Dario (darioacg)	102	25.78	52.40	21	20.59
4459.	kamothy (kamothy)	102	73.62	94.58	24	23.53
4460.	Ryan (_rhou_)	101	108.93	144.95	60	59.41
4461.	Zils (zils_)	101	87.87	101.96	29	28.71
4462.	uann (uann1)	101	64.53	78.68	27	26.73
4463.	hetang (typr_1)	101	62.88	76.47	33	32.67
4464.	Ross (trickydick6)	101	105.42	135.11	37	36.63
4465.	Welcometomycrucifixion (tim...	101	100.24	118.66	35	34.65
4466.	Steve (stevegocoding)	101	60.86	77.89	18	17.82
4467.	JD (snag1)	101	72.08	93.45	23	22.77
4468.	Nick (slotharms)	101	73.59	89.85	16	15.84
4469.	Shanti Swaroop (shanti_swar...	101	79.69	94.45	26	25.74
4470.	ScreaM (scream2002)	101	58.04	81.96	12	11.88
4471.	Sameer (sameercarpenter)	101	62.16	77.14	21	20.79
4472.	Mac (redsmac)	101	73.01	91.46	26	25.74
4473.	Aditya (prakashaditya)	101	63.35	72.65	20	19.80
4474.	Chaos (numerodos)	101	131.30	161.81	70	69.31
4475.	James (james123wu)	101	75.70	101.56	24	23.76
4476.	Leviathan (furyx)	101	106.49	157.52	26	25.74
4477.	Frank (fizero)	101	58.35	71.93	10	9.90
4478.	Endstyle (endstylegg)	101	102.47	123.30	34	33.66
4479.	come (comecurry)	101	98.76	125.09	41	40.59
4480.	Mikita (byxmend)	101	55.02	68.44	13	12.87
4481.	Bonu (bonu21)	101	55.35	65.06	14	13.86
4482.	bean boy (binhthetyper)	101	56.20	74.30	17	16.83
4483.	Bdoo (bdo0)	101	35.07	48.53	2	1.98
4484.	Andy (andygeo)	101	44.02	56.23	14	13.86
4485.	Anavo (anavailable)	101	59.94	75.16	1	0.99
4486.	Benny (helmet123)	101	60.56	71.75	14	13.86
4487.	smq (_smq)	100	97.18	124.93	44	44.00
4488.	Brockton (ztgstover)	100	109.28	138.83	48	48.00
4489.	zoo (zoo868e)	100	65.19	77.56	25	25.00
4490.	Bob (xminer99)	100	61.44	88.97	22	22.00
4491.	Victor (victorzasz)	100	53.26	65.77	8	8.00
4492.	FREE PALESTINE (then1g)	100	96.10	118.62	34	34.00
4493.	Zoomer (somerandomkid76)	100	80.04	100.18	27	27.00
4494.	Tyler (slashrage)	100	64.40	80.95	19	19.00
4495.	Aidan (sirrahnadia)	100	109.73	137.79	44	44.00
4496.	Jimmy (ratjesus)	100	82.53	110.51	27	27.00
4497.	pipelined (polarilacari)	100	77.80	97.33	28	28.00
4498.	chad (pokeman34)	100	123.58	144.18	49	49.00
4499.	plantfan330 (plantfan330)	100	57.23	75.26	15	15.00
4500.	Arnau (pestopasta)	100	66.24	85.77	24	24.00
4501.	Perich (perich)	100	84.96	108.33	33	33.00
4502.	Sven (paindevil07)	100	69.52	80.95	24	24.00
4503.	Azar (nxp_azar)	100	60.43	76.57	51	51.00
4504.	Marx (marxjp)	100	78.06	99.36	25	25.00
4505.	Manish (manish_89)	100	53.47	66.48	18	18.00
4506.	Lukas (lukaslechner)	100	67.37	81.90	21	21.00
4507.	Kinfi4 (kinfi4)	100	79.35	100.07	21	21.00
4508.	khoinhalam (khoinhalam)	100	67.27	88.86	19	19.00
4509.	John (johnhemrom)	100	56.44	68.01	8	8.00
4510.	rasmus (jemjoyous)	100	77.70	106.50	45	45.00
4511.	idk man (ithatme)	100	51.71	71.99	8	8.00
4512.	idk_hii (idk_hii)	100	87.05	108.17	28	28.00
4513.	hellooooo (hk_in_london)	100	77.56	97.51	23	23.00
4514.	Harry (harrycomp16)	100	77.08	98.27	29	29.00
4515.	grigoar (grigoar)	100	76.87	98.92	25	25.00
4516.	goombamario (goombamario)	100	39.49	53.33	12	12.00
4517.	Filip (flameouken)	100	60.28	77.14	25	25.00
4518.	ACC [99 - 100] (dinoh_sandys)	100	84.70	105.20	44	44.00
4519.	Crystal (crystal_angelo)	100	88.88	116.41	33	33.00
4520.	Crash (crash_complete)	100	81.39	105.41	34	34.00
4521.	Ethan (conanethan)	100	91.71	114.48	30	30.00
4522.	César (c3sar36)	100	79.18	113.30	28	28.00
4523.	Big (boosted_ape)	100	67.88	81.52	30	30.00
4524.	Marcus (boopbeepboopboop)	100	86.79	108.85	30	30.00
4525.	Rashid (beats_exe)	100	73.62	101.36	28	28.00
4526.	Anton (antonjr04)	100	78.44	104.05	27	27.00
4527.	animalpsyche (animalpsyche)	100	72.52	89.83	24	24.00
4528.	Ahmed (ahmeed_a)	100	29.35	37.04	10	10.00
4529.	Koma5 (xultronix)	100	91.76	109.54	32	32.00
4530.	K a a y (none_available)	100	65.03	84.57	32	32.00
4531.	SpeedRacer (the_transporter)	100	53.12	73.43	8	8.00
4532.	THE MAK (realbenjaminmak)	100	82.44	99.04	35	35.00
4533.	JianClash (jianclash)	100	29.25	40.35	12	12.00
4534.	warya (warya)	99	64.64	89.28	77	77.78
4535.	Gus (uberro)	99	96.47	121.70	40	40.40
4536.	Toodles (toodles678)	99	104.77	151.44	43	43.43
4537.	Smokey (smokeytheoni)	99	79.21	97.50	24	24.24
4538.	Siddharth (sid_1310)	99	68.84	89.22	18	18.18
4539.	samy (samy_mohsen)	99	56.15	73.77	14	14.14
4540.	Benjamin (saltysnit)	99	95.66	113.62	39	39.39
4541.	Jerm (professional_keyboard...	99	87.70	123.50	36	36.36
4542.	Howard (papertofu)	99	137.01	164.59	75	75.76
4543.	Nick (nirosmit)	99	58.28	74.31	14	14.14
4544.	Yam (metrictensor)	99	110.51	133.98	46	46.46
4545.	Meet (meet27)	99	83.09	100.61	27	27.27
4546.	浩丁 (kusogedane)	99	102.32	125.13	43	43.43
4547.	Joy (joy_1)	99	70.25	82.13	22	22.22
4548.	my fingers are slow (jay12310)	99	92.78	111.56	30	30.30
4549.	Able (interstellarnova)	99	69.49	81.28	19	19.19
4550.	ibrahim (ibrahiem)	99	60.48	77.42	17	17.17
4551.	waifu (helpme_pls)	99	72.67	90.51	28	28.28
4552.	HelioSpook (heliospook)	99	34.85	47.95	1	1.01
4553.	Ducky (duckyz1)	99	73.13	93.61	23	23.23
4554.	Dreamside (dreamside0010)	99	63.88	88.51	18	18.18
4555.	isaac (cowwee90)	99	99.01	124.95	32	32.32
4556.	David (circuitnerd)	99	64.17	79.48	24	24.24
4557.	Montu (axom_shochwave)	99	85.61	104.05	22	22.22
4558.	Indian hacker man (asain_du...	99	62.89	80.45	17	17.17
4559.	ArkoSammy12 (arkosammy_1208)	99	75.64	105.60	27	27.27
4560.	tadej pogačar (acadiantaco)	99	119.98	162.91	53	53.54
4561.	lyrxcal (4l3y)	99	116.23	148.85	58	58.59
4562.	oscar (skarro)	99	61.42	78.12	24	24.24
4563.	Silent (silent_c1c4d4)	99	71.76	101.24	31	31.31
4564.	Suman (kissey)	99	60.46	76.02	23	23.23
4565.	Madeleine (maddiebeck)	99	73.71	92.47	29	29.29
4566.	wi.p (rendyrond)	99	61.83	90.03	19	19.19
4567.	Brayan (veraniego)	98	55.29	68.54	16	16.33
4568.	Mark (veltzer)	98	92.05	117.94	40	40.82
4569.	Vimim (tovtype)	98	81.24	96.95	20	20.41
4570.	Mausam (the_witcher)	98	78.22	93.13	33	33.67
4571.	JS (thenotorious619)	98	67.79	85.59	23	23.47
4572.	Tharun (tharun66)	98	67.15	90.07	11	11.22
4573.	Erick (smittywerben)	98	81.44	101.20	31	31.63
4574.	Singh (singh_ram)	98	54.23	74.05	10	10.20
4575.	myself (sakib9)	98	80.72	104.36	36	36.73
4576.	robdude22 (robodude22)	98	101.81	126.07	52	53.06
4577.	Pixel269 (pixeltwosixnine)	98	98.83	144.22	35	35.71
4578.	Oli (oli94)	98	103.56	138.37	42	42.86
4579.	elongatedsquirrel (nba_youn...	98	64.16	90.95	29	29.59
4580.	Rest in peace (michaeltrayv...	98	179.97	215.41	95	96.94
4581.	uhhhhhhh (membrane_ripper)	98	70.85	92.82	23	23.47
4582.	Mark (mamochiro)	98	65.96	81.44	21	21.43
4583.	Cody (kingbear2)	98	78.97	100.59	21	21.43
4584.	grandsheber (justbagdat)	98	61.23	72.56	37	37.76
4585.	jonica (jonicailagan)	98	99.54	123.00	32	32.65
4586.	Jack (jackshadow)	98	81.48	101.71	25	25.51
4587.	Ice (icedime)	98	88.71	107.21	34	34.69
4588.	Hannah (hpelay)	98	96.62	117.72	37	37.76
4589.	Freundschaft Bus (freundsch...	98	86.04	105.66	34	34.69
4590.	deepak (fireyfingers)	98	46.09	60.31	6	6.12
4591.	Erik (erik4)	98	83.55	102.73	31	31.63
4592.	Chhavi (chhavijain1111)	98	70.49	88.20	19	19.39
4593.	macura (bobbygreg)	98	85.25	122.65	36	36.73
4594.	BASIL (basilps123)	98	76.37	88.86	26	26.53
4595.	Aditya (aditya9219)	98	76.70	96.26	24	24.49
4596.	Dahmer's (hybridtattu)	98	33.03	49.97	10	10.20
4597.	Dominik (b14ucky)	98	64.47	81.83	26	26.53
4598.	Vroom (woem)	98	61.99	75.20	30	30.61
4599.	Nathan (vanderha)	97	80.66	102.72	18	18.56
4600.	ton (tonton31)	97	87.47	110.43	32	32.99
4601.	Ceres (the445guy)	97	87.56	115.48	38	39.18
4602.	Stam (stam_01)	97	79.43	106.06	32	32.99
4603.	jojo (spacelion121319)	97	75.50	99.53	23	23.71
4604.	Marm (slayerxy)	97	144.59	172.00	69	71.13
4605.	Fork (sir_fork)	97	61.70	86.32	12	12.37
4606.	Sal-Kal (sal_kal)	97	80.44	101.38	36	37.11
4607.	Matt (rosettastoned)	97	93.77	113.84	39	40.21
4608.	Roper (ropergames)	97	47.44	75.03	8	8.25
4609.	Rany (ranystephan)	97	60.51	87.69	16	16.49
4610.	Principle (principle105)	97	120.53	149.70	51	52.58
4611.	typer (practise_to_type)	97	59.66	74.46	38	39.18
4612.	Om (omsharma612)	97	61.39	80.97	14	14.43
4613.	Muhd Khalid (lid313)	97	75.37	95.70	25	25.77
4614.	jeremiah (jeremiah12345)	97	87.72	106.98	32	32.99
4615.	M (iamake)	97	75.69	93.02	24	24.74
4616.	Grim (grimtorcher)	97	68.46	91.23	24	24.74
4617.	Kasidit (ganadosa)	97	46.05	58.89	6	6.19
4618.	Rask (frederik0147)	97	66.92	77.36	16	16.49
4619.	n0 (doo1222)	97	69.81	87.51	16	16.49
4620.	Eri (bobtentencarracer)	97	92.51	115.87	34	35.05
4621.	Benjamin (bnje1)	97	105.67	139.94	41	42.27
4622.	Valentin (bg4uk)	97	57.45	73.73	16	16.49
4623.	anjal (anjal23)	97	84.90	107.48	32	32.99
4624.	Raunak (aabbccdd4444)	97	81.58	97.53	25	25.77
4625.	Syed Faysel (syedfaysel)	97	52.04	66.83	15	15.46
4626.	Derrick (quiet_alien)	97	49.54	72.33	10	10.31
4627.	Ikeai0515 (uanea0516)	96	88.99	111.87	33	34.38
4628.	thunderbeast (thunderbeast_)	96	77.25	101.59	32	33.33
4629.	Trevor (thetrevormonreal)	96	85.84	115.48	25	26.04
4630.	Vu (taptyping)	96	63.89	85.16	18	18.75
4631.	fingerSkate (skhmt)	96	70.52	89.55	18	18.75
4632.	oh god dvorak is so bad (se...	96	128.01	148.87	75	78.13
4633.	Scryp (scryp)	96	102.24	125.66	41	42.71
4634.	qwerab (qwerab)	96	67.54	79.30	19	19.79
4635.	Takumi86 (olliedudd)	96	67.44	88.02	15	15.63
4636.	Ankur (naresh12)	96	65.26	77.79	24	25.00
4637.	FOO (mintaly_unstable)	96	73.94	91.14	25	26.04
4638.	average rice enjoyer (kireg...	96	141.68	190.60	33	34.38
4639.	Wallapa (kefatypist)	96	47.33	56.42	11	11.46
4640.	Jinf931 (jinf931)	96	86.52	108.58	31	32.29
4641.	Gergő (gergo225)	96	81.20	100.46	29	30.21
4642.	geras (gerastv)	96	98.57	146.89	29	30.21
4643.	Steven (gamma_knife17)	96	102.14	123.55	40	41.67
4644.	ouchies (evilemmelina)	96	113.04	147.57	47	48.96
4645.	Eric (ebiman9726)	96	58.68	86.59	14	14.58
4646.	Dr (drchhun)	96	58.82	76.93	15	15.63
4647.	develsixteen (develsixteen)	96	94.03	112.32	26	27.08
4648.	jb (deamon_214)	96	41.04	60.86	11	11.46
4649.	Em (chuchu)	96	77.93	94.83	27	28.13
4650.	Catman (catman847)	96	71.18	86.41	24	25.00
4651.	Nathan (buddyurslow)	96	89.14	106.35	37	38.54
4652.	Bryan.. XD (bryan_xd)	96	76.54	106.42	24	25.00
4653.	Thomas (banone)	96	46.80	57.35	10	10.42
4654.	Areeb (areebur)	96	68.98	85.24	29	30.21
4655.	Shohan (ansshohan)	96	75.41	95.52	23	23.96
4656.	alaa (alaa_eddin)	96	44.75	53.13	16	16.67
4657.	carina (carina05)	96	107.63	132.67	87	90.63
4658.	Lukares (dulacz)	96	80.30	93.21	30	31.25
4659.	Andy (graydragon12)	96	78.24	102.85	36	37.50
4660.	Ethan (zshooter0077)	95	57.02	74.36	18	18.95
4661.	Zito (zrelova)	95	113.61	138.39	52	54.74
4662.	YSSH (yosshi)	95	79.83	97.27	20	21.05
4663.	Samir (wickedl4ndo)	95	63.18	83.99	24	25.26
4664.	WinG9G (vving020515)	95	68.87	85.81	16	16.84
4665.	🎈 (typing_badly)	95	133.99	162.56	55	57.89
4666.	Dan (typheratrix)	95	78.74	106.76	21	22.11
4667.	turbocell48 (turbocell48)	95	119.43	145.23	57	60.00
4668.	Toowe (toowe)	95	73.07	96.91	20	21.05
4669.	raj (the_karna)	95	60.25	77.72	21	22.11
4670.	Oscar (oarr)	95	57.70	73.33	15	15.79
4671.	Sriram (sriramrox)	95	56.83	78.78	30	31.58
4672.	Shivam (shivy08)	95	68.13	84.06	38	40.00
4673.	cowburrs (satlight)	95	82.62	107.18	30	31.58
4674.	clackity (phys1cs)	95	63.37	80.85	19	20.00
4675.	morty (morty_lh)	95	49.76	66.69	11	11.58
4676.	George (mega_type_racer)	95	95.82	114.07	44	46.32
4677.	Marsal (marsalsz)	95	77.27	100.24	30	31.58
4678.	Marvin (malvolio)	95	83.69	99.39	27	28.42
4679.	Alexa (lexalexa100)	95	120.94	141.71	67	70.53
4680.	Leon (leon22)	95	96.68	118.06	33	34.74
4681.	Samuel (knightsight)	95	118.33	154.88	68	71.58
4682.	krisr17 (kk017)	95	81.71	101.16	35	36.84
4683.	sam (justlikethat)	95	54.93	69.83	8	8.42
4684.	John (johnrupesh)	95	80.78	101.45	25	26.32
4685.	Joosh (jewsh)	95	82.40	103.13	28	29.47
4686.	Jelly belly (jellybabysexys...	95	67.73	85.59	20	21.05
4687.	Zephyr (introstealer)	95	76.01	96.54	25	26.32
4688.	husq (husq)	95	106.70	132.36	46	48.42
4689.	huddled (haraldgb)	95	89.32	106.25	27	28.42
4690.	AHomieNucleus (galaxxyn1)	95	97.01	116.50	36	37.89
4691.	Amirzhan (dungeon_beast13)	95	44.70	55.07	13	13.68
4692.	darthinfinix (darthinfinix)	95	77.23	106.85	26	27.37
4693.	Ashley (darlavsue12)	95	93.33	114.02	28	29.47
4694.	cole (cole_makker)	95	40.98	54.30	9	9.47
4695.	Code (codeiii)	95	60.07	74.80	17	17.89
4696.	Capivara (capivaradafarialima)	95	79.19	98.76	27	28.42
4697.	Vladislav Ostrovsky (atmsphrx)	95	94.10	121.16	35	36.84
4698.	Aniruddh (arl17)	95	48.24	57.24	7	7.37
4699.	trakovsik (beyazzenci)	95	69.68	86.49	27	28.42
4700.	rexjo7 (rexjo7)	95	72.86	118.05	30	31.58
4701.	Tomas (tigfiend)	95	62.30	76.48	12	12.63
4702.	Tze Ning (zzzzzningd)	94	80.94	100.84	27	28.72
4703.	Joe (zeppyg)	94	90.72	111.10	31	32.98
4704.	z0rp (z0rp)	94	103.87	131.46	47	50.00
4705.	Vivek (vivek62)	94	62.46	79.70	18	19.15
4706.	lilvic (vickty)	94	102.99	125.62	45	47.87
4707.	Hassan (urboyhassan)	94	77.75	96.01	19	20.21
4708.	Tamás (tamas)	94	98.79	136.90	44	46.81
4709.	Me (something_s)	94	110.92	144.29	42	44.68
4710.	Jason (serenity47)	94	94.56	113.21	34	36.17
4711.	(records)	94	115.97	147.13	50	53.19
4712.	Souvik (rascalam)	94	71.14	95.50	22	23.40
4713.	pwxown (pwxown123)	94	64.66	79.70	21	22.34
4714.	Goodwmyfingers (polterg3ist)	94	108.73	132.01	37	39.36
4715.	pituf0 (pituf0)	94	95.36	123.92	34	36.17
4716.	aaaaaaaaaaa (mintlyowo)	94	140.93	185.41	71	75.53
4717.	Mark (mastopuppets)	94	61.38	84.63	21	22.34
4718.	Madiyor (madiyor)	94	72.81	96.09	30	31.91
4719.	Christian (loggityloglog)	94	90.68	116.23	29	30.85
4720.	Rohan B. (linuxman_linux)	94	139.79	174.64	78	82.98
4721.	Lakshay (lakshay882)	94	51.10	65.68	19	20.21
4722.	Koolis (koolisz)	94	92.55	110.01	38	40.43
4723.	Jeffy (jeffyl)	94	119.71	150.35	57	60.64
4724.	Grzegorz (jag1)	94	70.28	87.93	25	26.60
4725.	rebecca (ionn)	94	94.59	114.24	33	35.11
4726.	imtiaz (imtiaz12)	94	68.98	97.17	28	29.79
4727.	jacob (iljain)	94	89.23	112.89	29	30.85
4728.	TASHI (erehh19)	94	40.90	56.90	41	43.62
4729.	Divyanshu (dev064)	94	30.25	43.24	14	14.89
4730.	Casper (casperliuliuliu)	94	53.34	71.76	12	12.77
4731.	Jimmy (carb0n13)	94	92.68	116.35	29	30.85
4732.	caesar (caesar03)	94	54.57	68.15	12	12.77
4733.	Avi (avi222)	94	29.40	42.46	9	9.57
4734.	Anvesh (anveshreddy18)	94	74.72	92.00	24	25.53
4735.	goku (dragonballsuper)	94	60.77	73.51	18	19.15
4736.	kuutti (pela10)	94	72.59	96.73	49	52.13
4737.	husky (hungryhusky)	94	54.60	69.87	17	18.09
4738.	Will (squilii)	94	63.95	80.82	20	21.28
4739.	Zak (zajawe)	93	80.08	97.50	27	29.03
4740.	Yessimkhan (yess_0)	93	26.51	38.62	23	24.73
4741.	Yash (yash23)	93	76.20	107.73	26	27.96
4742.	gusher (wizardlordbob)	93	62.40	77.98	16	17.20
4743.	venky (venkywonka)	93	73.15	97.61	20	21.51
4744.	Lord (valharius)	93	94.05	112.48	37	39.78
4745.	Vincent (v1ncent)	93	147.32	174.95	74	79.57
4746.	tito (titoreo)	93	69.48	94.62	22	23.66
4747.	memers (thememers)	93	51.39	63.72	12	12.90
4748.	sagar (sgr5)	93	46.52	59.06	12	12.90
4749.	Teodor (maniacth)	93	57.08	72.10	16	17.20
4750.	md abdullah (mamun220)	93	39.66	51.76	9	9.68
4751.	Luis (luismec90)	93	62.67	89.49	26	27.96
4752.	017 (k_chun)	93	69.03	87.83	23	24.73
4753.	house (jrsp5)	93	91.46	107.59	28	30.11
4754.	JoaoPauluu (joaopauluu)	93	104.05	137.39	50	53.76
4755.	Miguel (jalb)	93	92.27	112.77	25	26.88
4756.	Hxwk (hxwkoncrack)	93	76.04	97.73	20	21.51
4757.	Herbie (hjrand1005)	93	96.85	116.52	37	39.78
4758.	Felix (felizocker)	93	75.70	99.48	20	21.51
4759.	honk (fallguys)	93	70.80	94.61	26	27.96
4760.	Declan (deccazz)	93	93.71	112.19	40	43.01
4761.	Siddhant (code_talker)	93	112.74	134.56	42	45.16
4762.	Filip (churllix)	93	58.80	73.19	10	10.75
4763.	Burak (burakkor434)	93	71.17	87.02	19	20.43
4764.	Neo (aonixn)	93	80.80	100.94	24	25.81
4765.	Alberto (angry_grandad)	93	64.84	78.67	20	21.51
4766.	Elk (elkx)	93	50.96	68.17	12	12.90
4767.	Johnty (boardsupremacy)	93	85.76	120.10	36	38.71
4768.	Utkarsh (utkarshsarkar)	93	36.99	44.32	5	5.38
4769.	tstats[jimmyneuson] (jimmyn...	93	87.70	103.82	18	19.35
4770.	Ray (thickdoink)	93	29.21	68.15	13	13.98
4771.	Jike (procrastinatingking)	93	79.73	103.80	47	50.54
4772.	i am (anwar24)	93	53.46	68.92	13	13.98
4773.	t0oms (t0oms)	93	57.80	71.00	15	16.13
4774.	Jonas (zamurai88)	92	67.53	85.70	23	25.00
4775.	x1300252 (x1300252)	92	40.92	49.60	9	9.78
4776.	vita_melk (vita_melk)	92	73.76	93.93	28	30.43
4777.	Josh (unkret)	92	60.11	77.86	23	25.00
4778.	Subhajit (tumpasona)	92	51.43	64.83	11	11.96
4779.	timas (timastimas)	92	82.39	98.06	30	32.61
4780.	Thickspinach (thickspinach)	92	82.79	102.18	25	27.17
4781.	Anna (slewa)	92	46.10	57.98	5	5.43
4782.	Derry (siribackwards)	92	80.72	100.69	28	30.43
4783.	Vinh (shadeomen)	92	97.95	120.17	39	42.39
4784.	Rajish (rajish)	92	90.82	108.17	30	32.61
4785.	Typer (pjottur)	92	62.19	76.73	17	18.48
4786.	The don (photondestroyer)	92	74.52	91.86	18	19.57
4787.	Nahla (na_hla)	92	25.77	37.03	19	20.65
4788.	Nuno (n4n0x01)	92	78.38	96.25	30	32.61
4789.	msm (mousamlimbu)	92	62.91	81.16	34	36.96
4790.	Mohchih (mohchih)	92	78.25	107.79	24	26.09
4791.	Melissa (mel8402)	92	70.02	94.88	14	15.22
4792.	Kevin (kevinparkit)	92	101.82	121.72	35	38.04
4793.	Jack (jx34tech)	92	62.69	87.97	18	19.57
4794.	Jun Kang (junkang098)	92	95.55	128.22	33	35.87
4795.	Josh (josgo888)	92	60.79	78.38	19	20.65
4796.	Jonathan (jontheprinter)	92	79.87	100.22	24	26.09
4797.	Jason Hean (jackson95)	92	51.67	63.76	7	7.61
4798.	Hawky (itshawky)	92	130.54	158.53	62	67.39
4799.	Mark (inthe)	92	79.12	97.23	18	19.57
4800.	Kevin (ibekevinn)	92	100.44	124.72	51	55.43
4801.	HGud (hgudtk)	92	85.77	116.81	23	25.00
4802.	Gerry (gl701)	92	112.15	137.96	46	50.00
4803.	Farhan (ft10)	92	73.25	88.82	20	21.74
4804.	🥬 (freshkale_workman)	92	74.83	91.91	24	26.09
4805.	Emmanuel (emmanuelmoon)	92	57.55	72.89	18	19.57
4806.	Dyllan (dyllanbui)	92	92.08	118.40	38	41.30
4807.	Breeze (driftbreeze)	92	108.76	126.84	44	47.83
4808.	Sam (disasterlooms)	92	110.69	133.50	38	41.30
4809.	demberel (demberel94)	92	73.00	89.49	31	33.70
4810.	Vishnu (crazy_typeracer)	92	70.67	92.71	24	26.09
4811.	choco (chocolateblocks)	92	105.94	146.75	45	48.91
4812.	Pumpkin Raj (chillreksai)	92	96.63	115.98	44	47.83
4813.	Bekkhan (bkun)	92	84.24	107.57	22	23.91
4814.	mani (bigmeat_)	92	104.82	140.49	48	52.17
4815.	Begatim Bytyqi (begatim)	92	54.54	67.76	18	19.57
4816.	alam (alamjael)	92	78.25	102.63	18	19.57
4817.	Agamemnon (agamemnon_)	92	56.76	74.35	9	9.78
4818.	Khulugjin (aceno)	92	89.26	115.39	37	40.22
4819.	Direwolf (abdelmoezhj)	92	81.59	100.89	20	21.74
4820.	Joe (2513134)	92	109.83	131.26	39	42.39
4821.	Henry (taipeik9)	92	66.10	85.23	26	28.26
4822.	paul (slowsim)	92	28.75	37.82	13	14.13
4823.	░ (_warrior_)	91	103.71	120.83	41	45.05
4824.	Sven (zeverit)	91	97.65	118.18	35	38.46
4825.	AlphaQ (zbooya)	91	60.25	72.02	16	17.58
4826.	Yhannis (yhannis)	91	82.73	101.70	25	27.47
4827.	Bartłomiej (y3v4d)	91	104.54	119.31	41	45.05
4828.	Kevin (windn6)	91	96.33	123.33	33	36.26
4829.	vm (vm_gojiya)	91	60.63	79.07	17	18.68
4830.	Aleksandar (usernamegold)	91	99.66	119.74	38	41.76
4831.	Martin (typeracist_)	91	82.27	104.54	47	51.65
4832.	tsapi (tsapi)	91	102.78	129.25	31	34.07
4833.	Alex (tra_pz)	91	86.83	114.38	24	26.37
4834.	Harsh (todorokishotoua15)	91	49.60	70.59	71	78.02
4835.	The (the_typing_train)	91	90.21	113.02	34	37.36
4836.	bronze (thebronzesword)	91	105.21	130.79	52	57.14
4837.	Sydney (sydneykimbell)	91	116.52	134.15	47	51.65
4838.	Spam (ssspeed)	91	74.52	94.23	29	31.87
4839.	Md Saim (saimahmad)	91	68.92	85.36	25	27.47
4840.	Rabbi (rhdevil)	91	36.35	49.11	6	6.59
4841.	Rex (rexcaliber_115)	91	83.37	111.23	28	30.77
4842.	mashrafi (qweer)	91	44.48	58.57	9	9.89
4843.	Parvez (parvez31)	91	46.60	57.86	14	15.38
4844.	Andy (parkourmaster302)	91	108.85	137.31	57	62.64
4845.	Mmm coffee (orchdork7926)	91	103.73	123.15	36	39.56
4846.	Tyler (omni_aspect)	91	81.28	124.76	28	30.77
4847.	Jannyx (nyxal)	91	88.15	111.97	31	34.07
4848.	Mobinul (mobinhmmh1)	91	46.32	53.13	7	7.69
4849.	nomad_valhalla (me_manas17)	91	54.76	70.61	18	19.78
4850.	MasonColemak (masoncolemak)	91	92.76	114.15	26	28.57
4851.	Yurii (kruason)	91	60.08	71.26	19	20.88
4852.	Dvorak (kkqu)	91	96.49	114.55	35	38.46
4853.	Ken (kenzymazy)	91	82.13	99.39	28	30.77
4854.	kripp (hotdoghunter)	91	85.68	120.03	29	31.87
4855.	ahmad (h0gan_2020)	91	51.20	74.25	17	18.68
4856.	dinker (gumbolaya)	91	145.49	170.49	14	15.38
4857.	Slava (gilescope)	91	44.17	53.96	23	25.27
4858.	Hnnnnngh (frostequinox)	91	134.89	157.74	66	72.53
4859.	Ritardo (ett5252)	91	120.68	152.90	48	52.75
4860.	白貓 (cutewhitecat)	91	52.64	64.64	22	24.18
4861.	chom (chom2474)	91	109.06	164.41	51	56.04
4862.	Clay (cduck621)	91	78.17	97.06	27	29.67
4863.	Areppa (areppa)	91	75.73	92.87	12	13.19
4864.	anth (ant_h)	91	71.30	86.76	23	25.27
4865.	Krikium (krikium)	91	68.31	77.15	22	24.18
4866.	Jack (hammer_jack)	91	52.45	68.20	13	14.29
4867.	Dev (dev_1729)	91	71.02	83.21	21	23.08
4868.	MAMUN (wmamunhossain)	90	55.95	70.80	15	16.67
4869.	wasim (wasim7198)	90	51.84	60.60	8	8.89
4870.	Ranger (turbo_99)	90	74.72	88.50	31	34.44
4871.	Tuan (tuan_nguyen)	90	115.28	140.83	49	54.44
4872.	fischld (tokiwa)	90	88.47	109.82	25	27.78
4873.	storm (stooormmm)	90	98.97	124.15	39	43.33
4874.	zyuken (spaceee)	90	100.43	143.40	35	38.89
4875.	Vienna (sexystan69)	90	68.85	92.40	23	25.56
4876.	Sayu_ (sayu_)	90	53.00	63.14	7	7.78
4877.	Brandon (retrogamer56)	90	115.72	138.81	54	60.00
4878.	poqe8819 (poqe8819)	90	95.18	121.45	21	23.33
4879.	Martin (palchone)	90	74.03	92.01	26	28.89
4880.	car (nostalgiatest)	90	100.67	130.51	40	44.44
4881.	Kono Dio Da (nankan6111)	90	106.75	130.09	39	43.33
4882.	Nak (nakulo)	90	67.49	93.41	19	21.11
4883.	Moellie (moelong1)	90	66.02	87.05	20	22.22
4884.	maoam (maoamwins)	90	92.04	112.59	32	35.56
4885.	Lack (lackhammer)	90	98.31	118.20	34	37.78
4886.	Ksizzzzz (ksiz)	90	85.63	107.03	32	35.56
4887.	Norik (kingjulian1)	90	60.66	74.38	14	15.56
4888.	kj (kellydebow)	90	63.59	87.37	19	21.11
4889.	Johnofan (johnofan)	90	91.57	123.15	24	26.67
4890.	JBrocksfellas (jbrocksfellas)	90	56.92	70.32	30	33.33
4891.	immikeylee (immikeylee)	90	108.76	126.99	49	54.44
4892.	hejukaza (hejukaza)	90	58.76	95.38	22	24.44
4893.	gloria (glorialostthegame)	90	101.62	126.49	32	35.56
4894.	G L O O M Y (gloomy24)	90	46.02	57.15	6	6.67
4895.	mingi (gatangae)	90	78.89	95.67	26	28.89
4896.	DataCrusader (faruzzy)	90	64.55	74.22	28	31.11
4897.	Omega (enmendurana)	90	50.55	65.74	6	6.67
4898.	Shane (enahs_py)	90	97.97	119.82	39	43.33
4899.	Emmy (emilyelaine)	90	93.02	112.10	31	34.44
4900.	oreo (e00d)	90	105.49	135.41	47	52.22
4901.	Kebab (durum_kebab)	90	91.33	116.51	33	36.67
4902.	Daniel (danielsabox)	90	89.92	111.64	32	35.56
4903.	dumbdwei (cringe69)	90	73.99	93.49	17	18.89
4904.	Evan (crcd)	90	76.80	92.91	20	22.22
4905.	. (cope_and_seethe)	90	115.19	147.17	49	54.44
4906.	Venus (ching_ching)	90	69.80	86.26	29	32.22
4907.	Celiakos (celiakos)	90	48.93	57.91	8	8.89
4908.	Josh (belewcookies)	90	66.36	82.95	22	24.44
4909.	Naimul (bangladeshi)	90	31.28	44.23	6	6.67
4910.	Hi (aspenink)	90	110.87	142.96	58	64.44
4911.	Alejandro (akakmx)	90	78.33	98.39	23	25.56
4912.	A (ag2718)	90	113.61	145.09	40	44.44
4913.	Adrian (aeroplaneking)	90	98.32	120.70	32	35.56
4914.	rieicmio (aerialstunt)	90	84.17	102.22	29	32.22
4915.	Deus_Machina (acut3_racy)	90	102.11	134.06	34	37.78
4916.	abi19911 (abi19911)	90	63.44	87.02	15	16.67
4917.	Nguyen (nguyenpa3963)	90	38.11	51.81	3	3.33
4918.	lizzie-beth (lizzie_beth)	90	69.66	87.82	40	44.44
4919.	Sunil Nishad (senpaaiii)	90	32.97	44.05	6	6.67
4920.	Danylo Dolhopolov (danylos)	90	21.13	31.51	21	23.33
4921.	rpx (caspertrxsh)	90	57.39	73.07	12	13.33
4922.	WELLINGTON (luissluis202)	90	90.71	119.84	30	33.33
4923.	Yelxuh (yelxuh)	89	121.86	162.95	51	57.30
4924.	Steve (stevestupidface)	89	104.73	124.59	44	49.44
4925.	Stefan (stefanknez03)	89	36.67	51.52	6	6.74
4926.	q (scullyy)	89	81.03	108.18	51	57.30
4927.	SalahDin (salastro)	89	69.88	86.63	21	23.60
4928.	Safi (safeehalim)	89	70.42	89.21	27	30.34
4929.	tofu (reversytofu)	89	119.04	150.16	54	60.67
4930.	Pendejo (pendejo13)	89	53.87	64.62	7	7.87
4931.	Kevin (pekkanator1)	89	100.91	124.15	39	43.82
4932.	Paul (pasham999)	89	62.12	72.83	20	22.47
4933.	apostolos (orou)	89	39.31	55.93	12	13.48
4934.	tstats[orbitaltowel] (orbit...	89	93.15	126.41	38	42.70
4935.	Mirtininkas (mirtininkas)	89	63.66	90.64	18	20.22
4936.	Leo (me10250)	89	60.04	89.03	19	21.35
4937.	Angeline (mangosteen18)	89	59.33	75.46	11	12.36
4938.	lone (lone17)	89	59.62	86.34	21	23.60
4939.	lolitsgow (lolitsgow)	89	86.23	100.23	26	29.21
4940.	Tom (krarc)	89	84.31	110.46	20	22.47
4941.	iwillcomboyou (iwillcomboyou)	89	49.59	67.62	6	6.74
4942.	Hamza (hamza_type)	89	58.14	74.37	16	17.98
4943.	Chef Giuliano (gd27)	89	90.56	113.32	19	21.35
4944.	FiB0 (fiboss)	89	95.15	119.63	68	76.40
4945.	Affan (fantzy)	89	38.10	55.67	5	5.62
4946.	Daedalus (dufficinetic)	89	70.68	87.90	17	19.10
4947.	Tim (dreamaz)	89	83.46	99.54	26	29.21
4948.	Draco (draco_the_toad)	89	67.75	92.70	29	32.58
4949.	Dhruv (dhruv8601)	89	61.91	84.57	12	13.48
4950.	Jason (d4tb0i)	89	77.26	93.93	17	19.10
4951.	Chagil (chagil)	89	116.39	152.38	41	46.07
4952.	mahdi (carpenterbrother)	89	68.63	83.12	20	22.47
4953.	billypeppin (billypeppin)	89	112.48	139.43	36	40.45
4954.	Long (bachthime)	89	70.89	92.99	19	21.35
4955.	Nick (adyingwalrus)	89	118.64	141.06	38	42.70
4956.	6226 (6226)	89	88.07	104.02	26	29.21
4957.	KGHZY (kghzy)	89	44.93	65.97	7	7.87
4958.	marmar (marmarmarmar)	89	93.87	121.94	31	34.83
4959.	bigdoongg (bighotdogg)	89	56.52	74.28	17	19.10
4960.	Kristel (speedygonzales1997)	89	45.94	58.02	6	6.74
4961.	Michał (michalll)	89	74.63	90.28	20	22.47
4962.	Gabe (yokingszn)	88	72.36	87.43	30	34.09
4963.	Tarun (tpunhani)	88	70.95	94.01	23	26.14
4964.	Spritly (spritly)	88	87.65	106.65	30	34.09
4965.	Tamir (recoon44)	88	49.55	67.66	8	9.09
4966.	Prabh (prabh1601)	88	85.27	103.95	31	35.23
4967.	Pach (pachslayer)	88	112.18	137.70	39	44.32
4968.	Neo (neosteps)	88	67.25	90.16	26	29.55
4969.	Jonathan (mrschubidu)	88	65.13	87.20	24	27.27
4970.	Marc (maarcabiaad)	88	94.25	126.47	22	25.00
4971.	Krish (krish7)	88	50.93	64.61	6	6.82
4972.	Shakil Kabir (kopbdshakil)	88	66.07	81.52	23	26.14
4973.	heavy (heavyshaker)	88	52.61	64.34	17	19.32
4974.	Will (ghostal)	88	100.01	125.83	40	45.45
4975.	fixing my (fixing_bad_habits)	88	106.98	124.44	37	42.05
4976.	JK (ettanin)	88	60.96	73.11	11	12.50
4977.	Erza (erza_loves_coffee)	88	59.85	73.42	9	10.23
4978.	sdf (delta23)	88	105.14	132.70	42	47.73
4979.	🐸bingus🐸 (dearmr)	88	114.93	136.42	49	55.68
4980.	Cat (catcatcatcatcatcatcatcat)	88	107.48	129.09	61	69.32
4981.	Cammy (cammy04)	88	70.85	82.82	15	17.05
4982.	Pranay (ant1sipater)	88	70.13	87.97	21	23.86
4983.	Daniel (altold)	88	91.92	107.52	29	32.95
4984.	Alex (alexey0)	88	67.50	81.50	25	28.41
4985.	Abdullatif (ak_type_master)	88	62.87	73.73	10	11.36
4986.	Adepttyper123 (adepttyper123)	88	92.13	118.09	37	42.05
4987.	kumar (kumar_adity_a)	88	54.22	65.22	11	12.50
4988.	asfastasurrelation (darryl11)	88	55.37	76.62	6	6.82
4989.	Tyler (tylerbeep)	88	39.88	53.86	7	7.95
4990.	LAVISH (lavvish)	88	44.75	63.20	18	20.45
4991.	Igor (zig84)	87	78.92	97.26	25	28.74
4992.	random (waltersgo)	87	95.43	113.19	32	36.78
4993.	Tastic (t_tastic)	87	71.30	99.59	49	56.32
4994.	tomthegamer150 (tomthegamer)	87	78.26	101.82	23	26.44
4995.	Marc (thehobbit6937)	87	69.15	90.73	25	28.74
4996.	Jole (sliceoflife)	87	87.74	103.19	33	37.93
4997.	s2 (simon_f1)	87	92.21	107.33	28	32.18
4998.	Matthew (rush_a)	87	84.77	109.02	25	28.74
4999.	Romi (romi14)	87	96.95	127.84	26	29.89
5000.	Risheet (risheet_7)	87	64.30	81.23	25	28.74
5001.	Prex (prex)	87	54.27	72.12	26	29.89
5002.	Sean (polosauris)	87	79.93	102.48	22	25.29
5003.	S M (plaban13)	87	42.56	54.11	7	8.05
5004.	otomen (nurul_liayana)	87	82.20	104.63	29	33.33
5005.	fastkid (notfastkid)	87	89.99	118.38	28	32.18
5006.	Nonstoplink (nonstoplink2)	87	94.30	136.60	42	48.28
5007.	omar (nightkappa73)	87	71.01	91.41	17	19.54
5008.	Nigel Yul (nigelyul)	87	110.38	131.05	49	56.32
5009.	Tony (naka__)	87	100.23	129.84	32	36.78
5010.	NadAlaba (nadalaba)	87	54.91	79.56	16	18.39
5011.	Kumar Charan (mr_kc)	87	48.71	62.51	5	5.75
5012.	MH (mh_parag)	87	70.73	88.82	22	25.29
5013.	Malcolm (malcolm_)	87	89.17	109.54	38	43.68
5014.	Rin (komorebi2)	87	136.26	191.51	48	55.17
5015.	Kirubel (kirubelt)	87	58.21	71.02	14	16.09
5016.	josca (josca)	87	75.23	92.86	32	36.78
5017.	BlueOctupus 🦑 (jim_my)	87	57.29	73.85	18	20.69
5018.	Snail's Pace (hardtack)	87	86.71	108.35	32	36.78
5019.	Hoang (feelsdankman_1)	87	83.25	105.65	13	14.94
5020.	Eric (erichamers)	87	85.90	106.76	34	39.08
5021.	GOTTAGOFAST (b_200910028)	87	59.59	77.09	18	20.69
5022.	Patrick (burntriceboi)	87	49.38	76.15	15	17.24
5023.	Batbold (burabatbolf)	87	65.77	85.29	26	29.89
5024.	Jordan (brownbox)	87	70.75	84.85	29	33.33
5025.	Andrej (andy144)	87	72.71	86.08	19	21.84
5026.	Ali (amizan8653)	87	84.54	104.56	27	31.03
5027.	Abode (abulrahman_kallas)	87	24.67	37.29	19	21.84
5028.	faxer (faxer123)	87	33.74	46.96	11	12.64
5029.	Tamer (tls_15)	87	56.32	75.29	11	12.64
5030.	Jau (maievvvv)	87	62.44	86.72	76	87.36
5031.	ikkumaru (ikkumaru)	87	43.18	53.66	7	8.05
5032.	David (dragon25321)	87	77.58	96.52	21	24.14
5033.	Joaquin (zevolish)	86	106.27	129.98	45	52.33
5034.	yeet (yeetanut)	86	114.52	159.17	37	43.02
5035.	lokesh (vidhvanshak)	86	56.64	67.64	16	18.60
5036.	uzu (uzuiiske)	86	106.77	135.37	47	54.65
5037.	Qing En (twea)	86	53.02	69.37	14	16.28
5038.	bobby (trowlazer)	86	130.14	149.72	63	73.26
5039.	Bruno (tresco)	86	105.21	143.04	33	38.37
5040.	treespirit (treespirit)	86	89.97	111.03	25	29.07
5041.	Mony The G (skull_slayer)	86	122.45	161.09	52	60.47
5042.	Shamseer (shamsu)	86	45.89	62.67	11	12.79
5043.	SB (sbjeans)	86	66.09	78.51	24	27.91
5044.	Rain (rain_19)	86	68.27	87.65	32	37.21
5045.	Jim (pokemontcg2)	86	124.68	152.34	51	59.30
5046.	Palish (palish)	86	70.78	87.40	22	25.58
5047.	Owen (owenxc1234)	86	119.00	160.43	49	56.98
5048.	TooTired (oturan11)	86	94.18	130.42	24	27.91
5049.	Nelson (nelson_typer)	86	51.21	62.08	6	6.98
5050.	August (myracule)	86	54.96	68.28	8	9.30
5051.	Mohaka (mohaka)	86	55.91	72.49	8	9.30
5052.	Junior (mkunaji)	86	60.73	73.93	23	26.74
5053.	maxwelljones14 (maxwelljones)	86	99.35	122.31	32	37.21
5054.	Ted (lucky_strike)	86	91.05	111.58	22	25.58
5055.	Krystall (krystaller)	86	43.30	55.06	6	6.98
5056.	Eugene (kpopgay)	86	79.70	104.00	20	23.26
5057.	Kevin (kevin_zhang)	86	79.61	99.68	21	24.42
5058.	Jayden (jripic137)	86	105.38	123.23	57	66.28
5059.	Ashish (grimjaw7)	86	68.13	79.06	14	16.28
5060.	Hehe (gagokarin)	86	114.55	158.63	46	53.49
5061.	Dvorak on (freddysg)	86	74.72	99.52	85	98.84
5062.	Fishy_Types (fishy_types)	86	96.56	126.46	33	38.37
5063.	Eli (e_lightning)	86	64.94	81.41	20	23.26
5064.	Dong (dongggg)	86	86.54	108.41	29	33.72
5065.	dalia (daliafraga)	86	78.09	92.72	21	24.42
5066.	Jalen (dabesttypr)	86	90.82	111.40	25	29.07
5067.	caleb (caleb123456)	86	125.48	151.84	48	55.81
5068.	Adrian (bobsgotepicskills)	86	72.53	90.96	17	19.77
5069.	GreatWhiteShark (black_b6969)	86	92.07	114.02	25	29.07
5070.	তৌসিফুল ফ�...	86	83.40	99.30	25	29.07
5071.	Ayy (ayush_parihar)	86	60.27	76.90	12	13.95
5072.	Asaan (asaan)	86	48.31	63.74	5	5.81
5073.	Anunnaki (anunnaki77)	86	52.17	65.05	17	19.77
5074.	Tursunali (ali_khan)	86	60.85	86.76	18	20.93
5075.	ahnfnsr (ahnfnsr)	86	78.51	96.99	17	19.77
5076.	Green Tea (2001186)	86	99.93	131.76	24	27.91
5077.	Peter (cruzp_63_mobile)	86	37.15	52.46	2	2.33
5078.	mdawg101 (mdawg10101)	86	65.07	84.29	18	20.93
5079.	Layth (a_layth_z)	86	34.88	48.78	6	6.98
5080.	hoji (hoging)	86	44.97	53.20	11	12.79
5081.	abc (abcijkkkk)	86	47.40	63.56	18	20.93
5082.	Nate (n8thenb)	86	66.89	84.90	16	18.60
5083.	Chris (___chris)	85	85.05	106.74	24	28.24
5084.	zyrch (zyrch)	85	71.30	89.12	26	30.59
5085.	Jesse (yojesse__)	85	70.82	101.01	19	22.35
5086.	wlof (wlof)	85	64.68	77.55	19	22.35
5087.	Luca (tracked)	85	67.08	89.32	16	18.82
5088.	TehTrooper (tehtrooper)	85	68.76	83.76	18	21.18
5089.	fast_as_f*ck (techniqueee1337)	85	28.99	39.45	8	9.41
5090.	Syrup (syrupsandwich)	85	118.48	155.73	41	48.24
5091.	Sven (sven0101)	85	57.39	72.30	16	18.82
5092.	superkhau (superkhau)	85	104.49	142.57	34	40.00
5093.	StevesterH (stevesterh)	85	94.83	117.24	24	28.24
5094.	Jake (starbless)	85	98.30	123.66	33	38.82
5095.	Saurav (srvsaha)	85	63.65	86.02	20	23.53
5096.	Akash (speedy_acj)	85	86.93	104.73	32	37.65
5097.	Sicoz (skyarc12)	85	98.32	120.03	30	35.29
5098.	HngryChef (siam33162)	85	53.97	73.49	9	10.59
5099.	Jacob (shrimploin)	85	126.54	159.24	46	54.12
5100.	b (savagesapien)	85	72.91	94.56	18	21.18
5101.	Sean (qpalzm123)	85	90.12	112.82	24	28.24
5102.	Harvey (precisiongoat)	85	66.75	78.73	16	18.82
5103.	Matthew (noobdestroyer69)	85	98.49	120.57	48	56.47
5104.	raven (mr_raven)	85	70.70	87.57	28	32.94
5105.	Miky (mikymoose)	85	52.66	61.80	9	10.59
5106.	Mason (mgbaird)	85	53.46	72.25	11	12.94
5107.	Gobind (meri_marzi)	85	73.38	112.74	14	16.47
5108.	ZanderL (mcmickeylyc)	85	79.66	95.90	27	31.76
5109.	Mars (mars212163)	85	89.54	110.42	29	34.12
5110.	Moritz (mango_1212)	85	49.37	66.17	13	15.29
5111.	Kusahgra (kushagra813)	85	79.93	94.23	23	27.06
5112.	king (kingkuzo)	85	91.01	111.53	30	35.29
5113.	---| (karthivi95)	85	80.04	97.90	22	25.88
5114.	Jeremy (jerbear27)	85	83.03	102.97	31	36.47
5115.	Bart (itwashishat)	85	49.91	73.32	11	12.94
5116.	IMcRoni (imcroni)	85	91.47	123.37	26	30.59
5117.	iglo31 (iglo31)	85	74.18	95.01	20	23.53
5118.	iAmKaviar (iamkaviar)	85	58.74	76.60	15	17.65
5119.	Gabriel (hong_kong_)	85	73.99	93.90	27	31.76
5120.	(g_fruit)	85	133.21	157.55	60	70.59
5121.	Artur (ester_versuch)	85	57.49	67.43	11	12.94
5122.	rawrrr (darrrrrrr)	85	97.74	114.77	33	38.82
5123.	conquodS (cobraa)	85	99.51	123.47	39	45.88
5124.	Person (ali_666_)	85	98.30	118.07	36	42.35
5125.	A (akane49)	85	62.21	76.63	22	25.88
5126.	B00P (aaron_sy1)	85	91.65	112.73	30	35.29
5127.	Ayman (7times)	85	67.60	93.12	24	28.24
5128.	Rui (raiyik)	85	69.36	83.16	23	27.06
5129.	Silat (1guts_is_berserk)	85	37.41	49.07	14	16.47
5130.	Yem (yemm)	85	53.76	65.97	19	22.35
5131.	Jilly (thors_right_nut)	85	75.77	89.07	17	20.00
5132.	Gene (dorites)	85	65.65	81.77	21	24.71
5133.	Zubair Ali (zubairali)	84	58.79	76.34	11	13.10
5134.	Carlton (wizardhero)	84	82.17	96.74	18	21.43
5135.	VoiceOfTheWorld (voiceofthe...	84	62.64	77.93	17	20.24
5136.	​​yosefxlr8 (vaniix_)	84	89.01	111.07	22	26.19
5137.	Anu (typeradha)	84	109.36	128.27	36	42.86
5138.	tourist (tourist18)	84	71.21	80.80	22	26.19
5139.	sussyplayer (sussyplayer696...	84	66.95	81.79	13	15.48
5140.	Shokhrukh (shokhrukh18)	84	65.59	76.66	32	38.10
5141.	Saugat (saugat_regmi)	84	53.57	66.73	7	8.33
5142.	Ed (recht)	84	93.34	110.33	40	47.62
5143.	Nice (pranavkum123)	84	111.22	136.61	35	41.67
5144.	Nasser (nass_1000)	84	53.32	67.50	5	5.95
5145.	MoonSpoon (moonspoon1337)	84	47.90	63.15	5	5.95
5146.	Mohammad (mohammadmc)	84	70.70	91.08	20	23.81
5147.	McBurger (mcburger)	84	67.62	88.62	15	17.86
5148.	joey (legend_joey)	84	48.51	65.32	14	16.67
5149.	Kitty (kxkixi)	84	116.91	135.95	46	54.76
5150.	Paul Kenneth (kennetoy2302)	84	58.67	78.21	20	23.81
5151.	Jump (jump420)	84	54.27	71.43	13	15.48
5152.	JEWels (juewls)	84	58.63	76.87	16	19.05
5153.	Jon (jonlivestrong)	84	83.47	106.21	32	38.10
5154.	Jay (jayser6)	84	90.68	116.99	30	35.71
5155.	Jason (jachian)	84	107.79	133.84	51	60.71
5156.	Harshit (harshu19)	84	51.51	62.38	6	7.14
5157.	Ahmed (goushaa)	84	56.74	73.59	11	13.10
5158.	SilentHill (gosha666)	84	98.21	117.87	33	39.29
5159.	Vikram (galvarino_)	84	49.52	58.85	5	5.95
5160.	ant (fourmi)	84	40.01	47.87	3	3.57
5161.	MoralCharity (ethicalgivings)	84	115.54	158.96	47	55.95
5162.	Jesper (dwingx)	84	104.79	136.37	28	33.33
5163.	Chetan (chetankawarkhe)	84	58.80	81.44	16	19.05
5164.	carlos (carlit0)	84	96.81	121.90	25	29.76
5165.	Jimbo (bugprostate)	84	81.53	101.40	26	30.95
5166.	deez (biggy2)	84	104.66	121.02	30	35.71
5167.	AYJayeh (ayjayeh)	84	59.91	73.78	20	23.81
5168.	Arijit (arijitgupta42)	84	71.91	91.82	28	33.33
5169.	Anirudh (anirudh06)	84	74.52	88.13	37	44.05
5170.	dj_sevdah (dj_sevdah)	84	63.54	83.45	27	32.14
5171.	fnkl (fnkl)	84	77.43	105.66	23	27.38
5172.	shinygia (shinygia)	84	65.00	82.21	20	23.81
5173.	Shiba (pianolover123)	84	107.44	140.61	50	59.52
5174.	Elias (mojolake)	84	72.34	100.28	22	26.19
5175.	nick (ismenick)	84	62.84	81.60	16	19.05
5176.	tdawg (tdawg11)	84	70.99	102.63	29	34.52
5177.	Kid (zenfire9001)	83	85.23	107.71	20	24.10
5178.	Toko (xisderr)	83	55.58	75.68	10	12.05
5179.	Pp (typerace2002)	83	57.65	70.89	14	16.87
5180.	Baby Shark (toinfinity1)	83	97.67	120.18	32	38.55
5181.	doctor (timelordvader)	83	48.19	60.36	7	8.43
5182.	Storm (st0rm7)	83	50.31	62.57	8	9.64
5183.	spider (spidergod)	83	51.09	68.94	10	12.05
5184.	. (speedyant)	83	113.17	141.69	37	44.58
5185.	Amo (santan_amzy)	83	89.07	101.49	26	31.33
5186.	Elliott (s1ldafort)	83	75.83	95.84	23	27.71
5187.	Rudolf (rutzzz)	83	94.32	119.98	33	39.76
5188.	rideler (rideler)	83	66.28	79.87	19	22.89
5189.	darren (raisinnbrann)	83	66.53	91.99	17	20.48
5190.	Zach (qwerty1221)	83	90.55	110.30	21	25.30
5191.	Jim (problemset)	83	85.40	106.37	27	32.53
5192.	JJ (peppermints)	83	78.76	90.57	16	19.28
5193.	Zachary (peanutbutter146)	83	69.44	84.54	21	25.30
5194.	Omunyokol (omunyokol)	83	64.44	84.09	14	16.87
5195.	Obatop (obatop)	83	92.49	122.31	26	31.33
5196.	noah (noahruether)	83	57.09	77.52	16	19.28
5197.	Noah (noah187)	83	88.97	102.61	27	32.53
5198.	Ali (medtype)	83	134.87	164.68	55	66.27
5199.	help (mango_mango_mango)	83	103.73	124.72	44	53.01
5200.	Sky (lanprodn41)	83	91.87	110.35	28	33.73
5201.	Kunal (kunaldutta)	83	40.67	55.60	10	12.05
5202.	Kitchen (kitchen_operator)	83	72.38	88.51	17	20.48
5203.	MAYANK (kartosbrotherinlaw)	83	57.92	71.85	14	16.87
5204.	Harrison (harryblueberry)	83	118.40	158.91	51	61.45
5205.	Andrews (godspeeedd)	83	70.24	96.82	20	24.10
5206.	Erick (ep1ore)	83	65.59	80.51	20	24.10
5207.	Emeer (emeer_macapili)	83	60.35	74.60	16	19.28
5208.	Dan (dnor1313)	83	93.03	120.85	31	37.35
5209.	D (darueru241)	83	54.85	66.05	13	15.66
5210.	Daivat (daivatvaishnani)	83	75.39	89.09	19	22.89
5211.	Donked (cyrany)	83	85.67	105.71	26	31.33
5212.	chesco (chesco97)	83	73.66	91.37	27	32.53
5213.	simon (chainsawteeth)	83	70.91	83.14	21	25.30
5214.	Carmondai (carmondai)	83	44.78	53.04	5	6.02
5215.	Sherlock (caramel1995)	83	118.25	143.37	45	54.22
5216.	buhaN (buhan1337)	83	80.64	95.53	28	33.73
5217.	Blade0307 (blade0307)	83	65.21	78.14	14	16.87
5218.	ya BOI (beasted6969)	83	110.71	139.32	32	38.55
5219.	Bartek (batek_kierownik)	83	105.79	143.15	47	56.63
5220.	kes (barubelajarhehe)	83	64.63	77.86	18	21.69
5221.	Alex (alexwpm)	83	62.26	81.84	15	18.07
5222.	Felix (sp4cebar)	83	70.42	88.30	19	22.89
5223.	Bryce (pennydog13)	83	56.09	70.47	12	14.46
5224.	Abraiz (abraiz)	83	57.03	68.65	11	13.25
5225.	Alpamys (a1pamys)	83	74.26	96.77	16	19.28
5226.	GZ (dysonspheres)	83	97.49	112.87	22	26.51
5227.	Space (spacecarrot)	83	79.07	95.63	21	25.30
5228.	Lauris (toxic_bowl)	82	72.93	85.55	23	28.05
5229.	Ron (rounakc18)	82	101.90	117.16	24	29.27
5230.	rita (rita_mahato)	82	46.65	62.06	7	8.54
5231.	Ravel (raveltan)	82	62.95	73.82	20	24.39
5232.	Mayank (person_mayank)	82	77.20	94.78	19	23.17
5233.	Nazarii (nazarii_z)	82	72.05	91.99	18	21.95
5234.	Mike Adrian (mikeadrian)	82	74.33	86.09	15	18.29
5235.	. (lv23)	82	82.01	106.78	20	24.39
5236.	Lucas (lucasbush3)	82	74.36	94.67	34	41.46
5237.	L (lpuczynski)	82	71.52	88.48	21	25.61
5238.	Romit (junior12345)	82	60.62	77.28	19	23.17
5239.	qwerty (jowk)	82	84.03	107.27	22	26.83
5240.	FT_Zeref (iamzeref)	82	29.49	40.59	15	18.29
5241.	Gaurav (gaurav2607)	82	48.88	63.59	12	14.63
5242.	Majdi (freuud)	82	84.10	97.35	27	32.93
5243.	Aldir (faway)	82	83.26	100.62	19	23.17
5244.	M (faster_than_your_father_...	82	54.75	65.14	13	15.85
5245.	Ezz Abuzaid (ezzabuzaid)	82	59.83	72.53	20	24.39
5246.	Michael (dodus)	82	90.48	106.40	17	20.73
5247.	Dipesh (dipeshm77)	82	76.78	91.55	18	21.95
5248.	Aranyo (chimichenghiskhan)	82	96.35	114.45	36	43.90
5249.	chekic (chekic)	82	88.79	114.60	27	32.93
5250.	Ivan (bbqhehe)	82	129.14	152.00	50	60.98
5251.	Amit (a_myth)	82	66.50	75.29	15	18.29
5252.	Wake (awriter)	82	72.19	98.43	20	24.39
5253.	Asis (asis1998)	82	47.80	66.18	11	13.41
5254.	ari (aryanonye)	82	67.98	75.77	19	23.17
5255.	oscar (ansgar92314)	82	88.32	106.83	27	32.93
5256.	Abhishek (abhishekxix)	82	66.58	86.62	21	25.61
5257.	Abdelrahman (abdo_mano)	82	42.00	52.63	3	3.66
5258.	Govind (404fixer)	82	56.51	69.93	11	13.41
5259.	Leo (powerleo101)	82	81.09	114.75	25	30.49
5260.	self (fzires)	82	99.82	123.29	32	39.02
5261.	Blake (topo666)	82	64.72	91.85	19	23.17
5262.	Vedaant (vedu_baba)	82	57.78	73.12	4	4.88
5263.	Bbblaire (bbbblaire)	82	78.12	93.43	23	28.05
5264.	zach (zacc2285)	81	103.18	124.04	35	43.21
5265.	(vizzzard)	81	68.28	88.22	21	25.93
5266.	v (vinay747)	81	48.54	64.34	9	11.11
5267.	Ben@ (uniconsole)	81	56.12	74.39	11	13.58
5268.	Typer4e (unbreakse)	81	90.71	106.26	21	25.93
5269.	vulture (typinguntilcompute...	81	111.52	133.09	45	55.56
5270.	Jimothy (typeman_69_420)	81	43.87	64.60	3	3.70
5271.	user_012 (tsitohaina)	81	46.73	57.43	19	23.46
5272.	Tmr (tmr_sa)	81	35.61	45.90	6	7.41
5273.	Jaxon Tatton (superjax101st)	81	50.66	74.88	47	58.02
5274.	snipa146 (streamsniper146)	81	36.85	50.15	5	6.17
5275.	Cathy (strawberrylatte)	81	78.94	101.11	15	18.52
5276.	Sourav (sourav008)	81	48.30	58.60	8	9.88
5277.	Nick (soltymong)	81	65.33	87.18	21	25.93
5278.	sky (skymario)	81	71.85	98.21	15	18.52
5279.	Shreyas (shreyastalathi)	81	72.01	88.25	14	17.28
5280.	Skipper (samskipper)	81	29.27	39.07	17	20.99
5281.	RAJIV RANJAN (rajiv_ranjan_1)	81	42.30	59.29	6	7.41
5282.	Blake (raccoonswoon)	81	75.95	96.01	22	27.16
5283.	Raaed (raaed_23)	81	96.05	127.39	33	40.74
5284.	Jan (q1xter)	81	69.98	84.94	16	19.75
5285.	Presiyan (presiyan15)	81	65.53	81.78	13	16.05
5286.	Ovidiu (ovidiu0720)	81	61.25	72.17	15	18.52
5287.	Omar (omarr84)	81	64.67	77.21	15	18.52
5288.	Omer (om3rrr)	81	101.52	128.03	32	39.51
5289.	Odo (odo_bean)	81	64.20	80.14	21	25.93
5290.	Thao (ncthao)	81	75.00	98.37	31	38.27
5291.	mubara (mubara)	81	37.09	49.18	8	9.88
5292.	The (mrperfectionista)	81	49.66	59.15	8	9.88
5293.	Lakshya (lakshyasharma)	81	69.76	88.47	21	25.93
5294.	Tommy (kamuimaru)	81	113.75	145.12	41	50.62
5295.	kajuna (kajuna)	81	90.41	123.14	30	37.04
5296.	Joshua (justdatotherguy)	81	73.39	90.18	23	28.40
5297.	No (jopear)	81	75.39	89.26	17	20.99
5298.	Joey (joeyp123)	81	76.43	93.49	14	17.28
5299.	Jason (jbb817)	81	128.39	154.54	54	66.67
5300.	Baxtiyor (iotype)	81	90.35	104.71	32	39.51
5301.	holsoma (holsoma)	81	82.91	97.42	26	32.10
5302.	hamada (hamada377)	81	22.44	34.08	14	17.28
5303.	akhil (hailk11)	81	77.55	95.64	21	25.93
5304.	Håvard (haavga)	81	64.98	83.48	13	16.05
5305.	ghxstly-_-kid (ghxstlykid)	81	54.57	69.56	6	7.41
5306.	Declan (doctordirl)	81	99.71	116.91	27	33.33
5307.	Dew2118 (dew_2118)	81	68.03	79.07	15	18.52
5308.	David (davidstakic)	81	58.36	77.56	13	16.05
5309.	Danzcotic (danzcotic)	81	85.55	106.54	20	24.69
5310.	Ranit (colemakgang)	81	99.95	132.39	32	39.51
5311.	Brzzz (brzzz)	81	77.49	94.81	19	23.46
5312.	Missile Input (breadlump)	81	83.67	104.08	21	25.93
5313.	Ayham (ayhamgh)	81	59.30	74.04	19	23.46
5314.	Salamander (20_minutes_per_...	81	90.50	108.41	47	58.02
5315.	mcg (_mcg)	81	74.10	87.57	19	23.46
5316.	Bingo Bongo (bingo_bongo_)	81	79.07	97.60	25	30.86
5317.	seb (xsebzero)	81	76.74	98.73	23	28.40
5318.	Bastien_race28 (bastien_rac...	81	72.88	88.50	20	24.69
5319.	Pavel (pavelmirror)	81	37.90	44.35	5	6.17
5320.	jyjy (jyking99)	81	75.44	101.46	19	23.46
5321.	Kayden (kaydengiang2512)	81	72.09	92.44	62	76.54
5322.	The Green (hemanth37)	81	51.70	67.97	9	11.11
5323.	Zoltatorrez (zoltatorrez)	80	72.41	88.50	15	18.75
5324.	Brandon (zombieapocalypse)	80	67.83	82.53	20	25.00
5325.	Zachary (zacharide)	80	61.61	83.03	21	26.25
5326.	Viet (viettp)	80	50.16	64.18	6	7.50
5327.	Marcel (thiccer_marc)	80	106.42	137.36	42	52.50
5328.	Logan (thewhiteowl69)	80	80.22	105.64	21	26.25
5329.	Alex (snowbdd9f1)	80	80.55	97.30	26	32.50
5330.	Slowman (slowman101)	80	96.67	111.04	30	37.50
5331.	sharavsambuu (sharavsambuu)	80	70.95	86.67	22	27.50
5332.	Shane (shane_woosh)	80	100.95	123.02	38	47.50
5333.	shahan (shahanj)	80	66.66	95.57	25	31.25
5334.	Schpuunk (schpuunk)	80	68.84	86.62	25	31.25
5335.	Reimar (reimarpb)	80	97.15	115.44	40	50.00
5336.	pprav (potato69420)	80	95.74	120.51	23	28.75
5337.	Quinn (peea)	80	86.55	107.10	23	28.75
5338.	MsPianomama (mspianomama)	80	93.70	121.18	28	35.00
5339.	Fadil (mr_fadil48)	80	59.26	79.27	15	18.75
5340.	Harry (moto1310)	80	53.72	77.87	22	27.50
5341.	Bakhodir (marko_w)	80	59.73	77.02	26	32.50
5342.	pen (lock3r)	80	97.15	125.46	25	31.25
5343.	TRLT - YouTube (krux_254)	80	51.02	64.22	16	20.00
5344.	Kenzen (kenzen18)	80	70.72	87.53	23	28.75
5345.	kamal (kemokingdod)	80	22.02	33.09	15	18.75
5346.	KMN (kanatbekov_24)	80	54.03	65.83	6	7.50
5347.	JoePuttatoe (joeputtatoe626_)	80	63.06	86.93	20	25.00
5348.	Dat (jgatz)	80	91.74	107.81	29	36.25
5349.	Benjamin (izno)	80	58.12	84.79	19	23.75
5350.	tstats[ioannisvrynios] (ioa...	80	110.75	148.15	36	45.00
5351.	Hi (hime_)	80	74.07	89.29	19	23.75
5352.	Harry (harpreetsingh005)	80	74.70	97.01	16	20.00
5353.	Agnes-Joker (guitarbed)	80	104.77	130.99	44	55.00
5354.	Gio (gio_etche)	80	96.46	125.10	27	33.75
5355.	Nicolas (fruscianterules)	80	81.71	112.68	27	33.75
5356.	Fernando (ferthekiller6_)	80	82.20	107.16	27	33.75
5357.	fantdm4@gmail.com (evolnizark)	80	60.24	80.99	25	31.25
5358.	Helena (evanalfred0817)	80	86.40	111.77	42	52.50
5359.	Eli (elithesped)	80	127.72	167.40	54	67.50
5360.	m_j (dontlistentome)	80	87.12	115.94	25	31.25
5361.	David (davidjohnston20)	80	107.15	134.68	32	40.00
5362.	Don Quixote (crunchjunkie)	80	49.55	62.57	12	15.00
5363.	EJ (clarencedc)	80	83.89	114.34	30	37.50
5364.	Chetan (chetanhaobijam)	80	77.46	101.48	14	17.50
5365.	Bingsong (bingsongbingsong)	80	64.45	79.07	11	13.75
5366.	Stepan (a_s_v)	80	82.08	94.77	25	31.25
5367.	ambi (ambiidextrous)	80	92.79	120.58	38	47.50
5368.	k (ahhhjk)	80	81.85	107.21	22	27.50
5369.	AbdElazeem (abd_alazeem)	80	39.81	52.41	6	7.50
5370.	Abderrahim (aaissa)	80	65.23	88.06	16	20.00
5371.	Jakeyboi (00hike)	80	83.59	102.87	25	31.25
5372.	Cannelle (cannelle)	80	47.17	59.09	10	12.50
5373.	Dirk (treetoucher)	80	56.01	68.38	11	13.75
5374.	Rice (riceinbob)	80	70.47	89.12	28	35.00
5375.	x (roadtoonehundwpm)	80	76.07	93.62	22	27.50
5376.	skiie (huypig11)	80	60.93	73.88	15	18.75
5377.	Mo (mo7azeem)	80	94.17	107.28	25	31.25
5378.	ahmad (ahmad3r)	80	23.36	32.04	24	30.00
5379.	turbo (turbo_fister)	80	82.81	99.48	28	35.00
5380.	Vipul (vipulsings)	80	60.08	72.94	15	18.75
5381.	wunyan (wunyannie)	79	105.59	128.12	31	39.24
5382.	Robert (wobert_)	79	130.41	165.59	52	65.82
5383.	Adam (waba_waba)	79	57.52	70.61	11	13.92
5384.	trqvcr (trqvcr)	79	66.99	96.27	17	21.52
5385.	ThatLastWaffle (thatlastwaf...	79	89.59	117.02	31	39.24
5386.	Mikołaj (sweed4life)	79	36.68	54.86	10	12.66
5387.	ST (subsonic86)	79	41.41	52.36	2	2.53
5388.	Noodle (stayed)	79	95.26	153.12	38	48.10
5389.	sssssssssssssss (sssssnake)	79	102.56	131.47	38	48.10
5390.	toudouche (seni42)	79	89.06	105.11	27	34.18
5391.	sawamura (sawamura)	79	52.20	65.36	12	15.19
5392.	ASHIK (samael99)	79	40.58	52.49	5	6.33
5393.	Roelof (roeloflucka)	79	78.03	93.32	20	25.32
5394.	plip (plip)	79	57.74	69.34	15	18.99
5395.	sayba (nusaiba4)	79	49.43	60.51	6	7.59
5396.	Nicholson (nic8ag)	79	61.29	79.46	18	22.78
5397.	nerif (nerif)	79	122.69	158.35	43	54.43
5398.	Nathan (natekruger)	79	89.09	116.01	28	35.44
5399.	Naomi (naomielianora)	79	70.21	87.18	20	25.32
5400.	⁦⁧Mukundan (mukundan314)	79	85.35	106.49	23	29.11
5401.	md mahadie (mdmahadiehasanh...	79	71.01	88.44	21	26.58
5402.	L0G0S (logos_)	79	94.67	114.69	40	50.63
5403.	Light (light655)	79	58.30	72.48	19	24.05
5404.	Kasper (kaspertypes)	79	132.91	168.48	58	73.42
5405.	종지 (jonge1124)	79	98.81	120.85	31	39.24
5406.	Richard (jjjxxx)	79	65.59	80.38	16	20.25
5407.	Jayden (jdawwgg)	79	67.29	96.29	20	25.32
5408.	Frank (jaxfrank)	79	60.08	73.33	15	18.99
5409.	eugene paul (itdrmts)	79	78.60	91.60	26	32.91
5410.	Aufan (icepondx)	79	88.61	106.50	22	27.85
5411.	Garrett (grgarrett)	79	92.89	112.73	24	30.38
5412.	abdelrahman (basyouni74)	79	35.38	44.98	4	5.06
5413.	babao (babao)	79	85.06	114.66	23	29.11
5414.	Akeisara (ake_e_e)	79	46.24	56.67	9	11.39
5415.	Aespar (aespar)	79	93.72	114.27	28	35.44
5416.	Aang_Guns (aang_guns)	79	59.63	73.52	13	16.46
5417.	fast-typist101 (vuylsteke)	79	90.89	115.41	30	37.97
5418.	Hassan (7zn5alid)	79	61.10	75.21	21	26.58
5419.	SouL (s4ul)	79	58.40	72.55	16	20.25
5420.	Pink (pinkunikorn)	79	60.48	79.72	18	22.78
5421.	ineed (buttado_g)	79	61.99	93.39	20	25.32
5422.	Mikey (mikey2020)	79	58.34	80.53	12	15.19
5423.	Ink (slidxt)	79	62.32	77.24	16	20.25
5424.	muhammad (akbacha)	79	44.47	61.37	6	7.59
5425.	z (zivry)	78	70.15	84.52	20	25.64
5426.	yuh (yuhyeetyaw)	78	103.92	130.74	33	42.31
5427.	Youssof (youssof10)	78	62.03	79.18	61	78.21
5428.	Gurshaant Singh (waffleflau...	78	60.94	76.30	29	37.18
5429.	Vala (valarn)	78	48.53	59.43	4	5.13
5430.	Toni (topityper)	78	89.49	110.77	26	33.33
5431.	Diego (thebeastboi__)	78	77.74	99.57	31	39.74
5432.	Tendinits (tendinits)	78	65.94	93.38	27	34.62
5433.	Thomas (tammis)	78	105.67	121.13	39	50.00
5434.	Pizdonja (sule57)	78	97.36	115.38	22	28.21
5435.	Shubham (shubham_)	78	70.90	87.93	16	20.51
5436.	Glade (shogekiha)	78	111.18	134.25	58	74.36
5437.	Shen301 (shen301)	78	57.58	69.38	9	11.54
5438.	Shaun (shaun_c)	78	88.82	107.67	22	28.21
5439.	Shai (shai15)	78	63.32	73.43	14	17.95
5440.	Scer_1 (scer)	78	66.92	86.01	18	23.08
5441.	Rajesh (rcham)	78	39.63	50.50	3	3.85
5442.	Pranto (pranto2722)	78	86.04	103.59	23	29.49
5443.	Saul (paulsaredes)	78	93.15	115.34	29	37.18
5444.	Yusuf (northernbay4)	78	51.50	68.37	12	15.38
5445.	Jay (noj0ke)	78	90.83	122.71	22	28.21
5446.	Orion (nettle)	78	41.62	49.86	10	12.82
5447.	Natalie (natcard)	78	104.62	130.00	36	46.15
5448.	Marc (mwahab_)	78	104.96	137.18	39	50.00
5449.	chunchunmaru (mr_mystery4896)	78	87.62	116.87	30	38.46
5450.	Tangent (mrtangent)	78	69.23	92.24	16	20.51
5451.	Mohamed (mohamedsameh)	78	59.79	70.64	13	16.67
5452.	Adley (milf_slayer)	78	46.74	56.68	6	7.69
5453.	may (maciem14)	78	66.96	93.54	20	25.64
5454.	Arthur (lelface)	78	102.19	131.80	36	46.15
5455.	Saba (junior6)	78	91.75	113.42	29	37.18
5456.	Yuri (json223)	78	102.75	129.88	39	50.00
5457.	Josh (joshjacks)	78	96.67	112.93	36	46.15
5458.	PinapL (joshiedean63)	78	50.32	67.80	12	15.38
5459.	Eliud (inggoodface)	78	96.77	133.10	19	24.36
5460.	Hassan (hassansajjad)	78	94.80	136.72	25	32.05
5461.	Gurra (halogurra)	78	81.03	111.92	19	24.36
5462.	fool (geekdud)	78	94.29	114.14	21	26.92
5463.	Alexeï (g4520u10)	78	37.79	51.06	3	3.85
5464.	Me (emailgmailcom)	78	56.34	78.24	6	7.69
5465.	Jan (elapid)	78	99.42	116.52	37	47.44
5466.	Steven (eeekom)	78	79.65	108.10	22	28.21
5467.	Nyora (dvorak_mode)	78	108.65	130.69	41	52.56
5468.	dexterj (dexterj)	78	86.52	109.44	20	25.64
5469.	Danny (danny_whal)	78	68.09	91.79	22	28.21
5470.	Cres (crespear)	78	84.89	105.63	19	24.36
5471.	jeff (cqyimo42)	78	114.39	133.67	34	43.59
5472.	Brian (bv_altxps)	78	116.73	146.24	40	51.28
5473.	toki_crush (boom_51)	78	105.99	128.68	46	58.97
5474.	Axel (axeltb)	78	70.84	86.82	23	29.49
5475.	Abizer (abizern)	78	80.33	98.83	24	30.77
5476.	79 Camaro (79camaro737)	78	100.18	124.31	30	38.46
5477.	Shar (sharkg16)	78	119.13	138.14	32	41.03
5478.	Dinah (kirbytyper)	78	90.48	114.50	25	32.05
5479.	Matin (pmflash666)	78	28.42	38.25	14	17.95
5480.	Casper Tyson (caspertyson)	78	53.54	67.50	11	14.10
5481.	Nikk (white13)	77	101.45	123.63	34	44.16
5482.	Michael (v3spula)	77	100.86	131.40	19	24.68
5483.	nullchilly (tuwuna)	77	122.76	274.05	39	50.65
5484.	YT (tim72)	77	57.01	73.11	8	10.39
5485.	... (the_sesquipedalienist)	77	102.27	137.30	36	46.75
5486.	KirILL (spl4yce)	77	75.91	98.77	18	23.38
5487.	Sparshong (sparshong)	77	78.53	98.59	24	31.17
5488.	S (sima0502)	77	84.76	103.66	22	28.57
5489.	ritwik (ritwik3856)	77	73.63	97.00	18	23.38
5490.	Prem (premkumar12)	77	31.47	40.00	6	7.79
5491.	Tiffany (potatosmeller)	77	72.88	90.90	13	16.88
5492.	no (noob1720)	77	84.74	98.03	21	27.27
5493.	Navdeep (navk007)	77	48.64	64.54	10	12.99
5494.	Marwan (marwans)	77	49.61	61.62	6	7.79
5495.	sigit (licardi)	77	75.77	96.00	23	29.87
5496.	Kyle (kuronkuu)	77	85.57	121.30	23	29.87
5497.	Ng (kinkhai)	77	70.25	89.61	17	22.08
5498.	Khit (khitnay)	77	96.14	117.89	35	45.45
5499.	Hi (jxjx)	77	83.73	97.99	28	36.36
5500.	Vincent (jvgcalites)	77	84.11	102.02	18	23.38
5501.	que (jhavul)	77	119.85	153.20	48	62.34
5502.	Arber (hitit)	77	50.51	71.80	3	3.90
5503.	Andrew (greatfighter10)	77	97.02	110.56	27	35.06
5504.	john (funkefeet)	77	43.86	57.07	8	10.39
5505.	Fabian (fabii1309)	77	90.54	108.23	27	35.06
5506.	Tim (eternalwind)	77	67.61	81.57	15	19.48
5507.	BBIBBI (eddie110)	77	98.95	116.77	35	45.45
5508.	DULAL (dulal744574)	77	39.85	52.82	7	9.09
5509.	updog (danielseow)	77	99.62	118.42	25	32.47
5510.	Chicken (chickenpowerftw)	77	87.49	115.77	19	24.68
5511.	Yogesh (bestyogesh)	77	71.34	88.11	13	16.88
5512.	YNCBearz (bear19930414)	77	71.24	85.35	16	20.78
5513.	Basel (baselhatata)	77	85.09	108.70	30	38.96
5514.	Ahmed (ahmed20)	77	44.26	55.28	6	7.79
5515.	zoidburger (adamczh1)	77	127.52	149.36	49	63.64
5516.	Huevonette (heavenslurp)	77	42.67	52.24	5	6.49
5517.	lost (lost2037)	77	36.03	50.09	10	12.99
5518.	Sourav (_sourav_sarkar_)	76	59.72	81.10	13	17.11
5519.	Beybaris (zstorm_rd)	76	83.52	101.77	21	27.63
5520.	Zitti (zittti)	76	67.10	82.79	18	23.68
5521.	William (williamy34)	76	75.88	91.46	23	30.26
5522.	Lucian (the_eighth_wonder)	76	73.05	92.05	13	17.11
5523.	Alex (theflyestlai)	76	69.11	91.56	16	21.05
5524.	william (thefastest69)	76	100.76	134.25	23	30.26
5525.	Bhar8at (thecalamitousduck)	76	61.24	81.33	9	11.84
5526.	swoLee (swolee)	76	94.26	116.46	27	35.53
5527.	Sven (swen999)	76	80.27	94.06	25	32.89
5528.	Sumit (smromuec)	76	92.85	110.12	24	31.58
5529.	Slow (slow_typer111)	76	39.16	49.82	2	2.63
5530.	Shingo (shingoshoji)	76	110.63	134.63	36	47.37
5531.	shavalli (shavalli)	76	44.75	59.47	7	9.21
5532.	Gada go FAAASST (seesawsi)	76	83.80	97.31	17	22.37
5533.	Rahul (rocketiscracked)	76	59.21	82.91	22	28.95
5534.	Fresca (reifresca)	76	100.53	115.84	19	25.00
5535.	Isaac (psachy)	76	98.41	128.40	31	40.79
5536.	Bam (phoenixthestral)	76	95.94	118.45	26	34.21
5537.	Sergio (perezsergioace)	76	70.15	82.21	22	28.95
5538.	Pavan (pa163361)	76	75.67	90.46	43	56.58
5539.	Nitro (nitrocrate)	76	95.92	114.08	34	44.74
5540.	Nave (naveleon)	76	61.31	81.54	15	19.74
5541.	Mr.chops (mr_chops)	76	90.67	104.21	26	34.21
5542.	Mohamed Emara (mohamed_emara)	76	47.12	59.99	7	9.21
5543.	alex (mimzy1995ns)	76	78.22	95.37	20	26.32
5544.	Anthony (mike916)	76	93.32	112.55	37	48.68
5545.	Will (lynxwill_bov)	76	75.04	103.88	14	18.42
5546.	lol (luv_you)	76	124.96	150.16	50	65.79
5547.	♦☺♦ (lookdownnotjustup)	76	67.63	80.45	19	25.00
5548.	Ryan (lilchicken)	76	83.89	99.38	17	22.37
5549.	Lego (lamborgotii)	76	113.57	147.64	65	85.53
5550.	Shahan Sanjid Khan (korosen...	76	70.59	82.86	17	22.37
5551.	David (klassmagicer17)	76	89.87	111.23	24	31.58
5552.	Khadiza (khadiza)	76	30.49	37.54	6	7.89
5553.	kandarp (kandarp_5)	76	59.55	79.34	17	22.37
5554.	Oikawa (kakashihatake1205)	76	74.14	92.12	22	28.95
5555.	Jimmy (jiminator)	76	67.20	79.55	17	22.37
5556.	JahJi (jahji)	76	91.85	115.21	27	35.53
5557.	Dawid (ilordawid)	76	65.85	83.70	13	17.11
5558.	Hoasm (hoasm_gnaba)	76	43.67	54.88	11	14.47
5559.	Kevin Rendell (hankami37)	76	74.96	92.66	19	25.00
5560.	Morris (h0nny)	76	107.28	144.14	26	34.21
5561.	BobDaAsianBuilda (fortnitef...	76	115.62	134.70	32	42.11
5562.	Fitive (fitive_gaming)	76	63.96	82.64	20	26.32
5563.	Farhan (farhan_op)	76	94.44	113.70	40	52.63
5564.	fakedpoet (fakedpoet)	76	62.34	72.34	10	13.16
5565.	Emma (emmalischka)	76	56.84	65.02	13	17.11
5566.	Oneness (dreamtime)	76	89.97	103.59	22	28.95
5567.	Dragos (dragos_valak12)	76	55.03	79.22	8	10.53
5568.	arnab (dark_morty)	76	68.86	87.26	24	31.58
5569.	Andrew (completespud)	76	86.30	107.72	25	32.89
5570.	Tsunami (bmo12)	76	65.53	80.85	23	30.26
5571.	Matt (beano15)	76	76.34	96.46	17	22.37
5572.	Braden (barbuthnot)	76	92.94	108.45	30	39.47
5573.	Buyandelger (b200970010)	76	43.06	56.30	11	14.47
5574.	Adam (azonite)	76	107.47	139.99	45	59.21
5575.	Atomic (atomicf)	76	44.50	70.81	18	23.68
5576.	Nathan (alteriffic)	76	90.95	113.46	29	38.16
5577.	Jimbo (doa_jimbo)	76	66.55	85.51	19	25.00
5578.	Chad (douchebagasshole)	76	71.80	84.73	19	25.00
5579.	Đạt (thanhdat9503)	76	34.13	42.66	8	10.53
5580.	Ahmed (ahmedosama14)	76	84.40	105.04	19	25.00
5581.	xtr (xtr_)	76	74.35	94.65	16	21.05
5582.	8N (_8n_)	75	57.11	75.12	14	18.67
5583.	Yanterko (yanterko)	75	93.68	112.05	32	42.67
5584.	Tyler (xtios)	75	111.04	130.89	36	48.00
5585.	Fábio (vallkorion)	75	63.06	74.29	17	22.67
5586.	Kris (tymptra)	75	60.80	73.49	14	18.67
5587.	Test Project 3 (turkishtyper)	75	77.49	101.79	5	6.67
5588.	Motch (treemes)	75	73.67	89.76	16	21.33
5589.	Tomaz (tomaz1502)	75	92.23	108.57	25	33.33
5590.	Tawalisi (tawalisi_1500)	75	76.81	92.68	18	24.00
5591.	Korey (serveo21)	75	61.06	75.04	15	20.00
5592.	Saurav (sauravdeore)	75	88.01	103.92	22	29.33
5593.	2fast4u (russell12345)	75	108.62	134.93	36	48.00
5594.	Lloyd (rketch)	75	78.55	93.07	18	24.00
5595.	Pranav (pranavsetpal)	75	60.68	82.66	11	14.67
5596.	potato (potato42069)	75	101.81	132.72	46	61.33
5597.	platno (platno)	75	101.90	116.72	33	44.00
5598.	Plague (plaguey)	75	81.03	95.88	10	13.33
5599.	nizam (nizamovicxi)	75	84.78	103.27	19	25.33
5600.	nart (nartyaltchin)	75	65.06	81.93	17	22.67
5601.	Nada (nadazz9)	75	31.75	39.33	6	8.00
5602.	Michael (mscott3)	75	112.82	137.34	30	40.00
5603.	Mostafa (moghorab)	75	41.44	54.20	10	13.33
5604.	Miles (miles223)	75	153.98	185.62	62	82.67
5605.	Kiryu (kiryugozi)	75	75.11	105.19	18	24.00
5606.	Khoa (khoadeptrai111)	75	78.49	113.93	21	28.00
5607.	JRT (jrt829)	75	75.49	87.67	15	20.00
5608.	poemich (jerkyice)	75	73.69	87.59	28	37.33
5609.	Lasse (imlasse)	75	82.26	100.42	20	26.67
5610.	Mohsin Ali (gillbest)	75	42.23	51.00	8	10.67
5611.	flaneur (flaneurnq)	75	171.49	203.98	71	94.67
5612.	Henry (flamekata24)	75	90.78	109.08	33	44.00
5613.	Seilacara (eunaosei)	75	65.38	80.23	19	25.33
5614.	Rohan (dragami)	75	75.39	110.37	20	26.67
5615.	Igor (disstream2)	75	63.29	72.84	16	21.33
5616.	Chris (chrisjordan23)	75	82.01	102.30	22	29.33
5617.	Chizi (chiziivictor)	75	51.48	61.42	10	13.33
5618.	Mort (captain_fredrickson)	75	72.84	88.77	12	16.00
5619.	not your dad (buthee)	75	115.38	139.38	44	58.67
5620.	GabWasTaken (bored_dude)	75	66.81	89.49	10	13.33
5621.	beta (betameta123)	75	89.69	106.47	19	25.33
5622.	Edward (batskater1234)	75	87.84	135.94	20	26.67
5623.	Kei (aznkei)	75	75.34	90.66	17	22.67
5624.	andy (andytixn)	75	146.44	194.75	55	73.33
5625.	A.B.G (ahmed_burham_pro)	75	67.42	79.63	12	16.00
5626.	3ymsdet (3ymsdet)	75	121.82	160.85	54	72.00
5627.	iuhyuh (iuhyuh)	75	80.62	108.91	29	38.67
5628.	Ywq06 (ywq06)	74	93.88	122.54	26	35.14
5629.	mateo (yaboimateo)	74	86.86	115.01	23	31.08
5630.	Arnav (variable_seal)	74	51.00	71.05	7	9.46
5631.	Nonthapat (uniq0rn)	74	48.65	60.52	6	8.11
5632.	Totally Not A Cat (totallyn...	74	56.55	71.88	15	20.27
5633.	Tormod (tormodfh)	74	44.98	57.24	5	6.76
5634.	Toonafisch (toonafisch)	74	75.04	94.90	19	25.68
5635.	van (toofasthoot)	74	86.83	103.87	13	17.57
5636.	Rishabh (thomasshellby)	74	76.88	96.49	19	25.68
5637.	samongcs (thesamuelong10)	74	61.88	74.72	16	21.62
5638.	Tenzin (tenzinfrost)	74	40.17	54.77	6	8.11
5639.	Stonebreaker (stonebreaker)	74	36.78	48.77	6	8.11
5640.	u (stirlo21)	74	77.95	90.01	8	10.81
5641.	Nate (somemoresmors)	74	82.96	106.63	20	27.03
5642.	Sebastian (shrekbastian)	74	80.90	100.80	33	44.59
5643.	sAnideos (sanideos)	74	81.51	97.78	15	20.27
5644.	Saket (saketraj)	74	62.68	74.42	10	13.51
5645.	Lettuce (rolesg)	74	88.56	133.31	25	33.78
5646.	reall (reall)	74	81.88	97.36	21	28.38
5647.	Quinten (qspuijman)	74	86.92	102.82	27	36.49
5648.	Prathamesh (prathamesh0927)	74	60.78	78.34	10	13.51
5649.	payn (paynnn_)	74	102.70	123.30	32	43.24
5650.	Oscar (oscrrmrz)	74	66.64	105.52	18	24.32
5651.	Mr. Fancy (mr_fancy77)	74	70.48	90.22	18	24.32
5652.	PR (mrprx)	74	93.98	114.03	25	33.78
5653.	Johny (mijq)	74	42.29	51.10	7	9.46
5654.	Lukas (lukasprestonchow)	74	79.98	108.37	32	43.24
5655.	amanogawa (lhykv)	74	151.47	186.27	60	81.08
5656.	ok (laggyfeetshake123)	74	133.01	161.00	49	66.22
5657.	lindsey:) (labercrombie36)	74	110.55	132.20	38	51.35
5658.	kyoppiy (kyoppiy)	74	42.58	56.90	3	4.05
5659.	mohamed (karray)	74	45.64	57.65	4	5.41
5660.	silver_soul (jooeeee)	74	80.85	105.61	18	24.32
5661.	Binly (inahee)	74	53.72	66.76	11	14.86
5662.	Bhavya (iconic_typer)	74	57.67	69.49	7	9.46
5663.	HHpotatoes (hhpotatoes)	74	80.79	101.88	17	22.97
5664.	Miika (hakkerijehu)	74	69.93	85.10	15	20.27
5665.	Foren (foren)	74	50.32	67.71	14	18.92
5666.	Experiment 626 (eee01)	74	93.31	115.46	32	43.24
5667.	Jack (ditabyte)	74	66.23	87.38	17	22.97
5668.	🥺👉👈 (daddy_mememas...	74	73.61	93.12	18	24.32
5669.	Aidan (coconutwaffle)	74	74.69	93.12	21	28.38
5670.	Maddie (ciderto)	74	89.39	121.19	23	31.08
5671.	CurryAbalone (careycai)	74	86.64	124.36	27	36.49
5672.	Bleu (bleublix)	74	73.19	88.78	20	27.03
5673.	Bachiri (bachiri)	74	83.03	95.29	15	20.27
5674.	Aaron (ayeayeron)	74	59.28	72.33	20	27.03
5675.	Ashton (ashtonnothsa)	74	31.29	43.04	7	9.46
5676.	Aryan (aryan7_king)	74	48.89	66.04	5	6.76
5677.	Aryaman (aryaman04)	74	86.96	111.64	25	33.78
5678.	Ahead (ahadwhat)	74	74.03	100.10	41	55.41
5679.	Adrian (adrian_himself)	74	53.45	67.49	9	12.16
5680.	aditya (adityaraj322)	74	54.15	69.19	13	17.57
5681.	Abhishek (abhichauhan)	74	41.95	57.20	4	5.41
5682.	aawan (aawan_viator)	74	56.05	66.59	11	14.86
5683.	asdasdf (211bazooka)	74	99.78	122.23	27	36.49
5684.	Mario (mariobeh)	74	52.39	71.39	6	8.11
5685.	Benjamin (benjikrafter)	74	62.00	73.43	11	14.86
5686.	Farrux (farruxprogg)	74	25.84	34.61	19	25.68
5687.	Musa (jaydeep712)	74	74.84	85.62	20	27.03
5688.	abc (thedumpster)	74	63.53	92.30	20	27.03
5689.	veer pratap singh (_veerpra...	73	45.82	56.22	28	38.36
5690.	Richard (zzzcha10)	73	107.46	128.12	38	52.05
5691.	Sour (yung246)	73	59.07	70.00	12	16.44
5692.	yes (yesmaybeno)	73	99.02	123.37	42	57.53
5693.	Yeraly (yeraly_)	73	66.74	86.94	15	20.55
5694.	Winter (winter_dawn)	73	95.94	116.60	27	36.99
5695.	Malcolm (weatherman7921)	73	66.92	81.16	12	16.44
5696.	Steven (vivihuang)	73	89.41	118.28	22	30.14
5697.	tstats[typingsid02] (typing...	73	67.46	80.59	14	19.18
5698.	Oliver (typer2947)	73	50.23	64.61	6	8.22
5699.	Alex (truxior)	73	91.04	108.33	23	31.51
5700.	snow leopard (truechaos)	73	120.15	157.43	39	53.42
5701.	Kyozō (thegiantchip)	73	96.65	118.76	36	49.32
5702.	terrace (terrace2fast)	73	121.56	169.58	35	47.95
5703.	Taeyang (taeta3)	73	84.37	107.41	16	21.92
5704.	Sam (samtsullivan)	73	121.17	149.61	31	42.47
5705.	ROWLAND (rownet)	73	62.33	76.25	14	19.18
5706.	Wayne (retroweezy)	73	87.83	105.91	29	39.73
5707.	Rigno (redbubba)	73	118.44	144.70	37	50.68
5708.	anntz (reaction__)	73	86.89	108.05	26	35.62
5709.	dsc: ishwr (psychic7195)	73	102.66	133.30	62	84.93
5710.	peaNUTS (prabeshdai)	73	64.18	80.00	15	20.55
5711.	Paul (pkanas)	73	113.76	150.25	40	54.79
5712.	Peshraw-Kurdi (peshraw)	73	59.24	76.67	12	16.44
5713.	paveN (paven_)	73	59.13	73.67	15	20.55
5714.	pasha (pasha8800)	73	61.55	74.60	25	34.25
5715.	Ryan (nuigit)	73	99.11	134.57	31	42.47
5716.	Nadarsha (nadarsha)	73	21.24	29.83	23	31.51
5717.	musratte (musratte)	73	81.89	100.11	21	28.77
5718.	Never :q! (mista_t)	73	58.06	77.11	12	16.44
5719.	Madhvendra (madhvendra)	73	21.27	37.14	23	31.51
5720.	Loege (loege)	73	97.35	120.44	28	38.36
5721.	Lime (lizzardwizzard)	73	37.75	46.17	3	4.11
5722.	leodelfo (leodelfo)	73	95.65	114.47	27	36.99
5723.	Torrey (lavamob64)	73	100.17	123.80	35	47.95
5724.	KilinWei (kilinwei)	73	62.39	74.09	19	26.03
5725.	Kelly (kellyqin)	73	34.79	44.29	2	2.74
5726.	Kapi (kapi_boi)	73	58.57	79.33	13	17.81
5727.	Jerome (jerome_ctq)	73	86.63	106.52	11	15.07
5728.	Jerome (jeromesiu1210)	73	90.30	105.30	26	35.62
5729.	Arr (htunkyaw)	73	84.77	107.43	17	23.29
5730.	Grenek (grenek)	73	102.40	122.27	30	41.10
5731.	Duffy (duffylam)	73	40.95	55.51	5	6.85
5732.	Booba (drakonsio)	73	94.69	115.66	22	30.14
5733.	noise (dp123)	73	134.48	177.15	52	71.23
5734.	davidpasion (davidpasion)	73	93.27	107.88	27	36.99
5735.	Darrin (darrinj)	73	68.89	84.45	24	32.88
5736.	Daniel (dark0nee)	73	84.09	96.25	20	27.40
5737.	veenu (comp_typist)	73	69.86	88.61	17	23.29
5738.	Anuj (coder05)	73	92.36	112.89	32	43.84
5739.	Chester (chesterization)	73	71.26	82.53	12	16.44
5740.	Erica (canadianhuman)	73	69.29	85.44	16	21.92
5741.	tehfu (brownmilk)	73	92.28	115.78	28	38.36
5742.	Blakley (blakley)	73	93.12	115.71	24	32.88
5743.	Aidan (b8its)	73	93.70	107.94	22	30.14
5744.	austirol (austirol)	73	20.17	33.25	11	15.07
5745.	Austin (austinmarton)	73	101.29	123.85	27	36.99
5746.	ang (angelah)	73	94.42	112.37	37	50.68
5747.	Adam (adamsawahgamer)	73	76.97	95.48	23	31.51
5748.	abh1sh3k (abh1sh3k)	73	81.43	96.30	41	56.16
5749.	don (psyfer_69)	73	72.14	92.25	14	19.18
5750.	Wallace (timmaddog)	73	94.23	112.96	18	24.66
5751.	Ulrich (ulrichji)	73	82.57	98.87	24	32.88
5752.	joygerry (joygerry)	73	76.95	96.31	18	24.66
5753.	Lorenz (yaramaisus)	73	30.28	42.24	5	6.85
5754.	Sam_2021 (sams_69420)	73	56.19	69.05	15	20.55
5755.	Darren (zincj)	72	43.14	76.38	7	9.72
5756.	The Hunter (the_hunter_)	72	86.25	104.30	28	38.89
5757.	Kenneth (thedas)	72	88.23	109.79	25	34.72
5758.	Daniel (swietlikkielce)	72	62.18	84.78	15	20.83
5759.	travman (sunshinemamba)	72	71.85	91.04	16	22.22
5760.	Saurav (saurav555)	72	61.95	86.03	16	22.22
5761.	Sanjeevwa (sanjeevwa)	72	79.74	96.38	20	27.78
5762.	Sheldon (rooksword3393)	72	88.01	106.47	15	20.83
5763.	Raakulan (raakulan_94)	72	46.15	55.56	6	8.33
5764.	Pineapple (pineapple_pie1)	72	77.12	95.82	20	27.78
5765.	Alvaro (patomalo)	72	49.99	64.65	8	11.11
5766.	Nils (nosta_06)	72	82.21	101.43	25	34.72
5767.	nishi (nishi_san)	72	67.07	80.80	16	22.22
5768.	Toan (nguoichuadangki)	72	68.66	90.40	32	44.44
5769.	nexro (nexro44)	72	99.13	114.57	32	44.44
5770.	Melwan (melwan)	72	43.98	55.31	3	4.17
5771.	Chris (lumms)	72	86.46	116.02	28	38.89
5772.	derrick (lewi0332)	72	49.66	64.55	4	5.56
5773.	LEANG (leangsy22)	72	34.43	42.22	5	6.94
5774.	Marcellus (krouthen)	72	103.15	135.31	24	33.33
5775.	k1suxu (k1suxu)	72	69.56	82.14	14	19.44
5776.	josh (jshg)	72	102.06	127.78	24	33.33
5777.	GreatKing (greatking)	72	104.54	120.48	31	43.06
5778.	Goldenpigg (goldenpigg123)	72	90.55	120.13	25	34.72
5779.	gegs921 (gegs921)	72	106.65	129.69	30	41.67
5780.	dayman (gangbeast_21)	72	73.47	99.43	19	26.39
5781.	FROST (frostxdemons)	72	77.56	95.16	26	36.11
5782.	Faiq (faiq57)	72	83.40	101.80	28	38.89
5783.	Noah (excell)	72	85.16	107.70	21	29.17
5784.	Emily (ellajournal13)	72	86.60	104.45	16	22.22
5785.	Ekezuke (ekezuke)	72	59.71	77.24	19	26.39
5786.	Hernan (edry12)	72	53.36	72.58	15	20.83
5787.	Selyaka (ddamyanov)	72	72.09	93.35	29	40.28
5788.	Dario (dariovondrasek)	72	46.61	57.65	9	12.50
5789.	cvs (cvs_pharmacy)	72	110.51	143.33	32	44.44
5790.	Chris (cascade_)	72	75.03	95.11	14	19.44
5791.	Bouba (breadbake)	72	107.82	124.47	39	54.17
5792.	JC (bid4peace)	72	58.37	72.69	12	16.67
5793.	barmijo (barmijo)	72	69.68	92.64	17	23.61
5794.	Cameron (ballsinyourface)	72	82.37	109.35	19	26.39
5795.	Alex (ask496)	72	111.56	126.42	30	41.67
5796.	Asier (asierart)	72	69.38	93.17	24	33.33
5797.	Reynol (arsen714)	72	78.45	103.03	13	18.06
5798.	Annwesha (annwesha)	72	56.09	66.98	8	11.11
5799.	Aidan (amess92304)	72	63.23	77.48	18	25.00
5800.	JD (ahiajd)	72	75.91	90.58	12	16.67
5801.	Advith (advithshetty02)	72	78.33	98.03	19	26.39
5802.	AsiaSeries (adeepra)	72	65.81	75.63	19	26.39
5803.	Abhijeet (abhibaj007)	72	41.88	48.83	7	9.72
5804.	jojojo (astrot)	72	30.69	38.79	5	6.94
5805.	brooke (brookeech)	72	51.77	71.92	13	18.06
5806.	Matthew (matty_foo_foo)	72	54.52	67.48	6	8.33
5807.	Logan (iceisnice)	72	64.84	89.35	19	26.39
5808.	Ru (impurelight)	72	51.17	68.39	11	15.28
5809.	CoolBongoBoy (nerdrepellent)	72	79.26	96.85	23	31.94
5810.	Matt (shayosu)	72	83.46	103.25	19	26.39
5811.	F (_ft__)	71	66.60	88.11	19	26.76
5812.	har (zsbzsb)	71	86.44	106.76	26	36.62
5813.	Bartek (undg)	71	55.00	69.51	17	23.94
5814.	Tunmsie (tunmi_dev)	71	87.84	104.96	26	36.62
5815.	Sebastian (tulanir)	71	99.83	122.67	30	42.25
5816.	Johan (treeff)	71	92.77	119.30	21	29.58
5817.	Sudipta Sarkar (sudipta276)	71	42.38	49.73	7	9.86
5818.	Arthur (squekk)	71	39.70	50.47	28	39.44
5819.	sonny (sonnysixteen)	71	89.17	111.28	27	38.03
5820.	Md. Shafiul Islam (sohan110...	71	42.47	53.53	6	8.45
5821.	Slice Dice (slicedice)	71	56.20	71.87	10	14.08
5822.	Shahana (shahanas)	71	83.42	102.21	21	29.58
5823.	R (sevenexpert)	71	86.35	99.99	26	36.62
5824.	sedate (sedatekitten)	71	96.05	135.10	27	38.03
5825.	Ravenwolf (rvenwolf)	71	84.21	101.37	22	30.99
5826.	Empio (ppdodoqqq)	71	39.68	50.24	12	16.90
5827.	Ponymouse (ponymous)	71	96.50	129.56	33	46.48
5828.	Nail (nailail)	71	34.27	42.62	3	4.23
5829.	Noah Ignacio (nachos_7575)	71	71.31	83.47	14	19.72
5830.	Lutfullokh (mirzaqosimov)	71	50.58	65.36	9	12.68
5831.	Mr (luke44661)	71	52.33	64.36	5	7.04
5832.	Locomotion22 (locomotion22)	71	62.16	85.55	16	22.54
5833.	Maserati (latitude_5a)	71	63.18	77.28	13	18.31
5834.	Ashish (landxcape)	71	53.39	63.98	5	7.04
5835.	Kolock (kolock)	71	100.19	123.92	28	39.44
5836.	Homie (kingtrammy)	71	90.48	119.57	25	35.21
5837.	Juan (juan_mo)	71	67.85	88.99	12	16.90
5838.	Jessica (jesshe183)	71	86.09	102.41	12	16.90
5839.	Jacob (jacobr2d3)	71	75.19	98.05	24	33.80
5840.	imbad (imbad789)	71	97.49	129.84	19	26.76
5841.	Helmi Abdul (helmiabdul)	71	71.47	80.29	15	21.13
5842.	Ujjwal (half_blooded)	71	57.60	69.28	6	8.45
5843.	BlueCar (greencar)	71	59.09	72.07	10	14.08
5844.	ghostspirit (ghostspirit)	71	94.28	115.85	28	39.44
5845.	G (gc3shadow)	71	101.39	126.70	38	53.52
5846.	Hossen (galacticcheese1)	71	96.88	119.16	25	35.21
5847.	Vedica (gairolavedica)	71	34.44	45.21	9	12.68
5848.	Danny (flowburst)	71	121.61	153.26	42	59.15
5849.	Jacob (emptypaintbrush)	71	80.91	105.37	27	38.03
5850.	Alcolopa (emilioelmurr)	71	69.27	92.64	13	18.31
5851.	㋡㋛☹ (chzeeshan)	71	88.99	104.67	29	40.85
5852.	Xuanming (caoxuanming)	71	49.19	58.45	8	11.27
5853.	Fabijan (bifazg)	71	109.33	132.81	38	53.52
5854.	Brandon (bgrospe)	71	102.70	128.55	35	49.30
5855.	Garett (assaulted)	71	117.46	140.33	39	54.93
5856.	Med Amine (med_amine)	71	42.87	55.92	9	12.68
5857.	Kyle (kyle_w27129)	71	42.19	51.50	6	8.45
5858.	Sfang (johnblund)	71	80.29	100.32	22	30.99
5859.	Zosia Nicholson (zosianicho...	70	76.85	104.60	11	15.71
5860.	Yehezkiel Raymundo (yehezki...	70	106.50	129.36	25	35.71
5861.	Kasper (yckf2)	70	124.15	155.13	50	71.43
5862.	Salman (xinvoker)	70	82.55	109.90	23	32.86
5863.	Wildebeest (wildebeest1)	70	60.56	75.04	7	10.00
5864.	Toyota (websitejunkie)	70	116.46	158.88	43	61.43
5865.	wade (waderf)	70	39.16	53.37	5	7.14
5866.	Abhishek (vbunny)	70	57.64	72.57	11	15.71
5867.	Valoix (valoixgaming)	70	68.42	81.02	63	90.00
5868.	tserse (tserse)	70	89.60	104.09	14	20.00
5869.	tony (tony_starc303)	70	55.99	66.73	9	12.86
5870.	TC Stinkey Mouse (thst4483)	70	94.05	119.24	19	27.14
5871.	teraah (teraah)	70	99.56	133.44	33	47.14
5872.	Md. Tarikul (tarikul_01)	70	60.71	80.32	13	18.57
5873.	Bob (sydre2)	70	96.42	113.73	35	50.00
5874.	victor (swegboi)	70	128.05	162.64	47	67.14
5875.	Stefan (stefradjen)	70	102.22	125.99	37	52.86
5876.	Stay (stayscaffolded)	70	98.04	125.17	20	28.57
5877.	adil (silawatadil)	70	56.47	72.29	15	21.43
5878.	Shuxuan (shuxuan)	70	58.48	75.22	13	18.57
5879.	nizika (shouronpou)	70	92.52	118.80	22	31.43
5880.	Shaina (shainaziza)	70	73.14	99.61	24	34.29
5881.	null (sectest)	70	103.39	115.33	30	42.86
5882.	Md. (ranoy)	70	25.45	38.87	14	20.00
5883.	Paolo (powlu)	70	76.00	95.56	23	32.86
5884.	Nik (nik_farhan)	70	77.75	109.32	21	30.00
5885.	Nikolino (nikolinolive)	70	65.62	84.29	40	57.14
5886.	lolow (neworange999)	70	101.69	129.58	32	45.71
5887.	Myka (mosin_warrior)	70	60.65	73.74	9	12.86
5888.	Kevin (moffitt)	70	151.74	173.14	61	87.14
5889.	mike (mikehawk12345)	70	96.50	129.78	29	41.43
5890.	5k m1chael (mihai03)	70	94.36	110.00	21	30.00
5891.	mitchell (miceol)	70	76.47	105.71	9	12.86
5892.	Louis (loucru1)	70	87.47	106.02	21	30.00
5893.	tstats[log1xmeister] (log1x...	70	88.80	113.85	26	37.14
5894.	Leong (leong_ckai)	70	61.71	76.80	12	17.14
5895.	Kimberly (kimboslice16)	70	95.86	120.63	36	51.43
5896.	Logi K380 (kedr0n)	70	122.84	144.65	37	52.86
5897.	kalisto (kalisto)	70	63.11	76.21	10	14.29
5898.	Greatman (jimmy_x)	70	87.06	102.30	16	22.86
5899.	kjr (jianrong2004)	70	44.15	53.45	3	4.29
5900.	Jav (jav77)	70	71.71	83.14	13	18.57
5901.	Jared (jaredblack)	70	98.18	117.10	56	80.00
5902.	James (itsbamble)	70	95.60	113.96	25	35.71
5903.	ironmk11 (ironmk11)	70	88.36	107.27	21	30.00
5904.	Imad (imad_uo)	70	42.83	52.47	6	8.57
5905.	Abhas (imabhas)	70	62.09	83.76	11	15.71
5906.	hoangnam75 (hoagnnam75)	70	96.03	112.53	26	37.14
5907.	. (hanthedude)	70	112.36	129.95	40	57.14
5908.	hamza (hamza_8)	70	52.52	63.63	5	7.14
5909.	mr.purpose24 (hacker51)	70	72.18	88.66	20	28.57
5910.	hrsh (h3rs8)	70	91.03	117.22	20	28.57
5911.	John Paulo (guehnwyvar)	70	78.35	97.79	25	35.71
5912.	Jerrynick (goldenxbulletz)	70	74.28	98.94	16	22.86
5913.	FAITH (fjoel)	70	30.05	45.41	10	14.29
5914.	Farid (faridmusayev)	70	87.75	118.17	24	34.29
5915.	Evangelos (es305)	70	85.66	110.82	26	37.14
5916.	erakai (erakai)	70	140.34	171.34	48	68.57
5917.	EG (eg_immortal)	70	43.21	59.90	18	25.71
5918.	Eli (eberger03)	70	87.53	110.01	23	32.86
5919.	Charles (doubleqin)	70	122.60	145.35	40	57.14
5920.	poop (dompozo)	70	66.84	88.05	23	32.86
5921.	Charles (charles_good)	70	79.81	92.43	21	30.00
5922.	Hadi (charaka)	70	95.95	117.81	25	35.71
5923.	napkin (call_me_napkin)	70	133.51	169.54	41	58.57
5924.	Kyle (break_fast)	70	53.21	73.14	9	12.86
5925.	duncan (bobby29831)	70	97.78	112.17	26	37.14
5926.	AD (blastoise13524)	70	74.13	116.72	26	37.14
5927.	Salman (blackstrobe)	70	93.58	112.97	26	37.14
5928.	Aryan (aryan_16)	70	63.09	74.93	11	15.71
5929.	Arsennn (arsenn)	70	88.72	115.39	19	27.14
5930.	Aniket (aniket_pithadia)	70	58.35	78.86	12	17.14
5931.	megatron (ahnomi)	70	68.18	83.66	18	25.71
5932.	Adil (adika_r)	70	71.03	83.63	22	31.43
5933.	Sanic (192378)	70	97.11	116.77	27	38.57
5934.	Jakub (jakubuwu)	70	49.94	63.30	9	12.86
5935.	Möhsün (pogodemon)	70	61.62	79.96	19	27.14
5936.	Mohammed (mohammed_almadani)	70	57.57	64.68	7	10.00
5937.	Marwan (the_typo_typist)	70	60.85	82.74	16	22.86
5938.	Sean (fairx)	70	42.92	53.33	1	1.43
5939.	Aditya (zwelgop)	69	76.45	101.48	18	26.09
5940.	Zecro (zecro_48)	69	39.76	53.61	2	2.90
5941.	yurii (yurcifer)	69	52.64	67.57	8	11.59
5942.	Voak (voak)	69	51.31	65.07	11	15.94
5943.	Arief (valliante)	69	88.24	105.53	31	44.93
5944.	Mike (tonz30)	69	80.52	96.27	18	26.09
5945.	Daniel (throwmycage)	69	54.05	67.60	5	7.25
5946.	spetterpoep (spetterpoep)	69	94.36	119.78	26	37.68
5947.	Jesse (soval)	69	65.43	87.63	8	11.59
5948.	Shynali Otep (shynali)	69	27.58	34.85	10	14.49
5949.	Scribbled (scribbled_trashhh)	69	61.15	78.07	9	13.04
5950.	johan (sagapam)	69	52.22	63.49	9	13.04
5951.	Tadej (reyalpdab2)	69	116.12	138.26	41	59.42
5952.	Renato Emeric (renatoemeric11)	69	63.58	77.77	10	14.49
5953.	Ramez (ramezraymond)	69	88.51	104.72	29	42.03
5954.	Prince (prince7589)	69	95.80	116.67	34	49.28
5955.	Harry (pandasboob)	69	118.28	143.54	34	49.28
5956.	T (omega5002)	69	83.84	98.25	19	27.54
5957.	Raiden Shogun (ntd_dll)	69	92.14	111.59	23	33.33
5958.	Norman (noromoon)	69	68.17	87.48	15	21.74
5959.	Naomi (nmb813)	69	49.90	61.75	5	7.25
5960.	naganandana (naganandana)	69	71.17	84.93	17	24.64
5961.	Yiming (mymreview)	69	69.99	95.75	24	34.78
5962.	moon (moon_anna)	69	67.49	84.12	23	33.33
5963.	Alazar (mealazar)	69	58.68	74.71	9	13.04
5964.	Isaac (ksspook)	69	43.52	62.22	4	5.80
5965.	Khenh (khnhnguyen)	69	60.07	93.28	19	27.54
5966.	A-Train (k4sh1zy)	69	71.41	88.39	16	23.19
5967.	Jimmy (jimmy890302)	69	60.95	74.41	9	13.04
5968.	Anon (jeff10)	69	141.02	173.22	63	91.30
5969.	Zhamshid (Jam1lbek) (jam1lbek)	69	44.94	61.14	12	17.39
5970.	Mio (i_drive_car_lol)	69	69.24	90.62	17	24.64
5971.	i'm a band kid (imabandkid)	69	85.55	107.60	41	59.42
5972.	Ernst (hopeofmercy)	69	90.24	117.23	27	39.13
5973.	Henry (henrybutschool)	69	81.81	97.75	20	28.99
5974.	Gidean (gidean)	69	81.97	98.01	15	21.74
5975.	Alejandro (foreversick)	69	89.61	110.91	23	33.33
5976.	Femke (fffemke)	69	64.68	80.73	19	27.54
5977.	dude_BrahMan (dudebrahman)	69	104.05	131.45	36	52.17
5978.	Dustin (dsthegold23)	69	95.06	117.12	23	33.33
5979.	Nyxious (demonicious)	69	80.35	96.37	22	31.88
5980.	Nimble fingers (deadjarus)	69	57.85	71.03	6	8.70
5981.	Danny (danny1901)	69	96.26	116.94	29	42.03
5982.	D A M A G E D (dama_ged)	69	107.47	129.73	28	40.58
5983.	Abdi (bravenoob)	69	60.94	77.62	13	18.84
5984.	Astoshan (astoshan)	69	64.17	83.24	17	24.64
5985.	Avalanche (arnobel)	69	62.00	70.75	17	24.64
5986.	Arka (arkacsedu)	69	73.23	90.46	13	18.84
5987.	Riley (amlockedinfridge)	69	93.61	116.41	26	37.68
5988.	Akshay (akshaymkupnoor)	69	52.23	63.48	4	5.80
5989.	Af (aepaef17)	69	71.18	90.75	18	26.09
5990.	0verhaul (0verhaul)	69	66.99	104.17	17	24.64
5991.	Smitesh (smiteshp)	69	70.51	81.67	16	23.19
5992.	Jeferson Beliber (jbyungz)	69	81.17	116.12	26	37.68
5993.	Victor (dczxao)	69	74.23	91.31	15	21.74
5994.	grim (gri16m)	69	89.20	116.34	25	36.23
5995.	DKTang (killnoevil)	69	86.53	108.06	20	28.99
5996.	Francisco (frantark)	69	45.70	69.46	5	7.25
5997.	vakupen (vakupen)	69	42.13	77.56	16	23.19
5998.	Beri (beri_)	69	61.71	75.01	23	33.33
5999.	Ghufran Ahmed (gahse)	69	34.17	46.35	1	1.45
6000.	Jack (s_7ven)	69	67.62	86.83	28	40.58
6001.	Zyad (zyad0magdy)	68	65.20	84.21	15	22.06
6002.	F. (yrebainahs)	68	100.42	120.45	28	41.18
6003.	Long (wesleylong)	68	80.37	101.53	13	19.12
6004.	Wael(▀̿Ĺ̯▀̿ ̿) (wa...	68	62.87	83.46	45	66.18
6005.	De9mond (uniwite)	68	72.86	87.43	13	19.12
6006.	Parminder (trion129)	68	44.66	56.87	5	7.35
6007.	stegmarb (stegmarb)	68	68.14	95.63	16	23.53
6008.	SlowBoy (slow_boy_neen)	68	86.85	109.35	17	25.00
6009.	Sizzled (sizzledbeans)	68	94.92	117.09	25	36.76
6010.	Russellazy (russellazy)	68	84.24	111.76	20	29.41
6011.	AG (rollingpanda0)	68	68.17	81.99	15	22.06
6012.	🗿 (rjh7)	68	61.86	82.25	11	16.18
6013.	Daryoush (rango__nice)	68	18.08	25.70	14	20.59
6014.	pri (prinni)	68	93.16	109.50	23	33.82
6015.	H J (ojinjin)	68	80.74	99.95	17	25.00
6016.	touko.ursin (oikipoiki)	68	62.55	72.85	17	25.00
6017.	nwieuv (nwieuv)	68	135.68	162.53	51	75.00
6018.	Nischal (nischal165)	68	64.43	76.15	18	26.47
6019.	Nahush (nahush28)	68	63.73	79.12	17	25.00
6020.	Bob (mrgeeses)	68	90.57	114.59	25	36.76
6021.	tstats[mozra3] (mozra3)	68	61.31	79.26	19	27.94
6022.	Nic (matcaps)	68	66.93	81.78	16	23.53
6023.	A (kmos)	68	94.88	115.53	29	42.65
6024.	shaan (khem92)	68	99.45	110.39	26	38.24
6025.	Jerome (jerome251998)	68	75.45	93.36	14	20.59
6026.	Johnathan (jellyowar308)	68	101.39	122.61	27	39.71
6027.	Diego (isqube)	68	73.98	92.41	15	22.06
6028.	Ion (incode4it)	68	95.96	133.97	28	41.18
6029.	Hunter (hunterwho43)	68	112.33	131.19	31	45.59
6030.	Hamada (hamadasalhab)	68	74.31	93.99	17	25.00
6031.	SenAlice (gokamiso)	68	73.98	90.14	14	20.59
6032.	v (gamegodv)	68	61.31	75.63	18	26.47
6033.	mitchell (fool1shdemxn)	68	88.45	109.59	26	38.24
6034.	Tobi (fastestflash)	68	108.93	137.98	39	57.35
6035.	Eboy (e_nonymous)	68	66.01	84.79	15	22.06
6036.	Ethan (ethanchansk)	68	94.74	119.50	28	41.18
6037.	Bray (erasleeps)	68	103.98	136.28	34	50.00
6038.	elnaz (elnaznsi)	68	54.40	71.98	45	66.18
6039.	Naing Htoo Aung (devii92)	68	86.49	103.50	23	33.82
6040.	Dark (darkelevent)	68	74.25	91.95	13	19.12
6041.	Iemand (darckshy)	68	73.47	89.53	24	35.29
6042.	hanno (busterity)	68	77.88	96.33	16	23.53
6043.	bouse7th (bouse7th)	68	52.76	62.77	6	8.82
6044.	Bonifacijus (bonifacijus)	68	53.37	74.15	6	8.82
6045.	hehe (blazeclash)	68	106.08	130.40	29	42.65
6046.	Papa (big_papa69)	68	43.54	54.77	7	10.29
6047.	Beata (beata111)	68	76.02	96.11	22	32.35
6048.	Lane (asdfedffd)	68	93.20	107.08	15	22.06
6049.	Andreas (andi_0324)	68	55.94	69.73	8	11.76
6050.	༄༊࿆Faith࿐ (adaling369)	68	85.44	106.26	16	23.53
6051.	Oblivyxia (oblivyxia)	68	84.80	108.77	29	42.65
6052.	Faraaz (_faraaz_)	68	45.48	65.06	8	11.76
6053.	Akilah (akilah1)	68	56.66	73.59	12	17.65
6054.	Caden (csjones1358)	68	33.18	43.51	8	11.76
6055.	Jackson (bigstix006)	68	55.20	68.29	13	19.12
6056.	rachie (grrachie)	68	97.04	114.25	35	51.47
6057.	Ren (yirenwang)	67	61.03	80.26	13	19.40
6058.	Loading.... (xbooza)	67	78.48	92.17	14	20.90
6059.	wobba (wobba)	67	84.00	99.25	21	31.34
6060.	Noah (typer_noah)	67	65.90	81.61	13	19.40
6061.	suraj giri (surajgirioffl)	67	69.10	79.77	18	26.87
6062.	Steven (stuvun)	67	101.55	118.23	35	52.24
6063.	Spy (spy71)	67	39.20	90.45	4	5.97
6064.	man (speedweeweeman)	67	112.92	139.02	40	59.70
6065.	NeverRage (solid_raiden)	67	108.41	129.75	37	55.22
6066.	Master (smartax)	67	98.38	123.59	17	25.37
6067.	Tom (rubik1908)	67	79.27	103.94	18	26.87
6068.	Reto (reddo)	67	85.68	104.21	21	31.34
6069.	purple (purplejust)	67	56.37	72.09	17	25.37
6070.	Prashant Kumar (prasha3nt)	67	30.95	38.04	5	7.46
6071.	Wiphoothorn (poomws)	67	40.64	54.05	5	7.46
6072.	Phong (phong1902)	67	71.59	95.44	15	22.39
6073.	Dillon (peak3433)	67	83.16	108.36	12	17.91
6074.	Paige (patrickwest)	67	67.59	75.71	15	22.39
6075.	noob (noahc207)	67	70.18	99.66	15	22.39
6076.	Jeff (navigation07)	67	67.89	84.05	14	20.90
6077.	mahmoud (modokatr)	67	51.00	66.27	3	4.48
6078.	Mateusz (matswiatek)	67	42.99	54.32	1	1.49
6079.	Marni (marniparnie)	67	44.41	60.24	5	7.46
6080.	Magz (magzse7en)	67	85.49	106.77	25	37.31
6081.	I lost (lxtxmx1)	67	80.09	112.37	10	14.93
6082.	Ludvig (lochecho)	67	121.93	146.19	45	67.16
6083.	Lộc (loccb90)	67	72.62	92.56	15	22.39
6084.	Justin (liontan)	67	87.20	104.74	28	41.79
6085.	Kicker (kickermasu)	67	73.39	89.17	16	23.88
6086.	karimulla (karimulla12)	67	71.05	96.75	18	26.87
6087.	jjjjjj (jitu8149)	67	64.64	79.78	20	29.85
6088.	Jennie (jeniibearr)	67	112.93	144.88	39	58.21
6089.	zxc (idcidcidcidc)	67	68.25	86.89	15	22.39
6090.	SCUT-黄光积 (hy_1314)	67	59.53	76.94	5	7.46
6091.	hamzah (hamzahzzs)	67	67.55	88.27	17	25.37
6092.	Greg (grrg)	67	81.72	97.72	17	25.37
6093.	Nawazish (ghostlead420)	67	49.12	65.26	5	7.46
6094.	Fedor (fshabashev)	67	90.14	103.07	17	25.37
6095.	Flash (flashyflashy)	67	127.18	146.45	45	67.16
6096.	filip (filko)	67	38.99	49.03	9	13.43
6097.	Machmori (explainingkamui)	67	65.78	80.63	16	23.88
6098.	Evelyn (evelynji)	67	77.09	92.55	20	29.85
6099.	Jen (ethima)	67	110.79	132.29	33	49.25
6100.	duckyful (duckydatyper)	67	74.24	103.99	9	13.43
6101.	Drakka (drakkathedark)	67	68.15	85.17	18	26.87
6102.	Diya (dmatulizo13)	67	56.89	75.19	15	22.39
6103.	Anurag (debroglie)	67	55.53	70.62	15	22.39
6104.	coolzacboy (coolzacboy)	67	97.47	116.83	23	34.33
6105.	Chris (bunkieme)	67	127.90	155.44	47	70.15
6106.	Brian (briansu)	67	87.03	112.70	14	20.90
6107.	Brendan (brenakin)	67	83.71	104.98	23	34.33
6108.	Brandon (bqn0309)	67	98.95	131.40	23	34.33
6109.	Hans (b3n1s)	67	78.65	99.20	13	19.40
6110.	tstats[azhy_01] (azhy_01)	67	82.38	98.71	25	37.31
6111.	Bettina (awkventurer)	67	123.78	194.62	45	67.16
6112.	Ariscottle (ariscottle3106)	67	77.29	103.00	19	28.36
6113.	Amr (amr98)	67	53.18	61.40	6	8.96
6114.	Nathan (tposetime)	67	61.30	76.64	13	19.40
6115.	Chino (stylish1323)	67	65.13	86.43	13	19.40
6116.	Aly (aly_hussien)	67	16.13	22.04	9	13.43
6117.	kenzar (kenzar)	67	43.27	52.69	3	4.48
6118.	saif (saif07ahmed)	67	52.93	75.19	10	14.93
6119.	Joseph (scomosypes)	67	85.50	119.28	20	29.85
6120.	Rafiq Ahmed (tanjil2009)	67	38.92	50.41	8	11.94
6121.	Shreesh (shreesh)	67	57.35	76.38	11	16.42
6122.	Viz (viz_124)	67	59.15	76.84	9	13.43
6123.	hope (hopekhembo)	67	39.15	50.62	3	4.48
6124.	Ko (__lo)	66	88.21	119.28	23	34.85
6125.	Trai (yezurey)	66	38.89	60.11	4	6.06
6126.	RyanNXD0120 (xuanduy1269)	66	87.49	109.80	27	40.91
6127.	Xassie (xassie)	66	83.82	102.02	24	36.36
6128.	Róbert (worder01)	66	78.47	94.60	13	19.70
6129.	sam (wongy03)	66	97.33	122.83	40	60.61
6130.	Williawar (williawar)	66	86.29	105.63	20	30.30
6131.	Wieds (wieds)	66	65.17	80.83	16	24.24
6132.	Vinayak (vinayak_7989)	66	65.61	87.99	21	31.82
6133.	. (vectorale)	66	108.10	136.54	26	39.39
6134.	None (v8_eatr)	66	67.51	81.96	22	33.33
6135.	rahul (typer_typer)	66	37.56	45.85	9	13.64
6136.	Rod (twors_colemak)	66	109.81	133.80	31	46.97
6137.	Nathanael (tunahead)	66	102.94	121.45	37	56.06
6138.	Wilson (tigermatos)	66	60.90	74.58	12	18.18
6139.	Lewis (the_mysterium)	66	55.98	69.81	12	18.18
6140.	Slamsal (slamsal)	66	74.14	92.06	27	40.91
6141.	Amanda (simplesecretsauce)	66	88.07	107.94	18	27.27
6142.	Luka (sercasm)	66	117.68	136.84	43	65.15
6143.	Nic (scylla1)	66	104.88	129.69	30	45.45
6144.	Lucas (rlnb)	66	40.90	51.73	4	6.06
6145.	Pema (rimuru_tempest2004)	66	29.73	39.25	10	15.15
6146.	ricko (ricklo7)	66	96.44	123.48	22	33.33
6147.	dead account (ribombee)	66	125.53	163.64	25	37.88
6148.	Renardo (renarded)	66	145.50	188.54	34	51.52
6149.	9fingerstyle (readjust)	66	105.43	126.68	31	46.97
6150.	pylori (pylori)	66	88.10	108.75	24	36.36
6151.	Pouf (pouf_1)	66	53.62	67.14	18	27.27
6152.	flis (philip29)	66	97.16	124.86	28	42.42
6153.	Kajtebolikitica (patrik131)	66	89.25	108.16	21	31.82
6154.	Jeremy (orcane)	66	80.80	106.75	15	22.73
6155.	Oken (okenthelfocken)	66	63.81	85.41	14	21.21
6156.	kostis (oh_yeah_go)	66	49.21	58.90	5	7.58
6157.	femboy (nekokawaiiuwu)	66	127.74	152.18	49	74.24
6158.	Carlos (nearbywaffle)	66	93.70	120.99	22	33.33
6159.	Mythrick (mythrick)	66	100.69	122.52	27	40.91
6160.	Tortle (megahentai)	66	107.57	126.61	27	40.91
6161.	Joe (lanolin211)	66	90.92	120.45	28	42.42
6162.	Michael (kimbo1414)	66	79.77	105.45	14	21.21
6163.	KetanaBlade (ketanablade)	66	104.57	125.71	9	13.64
6164.	Ketan (ketan1314)	66	65.22	82.35	26	39.39
6165.	Kenneth (kennethraphael)	66	75.91	94.69	21	31.82
6166.	✨MTH Insane Typer✨ (jos...	66	162.40	201.84	57	86.36
6167.	Jordan (jordanlreynolds99)	66	79.24	99.33	23	34.85
6168.	Craig (jitterjuicegaming)	66	88.11	104.12	18	27.27
6169.	JanTheMan (jan_the_man)	66	56.87	68.25	6	9.09
6170.	Marzuq (itsmarzuq)	66	47.82	55.89	3	4.55
6171.	Hari (harisund)	66	120.47	164.12	44	66.67
6172.	Imnatoshi (hanmayujiro)	66	65.00	78.94	9	13.64
6173.	Ahmad (gmg12)	66	86.95	113.26	12	18.18
6174.	Frosty_Speed (frosty_s_speed)	66	51.92	79.48	9	13.64
6175.	jon (fishy159)	66	66.50	79.64	16	24.24
6176.	FatherWood (fatherwood)	66	69.71	84.23	16	24.24
6177.	Ethan (ethfer_77)	66	83.66	100.03	21	31.82
6178.	Emanuel (emanuelchristo)	66	67.53	80.57	19	28.79
6179.	Mr Plow (el_putino_1917)	66	65.87	84.86	16	24.24
6180.	Ellie (ellieoo)	66	89.98	110.30	16	24.24
6181.	Azamat (div2der)	66	75.07	98.16	18	27.27
6182.	Del (dellieran)	66	81.98	99.02	19	28.79
6183.	uko (darjaw)	66	79.79	97.46	29	43.94
6184.	(dafler)	66	117.44	135.05	36	54.55
6185.	swfan (curleyx)	66	76.31	96.83	20	30.30
6186.	soda, pop, tonic ( which on...	66	80.81	99.27	16	24.24
6187.	Bob (bobsvegana)	66	54.44	69.12	6	9.09
6188.	Ben (benpoopy)	66	71.97	95.15	22	33.33
6189.	Satwik Kashyap (annhilat0r)	66	63.49	79.64	10	15.15
6190.	Alexei (alexiedad)	66	85.37	109.09	13	19.70
6191.	Aidar (aidar13)	66	55.43	69.99	10	15.15
6192.	tamara (tyche1997)	66	39.16	52.32	4	6.06
6193.	Kvothe (relarkvothe)	66	83.94	98.04	18	27.27
6194.	Napasin (triplesic)	66	67.03	81.16	12	18.18
6195.	speedster11 (tygamer)	66	50.61	62.25	5	7.58
6196.	Ellis (sneakee)	66	77.54	93.43	15	22.73
6197.	Cadmiium (cadmiium)	66	92.96	118.04	31	46.97
6198.	Derto12 (derto12)	66	58.99	78.73	11	16.67
6199.	Youri (youriwatson)	66	61.95	74.28	8	12.12
6200.	Sanidhya (sanidhyas3s)	66	46.11	55.75	8	12.12
6201.	Gantulga (tsgantulga)	66	57.69	67.16	19	28.79
6202.	gilbo (ch0wner)	66	90.26	115.96	21	31.82
6203.	Roman (boycanoy)	66	69.35	84.52	14	21.21
6204.	Mrinal (_tt_)	65	82.86	99.48	15	23.08
6205.	Anda (_anda_)	65	83.08	104.52	21	32.31
6206.	zain (zain_nawaz)	65	57.76	82.48	14	21.54
6207.	yashar (yashar1)	65	55.63	67.03	8	12.31
6208.	George (wiliu)	65	110.98	161.04	36	55.38
6209.	Donee (volts5)	65	82.67	115.86	16	24.62
6210.	Chris (tschy)	65	45.52	58.67	5	7.69
6211.	Thunderstorm (thunderst0rm27)	65	115.72	137.66	51	78.46
6212.	Charlie (swordmole)	65	102.22	116.90	29	44.62
6213.	suddernpy (suddernpy)	65	62.43	77.90	20	30.77
6214.	Edisa (snoopy34)	65	109.62	129.08	37	56.92
6215.	SnakeTwix (snaketwix)	65	90.99	126.35	25	38.46
6216.	Shashank (sky08)	65	31.29	46.01	5	7.69
6217.	Skiddy (skiddybadoosh)	65	61.42	79.59	10	15.38
6218.	Axel (sector7)	65	87.00	108.14	19	29.23
6219.	Rodolfo (rojunman)	65	74.89	90.30	20	30.77
6220.	RMC (rmcproductions)	65	78.86	92.79	16	24.62
6221.	Marc (ratshepard)	65	97.42	119.10	32	49.23
6222.	Rahul (rahulburrito)	65	75.46	105.93	13	20.00
6223.	Puan (puanpro)	65	63.91	75.39	14	21.54
6224.	tommy bhau (pseudonetwork)	65	58.48	74.19	17	26.15
6225.	ProRick2358Y (prysp)	65	48.44	61.07	5	7.69
6226.	Pauli (pauli___)	65	72.88	92.75	19	29.23
6227.	pastarishi (pastarishi)	65	63.59	87.94	21	32.31
6228.	nil.rajmane@gmail.com (nila...	65	81.18	106.73	23	35.38
6229.	Mai (napping_koala)	65	72.64	87.88	18	27.69
6230.	mt005 (mt005)	65	76.65	98.86	15	23.08
6231.	Mounir (mounir_typing)	65	42.88	52.12	6	9.23
6232.	Miguel (migsarm)	65	79.18	88.43	12	18.46
6233.	Michael (meta1)	65	104.94	135.65	28	43.08
6234.	Matthew (mattisdabomb77)	65	74.10	92.88	14	21.54
6235.	Jui (laboni)	65	39.94	54.88	41	63.08
6236.	Max (kinginthenorth78)	65	84.61	99.88	22	33.85
6237.	Kiko (kikozz)	65	86.90	109.04	20	30.77
6238.	Khusan (khusan)	65	45.76	59.99	12	18.46
6239.	Karl (karl_marx_1818)	65	63.46	90.14	14	21.54
6240.	Junaid (junaidahmad3)	65	75.54	96.89	9	13.85
6241.	Jacob (jmbogo19)	65	67.00	86.37	17	26.15
6242.	James (jhoffman1204)	65	95.10	119.43	18	27.69
6243.	Daniel (irrrlrvant)	65	114.61	147.10	12	18.46
6244.	HenIsTheMan (henry_lim)	65	76.25	88.43	13	20.00
6245.	ILoveLofi (ginpaku)	65	71.43	94.39	15	23.08
6246.	Gabriel (gabp)	65	85.45	99.62	17	26.15
6247.	Derek (frigorific)	65	73.04	93.62	20	30.77
6248.	thocky caps (floodvalve)	65	112.24	128.89	32	49.23
6249.	Spin (firesquall)	65	90.95	114.81	18	27.69
6250.	Zach (encasedthought)	65	90.20	113.76	23	35.38
6251.	Yosapol (eji4h)	65	90.74	102.86	16	24.62
6252.	John Lizuer (dimasalangchae)	65	59.35	80.66	16	24.62
6253.	Deku (dekachu)	65	51.60	66.17	5	7.69
6254.	Damos (damos22)	65	51.92	61.68	7	10.77
6255.	Colin (cwandell31)	65	81.21	113.46	18	27.69
6256.	Todd (cooldude_69)	65	45.16	57.99	3	4.62
6257.	Colin (colinn02)	65	97.85	125.06	30	46.15
6258.	buruum (buruum)	65	106.34	130.68	36	55.38
6259.	Edvinas (bull3tf)	65	121.84	144.56	36	55.38
6260.	Ben (bennash13)	65	91.60	114.31	19	29.23
6261.	seyyed sina (aseidsina)	65	45.54	55.97	5	7.69
6262.	Alo (alooo)	65	48.04	59.26	3	4.62
6263.	Akbar (akbarovi)	65	59.08	73.25	8	12.31
6264.	Inesh (69420nice)	65	92.70	110.06	21	32.31
6265.	Tanya (verko)	65	41.37	51.91	7	10.77
6266.	Subhro (subhro_121)	65	54.40	67.73	2	3.08
6267.	Ursa (ursagaming)	65	79.29	98.91	23	35.38
6268.	Kyle (bloodfall90)	65	75.24	96.59	15	23.08
6269.	Alpha (alpha464)	65	77.56	101.84	23	35.38
6270.	John (venuntraxo)	65	86.08	120.17	25	38.46
6271.	tahmid (tahmid73)	65	52.70	60.97	4	6.15
6272.	Zuhaer (zaszuhaer)	64	100.38	115.91	22	34.38
6273.	Rika (z3us99)	64	83.95	101.85	23	35.94
6274.	Virus (virusinmotion)	64	51.15	67.44	11	17.19
6275.	ukimub (ukimub)	64	142.68	157.77	44	68.75
6276.	Gin (tonic_gin)	64	94.05	113.36	17	26.56
6277.	Tam (tam04101993)	64	73.73	93.39	18	28.13
6278.	Essy (supersonics123)	64	58.80	77.23	10	15.63
6279.	Marshall (stoppednile)	64	94.67	112.85	21	32.81
6280.	Aakash (srinivasan41)	64	132.37	167.18	49	76.56
6281.	Sophia (sophia_8)	64	74.18	89.24	12	18.75
6282.	Shreesh (shreesh_racer)	64	56.22	66.89	9	14.06
6283.	Joe (seph_of_joe)	64	126.47	158.93	39	60.94
6284.	Everly (scribblenerd)	64	77.69	99.34	18	28.13
6285.	Francisco Amat (saryon)	64	76.40	96.96	22	34.38
6286.	raim (raimmillion)	64	31.31	41.25	5	7.81
6287.	Priyam (priyam_raj)	64	67.94	83.35	14	21.88
6288.	Nooyag (priceisright2)	64	108.10	132.53	31	48.44
6289.	prgobet (prgobet)	64	75.17	97.38	26	40.63
6290.	Persov (persov)	64	93.39	119.57	21	32.81
6291.	Ethan (persom_)	64	77.32	97.04	14	21.88
6292.	PeriodicHAiL (periodichail)	64	67.55	79.08	17	26.56
6293.	Kim (ntk02)	64	73.14	96.18	16	25.00
6294.	altaire (notchrubble)	64	101.11	123.13	23	35.94
6295.	Mihovil (mladabobica)	64	86.08	106.40	27	42.19
6296.	💉 (milan_)	64	128.05	159.47	45	70.31
6297.	Trpimira (m15k0)	64	96.85	113.98	28	43.75
6298.	Jack (jr9810)	64	95.18	113.88	27	42.19
6299.	Steve (jack_of_all_trades)	64	87.70	103.39	23	35.94
6300.	Jack (jackmcg27)	64	68.17	83.79	20	31.25
6301.	Jun (jacketwithpockets)	64	94.26	126.42	21	32.81
6302.	bam (iamsobald)	64	95.75	123.43	24	37.50
6303.	Michael (hit2u)	64	103.78	148.42	25	39.06
6304.	▄︻̷̿┻̿═━一 (h...	64	88.47	110.74	26	40.63
6305.	Nate (haploeco)	64	59.87	80.29	10	15.63
6306.	Cecil (goodie1857)	64	96.79	127.35	46	71.88
6307.	Gay (fujikage999)	64	91.52	109.18	31	48.44
6308.	Frxntize (frxntize)	64	95.31	131.30	27	42.19
6309.	Anton (foroi)	64	48.07	60.56	10	15.63
6310.	HayfordHumade (flace)	64	59.99	71.74	13	20.31
6311.	eren (erenisdevil)	64	56.38	71.95	9	14.06
6312.	Elwin (elwin05)	64	60.90	69.70	14	21.88
6313.	Xiaorui (dxr1234)	64	69.31	83.39	14	21.88
6314.	Hamza (dribbble)	64	57.48	73.87	18	28.13
6315.	Damn (dammmson)	64	85.88	106.04	15	23.44
6316.	Ian (copywright)	64	88.88	113.34	20	31.25
6317.	Andeh (calluxdapotato)	64	101.63	117.42	27	42.19
6318.	Al Jade (c00k1e)	64	85.55	106.05	21	32.81
6319.	Joshua (buwan)	64	107.99	128.71	31	48.44
6320.	Adril (btsbiot)	64	71.53	99.21	17	26.56
6321.	bryan (bryan1111)	64	87.00	122.09	23	35.94
6322.	fastboi (boyfast)	64	91.72	110.08	35	54.69
6323.	Bob (bobtehguy)	64	118.82	139.20	44	68.75
6324.	Jonathan (bobjoni1233)	64	67.72	77.62	12	18.75
6325.	BobbyWasabi (bobby_wasabi_)	64	85.23	109.33	18	28.13
6326.	tstats[ayush_] (ayush_)	64	81.81	101.69	26	40.63
6327.	Attila (attila1)	64	44.52	54.91	5	7.81
6328.	Nazar (aimogenius)	64	72.28	91.22	9	14.06
6329.	absor (absor)	64	89.26	113.61	24	37.50
6330.	Abdou (abdoulabani1)	64	50.78	70.52	5	7.81
6331.	Lim (doxel)	64	69.83	92.77	13	20.31
6332.	audran bobo (audran_bobo)	64	30.12	41.41	17	26.56
6333.	Dummy (resshin11)	64	56.11	72.32	43	67.19
6334.	Luna (wrackspurt)	64	66.35	83.24	9	14.06
6335.	Shaw (shaw_7)	64	23.26	28.41	11	17.19
6336.	balint (bailnt)	64	66.17	78.60	17	26.56
6337.	まぬーゆき (dudebtm_yt)	64	57.23	98.41	21	32.81
6338.	Luka (vashakmadze_luka)	64	79.41	98.23	23	35.94
6339.	Jackson (jacksonchen666)	64	77.88	110.98	21	32.81
6340.	This person (woeaifsdka)	64	55.28	73.52	12	18.75
6341.	Tominator (tominator0_0)	64	53.16	67.94	7	10.94
6342.	Uemi (uemichan)	64	86.15	103.33	33	51.56
6343.	Sage (el_anticristo)	64	47.19	61.50	10	15.63
6344.	left testicle (yggvcdghhigt)	64	27.26	35.96	13	20.31
6345.	Wooloo (_extremely_bored)	63	105.92	127.77	20	31.75
6346.	Speed Cola (zdj361)	63	124.04	134.17	30	47.62
6347.	yoyojuice (yoyojuice)	63	103.42	146.22	21	33.33
6348.	suhai (xxrapidfirexx)	63	78.64	97.00	16	25.40
6349.	oldaccforpracticing (xsdream)	63	91.43	123.17	31	49.21
6350.	Matthew (wormshurm)	63	80.13	114.31	17	26.98
6351.	Wilford (wilfordjason)	63	123.95	149.81	32	50.79
6352.	They don't know me son (war...	63	96.55	133.65	30	47.62
6353.	Vahan (vaki)	63	25.42	33.91	14	22.22
6354.	Tommy (tommy_sylver)	63	69.45	90.32	28	44.44
6355.	Thymme (thymme)	63	84.55	108.82	26	41.27
6356.	Mark (tehone4u)	63	62.81	81.39	15	23.81
6357.	Spencer (spenciepoo)	63	120.14	148.39	39	61.90
6358.	👽 (sofreakingslow)	63	76.22	93.76	16	25.40
6359.	Jacob (slashingpuma)	63	97.75	114.51	26	41.27
6360.	Alice (shadowsofwaxwingsslain)	63	71.84	88.86	13	20.63
6361.	Kawaii (saranghoe)	63	99.90	126.73	28	44.44
6362.	Rakesh Singu (rakeshsingu)	63	68.55	99.02	15	23.81
6363.	Putrid (putridacid)	63	60.94	80.25	11	17.46
6364.	Pierrot (pierrotplays)	63	113.03	132.39	39	61.90
6365.	I'm so trash (peepolove)	63	114.94	129.41	28	44.44
6366.	Ballsdeepinthesoup (onlyico...	63	68.23	83.74	14	22.22
6367.	༼ つ ◕_◕ ༽つ (nyr...	63	54.34	72.31	12	19.05
6368.	No (noman75)	63	89.69	115.98	30	47.62
6369.	Neil (neilt_)	63	87.73	103.71	17	26.98
6370.	Mohab Tharwat (mohab97)	63	59.68	88.49	15	23.81
6371.	max (max2817max)	63	55.76	73.16	6	9.52
6372.	Amar (masteramar)	63	43.76	57.07	4	6.35
6373.	Marius (mariusniveri)	63	73.88	87.67	12	19.05
6374.	Magzhan (mako_siaa)	63	72.34	94.20	20	31.75
6375.	Max (mafab1)	63	118.94	148.45	38	60.32
6376.	Thang (lhg81hc)	63	72.15	86.11	14	22.22
6377.	ktzzzuuuu (ktzzz)	63	53.80	72.69	12	19.05
6378.	コタ (kotasucksatyping)	63	69.56	94.61	13	20.63
6379.	Kostaice (kostaice)	63	61.01	75.67	6	9.52
6380.	john (kingtypemaster)	63	75.21	90.36	31	49.21
6381.	Kit (kesuki)	63	125.16	149.89	42	66.67
6382.	Mate (hhmate)	63	59.90	74.78	10	15.87
6383.	George (gkoubbe)	63	67.65	83.45	19	30.16
6384.	FlyAtNight (flyonkeyboard)	63	84.95	101.06	22	34.92
6385.	Evan (elin4046)	63	102.48	123.48	22	34.92
6386.	D (davmarksman)	63	47.48	57.48	4	6.35
6387.	Oleksandr (c_u_b_e)	63	50.04	60.06	5	7.94
6388.	Collin (collin_felter)	63	89.40	107.20	19	30.16
6389.	i like to type (chuggaaconr...	63	115.80	141.01	37	58.73
6390.	Chrollo (chrollo283)	63	63.76	77.11	12	19.05
6391.	abhi (cheapcoder)	63	84.36	104.67	21	33.33
6392.	Cel (celerity_)	63	68.64	93.52	22	34.92
6393.	Danielle (bunelle)	63	44.26	64.37	8	12.70
6394.	Joseph (bnnes714)	63	43.16	61.62	7	11.11
6395.	Thien Nam Anh (benvu3005)	63	44.66	56.34	3	4.76
6396.	Awz. (awzcubensis)	63	49.55	65.54	11	17.46
6397.	Arnold (arnoldlek)	63	82.73	103.99	22	34.92
6398.	Huang.zy (amwzhenyu)	63	104.58	134.70	28	44.44
6399.	Von (vonjorie)	63	66.95	97.32	12	19.05
6400.	Hoàng (hoangloverboy)	63	78.46	93.90	11	17.46
6401.	Litefeather (litefeather)	63	57.67	69.60	10	15.87
6402.	AbsurdlyBlack (absurdlyblack)	63	78.22	108.47	18	28.57
6403.	Jennie (jorab)	63	50.23	62.23	7	11.11
6404.	OTERO81 (shashu_191)	63	45.78	58.99	7	11.11
6405.	Jax (jaxsnjohnson)	63	56.74	68.93	7	11.11
6406.	Seb (sebnivek)	63	56.52	66.80	10	15.87
6407.	Zor (zor365)	62	44.10	52.23	6	9.68
6408.	Daniel (zdaniel02_)	62	97.98	115.77	25	40.32
6409.	Xyexs (xyexs)	62	87.05	105.23	16	25.81
6410.	warm (warmthunder51)	62	68.50	88.67	15	24.19
6411.	turgz (turgz)	62	91.46	112.05	20	32.26
6412.	Wyman (speedy_boi420)	62	96.85	121.49	25	40.32
6413.	Jawad (sixtysicks66)	62	54.33	70.75	16	25.81
6414.	jm (sirpricebeach)	62	89.86	108.54	25	40.32
6415.	Siddhartha (sid_tiw)	62	99.48	120.07	31	50.00
6416.	alaa (salaa)	62	66.16	75.03	9	14.52
6417.	Rokas (rokasa369)	62	87.82	106.82	25	40.32
6418.	Redwan (redwan_360)	62	65.55	82.39	15	24.19
6419.	jungle_cruser (redscorn)	62	62.25	71.72	9	14.52
6420.	😎Believe and u WillSeeTh...	62	42.16	55.08	6	9.68
6421.	Rabber (polrabber)	62	65.43	85.79	15	24.19
6422.	Brendan (panikooooos)	62	121.50	148.43	33	53.23
6423.	Oleg (oleg27)	62	90.96	109.84	22	35.48
6424.	Nigel (nigeljames)	62	54.32	75.40	9	14.52
6425.	✔️▄◘🚀!new_luca@y...	62	108.16	134.95	32	51.61
6426.	Steven (nerobot)	62	67.30	84.68	9	14.52
6427.	Neeecu (neeecu)	62	72.43	90.15	14	22.58
6428.	Nathan (nat179)	62	81.96	107.05	55	88.71
6429.	(narzzz)	62	79.91	102.99	14	22.58
6430.	typeracist (moron212)	62	124.04	149.22	41	66.13
6431.	Joseph (meshram2001)	62	97.63	118.48	24	38.71
6432.	Faisal (md_faisal)	62	63.68	83.04	20	32.26
6433.	Márton (marcityperacer)	62	63.13	78.57	18	29.03
6434.	Lūkass (lukasslv)	62	76.48	100.84	14	22.58
6435.	Robert (lekia)	62	51.02	64.11	8	12.90
6436.	I×Blazar×I (lblazarl)	62	110.71	134.43	38	61.29
6437.	kabbo (kabbo25)	62	70.96	99.11	17	27.42
6438.	Youssef (jo1999)	62	84.65	99.36	15	24.19
6439.	N (jaripozz)	62	81.90	94.87	19	30.65
6440.	James (james702)	62	105.20	129.72	23	37.10
6441.	Cameron (iliveinabox117)	62	63.64	81.42	9	14.52
6442.	Gemma (gemmaaa)	62	70.60	91.83	17	27.42
6443.	3ntr0py (fr3udian)	62	95.86	112.32	20	32.26
6444.	Africa (ethiopian1252)	62	53.09	67.45	6	9.68
6445.	Joel (easynoob)	62	105.29	124.13	22	35.48
6446.	Dusan (dusanmilic95)	62	91.86	113.39	24	38.71
6447.	Luis (duelistone)	62	104.32	122.92	31	50.00
6448.	Biggus (drthunderface)	62	103.34	120.55	35	56.45
6449.	jerk (doofenshmirtzevil_inc)	62	59.69	71.50	16	25.81
6450.	Jay (dj_jay)	62	63.68	79.34	7	11.29
6451.	Brian (desbrigs)	62	77.00	97.29	12	19.35
6452.	dafiyoung (dafiyoung)	62	63.71	78.24	14	22.58
6453.	Penguino (cspenguino)	62	147.26	168.97	50	80.65
6454.	Copernicus (copernicsus)	62	81.09	112.51	22	35.48
6455.	Bryce (brycetifer)	62	86.97	120.45	20	32.26
6456.	BOBBY (bobbyquinn23)	62	51.41	68.45	6	9.68
6457.	Blitz Anschlag (blitzanschlag)	62	62.46	79.08	12	19.35
6458.	Alan (bl4n)	62	72.59	90.70	12	19.35
6459.	Sumit Prasad (beyonderr)	62	86.93	102.81	27	43.55
6460.	Bal (belgianwaffle)	62	115.69	144.43	35	56.45
6461.	(atypicaltypist)	62	117.21	152.11	34	54.84
6462.	ATHARVA (atharva07)	62	55.75	65.99	7	11.29
6463.	Aries Vince (arvj9)	62	68.19	95.23	18	29.03
6464.	Anlun (anlun)	62	77.58	100.03	22	35.48
6465.	ali (alimuhammadi)	62	38.52	56.60	1	1.61
6466.	Ahmed (ahmekal)	62	71.22	84.14	13	20.97
6467.	adugna (adex_22)	62	73.62	99.67	17	27.42
6468.	Adam (abrokke)	62	77.39	98.47	12	19.35
6469.	Abdallah (abdallah1)	62	72.21	83.46	13	20.97
6470.	Kobe (kobeelijah111)	62	86.50	112.54	19	30.65
6471.	Brandon (thewinterdonut)	62	70.86	93.02	25	40.32
6472.	Ali (iliyati)	62	65.44	77.46	12	19.35
6473.	Charles (charleswongnt)	62	82.45	108.18	19	30.65
6474.	A (axenaxii)	62	59.40	70.03	18	29.03
6475.	Newton Gain (newton7)	62	21.73	28.69	17	27.42
6476.	idkwhatoyusay (iuseblackswi...	62	82.39	100.24	19	30.65
6477.	evan (etearl)	62	58.63	76.45	8	12.90
6478.	James (vmisfit)	62	92.99	119.11	23	37.10
6479.	Ivan (realstyle)	62	44.92	54.59	10	16.13
6480.	Mike Kevin (mkcastro24)	62	75.27	86.76	18	29.03
6481.	Ahmad (gharbawy)	62	30.28	39.59	10	16.13
6482.	Matthias (_matthias_)	61	65.42	83.54	15	24.59
6483.	Marcus (_flipz)	61	89.89	101.95	13	21.31
6484.	Tamerlan (zhanglet)	61	56.33	71.36	10	16.39
6485.	Jan (zeekat)	61	87.51	118.47	16	26.23
6486.	Mustakim (winterflew)	61	72.44	91.63	20	32.79
6487.	Alex (wakeful_celery)	61	68.91	87.98	10	16.39
6488.	oldweeb (uchiha_obito)	61	89.88	106.16	33	54.10
6489.	E (typemctypeface)	61	100.13	118.95	20	32.79
6490.	Jarrett (typeguy14)	61	75.85	93.35	24	39.34
6491.	tylerthsss (tylerths)	61	112.23	131.21	28	45.90
6492.	Tran (ttphu28)	61	42.37	51.99	5	8.20
6493.	🐵🙈🙉🙊🐒🦍�...	61	117.27	151.95	33	54.10
6494.	Tashrif (tashrif_shahriar)	61	89.68	109.09	24	39.34
6495.	shivam (svmyadav)	61	72.09	85.85	9	14.75
6496.	Chapri 👛👛 (sunilswain)	61	60.79	85.74	13	21.31
6497.	Brayan (sneymo)	61	52.69	71.24	6	9.84
6498.	Krishna (shinigami00)	61	64.40	79.03	18	29.51
6499.	mariah (serialfriend)	61	98.94	124.75	21	34.43
6500.	Satyam (satyamslow)	61	55.19	70.12	10	16.39
6501.	Samiha (sammoha)	61	35.46	47.58	2	3.28
6502.	Salah (salah135)	61	54.29	68.67	4	6.56
6503.	RoA (romori)	61	56.57	67.65	12	19.67
6504.	Foole (rizzbor)	61	75.17	87.89	15	24.59
6505.	RicoBaby (ricoricoree_)	61	93.53	117.13	38	62.30
6506.	Rafeeq (raf_al)	61	77.21	97.70	17	27.87
6507.	Qaplan (qaplan)	61	55.71	64.73	24	39.34
6508.	Punder (punderland)	61	76.33	92.25	13	21.31
6509.	tstats[pumpkinsoup1] (pumpk...	61	121.94	159.47	36	59.02
6510.	Bill (proepicgamer101)	61	89.18	119.37	30	49.18
6511.	Said (porta_said)	61	37.74	48.48	3	4.92
6512.	Plotinus (plotinusdickens)	61	126.32	154.93	40	65.57
6513.	Alexander (olekpark)	61	105.56	124.46	26	42.62
6514.	Nicholas Dimitrov (nickytyp...	61	84.91	131.20	20	32.79
6515.	Denis (newdenispro)	61	65.54	84.82	14	22.95
6516.	MysticNovaLord (mysticnoval...	61	63.07	89.59	16	26.23
6517.	Mohammed (mshousha29)	61	50.69	65.12	7	11.48
6518.	Mayank (mmayank74)	61	61.20	79.37	10	16.39
6519.	meli (meli0604)	61	88.29	109.28	18	29.51
6520.	matthew (mattchy)	61	73.56	83.49	21	34.43
6521.	Mathias (mathias64)	61	72.56	99.60	13	21.31
6522.	Haiden (manthetypewriter)	61	42.24	56.89	11	18.03
6523.	Leukino (leukino)	61	92.91	127.78	20	32.79
6524.	kunal (kunaldongre)	61	78.43	96.99	15	24.59
6525.	Jethro (jethrofort)	61	76.51	101.59	20	32.79
6526.	Jenna (jennafer323)	61	72.83	106.88	16	26.23
6527.	Jainam (jainam123)	61	63.29	71.55	13	21.31
6528.	Hrant (hrant0)	61	78.98	92.64	16	26.23
6529.	SalmanMKC (hellothen)	61	135.57	177.10	9	14.75
6530.	silver (gr0ff)	61	94.83	115.86	31	50.82
6531.	im bored (googooalp)	61	62.22	80.26	16	26.23
6532.	FlameFrost (flamefrost)	61	90.39	112.56	26	42.62
6533.	emily (em0p6)	61	45.46	57.24	31	50.82
6534.	ekoadipg (ekoadipg)	61	106.51	135.01	23	37.70
6535.	Tomaz (dragart)	61	61.21	70.29	12	19.67
6536.	Tapioca (davidararipe)	61	75.58	93.62	19	31.15
6537.	Darren (darrentheboi)	61	106.21	130.61	24	39.34
6538.	Chloe (c_stvr)	61	89.73	111.60	26	42.62
6539.	Nicholas (creamycarrots)	61	113.55	139.24	35	57.38
6540.	Cowlor (cowlortyper1)	61	98.81	123.46	26	42.62
6541.	Gabs (coolkidswag)	61	96.90	121.66	15	24.59
6542.	Bruh (chesswithmath)	61	94.40	126.73	27	44.26
6543.	UReal (chc39615)	61	83.49	100.80	15	24.59
6544.	Audrey (catholicguilt)	61	80.55	102.84	17	27.87
6545.	Brent (brvnt)	61	84.91	103.09	20	32.79
6546.	arno (boxhill)	61	107.64	138.59	33	54.10
6547.	blood (bloodripper)	61	26.19	33.65	8	13.11
6548.	Nathan (axewtypes)	61	88.42	116.24	25	40.98
6549.	Andrew (andrewwin2003)	61	75.02	94.54	16	26.23
6550.	Ahmed (ahmedhallool)	61	48.24	57.93	5	8.20
6551.	Parsa (5barsa5seconds)	61	91.21	110.73	21	34.43
6552.	Nadiah (naddyhere)	61	75.09	90.01	22	36.07
6553.	Nurs (nurs_sarsenov)	61	65.40	79.90	22	36.07
6554.	zeno (zeno_sama)	61	36.25	47.63	13	21.31
6555.	Destroyer (destroyer101)	61	41.26	69.22	2	3.28
6556.	TH127001 (th127001)	61	48.68	64.34	3	4.92
6557.	Keng Soon (kengsoon11)	61	49.73	66.10	13	21.31
6558.	Simon (simon6609griley)	61	92.06	114.08	28	45.90
6559.	Yzmael (yzmael156)	60	98.44	122.38	31	51.67
6560.	Regulus ❄ (yo_yo_honey_si...	60	85.58	105.10	16	26.67
6561.	JB (wtfhowareyousofast)	60	117.09	151.56	35	58.33
6562.	Jay (wolfjay757)	60	84.33	105.30	21	35.00
6563.	william (willi30124)	60	68.75	85.89	15	25.00
6564.	gayman (vvvvvccvvvvv)	60	68.57	85.55	18	30.00
6565.	Vil (vil_)	60	92.89	117.03	20	33.33
6566.	Stefan (unknow_stef)	60	56.13	70.78	7	11.67
6567.	uglyjeffrey (uglyjeffrey)	60	69.53	89.36	21	35.00
6568.	Tyler (tyster02)	60	85.91	98.57	20	33.33
6569.	Typer (typertyping)	60	69.32	82.00	11	18.33
6570.	viv (toastexee)	60	91.19	116.60	13	21.67
6571.	Sulov (sul49)	60	67.82	86.22	19	31.67
6572.	spark (sparkkk)	60	81.99	121.23	19	31.67
6573.	Shashank (shashu1509)	60	86.09	107.58	15	25.00
6574.	Ace (semiace)	60	96.08	120.54	28	46.67
6575.	Rasmus (sbares)	60	92.00	109.14	22	36.67
6576.	Sandeep (sandeep_bhandari)	60	47.89	60.84	7	11.67
6577.	💓 (samhurwitz)	60	80.86	107.05	55	91.67
6578.	Rustam (rustam687)	60	86.04	111.45	20	33.33
6579.	harley (questionable0891)	60	50.13	65.93	7	11.67
6580.	NitroOrb (nitroorb)	60	86.85	112.81	21	35.00
6581.	Nicholas (nicholaslaw07)	60	78.84	101.20	13	21.67
6582.	MH (nibir4422322321)	60	55.81	68.67	5	8.33
6583.	NejcSLO (nfaca411)	60	52.62	67.34	9	15.00
6584.	x (mxlxdx)	60	128.65	175.95	24	40.00
6585.	Michael (ms_12)	60	77.34	98.72	13	21.67
6586.	Moritz (mogottsch)	60	82.23	96.97	23	38.33
6587.	(mistertfy64)	60	96.44	120.46	19	31.67
6588.	Shahadat Hossain (md_shahad...	60	46.29	56.41	8	13.33
6589.	Mat (mat78)	60	66.83	82.16	7	11.67
6590.	Mario (mariojr16)	60	72.50	90.82	16	26.67
6591.	Ian (llamasquad)	60	83.61	105.32	19	31.67
6592.	Kiara (liptica_k)	60	70.03	85.59	10	16.67
6593.	thursdays (liljuicebox491)	60	87.61	126.63	16	26.67
6594.	Mark (lemon________)	60	84.24	116.00	19	31.67
6595.	Lent√es (lemoninapie)	60	101.38	135.48	28	46.67
6596.	fatma (khadigaz)	60	65.45	82.25	18	30.00
6597.	Jynn (jynngecko)	60	50.77	66.67	18	30.00
6598.	jivanf (jivan108)	60	141.79	178.93	47	78.33
6599.	Mic (jesusluvr)	60	71.21	91.52	16	26.67
6600.	Jenny (jenny_02)	60	84.19	107.92	13	21.67
6601.	JC (invoicingkarma)	60	84.63	103.69	16	26.67
6602.	Horizon (hwinangkoso)	60	69.79	83.28	16	26.67
6603.	thanh (hust9x)	60	64.71	75.47	12	20.00
6604.	Liban (hujala1)	60	144.19	173.54	45	75.00
6605.	Xavier (gshizzahs)	60	106.01	127.62	28	46.67
6606.	road to 100wpm (getoar112)	60	93.64	115.53	26	43.33
6607.	Rachelle (foolishoni)	60	66.48	83.52	8	13.33
6608.	Flip (flip2theleft)	60	114.16	144.58	32	53.33
6609.	IndianGuy (fastindianguy)	60	94.05	107.45	31	51.67
6610.	jayden (fastest11yearoldtyp...	60	92.21	124.83	13	21.67
6611.	eric (ericsy)	60	100.04	118.32	23	38.33
6612.	Old Theme Rocks (dthp32776)	60	111.55	139.01	30	50.00
6613.	big slo (denvr)	60	72.90	91.51	13	21.67
6614.	AsadCoder (darkterror07)	60	74.40	103.10	14	23.33
6615.	Cole (coles_lambo_15)	60	87.11	110.85	22	36.67
6616.	Chan (cognacchan)	60	67.90	85.03	14	23.33
6617.	Sheep (celibustbike)	60	66.52	84.43	19	31.67
6618.	Carson (carsonting)	60	70.41	97.55	12	20.00
6619.	Jonas (calmdownnnnn)	60	73.54	93.43	10	16.67
6620.	Noah (bobapplepie)	60	101.78	117.34	26	43.33
6621.	Chua (big_boy_pack)	60	78.62	98.35	51	85.00
6622.	White (beast_5)	60	73.60	92.86	15	25.00
6623.	bayarjargal (bayaraajr)	60	62.12	79.39	27	45.00
6624.	Azaza (azazamaster)	60	57.64	67.70	11	18.33
6625.	AstroNomix (astronomix)	60	66.45	84.54	15	25.00
6626.	Aryan (aryan1504)	60	49.83	65.67	4	6.67
6627.	McQueen (aquino_jk)	60	40.31	51.18	4	6.67
6628.	Aibek (aosmonov)	60	80.89	99.42	24	40.00
6629.	Ankit (ankit0)	60	67.43	78.74	16	26.67
6630.	Marko (akagodyr)	60	43.94	54.88	6	10.00
6631.	hello (ajblizzard77)	60	74.28	101.44	20	33.33
6632.	Vaibhav (ahthserhsluk)	60	55.90	73.03	15	25.00
6633.	ahmet (ahmetyilmaz2002)	60	72.65	95.04	13	21.67
6634.	Harrison (happierwizard)	60	73.43	91.23	19	31.67
6635.	Joanne (jowelch25)	60	62.74	78.35	14	23.33
6636.	Urushihara (urushihara23)	60	40.64	52.36	5	8.33
6637.	makenna (kenniekat)	60	67.42	76.16	12	20.00
6638.	shiraku (otvxtyper)	60	78.26	91.36	16	26.67
6639.	ss (ssiq)	60	48.72	61.11	6	10.00
6640.	xdom (xdomiino)	59	82.69	106.41	21	35.59
6641.	weeAzuL (weeazul)	59	67.93	85.65	15	25.42
6642.	Volxage (volxage)	59	90.84	110.32	17	28.81
6643.	viper (viper3315)	59	67.21	78.35	10	16.95
6644.	none_of_ur_business (underc...	59	75.02	95.70	16	27.12
6645.	Miku (undeadninja)	59	83.34	96.63	15	25.42
6646.	Marc (tomatenmarc)	59	62.25	80.39	11	18.64
6647.	TITAN (titan_daddy)	59	55.26	73.24	12	20.34
6648.	The D Legend (the_d_legend)	59	84.02	97.02	14	23.73
6649.	TheZacher5645 (thezacher5645)	59	91.55	114.00	17	28.81
6650.	Hamz (thehamzarocks)	59	72.83	86.93	19	32.20
6651.	Tasnimul (tasnimul)	59	67.46	87.84	13	22.03
6652.	Sylvester (sylvestertyper)	59	94.27	110.76	17	28.81
6653.	Karina (syj4434)	59	79.22	100.26	25	42.37
6654.	Md Ahad Ali (sumon_ahmmed_001)	59	26.71	31.54	9	15.25
6655.	Shikhraj (shikhrajsingh)	59	107.81	129.86	25	42.37
6656.	Seb (sebastiancv)	59	87.46	106.19	19	32.20
6657.	Santiago (santiago101604)	59	71.39	99.24	15	25.42
6658.	tstats[rtupps] (rtupps)	59	63.56	84.67	9	15.25
6659.	Sion (retardation69)	59	46.39	55.17	5	8.47
6660.	handshurt (ozzytheasian)	59	94.76	125.88	29	49.15
6661.	Deimer (ogdeimer)	59	70.26	95.18	15	25.42
6662.	Andrew (nosingaround)	59	121.38	142.54	29	49.15
6663.	Jordan (mrkentman)	59	81.21	100.73	20	33.90
6664.	m0gu (mogumogu_)	59	72.25	91.01	12	20.34
6665.	Marcus (marcusmandarin)	59	105.60	132.55	29	49.15
6666.	hngggg (m4saki)	59	88.58	112.14	25	42.37
6667.	lRaml (lsomeonel)	59	88.02	108.63	23	38.98
6668.	Jusuf (kz99)	59	83.38	103.40	17	28.81
6669.	JumpingPenguin (jumpingpeng...	59	85.79	103.73	23	38.98
6670.	JSlyk (jslyk)	59	69.92	95.16	19	32.20
6671.	Mujeeb's (jeffyglue)	59	120.48	151.67	39	66.10
6672.	burrito1 (jacobef2)	59	121.46	142.15	29	49.15
6673.	Jackoman (jackoman)	59	36.05	41.70	6	10.17
6674.	idost (idost)	59	63.75	72.70	14	23.73
6675.	∞ (gatewaydrug)	59	111.03	125.60	29	49.15
6676.	frost (frost99)	59	67.69	80.87	12	20.34
6677.	ants (fr4nc3)	59	116.43	138.27	30	50.85
6678.	finityfly (finity_fly)	59	113.79	131.06	26	44.07
6679.	Leroy (fazecringe)	59	87.22	107.09	20	33.90
6680.	Michael (ezykielue)	59	91.88	108.06	19	32.20
6681.	Vagesh (don1909)	59	60.66	68.67	9	15.25
6682.	Dhvanik (dj_viradiya)	59	56.39	67.67	12	20.34
6683.	Daniar (dankas23)	59	37.00	45.43	1	1.69
6684.	dani (daniellielikesanime)	59	67.92	82.65	10	16.95
6685.	Joey (coxoncable)	59	89.56	112.69	19	32.20
6686.	Connor Craig (conn_fused1)	59	86.36	102.10	13	22.03
6687.	Clint (clint_kun)	59	115.32	135.10	25	42.37
6688.	cheryl (cheryl08)	59	78.63	92.94	10	16.95
6689.	Kai (cheongengkai)	59	89.38	109.45	15	25.42
6690.	Charts (charizardpotato)	59	90.26	106.06	27	45.76
6691.	⭕⃤ (carmatain)	59	102.02	140.32	24	40.68
6692.	carl (captain_deadpooooool)	59	66.15	78.04	14	23.73
6693.	Viktor (c0re_dump)	59	66.11	84.70	14	23.73
6694.	Narut (blowingbubbles)	59	100.59	124.78	22	37.29
6695.	Joseph (bigboybo28)	59	76.04	93.30	21	35.59
6696.	Caleb (balecus53)	59	77.20	91.56	9	15.25
6697.	Ashray (ashraygupta1)	59	72.23	88.29	12	20.34
6698.	ark (arkundu)	59	87.70	111.76	41	69.49
6699.	arjun (arjun_gamine)	59	54.87	70.02	7	11.86
6700.	Alex (alexlea444)	59	96.25	110.45	21	35.59
6701.	Feruz (akhbekdev)	59	45.31	56.41	6	10.17
6702.	Arthur (ajdem)	59	104.92	125.03	29	49.15
6703.	aa (aanyc)	59	59.58	71.25	9	15.25
6704.	Raj Gaurav (01indian)	59	56.45	67.56	15	25.42
6705.	Rageon (rageon787)	59	51.34	66.04	5	8.47
6706.	Sowm (sowm)	59	48.03	60.58	4	6.78
6707.	Vance (lamnbda)	59	62.62	79.27	9	15.25
6708.	Damian (bigsweat)	59	70.68	90.42	13	22.03
6709.	Shahryar (_shahryar_pjr)	58	94.57	124.23	31	53.45
6710.	🏎️Ziad (ziad_hamdy)	58	54.82	73.70	4	6.90
6711.	Steven (xuqc01)	58	101.65	122.96	24	41.38
6712.	Wepeel (wepeel)	58	88.07	122.85	22	37.93
6713.	Adam (vincentadam)	58	70.91	82.22	13	22.41
6714.	JP (vikiperle08)	58	65.11	88.92	15	25.86
6715.	pp (urppsmolhaha)	58	77.99	93.40	15	25.86
6716.	Bill (trainingb4tests)	58	96.88	127.99	22	37.93
6717.	purplefr|ction (tesla_diesel)	58	115.38	149.11	28	48.28
6718.	diko (sniperab3)	58	41.07	52.00	3	5.17
6719.	Sk1tt (sk1tt)	58	87.02	115.22	14	24.14
6720.	silver_hamburger (silver_ha...	58	33.25	44.48	6	10.34
6721.	Shoaib (shoaibesam)	58	55.78	76.97	2	3.45
6722.	(scaphism)	58	130.32	166.57	39	67.24
6723.	Sahil (sahil21db)	58	87.01	106.76	10	17.24
6724.	ryo (ryolate)	58	85.87	101.85	19	32.76
6725.	(razor11223344)	58	87.78	100.28	23	39.66
6726.	tango (rangotango)	58	70.94	97.78	34	58.62
6727.	Rajesh (rajesh110494)	58	82.23	100.87	16	27.59
6728.	Damon (pvdorginal)	58	96.23	117.74	20	34.48
6729.	Sebastian (proudpole)	58	91.92	115.47	19	32.76
6730.	Professional (professional_...	58	76.44	95.55	16	27.59
6731.	WIZard (prasadbhoir6786)	58	76.02	111.14	13	22.41
6732.	Boog (pinchejoseph)	58	46.33	59.24	13	22.41
6733.	Pharrell (pharrell000000)	58	45.96	65.41	8	13.79
6734.	Ronnie (onie12)	58	98.89	134.91	23	39.66
6735.	Tyler (oktherefella)	58	105.98	131.93	29	50.00
6736.	Chih-hai (oceansfavor)	58	63.66	72.27	10	17.24
6737.	Nokzendi (nokzendi)	58	79.28	99.03	13	22.41
6738.	Deepanshu (namelesswonder)	58	53.83	69.93	6	10.34
6739.	zombo (midgetmigerian)	58	94.27	110.90	24	41.38
6740.	i have no (miamam)	58	96.68	132.73	20	34.48
6741.	Nathan (memewhat123)	58	62.69	77.17	7	12.07
6742.	For_real (mailindra)	58	84.63	106.18	18	31.03
6743.	QK Alice Duo (macz1991)	58	128.03	153.35	26	44.83
6744.	laljan (laljan)	58	57.92	68.66	10	17.24
6745.	Krowa (krowa)	58	82.26	100.05	17	29.31
6746.	Krunch (kommanderk)	58	61.81	75.27	9	15.52
6747.	kemiy (kemiy)	58	115.95	139.01	30	51.72
6748.	Karsen (karguy3)	58	79.41	98.34	19	32.76
6749.	Kanna (kannamanna)	58	78.76	96.45	16	27.59
6750.	Matthew (juanspoon)	58	110.65	135.70	39	67.24
6751.	Jeff (jeformica)	58	91.78	115.38	20	34.48
6752.	Wyatt (isometricman)	58	94.61	126.09	30	51.72
6753.	Ishaque (ishaque)	58	75.33	88.93	12	20.69
6754.	RedRashGrain (improvising_m...	58	86.98	101.13	19	32.76
6755.	Highfire1 (higfire1)	58	72.78	88.41	17	29.31
6756.	Tom (hes_the_fastest)	58	41.96	54.30	3	5.17
6757.	Dao (heavenrefining)	58	50.56	70.17	21	36.21
6758.	Glenn (glenn101107)	58	89.63	109.21	21	36.21
6759.	sussybaka (fknneeow)	58	85.88	104.85	14	24.14
6760.	EM_K (em_k)	58	83.98	100.82	18	31.03
6761.	Drew (drew1008)	58	70.11	84.39	18	31.03
6762.	Demtros (demtros)	58	91.87	115.63	25	43.10
6763.	relaxx (cloudkid)	58	98.70	121.45	21	36.21
6764.	Chino (chinotorres_142)	58	57.56	72.90	13	22.41
6765.	Marco (chino01)	58	74.77	90.11	11	18.97
6766.	Burning (burningyolo)	58	54.16	67.23	7	12.07
6767.	berk (birb_v2)	58	49.89	57.95	3	5.17
6768.	ㅤ (bazar397)	58	78.18	93.56	14	24.14
6769.	baekos (baekos)	58	57.96	73.40	9	15.52
6770.	athresh (athresh)	58	79.49	101.22	12	20.69
6771.	Ashen (ashencone)	58	62.84	74.01	10	17.24
6772.	ARA (araaraara2)	58	50.13	74.75	6	10.34
6773.	Mar (aqancake)	58	88.24	107.34	22	37.93
6774.	Alvise (anklud)	58	70.17	82.63	13	22.41
6775.	Dan Jeryll (almadendj)	58	119.68	133.30	32	55.17
6776.	Almas (almas016)	58	46.43	54.00	10	17.24
6777.	Akhil (akhil_kunadiya)	58	39.86	51.82	2	3.45
6778.	smuel (14adamssam)	58	70.32	83.66	13	22.41
6779.	Dr_Sagui (drsagui)	58	63.54	82.26	5	8.62
6780.	Lourens (lourens)	58	51.71	63.64	8	13.79
6781.	sweet (slowly_salty)	58	40.09	56.33	2	3.45
6782.	Zulfiqar (fiqar_29)	58	43.63	52.06	7	12.07
6783.	Zuel (zuel)	58	32.81	41.45	3	5.17
6784.	tstats[_skrt_skrt_] (_skrt_...	57	72.78	86.42	11	19.30
6785.	... (zviki)	57	68.52	80.82	17	29.82
6786.	zhen (zhen_pei)	57	87.34	118.40	16	28.07
6787.	Matthew (yourtrashkld)	57	90.15	106.15	20	35.09
6788.	Xray (xrayburst)	57	55.22	65.11	9	15.79
6789.	Wassim (wxssim)	57	67.36	91.45	19	33.33
6790.	wub (wub_wub)	57	95.11	117.60	26	45.61
6791.	ezza (winko_)	57	78.72	93.18	18	31.58
6792.	Ako ay (walangpera)	57	106.23	128.27	18	31.58
6793.	v (typer953)	57	81.01	109.00	19	33.33
6794.	Pratik (trippyhob)	57	97.17	116.47	25	43.86
6795.	Derp (thelol)	57	97.37	119.01	43	75.44
6796.	Taylor (taylorcuber717)	57	95.26	119.06	24	42.11
6797.	takenbyWine (takenbywine)	57	60.12	72.22	10	17.54
6798.	Shubham (shubham409)	57	29.33	40.73	8	14.04
6799.	Shiheng (sbiengo_sama)	57	72.51	86.59	21	36.84
6800.	Sarah (sarah_the_slow_typer)	57	53.34	67.58	7	12.28
6801.	sanayaa (sanayaa)	57	80.93	98.66	18	31.58
6802.	Rocco (roccoduck)	57	78.01	100.66	12	21.05
6803.	Rishi (rishipoonia)	57	36.93	53.78	6	10.53
6804.	de (paradoxpigeonlaptop)	57	147.99	193.51	35	61.40
6805.	Thomas (palsgod)	57	138.99	164.84	46	80.70
6806.	Pacu (pacutv)	57	91.64	109.85	11	19.30
6807.	Eddie (nightwing_eddie)	57	90.27	108.80	21	36.84
6808.	nicole (nicoleyee_)	57	57.40	69.86	13	22.81
6809.	Lemon (mrlemon)	57	73.30	104.64	13	22.81
6810.	NGONO (mnae)	57	40.43	57.79	2	3.51
6811.	Mark (markstone_141)	57	78.84	92.53	19	33.33
6812.	mamounitor (mamounitor)	57	55.79	85.75	11	19.30
6813.	A (lvorg)	57	72.13	88.19	17	29.82
6814.	luckylian123 (luckylian123)	57	71.20	94.04	18	31.58
6815.	Ali (lembugoreng)	57	91.91	111.30	15	26.32
6816.	krishan (krishan_pro)	57	60.72	76.63	14	24.56
6817.	Elvis (krewe11a)	57	148.59	166.93	0	0.00
6818.	Jacob (jakkbb)	57	80.38	94.07	32	56.14
6819.	jaeg3r (jaeg3r)	57	84.66	99.32	14	24.56
6820.	Jacob (jacobtolstrup)	57	51.37	64.43	5	8.77
6821.	jack (jack815)	57	98.48	125.58	25	43.86
6822.	Troy (ic3b3rg)	57	61.99	76.21	17	29.82
6823.	hbomb (hbomber)	57	64.28	84.49	25	43.86
6824.	Anthony (funger99)	57	85.82	101.31	10	17.54
6825.	F (frogliker)	57	72.98	85.65	11	19.30
6826.	Fan (firesale)	57	67.30	81.33	15	26.32
6827.	fesd (fesd20)	57	68.50	84.83	16	28.07
6828.	Eric (edestroyer2604)	57	66.98	77.31	14	24.56
6829.	Joe (dostojoe)	57	54.19	67.73	4	7.02
6830.	Mayank (divine_godspeed)	57	72.45	89.99	6	10.53
6831.	Ashvini (danger_anna)	57	49.76	66.80	11	19.30
6832.	Cristian (crism123dm)	57	59.58	78.16	9	15.79
6833.	Chinmay (chinmay26)	57	65.37	78.72	12	21.05
6834.	Bob (cakesenpie)	57	113.00	138.65	28	49.12
6835.	Jared (buckdancer)	57	96.47	115.20	21	36.84
6836.	Joey (bpextermin8)	57	95.44	117.10	24	42.11
6837.	Banzexxx (banzexxx)	57	73.32	83.01	12	21.05
6838.	Avery (ba0z1)	57	94.22	120.99	35	61.40
6839.	Travis (azgoalie)	57	66.10	88.17	13	22.81
6840.	avighna (avighna)	57	67.79	92.03	13	22.81
6841.	Anshu79 (anshu79)	57	62.05	79.78	15	26.32
6842.	and (andy_r8)	57	72.04	92.15	15	26.32
6843.	Ella (amhaissup)	57	91.96	113.44	18	31.58
6844.	Akuma (akumaayush)	57	60.24	73.22	4	7.02
6845.	S J (abhi_28)	57	71.58	92.30	20	35.09
6846.	Ziad (0ziadmohamed0)	57	71.25	82.89	16	28.07
6847.	pearce (09mantaray)	57	111.83	150.57	31	54.39
6848.	Charles (cwayne)	57	73.06	83.77	13	22.81
6849.	Andres (primedope27)	57	54.67	63.68	5	8.77
6850.	k. (luvmissjanet)	57	44.39	55.36	7	12.28
6851.	Matias (matias2030nuevo)	57	26.79	36.46	15	26.32
6852.	Michel (michelena)	57	66.54	85.50	13	22.81
6853.	dad (dadadu)	57	61.88	72.96	9	15.79
6854.	Neesh (neesh774)	57	101.32	127.80	50	87.72
6855.	Thomas (mrprgmr)	57	39.06	51.76	3	5.26
6856.	divya (divyaggle)	57	39.00	46.47	4	7.02
6857.	Im a (belowaveragegang_69)	57	53.81	89.44	13	22.81
6858.	Atos (wolfcash)	56	87.05	100.56	15	26.79
6859.	Seri (vincent_aik)	56	93.17	109.08	22	39.29
6860.	Uxna (uxna)	56	103.73	127.16	26	46.43
6861.	Eric (unfazedglitch)	56	102.20	118.23	25	44.64
6862.	Vincent (turbovince)	56	63.76	73.14	14	25.00
6863.	Tobi_Uchiha_Rama (tobi_uchi...	56	45.98	55.22	9	16.07
6864.	sachin (timsixit)	56	54.87	71.89	9	16.07
6865.	TastyApple (tastyapple)	56	96.41	112.68	24	42.86
6866.	Svetoslav (svera)	56	54.33	64.66	6	10.71
6867.	stas (stasats)	56	32.77	42.49	0	0.00
6868.	Souhardya (souhardya98)	56	82.34	100.67	20	35.71
6869.	Jayden (slawsome)	56	56.45	67.73	2	3.57
6870.	Surya (shanky_111)	56	44.80	57.17	4	7.14
6871.	rugbyBREAD (rugbybread4free)	56	93.59	111.03	24	42.86
6872.	Radek (radecekwriter)	56	85.35	99.32	18	32.14
6873.	Provocative (provocativepig...	56	90.19	112.10	20	35.71
6874.	Collins (princey)	56	55.88	66.59	7	12.50
6875.	Boeing (planetyper78)	56	100.02	117.84	25	44.64
6876.	Khastro (peterakd)	56	108.33	144.60	26	46.43
6877.	OvenHeat (ovenheat)	56	117.64	163.03	37	66.07
6878.	notoverhere (notoverhere)	56	66.11	85.42	12	21.43
6879.	Hamza (nerodine)	56	74.67	89.30	16	28.57
6880.	narze (narze)	56	86.80	123.42	15	26.79
6881.	Jay (myladyjay)	56	69.52	88.56	13	23.21
6882.	MoreZigLessZag (morezig)	56	62.86	78.11	14	25.00
6883.	Monjur 101 (monjur_ahmed)	56	33.76	41.70	5	8.93
6884.	mataio (mataioo)	56	41.61	51.48	8	14.29
6885.	Ludvig (luddez1)	56	93.04	113.82	23	41.07
6886.	✔️▄◘🚀!new_luca@y...	56	133.95	214.36	34	60.71
6887.	Santiago (londono19)	56	100.08	123.36	16	28.57
6888.	Alex (laralex)	56	85.10	100.32	21	37.50
6889.	Md Ibrahim Hossain (komlaka...	56	61.78	69.79	12	21.43
6890.	Hùng (kenkenkiota)	56	96.93	116.28	23	41.07
6891.	Andrea (kazari)	56	90.97	105.14	26	46.43
6892.	Kasiourasg (kasiourasg)	56	108.62	133.06	33	58.93
6893.	Kabadahija (kabadahija30)	56	59.63	72.51	3	5.36
6894.	Joey (jmschrum)	56	80.10	95.99	17	30.36
6895.	Jerichaux (jerichaux)	56	112.70	134.50	28	50.00
6896.	Ineluctable (ineluctable)	56	107.00	141.31	27	48.21
6897.	Hajun (improve_ever)	56	109.30	135.29	39	69.64
6898.	Ren Hariren (hari623)	56	105.94	123.27	36	64.29
6899.	KENNETH (happydino)	56	94.75	120.14	24	42.86
6900.	James (frxction)	56	98.31	119.23	18	32.14
6901.	smolPixie (extraprincess)	56	86.03	105.21	18	32.14
6902.	Etienne (etienne_bepo)	56	93.17	111.64	3	5.36
6903.	Dave (davethreed)	56	56.11	68.03	5	8.93
6904.	Sid (cynocid)	56	93.82	117.15	21	37.50
6905.	Cylindian (cylindian)	56	104.53	123.73	21	37.50
6906.	Parth (cracker2111)	56	44.72	61.90	7	12.50
6907.	ch_tyt (ch_tyt)	56	72.86	90.96	13	23.21
6908.	chubbybala (chubbybala)	56	78.18	90.73	14	25.00
6909.	juggy (cannary)	56	46.10	61.48	6	10.71
6910.	brutalranked (brutalranked)	56	66.42	78.12	13	23.21
6911.	Jongchan (bot_chan)	56	75.94	95.03	9	16.07
6912.	Tawanda (bigx)	56	54.82	69.17	11	19.64
6913.	Benjamin (bigbentypes246)	56	75.61	90.98	15	26.79
6914.	besto (besto)	56	57.28	72.09	13	23.21
6915.	Ben (benjaminweschler)	56	80.46	107.50	18	32.14
6916.	Ahmed (beet790)	56	69.44	83.37	10	17.86
6917.	bananana (bana_na)	56	52.06	61.46	5	8.93
6918.	June (avvieey)	56	87.04	111.21	15	26.79
6919.	Holder (arcanezer0)	56	96.80	122.33	21	37.50
6920.	Andraž Gradišnik (andgrad)	56	102.96	123.32	25	44.64
6921.	ali (alifat)	56	50.00	58.55	5	8.93
6922.	Abhishek (abkrth)	56	78.14	93.47	15	26.79
6923.	abhi (abhi_sama)	56	77.02	96.89	18	32.14
6924.	0x045f (0x045f)	56	111.70	142.33	33	58.93
6925.	smooll (smoollbrain)	56	46.36	61.01	7	12.50
6926.	Ben (benjib)	56	78.45	98.02	17	30.36
6927.	ArcWand (arcwand)	56	79.86	101.98	13	23.21
6928.	tasnim (r4f1d)	56	37.28	51.86	6	10.71
6929.	tstats[kfinimizer] Kfinimiz...	56	49.11	68.18	6	10.71
6930.	rex (rex_k)	56	63.59	82.54	16	28.57
6931.	Gio (flordepapel)	56	88.65	108.21	16	28.57
6932.	Herman (monstrule)	56	61.70	73.40	11	19.64
6933.	G (igaurav)	56	35.04	49.02	7	12.50
6934.	sexy (sexykid)	56	48.69	60.44	7	12.50
6935.	Magnus (magnusfss)	56	54.48	64.49	11	19.64
6936.	Ethen (__ethen_03)	55	72.51	89.58	11	20.00
6937.	Avi (_avi_)	55	96.38	112.36	20	36.36
6938.	Zahra (zahra_a)	55	50.60	62.20	14	25.45
6939.	Kaushik (yeswekey)	55	96.65	112.10	16	29.09
6940.	marsh (yepeyi)	55	131.86	155.37	34	61.82
6941.	Yaniv (yaniv691)	55	55.06	67.69	13	23.64
6942.	danny (xsoii)	55	57.54	71.43	8	14.55
6943.	Steven (xdstephano)	55	80.01	104.02	8	14.55
6944.	fck you latency (whihi)	55	127.31	145.90	29	52.73
6945.	VitaliK (vitalik_2961)	55	66.42	79.02	12	21.82
6946.	vexx32 (vexx32)	55	49.03	62.26	7	12.73
6947.	vayuputra (vayuputra)	55	50.60	67.75	9	16.36
6948.	Albert (tastiermite)	55	98.06	118.36	25	45.45
6949.	Phil (sticky1981)	55	69.27	83.62	17	30.91
6950.	Thomas (speedbro)	55	67.89	89.07	15	27.27
6951.	San (slowcatnospeed)	55	27.61	34.71	7	12.73
6952.	Shadow (shadow_devil)	55	61.76	81.37	9	16.36
6953.	Sambhalang (samkchandy)	55	81.47	101.62	19	34.55
6954.	Robert (rzyao)	55	85.58	108.27	16	29.09
6955.	Russ (russcoder)	55	88.14	115.91	20	36.36
6956.	Ravindu (ravindu08)	55	62.38	75.68	11	20.00
6957.	Jack (randomdize)	55	71.50	103.47	13	23.64
6958.	Raging (ragingthunder)	55	89.65	107.19	21	38.18
6959.	Xavier (qiltz)	55	70.84	86.25	15	27.27
6960.	pingukalinu (pingukalinu)	55	55.76	70.78	4	7.27
6961.	Nikolay (niki12120)	55	48.20	61.14	26	47.27
6962.	Ying-Chen (nash_equilibrium)	55	54.16	64.73	6	10.91
6963.	Nabiha (nabiha_fatima01)	55	34.76	40.98	2	3.64
6964.	mellismacka (mellismacka)	55	91.21	108.15	21	38.18
6965.	McKle (mckle7)	55	85.17	101.79	14	25.45
6966.	Matt (mattmen)	55	46.87	68.13	3	5.45
6967.	YLime (lacua)	55	67.17	78.65	10	18.18
6968.	Konrad (konradgoldammer)	55	83.78	100.95	16	29.09
6969.	Victor (kizamui)	55	76.52	94.02	15	27.27
6970.	Kirby (kirbyjs)	55	65.89	84.06	12	21.82
6971.	fast af (josh53___)	55	94.10	112.89	23	41.82
6972.	Joseph (josefmcbrosef)	55	83.68	112.11	21	38.18
6973.	joseph (jmuganga544)	55	57.88	73.97	11	20.00
6974.	Jasur (jasurava)	55	30.89	44.81	9	16.36
6975.	Jaskirat (jaskiratsingh)	55	99.65	128.48	26	47.27
6976.	Jack (jack90001)	55	115.33	139.33	28	50.91
6977.	Pakko (iam_mzaa)	55	65.96	82.37	14	25.45
6978.	Donald (hotdognalds)	55	110.66	151.30	30	54.55
6979.	Dalia (flowhy_)	55	76.42	93.03	17	30.91
6980.	Halo (fishmona)	55	57.50	74.46	8	14.55
6981.	Fireworks (fireworkkss)	55	96.25	111.19	22	40.00
6982.	Ficfiris (ficfiris)	55	62.38	72.94	10	18.18
6983.	Cobra (devanshj)	55	83.63	98.97	16	29.09
6984.	derfet (derfet)	55	53.31	66.08	6	10.91
6985.	David (davidcaron)	55	70.62	90.20	15	27.27
6986.	danydoo (danydoo)	55	68.36	79.40	14	25.45
6987.	Daisy (daisy_sun)	55	66.42	84.75	14	25.45
6988.	cool_whip (cool_whip)	55	88.91	106.04	12	21.82
6989.	Joe (cobiejoe96)	55	86.12	102.87	14	25.45
6990.	Ollie (cheerfulnihilist)	55	83.82	108.08	16	29.09
6991.	charlene (charlenemiao)	55	59.30	72.28	7	12.73
6992.	Krishna (chaithu97)	55	65.00	76.19	18	32.73
6993.	carina (carina_caily)	55	47.03	77.47	17	30.91
6994.	mike (brons48)	55	85.41	125.15	19	34.55
6995.	Brandon (brandonzfu)	55	93.43	125.23	22	40.00
6996.	Pin (bleeep)	55	70.45	82.28	16	29.09
6997.	Adrian (bigbadbui)	55	91.34	119.68	18	32.73
6998.	Barry (barry21)	55	75.61	90.86	9	16.36
6999.	Azaro (azaroarazenka)	55	124.86	157.57	45	81.82
7000.	St (amirey)	55	65.40	84.57	14	25.45
7001.	Alnebras04 (alnebras04)	55	63.95	91.13	9	16.36
7002.	Aljaz (aljazb)	55	62.04	75.25	12	21.82
7003.	Al-amin (alamin01)	55	34.25	41.20	4	7.27
7004.	Andy (akapgan)	55	75.24	94.72	15	27.27
7005.	nela camelia (agatha67)	55	43.95	57.62	5	9.09
7006.	Afraidofthebomb (afraidofth...	55	125.16	159.29	38	69.09
7007.	Adamite (adamite2k)	55	99.54	122.21	17	30.91
7008.	David (actavis666)	55	69.08	83.53	19	34.55
7009.	Asilbek (acilbek)	55	35.27	47.83	1	1.82
7010.	John Paul (gizoru)	55	52.60	64.27	9	16.36
7011.	Jez (jezmann)	55	49.85	65.77	9	16.36
7012.	Jojo (jojannes1)	55	66.29	85.55	9	16.36
7013.	tstats[david2444] (david2444)	55	76.24	90.75	13	23.64
7014.	choe (choechoichang)	55	88.00	106.92	22	40.00
7015.	Jai (jaipi)	55	40.78	57.98	6	10.91
7016.	Josh (hyper_amoeba)	55	66.47	82.30	24	43.64
7017.	Dylan (playboiidylan)	55	65.49	81.23	10	18.18
7018.	Lucy (ldarwish)	55	63.21	78.96	11	20.00
7019.	Jacob (jacob_legere)	55	80.99	96.74	16	29.09
7020.	Jupiter (content_jupiter1)	55	44.55	55.90	3	5.45
7021.	Ken (kunai502)	55	127.50	149.49	37	67.27
7022.	Badi (badi159)	55	71.55	86.98	14	25.45
7023.	Tengis (tengis)	55	48.47	59.52	1	1.82
7024.	hooj (hoojamaphut)	55	79.78	109.26	19	34.55
7025.	Gab (harold156)	55	50.93	63.70	5	9.09
7026.	Jack (jackneall)	55	41.29	51.12	5	9.09
7027.	kapforty (kapforty)	55	96.96	125.37	17	30.91
7028.	Simmons1 (_simmons)	54	71.89	88.11	16	29.63
7029.	Wujue (wujue)	54	59.59	68.26	12	22.22
7030.	SHIVA (vishu_01)	54	67.43	87.77	17	31.48
7031.	Dmitrii (typescore)	54	44.89	59.06	12	22.22
7032.	Talby (talby)	54	110.80	143.36	26	48.15
7033.	Sujeev (sujeev)	54	53.66	70.40	7	12.96
7034.	sturge (sturgee)	54	72.45	105.79	14	25.93
7035.	procrastinating (sticknleaf)	54	105.34	129.21	28	51.85
7036.	Stanley (stanleyzhang9)	54	111.58	135.86	33	61.11
7037.	tstats[ssohrab] (ssohrab)	54	97.75	129.86	15	27.78
7038.	e-mili (speedy_007)	54	91.71	117.01	15	27.78
7039.	erty (someone8888)	54	107.72	139.67	29	53.70
7040.	slayerofthend (slayerofthend)	54	112.72	144.10	35	64.81
7041.	Shishcobober (shishcobober2)	54	81.38	98.73	12	22.22
7042.	Rommel (seekercuriousityxx)	54	49.72	68.76	7	12.96
7043.	Joel (seasmoke)	54	73.10	90.04	11	20.37
7044.	Reuben (reubensong)	54	97.82	136.15	26	48.15
7045.	Raghavan G V (raghavangv)	54	74.83	96.79	15	27.78
7046.	Pszymek (pszym)	54	77.54	109.82	16	29.63
7047.	prince (prince_singh)	54	36.66	44.69	6	11.11
7048.	James Wolfe (primalnacl)	54	80.03	99.85	20	37.04
7049.	pranked (pranker666)	54	84.12	102.91	18	33.33
7050.	Cihsa (oddlysatisfly)	54	96.79	115.65	20	37.04
7051.	Dennis (ocrayat16)	54	72.07	91.36	12	22.22
7052.	Nicholas (nsabadicci)	54	91.68	117.88	17	31.48
7053.	Slava (not_okay)	54	74.75	83.76	9	16.67
7054.	daniel (notorious13366)	54	33.76	47.73	11	20.37
7055.	Kevin (noimkevin)	54	120.65	137.04	31	57.41
7056.	Chad (nicwin)	54	112.10	139.29	26	48.15
7057.	Nicholas (nicszerman)	54	82.12	100.65	19	35.19
7058.	nguyen (nguyenanh2004)	54	61.02	75.38	9	16.67
7059.	Yasir (nay_yar110)	54	56.25	79.15	5	9.26
7060.	Nate (nateog)	54	103.97	134.72	23	42.59
7061.	Muaj17 (muaj17)	54	88.04	110.32	36	66.67
7062.	molnar (molnaredom)	54	38.99	47.17	7	12.96
7063.	chapo (mnxchapo)	54	97.94	120.79	16	29.63
7064.	Maynard (mftrumpet)	54	104.36	133.63	27	50.00
7065.	Master (masterdvorak)	54	82.86	98.28	12	22.22
7066.	Jun Jie (lemontea387)	54	100.60	124.17	22	40.74
7067.	😳😳😳 (lanterex)	54	97.00	110.60	23	42.59
7068.	Made In (kosowarner)	54	112.42	133.99	47	87.04
7069.	toki (kizunajemini2205)	54	99.09	129.14	26	48.15
7070.	Teeratat (kiwi2002)	54	79.07	96.85	12	22.22
7071.	Alex (khanis1)	54	85.96	102.06	15	27.78
7072.	Keegan (keegan9503)	54	70.68	87.83	14	25.93
7073.	Basil (kaneki_k3n)	54	92.71	114.19	16	29.63
7074.	Joshua (joshuawn)	54	151.28	180.63	43	79.63
7075.	Jazz (jazzfunk37)	54	79.71	95.65	18	33.33
7076.	Jp (j12p21)	54	88.64	110.42	11	20.37
7077.	Ben (izeben)	54	100.78	122.07	17	31.48
7078.	ibean (ibean)	54	69.15	81.27	15	27.78
7079.	hulkari (hulkari)	54	64.13	76.81	16	29.63
7080.	BreadForAll (hollowshadow)	54	103.87	126.93	20	37.04
7081.	𒅃 (hdgamez)	54	112.64	134.23	30	55.56
7082.	Harjot (harjot_singh)	54	74.37	90.06	13	24.07
7083.	Colemak (half_as_fizzy)	54	85.68	105.61	18	33.33
7084.	Phil (gunner_shents)	54	35.39	41.95	3	5.56
7085.	Boris (goat_56)	54	127.92	199.81	33	61.11
7086.	Gazeekoo (gazeekoo)	54	65.59	78.26	12	22.22
7087.	Amare (endmaster64)	54	60.53	75.57	53	98.15
7088.	Emma (embunde7)	54	92.40	122.10	34	62.96
7089.	Ducu (ducu)	54	59.89	67.96	10	18.52
7090.	Douglas (douglaswaugh)	54	66.47	78.71	11	20.37
7091.	Timothy (dilexed)	54	51.00	66.76	7	12.96
7092.	David (davidthegreat)	54	65.99	86.81	16	29.63
7093.	A (dasupakiwi)	54	65.99	83.81	13	24.07
7094.	Scott (chivalrousbanana)	54	45.44	57.59	4	7.41
7095.	bruh (bruhmoment8964)	54	152.60	172.84	47	87.04
7096.	Armisael (brandonbro)	54	76.43	101.40	19	35.19
7097.	Bone (bonepriest)	54	83.81	119.60	16	29.63
7098.	2XKO WAITING ROOM (bloodyra...	54	100.88	125.12	15	27.78
7099.	Bleachinq (bleachinq)	54	85.32	103.50	12	22.22
7100.	Amarpreet (bhangu_05)	54	55.81	68.43	4	7.41
7101.	Biohazard (b10hazard_)	54	86.54	106.23	7	12.96
7102.	Krishna (aurum_est_potestas)	54	71.31	86.05	15	27.78
7103.	Arman (arminhammer)	54	50.91	66.58	4	7.41
7104.	Ava (argerami)	54	63.35	81.39	17	31.48
7105.	V (alfredpennywrth)	54	97.88	113.98	19	35.19
7106.	Alfie (alfie_op)	54	55.78	68.77	12	22.22
7107.	Round (aboutaroundabout)	54	104.67	124.39	26	48.15
7108.	Aaron (aarone123)	54	87.93	101.01	16	29.63
7109.	Aadarsh (aadarshmani)	54	59.74	71.17	8	14.81
7110.	Ravi (131raviarya)	54	78.88	91.44	11	20.37
7111.	Omar (atrozyte)	54	78.68	99.74	21	38.89
7112.	Alexander (ysgatora)	54	66.04	84.95	13	24.07
7113.	Minh (nhminh)	54	87.36	110.09	21	38.89
7114.	Ayush (tueely)	54	90.22	113.36	21	38.89
7115.	omar shereef (omar_shereef)	54	54.33	64.48	7	12.96
7116.	bluesight (maveblue)	54	54.48	66.21	4	7.41
7117.	Rohit (toba89)	54	50.77	61.47	2	3.70
7118.	Whil (whil)	54	91.72	111.55	21	38.89
7119.	MasterToru (mastertoru)	54	85.83	104.24	13	24.07
7120.	tokisuno (tokisuno)	54	103.19	127.93	29	53.70
7121.	Andrew (zengwendian)	53	106.39	120.56	24	45.28
7122.	Yuval (yuvalalfa)	53	98.69	129.63	23	43.40
7123.	:) (yuuuhhh)	53	88.88	110.23	18	33.96
7124.	yazan (yazan_2000)	53	33.67	45.48	3	5.66
7125.	Wwuly (wwuly)	53	51.89	74.07	5	9.43
7126.	wond (wond_k_)	53	77.53	91.39	15	28.30
7127.	Jimmy (user39_on_dvorak)	53	81.67	99.58	10	18.87
7128.	Harald (updatin)	53	81.59	90.47	13	24.53
7129.	Alexander (typelanterne)	53	115.05	134.66	21	39.62
7130.	Max (triangl12)	53	107.78	132.10	24	45.28
7131.	tania (tlee120)	53	111.12	123.95	22	41.51
7132.	Chadwick (supasurreal)	53	48.21	61.87	6	11.32
7133.	sir (sirflu)	53	48.68	59.24	6	11.32
7134.	Faris (silverskied)	53	73.82	88.52	10	18.87
7135.	Syimyk (sam_j5)	53	59.66	72.04	11	20.75
7136.	Rikey (reycon)	53	49.41	68.63	6	11.32
7137.	rdnblg (rdnblg2)	53	56.99	69.65	14	26.42
7138.	rap (raprics8)	53	50.70	64.69	4	7.55
7139.	Rafiul (rafiul41)	53	81.49	98.57	14	26.42
7140.	Dan (radio_falcon)	53	105.77	128.97	24	45.28
7141.	Matt (piza01134)	53	81.96	104.04	13	24.53
7142.	AP (phea0001)	53	62.04	75.37	10	18.87
7143.	Hugo (paulz_420)	53	52.82	71.52	10	18.87
7144.	Chirpy (pandress)	53	102.12	128.83	25	47.17
7145.	cheems (pachaczb_dvorak)	53	66.09	78.30	11	20.75
7146.	Mahmoud (opssheesh)	53	85.54	110.30	11	20.75
7147.	Ollie (ogreig)	53	73.14	94.76	26	49.06
7148.	huh (noirblnqqq)	53	81.51	100.22	18	33.96
7149.	Nabil (nabil_lam)	53	47.79	70.11	4	7.55
7150.	Matthew (mmongillo)	53	63.08	74.16	12	22.64
7151.	mira (mlp1214)	53	55.87	70.34	9	16.98
7152.	William (michaelp_2222)	53	104.34	129.28	29	54.72
7153.	Lets Gooooo!!! (mattymooo2021)	53	47.95	61.64	6	11.32
7154.	mangkaw (mangkaw)	53	80.82	98.48	15	28.30
7155.	LuminousEgg (luminousegg)	53	77.81	99.56	15	28.30
7156.	Link (link_hyrule)	53	111.91	140.37	30	56.60
7157.	Mikhail (limedimenine)	53	95.04	115.51	18	33.96
7158.	k (kperez755)	53	86.84	116.22	19	35.85
7159.	Gabby (kirbykirbykirby)	53	79.84	94.44	10	18.87
7160.	Kash79 (kashyap79)	53	78.74	87.71	14	26.42
7161.	Carlos (karldan)	53	56.92	69.23	7	13.21
7162.	M (kapsa)	53	75.00	87.15	11	20.75
7163.	Joy (joyjumper11)	53	92.32	115.39	23	43.40
7164.	tstats[jason823] Jason (jas...	53	84.59	110.92	17	32.08
7165.	Unigen (id3n)	53	111.73	133.11	30	56.60
7166.	Ryan (hougs)	53	60.93	76.34	9	16.98
7167.	HawkEye (hawk_eye)	53	79.20	104.88	12	22.64
7168.	Rowel Abrasado (hallelujahptl)	53	46.60	61.52	7	13.21
7169.	GreenUmbrella (greenumbrella)	53	77.58	94.99	16	30.19
7170.	Fusionbolt (fusionbolt)	53	79.14	102.79	21	39.62
7171.	fml (fmldave89)	53	77.35	111.42	13	24.53
7172.	TK (filfirst)	53	86.42	100.81	17	32.08
7173.	Ferricks (ferri_ks)	53	58.55	75.31	11	20.75
7174.	Fedwig (fedwig)	53	102.34	125.93	23	43.40
7175.	Ethan (ethanos42)	53	73.85	98.37	23	43.40
7176.	ed81 (ed81)	53	46.84	55.30	6	11.32
7177.	Dungus (duungus)	53	79.11	110.87	14	26.42
7178.	lelle (davinkyy)	53	64.01	79.83	12	22.64
7179.	Danny (danyeeast)	53	73.36	92.36	13	24.53
7180.	winter (cora_)	53	92.33	112.27	22	41.51
7181.	Deez (coolio458)	53	78.15	95.69	12	22.64
7182.	ChurM8 (churm8)	53	92.77	125.59	38	71.70
7183.	Mauro (chunkerchunk)	53	136.58	156.01	36	67.92
7184.	ben (chompytheturtle)	53	115.27	141.68	37	69.81
7185.	Chinmay (chinmays1999)	53	69.40	78.54	15	28.30
7186.	Gabriel (cashewsoda)	53	92.71	109.24	18	33.96
7187.	bueno (bueno94)	53	64.75	79.33	15	28.30
7188.	ZXCRYO (btscarbon)	53	49.79	63.50	8	15.09
7189.	Blue (blue_cow)	53	41.66	60.57	11	20.75
7190.	beek (beekul)	53	60.43	77.01	8	15.09
7191.	Bee (beejbeeabeey)	53	102.34	124.50	16	30.19
7192.	Azhar (azharbhat)	53	67.76	85.16	10	18.87
7193.	Atreides (atreidaus)	53	76.23	92.57	13	24.53
7194.	Alessandro (asterlr)	53	105.06	130.77	13	24.53
7195.	Aruzhan (arrrujjka)	53	37.20	45.69	5	9.43
7196.	NoobMaster (anakwibu04)	53	105.66	121.57	36	67.92
7197.	cal (achildslaughter)	53	103.93	127.60	20	37.74
7198.	Rohan (rohanvit)	53	52.11	67.91	6	11.32
7199.	zeyad (zeyad_yasser)	53	27.69	35.61	13	24.53
7200.	Elizabeth (elizabethjulia)	53	44.25	61.65	5	9.43
7201.	Anjali (lily2001)	53	63.10	79.69	20	37.74
7202.	jen (jccen)	53	42.46	52.57	11	20.75
7203.	Nick (gelatinpizza)	53	87.65	111.85	14	26.42
7204.	Yash (yash_1234)	53	81.67	100.09	12	22.64
7205.	Yashwanth (kakashiyash)	53	65.00	80.66	9	16.98
7206.	Brandon (brandowompus)	53	83.37	103.44	12	22.64
7207.	Blacknight6900 (blacknight6...	53	70.15	87.19	27	50.94
7208.	Generals (gwapoko12312323321)	53	64.33	83.54	11	20.75
7209.	tyenavatyen (zombiewgoku77)	52	118.05	148.84	31	59.62
7210.	Zelalem (zolamk)	52	71.19	85.24	44	84.62
7211.	Matthew (zannon23)	52	90.32	108.55	14	26.92
7212.	Yutio (yutio)	52	48.88	58.20	3	5.77
7213.	vega (xxav)	52	75.12	94.39	11	21.15
7214.	Ivan (xaboff)	52	51.03	66.11	8	15.38
7215.	Mawon (wonlee)	52	90.76	109.45	19	36.54
7216.	▬|═══ﺤ (vikas112)	52	56.40	69.92	4	7.69
7217.	TOH (tohjh)	52	79.16	88.53	22	42.31
7218.	twitter.com/jidoreuu (tfuef...	52	124.15	149.30	34	65.38
7219.	TcJon (tcjon)	52	49.52	66.33	5	9.62
7220.	Nicholas (t0903591)	52	82.99	98.44	10	19.23
7221.	Sid (sxd_ss)	52	70.14	88.88	13	25.00
7222.	a (stanrude)	52	68.41	82.05	11	21.15
7223.	sfairat (sfairat)	52	55.24	63.56	6	11.54
7224.	shashi (sekhar184131)	52	81.38	98.42	13	25.00
7225.	Scar (scarskald)	52	66.64	88.05	15	28.85
7226.	Saurabh (saurabh002)	52	61.74	68.98	12	23.08
7227.	Corentin (risemu)	52	80.36	96.49	9	17.31
7228.	ダル (rex_rex)	52	75.80	102.57	15	28.85
7229.	John McCarthy (providerone)	52	102.83	118.87	25	48.08
7230.	PickleCork (proogle_can)	52	81.82	96.34	16	30.77
7231.	PracticeTouch (practicingto...	52	48.31	61.34	2	3.85
7232.	J (petalss)	52	67.98	84.54	11	21.15
7233.	zhlmsji (pathhologic)	52	101.27	141.13	23	44.23
7234.	Parsa (parsasq)	52	55.49	70.14	9	17.31
7235.	atoms (overblown)	52	67.41	81.64	27	51.92
7236.	nope251 (nope251)	52	60.36	72.92	5	9.62
7237.	Ian (nelson_kempkey)	52	106.04	133.29	17	32.69
7238.	Morgan (morgbot)	52	109.06	139.30	26	50.00
7239.	Morgan (morgansoares6)	52	70.41	93.60	9	17.31
7240.	Morad (morad_the_beast)	52	70.52	80.61	11	21.15
7241.	Ben (meh_guy)	52	109.51	128.84	34	65.38
7242.	Duc (maitheduc2002)	52	38.86	46.84	4	7.69
7243.	Ma (mahyunyi)	52	72.39	92.00	12	23.08
7244.	Onii-Chan (lowtall2006)	52	98.45	116.52	22	42.31
7245.	loungecore (loungecore)	52	98.76	116.52	21	40.38
7246.	lior (liorlubek)	52	58.84	78.33	10	19.23
7247.	LemonCatTAT (kiddie_sallie)	52	95.14	112.34	16	30.77
7248.	Kermilian Nguyen (kermilian...	52	59.22	75.08	10	19.23
7249.	Sadi (kandeemusic)	52	83.08	103.97	21	40.38
7250.	Suntery (jennk1)	52	59.26	71.39	9	17.31
7251.	Henrik (iupgrade)	52	95.94	116.15	22	42.31
7252.	Icchan (icchan84)	52	73.61	92.15	13	25.00
7253.	mr.hogsman (hogsman)	52	95.88	126.36	23	44.23
7254.	Henrique (henri3287)	52	45.84	56.94	3	5.77
7255.	Greg (gregdahwhale)	52	86.42	108.14	13	25.00
7256.	God (godlevel)	52	85.32	102.04	43	82.69
7257.	Elliot (girtholomew)	52	69.16	78.80	10	19.23
7258.	Fionalee (fionalee)	52	90.94	107.70	16	30.77
7259.	Tony (feetiswhynocaps)	52	90.09	112.37	19	36.54
7260.	lillian (fartgaret)	52	80.35	127.53	20	38.46
7261.	Eujean (eujean)	52	103.06	119.70	26	50.00
7262.	george (doctoras)	52	98.31	121.16	26	50.00
7263.	Delphie (delphie_)	52	106.44	127.60	27	51.92
7264.	nhim (chikiro)	52	62.88	83.20	7	13.46
7265.	max (chaxmase)	52	78.13	97.32	15	28.85
7266.	Ivan (breadguru)	52	51.62	61.47	7	13.46
7267.	Minh (blue002)	52	53.51	60.69	9	17.31
7268.	blendin (blendin11)	52	90.65	109.48	12	23.08
7269.	Batian (batiti51)	52	67.69	81.84	10	19.23
7270.	BARAA (barrettshot)	52	97.50	113.90	16	30.77
7271.	Ayokk (ayokk)	52	83.10	110.76	10	19.23
7272.	Jongwon (aviationchief)	52	90.67	121.04	45	86.54
7273.	ashalisalamdanam (ashalisal...	52	84.76	96.24	16	30.77
7274.	Ankit (ankit_chauhan)	52	69.04	86.35	15	28.85
7275.	ali-goes (alibookie)	52	85.91	117.12	15	28.85
7276.	Neanderthal (alacrity95)	52	127.41	170.60	27	51.92
7277.	abindev (abindev)	52	31.78	41.86	7	13.46
7278.	Julia (348753021)	52	117.41	139.09	33	63.46
7279.	Kevin (kevin41714)	52	78.99	93.10	12	23.08
7280.	Josh (fearzenemy)	52	56.24	74.16	8	15.38
7281.	Gary (yrag)	52	69.01	88.79	15	28.85
7282.	Pourya (orangefourinchdoorh...	52	45.29	55.91	6	11.54
7283.	Alexander (aexae)	52	51.45	79.58	5	9.62
7284.	GoD (1_god_1)	52	61.68	74.42	4	7.69
7285.	Darkhan (zhora577)	51	44.09	68.11	3	5.88
7286.	Delbert (zeckxel)	51	71.71	83.87	15	29.41
7287.	Yami (yamiph)	51	108.10	145.23	33	64.71
7288.	Ryan (xxhiny)	51	110.05	125.01	25	49.02
7289.	Jaris (xersai)	51	98.43	123.69	21	41.18
7290.	asphyxia (wylx)	51	65.44	93.04	12	23.53
7291.	William (wwuhoo)	51	75.85	94.00	14	27.45
7292.	Vyc (vyctor661)	51	93.70	115.49	17	33.33
7293.	Isaak (verysexyman)	51	51.21	66.12	5	9.80
7294.	Ernesto (venkinta)	51	86.14	103.46	21	41.18
7295.	Asto (ukikunz)	51	113.19	139.74	26	50.98
7296.	Teun (typingthunder)	51	48.63	57.89	2	3.92
7297.	consistently inconsistent (...	51	91.54	124.48	18	35.29
7298.	Swift (swiftens)	51	89.68	110.73	16	31.37
7299.	Stevie (stevie_thee_shep)	51	99.82	130.06	24	47.06
7300.	Chaerity (ssamurai)	51	88.36	101.99	14	27.45
7301.	Vela (somkungza)	51	78.52	99.25	15	29.41
7302.	sofa (sofaaa)	51	98.39	129.19	15	29.41
7303.	Chad (sixpacksexy)	51	100.92	119.79	16	31.37
7304.	mosho (sidosido)	51	85.39	102.59	12	23.53
7305.	Shin (shinfx)	51	87.44	106.58	20	39.22
7306.	Shayan (shanoo92)	51	63.38	83.59	26	50.98
7307.	Chikin (sailestial)	51	92.33	115.78	18	35.29
7308.	Safi (safiikram)	51	44.56	55.00	5	9.80
7309.	beans (rlbeans)	51	86.22	106.81	19	37.25
7310.	Raghav (raghavlaad)	51	70.77	91.80	13	25.49
7311.	Pro (progeorge123)	51	100.13	131.70	24	47.06
7312.	PoopBug (poop_bug)	51	93.80	110.58	19	37.25
7313.	Phoenix (phoenixwolfer)	51	103.30	132.55	26	50.98
7314.	laptop keyb (pasta2)	51	135.47	167.58	21	41.18
7315.	pepperooni (papipepperooni)	51	84.85	100.56	22	43.14
7316.	peckcs (opecks)	51	82.67	99.03	19	37.25
7317.	nehal (nehal1337)	51	115.13	134.72	28	54.90
7318.	Joshua (mrteeentee)	51	111.15	137.62	23	45.10
7319.	Mr. (mrasp)	51	61.74	78.31	13	25.49
7320.	anya (monarchunder)	51	95.90	124.26	29	56.86
7321.	Tenebrific (molkri)	51	92.55	107.25	17	33.33
7322.	Peetor (milleniumpoo)	51	86.04	114.36	13	25.49
7323.	Paolo (mcnugget25)	51	117.05	137.82	32	62.75
7324.	Max (maxma_69)	51	109.26	139.68	32	62.75
7325.	matan (matanselig)	51	27.31	34.56	6	11.76
7326.	Marwoleath (marwoleath)	51	76.49	90.97	7	13.73
7327.	OmaR (mandoo120)	51	51.77	63.83	7	13.73
7328.	Eric (mainsterr)	51	73.60	99.37	30	58.82
7329.	andrea (lotta98)	51	64.73	78.07	10	19.61
7330.	Kush (kushtek)	51	44.37	64.78	11	21.57
7331.	Kunal (kunal299)	51	76.08	94.11	15	29.41
7332.	Filip (keyboardwarrior772)	51	97.87	133.91	18	35.29
7333.	Jimmy (jx297)	51	103.59	117.21	24	47.06
7334.	Julian (julianalex2307)	51	92.63	129.17	21	41.18
7335.	JuanimelsPH (juanimels)	51	85.92	103.86	9	17.65
7336.	James (jpnjpn6)	51	87.48	109.54	22	43.14
7337.	Jeff (jooffy)	51	61.42	79.18	9	17.65
7338.	Melchorio (jcquints)	51	95.47	113.62	18	35.29
7339.	jamilxt (jamilxt)	51	60.96	73.84	14	27.45
7340.	Jamie (jamiegre)	51	114.59	141.98	25	49.02
7341.	Isak (isapan)	51	92.82	110.48	18	35.29
7342.	The Russian (imdarussian)	51	74.72	89.34	14	27.45
7343.	Jack (hyydenjakcz)	51	80.51	99.72	12	23.53
7344.	ばにらー　tired goodby...	51	123.37	177.82	21	41.18
7345.	Hitendra (hitendra)	51	72.68	96.01	37	72.55
7346.	zhz (haohauz)	51	126.73	156.22	35	68.63
7347.	shmoney (gupty_gang)	51	73.37	87.11	13	25.49
7348.	nanashi (greenjohnny135)	51	76.69	101.72	9	17.65
7349.	Jako (frafdothehero)	51	76.89	93.34	10	19.61
7350.	Fametime (fametime)	51	126.59	166.10	34	66.67
7351.	Elie (eliepr0)	51	117.57	142.10	24	47.06
7352.	Doge (dopeydoge)	51	79.99	104.19	15	29.41
7353.	Daniel (dna89)	51	70.14	85.58	14	27.45
7354.	Tristan (devyl)	51	83.12	95.54	13	25.49
7355.	epic (densehelium)	51	72.33	84.11	16	31.37
7356.	Akhil (deathstroke99)	51	64.01	75.90	9	17.65
7357.	Dagger (daggerbxii)	51	66.80	86.83	12	23.53
7358.	Radius (d4iry)	51	131.99	172.61	35	68.63
7359.	criasier (criasier)	51	113.97	138.02	31	60.78
7360.	Jason (cookja2000)	51	86.95	109.56	11	21.57
7361.	Brandon (boredintern123)	51	127.60	151.95	40	78.43
7362.	Blake (blaketrombone)	51	84.26	108.56	19	37.25
7363.	bioboy246 (bioboy246)	51	105.35	131.73	23	45.10
7364.	Bekzodbek (bekzod003)	51	44.17	63.11	12	23.53
7365.	owen (beemochop)	51	67.98	83.75	6	11.76
7366.	Badal Babu (bcube_nimble)	51	93.90	106.78	19	37.25
7367.	leon (bangingmyheadonthewall)	51	62.65	83.51	8	15.69
7368.	heck (aw_heck)	51	38.89	53.45	6	11.76
7369.	Ava (ava_gina)	51	60.38	69.62	4	7.84
7370.	TGG-J5NK5ZJ6LY (an66)	51	119.74	138.91	29	56.86
7371.	Alex (alex_mingguk)	51	73.27	95.76	13	25.49
7372.	aleph (alephyphen)	51	106.87	129.77	21	41.18
7373.	ahmed (ahmedmadgy711)	51	61.45	77.19	15	29.41
7374.	Adam (adumbsun)	51	101.63	134.43	23	45.10
7375.	adrianna (adriannna)	51	84.06	115.52	8	15.69
7376.	Abu Shaikh (abu_nibir)	51	67.46	78.11	11	21.57
7377.	Albert (abt8601)	51	96.62	113.54	23	45.10
7378.	𝔽₃₁ (2802)	51	104.78	124.05	30	58.82
7379.	Steve (lehoangkhang9)	51	76.22	89.88	15	29.41
7380.	Michaiah (pig101)	51	62.93	76.66	13	25.49
7381.	Jai (jaijoshi)	51	59.39	73.56	5	9.80
7382.	IdkFreaky (fs_frenchfries77)	51	66.55	76.20	11	21.57
7383.	Minate (minate)	51	53.24	64.44	4	7.84
7384.	Zi Liang (pohziliang)	51	57.97	71.58	11	21.57
7385.	Timo (vryzin)	51	48.72	63.36	5	9.80
7386.	Alyssa (agraha91)	51	64.83	76.84	15	29.41
7387.	Airwide (airwide)	51	40.16	47.01	7	13.73
7388.	Lorenz David (lupusregina)	51	83.82	105.50	14	27.45
7389.	Zayden (zayden_blaze)	50	91.27	121.91	18	36.00
7390.	zeroguard (z3r0gu4rd)	50	46.83	55.81	7	14.00
7391.	Yung (yungmyg)	50	39.36	48.94	4	8.00
7392.	Mandom (xristos980)	50	69.15	80.17	10	20.00
7393.	ℱ𝔯𝔢𝔢𝔡𝔬𝔪...	50	83.93	102.78	13	26.00
7394.	root (wanna_be_pro)	50	51.34	63.61	3	6.00
7395.	Tempest (tempestreu)	50	58.07	71.47	10	20.00
7396.	Harri (teddybaker)	50	53.22	63.67	7	14.00
7397.	Tadas (tadasmak)	50	76.89	91.00	10	20.00
7398.	Sylptic (sylptic)	50	98.74	118.60	19	38.00
7399.	صنديد (sundid)	50	91.81	114.46	14	28.00
7400.	DK ALONE (speed_typing)	50	47.49	62.38	4	8.00
7401.	¯\_(ツ)_/¯ (some_guy4444)	50	91.21	110.26	16	32.00
7402.	Tommy (snoopyisop)	50	105.03	148.25	21	42.00
7403.	slower than s2000 (slowpacito)	50	140.91	173.35	40	80.00
7404.	simon (simonhor1)	50	91.04	118.59	16	32.00
7405.	Shreyas (shreyas_jani)	50	74.38	93.45	15	30.00
7406.	deceptive (sergisreal)	50	93.92	109.54	16	32.00
7407.	ks (sempiedram)	50	87.85	108.68	11	22.00
7408.	SapCK (sapck)	50	99.91	122.21	21	42.00
7409.	Rodrigo (rugoso)	50	96.80	113.73	22	44.00
7410.	Isabella (refundmybirth_21)	50	60.97	79.86	12	24.00
7411.	pulkit (pulkitb)	50	31.04	46.89	4	8.00
7412.	lu (prymuslu)	50	90.70	106.76	16	32.00
7413.	Mihir (plibither8)	50	82.56	95.41	20	40.00
7414.	ben (panda_jellyfam)	50	97.44	117.27	25	50.00
7415.	PWian racer from chennai (o...	50	38.96	62.84	6	12.00
7416.	nostango (nostango)	50	79.68	93.83	16	32.00
7417.	Noridomi (noridomi)	50	86.96	102.83	14	28.00
7418.	ninja (ninja_op)	50	86.74	104.12	20	40.00
7419.	Nick (nick_txt)	50	93.53	120.25	23	46.00
7420.	TYPERACER (natem135)	50	96.73	126.65	17	34.00
7421.	Naga (nagaspar)	50	56.12	81.07	14	28.00
7422.	Narasimha Nadh (nadh_7)	50	70.93	86.99	15	30.00
7423.	Muhammad (muhammad95959)	50	44.84	52.48	7	14.00
7424.	MuffinMike (muffinmike)	50	91.06	108.87	13	26.00
7425.	Martin (mpgo13)	50	86.62	110.34	15	30.00
7426.	Matthew (mooncatcher)	50	73.63	96.51	9	18.00
7427.	Lloyd (milanh)	50	115.19	139.21	31	62.00
7428.	Steven (melkies)	50	80.94	90.94	16	32.00
7429.	mats (matserino)	50	49.84	65.02	6	12.00
7430.	Maffin (m4ff1n)	50	83.47	98.10	13	26.00
7431.	Lepry (leprykun)	50	63.99	82.98	17	34.00
7432.	Y Lee (leengau)	50	58.82	77.50	7	14.00
7433.	Stephen (laddlez)	50	81.56	109.76	13	26.00
7434.	𝐊 𝐑 𝐀 𝐊 𝐄 �...	50	95.77	113.20	19	38.00
7435.	Kevin (kimchioncolemak)	50	96.01	109.53	21	42.00
7436.	Kaushik (kaushik_nna)	50	89.65	107.14	18	36.00
7437.	ジョーヨ (joeyo)	50	107.11	123.30	24	48.00
7438.	joanne (joannekim63)	50	92.89	109.95	23	46.00
7439.	Jose (jduran7)	50	80.34	103.63	14	28.00
7440.	Jake (jdogcat1)	50	62.28	79.84	9	18.00
7441.	Jai (jaideepjr)	50	105.54	122.79	16	32.00
7442.	Instinct (instinct1)	50	96.16	130.93	20	40.00
7443.	Enzo (hypertxters)	50	94.19	115.63	25	50.00
7444.	h (huyho1207)	50	90.08	118.18	27	54.00
7445.	hossameldien (hossam23177)	50	59.83	75.25	9	18.00
7446.	haidanos (haidanos)	50	79.98	94.44	12	24.00
7447.	H4ndss (h4ndss1)	50	84.38	105.87	16	32.00
7448.	Gaurav (gauravvv2204)	50	51.74	64.50	4	8.00
7449.	Joseph (gauntdarkness)	50	79.94	112.32	7	14.00
7450.	TheStyne (fixinit1)	50	87.63	120.50	17	34.00
7451.	R0merol (farisfaikar_r)	50	73.40	88.74	16	32.00
7452.	yossi (exseibar)	50	57.21	72.88	3	6.00
7453.	Mohit (dumb_avocado)	50	51.99	65.89	5	10.00
7454.	Duc (dukenhu)	50	92.60	108.83	16	32.00
7455.	ddo (detdetjo)	50	81.26	94.55	15	30.00
7456.	yop (desuperslayer)	50	55.21	71.98	11	22.00
7457.	Name (defaultname)	50	79.63	111.87	15	30.00
7458.	don (dandhi)	50	85.70	102.46	20	40.00
7459.	Stoian (creep_fire97)	50	102.34	117.42	15	30.00
7460.	Connor (congoman)	50	47.47	59.95	4	8.00
7461.	Abhishek (coderguy1)	50	65.63	76.68	7	14.00
7462.	chlovis (chlovis)	50	28.02	41.81	7	14.00
7463.	Tilt (brianrk25)	50	72.05	85.73	49	98.00
7464.	BOBA (bobavfett)	50	54.58	66.60	6	12.00
7465.	G B (believeb)	50	27.09	37.49	33	66.00
7466.	китаец (artur_)	50	74.72	86.59	13	26.00
7467.	Arslan (arslan_03)	50	69.23	86.32	11	22.00
7468.	arimauta (arimauta)	50	43.28	56.71	1	2.00
7469.	Afaq (afaqkhan)	50	85.17	103.64	14	28.00
7470.	:] (acision)	50	78.38	93.71	15	30.00
7471.	2Slow (2slowkevin)	50	38.96	48.24	5	10.00
7472.	congrats on 1M club (23kuzn...	50	113.52	154.39	27	54.00
7473.	Katherine (kat5801)	50	52.65	64.00	1	2.00
7474.	SirAmateur (namelessamateur)	50	63.69	78.42	10	20.00
7475.	Ahmad (dr_ahmad)	50	42.55	53.38	5	10.00
7476.	Protek (protekripper)	50	38.30	48.00	5	10.00
7477.	chaaruzu (toishii)	50	63.55	82.57	5	10.00
7478.	Nate (jazzybanana)	50	50.19	63.92	9	18.00
7479.	Yuvraj (yuvraj_sharma)	50	64.06	79.40	12	24.00
7480.	DumbPeanut (dumb_peanut10)	50	45.40	56.10	4	8.00
7481.	Ankur (slownsteady108)	50	54.29	64.97	9	18.00
7482.	Thomas (tomtwo)	50	73.75	93.04	12	24.00
7483.	(negro100000_)	50	65.68	80.36	21	42.00
7484.	Happy129 (happy129)	50	63.68	78.76	6	12.00
7485.	Priyanshu (_priyanshu_)	49	56.54	67.30	10	20.41
7486.	Ziad Zaki (ziadzaki)	49	90.83	133.52	23	46.94
7487.	adamz (zhaanga09)	49	79.58	100.71	17	34.69
7488.	Shayan (zackroos)	49	70.26	91.23	9	18.37
7489.	Tuomo (ystavani_marko)	49	66.14	79.55	11	22.45
7490.	Yordanes (yordanes)	49	39.14	48.74	1	2.04
7491.	__8k.11Ine_ (yassine999)	49	68.59	87.49	11	22.45
7492.	savannah (wiggywonka)	49	100.51	118.85	17	34.69
7493.	Gil (violetgil)	49	113.18	124.64	21	42.86
7494.	Venderex (venderex)	49	94.43	139.23	25	51.02
7495.	Vahid (vahidmoradpour)	49	35.41	43.39	0	0.00
7496.	Mason (unelevate)	49	111.79	136.11	32	65.31
7497.	TypingAway (typinggggggg)	49	84.57	99.95	15	30.61
7498.	tragiƘ (tragik)	49	95.80	121.53	45	91.84
7499.	Fran (tippidytap)	49	74.42	94.95	14	28.57
7500.	Tipper_Typer (tipper_typer)	49	77.81	100.87	13	26.53
7501.	Lawrence (thunder_drain)	49	78.05	103.66	12	24.49
7502.	Kerem (tearsfears)	49	67.01	81.93	8	16.33
7503.	Pragyan (swordfish999)	49	76.30	101.92	7	14.29
7504.	dozingoff (stopcomparing)	49	99.05	118.45	22	44.90
7505.	Samuel (spiriteater)	49	84.95	96.81	15	30.61
7506.	Sophia (sophianotfound)	49	66.02	93.43	8	16.33
7507.	yeet to space (sn00py1310)	49	72.69	97.84	17	34.69
7508.	Skyyy06 (skyyy06)	49	99.52	121.67	17	34.69
7509.	SH (shrony)	49	64.60	75.41	11	22.45
7510.	Shawna (shawnanic856)	49	93.97	111.89	17	34.69
7511.	Sebastian (sev___)	49	104.42	136.40	20	40.82
7512.	Danyl (seataco)	49	56.09	76.80	16	32.65
7513.	sammysamm (sammysamm)	49	77.68	94.92	12	24.49
7514.	Rully (rully_monas)	49	72.35	94.39	11	22.45
7515.	Rachael (rachaelpoedia)	49	58.83	68.90	7	14.29
7516.	zetria (primalknight)	49	143.50	169.47	33	67.35
7517.	F*ck Zelenskyy (overmake)	49	82.81	99.26	18	36.73
7518.	Orblil (orblil)	49	68.41	97.62	13	26.53
7519.	Glenn (nnelg)	49	98.81	133.27	7	14.29
7520.	101 (needlepaws)	49	83.52	94.36	19	38.78
7521.	Brett (mrmahn)	49	110.64	125.97	33	67.35
7522.	may9 (may9)	49	60.47	71.84	12	24.49
7523.	Mati🅱IKL (mati2ooo)	49	97.95	116.03	20	40.82
7524.	Normal (marlon_caleb)	49	72.31	87.34	10	20.41
7525.	Mach 20 (mach20)	49	63.50	80.62	10	20.41
7526.	Lucifer (lucifer_kas)	49	88.36	116.04	23	46.94
7527.	repyx (lordgado)	49	51.27	69.40	7	14.29
7528.	Lilac (lilaclily)	49	21.91	28.51	9	18.37
7529.	Learn to pro (learntopro)	49	63.26	73.66	8	16.33
7530.	leaf (leafblower174)	49	103.59	139.80	32	65.31
7531.	Eduardo (laloaguirre720)	49	64.65	80.95	14	28.57
7532.	Q (kwhan)	49	103.38	124.09	27	55.10
7533.	jz (kokosha)	49	85.34	107.02	19	38.78
7534.	kiv (kivv)	49	86.85	108.88	20	40.82
7535.	kazden (kazdenetienne)	49	82.92	105.86	18	36.73
7536.	kalxoz (kalxoz97)	49	65.14	76.15	11	22.45
7537.	Tam (josephtambmt)	49	62.03	78.99	8	16.33
7538.	John (johnzeds)	49	77.38	95.20	8	16.33
7539.	Job (job007)	49	104.33	122.28	22	44.90
7540.	Ryan (jellyzerg)	49	90.81	105.96	21	42.86
7541.	FeelsGoodMan (jeffryvanessa1)	49	60.61	74.19	17	34.69
7542.	Jorge (jdominguezzz)	49	84.22	104.45	17	34.69
7543.	Jakm (jahkm)	49	47.89	60.92	8	16.33
7544.	Myro Bryan (iskwagong)	49	93.04	113.96	19	38.78
7545.	TypingGuy (iramus)	49	97.98	121.56	16	32.65
7546.	ABDELLATIF (hktitof)	49	61.26	79.90	11	22.45
7547.	Himanshu (himanshukpr)	49	42.69	50.83	4	8.16
7548.	haquaman_workman (haquaman_...	49	64.40	75.09	9	18.37
7549.	ILikeCars07 (gruhith)	49	86.25	97.81	12	24.49
7550.	rock dog (generic_exe)	49	81.62	95.19	16	32.65
7551.	Gianni (general_patches)	49	84.34	96.13	21	42.86
7552.	Non-quit acc (escri)	49	130.01	146.04	32	65.31
7553.	epigee (epigee)	49	105.37	128.88	17	34.69
7554.	Enclosed (enclosedletter)	49	85.02	103.09	17	34.69
7555.	ellie (ellmell13)	49	44.98	58.14	4	8.16
7556.	HMan (edhac)	49	98.06	123.46	16	32.65
7557.	Dziobak (dziobak)	49	92.59	118.74	15	30.61
7558.	Dumi (dumizeu)	49	43.92	55.47	6	12.24
7559.	Dontmindme (dontmindmepls)	49	50.62	62.40	5	10.20
7560.	Jay (dflkn4900s4)	49	82.99	99.21	16	32.65
7561.	DegageSpoon9280 (degagespoo...	49	53.11	63.13	6	12.24
7562.	Domo (dasuxosu)	49	85.71	116.49	20	40.82
7563.	Jake (darkxfade240)	49	79.43	93.73	12	24.49
7564.	Coru (coru12)	49	83.50	101.33	15	30.61
7565.	AHHH (chuckles1357)	49	88.83	110.67	11	22.45
7566.	Ryan Smith (chickenhelmet)	49	71.29	92.21	16	32.65
7567.	asdasd (chaizhengwen)	49	89.86	107.73	16	32.65
7568.	Celestrom (celestrom)	49	70.22	88.92	11	22.45
7569.	Carly (carlytarantino)	49	80.59	100.17	11	22.45
7570.	Typinator (candymn3)	49	100.75	124.45	17	34.69
7571.	Sml (cactusman215)	49	96.79	109.80	18	36.73
7572.	Bogoya (bogoya)	49	74.76	88.06	12	24.49
7573.	bobs (bobsbee)	49	33.91	49.31	4	8.16
7574.	Noah (bobothechimpanzee)	49	87.17	100.86	15	30.61
7575.	MM (blunderingpeon12)	49	82.81	99.86	12	24.49
7576.	Bryan (blcm123)	49	108.64	120.88	21	42.86
7577.	big (bigfudge14)	49	95.17	113.86	23	46.94
7578.	Beheshta (beheshta)	49	59.10	74.48	7	14.29
7579.	Marikyuun (bananaking121)	49	110.29	154.91	32	65.31
7580.	Pushkar (azuloto)	49	65.44	77.81	9	18.37
7581.	Ayush (ayush_1511)	49	67.34	80.07	18	36.73
7582.	aasdfa (awid)	49	90.29	104.59	16	32.65
7583.	𝕬𝖛𝖊𝖗𝖆𝖌�...	49	83.68	111.21	41	83.67
7584.	Ahnaf Shahriar (asifthegreat)	49	90.90	110.00	21	42.86
7585.	Arlene (arlenieeweenie)	49	132.39	165.75	35	71.43
7586.	Argon (argon273)	49	79.83	112.84	13	26.53
7587.	John (apathy_incarnate)	49	63.30	76.19	11	22.45
7588.	Antony (antonleghost)	49	89.37	116.44	15	30.61
7589.	Ankit (anktwd)	49	50.12	57.62	2	4.08
7590.	(altroq)	49	90.23	111.20	17	34.69
7591.	Adrian (adrianlee196)	49	117.16	133.24	26	53.06
7592.	Nicolas (acut3)	49	64.80	81.89	9	18.37
7593.	CrazyNeighbor (5qcheng007)	49	100.78	121.85	20	40.82
7594.	andrew (gorillaman9k)	49	67.28	82.64	30	61.22
7595.	pratham (pratham_s_k)	49	59.31	67.07	4	8.16
7596.	Kendall (fishstix_)	49	79.30	97.33	15	30.61
7597.	nakshatra (ng07)	49	20.62	25.38	9	18.37
7598.	Z4ZI3 (z4zi3)	49	65.71	78.32	41	83.67
7599.	Sankalp (sankalpgupta)	49	71.28	86.66	10	20.41
7600.	Fluroo (flurouu)	49	79.51	96.85	17	34.69
7601.	⚽⚽⚽⚽🏆🏆 (simon...	49	73.35	93.37	15	30.61
7602.	White (whitewolf04)	49	77.44	97.15	16	32.65
7603.	tstats[_jamin_] (_jamin_)	48	85.27	102.65	25	52.08
7604.	zatoichi (zatoishwan)	48	114.17	143.04	21	43.75
7605.	Yash (yomiiiii)	48	68.18	94.89	11	22.92
7606.	Jeffrey (weijini)	48	74.82	92.32	8	16.67
7607.	h (vondo28)	48	82.62	108.53	9	18.75
7608.	Vladislove (vladislove)	48	94.51	108.65	10	20.83
7609.	Vishal (vishalsaxena)	48	50.88	63.70	4	8.33
7610.	Jared (varmitz1)	48	82.19	103.45	14	29.17
7611.	Vab (vaheebee)	48	93.36	104.27	15	31.25
7612.	UnreliableSpare (unreliable...	48	63.49	77.75	9	18.75
7613.	Pere (unbreaksee)	48	90.65	104.53	15	31.25
7614.	roni raz (unbelieveable)	48	117.17	138.36	25	52.08
7615.	Tom (tvdb2003)	48	54.30	65.33	3	6.25
7616.	Turbo (turbo_typist)	48	90.98	142.68	15	31.25
7617.	DatGG (tristanko)	48	57.61	75.52	4	8.33
7618.	touchtypepracticer69 (touch...	48	85.79	97.33	12	25.00
7619.	Speed (thenimblefinger)	48	120.29	166.50	22	45.83
7620.	Kunal (thegamerkunal)	48	74.04	94.75	10	20.83
7621.	Andy (tempestxciii)	48	74.91	92.10	29	60.42
7622.	Sugeeth (sugeeth14)	48	77.91	110.96	14	29.17
7623.	ssshanto (ssshanto)	48	116.03	150.32	21	43.75
7624.	Srean (sreantsm)	48	34.24	46.73	3	6.25
7625.	Sphage (sphage)	48	91.82	117.10	18	37.50
7626.	Taslima (smita123)	48	41.17	52.87	27	56.25
7627.	Skewlankus (skewlankus)	48	62.34	79.15	11	22.92
7628.	SilicGK (silicgk)	48	89.76	121.79	12	25.00
7629.	hehe (shindo333)	48	86.58	100.18	20	41.67
7630.	SackHeadSam (sackheadsam)	48	44.07	63.52	4	8.33
7631.	Ryan (ryanhz)	48	91.23	113.77	18	37.50
7632.	ron (ronj23)	48	75.50	89.81	9	18.75
7633.	ronaldo (ronaldo_gao)	48	100.88	131.04	18	37.50
7634.	Remy (rmds_dln)	48	84.39	121.02	23	47.92
7635.	Acceptance (riskirw)	48	110.90	130.05	27	56.25
7636.	Rido (ridoho)	48	63.50	82.35	14	29.17
7637.	Joash (raz3rdarkkill)	48	79.91	98.60	13	27.08
7638.	James (raking123)	48	71.88	89.41	11	22.92
7639.	Quinco (quinco)	48	45.83	61.29	5	10.42
7640.	Praveen (praveen3791)	48	84.72	98.48	11	22.92
7641.	Simon (plantsdragon)	48	59.25	73.54	11	22.92
7642.	Chris (papadroop1)	48	119.52	144.28	23	47.92
7643.	Minnot (omar10211)	48	60.66	80.63	9	18.75
7644.	Ogg (ogg_)	48	75.30	89.29	16	33.33
7645.	NU (nusensei)	48	103.07	133.53	26	54.17
7646.	Niv (nivkapadia)	48	62.36	77.66	13	27.08
7647.	Kevin (niveik)	48	94.78	126.50	17	35.42
7648.	nikolas (nicknt)	48	71.32	87.21	8	16.67
7649.	Amir (nao.paladin@yahoo.com)	48	102.00	121.34	24	50.00
7650.	MsStPeter (msstpeter)	48	74.48	91.51	14	29.17
7651.	mr (mr_pineapple069)	48	68.17	86.05	17	35.42
7652.	BOB (mroglan)	48	84.51	96.49	12	25.00
7653.	MRBC (mrbc)	48	57.90	76.42	6	12.50
7654.	MrPoop (mother_lover)	48	63.11	77.28	10	20.83
7655.	mgamble (mgamble)	48	78.73	96.41	10	20.83
7656.	Mohammed (md_islam)	48	78.36	90.68	12	25.00
7657.	Andrew (mcentag)	48	112.89	140.75	20	41.67
7658.	Marius (mariukas_)	48	78.06	88.41	10	20.83
7659.	lithium's after image (lith...	48	127.09	148.68	30	62.50
7660.	Matt (lightning_mcqueef)	48	114.57	136.02	26	54.17
7661.	KA (keshavgrwl96)	48	81.35	104.98	7	14.58
7662.	Ken (kenrender)	48	42.21	50.38	3	6.25
7663.	Kc (kchehez)	48	75.10	94.90	6	12.50
7664.	June (ju_1304)	48	80.30	99.19	10	20.83
7665.	suns (jesse_kim)	48	67.08	86.23	20	41.67
7666.	Jam (jamtri)	48	114.19	134.91	26	54.17
7667.	Winter (jamesbandit)	48	52.11	62.60	3	6.25
7668.	Jai (jais)	48	83.61	99.55	12	25.00
7669.	Jack (jack2905)	48	94.84	117.44	18	37.50
7670.	Daniel (itypekindaquick)	48	64.71	76.29	9	18.75
7671.	Invictus (invictus69)	48	97.73	108.84	15	31.25
7672.	MKarma (im69d)	48	42.38	53.25	7	14.58
7673.	Ilana (ilana12)	48	57.72	68.22	6	12.50
7674.	hyhu (hyhy233)	48	78.12	91.45	11	22.92
7675.	arache (howeyzeh)	48	73.07	105.12	15	31.25
7676.	BNYKGDT (hopelessly_serious)	48	92.94	117.18	19	39.58
7677.	Teng (hentaiba3)	48	74.50	90.18	24	50.00
7678.	Hau (hauhauh)	48	73.54	86.29	15	31.25
7679.	Hadise (hadise)	48	123.30	161.15	31	64.58
7680.	Abdullah (ghadanfar)	48	96.33	119.45	17	35.42
7681.	Gridcoin (gabeneweii)	48	113.33	158.10	30	62.50
7682.	Leon (flopasd)	48	82.34	108.73	11	22.92
7683.	Justin (flamingoed02)	48	108.30	122.62	21	43.75
7684.	Fiona (fiona55)	48	88.15	104.17	13	27.08
7685.	Nik (fastesttyper101)	48	70.63	95.02	7	14.58
7686.	Nathan (el_cap_i_tan)	48	89.05	102.98	23	47.92
7687.	Edmund (edmundtyw1)	48	115.60	146.08	39	81.25
7688.	donkeysbanana (donkeysbanana)	48	83.83	105.76	18	37.50
7689.	Dylan (dmc71298)	48	103.60	129.06	27	56.25
7690.	Daniel (dansku01)	48	77.01	101.93	16	33.33
7691.	cubeian (cubeian)	48	59.09	74.41	5	10.42
7692.	CrpL (crippleed)	48	89.81	108.62	19	39.58
7693.	Captain (bobispro2)	48	110.13	124.54	25	52.08
7694.	Colin (blank9167)	48	114.35	141.20	26	54.17
7695.	Jherome Eduard (bl4nkk)	48	56.07	73.22	5	10.42
7696.	Soog (beez23)	48	93.50	105.05	11	22.92
7697.	auerabreak (auera)	48	81.98	98.06	11	22.92
7698.	(ashish_antil248)	48	57.93	74.74	8	16.67
7699.	Luis Victor (anubis_9)	48	74.25	86.48	11	22.92
7700.	Amritesh (anodyne12371)	48	36.07	51.13	2	4.17
7701.	amin (anmiimna)	48	60.34	73.40	8	16.67
7702.	Alex (amarcus0100)	48	52.65	66.83	10	20.83
7703.	alfie (alfieisback)	48	73.79	90.07	15	31.25
7704.	Aleksa (alexample)	48	80.08	93.30	16	33.33
7705.	Aidin (aidin177)	48	110.38	129.08	21	43.75
7706.	Acnologia (acnologia_123)	48	88.45	96.83	9	18.75
7707.	Frederich (acerx032)	48	87.41	106.71	18	37.50
7708.	tstats[0anonymous0123] (0an...	48	56.11	69.40	5	10.42
7709.	C4ll Me Sir (ssidd)	48	83.10	99.74	7	14.58
7710.	LaxiMax (laximax)	48	68.06	86.41	17	35.42
7711.	Noah (holyrhombi)	48	67.56	80.30	13	27.08
7712.	toby (tobyliekscows)	48	76.33	102.62	16	33.33
7713.	Luis (luggibuggi)	48	68.55	86.57	7	14.58
7714.	Apotekarne1337 (apotekarne1...	48	57.60	76.07	6	12.50
7715.	Panos (panospask)	48	58.95	76.12	13	27.08
7716.	mathder (willpackyourmother)	48	69.12	85.87	14	29.17
7717.	Klemensi (klemensi)	48	52.29	66.59	3	6.25
7718.	vrrrrrrrrm (olivrrm)	48	70.60	90.84	13	27.08
7719.	Jonondarnad (egoye)	48	65.40	82.11	36	75.00
7720.	Cam (cburr)	48	75.36	89.65	14	29.17
7721.	Sam (sam6420)	48	104.77	129.19	28	58.33
7722.	Kashmir (haris1)	48	48.85	61.95	4	8.33
7723.	Syed (syed_tahsin)	48	75.82	89.72	7	14.58
7724.	.... (_otto_)	47	59.19	72.27	7	14.89
7725.	Joy (_joy_)	47	65.94	80.34	8	17.02
7726.	Nurzhan (_bakytov_)	47	68.60	85.27	13	27.66
7727.	Giovanni (zombieagain)	47	56.30	67.89	3	6.38
7728.	Zach (zchen717)	47	113.17	135.80	24	51.06
7729.	yousuf (z3nko)	47	98.48	124.01	36	76.60
7730.	Yoru (yoruu12)	47	59.34	68.29	5	10.64
7731.	♪╠¥ö§€ƒ╣♫ (ye...	47	80.89	99.01	15	31.91
7732.	Garrick (yanawanas)	47	89.94	130.48	12	25.53
7733.	clement (xortoise)	47	70.07	87.00	18	38.30
7734.	William Vince (wvince02)	47	43.43	53.01	1	2.13
7735.	Sapphire (wl23)	47	85.08	106.14	14	29.79
7736.	Quibz (white_fire)	47	96.78	125.01	19	40.43
7737.	weicer (weicer)	47	92.81	113.75	17	36.17
7738.	WayLay (waylay17)	47	85.41	121.96	15	31.91
7739.	Virt (virtue_raj)	47	68.91	78.75	10	21.28
7740.	Vidit (vdop)	47	55.38	78.81	9	19.15
7741.	Maw (typemaw)	47	95.82	118.29	4	8.51
7742.	totaland (totaland)	47	62.97	75.38	8	17.02
7743.	Chris (tomatohead21)	47	112.45	136.42	18	38.30
7744.	Crackersontheshelf (taejung...	47	85.38	101.96	16	34.04
7745.	HowToTypin9 (supergodnes)	47	70.78	91.14	11	23.40
7746.	sprwhk (sprwhwk)	47	71.41	85.58	14	29.79
7747.	Zoey (soeyzandiego)	47	101.92	126.17	19	40.43
7748.	Stephen (slyspy)	47	49.54	65.64	1	2.13
7749.	DuongForeverAlone (sieunhan...	47	97.16	108.80	17	36.17
7750.	Joshua (shmucky)	47	122.61	137.88	24	51.06
7751.	Shino (shinobami)	47	46.48	58.53	4	8.51
7752.	Shiji (shiji_singh)	47	49.13	57.16	4	8.51
7753.	Sherzod Nadirov (sherzod_5)	47	29.62	37.67	5	10.64
7754.	Sarvang (sarlok393)	47	68.15	88.54	16	34.04
7755.	Raviraj (rvrjpdhr)	47	54.35	75.26	10	21.28
7756.	Jay (royjay)	47	61.56	78.11	8	17.02
7757.	regen45 (regen45)	47	32.41	45.23	4	8.51
7758.	Rishabh (rdmighty_i)	47	109.28	132.87	22	46.81
7759.	RageRaptor (rageraptor)	47	49.28	57.18	3	6.38
7760.	Kevin (popanto)	47	86.90	109.61	12	25.53
7761.	naige (pnolan55)	47	46.41	56.33	4	8.51
7762.	Chan (pizzx)	47	74.47	91.29	6	12.77
7763.	Petar (petars)	47	147.81	192.88	30	63.83
7764.	Flame (panutadk)	47	97.41	115.95	16	34.04
7765.	Ore (orediamond)	47	127.41	153.94	30	63.83
7766.	M (myles_jb)	47	101.78	124.37	20	42.55
7767.	mw3m (mw3m)	47	55.14	68.65	4	8.51
7768.	Doggy (mr_woofles)	47	73.50	113.18	14	29.79
7769.	Mr_Mic (mr_mic)	47	74.88	93.92	13	27.66
7770.	Priyansh (mrpriyansh)	47	61.24	71.20	7	14.89
7771.	Mriganka (mriganka)	47	66.37	85.86	8	17.02
7772.	Moishi (moishi)	47	84.10	102.73	14	29.79
7773.	Mohammad (mohammad__)	47	68.29	90.05	15	31.91
7774.	milki (milkepro)	47	59.49	85.99	9	19.15
7775.	racist (milfed)	47	49.90	72.48	7	14.89
7776.	Rostislav (mexanoz)	47	47.21	62.70	4	8.51
7777.	Marina (marniass)	47	98.94	117.84	15	31.91
7778.	Revolution (maqsoodwor)	47	21.50	33.55	8	17.02
7779.	Lonmanbeast (lonmanbeast)	47	70.39	83.05	9	19.15
7780.	Latif (lephant)	47	73.81	97.21	11	23.40
7781.	Samuel (kyoka_sui)	47	73.86	91.01	6	12.77
7782.	Wattsey (krwhlee15)	47	92.83	120.85	22	46.81
7783.	krs (krss)	47	63.55	76.97	15	31.91
7784.	KingBaby (kingzeroiii)	47	93.71	110.78	14	29.79
7785.	Dawn (kidlatako)	47	39.33	50.51	5	10.64
7786.	Kevin (kevzjhu)	47	107.54	131.16	18	38.30
7787.	kamoo (k4moo)	47	68.38	82.15	9	19.15
7788.	Jed (jedmedina)	47	81.13	112.14	11	23.40
7789.	Jill (jconn00)	47	67.79	82.93	9	19.15
7790.	JtG (jaylegee)	47	103.70	121.30	22	46.81
7791.	Jackson (jacksonmississippi)	47	76.30	102.90	13	27.66
7792.	itsKrish01 (itskrish01)	47	55.37	70.36	12	25.53
7793.	gtg dinner (ijikman)	47	110.76	133.69	18	38.30
7794.	Igor (igor2003)	47	70.74	88.92	11	23.40
7795.	Qida (ieatpizza)	47	72.35	85.02	8	17.02
7796.	Hari (hari_dev)	47	55.96	69.05	0	0.00
7797.	Henrik (grimmzl)	47	60.87	73.04	12	25.53
7798.	gc21 (giim_chyn)	47	92.42	115.53	17	36.17
7799.	George (geogeorge456)	47	54.92	73.21	8	17.02
7800.	zombie gaming (galaxybiscui...	47	83.23	105.32	17	36.17
7801.	Don Kaboul (gabbaryamdak)	47	70.44	85.45	15	31.91
7802.	Fred (fredxster)	47	66.33	80.12	4	8.51
7803.	Kamil (finessegod_)	47	78.23	100.02	12	25.53
7804.	Masquerade (fidtzy)	47	47.82	58.84	6	12.77
7805.	Eldritch (ficuno)	47	44.89	64.24	4	8.51
7806.	MY LIFE FOR PAKISTAN (eridpnc)	47	99.02	125.06	20	42.55
7807.	Eric (ericlauchiho)	47	62.55	79.71	8	17.02
7808.	Dev (devkoli)	47	48.93	64.49	3	6.38
7809.	Alyssa (destroyer090)	47	62.68	76.82	4	8.51
7810.	Deepan (deepan_hacker)	47	41.96	49.96	0	0.00
7811.	David (davers4)	47	78.77	110.18	13	27.66
7812.	fish (danf1)	47	95.34	112.09	19	40.43
7813.	chandara (chan92)	47	85.14	105.93	21	44.68
7814.	Carlkristie (carlkristie)	47	41.65	56.32	7	14.89
7815.	Millie (brunomarstm)	47	31.03	38.12	5	10.64
7816.	Beedle (bernod)	47	58.77	76.64	8	17.02
7817.	Alpuds (alpuds)	47	78.09	102.76	16	34.04
7818.	alis (aliss)	47	86.82	98.01	14	29.79
7819.	Georgios (aktorion)	47	47.83	56.80	2	4.26
7820.	J (akntmzjtj)	47	104.59	130.52	24	51.06
7821.	Adam (acassidy24)	47	71.11	90.39	11	23.40
7822.	Suvan (1080pixelz)	47	51.60	66.04	4	8.51
7823.	alberta (albertaa)	47	68.89	83.61	13	27.66
7824.	Kendii_Man (kendii_man)	47	79.04	100.04	28	59.57
7825.	Swagata (bulets)	47	53.86	62.83	10	21.28
7826.	Dhruv (dhruvmehta_409)	47	57.94	85.94	10	21.28
7827.	Plus (mpurasu)	47	56.41	70.58	7	14.89
7828.	Sagnik (shagzz_01)	47	60.82	77.90	8	17.02
7829.	kk (infinitq_z)	47	66.97	85.82	30	63.83
7830.	Maurya (maurya_21)	47	34.68	41.21	5	10.64
7831.	Jim (quacksoncrack)	47	81.55	108.33	17	36.17
7832.	Pim (_pmirum)	46	92.60	108.15	18	39.13
7833.	Emmy (_dadstype_)	46	83.60	103.24	12	26.09
7834.	Ziobr (ziobr)	46	92.00	108.72	19	41.30
7835.	Brohath (zevo100)	46	81.22	101.34	8	17.39
7836.	Enzo (yujiro144)	46	53.98	67.15	6	13.04
7837.	Sagar (xdronzer)	46	53.20	69.80	5	10.87
7838.	xahriman (xahriman)	46	73.95	93.32	11	23.91
7839.	wolfBream (wolfbream45)	46	122.41	139.13	29	63.04
7840.	will_t (will_t)	46	125.05	150.82	26	56.52
7841.	Wally101 (walrusboy101)	46	79.82	96.57	10	21.74
7842.	Daddy D (vr00m_)	46	59.78	79.80	8	17.39
7843.	Hans (ts6d)	46	77.61	94.56	13	28.26
7844.	thomas (tmastri)	46	74.60	94.22	6	13.04
7845.	Nathanael (tinkerer_nat)	46	82.28	102.93	12	26.09
7846.	Tilly (tillyrose)	46	92.55	111.13	20	43.48
7847.	Jitendra (techjittu)	46	49.86	61.77	5	10.87
7848.	誌綸 (tdog0507)	46	66.69	89.78	13	28.26
7849.	Aboostedninja (talonabuser)	46	96.12	125.00	15	32.61
7850.	Sunil (sunilislaz)	46	46.08	74.78	6	13.04
7851.	Suhas (suhaskurup)	46	87.53	101.81	13	28.26
7852.	SPyofgame (spyofgame)	46	89.45	106.47	26	56.52
7853.	spoon (spooderrr)	46	75.30	96.38	6	13.04
7854.	Christian (speciial)	46	58.83	70.93	6	13.04
7855.	BOOST~~~ (somen_chandra)	46	44.94	59.62	6	13.04
7856.	Yazeed (snake69)	46	82.73	106.03	15	32.61
7857.	Lexi (silentfungus)	46	30.50	48.74	10	21.74
7858.	SH (shokha09)	46	53.34	62.22	5	10.87
7859.	Hiraya (sheesh_24)	46	52.70	64.06	4	8.70
7860.	Saurav (seldom69)	46	59.91	73.26	8	17.39
7861.	Samir (samirissa)	46	55.13	72.45	9	19.57
7862.	Jai Nepal (sajalpoudel)	46	51.58	59.75	6	13.04
7863.	Ryan (ryanssd)	46	121.63	152.33	27	58.70
7864.	Caspian (qashu)	46	63.57	86.43	15	32.61
7865.	Pseudo (pseudo_here)	46	72.71	92.25	9	19.57
7866.	pp (priscillaaa)	46	86.05	107.03	10	21.74
7867.	Pranav (pranav16)	46	52.19	62.95	3	6.52
7868.	Sondr (pngstr)	46	75.10	88.56	11	23.91
7869.	⠀ (ploop123)	46	73.54	92.60	14	30.43
7870.	chiru (phenggot200darken)	46	79.54	99.71	9	19.57
7871.	Alexander (pharos)	46	44.10	64.34	15	32.61
7872.	Iveth (perlybomb)	46	55.45	67.74	8	17.39
7873.	PelMeni (pelmeni)	46	110.78	124.62	24	52.17
7874.	Paul (paulllx)	46	70.68	94.77	10	21.74
7875.	Angel (olivias69)	46	63.14	70.96	8	17.39
7876.	Abhimanyue (obsidian_abhi)	46	77.78	109.26	6	13.04
7877.	Nafiul (n_crypted)	46	67.50	80.70	6	13.04
7878.	NO_LYF (no_lyf)	46	63.98	79.18	14	30.43
7879.	barmanrahul (nothisisrahul)	46	69.72	83.74	10	21.74
7880.	Patiphan (nongper)	46	57.28	78.00	11	23.91
7881.	Nmn (nmn147)	46	60.52	73.44	11	23.91
7882.	Neel (neel19)	46	92.61	108.86	13	28.26
7883.	nadeem (nadeemgujjar)	46	67.89	80.09	10	21.74
7884.	Mohsen (mohsentypo)	46	63.22	74.60	17	36.96
7885.	Mayan (mayan__)	46	66.55	82.19	9	19.57
7886.	Max (maxim_brown)	46	65.34	81.60	8	17.39
7887.	kim (kimblimblimz)	46	129.61	169.76	32	69.57
7888.	Kimberly (kimbear_)	46	56.45	67.46	6	13.04
7889.	Justin (juicet1n2)	46	130.98	155.08	27	58.70
7890.	Joshua (jhsieh10)	46	88.85	105.24	16	34.78
7891.	Jacob (intellectualbrick)	46	66.45	84.42	14	30.43
7892.	Aaron (insertwordshere)	46	112.30	144.74	39	84.78
7893.	sMarty (imrwonder2)	46	93.98	126.95	13	28.26
7894.	icecreamfilling (icecreamfi...	46	89.90	105.12	14	30.43
7895.	H A N S (hans_bk)	46	72.74	86.03	12	26.09
7896.	guest_typist_new (guest_typ...	46	83.27	106.82	12	26.09
7897.	Epzilon (epzilonn)	46	137.12	163.22	38	82.61
7898.	Edgar (edgarflorez)	46	38.79	48.94	3	6.52
7899.	Dweeb (dweb)	46	76.30	94.48	22	47.83
7900.	Eric (draydere)	46	101.48	115.04	14	30.43
7901.	Accuracy (dozwolonymein)	46	80.49	98.83	11	23.91
7902.	mike (doorman32)	46	95.79	117.62	20	43.48
7903.	d'toe 😎😎😎😎 (det...	46	88.24	117.04	12	26.09
7904.	Martin (demonakinale)	46	123.40	147.90	29	63.04
7905.	Derriel (ddcj90)	46	56.61	68.83	9	19.57
7906.	Need (damdebotush)	46	41.80	48.86	4	8.70
7907.	Corn Philips (cornphilips)	46	81.59	101.27	15	32.61
7908.	David (cmagic_f)	46	90.43	107.61	12	26.09
7909.	Check (checkmunza)	46	83.02	100.23	11	23.91
7910.	Steven (carnivorous_crustat...	46	31.41	43.04	3	6.52
7911.	Julia (bunnimochi)	46	68.65	91.66	10	21.74
7912.	Brian (brianyounq)	46	104.03	126.73	22	47.83
7913.	Broll (billwong28)	46	79.89	93.43	11	23.91
7914.	ARTAN (begaal97)	46	102.05	117.47	17	36.96
7915.	Harshit (awpsun)	46	66.06	83.01	11	23.91
7916.	Asnar (asnarsar)	46	33.94	54.33	5	10.87
7917.	Ash (ashbacchus)	46	59.98	73.65	5	10.87
7918.	ansendice (asendice)	46	67.51	88.62	10	21.74
7919.	Arata (aratatakeda)	46	65.67	84.28	5	10.87
7920.	Annie (annie48)	46	62.98	72.91	11	23.91
7921.	Alexander (alexanderbutcheeks)	46	70.13	84.10	5	10.87
7922.	Aji (ajimathew)	46	50.84	66.62	11	23.91
7923.	chris (aito_cornaro)	46	72.90	92.41	11	23.91
7924.	Mohamed (abo4ams)	46	76.33	85.06	13	28.26
7925.	Abdu (abduqodirov)	46	71.99	94.54	7	15.22
7926.	Eobard (abdouhamel)	46	84.01	111.08	15	32.61
7927.	J (22jcoluby)	46	50.01	61.79	3	6.52
7928.	Ned (13_w)	46	60.99	78.00	5	10.87
7929.	Divy (thivy)	46	58.74	81.95	8	17.39
7930.	Sai (moon_toong)	46	31.03	41.03	2	4.35
7931.	Ab (timaby)	46	41.14	53.21	3	6.52
7932.	Naman (naman_vj)	46	65.20	82.42	11	23.91
7933.	Aevaela (aevaela)	46	106.52	131.85	21	45.65
7934.	Rithwik (rithwiksharma)	46	81.43	103.07	10	21.74
7935.	karim (karimbdf)	46	47.26	57.98	5	10.87
7936.	Anj (anj2000)	46	57.70	71.69	9	19.57
7937.	Daniel (xdax)	46	59.53	74.32	3	6.52
7938.	Rene (yayrene)	46	54.39	65.71	4	8.70
7939.	Fabricio (ruk68)	46	46.21	59.71	6	13.04
7940.	Admiral (admiralspoon)	46	93.45	115.13	21	45.65
7941.	Karl (cheeseborgar)	46	70.94	82.08	8	17.39
7942.	Auf (auf10)	46	40.26	51.73	2	4.35
7943.	Surendra (zurendra9)	45	73.52	86.32	9	20.00
7944.	Sam (zoinks_sam)	45	95.93	121.16	20	44.44
7945.	zin (zinzin27bs)	45	55.30	70.56	3	6.67
7946.	Daniel (zebrapopcorn)	45	95.45	124.22	18	40.00
7947.	Youssef (youssef_ait_bihi)	45	71.34	95.44	9	20.00
7948.	Yunus Emre (yemre95)	45	62.91	81.30	6	13.33
7949.	I'm_on_mobile (yeetusthyfetus)	45	99.60	126.08	23	51.11
7950.	yasser (yasserhr)	45	61.63	76.44	5	11.11
7951.	Varun (wolfie12)	45	56.12	65.03	4	8.89
7952.	Wiktor (wivvik)	45	47.64	60.21	5	11.11
7953.	Wesgar (wesgar)	45	67.82	77.78	15	33.33
7954.	Vikram (vikram_)	45	58.02	71.27	7	15.56
7955.	tstats[unoriginalname] (uno...	45	89.14	102.08	21	46.67
7956.	Tsetsen (unknownxxx)	45	69.46	82.45	34	75.56
7957.	Bray (turtlebray)	45	69.09	84.76	6	13.33
7958.	Sitraka (tsukimurphy)	45	85.34	100.63	9	20.00
7959.	Kennon (trainertaco)	45	67.77	80.69	10	22.22
7960.	Huan (thehuan2005)	45	68.85	90.34	11	24.44
7961.	Sh3y4sh (thegoldeneagle)	45	76.54	95.34	14	31.11
7962.	alberto (th3biscuit)	45	46.02	59.03	6	13.33
7963.	Ave (tessellatedtalent)	45	94.62	115.93	7	15.56
7964.	sv (sv_1419)	45	46.75	56.05	3	6.67
7965.	exqlouuebnfpgts (spitemim)	45	101.14	124.09	32	71.11
7966.	Kevin (spezzytv)	45	91.11	115.90	14	31.11
7967.	Bún Bò (snowk49)	45	90.48	111.07	13	28.89
7968.	Diego (snkybkyloike)	45	62.56	79.76	8	17.78
7969.	Sar (shift2alt)	45	59.62	70.68	13	28.89
7970.	Mona (segasunset)	45	82.78	103.03	18	40.00
7971.	Ross (rossmawd)	45	63.61	75.23	11	24.44
7972.	Roy (rocko95)	45	72.39	87.37	8	17.78
7973.	Michael (redwings20)	45	120.01	151.43	22	48.89
7974.	Pryl (pryl)	45	85.79	107.65	12	26.67
7975.	Poop (poopbuttpoop)	45	66.53	81.77	12	26.67
7976.	B (pbhavin8584)	45	44.39	54.74	0	0.00
7977.	Pastasoosi (pastasoosi)	45	49.97	60.86	3	6.67
7978.	passivestar (passivestar)	45	116.04	141.98	45	100.00
7979.	Zunbileg (ozbileg)	45	75.35	90.81	14	31.11
7980.	Asif (orthocresol)	45	79.68	91.61	10	22.22
7981.	Nrimanta (nwiziyanow)	45	45.37	63.69	12	26.67
7982.	Ritesh (novathor)	45	55.51	67.50	7	15.56
7983.	Nakura (nakura_sushi)	45	73.79	91.47	14	31.11
7984.	Naaman (nae26)	45	86.76	113.08	16	35.56
7985.	mushbert (mushbert)	45	55.60	69.40	12	26.67
7986.	E (mosanbrick)	45	106.64	124.13	20	44.44
7987.	k (mooneymooves)	45	69.48	88.19	5	11.11
7988.	miko (mikesxan)	45	74.77	89.17	18	40.00
7989.	Josiah (miitraa)	45	92.51	125.82	21	46.67
7990.	aWiltedRhythm (mbh38)	45	110.92	125.84	25	55.56
7991.	Max (maxube21)	45	59.46	70.51	12	26.67
7992.	Mason (mason8008)	45	95.45	116.30	16	35.56
7993.	Mahmoud (mahmoud_zaineldin)	45	63.68	80.32	8	17.78
7994.	Lutful (lutful)	45	44.30	50.79	6	13.33
7995.	Luciano (lucidokz)	45	72.75	99.55	9	20.00
7996.	Hippily (lord_kartikey)	45	26.15	38.20	12	26.67
7997.	lofr1t (lofr1t)	45	51.85	61.95	5	11.11
7998.	Louzani (lk_kheir)	45	42.77	54.30	2	4.44
7999.	Nicholas (legendarykeys)	45	81.36	101.45	13	28.89
8000.	Sai Venkat (ksvr)	45	57.41	71.60	7	15.56
8001.	KOU (koulangkaya)	45	59.89	72.75	7	15.56
8002.	Justin (jubnx)	45	54.17	69.90	5	11.11
8003.	Biggs (jobobhi)	45	86.52	104.73	14	31.11
8004.	Jubbers (jlin526)	45	125.23	144.28	31	68.89
8005.	Jeff (jeffwu1220)	45	93.41	110.12	13	28.89
8006.	Aether (its_deep)	45	51.14	66.72	13	28.89
8007.	ItsDuckyLol (itsduckylol)	45	77.45	91.02	9	20.00
8008.	Debasmit (inmessi)	45	59.57	68.40	14	31.11
8009.	XD (hphuonghehe)	45	61.31	74.68	8	17.78
8010.	Hiyoshi (hiyochan)	45	155.20	182.66	40	88.89
8011.	Eric (heeric)	45	110.41	123.99	19	42.22
8012.	Hassan (hassanjazzy143)	45	63.17	72.98	5	11.11
8013.	Halftimenerd1 (halftimenerd1)	45	52.92	64.01	7	15.56
8014.	GrandMaster (grandmaster101)	45	71.43	84.29	7	15.56
8015.	Ben (god0nline)	45	103.23	142.45	25	55.56
8016.	Gabbie (gg13)	45	75.47	91.30	9	20.00
8017.	Ganesh (gat786)	45	51.21	70.90	3	6.67
8018.	Frosted (frosted_bruh)	45	75.24	89.17	7	15.56
8019.	Luke (frag_pumpkin)	45	61.28	71.66	6	13.33
8020.	fihee (fihee)	45	60.36	79.78	12	26.67
8021.	fedja (fedza)	45	108.59	123.14	20	44.44
8022.	ducky (duckyboy0)	45	53.80	62.97	2	4.44
8023.	Solomon (donutrk)	45	148.65	187.49	34	75.56
8024.	Didoff (didoff)	45	67.48	82.16	10	22.22
8025.	dhara (dhara12)	45	37.80	47.15	3	6.67
8026.	Cygnus (cygnuss)	45	135.57	161.12	32	71.11
8027.	CTLim (ctlim02)	45	76.54	96.78	11	24.44
8028.	Cool (creepycumber)	45	82.00	99.28	12	26.67
8029.	Conning (conning)	45	108.58	127.67	22	48.89
8030.	Chicken (chickenhide)	45	124.47	155.65	29	64.44
8031.	Zyrin (captainzyrin1024)	45	85.99	106.12	15	33.33
8032.	K (blue_addict)	45	60.43	81.49	9	20.00
8033.	Blazian444 (blazian444)	45	108.11	129.57	14	31.11
8034.	BEMZ (bemz_mc)	45	50.63	63.38	10	22.22
8035.	Izanagi (baguettianmysticism)	45	179.78	210.49	45	100.00
8036.	Kevinh (baconpool14)	45	98.38	129.56	17	37.78
8037.	Darda (babyonbaby)	45	101.49	126.74	21	46.67
8038.	Emma (aria_tran)	45	64.07	84.73	11	24.44
8039.	Rajat (arakanfudo)	45	54.76	68.75	42	93.33
8040.	(andyjoekool)	45	95.46	159.17	17	37.78
8041.	leibniz (anamaya11)	45	63.25	75.53	9	20.00
8042.	AmgdHussein (amgd_hussein)	45	46.95	55.74	5	11.11
8043.	Alex (alexstrang25)	45	98.63	116.63	17	37.78
8044.	Ankit (akjung478)	45	55.07	65.23	4	8.89
8045.	acrymoore (acrymoore)	45	87.69	101.48	15	33.33
8046.	Abbacchio (abbacchio)	45	96.62	115.66	14	31.11
8047.	Spark (5parkmark)	45	84.91	102.04	15	33.33
8048.	James (2janghoon)	45	119.58	152.64	24	53.33
8049.	abc (1714245ctk41)	45	88.68	108.03	14	31.11
8050.	100% (100percentaccurate)	45	100.45	120.64	20	44.44
8051.	REV (krevengek)	45	39.09	46.26	2	4.44
8052.	sebastian (teekq)	45	102.46	120.65	12	26.67
8053.	Kingpin (bahmandoor)	45	80.96	93.67	18	40.00
8054.	Moazzam (qwikiquartz)	45	66.23	75.42	10	22.22
8055.	Divyansh (elessar42)	45	34.58	47.38	6	13.33
8056.	Cameron (cammy24)	45	90.57	118.57	26	57.78
8057.	azer8 (azer8)	45	56.44	69.90	3	6.67
8058.	rr (rosandy10)	45	60.28	73.20	10	22.22
8059.	Vincent (supersayu)	45	105.82	123.77	21	46.67
8060.	Enrico (ricodmarlon)	45	83.18	100.86	11	24.44
8061.	Yammine (y__y)	45	77.63	90.53	11	24.44
8062.	gufu12 (gufu12)	45	48.30	63.22	38	84.44
8063.	James (buttcheeks34)	45	99.31	113.97	17	37.78
8064.	Sen (puggowuggo)	45	38.28	49.65	12	26.67
8065.	Kirk (maruts)	45	76.36	99.89	15	33.33
8066.	Ame (imtodess)	45	75.47	102.03	9	20.00
8067.	Mark (bufferx)	45	77.44	93.93	12	26.67
8068.	Shohruxxon (shohruxxon7)	45	50.39	67.28	3	6.67
8069.	Stacky (headstack)	45	101.21	135.86	21	46.67
8070.	Andreas Boulios (boulibouli)	45	65.20	84.68	6	13.33
8071.	arne (arnegutten)	45	54.76	64.54	5	11.11
8072.	(zesty11)	44	109.68	135.33	14	31.82
8073.	xain (xainq)	44	51.71	62.42	7	15.91
8074.	weston (westonu)	44	97.70	121.73	20	45.45
8075.	Vera (verabee9183)	44	62.15	79.52	9	20.45
8076.	uled (uled)	44	71.40	98.57	18	40.91
8077.	Ryan (typerace_ryan)	44	56.29	68.69	9	20.45
8078.	Dog (tropicaldog17)	44	65.86	86.50	9	20.45
8079.	Cornelio (tirdsaba)	44	53.66	65.54	7	15.91
8080.	Tobiloba (thetobitron)	44	88.34	105.42	9	20.45
8081.	John (thegangplankgod)	44	125.47	152.02	31	70.45
8082.	Ivan (t3ry444y)	44	55.82	65.34	4	9.09
8083.	Bailey (swagoneering)	44	103.19	122.40	14	31.82
8084.	oliver (sushiboyking)	44	94.83	114.58	14	31.82
8085.	chikke (srujan_chikke)	44	31.23	39.38	5	11.36
8086.	beans (squirtly)	44	106.58	126.96	21	47.73
8087.	Hieu (spicy888)	44	61.65	76.67	9	20.45
8088.	thetacosmurgf (smurfer1121)	44	112.00	131.52	22	50.00
8089.	smug (smugwise_the_brave)	44	79.71	100.87	21	47.73
8090.	Zack (smagroda)	44	74.52	85.25	16	36.36
8091.	Ivan (s017180)	44	96.27	116.60	15	34.09
8092.	Robert (rwa102455)	44	101.59	119.88	17	38.64
8093.	tstats[rueo] (rueo)	44	49.16	60.77	5	11.36
8094.	Rounak (rouvai)	44	85.56	102.53	12	27.27
8095.	Rodrigo (rodrigoferrer)	44	87.93	101.55	17	38.64
8096.	Rikesh (rikesh)	44	100.75	129.96	25	56.82
8097.	Vineet (raovineet14)	44	58.01	66.38	5	11.36
8098.	Qi (qitang)	44	103.12	115.91	12	27.27
8099.	poobastank (poobastank)	44	76.17	93.24	7	15.91
8100.	pipez (pipez)	44	99.41	116.53	16	36.36
8101.	Kyle (pickles3201)	44	126.22	150.77	26	59.09
8102.	prehistoriczebra (penguin45)	44	62.21	84.74	13	29.55
8103.	An (pastwords)	44	75.59	93.48	16	36.36
8104.	Parth (parthpsh)	44	75.89	94.56	36	81.82
8105.	allie (oatmilf22)	44	62.62	83.78	11	25.00
8106.	¯\_(ツ)_/¯ (nopatno)	44	140.74	189.90	31	70.45
8107.	n0neya (noneyaaa)	44	98.82	114.28	17	38.64
8108.	Niraj (nirajkamat)	44	32.17	39.49	2	4.55
8109.	Yung N8 (ngreene5)	44	63.81	87.45	13	29.55
8110.	(nalyd_on_colemak)	44	101.29	156.07	0	0.00
8111.	J (mr_wood)	44	89.64	112.44	15	34.09
8112.	MrDot (mr_dot)	44	61.00	78.75	11	25.00
8113.	Mo (mosidhom)	44	87.52	109.37	13	29.55
8114.	aindriu (morrisa8)	44	66.24	80.89	8	18.18
8115.	Mohamed (mednoun)	44	63.18	72.10	5	11.36
8116.	Maybe (maybe413)	44	118.62	129.97	22	50.00
8117.	Chanokchon (mantarays)	44	61.80	70.32	9	20.45
8118.	lumapools (lumapools)	44	92.18	107.46	16	36.36
8119.	dennis (ludennis0606)	44	89.06	107.72	11	25.00
8120.	luis (lozalui004)	44	66.21	79.33	5	11.36
8121.	Lord (lord_v)	44	72.12	85.07	11	25.00
8122.	Colemak (life808)	44	93.29	118.20	15	34.09
8123.	Igor (kziv)	44	37.70	49.32	1	2.27
8124.	KeeG9x (keeg9x)	44	80.11	103.44	17	38.64
8125.	Kalin (kalin_a)	44	63.08	73.69	8	18.18
8126.	John (juseonghan)	44	120.26	149.15	22	50.00
8127.	Jim (jumsey)	44	82.73	106.62	13	29.55
8128.	S (juicebox_27)	44	91.22	115.55	17	38.64
8129.	now colemak! (jlam55555nonq...	44	125.54	145.63	32	72.73
8130.	Jin (jin_an)	44	73.36	87.55	14	31.82
8131.	JBK (jeyabalakrishnan)	44	44.24	53.65	3	6.82
8132.	jjerry (jerry_nyae)	44	85.74	104.88	7	15.91
8133.	Jake (jasala)	44	92.64	108.43	16	36.36
8134.	Izhar Ali (izhar368)	44	60.52	71.40	7	15.91
8135.	korn (itthikorn777)	44	49.77	59.56	5	11.36
8136.	isenze (isenze)	44	70.18	79.93	20	45.45
8137.	no (humeunculus)	44	124.97	146.82	24	54.55
8138.	Suhel (horacio_chopin)	44	70.42	83.00	9	20.45
8139.	heam (heamkream)	44	60.38	73.61	22	50.00
8140.	Harvey (harveyqqq)	44	86.21	101.28	12	27.27
8141.	Grey (grey2)	44	87.91	109.70	12	27.27
8142.	MUJER (giovvah)	44	134.25	147.90	29	65.91
8143.	John (gakbo)	44	82.15	108.68	10	22.73
8144.	Jacob (gadekaja)	44	90.45	118.42	13	29.55
8145.	John (fsxsteamboss)	44	57.90	70.69	7	15.91
8146.	Glen (foxdigits)	44	106.96	136.93	20	45.45
8147.	Abhishek (erabh)	44	45.41	56.49	9	20.45
8148.	69 WPM andy (eerietants)	44	69.60	93.46	13	29.55
8149.	tstats[easybeef] (easybeef)	44	62.42	80.11	5	11.36
8150.	Calvin (doyotko)	44	106.83	134.44	18	40.91
8151.	Dan (dgallerz)	44	84.88	106.43	14	31.82
8152.	(dev_origami)	44	96.10	117.05	15	34.09
8153.	Kshitij (desikheeda)	44	69.62	81.18	14	31.82
8154.	NewTyper50 (demo_admin)	44	121.53	143.36	21	47.73
8155.	Deadman (deadrohan19)	44	43.74	55.56	3	6.82
8156.	Ahmed (deadmoonsoldier)	44	66.78	79.70	9	20.45
8157.	Dash (darkdash)	44	98.73	116.61	17	38.64
8158.	Francis (coronadoloser76)	44	75.92	91.72	11	25.00
8159.	Alexander (codec4)	44	82.49	94.72	8	18.18
8160.	Sop (coachprincesssoppy)	44	67.02	80.39	11	25.00
8161.	Ethan (chung_ethan)	44	72.32	142.94	8	18.18
8162.	Coughingmouse (cexora)	44	63.46	84.33	3	6.82
8163.	Cedric (cedrilicity)	44	85.46	126.57	15	34.09
8164.	Captain (ccap)	44	39.26	50.94	37	84.09
8165.	TypeNightmare (bozijovel)	44	53.64	64.85	0	0.00
8166.	Blue (blueberkeley)	44	90.98	124.32	13	29.55
8167.	be (besalt)	44	85.22	105.90	10	22.73
8168.	k1mbap (beaned_fish)	44	107.78	129.52	29	65.91
8169.	Bae (baenimbae12)	44	84.02	105.70	13	29.55
8170.	bachu (bachu2020)	44	59.38	82.72	12	27.27
8171.	Andres (avillarreal14)	44	87.77	99.35	8	18.18
8172.	Ausar (ausar0)	44	106.92	124.00	22	50.00
8173.	Braylin (atlasrising)	44	106.87	117.08	24	54.55
8174.	Chatura (atakatus)	44	51.40	62.07	4	9.09
8175.	Alex (aselia_azim)	44	48.40	59.10	4	9.09
8176.	Anuj (anujsharma411)	44	76.97	90.37	16	36.36
8177.	Ankush (ankushchavhan7596)	44	50.88	60.17	7	15.91
8178.	Ankith101 (ankith101)	44	51.93	69.48	7	15.91
8179.	Amit (amitu7)	44	68.39	83.04	11	25.00
8180.	Al (alriad)	44	59.47	68.28	11	25.00
8181.	Alex (alexkylelee)	44	105.51	138.04	22	50.00
8182.	Aero (aerosoul)	44	67.97	81.86	4	9.09
8183.	10SlowFingers (aabhas)	44	65.51	84.16	6	13.64
8184.	andrew (400wpmalphamale)	44	98.58	136.16	20	45.45
8185.	Ole (olenord)	44	79.53	93.77	11	25.00
8186.	pudding_ (ericedge3315)	44	83.74	97.66	12	27.27
8187.	Syterelic (syterelic)	44	76.52	95.06	14	31.82
8188.	Yuni (yuni190)	44	79.78	99.01	11	25.00
8189.	Balibari, (balibari)	44	73.51	91.13	10	22.73
8190.	Wu (recharge323)	44	48.92	60.35	4	9.09
8191.	Blob (blobby21)	44	62.27	84.11	6	13.64
8192.	Angel (cyclomos)	44	70.07	90.73	6	13.64
8193.	Anand 🇳🇵 (anand_from_...	44	60.66	78.10	7	15.91
8194.	Mohamed (lester_ze_molester)	44	50.54	65.33	3	6.82
8195.	Darkrydier (darkrydier)	44	90.30	114.68	14	31.82
8196.	Llyrad (sopthelast)	44	67.61	77.13	7	15.91
8197.	Regine (regineann)	44	74.19	90.07	10	22.73
8198.	po1nt (_po1nt_)	43	77.00	87.37	13	30.23
8199.	Phi (ze_phi)	43	87.20	102.13	16	37.21
8200.	tstats[yeunakho] (yeunakho)	43	38.49	54.04	3	6.98
8201.	adrian (yeahaight)	43	52.00	75.05	5	11.63
8202.	Coffee Boy (xuantungbrian)	43	45.43	53.92	1	2.33
8203.	Eloona (wombatinmaison)	43	91.27	112.37	14	32.56
8204.	Juan (wolf_1)	43	64.83	77.32	8	18.60
8205.	Prince (wayward_prince)	43	79.88	109.68	13	30.23
8206.	Allan (unknownfiles)	43	100.06	120.76	15	34.88
8207.	Mihkel (tikstiks)	43	81.40	101.94	17	39.53
8208.	Charles (themythicalvlad)	43	107.64	118.91	22	51.16
8209.	Rafael (syrena)	43	87.96	109.14	13	30.23
8210.	Great (synergy__)	43	91.99	113.97	17	39.53
8211.	Steven (steventheplayer)	43	73.38	91.68	16	37.21
8212.	steveleeb (steveleeb)	43	131.27	152.07	22	51.16
8213.	SHRI (srinivasdokare)	43	53.41	69.96	4	9.30
8214.	☞sondv (sondv)	43	90.82	111.04	16	37.21
8215.	Phinix (soaringphinix)	43	84.11	99.62	10	23.26
8216.	Hieu (sn1rep)	43	58.14	70.61	6	13.95
8217.	sirjan (sirwolf208)	43	60.86	67.55	15	34.88
8218.	Dan (sirdanofthedirt)	43	81.61	99.37	11	25.58
8219.	Sarah (shetzah)	43	78.22	99.93	8	18.60
8220.	severed_toast (severedtoast)	43	102.50	140.59	15	34.88
8221.	Sanwal (sanwal_junejo0007)	43	47.98	61.30	2	4.65
8222.	Sangi (sangi38)	43	92.00	103.88	13	30.23
8223.	Salehbin (saleh_mksd)	43	34.86	42.47	0	0.00
8224.	ruby (rubymuzz)	43	61.10	85.57	8	18.60
8225.	Kyle Johnson (rickharrisoncoc)	43	85.60	102.58	16	37.21
8226.	Rey (reypanerz)	43	51.38	65.10	8	18.60
8227.	Butchy (randomguy4ever)	43	70.42	90.17	12	27.91
8228.	(quadroopl)	43	159.40	185.48	27	62.79
8229.	j (potatostock)	43	72.13	94.08	11	25.58
8230.	tstats[pook_dvorak] (pook_d...	43	102.35	125.57	15	34.88
8231.	Philip (plip_1021)	43	85.46	94.17	12	27.91
8232.	George (peposss)	43	86.40	94.96	12	27.91
8233.	osso (osso94)	43	70.02	94.49	15	34.88
8234.	oskar (osny19)	43	105.14	123.12	18	41.86
8235.	katie (okaykatieokay)	43	80.06	94.36	8	18.60
8236.	nicole (nkkicole)	43	74.94	94.36	10	23.26
8237.	Aaron (nightcreators)	43	104.37	127.86	16	37.21
8238.	1234 (nemesistroy)	43	70.04	108.55	11	25.58
8239.	lmao (nate11111)	43	101.19	119.32	15	34.88
8240.	Napplebee (napplebee)	43	60.70	73.73	7	16.28
8241.	Nabeel (nabz126)	43	52.76	64.38	6	13.95
8242.	Mohammed (mohammed55555)	43	82.39	93.10	14	32.56
8243.	Mikel (mikelhector)	43	78.10	96.72	19	44.19
8244.	Melas (melas1)	43	98.97	117.14	12	27.91
8245.	Maruberry (maruberry)	43	100.61	126.75	15	34.88
8246.	Armando (mandy1339)	43	84.36	98.47	12	27.91
8247.	:( (magtraxer)	43	102.29	134.71	15	34.88
8248.	Trianglateral (luckyashraj)	43	61.16	69.95	7	16.28
8249.	Mohamed A. (lim_elnoll96)	43	48.33	64.18	8	18.60
8250.	Harley (legendharley)	43	99.28	118.65	19	44.19
8251.	Vũ (khanhyeuquan)	43	88.58	108.08	13	30.23
8252.	shinkou (kashinkou)	43	57.04	75.24	23	53.49
8253.	Jack (jackiechips)	43	31.13	41.66	7	16.28
8254.	Sam (ie_dead)	43	72.41	101.69	9	20.93
8255.	Himanshu (himanshumishra3198)	43	59.74	68.65	11	25.58
8256.	hhdhwuus (hhdhwuus)	43	72.46	88.67	9	20.93
8257.	Momo (helloworldwhatniceday...	43	98.35	120.89	12	27.91
8258.	salad fingers (guuul)	43	117.18	138.03	20	46.51
8259.	Elliot (gofire8)	43	86.32	106.30	7	16.28
8260.	goe (goeeeeeeee)	43	83.16	99.75	0	0.00
8261.	tameflame (gabrieljohngabri...	43	82.04	95.82	9	20.93
8262.	ea (fluxheat)	43	54.37	68.09	7	16.28
8263.	faith (flatypus)	43	114.16	146.48	28	65.12
8264.	Tausif (fishey3)	43	63.15	81.36	8	18.60
8265.	Ezzy (ezzzyz)	43	50.05	60.08	3	6.98
8266.	Megaracer BTW (erkytyper)	43	83.04	95.27	14	32.56
8267.	Danny (ecgab)	43	99.44	118.32	17	39.53
8268.	NCCFlame (dysfunctional_dra...	43	92.43	121.21	12	27.91
8269.	Disqusting (disqusting_mclo...	43	50.87	64.71	5	11.63
8270.	Дидакус (didacus)	43	96.71	110.21	17	39.53
8271.	Tony 🐱👤 (demon0192)	43	106.30	128.51	23	53.49
8272.	meow (dalayalia)	43	66.45	82.85	10	23.26
8273.	D (dabirik)	43	64.45	78.66	11	25.58
8274.	CopyNinja09 (copyninja_)	43	44.02	52.03	2	4.65
8275.	Christian (chrisshaw)	43	130.65	154.63	29	67.44
8276.	senpai (chottomatte)	43	86.74	117.60	10	23.26
8277.	Matt (chillmaster)	43	67.43	78.20	10	23.26
8278.	Chase (chezit7)	43	82.09	105.34	11	25.58
8279.	Cassie Lynn (cassielynz_00)	43	72.05	86.65	14	32.56
8280.	Quốc (cangu07042006)	43	112.48	132.39	22	51.16
8281.	typinggawd (brandon934)	43	90.42	115.00	19	44.19
8282.	Nick (bopob)	43	93.62	114.99	22	51.16
8283.	Bil3ygr (bil3ygr)	43	64.14	90.28	9	20.93
8284.	Berty (bertybert)	43	76.93	94.02	18	41.86
8285.	TypingNoob (bekarihh)	43	78.95	95.59	11	25.58
8286.	BanjoBoss (banjoboss)	43	96.08	119.71	20	46.51
8287.	Atom (atom_atom)	43	67.99	85.90	12	27.91
8288.	QuietObedientConsent (arrow...	43	92.78	114.36	13	30.23
8289.	Arda (ardat96)	43	59.82	73.44	11	25.58
8290.	Ankit Sarkar (ankitsarkar)	43	49.74	65.46	40	93.02
8291.	Ivan (aivan2)	43	71.97	85.96	11	25.58
8292.	Armon (airtyper_11)	43	82.09	109.59	11	25.58
8293.	ahmed (ahmed393)	43	68.39	76.61	4	9.30
8294.	Aayam (aayam_04)	43	38.62	49.65	1	2.33
8295.	MIke (3nd4u)	43	65.10	86.03	16	37.21
8296.	Leinad (msdfar)	43	72.87	96.59	10	23.26
8297.	iron4in2020 (iron4in2020)	43	64.56	73.71	13	30.23
8298.	Abil (phr0zencr3w)	43	47.03	57.16	7	16.28
8299.	Edward (smegle2)	43	53.55	67.80	4	9.30
8300.	imhemantchaubey (hemantchau...	43	42.56	58.20	2	4.65
8301.	Jake (jake1151)	43	50.52	60.49	2	4.65
8302.	Kpusta (cabbagemans)	43	76.74	91.18	11	25.58
8303.	Josh (josh122203)	43	65.74	80.01	7	16.28
8304.	ryujin's footrest (iankenneth)	43	77.08	90.72	14	32.56
8305.	sygn (sygn_ray)	43	39.72	46.68	2	4.65
8306.	harabau (harabau)	43	70.75	84.65	14	32.56
8307.	Zombie (zombiecoder)	42	39.67	50.32	3	7.14
8308.	Kyle (zan9etsu)	42	58.49	73.38	12	28.57
8309.	Yazan (yazan_al)	42	67.72	78.93	12	28.57
8310.	Yas'-' (yaser_)	42	64.92	79.80	6	14.29
8311.	Chris (wupops)	42	62.04	82.00	12	28.57
8312.	MistakesWereMade (workmanty...	42	81.85	99.00	16	38.10
8313.	Adrian (whyisthisnotavailable)	42	104.98	135.56	26	61.90
8314.	WhyAre (whyare)	42	78.91	132.92	10	23.81
8315.	Vova (v_hg_p)	42	56.41	76.53	4	9.52
8316.	vix (vrinze)	42	77.26	92.64	9	21.43
8317.	usstudent101 (usstudent101)	42	107.97	140.13	22	52.38
8318.	Roma (useflame)	42	88.20	103.80	12	28.57
8319.	w_mb1 (trundling)	42	89.42	106.40	23	54.76
8320.	Alisher (tourist671)	42	60.62	74.81	14	33.33
8321.	justice (totorek)	42	39.86	51.27	2	4.76
8322.	keychronk6 (theonlydvorakguy)	42	103.68	121.06	18	42.86
8323.	sw0rd (sw0rd)	42	82.17	101.65	15	35.71
8324.	Tomas (sumtinlazy)	42	108.11	126.92	19	45.24
8325.	reever (ssamu)	42	85.59	108.09	11	26.19
8326.	Ahmad (slayman19)	42	133.57	168.27	27	64.29
8327.	Ludwig (simontypo)	42	68.42	86.75	15	35.71
8328.	shrenik (shrenikr235)	42	90.85	128.02	16	38.10
8329.	Shiv (shivam9_)	42	58.98	73.97	13	30.95
8330.	Shift (shiftw)	42	77.05	94.54	14	33.33
8331.	Scooby (scoobydooby)	42	53.33	65.51	2	4.76
8332.	Sanyeet (sanyeet)	42	86.50	104.89	14	33.33
8333.	Sam (sam3456)	42	87.01	110.61	10	23.81
8334.	Ruben (rubenzhang)	42	93.46	108.15	15	35.71
8335.	RjTvqH (rjtvqh)	42	68.99	84.55	7	16.67
8336.	Ros (ric_ros_839)	42	41.46	48.75	5	11.90
8337.	Fedor (raxker)	42	47.26	53.67	1	2.38
8338.	Rain (rainy)	42	70.00	98.38	10	23.81
8339.	Parv (parvmodi)	42	56.93	65.66	6	14.29
8340.	omardigits (omarmejiaa)	42	54.57	67.02	6	14.29
8341.	Niofer (niofer)	42	77.76	98.52	8	19.05
8342.	nea (neapollotan)	42	70.67	85.42	8	19.05
8343.	Naulitus (naulitus)	42	69.15	79.64	11	26.19
8344.	Kristijonas (nasyrke)	42	78.70	90.81	16	38.10
8345.	1step (narcindin)	42	104.88	130.93	14	33.33
8346.	Dominik (monteymontey)	42	89.74	112.01	14	33.33
8347.	Anonymous (mntlprblm)	42	87.52	113.60	17	40.48
8348.	mt (migclare)	42	87.69	109.61	13	30.95
8349.	Lőrinc (mbalazs)	42	107.93	119.31	24	57.14
8350.	Mathyou (mathyou_177)	42	69.84	78.80	5	11.90
8351.	Masy (masy404)	42	66.49	82.20	36	85.71
8352.	Fastpoke (make_me_better)	42	69.22	86.07	11	26.19
8353.	maikim (maikim)	42	74.58	90.26	12	28.57
8354.	Mahatej Varma (mahatejvarma)	42	67.32	84.94	11	26.19
8355.	Aman (mag1k_iwnl)	42	63.88	79.92	14	33.33
8356.	Mad (mad888)	42	93.01	117.10	28	66.67
8357.	Luvie (luvie1310)	42	74.73	91.75	15	35.71
8358.	llameow (llameoww)	42	114.04	134.83	25	59.52
8359.	MeguminQT (leonathor)	42	90.48	101.83	20	47.62
8360.	Justin (leethelethal)	42	93.52	111.58	11	26.19
8361.	watchdominion.com (leegunner)	42	100.76	125.28	14	33.33
8362.	kanak (k_a_n_a_k)	42	44.20	58.78	3	7.14
8363.	Andrei (kulturedschwein)	42	54.20	74.25	4	9.52
8364.	sync (kjh2196)	42	102.63	116.28	17	40.48
8365.	Kirti (kirti773)	42	49.43	76.98	3	7.14
8366.	ω (kerdax)	42	79.94	97.66	8	19.05
8367.	john (jpom16)	42	58.77	71.89	9	21.43
8368.	Joshua (joshua172)	42	93.45	115.21	17	40.48
8369.	Aleksije (jastar)	42	45.53	58.60	8	19.05
8370.	Taco (i_the_sausage)	42	86.74	108.92	8	19.05
8371.	ivan (ivanchok)	42	94.14	118.25	15	35.71
8372.	tstats[isakooooo] (isakooooo)	42	121.50	144.23	21	50.00
8373.	Isaac (hyperkids)	42	119.60	142.62	18	42.86
8374.	Noah (hvon)	42	104.42	125.19	19	45.24
8375.	Hussain (hussainkhan)	42	56.80	71.57	4	9.52
8376.	Hreyfill Hreyfill (hreyfill)	42	144.13	180.23	35	83.33
8377.	hahnur (hahnurk)	42	98.28	116.57	16	38.10
8378.	sarah (hahaimsmart)	42	86.17	106.76	15	35.71
8379.	gst (gsttyping)	42	40.96	49.51	4	9.52
8380.	Miyamura (grapewiggler)	42	78.65	94.86	14	33.33
8381.	Gooby (goobygod)	42	98.48	123.90	25	59.52
8382.	Ara (goatrager)	42	64.45	89.79	10	23.81
8383.	Tugssaikhan (gantsogtt)	42	53.14	69.83	9	21.43
8384.	ludwigg (froggg)	42	75.39	100.33	6	14.29
8385.	James (fintero)	42	66.15	83.16	12	28.57
8386.	Eli (elity)	42	72.37	88.07	8	19.05
8387.	(egahbh)	42	134.81	153.40	28	66.67
8388.	Adam (ediggity152005)	42	120.01	135.57	24	57.14
8389.	Dmitriy (dimasidorenko)	42	53.68	62.39	7	16.67
8390.	Talha (digitaldruglord)	42	68.36	75.84	9	21.43
8391.	David (dgiddens928)	42	78.37	101.41	9	21.43
8392.	Devesh (dev344)	42	81.45	92.43	12	28.57
8393.	nielr (danyl)	42	61.76	81.42	6	14.29
8394.	Dingo Dango (dankwanktank)	42	70.65	91.64	14	33.33
8395.	Dude (damonjammin)	42	55.87	72.80	6	14.29
8396.	daikonsama (daikonsama)	42	52.00	66.66	6	14.29
8397.	Daniel (d123aniel)	42	95.71	118.96	18	42.86
8398.	crz316 (crz316)	42	41.23	49.16	2	4.76
8399.	retired, for now ᐢ.‸.�...	42	91.39	104.90	16	38.10
8400.	Chris (chrisk_04)	42	60.25	78.47	5	11.90
8401.	Charlie (charlieeeee)	42	92.54	110.30	16	38.10
8402.	Creams4 (chadzuko)	42	91.72	120.01	10	23.81
8403.	Bodyguard (bxdygxard)	42	50.42	64.07	3	7.14
8404.	Issaree (boranorben)	42	55.68	66.93	2	4.76
8405.	Pranav (bodiez)	42	75.20	101.24	16	38.10
8406.	Bobirjon (bob_pro)	42	61.00	72.84	11	26.19
8407.	Gibson (better_gibby)	42	99.59	120.04	13	30.95
8408.	Ben (benjals9)	42	59.61	78.49	10	23.81
8409.	dean (aydeano)	42	88.19	117.73	10	23.81
8410.	ariyaninj (aryaninj)	42	48.78	70.89	9	21.43
8411.	Angel (angelrami003)	42	51.55	64.20	2	4.76
8412.	Andrei (andyspeed)	42	72.19	89.57	13	30.95
8413.	Amarant (amarant_)	42	68.27	84.99	7	16.67
8414.	Ahpoo (ahpoo)	42	82.43	103.29	12	28.57
8415.	Adlin (adlin_typer18)	42	69.73	87.84	15	35.71
8416.	accorn (accorn279)	42	128.51	145.35	28	66.67
8417.	Abe (abe299)	42	51.83	67.85	6	14.29
8418.	Rafael (23woodyj)	42	89.86	108.01	13	30.95
8419.	Hunter (sascroc)	42	78.62	98.22	7	16.67
8420.	Fred (fgrady3)	42	60.60	72.51	4	9.52
8421.	Sanjero (sanjero)	42	63.88	77.55	9	21.43
8422.	Vinamr (h_e_y)	42	88.05	101.58	9	21.43
8423.	Eric (kusikiwi)	42	90.12	120.92	11	26.19
8424.	Cloudyrain (cloudy_rain)	42	44.78	60.40	4	9.52
8425.	Hanif (hanifimaduddin)	42	50.28	71.50	6	14.29
8426.	Ceus (simply_ceus)	42	67.92	79.56	12	28.57
8427.	J (jbddiesel)	42	59.70	73.05	11	26.19
8428.	Theo (theomorrison)	42	82.54	97.67	9	21.43
8429.	shanky (shasha06)	42	33.06	43.73	4	9.52
8430.	Raja (rajatype)	42	59.86	77.93	8	19.05
8431.	Pjmarella05 (pjmarella05)	42	55.93	68.36	5	11.90
8432.	Mindy (minnie3319)	42	76.53	89.21	16	38.10
8433.	Wolfgang (wolfgang_69)	42	46.00	62.33	3	7.14
8434.	Nyx (_nyxx_)	41	27.17	31.39	13	31.71
8435.	zefanya24k (zefanya24k)	41	111.80	132.29	18	43.90
8436.	banvotesgames (x_adware)	41	123.34	153.41	16	39.02
8437.	Bryan (xxavalonxx)	41	64.62	75.39	11	26.83
8438.	Waterman304 (waterman304)	41	99.27	111.75	12	29.27
8439.	Walnert (walnert)	41	96.60	115.29	24	58.54
8440.	Hai (vroyibg)	41	61.00	72.31	8	19.51
8441.	Pieter (umbravanlocks)	41	67.73	82.16	6	14.63
8442.	Car (ufoes)	41	75.76	93.51	7	17.07
8443.	Uladzislau (tumilok)	41	66.73	79.42	12	29.27
8444.	AJ (theloafingone)	41	109.08	131.73	28	68.29
8445.	em (thelawsofjay)	41	130.68	155.15	29	70.73
8446.	Bro (termog)	41	72.68	87.45	14	34.15
8447.	sean (tak32)	41	83.66	99.97	5	12.20
8448.	Josh (syztyqus)	41	82.97	94.64	14	34.15
8449.	Sujal (sujal_fast)	41	53.98	69.14	4	9.76
8450.	Hhhh (strawbirry)	41	93.41	116.88	14	34.15
8451.	Simone (simone79)	41	76.57	83.88	12	29.27
8452.	Gabe (silentsnake2398)	41	72.50	85.63	9	21.95
8453.	SHU (shu_ik)	41	84.80	107.25	14	34.15
8454.	BAZINGA (shruthi_)	41	54.42	61.89	3	7.32
8455.	Alex (servicer)	41	76.07	96.92	12	29.27
8456.	SECsplitOND (secsplitond)	41	96.58	122.99	20	48.78
8457.	scubtle (scrubsworth)	41	88.31	100.20	15	36.59
8458.	Sander (s4ndert)	41	61.21	85.26	12	29.27
8459.	Rubin (rubintypes)	41	81.34	95.39	12	29.27
8460.	Robby (roweki21)	41	81.90	100.17	14	34.15
8461.	Ripon Kumar (riponcse)	41	60.05	79.24	9	21.95
8462.	Stefan (ringding)	41	102.93	122.57	12	29.27
8463.	Rimuru (rim_uru)	41	54.19	64.16	3	7.32
8464.	R1CZ4RD (riczard)	41	51.61	61.81	4	9.76
8465.	Richie (richiemoring)	41	45.90	58.78	2	4.88
8466.	Shawn (rcvroom)	41	109.02	128.62	25	60.98
8467.	raymond (raymondgggg)	41	81.18	100.20	4	9.76
8468.	Ravi (raviparasar1997@gmail...	41	67.90	84.08	10	24.39
8469.	Renzo (raccon)	41	76.12	99.26	13	31.71
8470.	person (person625)	41	108.56	121.97	18	43.90
8471.	oToToT (ototot3ot)	41	68.70	80.80	10	24.39
8472.	noctedie (noctedie)	41	70.28	98.35	13	31.71
8473.	Nishit (nishit130)	41	60.79	77.15	9	21.95
8474.	Nick (nicklong1599)	41	109.19	127.53	21	51.22
8475.	Naren Manikandan (nane_m)	41	64.68	77.56	8	19.51
8476.	ko (nakanidashite)	41	63.08	85.91	12	29.27
8477.	Mon (m_nguyen05)	41	63.26	73.72	10	24.39
8478.	Princh (mvprinch)	41	113.99	135.75	24	58.54
8479.	Ricky (muffinpotato)	41	99.70	116.99	23	56.10
8480.	Moola_80wpm (moola_80wpm)	41	59.96	71.36	7	17.07
8481.	Kato (mkatoh)	41	87.50	108.43	15	36.59
8482.	Mukul (mega_mukul)	41	56.23	63.26	6	14.63
8483.	Potato (mega_juicer)	41	92.27	115.41	9	21.95
8484.	thomas (maxipixels)	41	77.76	102.62	13	31.71
8485.	Bojongkers (manqjayak)	41	98.90	122.33	18	43.90
8486.	MajesticBudder (majesticbud...	41	78.70	91.54	6	14.63
8487.	𝔏𝔦𝔪𝔬𝔟𝔢�...	41	55.53	64.94	2	4.88
8488.	Lalith Sharma (lalith_sharma7)	41	40.17	51.70	6	14.63
8489.	Lelu (laku_)	41	121.76	143.02	24	58.54
8490.	Kyle (kyman73)	41	99.97	127.06	16	39.02
8491.	Pawan (kpawans00533)	41	66.03	78.43	5	12.20
8492.	Kitzuney (kitzuney)	41	85.05	95.74	13	31.71
8493.	NO (kinda_weird_bro)	41	42.86	56.04	6	14.63
8494.	Sebastian (jschavesr)	41	59.82	74.99	3	7.32
8495.	JC (jollibeech)	41	76.61	90.80	23	56.10
8496.	Jake (jkdriven)	41	81.06	98.75	10	24.39
8497.	Jiawei (jiaweilin)	41	54.96	69.59	5	12.20
8498.	Jack (jack__toast)	41	81.20	96.08	9	21.95
8499.	flaneur simp (inariii)	41	149.68	183.65	8	19.51
8500.	kei (impeeverything)	41	129.64	165.19	25	60.98
8501.	illa (iladnas)	41	54.44	68.45	6	14.63
8502.	Jim (hockeyhead019)	41	96.29	110.93	14	34.15
8503.	Manish (hi_son)	41	43.74	62.48	6	14.63
8504.	Gunter (gunter1963)	41	47.35	58.60	5	12.20
8505.	Kieran (godquack)	41	65.91	76.75	10	24.39
8506.	Mr (glock19)	41	64.46	83.03	5	12.20
8507.	get_on_board (get_on_board)	41	98.39	114.39	21	51.22
8508.	georgebax (gbax)	41	94.51	112.69	14	34.15
8509.	Andrew (fyir)	41	71.31	90.35	13	31.71
8510.	frog! (froggysauce)	41	72.21	92.18	17	41.46
8511.	FRATNIX (fratnix)	41	70.68	84.35	13	31.71
8512.	Takumi (fractylz)	41	92.30	112.54	11	26.83
8513.	flaskur (flaskur)	41	88.42	103.39	10	24.39
8514.	A (fdsjaklfdsaj)	41	96.66	113.91	16	39.02
8515.	Luffy (fawnful)	41	52.87	65.34	4	9.76
8516.	Urolbek (faithful_1707)	41	65.48	77.01	8	19.51
8517.	karovD (fablem_workman)	41	77.18	97.88	12	29.27
8518.	mushykeys (exileflame282004)	41	68.87	85.60	4	9.76
8519.	Reetu Raj (eternal77)	41	41.57	50.39	7	17.07
8520.	Jennifer (ennyvanna)	41	18.02	22.53	7	17.07
8521.	John (enhoj22)	41	75.54	84.41	8	19.51
8522.	Emiesh (emiway247)	41	42.75	52.52	12	29.27
8523.	Joze (el_lobe)	41	106.08	127.65	18	43.90
8524.	Carrot (elelin)	41	58.03	72.36	11	26.83
8525.	BiggyBallsHD (egg_plant_pete)	41	53.29	65.86	3	7.32
8526.	Chris (eb_p0pe)	41	99.10	136.65	14	34.15
8527.	Dunkmasta (dunkmasta)	41	93.44	114.21	21	51.22
8528.	beep (doinyamom1337)	41	56.11	68.56	6	14.63
8529.	Jochwa (djoshuahebert)	41	80.67	96.33	12	29.27
8530.	D. (dissonvnt)	41	63.56	84.21	6	14.63
8531.	Dean (de4n_whit3)	41	100.06	127.57	25	60.98
8532.	colin (crustyrustonline)	41	55.67	79.48	7	17.07
8533.	N (crazycalm007)	41	88.14	105.61	9	21.95
8534.	CPL62Connor (cpl62_connorx)	41	53.93	68.84	9	21.95
8535.	coolfission (coolfission)	41	118.84	130.70	21	51.22
8536.	Confetix (confetix)	41	94.40	118.53	14	34.15
8537.	Cheney (cheneyc9999)	41	81.28	104.20	16	39.02
8538.	catfree (catfree)	41	116.05	130.95	21	51.22
8539.	Carter (carter44502)	41	87.76	102.10	10	24.39
8540.	Jasckon (camochameleon56)	41	79.18	95.06	11	26.83
8541.	sixten (calvin2)	41	81.25	98.70	11	26.83
8542.	b (byron911)	41	68.62	94.85	11	26.83
8543.	(brockbnntt)	41	84.25	110.86	15	36.59
8544.	Brendan (brendanlo4)	41	93.10	109.18	19	46.34
8545.	tstats[borzoian40] (borzoia...	41	87.46	106.13	18	43.90
8546.	Boomer (boomer_typer)	41	88.51	111.75	9	21.95
8547.	Noob (bloodylord)	41	46.17	63.67	11	26.83
8548.	Bikash (bikash_grg)	41	70.29	88.20	9	21.95
8549.	Mouse (atypingmouse)	41	71.65	87.41	12	29.27
8550.	Karina (asapkarina)	41	74.39	102.85	13	31.71
8551.	Jack (arcinae)	41	120.42	152.31	27	65.85
8552.	Amir (48u_54l1m)	41	78.46	90.37	10	24.39
8553.	Denny (yoanesdenny)	41	57.54	70.73	5	12.20
8554.	Periodude (rastapasta_ke)	41	61.02	72.94	9	21.95
8555.	light (light_dawn)	41	55.70	67.01	5	12.20
8556.	Connor (connoc)	41	54.71	71.28	4	9.76
8557.	kem (krelma)	41	90.70	110.83	17	41.46
8558.	Kiet (fagala)	41	46.99	54.05	5	12.20
8559.	Ben (xlockedbw)	41	44.00	60.38	1	2.44
8560.	Miguel Demonteverde (migs0999)	41	64.74	85.65	11	26.83
8561.	Ruby (_truby)	40	66.36	91.66	9	22.50
8562.	Alex (zipphys)	40	82.07	101.67	10	25.00
8563.	Ja (zentojamorn)	40	80.89	106.66	12	30.00
8564.	Yasser (yesserspeed)	40	64.68	78.61	12	30.00
8565.	ぜんじろう (yablu)	40	57.68	68.31	16	40.00
8566.	Sarves (xmemestar420)	40	98.53	122.17	13	32.50
8567.	Mato (xholm)	40	57.15	66.17	7	17.50
8568.	Whitecap (whitecap)	40	65.08	79.41	7	17.50
8569.	Wealthycentro (wealthycentro)	40	82.54	103.51	18	45.00
8570.	karina (wattisgone)	40	88.85	108.57	14	35.00
8571.	Enosh (watahec)	40	83.27	101.76	13	32.50
8572.	Vanessa (vanessahjp)	40	61.11	76.01	10	25.00
8573.	name (username04)	40	75.58	94.66	10	25.00
8574.	Uros (uroskrunic1988)	40	88.01	100.11	13	32.50
8575.	Joshua (twinklestarchild)	40	65.85	82.61	13	32.50
8576.	Esi (tsoob)	40	52.09	60.79	3	7.50
8577.	Tsuguto (tkogamer)	40	81.16	100.12	8	20.00
8578.	Doomer (thedoomer)	40	71.92	86.24	14	35.00
8579.	miranda (tfond)	40	75.60	83.95	10	25.00
8580.	Taco (tacobandit)	40	103.89	125.83	12	30.00
8581.	Shivam (swadhwa)	40	70.59	91.93	13	32.50
8582.	superss2104 (superss2104)	40	71.84	89.48	7	17.50
8583.	Sravan (sravanstg)	40	54.45	64.70	8	20.00
8584.	sqbaee (sqbaee)	40	41.50	47.72	5	12.50
8585.	Sonase (sonase19)	40	65.25	82.62	10	25.00
8586.	Joe Smith (slowtypingdino)	40	41.04	54.47	1	2.50
8587.	Joe (siyyy)	40	107.83	132.28	17	42.50
8588.	sir (sirhelp)	40	86.70	100.98	10	25.00
8589.	Alex (silverax3)	40	87.71	101.78	13	32.50
8590.	shinutsi (shinutsi)	40	89.76	104.62	17	42.50
8591.	Barry (shahkulu)	40	72.01	93.19	23	57.50
8592.	Soham (shadeoxide)	40	97.76	115.19	16	40.00
8593.	chandra (sekhar_88)	40	69.54	81.59	9	22.50
8594.	Ahadh (sedoninju)	40	53.88	63.77	9	22.50
8595.	sarthak (sarthak14327)	40	52.95	64.00	3	7.50
8596.	Rowan (rusicus)	40	72.42	93.01	10	25.00
8597.	geoff_g (roy_the_gizm0)	40	51.68	63.53	6	15.00
8598.	Roy (royzz)	40	87.06	108.36	16	40.00
8599.	rothdu (rothdu)	40	80.52	97.55	9	22.50
8600.	Zapphy (ronaldlincon)	40	88.15	114.57	27	67.50
8601.	Ronak (ronakkaria)	40	101.66	138.65	20	50.00
8602.	Trung (rohan86)	40	61.16	71.09	8	20.00
8603.	rodaina (rodaina)	40	35.28	47.77	4	10.00
8604.	Earnest (redwhirl)	40	87.88	97.91	15	37.50
8605.	Razor (razor_1)	40	72.05	91.34	11	27.50
8606.	FREE XANDER (razorlemon2)	40	146.36	223.70	25	62.50
8607.	Matt (purple_gorilla21)	40	71.66	88.96	9	22.50
8608.	Raphael (purified_salt)	40	69.45	86.39	10	25.00
8609.	Bodhi$attiva (ptran)	40	84.85	107.19	11	27.50
8610.	Artichoke (poofydragon)	40	74.62	93.73	11	27.50
8611.	Jason (poleam)	40	86.38	112.95	15	37.50
8612.	getfingrd (piggo1228)	40	103.82	123.80	16	40.00
8613.	Joel (phitsuh)	40	101.94	121.32	19	47.50
8614.	Dimitri (penguinhams)	40	93.03	120.74	14	35.00
8615.	Paul (obtrunco)	40	83.86	95.04	9	22.50
8616.	Andy (nycnets15)	40	111.38	143.47	19	47.50
8617.	Kazz (nutkazz)	40	74.72	91.56	12	30.00
8618.	Norbert (norbert515)	40	93.91	113.99	15	37.50
8619.	justme (nightval)	40	96.04	126.08	15	37.50
8620.	Nicole (nickizard)	40	45.48	69.96	3	7.50
8621.	Viktor (niandog)	40	52.96	66.25	5	12.50
8622.	Nawaraj Bista (nawaking)	40	52.87	65.54	4	10.00
8623.	Joe Mama (musicalsquire)	40	121.44	148.43	20	50.00
8624.	Mohamed (mohamedemad13)	40	72.92	87.51	10	25.00
8625.	Jack (modesties)	40	84.05	100.25	14	35.00
8626.	micur (micur)	40	107.00	125.57	21	52.50
8627.	Mendel (mendeljacks)	40	96.96	113.57	20	50.00
8628.	Memat (memat)	40	97.98	121.18	23	57.50
8629.	Mikel (meekay)	40	96.57	119.64	14	35.00
8630.	medo (medocool)	40	79.00	94.62	10	25.00
8631.	Nicholas (massive_nick)	40	72.74	94.89	20	50.00
8632.	tstats[manuelnara] (manueln...	40	51.98	66.44	4	10.00
8633.	Kieran (manawa)	40	77.39	100.48	15	37.50
8634.	Yogeshwar (mad_steins)	40	63.43	76.81	5	12.50
8635.	lolwut9001 (lolwut9001)	40	116.83	148.85	24	60.00
8636.	logicism (logicism)	40	105.52	123.76	17	42.50
8637.	Lil (liljuicy)	40	97.04	127.12	14	35.00
8638.	Lorenzo (leroiken11)	40	76.26	97.84	6	15.00
8639.	(lassolass)	40	80.65	97.62	13	32.50
8640.	Landers (landersex)	40	94.15	106.61	16	40.00
8641.	KronosBruh (kronosbruh)	40	63.04	86.20	7	17.50
8642.	Kris (kris510)	40	54.20	61.05	4	10.00
8643.	kr02lc (kreadzz)	40	81.05	109.00	17	42.50
8644.	Felipe (krakon_3)	40	74.21	90.43	8	20.00
8645.	Kornel (kornelt)	40	76.82	94.03	9	22.50
8646.	killerman (killerman_007)	40	54.19	73.81	12	30.00
8647.	Kiiryuu (kiiryuu)	40	110.57	127.39	19	47.50
8648.	Marcin (kawre)	40	92.21	117.08	14	35.00
8649.	Katherine (katherinekelly2012)	40	73.76	88.93	27	67.50
8650.	Kamen (kamen08)	40	63.74	82.01	11	27.50
8651.	Md Abdul (kader)	40	34.09	47.88	1	2.50
8652.	Josh (josh_carlin)	40	63.11	78.61	8	20.00
8653.	johnick44 (johnick44)	40	71.24	83.16	7	17.50
8654.	Jewmo (jewmo)	40	88.37	107.20	24	60.00
8655.	N o y b (jet1k)	40	105.04	120.75	19	47.50
8656.	Jester (jestertyper)	40	142.46	175.43	24	60.00
8657.	Jakob (jakobgran)	40	63.13	80.59	9	22.50
8658.	Jack (jacknachos)	40	77.89	96.09	12	30.00
8659.	J0kerJ4y (j0kerj4y)	40	106.58	124.16	18	45.00
8660.	skippie (itsskippie)	40	104.65	123.50	21	52.50
8661.	marvic (itsmarvic)	40	85.43	106.94	12	30.00
8662.	Issam (issam_08)	40	57.11	69.35	5	12.50
8663.	Ishaan (ishaanmahajan)	40	46.76	56.86	24	60.00
8664.	Jan (ingenieur)	40	84.19	97.98	12	30.00
8665.	Aayush (imqwerty)	40	106.82	123.26	21	52.50
8666.	ihateonyou (ihateonyou)	40	126.77	156.08	27	67.50
8667.	iCanBreathe (icanbreathe)	40	91.42	114.80	15	37.50
8668.	hotbx (hotbxlockbx)	40	80.80	93.90	15	37.50
8669.	Harry (harrycc3000)	40	87.08	100.23	16	40.00
8670.	Gareth (garethlyh)	40	90.19	109.84	13	32.50
8671.	Feras (frsbg)	40	92.36	118.28	13	32.50
8672.	fakhry (fakhryodi)	40	67.77	87.57	10	25.00
8673.	paranoid (enemy1337)	40	77.34	95.89	9	22.50
8674.	dwikydd (dwikydd)	40	77.77	91.83	12	30.00
8675.	ballentine (drinkitup)	40	106.14	130.07	24	60.00
8676.	Tahsin (drevil13)	40	84.92	99.19	12	30.00
8677.	Dorel (dorelm)	40	80.86	107.01	12	30.00
8678.	David (david_nguyen21)	40	67.70	82.03	4	10.00
8679.	curtavian (curtavi)	40	44.17	53.78	3	7.50
8680.	CulinArki (culinarki)	40	78.25	91.98	7	17.50
8681.	Blank (ct7567)	40	92.37	104.88	10	25.00
8682.	chuu (chuuceae)	40	100.76	127.19	36	90.00
8683.	Chet (chethus)	40	100.50	120.75	12	30.00
8684.	Peter (ch9cken)	40	93.39	123.21	12	30.00
8685.	Candlelight (candlelight8)	40	84.72	103.65	12	30.00
8686.	Abdullah (bunajim)	40	62.84	80.58	12	30.00
8687.	Braden (brad9181)	40	74.95	93.51	10	25.00
8688.	Bottlecapbottom (bottlecapb...	40	57.41	67.03	4	10.00
8689.	botlof (botl0f)	40	77.60	93.18	7	17.50
8690.	Joe (bop1000)	40	100.84	116.67	16	40.00
8691.	Emmanuel (blaez_)	40	67.73	78.58	16	40.00
8692.	BJ (bjfoutz00)	40	89.25	115.49	8	20.00
8693.	Bhuvanesh (bhuvaneshh)	40	35.44	43.56	3	7.50
8694.	roshan (bhattaroshan)	40	81.13	89.51	11	27.50
8695.	BetTheDerp (betthederp)	40	108.85	140.35	27	67.50
8696.	Betelgeuse (betelgeuse2310)	40	45.81	60.24	2	5.00
8697.	BakesChamp (bakes1223)	40	111.03	132.62	23	57.50
8698.	Aviral (aviralbh1)	40	87.10	103.01	17	42.50
8699.	Aril (arielkusnoto)	40	68.72	84.73	8	20.00
8700.	Ansh (anshghosh)	40	93.24	114.88	16	40.00
8701.	Aditya (anonymoose17)	40	89.91	110.91	9	22.50
8702.	Daniel (akr115)	40	48.67	58.68	3	7.50
8703.	AbsoluteZeroK (absolutezero...	40	88.54	105.39	15	37.50
8704.	Aaron (aasworth)	40	75.05	94.35	10	25.00
8705.	Aarondn34 (aarondn34)	40	82.68	98.97	6	15.00
8706.	Peter (1_peter_1)	40	53.56	60.60	5	12.50
8707.	Dennis (1nys)	40	76.95	100.45	12	30.00
8708.	(19wpmavg)	40	87.07	104.79	16	40.00
8709.	Speedy (iamspeeeeeeeed)	40	53.82	65.14	1	2.50
8710.	Astolfo (astolfokawaii)	40	36.14	46.94	4	10.00
8711.	Yogender Singh Jadon (yogen...	40	91.79	113.91	17	42.50
8712.	champ (kalmaxz)	40	41.00	58.01	6	15.00
8713.	mal (malrie)	40	55.00	66.44	6	15.00
8714.	Crinum (crinum)	40	49.23	69.29	4	10.00
8715.	Ahnaf (crimson_doe)	40	57.10	67.72	4	10.00
8716.	SOUL (soul699)	40	44.57	61.15	10	25.00
8717.	jackes (jackez)	40	32.00	41.95	0	0.00
8718.	Ibrohim (reedox)	40	47.11	59.72	9	22.50
8719.	Cryptic (mbgamer01248)	40	68.34	81.42	11	27.50
8720.	Rahil (thekaratekid)	40	81.23	105.87	34	85.00
8721.	Guido (guidofe)	40	59.61	77.76	5	12.50
8722.	30 wpm typer (harshshelar)	40	37.80	47.86	2	5.00
8723.	TextingDriver (shandysk)	40	68.86	76.90	6	15.00
8724.	Divyansh (_divyanshwastaken)	39	24.25	33.53	9	23.08
8725.	( ͡° ͜ʖ ͡°) (zarthax69)	39	100.58	125.44	19	48.72
8726.	Allison (zarfynn)	39	89.36	106.26	15	38.46
8727.	Shivesh Tiwari (yuvanastra)	39	66.22	87.77	13	33.33
8728.	Le (yorkist)	39	55.32	68.36	9	23.08
8729.	yonatan (yonatanlib)	39	59.74	71.03	2	5.13
8730.	Venus (xxvenusxx)	39	70.39	91.87	10	25.64
8731.	William (williamc7879)	39	124.41	158.72	33	84.62
8732.	Jason (wepanator)	39	60.83	76.15	8	20.51
8733.	William (wdk5013)	39	88.87	111.65	16	41.03
8734.	Roger (walki_bv)	39	47.82	54.94	3	7.69
8735.	Vlad (vladdycrz)	39	90.48	112.48	11	28.21
8736.	Vivek (vivekjoshi556)	39	77.90	96.07	11	28.21
8737.	vee (veedoze)	39	86.09	107.14	10	25.64
8738.	Tiago (tiagval)	39	57.11	75.43	7	17.95
8739.	Thunder (thunder05)	39	38.19	50.26	0	0.00
8740.	spoon (thrownspoon)	39	65.82	83.09	6	15.38
8741.	The Medium (themedium)	39	61.57	71.27	6	15.38
8742.	Bourdon 16' (thekeyofg)	39	90.86	103.39	14	35.90
8743.	suff (suffy2)	39	53.80	71.86	9	23.08
8744.	burgir. (sub10cuber)	39	103.45	126.27	14	35.90
8745.	0 (studdab)	39	54.82	63.38	2	5.13
8746.	ya (stfudesu)	39	96.75	125.33	15	38.46
8747.	Juey (spyrox)	39	66.94	79.54	6	15.38
8748.	Loudy (skolchem)	39	54.11	65.03	5	12.82
8749.	Kevin (siacker)	39	128.18	160.52	28	71.79
8750.	Shobaik (shobaik_04)	39	49.54	60.38	6	15.38
8751.	Saphrog (saphrog)	39	69.89	87.36	8	20.51
8752.	Varun (salmonwings8207)	39	59.19	72.60	10	25.64
8753.	Sajal (sajal0809)	39	45.05	55.95	3	7.69
8754.	ALIF (ronin98)	39	58.78	70.46	6	15.38
8755.	Ricky (rickestsot)	39	96.82	118.33	19	48.72
8756.	rethya (reimogi)	39	117.21	142.62	18	46.15
8757.	Rehan (rehan_vibes)	39	52.60	70.22	25	64.10
8758.	Ray (ray_jan)	39	32.33	39.32	1	2.56
8759.	Jr (rattllingsecret)	39	60.20	74.34	26	66.67
8760.	Gary (prtuc2)	39	78.36	91.13	10	25.64
8761.	Allan (pronewb2325)	39	56.48	68.06	8	20.51
8762.	PRANADALA (pranadala)	39	76.76	88.57	17	43.59
8763.	Anar (pomegarnet)	39	57.74	74.56	7	17.95
8764.	pono (pnawan)	39	88.35	115.13	17	43.59
8765.	Pluufi (pluufi)	39	104.97	125.56	34	87.18
8766.	Gwen (planetzero)	39	45.99	60.23	4	10.26
8767.	Xhu (okxhu)	39	75.88	91.51	11	28.21
8768.	Kostboss (okostas)	39	112.56	127.64	18	46.15
8769.	Rami (nub_paws)	39	92.74	106.00	14	35.90
8770.	Allay (noob_wrath)	39	94.81	111.10	12	30.77
8771.	kdjaiel (nobody42)	39	26.60	35.42	3	7.69
8772.	ni (nischalace)	39	64.08	81.41	12	30.77
8773.	Angel (ninjasneak543)	39	82.67	97.77	13	33.33
8774.	Nilias (nilias121)	39	79.42	92.58	11	28.21
8775.	Ali (naseria1)	39	62.28	80.64	10	25.64
8776.	Nabil (nabil_aldihni)	39	107.72	132.51	20	51.28
8777.	Alex (mysterybox)	39	90.46	115.68	20	51.28
8778.	Austin (millerlite)	39	54.24	65.94	3	7.69
8779.	Christopher (milk38)	39	42.73	54.26	2	5.13
8780.	Enkh-Och (mglstew)	39	84.24	110.74	26	66.67
8781.	It's Davda ✅👣 (meetdavda)	39	118.84	137.59	25	64.10
8782.	Louis (meenepo)	39	107.31	137.45	15	38.46
8783.	maufry (maufry)	39	90.79	112.64	11	28.21
8784.	lucas (lucas757)	39	86.98	104.17	9	23.08
8785.	Lotus (lotus7)	39	99.91	118.74	14	35.90
8786.	Locus (locus_)	39	54.47	62.33	3	7.69
8787.	Fredric (lockheart456)	39	74.26	89.07	9	23.08
8788.	Omik (litynity)	39	44.79	61.33	7	17.95
8789.	Tiger (lilnhan)	39	79.69	92.83	6	15.38
8790.	Jozef (lawalamp12)	39	88.91	101.58	20	51.28
8791.	kyle (kylesch)	39	104.23	115.48	13	33.33
8792.	kyasaa (kyasaa)	39	70.38	81.77	13	33.33
8793.	Hehe (kumotz)	39	64.91	85.18	17	43.59
8794.	Manas (kingmanas)	39	74.26	87.08	8	20.51
8795.	Nathan (killzs)	39	68.69	83.40	9	23.08
8796.	kila (kila_lol)	39	57.04	68.22	3	7.69
8797.	kifumi (kifumi)	39	113.94	129.96	19	48.72
8798.	Khawla Halim (khawla_hlm)	39	39.46	46.23	3	7.69
8799.	keval (keval18)	39	70.20	84.11	10	25.64
8800.	Le Kang (kangkanglw)	39	71.26	89.85	11	28.21
8801.	josiah (josiah_is_weird)	39	60.87	73.25	8	20.51
8802.	ジョン (johnr_)	39	110.11	150.97	21	53.85
8803.	Johnny (johnnyquest30)	39	91.10	104.81	37	94.87
8804.	Jen (jen_23)	39	83.09	108.86	18	46.15
8805.	William (ithan)	39	64.11	85.13	9	23.08
8806.	Izzy (ishey)	39	101.73	126.32	14	35.90
8807.	Inrieal. (inrieal)	39	56.93	67.74	4	10.26
8808.	InboxRatio (inboxratio)	39	74.67	87.59	13	33.33
8809.	can we have some simple sho...	39	120.72	162.37	23	58.97
8810.	. (hiradesuwu)	39	59.30	73.00	11	28.21
8811.	himanshu (himanshukumar_ce)	39	47.85	60.52	4	10.26
8812.	Brandon (hereisausername2)	39	150.39	178.38	19	48.72
8813.	llllllllll (gndndfs)	39	61.28	74.07	10	25.64
8814.	. (ggsnipes)	39	85.52	103.00	14	35.90
8815.	George (geoju)	39	85.15	106.75	13	33.33
8816.	Racharg (freedobby)	39	73.40	90.50	7	17.95
8817.	Benny (fransiskusbenny)	39	55.10	68.73	5	12.82
8818.	fen (fen10)	39	107.41	155.44	22	56.41
8819.	slowboiken (fastken)	39	81.66	98.93	9	23.08
8820.	Ethna (ethna)	39	86.46	103.72	11	28.21
8821.	end (end_pro)	39	65.76	82.72	7	17.95
8822.	EkBros (ekbros9_)	39	76.11	96.31	8	20.51
8823.	kuan-yu (edisonhello)	39	78.97	90.36	5	12.82
8824.	Raul (eatmydusthoe)	39	67.64	83.68	7	17.95
8825.	Driew (driew)	39	88.73	113.79	14	35.90
8826.	From the river to the sea (...	39	86.75	111.10	11	28.21
8827.	Kuczora (drael1024)	39	99.05	123.02	19	48.72
8828.	Daniele (dprimon)	39	36.62	46.38	3	7.69
8829.	Robin (dontcallmenymphadora)	39	80.41	96.52	11	28.21
8830.	Dongles (dongles)	39	128.11	159.88	28	71.79
8831.	DONATETOWATERAID (donatetow...	39	117.94	141.04	28	71.79
8832.	David (dlreed27)	39	102.06	116.07	21	53.85
8833.	Danky (dankyv1)	39	60.68	71.60	11	28.21
8834.	Clone (clonex1)	39	60.63	73.61	7	17.95
8835.	Tomas (clickity_clark)	39	49.12	62.17	3	7.69
8836.	Mike (cherryot)	39	89.49	109.17	9	23.08
8837.	charlotte (charltypes)	39	64.94	75.92	16	41.03
8838.	Cavid (cavid)	39	54.09	63.91	4	10.26
8839.	B (bz___)	39	149.86	196.51	26	66.67
8840.	Ian (bunnyian)	39	86.56	106.28	8	20.51
8841.	brocco (brocollie)	39	81.42	99.88	12	30.77
8842.	Soonbeom (bringu2h)	39	57.19	64.33	7	17.95
8843.	UWU (blizztera)	39	77.44	89.14	15	38.46
8844.	Beksultan (bexultan)	39	89.87	107.06	16	41.03
8845.	_ (baoy)	39	88.68	111.98	12	30.77
8846.	Chloe (bananatyper9)	39	98.00	125.69	14	35.90
8847.	Alvin (ayesizzle)	39	101.47	116.01	17	43.59
8848.	Arsalnovt (arsalnovt)	39	68.05	85.08	11	28.21
8849.	ariferrari (ariferrari)	39	60.99	75.90	6	15.38
8850.	Max (antmanmax)	39	122.66	141.91	24	61.54
8851.	Anmulla (anmulla)	39	29.53	39.44	5	12.82
8852.	Andy (andyjg47)	39	107.49	140.00	19	48.72
8853.	anand (anandzzz1973)	39	64.01	81.59	15	38.46
8854.	Aman (aman_7002)	39	39.87	47.18	5	12.82
8855.	ALostKorean (alostkorean)	39	104.52	132.05	16	41.03
8856.	Arthur (agouraptor)	39	45.13	60.46	2	5.13
8857.	Jacques (acesfracked)	39	79.45	91.61	13	33.33
8858.	Syam (aaasssppp)	39	43.11	56.85	10	25.64
8859.	রাতুল (1415926535...	39	58.27	72.11	5	12.82
8860.	Hugo (vangoulard)	39	50.18	63.76	4	10.26
8861.	Elec (elecki)	39	56.65	70.95	14	35.90
8862.	Narki (narkivitek)	39	62.07	78.77	4	10.26
8863.	Daniel (yourfqace)	39	90.37	116.85	15	38.46
8864.	Kingsley (cyber_br0)	39	46.07	57.92	4	10.26
8865.	Kartikeya (karotiko)	39	70.21	87.60	9	23.08
8866.	TPK (tpk_coff33)	39	48.81	62.47	6	15.38
8867.	eli (ollro)	39	56.11	70.69	14	35.90
8868.	yousef (yousef3)	39	33.16	43.83	11	28.21
8869.	Bruzsa (bruzs)	39	54.41	66.37	2	5.13
8870.	saketh (saketh_v)	39	47.80	57.44	4	10.26
8871.	Shagirthan (vemidse)	39	42.70	48.23	4	10.26
8872.	Noodles (47noodles)	39	72.92	82.35	20	51.28
8873.	eivind (limberton)	39	68.77	95.80	13	33.33
8874.	🏎️frank (__slowtypist__)	38	110.93	128.20	14	36.84
8875.	yuvibirdi (yuvi_birdi)	38	70.47	83.08	7	18.42
8876.	yuth (yuth_isme)	38	51.54	62.91	7	18.42
8877.	James (youngthe)	38	45.40	55.40	4	10.53
8878.	Ulises (xindrome)	38	64.49	78.34	6	15.79
8879.	Xeogran (xeogran)	38	172.82	198.75	35	92.11
8880.	Etalm (walter_gilbert)	38	114.43	142.09	22	57.89
8881.	Wowa (vovsanka)	38	67.04	77.60	6	15.79
8882.	Vmanalt (vmanalt)	38	94.07	111.99	17	44.74
8883.	Viet Trung (viettrung9012)	38	93.27	106.99	18	47.37
8884.	Jorryn (vicmg)	38	81.35	98.09	7	18.42
8885.	Uways (uways)	38	66.04	86.43	7	18.42
8886.	Charles (tyuule)	38	95.89	122.28	21	55.26
8887.	Tayden (tydn12)	38	76.41	97.01	10	26.32
8888.	Christian (trotuele)	38	75.14	88.13	7	18.42
8889.	Triton (tritonthetrident)	38	71.71	85.72	12	31.58
8890.	Thomaskov (thomas861205)	38	60.61	71.40	5	13.16
8891.	Last (thelastmuffin)	38	102.12	118.05	14	36.84
8892.	Dasha (thedashaier)	38	87.73	100.44	17	44.74
8893.	James (th3james)	38	79.75	97.93	10	26.32
8894.	sk (teslateslatesla)	38	89.09	108.60	7	18.42
8895.	T (tegicupala)	38	91.66	103.05	14	36.84
8896.	Tashima (tashima42)	38	83.55	109.79	13	34.21
8897.	Grandjudge (talonted)	38	81.59	102.17	11	28.95
8898.	Aaron (suckmeoffhoe)	38	68.63	81.94	8	21.05
8899.	Professor (steveisawesomer)	38	62.10	74.28	10	26.32
8900.	snowdenwald (snowdenwald)	38	80.78	97.50	9	23.68
8901.	Sneha (sneha_1610)	38	35.65	46.48	3	7.89
8902.	Luka (smilyee)	38	57.30	69.74	7	18.42
8903.	Christ (slowasf1)	38	106.69	132.84	16	42.11
8904.	Samuel (slee2)	38	63.08	81.66	4	10.53
8905.	Shubham (shubham2007)	38	44.64	60.49	1	2.63
8906.	shubham (shubham1999)	38	92.32	115.66	15	39.47
8907.	Shlock (shlockington)	38	105.12	124.56	19	50.00
8908.	Sharkbait (sharkydabnab)	38	84.27	106.53	13	34.21
8909.	Shantanu (shantanugupt)	38	44.74	55.13	6	15.79
8910.	Jeffrey (seedotgrass)	38	72.47	83.95	11	28.95
8911.	Oscar (scarigam)	38	88.85	102.08	3	7.89
8912.	Sanad (sanad)	38	33.34	42.38	7	18.42
8913.	Saba (samsungexynos)	38	78.93	104.43	10	26.32
8914.	Sami (sami_66)	38	49.28	56.52	3	7.89
8915.	Jayseek (saltymood)	38	71.94	93.63	10	26.32
8916.	sagar (sagarlama)	38	37.14	47.80	3	7.89
8917.	Protein (rsandland)	38	84.77	98.75	9	23.68
8918.	Roman (roman_kovalchuk)	38	57.91	67.17	2	5.26
8919.	Thi (rodingersmg)	38	87.67	107.95	11	28.95
8920.	Mistakes Were Made (rhino1998)	38	73.18	88.72	11	28.95
8921.	Renson (renson1)	38	107.05	137.45	16	42.11
8922.	中学 (randomguyhe)	38	83.09	100.15	9	23.68
8923.	Crudux-Crue (raman_rr)	38	54.37	65.22	3	7.89
8924.	ragnarok (ragnarokiscomming)	38	79.51	98.60	9	23.68
8925.	Quintino (quintino123)	38	94.15	109.04	8	21.05
8926.	LiterallyYou (quesket)	38	74.61	97.88	8	21.05
8927.	pogi (pogy)	38	47.95	69.18	9	23.68
8928.	foxgirl (playtoomuchgames)	38	98.43	127.26	10	26.32
8929.	Viktor (pineapple212)	38	94.30	127.46	12	31.58
8930.	jayp (phrasez)	38	92.72	122.02	27	71.05
8931.	не встретил бо�...	38	151.56	166.12	34	89.47
8932.	Tosti-ijzer (paupermongool)	38	99.14	112.80	10	26.32
8933.	bat (origluun)	38	79.59	92.82	8	21.05
8934.	clooverhoover (olivesandlem...	38	67.74	95.00	9	23.68
8935.	nyouhas (nyouhas_)	38	90.35	112.45	20	52.63
8936.	Noukarin (noukarin)	38	84.41	106.47	10	26.32
8937.	Nitrogen (nitrogen_addict)	38	47.89	59.10	3	7.89
8938.	Nemsi (nemsii)	38	128.77	145.52	23	60.53
8939.	Arden (moo_o)	38	93.50	121.21	13	34.21
8940.	kayg (miryokucolemakdh)	38	84.10	106.25	20	52.63
8941.	shum (michaelshumshum)	38	84.01	101.00	12	31.58
8942.	Mewn (mewn)	38	78.47	95.27	12	31.58
8943.	Muhammad Amin (mast1999)	38	53.99	77.14	17	44.74
8944.	Marouane (maromaro02)	38	53.48	64.09	2	5.26
8945.	Mark (markachuang)	38	88.90	108.64	16	42.11
8946.	Manas (manasmahanand)	38	60.43	70.92	11	28.95
8947.	lin (lty2002)	38	60.33	83.67	10	26.32
8948.	The Papal State (loquiera)	38	97.07	113.06	11	28.95
8949.	Hitscan (loonatick_src)	38	93.12	112.79	15	39.47
8950.	Marty (lagoskid)	38	71.28	91.47	17	44.74
8951.	Kevin Carl (kevincarl09)	38	59.07	67.53	7	18.42
8952.	Kaushik (kaushik13)	38	64.13	85.68	10	26.32
8953.	karina (kar1na_)	38	53.48	66.34	5	13.16
8954.	mmmmm (kamenrider345)	38	77.30	95.24	11	28.95
8955.	Kagamine Len (kagamine_len)	38	97.00	120.45	9	23.68
8956.	Amir (justinpaper)	38	43.23	53.12	7	18.42
8957.	Joseph (jsph273)	38	106.14	124.34	21	55.26
8958.	Jerry (jerryr5279)	38	94.55	124.68	13	34.21
8959.	Ellie (jellylie2005)	38	67.79	79.65	6	15.79
8960.	Jacob (jeepers_jake)	38	109.95	134.13	22	57.89
8961.	Jan Kozaruk (jackoza)	38	22.60	32.17	21	55.26
8962.	(ilikeponyz20)	38	94.55	110.44	15	39.47
8963.	Vladislav (iivlad)	38	59.87	74.39	8	21.05
8964.	G (hyperglide)	38	129.62	152.16	22	57.89
8965.	heclord (heclord)	38	93.13	108.04	11	28.95
8966.	H. (hblord)	38	96.47	110.06	21	55.26
8967.	hs (hakanserce)	38	75.85	91.08	8	21.05
8968.	Hajar (hajar424)	38	89.76	113.89	10	26.32
8969.	Gustas (guzhazi)	38	84.29	114.28	13	34.21
8970.	Ozz (gravechill)	38	98.95	129.78	15	39.47
8971.	0 (gochoo)	38	93.39	107.68	13	34.21
8972.	Filthy (filthyballer)	38	55.92	66.87	5	13.16
8973.	ferris (ferrisiscool)	38	82.37	100.06	13	34.21
8974.	Feriiii (feriiiiiiii)	38	54.22	63.41	5	13.16
8975.	EthanDennisttv (ethandennis)	38	107.63	130.94	14	36.84
8976.	john (er3g10us)	38	54.38	70.00	10	26.32
8977.	dox3 (dox3m)	38	61.60	75.79	12	31.58
8978.	aoeu (dengzacd)	38	132.19	152.75	21	55.26
8979.	DR (dekesta_)	38	114.74	144.22	28	73.68
8980.	Sangyoung (ddragoons)	38	121.72	154.36	24	63.16
8981.	Karthik (darthmortem)	38	60.00	73.95	6	15.79
8982.	ちゃりかく (clayjar)	38	120.20	137.27	22	57.89
8983.	Hello (clappy)	38	74.63	89.63	13	34.21
8984.	C4MFZ (c4mfz)	38	67.48	81.72	7	18.42
8985.	Kevin (busterz)	38	43.48	52.58	3	7.89
8986.	Burger (burgercheese)	38	110.84	134.18	24	63.16
8987.	brobie (brobie747)	38	96.31	120.45	14	36.84
8988.	Bit (bitnerik)	38	66.28	77.37	6	15.79
8989.	Henry (barihenry)	38	96.91	114.69	15	39.47
8990.	Awkward (awkward_fruitcake)	38	90.00	100.82	9	23.68
8991.	Peter (avezan)	38	95.33	127.93	14	36.84
8992.	Jake (aurelias)	38	104.76	128.77	12	31.58
8993.	PrairieBaron (atbaron)	38	77.29	93.98	9	23.68
8994.	AspectOfTheNerd (aspectofth...	38	94.59	125.63	15	39.47
8995.	Asylbek (askodzhenaliev)	38	35.10	43.55	14	36.84
8996.	Arthur (art8urch3ng)	38	53.03	68.61	5	13.16
8997.	abracadabra (ariunerdene)	38	35.17	43.51	11	28.95
8998.	loli (annalise00)	38	76.11	91.46	9	23.68
8999.	Anmol (anmoljaat_)	38	43.19	52.69	9	23.68
9000.	Anha (anha05)	38	64.25	77.88	6	15.79
9001.	Angelo (angelo123123)	38	124.38	149.20	26	68.42
9002.	angelic (angeliccalling)	38	29.28	43.70	4	10.53
9003.	Michael (anfestan)	38	29.88	40.25	5	13.16
9004.	anas (anas771989)	38	51.53	61.11	3	7.89
9005.	AmazingKitchen (amazingkitc...	38	86.92	100.85	10	26.32
9006.	Altair (altairaltair)	38	50.98	65.80	7	18.42
9007.	Juan (alcaann)	38	67.79	83.93	13	34.21
9008.	Akshay (akshayxw69)	38	70.50	85.60	4	10.53
9009.	Dara (adoran)	38	79.87	100.97	8	21.05
9010.	Slow Typer (4rs3n1c)	38	76.60	90.14	19	50.00
9011.	potato (potatoattack)	38	77.63	90.29	13	34.21
9012.	Anton kenneth lee bell (m011y)	38	77.20	94.35	9	23.68
9013.	Robert (robboy)	38	76.67	102.90	5	13.16
9014.	dove (nach9208)	38	90.29	111.18	14	36.84
9015.	BlackVerse (drako201)	38	62.74	77.80	7	18.42
9016.	mangesh (muxx)	38	29.32	38.99	8	21.05
9017.	ANKUR BARNWAL (ankur_123)	38	63.60	79.09	9	23.68
9018.	Michal (murb)	38	58.55	69.88	7	18.42
9019.	WeWake (we_wake)	38	55.85	66.37	4	10.53
9020.	Paulo (bibon98)	38	72.97	89.80	11	28.95
9021.	Leemon (leemon_slice)	38	34.70	54.83	3	7.89
9022.	vsn (miniliki)	38	90.52	109.45	14	36.84
9023.	Michael (biggerpeach)	38	74.27	90.94	6	15.79
9024.	Genta (azcr1_)	38	34.92	43.25	17	44.74
9025.	Kian (kiwiyan)	38	91.76	110.38	26	68.42
9026.	pavan sai (pavan2569)	38	57.95	70.00	5	13.16
9027.	iris (noom3000)	38	73.78	92.97	11	28.95
9028.	happyft (happyft)	38	123.91	159.64	19	50.00
9029.	Lambo (lambodhar)	38	56.05	68.50	27	71.05
9030.	forehead (piratebs)	38	124.51	151.56	20	52.63
9031.	WAD (_waddup_)	37	66.20	82.54	14	37.84
9032.	Ian (zento_x)	37	62.35	72.81	5	13.51
9033.	InHuMaN (yminag123)	37	111.41	127.49	16	43.24
9034.	yessine (yessine14)	37	62.66	77.81	9	24.32
9035.	Ethan (yaboinugget)	37	124.67	152.04	18	48.65
9036.	FTL (xxfangtingxx)	37	72.44	86.56	8	21.62
9037.	W (w_v_)	37	94.39	120.43	18	48.65
9038.	Ben (wippidy)	37	75.15	91.62	9	24.32
9039.	hi (watlok)	37	131.93	159.04	20	54.05
9040.	Vishal (vpm911)	37	77.15	98.92	5	13.51
9041.	Vatsala (vatsala)	37	60.92	71.61	7	18.92
9042.	u8y7541 (u8y7541)	37	136.10	160.55	25	67.57
9043.	Ball Sweat (typing_man_man)	37	76.77	89.99	8	21.62
9044.	I am in school rn (typingin...	37	85.68	98.66	15	40.54
9045.	Abhinav (typingcompany)	37	37.94	50.03	3	8.11
9046.	Type (type_racer_15)	37	67.71	81.06	8	21.62
9047.	Jack (turtlejack)	37	53.67	63.28	5	13.51
9048.	TTMo1 (ttmer)	37	143.58	187.08	30	81.08
9049.	Rock (trailersg)	37	68.13	77.88	9	24.32
9050.	Fast (too_fast_foru)	37	63.89	73.55	5	13.51
9051.	John (tmikelburg)	37	107.16	137.61	10	27.03
9052.	Fae (suga_spice)	37	38.72	48.76	12	32.43
9053.	Amarnath (stormprod)	37	71.93	99.10	11	29.73
9054.	Andrew (sq_leonhart)	37	97.87	116.36	18	48.65
9055.	Sophia (sophia2020)	37	82.57	101.88	4	10.81
9056.	. (solorex_)	37	82.57	120.32	25	67.57
9057.	Erick (sockeymeow)	37	92.46	110.13	7	18.92
9058.	light (skepnap)	37	42.39	54.79	1	2.70
9059.	Jojuh (shojubruh)	37	90.86	112.81	19	51.35
9060.	shiru (shiruetto68)	37	116.07	142.18	19	51.35
9061.	Shenen (shenenjump)	37	104.95	122.65	20	54.05
9062.	Jason (saltybaskets)	37	90.47	106.31	10	27.03
9063.	Kyle (sadkhaki)	37	53.97	64.96	3	8.11
9064.	Aru (s3rikbaeva)	37	46.26	61.90	5	13.51
9065.	Rold (roldmargruv)	37	66.82	82.54	22	59.46
9066.	Aarsh (revolt1ng)	37	65.90	77.70	8	21.62
9067.	Rekordea (rekordea)	37	85.20	113.35	13	35.14
9068.	1 (reforme)	37	76.34	89.24	9	24.32
9069.	Parvez (pz1971)	37	73.45	83.35	14	37.84
9070.	Yevhenii (prinzeugen)	37	85.23	100.44	14	37.84
9071.	radar (pranav24)	37	59.93	71.62	13	35.14
9072.	andrew (potatoh)	37	83.73	102.11	11	29.73
9073.	light (pinkyhurts)	37	74.47	87.95	10	27.03
9074.	PancakeDAWGZ (pancakedawgz)	37	121.02	139.42	19	51.35
9075.	Liad (ozonzono)	37	74.78	93.74	6	16.22
9076.	orde (orde)	37	103.03	129.43	10	27.03
9077.	Omar (omarabzd)	37	86.97	106.78	15	40.54
9078.	Omer (okirnap)	37	86.79	102.96	9	24.32
9079.	NC3 (nickkcastaneda)	37	63.10	81.42	13	35.14
9080.	Mohammad (naveedroy)	37	36.90	44.41	3	8.11
9081.	nadeem (nadeemgujjar560)	37	64.50	80.02	11	29.73
9082.	azaab (minsato)	37	69.10	85.07	7	18.92
9083.	Matthew (mbryantms)	37	110.89	130.70	19	51.35
9084.	Luke (lukedood)	37	106.48	137.71	21	56.76
9085.	juliana (lilfl3shy)	37	47.32	54.72	5	13.51
9086.	LightUnicorn839 (lightunico...	37	39.47	49.88	1	2.70
9087.	Roast (lemonshine)	37	59.68	76.45	7	18.92
9088.	RENIEL RENZ (leiner_ross15)	37	73.39	83.94	12	32.43
9089.	Ali (lasthunter69)	37	61.03	78.22	7	18.92
9090.	Lai (lai_)	37	80.05	94.35	11	29.73
9091.	Kijurin (kijurin)	37	75.26	90.83	12	32.43
9092.	Kelvin (kelvin666)	37	60.85	71.14	10	27.03
9093.	Kyla (kdawg22)	37	95.16	109.56	21	56.76
9094.	kamal (kamaluddin)	37	37.68	46.35	1	2.70
9095.	tstats[kafuu] (kafuu)	37	104.33	140.60	20	54.05
9096.	詠璿 (justforfun0906)	37	56.78	67.11	7	18.92
9097.	Justanalek (justanalek)	37	69.27	79.65	5	13.51
9098.	Jimmy (jimmyr1027)	37	90.87	126.65	25	67.57
9099.	Jason (jason_the_human)	37	58.16	70.65	8	21.62
9100.	Jamie (jamiekwok)	37	48.19	54.99	1	2.70
9101.	Justin (j98101237)	37	66.43	85.65	10	27.03
9102.	69 (i_am_better_than_u_lol)	37	66.11	85.48	27	72.97
9103.	amanita! (irving1234028)	37	116.00	142.93	18	48.65
9104.	Intetsu (intetsun6)	37	30.12	36.70	2	5.41
9105.	Oscar (iloveveck)	37	60.99	84.20	2	5.41
9106.	iks de (iksdebro)	37	92.56	117.83	13	35.14
9107.	hewan (ikan_laut)	37	32.55	36.83	5	13.51
9108.	Bart (hubba485)	37	117.82	136.26	17	45.95
9109.	Rain (hlbentz)	37	125.33	143.54	22	59.46
9110.	Max (hihello12327)	37	70.26	87.86	11	29.73
9111.	gyfan10 (gyfan10)	37	75.03	93.31	8	21.62
9112.	Gustav (gustavelmqvist)	37	86.31	107.77	12	32.43
9113.	Grosse (grossescheisse)	37	56.96	72.20	6	16.22
9114.	Grace (gracejin)	37	38.66	51.80	0	0.00
9115.	Dawg (goon_goonster)	37	87.37	104.00	13	35.14
9116.	Nakoa Blue (goldtiger7)	37	39.50	48.51	1	2.70
9117.	Frostsights (frostsights)	37	100.29	119.34	11	29.73
9118.	Purpl3 (froghie)	37	67.18	89.56	14	37.84
9119.	Sentinel (fedayeen)	37	83.62	98.49	12	32.43
9120.	Erza (ewalk91098)	37	51.99	60.30	5	13.51
9121.	sky (elsecaller)	37	88.60	98.93	6	16.22
9122.	Thundering (electricbiscuit)	37	121.21	139.26	16	43.24
9123.	Echo (echo316)	37	78.02	103.61	7	18.92
9124.	Alex (eagles1106)	37	105.95	151.99	22	59.46
9125.	ZeroNine (dtrix)	37	106.86	137.44	11	29.73
9126.	Diego (diegogamer0528)	37	53.47	65.44	11	29.73
9127.	Diamond (diamond_desu)	37	67.40	85.76	13	35.14
9128.	dezo (deroze)	37	92.58	106.58	9	24.32
9129.	Deanna (deanna123)	37	74.02	97.24	6	16.22
9130.	Shawn (cubershz)	37	114.78	137.62	19	51.35
9131.	chubbypugs21 (chubbypugs21)	37	88.39	106.33	11	29.73
9132.	Hugh Janus (chrispoulos)	37	74.26	85.62	11	29.73
9133.	Celia (ccelo)	37	48.67	68.06	5	13.51
9134.	Ivan (budabudimir)	37	86.51	102.15	12	32.43
9135.	Bonzi (bonzibuddy420)	37	104.44	148.88	15	40.54
9136.	Ryan (bluesquirrel)	37	87.14	109.97	12	32.43
9137.	learning djorjak (blondebois)	37	87.23	110.52	14	37.84
9138.	Majed (bestwifi)	37	87.58	101.64	19	51.35
9139.	bbcola18 (bbcola18)	37	101.54	130.91	17	45.95
9140.	Bart (bartok)	37	65.81	84.14	14	37.84
9141.	barrybee789 (barrybee789)	37	58.86	70.13	4	10.81
9142.	baekd (baekde)	37	83.53	110.69	10	27.03
9143.	i like typing (a_hole)	37	52.05	68.57	25	67.57
9144.	Aviv (avivbn263)	37	120.97	132.93	19	51.35
9145.	Alex (alkan137)	37	90.49	121.30	16	43.24
9146.	Aeriana (aer000)	37	44.70	57.57	3	8.11
9147.	GODLIKE (acrimeisnotfine)	37	71.09	93.38	13	35.14
9148.	Lintang (8inx)	37	31.58	40.32	6	16.22
9149.	nattapakon (63100932)	37	26.83	30.92	12	32.43
9150.	Mohammad Imam (1mam)	37	70.85	85.12	13	35.14
9151.	Willow (02_wl_04)	37	68.55	83.09	19	51.35
9152.	bigchick (bigchickbird)	37	87.29	106.11	11	29.73
9153.	AKarudwal (akarudwal)	37	47.19	63.93	5	13.51
9154.	mouni (mouni90)	37	48.01	57.17	1	2.70
9155.	Arif (arif_shahriar)	37	54.11	64.18	3	8.11
9156.	Mara (mara_bbg)	37	76.37	93.11	7	18.92
9157.	yaboi (yaboironny)	37	82.17	94.99	10	27.03
9158.	Stephen (potsee)	37	76.77	90.21	9	24.32
9159.	Drombulje (drombulje)	37	32.71	40.11	2	5.41
9160.	soph (nasasoph)	37	57.16	66.09	4	10.81
9161.	Bappo (bappoxd)	37	73.49	87.77	9	24.32
9162.	Jakin (anonymousty)	37	92.59	115.02	15	40.54
9163.	Pitfulll (pitfulll)	37	47.72	58.98	3	8.11
9164.	Naman (nnamansingh)	37	33.99	47.32	4	10.81
9165.	roth (roth_31)	37	50.65	59.61	0	0.00
9166.	Blue (bluzs)	37	58.04	66.98	6	16.22
9167.	WeiWeiMan (weiweiman)	37	97.95	118.31	18	48.65
9168.	Khurshed (fingers_on_fire69)	37	52.89	68.87	25	67.57
9169.	Zol (zoltac)	36	89.46	116.18	8	22.22
9170.	Shelby (zalak_b)	36	60.98	76.07	2	5.56
9171.	Vinícius (yamatano)	36	57.01	64.62	4	11.11
9172.	Xavieku (xavieku)	36	68.48	80.50	14	38.89
9173.	Westly (wslafleur)	36	114.69	133.06	19	52.78
9174.	Ethan (wolfiedude14)	36	65.62	83.28	30	83.33
9175.	chris (walchrisc)	36	80.03	92.80	15	41.67
9176.	Vision (vision_of_infinity)	36	80.19	92.45	9	25.00
9177.	Jack (tzak)	36	113.77	132.42	15	41.67
9178.	tlbi (tla109)	36	106.41	135.72	24	66.67
9179.	Evan (theworkmanmuffin)	36	77.06	88.49	11	30.56
9180.	thespaghetti27 (thespaghett...	36	67.11	90.39	12	33.33
9181.	thepenguinmonkey (thepengui...	36	79.28	90.02	7	19.44
9182.	Tesla (teslalord)	36	92.93	112.83	16	44.44
9183.	Tanvir (tanvir187)	36	87.92	110.45	9	25.00
9184.	Do (tai230)	36	55.99	66.85	4	11.11
9185.	Sujit (sujit2000)	36	73.65	92.42	12	33.33
9186.	Guest (solovf)	36	155.36	205.65	32	88.89
9187.	akum! (solargiants)	36	43.54	55.01	3	8.33
9188.	KJ (snthaoeu)	36	117.46	136.94	16	44.44
9189.	Levi (sniperkiller2)	36	61.73	73.39	9	25.00
9190.	(slowghost)	36	201.90	242.96	34	94.44
9191.	Salem (slomy0010)	36	47.93	57.16	3	8.33
9192.	(slimaniimededdineabderrah...	36	55.62	66.87	5	13.89
9193.	Twinkle (sirius_07)	36	51.24	59.36	1	2.78
9194.	Chris Klenø (sircw)	36	135.33	172.14	29	80.56
9195.	Kladdigt (sigius)	36	93.49	109.71	11	30.56
9196.	Jason (r_matey)	36	94.14	110.31	11	30.56
9197.	rufus (rufi999)	36	53.03	63.74	3	8.33
9198.	Raimbek (rk_avilbekov)	36	53.26	65.38	6	16.67
9199.	R (renxsis)	36	98.93	136.50	11	30.56
9200.	Kabera (rcdude27)	36	107.00	123.88	15	41.67
9201.	Ramona (ramonaflowers101)	36	98.01	110.32	15	41.67
9202.	Adam (photoequal)	36	31.41	37.67	2	5.56
9203.	Persy (persy)	36	62.44	82.96	8	22.22
9204.	(pepeworm_colemak)	36	148.60	217.82	10	27.78
9205.	pennani (pennani)	36	82.65	95.46	17	47.22
9206.	P (patrickkayne)	36	74.01	94.57	4	11.11
9207.	John (parallaxjedi)	36	98.11	110.13	13	36.11
9208.	Napat (omakaze)	36	65.64	80.86	7	19.44
9209.	caden (okaydern)	36	93.82	107.72	18	50.00
9210.	odezzki (odezzki)	36	81.20	96.98	11	30.56
9211.	NutMonger (nutmonger)	36	68.10	82.42	8	22.22
9212.	yess (notavailabe)	36	103.17	124.76	15	41.67
9213.	Mulosh (mulosh)	36	109.71	125.93	16	44.44
9214.	Lawrence (mrlab)	36	74.86	90.63	7	19.44
9215.	M (mostafam)	36	83.07	102.81	11	30.56
9216.	willy (monvment)	36	80.63	98.14	14	38.89
9217.	Mons (monstoonix)	36	82.05	94.42	11	30.56
9218.	Mohib (mohib33)	36	81.36	96.23	18	50.00
9219.	Mekrigen (mekrigen)	36	62.17	73.53	7	19.44
9220.	MasterMind (master__mind)	36	90.96	104.25	17	47.22
9221.	Marc (maroenzo)	36	89.16	106.18	13	36.11
9222.	Marcel (marcelmladi)	36	30.32	37.79	9	25.00
9223.	Mantis (mantisplays)	36	97.02	127.43	8	22.22
9224.	Luiz (lznetorox)	36	69.26	85.33	8	22.22
9225.	Luis Francisco (luifrancgom)	36	37.14	50.16	2	5.56
9226.	LubedCube (lubed_cube)	36	61.01	71.97	10	27.78
9227.	Leaderboard is (leaderboard...	36	94.19	139.30	10	27.78
9228.	Arsen (konars_04)	36	25.60	33.86	3	8.33
9229.	Necrophos (komaroffski)	36	77.70	98.40	9	25.00
9230.	bob (kkgd)	36	92.51	105.43	16	44.44
9231.	Asian (kiniiranai)	36	92.69	108.06	12	33.33
9232.	Karimu (karimuosman)	36	107.43	122.79	21	58.33
9233.	El (kandel)	36	61.28	82.47	5	13.89
9234.	kabir raj (kabir26)	36	60.59	69.06	6	16.67
9235.	Aria (juicyhaluja)	36	116.04	156.76	18	50.00
9236.	Joshua (joshuahd)	36	81.89	98.99	14	38.89
9237.	Jordan (jordatypist)	36	106.80	132.79	13	36.11
9238.	Jonathan (jonathankim1999)	36	83.29	100.04	9	25.00
9239.	ghostofnav (jokerhyper)	36	73.28	86.50	9	25.00
9240.	Eric (joker4120)	36	63.43	79.83	8	22.22
9241.	Jean (jeanerino)	36	60.18	72.11	10	27.78
9242.	its_Atrap (its_atrap)	36	94.36	111.53	15	41.67
9243.	itssarcazm (itssarcazm)	36	92.81	115.14	10	27.78
9244.	Amdadul (imlak)	36	45.00	59.61	3	8.33
9245.	Wapiro (ihatejuices)	36	68.80	79.53	6	16.67
9246.	BOz (hyund0)	36	117.38	133.49	22	61.11
9247.	Christine (hugowolf)	36	96.04	115.77	19	52.78
9248.	Sporadic (howsporadic)	36	121.90	154.98	26	72.22
9249.	Aisier (hfssma)	36	94.88	109.44	16	44.44
9250.	herman (herman159)	36	93.70	109.66	9	25.00
9251.	Heorhii (heorhii_hryhorov)	36	82.44	99.96	8	22.22
9252.	Anthony (gphobes)	36	118.94	148.08	21	58.33
9253.	Ricardo (golden_boi)	36	55.44	64.47	4	11.11
9254.	gandastik (gandsatik)	36	84.70	98.82	11	30.56
9255.	Damiano (fullomen)	36	83.43	93.28	6	16.67
9256.	Fiji (fijired2)	36	88.38	110.76	12	33.33
9257.	Fabricio (ffontesb)	36	42.81	52.95	7	19.44
9258.	Exxotix (exxotix)	36	62.30	90.93	16	44.44
9259.	Eugene (entilaren)	36	99.82	121.37	21	58.33
9260.	elizabeth (elizabeth1ee)	36	116.29	136.46	21	58.33
9261.	Richard (elevatecrazy_yt)	36	86.46	104.02	11	30.56
9262.	egg (egguard)	36	80.33	98.02	7	19.44
9263.	Egbadon (egbadon)	36	52.18	61.46	7	19.44
9264.	John (dyst0pia)	36	62.85	76.86	26	72.22
9265.	Concomitant (dvorakdork)	36	99.17	109.62	16	44.44
9266.	dissonantly (dissonantly)	36	107.10	130.99	18	50.00
9267.	Cyberstrike (cyberstrike)	36	43.39	56.02	3	8.33
9268.	Cucu (cucu_grey)	36	62.44	72.44	7	19.44
9269.	Crehan (crayon144)	36	60.64	68.61	11	30.56
9270.	scr4tchman (connerkainnerkai)	36	78.54	90.96	12	33.33
9271.	👺 (confiscar)	36	92.79	113.27	10	27.78
9272.	Christopher (codaki)	36	47.81	59.99	5	13.89
9273.	Kai (ckai)	36	84.89	109.76	6	16.67
9274.	Finna (captfinn)	36	71.69	81.44	7	19.44
9275.	Cameron (camalb02)	36	42.39	53.06	1	2.78
9276.	asdftr (buhdo)	36	74.59	90.21	10	27.78
9277.	Batkhishig (btkshg)	36	75.39	86.78	9	25.00
9278.	bruuuh (bruhxfish)	36	101.21	120.41	12	33.33
9279.	Bruno (brbeans)	36	90.49	114.29	12	33.33
9280.	Bipin (bipin_emp123)	36	57.10	66.94	5	13.89
9281.	abdullah (billnyezenazispy)	36	58.25	67.76	10	27.78
9282.	Bernice Hee Shu Qi (bernice...	36	69.16	80.88	6	16.67
9283.	Bek (bekkk)	36	52.53	61.41	7	19.44
9284.	aver (aversioneer)	36	63.14	76.69	5	13.89
9285.	gta (asldkfj)	36	72.80	90.31	7	19.44
9286.	ashbellebsha (ashbel_g)	36	87.59	113.25	9	25.00
9287.	Mateo (asetato)	36	69.26	86.32	8	22.22
9288.	Arun (arun808)	36	101.98	122.81	16	44.44
9289.	Art (arturopakastur)	36	105.82	120.88	14	38.89
9290.	Rajat (argentum_1807)	36	73.05	86.53	9	25.00
9291.	James (arctos)	36	48.43	59.08	1	2.78
9292.	🐢🐢🐢🐢 (amogh1420)	36	93.58	109.06	16	44.44
9293.	Amit (amitkarmakar13)	36	79.85	99.43	14	38.89
9294.	Daniel (amai727)	36	116.19	146.70	20	55.56
9295.	Joosep (aktos)	36	92.49	111.38	13	36.11
9296.	akram (akrambr)	36	37.48	46.06	3	8.33
9297.	Ayedread (ade15)	36	72.18	84.09	7	19.44
9298.	Fuel plane (1pavanb)	36	54.78	67.90	14	38.89
9299.	Happy (happy_jms)	36	69.54	87.29	15	41.67
9300.	Soul (quentinlikesaot)	36	76.79	96.82	9	25.00
9301.	james (jamesfarmer)	36	71.67	87.30	11	30.56
9302.	Peyton (peytonk608)	36	77.92	90.55	4	11.11
9303.	Henry (parrotfish)	36	101.78	119.89	15	41.67
9304.	Octagonal (octagonalwalnut)	36	111.16	138.44	21	58.33
9305.	arcticfox (spiky_echidna)	36	70.98	102.71	7	19.44
9306.	yam (yamazakura)	36	66.64	89.51	6	16.67
9307.	Harith (6krypto)	36	49.23	59.80	5	13.89
9308.	OLMA - (lyndon29)	36	36.76	47.39	6	16.67
9309.	Rushikesh Dhatinge (rushike...	36	32.84	39.42	5	13.89
9310.	Gabrielle (gabriellerose86)	36	58.76	71.79	6	16.67
9311.	Quavis (jewishween)	36	83.26	100.91	14	38.89
9312.	amine (laribi)	36	31.07	37.38	5	13.89
9313.	Molly (butteryfly)	36	79.74	94.09	6	16.67
9314.	Cypan :) (ckrawetko)	36	24.12	33.25	8	22.22
9315.	isabella (coscarellai070)	36	52.59	63.67	4	11.11
9316.	tgb524 (_yuno)	35	105.75	128.14	18	51.43
9317.	devil_02 (_ebad_)	35	41.83	52.55	4	11.43
9318.	yntylox (yntylox)	35	37.39	55.96	3	8.57
9319.	Muhammad (xxvv)	35	74.05	89.87	8	22.86
9320.	Evans (xerodo)	35	83.56	95.13	13	37.14
9321.	Johannes (xcillingx)	35	56.66	68.86	5	14.29
9322.	Usman (x1itachi)	35	112.96	143.34	17	48.57
9323.	Wizrud (wizurd_)	35	78.33	91.31	6	17.14
9324.	veryfast (veryfastxd)	35	92.30	108.76	9	25.71
9325.	offblacc (vekikornjaca)	35	87.41	109.11	17	48.57
9326.	Taiki (vegantaiki)	35	71.03	89.24	11	31.43
9327.	Michael (val_slow)	35	86.18	102.59	14	40.00
9328.	typer_trainer (typer_trainer)	35	90.36	110.13	12	34.29
9329.	ANUP (typekashyap)	35	68.61	83.78	9	25.71
9330.	jeff (typecringe)	35	105.10	120.44	14	40.00
9331.	Sergey (tsykurawork)	35	59.44	69.71	8	22.86
9332.	Nazib (tony_129)	35	60.58	76.14	9	25.71
9333.	doncheadle (timothyqian)	35	97.56	117.74	16	45.71
9334.	Thiemo (thiemok)	35	68.21	80.50	7	20.00
9335.	Eric (thiccbrick)	35	72.31	104.53	11	31.43
9336.	Boipelo (the_big_bp)	35	38.47	45.83	5	14.29
9337.	∞ (technolojesus)	35	68.03	75.84	8	22.86
9338.	Non (tata32000)	35	75.20	92.06	8	22.86
9339.	Tardy (tardyislazy)	35	74.67	90.22	11	31.43
9340.	McLovin (tappytyper)	35	103.56	121.86	11	31.43
9341.	tap (tappineapple)	35	93.02	121.86	13	37.14
9342.	Swastik (swastik220705)	35	56.06	66.22	6	17.14
9343.	Soner (soner)	35	127.62	155.63	21	60.00
9344.	sol (solshad)	35	69.64	89.60	6	17.14
9345.	Choco (slowest_sloth)	35	61.78	79.38	5	14.29
9346.	Gabriel (slenders)	35	70.08	100.56	20	57.14
9347.	roy (shote)	35	55.35	64.44	1	2.86
9348.	Say_the (saythe)	35	63.36	80.07	6	17.14
9349.	Shohidujjaman (sajib975)	35	45.26	56.39	33	94.29
9350.	Saber (saberspeed777)	35	100.41	121.44	13	37.14
9351.	Jay (saberon1402)	35	63.74	72.90	0	0.00
9352.	K (rynetemp)	35	70.81	102.61	9	25.71
9353.	amy (rose51203)	35	99.67	125.87	8	22.86
9354.	رحيم (rahim06)	35	59.71	70.11	3	8.57
9355.	Gavin (qwertyparty)	35	98.07	121.19	14	40.00
9356.	Peter (ptrmai)	35	83.20	95.56	9	25.71
9357.	Under (polish_underdog)	35	107.43	119.89	22	62.86
9358.	PK (pkhou)	35	49.72	64.29	3	8.57
9359.	aerisslowers (pietrucha33)	35	77.51	98.83	9	25.71
9360.	1234 (perfect_practice)	35	112.01	132.53	17	48.57
9361.	PoonPounder (p00np0under)	35	63.96	76.58	12	34.29
9362.	Gilbert (ooblek)	35	87.73	106.44	10	28.57
9363.	Anton (noviru)	35	72.11	87.33	9	25.71
9364.	Novas (novas_arcos)	35	81.88	94.14	7	20.00
9365.	Ninja (ninjaacat)	35	90.09	108.48	12	34.29
9366.	Neil (neilborde)	35	101.33	122.55	12	34.29
9367.	Camden (mypenguinbuddy)	35	103.31	132.65	14	40.00
9368.	Ryan (moseqa)	35	63.90	82.02	3	8.57
9369.	Jacob (monkeybenq)	35	105.83	129.58	18	51.43
9370.	misab (misabshibu)	35	20.67	31.08	14	40.00
9371.	Dagareth (mindcrime)	35	86.19	105.25	8	22.86
9372.	Jemo (mille_colombes)	35	78.62	96.08	11	31.43
9373.	MilkhoundTTV (milkhound)	35	107.39	140.66	12	34.29
9374.	MHR (mhrofficial)	35	58.47	72.91	6	17.14
9375.	Ajay (metacorb)	35	56.11	66.16	4	11.43
9376.	Louis 🤴🏾 (matiny)	35	51.19	61.84	2	5.71
9377.	Mark (mark666)	35	67.81	96.93	16	45.71
9378.	Maple (maplesyrup789)	35	83.13	101.69	17	48.57
9379.	mtn (m0untain)	35	71.54	88.19	8	22.86
9380.	Hayaku (m0tt0_hayaku)	35	53.49	66.39	3	8.57
9381.	lysrac (lysrac)	35	66.62	88.81	5	14.29
9382.	Lux (lux_winters)	35	105.64	127.96	23	65.71
9383.	Guilherme (luxidu)	35	75.60	86.45	11	31.43
9384.	justin (lookitsjustin)	35	90.19	110.67	15	42.86
9385.	Robert (lonewulf92)	35	120.96	156.81	19	54.29
9386.	Kylie (kyky_)	35	98.86	111.56	12	34.29
9387.	kpsmelvin (kpsmelvin)	35	55.50	67.04	5	14.29
9388.	Kizu (kizuiyo)	35	89.08	111.26	10	28.57
9389.	Kish (kisharora)	35	57.23	69.68	10	28.57
9390.	Blessed (king_blessed)	35	61.78	81.10	9	25.71
9391.	kilkuwu (kilkuwu)	35	79.16	93.29	9	25.71
9392.	Kenny (kenny053)	35	41.17	49.69	6	17.14
9393.	Shalowley (keepitcookie)	35	78.84	99.14	6	17.14
9394.	KarstenPH (karstenplayz)	35	47.26	64.77	10	28.57
9395.	arnav (junkbaby)	35	118.61	147.69	21	60.00
9396.	Juls (juls22)	35	93.33	106.04	8	22.86
9397.	Jokūbas (jokstercube)	35	74.51	91.00	14	40.00
9398.	JimDeezy (jimdeezy)	35	106.25	145.37	14	40.00
9399.	Jorge (jfgf11)	35	78.06	99.90	6	17.14
9400.	Jeffryl (jeffryl26)	35	47.44	55.36	5	14.29
9401.	jazz (jazzhand)	35	50.53	60.06	2	5.71
9402.	Shiba (jasjaapdua)	35	88.15	105.05	17	48.57
9403.	Simon (jangjun0901)	35	94.35	117.79	12	34.29
9404.	J (jacktwamb52)	35	105.48	120.56	12	34.29
9405.	Jackson (jackfast)	35	43.12	50.53	1	2.86
9406.	IVAN (ivil)	35	55.90	66.31	6	17.14
9407.	Muhammed (iosonoosha)	35	83.21	100.62	8	22.86
9408.	Ingyou (ingsta)	35	113.21	126.20	15	42.86
9409.	Hani (imonster_22)	35	83.52	109.15	16	45.71
9410.	Guest (imadethisfornoreason)	35	42.83	57.07	1	2.86
9411.	Jack (ikombo)	35	129.63	144.11	23	65.71
9412.	|I|I|I|I|I|I| (iknowwhatimd...	35	81.88	97.84	11	31.43
9413.	Ignacio 🧉 (ignatirabo)	35	69.53	87.28	9	25.71
9414.	Lukas (iamlukas)	35	50.18	62.98	3	8.57
9415.	Amir (iamir)	35	64.87	80.80	8	22.86
9416.	Matthew (hotdawg200)	35	69.75	83.81	7	20.00
9417.	Chuck (helicopter123)	35	121.45	140.37	25	71.43
9418.	x0.25 speed (hazyy324)	35	95.51	113.07	12	34.29
9419.	Joshua (gottajet)	35	72.50	85.28	7	20.00
9420.	Jason (goosejuice)	35	84.26	98.60	6	17.14
9421.	Giovanni (giosda)	35	139.36	179.94	23	65.71
9422.	Martin (gibom)	35	75.28	87.30	10	28.57
9423.	Emil (genjimaster)	35	82.23	93.90	13	37.14
9424.	GeekThrill (geekthrill)	35	56.74	69.14	2	5.71
9425.	gameing (gameing_)	35	65.50	79.51	8	22.86
9426.	OTL (floormint)	35	63.11	69.79	7	20.00
9427.	Financier (financier)	35	121.50	141.06	16	45.71
9428.	Farhan M. (farhanmasud)	35	83.36	95.04	8	22.86
9429.	David (fantasticdavid)	35	68.89	86.04	8	22.86
9430.	🥇 Evan C. (evancnavarro)	35	103.47	118.45	13	37.14
9431.	Max (elsancho5)	35	94.06	112.56	10	28.57
9432.	ahmed (elkfafy)	35	55.99	71.17	2	5.71
9433.	Rob (ebqs)	35	57.16	68.45	4	11.43
9434.	Daniel (dsonger20)	35	90.13	112.44	13	37.14
9435.	Derek (doggish)	35	92.99	109.74	12	34.29
9436.	Wasabi (distartor)	35	54.78	65.83	7	20.00
9437.	Adi (diddly_doo)	35	84.13	95.31	7	20.00
9438.	Deron (deronpianoplayer)	35	74.68	92.40	10	28.57
9439.	dedendje (dedendje)	35	83.58	94.95	8	22.86
9440.	Darian (darian_adiwarna)	35	80.84	104.45	11	31.43
9441.	DanGaL2017 (dangal2017)	35	65.56	77.19	10	28.57
9442.	Crayon (crayonsc)	35	81.24	98.78	9	25.71
9443.	cortmarshal (cortmarshal)	35	97.59	122.44	12	34.29
9444.	Comfy_Kitten (comfykitten)	35	100.58	119.53	13	37.14
9445.	citrus (citrustrack)	35	111.85	131.40	21	60.00
9446.	Chris (chrislowe)	35	82.27	100.06	12	34.29
9447.	chalk (chalkboard)	35	78.33	91.20	11	31.43
9448.	Dharma (cdharmateja)	35	78.97	95.88	20	57.14
9449.	I love ctrl + backspace (ca...	35	85.10	106.68	14	40.00
9450.	Carter (cartermanator)	35	65.63	82.45	5	14.29
9451.	Cadence (cadence_workman)	35	114.99	135.64	24	68.57
9452.	Caco (cacopholey)	35	85.09	111.00	11	31.43
9453.	Name (buttface69)	35	128.77	151.17	18	51.43
9454.	Brt (brtboi)	35	70.37	90.71	7	20.00
9455.	Bread (breadandbuddha)	35	98.88	117.08	25	71.43
9456.	Christian (bobbyjrrocks)	35	82.84	108.76	6	17.14
9457.	shellyshellyshellyumm (blue...	35	100.35	114.97	13	37.14
9458.	Dhia Eddine (bl1ndk)	35	48.10	56.94	1	2.86
9459.	Anish (bira_01)	35	58.22	69.92	8	22.86
9460.	big (bigfinger420)	35	103.43	122.40	13	37.14
9461.	FoolSt0p (beanenthusiast)	35	89.24	114.63	12	34.29
9462.	Bartłomiej (baryla69baryla69)	35	79.40	90.78	14	40.00
9463.	Camel (bandar314@yahoo.com)	35	67.21	84.63	7	20.00
9464.	Bridget (bahns)	35	60.83	80.96	8	22.86
9465.	Ilya (azeti1)	35	52.35	58.42	6	17.14
9466.	Abdelrahman (awebdo)	35	55.27	65.87	2	5.71
9467.	Dalle (ash_ish)	35	76.01	100.43	9	25.71
9468.	Alex (aqin24)	35	108.74	121.43	19	54.29
9469.	ANDRAGOMOR (andrago_)	35	47.05	59.31	1	2.86
9470.	subham (alexus78)	35	58.19	67.36	9	25.71
9471.	Aelius (aelius_l)	35	120.10	146.43	16	45.71
9472.	Adzeyns (adzenys)	35	97.72	118.45	16	45.71
9473.	AIbek (3xter)	35	56.86	65.05	2	5.71
9474.	Magieschnuller (magieschnul...	35	70.56	79.15	9	25.71
9475.	aeign (eyncore)	35	70.66	85.64	6	17.14
9476.	kxngh (kingh17)	35	60.30	74.72	26	74.29
9477.	safia (safia1607)	35	50.76	62.36	2	5.71
9478.	Xingyu (findmealone)	35	46.54	66.30	6	17.14
9479.	JSD (_jsd)	35	44.11	56.19	1	2.86
9480.	Anav (dark_winter)	35	75.29	90.51	9	25.71
9481.	shahidul islam (prantoislam...	35	44.90	55.32	7	20.00
9482.	ahmed (mamado69)	35	51.31	62.49	5	14.29
9483.	Allison (ixonic_alli)	35	38.72	50.36	0	0.00
9484.	Thumb (tomtom__ever)	35	100.97	125.80	13	37.14
9485.	NotInfinite (notinfinite)	35	79.00	97.07	12	34.29
9486.	Ahemed (a_loose_cannon)	35	59.34	68.53	9	25.71
9487.	Aditya (aditya786123)	35	59.11	72.52	7	20.00
9488.	Angus (type_yahweh)	35	72.25	84.94	12	34.29
9489.	van (thien3060)	35	67.93	84.00	7	20.00
9490.	Simeon (simbg)	35	36.98	46.40	3	8.57
9491.	Eva (etty_mijing)	35	92.71	111.66	18	51.43
9492.	Nahid Hasan Pallab (pallab4...	35	56.17	68.38	4	11.43
9493.	Rick (eric1699)	35	70.70	81.04	8	22.86
9494.	Cris Anthony (crisanthonio_...	35	39.97	47.62	3	8.57
9495.	Zhroon (znub)	34	81.52	103.73	9	26.47
9496.	zizonesol (zizonesol)	34	63.93	75.75	10	29.41
9497.	zeko (zekoo)	34	108.22	124.54	13	38.24
9498.	Tyler (yppah)	34	104.24	117.27	18	52.94
9499.	bofa (xxx_bofa_xxx)	34	107.48	118.74	12	35.29
9500.	boop (xkeons)	34	48.41	57.88	0	0.00
9501.	Dylan (xdylkay)	34	108.39	122.85	20	58.82
9502.	Derek (xdirection)	34	95.80	117.24	14	41.18
9503.	Wuchereria (wuchereria)	34	105.17	121.56	19	55.88
9504.	wingman41 (wingman41)	34	81.99	98.53	9	26.47
9505.	JEFF (wimpyjeff)	34	69.55	86.26	10	29.41
9506.	unholy (virus_)	34	55.65	69.72	6	17.65
9507.	Charlotte (videogame_hacker)	34	133.74	161.56	28	82.35
9508.	Hey (veeceebee)	34	93.23	116.89	18	52.94
9509.	Vedant (ved2254)	34	69.97	80.33	7	20.59
9510.	Valeria (valeriacervel)	34	65.72	79.41	6	17.65
9511.	Tyrocune (tyrocune)	34	58.94	69.64	8	23.53
9512.	Jericho (typersimon)	34	86.95	98.30	10	29.41
9513.	Daphne (trippyonions)	34	67.32	86.97	7	20.59
9514.	Maksym (trickstermaks)	34	70.96	91.34	7	20.59
9515.	Tom (tom1110)	34	65.77	90.73	8	23.53
9516.	Iocus (tisabay)	34	62.46	83.61	3	8.82
9517.	Timofey (timofey_s)	34	90.26	104.19	9	26.47
9518.	Thunderwith (thunderwith)	34	94.54	130.13	14	41.18
9519.	rae (thedarkoknight)	34	91.38	113.05	16	47.06
9520.	thebeesknees (thebeesknees_)	34	83.67	104.44	16	47.06
9521.	Connor (swedish_master)	34	67.17	81.52	6	17.65
9522.	Cthulhu (survivcthulhu)	34	74.76	92.38	6	17.65
9523.	superultimate23 (superultim...	34	57.47	73.37	6	17.65
9524.	Dan (subprime)	34	114.23	143.24	21	61.76
9525.	Stick (stick69)	34	59.45	71.92	6	17.65
9526.	Cameron (spinnie123)	34	56.93	67.96	4	11.76
9527.	an average vietnamese typis...	34	79.98	113.28	9	26.47
9528.	Mitsuo (sp33d1sk3y)	34	102.19	118.46	14	41.18
9529.	Sole (soleduck)	34	122.41	152.43	14	41.18
9530.	ada (smdge)	34	76.16	99.45	9	26.47
9531.	Smack (smack_ke)	34	60.33	69.10	6	17.65
9532.	(singalong_monkey)	34	87.06	102.70	14	41.18
9533.	yan (shocker142)	34	91.62	105.78	12	35.29
9534.	katie (shartball)	34	57.25	70.69	5	14.71
9535.	Corona Time (shamalamakiwi)	34	71.91	91.61	10	29.41
9536.	Serenity (seerenityy)	34	115.84	134.37	21	61.76
9537.	raffa (scoradian)	34	93.51	103.55	15	44.12
9538.	sangay (sangay2018)	34	53.77	65.47	1	2.94
9539.	Pakistan is my Love (sancbae)	34	57.44	71.80	19	55.88
9540.	Sami (samitariq94)	34	125.00	142.96	27	79.41
9541.	ogamiseta (samarthos)	34	119.95	129.56	12	35.29
9542.	salmi (salmitot)	34	88.90	105.94	15	44.12
9543.	Sadra (sadra17)	34	102.04	121.03	15	44.12
9544.	Russian (russian_comrade)	34	68.68	80.59	11	32.35
9545.	Ruben (ruben_ashughyan)	34	68.73	85.42	8	23.53
9546.	Mike (roguecurlybracket)	34	98.11	114.51	10	29.41
9547.	Robsonwp (robsonwp)	34	86.38	102.34	9	26.47
9548.	Raghav (rkaushal_03)	34	39.54	47.95	2	5.88
9549.	Richie (richiele_01)	34	94.53	119.92	15	44.12
9550.	Lorum (rexicide)	34	105.21	136.33	14	41.18
9551.	Fin (resarded)	34	63.08	85.66	10	29.41
9552.	(rektbydoge21)	34	83.49	99.87	8	23.53
9553.	Ricky (rcheungwtf)	34	95.71	115.68	9	26.47
9554.	Wai Yon (ravesplash)	34	70.65	79.24	17	50.00
9555.	Rageon (rageon718)	34	62.01	72.55	12	35.29
9556.	Emad Iqbal (racer47)	34	88.89	104.01	10	29.41
9557.	Racecar (racecar_lettuce)	34	125.54	137.37	22	64.71
9558.	Quagsire (quagsireyaj)	34	78.35	98.72	15	44.12
9559.	Aviral (programmer_typist)	34	65.52	85.78	7	20.59
9560.	MD. Rashedul (porosh45)	34	58.72	75.48	5	14.71
9561.	pedro (pedrovales)	34	53.88	63.93	3	8.82
9562.	Pawan (pawan_kumar)	34	68.93	81.90	7	20.59
9563.	Warley (patrickwarley)	34	41.71	54.24	1	2.94
9564.	nocchio (nocchio)	34	100.29	119.60	10	29.41
9565.	Ninth (ninth_player)	34	89.52	104.33	23	67.65
9566.	go easy (nielsenco)	34	115.51	139.69	27	79.41
9567.	Nam (nchu027)	34	84.00	111.22	14	41.18
9568.	Nam3tA3n (nam3tak3n)	34	52.59	67.16	1	2.94
9569.	Naba (naba0224)	34	95.28	106.29	15	44.12
9570.	mulluch (mulluchian)	34	76.90	97.63	6	17.65
9571.	mmlvx (mmlvx)	34	63.91	74.88	11	32.35
9572.	grieves (mmcph36)	34	81.49	91.99	4	11.76
9573.	Miz (miztypes)	34	110.23	125.64	16	47.06
9574.	gradient (misaelmmorales06)	34	94.37	111.20	12	35.29
9575.	ash (mikadole)	34	89.87	109.88	15	44.12
9576.	Migsgd (migelawan123)	34	131.34	151.21	27	79.41
9577.	Adam (merrth)	34	95.95	111.42	6	17.65
9578.	Mole (mementomole)	34	51.44	68.42	8	23.53
9579.	Micheal (mbroaders)	34	74.77	89.88	9	26.47
9580.	Matthew (matthewdilks)	34	85.51	111.09	17	50.00
9581.	Masked (masked_error)	34	60.27	72.97	11	32.35
9582.	Marinos (marinosdim)	34	52.59	63.36	1	2.94
9583.	Salchica (machete24x)	34	90.93	117.34	9	26.47
9584.	Locksley (locksng12)	34	83.74	99.40	13	38.24
9585.	Lanlana (llnfriend)	34	54.26	74.15	17	50.00
9586.	theerapat (lipertal)	34	62.36	81.72	8	23.53
9587.	Nick (lemech)	34	55.07	71.39	6	17.65
9588.	Kshitij (kshitij_srv)	34	70.17	80.42	6	17.65
9589.	kosmanaut (kosmanaut)	34	90.68	107.06	10	29.41
9590.	Kiran (kkdatkiran)	34	78.80	90.49	8	23.53
9591.	John (kircher32245)	34	80.11	111.73	14	41.18
9592.	Peter (kamikaze1336)	34	79.76	104.47	13	38.24
9593.	Jacq (jvjacq)	34	61.18	79.35	8	23.53
9594.	Justin (jpsmith)	34	51.79	63.86	2	5.88
9595.	Jorgle (jorgleframpleton)	34	88.20	99.62	13	38.24
9596.	Jon (jonc5201)	34	85.81	100.11	13	38.24
9597.	Jackie (johnsonj13)	34	68.70	83.76	14	41.18
9598.	ttv/J0bro (jobrocraftstep)	34	89.54	110.89	10	29.41
9599.	Jha (jha94)	34	120.52	145.78	22	64.71
9600.	Jetless (jetless27)	34	65.28	84.05	7	20.59
9601.	jc.ekrem (jc_ekrem)	34	76.95	95.13	11	32.35
9602.	JaydenPrbhd (jayden_prbhd010)	34	66.37	89.82	6	17.65
9603.	+923326006034 (janan9233260...	34	57.88	72.31	6	17.65
9604.	!dreamer#9577@dscrd (jaixhi...	34	63.06	77.68	8	23.53
9605.	jad (jadtriestyping)	34	78.49	92.55	3	8.82
9606.	Jalen (jaalen21)	34	86.33	102.57	12	35.29
9607.	itbolt (itbolt)	34	95.85	128.38	17	50.00
9608.	Ivan (ipenipent)	34	111.82	131.82	23	67.65
9609.	Race (im_not_cheating_ur_wi...	34	90.80	107.34	13	38.24
9610.	Robbie (idkloltype)	34	45.68	56.43	4	11.76
9611.	ryan (hopedarklord1)	34	116.89	140.38	20	58.82
9612.	Hk (hk2257853)	34	48.68	61.73	4	11.76
9613.	Hikaru (hikaruk)	34	58.13	67.83	4	11.76
9614.	heikrana (heikrana)	34	69.81	79.50	10	29.41
9615.	Mark (haxos)	34	90.70	104.82	13	38.24
9616.	Tzemis (greekjames)	34	90.41	118.03	14	41.18
9617.	brooklyn (furretmastr)	34	106.88	126.24	12	35.29
9618.	ABC (funnelcake9)	34	122.69	137.00	17	50.00
9619.	Justin (flamebun)	34	99.54	118.83	16	47.06
9620.	Fauzan (fblues)	34	89.04	99.18	10	29.41
9621.	Eryk (fatmamma)	34	91.09	102.49	8	23.53
9622.	Askefise (fast_as_sanic)	34	90.72	114.99	18	52.94
9623.	Marcus (fakedefulty)	34	41.40	57.26	3	8.82
9624.	Fabi (fabilula)	34	43.40	57.05	3	8.82
9625.	Erl (erlisgod)	34	54.36	63.01	4	11.76
9626.	Skraap (elskrapo)	34	86.51	104.59	7	20.59
9627.	elbert (elbert1104)	34	59.27	70.35	6	17.65
9628.	harsh spacebar broke lol (d...	34	56.40	71.78	6	17.65
9629.	Dileep (dileepnk)	34	87.57	117.66	11	32.35
9630.	Vandy (desmaid)	34	105.13	124.53	18	52.94
9631.	John (dent12)	34	53.75	67.20	7	20.59
9632.	Prdel (dendritic_cell)	34	62.74	69.68	9	26.47
9633.	Jay (cutecanadian)	34	57.33	69.82	8	23.53
9634.	Iyanically (cryptic_cosmic)	34	80.39	96.72	10	29.41
9635.	sion (crossblade06)	34	75.31	87.13	11	32.35
9636.	Mehraj Mahmood (comiccypressm)	34	33.87	41.16	0	0.00
9637.	Andrew Li (combatwombat123)	34	78.00	91.51	12	35.29
9638.	Clement (clem_jestin)	34	48.53	55.28	2	5.88
9639.	Cindy (cindy1889)	34	69.69	83.36	16	47.06
9640.	Adrian (cheeseshrub)	34	74.18	98.28	8	23.53
9641.	Cameron (camerong123)	34	119.11	143.68	19	55.88
9642.	brindobob (brindobob)	34	138.97	160.83	27	79.41
9643.	Brihoness (brihoness)	34	63.84	76.24	9	26.47
9644.	Alexgiomuel (bionicmjallday...	34	56.04	72.97	4	11.76
9645.	ben (bentypemaster)	34	64.30	76.00	4	11.76
9646.	Benjamin (benhundos)	34	84.16	96.81	8	23.53
9647.	bbygirlturtle (bbygirlturtle)	34	49.59	67.23	7	20.59
9648.	Bob (baine001)	34	74.90	95.54	5	14.71
9649.	loser (badatenglish)	34	88.83	113.70	12	35.29
9650.	Ash (ash_ketchump)	34	49.01	65.62	4	11.76
9651.	appu (appu46)	34	50.52	61.25	5	14.71
9652.	ApocJTL (apocjtl)	34	89.05	115.85	10	29.41
9653.	Small (amaro123)	34	84.48	103.96	7	20.59
9654.	Alstr (alstr)	34	90.90	118.69	15	44.12
9655.	ali (alianggie)	34	48.76	61.25	3	8.82
9656.	Aji (ajiwahyuw)	34	94.90	109.00	17	50.00
9657.	Ahsan (ahsanhussain)	34	103.08	119.64	13	38.24
9658.	Frangsinatra (addaxer)	34	83.04	105.83	10	29.41
9659.	Artichamp (abhrajit_saha)	34	78.44	93.13	8	23.53
9660.	Abhishek (abhi_720)	34	43.12	54.78	1	2.94
9661.	Abdullah (abdullahshah_)	34	45.51	55.04	1	2.94
9662.	Aadil (aadil0392)	34	68.10	86.23	10	29.41
9663.	ARTHUR (4rthur)	34	85.17	107.92	12	35.29
9664.	krittika (mojitroll)	34	73.19	83.47	7	20.59
9665.	lerii (lerii)	34	46.47	59.86	3	8.82
9666.	Matthew (mpfstudios)	34	52.23	66.38	5	14.71
9667.	Aziza (meem_grfx)	34	52.50	62.55	3	8.82
9668.	Neelie (neeliee)	34	101.00	115.05	15	44.12
9669.	Triyanshu (triyanshu1996)	34	58.68	72.36	6	17.65
9670.	Jesse (jrochefo)	34	61.13	69.42	5	14.71
9671.	Elya (elyagolry)	34	43.03	58.44	8	23.53
9672.	JB (chequer)	34	123.54	146.50	19	55.88
9673.	swapnil (sj480)	34	30.52	37.53	4	11.76
9674.	Nuradil (nuradil_zhambyl)	34	107.29	130.16	14	41.18
9675.	Jakob (shaquer)	34	82.62	101.76	11	32.35
9676.	Paul (pauljurgens)	34	65.07	78.85	9	26.47
9677.	Kevin (hylo28)	34	103.58	123.87	14	41.18
9678.	Jannett (jannett)	34	24.72	35.66	5	14.71
9679.	kai (iiiiikai)	34	55.62	72.12	5	14.71
9680.	PP (s090351114)	34	53.69	63.39	7	20.59
9681.	Jeremy (jeteryankee2)	34	80.99	102.92	13	38.24
9682.	Pharaoh (pharaoh_zr)	34	61.38	81.36	14	41.18
9683.	Thanh (alians)	34	69.55	82.52	7	20.59
9684.	do better (do_better)	34	71.87	90.82	8	23.53
9685.	Phillip (jurten)	34	94.31	123.36	24	70.59
9686.	Ted (ted_j_kaczynski)	34	75.31	92.92	14	41.18
9687.	Nikobaby (robemigani)	34	73.91	96.38	8	23.53
9688.	tstats[rafid149] (rafid149)	34	74.68	99.44	6	17.65
9689.	Zerrox (zerrox)	33	100.50	116.99	16	48.48
9690.	Vilantas (zenblax)	33	44.47	49.97	7	21.21
9691.	Zedrick (zedrickbr)	33	128.24	152.60	25	75.76
9692.	Doyle (zdubhghaill)	33	68.28	82.14	6	18.18
9693.	Zac (zactus_)	33	57.97	70.02	4	12.12
9694.	Kutya (ysakovvvs)	33	42.67	52.62	4	12.12
9695.	YaBoi (yab0i)	33	63.78	74.61	4	12.12
9696.	(xxgamerprofunxx)	33	95.23	111.89	7	21.21
9697.	Xeethra (xeethra)	33	89.14	105.31	15	45.45
9698.	Santosh (wow123__)	33	50.37	60.55	4	12.12
9699.	Wella (wella05)	33	61.23	75.92	24	72.73
9700.	Tom (voiovinili)	33	70.54	89.53	7	21.21
9701.	vamsi (vamsibharadwaj)	33	55.90	64.41	3	9.09
9702.	Uziel1595 (uziel1595)	33	61.57	74.97	7	21.21
9703.	Simon (unclesimon)	33	60.59	93.68	18	54.55
9704.	Uddaya (uddaya)	33	61.93	77.17	8	24.24
9705.	ɥsǝdǝǝᗡ (toxin_d)	33	67.61	80.77	12	36.36
9706.	Scarlet (tongli10)	33	69.71	82.98	10	30.30
9707.	timmy (timmy14)	33	75.81	88.63	11	33.33
9708.	TIFF (tiffanytai888)	33	44.55	51.01	3	9.09
9709.	Kurt (thydark)	33	104.77	124.55	19	57.58
9710.	Thithiesha (thithiesha)	33	69.37	80.85	11	33.33
9711.	Sam (the___sam)	33	71.65	84.52	5	15.15
9712.	Ryan (theguy985)	33	87.38	119.70	14	42.42
9713.	Matthew (thefinchler)	33	71.23	80.89	6	18.18
9714.	Taquid (taquid)	33	70.50	85.79	12	36.36
9715.	Tair (tako_01)	33	33.51	41.03	2	6.06
9716.	Jake (superduperjake)	33	86.47	100.04	12	36.36
9717.	sulux (sulux_14)	33	52.45	60.62	0	0.00
9718.	Sylvaen (suggestedrp)	33	90.44	107.64	11	33.33
9719.	Kersey (strythio)	33	107.43	125.43	23	69.70
9720.	David (spurgeon)	33	82.43	107.54	4	12.12
9721.	Spike (sp4rks)	33	64.51	83.90	10	30.30
9722.	Socceryolo (socceryolo)	33	57.90	79.55	5	15.15
9723.	Guest (slowpokest)	33	77.61	104.52	7	21.21
9724.	(slowandinaccurate)	33	121.79	164.93	19	57.58
9725.	Lagmybsf (sk0ttt)	33	90.36	109.44	13	39.39
9726.	Gilbert (sigalingging_23)	33	88.21	102.77	7	21.21
9727.	xD (shabanllokmja)	33	54.25	67.51	4	12.12
9728.	Sestain (sestain)	33	76.29	91.21	9	27.27
9729.	JDizzle (serinus)	33	99.27	132.74	13	39.39
9730.	sasquatch (sasquatchplatypus)	33	40.63	53.57	5	15.15
9731.	Andrew (sasamori)	33	92.48	110.11	12	36.36
9732.	rodrigo (rodtronx)	33	74.61	86.41	4	12.12
9733.	RITIK (ritik1999)	33	32.32	38.22	3	9.09
9734.	Vivian Le (riru)	33	65.03	76.29	3	9.09
9735.	Ridans (ridans)	33	78.22	98.63	7	21.21
9736.	Rhune (rhunetro)	33	68.21	80.14	6	18.18
9737.	ralf (rhalfik)	33	72.48	92.53	10	30.30
9738.	Ben (random_peepsle12)	33	64.17	74.53	7	21.21
9739.	ramu kumar (ramu_kumar)	33	63.43	76.93	10	30.30
9740.	rambalaji (rambalaji)	33	75.54	98.37	11	33.33
9741.	Rakshit_dvorak (rakshit007)	33	78.13	95.08	14	42.42
9742.	rajan (rajan_singh123)	33	44.73	53.91	22	66.67
9743.	raging_wolf (raging_wolf)	33	56.67	69.97	3	9.09
9744.	r0hkx (r0hkx)	33	88.63	111.67	8	24.24
9745.	Quang (puangpro__6969)	33	58.32	69.23	15	45.45
9746.	Will (pozzpyo)	33	93.73	104.39	13	39.39
9747.	PJ (pjk519)	33	64.72	80.31	8	24.24
9748.	Ed (pelly1863)	33	86.29	99.87	6	18.18
9749.	Pegasus X (pegasusx)	33	34.08	45.58	1	3.03
9750.	Happy (paimon__)	33	70.39	86.15	7	21.21
9751.	Null (nullstring)	33	91.65	106.44	11	33.33
9752.	Nuan (nuan56)	33	72.06	91.79	7	21.21
9753.	(nt_chill)	33	99.88	118.27	12	36.36
9754.	Luke (nsaagent115)	33	92.30	112.83	12	36.36
9755.	Garbage (nerdballer)	33	127.63	151.31	22	66.67
9756.	Nik (nazeki)	33	96.37	123.41	19	57.58
9757.	Andrew (narchio)	33	98.45	118.93	10	30.30
9758.	Yuko (naoyuko)	33	77.53	84.74	7	21.21
9759.	Naomi (namtheyam)	33	98.29	116.51	16	48.48
9760.	Perhs (mrbunnym)	33	64.72	85.51	7	21.21
9761.	mky (mky1)	33	85.35	101.89	13	39.39
9762.	ig @emkloco (mkplayz)	33	80.40	96.05	6	18.18
9763.	Mitchell (mitchell721)	33	74.00	100.07	5	15.15
9764.	laffytaffy (mihirsm)	33	69.49	86.36	4	12.12
9765.	Mitchell (mdyer44)	33	86.53	107.17	11	33.33
9766.	chaotix (mcomm7)	33	75.13	89.31	6	18.18
9767.	Maxi (maxi25)	33	65.32	79.69	7	21.21
9768.	Marky (mark2most)	33	69.93	85.59	4	12.12
9769.	Mandeep (mani7246)	33	66.43	80.56	10	30.30
9770.	Couldn't be you (malthekr)	33	83.50	95.89	29	87.88
9771.	m0nst3r (m0nst3r9)	33	54.30	67.43	7	21.21
9772.	Liam (lwebb167)	33	79.87	89.06	9	27.27
9773.	LuciD (luci_d)	33	82.95	94.26	15	45.45
9774.	tstats[lil_issam312] (lil_i...	33	31.93	39.19	1	3.03
9775.	King Bygone (lil_bygone)	33	95.41	117.08	7	21.21
9776.	Wen (legendxiang)	33	87.54	105.84	11	33.33
9777.	Noah (l0cket)	33	61.39	75.56	4	12.12
9778.	krystall (krrystall)	33	57.37	74.94	7	21.21
9779.	Krish (krish_agn)	33	43.05	56.27	14	42.42
9780.	Ludvig (krang)	33	60.44	73.16	9	27.27
9781.	kevin (kevinstj)	33	94.53	127.61	11	33.33
9782.	keb (kerringtonbridges)	33	57.64	74.94	6	18.18
9783.	MOHANA (kanthetimohana)	33	59.92	70.37	0	0.00
9784.	Kalin (kamarel)	33	84.93	104.81	13	39.39
9785.	Yoshi (justayoshi)	33	74.27	91.65	6	18.18
9786.	Guest (jun16)	33	82.80	96.27	11	33.33
9787.	Ice (juicedicee)	33	73.25	92.19	9	27.27
9788.	Joshua (joshuajunhee)	33	83.54	116.76	10	30.30
9789.	Jonah (jonahtzy)	33	76.86	106.28	12	36.36
9790.	Ron(ald) (jellybeanman)	33	97.38	114.32	20	60.61
9791.	James (jameslroll)	33	114.33	134.74	19	57.58
9792.	Puntlander (jamaquube)	33	76.19	87.05	8	24.24
9793.	Jáky (jaky_)	33	45.45	53.33	4	12.12
9794.	Aryan (jai_ho420)	33	42.56	57.11	2	6.06
9795.	Ivan (ivangoh321)	33	79.35	88.46	7	21.21
9796.	Lynnette (its_lynnie27)	33	111.80	173.89	19	57.58
9797.	khy (itskhylmao)	33	59.91	75.57	27	81.82
9798.	iterative (iterative)	33	36.76	45.44	1	3.03
9799.	Insany (insanyngame)	33	64.11	73.28	17	51.52
9800.	Oflu61 (ilkerb)	33	113.26	133.30	18	54.55
9801.	hutab (hutab)	33	66.50	81.97	14	42.42
9802.	Adam (hodowcaowiec)	33	82.38	93.37	8	24.24
9803.	HK_TeddyBear (hk_teddybear)	33	39.10	52.69	4	12.12
9804.	HiroHero (hirohero89)	33	100.80	121.10	13	39.39
9805.	tstats[harryrich02] (harryr...	33	61.89	73.09	5	15.15
9806.	hao (haoatran)	33	93.76	106.25	18	54.55
9807.	Hachikachi (hachikachi)	33	105.01	123.28	18	54.55
9808.	Habibur (habiburrahman_mu)	33	43.81	68.34	8	24.24
9809.	G_low (g_low)	33	59.13	89.87	11	33.33
9810.	Adam (goodboyadam)	33	101.39	130.26	9	27.27
9811.	R (ghostboy)	33	89.58	115.28	19	57.58
9812.	Bootstrap (gaurav021992)	33	66.86	86.57	19	57.58
9813.	Vladimír (froggz)	33	107.11	124.04	23	69.70
9814.	forever_extinct (forever_ex...	33	77.44	103.84	7	21.21
9815.	umang patel (fiasty)	33	48.73	59.55	3	9.09
9816.	Jake (faljake)	33	86.51	112.38	16	48.48
9817.	Esraa (esraa14)	33	17.64	28.41	10	30.30
9818.	Samantha (epoxicx)	33	74.23	101.00	7	21.21
9819.	Enreden (enreden)	33	74.49	95.51	11	33.33
9820.	Eico (eico66)	33	75.77	90.03	11	33.33
9821.	Eduardo (eduardofreitas)	33	59.84	71.35	4	12.12
9822.	Ebi13579 (ebenezer13579)	33	107.44	132.69	7	21.21
9823.	doniee (doniee)	33	101.14	114.70	12	36.36
9824.	streetcar (dohrn1i)	33	74.67	94.43	17	51.52
9825.	Jard (dogspa)	33	105.78	122.95	17	51.52
9826.	Jan (de_necromancer)	33	47.49	60.21	5	15.15
9827.	Deen (deenibsyed)	33	87.98	99.50	9	27.27
9828.	Eric (wangjangler)	33	81.92	94.70	7	21.21
9829.	Grant (datasianguy23)	33	111.13	136.03	17	51.52
9830.	Daniel (danntheman21)	33	54.70	68.78	5	15.15
9831.	Dankerino (dankerinohd)	33	79.43	94.15	11	33.33
9832.	amalia (chowdergirl)	33	87.21	108.56	10	30.30
9833.	butane (butanebutton)	33	81.09	96.80	23	69.70
9834.	breadedsouth (breadedsouth)	33	69.22	101.25	4	12.12
9835.	August (boxcybrawler)	33	66.59	75.12	8	24.24
9836.	Emmett (bigblueyeti)	33	77.58	90.81	5	15.15
9837.	binay (biany671)	33	36.80	46.06	3	9.09
9838.	Bermet (bermetibr)	33	36.26	44.93	0	0.00
9839.	JumboTub4 (ben_is)	33	68.75	86.78	7	21.21
9840.	baker (bakervai001)	33	37.25	46.60	1	3.03
9841.	Hari (baby1_jimmy)	33	121.69	145.25	17	51.52
9842.	Awnvar (awnvar)	33	55.22	70.53	4	12.12
9843.	adam (armorcle__)	33	110.31	132.16	15	45.45
9844.	starsick (ardentauthoress)	33	103.72	122.72	18	54.55
9845.	Appel (appelboer)	33	75.42	93.39	11	33.33
9846.	Annie (anniesimp)	33	77.07	91.33	10	30.30
9847.	Anisath Kirubakaran (anisath)	33	44.44	52.69	4	12.12
9848.	AnesDZ (anes201)	33	79.72	93.98	11	33.33
9849.	alex j (alexjonelis)	33	64.61	82.88	14	42.42
9850.	Alexey (aleksn7)	33	68.06	82.70	5	15.15
9851.	Anton (alejendaryguy)	33	104.58	121.95	1	3.03
9852.	TulBott (alb3rth3nry)	33	101.29	118.77	14	42.42
9853.	AGTNurat (agtnurat)	33	119.05	142.35	20	60.61
9854.	abnf (abnf)	33	78.89	90.44	9	27.27
9855.	Max (2zmaxx)	33	96.02	117.32	14	42.42
9856.	Angel (angelbullet)	33	76.31	87.82	12	36.36
9857.	macc (softiebby)	33	87.57	112.23	9	27.27
9858.	shshsh (alex2003_)	33	47.36	55.76	2	6.06
9859.	Julien (dadcomeback)	33	92.87	106.88	14	42.42
9860.	Arun (arunkodumuru)	33	66.75	81.24	9	27.27
9861.	Ajeet (stripedcat12)	33	66.36	79.79	10	30.30
9862.	ARF (arf_g3)	33	72.01	87.45	11	33.33
9863.	Sun (sun730)	33	105.34	121.70	14	42.42
9864.	sarah (samuro)	33	114.40	136.04	18	54.55
9865.	GreenMilk (greenmilk7)	33	70.57	97.55	8	24.24
9866.	Fold Folded (nomine)	33	86.85	99.28	11	33.33
9867.	Anky (ankybisen)	33	39.65	50.29	1	3.03
9868.	Gojdoma (gojdoma1910)	33	78.73	99.94	11	33.33
9869.	sinnoh (serokai1721)	33	71.92	94.60	10	30.30
9870.	carzard (carzard)	33	52.58	61.67	5	15.15
9871.	remu (remu_gareu)	33	61.62	69.32	0	0.00
9872.	Gergő (gergi7600)	33	63.71	81.53	7	21.21
9873.	Venom (_venom)	32	77.04	94.46	10	31.25
9874.	AaronIsADonkey (_gg_ez_)	32	114.93	137.46	14	43.75
9875.	Zenith (zenith1g)	32	43.65	54.54	1	3.13
9876.	Hoang (yungrax)	32	57.50	68.37	6	18.75
9877.	Yogesh (yogesh9770)	32	45.98	70.07	4	12.50
9878.	MooD (xslel)	32	97.99	125.49	11	34.38
9879.	tstats[xeg28] (xeg28)	32	84.39	94.88	11	34.38
9880.	a (xdxdxd1234)	32	80.99	92.84	4	12.50
9881.	Welame (welame)	32	82.47	96.96	0	0.00
9882.	ColeMacca (weenyboi)	32	75.76	89.97	8	25.00
9883.	Melissa (wally88)	32	99.28	110.54	11	34.38
9884.	Vladi (wacy11)	32	89.41	113.06	10	31.25
9885.	Sunil (w0rds)	32	60.18	79.30	5	15.63
9886.	VYCanis (vycanis55)	32	97.03	105.75	15	46.88
9887.	THE STARDUST (void07)	32	62.15	79.19	7	21.88
9888.	Timo (ustimoger)	32	60.48	76.69	11	34.38
9889.	Will (urbanmist)	32	80.91	94.96	13	40.63
9890.	Ahmed (uproo)	32	63.08	80.86	8	25.00
9891.	Uncreeperble (uncreeperble)	32	84.78	117.56	10	31.25
9892.	AA (typee45)	32	44.22	54.69	6	18.75
9893.	tropics (tropicswpm56)	32	75.48	88.81	11	34.38
9894.	Tonchi (tonch1)	32	95.00	109.04	15	46.88
9895.	Alex (titleist_pro_v1x)	32	79.70	98.94	18	56.25
9896.	Jonathan (the_mechanical)	32	97.86	123.52	9	28.13
9897.	Ronny (the_mandalorian)	32	42.89	56.64	2	6.25
9898.	theaveragedude (the_avg_dude)	32	81.03	98.09	8	25.00
9899.	Timothy (thekoreanbanana)	32	82.68	97.09	14	43.75
9900.	Lightning (thecarsfan)	32	68.55	76.71	7	21.88
9901.	Taybuscus (taybuscus)	32	71.57	88.24	8	25.00
9902.	OnlyStanz (tanni)	32	87.00	104.98	12	37.50
9903.	HASHTAG (talk_is_cheap_like...	32	121.98	141.39	17	53.13
9904.	E (boop_bop)	32	47.23	57.08	0	0.00
9905.	Edward (supereduardus)	32	97.94	117.04	17	53.13
9906.	שפיצער (spitzer722)	32	65.51	85.56	7	21.88
9907.	Saim (spirit_)	32	77.11	101.49	9	28.13
9908.	slowmxbrowns (slowmxbrowns)	32	87.49	103.65	10	31.25
9909.	SLEEPINGzZZ (sleepingzzz)	32	53.20	64.03	5	15.63
9910.	Simeon (sim80)	32	122.38	148.29	17	53.13
9911.	Shon (shonboy21)	32	63.33	75.19	4	12.50
9912.	Shiasuni (shiasuni)	32	114.25	138.24	20	62.50
9913.	Shaun (shaunlooi)	32	84.04	99.07	11	34.38
9914.	Ahanaf Shahriar (shahriar013)	32	48.65	59.37	1	3.13
9915.	Logan (shadows36)	32	69.44	93.82	10	31.25
9916.	scpals (scpals)	32	79.22	102.64	10	31.25
9917.	Sarafraj (sarafraj)	32	49.57	57.20	1	3.13
9918.	Samadou (samadou_10)	32	80.59	102.96	12	37.50
9919.	RyZe (ryzehopz)	32	62.16	80.30	10	31.25
9920.	Ryan (ryanlondon)	32	57.11	72.48	6	18.75
9921.	Tyler Rankin (rxnkin)	32	66.81	80.96	6	18.75
9922.	ronald (ronaldalbarn)	32	87.25	105.65	7	21.88
9923.	Rocks D. (rocksdxebec00)	32	58.24	69.36	6	18.75
9924.	Bakugo (respiro72)	32	118.43	136.95	22	68.75
9925.	Rachel (rachel85881)	32	105.30	118.79	21	65.63
9926.	Anna (rabbitpickles69)	32	93.70	129.75	11	34.38
9927.	Raagaception (raagaception)	32	83.33	105.41	11	34.38
9928.	uzi (r3yna)	32	74.33	92.13	12	37.50
9929.	brownbelly (pvthg)	32	86.92	109.81	12	37.50
9930.	PRACTICE (practicecar)	32	117.33	143.37	19	59.38
9931.	PropheticNPC (potencity)	32	90.79	110.76	8	25.00
9932.	player (player172)	32	39.13	96.44	9	28.13
9933.	Arsh (piratexx)	32	78.04	90.39	23	71.88
9934.	ninii (paniini)	32	91.87	110.12	17	53.13
9935.	Amine (ov4h)	32	59.26	74.26	8	25.00
9936.	Lego (outboxer009)	32	44.65	51.82	3	9.38
9937.	organic (organic__filter)	32	61.72	73.36	6	18.75
9938.	Oscar (oguana)	32	67.44	82.83	6	18.75
9939.	Nico (npvalerio8)	32	89.39	109.18	13	40.63
9940.	Stalin (notdavidcameron)	32	117.89	146.39	18	56.25
9941.	Aanshu (noob_typist_404)	32	68.52	79.94	12	37.50
9942.	Martin (niquid)	32	76.77	90.93	9	28.13
9943.	Nieid (nieid)	32	87.99	116.68	14	43.75
9944.	nakkisoppa666 (nakkisoppa666)	32	98.04	131.34	9	28.13
9945.	Nazarbek (na2a_)	32	111.38	125.58	15	46.88
9946.	Milan (m_i_n_o)	32	56.55	71.07	4	12.50
9947.	Mackenzie (music1713)	32	34.75	40.44	0	0.00
9948.	mukrohin (mukrohin)	32	90.41	109.08	9	28.13
9949.	tstats[muhd99] (muhd99)	32	68.99	79.29	10	31.25
9950.	Matt Tierney (mtierney111)	32	76.22	100.14	9	28.13
9951.	Percy (mraudiodrama)	32	98.57	116.05	14	43.75
9952.	Matthew (mpb0401)	32	67.64	80.40	5	15.63
9953.	Tanakrit (mogoon)	32	56.34	65.62	7	21.88
9954.	Mamdouh (mmdh)	32	64.44	80.67	11	34.38
9955.	nah (ministermeme)	32	93.31	111.67	9	28.13
9956.	Meruem (meruem1919)	32	140.92	173.02	23	71.88
9957.	Kaung Pyae (meandmyfriend4)	32	57.76	70.40	6	18.75
9958.	Sean (masian08)	32	90.16	105.90	5	15.63
9959.	Melon (mailmelon)	32	54.98	67.17	4	12.50
9960.	MAGNUS (magnus03)	32	57.01	80.73	6	18.75
9961.	Lucia (lucialima)	32	47.18	56.25	2	6.25
9962.	Christopher (lord_pretzel)	32	86.94	109.25	7	21.88
9963.	long (longlonglong)	32	64.58	80.46	7	21.88
9964.	Lojants (lojants1)	32	95.77	111.65	10	31.25
9965.	Albert (lnseed)	32	77.28	96.30	6	18.75
9966.	Eric (llmangoll)	32	66.10	82.09	17	53.13
9967.	LAO (legendoflaohan)	32	69.92	85.76	8	25.00
9968.	Brylle (latios12349)	32	55.25	64.48	1	3.13
9969.	Lathoa (lathoa)	32	79.99	95.29	17	53.13
9970.	Kyle (kyle_15)	32	43.36	57.37	1	3.13
9971.	-_- (kxs5)	32	110.77	124.92	24	75.00
9972.	Alberto Balsalm (kutaybozkurt)	32	70.56	82.63	12	37.50
9973.	twitch.tv/klokkismann (klok...	32	126.39	151.08	8	25.00
9974.	hyunki (kirene)	32	72.34	82.12	10	31.25
9975.	Keith (keithlor)	32	127.22	147.69	18	56.25
9976.	🥴 (kangjushang)	32	50.65	61.50	1	3.13
9977.	v(._.)v (justbeatya)	32	64.92	78.96	6	18.75
9978.	Julian (julianeadie)	32	53.33	63.03	3	9.38
9979.	Julia (juliaar)	32	56.76	70.15	7	21.88
9980.	Juggernaut (jugg07)	32	96.32	112.60	11	34.38
9981.	James (jrm371)	32	75.85	103.51	11	34.38
9982.	Joshua (joshque)	32	92.67	110.35	4	12.50
9983.	Jose (jgeer)	32	66.16	75.42	6	18.75
9984.	JackBurst (jackburst)	32	107.16	125.24	12	37.50
9985.	Joey (j0ash08)	32	56.37	66.32	16	50.00
9986.	Hasit (invincible678)	32	59.20	87.45	5	15.63
9987.	Highly unskilled (intenseag...	32	152.54	201.70	20	62.50
9988.	Smitty W. (ifartfire)	32	71.42	84.18	7	21.88
9989.	ICE TEA (ice_tea911)	32	59.33	70.89	5	15.63
9990.	Victor (hueylouisnonews)	32	90.74	103.70	12	37.50
9991.	Sclai (house_cat)	32	71.14	81.98	7	21.88
9992.	Hobo (hobo_rapper)	32	83.82	101.30	8	25.00
9993.	AHEN (henneberg)	32	104.15	138.74	12	37.50
9994.	haidilaohotpot (haidilaohot...	32	81.26	91.41	7	21.88
9995.	Gleb (gsavchenko)	32	59.90	68.84	3	9.38
9996.	Graham (grayham11)	32	85.08	99.76	9	28.13
9997.	scarFace (gray25905634)	32	72.53	92.65	7	21.88
9998.	Grace (gracecatan)	32	118.34	131.73	14	43.75
9999.	GoldenSnitch (goldensnitch73)	32	84.96	103.83	7	21.88
10000.	Glad (glad99)	32	74.68	94.57	7	21.88
10001.	Giovanni (giovannigando)	32	80.27	89.92	8	25.00
10002.	Graham (gfoote)	32	96.44	108.33	12	37.50
10003.	Andrew (get_hyped20)	32	95.11	115.36	17	53.13
10004.	Flex (flexiblerhyme30)	32	58.01	71.49	8	25.00
10005.	Chuanyao (finalconflux)	32	87.96	111.04	13	40.63
10006.	Eric (envyhope)	32	87.24	103.21	9	28.13
10007.	engager (engager)	32	65.41	73.88	2	6.25
10008.	Emily (emilyk_3357)	32	93.47	114.49	12	37.50
10009.	Elsawy (elsawy636)	32	78.48	87.78	6	18.75
10010.	SirCanaanDoyle (elevayshun)	32	113.39	143.05	18	56.25
10011.	SlipperySlope (eeilu)	32	77.30	88.62	10	31.25
10012.	Dustin (dustindp99)	32	94.58	110.69	12	37.50
10013.	Dustin (dustin099)	32	87.74	104.16	12	37.50
10014.	The (dhemagicianking)	32	117.51	140.75	14	43.75
10015.	(dev_rec)	32	150.31	185.43	17	53.13
10016.	David (davejiggy)	32	62.52	75.09	5	15.63
10017.	Darkleonard (darkleonard)	32	109.16	124.14	12	37.50
10018.	Danat (danat_ayazbayev)	32	98.52	113.93	10	31.25
10019.	Dammsugaren (dammsugaren)	32	81.09	95.00	11	34.38
10020.	Curo (curo)	32	77.73	91.73	8	25.00
10021.	Cosmin (cosmyd)	32	58.91	69.20	3	9.38
10022.	cookie (cookienbo)	32	79.04	107.54	9	28.13
10023.	Sai Srujan Kumar (chsrujan)	32	95.43	106.39	9	28.13
10024.	Carlos (carlos_007)	32	63.56	75.91	8	25.00
10025.	Espii (carlespe13)	32	69.68	82.79	14	43.75
10026.	Brennan (brennanminns)	32	86.41	104.38	12	37.50
10027.	Putu (boostedwrx)	32	114.72	145.23	17	53.13
10028.	Gordon (boboiv)	32	87.37	114.90	8	25.00
10029.	ameerah (bluecandy)	32	98.63	109.51	16	50.00
10030.	Bibek (bibek_)	32	80.42	94.70	4	12.50
10031.	Prem (batprem)	32	58.02	67.59	3	9.38
10032.	Zack (averyackz)	32	62.71	85.23	8	25.00
10033.	Morpheus14 (atilla_14)	32	81.94	95.50	13	40.63
10034.	Aaron (asc_the_fighter)	32	23.57	28.75	7	21.88
10035.	aron (aron25)	32	95.65	111.05	20	62.50
10036.	Arespi (arespi)	32	89.93	101.79	8	25.00
10037.	Antombomb (antombomb)	32	32.36	45.83	3	9.38
10038.	Anthony (anthonyjhwu)	32	47.72	56.60	2	6.25
10039.	Adebayọ (annonp)	32	67.67	89.19	8	25.00
10040.	milyn (alymilyn)	32	64.82	74.86	10	31.25
10041.	All-Rounder_28 (allrounder28)	32	74.26	96.16	9	28.13
10042.	good (afternoonracer)	32	81.80	101.02	14	43.75
10043.	🐌 (adas291)	32	77.21	86.48	12	37.50
10044.	Ace (acechow)	32	91.85	113.51	10	31.25
10045.	Abhishek (abhikumar98)	32	65.78	76.72	7	21.88
10046.	Abdullah (abdullahbb102)	32	71.71	94.92	4	12.50
10047.	Thomas (2minute)	32	68.82	76.45	9	28.13
10048.	Leo (1_typer_boy_1)	32	86.91	101.78	8	25.00
10049.	Nick (1chompy_)	32	79.40	90.82	11	34.38
10050.	Ramakant (ramakant)	32	35.46	49.52	1	3.13
10051.	Spectral (sspectral)	32	60.16	74.76	3	9.38
10052.	Toni (meecoula)	32	90.54	106.34	10	31.25
10053.	Joaquin (joaquino19)	32	46.45	57.39	21	65.63
10054.	Matt (hoopenator)	32	62.39	79.16	7	21.88
10055.	Adrian (apa9906)	32	71.55	90.94	30	93.75
10056.	Yuvi (yuva_yuvi)	32	44.14	55.24	5	15.63
10057.	Yul (toonguy)	32	90.22	120.20	16	50.00
10058.	sheg (shegsheg)	32	76.66	92.80	8	25.00
10059.	Alexander (thefastgumby)	32	56.60	64.95	5	15.63
10060.	Uran (uran001)	32	56.91	67.16	15	46.88
10061.	Austin (asasa3092)	32	71.45	89.36	7	21.88
10062.	Soham (microsword)	32	71.32	82.80	7	21.88
10063.	Liam (liamdasilva)	32	80.39	97.22	4	12.50
10064.	m (llelouchh)	32	80.25	96.46	9	28.13
10065.	Buka (obuka)	32	41.59	52.24	3	9.38
10066.	mark (heaterbeater)	32	93.12	111.77	9	28.13
10067.	Nikola (_not_)	31	47.92	54.44	1	3.23
10068.	mo (yo_mo)	31	56.29	68.65	3	9.68
10069.	lol (yowennnn)	31	80.55	99.53	11	35.48
10070.	melon (yoonity_)	31	114.05	131.49	21	67.74
10071.	Yani (yani916)	31	77.74	89.96	7	22.58
10072.	marco (xqz_u)	31	65.21	74.50	9	29.03
10073.	Seizoxu (xezious)	31	92.64	110.99	15	48.39
10074.	fnf (whitezetra)	31	89.66	111.88	9	29.03
10075.	Whelps (whelps)	31	115.37	152.09	18	58.06
10076.	K (wh0mst)	31	62.91	73.50	4	12.90
10077.	Virbox (web_user)	31	96.99	110.98	11	35.48
10078.	Watrdos (watrdos)	31	84.52	103.12	8	25.81
10079.	Jeffrey (vlasfack)	31	68.36	81.39	7	22.58
10080.	Orca (virtualorca)	31	80.47	92.02	11	35.48
10081.	Lux (veyro)	31	63.15	73.35	10	32.26
10082.	Hah (verdaderopan)	31	102.75	119.17	11	35.48
10083.	Ultimate_Coder (ultimate_co...	31	107.99	122.04	17	54.84
10084.	Jammie (nonquit) (typos_zzz)	31	176.19	217.38	22	70.97
10085.	(typing_doggo)	31	97.14	115.16	14	45.16
10086.	Turuo (turuo)	31	66.51	79.81	7	22.58
10087.	Alex (tsaalex)	31	91.52	108.03	9	29.03
10088.	Trevor (trevor10)	31	30.38	39.83	3	9.68
10089.	😈 (topthis)	31	94.81	111.46	8	25.81
10090.	James (the_swan)	31	108.69	127.33	21	67.74
10091.	Daniel (teraminx)	31	129.32	142.46	25	80.65
10092.	Eugene (taiwansfinest)	31	96.05	119.95	10	32.26
10093.	Mr. (superfat)	31	63.07	75.11	4	12.90
10094.	Stuart (stuart000little)	31	56.44	66.17	4	12.90
10095.	Rowan (spindlecreek)	31	66.82	80.48	5	16.13
10096.	gixxer (somewhat_noob)	31	74.93	89.03	5	16.13
10097.	Catering (sneevy)	31	116.30	131.33	14	45.16
10098.	sai (smuna13)	31	80.47	96.11	5	16.13
10099.	slowAf (slow_af_dvorak)	31	87.95	113.67	6	19.35
10100.	Sukanya (siriros)	31	31.44	40.28	2	6.45
10101.	shuaib (shuaibabrar)	31	68.97	80.48	7	22.58
10102.	Shanon (shadowyshadows)	31	148.71	179.84	24	77.42
10103.	Andreas (sgtreent)	31	87.81	105.61	15	48.39
10104.	sev (sev4tou)	31	58.85	66.58	7	22.58
10105.	Binscuit (scoutzc)	31	70.51	83.82	8	25.81
10106.	Sarang (sargfromind)	31	46.32	57.91	4	12.90
10107.	Samit (samitkapoor)	31	77.69	97.04	8	25.81
10108.	ShyKnee (samflysure)	31	58.81	67.96	3	9.68
10109.	nanoray (saliciti)	31	94.02	116.20	11	35.48
10110.	sadwipe (sadwipe)	31	79.80	91.18	7	22.58
10111.	Rubber (rubberduckcolemak)	31	83.35	110.28	10	32.26
10112.	Raul (rromer41)	31	58.41	71.35	0	0.00
10113.	Roy (royroyking)	31	89.89	113.16	10	32.26
10114.	Rikka (rikka_takanashi)	31	123.04	152.90	18	58.06
10115.	Rhevan (rhevan)	31	53.22	61.49	10	32.26
10116.	Reyque (reyquexd)	31	107.93	129.88	10	32.26
10117.	Raul (raule_maule)	31	69.52	83.88	7	22.58
10118.	Raj (raj__)	31	88.12	106.16	10	32.26
10119.	Rad (radandrei)	31	99.77	110.83	19	61.29
10120.	prasanjith (prasanjith)	31	61.64	73.03	3	9.68
10121.	Ivan (pop5a)	31	90.77	113.99	10	32.26
10122.	perm (perm_typeracer)	31	62.34	72.55	3	9.68
10123.	Paul (paulg2k_csgo)	31	73.53	87.80	7	22.58
10124.	Geetansh (pandaculture)	31	74.25	87.42	5	16.13
10125.	OMGnesststats[omgness321] (...	31	69.92	88.99	7	22.58
10126.	Mudit (n___)	31	68.19	79.50	8	25.81
10127.	Nyp3r (nyp3r)	31	59.96	70.85	3	9.68
10128.	NoNo (nonoesimposible)	31	110.07	126.26	15	48.39
10129.	nitrosquid (nitrosquid)	31	96.52	126.27	10	32.26
10130.	nagz (naxumi)	31	82.96	113.98	10	32.26
10131.	mustard maiden (mustardmaiden)	31	115.69	135.64	16	51.61
10132.	Mukhametkali (mr_koten)	31	31.14	39.45	8	25.81
10133.	Mesotelioma (mesotelioma)	31	92.08	107.17	13	41.94
10134.	Max (max_6058)	31	82.06	95.36	10	32.26
10135.	Markus (markustelser)	31	76.50	87.84	14	45.16
10136.	Mads (madsbv)	31	95.95	112.66	15	48.39
10137.	Max (madmax89)	31	81.42	90.96	6	19.35
10138.	Luthfi (luthfiidrus1612)	31	68.50	78.85	10	32.26
10139.	June (lumierevi)	31	84.04	98.72	9	29.03
10140.	lotok (lotok_14)	31	86.52	108.30	8	25.81
10141.	Bob Gnarly (lobmys)	31	76.93	97.01	10	32.26
10142.	LittleYun (littleyun)	31	72.96	91.74	8	25.81
10143.	N (lin_snarp)	31	45.93	60.44	3	9.68
10144.	Chicony osu! (leva_russian)	31	85.99	98.85	11	35.48
10145.	LeTwash (letwash)	31	73.51	92.03	9	29.03
10146.	Lasped (lasped)	31	91.43	109.67	7	22.58
10147.	Ram (laiforever)	31	46.67	55.48	3	9.68
10148.	Jacob (labotski)	31	65.89	79.97	5	16.13
10149.	Benjamin (kullaaaa)	31	72.16	84.44	8	25.81
10150.	nitram (kros9987)	31	62.93	74.77	4	12.90
10151.	Kowalski (kowalski_)	31	109.59	129.52	15	48.39
10152.	Mayumi (kogl_mieko)	31	68.56	84.33	4	12.90
10153.	Kevin (kidview)	31	68.44	86.43	1	3.23
10154.	Kunihiko (keuno)	31	62.72	72.90	7	22.58
10155.	Ma (kenma262)	31	88.46	101.82	9	29.03
10156.	Jweel (jweel_kar)	31	46.14	55.89	4	12.90
10157.	Jason (jwangbang)	31	82.76	95.45	8	25.81
10158.	just_tito (just_tito)	31	33.10	41.84	1	3.23
10159.	Mattis (juicedrabbit)	31	77.43	94.02	9	29.03
10160.	Jonathan (jonathan081)	31	95.75	117.04	12	38.71
10161.	Jet (jetwinjo)	31	54.03	62.24	4	12.90
10162.	javonte (javonteslow)	31	118.15	153.82	22	70.97
10163.	jam (jamhill)	31	61.29	72.31	5	16.13
10164.	J (jairo_113)	31	57.02	69.78	11	35.48
10165.	ix4l (ix4l19)	31	68.79	79.13	8	25.81
10166.	Rahul (itzrall)	31	64.86	85.59	8	25.81
10167.	itypeabove130only (itypeabo...	31	134.05	157.89	19	61.29
10168.	John (imsoepic)	31	96.33	109.62	10	32.26
10169.	A. Moe Gus (iltg)	31	75.34	90.82	10	32.26
10170.	HxntedRex (hxntedrex)	31	95.21	108.24	11	35.48
10171.	Howard (howardpx2016)	31	108.04	123.93	9	29.03
10172.	not (hayso)	31	110.89	130.44	15	48.39
10173.	nahte (hawkzle)	31	46.78	61.20	6	19.35
10174.	hamin (hamin)	31	102.80	129.19	16	51.61
10175.	Hagen (hag3nl)	31	63.06	70.23	8	25.81
10176.	wolff (gwolff)	31	151.40	175.67	25	80.65
10177.	Gourango (gsrajeni)	31	66.92	83.64	6	19.35
10178.	gre (gregoryrogel)	31	59.32	72.30	5	16.13
10179.	augh (goodmint)	31	81.00	101.90	9	29.03
10180.	dog (ginasmocha)	31	82.35	118.51	11	35.48
10181.	Nicholas (gigamammothtyper123)	31	57.35	75.42	3	9.68
10182.	Huy (giahuy7753)	31	67.89	82.99	5	16.13
10183.	HUONO (gghuono)	31	83.70	95.90	13	41.94
10184.	Spartan Warrior (gerogeka1111)	31	72.24	91.01	7	22.58
10185.	Gautam (gbasak)	31	52.35	60.03	0	0.00
10186.	bashar (fuddle_)	31	40.18	53.64	2	6.45
10187.	Faiq Ayubi (froxt)	31	60.54	91.50	8	25.81
10188.	Flying (flyingdemon)	31	50.88	67.32	6	19.35
10189.	fathima (fathimaa)	31	46.92	58.17	2	6.45
10190.	Erik (ezhou21)	31	94.09	116.92	13	41.94
10191.	neo (eliteneo)	31	92.92	110.74	7	22.58
10192.	Leif (electricronny)	31	109.64	127.83	16	51.61
10193.	paul (dunzo18)	31	69.12	95.05	5	16.13
10194.	Isaac (dolemitesundae)	31	88.50	109.05	7	22.58
10195.	Thai (despotron)	31	95.92	115.01	7	22.58
10196.	Daniel (dasno)	31	67.83	78.14	4	12.90
10197.	Pascal (darm4n)	31	92.18	106.22	8	25.81
10198.	Mad_Dog (darkus_dragonoid)	31	83.05	94.86	11	35.48
10199.	. (darkis)	31	112.39	144.41	21	67.74
10200.	Cramp (crampdg)	31	111.13	130.71	16	51.61
10201.	Conor (conorwalsh1601)	31	63.68	82.96	8	25.81
10202.	Chris (chris_9001)	31	87.13	107.14	19	61.29
10203.	ChivalKnight (chivalknight)	31	75.32	88.79	8	25.81
10204.	chillresident (chillresident)	31	95.76	109.58	8	25.81
10205.	Ben (chewy_bran)	31	76.59	91.69	7	22.58
10206.	Catrinet (catrinet)	31	35.90	41.85	0	0.00
10207.	Schuyler (captainsky03)	31	109.90	131.60	15	48.39
10208.	Bertalan (brtln)	31	69.74	86.79	15	48.39
10209.	Steven (boomkat)	31	88.12	113.59	9	29.03
10210.	Tom (bobtom8482)	31	86.73	109.19	12	38.71
10211.	Paul (bisente006)	31	53.41	69.77	10	32.26
10212.	Binamra (binamra)	31	64.89	91.97	6	19.35
10213.	C (bigcdub)	31	60.82	79.98	9	29.03
10214.	bader (bhilal)	31	36.62	45.93	2	6.45
10215.	Bhaskar (bhaskar942)	31	59.11	73.79	3	9.68
10216.	Brendan (bfay)	31	97.06	119.12	10	32.26
10217.	Roberto (bertdog1995)	31	93.36	105.15	9	29.03
10218.	BeastBoy (beastboykadil)	31	49.25	61.30	2	6.45
10219.	Avrick (avmend)	31	73.34	91.73	11	35.48
10220.	laundromatt (austen_washer)	31	90.65	116.11	12	38.71
10221.	Renato (ato2000)	31	89.83	106.89	10	32.26
10222.	Bruno (armitageb)	31	108.22	132.01	14	45.16
10223.	No Mistakes (apsnacks)	31	92.86	114.27	7	22.58
10224.	Gio (apex_shrimp)	31	71.81	80.33	6	19.35
10225.	Anton (antonium)	31	77.70	102.65	12	38.71
10226.	AnniK (anni_k)	31	90.77	111.53	13	41.94
10227.	Amit (amitsetty)	31	125.04	144.79	11	35.48
10228.	alyssa (alyyyssa)	31	98.07	113.14	9	29.03
10229.	Alex (alexyoung)	31	78.30	95.77	4	12.90
10230.	Andrew (ajw5196)	31	57.92	77.89	5	16.13
10231.	Alasdair (aisaem)	31	106.23	121.14	15	48.39
10232.	AgentGarbo (agentgarbo)	31	74.72	93.62	7	22.58
10233.	Aditya (aditya_2703)	31	68.76	83.45	3	9.68
10234.	abdullah (abdullah1233)	31	58.28	72.10	7	22.58
10235.	Abhishek (abc_cs)	31	88.97	102.42	8	25.81
10236.	ottar dio (aag3098)	31	61.25	71.52	4	12.90
10237.	Igor (6eamed)	31	92.59	112.78	10	32.26
10238.	1980 (1980ops)	31	104.63	119.28	14	45.16
10239.	Poul ib Uitsatikitseq (13fu...	31	33.27	44.34	1	3.23
10240.	martiangnome (martiangnome)	31	71.90	78.62	8	25.81
10241.	zainal (ali200276)	31	54.16	65.20	3	9.68
10242.	Suwidiana (suwidhi)	31	70.54	90.76	12	38.71
10243.	DolnaNaka (dolnanaka)	31	72.98	93.29	10	32.26
10244.	Lost (lostviajero)	31	91.00	105.40	13	41.94
10245.	Audrey (cow_rj1204)	31	49.96	83.86	9	29.03
10246.	QWERTYsamuel (gottagofast1111)	31	49.98	58.90	3	9.68
10247.	Julian (corpse13)	31	71.00	83.22	8	25.81
10248.	screaM (scream_)	31	122.64	148.84	20	64.52
10249.	Vanessa (vanoob)	31	54.25	66.40	5	16.13
10250.	Yashaswe (yash_10)	31	76.54	94.44	11	35.48
10251.	mgLover (mannyglover)	31	46.42	53.67	0	0.00
10252.	Jacob (jacobdante)	31	68.66	79.12	7	22.58
10253.	K (335469854)	31	109.02	129.18	16	51.61
10254.	tbgracy (tbgracy)	31	68.43	80.21	2	6.45
10255.	Aman (_aman_)	31	56.52	61.69	6	19.35
10256.	Gumbers (gumborb)	31	57.18	67.93	3	9.68
10257.	Starlitblond (melaniemc)	31	59.17	73.32	6	19.35
10258.	Sourab (voyager7)	31	60.62	71.75	5	16.13
10259.	cicerolb27 (cicerolb03)	31	99.20	120.72	18	58.06
10260.	Jackson (deepfryinit)	31	95.98	127.14	8	25.81
10261.	aurophoe (aurophoe)	31	90.63	109.16	11	35.48
10262.	P-chan (pchan555)	31	66.19	89.44	6	19.35
10263.	Olivia (livbanks)	31	67.75	83.51	10	32.26
10264.	JackPlayZ31 (jackplayz31)	31	46.49	55.76	2	6.45
10265.	samir (_samir)	30	83.75	107.13	25	83.33
10266.	ArV (_arv_)	30	62.59	70.62	6	20.00
10267.	Jacob (zoloto67)	30	96.95	111.58	12	40.00
10268.	Hazique Mirza (ziquemirza)	30	50.67	59.09	1	3.33
10269.	zeropollyvtuber (zeppi)	30	130.25	151.08	23	76.67
10270.	Zear (zear5)	30	74.83	92.83	7	23.33
10271.	Callum (yuihirasawa)	30	86.87	101.63	14	46.67
10272.	sebi (ysebi)	30	62.95	73.01	6	20.00
10273.	Yoongo (yoongo)	30	91.14	104.93	10	33.33
10274.	Winson (wwang038)	30	89.70	107.27	15	50.00
10275.	Arnold (wiktor172003)	30	83.19	99.28	6	20.00
10276.	walid (walid1997)	30	77.74	90.60	8	26.67
10277.	Derek (vonarxd)	30	90.39	98.97	6	20.00
10278.	Mike (unforgotten)	30	108.35	134.75	17	56.67
10279.	ayeitsme (ughg)	30	53.95	75.07	3	10.00
10280.	Kameloc (twoddle2)	30	80.74	92.64	8	26.67
10281.	Tops (tufeng)	30	68.83	84.90	10	33.33
10282.	Translator (trnsltr)	30	95.79	112.72	12	40.00
10283.	Pavel (trialtry)	30	76.87	88.17	12	40.00
10284.	Aidan (trabpukcip)	30	108.04	129.04	16	53.33
10285.	Tina (tprentis22)	30	61.58	70.91	4	13.33
10286.	Anthony (tonymontaro)	30	74.77	84.87	5	16.67
10287.	Toasted (toasted_)	30	71.91	84.30	8	26.67
10288.	tnn21 (tnn21)	30	105.67	140.90	8	26.67
10289.	thundr (thundr001)	30	43.71	54.01	1	3.33
10290.	Theo (the_o_choked)	30	78.91	92.61	7	23.33
10291.	notorioustype (thenotorious...	30	49.61	57.62	3	10.00
10292.	Johan (thehutt)	30	70.72	81.34	19	63.33
10293.	tesseract (tesseract1996)	30	56.48	70.51	4	13.33
10294.	Ethan (terean)	30	113.21	126.72	18	60.00
10295.	syz (syzzzzzzz)	30	62.29	78.08	3	10.00
10296.	SWAPNIL (swapnil326)	30	81.50	94.58	12	40.00
10297.	Isak (stitchy_)	30	62.73	83.31	10	33.33
10298.	Starry (starsky123)	30	92.88	111.53	13	43.33
10299.	Griffin (speedyboi4506)	30	101.55	129.61	14	46.67
10300.	SOBO (sobo)	30	76.58	88.18	6	20.00
10301.	lol (sngtx)	30	81.81	103.50	8	26.67
10302.	Cassi (slowerthanmolasses)	30	59.47	73.09	4	13.33
10303.	Avery (skipperbud)	30	73.43	86.16	7	23.33
10304.	Josh (shrekker)	30	119.95	141.48	13	43.33
10305.	sho (shoshosho1)	30	59.93	75.22	10	33.33
10306.	JS (shadyshadez)	30	104.34	122.15	14	46.67
10307.	Sergej (segi)	30	65.89	88.13	2	6.67
10308.	x (sealnot123)	30	81.65	97.84	9	30.00
10309.	Sashaw (sashaww)	30	90.43	111.33	9	30.00
10310.	SiD (samueldim)	30	89.94	102.12	13	43.33
10311.	Ryan (ryan3760)	30	54.26	67.48	3	10.00
10312.	rum3r (rum3r)	30	69.04	78.75	6	20.00
10313.	Riser (riser1)	30	60.77	74.61	8	26.67
10314.	riggers (riggers)	30	62.85	81.35	6	20.00
10315.	revoosh (revoosh)	30	103.80	119.42	14	46.67
10316.	Rassulkhair (rassulkhair)	30	54.81	64.62	4	13.33
10317.	Sapphic Llama (rare_taco)	30	51.24	68.84	2	6.67
10318.	Rankoll (rankoll)	30	75.66	86.90	10	33.33
10319.	RadAlienware (rad_alienware)	30	65.86	79.53	6	20.00
10320.	Rich (r1hh)	30	87.19	108.99	10	33.33
10321.	IwasFASTonQWERTYnowIuseDVOR...	30	78.27	95.51	7	23.33
10322.	ben (prizmoasd)	30	96.10	112.97	8	26.67
10323.	Caleb (prismiasma)	30	112.65	128.97	11	36.67
10324.	Jakub (prism1349)	30	68.06	81.64	4	13.33
10325.	Pointyepic (pointyepic)	30	97.55	118.78	13	43.33
10326.	MiazMe (pmax)	30	85.57	102.28	9	30.00
10327.	Jesse (pinec0ne)	30	82.55	94.40	8	26.67
10328.	Petter (ph140)	30	82.44	108.59	13	43.33
10329.	pewpewdevildog (pewpewdevil...	30	80.98	92.13	7	23.33
10330.	Peter (petermc2007)	30	94.94	109.55	15	50.00
10331.	fan de Iknash (pedrou)	30	113.19	139.72	15	50.00
10332.	Patrick (patclark)	30	91.23	101.92	11	36.67
10333.	Rodrigo (pacha2880)	30	71.12	81.85	7	23.33
10334.	Piyush (p1yu5h)	30	59.38	67.88	7	23.33
10335.	OwenF (owenf)	30	46.64	72.39	0	0.00
10336.	Oliver (oviewill)	30	66.63	75.87	6	20.00
10337.	Nox (nymanne)	30	99.52	117.69	16	53.33
10338.	nother (nother)	30	54.95	66.47	6	20.00
10339.	B (nonemorenegative)	30	100.86	144.79	12	40.00
10340.	Sochi (noizi)	30	74.61	94.52	6	20.00
10341.	DaddyChill (nightynine)	30	54.43	68.67	2	6.67
10342.	Nicholas (nemath)	30	87.27	106.65	10	33.33
10343.	Nelvin (nelvin27)	30	89.48	109.67	9	30.00
10344.	Piyabuht (nekktheredsand)	30	72.83	90.63	8	26.67
10345.	Naitik (naitik_lisa)	30	39.95	48.93	2	6.67
10346.	muzakh (muzakkiha)	30	87.52	104.02	6	20.00
10347.	Muhammad Musharaf (musharaf35)	30	59.36	74.04	8	26.67
10348.	Murfy (murfychia)	30	70.17	81.58	11	36.67
10349.	Aman (multiversal_aspirator)	30	64.91	70.77	6	20.00
10350.	MtDewaholic (mtdewaholic)	30	103.85	123.99	8	26.67
10351.	Mr (mrmindgames)	30	91.61	109.83	25	83.33
10352.	MJ (mj_02)	30	93.53	107.60	15	50.00
10353.	Mich (michdaevinci)	30	74.36	93.16	7	23.33
10354.	Mohamad (mhmd_khlf)	30	87.44	95.75	5	16.67
10355.	merlot (merlotsuma)	30	43.68	54.50	3	10.00
10356.	Mayur S (mayur_chirttaragi)	30	60.57	72.35	4	13.33
10357.	mike (maykqwe)	30	93.95	114.04	11	36.67
10358.	stay fresh cheese bags (maw...	30	137.38	157.12	22	73.33
10359.	King (maichen777)	30	88.64	100.11	8	26.67
10360.	qwerty (longhongc)	30	80.92	94.76	6	20.00
10361.	Lokinoha (lokinoha)	30	73.79	85.08	3	10.00
10362.	Ivan (ljakpa)	30	95.32	104.93	10	33.33
10363.	Pengu (lilpengu)	30	83.88	100.25	10	33.33
10364.	chetty (lilchetty_x3)	30	86.18	95.87	11	36.67
10365.	E (le_chonks)	30	82.25	102.79	21	70.00
10366.	Letter (letterofpower)	30	80.73	100.93	1	3.33
10367.	slow_racer (left_arm_chinaman)	30	57.46	66.57	2	6.67
10368.	Leah (leahlovesjisung)	30	80.82	93.79	13	43.33
10369.	khlaid (kmaf)	30	63.25	84.38	6	20.00
10370.	Krish (kkrish100)	30	78.94	101.73	7	23.33
10371.	kimhong01 (kimmong)	30	74.61	82.27	7	23.33
10372.	Damyian (kight)	30	97.25	126.33	11	36.67
10373.	Kaimetsu (kaimetsu)	30	98.88	127.08	11	36.67
10374.	Ansar (kabdik)	30	35.72	43.17	2	6.67
10375.	Juicedit (juicedit)	30	102.09	127.72	10	33.33
10376.	Me (juicedcows)	30	93.78	117.64	5	16.67
10377.	Juantonomoe (juantonomoe)	30	115.30	131.74	18	60.00
10378.	John (johncha15724)	30	95.83	110.30	10	33.33
10379.	Joe (joemamma121)	30	68.78	85.35	10	33.33
10380.	Jacob (jkhindo64)	30	92.52	109.54	8	26.67
10381.	cody (jiji247)	30	145.81	163.33	23	76.67
10382.	Jasmine (jasmine5752)	30	54.43	62.52	5	16.67
10383.	Ivan (ivanplaystr)	30	105.69	116.85	16	53.33
10384.	Ivan (ivanh922114)	30	64.80	76.01	7	23.33
10385.	Khaled (itskhaled)	30	39.70	58.31	2	6.67
10386.	Joshua (insanelol)	30	83.44	99.02	9	30.00
10387.	Im Hacker (im_hacker)	30	100.05	117.55	16	53.33
10388.	Dana (icantthinkofausername)	30	117.19	135.51	20	66.67
10389.	Mason (hyojin2k)	30	98.91	112.01	13	43.33
10390.	namdo (huynhnamdo96)	30	66.16	74.23	4	13.33
10391.	Hot Cross Puns (hot_cross_p...	30	97.86	112.31	29	96.67
10392.	James (horjamez)	30	63.93	76.14	7	23.33
10393.	Henrique (hnrqe)	30	98.69	150.82	12	40.00
10394.	Richard (heferous)	30	57.35	78.52	3	10.00
10395.	Hamang (hamangpincong)	30	50.05	60.76	5	16.67
10396.	Alicja (gymnast2008)	30	50.88	62.59	3	10.00
10397.	Guber (guberxz)	30	62.43	73.55	9	30.00
10398.	Gnany (gnanyadapa)	30	48.77	65.93	5	16.67
10399.	Jack (giglioroninomicon)	30	103.88	126.94	10	33.33
10400.	Garamonde (garamonde)	30	75.21	90.51	10	33.33
10401.	Ickooo (gamerchancer)	30	82.41	96.04	8	26.67
10402.	Jakub (f_ckshit)	30	69.18	80.81	11	36.67
10403.	Clay Cain (fredrafferty)	30	45.26	55.43	2	6.67
10404.	jonas (frallan34)	30	61.45	76.37	8	26.67
10405.	Fly1nthe5ky (fly1nthe5ky)	30	85.23	100.80	9	30.00
10406.	Floopy (floopy__)	30	100.89	122.19	16	53.33
10407.	monster (flamewarz)	30	74.06	94.11	11	36.67
10408.	Joe (fireflygrave)	30	82.66	105.98	5	16.67
10409.	Kauã (fernandes10)	30	72.60	86.93	9	30.00
10410.	myth (fear_ed)	30	118.48	135.71	22	73.33
10411.	Anton (fantoniko)	30	52.43	56.30	1	3.33
10412.	Marcus (evanitez)	30	120.04	143.45	15	50.00
10413.	Eugene (eugeneteoh)	30	96.15	122.21	12	40.00
10414.	Ethan (etwa)	30	98.27	115.34	16	53.33
10415.	E. (esheby)	30	62.51	72.56	5	16.67
10416.	Steven (engine210)	30	76.04	91.14	8	26.67
10417.	neo (eliteneo_dvo)	30	87.49	101.05	8	26.67
10418.	Franzvic (elbruh)	30	90.91	117.93	9	30.00
10419.	aokepoke (dweepers)	30	92.70	112.60	7	23.33
10420.	Andrew (dodapotato)	30	44.22	58.53	2	6.67
10421.	Dizzi (dizzitypes)	30	93.80	116.00	8	26.67
10422.	didi (didi_pot)	30	69.83	81.25	7	23.33
10423.	nah (determination_)	30	114.42	136.75	14	46.67
10424.	Jeremy (definee)	30	86.80	104.16	5	16.67
10425.	Shan (debayon4545)	30	104.14	139.38	16	53.33
10426.	Vihas (datlightning)	30	82.83	102.74	8	26.67
10427.	Siddharth (darksun27)	30	55.04	65.57	6	20.00
10428.	daniel (danfinch07)	30	44.44	52.86	4	13.33
10429.	Daniel (daknk)	30	56.82	65.72	6	20.00
10430.	weird keyboard (cyphex)	30	100.95	118.61	9	30.00
10431.	Sashreek (cygnus206)	30	75.89	94.27	11	36.67
10432.	Liny (counting_star)	30	64.90	79.23	7	23.33
10433.	Norman (codificat)	30	80.07	92.63	10	33.33
10434.	YZZUB (chuang010896)	30	84.23	103.25	10	33.33
10435.	1myvar (chowchunfu)	30	104.31	121.99	15	50.00
10436.	Chad (chadkorrea)	30	56.38	68.64	5	16.67
10437.	|)are2|_eap (cepetir)	30	90.85	109.02	7	23.33
10438.	cagdas (cagirtas)	30	64.45	74.85	8	26.67
10439.	Brian (brian3927)	30	95.84	118.26	11	36.67
10440.	bq666 (bq666)	30	66.79	88.30	6	20.00
10441.	bp4dn (bp4dn)	30	100.22	121.91	11	36.67
10442.	bongking (bongking)	30	87.78	115.56	8	26.67
10443.	Bodie (bodejazz)	30	84.86	98.14	10	33.33
10444.	BobdeThird (bobdethird)	30	95.83	136.53	12	40.00
10445.	Blue (blue03yt)	30	74.44	102.28	14	46.67
10446.	BlazeAries (blaze_aries)	30	75.13	87.61	8	26.67
10447.	Ben (benthenoob961)	30	64.62	89.04	6	20.00
10448.	plusultratyper (bellpepper)	30	61.20	82.46	6	20.00
10449.	Peter (beepseeker)	30	110.35	142.20	14	46.67
10450.	be4r (be4r_)	30	63.11	71.10	3	10.00
10451.	avisheek (avisheek)	30	46.30	84.29	1	3.33
10452.	Asmus (asmus__)	30	59.17	75.14	6	20.00
10453.	Ásþór (asibasi)	30	80.50	97.65	8	26.67
10454.	Charles (armdev)	30	79.68	96.91	14	46.67
10455.	Arif (areyf)	30	49.92	60.02	6	20.00
10456.	Ayon (apaul23)	30	107.81	124.59	14	46.67
10457.	angry (angryfingers)	30	65.65	76.93	8	26.67
10458.	Alyan (alyanm)	30	114.36	135.84	5	16.67
10459.	Alvin (alwin630)	30	96.69	116.00	11	36.67
10460.	Alex (alexlizx)	30	82.54	98.45	6	20.00
10461.	Axolotl (aj0l0tl)	30	69.83	79.56	3	10.00
10462.	Afiq (afiqapon91)	30	52.38	64.89	2	6.67
10463.	Adres (adres)	30	53.12	62.32	4	13.33
10464.	sigma (adelshehadeh)	30	64.69	79.48	5	16.67
10465.	Aaron (aaronfrdumb)	30	60.07	74.98	8	26.67
10466.	Lars (aaberg)	30	87.20	100.60	5	16.67
10467.	Bot (348866896)	30	92.61	114.57	8	26.67
10468.	2E13 (1d14)	30	69.76	83.87	13	43.33
10469.	1776 (17_abe_76)	30	56.03	71.86	4	13.33
10470.	10time (10time)	30	38.53	58.21	5	16.67
10471.	0hyeah (0hyeah)	30	55.01	67.44	4	13.33
10472.	Joshua (josheems)	30	85.83	110.11	8	26.67
10473.	Sup (harry_kane)	30	50.83	60.65	4	13.33
10474.	big fudge (bigfudge84)	30	44.45	59.07	4	13.33
10475.	Arvi (arvi4321)	30	91.04	117.07	13	43.33
10476.	Yousuf (khanyousuf)	30	59.05	69.15	7	23.33
10477.	Parnika:) (parnika)	30	58.53	68.58	4	13.33
10478.	Magi (magi_dragon)	30	86.68	105.44	9	30.00
10479.	Dalton Machart (dzmachart25)	30	56.19	71.97	4	13.33
10480.	Blue (blue03)	30	74.44	102.28	14	46.67
10481.	Anjani (aryastark91)	30	93.78	107.97	8	26.67
10482.	Vincent (vincent16th)	30	51.30	61.45	7	23.33
10483.	will (ballsinjaws)	30	71.18	84.57	5	16.67
10484.	taco (tacoooooo)	30	73.11	85.12	5	16.67
10485.	Tommy (jymmot)	30	109.40	125.92	18	60.00
10486.	haskdfa (asdfbaewf)	30	93.03	110.71	14	46.67
10487.	P (guest2911)	30	63.92	90.50	7	23.33
10488.	Colin (legeometry)	30	133.89	156.52	27	90.00
10489.	dave (shalomski)	30	40.35	48.64	1	3.33
10490.	Ahmed (skaly)	30	44.87	55.49	19	63.33
10491.	Aidan (a_danroos)	30	68.65	83.68	9	30.00
10492.	qwerty (spellboundmage)	30	94.11	114.70	18	60.00
10493.	Gamewatchable (gamewatchable)	30	99.84	129.03	16	53.33
10494.	shubham (sk_07)	30	33.22	40.83	1	3.33
10495.	Sazs (sazs_)	30	57.31	65.28	17	56.67
10496.	jeremy (tunefullcobra)	30	56.30	67.57	7	23.33
10497.	Guian Cyrus (guiancyrus14)	30	63.44	80.02	7	23.33
10498.	XDloco (xdloco)	30	71.21	82.89	15	50.00
10499.	Jhairus (jhairus)	30	61.43	73.71	6	20.00
10500.	sunil (sunil01)	30	28.26	36.17	4	13.33
10501.	gerleva (_mr_e_)	29	65.95	74.99	5	17.24
10502.	fastest (_fastest_typist)	29	75.48	96.56	11	37.93
10503.	Z-Dvorak (zzdarke)	29	71.87	91.63	8	27.59
10504.	zhem_ (zhem)	29	107.52	130.10	14	48.28
10505.	Zharfan (zharfanadli)	29	94.03	113.62	16	55.17
10506.	Zeryx (zeryx_typing)	29	72.83	83.07	5	17.24
10507.	zei (zeizuta)	29	28.27	34.59	7	24.14
10508.	Zakaria (zackzack1224)	29	82.35	98.31	11	37.93
10509.	Sam (yaboisam_)	29	88.83	108.16	11	37.93
10510.	Luna (xluna420)	29	81.38	95.01	17	58.62
10511.	Andrew (wongsifu)	29	83.61	99.08	16	55.17
10512.	Kelvin - Colemak (winlost)	29	108.44	122.12	14	48.28
10513.	William (willteee)	29	99.74	123.77	8	27.59
10514.	Jared (willetsjared)	29	73.42	90.09	7	24.14
10515.	WhiteRose (whiter9se)	29	37.83	45.97	0	0.00
10516.	David (wdnch)	29	76.75	91.79	9	31.03
10517.	W (wbhizzle7)	29	100.71	122.04	6	20.69
10518.	( ͡° ͜ʖ ͡°) (warrine...	29	61.23	78.26	5	17.24
10519.	VSF (vsf123)	29	28.36	34.47	5	17.24
10520.	Victor (victorm900)	29	71.20	79.01	4	13.79
10521.	Vaibhav (vibhix)	29	75.17	90.60	6	20.69
10522.	Nick (vergil_00)	29	75.23	93.45	11	37.93
10523.	Lucas (veraluc)	29	96.99	119.25	8	27.59
10524.	Jacob (vanosgaming2014)	29	118.97	138.04	17	58.62
10525.	Yupa (valleyofthewin)	29	72.08	80.06	2	6.90
10526.	Umalis (umali)	29	54.85	66.59	7	24.14
10527.	Fealing (typistboy)	29	88.11	104.98	6	20.69
10528.	Twistees (twisteesboy)	29	79.63	98.98	15	51.72
10529.	It's me! (tuppence)	29	65.31	84.15	7	24.14
10530.	Justin (trudeaucooks)	29	138.37	195.76	22	75.86
10531.	Troy (troydaigneau)	29	94.96	118.90	5	17.24
10532.	Zkye (trestiel)	29	72.24	93.09	9	31.03
10533.	Roo (trepur349)	29	100.82	123.97	11	37.93
10534.	cody (tkdanimal)	29	70.15	83.74	5	17.24
10535.	Majid (thetypingnerd852)	29	36.59	48.39	4	13.79
10536.	swooshmcgoosh (swooshmcgoosh)	29	107.82	133.38	14	48.28
10537.	owen (sushisynth12)	29	83.43	102.45	5	17.24
10538.	Bertie (sunstonesharptor)	29	70.38	84.29	0	0.00
10539.	Eric (sumtypaway)	29	63.32	84.41	6	20.69
10540.	Suhas (suhoos)	29	103.68	125.67	16	55.17
10541.	gae (subtoentaloop)	29	77.92	99.76	7	24.14
10542.	stash (stash_)	29	43.16	53.76	2	6.90
10543.	Teddy (stargazingteddy)	29	53.16	63.88	4	13.79
10544.	tstats[sspaghettii] (sspagh...	29	92.74	108.16	9	31.03
10545.	Austin (splashtime)	29	97.36	109.88	14	48.28
10546.	grammy (spicybbqsauce)	29	64.64	78.51	4	13.79
10547.	Pinkies (smile_typer)	29	100.43	115.66	15	51.72
10548.	Regan (smalltymehero)	29	63.14	73.04	5	17.24
10549.	skepsi87 (skepsi87)	29	45.16	58.23	5	17.24
10550.	Priscilla (simplyscience)	29	121.78	150.53	23	79.31
10551.	Silent G (silentgisback)	29	115.03	135.93	15	51.72
10552.	꧁🎧웃 ֆɨɖɖɦǟռȶ...	29	60.03	78.10	7	24.14
10553.	Jhonnathan Ramirez (siaxais)	29	40.62	57.90	0	0.00
10554.	yung (shwn)	29	122.29	148.27	17	58.62
10555.	Sharath (sharathnirmala)	29	54.43	67.72	4	13.79
10556.	shantanu (shantothegreat)	29	67.63	85.57	5	17.24
10557.	o (seticl)	29	99.88	125.44	11	37.93
10558.	seer23 (seer23)	29	77.05	91.69	21	72.41
10559.	Namoonia (sasti_chars)	29	61.54	81.66	4	13.79
10560.	Brendyy (sabtooth)	29	126.39	141.21	18	62.07
10561.	Ryan (rya02)	29	61.97	77.57	7	24.14
10562.	Karl (refllexz)	29	80.67	96.08	7	24.14
10563.	Niklas (reeklas)	29	54.85	60.60	21	72.41
10564.	Ray (ray1829)	29	114.37	144.37	18	62.07
10565.	Rainbow (rainbowdudebh)	29	125.39	157.75	19	65.52
10566.	Gnomeツ (raging_gnome)	29	110.72	142.00	14	48.28
10567.	Romeo (r0mpan)	29	42.89	51.68	10	34.48
10568.	Praise (praisehim)	29	115.05	130.41	11	37.93
10569.	Peter (pklly)	29	60.39	78.07	5	17.24
10570.	Pinoy (pinoytypist01)	29	83.32	99.34	3	10.34
10571.	PingingCarrot16 (pingingcar...	29	67.29	89.20	7	24.14
10572.	Pina (pina_pog)	29	125.50	156.11	23	79.31
10573.	Pere_Gil (pere_gil)	29	77.26	89.26	3	10.34
10574.	Savannah (peaches39)	29	70.82	85.20	8	27.59
10575.	Chee (pcheekz)	29	50.12	67.30	7	24.14
10576.	Patrick (patbl)	29	87.20	108.40	14	48.28
10577.	ThePastor (pastor3974)	29	63.59	89.87	5	17.24
10578.	Paracoax (paracoax)	29	106.39	128.42	13	44.83
10579.	Thomas (nunu464)	29	60.48	74.57	9	31.03
10580.	THE KID (nschattner)	29	94.91	118.90	10	34.48
10581.	Novades (novades)	29	69.51	86.45	9	31.03
10582.	℮ (nicepal)	29	137.30	155.75	22	75.86
10583.	Esmeralda (niccon)	29	83.07	97.44	5	17.24
10584.	Neske (neske)	29	98.48	124.67	14	48.28
10585.	(nenontank_)	29	90.05	135.08	10	34.48
10586.	Nalahatra (nalahatra)	29	47.90	67.43	2	6.90
10587.	Mustafa (musthelegend)	29	90.93	106.47	7	24.14
10588.	MoresVance (moresvance)	29	102.82	125.22	15	51.72
10589.	Bijay (moneybijay)	29	93.12	112.76	11	37.93
10590.	lucas (moisturisingcream)	29	66.09	77.83	7	24.14
10591.	Georgi (mitevw)	29	32.58	41.20	1	3.45
10592.	Milky (milkxy)	29	96.83	115.09	19	65.52
10593.	Munkhsuld (mbior)	29	74.13	82.99	8	27.59
10594.	Mark (mariktypes)	29	117.56	141.94	16	55.17
10595.	m3d (m3dsh)	29	74.66	91.81	10	34.48
10596.	Lyons (lyoons)	29	121.07	150.05	24	82.76
10597.	Lush (lush_krom)	29	98.15	111.25	15	51.72
10598.	smino (lucskosur420)	29	61.86	78.26	5	17.24
10599.	Machine (longshort)	29	58.23	75.27	6	20.69
10600.	Nate (lobdog)	29	84.66	106.23	8	27.59
10601.	Lil (lil_wymn20)	29	38.90	46.32	3	10.34
10602.	LadaSedan (ladasedan)	29	83.61	94.63	3	10.34
10603.	Angel (kyngbui)	29	114.91	149.41	15	51.72
10604.	kyletsetse (kyletsetse)	29	126.40	150.80	26	89.66
10605.	kottt (kweent182)	29	97.72	107.92	9	31.03
10606.	Kamiltoni (ktonig1221)	29	33.07	52.81	3	10.34
10607.	E (knight250)	29	70.20	83.28	27	93.10
10608.	Rae (kmacc)	29	51.08	67.51	2	6.90
10609.	Kevin (kevinmeseeyou)	29	102.31	114.28	9	31.03
10610.	kenneth (kenneth29)	29	65.34	77.45	3	10.34
10611.	Nektarios (kapiras)	29	37.41	50.06	2	6.90
10612.	Md Ziaur Rahman (juall)	29	39.92	52.35	2	6.90
10613.	Jacob (jsmith182)	29	89.34	102.31	14	48.28
10614.	Joshua (joshnah)	29	86.06	105.44	11	37.93
10615.	Joshua (joshbenja)	29	97.33	110.35	9	31.03
10616.	Jayuke (jontrask)	29	102.10	125.30	13	44.83
10617.	Jokrr (jokrr7)	29	77.10	88.67	10	34.48
10618.	JC (joker801)	29	44.46	49.46	2	6.90
10619.	Jerod (jeroddddd)	29	109.54	129.55	14	48.28
10620.	Jeev (jeevjoel)	29	70.26	92.63	7	24.14
10621.	Jeemin (jeemini)	29	101.64	124.15	13	44.83
10622.	Jayden (jayballr)	29	81.88	102.68	7	24.14
10623.	Jacques (jacquesp)	29	85.95	104.94	3	10.34
10624.	Jackelton (jackelton)	29	93.27	112.13	10	34.48
10625.	tstats[jaadunath] (jaadunath)	29	74.84	90.85	8	27.59
10626.	IamUrs (i_am_urs)	29	82.03	102.77	5	17.24
10627.	imi (imitavor)	29	55.81	68.16	2	6.90
10628.	Jeon (idnyhn)	29	94.31	117.29	12	41.38
10629.	hyeonk (hyeonk)	29	99.56	122.70	12	41.38
10630.	Hridoy (hridoymahmud71)	29	40.79	46.96	2	6.90
10631.	Raheeb (hoenchioma)	29	57.57	71.02	2	6.90
10632.	Wixxers (heyitswixx)	29	62.08	80.05	13	44.83
10633.	dsc.gg/uk-train (hellomynam...	29	63.75	82.58	19	65.52
10634.	haaa (h505)	29	73.73	84.84	7	24.14
10635.	GMHazem (gm_hazem02)	29	72.90	90.73	5	17.24
10636.	CheetahDude (ghysdd)	29	96.15	115.88	11	37.93
10637.	Dum (getintherobotshinji)	29	99.55	118.62	17	58.62
10638.	George (gecovin)	29	96.90	118.65	11	37.93
10639.	Kowala Bear (gaverpro)	29	141.83	168.60	20	68.97
10640.	loiyus (fuzxy)	29	101.53	121.95	10	34.48
10641.	mrooogaboooga (foulackfoula...	29	90.90	114.56	4	13.79
10642.	Mavis (firkinmugs)	29	72.22	83.97	9	31.03
10643.	Henk (fattieruns)	29	74.33	86.55	8	27.59
10644.	tstats[faiz_legend] (faiz_l...	29	71.60	94.41	6	20.69
10645.	nootnoot (ezoid_nootnoot)	29	50.89	68.92	7	24.14
10646.	vion (evions)	29	47.64	66.10	2	6.90
10647.	Eder (edertyper)	29	88.13	103.04	10	34.48
10648.	Ora Ora (eddyyang2003)	29	102.36	115.96	19	65.52
10649.	Hektor (dr_sparkles)	29	60.15	75.88	14	48.28
10650.	Zap (drdecember)	29	70.75	86.00	7	24.14
10651.	Doven (doven)	29	85.36	104.01	13	44.83
10652.	dev (devgiri0082)	29	66.03	76.84	0	0.00
10653.	Deepak (deepakthegreat)	29	60.67	79.63	5	17.24
10654.	david (davie04)	29	88.59	106.18	8	27.59
10655.	davidbird764 (davidbird764)	29	106.74	125.03	13	44.83
10656.	Ishmam Jarif Daula (daula507)	29	53.54	71.37	15	51.72
10657.	Connor (ctw0611)	29	124.64	146.89	22	75.86
10658.	Akashi (coppokim)	29	43.05	53.25	6	20.69
10659.	CoolGuy (cool_guy5583)	29	72.16	85.76	12	41.38
10660.	Kyjro (codertimeing)	29	66.98	85.09	6	20.69
10661.	Cinari (cinari)	29	96.87	108.54	6	20.69
10662.	Chris (chrisrapid)	29	50.54	57.17	5	17.24
10663.	Chris (chrislh221)	29	91.33	103.66	13	44.83
10664.	Chi (chiphan1993)	29	122.33	138.40	16	55.17
10665.	CHIEN (chient)	29	101.29	112.36	10	34.48
10666.	Cassidy (cassidyfaith)	29	90.36	129.61	12	41.38
10667.	yanzhi (cakeuuuu)	29	78.40	91.18	10	34.48
10668.	Ben (bv_nie)	29	87.57	112.42	8	27.59
10669.	Brian (brianbanri)	29	90.98	107.98	11	37.93
10670.	caden (breezynotcheezy)	29	65.98	92.27	11	37.93
10671.	Brayden (braddin123)	29	94.97	114.42	11	37.93
10672.	Bridget (boomsey)	29	99.48	124.37	13	44.83
10673.	Suvhoraj (blazing_cuber)	29	50.49	67.66	3	10.34
10674.	Bertra (bertraml)	29	81.70	93.04	8	27.59
10675.	berkay (berkayyalin)	29	92.91	107.45	13	44.83
10676.	Bennie (beneficial_bean)	29	71.56	89.70	9	31.03
10677.	Dustin (belyea)	29	101.63	127.62	12	41.38
10678.	Kaymart (barrix)	29	71.15	97.00	10	34.48
10679.	Khesar (babywicker)	29	52.22	67.79	1	3.45
10680.	Will (awesomeguy1427)	29	63.71	76.10	5	17.24
10681.	Andy (avocadocream)	29	81.23	101.99	6	20.69
10682.	Andrew (astrel)	29	107.15	123.81	10	34.48
10683.	Aman (ashriv88)	29	80.26	104.84	8	27.59
10684.	Apathy (apathyy)	29	87.88	103.90	8	27.59
10685.	Anshit (anshitgrg)	29	51.73	68.42	3	10.34
10686.	Bob (allanbarry)	29	71.56	81.63	12	41.38
10687.	Cyber (alifarra)	29	72.61	91.83	11	37.93
10688.	aldrigon (aldrigon)	29	93.68	120.66	18	62.07
10689.	Andi (agraumann)	29	68.58	89.33	8	27.59
10690.	AggieMet (aggiemet)	29	61.26	83.31	9	31.03
10691.	7amada (7amada)	29	80.80	91.86	6	20.69
10692.	duy (69discombobulates)	29	61.93	72.52	12	41.38
10693.	Edward (1934__)	29	89.36	116.03	12	41.38
10694.	k (edhne)	29	60.40	74.07	7	24.14
10695.	Lisbeth (l1sbeth_dam)	29	44.86	60.20	2	6.90
10696.	Ambuj (ambujsingh)	29	56.29	68.48	6	20.69
10697.	Littenator (littenator)	29	58.98	71.94	5	17.24
10698.	Brur (brur)	29	62.94	77.10	8	27.59
10699.	Jakub (jintax)	29	54.95	66.97	6	20.69
10700.	ashley (ashleyyyuwu)	29	35.72	45.84	3	10.34
10701.	Aries (notanaries)	29	93.22	108.28	13	44.83
10702.	Mani (manissekhon)	29	58.05	73.85	18	62.07
10703.	Caltos (caltos_virnam)	29	87.89	105.42	9	31.03
10704.	kalki (draken_14)	29	52.60	60.68	7	24.14
10705.	Ross Geller (ross191139)	29	58.15	66.55	5	17.24
10706.	Levi (levi4th)	29	64.70	82.00	3	10.34
10707.	Brock (fastmurphtype)	29	73.40	80.83	17	58.62
10708.	Lucas (lucasthetypingmaster)	29	89.09	103.21	8	27.59
10709.	R Worth (_crbn)	29	50.67	59.75	1	3.45
10710.	VinnyZ (vinnyzed)	29	79.07	99.84	13	44.83
10711.	Vincent (just_carbon)	29	72.43	83.82	5	17.24
10712.	Jobenveer (jobenveer)	29	30.44	39.83	4	13.79
10713.	Blizzard (_bl1zzard)	29	64.21	79.22	12	41.38
10714.	Stacks (_stacksqueue2)	28	62.39	77.73	6	21.43
10715.	Max (_maxkoo_)	28	61.43	67.11	4	14.29
10716.	Lucky (_lucky__verma__)	28	21.62	30.50	5	17.86
10717.	Jalex (_jalex)	28	49.17	59.33	1	3.57
10718.	Asim (_asim_)	28	83.56	94.47	10	35.71
10719.	nattapakon (zudiyeah)	28	25.82	33.03	1	3.57
10720.	Justin (zexcel)	28	118.30	128.91	13	46.43
10721.	Youri (yourischuur)	28	100.73	125.78	9	32.14
10722.	yihuididi (yihuididi)	28	54.38	65.53	3	10.71
10723.	Yexsys (yexsys)	28	76.23	105.00	6	21.43
10724.	e2blu (yellowe2)	28	108.93	126.84	11	39.29
10725.	((: (yeeyeehehe)	28	117.94	135.53	13	46.43
10726.	(xyztcube)	28	94.60	104.91	9	32.14
10727.	xhqrry has two fingers (xhq...	28	68.18	78.08	8	28.57
10728.	Edward (xarvus)	28	93.86	111.93	9	32.14
10729.	John (wolman511)	28	110.58	133.39	12	42.86
10730.	THE JEWELL (wildhorsesthe2nd)	28	103.05	137.92	15	53.57
10731.	Wiktor (wicker6)	28	78.62	98.43	6	21.43
10732.	will (whitedarko)	28	94.46	114.44	12	42.86
10733.	Keyser (whereskeyser)	28	92.87	116.61	11	39.29
10734.	George (wavy_shakespeare)	28	72.04	88.76	12	42.86
10735.	tdsar (volterxien)	28	110.00	126.69	14	50.00
10736.	Andrew (viper42usa)	28	92.18	101.89	6	21.43
10737.	Vinesh (vineshdodiya)	28	50.89	58.39	3	10.71
10738.	Vinay (vinaynani92)	28	82.53	98.85	11	39.29
10739.	Josh (vaximus)	28	85.77	100.73	7	25.00
10740.	vamsi (vamsivadrevu)	28	88.02	109.34	8	28.57
10741.	vakilral (vakilral)	28	85.46	99.12	7	25.00
10742.	Joshua (typing_huh1)	28	99.79	120.59	14	50.00
10743.	Ryo (troublecuber)	28	80.66	93.66	3	10.71
10744.	Andrew (trazer)	28	103.66	112.63	8	28.57
10745.	Gary (traeyoung)	28	143.78	171.50	20	71.43
10746.	Tokugawa (tokugawapants)	28	131.61	152.08	17	60.71
10747.	Evan (toastypoints)	28	97.57	119.97	15	53.57
10748.	Harry (tls278)	28	60.18	68.78	8	28.57
10749.	Daniel (theyluvdaniell)	28	73.68	89.94	5	17.86
10750.	ry (therylyndshow)	28	80.40	97.18	8	28.57
10751.	Totus (thepenguin183)	28	91.30	117.94	11	39.29
10752.	༼ つ ◕_◕ ༽つ (the...	28	78.38	95.76	8	28.57
10753.	Themi (themis3000)	28	59.76	68.45	5	17.86
10754.	Duncan (thedunco)	28	90.11	104.30	9	32.14
10755.	Ethan (thatonepear)	28	106.02	117.46	10	35.71
10756.	telorbuzzu (telorbusu)	28	113.40	133.37	15	53.57
10757.	Justin (tacder)	28	41.09	53.07	2	7.14
10758.	Abdulhadi (surebeta)	28	58.85	68.04	3	10.71
10759.	Sunbites (sunbites_4610)	28	81.38	102.48	15	53.57
10760.	Benjamin (strangelyroblo)	28	74.27	91.81	7	25.00
10761.	Spy (spy12150)	28	103.82	118.52	13	46.43
10762.	Chris P. Bacon (spicy_toast)	28	88.28	104.95	11	39.29
10763.	Be At Peace (spacepajamas)	28	89.03	100.56	11	39.29
10764.	Smoke (smoke91)	28	86.52	102.11	6	21.43
10765.	Sludge (sludgeneedbeer)	28	48.47	58.31	4	14.29
10766.	sleepy (sleepy_tf)	28	92.72	117.76	10	35.71
10767.	skeleton (skeleton0)	28	101.29	117.20	13	46.43
10768.	tstats[sinkingecstasies] (s...	28	105.27	128.78	10	35.71
10769.	ShowMeDaWay (showmak)	28	53.51	68.49	12	42.86
10770.	Shimbo (shimbobaby)	28	63.45	80.47	19	67.86
10771.	sherif (sherifu3)	28	35.89	43.11	1	3.57
10772.	Shadowfader (shadowfader)	28	39.09	45.19	3	10.71
10773.	Joshua (sh1nobie)	28	117.80	150.35	8	28.57
10774.	Nady (serufidesu)	28	64.49	79.91	6	21.43
10775.	Guillermo (schobzax)	28	123.46	154.23	21	75.00
10776.	Sawill (sawill)	28	78.73	94.61	6	21.43
10777.	Steve (sanptyper)	28	107.28	118.97	11	39.29
10778.	Sanjar0126 (sanjar0126)	28	62.45	73.64	10	35.71
10779.	spam (sammywammyllamma)	28	94.75	109.11	12	42.86
10780.	Sagi (sagi_hv)	28	38.05	45.18	1	3.57
10781.	Ryuu (sacreddany)	28	83.24	96.00	7	25.00
10782.	RZ5D (rz5d)	28	90.21	113.32	16	57.14
10783.	Gabriel (ryulzaki)	28	62.46	85.54	6	21.43
10784.	Rishay (rishayg)	28	58.09	68.07	6	21.43
10785.	Monica (ricefun)	28	92.78	106.46	8	28.57
10786.	Reyna (reyeg4)	28	79.06	97.05	13	46.43
10787.	doraemon (reazulislam)	28	60.66	71.48	5	17.86
10788.	SDF (rc12chy)	28	37.27	47.21	4	14.29
10789.	Ravshan (ravshan)	28	54.45	66.09	3	10.71
10790.	RashidTalib123 (rashid_tali...	28	89.49	105.99	13	46.43
10791.	rain (qwimnetypes)	28	79.48	100.29	10	35.71
10792.	moni (pzza404)	28	68.05	97.90	7	25.00
10793.	JO (pinkvelociraptor)	28	58.89	72.90	9	32.14
10794.	Mona (picolee)	28	49.59	62.35	6	21.43
10795.	Alan (papizene)	28	71.45	85.65	5	17.86
10796.	﹤୨♡୧﹥ (pa1ntwater)	28	56.32	68.26	2	7.14
10797.	orthohalmak (orthohalmak)	28	72.42	81.88	8	28.57
10798.	nyoomian (nyoomian)	28	100.24	109.45	10	35.71
10799.	Nitta (nitta814)	28	85.49	96.19	7	25.00
10800.	nikki (nikki0420)	28	63.36	72.05	8	28.57
10801.	Niceable (niceable)	28	89.33	108.69	9	32.14
10802.	Dr. NedStark (nedstark2_0)	28	34.75	41.48	3	10.71
10803.	The (navya2008)	28	44.23	62.77	6	21.43
10804.	Nathan (nathanbotas)	28	121.77	155.23	15	53.57
10805.	Nalchee (nalchee1)	28	111.41	131.99	7	25.00
10806.	Prathamesh (mystic_1)	28	71.08	82.88	9	32.14
10807.	Mister (mystery_qwerty)	28	80.99	91.56	12	42.86
10808.	Michael (mrk0508)	28	88.58	98.49	9	32.14
10809.	Cal (mrbegon)	28	69.14	81.09	6	21.43
10810.	Martin (mpenkov)	28	74.06	97.89	3	10.71
10811.	John (mernst)	28	77.80	89.80	5	17.86
10812.	Mehrshad (mehr74)	28	80.37	117.25	4	14.29
10813.	Meeb (meeb24)	28	103.20	134.60	12	42.86
10814.	Mark (maverick2455)	28	61.85	71.67	3	10.71
10815.	Matt (mattserblo)	28	82.59	99.42	15	53.57
10816.	Mark (markgeorge)	28	64.59	73.57	4	14.29
10817.	meemw (markenmaw)	28	72.46	87.37	5	17.86
10818.	Adrian (mangojuice_)	28	82.93	95.93	9	32.14
10819.	Malondee (malondee)	28	93.39	107.95	8	28.57
10820.	Malchez Link (malchez)	28	62.96	77.95	5	17.86
10821.	sunny (maff_)	28	95.82	111.26	16	57.14
10822.	lpd11 (lpd11)	28	85.39	93.21	9	32.14
10823.	Roy (lordkite)	28	92.27	117.65	12	42.86
10824.	(loom981)	28	121.60	145.51	13	46.43
10825.	‹/hex› (linguistic)	28	106.64	123.08	14	50.00
10826.	IONIS (liaro0903)	28	98.01	109.08	5	17.86
10827.	Law (law_sm)	28	74.26	93.68	9	32.14
10828.	kzara (kzara6)	28	67.37	84.81	10	35.71
10829.	David (klydden)	28	103.67	115.12	10	35.71
10830.	B (kinfthaderp)	28	118.59	136.09	12	42.86
10831.	Kimi (kimichanga)	28	50.52	59.86	6	21.43
10832.	nick (kicknenton)	28	86.56	97.76	11	39.29
10833.	Kheersagar (kheersagar)	28	36.92	44.69	4	14.29
10834.	Kevin (kevinfjbecker)	28	41.11	48.17	4	14.29
10835.	Kayyy (kayyy99)	28	38.30	49.42	0	0.00
10836.	karsten (karstensen)	28	67.42	83.26	5	17.86
10837.	sparda (kamoess0)	28	86.50	101.62	8	28.57
10838.	kaede (kaede1)	28	75.62	94.24	3	10.71
10839.	Mac (justmac)	28	72.79	87.18	1	3.57
10840.	oli (johnvenz16)	28	89.91	101.87	12	42.86
10841.	Josh (jnavin54)	28	52.55	63.45	3	10.71
10842.	Jmam (jmam)	28	103.40	125.90	10	35.71
10843.	A (jllkii123)	28	67.65	77.16	9	32.14
10844.	James (jayuplink)	28	85.07	98.82	8	28.57
10845.	Jem (jampr)	28	93.53	109.67	9	32.14
10846.	jake (jakez)	28	53.20	64.79	6	21.43
10847.	Jack (jack8888)	28	130.20	178.00	1	3.57
10848.	Nuggs (itsmenuggetz)	28	72.68	94.97	10	35.71
10849.	Itay (itay4430)	28	102.05	127.04	14	50.00
10850.	isaiah (isaiahturnip)	28	109.15	135.05	14	50.00
10851.	Peter (ironman2711)	28	55.60	74.55	6	21.43
10852.	Impulsetyper (impulsetyper)	28	78.40	90.00	7	25.00
10853.	EpikPanda (imanepikpanda)	28	57.26	67.36	7	25.00
10854.	Sam (idcaboutnames)	28	77.36	88.55	10	35.71
10855.	Ian (ian1806)	28	132.87	150.74	15	53.57
10856.	Ethan Jeff (hypernacho)	28	89.01	115.96	9	32.14
10857.	Rathalos (honored1234)	28	64.83	77.41	5	17.86
10858.	Hoang (hoangama)	28	58.01	67.55	3	10.71
10859.	Hmjo707 (hmjo)	28	92.59	122.09	13	46.43
10860.	Aldar Kose (hkoldas)	28	67.48	80.81	10	35.71
10861.	Sub to spenzalo (hi_shoemaker)	28	121.59	145.52	15	53.57
10862.	Hideto (hikimarun)	28	73.67	90.96	8	28.57
10863.	Andrew (happie)	28	72.99	87.96	3	10.71
10864.	G (gtyper123)	28	47.56	60.45	5	17.86
10865.	Vaibhav (genius6)	28	62.63	84.02	11	39.29
10866.	Robert (furyon700)	28	74.75	98.64	5	17.86
10867.	Nando (frozgamingz)	28	98.15	121.77	12	42.86
10868.	Freowy (freowy)	28	89.25	106.94	6	21.43
10869.	Francisco (francisc0)	28	56.08	74.36	2	7.14
10870.	Fopuy (fopuy)	28	107.80	124.49	14	50.00
10871.	v (fnut)	28	79.83	97.62	21	75.00
10872.	John (flyingraven)	28	97.31	116.68	11	39.29
10873.	flopvx (flopvx)	28	98.47	123.70	8	28.57
10874.	firxe (firxe139)	28	85.84	100.80	8	28.57
10875.	Fidelity (fidelityssj)	28	107.76	119.34	11	39.29
10876.	Jacob (fastjacob)	28	114.36	133.91	15	53.57
10877.	tommy (err0reverafter)	28	103.97	122.15	16	57.14
10878.	(erokopes)	28	128.36	144.59	16	57.14
10879.	Eric (ericniyigaba)	28	56.98	73.22	3	10.71
10880.	Emily (emstand)	28	95.61	105.47	12	42.86
10881.	Eli (elikgeneral)	28	82.00	94.11	5	17.86
10882.	Gawiweu (edugg98)	28	62.86	78.32	8	28.57
10883.	David (dvdtan20)	28	78.47	89.37	3	10.71
10884.	David (du6e)	28	51.41	62.73	1	3.57
10885.	Drowg (drowg)	28	51.49	62.32	5	17.86
10886.	Donovan (donnyredzone)	28	59.85	71.22	4	14.29
10887.	Dioscene (dioscene)	28	115.59	135.34	15	53.57
10888.	Delvin (delvinsabrin)	28	78.30	88.74	6	21.43
10889.	Delve (delve17)	28	101.91	117.42	19	67.86
10890.	Lennox (datshall)	28	81.59	99.21	3	10.71
10891.	Martin (datlos)	28	48.22	58.75	0	0.00
10892.	Luc (darth_luc)	28	45.16	60.29	2	7.14
10893.	Darlena (darlena)	28	97.67	124.57	9	32.14
10894.	Gustavo Fring (cxmpy)	28	101.01	119.25	11	39.29
10895.	Jon (customabilities)	28	105.92	127.12	14	50.00
10896.	. (crazyhow7)	28	52.57	69.43	1	3.57
10897.	alkalime (cptsprinklez)	28	79.79	95.31	12	42.86
10898.	Courtney (clc0778clc)	28	101.63	126.57	11	39.29
10899.	chuck1ehead (chuck1ehead)	28	55.27	73.89	4	14.29
10900.	Chris (chrissquid)	28	83.66	104.28	9	32.14
10901.	Walter (chimken1234)	28	84.45	106.70	10	35.71
10902.	Kritik (chaoseyy)	28	63.77	78.56	5	17.86
10903.	canadavid1 (canadavid1)	28	38.43	49.95	2	7.14
10904.	vjalt (bullymaguire)	28	71.20	84.40	6	21.43
10905.	Bala Klava (brullsker)	28	71.81	80.60	7	25.00
10906.	Bitgalle (bitgalle)	28	85.67	95.41	11	39.29
10907.	Antatia (bi0hazrd_522)	28	77.21	94.53	6	21.43
10908.	Anjan (beaszt_nix)	28	93.84	111.28	9	32.14
10909.	Vinícius (batovs)	28	57.11	71.95	6	21.43
10910.	Basone01 (basone01)	28	74.68	89.74	11	39.29
10911.	Muhammed (a_mhmmd)	28	74.62	86.10	7	25.00
10912.	albatross (awehiuaf)	28	97.87	120.13	15	53.57
10913.	Atsubyo (atsubyo)	28	79.91	104.59	4	14.29
10914.	Kartik (artist007)	28	50.87	65.19	4	14.29
10915.	arthur (arthurc999)	28	55.40	69.27	4	14.29
10916.	ariel (arielsoko)	28	102.43	124.20	15	53.57
10917.	Archery (archeryiskey)	28	107.58	124.80	9	32.14
10918.	🚀 (aqua_desu)	28	133.79	158.94	18	64.29
10919.	Anton (antonchen)	28	123.04	151.91	27	96.43
10920.	Andy (andy_andy)	28	57.94	67.91	4	14.29
10921.	Anceint (anceint)	28	83.04	101.10	10	35.71
10922.	Ali (alishyper12)	28	86.35	105.83	15	53.57
10923.	Akshay (aksseet)	28	120.43	147.47	19	67.86
10924.	Adam (adxam)	28	70.49	81.07	5	17.86
10925.	adarsh_rzh (adarsh_rzh)	28	59.15	75.44	8	28.57
10926.	Raz (adashi)	28	83.94	107.08	12	42.86
10927.	Abhinav (abhinav42)	28	53.26	61.88	3	10.71
10928.	Adrian (aadoy_)	28	51.28	67.82	2	7.14
10929.	index finger spacebar user ...	28	118.89	138.17	10	35.71
10930.	teeto (1005sv)	28	93.37	116.87	8	28.57
10931.	T (0_________0)	28	67.56	79.57	6	21.43
10932.	Logan (g0atb0lt)	28	74.53	107.50	8	28.57
10933.	Pat2475 (pat2475)	28	44.13	60.70	3	10.71
10934.	Quinn (wind_chaser)	28	36.28	45.06	3	10.71
10935.	Hexa (hexaa)	28	69.26	83.99	4	14.29
10936.	Quynh (spinelsun)	28	73.94	87.02	10	35.71
10937.	Angelos (mangas)	28	68.91	81.44	6	21.43
10938.	Ken (twofourty)	28	77.37	89.64	11	39.29
10939.	sarat (saratrajput)	28	74.59	86.51	5	17.86
10940.	darkDEMISE (dark_demise)	28	72.43	84.91	5	17.86
10941.	Mae (mimstermae)	28	111.71	133.40	17	60.71
10942.	Philip (bigasianmidget)	28	75.86	90.18	11	39.29
10943.	Zander (aok9999)	28	54.65	70.71	4	14.29
10944.	Slow Typist (oatsy)	28	80.68	92.43	5	17.86
10945.	David Baril (dbaril2002)	28	61.29	73.61	6	21.43
10946.	Liddle (0_night)	28	68.96	80.58	5	17.86
10947.	Martin (martinlq)	28	62.91	72.15	4	14.29
10948.	kuroo (kurodra5634)	28	42.25	51.06	2	7.14
10949.	Fromix (fromix)	28	108.50	132.31	16	57.14
10950.	Soham (infitro)	28	32.12	39.82	3	10.71
10951.	Karrot (karrotdraws)	28	87.45	100.94	6	21.43
10952.	Rori (rori_)	28	77.72	91.96	6	21.43
10953.	|||||||||||||||||| (breadfr...	28	65.87	83.24	2	7.14
10954.	aubs (kokokokie)	28	56.90	69.30	3	10.71
10955.	Georgi (zoreau)	28	62.57	82.79	5	17.86
10956.	Tzurok (tzurok)	28	66.89	77.68	6	21.43
10957.	YourWorst (ajplayzthat)	28	68.99	95.36	10	35.71
10958.	Rensevt (rensevt)	28	57.12	64.45	4	14.29
10959.	Mohamed (_mohammed_taha_)	27	64.18	72.47	2	7.41
10960.	z3x7 (zegadb)	27	69.45	84.44	7	25.93
10961.	zeeko (zeekomeeko)	27	61.27	71.82	8	29.63
10962.	Zachry (zachwn)	27	81.79	98.67	6	22.22
10963.	My (z0rtzp1zku)	27	74.94	87.09	9	33.33
10964.	Lance Toby (ybot28)	27	67.35	83.38	9	33.33
10965.	Jayden (y4nrui)	27	106.17	125.97	14	51.85
10966.	wooson (wooson)	27	69.94	81.80	6	22.22
10967.	gamem (wkdgurtna)	27	69.43	92.44	8	29.63
10968.	Wesley (wesleymelon)	27	116.75	145.46	13	48.15
10969.	Warren (war_30)	27	59.64	76.94	5	18.52
10970.	Victor (vlnash2002)	27	93.58	108.41	12	44.44
10971.	Viwarrior (viwarrior)	27	80.40	95.48	7	25.93
10972.	Aleksandar (virage94)	27	55.61	67.37	4	14.81
10973.	bruhmoment (victorio_)	27	102.73	129.15	7	25.93
10974.	Vicodin (vicodin_freeman)	27	91.02	116.81	8	29.63
10975.	laptop keyboard era (vfctyr...	27	139.91	159.73	24	88.89
10976.	Vedanta Sharan (vedbro)	27	40.34	58.81	3	11.11
10977.	Uwu (uwudesuka)	27	79.16	91.70	12	44.44
10978.	Usmon (usmonjonh)	27	50.64	70.38	14	51.85
10979.	Vincent (tyt14)	27	58.04	77.77	3	11.11
10980.	Tyson (tysonking33)	27	46.20	59.86	0	0.00
10981.	Mack (tron__)	27	99.20	111.48	10	37.04
10982.	Felix (tresflex)	27	86.70	107.76	9	33.33
10983.	Jonowo (trainerjono)	27	109.15	126.95	15	55.56
10984.	Elton John (tonundrum)	27	56.74	72.00	7	25.93
10985.	t (tomn114)	27	132.18	154.88	16	59.26
10986.	ᕙ(˵ ಠ ਊ ಠ ˵)ᕗ (...	27	79.57	99.41	9	33.33
10987.	kevin (titiloka)	27	40.80	47.19	2	7.41
10988.	Timothy (timothy5597)	27	64.63	79.24	4	14.81
10989.	Harsh (the_slow_one_123)	27	48.38	62.29	3	11.11
10990.	Thelonious (thelonious)	27	76.72	93.34	7	25.93
10991.	Alfie (theaqualord)	27	106.87	134.87	19	70.37
10992.	Thane (thaynt)	27	94.51	114.31	12	44.44
10993.	Teodor (teo_climber)	27	65.14	77.28	5	18.52
10994.	Temu (temex)	27	85.63	92.55	12	44.44
10995.	StellarDoc11 (tarth15)	27	80.50	96.70	17	62.96
10996.	Sunyog (sunyog)	27	43.08	65.20	5	18.52
10997.	Sunny (sunnylee0123)	27	123.07	146.10	20	74.07
10998.	omar (streetfighterlan123)	27	149.16	192.98	15	55.56
10999.	spycow27 (spycow27)	27	95.40	105.96	26	96.30
11000.	Aurora (sparrowfan101)	27	96.84	114.22	9	33.33
11001.	sevgik (soranges)	27	88.48	123.64	7	25.93
11002.	Snowy (snowysauce)	27	109.57	130.15	12	44.44
11003.	Todor (todoriko)	27	31.29	38.52	1	3.70
11004.	Bobby (slowtyper557)	27	112.83	128.22	13	48.15
11005.	skywalker123 (skywalker123)	27	80.26	99.38	2	7.41
11006.	Nenad (sima_car)	27	60.05	73.97	3	11.11
11007.	6969 (silky_)	27	107.48	118.55	13	48.15
11008.	Silent (silent_solous)	27	108.13	129.46	20	74.07
11009.	barack (shming)	27	118.31	135.06	20	74.07
11010.	shahrukh (shahrukh77)	27	61.74	74.00	8	29.63
11011.	Duc (setokouse)	27	75.17	91.05	11	40.74
11012.	Sanjay (sanjaysins)	27	58.17	71.85	5	18.52
11013.	Saif (saif_kitaz)	27	57.10	64.80	4	14.81
11014.	Dr. (saddathasan)	27	67.20	79.49	6	22.22
11015.	Saber (saber2756)	27	98.74	128.74	12	44.44
11016.	Soumyajeet (s0umyajeet)	27	82.55	89.03	13	48.15
11017.	Violet (rxviolet)	27	81.98	100.89	8	29.63
11018.	Ruben (rubsi)	27	79.07	96.43	11	40.74
11019.	Roger (rogerboston)	27	59.43	77.53	4	14.81
11020.	robot (robotbb)	27	49.76	64.32	4	14.81
11021.	Rictor (rictormidgekin)	27	94.12	114.17	8	29.63
11022.	Amit (red2black)	27	65.84	78.92	8	29.63
11023.	Ben (realolympian)	27	64.10	78.05	6	22.22
11024.	Alikhan (realikh)	27	84.49	97.77	9	33.33
11025.	randomyr (randomyr)	27	93.81	107.09	11	40.74
11026.	raeraven (raeraven)	27	39.02	47.24	4	14.81
11027.	Caleb (qwerty345)	27	55.16	63.69	11	40.74
11028.	A (qkrdnwls6)	27	76.74	96.10	26	96.30
11029.	Psalmer (psalmer)	27	73.71	91.94	10	37.04
11030.	prans (prans12)	27	60.26	75.26	3	11.11
11031.	Adam (pop123gyg)	27	29.82	35.90	2	7.41
11032.	Himanshu (pluto_ish)	27	72.89	93.45	20	74.07
11033.	pz (pingzhi)	27	77.75	87.56	4	14.81
11034.	George (piehead567)	27	96.26	109.78	14	51.85
11035.	Phenos (phenos)	27	102.48	126.47	10	37.04
11036.	Pena (pena_perse)	27	57.29	65.58	3	11.11
11037.	Chanel (pandabean)	27	88.18	109.16	6	22.22
11038.	paldoo (paldoo)	27	72.78	92.21	6	22.22
11039.	Nizar (oxlord)	27	77.58	93.17	8	29.63
11040.	Dale (owenone)	27	113.31	127.97	20	74.07
11041.	Ali (oplo)	27	99.42	122.04	9	33.33
11042.	ollybollydisco (ollybollydi...	27	70.11	95.54	5	18.52
11043.	NuclearBacon (nuclearbaconyt)	27	61.11	88.84	7	25.93
11044.	OysterRice (notterrancehuang)	27	119.71	137.82	16	59.26
11045.	BeGood (notideal)	27	85.19	106.40	6	22.22
11046.	N0VA (nooova)	27	65.52	81.62	7	25.93
11047.	Noobiest (noobiestmaster)	27	71.14	93.38	7	25.93
11048.	Nate (nhanzel)	27	86.47	105.54	7	25.93
11049.	Muhammad (muhammad_pak)	27	86.96	106.06	9	33.33
11050.	Mr (mrrius99)	27	66.26	76.42	12	44.44
11051.	Emre (mr3mr3)	27	109.70	126.43	17	62.96
11052.	Rylan (moonraker505)	27	87.24	110.10	17	62.96
11053.	ng (minhtuhay123)	27	75.09	90.87	6	22.22
11054.	milop (milop)	27	71.90	85.46	9	33.33
11055.	Velocitys (mikesyeet)	27	83.01	102.79	8	29.63
11056.	Mike (mikereze)	27	54.26	68.54	1	3.70
11057.	Darren (meodaze)	27	106.07	122.82	16	59.26
11058.	Michael Loh (mclec950125)	27	75.23	84.45	7	25.93
11059.	MAYANK (mayank10)	27	46.87	54.25	2	7.41
11060.	M (maxopie)	27	85.41	97.79	6	22.22
11061.	Max (maxarfvidsson)	27	73.44	91.78	7	25.93
11062.	Max (max2004awesome)	27	102.66	119.10	9	33.33
11063.	Hugh (mathimati)	27	99.29	126.17	17	62.96
11064.	Mary (marymyers)	27	94.97	113.28	12	44.44
11065.	Julia (malh)	27	34.34	41.61	2	7.41
11066.	Bryan (lufrewaffle)	27	60.61	70.68	5	18.52
11067.	Sauce (lolplox123)	27	107.22	148.79	9	33.33
11068.	boo (lolitsme)	27	75.52	88.70	6	22.22
11069.	Everest (likethemountain)	27	77.16	95.76	7	25.93
11070.	David (leepictrollexd)	27	108.70	126.26	16	59.26
11071.	Naresh (learnrapid)	27	47.38	57.06	5	18.52
11072.	Laznia (lasthomeless)	27	56.06	65.26	1	3.70
11073.	tak power (langsungg)	27	85.15	96.64	7	25.93
11074.	Thpp (kulaspa)	27	97.62	114.51	13	48.15
11075.	kuchukas (kuchukas)	27	51.25	62.64	2	7.41
11076.	Kostia (kostia)	27	52.10	63.27	4	14.81
11077.	Underscores4Fun (koskos)	27	79.88	96.72	6	22.22
11078.	potato (kongkan_)	27	98.75	113.49	13	48.15
11079.	Kyle (kle33)	27	67.16	78.30	8	29.63
11080.	Alvin (kishoarima)	27	62.32	71.27	4	14.81
11081.	Shahobiddin (khusniddinov_uz1)	27	55.07	65.38	6	22.22
11082.	keytiX (keyti)	27	41.62	49.69	2	7.41
11083.	Kenneth (kensan73)	27	103.48	118.68	18	66.67
11084.	Membrane69 (keifermatthew)	27	89.05	109.14	9	33.33
11085.	Kaeso (kaeso_krupp)	27	92.70	107.69	12	44.44
11086.	kaare (kaare)	27	78.35	105.45	8	29.63
11087.	k3n (k3nnn)	27	138.95	152.38	20	74.07
11088.	Julian72696 (julian72696)	27	93.64	119.37	7	25.93
11089.	John (john_sharks)	27	78.65	85.76	5	18.52
11090.	John (jimminyyy)	27	81.73	108.41	9	33.33
11091.	Jonathan (jimbothegreat)	27	76.80	99.57	10	37.04
11092.	JesseCarl (jessecarl)	27	72.17	85.85	6	22.22
11093.	Jaz (jazwolff)	27	61.25	73.60	3	11.11
11094.	Jose Antonio (jarceantonio)	27	76.80	94.80	7	25.93
11095.	Jake (jakexx)	27	86.12	113.90	9	33.33
11096.	Vytenis (jackeddj)	27	69.90	86.67	8	29.63
11097.	Jjajangmyeon (izzu)	27	72.90	88.04	7	25.93
11098.	irving (irvingnivri)	27	78.68	91.03	5	18.52
11099.	찬우 (inphinity)	27	122.11	163.87	14	51.85
11100.	Ben (hurstsys)	27	52.55	62.41	1	3.70
11101.	Radu (horixyt21)	27	93.87	108.65	8	29.63
11102.	Scott (holyomgida)	27	101.76	118.87	10	37.04
11103.	Louis (hlouis)	27	111.34	131.18	16	59.26
11104.	Rotem (hi_im_rotem_2006)	27	68.45	83.53	7	25.93
11105.	mashed_potato (hello_world199)	27	67.43	80.09	7	25.93
11106.	Lasse Hededal (hededal)	27	70.46	86.33	7	25.93
11107.	Luke (harrislp1979)	27	59.64	73.20	8	29.63
11108.	ﱞﱞﱞﱞﱞﱞﱞﱞﱞ...	27	84.43	98.55	14	51.85
11109.	Gabe (gsoares026)	27	111.25	143.58	22	81.48
11110.	sangvar (greeker)	27	71.64	87.19	13	48.15
11111.	Ainsley (giannis199)	27	69.36	83.48	6	22.22
11112.	Tan (ghtann)	27	78.30	90.45	5	18.52
11113.	Adam (george_williams14798)	27	109.14	131.04	14	51.85
11114.	M.Verstappen (gameroubas)	27	102.55	119.64	12	44.44
11115.	Gabby (gabbychan)	27	66.85	83.75	8	29.63
11116.	folgue02 (folgue)	27	84.17	99.42	9	33.33
11117.	FireGumz (firegumz)	27	56.51	74.00	4	14.81
11118.	fei (feiamor)	27	63.46	84.58	6	22.22
11119.	Fave (fave_22)	27	52.81	59.18	2	7.41
11120.	Henry (fastypr)	27	88.00	106.38	15	55.56
11121.	distopia (far_sunflower)	27	53.15	64.05	1	3.70
11122.	Fabricio (fabrox)	27	68.33	87.52	7	25.93
11123.	Vincent (ezbread)	27	69.79	85.89	11	40.74
11124.	Evan (estarr14)	27	52.35	63.45	2	7.41
11125.	Ellen (eeecp)	27	76.18	88.15	6	22.22
11126.	Edilbek (edok_mal4)	27	48.77	65.67	3	11.11
11127.	bum_fluff (dritt)	27	124.47	137.60	18	66.67
11128.	Dylan (drink_windex)	27	69.78	82.91	4	14.81
11129.	Djaenk (djaenk)	27	107.27	147.99	16	59.26
11130.	Vit (denysvit)	27	84.10	94.97	12	44.44
11131.	Dennis (dendendenlee)	27	61.36	73.31	6	22.22
11132.	Dein (deinfreund)	27	116.63	136.95	27	100.00
11133.	wet nightmare (daviddloco)	27	92.74	105.41	13	48.15
11134.	Dev (darkpi)	27	71.32	85.34	3	11.11
11135.	Darin (darin_ss)	27	46.12	65.96	1	3.70
11136.	Daedalus (daedalusmahda)	27	87.39	98.46	14	51.85
11137.	æ (c_c_c)	27	91.10	126.62	10	37.04
11138.	cung (cungdongma)	27	76.54	91.42	10	37.04
11139.	Craig (craiggsell)	27	68.81	77.40	5	18.52
11140.	Chirath (cp_guy)	27	64.17	78.68	6	22.22
11141.	Casey (covertmidget)	27	66.90	81.79	15	55.56
11142.	BUS (bus12)	27	94.09	108.94	8	29.63
11143.	Sahabuddin (blitzbibi)	27	51.72	59.97	4	14.81
11144.	Ben (blister99)	27	110.76	126.13	19	70.37
11145.	Bionodroid (bionodroid)	27	69.21	82.00	3	11.11
11146.	BigBreadBaker (bigbreadbaker)	27	130.01	158.06	19	70.37
11147.	bianca (bi4nc4hannah)	27	53.08	64.87	10	37.04
11148.	Ethan (bewilderex63)	27	107.72	136.22	12	44.44
11149.	bayu (bayun2445)	27	45.38	55.99	2	7.41
11150.	bacy (bacy)	27	54.05	66.97	2	7.41
11151.	Ahmed (a_h5s_h)	27	52.62	63.78	0	0.00
11152.	arman (arman_types)	27	112.81	145.96	13	48.15
11153.	arham (arham_doshi)	27	51.86	59.27	2	7.41
11154.	AranKz (arankz)	27	81.82	97.26	7	25.93
11155.	d1ff1cult (apysch)	27	117.08	128.54	15	55.56
11156.	Ahmad (apathicss)	27	74.55	90.43	17	62.96
11157.	Tran Thai Anh (anh_tran123)	27	65.66	73.83	5	18.52
11158.	ana (anachokheli)	27	46.19	57.77	1	3.70
11159.	Aman (amansharma10)	27	62.45	74.86	5	18.52
11160.	Kelven (agentbowtie)	27	60.76	73.89	7	25.93
11161.	Aecor (aecor)	27	103.06	114.74	7	25.93
11162.	Adam1t (adam1t)	27	60.93	77.96	5	18.52
11163.	Abonkwe (abonkwe)	27	79.94	96.83	9	33.33
11164.	tstats[abhishekyeskholiya] ...	27	79.30	95.45	8	29.63
11165.	Marco (abababaaaa)	27	69.96	86.13	6	22.22
11166.	pwned (16wpm)	27	84.91	95.55	4	14.81
11167.	Sinuro (0sty)	27	76.13	102.22	13	48.15
11168.	Hifjul (hifjul)	27	57.03	70.07	2	7.41
11169.	James (adamorjames)	27	61.51	74.72	7	25.93
11170.	Daniel (dxnielchoo)	27	64.69	88.80	10	37.04
11171.	Brandan (brandanprice)	27	56.05	70.98	4	14.81
11172.	matthew (hewasnumber1)	27	65.63	83.89	6	22.22
11173.	Ognian (ogihaxer)	27	56.54	69.27	20	74.07
11174.	Stalast (stalast)	27	89.46	111.87	1	3.70
11175.	Ivan (potatokingdom)	27	85.78	101.01	6	22.22
11176.	scoutie (scoutieee)	27	77.05	92.46	6	22.22
11177.	Jon (rockitman)	27	102.66	141.32	12	44.44
11178.	Kevin (iuhnivek)	27	82.90	95.84	4	14.81
11179.	Samin (_nimas)	27	53.58	66.14	2	7.41
11180.	harsha (master_ogasaku)	27	36.31	46.15	3	11.11
11181.	Stephanie (zoomer1)	27	32.80	46.09	1	3.70
11182.	Arshak (arshak00)	27	56.28	64.02	5	18.52
11183.	Sebastian (cohnan)	27	74.66	88.39	8	29.63
11184.	ToothDK (dkindred)	27	68.92	98.62	24	88.89
11185.	Wegster (nico88villa)	27	56.69	66.15	9	33.33
11186.	Cayden (klxverzz)	27	45.45	58.60	7	25.93
11187.	Harry (harryswan)	27	66.16	93.02	10	37.04
11188.	La (listentonct)	27	68.52	81.52	9	33.33
11189.	Fahd (faddyboi)	27	85.80	106.50	7	25.93
11190.	ardabil (ardabil)	27	20.13	25.86	6	22.22
11191.	hw4nb (hw4nb)	27	57.65	76.19	5	18.52
11192.	Greatest (_greatestever_)	26	66.41	79.48	9	34.62
11193.	Emrys (zyronwhite123)	26	51.57	63.23	0	0.00
11194.	will (zootzootie)	26	84.98	103.06	8	30.77
11195.	Peter (zoodoo)	26	97.70	119.13	12	46.15
11196.	Zitwitcool (zitwitcool)	26	46.88	57.80	4	15.38
11197.	DY (yuyue1)	26	99.80	120.07	13	50.00
11198.	Charlie (xharlie)	26	83.12	101.41	5	19.23
11199.	wood warrior (wood_warrior)	26	62.95	73.98	5	19.23
11200.	Seth (wongaa)	26	74.35	94.23	9	34.62
11201.	Trying (whatisyourtalent)	26	55.09	72.75	5	19.23
11202.	wgreenihrcorp2 (wgreenihrco...	26	52.54	64.24	8	30.77
11203.	Jacob (werjac)	26	72.70	90.04	5	19.23
11204.	Winson (weezy_winson)	26	81.59	120.74	11	42.31
11205.	Wakil (wakil7)	26	54.77	66.89	6	23.08
11206.	Vishnu Chauhan (vishnuchauhan)	26	74.18	83.78	9	34.62
11207.	vicky (vickysiva007)	26	53.30	61.37	5	19.23
11208.	Victoria (vicksun)	26	59.47	67.92	2	7.69
11209.	Vivi (veevaa)	26	75.77	88.21	8	30.77
11210.	Ved (ved_)	26	32.31	44.43	1	3.85
11211.	Unai (unaiberis)	26	81.51	92.29	12	46.15
11212.	Patrick (ugonnaeatthatcrois...	26	67.33	80.51	6	23.08
11213.	krunal (triplekbro)	26	66.36	84.00	14	53.85
11214.	LM (trashtocash)	26	63.49	76.56	3	11.54
11215.	Mitch (toddlerdust)	26	134.49	149.07	0	0.00
11216.	tinkureddy (tinkureddy)	26	86.13	104.35	13	50.00
11217.	Timothy (timothy273)	26	63.49	75.00	7	26.92
11218.	Heather (tilly_day)	26	57.00	64.98	7	26.92
11219.	Christian (thermikk)	26	87.16	113.86	7	26.92
11220.	(thereayou)	26	84.06	99.22	8	30.77
11221.	Theo (theogv)	26	97.41	116.39	13	50.00
11222.	thavin (thavinxz)	26	73.98	88.35	8	30.77
11223.	Johnny (thatbigboy)	26	113.97	129.71	13	50.00
11224.	Itachi (thanos_18)	26	39.95	53.90	4	15.38
11225.	Terairk (terairk)	26	106.12	121.79	2	7.69
11226.	Teddie (teddie37)	26	65.07	76.47	7	26.92
11227.	tia (teayah)	26	58.89	71.81	9	34.62
11228.	taseh (taseh)	26	117.27	129.91	14	53.85
11229.	Leia (s_leia)	26	127.32	167.05	17	65.38
11230.	blob (susuthichansushi)	26	82.74	98.26	6	23.08
11231.	Linus (starhiro654)	26	92.41	115.72	9	34.62
11232.	s (sqood)	26	69.34	83.12	6	23.08
11233.	Speedswiper (speedswiper)	26	111.08	128.03	12	46.15
11234.	SPEED (speedbear)	26	109.86	128.32	11	42.31
11235.	War (sorted99)	26	54.99	64.29	3	11.54
11236.	SJ (sonialj)	26	53.05	62.78	4	15.38
11237.	A.A.Fouad (snkpl)	26	69.35	81.74	5	19.23
11238.	Aleksei (snejink)	26	38.23	48.56	0	0.00
11239.	Jeremy (slorsx89)	26	72.53	86.15	6	23.08
11240.	Kendall (skeletonsinc)	26	105.14	123.79	13	50.00
11241.	John (sirfightsalot)	26	77.81	92.38	7	26.92
11242.	Dev (sident)	26	99.68	118.14	14	53.85
11243.	Siberius (siberiusalpha)	26	63.40	76.80	7	26.92
11244.	Shreyash (shreyash_he)	26	32.28	37.26	7	26.92
11245.	Joe (shmooo)	26	113.22	131.36	13	50.00
11246.	scampe (scampe)	26	104.59	119.87	16	61.54
11247.	asdf (rushlync)	26	79.75	92.70	6	23.08
11248.	Colemak (road2work100)	26	83.15	98.16	7	26.92
11249.	Zoe (riverz)	26	86.64	105.31	7	26.92
11250.	Kuzma (rikoj02)	26	93.01	115.42	9	34.62
11251.	R1 (richthe1kid)	26	94.33	117.46	9	34.62
11252.	Ricardo (ricardo1610)	26	66.92	78.50	5	19.23
11253.	repeatt (repeatt)	26	81.96	101.96	7	26.92
11254.	Sir RB (rblogan3)	26	59.83	70.13	5	19.23
11255.	Rajiv (rajiv_431)	26	41.26	51.78	3	11.54
11256.	Raivo (raivopleika)	26	32.16	43.30	2	7.69
11257.	vijay (pykethtitan)	26	91.74	111.58	10	38.46
11258.	Pro (pro_talon)	26	35.02	41.13	0	0.00
11259.	Preaben (preabae)	26	81.31	100.77	6	23.08
11260.	Omar (postmodernpostman)	26	110.35	134.30	14	53.85
11261.	Porkyy (porkyp10)	26	103.15	129.61	14	53.85
11262.	Rahul (pirate_racer)	26	49.98	58.33	0	0.00
11263.	Phire (phire_xic)	26	67.42	92.24	7	26.92
11264.	Peppito (peppito)	26	118.34	147.12	18	69.23
11265.	palisfpauul (palisfpauul)	26	96.34	107.97	11	42.31
11266.	ozzyy (ozzyy_163)	26	63.75	77.18	10	38.46
11267.	zero (ozero)	26	100.68	117.30	11	42.31
11268.	Just (ottovon)	26	65.47	85.37	4	15.38
11269.	Oscar (oscrrrrrrr)	26	61.37	84.67	9	34.62
11270.	Osaji (osaji)	26	80.48	93.53	7	26.92
11271.	Stuart (orihsenak)	26	70.05	83.71	8	30.77
11272.	Thomas (onlyphams)	26	85.02	112.28	7	26.92
11273.	Marco (oblq)	26	77.65	92.52	6	23.08
11274.	hard to type (obahi)	26	36.38	42.02	2	7.69
11275.	Nathan (n_tber)	26	30.53	43.81	5	19.23
11276.	noahrwilly (noahrwilly)	26	87.52	99.28	9	34.62
11277.	Nino (ninodoko)	26	121.66	137.50	14	53.85
11278.	Niklas (niklash)	26	89.40	109.37	9	34.62
11279.	Nikee (nikee25)	26	83.96	97.95	11	42.31
11280.	Benji (nepzy)	26	82.51	98.96	13	50.00
11281.	Niko Zhang (neko23)	26	81.53	98.14	7	26.92
11282.	Daniel (nedgcb)	26	88.75	110.05	7	26.92
11283.	c (nb888)	26	109.49	125.02	11	42.31
11284.	Nasar (nasarlagenda)	26	60.57	75.75	6	23.08
11285.	Nanashi (nanasheen)	26	98.95	128.05	9	34.62
11286.	naileuX (naileux)	26	85.47	110.45	10	38.46
11287.	MyBihLuhDoCocaine (mybiluhd...	26	97.65	124.05	11	42.31
11288.	workmanLayout (mustelad)	26	81.64	95.42	8	30.77
11289.	Mustafa (mustafaalyagoub)	26	88.16	101.69	5	19.23
11290.	Fluffy (musketeer)	26	52.41	67.78	6	23.08
11291.	mursh (mursh)	26	64.41	88.03	8	30.77
11292.	Eicy (moreseicy)	26	77.49	87.64	7	26.92
11293.	Mojo (mojo1289)	26	81.26	100.11	12	46.15
11294.	Julise (mintytea)	26	42.58	54.26	4	15.38
11295.	mike (mike4madness)	26	68.20	76.06	6	23.08
11296.	saba (midvert)	26	71.18	83.67	14	53.85
11297.	methodiical (methodiical)	26	82.44	104.61	3	11.54
11298.	Matthijs (matthijsb)	26	65.73	80.99	5	19.23
11299.	mart9n (mart9n)	26	108.46	120.89	17	65.38
11300.	Marcus (marcustham)	26	59.44	69.46	5	19.23
11301.	Darrick (mapleroasted)	26	84.40	108.73	10	38.46
11302.	Mackyy. (mackipecko)	26	122.99	138.37	23	88.46
11303.	Daan (macdann6)	26	82.77	97.00	7	26.92
11304.	i am (lynx_noob)	26	32.62	40.50	5	19.23
11305.	Jamliv (lvpec)	26	66.83	82.05	5	19.23
11306.	Lubo (lubokkanev)	26	101.44	117.88	10	38.46
11307.	zhiyu (losterzu)	26	77.91	96.71	10	38.46
11308.	Tao (litao91)	26	89.51	106.59	8	30.77
11309.	liperdi (liperdi)	26	53.55	59.36	2	7.69
11310.	IChun (lighttodie)	26	88.89	104.44	8	30.77
11311.	Lee Bing Bong (lee_bing_bong)	26	95.79	117.54	13	50.00
11312.	kwonman99 (kwonman99)	26	91.15	112.54	8	30.77
11313.	Kuma (kumatero1)	26	62.31	75.93	5	19.23
11314.	Brandon (kosaido)	26	76.58	88.82	11	42.31
11315.	kopok (kopokopok)	26	66.62	82.88	4	15.38
11316.	Seth (kliney4)	26	74.38	85.33	7	26.92
11317.	Khaled (khaled2252)	26	97.95	117.38	11	42.31
11318.	Vince (kerokeroro)	26	68.82	82.14	4	15.38
11319.	Lucia (kenyousmile)	26	57.86	69.03	2	7.69
11320.	Kek_LordDvorak (kek_lorddvo...	26	80.72	101.06	6	23.08
11321.	Kay (kaylakhots)	26	79.48	95.62	17	65.38
11322.	Kasey (kaseshib)	26	85.13	105.36	6	23.08
11323.	KirinChibi (k4nna)	26	119.76	139.44	21	80.77
11324.	Jumpye (jumpye)	26	134.62	157.71	18	69.23
11325.	JVY (julvi)	26	68.71	86.06	9	34.62
11326.	Juggle (juggle6)	26	115.56	133.86	16	61.54
11327.	Josh (jtaube)	26	84.75	97.01	7	26.92
11328.	jesse (jessef_9000)	26	76.06	96.94	10	38.46
11329.	JEREYO05 (jereyo05)	26	44.37	54.27	3	11.54
11330.	Jay (jay_cubed22)	26	97.92	111.99	9	34.62
11331.	Suh dude (jaykwon)	26	85.88	106.84	6	23.08
11332.	j (jas1yne)	26	101.29	114.99	9	34.62
11333.	deez (ishkena)	26	88.38	112.01	22	84.62
11334.	imslowaf (imslowafuwu)	26	75.64	89.54	8	30.77
11335.	Ed (illuxionist)	26	94.99	113.70	16	61.54
11336.	Ian Jerome (ianjerome)	26	54.20	62.58	7	26.92
11337.	Lucas (huy1804)	26	69.28	88.49	7	26.92
11338.	HunTer (hunter420)	26	43.96	50.06	3	11.54
11339.	arif (hmmmnotokay)	26	73.50	93.97	7	26.92
11340.	hunt (hmich)	26	91.37	105.25	15	57.69
11341.	Cody (hippolytus)	26	93.19	124.79	9	34.62
11342.	Hien (hien1201)	26	76.25	83.82	5	19.23
11343.	lane (hiddenplays)	26	29.22	34.88	0	0.00
11344.	Adithiya (havlen1)	26	53.96	63.02	2	7.69
11345.	... (h01001010)	26	89.58	108.86	6	23.08
11346.	Varun Goyal (govarun)	26	63.05	73.07	5	19.23
11347.	Gnanendar (gnanickky)	26	57.64	64.69	3	11.54
11348.	Gintoki (ginnoji)	26	67.93	84.94	6	23.08
11349.	Ghislaine (ghislanemaxwell)	26	89.08	110.26	12	46.15
11350.	Abdur (genway_dev)	26	37.99	52.23	4	15.38
11351.	Garvežiukas (garvezinis)	26	70.04	98.75	8	30.77
11352.	Gabe (gabuthebabu)	26	95.82	112.08	13	50.00
11353.	FisH...MaN (fish_man)	26	81.69	101.21	26	100.00
11354.	Fernando Morato (fernandomo...	26	72.34	86.29	4	15.38
11355.	Fandom (fandom_girl)	26	58.09	72.28	7	26.92
11356.	Ian (e__n)	26	102.73	120.81	8	30.77
11357.	Ivan (evanmico)	26	87.46	96.71	19	73.08
11358.	Andrew (entranco)	26	90.97	108.58	9	34.62
11359.	emczuk (emczuk)	26	115.87	130.68	8	30.77
11360.	Earth (earth_chan)	26	94.29	112.62	15	57.69
11361.	Dana (dwhite84)	26	71.54	98.14	10	38.46
11362.	Darren (dtwcdarren)	26	76.79	98.14	4	15.38
11363.	droLnomeD (drolnomed)	26	77.98	97.47	5	19.23
11364.	Jake (drjakeman)	26	118.24	133.71	21	80.77
11365.	Denis Çerri (deniscerri)	26	90.62	109.04	10	38.46
11366.	DD (ddcute)	26	60.98	70.77	9	34.62
11367.	Dave (davidkim123)	26	106.72	123.96	14	53.85
11368.	bailey (darkness04)	26	59.00	98.72	11	42.31
11369.	Dan (danmarculet)	26	106.71	115.70	14	53.85
11370.	Davvy (daavvyy)	26	92.87	122.59	11	42.31
11371.	H (curlwurl)	26	89.97	105.32	6	23.08
11372.	abhay (cs_abhay)	26	77.46	93.86	6	23.08
11373.	Asrar (cruzen)	26	62.56	73.47	3	11.54
11374.	Jason (cowlodger123)	26	93.18	127.93	18	69.23
11375.	stranger (courage_iberg)	26	50.18	65.73	4	15.38
11376.	cooper (cooperwoop)	26	73.92	95.55	10	38.46
11377.	Max (convie)	26	98.11	119.20	8	30.77
11378.	Cristian (cmatiasc)	26	97.16	112.43	13	50.00
11379.	Ozan (clutchupmate)	26	104.55	130.95	11	42.31
11380.	Sebastian (cloutimus)	26	88.66	104.95	12	46.15
11381.	Sebastian (clicthekeys)	26	45.95	75.91	0	0.00
11382.	Charles (chuckly)	26	81.02	95.26	5	19.23
11383.	Lim (chiyennn)	26	67.07	75.89	7	26.92
11384.	alex (chinese69)	26	108.75	127.44	14	53.85
11385.	CelestialAmber (celestialam...	26	86.88	101.97	10	38.46
11386.	mo (ceiba)	26	81.38	95.98	5	19.23
11387.	Cecil (cecil_behar64)	26	89.33	96.98	5	19.23
11388.	Carter (cartersaechoa92)	26	89.53	104.10	6	23.08
11389.	tw0f1v3w0n (capricitor)	26	103.78	124.44	14	53.85
11390.	Justin (bothon21)	26	100.93	122.88	12	46.15
11391.	Blaize (bomoko)	26	73.82	85.93	8	30.77
11392.	Dakota (boda69)	26	50.03	58.64	3	11.54
11393.	William (bnuldun)	26	92.42	114.05	9	34.62
11394.	KMMOPJ1 (blueflammednezha)	26	64.00	78.53	7	26.92
11395.	Blitzgate (blitzgate)	26	77.79	92.30	6	23.08
11396.	Aaron (bigfategg)	26	77.89	91.84	7	26.92
11397.	Darren (baochun2)	26	94.81	115.47	11	42.31
11398.	ballz (ballzbazz)	26	71.36	78.39	6	23.08
11399.	Daddy (badassabd)	26	47.42	64.22	4	15.38
11400.	qwe (azeem838)	26	37.03	45.04	3	11.54
11401.	AxelDT (axman292)	26	81.63	93.97	6	23.08
11402.	Thomas (ashryx)	26	92.19	109.96	9	34.62
11403.	Arunkumar (arunkumar49)	26	72.15	87.49	12	46.15
11404.	APS (arsh_aps)	26	68.65	83.22	7	26.92
11405.	Alex (aralizer)	26	50.35	58.37	2	7.69
11406.	applecards (applecards)	26	60.47	75.67	5	19.23
11407.	Anurag (anuragbhatt)	26	69.05	87.58	1	3.85
11408.	Mike (anaperius)	26	48.30	59.36	13	50.00
11409.	Anas (ananzeh)	26	67.58	77.81	5	19.23
11410.	Anthony (an1hony)	26	97.84	116.86	6	23.08
11411.	A (amartindale)	26	43.26	54.67	2	7.69
11412.	Nissan GT-R (amalyano)	26	72.27	82.02	6	23.08
11413.	Jasper (ajaystr)	26	56.09	65.46	4	15.38
11414.	Advik (advik123)	26	59.07	66.98	7	26.92
11415.	Achuyat (achuyat)	26	38.17	48.86	2	7.69
11416.	Abhirup Das (abhirupdas200)	26	72.07	99.17	8	30.77
11417.	Abas (abasf14687)	26	62.20	80.39	9	34.62
11418.	Ayoub (4youb)	26	36.49	44.65	10	38.46
11419.	Jeff (3deer6)	26	59.55	75.12	4	15.38
11420.	Wzq (3125114)	26	88.32	100.52	6	23.08
11421.	Blake (25kangboyang)	26	94.73	116.77	9	34.62
11422.	Ahmed Husayn (pr1vate)	26	44.90	53.92	4	15.38
11423.	KURM (kurm)	26	47.03	58.64	2	7.69
11424.	kyvu (kyvu)	26	89.20	113.63	5	19.23
11425.	VerTue (xmarc)	26	67.33	83.37	9	34.62
11426.	J (jus_t)	26	55.50	67.70	4	15.38
11427.	Voldemar (voldemortenz)	26	39.97	50.32	1	3.85
11428.	Dark (raynous)	26	57.32	66.60	4	15.38
11429.	del (yggdrasilll)	26	78.12	89.85	7	26.92
11430.	Swice (swice)	26	57.44	71.69	5	19.23
11431.	Turd (turd_nugget1337)	26	50.80	63.98	2	7.69
11432.	M1 (m1_englondon)	26	62.65	73.09	3	11.54
11433.	Xavier (xavierboutot)	26	71.46	84.97	7	26.92
11434.	Segale (barbara01)	26	86.61	102.15	8	30.77
11435.	Eddie (e2damilla)	26	66.99	81.72	10	38.46
11436.	Chee (pigupenguin)	26	81.31	97.66	15	57.69
11437.	Nard (hackerskeyboard)	26	89.54	100.17	7	26.92
11438.	Hisham (kaalan007)	26	52.55	61.03	3	11.54
11439.	Stefano (stefano98)	26	33.21	44.67	1	3.85
11440.	Acks (acksmurder)	26	52.52	70.56	2	7.69
11441.	Trace (kerotace)	26	44.16	53.75	1	3.85
11442.	Sean (seanso952)	26	104.32	118.98	11	42.31
11443.	Onlyifpanda (zailahmae)	26	48.83	61.40	0	0.00
11444.	Ashraf (ataibani001)	26	88.04	98.41	7	26.92
11445.	Estrode (estrode)	26	81.52	103.61	15	57.69
11446.	Thanos (thanosrr)	26	64.24	75.00	7	26.92
11447.	Fatso (fatsolebatso)	26	82.17	103.26	18	69.23
11448.	Nautilus (nautilus_3374)	26	50.37	61.89	3	11.54
11449.	N0rmL (_mee_)	25	92.91	104.64	10	40.00
11450.	old layout (_darya_)	25	86.47	105.95	6	24.00
11451.	allison (_allisonsun)	25	62.98	73.15	5	20.00
11452.	Zonic (zonic77)	25	94.43	105.51	14	56.00
11453.	zalpro (zalpro)	25	62.98	77.19	4	16.00
11454.	Yaas (yaas63)	25	58.52	69.76	3	12.00
11455.	Katie (xkaytea)	25	81.07	97.91	7	28.00
11456.	Wynton (wyntonrude17)	25	77.29	100.57	6	24.00
11457.	Saksham (wrath101)	25	78.82	98.38	6	24.00
11458.	Max (winstonlisa)	25	110.94	130.31	12	48.00
11459.	Will (willbo2006)	25	60.82	78.54	4	16.00
11460.	Wawa (wawasc)	25	74.33	92.01	2	8.00
11461.	opperhoofd (wart)	25	62.69	72.89	5	20.00
11462.	BrammetjeBaas (vyx_spaghettt)	25	55.64	61.76	1	4.00
11463.	Phillip (vuzula)	25	36.04	47.54	3	12.00
11464.	volt (voltb)	25	72.64	90.28	5	20.00
11465.	vishalvoid (vishalvoid)	25	38.62	45.92	2	8.00
11466.	Veedek (veedek)	25	87.91	111.31	8	32.00
11467.	UzanR (uzanr)	25	55.63	64.73	2	8.00
11468.	MK (uosom)	25	77.12	98.12	7	28.00
11469.	VNLEASHED (unlevshed)	25	71.35	89.14	9	36.00
11470.	Timo (ubulin)	25	94.24	111.36	10	40.00
11471.	Txeru (txeru)	25	71.58	79.32	25	100.00
11472.	Quyen (tsaiduk)	25	82.96	102.11	8	32.00
11473.	Erik (trixx7)	25	74.18	91.72	7	28.00
11474.	anon (triphosphate)	25	89.50	106.49	10	40.00
11475.	TotalledZebra (totalledzebra)	25	109.22	129.34	17	68.00
11476.	Tim (timoteo_lol)	25	93.15	109.98	9	36.00
11477.	Thunderz (thunderz2016)	25	101.78	118.21	12	48.00
11478.	The_rock (the_rock97)	25	47.25	61.99	2	8.00
11479.	Ternimus (ternimus)	25	74.91	83.79	10	40.00
11480.	TANEdos (tanedos)	25	90.93	107.96	7	28.00
11481.	Syed (syedmadad)	25	58.85	77.71	2	8.00
11482.	Sweater (swtr)	25	77.49	98.12	7	28.00
11483.	Ethan (sweethan)	25	97.38	113.11	4	16.00
11484.	Aviel (suxhe)	25	94.81	117.81	6	24.00
11485.	Kasper (suttergren)	25	52.61	59.06	1	4.00
11486.	Surreal (surreal_cereal)	25	72.16	83.61	8	32.00
11487.	K (sunfalls)	25	101.90	116.00	13	52.00
11488.	suaad (suaad)	25	46.91	56.53	2	8.00
11489.	Ana (sturmshatten)	25	41.16	52.14	3	12.00
11490.	Azee (speedy65)	25	64.68	70.93	9	36.00
11491.	sophia (sophiacav)	25	100.69	111.74	7	28.00
11492.	Praveen (solvedbiscuit71)	25	38.54	51.04	1	4.00
11493.	BLURB (snowq)	25	100.56	117.44	12	48.00
11494.	VaporSZN (vaporszn)	25	90.61	107.33	12	48.00
11495.	Ellie (sluis9_halmak)	25	27.04	36.21	10	40.00
11496.	gianni (slowasf99)	25	107.02	131.46	10	40.00
11497.	siddharth (siddharthr)	25	66.61	79.20	6	24.00
11498.	Ty (sick_wubs)	25	47.24	67.32	2	8.00
11499.	Ahnaf (shahriarme)	25	42.73	52.76	1	4.00
11500.	shahmeer (shahmeernoob)	25	54.24	62.93	3	12.00
11501.	Setons (setonsgrandpa)	25	73.31	87.43	9	36.00
11502.	Saumya (saumya69)	25	66.91	75.92	6	24.00
11503.	sasuke (sasukee)	25	51.40	64.01	1	4.00
11504.	Sarah Bisher (sarahbisher)	25	102.55	111.72	12	48.00
11505.	ara ara (sage_of_six_trees)	25	66.65	78.06	8	32.00
11506.	sabian (sabiansaige)	25	59.41	75.28	4	16.00
11507.	Rayleigh (r_chin)	25	93.42	115.14	8	32.00
11508.	James (ryyuu)	25	99.63	120.99	13	52.00
11509.	dark (rycae)	25	71.49	82.90	9	36.00
11510.	Saurabh (rustie_123)	25	67.77	76.88	5	20.00
11511.	I can't type!!! (roychan1)	25	100.59	129.92	12	48.00
11512.	Vignesh (rosvicky)	25	54.69	65.25	5	20.00
11513.	Ron (ronlaniado)	25	92.85	107.66	8	32.00
11514.	Brigid (riniti)	25	102.85	115.10	15	60.00
11515.	Bryce (ribit500)	25	52.83	65.53	2	8.00
11516.	s3Bz (reganisgod)	25	93.49	105.50	8	32.00
11517.	Gamer (reallyrandomname)	25	137.14	168.63	21	84.00
11518.	Radu (rdrnd)	25	61.68	71.44	7	28.00
11519.	Raiym (rayimbek)	25	74.23	89.30	7	28.00
11520.	Jebaited (raizzel)	25	81.70	94.99	8	32.00
11521.	sabir (rabugi)	25	25.10	34.92	4	16.00
11522.	Tran (qsang)	25	62.03	78.26	6	24.00
11523.	Kuaz (qaz855175b)	25	65.96	78.22	6	24.00
11524.	Helmut (psyonara_dvorak)	25	50.89	61.43	3	12.00
11525.	Priyanshu (psxuchiha)	25	59.44	72.99	1	4.00
11526.	Suven (psuv)	25	58.48	65.17	0	0.00
11527.	efthymios (poios_malphite)	25	66.34	77.36	5	20.00
11528.	Shivashis (plant99)	25	94.67	111.69	5	20.00
11529.	pastamath (pastalavista)	25	56.73	70.46	8	32.00
11530.	password (passworder)	25	66.56	73.09	4	16.00
11531.	Bella (papidiabolus)	25	60.79	74.82	3	12.00
11532.	PandoraOG (pandoraog)	25	56.30	62.92	2	8.00
11533.	Onionkreb (onionkreb)	25	116.04	130.43	15	60.00
11534.	zr (oilyfishball123)	25	73.68	81.96	7	28.00
11535.	Iwan (ocalukivan)	25	18.08	42.90	4	16.00
11536.	Say My Name (notreallyasteve)	25	104.38	138.14	10	40.00
11537.	Jason (nooneuknow)	25	75.22	85.66	5	20.00
11538.	nolan (nolwoods)	25	52.76	60.10	2	8.00
11539.	nlthebiebs (nlfthebiebs)	25	60.49	70.42	3	12.00
11540.	Faizaan (nitroblast)	25	89.17	133.07	15	60.00
11541.	nitrox (nitr0x)	25	99.06	117.44	14	56.00
11542.	Nishant (nishantdesai1306)	25	73.42	89.86	5	20.00
11543.	NHK (nhk451f)	25	61.34	74.11	8	32.00
11544.	Jan (natrix_)	25	49.58	61.04	12	48.00
11545.	bode (mywaifubestwaifu)	25	64.96	101.73	5	20.00
11546.	Jack Pascoe (mrprotyperman69)	25	71.09	90.59	18	72.00
11547.	Pickle (mrpicklebody)	25	56.86	68.81	2	8.00
11548.	Secret Animals December 15 ...	25	139.76	164.00	17	68.00
11549.	bryan (morenomust)	25	70.28	101.44	8	32.00
11550.	Kiyo (misterkiyo)	25	84.28	100.88	5	20.00
11551.	Edward (mistaek)	25	97.87	119.58	13	52.00
11552.	Michelle (minspire)	25	98.42	115.84	12	48.00
11553.	Michael Rostom (michaelrous...	25	58.80	65.85	3	12.00
11554.	tstats[meratanak] (meratanak)	25	59.81	74.00	8	32.00
11555.	Meditate (meditate)	25	94.75	113.63	6	24.00
11556.	Yassin (meddyassin)	25	62.70	77.10	7	28.00
11557.	ratbastard (mattbierwirth)	25	115.02	136.19	16	64.00
11558.	Jeevun (masterjeev)	25	55.88	71.86	5	20.00
11559.	mangya (mangya)	25	49.69	61.35	4	16.00
11560.	mac☮✈ie← →k🥵 (ma...	25	88.49	98.01	9	36.00
11561.	Marius (m4ryu5)	25	60.92	69.66	5	20.00
11562.	jeakai (lolilo123)	25	100.46	125.39	7	28.00
11563.	Mia (lkortebe)	25	128.11	164.11	18	72.00
11564.	Sam (lingbing)	25	82.97	94.90	10	40.00
11565.	Lily (lilell)	25	110.29	123.69	6	24.00
11566.	btonkh (le_shindeplouf)	25	79.43	96.20	25	100.00
11567.	abel (lessthanthirtyfive)	25	101.02	110.57	10	40.00
11568.	lenux005 (lenux005)	25	65.03	88.56	5	20.00
11569.	Leah (leah_is_not_available)	25	89.52	103.68	9	36.00
11570.	❤❤❤ (lavenenoz)	25	118.75	133.57	4	16.00
11571.	Preston (lantzer)	25	95.67	127.84	7	28.00
11572.	Nun (lackingnight)	25	65.68	83.90	3	12.00
11573.	Kriss (kkright)	25	89.18	105.55	9	36.00
11574.	Victor (kingofdawn)	25	72.43	94.11	8	32.00
11575.	kingcokes (kingcokes)	25	75.22	89.36	3	12.00
11576.	susan (kf7hdw)	25	120.10	140.31	13	52.00
11577.	Keti (keti_hawk)	25	75.14	89.15	4	16.00
11578.	KaloiNa (kaloina)	25	19.83	31.05	7	28.00
11579.	Mohammed Julfikar Ali (julf...	25	70.57	89.74	9	36.00
11580.	Josh (joshmankey7)	25	112.32	142.50	15	60.00
11581.	Jose (josethomas)	25	97.40	111.38	11	44.00
11582.	joon (joonleey)	25	61.58	69.72	5	20.00
11583.	Joketts (joketts)	25	81.05	95.82	9	36.00
11584.	Joseph (jkc7)	25	101.39	113.25	5	20.00
11585.	jhairssteven (jhairssteven)	25	59.83	74.61	3	12.00
11586.	Super slow (jan_war)	25	70.49	85.51	6	24.00
11587.	Jakawat (jakawat)	25	73.41	88.08	6	24.00
11588.	space 65 (jacob1361)	25	84.17	111.16	8	32.00
11589.	Daniel (intangiblesniper)	25	135.94	167.94	18	72.00
11590.	Jonathan (imprettysaxy)	25	122.74	149.46	15	60.00
11591.	ikkyu (ikkyu)	25	40.75	49.04	3	12.00
11592.	jimy (iceposident)	25	79.00	97.71	8	32.00
11593.	joel (ibeatjoeleverytime)	25	100.83	123.26	7	28.00
11594.	Ian (ianduu)	25	58.07	68.37	7	28.00
11595.	Hen_r.y (h_enry)	25	47.75	55.20	3	12.00
11596.	Hossein (hosseinzafari)	25	52.22	60.81	9	36.00
11597.	Miles (hauskaz)	25	89.58	109.60	5	20.00
11598.	Haribo (haribooo)	25	80.99	94.75	4	16.00
11599.	hannah (hannahvilla)	25	98.00	118.17	15	60.00
11600.	Free Palestine (halemogpa)	25	57.01	72.54	3	12.00
11601.	Gevashkar (gevashkar)	25	67.25	80.89	10	40.00
11602.	gDan (gdan)	25	51.27	66.77	5	20.00
11603.	shravan (gammarays)	25	74.87	91.22	6	24.00
11604.	Alex (fluffehpander)	25	98.64	111.18	14	56.00
11605.	Jay (finikin)	25	86.19	99.98	6	24.00
11606.	Abtin (fada1)	25	98.99	116.54	13	52.00
11607.	Ezio (ezio129)	25	59.31	71.68	4	16.00
11608.	Eskah (eskah)	25	74.64	91.62	5	20.00
11609.	eril (eril)	25	108.69	119.51	11	44.00
11610.	Srinidhi (eren_eager)	25	54.48	66.73	3	12.00
11611.	Yaroslav (eloren)	25	70.91	90.81	3	12.00
11612.	Elliot (elliot_cooper)	25	58.17	72.73	5	20.00
11613.	Elahe (elldora)	25	44.24	58.61	1	4.00
11614.	Elias (eliasy7)	25	97.90	125.05	23	92.00
11615.	Edwin Salinas (edos4)	25	65.35	80.33	0	0.00
11616.	edna (ednanaanaa)	25	58.61	71.78	5	20.00
11617.	et (edcolemak)	25	115.35	130.77	12	48.00
11618.	Dat (dvorakprodigy)	25	120.86	137.28	12	48.00
11619.	Zed_Query_Base (duyanh3897)	25	51.52	78.80	0	0.00
11620.	Jess (dragonfire24)	25	82.42	103.42	12	48.00
11621.	Dominic (dominic2382)	25	53.00	64.69	5	20.00
11622.	DogHole (doghole)	25	132.23	176.60	14	56.00
11623.	Dillruba (dishadipa223)	25	37.03	48.39	7	28.00
11624.	Dan (diamond98)	25	49.10	56.25	2	8.00
11625.	Theo (dhm_learner)	25	21.33	36.47	3	12.00
11626.	Rob (destructo91)	25	97.81	115.21	7	28.00
11627.	Jay (destroyer1101)	25	60.86	73.96	6	24.00
11628.	David (davidjnovak)	25	81.34	102.99	5	20.00
11629.	dantheman27 (dantheman8529)	25	66.45	82.17	7	28.00
11630.	Daniel (dannybot)	25	78.42	89.23	6	24.00
11631.	damafps (damafps)	25	71.82	84.57	5	20.00
11632.	maap_yach (crstlgo09)	25	80.25	102.51	7	28.00
11633.	Crricket (crricket)	25	76.48	96.17	8	32.00
11634.	crocotyper (crocotyper)	25	130.29	154.74	17	68.00
11635.	ToTo (complexion)	25	87.61	106.21	9	36.00
11636.	Chris (chrischu)	25	61.28	76.66	5	20.00
11637.	Chris (chris979)	25	83.76	105.04	5	20.00
11638.	Christoffer (chrippa01)	25	71.44	81.61	3	12.00
11639.	Lucas (ceebzz)	25	107.69	118.37	10	40.00
11640.	Brian (brianyosua)	25	101.71	120.60	11	44.00
11641.	Brendon (brenster)	25	45.85	63.78	1	4.00
11642.	Bread (breadmonkey)	25	96.98	114.94	9	36.00
11643.	blob_mister (blob_mister)	25	105.08	122.74	9	36.00
11644.	Cloud (blackcloud010)	25	112.26	127.79	15	60.00
11645.	bino_ (bino_)	25	78.23	88.15	6	24.00
11646.	B (benfield)	25	59.79	70.46	1	4.00
11647.	Joshua (beastjg)	25	89.23	109.77	11	44.00
11648.	earlprotyper (beamerboyy)	25	112.58	127.01	13	52.00
11649.	Bala (balaboi)	25	69.10	79.88	8	32.00
11650.	Joseph (baggs33)	25	102.56	125.20	10	40.00
11651.	aerooo (babatunde_olatunji)	25	61.05	82.57	9	36.00
11652.	Avaxar (avaxar)	25	74.66	95.61	13	52.00
11653.	typing.bro26 (ashokkaji)	25	39.72	52.32	4	16.00
11654.	Artorias (artorias_)	25	84.85	101.15	0	0.00
11655.	Arjun (arjun_0004)	25	104.28	116.76	11	44.00
11656.	Austin (apollo2020)	25	60.14	69.22	4	16.00
11657.	Satis (angpogikotalaga123)	25	138.05	156.29	15	60.00
11658.	Albert (aneuck)	25	84.75	110.62	11	44.00
11659.	Andrei (andreibanc)	25	80.59	96.47	5	20.00
11660.	Amin (amin_eatemad)	25	74.12	87.59	4	16.00
11661.	Amelia (amelia03)	25	89.41	109.75	10	40.00
11662.	Alfred (alfredsando)	25	88.44	103.26	9	36.00
11663.	Alex (alex_ryan)	25	67.31	88.67	2	8.00
11664.	alexjr977 (alexjr977)	25	51.37	64.88	1	4.00
11665.	Akshat (akshatsingh1_)	25	76.95	99.84	6	24.00
11666.	A Owadud (akash655)	25	56.93	69.73	1	4.00
11667.	Aaron (ajmoore0351)	25	65.43	79.31	5	20.00
11668.	Augusto (ahidalgob)	25	81.34	91.01	15	60.00
11669.	André (agdf)	25	70.93	78.58	6	24.00
11670.	Adrian (adrianmonaghan)	25	90.21	110.85	6	24.00
11671.	Adam (adamcoch)	25	84.99	95.52	7	28.00
11672.	Dvorak Klaas (acheron)	25	69.85	83.20	5	20.00
11673.	ableable (ableford)	25	96.05	109.43	14	56.00
11674.	Adarsh (aadi_2301)	25	38.40	48.22	0	0.00
11675.	Temuun (moon50)	25	64.95	81.59	3	12.00
11676.	Brendan (brendanr)	25	75.24	85.28	4	16.00
11677.	Max (jhared06)	25	63.84	74.12	12	48.00
11678.	mowglie (mowgliegaming)	25	67.79	79.36	8	32.00
11679.	Luke (lukecooper)	25	87.38	102.40	9	36.00
11680.	gregge (gregge_v2)	25	42.14	52.87	1	4.00
11681.	Lane (lane2295)	25	83.52	103.31	7	28.00
11682.	cameron (souregs)	25	57.07	67.18	3	12.00
11683.	DonFinn (fegermitn)	25	65.19	81.12	3	12.00
11684.	tteessssaa (tteessssaa)	25	62.16	78.64	8	32.00
11685.	Angel (aggel333)	25	87.88	103.73	12	48.00
11686.	Link (drainn)	25	60.64	75.79	7	28.00
11687.	Jooshua (me_no_good_at_typing)	25	75.94	89.06	3	12.00
11688.	AllCrumpledUp (stableigloo)	25	107.53	117.58	9	36.00
11689.	Herrah (neiljmth)	25	100.27	117.54	11	44.00
11690.	Cobi (cobidortch)	25	82.34	98.09	9	36.00
11691.	Fang (fangphire)	25	59.11	67.86	4	16.00
11692.	ItsAleq (itsaleq)	25	47.21	62.04	3	12.00
11693.	J (nordar)	25	60.99	68.09	4	16.00
11694.	Mayowa (paitin)	25	82.62	89.72	3	12.00
11695.	Bořek (tvojesestra)	25	89.94	113.59	10	40.00
11696.	William (siaomai1030)	25	39.91	44.43	4	16.00
11697.	Turtle (turtdagon)	25	88.00	107.77	6	24.00
11698.	Jose (rotaryjoey)	25	65.89	83.14	7	28.00
11699.	Arnoud (arnoud)	25	61.12	75.40	5	20.00
11700.	Umbra (umbra69)	25	67.43	77.82	0	0.00
11701.	Rubén (ryn_0)	25	39.83	47.49	4	16.00
11702.	Halo (hxlox)	25	71.85	89.71	16	64.00
11703.	t11h (t111h)	25	42.95	52.12	2	8.00
11704.	bau (padam21)	25	78.17	94.10	6	24.00
11705.	Idontknow (practice420)	25	65.77	77.10	4	16.00
11706.	Mobin (nibomilad)	25	42.51	52.34	2	8.00
11707.	Pulkit (the_tratios)	25	41.28	52.97	4	16.00
11708.	C (re4gd)	25	66.24	93.09	3	12.00
11709.	poopoo (nofaceman_mp4)	25	69.14	93.77	7	28.00
11710.	Sikais (sikais)	25	48.36	57.17	24	96.00
11711.	Fighter (fighter23)	25	33.26	40.15	7	28.00
11712.	DragonKingCosmos (dragonkin...	25	59.75	79.11	8	32.00
11713.	Pasto (pasto_gris)	25	72.22	92.44	4	16.00
11714.	Shanto (hi_shanto)	25	49.13	64.05	3	12.00
11715.	v33 (__v33__)	24	62.74	72.64	3	12.50
11716.	Zint (_zint_)	24	89.69	121.84	7	29.17
11717.	Irarref (_ofking)	24	59.97	73.49	4	16.67
11718.	Zockie (zockie)	24	74.27	85.32	7	29.17
11719.	Pretty Epic (zimbaycoleo)	24	98.80	125.18	11	45.83
11720.	Zhalgas (zhalgas_04)	24	40.88	46.99	12	50.00
11721.	Nicolas (yulkbbq)	24	101.20	113.42	7	29.17
11722.	leo (ytxqz)	24	59.45	71.56	3	12.50
11723.	Alex (your_pal_al)	24	88.58	111.47	11	45.83
11724.	Juan (yosohs)	24	73.30	88.23	4	16.67
11725.	haryson (xooflo)	24	121.89	140.19	8	33.33
11726.	akaxls (xlsbestplayer)	24	59.73	73.11	6	25.00
11727.	Wojciech (wpietron)	24	74.68	91.22	7	29.17
11728.	Wafles (waflebars)	24	73.07	89.73	6	25.00
11729.	whoam (w1ld13)	24	70.00	82.58	5	20.83
11730.	my fingers hurt (voltwitz)	24	134.71	151.91	18	75.00
11731.	Volta (vo1_ta)	24	92.59	110.97	15	62.50
11732.	Vishnu (vishnu_is_goated)	24	71.77	89.48	8	33.33
11733.	Vinne (vinne10)	24	98.93	127.85	6	25.00
11734.	viincent (viiincent)	24	89.27	119.39	7	29.17
11735.	V3RN0N (v3rn0n)	24	103.37	120.03	12	50.00
11736.	Utsah (utsah470)	24	42.68	56.65	2	8.33
11737.	tylgo (tylgo)	24	95.26	108.43	10	41.67
11738.	Joe (tormund)	24	67.48	79.33	7	29.17
11739.	Tommy (tommywiseau95)	24	32.91	39.18	1	4.17
11740.	Aditya (timmyaditya)	24	65.03	82.51	13	54.17
11741.	Tim (timhoxton)	24	41.53	49.70	1	4.17
11742.	Mig (timenextluck)	24	47.00	58.99	4	16.67
11743.	Thomas (thomasltran)	24	98.40	117.61	9	37.50
11744.	TheGreatYS (thegreatys)	24	69.28	79.06	8	33.33
11745.	megghraj (thegame365)	24	62.55	77.18	2	8.33
11746.	thecourtneyv (thecourtneyv)	24	89.47	105.28	12	50.00
11747.	Renata (thebluesavvy1)	24	71.63	87.25	3	12.50
11748.	Cocoa (thatclassykid)	24	76.79	88.95	6	25.00
11749.	Teh (tehtehteh)	24	121.91	135.93	16	66.67
11750.	Teen (teenunicorn)	24	101.42	122.26	9	37.50
11751.	Daniel (swampy28)	24	47.30	58.57	3	12.50
11752.	Surya (suryathoppae)	24	69.15	99.15	5	20.83
11753.	streamix (streamix)	24	76.62	89.62	9	37.50
11754.	tyler (ssjtyru)	24	95.53	114.39	5	20.83
11755.	Filip (sodic)	24	87.81	105.04	13	54.17
11756.	Cass (sneakyperryplat)	24	116.19	141.11	11	45.83
11757.	Blake (skidaddle)	24	96.82	125.39	6	25.00
11758.	sircle (sircle)	24	67.25	75.73	5	20.83
11759.	shot607 (shot607)	24	124.03	142.11	19	79.17
11760.	shoobb (shooby28)	24	85.54	102.51	7	29.17
11761.	Dankey Kang (shabooty)	24	120.61	137.05	14	58.33
11762.	Sean (sfeendog)	24	74.95	86.11	1	4.17
11763.	Sejer (sejert)	24	73.37	93.53	9	37.50
11764.	scor (scorbalope)	24	72.46	84.15	4	16.67
11765.	Ankit (savage_floppy)	24	56.70	68.18	18	75.00
11766.	abatt (sas_1100)	24	97.85	118.70	8	33.33
11767.	Santiago (santi_ooo)	24	60.99	73.81	8	33.33
11768.	Salzd (salzd)	24	73.24	85.12	4	16.67
11769.	salmonjerky (salmonjerky)	24	118.30	137.98	12	50.00
11770.	Ryo (ryonamba)	24	75.49	94.31	3	12.50
11771.	Morple (roubry)	24	52.71	61.83	5	20.83
11772.	vroom (rott3n)	24	101.95	118.48	11	45.83
11773.	Juan (robbyro10)	24	74.18	85.25	11	45.83
11774.	Red (redhood07)	24	91.05	104.71	8	33.33
11775.	Andy (realasianjesus)	24	97.65	109.93	7	29.17
11776.	Randhy (randhy456)	24	86.07	99.27	7	29.17
11777.	ibm model m (qpaper)	24	82.95	97.82	7	29.17
11778.	elvi (puddingbb)	24	66.92	74.43	6	25.00
11779.	poornoday (poornoday)	24	44.64	52.55	3	12.50
11780.	Babu (pinklamborghini)	24	97.58	120.02	17	70.83
11781.	Hoopty (phantommonk)	24	108.17	121.28	18	75.00
11782.	Zöri (pevisa)	24	66.81	82.21	8	33.33
11783.	Soumyadip (pelitza)	24	77.66	90.71	3	12.50
11784.	paul (paulb20071106)	24	85.52	99.95	8	33.33
11785.	PL (patrick_legrand)	24	67.67	81.32	7	29.17
11786.	Parker (parqr)	24	81.75	97.38	6	25.00
11787.	parasjeet (parasjeet_singh)	24	21.27	30.29	7	29.17
11788.	失败者 (palmtreeeee)	24	88.96	101.76	9	37.50
11789.	sausage fingers (otterrr)	24	99.90	127.01	11	45.83
11790.	Pj (orchrist)	24	85.37	106.57	2	8.33
11791.	Nicholas (omzero)	24	71.25	82.80	5	20.83
11792.	Chayton (omenop)	24	65.71	78.74	18	75.00
11793.	lol (nutmyballs)	24	88.76	96.67	10	41.67
11794.	Dave (nut4)	24	90.25	113.34	5	20.83
11795.	Not_Orious (not_computer)	24	111.36	132.76	10	41.67
11796.	Leung (noobie_markie)	24	77.87	92.11	4	16.67
11797.	Viet (noobaxereport)	24	70.63	82.37	5	20.83
11798.	Nono (nono11jp)	24	77.12	92.84	7	29.17
11799.	Noah (noaboston)	24	60.80	79.31	3	12.50
11800.	Nivekdood (nivekdood)	24	94.04	123.24	13	54.17
11801.	Ryan (ninjacowwizard)	24	67.95	86.75	6	25.00
11802.	MD Nasir Uddin (nasiruddin1...	24	33.33	45.11	1	4.17
11803.	Ruufa (narwhal_cream)	24	58.31	73.16	5	20.83
11804.	Nachito007 (nachito007)	24	51.58	67.15	4	16.67
11805.	ISRAEL SPEED RACER (nabong)	24	106.31	129.27	20	83.33
11806.	Muhammadsiddiq (muhammadsid...	24	46.34	54.97	4	16.67
11807.	MrFunk (mrfunkee_)	24	57.20	68.06	6	25.00
11808.	mags (moopymags)	24	113.50	143.99	21	87.50
11809.	Mohsen (mohsenbing)	24	37.57	44.22	2	8.33
11810.	Mohamed (mohamed5550)	24	52.12	64.16	2	8.33
11811.	Michael (mkelnei)	24	74.36	90.09	7	29.17
11812.	Michael (michaz)	24	61.09	68.34	4	16.67
11813.	Brandon (mibbrandon)	24	68.85	78.08	4	16.67
11814.	Matías (mendezmatias)	24	51.72	63.48	0	0.00
11815.	Michael (mddover)	24	62.01	72.46	6	25.00
11816.	Mariol (mcakalli)	24	60.04	70.31	5	20.83
11817.	mayo (mayo_tp01)	24	110.16	137.78	3	12.50
11818.	Matty (matty_b_raps)	24	71.53	86.84	3	12.50
11819.	Matěj (mates542cz)	24	57.76	71.58	3	12.50
11820.	M5 (mariahendrikx)	24	105.13	129.64	10	41.67
11821.	Arslan (malikarslan)	24	62.27	80.47	7	29.17
11822.	Bart (madhavgoyal)	24	70.52	85.06	4	16.67
11823.	Macklin (macklin123)	24	92.01	100.86	8	33.33
11824.	Lo_key (lo_key)	24	76.39	87.66	4	16.67
11825.	LLyn (llyn)	24	88.47	110.16	7	29.17
11826.	David (litening72)	24	68.07	78.79	4	16.67
11827.	Markus (lil_manila)	24	53.69	65.18	2	8.33
11828.	LiKeRoMaNiA (likeromania)	24	73.31	82.12	4	16.67
11829.	lexi (leximeow)	24	98.77	119.99	10	41.67
11830.	TinyTim (lavoiet)	24	72.46	84.98	4	16.67
11831.	Andre (lapp13slaf)	24	70.60	86.02	5	20.83
11832.	Laet (laet99)	24	108.03	124.61	12	50.00
11833.	Jen (ladyjen)	24	38.08	46.55	0	0.00
11834.	Kaiden (ksetay)	24	65.43	84.12	5	20.83
11835.	Pavan (kpavankotesh)	24	75.07	92.38	11	45.83
11836.	Deven (kikaliyo)	24	79.02	94.66	5	20.83
11837.	Kevin (kevink1844)	24	73.16	86.49	7	29.17
11838.	Kevin (kevchen0908)	24	77.57	90.92	4	16.67
11839.	D4Backdoor (keskin)	24	85.35	103.85	4	16.67
11840.	Kelvin (kelvinohhh)	24	64.30	78.99	6	25.00
11841.	Will (karl__marx)	24	109.94	144.74	18	75.00
11842.	Kaori (kaori13)	24	58.28	69.11	4	16.67
11843.	Junle (junlez)	24	82.91	99.31	10	41.67
11844.	Jeff (jschillr)	24	61.30	75.63	7	29.17
11845.	JN (jnnnn)	24	78.36	85.25	7	29.17
11846.	D3athStArBaNana_63 (jmsmnlpz)	24	51.51	67.69	5	20.83
11847.	Jay (jaydhanani36)	24	81.39	94.88	9	37.50
11848.	Stivang96 (janse122)	24	90.08	114.39	13	54.17
11849.	Jan (janpaint4221)	24	88.96	106.81	6	25.00
11850.	Jack (jacktheoven)	24	97.84	110.90	9	37.50
11851.	Will (iyeiye_captain_)	24	85.73	102.82	5	20.83
11852.	Ian (imatson9119)	24	89.60	102.90	8	33.33
11853.	ibizabroker (ibizabroker)	24	66.21	73.69	5	20.83
11854.	Heathe (hwhl)	24	101.06	119.39	9	37.50
11855.	Josh (hsoj1)	24	79.79	87.24	5	20.83
11856.	hrithik (hrithikmanoj)	24	58.52	66.37	5	20.83
11857.	Henry (hongquan448)	24	62.95	74.42	5	20.83
11858.	HiroM (hirom)	24	91.97	114.00	12	50.00
11859.	Unknown (hikaru0628)	24	42.50	55.08	5	20.83
11860.	HiHowIsYourDay (hihowisyour...	24	101.07	125.45	3	12.50
11861.	Tong (hiddenbanana)	24	80.24	94.25	5	20.83
11862.	Hendeen (hendeen)	24	55.76	68.23	3	12.50
11863.	Daniil (hate_machine)	24	56.57	66.83	13	54.17
11864.	Hasano (hasano14)	24	67.22	83.21	8	33.33
11865.	Harsh (harsh_dubey)	24	34.88	46.46	1	4.17
11866.	Hackai (hackai)	24	45.58	57.47	4	16.67
11867.	Yuji (gugox10)	24	120.92	139.53	16	66.67
11868.	Grzegorz (gorix)	24	74.15	88.36	3	12.50
11869.	Adel (goldfist10)	24	112.02	127.80	11	45.83
11870.	krabbygail (goldenxy)	24	81.19	97.59	12	50.00
11871.	nothing (galaxiedhomerow)	24	144.83	178.11	18	75.00
11872.	fr33ak (fr33ak)	24	63.77	73.96	5	20.83
11873.	Chidum (flashstriker007)	24	58.61	79.08	4	16.67
11874.	Alan (fireslayer1090)	24	78.51	91.78	5	20.83
11875.	Filip (finicky_)	24	71.65	91.15	7	29.17
11876.	fiaz (fiazmahmud)	24	48.87	57.71	4	16.67
11877.	frank (fastfingersfrank)	24	116.56	137.60	12	50.00
11878.	Famesh (fampatel)	24	92.74	120.96	8	33.33
11879.	ExpensiveDinner (expensived...	24	113.72	131.93	8	33.33
11880.	Memes (ethanlee70)	24	93.51	114.12	9	37.50
11881.	Advait (epik_guy1)	24	95.25	113.41	7	29.17
11882.	Matts (emzee_a)	24	73.27	86.74	8	33.33
11883.	Aviv (el_duckino)	24	76.52	95.29	9	37.50
11884.	Ellis (ellismk123)	24	64.40	74.17	3	12.50
11885.	ELGstud (elg_stud)	24	46.02	58.15	2	8.33
11886.	dxriuz_dvorak (dxriuzdvorak)	24	43.47	51.24	4	16.67
11887.	dugnutt (dugnutt)	24	65.63	77.38	6	25.00
11888.	DTConks (dtconks)	24	75.96	93.58	6	25.00
11889.	aaron (doxxa)	24	125.72	140.91	12	50.00
11890.	Mangekyou (double_mangekyou)	24	108.04	131.85	13	54.17
11891.	Damn kid (dezzer_legend)	24	88.33	101.94	9	37.50
11892.	Dairy (derryne)	24	76.04	88.27	9	37.50
11893.	Alish (dek_u)	24	85.45	106.09	9	37.50
11894.	Beaster (deeznutshagotch)	24	113.57	132.84	14	58.33
11895.	Dave (davidneymar)	24	41.52	49.83	0	0.00
11896.	sourabh (datikas)	24	63.67	69.33	5	20.83
11897.	Darth (darthhideoustheugly)	24	74.28	82.49	6	25.00
11898.	sweet chili (darinoee)	24	119.17	137.10	20	83.33
11899.	Dan (danisoz12)	24	95.22	111.24	12	50.00
11900.	Cyrus (cyrusnthng)	24	45.46	59.36	2	8.33
11901.	Cyptre (cyptre)	24	59.10	77.64	6	25.00
11902.	Jonah (cuz_im_batman)	24	66.36	86.85	5	20.83
11903.	Controller Player (countarc...	24	69.97	88.66	7	29.17
11904.	voopx (coopnorth)	24	67.78	87.05	5	20.83
11905.	Azzy (clavanonoyes)	24	57.11	65.30	1	4.17
11906.	(っ◔◡◔)っ ♥ Tyoma...	24	86.54	93.48	7	29.17
11907.	Charlie (charlibre)	24	85.03	107.31	8	33.33
11908.	Celest (celestialpha)	24	46.69	61.26	3	12.50
11909.	Henry (ceeefore)	24	67.78	81.57	3	12.50
11910.	Christian (cbc2508)	24	93.72	113.33	12	50.00
11911.	Cau Be (caubelangthang)	24	93.49	111.02	10	41.67
11912.	Carlo (carlofernandez)	24	72.39	86.73	5	20.83
11913.	Christian (cardonacx)	24	73.01	88.45	10	41.67
11914.	cam (cam69)	24	80.98	100.23	13	54.17
11915.	Burr (burrasaurs)	24	76.29	97.72	10	41.67
11916.	Please use an appropriate n...	24	73.46	85.63	4	16.67
11917.	v0rtex- (bouraoui)	24	66.64	75.47	8	33.33
11918.	Sand (bizzarehuman)	24	58.16	70.20	3	12.50
11919.	bindyy (bindyy)	24	116.48	136.98	16	66.67
11920.	Bill (bill_slouch)	24	95.94	118.64	11	45.83
11921.	Lucky (bigowlyeyes)	24	100.16	112.93	7	29.17
11922.	Benjamin (ben_jam_in_franklin)	24	79.27	95.57	3	12.50
11923.	Bea (bearainbow)	24	84.38	100.32	6	25.00
11924.	Brandon (bandantran)	24	105.46	128.80	12	50.00
11925.	baha (bahakz)	24	89.98	101.85	9	37.50
11926.	Bacte (bacte73)	24	74.87	86.26	9	37.50
11927.	Aaron (ayildiztas)	24	60.19	77.03	2	8.33
11928.	(aus10_)	24	125.53	142.02	18	75.00
11929.	Ashraful (ashraful_alam)	24	54.63	65.51	3	12.50
11930.	Dark (arunabh_kalita)	24	48.40	57.61	4	16.67
11931.	An (an_dtr)	24	47.38	58.87	1	4.17
11932.	Duy (anthonytom)	24	114.09	128.06	10	41.67
11933.	Andreas (andysave)	24	78.33	94.27	7	29.17
11934.	Alex (alex_ofl)	24	77.56	90.76	5	20.83
11935.	Basma (airiii)	24	43.66	59.14	4	16.67
11936.	icosaedru (achimia)	24	87.64	98.29	6	25.00
11937.	abyl (abyl_10)	24	56.01	65.69	4	16.67
11938.	Abrar Shah (abrar_shah)	24	40.80	52.55	4	16.67
11939.	abdul (abdullateef4u)	24	60.71	69.87	4	16.67
11940.	Dude (48023984)	24	102.90	113.97	14	58.33
11941.	root (1_root_1)	24	71.87	83.63	6	25.00
11942.	1938 (1938)	24	57.04	83.79	2	8.33
11943.	Saksham (0_lol_0)	24	97.92	109.86	17	70.83
11944.	senneres (senneres)	24	66.92	80.69	5	20.83
11945.	die (dot65436)	24	54.54	68.50	7	29.17
11946.	Brady (bradychen)	24	51.06	60.67	4	16.67
11947.	Jackson (yoshiproz)	24	70.82	89.09	7	29.17
11948.	Cyrusssss (cyrusysleung)	24	70.96	86.44	4	16.67
11949.	don't (silversnow468)	24	59.64	69.93	10	41.67
11950.	jonas (jonas889)	24	79.35	94.85	6	25.00
11951.	Winter (winterlem)	24	90.98	104.45	11	45.83
11952.	Usotsuki (usottsuki)	24	72.88	84.87	5	20.83
11953.	Arthur (s4kko_)	24	49.36	62.05	0	0.00
11954.	Smac (smacpats)	24	103.33	117.70	8	33.33
11955.	Sijiur (Rohingya) (sijiur)	24	33.21	41.04	4	16.67
11956.	Rachel (purplerhythm)	24	52.41	61.64	6	25.00
11957.	jodie (jodieodieodie)	24	45.87	64.38	0	0.00
11958.	Hell (killsohard)	24	65.79	82.02	13	54.17
11959.	Ananyobrata (ananyo141)	24	64.39	74.56	5	20.83
11960.	Gnomes (gnomes_)	24	59.54	71.97	3	12.50
11961.	Bolio (killerjimt)	24	38.29	47.48	1	4.17
11962.	Apperentice (kkfarhan23)	24	43.05	52.71	1	4.17
11963.	Nick (darknitexbl)	24	50.68	65.42	2	8.33
11964.	Haseeb (redhaseeb)	24	88.26	102.40	8	33.33
11965.	Khushank (khushsaini)	24	43.85	51.06	2	8.33
11966.	Daniel (danield3176)	24	82.83	98.83	7	29.17
11967.	Ghal (ghal_dj)	24	98.95	117.96	9	37.50
11968.	Diego (perroabuelo)	24	47.85	60.69	3	12.50
11969.	Kai (kai_phoenix)	24	52.54	65.05	4	16.67
11970.	ryxn (ryanwithax)	24	43.91	52.01	1	4.17
11971.	Pax (paxx94)	24	65.22	87.30	7	29.17
11972.	corny (cornyjacobie)	24	70.61	88.94	22	91.67
11973.	Jeremy (geekjeremy)	24	64.17	74.29	8	33.33
11974.	Sumreen (sumreenr)	24	93.18	138.72	7	29.17
11975.	Arunava (wizardio)	24	53.57	67.22	3	12.50
11976.	Paulo (paulobacelar)	24	79.11	91.28	7	29.17
11977.	Abhinav (kodeabhi)	24	49.37	62.23	1	4.17
11978.	Olivia (b00bs69)	24	56.95	68.26	6	25.00
11979.	ad (adex69)	24	53.69	63.42	3	12.50
11980.	Anupam (anupammajhi)	24	47.07	53.76	4	16.67
11981.	Cabbage (cabbage_)	24	82.65	101.08	8	33.33
11982.	Toby (_toblerone_)	23	78.56	97.86	5	21.74
11983.	Yuudai (zilchdear)	23	46.84	54.53	2	8.70
11984.	maciek (zadtrie)	23	71.42	91.85	8	34.78
11985.	Yarnell (ytoei)	23	75.57	92.09	5	21.74
11986.	Yelnur (ye1nur)	23	48.54	56.06	4	17.39
11987.	craster (yaboiedgy)	23	82.44	96.16	11	47.83
11988.	Kevin (xertheon)	23	108.57	129.11	7	30.43
11989.	xCocoaCrazy (xcocoacrazy)	23	75.08	93.17	9	39.13
11990.	tstats[wimbleimble] (wimble...	23	94.55	122.00	5	21.74
11991.	Georgios (vlassonio)	23	53.59	64.12	5	21.74
11992.	BadTyper (very_really_bad_t...	23	43.56	50.40	3	13.04
11993.	Varun (varuns924)	23	82.79	105.18	6	26.09
11994.	uuind (uuind)	23	117.66	134.81	11	47.83
11995.	Aaron (unrealapex)	23	82.59	102.30	11	47.83
11996.	andrei (uncleandre)	23	88.08	119.52	8	34.78
11997.	speed420 (uhfees)	23	59.01	71.97	2	8.70
11998.	Jotaro (udetha)	23	86.48	106.69	6	26.09
11999.	Uddi (uddi_racer19)	23	49.63	63.28	2	8.70
12000.	Sorin (tur7le0010)	23	97.38	119.31	14	60.87
12001.	Tselmeg (tselmegkh)	23	101.67	126.54	15	65.22
12002.	Hao (truonganhhao)	23	87.45	107.82	8	34.78
12003.	Sheraz (toruowo)	23	87.39	109.15	8	34.78
12004.	Aj (toppingsplease)	23	99.22	107.59	11	47.83
12005.	tobia (tobiabig)	23	52.48	61.88	3	13.04
12006.	Stray (tiemevanderhoek)	23	50.18	67.84	6	26.09
12007.	bob (thot_slayer420)	23	90.78	107.58	3	13.04
12008.	Thor (thorthegodoflightning)	23	38.96	53.92	1	4.35
12009.	SenPIe (thesenpie)	23	75.24	88.77	5	21.74
12010.	Natapon (tetracarboxylic)	23	75.94	84.84	4	17.39
12011.	Tayyab (tayyabismail149)	23	50.60	65.69	7	30.43
12012.	Tandy (tandysu)	23	107.46	134.62	12	52.17
12013.	syswinh (syswinh)	23	89.95	103.65	9	39.13
12014.	Steve (stevocat)	23	68.55	80.20	12	52.17
12015.	Turtle (stevetheturtle)	23	76.32	86.07	5	21.74
12016.	Cássio (ssscassio)	23	80.70	91.47	3	13.04
12017.	Fite (squidderp)	23	90.35	107.36	7	30.43
12018.	devansh (speedcuber05)	23	45.27	54.06	4	17.39
12019.	spectrophobia (spectrophobia)	23	38.95	51.19	1	4.35
12020.	Slim (slimkevin)	23	60.00	67.03	4	17.39
12021.	Dkippy (sirdunklenutsiii)	23	92.39	108.47	6	26.09
12022.	Roi (sibo532)	23	86.54	102.02	6	26.09
12023.	shebaw (shebaw)	23	97.19	115.28	7	30.43
12024.	Justin (shaowen)	23	118.31	131.49	12	52.17
12025.	shanranran (shanranran)	23	93.91	111.23	7	30.43
12026.	Shamim (shamimiqram)	23	56.86	68.83	3	13.04
12027.	Mazze (shadyone)	23	74.35	86.87	10	43.48
12028.	oShado (shadowwalker15)	23	87.20	108.25	6	26.09
12029.	Sebastian (sfmiguez)	23	96.99	127.37	9	39.13
12030.	Ellie (senimoo)	23	116.68	150.67	11	47.83
12031.	Kayden (semitart)	23	49.19	59.08	4	17.39
12032.	John (seaofnonsense)	23	99.40	118.28	10	43.48
12033.	scsdawg (scsdawg)	23	77.75	102.55	5	21.74
12034.	santi (santimcc)	23	61.44	69.22	2	8.70
12035.	Sameer Gupta (sammyonswitch)	23	72.44	85.09	4	17.39
12036.	Chris (s3r4ph)	23	45.49	59.01	2	8.70
12037.	Lukas (s018296)	23	108.94	124.90	12	52.17
12038.	NotRyan (ryantheexiled)	23	98.57	123.41	11	47.83
12039.	justin (rold_jisas)	23	80.12	91.40	5	21.74
12040.	richardhead (richardhed)	23	123.35	148.55	13	56.52
12041.	Kyle (rexi_typed_you)	23	60.79	69.06	13	56.52
12042.	Remark (remark21)	23	76.50	86.85	8	34.78
12043.	Reflex1on (reflexion)	23	91.44	113.63	7	30.43
12044.	RedXIII (red_xiii)	23	81.95	94.40	7	30.43
12045.	¯\_(ツ)_/¯ (raredutchkil...	23	85.05	103.87	6	26.09
12046.	Rajesh (rajeshpanjiyar)	23	41.95	51.41	3	13.04
12047.	R4ven (r4ven)	23	80.73	94.83	4	17.39
12048.	Adrian (r3ko5)	23	81.20	98.50	4	17.39
12049.	Hayden (r1plee)	23	72.21	94.04	8	34.78
12050.	qtq🐇🍊🍰 (qtqtq)	23	91.16	103.48	5	21.74
12051.	Jacob (q2q1wwe)	23	82.98	96.92	6	26.09
12052.	Trent (priyank45)	23	83.09	109.37	14	60.87
12053.	Pritom (pritom_99)	23	56.53	67.80	4	17.39
12054.	Nobody (pengfire)	23	95.39	116.62	10	43.48
12055.	Peanut (peanutpocket)	23	119.70	135.69	8	34.78
12056.	paffy (paffy77)	23	87.75	103.31	8	34.78
12057.	Paddy (paddyclohessy12)	23	68.99	81.21	7	30.43
12058.	P00nsl4y3r (p00nsl4y3r)	23	64.39	76.17	4	17.39
12059.	hi lol (overdosednq)	23	126.70	158.63	17	73.91
12060.	Osfbro (osfbroofficial)	23	44.73	52.14	3	13.04
12061.	أُمنية (omnitypewriter)	23	86.42	105.44	6	26.09
12062.	Bakdauet (omir)	23	53.38	63.11	2	8.70
12063.	Ojal (ojhhhal)	23	96.26	105.89	6	26.09
12064.	Nicholas (nxcholas)	23	80.85	89.97	6	26.09
12065.	Nuboo (nuboo)	23	117.15	142.94	14	60.87
12066.	Kian (noob123af)	23	61.26	73.06	3	13.04
12067.	noob (nonquitburner)	23	125.11	146.23	10	43.48
12068.	Nesto (nesto2042)	23	72.44	91.45	2	8.70
12069.	Tijme (nemjit)	23	70.26	83.55	4	17.39
12070.	Neeraj (neeraj_kumar_coder)	23	77.32	93.18	4	17.39
12071.	Stephanie (naderly)	23	76.46	85.93	4	17.39
12072.	Murad (muradeliyev)	23	69.01	82.24	8	34.78
12073.	Hugh (mrpiface101)	23	109.38	124.66	11	47.83
12074.	Max (mpschorr)	23	94.86	111.25	2	8.70
12075.	Max (mpegasus)	23	97.94	107.43	8	34.78
12076.	Moy (moy231)	23	72.33	83.90	6	26.09
12077.	Anton (mojo98)	23	67.63	91.28	6	26.09
12078.	Tom (mlgplayer)	23	90.44	109.65	7	30.43
12079.	Mimsqueeze (mimsqueeze)	23	75.56	94.60	6	26.09
12080.	Mike (mike_shen)	23	96.70	115.75	10	43.48
12081.	Mike (micko34)	23	86.52	116.26	5	21.74
12082.	Barry Allan (messylingard)	23	69.75	80.82	3	13.04
12083.	amy (mesemi)	23	98.36	115.40	12	52.17
12084.	Caleb (meow4562)	23	88.75	106.76	5	21.74
12085.	Faruk (megaracer_faruk17)	23	89.42	106.35	10	43.48
12086.	Maestro (meessus)	23	104.19	131.62	20	86.96
12087.	MaxMul (maxmul)	23	83.22	106.89	11	47.83
12088.	Max (maxmeza)	23	80.63	99.01	6	26.09
12089.	Matthew (matthew_hall2)	23	95.93	119.11	6	26.09
12090.	Makhambet (markiz)	23	76.70	94.37	4	17.39
12091.	Marcus (marcus_t)	23	68.81	78.41	5	21.74
12092.	Manzood (manzood)	23	83.14	93.34	7	30.43
12093.	Mangopod (mangopod_)	23	62.49	75.50	6	26.09
12094.	Capricorn (mangosquirrel)	23	105.95	119.65	9	39.13
12095.	Yuan (lydxlx)	23	123.54	130.87	4	17.39
12096.	lunarised (lunarised)	23	62.67	71.71	7	30.43
12097.	Lumberjack (lumberpython)	23	89.48	109.43	7	30.43
12098.	Lucas (lucasppestana)	23	66.77	83.21	5	21.74
12099.	Potato (lovlieice)	23	95.54	119.07	13	56.52
12100.	sarang (lovejoy)	23	54.30	63.10	1	4.35
12101.	Minwoo (lotuszero)	23	66.39	78.64	3	13.04
12102.	Carlos (lagoon_monster)	23	80.47	90.44	6	26.09
12103.	laamiya (laamiya)	23	43.11	49.09	2	8.70
12104.	Kyle (kyleoh)	23	90.19	106.11	9	39.13
12105.	krishna (krishnad)	23	74.14	86.54	2	8.70
12106.	Miko (kimonoso)	23	87.61	102.17	8	34.78
12107.	ye ye (kermatt3)	23	92.85	130.16	10	43.48
12108.	kalirocketdev (kalirocketdev)	23	64.26	83.78	5	21.74
12109.	Eman (kaido187)	23	48.47	60.13	3	13.04
12110.	Jem (j_enchev)	23	78.65	91.00	5	21.74
12111.	Justine (justine_02003)	23	47.42	61.22	1	4.35
12112.	Foolish (justashish4556)	23	59.28	66.86	8	34.78
12113.	Joel (jsandyt9)	23	91.17	111.29	5	21.74
12114.	Jon (jrowephoto)	23	94.38	125.48	7	30.43
12115.	Johanna (johanna9813)	23	81.65	91.67	8	34.78
12116.	Jiang (jghjianghan)	23	85.73	109.53	6	26.09
12117.	Jacobi (jevtrout)	23	64.82	77.03	5	21.74
12118.	CommanderJiJi (jeromealmogu...	23	54.93	67.14	3	13.04
12119.	McVitie’s (jdfjdghnjdjdf)	23	51.70	64.74	4	17.39
12120.	Jc (jcamp0)	23	66.42	79.00	7	30.43
12121.	Andre (jahraccoon69)	23	103.57	115.33	10	43.48
12122.	Jahir (jahir___)	23	58.31	72.42	6	26.09
12123.	Jerry (j27smith)	23	70.11	100.86	5	21.74
12124.	JoY (j0y_y)	23	73.14	86.50	4	17.39
12125.	ISeeRed (iseered)	23	62.59	73.92	5	21.74
12126.	IRDunno (irdunno)	23	57.91	70.18	7	30.43
12127.	ilman (ilmannafj)	23	35.49	40.97	1	4.35
12128.	Splitslayer Chill (ikramnisar)	23	50.39	68.04	5	21.74
12129.	Devanshu (iamdevanshu)	23	50.26	55.88	3	13.04
12130.	WiteLightningHWD (hwds1)	23	73.98	99.26	7	30.43
12131.	Michael (hulkmagnet)	23	87.96	99.42	6	26.09
12132.	asian (hugeterror)	23	72.38	88.52	5	21.74
12133.	Heino (hsirvio)	23	107.90	117.42	16	69.57
12134.	House (houses)	23	81.79	96.42	3	13.04
12135.	James (hot_panty_dropper)	23	94.74	104.77	5	21.74
12136.	stand with russia (hellofki...	23	71.58	82.20	9	39.13
12137.	heehee (heehee2)	23	55.06	70.12	2	8.70
12138.	hau (hau1228)	23	73.30	93.59	5	21.74
12139.	Hani (hanibchl)	23	73.52	88.05	9	39.13
12140.	HallowSamurai (hallowsamurai)	23	32.77	38.56	1	4.35
12141.	gog (guanquan)	23	80.07	96.45	12	52.17
12142.	Johnny (gonzales_x_dumpy)	23	114.43	131.08	11	47.83
12143.	geo (geomateyt)	23	55.13	68.85	20	86.96
12144.	Geirdriful (geirdriful)	23	81.63	99.21	4	17.39
12145.	GameChaos (game_chaos)	23	97.52	113.15	9	39.13
12146.	Gotcha (g0tcha)	23	90.51	116.77	7	30.43
12147.	G Dragon (g.w.l.griffiths@b...	23	63.08	76.97	5	21.74
12148.	F u r u y á (furuya)	23	110.67	129.36	10	43.48
12149.	Даниел (freewaydani)	23	99.22	122.03	13	56.52
12150.	Floixman (floixman)	23	90.17	110.65	11	47.83
12151.	James (fisher_man08)	23	36.10	41.98	2	8.70
12152.	Dan (fireliar)	23	72.18	79.24	3	13.04
12153.	Jimrey (filipinoboi)	23	82.78	108.07	8	34.78
12154.	Fiha (fiha16)	23	59.01	71.53	11	47.83
12155.	Mercapto (fast_typer10)	23	48.45	63.92	1	4.35
12156.	wuque pink (exanta)	23	95.57	122.83	7	30.43
12157.	Muhammad (exampz)	23	64.88	81.70	4	17.39
12158.	Danny (evolt)	23	66.52	79.73	6	26.09
12159.	Theodore (erodoeht)	23	93.59	111.28	8	34.78
12160.	Eragon (eragon_kaizen)	23	29.50	44.11	4	17.39
12161.	Yihoi (equation)	23	103.49	117.20	15	65.22
12162.	Alex (epintus)	23	95.87	112.67	12	52.17
12163.	KaoruLikesMakotoYukiTooMuch...	23	65.63	79.01	5	21.74
12164.	Eliana (elianaswagmama)	23	79.74	104.01	10	43.48
12165.	Michael (eilreivax)	23	101.20	117.91	4	17.39
12166.	fwEWE (edward3001)	23	101.29	134.56	18	78.26
12167.	D (d_4biden1)	23	95.58	107.47	4	17.39
12168.	Raghupati (double_toned)	23	65.79	76.35	8	34.78
12169.	kaatak_kataak (doggie0985)	23	75.82	97.69	7	30.43
12170.	DFA (dj2119)	23	102.69	123.25	9	39.13
12171.	Devin (distortedharmony)	23	97.36	125.34	11	47.83
12172.	Dimitar (dimitar2424)	23	93.64	111.23	12	52.17
12173.	Dillon (dillon147852)	23	67.18	80.28	7	30.43
12174.	no ring finger (denebaltair)	23	128.61	145.74	15	65.22
12175.	Lulu (def__init__)	23	84.24	101.67	6	26.09
12176.	Daryll (daryll_ko)	23	96.48	110.29	13	56.52
12177.	dawdad (darkschore)	23	102.26	116.38	12	52.17
12178.	lalit (daredevil_5859)	23	66.23	90.40	6	26.09
12179.	Dnyanendra (danyk_16)	23	68.47	80.39	6	26.09
12180.	Danger Guy (dangerguy)	23	95.11	116.06	9	39.13
12181.	Dan (danclevia)	23	65.70	70.93	4	17.39
12182.	cynthia (cynthiween)	23	58.19	69.99	6	26.09
12183.	cuong (cuongbt91)	23	84.24	92.52	8	34.78
12184.	Ari (cuda_)	23	90.43	105.57	10	43.48
12185.	jurc (cruj)	23	43.97	51.92	2	8.70
12186.	copter28 (copter28)	23	85.82	104.20	9	39.13
12187.	Rony (cleff)	23	102.14	125.57	22	95.65
12188.	CHi (chiyippi)	23	41.69	54.33	3	13.04
12189.	Chez (chezdude)	23	93.10	103.65	12	52.17
12190.	Char (char_meleon)	23	87.21	108.28	5	21.74
12191.	lixir (catjam)	23	42.68	57.23	2	8.70
12192.	cathating89-dvorak (cathati...	23	92.34	116.60	7	30.43
12193.	Obama (captnawesome)	23	73.34	84.29	6	26.09
12194.	capo (caporv)	23	95.06	108.50	9	39.13
12195.	Malupet si (bugret)	23	66.60	80.73	9	39.13
12196.	Bree (briannanimal)	23	68.89	87.37	11	47.83
12197.	Bread (bread_store)	23	85.55	102.27	5	21.74
12198.	Bodzio (boguslav)	23	73.43	84.22	9	39.13
12199.	bobaglow (boabglow)	23	75.24	94.87	3	13.04
12200.	Figo (bmfc4444)	23	72.57	88.64	6	26.09
12201.	Gaurav (blockcipherr)	23	50.47	62.49	1	4.35
12202.	blandfoodman (blandfoodman)	23	68.48	83.20	6	26.09
12203.	Blaku (blaku03)	23	64.26	75.66	10	43.48
12204.	type beats (blackjack245)	23	80.31	99.10	9	39.13
12205.	Sean (bigdinky)	23	123.94	145.59	13	56.52
12206.	BigBoiB (bigboib)	23	63.79	70.28	5	21.74
12207.	BrocK (bhagvat17)	23	47.46	55.63	0	0.00
12208.	BigDiqSix9 (bernazrei69)	23	89.05	105.44	10	43.48
12209.	Chicken (bbqsauceonmytitties)	23	86.85	103.33	9	39.13
12210.	TheGod (bboytheqt)	23	72.07	83.34	7	30.43
12211.	Rohan (barney564)	23	72.80	85.29	10	43.48
12212.	bambam (bambamshazam)	23	76.06	86.53	8	34.78
12213.	Grace (baddestbich69)	23	89.83	101.59	6	26.09
12214.	A.S.M.777 (a_s_m_777)	23	84.39	102.56	7	30.43
12215.	Ayera (ayera_04)	23	48.02	55.03	2	8.70
12216.	Aubrey (awbrey)	23	44.11	59.96	2	8.70
12217.	Andrew (awand0806)	23	111.45	129.11	13	56.52
12218.	fast_and_curious (asimali246)	23	94.99	109.94	7	30.43
12219.	asdf (asdfdsasdfdsasdf)	23	43.93	53.89	2	8.70
12220.	Arif (arif224)	23	67.57	78.65	7	30.43
12221.	Anduin (anduin2017)	23	85.75	97.34	6	26.09
12222.	an0ma1y (an0ma1y)	23	92.59	107.97	9	39.13
12223.	Asir Mosaddek (amsakib)	23	64.98	78.36	16	69.57
12224.	alieb (alieb)	23	122.95	151.74	14	60.87
12225.	Coolman (alibekesanov)	23	57.87	70.58	3	13.04
12226.	Aiman (aiman_a)	23	97.84	110.38	10	43.48
12227.	Ian (agenti23)	23	111.18	127.96	11	47.83
12228.	(accelerated)	23	132.06	150.16	18	78.26
12229.	Abhishek (abhi_bharti)	23	48.62	60.93	2	8.70
12230.	abelrobot (abelrobot)	23	86.72	104.85	7	30.43
12231.	Aarif (aarif_a)	23	85.94	99.37	5	21.74
12232.	Wolfie (aaradhya10)	23	80.37	95.30	15	65.22
12233.	Andrei (aandreixon)	23	81.18	95.37	6	26.09
12234.	I'm stuck (666769)	23	78.54	93.34	5	21.74
12235.	mm (613sadnesses)	23	143.84	171.05	15	65.22
12236.	Angelo (2teletabiez)	23	66.60	78.87	3	13.04
12237.	_ (2sloww)	23	62.41	72.21	4	17.39
12238.	Hugo (21039)	23	62.37	73.88	4	17.39
12239.	Kevin (1kevstahz)	23	98.55	118.09	16	69.57
12240.	10 (10thetypist)	23	78.44	88.28	4	17.39
12241.	Ben (01ben10)	23	89.98	108.67	6	26.09
12242.	Zakaria (zakariaarzoo)	23	54.60	63.85	5	21.74
12243.	musavir (musa_2020)	23	43.04	49.64	3	13.04
12244.	Geoffrey (cybrxt)	23	76.62	89.56	18	78.26
12245.	Kevin (aightwhoshitmyself)	23	77.16	92.51	6	26.09
12246.	Aldan (aldany)	23	73.83	89.01	7	30.43
12247.	samarth joel (samjrin)	23	47.88	57.97	3	13.04
12248.	Tommy (tomister99)	23	68.86	80.02	7	30.43
12249.	Kerele (kerele)	23	90.45	104.20	12	52.17
12250.	Abir (abir247)	23	57.84	79.82	4	17.39
12251.	Bas (bas_hoeflaak)	23	77.02	89.55	7	30.43
12252.	Jake (jake_craven)	23	57.35	69.82	4	17.39
12253.	Michael (zmjcb)	23	65.76	82.11	6	26.09
12254.	Spider (spidey13)	23	57.90	73.19	7	30.43
12255.	Dredd (dredd20)	23	67.39	87.32	9	39.13
12256.	Maltha (malthazen)	23	52.25	64.08	1	4.35
12257.	Lezzgo (romsky1)	23	42.12	50.02	2	8.70
12258.	Anudari (anuka01)	23	51.76	62.82	0	0.00
12259.	Lesley (powerchopper)	23	81.04	99.42	7	30.43
12260.	J D (2ralph2)	23	78.52	95.97	23	100.00
12261.	Parsa (pblague)	23	51.20	64.42	2	8.70
12262.	Mohanad (nogaf)	23	64.70	71.79	4	17.39
12263.	EATMYDUST (bwisus)	23	70.11	82.14	10	43.48
12264.	eren (eren_lee)	23	35.07	41.98	1	4.35
12265.	Christian (mista_chris)	23	38.46	52.53	14	60.87
12266.	JULIANA (siwon22)	23	60.90	73.96	4	17.39
12267.	fusekle2226 (fusekle2226)	23	36.18	43.43	0	0.00
12268.	Alex (alexkov)	23	48.89	57.33	4	17.39
12269.	Nik (nikb89)	23	35.02	47.09	2	8.70
12270.	geczy (barnageci)	23	98.68	124.85	9	39.13
12271.	Nay (naykuku228)	23	58.44	66.76	6	26.09
12272.	Kevin (klinklang)	23	76.06	87.19	7	30.43
12273.	munna (munna13)	23	48.82	59.04	1	4.35
12274.	Airidas (airisr)	23	75.65	87.57	4	17.39
12275.	anu (_anu)	23	33.59	41.23	0	0.00
12276.	No (jsonwg)	23	92.67	113.04	10	43.48
12277.	Yashi (_o_wobless)	22	50.47	64.30	2	9.09
12278.	KIRA (_arik_)	22	43.23	49.99	4	18.18
12279.	Ryley (zqroh)	22	59.68	71.13	4	18.18
12280.	Zerieox (zerieox)	22	84.21	105.14	5	22.73
12281.	That One Guy (zbomber21)	22	115.45	142.54	21	95.45
12282.	Eric (yuurrrrr)	22	85.86	95.75	5	22.73
12283.	Brody (yuumi)	22	109.20	135.14	14	63.64
12284.	maro (yenic)	22	64.08	74.52	3	13.64
12285.	Yegor (yegorshevchenko)	22	50.13	58.10	2	9.09
12286.	Yassine (yassinejedidi)	22	69.59	94.63	13	59.09
12287.	Yaroslav (yaros)	22	67.06	77.23	9	40.91
12288.	momo (yaomomo)	22	79.58	94.87	9	40.91
12289.	Xzereath (xzereath)	22	95.59	119.47	11	50.00
12290.	Wattery (xwattery)	22	43.75	53.56	0	0.00
12291.	willybear (willybear)	22	83.79	100.03	5	22.73
12292.	b (whylxve)	22	69.90	84.13	3	13.64
12293.	eqwt (whuhu)	22	113.08	136.02	17	77.27
12294.	Jonas (whatisupyou)	22	115.18	129.92	14	63.64
12295.	vyst (vystoric)	22	129.17	141.71	16	72.73
12296.	Vinit (vspundir)	22	45.68	55.23	1	4.55
12297.	vishnu (visshnu)	22	51.97	62.70	1	4.55
12298.	VibrantVanilla (vibrantvani...	22	78.16	97.13	6	27.27
12299.	Hiren (userhiren)	22	61.01	76.98	6	27.27
12300.	Samay (upadsamay387)	22	77.11	93.07	3	13.64
12301.	Umid (umid2000)	22	66.10	77.89	4	18.18
12302.	Umair (umairkhan)	22	77.96	86.52	7	31.82
12303.	typingboob (typingboob)	22	60.72	71.43	4	18.18
12304.	Sub-Par (typerslower)	22	111.13	121.25	12	54.55
12305.	Rajveer (typerfastboi27_)	22	62.39	85.13	5	22.73
12306.	Triloluc (triloluc)	22	91.05	105.85	11	50.00
12307.	Ohh (trappy24)	22	77.64	97.74	5	22.73
12308.	ucsd_kid (trainermax)	22	157.18	183.32	19	86.36
12309.	Theodor (thimius)	22	86.28	101.63	10	45.45
12310.	Phil (themonk)	22	98.42	118.35	7	31.82
12311.	Chris (themainchris)	22	78.30	90.84	9	40.91
12312.	(thebob2713)	22	60.75	77.24	6	27.27
12313.	temazh (temazh)	22	77.26	90.59	6	27.27
12314.	Caleb (syfulis)	22	91.14	105.63	5	22.73
12315.	Sumnerbean (sumnerbean)	22	60.39	80.14	6	27.27
12316.	Stranger (stranger_danger1224)	22	45.73	62.99	1	4.55
12317.	misty (sprainedartery)	22	95.02	113.58	9	40.91
12318.	Papa (solutional)	22	100.12	122.37	11	50.00
12319.	Alexander (solchild)	22	75.73	85.78	8	36.36
12320.	soda (sodafortwo)	22	72.59	81.35	7	31.82
12321.	RougeGod (socratic74)	22	64.73	71.35	6	27.27
12322.	ki (slutsupreme)	22	103.61	127.97	6	27.27
12323.	green (sleepingducksanddrag...	22	38.89	45.78	2	9.09
12324.	Leah (slanted_sunlight)	22	89.68	99.22	9	40.91
12325.	rai (siomaipusa)	22	83.64	109.85	12	54.55
12326.	simon (simonnoin)	22	64.99	78.06	8	36.36
12327.	Shunrai (shunrai1110)	22	95.27	123.25	9	40.91
12328.	shorty (shortygiant)	22	53.61	65.82	4	18.18
12329.	Shome (shmoe9806)	22	65.43	73.86	5	22.73
12330.	catboy (sheepando)	22	111.23	123.19	7	31.82
12331.	Sheel (sheel)	22	102.48	113.80	12	54.55
12332.	WAKing (shashashane)	22	35.66	43.85	1	4.55
12333.	Shannon (scthemonk)	22	64.65	76.23	5	22.73
12334.	for reckful (savioshadow)	22	95.53	107.49	8	36.36
12335.	SamSkey (samskey)	22	77.68	94.82	7	31.82
12336.	Shabylkhan (saken03)	22	43.80	53.67	3	13.64
12337.	saad (saad88)	22	63.69	69.51	4	18.18
12338.	Felmer (rustycookieee)	22	86.72	96.63	8	36.36
12339.	Vaccination (roughandtumble)	22	94.32	106.16	5	22.73
12340.	Matt (robertwill)	22	53.11	65.01	2	9.09
12341.	road to 100 (roadtoglobalmc)	22	89.47	110.66	6	27.27
12342.	ヤギ (ringtack)	22	107.46	124.21	13	59.09
12343.	Abdulla (rifah99)	22	79.42	89.28	2	9.09
12344.	Ricky (rictsa05)	22	53.00	62.20	2	9.09
12345.	Ricebowl (ricebowljohnson)	22	100.28	121.58	6	27.27
12346.	rg2005 (rg2005)	22	88.34	111.94	8	36.36
12347.	Dan (reddabbler)	22	63.83	83.12	4	18.18
12348.	Ryan (rdem)	22	54.17	65.22	0	0.00
12349.	Rare (rare_0001)	22	69.07	82.52	6	27.27
12350.	Vinchenzo (qwertyuiopps)	22	94.02	112.89	11	50.00
12351.	Qwerty (qwertyazerty)	22	81.74	94.82	7	31.82
12352.	Saumya (quinn_1)	22	42.57	52.66	3	13.64
12353.	Taksa-orn (proudpi)	22	73.44	96.63	3	13.64
12354.	Parsa (pr8222)	22	50.36	59.40	1	4.55
12355.	Alex (poop_guy)	22	85.08	98.32	3	13.64
12356.	Polar (polishpolarbear)	22	86.60	111.42	9	40.91
12357.	adr (poison_pwn)	22	74.34	86.87	2	9.09
12358.	Ross (pogchammp)	22	84.13	111.07	7	31.82
12359.	Pooh (po0h_)	22	35.91	41.97	1	4.55
12360.	pjja (pjja)	22	115.79	145.30	14	63.64
12361.	a1ways (pi___)	22	104.18	127.50	9	40.91
12362.	Silver (pixel47)	22	97.76	112.47	7	31.82
12363.	pinto (pintozza)	22	79.38	92.36	8	36.36
12364.	Pina (pinapelzx)	22	78.50	94.66	5	22.73
12365.	Pedro (pedroarcem)	22	70.23	81.52	1	4.55
12366.	pebble (pebblewebble)	22	85.22	100.32	7	31.82
12367.	Payu (payu_w)	22	82.76	91.26	1	4.55
12368.	Paul (paul1106)	22	66.93	75.52	5	22.73
12369.	Paksolek (paksolek)	22	54.11	67.12	3	13.64
12370.	V (p3rplexed)	22	89.59	109.39	7	31.82
12371.	Overlay1 (overlay1)	22	63.80	72.48	2	9.09
12372.	rotscatpill (orangetinman)	22	65.31	74.83	7	31.82
12373.	nuttendabutt (nuttendabutt)	22	33.31	37.26	2	9.09
12374.	Umidjon (nouser493)	22	56.52	68.89	17	77.27
12375.	wii (nobodylovesraymond)	22	85.19	98.52	7	31.82
12376.	Nischay (nitrospeed2709)	22	71.94	82.60	8	36.36
12377.	Nels (nels_senti)	22	74.17	91.68	9	40.91
12378.	naomi (naomii_)	22	59.94	71.03	5	22.73
12379.	L + (n1ckname152)	22	93.28	111.15	12	54.55
12380.	MrOkapus (mrokapus)	22	61.46	72.13	7	31.82
12381.	Moodrammer (moodrammer)	22	64.39	73.30	5	22.73
12382.	Md. Mojnu (mojnu20)	22	38.91	43.96	2	9.09
12383.	Jacquelyn (mobear06)	22	89.38	115.20	6	27.27
12384.	Matthew (mmeppelink20)	22	97.84	127.06	10	45.45
12385.	Maddy (mlong)	22	101.46	116.75	11	50.00
12386.	Jake (mjakecarlo)	22	72.60	88.75	9	40.91
12387.	Michael (michaelyang)	22	79.20	92.91	5	22.73
12388.	mercy (mercy_13)	22	64.44	77.52	4	18.18
12389.	carlos (mecsczek)	22	105.46	117.89	11	50.00
12390.	Zia (mechatronic_beast)	22	50.46	60.44	2	9.09
12391.	Paul (mcbain788)	22	95.12	111.41	18	81.82
12392.	Max (maxy_boi)	22	59.54	69.60	11	50.00
12393.	rohan (maverick_mind69)	22	77.67	100.86	4	18.18
12394.	Martin (maniacal_martin)	22	72.57	82.83	2	9.09
12395.	Leslie (mamaleslie81)	22	66.02	82.40	4	18.18
12396.	Mahdi (mahdiranjbar)	22	74.88	86.31	1	4.55
12397.	chie (lotusimpact)	22	86.01	110.87	7	31.82
12398.	John (loki83jcg)	22	93.43	111.12	8	36.36
12399.	lokar (lokar123)	22	144.66	178.80	13	59.09
12400.	Tu Thien (logan1912)	22	64.47	77.71	3	13.64
12401.	llihcchill (llihcchill)	22	70.78	84.76	6	27.27
12402.	lulu (llaurenlouise)	22	54.21	64.12	3	13.64
12403.	Liz (lizfrizzle)	22	103.48	133.88	8	36.36
12404.	Light (lighteous_)	22	72.29	94.98	6	27.27
12405.	Licery (licery)	22	61.90	73.75	7	31.82
12406.	lgwk (lgwk)	22	51.89	58.73	0	0.00
12407.	Ryekane🖤 (lechepapu)	22	135.03	164.86	8	36.36
12408.	Lapis (lapis_pislapis)	22	125.74	176.13	15	68.18
12409.	Kumar (kumar_thapa1)	22	78.47	87.01	7	31.82
12410.	krupa (krups)	22	63.68	84.15	3	13.64
12411.	Daniel (korice)	22	92.92	124.00	5	22.73
12412.	Adam (koltaia30)	22	65.61	79.72	8	36.36
12413.	John (kobas)	22	48.14	56.56	1	4.55
12414.	Annabelle (kiwi_punk)	22	64.08	80.59	5	22.73
12415.	Kiki (kiki_)	22	39.86	46.78	0	0.00
12416.	Tushar (kensei22)	22	49.13	54.08	1	4.55
12417.	Kenewbi (kenewbi)	22	71.89	88.57	7	31.82
12418.	Yakhe (ken007)	22	76.50	91.59	10	45.45
12419.	(keegant)	22	152.27	180.56	4	18.18
12420.	Kartavya (kartavyajain)	22	96.75	112.59	11	50.00
12421.	James (karonar)	22	98.06	110.94	6	27.27
12422.	George (karmatimer)	22	73.88	83.44	7	31.82
12423.	Karlsen (karlsenlopez18)	22	90.34	108.98	6	27.27
12424.	Jacob (karagiannis1)	22	56.34	65.64	1	4.55
12425.	Kanzi (kanzi)	22	70.02	80.74	7	31.82
12426.	kage (kage_bigfoot)	22	61.78	74.47	7	31.82
12427.	j (jy22019)	22	55.02	63.28	0	0.00
12428.	Je (jxnnele)	22	56.42	72.57	17	77.27
12429.	jujufrost (jujufrost)	22	73.01	86.19	3	13.64
12430.	JTD845 (jtd845)	22	94.21	107.96	15	68.18
12431.	God (jpaul100)	22	71.94	86.02	6	27.27
12432.	Joy (joyyang810035)	22	87.99	118.20	8	36.36
12433.	Joshua (joshuamtinker)	22	62.31	87.21	3	13.64
12434.	Jordan (jordy2394)	22	41.80	49.40	2	9.09
12435.	Jeydin21 (jeydin21)	22	81.49	101.32	9	40.91
12436.	Jess (jessnixon94)	22	106.75	129.75	7	31.82
12437.	Jen (jenniferrocks07)	22	97.23	115.29	7	31.82
12438.	Jenbi (jenbi)	22	75.89	89.04	3	13.64
12439.	MrKK (jeldikk)	22	72.65	85.64	4	18.18
12440.	J (jduncanlee)	22	106.58	132.33	11	50.00
12441.	jazzy (jazzy_trojan)	22	85.39	102.61	8	36.36
12442.	jantheman (jantheman21)	22	81.99	119.73	21	95.45
12443.	Jack (jackripper9)	22	53.35	78.77	4	18.18
12444.	JackbroDaeGamer (jackbrothe...	22	63.65	75.57	7	31.82
12445.	izzy (izzyy2)	22	42.71	53.34	13	59.09
12446.	Izzy (izzypistilli)	22	78.55	92.93	10	45.45
12447.	kentei (itskentai)	22	67.43	80.27	7	31.82
12448.	Sigh (isigh)	22	93.48	110.71	11	50.00
12449.	InterLude (interlude)	22	101.61	145.49	10	45.45
12450.	ooo (inout)	22	85.69	105.84	7	31.82
12451.	Ignite (ignite777)	22	68.34	86.69	11	50.00
12452.	jay (icantfeel)	22	59.15	70.25	5	22.73
12453.	Abhijith (iabz)	22	56.09	71.82	3	13.64
12454.	Muhammad (hydra_assassin)	22	61.05	71.95	6	27.27
12455.	Josh (hoverdoge)	22	105.89	133.96	10	45.45
12456.	Kay (hothandj)	22	90.64	110.42	4	18.18
12457.	Jose (hosey_)	22	85.38	104.71	5	22.73
12458.	Stefan (hollownaoya)	22	82.09	99.06	4	18.18
12459.	Hekonii (hekonii)	22	82.12	95.63	2	9.09
12460.	Havenix (havenix)	22	74.14	87.97	4	18.18
12461.	Hasan (hasan95)	22	52.07	66.30	1	4.55
12462.	Товарищ (hamkor)	22	85.26	97.15	9	40.91
12463.	fun (haifiveywivey)	22	98.84	118.78	12	54.55
12464.	hack89 (hack89)	22	63.50	68.59	5	22.73
12465.	Michael (grumos)	22	83.06	92.24	5	22.73
12466.	DaTa (good_vibes)	22	73.22	86.49	8	36.36
12467.	Giorillium (goodguygio)	22	73.96	91.86	3	13.64
12468.	🇲🇳 Mazaalai (goodgodk...	22	97.66	117.30	8	36.36
12469.	Jordan (godlysharky)	22	54.19	68.49	1	4.55
12470.	ginteaa (ginteaa)	22	102.74	116.36	7	31.82
12471.	Gijs (gijs__g)	22	72.86	89.63	7	31.82
12472.	gela (gelacutie)	22	38.33	50.77	5	22.73
12473.	George (gbotev)	22	91.04	101.19	8	36.36
12474.	Jordi (gandalfdablack1)	22	69.90	85.23	5	22.73
12475.	Gabriel (gabrielbutu)	22	86.99	102.97	8	36.36
12476.	Ada (fumingadam)	22	93.98	112.64	10	45.45
12477.	Mary (frailmary)	22	83.21	94.18	6	27.27
12478.	Floriaan (floriaanvb)	22	51.10	58.94	1	4.55
12479.	Atticus crunch (fablesnfobb...	22	91.23	114.54	9	40.91
12480.	Elijah (e___)	22	49.63	68.96	1	4.55
12481.	Flusercluck (explocow)	22	78.65	99.84	6	27.27
12482.	Eslam (eslamalien)	22	45.43	54.72	2	9.09
12483.	erka (erkaboy)	22	76.66	92.59	5	22.73
12484.	eric (eric5000)	22	112.38	136.04	16	72.73
12485.	hotdogs are sandwiches (era...	22	108.28	122.26	6	27.27
12486.	Efgeen (efgeen)	22	100.36	129.99	10	45.45
12487.	Eeegh (eeegh)	22	54.61	69.70	2	9.09
12488.	Dustan (dustank)	22	47.99	57.80	1	4.55
12489.	Dullpig (dullpig)	22	70.11	85.49	4	18.18
12490.	Frederik (drlambogamer)	22	76.03	86.46	12	54.55
12491.	doubleplusgood (doubleplusg...	22	76.36	96.66	3	13.64
12492.	Drew (dmart)	22	73.10	88.84	2	9.09
12493.	A (djakl)	22	101.45	114.86	8	36.36
12494.	Terence (dijkstras)	22	94.42	105.52	5	22.73
12495.	Dev (devyadavv)	22	40.99	49.24	0	0.00
12496.	Suktinis (destrain)	22	71.99	85.13	4	18.18
12497.	Be (deathpulse)	22	113.14	133.46	9	40.91
12498.	Daniel (danielyawn)	22	76.46	94.10	2	9.09
12499.	Diego (daigo356)	22	60.75	69.67	6	27.27
12500.	David (d8vidherrera)	22	108.67	131.91	12	54.55
12501.	Could be you (cycosniper)	22	87.69	113.71	6	27.27
12502.	SJ (cwr_sej)	22	80.47	95.47	3	13.64
12503.	Electric (cuitcuit)	22	97.38	114.19	12	54.55
12504.	Stephanie (cuber155)	22	71.63	86.32	7	31.82
12505.	Crims0n (crimsonnn)	22	67.18	77.18	3	13.64
12506.	Martin (crimsonmartin)	22	76.09	86.37	4	18.18
12507.	Roman (cosmic_mythos)	22	51.49	65.98	4	18.18
12508.	a (coolguy73)	22	104.45	124.54	19	86.36
12509.	Nemanja (conemanija)	22	42.20	53.90	2	9.09
12510.	Clemens (cleminator)	22	59.68	66.31	5	22.73
12511.	Murtaza (chichawww)	22	44.95	57.21	1	4.55
12512.	Captain (captainalliance)	22	67.49	80.26	7	31.82
12513.	caesthetis (caesthetis)	22	107.79	128.13	11	50.00
12514.	John (caduke)	22	90.58	115.83	9	40.91
12515.	LUKAS (brabomclaren)	22	76.37	87.20	6	27.27
12516.	Bozsó (bozso)	22	61.75	77.13	5	22.73
12517.	Bolt7911 (bolt7911)	22	52.69	70.04	6	27.27
12518.	Sabba7 (bodynasser)	22	49.08	61.23	3	13.64
12519.	Inferendum (bloonchipper)	22	68.66	95.63	5	22.73
12520.	bo (biznessmun)	22	102.03	116.88	15	68.18
12521.	Adam (bezwzglednyadas)	22	67.91	81.29	6	27.27
12522.	bepis (bepis_pebis)	22	108.94	125.47	8	36.36
12523.	swagb0y (beckseamons)	22	81.17	99.60	6	27.27
12524.	Bailey (bbrusca98)	22	82.51	98.68	6	27.27
12525.	Austin (austinkg)	22	78.85	90.68	3	13.64
12526.	Kevin (ashret)	22	137.70	169.02	19	86.36
12527.	ashl5t (ashl5t)	22	52.80	80.22	18	81.82
12528.	w (artemisfowl3rd)	22	103.89	130.94	11	50.00
12529.	Armaan_Gill (armaan_gill)	22	66.14	77.47	4	18.18
12530.	FreeHongKong (aquaficial)	22	106.55	130.75	7	31.82
12531.	Antonio (antonio_blueballs)	22	64.85	77.25	6	27.27
12532.	Annabelle (annaballlzz)	22	84.39	96.57	4	18.18
12533.	Anas (anas023)	22	25.22	34.36	7	31.82
12534.	Ana Beatriz (anaporumtriz)	22	43.37	50.26	3	13.64
12535.	tstats[an1ma] (an1ma)	22	46.13	57.44	2	9.09
12536.	area_51 (amritspkt65)	22	62.35	76.13	5	22.73
12537.	poorjar (amgminequality)	22	113.26	133.05	9	40.91
12538.	slippedfinger (alpha_centauri)	22	68.02	78.73	4	18.18
12539.	Jack (alphamale28)	22	98.20	124.58	3	13.64
12540.	Jason (alfa871212)	22	47.86	57.44	5	22.73
12541.	Alex (alexrichardson)	22	51.75	62.18	3	13.64
12542.	Aleksa (aleksa55)	22	66.00	82.61	4	18.18
12543.	Arpit (ak_31loaded)	22	43.64	50.14	2	9.09
12544.	Aids (aids___)	22	98.46	107.91	5	22.73
12545.	Ahnta (ahnta)	22	68.10	80.16	3	13.64
12546.	MD ADNAN (adnantech17)	22	67.30	74.11	3	13.64
12547.	7tysins (acedragonheart)	22	85.62	99.25	9	40.91
12548.	ABHISHEK PATEL (abhi_0601)	22	40.97	54.76	3	13.64
12549.	Abhishek (abhishake12201)	22	40.09	56.72	3	13.64
12550.	Ballistic (8a11istic)	22	70.81	78.96	7	31.82
12551.	Juice (4804210474)	22	66.64	83.91	4	18.18
12552.	Emman (3mm4n)	22	59.78	69.58	6	27.27
12553.	Raggy (a11owed)	22	102.02	115.37	16	72.73
12554.	vi (vipandas)	22	83.37	103.00	10	45.45
12555.	tudgengthorf (tudgengthorf)	22	77.64	93.27	4	18.18
12556.	John (johnwenshoe)	22	95.93	117.96	13	59.09
12557.	Kuya JJ (kuya_jj)	22	48.12	59.97	3	13.64
12558.	Rene (reniaraq)	22	47.20	62.00	15	68.18
12559.	Bryce (bryce4)	22	87.38	105.41	9	40.91
12560.	Isaac (ilikepie3)	22	48.08	60.11	2	9.09
12561.	Cj (emperorblank)	22	48.69	60.44	1	4.55
12562.	Koeliga (koeliga)	22	68.26	78.50	7	31.82
12563.	yo (markus1012)	22	102.79	115.04	12	54.55
12564.	john (joahuaj)	22	35.83	44.18	1	4.55
12565.	wang (wangcai)	22	40.23	48.01	2	9.09
12566.	max (vezorack)	22	53.12	60.99	3	13.64
12567.	reiyashi (reiyashi)	22	108.18	119.89	9	40.91
12568.	Metal09 (metal09)	22	46.62	56.15	1	4.55
12569.	cring (cringeman10021)	22	62.72	76.35	6	27.27
12570.	jozz (danishbun)	22	39.63	53.02	2	9.09
12571.	Tobi (ohcibi)	22	84.85	105.80	8	36.36
12572.	inzemamul (inzi2004)	22	47.54	57.55	3	13.64
12573.	Joey (saria_calla)	22	31.74	38.45	1	4.55
12574.	Nick (envynav)	22	60.69	67.25	4	18.18
12575.	Madelaine (madelaineriddle)	22	54.14	61.95	11	50.00
12576.	cr1xzs (cr1xzs)	22	63.46	73.04	3	13.64
12577.	ali_mehdi (syedmehtab2125)	22	44.49	52.07	1	4.55
12578.	Kevin (kevinchangjk)	22	67.53	86.02	6	27.27
12579.	Dimitar (dnonov)	22	59.17	65.77	2	9.09
12580.	Gotta go (mattjl)	22	107.05	116.17	15	68.18
12581.	Abhishek (abhig)	22	57.18	67.46	4	18.18
12582.	Grandest (grandest)	22	112.13	130.53	12	54.55
12583.	Md (iamtheasad)	22	49.86	59.33	2	9.09
12584.	Arad (aradarbel10)	22	76.76	95.00	7	31.82
12585.	Matt (rapt0rinasuit)	22	48.11	61.72	2	9.09
12586.	Faizan (not_faizan)	22	57.96	77.08	7	31.82
12587.	saugat (typersaugat)	22	44.42	53.31	2	9.09
12588.	Var (varrenleandro)	22	80.37	93.89	9	40.91
12589.	stark16 (stark16)	22	42.26	51.00	1	4.55
12590.	jagraj (jagraj)	22	59.87	68.73	4	18.18
12591.	Zac (kingkapitolz)	22	56.49	70.61	5	22.73
12592.	Lohiek (lohiek)	22	79.66	91.31	22	100.00
12593.	A (__a_)	21	84.75	101.27	6	28.57
12594.	Sourav (_sourav_)	21	29.80	34.69	1	4.76
12595.	beroo (_nwahz)	21	75.66	91.21	11	52.38
12596.	한국사람 아니야 (zlyxx)	21	84.70	110.47	6	28.57
12597.	Ziclue (ziclue)	21	90.25	109.52	8	38.10
12598.	Zemo (zemo77)	21	110.47	124.05	9	42.86
12599.	asdf (zainamjad)	21	80.37	89.28	5	23.81
12600.	wpm + x (x_wpm_more)	21	47.76	56.55	1	4.76
12601.	ximecat (ximecat)	21	113.44	133.08	14	66.67
12602.	wrentay (wrentay)	21	107.76	140.48	6	28.57
12603.	Denny (what_tf_is_up_kyle)	21	59.41	80.73	5	23.81
12604.	Whats (whatsderivative)	21	92.91	104.86	10	47.62
12605.	wayexzee (wayexzee)	21	71.16	80.68	5	23.81
12606.	Murka (wassupbuddy)	21	81.53	100.14	13	61.90
12607.	Gabriel (warbros123)	21	77.93	98.53	9	42.86
12608.	Velyro (velyro)	21	86.18	96.86	7	33.33
12609.	BESTYINA (vdud3)	21	146.90	165.68	17	80.95
12610.	Niko (varial)	21	132.33	154.77	17	80.95
12611.	nat (vanilla7)	21	75.71	94.08	9	42.86
12612.	Villan (v1llan)	21	47.54	54.75	2	9.52
12613.	Eli (uvafan)	21	105.73	123.51	11	52.38
12614.	David (usainturtle)	21	39.49	50.24	2	9.52
12615.	Unique (unique1402)	21	59.69	79.81	7	33.33
12616.	(typist215)	21	83.10	97.00	10	47.62
12617.	reiden (typingreiden)	21	86.97	104.82	6	28.57
12618.	Asters (typer1typer)	21	101.69	117.57	9	42.86
12619.	Nabil (twin_n)	21	64.66	86.03	2	9.52
12620.	TrOn (tron_691)	21	44.46	50.92	1	4.76
12621.	Top (tophatjones)	21	100.70	114.45	21	100.00
12622.	Le Van (tlong900)	21	71.71	82.41	8	38.10
12623.	Tony (tjzhao)	21	56.87	70.88	4	19.05
12624.	tjk113 (tjk113)	21	89.35	105.58	6	28.57
12625.	Tim (timduh)	21	52.07	59.04	3	14.29
12626.	Matsvei (tictacfruit)	21	70.52	80.96	5	23.81
12627.	Thursday (thursdays)	21	106.69	123.77	9	42.86
12628.	Raymond (thiccthighs)	21	67.81	81.28	1	4.76
12629.	CJ (the_winner_is_here)	21	57.31	70.20	4	19.05
12630.	Hayden (the_dizzler)	21	85.35	99.55	8	38.10
12631.	Devids (theneo)	21	107.59	126.89	8	38.10
12632.	Albert (thehacker08)	21	63.84	73.19	3	14.29
12633.	budda (theblackeye)	21	102.05	120.58	9	42.86
12634.	th (thanasis2002)	21	93.79	112.30	12	57.14
12635.	Reanu (terrenceskill)	21	56.88	67.87	3	14.29
12636.	A (taffing)	21	71.01	82.13	0	0.00
12637.	Priyabrata (s_h_a_r_k)	21	47.76	53.66	2	9.52
12638.	sai (syrus_dhark)	21	49.02	61.33	1	4.76
12639.	sus99hant (sus99hant)	21	60.70	73.89	4	19.05
12640.	Avi (suppppp)	21	72.75	83.95	5	23.81
12641.	Demon (sun_voca)	21	101.55	116.09	5	23.81
12642.	Krystal (sunshinenmyeyes)	21	81.49	103.02	6	28.57
12643.	Subhaan (subhaan)	21	79.82	97.22	4	19.05
12644.	beiluo (beiluo)	21	64.29	74.29	9	42.86
12645.	Oakton (oakton)	21	42.68	60.95	2	9.52
12646.	squishyiop (squishyiop)	21	44.51	62.06	1	4.76
12647.	Speedwalker (speedwalker68)	21	63.56	74.65	2	9.52
12648.	Soulreaper (soulreaperdeath...	21	63.96	76.14	4	19.05
12649.	slow typer (slooowest_typer)	21	58.47	72.63	2	9.52
12650.	Sir (sirmaax)	21	72.55	103.30	6	28.57
12651.	Silvia (silvia_thenan)	21	75.10	95.89	6	28.57
12652.	Shikhar (shikhar_tyagi)	21	100.45	115.02	10	47.62
12653.	shau (shauwei_0510)	21	64.10	79.74	4	19.05
12654.	Indian_Lad (shashank5665)	21	52.83	60.74	2	9.52
12655.	shailendra (shailendraji)	21	53.33	61.89	1	4.76
12656.	Shahmir (shahmirishere)	21	93.70	115.57	10	47.62
12657.	Shaheer (shaheer49)	21	64.18	71.08	6	28.57
12658.	scqrch (scqrch)	21	60.65	66.30	4	19.05
12659.	SaltyHobo (saltyhobo)	21	88.53	105.36	6	28.57
12660.	Sharif (sa524402)	21	26.89	37.95	5	23.81
12661.	Rylez (rylezyt)	21	65.98	78.13	7	33.33
12662.	Rory (roricus)	21	72.09	84.29	5	23.81
12663.	ron (ronk17)	21	66.36	73.32	4	19.05
12664.	Rodrigo (rodplaying)	21	47.12	53.06	1	4.76
12665.	Robert (robertgrylls)	21	70.34	83.67	8	38.10
12666.	Hans (retrovibes_11)	21	91.23	105.41	11	52.38
12667.	redhotdancer1821 (redhotdan...	21	97.62	114.59	6	28.57
12668.	Rebekah (rebekahtomski)	21	65.13	74.34	4	19.05
12669.	Rawat (rawat_shiv)	21	43.64	51.01	3	14.29
12670.	Rafail (raphaelpap)	21	68.92	82.57	20	95.24
12671.	Nick (rageemy)	21	102.59	114.32	14	66.67
12672.	Rae (rae149)	21	61.05	79.21	5	23.81
12673.	Zuko (rachet_22)	21	91.30	109.61	7	33.33
12674.	Sebastian (racermaster_)	21	59.55	72.22	2	9.52
12675.	quat (quat)	21	97.79	112.47	7	33.33
12676.	Hung (qhung312)	21	77.38	86.83	4	19.05
12677.	Kong (qbored)	21	47.35	53.83	1	4.76
12678.	Stuart (psephos)	21	93.41	114.47	6	28.57
12679.	Prashant (prashant_204)	21	70.85	92.45	4	19.05
12680.	ตาแดง (pitagorus)	21	88.42	99.17	5	23.81
12681.	Philip (philr12)	21	79.75	91.13	5	23.81
12682.	shea (pengu1927)	21	69.49	82.01	5	23.81
12683.	Peachbird (peachbird)	21	51.38	65.66	6	28.57
12684.	paxuy (paxuy)	21	68.62	80.51	3	14.29
12685.	Patrick (patrick_st4r)	21	65.61	75.66	9	42.86
12686.	boop (owiwchu)	21	63.21	72.16	2	9.52
12687.	FREE PALESTINE (os1506)	21	80.95	92.68	5	23.81
12688.	orangie (orangie_)	21	47.50	57.56	2	9.52
12689.	Adrian (orangebase)	21	131.34	147.57	15	71.43
12690.	Omsin (omsinkrissada)	21	83.00	96.80	8	38.10
12691.	S0R4 (omniores22)	21	94.80	110.64	8	38.10
12692.	Nazmus (nxbot)	21	53.66	64.11	2	9.52
12693.	number1 (number1racer)	21	45.99	54.31	2	9.52
12694.	Nully (nullly)	21	74.79	96.62	5	23.81
12695.	Noxellar (noxellar)	21	93.52	108.09	7	33.33
12696.	William (not_your_username)	21	67.34	92.22	4	19.05
12697.	notkailey (notkailey)	21	85.04	98.50	9	42.86
12698.	noob_master (noob_master_6_9)	21	65.01	74.86	5	23.81
12699.	Nicolai (nicolair222)	21	102.33	114.36	5	23.81
12700.	Nick (nickbanderson)	21	85.87	111.20	12	57.14
12701.	Blac (nice_tea)	21	72.50	93.12	6	28.57
12702.	Narayan (narayan2002)	21	58.85	73.49	16	76.19
12703.	AgniArse (n3ug13rd3)	21	79.67	89.44	5	23.81
12704.	Moataz (mizosoft)	21	77.89	88.08	7	33.33
12705.	Dominik (misiekwiev13)	21	56.79	66.42	2	9.52
12706.	Lior (miliday)	21	42.62	52.07	3	14.29
12707.	Outlaw (midnight_tuna)	21	77.79	97.52	3	14.29
12708.	Michael (michael9009)	21	91.74	126.82	6	28.57
12709.	Muhammad (mhasan01)	21	102.13	113.66	6	28.57
12710.	meme (mememem)	21	90.62	103.78	9	42.86
12711.	invader (megawutt)	21	64.37	75.30	8	38.10
12712.	MZ (mbzz)	21	83.43	99.29	8	38.10
12713.	Mateus (mateusmelo)	21	64.71	77.77	7	33.33
12714.	roee (masterroee3)	21	64.07	80.91	5	23.81
12715.	MasterlyHoney (masterlyhone...	21	48.50	59.55	0	0.00
12716.	Ammar (marsicus)	21	84.41	101.86	10	47.62
12717.	Marcki (marcki)	21	76.20	84.17	4	19.05
12718.	Markus (marcasrealaccount)	21	93.93	105.45	10	47.62
12719.	Mark (maolson97)	21	87.98	107.89	6	28.57
12720.	tstats[mannyblaze] (mannybl...	21	58.17	80.57	3	14.29
12721.	Ian (mail_order_bride)	21	56.66	70.02	2	9.52
12722.	Roman (madness1st)	21	51.97	60.99	2	9.52
12723.	Luke (lukeatme)	21	67.55	80.97	12	57.14
12724.	Luis (luismiguelcopadiaz)	21	82.16	92.75	7	33.33
12725.	patrick (lucky_ninja3412)	21	69.47	92.00	5	23.81
12726.	Tekin (liggrod)	21	79.11	90.39	9	42.86
12727.	Leo (leo123457)	21	53.83	63.42	18	85.71
12728.	Lazer (lawins)	21	102.96	114.07	3	14.29
12729.	Lars (larzz_z)	21	82.13	100.31	10	47.62
12730.	Kshitij (kshitij21)	21	55.65	65.01	6	28.57
12731.	Sean (kokamell16_)	21	48.43	58.12	2	9.52
12732.	Koby (kobyhatton)	21	95.51	115.72	8	38.10
12733.	V (kiritoyang)	21	103.19	131.43	7	33.33
12734.	Kaylo (kaylo060)	21	80.92	97.99	6	28.57
12735.	Mouhamed (karlosalol)	21	64.83	79.28	5	23.81
12736.	Karen (karent_x3)	21	70.76	83.96	5	23.81
12737.	Katie (kantielope)	21	82.34	99.20	4	19.05
12738.	Kamrul (kamrul_ahsan)	21	29.52	34.13	1	4.76
12739.	Kai (kaitheguy_)	21	81.52	97.75	7	33.33
12740.	Aidyn (justaidyn)	21	95.87	105.53	6	28.57
12741.	vroom (junap)	21	96.56	116.70	8	38.10
12742.	Juan (juandz)	21	44.08	51.71	4	19.05
12743.	Jeffrey (jshen13)	21	88.89	101.22	8	38.10
12744.	Jono (jonodvorak)	21	128.40	142.72	13	61.90
12745.	Jon (jonbeka)	21	56.10	64.37	3	14.29
12746.	johnballs (johnballs)	21	92.20	101.38	6	28.57
12747.	Johan (johanapa)	21	97.34	117.48	19	90.48
12748.	my mango (joe_froggy)	21	72.93	90.93	1	4.76
12749.	Edward (jinsye)	21	96.48	115.18	6	28.57
12750.	Jason (jihoon222)	21	134.10	150.88	19	90.48
12751.	Jerry24562 (jerry24562)	21	82.38	92.03	0	0.00
12752.	Water (jeffersonjap)	21	106.89	117.84	14	66.67
12753.	Tobe (jeeko_pogi)	21	72.14	84.97	4	19.05
12754.	Jason (jasew)	21	62.75	91.63	4	19.05
12755.	Jamshidbek (jamshid_4510)	21	44.72	51.70	8	38.10
12756.	James (jamesks)	21	85.44	96.74	7	33.33
12757.	Jake (jakeypancakey)	21	108.93	129.44	11	52.38
12758.	Corey (i_dont_like_anime)	21	88.11	113.44	7	33.33
12759.	I type slow (itypeslowlol1)	21	99.73	117.98	9	42.86
12760.	Eric (isoh)	21	94.94	112.59	7	33.33
12761.	스티븐 (ishes)	21	101.48	109.94	9	42.86
12762.	Aleksandr Ippatev (ippatev)	21	71.96	95.75	9	42.86
12763.	Insulin (insulingaming)	21	74.91	85.61	7	33.33
12764.	Siddhant (indianracer385)	21	68.50	88.40	0	0.00
12765.	Benji (ijneb)	21	86.04	111.12	5	23.81
12766.	iCheese (icheese23)	21	101.81	117.49	10	47.62
12767.	Fez (iamsuperspeed)	21	101.79	110.26	9	42.86
12768.	xd (huskyyy)	21	102.85	122.23	12	57.14
12769.	Nate (hoopstrings)	21	105.36	118.88	9	42.86
12770.	Mike (hipsterdufus)	21	95.76	106.32	12	57.14
12771.	Ace (hiken_ace)	21	74.60	84.97	14	66.67
12772.	Hey (heythere0)	21	74.44	84.88	3	14.29
12773.	Ifat (helloitsifat)	21	76.45	89.41	4	19.05
12774.	Helena (helena_mp)	21	58.69	67.44	3	14.29
12775.	Hecks (hecksadecimal)	21	91.93	113.57	10	47.62
12776.	Egor (hawkeg)	21	55.80	66.58	6	28.57
12777.	Hahohe (hahohe3)	21	98.74	123.62	9	42.86
12778.	Karina (guyrina)	21	102.62	123.44	9	42.86
12779.	Grigory (gregkhan)	21	92.42	110.96	12	57.14
12780.	Miguel (gheed22)	21	85.91	98.79	8	38.10
12781.	Eddie (ger_eddie)	21	71.14	77.07	4	19.05
12782.	AtomicSkunk (georgel8314)	21	81.07	93.04	6	28.57
12783.	Evan (gemofevan)	21	117.78	145.51	8	38.10
12784.	Leo (geckuchicken)	21	68.23	85.15	7	33.33
12785.	elio! (gabspyz)	21	80.94	95.30	5	23.81
12786.	Charles (future965)	21	63.65	72.71	1	4.76
12787.	Frederik (freeder1k)	21	61.67	72.48	2	9.52
12788.	Frode (fr0so)	21	59.87	68.70	2	9.52
12789.	Kai Wei (fortissimo)	21	108.06	132.69	12	57.14
12790.	Foqsi (foqsi)	21	102.33	122.45	9	42.86
12791.	Speedy (flux2k)	21	113.14	134.10	12	57.14
12792.	Patty (flappypatty420)	21	66.47	89.11	5	23.81
12793.	Felipe (felipet)	21	85.93	98.76	4	19.05
12794.	Felipe (felipazo_06)	21	57.00	77.43	7	33.33
12795.	this is feimser (feimser)	21	67.78	76.21	8	38.10
12796.	Harry (feeshgang)	21	109.34	127.77	12	57.14
12797.	Ali (fanstic)	21	64.72	74.96	3	14.29
12798.	Fairyball (fairyballyt)	21	85.45	98.80	4	19.05
12799.	Junito (exter72)	21	75.70	97.03	6	28.57
12800.	Mohammed Waseemuddin (ertug...	21	57.08	67.66	5	23.81
12801.	Erie (eridu)	21	76.20	101.65	6	28.57
12802.	Muhammad (entamalomak)	21	69.92	79.60	7	33.33
12803.	emily (emily_chwn)	21	77.13	84.14	2	9.52
12804.	Elmer (elmerr)	21	95.24	105.94	7	33.33
12805.	Elijah (elijahp24)	21	62.44	75.71	5	23.81
12806.	Yaowee (eggyicecream)	21	70.21	82.18	6	28.57
12807.	D1FFeR (ec0426)	21	60.76	77.31	2	9.52
12808.	D1ck F1ngers (d_wratten18)	21	66.42	76.23	6	28.57
12809.	shylingg (dyingllama)	21	109.82	125.47	11	52.38
12810.	Nathanael James (dyemz)	21	87.71	98.70	7	33.33
12811.	Duschi (duschi)	21	93.96	108.30	8	38.10
12812.	K (duhhhhhhhhhhh)	21	87.14	106.22	8	38.10
12813.	Typing (drained_typist)	21	101.27	114.27	11	52.38
12814.	dq (dqmaniac)	21	123.44	139.80	14	66.67
12815.	. (doomslug5)	21	82.55	91.03	4	19.05
12816.	Sardar Taha (dice111)	21	107.66	123.58	9	42.86
12817.	Dexter (dexter2fast)	21	87.75	105.81	8	38.10
12818.	DENYS (denysesjs)	21	100.68	114.35	13	61.90
12819.	Nairi (demerton)	21	78.61	95.43	3	14.29
12820.	Deko (deko_moon)	21	88.57	105.54	8	38.10
12821.	Manye (davemanye)	21	60.32	81.18	8	38.10
12822.	Daulet (daukabase)	21	62.79	76.99	3	14.29
12823.	Chris (datapointchris)	21	85.61	102.99	5	23.81
12824.	balzac (dasbalzac)	21	31.63	38.12	3	14.29
12825.	Sisyphus (darkwinterfurry)	21	80.50	96.63	6	28.57
12826.	dannsy (dannsy)	21	101.54	115.13	8	38.10
12827.	Ryan (dandaflaff)	21	45.39	58.45	2	9.52
12828.	Damian (damianm8)	21	76.84	86.71	6	28.57
12829.	Aishiteru (daedalus__)	21	79.16	96.03	11	52.38
12830.	cuzimogni (cuzimogni)	21	67.42	76.32	1	4.76
12831.	cuppajoeman.com (cuppajoeman)	21	95.25	109.17	8	38.10
12832.	Clement (clement_ps)	21	107.44	129.20	6	28.57
12833.	Akhil (cheetahoo7)	21	85.04	95.98	7	33.33
12834.	joe (cbel3111)	21	79.73	98.67	5	23.81
12835.	Casual (casualhat)	21	53.11	59.52	4	19.05
12836.	Carl (carlalalala)	21	79.52	94.90	11	52.38
12837.	Captain M (captain254)	21	51.15	60.53	2	9.52
12838.	Mohamed (camposha)	21	63.23	73.53	3	14.29
12839.	byrtolet (byrtolet)	21	78.60	92.97	8	38.10
12840.	Dan (bupkisdaddy)	21	82.19	107.02	11	52.38
12841.	Bram (bramdk)	21	81.82	99.02	10	47.62
12842.	bok (bokk)	21	99.15	125.72	12	57.14
12843.	Blu (blu_0)	21	85.31	101.64	12	57.14
12844.	Zach (blurridge)	21	91.43	110.90	7	33.33
12845.	Jonathan (blue_blobfish)	21	88.11	104.88	5	23.81
12846.	jeff (blawalaw)	21	112.14	131.27	11	52.38
12847.	Kin (binbobum12s)	21	70.49	82.74	6	28.57
12848.	Petr (bigbang1112)	21	100.66	116.10	9	42.86
12849.	ben (bendoverr05)	21	65.60	84.34	3	14.29
12850.	You're not that slow (beast...	21	135.35	162.32	14	66.67
12851.	BearJere (bearjere)	21	101.88	112.78	12	57.14
12852.	KJ (barraclaw)	21	93.87	107.18	5	23.81
12853.	Michael (baomoichoi122)	21	51.18	66.99	1	4.76
12854.	Bis (b1s_qu1t)	21	67.11	82.41	3	14.29
12855.	Azerniiiic (azernic)	21	91.31	109.40	6	28.57
12856.	Typomaster (axioo123)	21	66.77	81.85	6	28.57
12857.	Jack (awesomekiwi23)	21	89.63	104.01	13	61.90
12858.	Avernu (avernu)	21	81.10	101.36	7	33.33
12859.	Josh (auto111032)	21	90.74	107.71	10	47.62
12860.	Chelsea (aurialing)	21	96.90	105.57	5	23.81
12861.	Anastasya (athh97)	21	64.27	81.22	5	23.81
12862.	Askhat (askhat0109)	21	35.38	45.87	0	0.00
12863.	Tala (another_ostrich)	21	84.40	95.69	7	33.33
12864.	Rijey (anilarq)	21	49.68	59.05	2	9.52
12865.	Aniket (aniketb97)	21	54.15	64.20	3	14.29
12866.	angelo (angeio)	21	164.89	183.93	19	90.48
12867.	no sweat (anduatm)	21	89.45	101.53	9	42.86
12868.	Ammar (ammarthetyper)	21	106.19	120.25	9	42.86
12869.	AmmarDab3an (ammardab3an)	21	72.75	84.14	5	23.81
12870.	al (allizer)	21	36.20	43.86	1	4.76
12871.	Aliff (aliffhakimi)	21	95.39	113.95	11	52.38
12872.	Alex (alextamago)	21	104.23	125.63	7	33.33
12873.	Alb (alb_themighty)	21	62.06	74.98	3	14.29
12874.	Alan (alan_hsiu)	21	25.65	34.38	0	0.00
12875.	Jean (akrinias)	21	111.10	126.87	11	52.38
12876.	Idas (aidasas)	21	97.95	117.92	10	47.62
12877.	Residential (agent_resident2)	21	91.97	102.54	8	38.10
12878.	ray (afrojelly)	21	91.32	105.36	8	38.10
12879.	Sam (advil)	21	115.56	128.76	12	57.14
12880.	Jannatul (adon22)	21	53.58	61.97	2	9.52
12881.	abhishek (abhisheksaxenasep)	21	57.13	65.40	4	19.05
12882.	A7med (a7med_1)	21	41.01	50.88	1	4.76
12883.	Enzo (60wpmwhat)	21	86.62	99.85	8	38.10
12884.	steve (21steven_)	21	83.54	111.00	3	14.29
12885.	InsertNameHere (1ns3rtn4m3h...	21	95.55	117.13	4	19.05
12886.	Subikshaa (subikshaa18)	21	63.54	79.94	8	38.10
12887.	Chatham (cala95)	21	89.46	105.39	10	47.62
12888.	Agno3317 (agno3317)	21	53.78	61.88	1	4.76
12889.	Marek (smudla)	21	54.96	63.53	4	19.05
12890.	sammy (whymehere)	21	31.88	43.83	3	14.29
12891.	Jezzer (60wpmbot)	21	91.29	108.98	9	42.86
12892.	Robert (r0bm4c)	21	70.76	82.45	8	38.10
12893.	Zaid (kaitania)	21	93.83	115.78	17	80.95
12894.	Angus (director7)	21	77.78	88.39	9	42.86
12895.	Quamtam (quamtam)	21	71.53	93.24	5	23.81
12896.	Dennis (deadmans_22)	21	63.59	74.99	6	28.57
12897.	qbit (qixotic)	21	96.52	105.57	7	33.33
12898.	go_ez_plz (go_ex_plz)	21	92.44	111.79	8	38.10
12899.	Mark (verysourfox)	21	62.66	78.69	7	33.33
12900.	Eminem (leonard_jose)	21	63.24	73.58	2	9.52
12901.	James (xiero)	21	75.69	84.36	3	14.29
12902.	Holden (hrmercer)	21	67.40	79.56	5	23.81
12903.	Hudodo (hudodo)	21	48.61	72.80	4	19.05
12904.	On the Go (rumasud99)	21	53.20	64.42	1	4.76
12905.	Bryan (gambino478)	21	77.32	92.18	6	28.57
12906.	Akmentop (akmentop)	21	68.98	84.26	6	28.57
12907.	V (usotsuki)	21	48.04	57.39	4	19.05
12908.	Carlos (cdrlao)	21	76.59	92.44	8	38.10
12909.	felixjack (felixjack)	21	37.35	49.17	1	4.76
12910.	Hunter (eidetic)	21	80.21	90.96	12	57.14
12911.	mel (merlynmanoj)	21	78.68	94.12	4	19.05
12912.	Jass (hsiehjason00)	21	50.68	56.36	4	19.05
12913.	Voda (vodatrash)	21	75.00	92.27	7	33.33
12914.	Brock (blobweadner)	21	44.06	53.83	6	28.57
12915.	Emerald (emeraldz05)	21	74.24	85.43	6	28.57
12916.	Rajlohith (mrbadattitude)	21	44.30	51.30	1	4.76
12917.	Isabella (himeenthusiast)	21	59.99	72.52	1	4.76
12918.	Dev (ananddev)	21	62.34	73.30	4	19.05
12919.	Abhinand (abhinandarun02)	21	37.74	51.23	1	4.76
12920.	360 (crankin90s)	21	57.11	77.35	3	14.29
12921.	Pip (pipsquik)	21	93.56	115.33	7	33.33
12922.	Dimitris (sussy_baka_jimbo)	21	52.97	62.66	1	4.76
12923.	Jason (supergjason)	21	105.47	125.60	10	47.62
12924.	Samuel (shironeko213)	21	80.02	94.73	10	47.62
12925.	Duc Anh (thoidithim2810)	21	51.23	58.96	1	4.76
12926.	ajmal (ajmalbinnizam)	21	44.74	49.04	5	23.81
12927.	wiz (_wiz_)	20	60.86	71.40	5	25.00
12928.	!! (zzzoodle)	20	83.14	103.95	3	15.00
12929.	Franky (zyrefe)	20	109.33	128.60	10	50.00
12930.	Zack (zqlimy)	20	77.58	90.06	4	20.00
12931.	yaotly (yaotli)	20	48.15	54.06	2	10.00
12932.	Yadira (yadirairiz)	20	97.01	118.74	7	35.00
12933.	XzXc (xzxc4444)	20	72.79	82.97	5	25.00
12934.	xtian (xtian91)	20	63.74	73.79	4	20.00
12935.	XpORPID (xporpid)	20	85.94	104.79	6	30.00
12936.	Xel (xelqqii)	20	77.42	93.35	6	30.00
12937.	matvei (xbabushka)	20	60.24	81.32	9	45.00
12938.	Bún bò Huế (wynos)	20	125.29	139.48	17	85.00
12939.	w0wdead (wowdead)	20	55.27	70.12	18	90.00
12940.	Lucas (wollmyth)	20	83.70	97.11	2	10.00
12941.	. (wheelzaboo)	20	79.70	90.70	4	20.00
12942.	Nathaniel (wetaketolong)	20	91.86	106.82	5	25.00
12943.	Wes (wespiard)	20	77.20	92.99	12	60.00
12944.	Erlend (weserl)	20	55.56	65.71	2	10.00
12945.	Jeff (websterjs)	20	84.00	94.12	3	15.00
12946.	Pat (wareem)	20	95.38	114.41	7	35.00
12947.	Cedric (vlako)	20	86.72	102.77	5	25.00
12948.	Visura (visuraprabod)	20	60.73	66.98	3	15.00
12949.	Kranite (vg_infernozz)	20	94.88	115.29	9	45.00
12950.	Varaug (varaug33)	20	100.85	110.33	11	55.00
12951.	Vaibhav (vaibhav974)	20	89.61	102.56	5	25.00
12952.	Sergei (unicrus)	20	63.47	70.86	4	20.00
12953.	Atichon (ultraballminorz)	20	74.81	85.55	4	20.00
12954.	Roman (tyronefromdetroit_7)	20	61.00	69.36	2	10.00
12955.	Sebas (typingtiran)	20	78.16	93.99	6	30.00
12956.	Brent (typer1987)	20	93.63	114.03	8	40.00
12957.	Tristan (typeinthebox)	20	69.22	89.57	4	20.00
12958.	Tycho (tychobroucke)	20	88.89	104.79	5	25.00
12959.	Tyler (tybow99)	20	108.39	117.49	6	30.00
12960.	Tanya (tyarbrough71)	20	75.22	89.96	4	20.00
12961.	bec (twentyonepotato)	20	81.34	94.81	4	20.00
12962.	Tunihorn (tunihorn)	20	100.40	131.37	11	55.00
12963.	tsds (tsds)	20	67.89	85.02	4	20.00
12964.	trut (trut)	20	87.60	100.61	4	20.00
12965.	trex (trexwithlasereyes)	20	72.57	82.78	11	55.00
12966.	Toktar (tokha)	20	35.94	42.32	0	0.00
12967.	Kocsis (tisq13)	20	55.78	67.66	4	20.00
12968.	DataDev (tinysingh)	20	52.91	68.36	2	10.00
12969.	Ian (tinysilverfish)	20	99.99	144.27	5	25.00
12970.	tiglas (tiglas)	20	71.32	80.57	4	20.00
12971.	TidyTurtle (tidyturtle)	20	98.79	125.67	6	30.00
12972.	Dan (themanisdan)	20	96.31	108.87	7	35.00
12973.	Drew (thecomedyne04)	20	90.00	115.35	7	35.00
12974.	nabileT (telibanalex)	20	94.33	108.61	9	45.00
12975.	ty (tbtbtbt)	20	121.15	154.58	13	65.00
12976.	Fabian (tay0w)	20	86.79	110.68	7	35.00
12977.	ee (tally_dvorak)	20	93.12	103.56	10	50.00
12978.	Jonas (superare)	20	78.39	103.63	3	15.00
12979.	Suddenly (suddenlynothing)	20	96.50	108.43	8	40.00
12980.	Squeeeeeps (squeeeeeps)	20	48.49	57.70	2	10.00
12981.	Spiren (spirenz)	20	113.89	134.49	10	50.00
12982.	Victoria (speedrun_dreamstyle)	20	79.33	95.19	16	80.00
12983.	snipe (snipe75)	20	50.42	67.45	1	5.00
12984.	Jacob (sl_jacob)	20	80.86	92.15	2	10.00
12985.	Devin (slinky88)	20	67.29	80.61	6	30.00
12986.	Skylos (skylos)	20	107.90	136.79	7	35.00
12987.	Manal (skullcicator)	20	91.26	117.20	5	25.00
12988.	sknny (sknny)	20	80.64	95.30	13	65.00
12989.	sk (skkk)	20	105.77	116.94	6	30.00
12990.	SIX (six_p)	20	60.11	66.78	3	15.00
12991.	Hmm (sironronron)	20	105.10	123.82	11	55.00
12992.	Shuraque (shuraque)	20	74.48	85.56	5	25.00
12993.	Shrimpo (shrimpo)	20	82.47	98.82	7	35.00
12994.	Shichibukai (shichibukai2002)	20	93.26	103.38	8	40.00
12995.	Shashanka (shashankanath)	20	49.04	61.21	13	65.00
12996.	Shadow (shadowrose01)	20	43.73	49.09	1	5.00
12997.	Themis Evangelinos (sellak)	20	50.86	60.79	2	10.00
12998.	MoshuFingers (scotscottie)	20	73.67	85.55	7	35.00
12999.	︻デ═一▸ (santoshmsk)	20	61.65	74.72	7	35.00
13000.	Me (sandwichshop)	20	79.89	88.49	11	55.00
13001.	Saikiran (sai_kiran_07)	20	56.31	72.76	3	15.00
13002.	Sai Mani Raj (saimaniraj)	20	70.34	89.57	6	30.00
13003.	Roy (rwfeng72)	20	93.68	114.73	7	35.00
13004.	Ron (ronsar)	20	50.89	60.12	3	15.00
13005.	Blue (rodtypes)	20	79.79	99.27	8	40.00
13006.	student bored in school (ri...	20	62.09	69.34	4	20.00
13007.	Rikka (rikkaislife)	20	38.07	45.32	8	40.00
13008.	ric (ricman0)	20	70.38	89.12	3	15.00
13009.	ReklessDragon (reklessdragon)	20	95.34	113.22	9	45.00
13010.	Boris (redsnake07)	20	113.45	132.75	8	40.00
13011.	Eugene (rawners)	20	71.77	80.27	8	40.00
13012.	Randy (randonandoz)	20	93.58	107.02	12	60.00
13013.	Daniel (randomgamer1017)	20	106.39	132.92	10	50.00
13014.	Ricardo (rambolis)	20	66.25	75.78	2	10.00
13015.	deadass (rajteezy)	20	67.18	77.23	2	10.00
13016.	drunk rain (rainnonquit)	20	154.92	178.95	18	90.00
13017.	Raghav (raghav8822)	20	74.29	84.35	4	20.00
13018.	Robbie (qweens)	20	76.86	89.79	8	40.00
13019.	Questt (questtlee)	20	93.01	111.73	9	45.00
13020.	qazaqyanke (qazaqyanke)	20	38.72	80.06	1	5.00
13021.	Jumpo (purplejumpo)	20	97.78	116.16	6	30.00
13022.	O]]!! (prvlg)	20	87.21	104.01	8	40.00
13023.	huge (postmortem)	20	97.50	122.23	10	50.00
13024.	Poochi (poochizoom)	20	125.91	153.61	13	65.00
13025.	poepmannetje (poepmannetje)	20	71.15	86.19	4	20.00
13026.	Pavel Kotsev (pkotsev)	20	71.31	78.87	3	15.00
13027.	stop quitting (phrosnite)	20	83.60	106.42	3	15.00
13028.	Peyush (peyush)	20	45.90	55.42	2	10.00
13029.	David (peacehf123)	20	92.64	102.68	0	0.00
13030.	The Write Tale (pchanbps1)	20	93.11	99.83	8	40.00
13031.	Gibby (papimonster69)	20	84.70	94.25	7	35.00
13032.	Ali (oorkade)	20	66.47	77.30	11	55.00
13033.	omar (omarkarboul)	20	50.59	56.75	1	5.00
13034.	Ohm (ohmstar123)	20	82.72	98.34	9	45.00
13035.	Nathan (nper4lta)	20	61.60	75.32	4	20.00
13036.	Not (not_cracked_)	20	104.60	120.01	6	30.00
13037.	salad (notyoursalad)	20	81.38	93.49	6	30.00
13038.	Molly (notevenhalf2000)	20	84.43	103.16	3	15.00
13039.	Kaat (norbertathedragon)	20	61.37	79.97	2	10.00
13040.	wayne (nonlimit)	20	85.64	98.87	4	20.00
13041.	Alex (nobrakes58)	20	90.92	107.22	7	35.00
13042.	Decent (nicokart)	20	76.29	92.04	3	15.00
13043.	troi lanh uoc dc nam tay e ...	20	59.95	98.35	9	45.00
13044.	luzy (neptunehoney)	20	98.27	121.70	8	40.00
13045.	Necdet Ali (necdetaliozdur)	20	79.65	87.68	7	35.00
13046.	Naveen Kumar (naveen_1729)	20	59.94	73.35	1	5.00
13047.	ᕕ༼ ; •̀︿•́༽�...	20	102.93	122.52	18	90.00
13048.	Adam (musterling)	20	103.03	119.91	16	80.00
13049.	mrw1 (mrw1)	20	76.95	91.52	7	35.00
13050.	Friden (mrtokke)	20	63.68	77.22	5	25.00
13051.	Andy (mrfoggz)	20	87.13	95.69	2	10.00
13052.	Mostafah (mosty295)	20	76.19	89.70	8	40.00
13053.	eric (mordor5555)	20	77.70	96.66	7	35.00
13054.	G.A.F (mochillavila)	20	56.37	69.29	2	10.00
13055.	mobo (mobo)	20	123.31	150.55	13	65.00
13056.	Eugene (mineugene)	20	85.82	95.65	9	45.00
13057.	millstypes (millstypes)	20	70.96	83.81	7	35.00
13058.	Zhikouan (mikelee543)	20	87.88	101.44	7	35.00
13059.	Hải (microwaveablepasta)	20	77.06	98.74	5	25.00
13060.	Mia (miajasmine)	20	76.56	93.78	5	25.00
13061.	mg (mgperson)	20	114.81	131.83	11	55.00
13062.	memmoman (memmo)	20	74.11	96.62	7	35.00
13063.	Tammy (mausaye)	20	79.29	91.70	5	25.00
13064.	Matin (matin_pasargad)	20	84.18	98.41	5	25.00
13065.	juzerr (markopokupecc)	20	95.93	125.79	5	25.00
13066.	Mark (markmango)	20	94.07	112.28	7	35.00
13067.	Piccolo (makankasappa)	20	67.83	79.11	6	30.00
13068.	Mahmudul (mahmudul_hhh)	20	44.95	56.64	3	15.00
13069.	Matthew (m1234d)	20	122.16	146.89	12	60.00
13070.	Luke (lukethepuke)	20	47.04	54.23	1	5.00
13071.	Lucy (lucyd266)	20	82.28	92.52	9	45.00
13072.	Louie John (loumexx12)	20	83.79	97.61	10	50.00
13073.	Lilah (livymud)	20	45.69	50.64	5	25.00
13074.	lex (lex_isamess)	20	103.73	134.40	12	60.00
13075.	lettuce (lettuceandahalf)	20	79.25	104.07	5	25.00
13076.	Artur (lepayo)	20	112.02	137.72	9	45.00
13077.	Leo (leo_typing)	20	80.10	97.05	3	15.00
13078.	ItypeCuzIhavenoGF (leftmask35)	20	46.51	54.27	2	10.00
13079.	Darrell (lastronus)	20	98.76	116.35	9	45.00
13080.	kRystal (krystal69)	20	67.95	88.79	13	65.00
13081.	Kevin (kevinu)	20	112.48	126.59	8	40.00
13082.	kp (kennethputra)	20	83.72	100.05	4	20.00
13083.	Kaybe (kaybnde)	20	101.70	117.87	8	40.00
13084.	Mr. lee's expository writin...	20	134.35	148.58	15	75.00
13085.	kauko (kaukokolka)	20	79.52	97.28	17	85.00
13086.	Kalash (kalz25)	20	86.18	101.63	2	10.00
13087.	salah (kaltab)	20	66.88	76.47	3	15.00
13088.	Leo (kakiu2000)	20	51.87	58.14	6	30.00
13089.	abdelrhman (kahraba92)	20	40.18	47.43	1	5.00
13090.	Eliza (kaeco_)	20	26.16	37.63	3	15.00
13091.	J (jyorange)	20	119.26	154.48	12	60.00
13092.	Jonathan (jyap042)	20	66.44	74.22	4	20.00
13093.	Joseph (jv33zy)	20	103.41	118.82	9	45.00
13094.	Joe (jqal)	20	90.32	105.39	6	30.00
13095.	Josh (joshmgeorge)	20	81.46	91.80	6	30.00
13096.	josh (joshahk)	20	88.90	121.58	7	35.00
13097.	Sweaty (josef_stylin)	20	127.95	151.37	11	55.00
13098.	23 (jorgexdlol)	20	70.41	82.16	6	30.00
13099.	Johan (joey67)	20	64.59	77.28	8	40.00
13100.	Joel (joel_w2)	20	101.62	112.56	5	25.00
13101.	jupiter (joaelis)	20	45.98	72.31	2	10.00
13102.	John (jjov17)	20	74.01	86.42	1	5.00
13103.	Jim (jim90247)	20	58.35	68.09	2	10.00
13104.	jesad (jesadilvan)	20	62.87	75.20	6	30.00
13105.	hmm (jerm_killer)	20	80.40	95.34	5	25.00
13106.	Dominik (jazzon)	20	98.48	122.81	7	35.00
13107.	Takoyaki (jayisloco)	20	51.65	59.88	2	10.00
13108.	jam_xd_ (jam_xd_)	20	91.14	104.90	3	15.00
13109.	Jake (jakepf00dvorak)	20	79.74	89.12	5	25.00
13110.	Rahul (jakatir)	20	87.08	106.50	7	35.00
13111.	Jaime (jaimeathedisco)	20	80.50	94.06	5	25.00
13112.	Jahid (jahidk9)	20	42.73	53.85	5	25.00
13113.	jackmaoff (jackmaoff)	20	68.53	81.63	6	30.00
13114.	Jack (jackcoleero)	20	73.96	87.48	7	35.00
13115.	isthislewz (isthislewz)	20	93.39	104.83	6	30.00
13116.	Isaac (ipohzw)	20	87.23	111.04	8	40.00
13117.	IpohGirl (ipohgirl8)	20	56.44	73.40	6	30.00
13118.	Kristijan (invisibleloki)	20	110.11	118.74	11	55.00
13119.	Stephen (installed)	20	126.09	167.79	9	45.00
13120.	Elskrim (important)	20	114.11	138.77	12	60.00
13121.	WhatIsLowkey (ihorsedyou)	20	126.67	144.83	12	60.00
13122.	Pickle (iceberger17)	20	74.39	95.44	5	25.00
13123.	iAmPardi (iampardi)	20	104.16	123.76	11	55.00
13124.	Hynoh (hynoh)	20	95.85	116.56	4	20.00
13125.	HoDaMoFoDor (hodamofodor)	20	97.57	119.63	11	55.00
13126.	hissi (hissi)	20	88.97	109.90	7	35.00
13127.	Hibird (hibird)	20	107.80	118.76	15	75.00
13128.	Hassan (hassanalmatar)	20	61.28	70.99	3	15.00
13129.	Hanica (hanicanii)	20	58.71	70.94	6	30.00
13130.	Hamzah (hamzaaho7722)	20	36.13	40.56	2	10.00
13131.	Erik (hadooo)	20	79.76	91.64	4	20.00
13132.	Guilherme (guilhaugusto)	20	57.68	67.00	2	10.00
13133.	tstats[guest_typists] (gues...	20	86.64	114.30	6	30.00
13134.	Kevin (gtwatt)	20	75.18	86.56	8	40.00
13135.	uhhhhhh (gtiff71)	20	94.16	106.93	9	45.00
13136.	Gr0undhog_x (gr0undhog)	20	104.70	125.68	10	50.00
13137.	Yerder (gokewho)	20	130.52	150.37	12	60.00
13138.	Goal_100wpm (goal_200wpm)	20	53.24	62.40	3	15.00
13139.	Hugo (glaucon)	20	82.18	92.54	5	25.00
13140.	Yioryis (giorgis)	20	107.75	130.73	13	65.00
13141.	Utkarsh (gbuckets30)	20	92.45	101.73	4	20.00
13142.	Gabe (garff)	20	55.05	61.52	1	5.00
13143.	garetmi (gammex)	20	80.54	97.55	3	15.00
13144.	Gamer (gamer650xd)	20	91.00	110.73	9	45.00
13145.	Fyter (fyter)	20	75.44	87.74	2	10.00
13146.	Earl (furankuring)	20	86.90	98.00	9	45.00
13147.	enrique (fugitivecloud)	20	105.59	121.62	9	45.00
13148.	nathanael (flyeroscer)	20	56.10	74.40	4	20.00
13149.	flourish (fl0urish)	20	81.39	112.48	8	40.00
13150.	Draco (fish0228)	20	71.91	88.72	18	90.00
13151.	LEB (fhgfl)	20	42.59	51.78	0	0.00
13152.	fbabylemon (fbabylemon)	20	85.22	96.15	7	35.00
13153.	Fvthy (fathyamer)	20	52.67	61.81	2	10.00
13154.	evaqate (evaqate)	20	64.63	77.87	3	15.00
13155.	Thav (epic_boyo_123)	20	56.04	66.75	2	10.00
13156.	EncodedTyper (encodedtyper)	20	89.79	106.48	6	30.00
13157.	Tyrell (elter)	20	53.90	73.70	6	30.00
13158.	Joe (elisouthworth)	20	113.89	143.88	13	65.00
13159.	Arslan (elbosynov)	20	26.40	30.86	14	70.00
13160.	g (eggwen)	20	64.09	73.29	6	30.00
13161.	Brian (eeyjnairb)	20	105.23	119.26	8	40.00
13162.	Maskedknight (edward5958)	20	94.62	117.06	7	35.00
13163.	Tajwar (dxadcircuit)	20	74.25	91.38	6	30.00
13164.	DUFOUR (dufour)	20	116.76	139.05	10	50.00
13165.	Drifter (drifter103)	20	120.66	133.80	8	40.00
13166.	Dhananjay (dk35840)	20	54.49	62.39	5	25.00
13167.	Justin (disney6)	20	106.59	136.70	13	65.00
13168.	DInokyd (dinokyd)	20	74.37	91.00	6	30.00
13169.	Devansh (devansh_dua)	20	39.48	47.96	2	10.00
13170.	Peeter (detectiveleht)	20	49.65	58.24	6	30.00
13171.	A (deoignition)	20	70.41	79.44	2	10.00
13172.	Demon (demon_hunter_bd)	20	48.45	55.67	1	5.00
13173.	Dicky (dcstormrage)	20	67.56	78.77	7	35.00
13174.	Darjinero (darjinero)	20	88.17	99.41	9	45.00
13175.	Alex (dangercomeswithalex)	20	70.14	87.26	9	45.00
13176.	fingers hurt (cxyym)	20	100.69	116.49	10	50.00
13177.	csAxer8 (csaxer)	20	101.94	126.48	9	45.00
13178.	CRISTO (cristomathew7)	20	69.41	83.53	4	20.00
13179.	Donkey (crazybraden)	20	82.69	97.28	4	20.00
13180.	Nero was here (correct_fing...	20	116.13	132.59	11	55.00
13181.	cana (cnry)	20	110.02	125.26	12	60.00
13182.	D (chubbieveggie)	20	84.59	96.01	5	25.00
13183.	Chris (christrilling)	20	115.70	128.49	15	75.00
13184.	Christian (chrillzen)	20	99.26	119.49	5	25.00
13185.	chez (chezzion)	20	81.38	96.16	2	10.00
13186.	Chad (chad87)	20	98.04	115.80	11	55.00
13187.	carpathian (carpathian)	20	83.72	103.11	5	25.00
13188.	Shaan (captainshaani)	20	47.06	59.55	5	25.00
13189.	Christopher (canorve)	20	53.80	63.70	1	5.00
13190.	sam (candle4)	20	93.93	116.23	6	30.00
13191.	Callow (callowblack)	20	56.60	67.29	4	20.00
13192.	Mohamed (byfarag)	20	122.98	144.18	12	60.00
13193.	Brady (bward62)	20	94.75	119.25	8	40.00
13194.	Bob (bushybrows)	20	97.90	118.49	9	45.00
13195.	Alicia Peas (bundt)	20	65.90	77.87	5	25.00
13196.	(bummered)	20	130.52	168.87	10	50.00
13197.	Brian (btong)	20	111.37	135.12	7	35.00
13198.	Bruh (bruhletuce)	20	63.19	72.75	6	30.00
13199.	hamger (broncos1388)	20	60.52	76.54	2	10.00
13200.	Sami (britishrifleman)	20	66.45	88.52	1	5.00
13201.	Random (bogdanmironov)	20	81.38	93.98	4	20.00
13202.	Gregory (bobren)	20	97.35	106.42	5	25.00
13203.	noms (bloopdaferd)	20	81.33	98.05	4	20.00
13204.	bloncing (bloncing)	20	66.40	77.28	4	20.00
13205.	Kana smurf (blackmind)	20	91.77	107.86	11	55.00
13206.	Matt (bigrocku)	20	73.50	87.94	6	30.00
13207.	Joe (bigboythrows)	20	100.06	113.95	9	45.00
13208.	bharat (bharatcoder007)	20	52.51	64.83	4	20.00
13209.	z (bazackk4)	20	79.21	97.12	9	45.00
13210.	Baran (baranomania)	20	84.62	101.33	5	25.00
13211.	Banun (banun)	20	55.99	68.91	2	10.00
13212.	Bangerzz (bangerzz)	20	65.31	86.98	2	10.00
13213.	Irsyad (azcat01)	20	66.51	77.53	4	20.00
13214.	Korbin (auvvia)	20	84.36	102.42	7	35.00
13215.	AUDEAMUS (audeamus)	20	61.90	79.57	1	5.00
13216.	Astra (astrame)	20	77.14	89.27	4	20.00
13217.	ASP00KY (aspooky)	20	57.49	77.33	8	40.00
13218.	revaN (ashun)	20	101.69	114.79	6	30.00
13219.	nah id win (aragorn_the_snake)	20	125.75	136.98	1	5.00
13220.	AppleSnap (applesnap_1)	20	57.27	68.16	5	25.00
13221.	Eric (appleipad556)	20	132.93	147.26	17	85.00
13222.	anntaylor (anntaylorn)	20	134.77	172.29	17	85.00
13223.	Anita (anita0718)	20	99.20	119.83	8	40.00
13224.	anik akash (anikakash)	20	40.35	52.45	3	15.00
13225.	Wolfie (amrkhaled09)	20	98.61	127.33	10	50.00
13226.	Amin (amin_farzane)	20	73.55	80.67	4	20.00
13227.	Amelia (amelia_j_s)	20	56.88	64.06	7	35.00
13228.	Alper (alperiox)	20	108.08	129.26	7	35.00
13229.	Alon (alon276)	20	101.91	113.72	12	60.00
13230.	TSpin (all_type)	20	76.05	87.81	4	20.00
13231.	Jesse (alfonz)	20	68.70	80.89	5	25.00
13232.	Akbor (akbor_ab)	20	52.12	65.11	2	10.00
13233.	Eduardo (airplane_cakes)	20	84.07	109.36	5	25.00
13234.	Aimbot (aimbot2003)	20	66.96	77.90	7	35.00
13235.	Rasmis (ahtavarasmus)	20	54.82	67.23	6	30.00
13236.	Afzaal (afzaalahmad)	20	45.86	59.37	3	15.00
13237.	Muhammad (afi__afi)	20	43.13	52.91	1	5.00
13238.	affnah (affnah)	20	121.36	134.76	6	30.00
13239.	Achyut (achyut_india)	20	76.06	90.28	5	25.00
13240.	Alan (acfrost3)	20	50.89	60.32	2	10.00
13241.	Abqw112 (abqw112)	20	95.42	112.34	8	40.00
13242.	Syrus (abbys_sof)	20	80.23	91.80	7	35.00
13243.	AA Batteries (aa_batteries)	20	80.02	91.42	3	15.00
13244.	aarush_ (aarush_)	20	81.21	92.81	6	30.00
13245.	Aadhi (aadhi936)	20	56.19	60.15	1	5.00
13246.	Santhosh (54nth05h)	20	62.15	74.50	7	35.00
13247.	Suns (49suns)	20	70.75	80.14	2	10.00
13248.	Greedy (greedy_78)	20	72.90	89.27	5	25.00
13249.	ThPh (thph)	20	18.72	22.86	2	10.00
13250.	bence (stefler01)	20	70.94	83.37	6	30.00
13251.	Senvidu (galaxy_slayer_zed)	20	56.32	67.11	0	0.00
13252.	tstats[mirfattah] (mirfattah)	20	44.75	55.80	1	5.00
13253.	Unknown (__unkn0wn__)	20	85.15	102.98	5	25.00
13254.	Michael (mspain0729)	20	74.59	87.90	7	35.00
13255.	Alex (alexm11593)	20	54.27	64.97	6	30.00
13256.	Lulu (aztral)	20	58.75	68.38	6	30.00
13257.	Joshua (josh3000)	20	60.13	72.86	7	35.00
13258.	G (foad420)	20	74.76	97.59	6	30.00
13259.	Lucas (opoutinechooo)	20	76.31	86.61	6	30.00
13260.	Tony (generalbob1212)	20	90.57	109.99	8	40.00
13261.	Romain (romainl456)	20	65.46	80.79	6	30.00
13262.	Dana (cutie68176)	20	39.59	46.69	0	0.00
13263.	YellowyLOL (seojoon)	20	81.92	93.87	7	35.00
13264.	Di (qazydi)	20	64.67	75.44	13	65.00
13265.	Pytist (talentoncolemak)	20	79.13	88.80	8	40.00
13266.	Mike (mikechill_69)	20	56.41	70.86	4	20.00
13267.	rhi (okrhi)	20	75.01	87.64	2	10.00
13268.	Daniel (moixland)	20	100.34	116.07	12	60.00
13269.	jlang (jlang2)	20	65.60	83.25	4	20.00
13270.	Dave (dsolesvik)	20	102.24	122.71	14	70.00
13271.	Hunter (midorieon)	20	57.76	71.42	3	15.00
13272.	Haiku (mastahaiku)	20	82.88	96.08	9	45.00
13273.	Jonas (jonstep)	20	46.84	59.71	2	10.00
13274.	Nightkid (tatami_downshift)	20	45.61	54.24	3	15.00
13275.	Alan (autisticfish)	20	101.26	119.16	10	50.00
13276.	Mohammed (mohammed_m)	20	67.33	77.35	2	10.00
13277.	janina (janinaa)	20	43.62	53.94	3	15.00
13278.	KY (9v_lky)	20	62.25	80.85	4	20.00
13279.	Bob (bob192433)	20	98.66	108.57	8	40.00
13280.	K (keiarcy)	20	87.91	100.46	5	25.00
13281.	Blaire (sayurblaires)	20	64.60	76.24	7	35.00
13282.	Ben (2benn)	20	74.81	90.56	6	30.00
13283.	ja (bigfatpotato)	20	50.64	62.50	4	20.00
13284.	miguel (gonzalodtd)	20	76.54	94.75	8	40.00
13285.	mk (ekoam)	20	52.02	62.82	5	25.00
13286.	velano (velano)	20	64.27	80.93	5	25.00
13287.	Ero_Senin (typer_sensei)	20	33.72	39.60	4	20.00
13288.	John (minipax)	20	60.18	67.75	4	20.00
13289.	Amine (goshey)	20	57.81	67.21	6	30.00
13290.	Kenny (rexnihilo)	20	43.12	56.00	3	15.00
13291.	ohreo (ohreo)	20	92.78	119.83	8	40.00
13292.	Tristan (triscross)	20	67.53	74.03	5	25.00
13293.	Claywell (claywello)	20	45.55	52.47	2	10.00
13294.	Henry (shocksan)	20	35.03	45.15	0	0.00
13295.	mtmonk (vxnomous_)	20	53.55	62.73	8	40.00
13296.	Perry (plebeian7)	20	66.15	88.56	10	50.00
13297.	Yashwanth (csyashwanth)	20	35.81	44.47	2	10.00
13298.	Nguyễn Minh (shiftk)	20	65.08	102.86	5	25.00
13299.	rae (notraeign)	20	100.41	120.48	6	30.00
13300.	Penguin (penguin24562)	20	105.83	134.55	19	95.00
13301.	Eli (gokutypingwizard_)	20	23.72	31.93	7	35.00
13302.	Hopp (461am)	20	82.82	96.46	7	35.00
13303.	Lucas (sonic_car_lucas_ling)	20	68.18	90.03	3	15.00
13304.	james (minecraft001yt)	20	83.27	97.06	11	55.00
13305.	Andi (andih)	20	72.87	91.80	7	35.00
13306.	James (__james)	19	57.84	68.73	4	21.05
13307.	Hannah (_hannahxr)	19	66.24	76.41	5	26.32
13308.	Zakir (z_slayer)	19	68.14	78.35	8	42.11
13309.	Cyrus (zombie_kid_likes_tur...	19	87.32	114.42	5	26.32
13310.	Kevin (zenicide)	19	100.81	120.76	8	42.11
13311.	kushkus (zefirokouz)	19	81.89	96.51	6	31.58
13312.	Zamira (zamira89)	19	23.78	27.09	8	42.11
13313.	zahid (zahid_hasan_sahin)	19	58.92	70.72	5	26.32
13314.	Zach (zacuum)	19	85.34	105.06	5	26.32
13315.	Zack (zackjwilk)	19	102.83	122.54	9	47.37
13316.	Zach (zachattack8910)	19	75.23	92.82	2	10.53
13317.	Shian (ytxiang1997)	19	89.20	101.87	2	10.53
13318.	Liam (yourmotherguy)	19	94.60	110.55	10	52.63
13319.	Regin (yoloburgerking)	19	109.99	122.59	9	47.37
13320.	yaQvadrat (yaqvadrat)	19	61.05	72.86	4	21.05
13321.	yang (yangtyper)	19	79.14	87.49	5	26.32
13322.	Paul (yangaapaul)	19	125.98	149.66	13	68.42
13323.	Marc (xmarcxx)	19	77.53	95.11	3	15.79
13324.	Alex (xanderamb)	19	81.16	97.48	9	47.37
13325.	wiktor (wiktoroski1995)	19	27.70	36.44	4	21.05
13326.	Kevin (whatsyourtype)	19	111.75	131.84	8	42.11
13327.	Weegeepootis (weegeepootis)	19	118.44	135.06	8	42.11
13328.	Walter (walter1)	19	92.78	102.47	8	42.11
13329.	DybVv (vuong02011996)	19	54.00	63.71	4	21.05
13330.	Khoi Nguyen (vukhoinguyen8492)	19	105.47	117.36	8	42.11
13331.	vormin (vormin)	19	63.00	72.46	5	26.32
13332.	Vishishta (vishik_685)	19	71.83	81.02	7	36.84
13333.	Dan (videogamewarriortv)	19	114.21	144.77	11	57.89
13334.	Boris (vhoma)	19	55.52	60.80	1	5.26
13335.	Jun (vegetto1126)	19	112.07	129.66	12	63.16
13336.	Valtishqq (valti46)	19	78.93	90.25	5	26.32
13337.	Michael (valibukk)	19	66.87	75.21	7	36.84
13338.	Utku (utkumaden)	19	75.71	89.14	5	26.32
13339.	U (uqs1)	19	63.83	74.67	2	10.53
13340.	ungabunga (ungabungaoobunga)	19	87.27	110.66	4	21.05
13341.	Obama (underi7)	19	92.26	105.67	10	52.63
13342.	Alan (typing_alan)	19	65.28	76.68	5	26.32
13343.	Turningworld (turningworld)	19	59.80	70.52	8	42.11
13344.	Trey (trxtier)	19	54.21	75.98	2	10.53
13345.	Truvius (truvius)	19	86.68	107.89	4	21.05
13346.	Josh (tributedajerk)	19	103.69	128.82	10	52.63
13347.	Tomasz (toumash)	19	71.55	84.89	8	42.11
13348.	Toshi (totora)	19	42.01	54.13	1	5.26
13349.	Tobias (tospon)	19	28.73	33.56	6	31.58
13350.	tontin (tontinvicinta)	19	92.70	111.85	5	26.32
13351.	Tibnel (tonels)	19	115.23	141.30	10	52.63
13352.	chalantorn (tonchalantron)	19	71.00	86.51	14	73.68
13353.	TapTapTappy (tomcolemak)	19	115.63	136.22	9	47.37
13354.	Tej (tjoshi12)	19	94.71	108.84	7	36.84
13355.	Faustino (tinoriffic)	19	102.15	112.77	7	36.84
13356.	Tan (tim0909)	19	124.53	140.79	12	63.16
13357.	Thuong (thuongle19)	19	66.45	76.38	4	21.05
13358.	Ryan (thoughtpotato)	19	96.32	112.43	5	26.32
13359.	pogchamp (the_frog_champ)	19	119.92	164.12	11	57.89
13360.	Radu Codescu (the_eagle)	19	53.19	59.77	4	21.05
13361.	Coconut (the_coconut)	19	97.09	107.15	6	31.58
13362.	Anson (the_chill_templar)	19	90.32	109.31	10	52.63
13363.	Luc (theshadowcuber)	19	92.31	111.84	4	21.05
13364.	Aaron (theredspartan)	19	86.84	101.98	5	26.32
13365.	theonesomebodey (theonesome...	19	67.52	98.84	3	15.79
13366.	daniiar (thedoni)	19	43.04	55.14	1	5.26
13367.	the1stpsycho (the1stpsycho)	19	76.71	93.81	6	31.58
13368.	Maddy (teruteru2116)	19	113.98	152.51	12	63.16
13369.	Iftakhar (tanvir021)	19	45.74	51.75	1	5.26
13370.	Tan (tang_)	19	65.52	77.88	7	36.84
13371.	Danny (taipmaster)	19	97.55	120.38	10	52.63
13372.	Alan (taialan)	19	87.07	99.83	17	89.47
13373.	Sumit (sysoutme)	19	65.32	71.25	3	15.79
13374.	Maxi (swimincircles)	19	85.15	104.47	8	42.11
13375.	MadsFuldGas (swaax)	19	139.32	160.32	17	89.47
13376.	सुरेन्द्र...	19	56.55	69.09	1	5.26
13377.	Joe (suqmadiqmann)	19	98.70	115.94	10	52.63
13378.	Landon (sugamalia)	19	98.88	132.34	6	31.58
13379.	Sue (suevang)	19	62.24	78.76	2	10.53
13380.	Styo (styofox)	19	53.50	61.59	2	10.53
13381.	strange (strangeeggs)	19	133.86	165.74	8	42.11
13382.	stormchaserwhienne (stormch...	19	78.75	102.54	6	31.58
13383.	Stevey (steveaiva)	19	56.87	67.42	2	10.53
13384.	Kasey (kaseykasey)	19	48.02	56.88	3	15.79
13385.	Miguel (spiritdesire)	19	79.50	88.61	5	26.32
13386.	Aria (spaceface32)	19	82.59	98.42	3	15.79
13387.	Tomislav (sovageng)	19	76.39	85.69	6	31.58
13388.	Ler (soospooky)	19	97.67	107.05	7	36.84
13389.	SoopaKhell (soopakhell)	19	109.73	129.87	14	73.68
13390.	Somanos (somanos)	19	96.13	109.36	8	42.11
13391.	brad (soccerboyy)	19	91.25	120.56	8	42.11
13392.	Daan (skunki)	19	81.70	91.72	7	36.84
13393.	tstats[sivert_ivert] (siver...	19	87.85	112.44	5	26.32
13394.	Sisi (sisiamor)	19	121.49	141.02	13	68.42
13395.	(sirreinz)	19	94.13	106.21	8	42.11
13396.	Daniel (siichotic)	19	103.64	121.78	3	15.79
13397.	Bertie (shkablameo)	19	54.91	64.61	2	10.53
13398.	Shawn (shawtyper)	19	57.59	73.79	4	21.05
13399.	SeldRiyo (seldriyo)	19	56.16	63.31	3	15.79
13400.	Caro :3 (scary_carrie)	19	59.25	70.82	3	15.79
13401.	Sc0rxh (sc0rxh)	19	107.95	123.16	6	31.58
13402.	based_hitler_69 (sav_ru)	19	47.90	54.69	1	5.26
13403.	Sapphire (sapphirexsky)	19	86.25	129.24	5	26.32
13404.	Sapient (sapient)	19	85.69	106.89	4	21.05
13405.	1337 (samseks)	19	89.91	104.82	9	47.37
13406.	Samantha (samantha_314)	19	99.96	117.69	10	52.63
13407.	SadRoad (sadroad)	19	90.78	123.10	6	31.58
13408.	Cherry (s9crs)	19	42.74	51.96	1	5.26
13409.	Robin (rxb1nn)	19	75.21	93.25	4	21.05
13410.	rpyx (rpyx)	19	115.39	131.24	13	68.42
13411.	RPUSam (rpusam)	19	151.38	160.44	18	94.74
13412.	rohit (rohitzerofour)	19	47.47	67.35	2	10.53
13413.	Rishit (rishitlogar)	19	74.12	89.84	2	10.53
13414.	fanatic (rijulbidhan)	19	81.07	91.36	8	42.11
13415.	Rick (rick_200wpm)	19	10.83	14.09	10	52.63
13416.	Themis (reitgg)	19	105.94	127.35	13	68.42
13417.	FreePalestine (reda6aboob)	19	24.83	31.11	5	26.32
13418.	ReconMarine (reconmarine117)	19	71.43	81.01	7	36.84
13419.	Nefritees (realnefritees)	19	69.79	82.82	6	31.58
13420.	rao (raonavdeep)	19	55.62	67.92	5	26.32
13421.	Roope (randommaster)	19	57.38	62.82	6	31.58
13422.	Rahma (rahhma)	19	69.86	78.92	10	52.63
13423.	Clare (radioclare)	19	83.53	102.79	5	26.32
13424.	Q3stor (q3stor)	19	35.65	44.80	3	15.79
13425.	temp23178946 (previouslol)	19	90.15	112.20	5	26.32
13426.	Pramit (pramittt)	19	51.40	64.18	1	5.26
13427.	Jason (pradogy)	19	79.73	102.33	2	10.53
13428.	Playboifarti (playboifarti)	19	62.54	77.96	3	15.79
13429.	PkRb21 (pkrb21)	19	65.05	73.09	5	26.32
13430.	PIXI (pixipixi)	19	136.43	176.90	11	57.89
13431.	PixelFog (pixelfog)	19	99.96	111.62	6	31.58
13432.	Speedy (pindakaaspot123)	19	85.70	109.01	6	31.58
13433.	Soós (pbaalt)	19	73.48	88.45	5	26.32
13434.	Paulie (paulie_)	19	107.96	126.80	7	36.84
13435.	Pasta_Devoured (pasta_devou...	19	45.44	52.68	17	89.47
13436.	Parnian (parnian)	19	47.70	56.28	0	0.00
13437.	Cael (paile)	19	95.51	117.19	7	36.84
13438.	Jo (oyangjo)	19	71.91	92.45	4	21.05
13439.	otve (otve)	19	64.41	85.98	6	31.58
13440.	OranH77 (oranh77)	19	78.88	94.08	6	31.58
13441.	Alex (omggitsalphaa)	19	92.06	106.80	5	26.32
13442.	Ollie (olijf)	19	81.75	95.49	8	42.11
13443.	Eldin (oktea)	19	100.29	118.98	8	42.11
13444.	Nathan (nzhang5075)	19	77.88	89.79	4	21.05
13445.	Nynnf (nynnf)	19	82.95	96.11	15	78.95
13446.	Nvzhnn (nvzhnn)	19	97.54	113.19	9	47.37
13447.	Youssef (nuggetdip)	19	68.20	77.01	4	21.05
13448.	NRC_131_G (nrc_131_g)	19	86.08	104.15	16	84.21
13449.	Nabin (npboss)	19	52.50	62.93	4	21.05
13450.	xuehua (noquitnrooom)	19	120.57	144.58	12	63.16
13451.	Daniel (nodasch)	19	64.90	81.91	4	21.05
13452.	Jason (njasow)	19	112.17	123.39	12	63.16
13453.	Jibon (ninja0x)	19	43.44	50.64	2	10.53
13454.	Nicolai (nicolaifeldthaus)	19	79.83	92.38	5	26.32
13455.	Jus (nicememe12)	19	97.18	111.32	9	47.37
13456.	Nefko (nefko)	19	90.98	108.20	5	26.32
13457.	Natan (nati_130)	19	38.97	46.37	0	0.00
13458.	Nabil (nabilhuda)	19	64.70	78.06	5	26.32
13459.	tstats[nabil365] (nabil365)	19	53.79	68.65	3	15.79
13460.	adam (n0tracist)	19	104.77	122.42	11	57.89
13461.	MUHAMMAD (m_haris676)	19	33.80	40.59	6	31.58
13462.	Mike (mxtinkxm)	19	41.09	60.87	2	10.53
13463.	mush (mushkatsu)	19	70.82	91.54	2	10.53
13464.	Addis (mryoungaddis)	19	62.78	74.75	2	10.53
13465.	lamok (mrgago)	19	96.36	123.72	13	68.42
13466.	Sompang (mplegato)	19	87.42	98.32	5	26.32
13467.	Mark (mose9634)	19	95.32	110.65	7	36.84
13468.	Dill (monkeyman1637)	19	77.97	91.81	8	42.11
13469.	Möhri (moehri)	19	72.55	88.80	15	78.95
13470.	Moe (moeb1us)	19	82.59	107.02	10	52.63
13471.	Nurul (mnislam)	19	86.08	93.35	8	42.11
13472.	Paloma (mmmmtype)	19	69.74	80.77	6	31.58
13473.	Micah (mjdomo)	19	88.72	101.04	8	42.11
13474.	Vãi Trí (minhtrihard)	19	82.37	96.02	3	15.79
13475.	Michael (mikenike52899)	19	94.50	110.55	6	31.58
13476.	Andrew (mhayes4701)	19	89.44	96.60	6	31.58
13477.	Michael (meowmeowmikey)	19	101.32	131.15	9	47.37
13478.	Melioninas (melioninas)	19	70.42	83.65	6	31.58
13479.	Manos (me1nos)	19	54.10	68.47	0	0.00
13480.	Matthew (mcluzar)	19	104.53	127.32	10	52.63
13481.	mcjohn_117 (mcjohn_117)	19	91.66	109.37	9	47.37
13482.	Son (mcc_sasuke)	19	60.50	75.08	5	26.32
13483.	MB (mb_the_lighting)	19	67.45	78.18	6	31.58
13484.	Matin (matinkh)	19	83.16	96.89	7	36.84
13485.	Martin (martinw89)	19	82.18	96.54	5	26.32
13486.	Martine (martine_338)	19	59.82	72.35	14	73.68
13487.	Segs (mahrush)	19	56.47	68.10	9	47.37
13488.	Mahmoud (mahmoudalbadarin)	19	66.47	75.35	5	26.32
13489.	Mack (mackimations)	19	87.73	100.76	7	36.84
13490.	tomcr00se (lqszlo)	19	60.57	77.21	17	89.47
13491.	Lowie (lowie_987)	19	67.36	78.19	6	31.58
13492.	Jonathan (lone_lee)	19	93.49	113.93	7	36.84
13493.	Elisabeth (liz4liz5)	19	98.10	121.99	9	47.37
13494.	xhulio (lighting11)	19	65.47	79.97	5	26.32
13495.	leonardo (leonardouwu)	19	64.90	74.78	3	15.79
13496.	Lemons (lemonslmfao)	19	53.56	61.72	10	52.63
13497.	Lazyteam (lazyteam)	19	73.07	87.39	4	21.05
13498.	Lucas (larkluco)	19	55.97	63.86	4	21.05
13499.	Larisa (larisa402)	19	74.54	91.57	4	21.05
13500.	⠀ (lain_)	19	58.53	71.36	4	21.05
13501.	Solomann (kuttamma01)	19	108.22	127.85	10	52.63
13502.	Jakob (kroelle_korean)	19	94.39	107.52	10	52.63
13503.	Kristian (kristiandiana)	19	69.02	80.09	5	26.32
13504.	Kazoo (kosu_kat)	19	72.81	79.97	6	31.58
13505.	Purple (komnambongo)	19	111.67	143.82	8	42.11
13506.	Ebok (kobe5623)	19	94.26	109.34	10	52.63
13507.	Yesitsme (kingbee11)	19	49.49	62.49	3	15.79
13508.	Tony (kevinneeraj)	19	112.44	130.81	11	57.89
13509.	Kazuki (kazuki_kun)	19	88.60	99.76	6	31.58
13510.	Kažkas (kazkass)	19	70.76	77.12	5	26.32
13511.	Ayush (kanodiaayush)	19	93.33	111.13	5	26.32
13512.	Kanazaki (kanazaki)	19	81.14	95.68	7	36.84
13513.	Kagero (kagero_)	19	67.36	85.93	4	21.05
13514.	bruh (k3nny11)	19	67.54	85.28	4	21.05
13515.	Juniper (junipergd)	19	108.54	144.84	12	63.16
13516.	Julia (juliazc)	19	88.30	101.75	4	21.05
13517.	Jessica (jsilvers27)	19	74.73	85.84	5	26.32
13518.	Joseba (jouelcamper555)	19	56.97	73.52	2	10.53
13519.	Josiah (josiah_cw)	19	79.92	89.81	2	10.53
13520.	yerimiese (johwee)	19	94.59	108.88	7	36.84
13521.	Joel (joellimcy129)	19	94.11	111.97	15	78.95
13522.	Jxshify (jkbestgamer)	19	106.60	138.24	18	94.74
13523.	Thomas (jitensha03)	19	76.95	97.83	10	52.63
13524.	Jillian (jillianbonfoeyoops...	19	55.30	67.40	10	52.63
13525.	Jesse (jesser1440)	19	73.08	85.06	5	26.32
13526.	JerseySlums (jerseyslums)	19	84.12	113.47	7	36.84
13527.	Jerin (jerinjames)	19	54.29	63.63	5	26.32
13528.	J (jdizzla)	19	121.45	149.63	8	42.11
13529.	James (james_jjv)	19	72.61	87.24	7	36.84
13530.	James (jameshasconnected)	19	50.01	67.16	1	5.26
13531.	James (james0306)	19	79.21	95.95	2	10.53
13532.	Jam (jamelele)	19	125.27	145.60	13	68.42
13533.	Jax (jacksonn131)	19	84.58	107.12	4	21.05
13534.	Jack (iviagicjack)	19	97.65	113.23	7	36.84
13535.	ivan (ivanferraro)	19	74.57	86.42	3	15.79
13536.	Tact (itstact)	19	98.73	114.36	8	42.11
13537.	itsgohtime (itsgohtime)	19	125.10	134.80	13	68.42
13538.	Juan (isayuno)	19	100.88	114.53	10	52.63
13539.	Kylle (iomeotic)	19	73.44	91.31	6	31.58
13540.	amir (ioio)	19	88.30	113.80	13	68.42
13541.	Nicolas (insont)	19	78.22	90.78	7	36.84
13542.	Inox (inox)	19	85.37	97.25	6	31.58
13543.	alvarado (im_wilin)	19	81.86	95.99	5	26.32
13544.	Lawrence (imetsia)	19	106.25	116.13	8	42.11
13545.	Thomas (ilikebigtitties69)	19	67.31	74.40	7	36.84
13546.	Jim (ifeelhyper)	19	114.46	134.56	11	57.89
13547.	icening (icening)	19	40.88	45.93	4	21.05
13548.	Ian (iango23)	19	59.97	75.34	5	26.32
13549.	Skylar (iamskyhawk)	19	90.70	101.64	11	57.89
13550.	Ashish (iamprogrammar)	19	66.03	73.90	5	26.32
13551.	IAGamingWay (iagamingway)	19	74.86	87.68	14	73.68
13552.	Randy (hype_rion)	19	62.18	83.28	3	15.79
13553.	Brian (hydrobox)	19	85.30	96.46	2	10.53
13554.	Hoang (huyyyyyyyyyyyyyyyyy)	19	70.28	77.67	4	21.05
13555.	me (hseruslihkus)	19	49.88	59.32	2	10.53
13556.	Steven (hondasivakgaming)	19	77.87	104.50	6	31.58
13557.	Hol (holster)	19	92.42	107.00	9	47.37
13558.	HerrBlinkenlicht (herrblink...	19	64.46	80.41	1	5.26
13559.	ok (herbaltea)	19	97.80	121.03	9	47.37
13560.	Hazim (hazm)	19	98.60	116.91	13	68.42
13561.	Hari Chandan Das (harichand...	19	57.68	67.19	1	5.26
13562.	titty (happyfaceman)	19	67.64	81.72	5	26.32
13563.	IHnanah (hanahaoha)	19	134.92	176.36	16	84.21
13564.	Hamlet (hamabaya)	19	102.51	115.47	5	26.32
13565.	Nah (halo375)	19	58.54	69.88	5	26.32
13566.	LE ANH QUAN (hacbachmaquan)	19	82.20	97.58	8	42.11
13567.	Andy (gunwing54)	19	96.66	114.89	4	21.05
13568.	Nelson (guaxini)	19	53.11	61.88	1	5.26
13569.	Gavin (gt3ch1)	19	95.10	118.12	8	42.11
13570.	Geo (godex)	19	95.48	114.43	7	36.84
13571.	Daniel (gismo359)	19	82.93	92.81	8	42.11
13572.	Gabi (gabitzuxxl)	19	109.49	121.68	7	36.84
13573.	David (fuzzycheeks)	19	111.26	130.23	8	42.11
13574.	blaine (frikker)	19	118.12	151.78	15	78.95
13575.	Erika (frenzymania)	19	84.77	101.64	3	15.79
13576.	Lewis (fr0stbites)	19	77.75	90.89	8	42.11
13577.	fosty (fostyfog)	19	46.57	62.62	5	26.32
13578.	Sakura (foreheady)	19	75.64	84.72	1	5.26
13579.	fred (foop1)	19	112.20	128.19	10	52.63
13580.	Ray (flexray)	19	86.94	108.85	7	36.84
13581.	FlaTrix (flatrix)	19	312.06	448.52	19	100.00
13582.	Filip (fifi_wilk)	19	81.60	94.37	6	31.58
13583.	fergisson (fergiss)	19	65.88	76.47	6	31.58
13584.	Aidan (fastflangies)	19	67.29	78.57	8	42.11
13585.	Ian (fadedrobin)	19	72.78	100.95	6	31.58
13586.	eyeliddy (eyeliddy)	19	99.32	119.86	11	57.89
13587.	Leon (extremegamer116)	19	100.29	125.96	5	26.32
13588.	Evan (evang_dvorak)	19	103.15	120.28	12	63.16
13589.	EthKrae (ethkrae)	19	72.66	82.02	5	26.32
13590.	equations (equationslayer12)	19	74.67	94.70	4	21.05
13591.	Ahmad (eqbalshekib)	19	65.64	81.49	7	36.84
13592.	Epik Dino (epikdinosaur)	19	66.22	76.67	4	21.05
13593.	RIP Byron (enriquecollin)	19	131.24	155.19	11	57.89
13594.	visily (enlive3)	19	72.63	96.60	6	31.58
13595.	Prawny (enderduck247)	19	88.71	119.22	17	89.47
13596.	eman borham (ema_burham)	19	42.77	47.67	1	5.26
13597.	Emateos (emateos)	19	59.98	67.63	9	47.37
13598.	Ella (ellavampyrella)	19	49.53	57.56	2	10.53
13599.	elif (eliff)	19	66.57	80.99	7	36.84
13600.	Elias (eliasmarcelin0)	19	80.00	103.45	6	31.58
13601.	David (electro2020)	19	119.63	143.48	9	47.37
13602.	ekupro (ekupro)	19	44.68	51.89	2	10.53
13603.	Eifie (eifietheward)	19	62.29	88.50	2	10.53
13604.	Satyam (echosatyam)	19	57.48	68.85	3	15.79
13605.	Mazeppa (dynozawa)	19	93.63	103.35	4	21.05
13606.	dukka (dukka_)	19	106.81	121.46	7	36.84
13607.	RIP yomps (dtfps)	19	103.24	122.17	18	94.74
13608.	Sascha (dsm716)	19	39.51	45.26	2	10.53
13609.	Downsouthspy (drax_)	19	78.01	92.76	7	36.84
13610.	jin (dragon51221)	19	86.29	94.76	6	31.58
13611.	Dookie Shoes (dookie_shoes)	19	100.54	124.57	6	31.58
13612.	Arrogant (dkaocka)	19	102.68	120.91	6	31.58
13613.	Steven (df1337)	19	112.93	138.38	9	47.37
13614.	desa (desa7645)	19	38.31	45.86	0	0.00
13615.	Guest (dbluedb)	19	68.37	92.87	1	5.26
13616.	Kike (darkskyflow)	19	51.76	59.51	9	47.37
13617.	Darkcryed (darkcryed)	19	90.33	106.41	5	26.32
13618.	Lee (cytokid101)	19	136.80	159.07	13	68.42
13619.	Cryp_ted (crypted06)	19	106.54	121.42	19	100.00
13620.	Ethan (crissps)	19	74.18	92.35	5	26.32
13621.	Dumby (cooh)	19	89.01	100.38	5	26.32
13622.	Hacker (console0)	19	38.00	45.35	1	5.26
13623.	Blackmooer (colinluca)	19	76.86	89.94	7	36.84
13624.	Jesse (cliev)	19	126.82	150.33	13	68.42
13625.	Clark (clark_d)	19	52.95	70.41	1	5.26
13626.	Vlad (ciorap88)	19	67.21	84.01	4	21.05
13627.	mark (chuahuonga)	19	62.88	76.36	3	15.79
13628.	Devon (cheeky_sneakster)	19	86.39	101.79	8	42.11
13629.	Ccucumber12 (ccucumber12)	19	72.80	84.56	5	26.32
13630.	Chris (cccxxxl)	19	103.73	116.44	19	100.00
13631.	CarrotyLemons (carrotylemons)	19	69.48	84.49	7	36.84
13632.	Carlz (carlz19)	19	89.85	105.36	5	26.32
13633.	Josh (capitanwalrus)	19	74.44	91.59	3	15.79
13634.	Ceramic (caleb_2000)	19	82.75	92.77	5	26.32
13635.	bvk (bvkv)	19	64.11	72.09	1	5.26
13636.	Arie (buenobonsai)	19	90.77	105.44	5	26.32
13637.	Bede (breadstickx)	19	90.85	99.44	4	21.05
13638.	Oleg (braga01)	19	83.28	92.31	7	36.84
13639.	Brady (bradymoller)	19	77.12	91.29	3	15.79
13640.	HUN (botyi22)	19	42.17	51.32	0	0.00
13641.	boocoo (boocoo)	19	77.92	94.32	3	15.79
13642.	Robert (bonsai_aus)	19	105.08	132.89	7	36.84
13643.	Nolan (blerz)	19	103.84	117.38	16	84.21
13644.	Blablle (blablle)	19	89.49	107.16	19	100.00
13645.	bigpotato24 (bigpotato24)	19	61.94	76.92	5	26.32
13646.	tirehtööri (benracer)	19	81.62	102.58	4	21.05
13647.	Stefaan (befferdw)	19	92.93	140.75	10	52.63
13648.	Brandon (bduick)	19	67.75	79.33	4	21.05
13649.	Andy (batt)	19	88.93	100.20	5	26.32
13650.	Basti (bastigga_)	19	70.35	83.16	5	26.32
13651.	Bakushou (bakushou)	19	56.45	67.79	2	10.53
13652.	Hoshi (b1ink)	19	75.47	90.90	6	31.58
13653.	Avinash (avinash625)	19	81.68	95.29	2	10.53
13654.	AuroraSpirix (auroraspirit)	19	101.08	130.84	8	42.11
13655.	Haany (asterp01)	19	61.94	77.11	2	10.53
13656.	Oliver (arscenic)	19	77.17	93.89	8	42.11
13657.	blooks (aprinter)	19	98.46	115.85	12	63.16
13658.	Ansh (ansh_001)	19	66.84	82.44	7	36.84
13659.	Guillermo (andragoner)	19	100.61	128.04	3	15.79
13660.	Amfomy (amfomy)	19	73.15	89.66	7	36.84
13661.	Amal (amalsan)	19	57.59	65.26	5	26.32
13662.	Guest (alvinaruto)	19	66.27	81.23	7	36.84
13663.	curious (allodic)	19	100.67	116.07	11	57.89
13664.	al2qx (al2qx)	19	78.54	92.57	6	31.58
13665.	tstats[aisultan] (aisultan)	19	75.30	92.89	4	21.05
13666.	Aidan (aidandapenguin)	19	58.65	66.71	1	5.26
13667.	lemonade (agolemonade)	19	90.24	115.86	6	31.58
13668.	Atanas (aginev)	19	47.08	56.07	3	15.79
13669.	Eaton (adgray09)	19	68.29	85.27	4	21.05
13670.	Jacob (addthenine)	19	85.79	98.73	5	26.32
13671.	blackjeseos (actuallyfadhli)	19	69.89	86.93	4	21.05
13672.	Rabia (abdessalam)	19	62.27	68.83	1	5.26
13673.	Aafeef (aafeef25)	19	60.20	78.86	17	89.47
13674.	Nick (aaaywhatup)	19	83.55	98.76	4	21.05
13675.	Eduardo (4lc1d3)	19	78.90	91.53	2	10.53
13676.	rome (1ensh1)	19	80.62	92.22	4	21.05
13677.	Barteritus (barteritus)	19	67.59	88.04	1	5.26
13678.	saktisudarsono (saktisudars...	19	80.68	92.68	3	15.79
13679.	Yusome (yusomeli)	19	59.07	71.83	5	26.32
13680.	Rustyrare (rustyrare)	19	69.16	82.51	6	31.58
13681.	Fábio (thefabio8000)	19	61.92	76.33	6	31.58
13682.	Scimza (scimza)	19	87.58	103.41	7	36.84
13683.	Bob (iamaninja66)	19	69.86	86.19	5	26.32
13684.	Hawk (hawkeye7662)	19	75.08	82.96	18	94.74
13685.	Ivan (boringspookycoolivan)	19	74.38	89.60	5	26.32
13686.	viktor (killingnexus)	19	58.76	69.70	3	15.79
13687.	Noah (trumpybear)	19	76.18	87.17	6	31.58
13688.	Z40Abanob (z40abanob)	19	70.87	88.73	12	63.16
13689.	hteraG (hterag)	19	78.70	100.74	5	26.32
13690.	Hao (hao1110)	19	44.45	61.51	2	10.53
13691.	Penguin (itsgirlgamer49)	19	36.04	46.35	0	0.00
13692.	kenzo (k3nx0)	19	58.49	68.41	1	5.26
13693.	shacha (shacha)	19	36.05	41.56	0	0.00
13694.	leo (enrage411)	19	59.02	73.47	7	36.84
13695.	Mengkuda (rakaoii)	19	46.14	50.82	1	5.26
13696.	John (john_willy)	19	64.61	78.33	10	52.63
13697.	Logan (18logsar)	19	68.54	78.74	8	42.11
13698.	TOAN (huytoan99z)	19	82.52	112.36	7	36.84
13699.	Henry (akarieon)	19	79.78	100.58	13	68.42
13700.	Pedro (tishi091)	19	68.56	76.72	5	26.32
13701.	ydna (smilez_)	19	81.50	103.37	3	15.79
13702.	Mango (monthly_mango)	19	88.42	102.65	10	52.63
13703.	Nawaf (equin)	19	77.15	96.13	2	10.53
13704.	Prince (pri_royal)	19	45.84	57.45	2	10.53
13705.	Ekku (ekkusi)	19	83.45	98.23	4	21.05
13706.	Harrison (nonotharry)	19	73.61	87.94	6	31.58
13707.	D (numzberouz)	19	82.96	99.67	9	47.37
13708.	Charles-John (geetarcharlie17)	19	87.52	111.03	4	21.05
13709.	sopology (sopology)	19	73.47	85.28	5	26.32
13710.	Kevin (kevinnarvaez)	19	51.29	60.05	17	89.47
13711.	David (davrand11)	19	66.01	84.54	6	31.58
13712.	Ling (penguinobeano)	19	113.94	138.27	13	68.42
13713.	Dieter (c4ntel0pe)	19	75.35	88.16	4	21.05
13714.	Edonis (edoedi15)	19	51.06	59.22	2	10.53
13715.	Joris (percyjw)	19	49.59	55.07	4	21.05
13716.	ilovelolipops (sad_hobbit)	19	55.22	64.34	1	5.26
13717.	enigmaticpixels (enigmaticp...	19	85.44	99.79	3	15.79
13718.	Aromasin (aromasin)	19	59.89	76.33	2	10.53
13719.	Alex (alexey1995)	19	26.27	31.29	2	10.53
13720.	Victor (unmighty)	19	98.58	115.54	9	47.37
13721.	Rare (neno20022)	19	47.19	57.88	2	10.53
13722.	Sckroob (sckroob)	19	113.23	125.38	6	31.58
13723.	aaa (adric96)	19	88.28	101.28	7	36.84
13724.	CuriousChild (curiouschild)	19	86.81	98.91	6	31.58
13725.	v3 (_v3_)	18	166.98	187.28	16	88.89
13726.	supreme (_supremes)	18	98.94	109.30	6	33.33
13727.	Ionut (ztonaz)	18	61.09	69.98	4	22.22
13728.	bob (zirx2)	18	87.33	100.02	3	16.67
13729.	Ziffit (ziffit)	18	35.15	42.01	2	11.11
13730.	Zachary (zacmanman)	18	99.24	114.50	3	16.67
13731.	Josh (yummy4skin)	18	83.54	112.40	5	27.78
13732.	Mike (yoshyosh)	18	55.98	66.75	0	0.00
13733.	Jan (yentzeg)	18	90.92	107.46	8	44.44
13734.	Yasunobu (yasunobu)	18	47.80	54.12	4	22.22
13735.	Yaman (yamyoume)	18	69.51	77.42	4	22.22
13736.	yabsira sisay (yabsira)	18	49.29	57.04	1	5.56
13737.	I AM SPEED (xelestis)	18	96.99	114.84	6	33.33
13738.	Xantrum (xantrum1)	18	77.28	96.73	7	38.89
13739.	Dan (writfate)	18	68.97	89.26	4	22.22
13740.	Work (worklife)	18	71.03	78.05	1	5.56
13741.	a (waahello)	18	102.64	119.21	5	27.78
13742.	Viniter (viniter_)	18	63.69	76.00	4	22.22
13743.	vilo (viloo)	18	94.19	114.46	9	50.00
13744.	valeriu (valeriu)	18	46.95	52.89	1	5.56
13745.	Emmanuel (ugochuku2000)	18	87.97	105.64	9	50.00
13746.	YW (tywee)	18	96.59	106.43	10	55.56
13747.	meo (typowriter16)	18	114.41	135.36	11	61.11
13748.	Dan (typefffast)	18	76.31	86.86	5	27.78
13749.	Joran (turkeyman)	18	107.78	126.42	9	50.00
13750.	n8 (ttensu)	18	98.30	113.83	7	38.89
13751.	Tomasz (tserbinowski)	18	47.16	53.88	1	5.56
13752.	truecoatcrew (truecoatcrew)	18	102.73	118.66	12	66.67
13753.	Tripp (tripptypes)	18	52.49	67.36	5	27.78
13754.	Travis (travisxball)	18	99.10	115.34	10	55.56
13755.	TotalTao (totaltao)	18	69.25	80.99	3	16.67
13756.	TornaxO7 (tornax)	18	53.46	58.04	1	5.56
13757.	tony (toeknee0)	18	82.54	95.32	4	22.22
13758.	tan (tnttant)	18	85.15	98.13	8	44.44
13759.	Tir8 (tir8)	18	74.90	88.75	5	27.78
13760.	cookie (timecookie)	18	84.91	95.48	8	44.44
13761.	Tia (tiaaakayyy)	18	114.93	131.27	9	50.00
13762.	Lynan (thonlynan)	18	52.44	67.20	4	22.22
13763.	thomas (thoarell)	18	90.68	107.78	1	5.56
13764.	Wing (thewing_)	18	83.08	114.78	2	11.11
13765.	TheUnder (theunderdoge)	18	78.67	94.26	4	22.22
13766.	Stefan (thebeaver5)	18	82.57	93.64	3	16.67
13767.	Thai (thaiph244)	18	90.87	108.55	7	38.89
13768.	??? (teslacia)	18	100.05	110.46	10	55.56
13769.	Tean (tean)	18	110.64	141.60	17	94.44
13770.	Tangguh (tangguh_)	18	76.17	95.25	5	27.78
13771.	Thomas (taimeru)	18	55.01	67.73	1	5.56
13772.	Tobi (t0b5)	18	74.66	86.43	1	5.56
13773.	Surajit (surajit)	18	58.21	69.77	1	5.56
13774.	J (superuby5)	18	95.09	107.52	7	38.89
13775.	SuperGion915 (supergion915)	18	70.45	82.41	4	22.22
13776.	Andy (superchickeneat)	18	88.49	109.20	11	61.11
13777.	saku (sukasa)	18	127.08	148.34	10	55.56
13778.	anne (strawberrybannenana)	18	82.78	104.31	10	55.56
13779.	Alyssa (stewalyssa)	18	76.37	90.75	6	33.33
13780.	Mr. (stealthykoalaber)	18	104.44	125.68	7	38.89
13781.	stealthevan (stealthevan)	18	109.78	140.70	9	50.00
13782.	Stan (stan3999)	18	71.35	84.71	3	16.67
13783.	Sticky (st1ckyman)	18	67.50	78.03	4	22.22
13784.	ssiKY (ssiky)	18	71.33	83.25	3	16.67
13785.	Tom (spicersoanner)	18	73.36	85.77	3	16.67
13786.	Soul (soulisgarb)	18	89.09	99.44	3	16.67
13787.	vivi (soulace)	18	125.25	153.26	8	44.44
13788.	Leonardo (sonoleo)	18	71.24	80.80	4	22.22
13789.	jenga (smokythunder)	18	108.06	137.08	5	27.78
13790.	jules! (smeme)	18	95.24	117.46	13	72.22
13791.	meher (smc181002)	18	53.86	72.15	3	16.67
13792.	Subid (slowth_369)	18	55.21	68.55	2	11.11
13793.	Simon (simonlee2216)	18	93.89	118.66	11	61.11
13794.	Shivam (shivam543)	18	83.79	98.69	5	27.78
13795.	Davit (shartavadavit0)	18	73.61	84.05	4	22.22
13796.	Sienna (sfdragon)	18	111.31	136.81	9	50.00
13797.	S (sestevens)	18	117.88	131.73	6	33.33
13798.	Parker (seriousnewt8)	18	71.07	87.01	4	22.22
13799.	sendiri (sendiri)	18	79.90	96.20	5	27.78
13800.	Seforius (seforius)	18	106.48	129.41	11	61.11
13801.	SeeJay (seejay_ferraro)	18	65.57	71.64	4	22.22
13802.	Sahil (sahilb7)	18	47.37	60.08	3	16.67
13803.	sahani prasad (sahani)	18	47.05	53.19	2	11.11
13804.	Victor (sadlad)	18	67.29	77.58	4	22.22
13805.	Russell (russellsapphire)	18	99.54	117.19	7	38.89
13806.	Russell (rtx420)	18	58.05	65.91	4	22.22
13807.	Rodrigo (rodgodkiller)	18	63.97	78.87	4	22.22
13808.	Assey (rockae)	18	89.31	109.10	9	50.00
13809.	Robbie (roadcasted)	18	101.80	129.76	6	33.33
13810.	Ruan (rmontelo)	18	92.65	106.50	7	38.89
13811.	rmbench (rmbench)	18	94.06	107.27	5	27.78
13812.	Ji (rk42745417)	18	66.00	77.48	1	5.56
13813.	Riley (rileygramlich)	18	77.27	91.31	6	33.33
13814.	Riley (riela_)	18	75.02	92.74	6	33.33
13815.	Richard (rgoulterbm40dsk)	18	85.57	98.34	6	33.33
13816.	KOCHENGOREN (renasha)	18	84.10	97.67	7	38.89
13817.	Riley (rbogren)	18	76.05	91.37	2	11.11
13818.	ray (raytrace)	18	55.59	69.30	0	0.00
13819.	R0L3eX (r0l3ex)	18	83.72	109.01	4	22.22
13820.	So Slow (quantum1)	18	117.22	137.54	9	50.00
13821.	qria (qria)	18	84.67	97.91	5	27.78
13822.	Qazz (qazztheqazz)	18	90.05	104.07	8	44.44
13823.	Kantapat (pyro_x)	18	55.39	88.02	12	66.67
13824.	pvx123 (pvx123)	18	33.37	38.19	0	0.00
13825.	presto (presto3000)	18	83.02	94.49	4	22.22
13826.	powerofmooogiza (powerofmoo...	18	107.83	125.10	7	38.89
13827.	popsickles (popsickles)	18	90.41	102.77	12	66.67
13828.	W8 4ME (pmarci9810)	18	86.43	98.50	3	16.67
13829.	Jakob Kammerlander (plssnipe)	18	64.45	76.75	3	16.67
13830.	paschalis (platoon132002)	18	45.08	48.92	4	22.22
13831.	Piggie (piggiepoop)	18	112.59	136.34	8	44.44
13832.	Peter (pieter_post)	18	95.00	116.17	14	77.78
13833.	hollow knight (phoenixwleft)	18	66.78	78.17	4	22.22
13834.	Pho (phobreze)	18	85.01	104.16	2	11.11
13835.	Pawan (pawanmsr)	18	55.40	62.03	3	16.67
13836.	Parsa (parsal)	18	81.76	92.77	5	27.78
13837.	Victor (paralisity)	18	65.04	76.57	3	16.67
13838.	Ozymandias (ozymandias_qc)	18	67.96	79.21	5	27.78
13839.	Fauzan (ozaenzenzen)	18	109.59	122.36	6	33.33
13840.	Owen (owenl131)	18	101.44	113.32	10	55.56
13841.	annette (owannette)	18	96.24	109.07	9	50.00
13842.	Johnny (onireves)	18	101.36	126.07	10	55.56
13843.	om (om0305)	18	65.61	76.69	5	27.78
13844.	Omar (oamrelhorbity)	18	55.58	61.77	3	16.67
13845.	Nuteee (nutee)	18	47.97	61.56	0	0.00
13846.	brayn (nmchanab)	18	80.46	86.34	8	44.44
13847.	Nathan (nlaha)	18	78.45	85.88	7	38.89
13848.	Nilacake (nilacake)	18	79.41	96.53	5	27.78
13849.	niko (nikoooo)	18	58.33	75.13	3	16.67
13850.	Nikhil (nikhil142)	18	90.02	106.58	6	33.33
13851.	you (nigamot)	18	63.86	84.68	3	16.67
13852.	Pratyaksh (nickpratyaksh)	18	76.30	92.12	18	100.00
13853.	Bruh (nicesuu)	18	86.33	95.84	5	27.78
13854.	God (nicechop)	18	63.11	71.61	2	11.11
13855.	Tran (newstrung)	18	82.28	91.04	2	11.11
13856.	nara (naraaa)	18	83.73	97.27	3	16.67
13857.	Nafre (nafre)	18	105.55	118.92	10	55.56
13858.	Jose (m_jose)	18	77.88	92.10	4	22.22
13859.	Mymumswims (mymumswims)	18	88.81	106.97	6	33.33
13860.	Mudmai (mudmai)	18	31.76	41.09	1	5.56
13861.	Moukim (moukim)	18	74.01	83.56	2	11.11
13862.	pup (mkpup)	18	73.19	86.67	5	27.78
13863.	Edward (minecrafterman)	18	47.79	57.55	0	0.00
13864.	mimo200 (mimo200be)	18	90.87	97.98	8	44.44
13865.	mike (mikeyfromqueens)	18	94.60	106.78	9	50.00
13866.	José Miguel (mikel2077)	18	84.93	101.22	6	33.33
13867.	mikaelawashere (mikaelawash...	18	73.08	89.02	5	27.78
13868.	midnightsimon (midnightsimon)	18	83.28	104.80	0	0.00
13869.	Martin (mewix)	18	87.07	101.44	1	5.56
13870.	Naisargi (mehtaphysicalfool)	18	87.11	99.48	5	27.78
13871.	Mathijs (mathijsmaes)	18	92.72	108.10	7	38.89
13872.	urmom (mars3000)	18	78.86	86.55	3	16.67
13873.	Mari (maribun)	18	94.53	116.26	16	88.89
13874.	josiah (mangofeline)	18	85.25	113.55	7	38.89
13875.	Manfred (manfredxu99)	18	152.20	179.09	17	94.44
13876.	Matthais (maciejosas2012)	18	100.67	116.74	5	27.78
13877.	Ted (macfan)	18	105.20	115.53	9	50.00
13878.	Luke (lukeov)	18	80.24	99.87	5	27.78
13879.	Johnathan Walter (luciferin)	18	97.01	108.78	5	27.78
13880.	Lukasz (lpodolski)	18	72.92	84.84	1	5.56
13881.	lodo4ka (lodo4ka)	18	70.45	83.82	3	16.67
13882.	Mr (littyzm)	18	107.27	125.48	4	22.22
13883.	Rein (lilpotatopop)	18	89.48	112.50	13	72.22
13884.	Klunky (liamrob)	18	85.92	107.44	11	61.11
13885.	Ante (ld77)	18	91.04	104.80	9	50.00
13886.	Jacob (krucinskij)	18	75.40	87.78	4	22.22
13887.	Kelly (kile07)	18	49.27	65.65	2	11.11
13888.	Khuslen (khyl)	18	58.41	69.39	3	16.67
13889.	Tofumaster (khenglon)	18	68.35	78.49	3	16.67
13890.	Kayak (kayakcanoe)	18	60.02	71.41	2	11.11
13891.	Kathy (kathy_starfire)	18	72.24	96.57	3	16.67
13892.	Kareem (kareemshehata)	18	42.48	53.48	0	0.00
13893.	KamilJan (kamil_jan)	18	90.05	100.97	7	38.89
13894.	Kacper (kacperpro)	18	99.21	124.38	13	72.22
13895.	James (justjames)	18	79.43	96.08	6	33.33
13896.	Julio (julio7125)	18	77.04	94.08	2	11.11
13897.	jude (judepls)	18	131.14	147.02	11	61.11
13898.	JSKE25 (jske25)	18	96.79	119.19	10	55.56
13899.	tstats[jpatrocinio5436] (jp...	18	83.14	94.87	9	50.00
13900.	JoYo (joyojo)	18	88.70	101.13	11	61.11
13901.	Joshua (joshuasymes)	18	87.33	105.68	8	44.44
13902.	Jonathan (jonc2002)	18	117.48	136.88	9	50.00
13903.	Jonas (jonasv888)	18	74.00	83.99	7	38.89
13904.	Mathew (johnnyio)	18	92.73	107.68	7	38.89
13905.	Johnny (johneeeee)	18	55.39	70.04	2	11.11
13906.	JKJ123 (jkj123)	18	67.18	83.98	1	5.56
13907.	J (jiffan)	18	84.86	96.30	4	22.22
13908.	snb (jftsnb)	18	60.11	69.69	5	27.78
13909.	jewels (jewelsboyfriend)	18	123.81	139.71	11	61.11
13910.	Clippy (jesspacito)	18	96.26	117.05	17	94.44
13911.	Jeremy (jerms716)	18	77.93	92.87	4	22.22
13912.	iquee (jeptha)	18	83.32	94.27	5	27.78
13913.	jaycuaa (jaycuaa)	18	77.30	92.44	1	5.56
13914.	Jawad (jawadwahmed)	18	73.44	90.04	5	27.78
13915.	James (jamesjamesjamesjames...	18	77.48	89.76	6	33.33
13916.	Harikrishnan R (ismashmykey...	18	52.40	59.77	4	22.22
13917.	Isabelle (isabook)	18	87.44	100.53	7	38.89
13918.	IntangiblePri (intangible_pri)	18	86.94	101.21	4	22.22
13919.	Ba (injuredninjaz)	18	89.44	108.61	6	33.33
13920.	INDO EUROPEAN (indo_europea...	18	70.24	86.45	9	50.00
13921.	ImTrash (imreallytrash)	18	91.24	105.19	5	27.78
13922.	SirAlhelm (iliur)	18	90.56	114.23	13	72.22
13923.	KaRMa (ikillyou22)	18	73.30	84.79	9	50.00
13924.	Ian (ianharold99)	18	78.32	98.71	2	11.11
13925.	Yato_Gami (hrittik_brittik)	18	37.96	48.22	1	5.56
13926.	Ishu (holistic_karma)	18	57.62	67.72	5	27.78
13927.	Holden (holden_ford)	18	28.20	36.15	3	16.67
13928.	HEMANTA (hemantahazariraipu...	18	61.05	75.25	7	38.89
13929.	hello (hello_people123)	18	48.72	58.75	4	22.22
13930.	Miyoko (heena_rawat)	18	42.67	49.28	1	5.56
13931.	Hari (hari191197)	18	77.64	98.67	6	33.33
13932.	Hola (harebrained)	18	89.31	101.28	8	44.44
13933.	hannah (hannahq)	18	99.10	120.85	6	33.33
13934.	Halo (halo1)	18	69.05	87.71	4	22.22
13935.	Manuel (haiyaaa)	18	53.79	66.55	2	11.11
13936.	Hmmm2100 (hahha2100)	18	79.96	91.86	8	44.44
13937.	Nandika (gzxccalibur)	18	47.87	53.21	3	16.67
13938.	no accuracy. can't type (gr...	18	122.34	158.63	9	50.00
13939.	Goushique (goushique)	18	80.01	96.97	7	38.89
13940.	Goop (goooop)	18	57.61	80.47	3	16.67
13941.	Eric (godhand4826)	18	70.34	81.88	3	16.67
13942.	gleen (gleenryan)	18	60.79	76.00	5	27.78
13943.	Przemysław (girenkol)	18	67.55	81.69	2	11.11
13944.	Makar (gatimoro)	18	71.30	81.28	8	44.44
13945.	Garrett (garrettchu)	18	128.28	164.03	14	77.78
13946.	Gabriel (gabrielfr2001)	18	88.76	102.17	5	27.78
13947.	gabral (gabral123)	18	76.12	92.11	4	22.22
13948.	(´▽`ʃ♡ƪ) (froggy_y)	18	106.42	128.90	10	55.56
13949.	James (frodobaggins_)	18	63.42	75.84	5	27.78
13950.	twitch.tv/empyr1cal (fritte...	18	97.30	116.42	9	50.00
13951.	fr00t_l00ps (fr00t_l00ps)	18	91.61	99.37	8	44.44
13952.	Franklin (fpstone)	18	79.97	96.83	3	16.67
13953.	Alex (foxtail8000)	18	72.58	93.46	5	27.78
13954.	Sadge (forebe)	18	61.81	70.05	17	94.44
13955.	Bryce (flipno)	18	75.45	84.72	3	16.67
13956.	Finuz (finuz)	18	51.38	59.80	1	5.56
13957.	Filip (fichomaster)	18	85.08	100.42	14	77.78
13958.	Jordan (feelingsreal)	18	112.95	131.82	9	50.00
13959.	Jáchym (fastfingerrs)	18	74.02	82.90	7	38.89
13960.	E dog (evan819)	18	95.84	118.82	8	44.44
13961.	Tim (euclid221)	18	90.43	100.35	9	50.00
13962.	ethan (ethanwander83)	18	75.96	97.64	3	16.67
13963.	Ethan (ethanluu)	18	56.92	64.89	6	33.33
13964.	Erza (erzaskill)	18	101.95	112.74	8	44.44
13965.	eri :) (eri0002)	18	89.58	113.44	8	44.44
13966.	Erdem (erdemhalil)	18	98.65	109.20	9	50.00
13967.	epicsyrian (epicsyrian)	18	56.40	63.46	1	5.56
13968.	Abraham (emptypilot)	18	90.67	102.38	3	16.67
13969.	Empress Irisu (empress_irisu)	18	104.34	124.87	8	44.44
13970.	elijah (elijahtheracecar)	18	72.82	90.55	2	11.11
13971.	Dzlandis (dzlandis)	18	106.22	138.61	15	83.33
13972.	rob (dydtaylor)	18	115.09	129.40	10	55.56
13973.	Dyanel (dyanel)	18	61.59	73.40	4	22.22
13974.	Draunzer (draunzer23)	18	37.72	44.38	2	11.11
13975.	Drama (dramajr)	18	76.67	98.62	5	27.78
13976.	Jordan (donkeywhistle)	18	90.42	101.17	7	38.89
13977.	Doggo (doggocz)	18	100.17	116.20	5	27.78
13978.	Dan (dncn)	18	55.56	71.74	5	27.78
13979.	Ellis (disphing)	18	101.05	117.95	8	44.44
13980.	DirtJohnson (dirtjohnson)	18	61.34	69.49	4	22.22
13981.	dever (deverart)	18	112.96	129.98	9	50.00
13982.	Deactrals (deactralsyt)	18	107.45	138.29	6	33.33
13983.	dax (daxwastaken)	18	74.65	89.39	6	33.33
13984.	Darijuan (darijuan)	18	70.80	83.48	7	38.89
13985.	Daniel (dannyxrpm)	18	59.63	74.23	9	50.00
13986.	Dan (danmurf)	18	73.27	92.78	8	44.44
13987.	Daniel (dani3lju777)	18	113.84	141.89	9	50.00
13988.	d (dafeiji)	18	105.68	132.57	8	44.44
13989.	Danny (cyicro75366)	18	85.68	111.10	2	11.11
13990.	Cade (ctw_)	18	97.27	119.72	8	44.44
13991.	Kyi Phyu (crystal_emerson)	18	84.78	95.34	6	33.33
13992.	Jorge (crovas)	18	72.78	80.38	3	16.67
13993.	Christopher (cprice4124)	18	103.04	122.15	4	22.22
13994.	Taufiq Dhanial (conradchill)	18	43.44	47.60	2	11.11
13995.	Conrad (conrad7)	18	100.80	117.00	8	44.44
13996.	comkichi (comkichi)	18	42.61	50.88	2	11.11
13997.	(cnremilia55)	18	129.67	140.93	11	61.11
13998.	CD (chris_keum_9)	18	83.13	94.41	7	38.89
13999.	Christina (christinacitta)	18	60.19	67.70	2	11.11
14000.	Cecil (cecilw)	18	92.63	109.10	6	33.33
14001.	Sam (cattheory)	18	82.59	99.87	4	22.22
14002.	Captain (captainbravo579)	18	34.02	37.16	0	0.00
14003.	cantfindname (cantfindname)	18	73.21	93.60	3	16.67
14004.	Cammyy_ (cammyy_)	18	71.63	85.80	4	22.22
14005.	Gabriel (bultaqi)	18	30.07	38.05	0	0.00
14006.	Jens (bullercool)	18	91.52	108.83	8	44.44
14007.	Bugz (bugzmoney)	18	68.84	98.65	16	88.89
14008.	Bryce (bryceweedz)	18	91.21	102.25	9	50.00
14009.	The Rainbow Dragon (broadwa...	18	89.40	97.72	4	22.22
14010.	jan Mase (brasidas422)	18	104.44	114.84	7	38.89
14011.	Glen Ford (boyroader)	18	35.48	42.58	1	5.56
14012.	Bong (bongman48)	18	45.89	58.47	2	11.11
14013.	David (bomely)	18	98.12	122.89	2	11.11
14014.	bobby (bobbyo)	18	85.59	99.06	4	22.22
14015.	Baba (bobabo)	18	118.76	135.94	7	38.89
14016.	twitch.tv/darkmatterv4 (blo...	18	112.61	132.11	6	33.33
14017.	Samyak (blk_ht_hk_r)	18	57.80	67.76	7	38.89
14018.	Manny (blimps)	18	56.08	68.05	3	16.67
14019.	Arman (blazzer1yr)	18	57.84	62.58	0	0.00
14020.	Firefingers (birthdaykids)	18	211.50	234.71	17	94.44
14021.	Bintang (bintung)	18	103.25	116.43	6	33.33
14022.	Julen (bi0hazard_jck)	18	67.67	79.32	3	16.67
14023.	Lemons (bhan1115)	18	106.84	122.40	10	55.56
14024.	XDXDXD (benskrrt)	18	95.32	114.70	9	50.00
14025.	Benjamin (benjaminjam)	18	94.68	118.51	5	27.78
14026.	Lizbeth (belthiz)	18	55.18	67.98	0	0.00
14027.	Beebit (beebit)	18	72.60	84.62	4	22.22
14028.	Ethan (bambamarama)	18	63.99	74.84	4	22.22
14029.	BaldricLinus (baldriclinus)	18	88.29	119.02	9	50.00
14030.	Victoria (azureale)	18	85.67	108.98	6	33.33
14031.	Ayush (ayush08)	18	61.71	73.77	5	27.78
14032.	Avery (avidavi)	18	106.16	125.54	6	33.33
14033.	Tim (auticons)	18	69.14	85.22	3	16.67
14034.	Atzac (atzac)	18	44.10	54.99	1	5.56
14035.	Aryan (aryandeore)	18	76.97	99.81	6	33.33
14036.	Austin (artannenbaum)	18	117.09	145.07	10	55.56
14037.	Adam (armen32cz)	18	70.69	84.31	0	0.00
14038.	Ryan (arkephonic)	18	89.59	111.57	5	27.78
14039.	archer (archerlkm)	18	45.06	54.93	3	16.67
14040.	Abdelghani (aogino)	18	59.70	78.53	5	27.78
14041.	Anthony (antoniotheslwotyper)	18	97.60	110.07	6	33.33
14042.	Aniket (aniket__sharma_)	18	43.69	55.91	3	16.67
14043.	anfun (anfun)	18	69.55	86.50	7	38.89
14044.	Carl (andrecar002)	18	57.18	67.48	1	5.56
14045.	AMG F1 (amg_gts)	18	67.59	79.05	4	22.22
14046.	205g0 (alpacav2)	18	112.35	127.06	9	50.00
14047.	moon11111 (aliyuhaidaru)	18	34.91	40.32	1	5.56
14048.	Alexis (alexxxisk)	18	81.64	97.19	4	22.22
14049.	LDVBC (alexouou136)	18	105.73	130.03	9	50.00
14050.	Alex (alexaaaaa)	18	74.89	88.16	3	16.67
14051.	Alex (alex1124)	18	107.36	134.69	10	55.56
14052.	akshat (akxs)	18	113.73	127.28	8	44.44
14053.	Amanda (aj1111)	18	58.92	79.24	3	16.67
14054.	AI (ailinda)	18	40.51	48.88	1	5.56
14055.	Ahmer (ahmergondal)	18	112.79	142.58	6	33.33
14056.	Killuminati (ahmedali25jan)	18	61.17	68.86	3	16.67
14057.	Ahmad (ahmad770)	18	45.87	59.17	2	11.11
14058.	aha (aha_aha2)	18	62.09	71.71	3	16.67
14059.	AgogFox (agogfox)	18	68.10	75.90	6	33.33
14060.	Justin (agent_jl)	18	135.69	149.06	11	61.11
14061.	Afroz (afroz23)	18	47.50	55.85	2	11.11
14062.	Aniket (aero81101)	18	63.15	75.15	2	11.11
14063.	Aditya (aditya_sharma)	18	74.24	87.80	5	27.78
14064.	Bruce Wayne (abhirupdas400)	18	70.20	78.77	2	11.11
14065.	abfh7002 (abfh)	18	51.63	67.52	4	22.22
14066.	Aidan (88its_dvorak)	18	64.19	73.41	7	38.89
14067.	Wong (60484916)	18	61.17	75.15	2	11.11
14068.	yooko (0ctagon)	18	55.79	62.50	3	16.67
14069.	Prince (03000066106)	18	69.35	82.75	8	44.44
14070.	CY Tan (slowest_typer_lol)	18	45.04	55.39	12	66.67
14071.	Lydia (lydia245)	18	50.70	61.08	4	22.22
14072.	Nick (propuzoficj)	18	96.80	117.09	6	33.33
14073.	Zakir (drea041455)	18	76.75	95.08	9	50.00
14074.	Sourabh (100rab)	18	58.86	64.80	3	16.67
14075.	Max (mad_man_max11)	18	57.86	73.78	6	33.33
14076.	David (hongduc1312)	18	45.38	58.41	10	55.56
14077.	ABDULSALLAM (med905040)	18	19.22	22.98	3	16.67
14078.	Abid (abidcsedu)	18	49.37	58.60	1	5.56
14079.	Kartlez (kartlez)	18	35.77	45.78	1	5.56
14080.	Rajat (rajat_2203)	18	52.39	64.52	16	88.89
14081.	Charlie Crossman (iimdrowni...	18	52.78	66.72	1	5.56
14082.	Jequiz (jequiz)	18	89.97	113.55	10	55.56
14083.	TD (tmd33643)	18	83.02	94.73	4	22.22
14084.	Angela (angie361)	18	59.43	67.54	2	11.11
14085.	Araxes (boneyflesh)	18	43.12	55.09	2	11.11
14086.	Gab (pawsthegabe)	18	75.78	91.84	12	66.67
14087.	Manish (manish_84)	18	41.02	47.83	17	94.44
14088.	ahmad (shexahmad)	18	70.11	73.85	4	22.22
14089.	Unaib Syed (unaibsyed)	18	53.48	64.67	3	16.67
14090.	Daniel (danrodbar)	18	42.00	48.57	3	16.67
14091.	Viet (cm3rp)	18	100.75	125.81	15	83.33
14092.	Keenan (keenanpanda)	18	39.76	49.04	2	11.11
14093.	No you (gino455)	18	55.19	66.68	1	5.56
14094.	Colby (iamzcolbz)	18	57.01	62.90	10	55.56
14095.	Miha (mihabala)	18	22.70	26.22	2	11.11
14096.	aialtyn (aialtyn)	18	18.11	21.33	3	16.67
14097.	Sima (sima814)	18	50.02	62.97	1	5.56
14098.	Ludvig (ludvig_tydanus)	18	47.74	57.11	1	5.56
14099.	rob (mortal_)	18	69.61	85.66	7	38.89
14100.	eyeris (eyerisheehee)	18	59.77	75.45	2	11.11
14101.	Kayna (kayna16)	18	58.10	71.74	5	27.78
14102.	Killer (killerswitch)	18	50.55	61.05	8	44.44
14103.	Alan (liquidalanzhu39)	18	108.48	131.77	8	44.44
14104.	bingo (tobingoiscool)	18	97.51	110.67	4	22.22
14105.	Galactipod (galactipod)	18	80.85	93.74	6	33.33
14106.	brody (kingbroseidon)	18	47.46	62.57	4	22.22
14107.	Thai (thaidollasign)	18	74.53	88.46	5	27.78
14108.	Zakary (zakaryatyping)	18	37.43	44.54	2	11.11
14109.	Chris (usan3xus)	18	85.57	100.06	7	38.89
14110.	Refep (refep123)	18	80.00	102.20	7	38.89
14111.	Hephaestus (zeeeekkkeeee)	18	79.05	98.75	4	22.22
14112.	joe (xanthic)	18	120.57	151.28	7	38.89
14113.	Justinas (justasss)	18	69.57	77.20	4	22.22
14114.	Magisplash (magisplash)	18	82.24	103.27	10	55.56
14115.	Will (frostyflakes155)	18	94.85	111.90	9	50.00
14116.	Shivend (shivend)	18	34.20	42.40	1	5.56
14117.	Aiden (smusky72)	18	66.71	81.35	7	38.89
14118.	Sandis (cejayz)	18	75.08	94.68	6	33.33
14119.	Some (typerbetyping)	18	70.98	96.08	4	22.22
14120.	David (davidg0d)	18	85.77	98.91	5	27.78
14121.	𝐼𝓉𝓈𝑀𝑒_ (itsm...	18	34.76	40.95	2	11.11
14122.	Alex M (killawritter)	18	53.25	60.58	7	38.89
14123.	Jay (jayinnn)	18	64.40	70.74	4	22.22
14124.	Dilli (dillisharma)	18	29.83	34.97	3	16.67
14125.	Milan (hwsx)	18	76.50	93.09	7	38.89
14126.	Ikin (ikin_ari)	18	102.38	122.34	9	50.00
14127.	Crescens (crescent0001)	18	60.25	67.59	7	38.89
14128.	J (jeremieshaker)	18	92.99	113.31	6	33.33
14129.	Paul (___paul___)	17	87.84	102.23	5	29.41
14130.	Gagik (_the_wind)	17	68.69	78.15	4	23.53
14131.	Medi (_medi)	17	109.87	127.94	6	35.29
14132.	Kyle (_dukz)	17	79.33	88.09	8	47.06
14133.	Zaid (zzzaid)	17	112.17	146.06	10	58.82
14134.	Winston (zywinston)	17	118.41	138.79	10	58.82
14135.	Free Palestine (zobad)	17	114.84	139.60	10	58.82
14136.	Znypr (znypr)	17	76.17	89.49	4	23.53
14137.	Oscar (zeropuu)	17	72.74	87.67	5	29.41
14138.	Zenyth (zenyth)	17	70.74	74.32	3	17.65
14139.	Kalap (zenithorigin)	17	135.99	160.74	14	82.35
14140.	Mohammad (zargar91)	17	53.91	67.82	2	11.76
14141.	Dan (yugurtz)	17	98.76	133.29	7	41.18
14142.	Yuelia (yuelia)	17	110.42	126.50	13	76.47
14143.	Yousuf Ali (yousuf_97)	17	47.92	55.94	5	29.41
14144.	Jo/yf (yousseff)	17	74.90	86.04	7	41.18
14145.	youcef (youcef_kehal011)	17	35.10	43.25	0	0.00
14146.	Eddie (yogurtdan)	17	83.07	121.00	1	5.88
14147.	JRD (yesjrd)	17	107.88	123.19	7	41.18
14148.	Suken (x_suken_x)	17	87.69	102.04	4	23.53
14149.	Sean (xslslx)	17	79.03	96.98	3	17.65
14150.	Grzegorz (xreere)	17	61.36	75.94	0	0.00
14151.	Justin (xpirep)	17	101.26	119.19	6	35.29
14152.	Nepotism (xjqm_z)	17	89.79	107.80	3	17.65
14153.	William (xenosaints)	17	108.43	125.59	7	41.18
14154.	Louis (xchampionx)	17	128.38	152.00	14	82.35
14155.	Riley (wulfmane)	17	86.16	122.06	5	29.41
14156.	Olivier (whiskyforagrownman)	17	93.70	116.56	6	35.29
14157.	Joakim (wakakins)	17	61.08	81.68	1	5.88
14158.	VyPah (vypah)	17	99.03	113.82	12	70.59
14159.	can't type :) (void7750)	17	112.49	126.53	10	58.82
14160.	ViktorT (vitr_88)	17	76.87	85.70	7	41.18
14161.	Erik (virumdreng)	17	89.55	102.66	11	64.71
14162.	Vincent (vincback)	17	104.67	117.42	5	29.41
14163.	Raiko (vilo1)	17	46.57	53.96	3	17.65
14164.	hallelujah (veil)	17	123.66	153.37	6	35.29
14165.	Vavro (vavro)	17	51.20	64.38	0	0.00
14166.	Valian (valian)	17	64.98	72.90	2	11.76
14167.	Vanessa (v4nv4n)	17	104.42	123.82	9	52.94
14168.	yooooooongi (utlyoongs)	17	88.80	107.74	5	29.41
14169.	Unicorn017 (unicorn017)	17	50.81	61.68	4	23.53
14170.	Ulises (umoreno)	17	62.52	69.77	3	17.65
14171.	Tyler47 (tytycrewz)	17	49.20	60.67	5	29.41
14172.	tiramisu (typist786)	17	77.91	86.36	5	29.41
14173.	typing chad (typing_chad)	17	74.68	97.67	0	0.00
14174.	Gerald (tycholoko)	17	74.87	98.40	4	23.53
14175.	Lucas (twinbros)	17	39.66	55.29	14	82.35
14176.	NIETian (tushgaurav)	17	44.84	54.75	10	58.82
14177.	Ryan (turtleboy1017)	17	103.35	112.65	6	35.29
14178.	ttvnaaya786 (ttvnaaya786)	17	89.65	101.20	4	23.53
14179.	Truong (truong_huy)	17	42.26	46.26	0	0.00
14180.	Ralph (triathreat)	17	96.80	124.46	9	52.94
14181.	trer10 (trer10)	17	89.57	102.86	6	35.29
14182.	Benjamin Netanyahu (tp0d)	17	99.35	122.33	7	41.18
14183.	Torron (torronlester)	17	48.16	57.63	1	5.88
14184.	Pratik (torpido99)	17	52.94	67.84	4	23.53
14185.	ㅤ (toptied)	17	101.98	133.73	7	41.18
14186.	Tulaib (toolayb)	17	79.16	94.43	9	52.94
14187.	tippy (tippytypo)	17	109.14	122.69	10	58.82
14188.	Timothy (timothyp823)	17	82.56	89.56	2	11.76
14189.	Nana (tianananana)	17	67.88	75.34	2	11.76
14190.	Omnia (the_omnivert)	17	72.91	84.03	5	29.41
14191.	Theo (the_o)	17	71.89	85.31	4	23.53
14192.	Jon Bob (thejonbob)	17	52.27	66.06	4	23.53
14193.	Ky (thaediir)	17	82.28	98.11	6	35.29
14194.	Alexandro (terribletyper0)	17	78.24	93.75	5	29.41
14195.	Terra (terranavis)	17	98.86	116.53	8	47.06
14196.	Carson (terminator2424)	17	81.16	105.42	5	29.41
14197.	Teho (tehoo)	17	111.31	129.74	12	70.59
14198.	Md. Tahsinul Anwar (tahsinu...	17	63.84	76.47	4	23.53
14199.	john (tacozmanz)	17	81.98	94.05	1	5.88
14200.	emily (swimmerpenguin)	17	101.22	118.35	10	58.82
14201.	John (supercriticalco2)	17	43.84	57.04	4	23.53
14202.	kobus (supercatspeed)	17	26.67	32.50	1	5.88
14203.	hafit (streekytyper)	17	64.80	76.06	4	23.53
14204.	Stefan (stephen27)	17	78.90	86.31	3	17.65
14205.	spiderman (spiderman943)	17	41.35	54.61	2	11.76
14206.	Rice (speedtoggled)	17	81.54	93.88	7	41.18
14207.	Jeel (speedracers_brother)	17	54.72	62.20	0	0.00
14208.	Tommy (sparkxd)	17	75.57	97.13	3	17.65
14209.	Spanchsan (spanchsan)	17	49.59	60.26	2	11.76
14210.	Young (so_many_errors)	17	92.80	112.55	7	41.18
14211.	Soren (sorentypes)	17	79.31	95.54	5	29.41
14212.	Soham (soham_grover)	17	46.72	60.57	3	17.65
14213.	Slowpoke (slowpoketypo)	17	61.07	70.17	2	11.76
14214.	Marie (slowestone)	17	31.30	39.41	1	5.88
14215.	Slicky (slickyslide)	17	59.60	66.31	4	23.53
14216.	Sam (sirgalahad7)	17	71.70	80.23	2	11.76
14217.	Katappa (sim007)	17	92.69	123.35	13	76.47
14218.	Spencer (silentfoe9)	17	63.00	71.16	7	41.18
14219.	Sid (sidd31)	17	51.94	57.05	1	5.88
14220.	shcal (shcal)	17	119.96	135.41	7	41.18
14221.	Shane (shane_umayanga)	17	53.64	60.22	1	5.88
14222.	shmz (shamyob)	17	60.58	70.22	2	11.76
14223.	Serhii (sergomashina)	17	58.36	63.57	5	29.41
14224.	Sepia (sepiadrunfada)	17	54.78	60.78	1	5.88
14225.	SeniorMomo (seniormomo)	17	105.68	131.57	8	47.06
14226.	Nathaniel (scryo)	17	70.46	94.65	3	17.65
14227.	schru (schru)	17	83.37	90.75	8	47.06
14228.	SantiX (santix1225)	17	71.92	91.77	7	41.18
14229.	Sammy (sammykiller)	17	82.93	97.08	4	23.53
14230.	Sujith (sai_sujith)	17	42.87	51.31	2	11.76
14231.	Said (saidahror_2021)	17	85.73	97.57	8	47.06
14232.	Leonardo (saborfaze)	17	67.84	80.34	3	17.65
14233.	R (ryanteebag)	17	116.09	129.02	12	70.59
14234.	Tom (rusteze)	17	66.59	76.41	3	17.65
14235.	Ruslan (ruslancik97)	17	58.07	73.76	3	17.65
14236.	Jessica (runningfox)	17	35.45	43.28	1	5.88
14237.	T (rumikasa)	17	140.68	168.01	17	100.00
14238.	Michael (rucc)	17	87.40	109.99	9	52.94
14239.	Kuy (rou168)	17	98.49	111.79	9	52.94
14240.	Leimondu (roshia)	17	95.37	104.80	7	41.18
14241.	tstats[roselaflesh] (rosela...	17	90.70	108.84	6	35.29
14242.	Roboute (robosote)	17	85.61	96.18	8	47.06
14243.	Ryan (rloftus)	17	65.17	70.70	2	11.76
14244.	I'm bad at this :( (rl27)	17	115.27	125.03	12	70.59
14245.	spi (ririnasandasimp)	17	68.90	87.88	16	94.12
14246.	Tuna (rippleshark)	17	55.76	66.02	3	17.65
14247.	Rick (rickssbm)	17	89.08	96.75	6	35.29
14248.	daydreamer (rhebbar)	17	29.72	37.49	2	11.76
14249.	Rey (reycuadrado)	17	115.20	147.96	8	47.06
14250.	Jake (relaxing)	17	57.41	68.16	3	17.65
14251.	rehsur (rehsur)	17	76.30	88.43	5	29.41
14252.	Regz (regz84)	17	84.70	99.49	8	47.06
14253.	Josh (raybanned)	17	84.02	108.86	3	17.65
14254.	forrest (rares9110)	17	50.47	57.78	3	17.65
14255.	rakushun (rakushun)	17	35.72	43.52	2	11.76
14256.	Rae (raedog)	17	119.09	138.95	6	35.29
14257.	Joses (radcaly)	17	71.27	86.41	3	17.65
14258.	Road to 90 wpm (qimichanga)	17	70.22	82.54	5	29.41
14259.	Rahil (prplplay)	17	58.46	67.38	2	11.76
14260.	Pradip (pradipg)	17	75.60	109.39	13	76.47
14261.	พงษ์ปกรจ์...	17	32.88	40.70	11	64.71
14262.	Scott (pogogunner)	17	85.28	103.09	9	52.94
14263.	Punch (pognick)	17	100.03	111.93	6	35.29
14264.	PNBLVN (pnblvn)	17	87.49	101.95	5	29.41
14265.	Plohka (plohka)	17	75.36	89.86	6	35.29
14266.	Renaldi (plbu)	17	74.46	92.40	3	17.65
14267.	mati (pitoloco)	17	49.98	64.89	1	5.88
14268.	PeterParker20 (piter11116)	17	78.75	94.08	6	35.29
14269.	Bryan (pinkypoo)	17	69.07	77.41	3	17.65
14270.	Myron (piececontrol_inq)	17	47.13	53.19	3	17.65
14271.	Hans (phindy)	17	99.50	124.79	3	17.65
14272.	Philluminati (philluminati)	17	81.99	95.35	5	29.41
14273.	Vidu (pererav)	17	60.13	68.97	3	17.65
14274.	Pelli (pellikan)	17	89.82	104.26	4	23.53
14275.	Rohith (pebblepot)	17	56.35	72.16	3	17.65
14276.	Paul (paultot)	17	32.80	39.35	2	11.76
14277.	🐌 (paultippt)	17	69.84	80.51	4	23.53
14278.	Patryk (patryk5361)	17	73.27	86.85	5	29.41
14279.	PapaCologne (papacologne1)	17	59.90	70.44	2	11.76
14280.	owlsoup (owlsoup)	17	93.34	115.70	8	47.06
14281.	OP (owenpatch)	17	99.21	115.02	6	35.29
14282.	Otakranio (otakranio)	17	63.91	83.28	4	23.53
14283.	piglet (orangepig111)	17	84.93	100.29	6	35.29
14284.	Onur (onur0591)	17	83.66	99.52	8	47.06
14285.	Omer (omersudo)	17	71.85	81.97	2	11.76
14286.	Ascend (obaht)	17	49.44	56.41	1	5.88
14287.	Nuwaisir (nuwaisir)	17	70.61	79.55	2	11.76
14288.	Tom (noviamagna)	17	104.82	123.16	5	29.41
14289.	noctnight (noctnight)	17	107.00	128.26	13	76.47
14290.	nkunder (nkunder16)	17	50.73	60.35	2	11.76
14291.	Do people have computers in...	17	75.83	91.35	1	5.88
14292.	nilebr (nilebr)	17	96.69	108.73	2	11.76
14293.	nikola (nikininja13)	17	63.47	79.07	4	23.53
14294.	ning (niing)	17	74.38	89.55	7	41.18
14295.	Nicholas (nicholaspatrick)	17	88.73	105.12	2	11.76
14296.	nam (ngxnam)	17	73.31	86.36	4	23.53
14297.	neville (neville_dnbh)	17	55.15	69.03	4	23.53
14298.	Natalia (natalia153)	17	55.91	65.61	4	23.53
14299.	MehproPlayz (mythicfx)	17	44.32	56.04	7	41.18
14300.	Michael (mwik)	17	108.25	122.23	8	47.06
14301.	Peter Paul "Paulie Walnuts"...	17	106.88	117.44	12	70.59
14302.	Munkhzorig (munkhzorig_0918)	17	42.33	48.37	1	5.88
14303.	Multi (multibala)	17	24.67	31.46	5	29.41
14304.	k1p (muggz)	17	77.21	100.70	3	17.65
14305.	moschisch (moschisch)	17	51.67	62.87	1	5.88
14306.	Monica (moni1101)	17	63.74	73.62	4	23.53
14307.	Moe (mohannd_h)	17	61.03	69.28	5	29.41
14308.	Timotej (mistimmo)	17	53.38	67.53	1	5.88
14309.	. (mioumioumiou)	17	53.25	62.40	2	11.76
14310.	Jiarui (mike9557)	17	70.50	87.09	4	23.53
14311.	mieszko (mieszkomieszko)	17	102.39	114.73	11	64.71
14312.	Michael (mhmadhatter)	17	72.11	83.46	3	17.65
14313.	Abdulmohsin (mhasen)	17	59.73	68.65	2	11.76
14314.	Janssen (mentalpower_ada)	17	67.17	76.86	7	41.18
14315.	tobias (memebigboyisbig)	17	62.00	68.54	5	29.41
14316.	Maximal (maximalelder)	17	79.06	93.36	7	41.18
14317.	Romping (max61090)	17	95.33	107.19	9	52.94
14318.	Matthew (matthewb83)	17	91.10	106.01	9	52.94
14319.	b lmao (matt16861)	17	129.39	144.72	12	70.59
14320.	Tahj (mathpunsaresin)	17	73.46	84.85	5	29.41
14321.	Max (marvelnoodles)	17	67.18	81.76	5	29.41
14322.	Martina (martinaon)	17	115.70	140.90	12	70.59
14323.	Cody (marshmink)	17	88.68	102.61	5	29.41
14324.	Aleksa (mandorinaa)	17	68.88	78.70	5	29.41
14325.	anAVGtyper (mallunahi)	17	58.24	73.19	0	0.00
14326.	mads (madsor)	17	57.51	73.27	7	41.18
14327.	Skafi (madps)	17	53.77	64.22	2	11.76
14328.	Mack (mack49)	17	59.92	83.06	4	23.53
14329.	Aiden (maccraker)	17	77.27	92.27	6	35.29
14330.	m3hdi (m3hdi_v1)	17	37.18	42.78	1	5.88
14331.	luiz (lzcr)	17	64.82	75.95	7	41.18
14332.	jonson (lyfissht)	17	78.28	98.03	5	29.41
14333.	Luis (luwec)	17	88.71	103.76	6	35.29
14334.	Luminer (luminerr)	17	71.46	82.06	7	41.18
14335.	sky (lumihime)	17	116.36	130.91	9	52.94
14336.	Lukas (lukaas506)	17	48.97	58.62	2	11.76
14337.	Lucifer (lucifer179)	17	98.82	116.88	10	58.82
14338.	Lucid (lucideous)	17	57.64	71.20	4	23.53
14339.	LoyalPotato (loyalpotato)	17	75.54	86.17	4	23.53
14340.	Lock'd (lockd)	17	88.38	102.83	6	35.29
14341.	Frederick (liquidfyre)	17	84.21	100.27	5	29.41
14342.	John (linkstart15)	17	75.06	98.57	3	17.65
14343.	Linh (linhbo5369)	17	57.95	70.03	5	29.41
14344.	YEET (lemonstate)	17	95.20	105.68	7	41.18
14345.	Endy (legaljeans)	17	76.52	90.58	6	35.29
14346.	Lee-Andria (leelo135)	17	52.29	67.67	0	0.00
14347.	Aidan (leankirito)	17	54.66	61.51	4	23.53
14348.	Dosnt (laxrpy)	17	64.49	74.15	2	11.76
14349.	Lavish (lavish10)	17	62.55	75.12	3	17.65
14350.	Lasey (lasey)	17	95.22	109.65	9	52.94
14351.	Landon (landonthull)	17	73.54	88.77	7	41.18
14352.	pearl (l3hargav)	17	88.30	98.37	4	23.53
14353.	Kypster (kypster)	17	90.86	111.69	5	29.41
14354.	kx_167 (kx_167)	17	46.96	58.80	2	11.76
14355.	ItsKevin (kwilz)	17	91.42	103.59	10	58.82
14356.	Vipin (kumarvipin)	17	46.43	54.09	1	5.88
14357.	Kristjan (krissimoney)	17	112.19	128.37	5	29.41
14358.	krishna (krishnatallani)	17	32.11	37.24	0	0.00
14359.	Alex (krim19)	17	108.07	120.27	11	64.71
14360.	ren (krenz)	17	72.64	87.66	5	29.41
14361.	codingmickey (kj_mickey)	17	54.12	66.00	3	17.65
14362.	kinderblack (kinderblack)	17	95.66	106.97	2	11.76
14363.	Rolf (key_fingerer)	17	38.32	44.42	0	0.00
14364.	Kevin (kevinstark10)	17	87.33	103.82	5	29.41
14365.	Kevin (kevgod48)	17	115.50	126.71	9	52.94
14366.	brandon (kbseah)	17	118.52	133.97	7	41.18
14367.	Kathryn (kathrynida)	17	94.40	104.98	8	47.06
14368.	Karston (karstonjim)	17	84.02	93.11	17	100.00
14369.	n (kantotoro)	17	42.98	64.59	2	11.76
14370.	Niko (kale_bog_vremena)	17	51.31	68.39	0	0.00
14371.	Avery (jythonscript)	17	90.03	99.44	5	29.41
14372.	JustMonotone (justmonotone)	17	117.77	131.15	12	70.59
14373.	Juprai (juprai)	17	126.78	155.21	10	58.82
14374.	Julien (julien123)	17	38.91	44.81	1	5.88
14375.	Jacob (jq231)	17	116.54	138.78	9	52.94
14376.	Jonathan (john_ee)	17	58.73	66.67	4	23.53
14377.	John (johnnymauser)	17	80.34	96.58	3	17.65
14378.	Joe (joemama17)	17	92.86	113.57	5	29.41
14379.	bryan (joebidens_son)	17	70.88	92.65	12	70.59
14380.	Jorgle (jmgcito)	17	65.78	83.65	5	29.41
14381.	Jimmy (jimmyceballos)	17	74.20	97.68	3	17.65
14382.	The Dank Duck (jephjeff)	17	73.05	83.54	4	23.53
14383.	Jacky (jclau299)	17	94.01	110.55	10	58.82
14384.	jazon (jazonandes)	17	121.24	160.25	7	41.18
14385.	Jaxson (jaxxxson)	17	110.79	123.81	7	41.18
14386.	javoscript (javoscript)	17	83.73	90.36	6	35.29
14387.	Jason (jasonliang19)	17	88.47	111.54	5	29.41
14388.	Jakob (jagebuuu)	17	52.96	62.75	2	11.76
14389.	Jordan (j0rdanb)	17	85.97	99.53	9	52.94
14390.	Farrel (i_i_c_h_e_n_i_i)	17	95.63	115.35	5	29.41
14391.	Brandon (ivantt)	17	105.62	125.86	9	52.94
14392.	ITSPUJIS (itspujis)	17	67.51	89.04	2	11.76
14393.	Iris (irxs_q)	17	145.02	168.48	14	82.35
14394.	DooDoo (ininjashadows)	17	78.53	106.89	3	17.65
14395.	Nolan (ilovebluecars_13)	17	13.71	17.01	5	29.41
14396.	Iliya (iliyacloud)	17	53.99	71.22	2	11.76
14397.	Imad (ikhan9059)	17	46.81	55.83	2	11.76
14398.	IDK (iimarch)	17	36.66	47.60	1	5.88
14399.	stef (ihasstuff)	17	71.84	80.29	7	41.18
14400.	Ivan (ichauster)	17	109.09	137.19	7	41.18
14401.	hwalters360 (hwalters360)	17	108.32	133.34	10	58.82
14402.	jib (huwakiin)	17	71.00	79.33	10	58.82
14403.	Ante (houci)	17	111.93	131.37	7	41.18
14404.	tenzin (hopeful_engineer)	17	83.35	95.89	4	23.53
14405.	hubbe (hoffiis)	17	68.92	75.32	4	23.53
14406.	hksgiroro (hksgiroro)	17	56.15	67.76	4	23.53
14407.	Gaurav (hisdudeness)	17	111.21	124.07	4	23.53
14408.	Thebe (hikwon)	17	86.68	98.31	5	29.41
14409.	Vinz (hexxel7)	17	105.75	115.95	8	47.06
14410.	Hexishu (hexishu)	17	105.70	119.66	17	100.00
14411.	Jerry (heatsflamesman)	17	128.45	149.57	14	82.35
14412.	haykalive (haykalive)	17	54.97	64.35	7	41.18
14413.	tstats[harveycoolestkid69] ...	17	103.34	125.94	5	29.41
14414.	Hans (hansyu7)	17	85.19	92.18	6	35.29
14415.	Hamza (hamzayt577)	17	66.34	77.24	1	5.88
14416.	The Legend of Jones (hadgeo...	17	128.08	166.42	7	41.18
14417.	Davey (gujin)	17	113.45	139.35	5	29.41
14418.	GpJay (gpjay)	17	56.54	63.60	3	17.65
14419.	Lukas (gotorono)	17	80.12	91.94	5	29.41
14420.	Connor (gothorpe)	17	65.03	75.03	7	41.18
14421.	jack (golduckz)	17	110.21	131.92	8	47.06
14422.	knowagh (gnoweagh)	17	96.14	105.33	2	11.76
14423.	GitGawd (gitgawd)	17	88.77	104.30	10	58.82
14424.	Shimon (gastronom)	17	69.22	82.66	5	29.41
14425.	AttackKing (garypop)	17	47.29	53.59	3	17.65
14426.	Felix (ganc56141)	17	106.79	130.87	8	47.06
14427.	Gabriel (gabrielot)	17	44.63	52.55	7	41.18
14428.	gabe (gabersnake)	17	84.44	92.84	4	23.53
14429.	IAmAtomicツ (from_phlol)	17	93.28	111.95	9	52.94
14430.	Jakub (frogixd)	17	69.94	80.54	2	11.76
14431.	trapinch_ (fortissim2)	17	123.57	138.15	10	58.82
14432.	Typo (foop101)	17	76.48	92.59	5	29.41
14433.	Flash (flashlegion)	17	53.52	67.42	2	11.76
14434.	Yeeet (flamestar21)	17	45.24	56.30	4	23.53
14435.	Firzan (firzanarmani)	17	68.53	78.11	3	17.65
14436.	Jared (filmman2k3)	17	77.38	104.35	7	41.18
14437.	Francisco (fanaya2001)	17	50.65	69.94	1	5.88
14438.	faf (faf222)	17	48.46	60.26	1	5.88
14439.	Eshan (e_khan)	17	89.68	105.35	8	47.06
14440.	Eustion (eustion)	17	89.91	103.00	7	41.18
14441.	Ethan (ethankramer)	17	68.82	83.58	11	64.71
14442.	Ben (essequattro)	17	101.90	116.36	12	70.59
14443.	mb3awi (emptybox34)	17	100.50	111.41	7	41.18
14444.	wizz (empathetic_orange)	17	48.45	57.81	2	11.76
14445.	emma (emmmmmmmaaaaa)	17	75.12	86.68	1	5.88
14446.	Emil (emle10)	17	98.94	118.12	3	17.65
14447.	Mark (emessdoubleyou)	17	70.10	79.20	4	23.53
14448.	Liz (elizabethl3_13)	17	76.68	100.50	5	29.41
14449.	Someone (elderpotato)	17	88.42	104.55	6	35.29
14450.	Connor (edgeburn)	17	88.67	102.77	5	29.41
14451.	e (eddyhack)	17	89.46	105.81	8	47.06
14452.	Benjamin (echobox)	17	54.84	65.52	1	5.88
14453.	yes (easytoremember1)	17	104.41	116.65	3	17.65
14454.	Luuk (dutchprojects)	17	88.76	108.99	7	41.18
14455.	Megan (durvish)	17	71.83	89.24	3	17.65
14456.	Huy (duchuynguyen94)	17	89.31	97.36	8	47.06
14457.	Benjamin (drwumboo)	17	70.79	85.34	5	29.41
14458.	Andrew JK Brown (droid2)	17	53.90	62.49	2	11.76
14459.	Ghost (djinxkay)	17	116.93	146.25	10	58.82
14460.	Đình (dinhhhaii51)	17	75.18	91.60	2	11.76
14461.	epic gamer (dianalin2)	17	93.35	104.16	5	29.41
14462.	CZ (derpiestme)	17	97.74	111.47	7	41.18
14463.	Niels (dekleinekabouter)	17	83.80	99.35	2	11.76
14464.	Andres (defmaxer)	17	93.33	110.14	3	17.65
14465.	Deepanshu (deepanshu9)	17	66.77	79.33	7	41.18
14466.	Amir (dead_developer)	17	44.15	49.57	2	11.76
14467.	Cedric (ddeadz)	17	85.48	112.35	10	58.82
14468.	David Roberts (davidrobertsla)	17	78.99	99.30	15	88.24
14469.	Darren Goh (darrengoh_23)	17	86.72	104.44	7	41.18
14470.	Bhavya (dark_knight_2914)	17	58.60	70.67	10	58.82
14471.	Patrick (darkpatrick00)	17	99.30	107.26	5	29.41
14472.	Dany (danypeter)	17	75.03	93.78	11	64.71
14473.	nuzzlebuddy (danieldan937)	17	83.76	97.71	3	17.65
14474.	Dana (dana_cardinal)	17	125.09	141.84	13	76.47
14475.	dak (dakn)	17	90.48	104.13	6	35.29
14476.	Dauren (d0ka)	17	52.73	65.05	1	5.88
14477.	Cyrush (cyrus_h)	17	115.97	134.19	11	64.71
14478.	David (cuber988)	17	93.76	100.80	11	64.71
14479.	Crestyn (crestyn)	17	96.97	110.80	8	47.06
14480.	C (cpandar)	17	86.06	101.40	3	17.65
14481.	Rod (compangit)	17	93.66	106.37	6	35.29
14482.	Cole (coleb117)	17	105.78	114.90	0	0.00
14483.	SAM (clencod)	17	65.47	84.76	3	17.65
14484.	Matt (choofkoof)	17	100.69	112.59	10	58.82
14485.	Chessy (chescahi)	17	96.34	111.00	7	41.18
14486.	cheryl (cherylkaiser)	17	66.00	72.71	4	23.53
14487.	chepchombir (chepchombir)	17	68.82	77.37	6	35.29
14488.	Nieves (cheezy_butter)	17	86.10	104.35	4	23.53
14489.	Matija (ch4p0)	17	64.83	74.47	4	23.53
14490.	Casper (casperwang)	17	68.55	82.58	4	23.53
14491.	Isaac (carokann09)	17	100.58	113.60	1	5.88
14492.	mickey (c2sulli)	17	105.74	116.05	9	52.94
14493.	Semih (byshadow93)	17	66.88	78.09	6	35.29
14494.	DeStuert (bully_hunter)	17	59.79	68.60	2	11.76
14495.	deji the tank (bulgewarden)	17	66.92	83.63	7	41.18
14496.	Bogart (bogartii)	17	79.90	87.55	5	29.41
14497.	bobva (bobva)	17	107.02	128.74	9	52.94
14498.	boris (bobi412)	17	54.01	61.83	1	5.88
14499.	Bren (bnern)	17	75.34	89.60	4	23.53
14500.	Ben (blob1010)	17	47.67	59.97	2	11.76
14501.	Björn (bjornboss)	17	69.66	78.60	6	35.29
14502.	Zicheng (bin_laggin)	17	90.06	111.93	8	47.06
14503.	Finnnnnnn (bigfinsfananza)	17	84.61	101.64	6	35.29
14504.	Isabella (bfbubblegum)	17	90.83	103.65	4	23.53
14505.	Robert (bertazz)	17	51.27	59.81	1	5.88
14506.	Ava (berry_blue)	17	77.04	97.01	3	17.65
14507.	Bensie (bensie1)	17	105.05	124.32	14	82.35
14508.	bstridr (bellie__)	17	78.19	93.57	5	29.41
14509.	Phil (beastfromthe_east)	17	57.01	71.19	3	17.65
14510.	Baizak (baizak)	17	43.26	50.86	2	11.76
14511.	Austin (auzzyauger)	17	46.83	56.19	0	0.00
14512.	Alex Grace (attttyila)	17	91.88	101.88	7	41.18
14513.	Dre (atarez)	17	127.68	151.29	16	94.12
14514.	3 (astoria2213)	17	60.56	70.47	6	35.29
14515.	Ashveck (ashveck)	17	64.06	75.90	3	17.65
14516.	Muahmmad (arul2101)	17	64.09	87.76	5	29.41
14517.	ArticSeries (articseries)	17	97.85	106.92	6	35.29
14518.	army (armygirl123)	17	44.48	54.38	1	5.88
14519.	Ekar (argetlam1)	17	92.62	101.56	4	23.53
14520.	Gui (apollovx)	17	65.25	81.25	3	17.65
14521.	Janindu (aokiesan)	17	88.90	104.16	6	35.29
14522.	Ana (anophoo)	17	79.04	89.13	4	23.53
14523.	Annie (anniesshl)	17	66.78	80.13	7	41.18
14524.	ami (amisupreme)	17	110.70	130.11	9	52.94
14525.	amirhossein (amirho)	17	66.81	80.25	3	17.65
14526.	Ashley Harrison (amharrison15)	17	67.76	81.64	2	11.76
14527.	Eric (almiightyeric)	17	57.12	69.75	2	11.76
14528.	Alkinoos (alkonline66)	17	50.96	56.16	0	0.00
14529.	alisha (alishalovesyou)	17	80.12	95.88	2	11.76
14530.	Alinferno (alinferno)	17	70.05	87.93	15	88.24
14531.	Alex (alexhell)	17	82.23	96.30	3	17.65
14532.	Alexandar (alexandargrav)	17	66.77	83.11	4	23.53
14533.	Tobias (akwhideki)	17	89.55	102.03	11	64.71
14534.	Akela (akela123)	17	103.41	118.51	9	52.94
14535.	aibek (aibek210603)	17	43.19	49.76	2	11.76
14536.	ahmed (ahmed98)	17	63.36	76.22	2	11.76
14537.	Ahmad (ahmad4)	17	74.78	92.88	8	47.06
14538.	Louis (advguy)	17	99.00	111.28	9	52.94
14539.	Jack (adc6768)	17	97.37	114.43	7	41.18
14540.	ace (aceguarde)	17	99.80	118.14	16	94.12
14541.	Aboxgwer (aboxthetyper)	17	73.66	89.12	2	11.76
14542.	Abhijeet17o (abhijeet17o)	17	54.02	65.45	6	35.29
14543.	ABe (abenms92)	17	94.98	120.62	3	17.65
14544.	Iam (aaaallleen)	17	71.21	85.18	3	17.65
14545.	aaaaaaaaaaaaaa (aaaaaaaaooo...	17	64.27	76.32	6	35.29
14546.	962 Pixels (962pixels)	17	79.05	90.33	8	47.06
14547.	Jasper (7essek)	17	90.46	98.08	4	23.53
14548.	dd (6768695865)	17	51.17	57.76	1	5.88
14549.	David (2mill)	17	108.17	131.18	7	41.18
14550.	Li Han (1774li)	17	35.66	48.17	1	5.88
14551.	Lime (limabean60923)	17	67.94	77.78	5	29.41
14552.	Mariana (marianafa)	17	54.77	68.06	6	35.29
14553.	Araina (discobroccoli)	17	80.41	96.60	5	29.41
14554.	Jonah (yuuya_hori)	17	71.56	86.24	10	58.82
14555.	Joshua (tjosher)	17	96.19	106.61	7	41.18
14556.	Kanye (viprin_6749)	17	64.20	78.43	3	17.65
14557.	NICK ILARIDIS (nilaridis)	17	30.41	34.37	0	0.00
14558.	Ajax (ajaxdavis)	17	83.20	109.64	10	58.82
14559.	Pratyush (_darkcrow_)	17	55.39	63.39	4	23.53
14560.	Gustav (rexdk123)	17	47.23	55.56	4	23.53
14561.	3Cow (kendogplayz)	17	62.13	82.51	3	17.65
14562.	Mike (munduss)	17	121.36	146.77	9	52.94
14563.	noyoudweeb (noyoudweeb)	17	68.53	81.11	7	41.18
14564.	joe seph (loer)	17	86.40	103.74	6	35.29
14565.	Havinastroke (saltyhavin)	17	61.21	80.11	4	23.53
14566.	Afraaj (afraj)	17	63.31	74.28	4	23.53
14567.	Akshat (nothingness_)	17	55.98	65.54	5	29.41
14568.	Degeu (darius_primarul)	17	48.99	55.69	2	11.76
14569.	tmurtle123 (whenindan)	17	89.89	113.02	5	29.41
14570.	Cole (mechanicalmac)	17	60.26	69.60	4	23.53
14571.	AbeerOP (jazztoofast)	17	65.69	75.06	2	11.76
14572.	Kazu (kazu_0321)	17	43.23	50.99	4	23.53
14573.	Riu (yung_sushi)	17	51.81	64.27	9	52.94
14574.	jaoo (joaocunhajeronimo)	17	80.71	105.40	4	23.53
14575.	Cooper (cooperskat)	17	96.60	112.28	9	52.94
14576.	Sizzles (sizzlessnake)	17	31.79	36.43	2	11.76
14577.	Lukas (jabo_o)	17	30.85	36.77	5	29.41
14578.	ming (conphusion)	17	85.78	99.34	9	52.94
14579.	Eddie (edlebo)	17	77.36	91.51	4	23.53
14580.	jfjjrmfjg (jfjjrmfjg)	17	84.53	97.31	5	29.41
14581.	Joel (tellurican)	17	77.71	86.57	9	52.94
14582.	Daniel (serthh)	17	44.98	51.86	1	5.88
14583.	Stan (st4n)	17	72.93	82.01	1	5.88
14584.	Galeona (galeona)	17	68.17	77.92	4	23.53
14585.	Eats Their Veggies (eatsthe...	17	82.43	99.71	7	41.18
14586.	Thomas (tommytunes)	17	54.22	62.65	4	23.53
14587.	hoan (hoah_)	17	96.03	123.40	7	41.18
14588.	mav (mavx)	17	55.30	65.69	1	5.88
14589.	Appu (notappu)	17	46.44	59.45	3	17.65
14590.	cal (calcife)	17	94.53	136.45	5	29.41
14591.	Ben (crispr)	17	65.52	74.94	4	23.53
14592.	Ikhwan (khxirules)	17	43.08	55.99	3	17.65
14593.	Jack (jaxk45)	17	76.06	91.98	12	70.59
14594.	xc (bighmann)	17	73.15	100.95	4	23.53
14595.	Thomas (thetrain)	17	57.09	79.30	1	5.88
14596.	Sotoray (sotothecomedian)	17	54.46	67.40	1	5.88
14597.	sweatings (sweatings)	17	76.33	90.39	5	29.41
14598.	ainchester (razorcluster)	17	59.21	71.12	3	17.65
14599.	David (david2026)	17	58.21	66.28	4	23.53
14600.	Philippos (exterminator1000)	17	52.71	67.80	5	29.41
14601.	Ariz (arizb)	17	70.35	81.60	9	52.94
14602.	viDoppio (vidoppio)	17	72.85	91.02	4	23.53
14603.	Abdullah (toooi)	17	40.70	45.84	3	17.65
14604.	jmarttinen (jmarttinen)	17	76.61	86.78	6	35.29
14605.	Mlon Eusk (al2698)	17	75.52	92.28	3	17.65
14606.	Jonathan (swatjkon)	17	80.58	95.90	5	29.41
14607.	Wise Intelligent (wise_inte...	17	64.59	73.89	5	29.41
14608.	Mahboob (mahboob56)	17	86.41	100.48	9	52.94
14609.	Ripper (anikettheripper)	17	44.69	54.09	2	11.76
14610.	Prad (_rad0n_)	16	39.93	52.75	1	6.25
14611.	Itai (zytell)	16	73.08	91.76	3	18.75
14612.	Zond (zohend)	16	55.77	64.33	4	25.00
14613.	Zogurt (zogurt)	16	69.67	84.55	0	0.00
14614.	Jonte (zitrex)	16	91.17	108.37	3	18.75
14615.	Alex (zimbo21003)	16	70.73	83.78	2	12.50
14616.	Zai (zaibeez)	16	86.44	97.38	12	75.00
14617.	Zach (zach_htet)	16	82.76	94.64	3	18.75
14618.	yuts (yts1999)	16	76.51	86.39	0	0.00
14619.	yourrrfattt (yourrrfattt)	16	66.24	79.56	6	37.50
14620.	vaughn (youmomgae)	16	93.91	99.56	6	37.50
14621.	Roy (yoruio)	16	96.73	114.35	4	25.00
14622.	YoloPlayz (yoloplayz10)	16	61.52	76.33	4	25.00
14623.	(yewk)	16	85.31	101.39	8	50.00
14624.	yikes (yeknom)	16	96.03	110.54	7	43.75
14625.	Y (ydelirious)	16	87.42	106.82	4	25.00
14626.	AloneStranger (yasdf007)	16	73.77	79.56	7	43.75
14627.	xnfra (xnfra)	16	65.00	77.21	1	6.25
14628.	winterml3on (winterm3lon)	16	116.90	131.08	7	43.75
14629.	John (wilde1)	16	87.49	107.82	6	37.50
14630.	Mike (wikemazowski)	16	109.51	139.65	6	37.50
14631.	Wexxort (wexxort)	16	64.73	75.85	3	18.75
14632.	Khalid (weebsensation)	16	89.02	96.86	7	43.75
14633.	Teddy (wazazaby)	16	86.59	96.98	1	6.25
14634.	Schakrin (wavezzx)	16	66.25	78.39	4	25.00
14635.	Allison (vllisunshine)	16	72.42	85.96	3	18.75
14636.	Vlad (vlasuo)	16	111.14	138.59	8	50.00
14637.	Pavel (vladmrovich)	16	61.76	70.99	3	18.75
14638.	GargoyleG (vitalstatistixg)	16	91.80	102.09	6	37.50
14639.	viRo (virosnes)	16	116.21	143.24	7	43.75
14640.	vineel (vineel)	16	87.71	102.11	4	25.00
14641.	Vicente (vincetroid)	16	54.12	62.49	1	6.25
14642.	Thanasis (vidani)	16	57.18	68.22	3	18.75
14643.	Shawn (vglunatic)	16	79.72	98.14	6	37.50
14644.	Velonik (velonik_12)	16	60.67	66.60	4	25.00
14645.	Vaibhav (vaibhavvyas)	16	78.67	99.57	5	31.25
14646.	Doomguy (vader_)	16	76.03	92.64	6	37.50
14647.	Anoos (ushagaming)	16	77.63	97.08	4	25.00
14648.	user1458 (user1458)	16	65.39	70.68	4	25.00
14649.	alax (urlonglostdog)	16	65.43	74.34	2	12.50
14650.	Abdullah Al (uniquesociety)	16	56.84	65.49	10	62.50
14651.	YoloSwag (unicornbronie)	16	103.20	117.87	7	43.75
14652.	rycechckn (ultimategammer)	16	106.09	120.29	10	62.50
14653.	UberTraffic (ubertraffic)	16	73.59	85.85	3	18.75
14654.	Typhoid (typhoid)	16	124.08	147.07	10	62.50
14655.	Tyler (tyler3143)	16	94.82	115.82	6	37.50
14656.	TuffTofu (tufftofu)	16	97.17	115.19	9	56.25
14657.	Noemi (tsunommi)	16	87.94	119.76	0	0.00
14658.	Traviz (traviz)	16	78.95	102.56	10	62.50
14659.	Zelymm (toxicmyles)	16	84.46	124.71	14	87.50
14660.	nevergiveup (touristlevelis...	16	80.13	97.26	4	25.00
14661.	Tohru (tohruu)	16	71.43	90.78	3	18.75
14662.	tochidoh (tochidoh)	16	77.87	85.93	3	18.75
14663.	Jump (toadjump)	16	95.57	107.51	5	31.25
14664.	querty (thisiscamelcase)	16	65.51	79.53	2	12.50
14665.	Semanta (the_who)	16	73.73	90.55	4	25.00
14666.	The (theking2007)	16	28.21	32.89	4	25.00
14667.	hal (theemak)	16	49.10	59.67	1	6.25
14668.	teyedix (teyedix)	16	50.69	56.15	2	12.50
14669.	tenxone (tenxone)	16	34.52	45.02	2	12.50
14670.	Collin (temposchool)	16	91.12	113.20	6	37.50
14671.	Balazs (templomos51)	16	72.33	87.23	5	31.25
14672.	Julien (taxes_)	16	60.00	72.28	6	37.50
14673.	Taran (tarankloty)	16	128.87	148.23	7	43.75
14674.	tamjid (tamjid_hasnat)	16	48.73	52.93	1	6.25
14675.	V (tall_in_spirit)	16	141.07	158.97	12	75.00
14676.	Nicholas (swissbanklord)	16	59.33	76.21	3	18.75
14677.	ahmed (sw7ezztyper)	16	72.66	85.21	8	50.00
14678.	Marco (superquack10)	16	52.25	65.21	3	18.75
14679.	Sumona (sumona)	16	38.57	43.68	3	18.75
14680.	Sultan (sultanbro)	16	45.50	52.54	2	12.50
14681.	Hopeless (styrix358)	16	78.40	97.33	2	12.50
14682.	vikas (steady_tortoise)	16	42.35	53.68	1	6.25
14683.	Mirage (starry_mirage)	16	93.48	104.99	6	37.50
14684.	stacie (stackieeeee)	16	77.54	91.73	4	25.00
14685.	Srinivas (srini_iitkgp)	16	99.61	114.28	8	50.00
14686.	sretsaM (sretsam)	16	106.40	126.97	5	31.25
14687.	T-Bird (spartakick)	16	111.51	125.07	6	37.50
14688.	Spadger (spadgerr)	16	115.49	128.23	15	93.75
14689.	Space (spacedandy)	16	95.02	111.90	7	43.75
14690.	Anthony (sp333dy)	16	93.87	115.64	9	56.25
14691.	Sora (sosora)	16	43.03	51.62	3	18.75
14692.	Josh (sorry_typeracer)	16	75.54	94.59	5	31.25
14693.	Hafma (somaliangirl)	16	153.60	169.53	14	87.50
14694.	Ben (softaco)	16	126.34	142.89	4	25.00
14695.	fea (sofea_m)	16	41.50	52.66	2	12.50
14696.	Michal (snowykey)	16	60.76	74.55	4	25.00
14697.	Snouto (snoutowo)	16	98.90	116.57	10	62.50
14698.	Sergey (snich)	16	108.92	116.17	8	50.00
14699.	smowat (smowat)	16	65.26	78.31	2	12.50
14700.	Ernesto (smoking_kills)	16	64.87	80.72	2	12.50
14701.	SmiIe (smiie)	16	104.22	115.28	6	37.50
14702.	Kriss (smashingpinkey)	16	46.87	56.34	2	12.50
14703.	Slok (slokregmi___)	16	47.44	53.82	4	25.00
14704.	Simon (slimsonkysreformed)	16	78.62	92.41	5	31.25
14705.	TianHao (skydrag0n)	16	88.70	99.27	11	68.75
14706.	SIlvester (silvesterfake)	16	81.10	92.59	2	12.50
14707.	Pitt@_____ (shubhamshinde)	16	26.75	32.72	1	6.25
14708.	Shub (shub01)	16	79.50	90.94	2	12.50
14709.	Lee (shriveledegg)	16	94.68	116.48	6	37.50
14710.	Cheg (sheedipants)	16	57.82	66.81	5	31.25
14711.	shumkar (shbarpiev)	16	75.16	92.56	2	12.50
14712.	Severin (sevo4a)	16	106.49	132.97	6	37.50
14713.	Daniel (semashe)	16	90.03	114.73	8	50.00
14714.	segun (segun99)	16	46.65	54.38	1	6.25
14715.	Baibars (sazin_me)	16	62.84	70.92	7	43.75
14716.	Jason (samuraishinobi)	16	63.49	72.14	3	18.75
14717.	siri (sag339)	16	102.81	135.23	5	31.25
14718.	karrar (saffa990)	16	60.90	72.01	5	31.25
14719.	Ryan (rya_nly)	16	119.87	145.86	11	68.75
14720.	Ryan (ryantam279)	16	68.86	80.26	7	43.75
14721.	Rustem (rus101)	16	108.82	125.69	6	37.50
14722.	Abdurrachman (rrachman)	16	68.11	81.75	6	37.50
14723.	Herve Tran (royale81)	16	77.70	90.70	8	50.00
14724.	Andrew (ronioz)	16	79.58	91.93	6	37.50
14725.	রিফাত (rifat_072)	16	74.52	89.88	6	37.50
14726.	LacticMilk (richardios275)	16	73.43	87.53	2	12.50
14727.	Yah (reveri)	16	80.23	91.94	5	31.25
14728.	OREO (reocraft)	16	108.15	138.98	9	56.25
14729.	Shaggy (remrem0)	16	84.97	100.30	3	18.75
14730.	Morris (reinheart)	16	114.51	124.60	7	43.75
14731.	Robertas (rebutis)	16	69.91	76.43	6	37.50
14732.	Preet (rahal)	16	58.80	71.89	4	25.00
14733.	My (qwertytheuiop)	16	53.65	61.79	5	31.25
14734.	Kim (qwerko)	16	78.77	95.21	6	37.50
14735.	Harry (qqwwddvv852)	16	63.13	75.62	3	18.75
14736.	Qianxu Guo (qianxug)	16	94.44	112.39	10	62.50
14737.	Puppet (puppetsfingers)	16	90.39	114.61	6	37.50
14738.	Xingyu (pumpkinlighter)	16	56.79	67.13	3	18.75
14739.	PraWin (praveenapk)	16	56.47	63.73	3	18.75
14740.	Murphy (pouyacr72)	16	60.05	75.64	2	12.50
14741.	PotatoMike (potatomike)	16	89.41	111.48	4	25.00
14742.	21337R (poptart128)	16	109.92	131.56	10	62.50
14743.	ahmed (ponochio_)	16	52.92	60.51	4	25.00
14744.	PizzaPortal (pizzaportal)	16	77.76	107.24	7	43.75
14745.	chimp (phucktyping)	16	106.31	131.82	7	43.75
14746.	ph (phmi)	16	85.22	103.23	6	37.50
14747.	peppy (peppersteaku)	16	96.22	120.21	4	25.00
14748.	Philip (pengzz)	16	81.91	95.23	5	31.25
14749.	Farm (pandamkii)	16	99.82	115.63	9	56.25
14750.	Polly (pajberman)	16	114.12	134.28	8	50.00
14751.	Pablo (pablurp)	16	104.04	133.30	10	62.50
14752.	p055am (p055am)	16	55.41	70.01	6	37.50
14753.	oriom (orionrw)	16	119.99	138.57	11	68.75
14754.	OobertsTyping (oobertstyping)	16	106.38	124.11	7	43.75
14755.	Apple (omnipotential_magic)	16	70.82	80.22	1	6.25
14756.	Christopher (omicronexe)	16	77.04	94.87	7	43.75
14757.	Omar (omarkhair)	16	62.14	70.09	3	18.75
14758.	Olan (olan10001)	16	71.05	87.13	4	25.00
14759.	Noam (okahama)	16	71.53	86.41	3	18.75
14760.	Oink (oinklmao)	16	67.30	80.08	5	31.25
14761.	David (nunyobusiness)	16	123.26	142.17	9	56.25
14762.	vignesh (noob_typer16)	16	50.62	57.65	2	12.50
14763.	noob_slayer (noob_slayer)	16	98.83	111.37	7	43.75
14764.	tstats[n0body] (nobody01)	16	108.31	122.11	7	43.75
14765.	Musashi (noble_addiction)	16	75.62	94.11	5	31.25
14766.	nitesh (nkpcpr)	16	37.46	42.75	1	6.25
14767.	Fluoride Action Network (nize)	16	112.69	146.74	6	37.50
14768.	me (ninjagamer0060)	16	61.12	72.74	2	12.50
14769.	Nikki (niksta95)	16	124.62	154.84	13	81.25
14770.	marc (nightowl)	16	86.57	102.19	5	31.25
14771.	Desmond (night9sky)	16	65.19	76.91	4	25.00
14772.	nico yes nico (nic_o_nic)	16	103.02	140.12	5	31.25
14773.	Nick (nick1347)	16	89.42	102.84	8	50.00
14774.	Lucy (nemurinemuri)	16	103.52	112.55	8	50.00
14775.	Nathan (nayteo)	16	71.17	84.45	0	0.00
14776.	naviman (naviman)	16	94.98	114.02	7	43.75
14777.	natc (natc2)	16	84.99	97.86	7	43.75
14778.	tuffghost (namtap)	16	106.84	117.14	7	43.75
14779.	Milan (nalim)	16	72.90	78.94	2	12.50
14780.	Amila (n0wtype)	16	84.01	90.37	8	50.00
14781.	MyNameIsGodzLol (mynameisgo...	16	81.97	97.31	7	43.75
14782.	Joseph (mwita7)	16	59.88	73.55	0	0.00
14783.	Joshua (mr_mushroom_stew)	16	93.18	101.28	2	12.50
14784.	Mon (monmcgt)	16	73.29	86.12	3	18.75
14785.	Bryce (molohov)	16	90.77	116.36	5	31.25
14786.	medham (mohemedham)	16	51.81	61.48	0	0.00
14787.	youknow (moelesteronyakids)	16	24.12	28.38	4	25.00
14788.	Edwin (minsil)	16	87.72	104.94	8	50.00
14789.	◯__ MAX __◯ (minilaytr)	16	79.55	94.68	4	25.00
14790.	TheCuber (mine_star2046)	16	54.56	65.77	5	31.25
14791.	WhySoSlow (milktea_1999)	16	70.41	77.77	3	18.75
14792.	DaturdMig (migueldathird)	16	82.16	91.11	5	31.25
14793.	Emily (miffily)	16	98.22	109.64	12	75.00
14794.	Michał (michal_miszcz_123)	16	52.51	62.38	3	18.75
14795.	Kael (michael_deleon)	16	69.61	80.45	3	18.75
14796.	Garry (megatroop)	16	102.09	108.94	5	31.25
14797.	MD Imran (md_imran_hosen)	16	37.36	44.03	2	12.50
14798.	Boltedツ (mchackerz)	16	89.86	102.58	6	37.50
14799.	matuush (matuush)	16	61.49	70.01	12	75.00
14800.	mathemage (mathemage)	16	78.84	86.38	3	18.75
14801.	Lindsay (math314)	16	108.54	125.96	14	87.50
14802.	tstats[massive_man4] (massi...	16	113.21	144.84	6	37.50
14803.	Zach (malkyie)	16	87.34	110.30	6	37.50
14804.	maher (maherbmf)	16	46.49	59.05	2	12.50
14805.	Lord (mafiosnik)	16	48.29	55.35	2	12.50
14806.	Macrene (macrene)	16	102.56	118.82	8	50.00
14807.	Mike (m1kep)	16	74.17	97.26	6	37.50
14808.	karen (lvl100karen)	16	101.10	111.96	9	56.25
14809.	Val (luv2swimv)	16	118.93	148.05	10	62.50
14810.	Konstantine (luke_erdman)	16	88.27	96.56	5	31.25
14811.	Louis (lodero)	16	95.86	115.19	10	62.50
14812.	Abdallah (lno_namel)	16	27.39	32.21	1	6.25
14813.	Leo (ljrobispado)	16	68.40	75.88	4	25.00
14814.	Rosen (littlepero)	16	43.70	51.18	2	12.50
14815.	Zhen Qing (lim0721lim)	16	85.62	98.34	3	18.75
14816.	Leon (likarii)	16	88.75	108.00	6	37.50
14817.	Liam (liamc2)	16	62.42	74.73	2	12.50
14818.	lency (lencyb21)	16	47.68	55.06	2	12.50
14819.	Lecailloux (lecailloux)	16	66.49	78.15	5	31.25
14820.	Joash (lastassassin1)	16	77.57	91.54	5	31.25
14821.	Kate (larleek)	16	78.59	92.43	6	37.50
14822.	Kirito (laksh_4uh)	16	65.78	85.19	1	6.25
14823.	Kūfuku (kufuku)	16	68.56	83.08	7	43.75
14824.	Krzyś (kszysio)	16	85.07	103.15	6	37.50
14825.	YAS62kbdfans5 (ksydry6)	16	108.70	119.22	11	68.75
14826.	Kraven (kraven_lupei)	16	125.64	143.02	6	37.50
14827.	Artur (korfey)	16	35.42	40.43	0	0.00
14828.	nick (koot)	16	66.08	82.26	4	25.00
14829.	grace (koald)	16	90.13	103.63	4	25.00
14830.	Koala (koalazoo)	16	125.71	145.49	12	75.00
14831.	(klaritix)	16	137.58	167.33	12	75.00
14832.	Kitkat (kitkatt77)	16	64.25	77.33	2	12.50
14833.	kit (kitkatpaddywack)	16	97.24	110.89	5	31.25
14834.	KimsterH (kimsterh)	16	90.16	110.11	3	18.75
14835.	Lazar (kh00m4)	16	57.35	66.84	3	18.75
14836.	Ken (kgnishere)	16	83.76	92.33	7	43.75
14837.	Kevin (keviniskevy)	16	84.76	101.07	4	25.00
14838.	Keihlan (keihlan)	16	45.00	52.82	0	0.00
14839.	muhammed (katsh)	16	63.40	80.33	4	25.00
14840.	katrina mae (katrinamae_cru...	16	53.87	67.65	11	68.75
14841.	Oscar (karos_uchiha)	16	90.11	105.00	4	25.00
14842.	Karim Alaswad (karim_alaswa...	16	73.42	88.89	5	31.25
14843.	Johan (kankertypen)	16	114.65	137.40	7	43.75
14844.	KachoriJalebi (kachori_jalebi)	16	55.87	68.90	3	18.75
14845.	Kentaro (k3n74r0)	16	116.04	127.59	6	37.50
14846.	Saso McDaso (justtypefast)	16	137.64	161.47	13	81.25
14847.	Im slow (justmecha)	16	63.65	84.48	6	37.50
14848.	Justin (justbh)	16	97.19	110.95	3	18.75
14849.	tesseractive (jupyter)	16	73.73	87.07	2	12.50
14850.	Beilvert (jubeilvert)	16	72.48	87.99	1	6.25
14851.	Kimchi (jrhee)	16	100.39	125.25	6	37.50
14852.	Josh (joshuazhu516)	16	136.50	165.95	6	37.50
14853.	Joshua (joshuac_47)	16	67.77	92.72	8	50.00
14854.	GoneRogue (josephlee)	16	71.10	82.98	5	31.25
14855.	Jordan (jorjorg11)	16	53.27	59.14	3	18.75
14856.	Jordi (jordityper)	16	110.42	126.60	9	56.25
14857.	john mat (john_mat)	16	44.92	57.52	0	0.00
14858.	TypeRacerKid (johnsonbongo)	16	70.46	85.42	4	25.00
14859.	Johir (johir)	16	120.30	133.41	10	62.50
14860.	Johnny (jnguyen732)	16	90.84	101.61	7	43.75
14861.	faster (jjzxc1)	16	75.52	81.13	3	18.75
14862.	B (jixlimmy)	16	112.16	133.80	12	75.00
14863.	TeddY (jirayut)	16	60.03	70.89	6	37.50
14864.	Jezrael (jezjwv)	16	51.63	61.91	5	31.25
14865.	jfiewogh (jfiewogh)	16	92.22	121.19	12	75.00
14866.	jfkdlsaeng (jfkdlsaeng)	16	81.21	103.47	3	18.75
14867.	Mike (jewunit)	16	105.06	131.60	4	25.00
14868.	Jesus (jesus08)	16	62.52	72.14	5	31.25
14869.	Jaffri (jeffli2000)	16	90.71	103.54	9	56.25
14870.	Joseph (jdog_ld)	16	77.35	93.51	5	31.25
14871.	Jay Jo (jay20051209)	16	91.83	112.33	6	37.50
14872.	Jimbo (jarrydschray)	16	49.73	56.49	1	6.25
14873.	Jake (jakesk)	16	97.20	112.21	4	25.00
14874.	G (jaden)	16	83.65	93.91	6	37.50
14875.	Jack_potta (jack_potta)	16	68.36	79.53	4	25.00
14876.	Joerg (jabra11)	16	103.99	115.17	5	31.25
14877.	Parker (i_hunger101)	16	58.21	64.72	3	18.75
14878.	Victor (its_shadow)	16	108.82	127.36	10	62.50
14879.	YT (inverxted)	16	93.56	125.60	9	56.25
14880.	huessy (independencyy)	16	129.82	149.98	10	62.50
14881.	Jason (illumathottie)	16	97.00	116.33	12	75.00
14882.	abdulkhakim (ihkim)	16	65.30	80.25	3	18.75
14883.	wakolabot (idc_0306)	16	40.42	45.20	4	25.00
14884.	Ian (iancook)	16	95.30	112.66	5	31.25
14885.	AlexiaWasFound (iam_selc)	16	52.99	66.04	0	0.00
14886.	Raju (iamrajukhan)	16	52.36	60.58	1	6.25
14887.	David (hybridlikesrice)	16	124.72	133.70	7	43.75
14888.	Hania (hrychania)	16	43.57	54.40	0	0.00
14889.	Hrm_710 (hrmmm)	16	69.46	82.29	2	12.50
14890.	No one (howardog0707)	16	110.57	132.96	4	25.00
14891.	HJ (hjteq)	16	51.91	58.80	1	6.25
14892.	Henry (henry2)	16	107.74	116.29	9	56.25
14893.	hahah (hahahahahahaaaaa)	16	141.12	156.61	15	93.75
14894.	The killer (haaassan)	16	57.46	69.64	2	12.50
14895.	guhard (guhardos)	16	71.70	79.95	3	18.75
14896.	Chris (guffar)	16	103.57	120.70	5	31.25
14897.	Gnany (gnanickky1)	16	53.45	70.07	3	18.75
14898.	grace (girlalmighty)	16	80.18	95.98	1	6.25
14899.	Christian (gergoss)	16	95.94	117.24	11	68.75
14900.	Gavin (gavtoaster)	16	92.89	107.49	5	31.25
14901.	Garv (garv1908)	16	66.80	75.57	3	18.75
14902.	Galil (galil35)	16	90.16	111.41	7	43.75
14903.	Faaris (fxzz)	16	53.56	66.41	0	0.00
14904.	Swarnim (futuretonystark)	16	55.82	68.88	4	25.00
14905.	e (freshcabbage)	16	65.33	80.76	5	31.25
14906.	Alonne (freeman_1337)	16	87.63	95.44	8	50.00
14907.	Connor (frantelle)	16	71.23	87.40	6	37.50
14908.	🔱 (frankzzzzzzz)	16	82.54	89.60	1	6.25
14909.	Andrew (foruforu)	16	92.09	104.81	3	18.75
14910.	Snow (forgotmypassword)	16	103.51	116.87	11	68.75
14911.	Flaze07 (flaze07)	16	113.46	136.79	7	43.75
14912.	Ryan (flamepopo)	16	110.56	130.41	7	43.75
14913.	i was wrong (firewolfrain)	16	159.90	217.71	14	87.50
14914.	firealpaca1 (firealpaca1)	16	74.71	93.12	7	43.75
14915.	frog (fijixt)	16	92.60	117.46	12	75.00
14916.	Tyler Spruill (fightingox)	16	107.91	125.09	6	37.50
14917.	gonçalo (figados)	16	95.78	106.59	3	18.75
14918.	Abdullah (fe4rlesscloak)	16	100.09	119.65	8	50.00
14919.	FatPanduh (fatpanduh)	16	125.40	136.50	9	56.25
14920.	Vikram (fast_life)	16	44.39	51.31	2	12.50
14921.	Chimaera (excalibur4212)	16	114.09	143.13	9	56.25
14922.	Evelyn (evelyn_mh)	16	75.60	100.92	4	25.00
14923.	EternalTempest (eternaltemp...	16	54.68	63.88	2	12.50
14924.	Eren (eren_ackerman)	16	91.53	108.29	7	43.75
14925.	Epoch (epochisepic)	16	87.89	104.51	4	25.00
14926.	Epic (epic_gamer2834)	16	107.87	133.62	9	56.25
14927.	CJ (entrity_screamr)	16	113.60	136.53	7	43.75
14928.	Enea (enea)	16	66.83	79.51	1	6.25
14929.	Emre (emre0)	16	75.08	85.62	3	18.75
14930.	Elias (eliasjr)	16	72.43	86.45	5	31.25
14931.	Eesa (eesa10)	16	75.80	88.29	4	25.00
14932.	Edwin (edweezy)	16	104.95	120.12	4	25.00
14933.	Edvaize (edvaize)	16	61.02	67.72	4	25.00
14934.	Dennis (dwiebe)	16	45.22	55.19	3	18.75
14935.	MaskDuck (duongmt)	16	51.09	61.14	6	37.50
14936.	Lukas (dundis3000)	16	79.28	90.02	3	18.75
14937.	Aj (drome)	16	65.78	74.61	3	18.75
14938.	peace in byron (driveroncall)	16	120.53	156.84	9	56.25
14939.	Drew (drewsmithworkman)	16	95.09	107.22	5	31.25
14940.	Carson (dramagirl82)	16	71.62	80.60	5	31.25
14941.	Dvorak Keyboard (douglasawe...	16	61.03	75.64	5	31.25
14942.	not a race (donut_gublor)	16	97.77	120.02	5	31.25
14943.	Dongo (dongodm)	16	91.25	129.99	5	31.25
14944.	Spidget finger (djurancigan)	16	87.26	104.95	3	18.75
14945.	Djordje (djo666)	16	97.31	110.20	7	43.75
14946.	DiscoOrc (discoorc)	16	123.47	138.08	6	37.50
14947.	Alex (dippyshere)	16	86.41	108.72	12	75.00
14948.	DJ (dino_dj)	16	60.17	68.01	4	25.00
14949.	Dhruv (dhruvs301)	16	83.65	91.16	5	31.25
14950.	dewy (dewydh)	16	101.67	121.07	6	37.50
14951.	deon (deontan)	16	111.90	124.47	9	56.25
14952.	Parth (demolisher_1209)	16	79.74	97.31	7	43.75
14953.	Debojoti Das (debojoti_soumya)	16	88.24	98.70	7	43.75
14954.	Death (deathexploit)	16	100.79	116.71	16	100.00
14955.	dayqpi (dayqpi)	16	110.50	130.36	8	50.00
14956.	Davx_d (davx_d)	16	122.41	152.13	12	75.00
14957.	Rooster (darkjdm)	16	118.33	142.83	11	68.75
14958.	Nick (darapidninja)	16	76.47	88.79	16	100.00
14959.	Justin (dainese)	16	70.69	83.07	4	25.00
14960.	Christopher X Wu (cw86459)	16	85.75	112.41	1	6.25
14961.	Tim (cupboard)	16	62.47	92.64	0	0.00
14962.	aoxiang (cuiaoxiang)	16	82.16	98.00	6	37.50
14963.	Sid (criptonate)	16	71.87	79.86	6	37.50
14964.	NepThePep (creepyreapy)	16	68.85	90.06	1	6.25
14965.	Come (cosmeec)	16	73.23	89.68	6	37.50
14966.	Mason (contourflyer2)	16	55.73	65.17	0	0.00
14967.	lucho (colombimbo)	16	61.15	69.48	3	18.75
14968.	Cocospeed (cocospeedy)	16	47.58	53.45	1	6.25
14969.	clausrogisch (clausrogisch)	16	48.61	54.54	1	6.25
14970.	Alex (chucky9022_)	16	67.69	85.49	3	18.75
14971.	Christian (chrixsi)	16	80.44	95.55	6	37.50
14972.	Joe (chogpamp)	16	64.80	74.06	4	25.00
14973.	Chris (chink344)	16	95.09	110.21	5	31.25
14974.	Mert (chineeswall)	16	61.15	75.71	3	18.75
14975.	Charles (charles0420)	16	49.65	60.40	2	12.50
14976.	Cesar (cesarloachamin)	16	64.28	69.29	2	12.50
14977.	Tomlynn (carriganth)	16	47.15	51.63	2	12.50
14978.	Carlo (carlofletcher)	16	100.51	121.99	8	50.00
14979.	The Milkman (captain_noodle)	16	108.14	125.59	8	50.00
14980.	Lachlan (cancer88)	16	66.24	83.27	3	18.75
14981.	billy (bzmq)	16	117.24	131.02	12	75.00
14982.	Bytes (bytesandbots)	16	77.07	94.58	5	31.25
14983.	Mapko (buffi)	16	73.46	85.72	1	6.25
14984.	budjetti (budgettypo)	16	85.44	102.27	3	18.75
14985.	Kamalesh (brrrr_007)	16	85.12	105.84	4	25.00
14986.	Bronze (bronzefrakk)	16	85.08	94.34	5	31.25
14987.	Breadman (breadman0123)	16	85.39	96.55	5	31.25
14988.	Bosco (boscorj)	16	48.18	61.48	7	43.75
14989.	ahmed (borr3y)	16	52.45	59.20	2	12.50
14990.	Blue._. (bluewaves54)	16	83.91	98.85	6	37.50
14991.	carl (blackhole24)	16	64.15	74.82	5	31.25
14992.	Matthew (binko)	16	84.44	95.56	4	25.00
14993.	yuh (billbrown86)	16	53.08	64.54	2	12.50
14994.	Ben Asam (bemarc)	16	91.14	107.64	6	37.50
14995.	Beluga (belugabetter)	16	94.35	105.86	3	18.75
14996.	Abijith (believertn)	16	53.43	64.48	2	12.50
14997.	Jon (bdnoj618)	16	83.91	96.67	2	12.50
14998.	Sebastian (badwine)	16	55.73	71.77	2	12.50
14999.	Brian (a_job_well_done)	16	132.07	141.19	12	75.00
15000.	Ayush (ayushgandhi)	16	55.93	61.41	4	25.00
15001.	ayrus (ayrus01)	16	56.52	64.17	3	18.75
15002.	leonidas (awsomaw)	16	166.65	190.62	5	31.25
15003.	ava (ava_er)	16	41.40	56.37	2	12.50
15004.	kuan-Yu (austin737)	16	73.26	91.99	4	25.00
15005.	tobias (atomstodin)	16	65.68	82.78	5	31.25
15006.	Askur (askur00)	16	81.14	89.99	7	43.75
15007.	Aridia (aridia)	16	88.39	98.26	7	43.75
15008.	arichnad (arichnad)	16	80.51	103.64	2	12.50
15009.	aorer (aorer)	16	110.01	133.44	9	56.25
15010.	Ritu (anritu)	16	63.79	75.69	4	25.00
15011.	Luke (angelsfan)	16	89.83	105.57	15	93.75
15012.	candyyyyyyy (andewa_05)	16	103.22	121.01	13	81.25
15013.	Anderson (andarson)	16	85.84	96.60	5	31.25
15014.	Anaru (anaru797)	16	82.56	92.37	2	12.50
15015.	Amir (amirtrex)	16	58.06	70.86	3	18.75
15016.	Amir (amirb101)	16	88.71	110.71	13	81.25
15017.	Maccy (amaccy)	16	66.22	74.11	6	37.50
15018.	Ariel :) (alyas94)	16	71.71	85.48	4	25.00
15019.	Alles (allesboem)	16	100.14	118.53	6	37.50
15020.	alex (alexjimma)	16	26.42	31.45	3	18.75
15021.	Karibas (albiones)	16	76.44	89.10	4	25.00
15022.	Mohammad (alamin_typist)	16	84.51	98.83	6	37.50
15023.	Akribes (akribes)	16	92.33	106.94	6	37.50
15024.	Aidan (aidsiskindagoated)	16	67.68	78.03	2	12.50
15025.	ahmed saif (ahmedsaif)	16	69.46	76.54	2	12.50
15026.	ahmed (ahmedfoad246)	16	63.20	73.12	3	18.75
15027.	Harlis (ahk_master)	16	57.41	69.80	1	6.25
15028.	Aviram (adsherun)	16	87.78	107.68	4	25.00
15029.	Adrian (adrian4k_)	16	74.72	83.52	5	31.25
15030.	Karol (adobonimama)	16	83.48	99.08	3	18.75
15031.	Adil (adilmamed0v)	16	86.08	101.23	6	37.50
15032.	Adham2024 (adham2002)	16	60.57	78.39	3	18.75
15033.	Adamowich (adamowich)	16	84.31	102.65	3	18.75
15034.	æ (ac343)	16	100.47	118.13	7	43.75
15035.	Abhinav (abhinav28061)	16	38.97	44.36	2	12.50
15036.	Antoni (aachh)	16	108.91	128.50	8	50.00
15037.	Hisham (7ommus)	16	59.68	75.97	3	18.75
15038.	Brenda (6renda)	16	72.21	88.25	4	25.00
15039.	Mat (3nlist)	16	91.67	108.45	9	56.25
15040.	Donovan (24aad)	16	70.55	81.63	2	12.50
15041.	Haley (21stcenturyasian)	16	47.40	57.95	0	0.00
15042.	ray (rayearly2)	16	74.97	82.07	7	43.75
15043.	Anish (anish592)	16	54.62	63.52	1	6.25
15044.	Delphin (delmasgdp7)	16	45.59	55.31	0	0.00
15045.	Kian (kianhidayat)	16	70.86	84.41	5	31.25
15046.	Lucy (moca_lucy)	16	52.37	61.12	3	18.75
15047.	Adriane (cordzingerr)	16	73.83	94.23	7	43.75
15048.	Bemin (bemin)	16	44.76	63.04	1	6.25
15049.	Matthew (matt5671110)	16	93.68	101.01	5	31.25
15050.	Alijah (user_504)	16	49.78	57.01	2	12.50
15051.	GoldenKoopa (goldenkoopa)	16	60.10	70.79	4	25.00
15052.	toshi (toshi2135)	16	79.67	92.03	3	18.75
15053.	nicholas (xxxtexascion)	16	45.19	54.30	0	0.00
15054.	Sakibul (sakib62)	16	46.27	52.72	5	31.25
15055.	Alden (bibbedtoaster)	16	61.61	77.25	6	37.50
15056.	Julle (aikarauta)	16	94.85	108.73	10	62.50
15057.	tushar mathpal (tmathpal25)	16	49.48	54.69	2	12.50
15058.	NatanTopKek (abrn200)	16	48.25	56.98	1	6.25
15059.	sys3 (neporian)	16	91.34	118.82	4	25.00
15060.	Strattuss (strattuss)	16	101.80	117.40	8	50.00
15061.	Lemon (raymond_p21)	16	86.64	132.09	6	37.50
15062.	James (jfjames101)	16	85.19	95.55	9	56.25
15063.	aspyse (aspyse)	16	85.59	101.37	1	6.25
15064.	Taylor (tparr_05)	16	86.69	99.34	12	75.00
15065.	Shane (oo123654789)	16	67.84	75.93	5	31.25
15066.	quang (lequang89lk)	16	55.82	64.08	4	25.00
15067.	somethhing_324 (somethhing_...	16	30.55	45.01	4	25.00
15068.	LAvi (getoodasuals)	16	79.34	95.10	7	43.75
15069.	OyBer (oyber)	16	51.68	57.41	2	12.50
15070.	Andrew (andyroop18)	16	98.43	120.97	6	37.50
15071.	LISEK (jeneeczek)	16	25.65	33.33	3	18.75
15072.	Anthony (gently162)	16	86.26	108.14	6	37.50
15073.	Virgil (baron_red)	16	57.60	69.87	0	0.00
15074.	Audge (audge9)	16	101.70	111.51	4	25.00
15075.	Tonho (t0nhou)	16	63.07	68.53	1	6.25
15076.	One Handed (samilz92)	16	21.90	27.58	2	12.50
15077.	Vidun (vidunvj)	16	101.92	120.31	7	43.75
15078.	Player5k (player5k)	16	29.65	46.36	3	18.75
15079.	Enrique (enriquejh97)	16	58.66	72.20	2	12.50
15080.	Volc (volcanic_eruption)	16	65.26	74.05	2	12.50
15081.	wiwi (wiwi08)	16	49.40	54.98	2	12.50
15082.	Paul (00000000)	16	70.58	87.89	4	25.00
15083.	private (awwi)	16	54.33	60.04	0	0.00
15084.	xiugaze (xiugaze)	16	76.96	95.82	4	25.00
15085.	ashik (ashikmaximus)	16	27.69	35.08	1	6.25
15086.	Jeffrey (jeffmoore4815)	16	42.65	51.53	1	6.25
15087.	Terrific (samsoft)	16	69.15	82.42	6	37.50
15088.	strideisnot (strideisnot_po...	16	52.69	63.06	10	62.50
15089.	Mikiroow (mikiroow)	16	120.18	128.84	11	68.75
15090.	Stephen (sda370)	16	115.33	133.73	11	68.75
15091.	shawn (tesu23)	16	56.09	62.84	4	25.00
15092.	Orange (imorange)	16	62.94	79.15	6	37.50
15093.	Creamy Poo (mintbreezeplus)	16	55.36	64.02	6	37.50
15094.	Przemysław Węglik (weglik)	16	53.27	66.30	1	6.25
15095.	Chino (chino_mama)	16	102.18	118.06	7	43.75
15096.	nicatiau (nicole_mendes13)	16	50.80	57.69	12	75.00
15097.	Reggie (_fast_car_noises_)	15	48.77	55.87	1	6.67
15098.	Zozvo (zozvo)	15	45.95	60.35	1	6.67
15099.	Ugnius (zorgas)	15	77.30	91.65	5	33.33
15100.	Zzzzzz (zokey)	15	82.88	90.68	4	26.67
15101.	Varyemez✍️ (ziperz_the_...	15	94.23	103.40	5	33.33
15102.	Kaiden (zentacle)	15	86.56	97.07	4	26.67
15103.	Secre (zenmt)	15	69.98	84.90	7	46.67
15104.	Zane (za_schu)	15	65.66	81.82	3	20.00
15105.	Javin (zakurukito)	15	67.24	77.60	3	20.00
15106.	z1lo (z1lo)	15	62.05	71.65	2	13.33
15107.	( ͡° ͜ʖ ͡°)🖕 (your...	15	95.15	111.89	4	26.67
15108.	yogesh (yogipapu15)	15	60.72	69.48	3	20.00
15109.	Yellow (yellowleaf)	15	78.82	106.30	6	40.00
15110.	Emmett (yamaicewing)	15	68.57	75.73	3	20.00
15111.	Xyhop (xyhop)	15	78.29	92.72	8	53.33
15112.	JJ (xvitrix)	15	98.06	115.40	6	40.00
15113.	Ricards (xricheeh)	15	50.12	57.84	0	0.00
15114.	jie (xonjiex)	15	98.62	113.71	5	33.33
15115.	xcz (xcz05)	15	99.82	109.62	4	26.67
15116.	enfonius (wssh)	15	136.68	162.85	0	0.00
15117.	Mateusz (wirelesss)	15	53.15	60.94	4	26.67
15118.	William (will_exe)	15	48.98	55.17	2	13.33
15119.	WooshWoosh (wiertsmenator)	15	60.79	71.51	4	26.67
15120.	whaterman (whaterman)	15	63.47	78.50	8	53.33
15121.	Mikel (wellthatwasfun)	15	98.00	114.07	11	73.33
15122.	anousa (weebwithadog67)	15	108.00	123.71	9	60.00
15123.	Mark (waybeyondhope)	15	39.29	52.66	2	13.33
15124.	ivanchrome (watonearth)	15	103.96	119.73	7	46.67
15125.	Ken (waterlemon48)	15	88.79	106.11	7	46.67
15126.	Waseem (was11)	15	49.47	52.75	2	13.33
15127.	aleX (waisa)	15	67.31	88.72	3	20.00
15128.	w8 (w8lkinusa)	15	72.48	82.39	4	26.67
15129.	Vodon (vodon)	15	80.56	90.56	2	13.33
15130.	Vito (vito_t)	15	44.09	54.98	3	20.00
15131.	vioco (vioco)	15	74.96	85.06	1	6.67
15132.	Vasi (vasi1333)	15	85.74	95.75	6	40.00
15133.	Utkarsh (utkarsh_n)	15	58.91	70.75	3	20.00
15134.	Usmon (usmon_h)	15	56.38	61.23	13	86.67
15135.	Usman (usmanayubkhan)	15	63.55	76.46	1	6.67
15136.	user (user199012)	15	139.21	190.97	11	73.33
15137.	Gustav (ultragurkatv)	15	61.38	71.73	2	13.33
15138.	uggs (ugo_alo)	15	58.29	71.36	1	6.67
15139.	Brennen (uglyer)	15	108.96	120.27	7	46.67
15140.	uday (uday12381)	15	84.07	99.02	2	13.33
15141.	t_lea (t_lea)	15	87.01	104.62	3	20.00
15142.	Hamlet (typing__words)	15	103.07	130.29	9	60.00
15143.	Mayank (typingbadal)	15	39.53	47.50	1	6.67
15144.	Type (typespeed2020_)	15	87.00	107.07	5	33.33
15145.	Jacqueline (typegozoom)	15	44.36	52.21	1	6.67
15146.	Krzysztof (tygryz)	15	85.18	102.49	4	26.67
15147.	Harry (txharry)	15	96.09	106.71	3	20.00
15148.	Rachel (tweetybirdbird)	15	50.92	64.90	2	13.33
15149.	Tuan (tuan)	15	71.38	79.85	2	13.33
15150.	TryingToBeHooman (tryingtob...	15	63.71	79.15	5	33.33
15151.	trip (triphereon)	15	75.97	84.35	6	40.00
15152.	trailmix (trialtest)	15	103.85	117.29	10	66.67
15153.	Logan (toast_scrubber)	15	87.34	104.49	4	26.67
15154.	try (tipewriter123)	15	85.53	103.31	7	46.67
15155.	Tristan (timmychikin)	15	103.87	115.71	7	46.67
15156.	Justin (thisjustinj)	15	38.93	47.26	0	0.00
15157.	dakshesh (the_teslafan)	15	59.18	78.72	9	60.00
15158.	theunnoticable (theunnotica...	15	116.34	138.53	8	53.33
15159.	Brian (thepinkelephantcar)	15	96.82	124.73	3	20.00
15160.	Jeandre (theopgamer)	15	70.39	84.66	15	100.00
15161.	TGX20 (thegamerx20)	15	103.16	116.81	7	46.67
15162.	the (thebaneet)	15	89.89	108.47	5	33.33
15163.	sash (thatguysash)	15	102.39	118.86	7	46.67
15164.	TGNYC (tgnyc)	15	118.51	128.45	7	46.67
15165.	Temur (temurmannonov)	15	67.20	73.33	4	26.67
15166.	𝕃𝕦𝕗𝕗𝕪 (techon)	15	101.77	113.52	8	53.33
15167.	Tarun (tarun6119)	15	45.85	53.58	2	13.33
15168.	Dreeows (tanziomee)	15	58.72	72.73	3	20.00
15169.	Tanner (tannercraytor)	15	56.64	66.81	5	33.33
15170.	Alex (t3dr)	15	73.01	83.83	3	20.00
15171.	edyn (sylvyn)	15	51.02	60.10	1	6.67
15172.	Alex (swobe)	15	69.50	78.23	4	26.67
15173.	Suttikoon (suttikoonpp)	15	62.90	78.18	3	20.00
15174.	Surya (suryasunkari)	15	99.11	122.52	15	100.00
15175.	Mehmet (superfasttyper_0102)	15	60.94	76.74	3	20.00
15176.	Nuts (sumguy69)	15	112.53	125.23	8	53.33
15177.	dvorshark 🦈 (strongly_ty...	15	114.06	140.93	4	26.67
15178.	StantheAsian90 (stantheasia...	15	84.79	99.35	4	26.67
15179.	Stalking (stalkingdog)	15	86.30	103.51	1	6.67
15180.	Jeff (st1m)	15	50.93	56.63	1	6.67
15181.	George (ssbatch)	15	122.52	136.55	8	53.33
15182.	Chris (splixerr)	15	68.78	83.10	4	26.67
15183.	Brayden (soygoblin)	15	42.23	49.86	0	0.00
15184.	Soxi (soxi_colemak)	15	80.97	101.82	5	33.33
15185.	Toasty (somewhat_toasty)	15	67.88	80.30	3	20.00
15186.	Some1uknow (some1uknow)	15	58.38	66.62	2	13.33
15187.	Sofia (sofia_anical)	15	51.15	58.12	3	20.00
15188.	kowi (smoothfingers)	15	57.00	63.71	1	6.67
15189.	Prasanta (skyline049)	15	47.84	56.81	3	20.00
15190.	MeowPichu (skyarchbeast)	15	101.89	113.33	7	46.67
15191.	Dastan (skitllz)	15	40.02	44.09	0	0.00
15192.	sk (skdreams)	15	87.24	97.31	5	33.33
15193.	simmi (simmi999777)	15	55.73	68.89	3	20.00
15194.	TruffleJr (silvqrfrost)	15	44.40	49.69	1	6.67
15195.	Nedi (silencion)	15	43.44	49.61	2	13.33
15196.	Siddharth (siddharthrajpal)	15	71.55	78.09	4	26.67
15197.	Shrubber (shrubber)	15	67.92	77.28	3	20.00
15198.	Shriram (shri_baj)	15	37.43	44.14	1	6.67
15199.	Zachary (showmanthemoney)	15	82.93	89.94	3	20.00
15200.	Shashank (shashniq)	15	77.51	83.58	6	40.00
15201.	Senin (senin8pagi)	15	102.48	110.91	7	46.67
15202.	Syed Ashfaq (satmath)	15	41.45	46.08	2	13.33
15203.	Michael (sano459)	15	89.37	95.06	3	20.00
15204.	samsolt (samsolt)	15	51.36	62.87	3	20.00
15205.	Anuar (sagidollaev_)	15	49.29	57.08	13	86.67
15206.	Sagar (sagarcool)	15	48.35	56.00	2	13.33
15207.	George (ryallanrya)	15	108.64	127.06	9	60.00
15208.	Ruff (roofy2004)	15	81.38	92.97	4	26.67
15209.	ROAD TO 100!!! (ronkoe)	15	43.20	49.68	2	13.33
15210.	romo (romokom)	15	30.55	36.19	1	6.67
15211.	Rod_Regus (rod_regus)	15	78.47	87.83	1	6.67
15212.	Rick (rickthetyper)	15	107.66	141.38	4	26.67
15213.	Yuzu (rice_senpai)	15	89.77	102.46	4	26.67
15214.	RiceBOI111 (riceboi111)	15	103.98	128.26	9	60.00
15215.	Ren (renrob13)	15	115.47	132.15	12	80.00
15216.	Rashad (rashad19)	15	64.22	76.51	4	26.67
15217.	wy (randumbtyper)	15	141.49	160.75	13	86.67
15218.	Ryan (raisonfire)	15	97.84	112.90	9	60.00
15219.	nic (rainbowarsenal)	15	104.51	130.97	6	40.00
15220.	Type (racer4587)	15	62.05	92.43	4	26.67
15221.	Cute (rabbit4549)	15	82.22	99.80	4	26.67
15222.	R1ng (r1ng)	15	85.23	103.94	4	26.67
15223.	一向 (quan72io)	15	90.39	99.81	7	46.67
15224.	Fadhil (qazsxdcfv)	15	89.52	111.85	7	46.67
15225.	Pustinek (pustinek)	15	44.39	50.07	1	6.67
15226.	punished buster (punishedbu...	15	78.65	89.42	4	26.67
15227.	pemba (pttpemba)	15	51.69	65.83	2	13.33
15228.	Psychism (psychism)	15	95.19	128.84	7	46.67
15229.	Gregory (prosher)	15	52.33	57.16	1	6.67
15230.	Yut (poominb)	15	83.04	94.71	3	20.00
15231.	Doug (pontiacbandit)	15	73.75	83.23	3	20.00
15232.	Pomochko (pomochko)	15	66.75	83.92	1	6.67
15233.	Tommy (pnkflwrs)	15	88.32	102.25	6	40.00
15234.	Phillip (pjeong3120)	15	96.52	108.72	5	33.33
15235.	Pirapat (pirapatqwe)	15	95.03	114.25	5	33.33
15236.	pintoa (pintoa)	15	85.29	98.73	5	33.33
15237.	Arjun (pikabell)	15	61.46	80.30	3	20.00
15238.	Pieces (pieces08)	15	70.49	76.77	7	46.67
15239.	Hugo (phudgestuff)	15	61.95	72.18	3	20.00
15240.	Phoebo (phooboo)	15	69.57	88.31	4	26.67
15241.	Pearl (pearlescent)	15	121.59	137.60	10	66.67
15242.	patztablook22 (patztablook22)	15	83.83	95.97	5	33.33
15243.	panacotta (panacotta)	15	101.58	114.35	6	40.00
15244.	Olaf (p1stachiofurioso)	15	124.79	137.77	7	46.67
15245.	B (p1geonkid)	15	49.35	56.50	2	13.33
15246.	Krisjanis (overcastace332)	15	88.50	104.05	5	33.33
15247.	fastboi (ooofooo)	15	85.07	96.79	3	20.00
15248.	Isla (oodley)	15	64.83	75.61	5	33.33
15249.	Muhammad Omar (omar_farooq)	15	68.40	80.53	3	20.00
15250.	Omar El-Farouk (omarelfarou...	15	51.00	60.30	4	26.67
15251.	ollir (ollir)	15	99.70	107.53	9	60.00
15252.	Oleg (oleg20111511)	15	77.84	91.21	3	20.00
15253.	m (ogtong)	15	92.81	101.85	4	26.67
15254.	Ogatinasu (ogatinasu)	15	56.73	71.25	5	33.33
15255.	obsidianical (obsidianical)	15	70.17	95.54	3	20.00
15256.	Tobi (obiaas)	15	96.46	108.49	6	40.00
15257.	Zoya (noximy)	15	37.44	49.61	1	6.67
15258.	Nini (notthedestroyer)	15	58.39	69.36	2	13.33
15259.	(nonquit)	15	148.28	166.20	13	86.67
15260.	noman (noman121)	15	39.03	52.42	5	33.33
15261.	Ashraful (noid621376)	15	70.79	86.65	5	33.33
15262.	Noah (noahc3)	15	108.36	119.54	4	26.67
15263.	Nift (niviman)	15	107.36	120.40	7	46.67
15264.	Vinh (ninjapro)	15	75.90	92.57	7	46.67
15265.	Nicolas (nick4652)	15	97.41	113.93	10	66.67
15266.	Zoran (newslowkeyboard)	15	129.48	148.30	11	73.33
15267.	Neko (nekonekokneecaps)	15	93.31	104.32	9	60.00
15268.	Nathan (nathanv)	15	96.62	113.67	4	26.67
15269.	Miracle- (nakatsumiuchiha)	15	70.62	83.42	2	13.33
15270.	Nabil (nabilmuafa)	15	71.26	84.26	4	26.67
15271.	MusicSounds (musicsounds)	15	103.96	125.62	5	33.33
15272.	Mubashar (mubashar_javed)	15	69.37	85.27	5	33.33
15273.	Kirill (mr_beer)	15	46.95	49.72	0	0.00
15274.	פלסטין חופשית (...	15	102.60	114.75	6	40.00
15275.	Marc (mrives)	15	49.99	56.43	2	13.33
15276.	Mr. (mrdayton)	15	61.91	72.87	11	73.33
15277.	Gaurav (moodcode)	15	56.17	68.33	3	20.00
15278.	mt. (monthon993)	15	64.41	70.75	4	26.67
15279.	Justin (moneybagg)	15	67.48	76.20	4	26.67
15280.	Joshua (mochi0607)	15	94.64	121.34	8	53.33
15281.	foenem (mkmares_qwerty)	15	80.99	96.05	3	20.00
15282.	Mistey (mistey)	15	124.86	145.31	14	93.33
15283.	mir (mir_rahat)	15	43.79	50.13	3	20.00
15284.	mirlan (mirlanbek)	15	23.89	30.07	1	6.67
15285.	James (mirdan)	15	81.78	101.64	3	20.00
15286.	Mipow (mipow_kun)	15	62.09	70.62	6	40.00
15287.	Pisser (minsuk7)	15	98.01	110.97	7	46.67
15288.	Deepta (mind_palace)	15	73.12	82.66	2	13.33
15289.	miles (milesgreensmith)	15	82.69	92.83	3	20.00
15290.	Miles (milesgendreau)	15	87.38	108.00	5	33.33
15291.	milan (milansep27)	15	100.59	115.28	14	93.33
15292.	lou (mikubeez)	15	108.65	120.68	3	20.00
15293.	Miguel (miguelkristian)	15	92.78	101.84	3	20.00
15294.	Mayth (melvinmelgar)	15	53.84	60.90	0	0.00
15295.	Erik (mcmanerik)	15	53.63	60.87	1	6.67
15296.	Mateusz (matusz019)	15	67.05	80.46	6	40.00
15297.	tstats[mattinaglass] (matti...	15	68.19	89.61	4	26.67
15298.	Marshall (marshallmaofr)	15	108.39	127.06	8	53.33
15299.	Zheng_Dao (marmot0814)	15	87.22	104.07	5	33.33
15300.	Marlon (marlondestroyer)	15	92.44	101.71	4	26.67
15301.	Marley (marley)	15	99.27	105.63	6	40.00
15302.	Malik (madx)	15	71.33	78.46	5	33.33
15303.	MrDiRamio (madiramio)	15	97.27	108.46	9	60.00
15304.	racemaster (madcodez)	15	47.42	53.74	0	0.00
15305.	Jose (lupi1)	15	64.95	72.81	2	13.33
15306.	RJ (lufulu)	15	105.81	130.68	8	53.33
15307.	lucktale (lucktale)	15	92.04	127.67	3	20.00
15308.	Good Vibe Tribe (lucas_lm)	15	86.30	101.09	7	46.67
15309.	_l.y.m.y_ (loyehmoyeh)	15	64.09	75.44	4	26.67
15310.	loow (loowt)	15	59.47	72.54	2	13.33
15311.	lorenzo (lolloz98)	15	69.51	77.39	3	20.00
15312.	Shan (liushanen)	15	87.38	97.44	4	26.67
15313.	Lisa (lissandra)	15	72.39	88.48	11	73.33
15314.	andrey (linus01)	15	33.48	42.38	0	0.00
15315.	Joel (lil_wheeelz)	15	65.85	78.92	15	100.00
15316.	Isaac (libstwo)	15	60.30	73.62	3	20.00
15317.	Liam (liamzammit)	15	56.40	66.78	0	0.00
15318.	Leith (leith_)	15	75.38	95.65	12	80.00
15319.	Kai (leavelux)	15	88.23	99.67	8	53.33
15320.	Dylan (lavafxlx)	15	61.52	80.05	12	80.00
15321.	lastofspades (lastofspades)	15	137.26	150.45	11	73.33
15322.	Wade (larrage)	15	95.06	114.71	4	26.67
15323.	kym (kym2006)	15	104.97	123.81	12	80.00
15324.	kward937 (kward937)	15	80.34	95.99	4	26.67
15325.	Kellan (krusher7)	15	62.41	71.72	2	13.33
15326.	Kris (kris_z)	15	119.57	141.02	6	40.00
15327.	kostasss (kostasss)	15	43.12	54.86	2	13.33
15328.	KOOKOWACKYDUCK (kookowackyd...	15	83.86	101.48	6	40.00
15329.	Keziah (kookiru)	15	100.89	116.46	7	46.67
15330.	Honda (konradowtf)	15	63.08	72.29	3	20.00
15331.	Katherine (kleesaunders)	15	101.41	127.75	3	20.00
15332.	Chris (kiousaras13)	15	73.83	92.21	6	40.00
15333.	Phillip (kinkking123)	15	70.99	92.41	6	40.00
15334.	Wil (kingwilyn)	15	56.33	68.50	3	20.00
15335.	Dominik (killersshark)	15	57.29	65.49	4	26.67
15336.	bc (kilk3)	15	88.52	105.55	4	26.67
15337.	Ian (kfcdonutsandwich)	15	93.61	112.84	4	26.67
15338.	Edwin (keyhem_)	15	65.48	75.19	4	26.67
15339.	Kevin (kev011701)	15	110.86	126.85	10	66.67
15340.	Ken (keni98)	15	84.82	99.92	5	33.33
15341.	Kelsey (kelseysd)	15	82.21	111.16	7	46.67
15342.	kelian (kekelian)	15	62.25	68.11	3	20.00
15343.	Justin (keehyu)	15	102.20	113.59	9	60.00
15344.	kynght (kd1157)	15	83.49	102.90	4	26.67
15345.	kchou (kchou0907)	15	73.20	87.02	0	0.00
15346.	grace (katrvey)	15	81.41	95.61	2	13.33
15347.	John (karmetier)	15	89.03	108.25	5	33.33
15348.	Weeee (k1ngsman)	15	104.67	123.31	6	40.00
15349.	Jão (jumamjir)	15	42.56	50.04	1	6.67
15350.	jserv23 (jserv23)	15	106.71	115.91	9	60.00
15351.	poopy (joyuri)	15	99.23	125.37	7	46.67
15352.	Josh (joshcantypefast)	15	112.65	140.89	13	86.67
15353.	qqingcheng! 3 (jorjoresp)	15	95.56	109.29	5	33.33
15354.	josh (jojothebear03)	15	52.98	62.29	4	26.67
15355.	Joe (joe_1)	15	114.15	128.02	9	60.00
15356.	Joel (joelthesuperior)	15	128.21	150.94	6	40.00
15357.	jlsyber (jlsyber)	15	84.90	98.26	6	40.00
15358.	James (jlightning)	15	91.11	100.22	5	33.33
15359.	Joshua (jkm711)	15	70.66	86.53	3	20.00
15360.	Jim (jimvang8790)	15	72.70	79.05	4	26.67
15361.	Logan (jimmybiscuit39)	15	56.25	68.32	3	20.00
15362.	Jiezlin (jiezlin)	15	61.00	68.52	3	20.00
15363.	jeshen (jeshencx)	15	78.43	93.04	4	26.67
15364.	Jelmer (jelmerevers)	15	92.79	107.77	5	33.33
15365.	Jamie (jelly_jam_pudding)	15	75.75	94.00	4	26.67
15366.	Jeff (jeff_1107)	15	70.32	84.71	2	13.33
15367.	Jay (jayl2303)	15	103.23	122.89	6	40.00
15368.	BigJuicySlimy (javewave)	15	79.12	89.09	4	26.67
15369.	Jason (jasonpike)	15	90.26	98.80	1	6.67
15370.	poon (jamiepoon2003)	15	78.25	85.76	5	33.33
15371.	James (jamesmz_101)	15	28.16	35.49	0	0.00
15372.	JKerb (jakerb19)	15	77.43	97.77	5	33.33
15373.	`jakeeee_ (jakee_)	15	99.94	123.41	7	46.67
15374.	Long Double E.T. (jackje)	15	96.31	116.62	6	40.00
15375.	not (j097)	15	70.68	86.55	3	20.00
15376.	iStealCatNips (i_steal_cat_...	15	64.24	84.66	1	6.67
15377.	Joey (itzjoeyz)	15	93.56	114.66	5	33.33
15378.	Its (itslexemic)	15	61.72	75.78	10	66.67
15379.	justin (itsjustinz)	15	81.80	94.75	6	40.00
15380.	Brandon (itsbarn)	15	74.66	90.19	1	6.67
15381.	John (ionas22)	15	33.56	38.67	2	13.33
15382.	banana (intrepid_banana)	15	101.12	119.10	8	53.33
15383.	Laughing Fox (inkeet)	15	73.61	82.93	6	40.00
15384.	Its Me (infinityyt)	15	87.35	107.34	8	53.33
15385.	Inactiv (inactivak)	15	93.55	105.06	4	26.67
15386.	[SCC] Ignis (ignis_sphaera)	15	108.78	120.83	7	46.67
15387.	Robby (icybot)	15	92.04	106.11	7	46.67
15388.	Salvador (ick1salvado)	15	61.88	71.80	3	20.00
15389.	iamyellowhead (iamyellowhead)	15	65.68	81.44	8	53.33
15390.	H_24 (h_24)	15	81.80	105.70	3	20.00
15391.	uy (hygienic)	15	74.20	81.17	1	6.67
15392.	Howard (hwd15508)	15	113.25	134.39	11	73.33
15393.	Nothing (humblepikachu)	15	76.59	94.32	7	46.67
15394.	ben (hobomojo)	15	70.42	82.91	5	33.33
15395.	d (hirundinidae)	15	122.08	138.62	12	80.00
15396.	Abood (hirotto)	15	49.40	59.27	1	6.67
15397.	Henry (henry88k)	15	67.03	76.77	3	20.00
15398.	Henrricos (henrricos)	15	88.67	102.35	3	20.00
15399.	henlojav (henlojav)	15	93.97	111.40	8	53.33
15400.	Harrisandman (harrisandman)	15	66.27	81.69	8	53.33
15401.	Hannah (hann5h)	15	138.88	157.75	10	66.67
15402.	Jack (handsomejam)	15	100.79	114.51	6	40.00
15403.	Haley (halllw)	15	59.10	72.13	6	40.00
15404.	Habib (habibjajawie)	15	105.94	125.85	9	60.00
15405.	h1b80xwl0g1c (h1b80xwl0g1c)	15	47.64	51.18	1	6.67
15406.	Gustavo da Cruz (gustavodac...	15	94.93	123.27	6	40.00
15407.	s (gurub)	15	78.41	109.93	5	33.33
15408.	typingmonster (greenmonster...	15	95.78	107.97	8	53.33
15409.	Vitor (graysheep)	15	54.52	69.52	1	6.67
15410.	Jake (gooserman)	15	73.54	86.44	3	20.00
15411.	Sishir (goon72)	15	83.65	88.36	4	26.67
15412.	Cameron (goldenpenguin)	15	65.77	77.11	3	20.00
15413.	giann (giannperez123)	15	115.00	124.24	7	46.67
15414.	Bahador (ghostnod)	15	104.65	115.18	8	53.33
15415.	Aasish (ghisingo)	15	48.12	56.37	6	40.00
15416.	Siegward (ghin)	15	91.20	112.18	13	86.67
15417.	Marius (ghebu)	15	107.31	131.63	9	60.00
15418.	Genius (genius0teacher)	15	49.32	63.60	12	80.00
15419.	Meagan (gazzoo)	15	103.96	129.02	8	53.33
15420.	peepee (gamerlegion)	15	97.55	112.48	8	53.33
15421.	Gabriel (gabrielvi111)	15	69.87	80.28	1	6.67
15422.	Xuan Thong (fxcvs)	15	59.27	71.21	6	40.00
15423.	funss (funss)	15	71.61	85.11	1	6.67
15424.	Funday (funday11best)	15	71.79	87.42	12	80.00
15425.	Fudl (fudl)	15	53.11	65.49	2	13.33
15426.	veryfatman (frankknight23)	15	84.06	101.27	5	33.33
15427.	Forehead (foreheadq)	15	81.56	96.02	7	46.67
15428.	flashy (flashy1996)	15	80.60	90.19	6	40.00
15429.	J (fingerbanger96)	15	64.86	75.83	6	40.00
15430.	Matyi (filepmatyi)	15	71.40	83.46	3	20.00
15431.	Madi (fastcoder05)	15	47.12	53.16	0	0.00
15432.	farzi (farzi)	15	27.95	33.76	0	0.00
15433.	J (falsekrakk808)	15	101.84	119.18	7	46.67
15434.	sasd (fallenlarry)	15	84.76	104.10	7	46.67
15435.	Faizan Ali (faizanii)	15	45.20	58.41	2	13.33
15436.	facenne (facenne)	15	92.64	110.25	7	46.67
15437.	Ezektor (ezecktor)	15	91.70	110.60	4	26.67
15438.	Exab (exab)	15	54.28	65.26	6	40.00
15439.	Evan (evang12)	15	108.35	127.03	6	40.00
15440.	Juhair (error6251)	15	58.40	64.62	0	0.00
15441.	Erekle (erekle7)	15	53.75	63.12	1	6.67
15442.	Tran (envyriviere)	15	83.63	91.60	3	20.00
15443.	ben (enivre)	15	57.54	73.46	2	13.33
15444.	Paula (ems1324)	15	51.61	59.01	4	26.67
15445.	emre (emrevlog)	15	72.35	82.38	4	26.67
15446.	Matthew (emen_)	15	79.66	96.68	14	93.33
15447.	ElVash (elvash)	15	72.27	86.84	6	40.00
15448.	good (elquines4)	15	104.31	127.97	7	46.67
15449.	Ellie (ellie_mp3)	15	57.09	65.26	1	6.67
15450.	Lise (elishevah)	15	91.86	104.53	9	60.00
15451.	Eli (elijahbu)	15	86.67	97.68	5	33.33
15452.	Elgrekost (elgrekost)	15	68.17	81.63	13	86.67
15453.	elaine (elainezhu)	15	117.72	130.56	10	66.67
15454.	Ethan (ecannoy)	15	105.65	115.28	8	53.33
15455.	aurora (e4monn)	15	114.26	132.85	11	73.33
15456.	drew (drewg2009)	15	87.41	103.29	5	33.33
15457.	DreamCat04 (dreamcat04)	15	43.47	50.37	3	20.00
15458.	dbarr (drbarr)	15	44.04	52.90	2	13.33
15459.	Vincent (doogley)	15	56.90	64.03	5	33.33
15460.	Ali (donlafi)	15	57.18	62.64	3	20.00
15461.	I really like lettuce (domi...	15	99.42	117.13	8	53.33
15462.	dom (domaniquepham)	15	79.52	96.00	6	40.00
15463.	Eddie (diettea)	15	93.84	122.22	4	26.67
15464.	Geraldine (dendenmuushi)	15	40.23	49.05	1	6.67
15465.	Dankman (dedankman)	15	99.76	112.53	5	33.33
15466.	Davis (davis10)	15	61.09	76.07	4	26.67
15467.	David (davidliu323)	15	117.62	135.93	7	46.67
15468.	tstats[darkhat13] (darkhat13)	15	91.96	114.60	6	40.00
15469.	dapho (dapho)	15	73.07	98.05	12	80.00
15470.	Daniel (danrike22)	15	58.88	70.13	0	0.00
15471.	Dan (dankarnus)	15	67.82	79.85	2	13.33
15472.	Dawid (dadik)	15	64.35	75.96	5	33.33
15473.	Daniel (d4mage2k)	15	94.12	108.68	9	60.00
15474.	Ethan (creamycanoli)	15	98.92	126.26	6	40.00
15475.	Peter (crazynumnums)	15	95.17	109.38	9	60.00
15476.	Chris (craastad)	15	82.01	93.16	4	26.67
15477.	Konrad (cornyflakez)	15	93.88	105.85	8	53.33
15478.	Matías (colocolo91)	15	85.24	94.37	4	26.67
15479.	Thomas (coasterman)	15	86.46	100.56	5	33.33
15480.	sheik (clubs_)	15	82.29	104.20	7	46.67
15481.	Alex (citricdolphin)	15	102.34	115.84	7	46.67
15482.	christian (chriz411)	15	85.72	97.46	6	40.00
15483.	Christian (christian_oudard)	15	98.57	117.46	6	40.00
15484.	Chinsetgel (chinsetgel_mgl_3)	15	62.89	72.51	1	6.67
15485.	Chili (chilichonga)	15	63.67	73.30	2	13.33
15486.	Caine (cainegt)	15	78.83	88.48	3	20.00
15487.	Ivan (cactus9800)	15	47.98	53.65	0	0.00
15488.	Meme Page (butsuky)	15	106.06	117.46	11	73.33
15489.	B (btype123)	15	121.53	135.16	10	66.67
15490.	Bryan (bryan675)	15	123.99	145.33	12	80.00
15491.	Bruno (brunokoppel)	15	76.52	94.22	5	33.33
15492.	Bruh (bruh432)	15	104.37	117.80	9	60.00
15493.	brainuser5705 (brainuser5705)	15	89.72	101.72	4	26.67
15494.	Ash (boyfromindia)	15	69.88	88.55	7	46.67
15495.	E (boxofpaints)	15	68.84	73.20	6	40.00
15496.	Joe (bot_joe)	15	85.22	92.19	4	26.67
15497.	BobTuring (bobturing)	15	81.43	106.07	10	66.67
15498.	Bob (bobtyping)	15	78.09	83.84	2	13.33
15499.	Black (blackt)	15	63.33	69.68	7	46.67
15500.	chan (blackstarnova)	15	119.99	136.45	11	73.33
15501.	Krissz (bish1k)	15	91.64	102.81	5	33.33
15502.	Bean (benchen123)	15	91.31	101.10	7	46.67
15503.	bella (beliss08)	15	55.47	63.96	1	6.67
15504.	bee (bee0)	15	112.76	138.95	14	93.33
15505.	bart (bartfart)	15	84.88	92.08	3	20.00
15506.	bantan (bantan)	15	94.79	103.12	9	60.00
15507.	AJ (bacon_is_life)	15	89.07	102.50	6	40.00
15508.	Jacob (a_cheesy_wotsit)	15	85.86	114.16	5	33.33
15509.	Aztixz (aztix)	15	71.04	79.30	4	26.67
15510.	ayumu (ayumuxe)	15	82.22	94.62	12	80.00
15511.	Alex (aymlus)	15	91.36	105.05	6	40.00
15512.	Sean (axelsandrods)	15	64.69	78.91	4	26.67
15513.	awalvie (awalvie)	15	80.32	94.93	4	26.67
15514.	Asif ur rahman (asif_ur_rah...	15	44.83	56.60	2	13.33
15515.	Rimuru (ashborn_tempest)	15	75.66	88.56	3	20.00
15516.	Chris (aschlar)	15	88.09	119.53	3	20.00
15517.	Arzenith (arzou)	15	75.16	91.02	9	60.00
15518.	Aria (aria_3_)	15	51.16	65.06	3	20.00
15519.	Arian (ariankazemi)	15	35.99	40.97	0	0.00
15520.	arachnodactyly (arachnodact...	15	72.91	82.82	0	0.00
15521.	Chris (angoril)	15	56.82	67.46	4	26.67
15522.	Ele (anemoia)	15	105.68	119.62	5	33.33
15523.	Anel (anelbeads)	15	87.26	104.19	6	40.00
15524.	André (andrepascoa)	15	102.35	111.19	8	53.33
15525.	Anna (ana2007)	15	49.25	60.41	2	13.33
15526.	Amr (amrstien)	15	63.08	74.55	3	20.00
15527.	Ameen (ameen_a21)	15	66.31	80.24	2	13.33
15528.	LolipopAlexx (amazingskep_1)	15	63.89	75.35	3	20.00
15529.	AL1 (al1_16)	15	93.96	109.87	5	33.33
15530.	Akshy (akshy)	15	67.30	81.54	5	33.33
15531.	AjTopper (ajtopper)	15	40.19	47.31	0	0.00
15532.	AJamal31 (ajamal31)	15	79.43	107.30	5	33.33
15533.	austin (aiven)	15	72.52	79.62	5	33.33
15534.	Aidan (aidanmccomsey)	15	108.00	129.23	6	40.00
15535.	joe (aidanbbm)	15	59.08	72.05	0	0.00
15536.	yan (ahugedistraction)	15	88.51	104.30	7	46.67
15537.	Aeiphera (aeiphera)	15	107.33	120.90	6	40.00
15538.	Adam (adamrocks21)	15	56.67	62.33	2	13.33
15539.	Abu (abushakeeb)	15	93.99	108.19	5	33.33
15540.	Abe (abefqy)	15	83.74	116.82	6	40.00
15541.	Abdul Rafay (abdulpak)	15	39.64	47.44	2	13.33
15542.	Eric (20wpmboi)	15	63.31	74.55	3	20.00
15543.	Free Israel (1ocaltechsuppor1)	15	44.28	50.02	2	13.33
15544.	Gabe (115162382)	15	91.64	105.36	7	46.67
15545.	LilJabari (yesitsngo)	15	54.56	65.41	2	13.33
15546.	Sorrow (sorrow_da)	15	45.86	57.47	3	20.00
15547.	Julius (jus_kidding)	15	57.31	73.38	2	13.33
15548.	Brian (brianprs)	15	85.49	98.13	4	26.67
15549.	Gandalf (gandalfthefast)	15	58.89	68.53	2	13.33
15550.	Loan (loanvx)	15	96.33	120.43	5	33.33
15551.	Adam (ska_)	15	81.42	92.89	3	20.00
15552.	Nymeria (nymeria37)	15	93.15	114.05	4	26.67
15553.	David (completedark)	15	84.33	95.74	9	60.00
15554.	Zalabany (zalabany)	15	41.47	51.35	1	6.67
15555.	Yo (yo111)	15	60.15	75.55	4	26.67
15556.	Sam (samr7x7)	15	83.72	95.19	8	53.33
15557.	Rohit (roohitdagar)	15	40.60	48.06	1	6.67
15558.	近平 (trash_game)	15	34.56	40.11	0	0.00
15559.	Jul (happypig2)	15	87.95	104.04	5	33.33
15560.	Dr.Gliscor (drgliscor)	15	56.98	70.53	13	86.67
15561.	ketchup (rawmeatball)	15	104.41	128.96	8	53.33
15562.	captain (fegit)	15	82.87	93.20	3	20.00
15563.	VixenxD (vixenxd)	15	77.80	96.27	5	33.33
15564.	David (chopstick88)	15	73.01	96.13	2	13.33
15565.	josef (cthulhuz)	15	83.08	100.72	7	46.67
15566.	Matthew (mattscabrera)	15	106.64	129.01	9	60.00
15567.	irfan (irfankia)	15	44.50	59.88	7	46.67
15568.	Maddie (massivetrash)	15	73.08	91.05	7	46.67
15569.	Abass (abassali092)	15	52.64	62.25	3	20.00
15570.	Ollie (sherwoodoj)	15	77.47	96.15	3	20.00
15571.	Wenexx (wenexx)	15	75.70	100.13	5	33.33
15572.	Kipen (kipenjago)	15	68.28	78.18	7	46.67
15573.	Dhia (dhiadbh)	15	43.25	57.90	1	6.67
15574.	jlordo (jlordo)	15	91.36	105.98	5	33.33
15575.	Oscar (kull)	15	49.25	58.74	2	13.33
15576.	Laurence (beala_)	15	40.10	51.53	0	0.00
15577.	Andrew (andrew_00)	15	76.24	89.18	4	26.67
15578.	Hanan (sourc)	15	76.75	87.11	5	33.33
15579.	tstats[blosh] (blosh)	15	65.98	76.73	5	33.33
15580.	Adam (secondbesttyper)	15	70.73	83.60	6	40.00
15581.	Neil (bruvm8)	15	46.67	59.07	1	6.67
15582.	Hadouken (hadouken37)	15	94.57	110.70	7	46.67
15583.	Johnnyphan2009 (johnnyphan)	15	89.22	104.70	1	6.67
15584.	Vaibhav (kabir4991)	15	75.90	85.32	2	13.33
15585.	karim (karim32ar3)	15	67.61	80.26	0	0.00
15586.	Christopher (chubbzlyfe)	15	64.43	84.13	1	6.67
15587.	Mika (69ftlongshlong)	15	44.10	52.01	0	0.00
15588.	Rajat (rajat_maurya)	15	87.12	99.11	6	40.00
15589.	Hưng (whathe)	15	46.55	58.50	2	13.33
15590.	puggichu (puggichu)	15	78.40	91.69	5	33.33
15591.	friggy (friggy0000)	15	49.48	63.96	1	6.67
15592.	David (tracreed)	15	71.92	88.55	6	40.00
15593.	Samuel (sgpthomas)	15	90.99	111.34	1	6.67
15594.	cmc (codemastercpp)	15	76.92	91.39	4	26.67
15595.	Aryaman (typist1027)	15	82.26	93.37	8	53.33
15596.	Samuel (sammm274)	15	71.21	87.09	1	6.67
15597.	Azim (khalilovdev)	15	35.10	39.14	9	60.00
15598.	Vincenzo (_a_j_)	15	38.26	45.20	3	20.00
15599.	bassic (sakshambassi)	15	48.62	58.19	3	20.00
15600.	demonphase (ebullience)	15	68.29	82.12	1	6.67
15601.	.-. (peoplemaypee)	15	46.37	54.10	6	40.00
15602.	char (wormgirl)	15	80.66	98.03	6	40.00
15603.	D (derniee)	15	85.10	93.35	5	33.33
15604.	Thuuuuuun (thundertsun1)	15	89.71	109.70	4	26.67
15605.	Spect (spect3d)	15	81.93	101.63	6	40.00
15606.	Raven (raven_wong)	15	44.67	52.78	2	13.33
15607.	No (lexblaster)	15	30.53	34.76	1	6.67
15608.	Bhavita Pareshbhai Nakum (b...	15	60.77	84.95	3	20.00
15609.	Betsy (tiddy8bricks)	15	56.51	65.37	3	20.00
15610.	Mike (plane_crash)	15	52.82	62.14	0	0.00
15611.	poli team! (politeam)	15	49.32	60.31	0	0.00
15612.	sdmlkdasm (kilcklack)	15	45.60	49.95	0	0.00
15613.	Daryl (lyradd)	15	69.91	94.68	4	26.67
15614.	Davide Antonio (tamah11)	15	77.11	88.61	6	40.00
15615.	Tren (_tren)	14	76.78	89.28	4	28.57
15616.	Rishi (_slow_typer)	14	72.26	87.07	3	21.43
15617.	zreem (zreem)	14	57.46	90.96	0	0.00
15618.	Zoe (zoi77)	14	79.36	98.83	4	28.57
15619.	slow stinky balls (znerwill...	14	118.18	127.84	4	28.57
15620.	Zhavokhir (zhav0kh1r)	14	59.14	74.62	8	57.14
15621.	Zeraphim (zeraphim)	14	97.74	109.31	3	21.43
15622.	Zephyr (zephyrkai)	14	111.48	121.24	8	57.14
15623.	Zachary (zachary3352)	14	102.65	119.61	9	64.29
15624.	yal (yyal)	14	95.71	118.89	6	42.86
15625.	Yousef (yusopro)	14	64.35	69.72	7	50.00
15626.	PeteJai (yupuiho)	14	47.47	57.47	0	0.00
15627.	Justin (yummy_spin05)	14	58.51	67.48	2	14.29
15628.	*You're (yourmumlikesmytyping)	14	49.49	57.54	0	0.00
15629.	Nikki (yip14)	14	47.61	52.15	2	14.29
15630.	QLONA 🥵 (yeyas)	14	100.86	126.92	5	35.71
15631.	Jordan White (yepple_)	14	67.86	86.94	4	28.57
15632.	Ossi (xyeet)	14	123.84	138.78	8	57.14
15633.	Charles (xx_white_racer_xx)	14	102.21	117.92	6	42.86
15634.	Adam (xuxiym)	14	134.62	158.63	12	85.71
15635.	juicebox (xsolstice)	14	93.83	111.36	4	28.57
15636.	xinhui (xinhuixu)	14	46.69	50.57	4	28.57
15637.	bigman (xdbigman)	14	73.82	86.91	7	50.00
15638.	Jast (xcess0000)	14	34.88	44.40	3	21.43
15639.	Kael (wshuwshuwshi)	14	87.19	97.01	4	28.57
15640.	wRadion (wradion)	14	109.63	129.61	6	42.86
15641.	Wonder (wonderjaxe)	14	49.60	60.57	1	7.14
15642.	XOR_ (wisetoad)	14	96.52	114.87	7	50.00
15643.	willy (willywongker69)	14	86.17	99.23	3	21.43
15644.	WIll (wiillikeer)	14	62.54	70.44	12	85.71
15645.	whuwxl (whuwxl)	14	55.27	60.98	2	14.29
15646.	wantingpawer (wantingpawer)	14	100.81	120.30	8	57.14
15647.	vylnf (vylnf213)	14	48.07	53.60	0	0.00
15648.	Cary Zhang (vrozone)	14	99.06	120.67	8	57.14
15649.	Hasibuan (voyager28)	14	63.01	75.61	4	28.57
15650.	Ray (viruz789)	14	110.02	125.55	7	50.00
15651.	Virgin (virginchimp)	14	114.37	147.02	7	50.00
15652.	Vidhu Shikhar (vidhu_joshi)	14	61.65	76.79	3	21.43
15653.	Jodye (vice_pat)	14	63.09	73.20	3	21.43
15654.	vincentius (vgpabm)	14	71.35	83.20	11	78.57
15655.	Vernnamae (vernnamae03)	14	50.54	54.91	1	7.14
15656.	Allergic to (vanillahamster)	14	86.93	111.93	7	50.00
15657.	Van (vanberen)	14	71.18	81.55	6	42.86
15658.	kevin (uwupork)	14	96.23	113.88	8	57.14
15659.	typist (typist149)	14	53.22	64.25	1	7.14
15660.	Diana (typinglover1023)	14	102.98	116.39	8	57.14
15661.	Tom (twrig144)	14	89.38	106.46	5	35.71
15662.	Two (two_toned_69)	14	50.63	57.31	1	7.14
15663.	Trent (twesley20)	14	75.89	82.77	3	21.43
15664.	Charlotte (truest)	14	86.75	101.72	5	35.71
15665.	TripleMean (triplemean)	14	86.48	101.66	8	57.14
15666.	12Ethan! (towelette)	14	93.09	110.14	4	28.57
15667.	Heh (tophatheh)	14	76.65	85.82	3	21.43
15668.	Tom (tomshilling)	14	76.63	100.33	3	21.43
15669.	Tommy (tom441)	14	95.61	107.77	5	35.71
15670.	cock and (tmolls312)	14	83.03	94.81	8	57.14
15671.	Timothy (timothylee)	14	99.48	112.05	5	35.71
15672.	Tilly (tilly14)	14	72.96	88.14	2	14.29
15673.	Karta (thundermoon_911)	14	73.09	85.37	3	21.43
15674.	Ron (thtguyovrthr)	14	104.14	115.39	7	50.00
15675.	Cody (thoutravesty)	14	68.71	78.42	3	21.43
15676.	Thomas (thms_andrsn)	14	56.36	66.63	3	21.43
15677.	NongKao (thisiskao09)	14	44.60	51.80	2	14.29
15678.	the ayo (the_one_and_only_l...	14	64.11	77.97	5	35.71
15679.	Simo (thespeedoflight)	14	106.75	121.83	8	57.14
15680.	David (thedaveed)	14	102.28	124.43	10	71.43
15681.	Alberto (thearod5)	14	78.16	93.92	4	28.57
15682.	Kai (testphylean)	14	100.26	115.06	6	42.86
15683.	Nikolaus (testingcolemak)	14	66.27	78.24	3	21.43
15684.	bob (termina_112)	14	68.97	84.76	8	57.14
15685.	Terence (terence1234567)	14	91.78	104.61	6	42.86
15686.	John (tempocount)	14	110.37	126.93	6	42.86
15687.	Technetium (technetium_)	14	80.34	91.89	5	35.71
15688.	Harry (taytayalldaytay)	14	77.81	88.24	4	28.57
15689.	Taxx (taxx)	14	114.07	133.41	5	35.71
15690.	Tahbro (tahbro)	14	86.22	100.23	5	35.71
15691.	Taco Master (taco989)	14	61.70	69.95	5	35.71
15692.	Jasper (t3sted)	14	78.18	99.78	6	42.86
15693.	t2fast4u (t2fast4u)	14	97.10	122.86	4	28.57
15694.	Shynggyskhan (s_bazarbay)	14	70.05	77.31	4	28.57
15695.	syrianii (syrianii)	14	67.35	77.07	2	14.29
15696.	Sung (sungsangthesong)	14	106.71	125.27	14	100.00
15697.	guy (submer)	14	111.35	133.03	5	35.71
15698.	Kirk (lil_laker)	14	48.06	61.15	3	21.43
15699.	gautam (stupendous_man)	14	38.02	41.02	0	0.00
15700.	stuff423 (stuff423)	14	112.26	126.77	4	28.57
15701.	Sawyer (stmcpherso)	14	68.11	73.44	6	42.86
15702.	G (squasy)	14	92.04	106.02	3	21.43
15703.	Ava (spyder_)	14	56.80	71.70	1	7.14
15704.	Speeder (speeder99)	14	37.87	52.96	0	0.00
15705.	A (spectre_zero)	14	61.60	70.94	2	14.29
15706.	SPACE (spacegamer428)	14	44.58	54.05	2	14.29
15707.	Sour (sourbar)	14	55.71	64.40	2	14.29
15708.	Mitheelesh (sophomania2803)	14	80.41	91.65	7	50.00
15709.	cheruiyot (son_of_man)	14	106.46	122.63	3	21.43
15710.	Burger (somental)	14	63.74	75.80	2	14.29
15711.	Solo (solohan)	14	68.50	78.24	6	42.86
15712.	Simon (soinom)	14	67.45	75.51	7	50.00
15713.	Rahul (snickrdodle)	14	60.65	76.71	1	7.14
15714.	Lenni (smoldepressedboi)	14	61.48	68.65	1	7.14
15715.	Typing (slow_seizure_man)	14	55.44	70.04	3	21.43
15716.	Ben (slouchingstork)	14	60.58	65.30	2	14.29
15717.	chillin (slekap)	14	177.62	218.43	10	71.43
15718.	sleepy (sleeeepy_)	14	62.11	67.65	3	21.43
15719.	Slavic (slavicfedora)	14	102.69	124.13	3	21.43
15720.	A (sir_riot)	14	84.64	97.03	11	78.57
15721.	Isabella (sinnamonroll21)	14	92.31	106.18	6	42.86
15722.	Harpreet (singh_is_king)	14	31.42	38.05	1	7.14
15723.	Smaran (simpilly05)	14	67.30	83.22	3	21.43
15724.	真好玩 (simonhre)	14	69.57	81.40	3	21.43
15725.	David (sidrid)	14	50.50	58.78	1	7.14
15726.	shubham (shubham0007)	14	82.99	97.02	2	14.29
15727.	Shubhi (shoebee)	14	65.59	79.00	6	42.86
15728.	deadend (shiroku)	14	118.13	133.33	9	64.29
15729.	Mister (shiriou)	14	109.13	138.23	9	64.29
15730.	Mouse (shenx)	14	102.50	113.12	8	57.14
15731.	harold (sha_man)	14	47.99	53.10	1	7.14
15732.	Shannen (shannen_04)	14	95.97	107.94	6	42.86
15733.	shakk (shakk612)	14	79.95	97.70	5	35.71
15734.	Slow мΘşħΞ alt (shadow...	14	113.60	133.21	9	64.29
15735.	Donn (seabase)	14	39.38	50.03	0	0.00
15736.	Dustin (sdustink)	14	87.17	100.05	7	50.00
15737.	sdatta (sdatta)	14	73.40	86.28	3	21.43
15738.	. (scorae)	14	70.57	82.44	2	14.29
15739.	gamig (schleepy_boye)	14	68.88	82.06	2	14.29
15740.	Savv (savvey)	14	64.75	70.45	2	14.29
15741.	samy (samy_)	14	63.38	70.66	2	14.29
15742.	Salad (saladspoon)	14	90.99	102.84	6	42.86
15743.	Saj (saji652)	14	74.08	88.00	2	14.29
15744.	Safwan (safwanislam111)	14	73.17	80.91	3	21.43
15745.	saba (saba_on_mentos)	14	51.83	66.27	1	7.14
15746.	Saad (saad_mohammed7)	14	67.24	81.95	4	28.57
15747.	Saad Ahmed (saadahmed12858)	14	55.57	63.93	2	14.29
15748.	Will (r_u_sure)	14	101.49	113.88	5	35.71
15749.	Ryusei (ryu_525)	14	52.54	63.11	2	14.29
15750.	SheLuvRui (rushabh161)	14	109.39	118.57	7	50.00
15751.	rachel (rsimonton94)	14	97.15	114.78	4	28.57
15752.	rozetina (rozetina)	14	108.46	139.41	7	50.00
15753.	Roman (romaje_)	14	97.81	116.62	7	50.00
15754.	Roi (roi1255)	14	62.42	69.74	3	21.43
15755.	Robin (robaxtom)	14	74.03	86.61	5	35.71
15756.	RIJU (rijuthetyper)	14	65.82	74.91	4	28.57
15757.	Ryan (ricenoodles01)	14	88.75	125.63	4	28.57
15758.	Rexoblob (rexoblob)	14	76.75	85.95	2	14.29
15759.	rengmain (rengmain)	14	111.67	129.03	13	92.86
15760.	itypeforbyron (remez)	14	82.84	95.44	2	14.29
15761.	Reigina (reiginayari)	14	88.49	105.06	4	28.57
15762.	Redsteel (redsteel87)	14	83.25	105.24	2	14.29
15763.	Alex (rednaxt)	14	114.07	129.29	4	28.57
15764.	Caal (recumbent)	14	84.11	97.48	2	14.29
15765.	rdx (rdxx)	14	78.69	89.55	5	35.71
15766.	Raphael (razmataz99)	14	125.46	168.56	6	42.86
15767.	raymond (raymondrazer)	14	88.26	107.88	3	21.43
15768.	ray16k (ray16k)	14	133.09	146.29	10	71.43
15769.	Jona (ravioli_cheesecake12)	14	59.96	72.73	0	0.00
15770.	Rany (rany_games)	14	61.27	76.12	6	42.86
15771.	ramennoodles924 (ramennoodl...	14	87.19	108.40	3	21.43
15772.	reactor2 (rakesh_singh)	14	89.36	105.61	6	42.86
15773.	tstats[rajendra_thakur] (ra...	14	51.62	60.27	0	0.00
15774.	rk2699 (radhu)	14	74.04	87.00	2	14.29
15775.	Michael (raczcar)	14	92.98	110.39	6	42.86
15776.	Yeji (racket_21)	14	58.69	68.31	4	28.57
15777.	Patrick (pzuknome)	14	123.80	140.23	6	42.86
15778.	Puymieyches (puymieyches)	14	82.23	94.20	3	21.43
15779.	Iliyan (proto0o)	14	82.64	93.69	3	21.43
15780.	praxZ (praxz)	14	114.30	131.11	6	42.86
15781.	Mae (practice_type)	14	60.75	71.19	2	14.29
15782.	ptt (potatodogg)	14	111.20	126.51	8	57.14
15783.	Logan (postlogan)	14	90.57	109.04	6	42.86
15784.	Nameless (plot_da_pro)	14	56.55	66.67	8	57.14
15785.	Phle (plegethas)	14	67.05	73.91	1	7.14
15786.	Mike (pit820)	14	81.30	101.90	7	50.00
15787.	Pidguit (pidguit)	14	97.23	112.03	5	35.71
15788.	TypeBot (phycer)	14	96.91	110.97	5	35.71
15789.	Martynas (peepeeman42069)	14	81.81	94.51	10	71.43
15790.	Pana (pana_miguel)	14	83.27	100.01	5	35.71
15791.	paco (pacowaco)	14	73.40	80.99	8	57.14
15792.	i cant type (o_o_f)	14	110.28	136.86	8	57.14
15793.	Clicky (ottoble)	14	66.75	77.79	1	7.14
15794.	James (otes10)	14	63.36	71.53	1	7.14
15795.	Will (orketscience)	14	40.16	45.21	0	0.00
15796.	Justin (orccrusher99)	14	75.25	91.81	1	7.14
15797.	hayde (oofba)	14	101.40	118.87	8	57.14
15798.	Omkar (omkardalvi001)	14	67.06	77.26	1	7.14
15799.	hi (notarock)	14	115.21	130.38	8	57.14
15800.	ammu (notammu)	14	47.38	57.88	3	21.43
15801.	Josh (nocase)	14	113.17	139.80	11	78.57
15802.	Njord (njord19)	14	78.34	95.75	4	28.57
15803.	Nithin (nithinsanjey)	14	50.56	64.28	1	7.14
15804.	Jaynul A (nishatme)	14	61.26	70.82	2	14.29
15805.	Lightning (nirajp)	14	100.45	109.62	5	35.71
15806.	Nina (nina_lopes)	14	52.60	60.17	6	42.86
15807.	skye (nilumi)	14	39.38	47.23	1	7.14
15808.	Luffy (niloy2k76)	14	78.09	88.07	5	35.71
15809.	Nicholas (nikorosu)	14	55.40	62.39	2	14.29
15810.	Niftski (niftski)	14	88.78	109.74	9	64.29
15811.	neromantic (neromantic)	14	77.85	89.09	4	28.57
15812.	Mukhtar (nejaiski)	14	55.15	66.18	3	21.43
15813.	Sophia (need_to_run)	14	59.29	64.64	0	0.00
15814.	Rupesh (nedlog_rupesh)	14	79.13	94.25	5	35.71
15815.	Antonin (nebula__)	14	58.78	70.98	6	42.86
15816.	nazmush (nazmushsayadat)	14	58.33	70.14	0	0.00
15817.	Mew (mw46)	14	117.57	137.64	6	42.86
15818.	Muhsin (muhsinaldoori)	14	59.73	73.30	3	21.43
15819.	Muffin™ (muffintm)	14	77.50	100.88	7	50.00
15820.	Tristan (muffinheadtris)	14	40.88	51.95	1	7.14
15821.	mt (mtutunchi)	14	83.66	93.01	6	42.86
15822.	Guus (mr_leepel_)	14	92.55	102.57	7	50.00
15823.	david (mrriceeater)	14	104.43	123.95	5	35.71
15824.	Shahaf (mrpoopydoopy)	14	64.61	77.15	5	35.71
15825.	Mr.John (mrjohnwick)	14	55.90	67.63	5	35.71
15826.	Moulik (morocks)	14	98.58	116.77	2	14.29
15827.	Mooles (mooles)	14	125.42	139.39	10	71.43
15828.	Mohit Justin (mohitjustintudu)	14	39.29	51.02	2	14.29
15829.	Jeremy (mlgquikscopebruh)	14	92.87	127.49	6	42.86
15830.	Victor (mlad)	14	50.85	56.38	0	0.00
15831.	Mihai (mizaqe)	14	54.08	62.61	1	7.14
15832.	Mitchel (mitchthebaker)	14	99.07	116.95	7	50.00
15833.	Mipsy (mipsytheblue)	14	88.80	122.57	11	78.57
15834.	Miguel (miguel_leadersarena)	14	60.34	71.96	0	0.00
15835.	midayis (midayis)	14	56.77	80.76	4	28.57
15836.	Matthew Froehlick (mfro)	14	61.93	75.36	4	28.57
15837.	Meysam (meysam1231)	14	65.09	77.31	3	21.43
15838.	McNeal (mcnealgwapo)	14	68.96	76.62	3	21.43
15839.	Max (maxshaw2411)	14	90.36	102.70	12	85.71
15840.	Matt (mattsmouse)	14	93.27	118.31	4	28.57
15841.	Matthew (matthewarous)	14	129.84	147.29	14	100.00
15842.	Massimo (massir)	14	86.64	95.87	2	14.29
15843.	Blade_s0567 (mar_s)	14	63.03	77.25	3	21.43
15844.	1ntellectualL10n (martinledl)	14	79.86	88.19	6	42.86
15845.	Fardin (manzif)	14	89.81	102.34	8	57.14
15846.	manstick (manstick)	14	90.01	107.53	5	35.71
15847.	Maluck (maluck)	14	72.39	83.91	3	21.43
15848.	Mahmoud (mahmoud_12)	14	38.67	42.95	3	21.43
15849.	Mahbub (mahbubdev)	14	44.72	54.29	0	0.00
15850.	Mystik (magic_mystik)	14	64.77	77.07	6	42.86
15851.	mafia (mafia207)	14	59.16	74.02	3	21.43
15852.	Mac (macthemountain)	14	91.45	115.08	8	57.14
15853.	Μάξιμε (macmo)	14	117.70	129.27	8	57.14
15854.	Luminious (luminious)	14	81.70	95.13	2	14.29
15855.	Luke (lukechevy)	14	74.96	84.94	2	14.29
15856.	j (luckyslayer)	14	73.99	88.54	3	21.43
15857.	LubO_o (lub0_o)	14	69.39	84.07	6	42.86
15858.	Lokyin (lqkii)	14	109.93	138.81	4	28.57
15859.	Aryan (lost_arrow)	14	72.18	85.15	1	7.14
15860.	JR (lordjoshyy)	14	95.84	103.61	4	28.57
15861.	Cookrieme (lonarexiz)	14	80.97	93.41	5	35.71
15862.	Slobky (lmaoxdlolrofl)	14	101.04	121.76	5	35.71
15863.	decadent movement (lkmatter)	14	58.77	64.66	1	7.14
15864.	Sticky (littletea)	14	48.50	56.36	3	21.43
15865.	lil_lobster (lil_lobster)	14	67.79	75.32	2	14.29
15866.	Likkon (likkon_maddik)	14	71.25	84.31	6	42.86
15867.	Lik (lik007)	14	60.87	76.98	5	35.71
15868.	levani (levanacixo)	14	91.47	105.73	7	50.00
15869.	Eric (leftlaneeric)	14	88.77	100.43	12	85.71
15870.	jonathon (laptoptouchpad)	14	67.78	82.46	0	0.00
15871.	Landi (landiepileptic)	14	54.14	71.27	1	7.14
15872.	Cait (lamby17_)	14	76.32	85.02	4	28.57
15873.	Jake (lakejund)	14	105.65	126.08	6	42.86
15874.	Jatin (kumar_jatin)	14	67.55	80.78	3	21.43
15875.	Krish (krish2882005)	14	63.16	81.51	4	28.57
15876.	David (koreanboy)	14	93.21	115.90	3	21.43
15877.	Kirtaph (kirtaph)	14	88.96	115.18	4	28.57
15878.	Ryan (kingdr)	14	59.28	75.19	4	28.57
15879.	Alec (killjoy722)	14	78.62	93.61	4	28.57
15880.	Kifah (kifahthespartan)	14	62.14	78.34	2	14.29
15881.	Eric (keywe)	14	79.62	89.57	5	35.71
15882.	Tomek (kemor)	14	86.48	105.26	4	28.57
15883.	Keks (keksfromnextdoor)	14	61.15	67.80	4	28.57
15884.	. (keelanlambert)	14	57.97	69.44	5	35.71
15885.	Rai (kaythox)	14	108.80	125.70	5	35.71
15886.	nunya (karlremarks)	14	72.62	83.55	5	35.71
15887.	Johnny (k5kk)	14	108.05	142.62	9	64.29
15888.	Bektas (k1ngst0ne)	14	59.36	75.37	3	21.43
15889.	Samuel (justanotherasianont...	14	80.28	96.12	5	35.71
15890.	junior (junior2000)	14	55.89	67.02	4	28.57
15891.	jono (jonohubbard)	14	76.53	95.38	5	35.71
15892.	Jon (jonnylauws)	14	97.47	104.53	4	28.57
15893.	Jon (jon56)	14	82.22	98.58	7	50.00
15894.	John (johnphan05)	14	125.54	144.56	8	57.14
15895.	joe (joe_mam101)	14	59.72	72.27	3	21.43
15896.	Joe (joe_exotic6969)	14	63.03	72.57	1	7.14
15897.	Joey (joeykuo)	14	57.56	70.30	6	42.86
15898.	Jman (jkarlik22)	14	55.97	81.36	3	21.43
15899.	jjpjimmy (jjpjimmy)	14	81.21	98.59	6	42.86
15900.	jithin (jithinjoseph)	14	58.77	69.50	0	0.00
15901.	Jim (jimnguyen)	14	82.57	97.80	5	35.71
15902.	Rohith (jikki)	14	55.79	67.63	4	28.57
15903.	Jerwin (jherwynne)	14	72.08	87.29	3	21.43
15904.	JD (jhaaydee)	14	49.85	62.89	1	7.14
15905.	Imponed (jg814867)	14	74.24	88.90	3	21.43
15906.	JeiJei (jemjem09)	14	62.75	77.99	4	28.57
15907.	Jeffrey (jeffreyfeng)	14	95.86	115.79	5	35.71
15908.	Harry (jeeeerrrpop)	14	75.51	87.90	8	57.14
15909.	joshua (jawwshuaa)	14	99.68	116.47	6	42.86
15910.	Daniel (jansson)	14	93.31	105.69	6	42.86
15911.	James (jamessmurray)	14	53.53	60.11	1	7.14
15912.	James (james494)	14	101.46	112.99	8	57.14
15913.	Jakaria (jakaria_sami)	14	56.63	67.65	5	35.71
15914.	Barrett (jahspp)	14	70.88	81.45	4	28.57
15915.	Jacob (jacob643)	14	81.61	90.57	4	28.57
15916.	Isak (izzeww)	14	92.16	108.62	5	35.71
15917.	Elias (itzner)	14	45.04	59.21	3	21.43
15918.	deydey (iskalaberkberk0427)	14	76.94	88.34	4	28.57
15919.	iron (iron_pickaxe)	14	75.68	90.47	3	21.43
15920.	Nhaatj (iopaosi)	14	50.82	77.90	2	14.29
15921.	qwq (iomeow)	14	47.47	51.77	0	0.00
15922.	Simon (imp4l3r)	14	94.41	121.23	7	50.00
15923.	kian (imkian)	14	56.82	63.34	0	0.00
15924.	impostor (ilikepotatoesixty...	14	92.50	103.50	3	21.43
15925.	Igor (ikarus9393)	14	88.52	100.84	5	35.71
15926.	ignatius (ig_gy)	14	57.48	66.97	1	7.14
15927.	Hugi (hugi97)	14	89.28	100.07	5	35.71
15928.	Kai (htplayz2107)	14	82.83	93.69	1	7.14
15929.	jburd (htimseiluj)	14	78.32	90.79	5	35.71
15930.	Jacob (horenzo)	14	102.72	117.13	7	50.00
15931.	Hisham (hisham_m)	14	53.06	67.24	4	28.57
15932.	.zyf (hinglect)	14	96.64	110.43	6	42.86
15933.	Rohit Singh (himynameisrohi...	14	136.08	156.85	10	71.43
15934.	himanshu (himanshu_giri)	14	56.50	68.15	4	28.57
15935.	hieser (hieser)	14	32.33	36.57	2	14.29
15936.	David (hiddenpants10)	14	94.03	104.33	4	28.57
15937.	SomeGuy (hexadecimal101)	14	95.51	118.05	7	50.00
15938.	Henry Ruggs (henryruggs)	14	171.65	188.95	13	92.86
15939.	hegde_atri (hegde_atri)	14	74.49	89.64	2	14.29
15940.	Harsh (harsh1924)	14	55.06	63.78	2	14.29
15941.	Andrew (harris75098)	14	68.54	87.73	5	35.71
15942.	Bruh (hannibanani)	14	63.64	77.28	3	21.43
15943.	Teuku (hahasrul)	14	75.33	91.06	4	28.57
15944.	Habib (habib7777)	14	57.22	65.14	2	14.29
15945.	gummy (gummysheep)	14	105.34	116.97	7	50.00
15946.	tek it (guidryy)	14	37.99	53.19	0	0.00
15947.	mikey (grenadejumper)	14	65.86	84.01	3	21.43
15948.	Gourav (gourav001)	14	54.81	59.37	1	7.14
15949.	kiwiwi (gothickiwi)	14	49.28	61.10	1	7.14
15950.	Alh (gotank)	14	49.93	58.71	2	14.29
15951.	Maidul (goal100wpm)	14	36.26	43.79	2	14.29
15952.	Glen (glennnnn)	14	62.99	69.32	1	7.14
15953.	Anonymous (ghajik)	14	84.93	101.58	13	92.86
15954.	Last (galya_88)	14	68.43	77.39	3	21.43
15955.	Colin (galaxyytr)	14	81.99	94.31	4	28.57
15956.	Inic (gadomane)	14	73.08	89.15	4	28.57
15957.	Nick (frogd)	14	88.66	105.54	2	14.29
15958.	Bob (frenchburrito)	14	78.28	93.62	4	28.57
15959.	William (freewille)	14	96.82	115.99	6	42.86
15960.	fred777i (fred777i)	14	71.22	98.19	2	14.29
15961.	fongof (fongof)	14	89.35	100.03	3	21.43
15962.	Flowless (flowlessrusher)	14	64.25	71.24	14	100.00
15963.	Landon (floont)	14	120.00	127.79	6	42.86
15964.	Fineson (fineson)	14	107.40	138.13	7	50.00
15965.	ronan (fibbit)	14	82.26	94.06	3	21.43
15966.	Fesak10Fingers (fesak8)	14	60.77	73.05	7	50.00
15967.	Fathan (fathanpathurijal)	14	70.47	80.28	4	28.57
15968.	Farhan Osman (farhan16)	14	40.28	44.01	0	0.00
15969.	Fanturn (fanturn)	14	31.25	44.00	1	7.14
15970.	Thomas (f0x169)	14	78.84	90.96	3	21.43
15971.	Lucas (excorpse)	14	96.53	115.83	5	35.71
15972.	Esophose (esophose)	14	135.36	157.28	9	64.29
15973.	Esketitutu (esketitutu)	14	65.80	81.17	8	57.14
15974.	Derpy Stingray (ernchenghoo)	14	109.72	131.73	8	57.14
15975.	Khanh (erile)	14	59.01	66.74	0	0.00
15976.	Enzoo (enderboyx200)	14	131.27	140.68	11	78.57
15977.	Emily (emerrin)	14	98.60	106.09	5	35.71
15978.	aa (elk111)	14	75.54	91.55	3	21.43
15979.	luca (einsluca)	14	83.65	97.07	1	7.14
15980.	𝓰𝓸𝓸 𝓰𝓸𝓸 (...	14	75.50	90.57	7	50.00
15981.	Lewis (eatass123)	14	68.66	76.87	2	14.29
15982.	ear (earmold)	14	108.52	121.65	7	50.00
15983.	Dylan (dylearn)	14	63.38	72.86	0	0.00
15984.	dylan52528 (dylan52528)	14	70.59	85.89	4	28.57
15985.	Drizzy (dreazy)	14	83.16	104.71	5	35.71
15986.	dree (dre3)	14	76.85	92.75	3	21.43
15987.	Goomba (dragoomba)	14	148.16	166.18	7	50.00
15988.	Marcus Armstrong (down_with...	14	87.76	101.08	2	14.29
15989.	Daniel (dninja96)	14	102.13	116.79	4	28.57
15990.	Dylan (dkonquerer)	14	104.98	118.53	2	14.29
15991.	Hafizuddin (dinios_)	14	30.00	34.26	0	0.00
15992.	Dikshit (dikshitupadhya)	14	60.55	68.94	1	7.14
15993.	DerpVos (derpvos)	14	83.57	103.12	6	42.86
15994.	Nicholas (denicholas)	14	62.17	73.16	5	35.71
15995.	Radioactive (denharsh)	14	115.05	134.52	11	78.57
15996.	Dele (delenit0r)	14	77.00	88.65	2	14.29
15997.	Deiru (deiru)	14	101.76	121.54	3	21.43
15998.	Bob (deinosor)	14	105.69	123.84	5	35.71
15999.	Jody (deekif)	14	89.15	102.81	8	57.14
16000.	Deamon (deamontyper)	14	67.73	81.94	4	28.57
16001.	David (davecoolkid)	14	112.21	135.94	7	50.00
16002.	Dan (danwest124)	14	60.62	69.92	1	7.14
16003.	Dave (dachalco)	14	90.06	99.40	2	14.29
16004.	tstats[daball] (daball)	14	104.87	127.48	6	42.86
16005.	Czar (czarlol)	14	107.77	124.78	6	42.86
16006.	cython (cython)	14	63.72	74.83	2	14.29
16007.	Cavit Mert (cvtmrt)	14	64.91	77.65	13	92.86
16008.	abidlao07 (crystalrep)	14	55.95	77.32	14	100.00
16009.	John (cryptx_)	14	93.73	117.81	8	57.14
16010.	kj (crioyri)	14	99.47	115.05	8	57.14
16011.	coolror (coolroru)	14	84.30	105.01	4	28.57
16012.	Josh (complex_j)	14	48.99	56.83	1	7.14
16013.	Jon (coltirl)	14	67.32	88.69	1	7.14
16014.	Jordan (coffeeaddict99)	14	79.28	87.97	5	35.71
16015.	coen (coencidence)	14	106.92	132.61	3	21.43
16016.	Michael (clutch69master69)	14	122.41	135.03	11	78.57
16017.	Aicez (cluelessbruh)	14	48.86	57.72	0	0.00
16018.	Cloudios (cloudios)	14	68.34	84.57	4	28.57
16019.	Clfong (clfong)	14	60.46	74.27	1	7.14
16020.	CHT (cht64)	14	114.91	139.55	11	78.57
16021.	Chocorion (chocorion)	14	67.29	79.93	3	21.43
16022.	Timothy (chicken174)	14	21.46	27.87	3	21.43
16023.	I don't know (chessbro)	14	43.65	59.57	0	0.00
16024.	andygreg (chelloh)	14	62.09	77.69	4	28.57
16025.	Cheesetoast (cheesetoastman)	14	57.95	75.78	2	14.29
16026.	cha (chachu007)	14	73.51	87.04	2	14.29
16027.	celes (celescastro)	14	82.34	97.53	5	35.71
16028.	Ceb (cebq)	14	72.34	94.40	4	28.57
16029.	Chase (ccummins)	14	85.21	103.73	4	28.57
16030.	Talon (cclaww)	14	64.45	81.97	3	21.43
16031.	Matty (cannotdivideby0)	14	96.92	115.27	7	50.00
16032.	Cancyr (cancyr)	14	96.84	105.98	5	35.71
16033.	luis (bumfuzzled)	14	69.27	84.14	4	28.57
16034.	Mario (bujmar)	14	60.20	68.93	0	0.00
16035.	Anton (bujjaa)	14	68.24	75.23	1	7.14
16036.	Bruce (bruceboy1985)	14	116.16	131.86	8	57.14
16037.	David (bpsccheney)	14	78.61	86.04	5	35.71
16038.	jom (borezu)	14	128.89	145.31	11	78.57
16039.	Yoda (booya51)	14	98.63	114.33	5	35.71
16040.	Andrew (bonusducky)	14	99.70	115.36	1	7.14
16041.	Bob (bobjesus)	14	68.48	80.73	7	50.00
16042.	Blub (blub0)	14	86.45	106.36	8	57.14
16043.	Ramen (blazingramen)	14	99.84	110.32	6	42.86
16044.	Christler (blastydog)	14	120.86	140.91	10	71.43
16045.	Valk (blankfox)	14	80.06	94.68	4	28.57
16046.	Asma Azim (blackpanther_1)	14	63.35	70.42	4	28.57
16047.	Long (bizkidngo)	14	104.14	133.86	10	71.43
16048.	Trilo (bishh_27)	14	41.87	45.67	0	0.00
16049.	Brandon (birdysofly)	14	108.91	134.94	11	78.57
16050.	Bill (billsquare)	14	62.09	71.04	3	21.43
16051.	biady (biadyy)	14	96.04	101.54	5	35.71
16052.	bhuvi (bhuvi1606)	14	58.77	69.81	3	21.43
16053.	beepbeep (beep__beep)	14	71.38	83.19	2	14.29
16054.	beehah (beehahem)	14	100.96	115.92	7	50.00
16055.	beebooboop (beebooboop)	14	96.23	107.43	3	21.43
16056.	Big (beanbeanbean123)	14	44.41	50.10	0	0.00
16057.	Kutay (batselot)	14	62.80	72.14	3	21.43
16058.	Bailey (baileyeet)	14	73.37	101.71	2	14.29
16059.	badfaith (badfaith)	14	81.57	95.22	3	21.43
16060.	Gaus (azamku09)	14	57.20	64.60	2	14.29
16061.	Axurio (axurio)	14	68.36	80.57	6	42.86
16062.	Axel (axei)	14	60.30	71.97	0	0.00
16063.	avg (avgr)	14	16.78	22.67	1	7.14
16064.	Griffin (avalanchovy)	14	55.03	61.97	1	7.14
16065.	Aurel (aurelganteng)	14	79.21	94.24	6	42.86
16066.	Ath (athuu)	14	92.00	109.48	5	35.71
16067.	Yu (astridjin)	14	50.82	59.93	3	21.43
16068.	Adam (assassinbred)	14	97.46	105.67	2	14.29
16069.	Ibnu (asqallani)	14	56.91	69.74	3	21.43
16070.	Aiden (asiangarlic)	14	64.58	76.07	9	64.29
16071.	ashley (ashleyybbae)	14	101.27	113.53	10	71.43
16072.	asdf (asdf3)	14	84.44	92.33	2	14.29
16073.	ascyt.com (ascyt)	14	60.80	75.36	4	28.57
16074.	Aruji (aruji)	14	77.30	86.27	0	0.00
16075.	uwos (artuist)	14	97.03	107.13	7	50.00
16076.	ArthasEdit (arthasedit)	14	44.50	55.99	0	0.00
16077.	arryacc (arryacc)	14	45.17	49.87	2	14.29
16078.	Ashvik (ardude566)	14	76.86	99.77	5	35.71
16079.	ArcticWoof (arcticwoof)	14	57.84	63.12	2	14.29
16080.	Tabs (aptex)	14	94.83	106.69	5	35.71
16081.	Mario (applie_turnover)	14	42.31	54.34	2	14.29
16082.	Alperen (apleren)	14	55.64	63.54	2	14.29
16083.	ibayanto (antichronic)	14	86.39	111.40	8	57.14
16084.	qwerty (anoop208)	14	112.74	131.85	11	78.57
16085.	Anh Khoa (anhkhoa218)	14	49.40	57.38	2	14.29
16086.	Nate (angularblade)	14	71.83	91.98	4	28.57
16087.	Andy (andykim18)	14	95.99	110.08	4	28.57
16088.	Andrew (andrewlllee)	14	83.17	100.21	4	28.57
16089.	Andrew (andrewlwm)	14	78.87	96.84	5	35.71
16090.	_Nasta_ (anas_hamrouni)	14	65.87	80.54	7	50.00
16091.	Amar (amardhaliwal7)	14	54.40	69.89	1	7.14
16092.	Alec (alxiang)	14	100.43	123.94	2	14.29
16093.	Alexandros (ale_pouroulllis)	14	93.88	111.88	9	64.29
16094.	Alexa (alexa72)	14	105.24	126.98	6	42.86
16095.	Alex (alex7r360)	14	111.24	133.00	8	57.14
16096.	Aldreich (aldreich)	14	99.77	121.66	8	57.14
16097.	Arrtea (akrx)	14	39.53	46.25	0	0.00
16098.	asgfd (akjghaf)	14	70.23	77.97	2	14.29
16099.	bbbbbbbbbbbbbbbbbbbbbbbbbbb...	14	71.88	83.14	3	21.43
16100.	Eddie (agzastrgath)	14	91.20	101.75	5	35.71
16101.	Fluff (afluffyflamingo)	14	102.64	133.27	5	35.71
16102.	Julio (aero_jb)	14	61.86	70.74	4	28.57
16103.	Adnan (adnanasn)	14	51.39	55.75	0	0.00
16104.	Lavell (adenda2)	14	68.14	77.63	1	7.14
16105.	costin (acostin643)	14	102.24	116.31	3	21.43
16106.	Acke (ackehjarn)	14	89.07	104.37	3	21.43
16107.	Alyssa (abm10)	14	44.04	57.29	0	0.00
16108.	Abdullahi (abdullahi_samiir)	14	77.08	86.44	2	14.29
16109.	AK (a2526)	14	77.85	90.30	4	28.57
16110.	Andy (6arb)	14	101.36	115.57	7	50.00
16111.	白起小哥哥 (45989871)	14	46.41	60.91	2	14.29
16112.	Rebecca (221btimelord)	14	88.30	102.26	4	28.57
16113.	Camden (1848910)	14	69.80	86.76	5	35.71
16114.	Mohammad (11osos11)	14	78.57	93.47	6	42.86
16115.	shudawg (1122)	14	78.18	87.79	3	21.43
16116.	Angelo (ruly_2002)	14	76.98	95.23	2	14.29
16117.	Euan (euansuba)	14	69.84	82.51	14	100.00
16118.	Aaran (ninjatai)	14	43.44	51.46	0	0.00
16119.	Nathan (rockthecraft)	14	85.21	91.12	4	28.57
16120.	Ian (sirbossk)	14	82.16	93.60	2	14.29
16121.	Aniket (ani_ket_kmr)	14	89.37	104.55	5	35.71
16122.	ethan (1epyt)	14	76.45	87.98	5	35.71
16123.	Saheb (iamsahebgiri)	14	42.47	57.92	1	7.14
16124.	Josiah (instantnoodlez)	14	82.75	116.34	6	42.86
16125.	John (lilrecci3)	14	40.95	47.73	2	14.29
16126.	'Cannot be blank' (mountain...	14	102.51	120.86	4	28.57
16127.	ahmed (ahmedraslan28)	14	43.75	52.31	3	21.43
16128.	Toad (toad2six)	14	95.97	127.50	6	42.86
16129.	Daniel (iskrowy)	14	74.35	87.58	5	35.71
16130.	Abdul Rafay (rafay_angle)	14	43.70	49.19	2	14.29
16131.	Prabesh (itsprabesh)	14	60.57	75.14	2	14.29
16132.	Victoria (victoria_05)	14	48.52	59.87	1	7.14
16133.	rome (zombielols)	14	98.23	114.30	4	28.57
16134.	TerrorLlama (terrorllama)	14	73.48	85.14	2	14.29
16135.	John (john19221)	14	49.80	53.70	0	0.00
16136.	Mohammed (_police_)	14	75.37	87.68	3	21.43
16137.	John (omnirabbit)	14	103.23	115.30	8	57.14
16138.	Bob (didwin)	14	87.69	103.40	5	35.71
16139.	Aniket (theaniketdas)	14	89.04	121.75	5	35.71
16140.	Aaron (hertzzy)	14	51.27	55.29	3	21.43
16141.	Lee (dinotrooper)	14	78.22	111.69	4	28.57
16142.	wes (fckhomerow)	14	117.00	133.45	10	71.43
16143.	Bethany (thelegendarybethboii)	14	95.64	106.29	6	42.86
16144.	PLUTO (p1luto)	14	66.34	80.72	9	64.29
16145.	Anthony (adenn915)	14	76.82	102.05	2	14.29
16146.	Tag (terataj)	14	74.57	97.34	6	42.86
16147.	. (thediamond_35)	14	82.35	94.66	2	14.29
16148.	Emir (kasubukuro)	14	52.58	65.27	2	14.29
16149.	iverybadattyping (iverybada...	14	91.50	103.10	4	28.57
16150.	sky (forgottensky)	14	60.21	71.42	1	7.14
16151.	Arian (alatus_arian)	14	77.25	98.32	2	14.29
16152.	Md Abu Torab (torab_0123)	14	47.18	57.90	4	28.57
16153.	John (john8999)	14	49.52	57.65	0	0.00
16154.	Septrev (septrev)	14	50.28	56.15	1	7.14
16155.	Brian (britchkid)	14	103.73	124.69	10	71.43
16156.	atharv (xdbotsmaster)	14	52.36	61.92	0	0.00
16157.	heidi (emmalouise05)	14	62.96	73.66	3	21.43
16158.	Sal (saltypes)	14	51.01	56.83	3	21.43
16159.	Namura (namura)	14	83.81	92.80	8	57.14
16160.	Cameron (cameron_j)	14	83.59	93.01	6	42.86
16161.	thenu (lcfrmrngstr)	14	58.01	70.67	3	21.43
16162.	Andrii (shkroba)	14	71.82	86.86	3	21.43
16163.	Ahmed Ittihad (andy_dufresn...	14	65.38	72.19	3	21.43
16164.	Waldo (glibg10b)	14	64.84	71.99	4	28.57
16165.	Quan (quan_lad)	14	70.92	83.38	11	78.57
16166.	Gisela (gis99)	14	48.65	56.40	2	14.29
16167.	ethonk (ethonk)	14	88.75	96.38	6	42.86
16168.	Awesome Name Man (awesomena...	14	71.83	79.43	6	42.86
16169.	Esther (phamjam)	14	68.78	75.81	4	28.57
16170.	killua (alphaidgaf)	14	59.88	69.16	8	57.14
16171.	Dyllan (blockmaniac48)	14	68.76	85.40	3	21.43
16172.	Conor (crc1200)	14	70.15	88.18	6	42.86
16173.	Chizz (cheezeychizz)	14	82.94	93.17	6	42.86
16174.	Sudhir (sudhih)	14	60.37	75.82	4	28.57
16175.	Chris (pokedog27)	14	75.48	93.26	4	28.57
16176.	nekron35 (nekron35)	14	56.16	61.71	3	21.43
16177.	jamhood007 (jamhood007)	14	56.44	62.56	5	35.71
16178.	Thom (squiddy32)	14	92.01	124.26	4	28.57
16179.	Tyler (loltylerdowney)	14	82.26	93.66	1	7.14
16180.	gnat (gnatblue)	14	62.85	73.97	5	35.71
16181.	ZhiHan (flinzan)	14	47.62	53.34	1	7.14
16182.	samsam (samsamlol)	14	93.70	112.54	11	78.57
16183.	Athacal (athacal)	14	46.34	58.80	4	28.57
16184.	Rasheed (sheedywonder)	14	68.15	79.03	4	28.57
16185.	Waleed (waleed_saleh)	14	51.81	58.58	5	35.71
16186.	joni (rozygcf)	14	48.09	54.67	2	14.29
16187.	racernumberseven (racernumb...	14	56.34	63.19	1	7.14
16188.	Ben (tachibanaben)	14	91.11	110.48	4	28.57
16189.	Rosechilde (rosechilde)	14	47.61	56.75	1	7.14
16190.	Jeronimo (_slowmotion_)	13	113.70	125.63	5	38.46
16191.	Paka (_paka)	13	92.48	100.89	3	23.08
16192.	falling down (_nirvana)	13	118.74	124.74	6	46.15
16193.	Zakk (z_boi)	13	103.28	119.10	4	30.77
16194.	amer (zx_iii)	13	54.09	60.29	1	7.69
16195.	ଘ(੭ˊᵕˋ)੭* ੈ✩�...	13	120.96	133.01	12	92.31
16196.	Zero (zerolelouch)	13	54.07	65.77	2	15.38
16197.	logan (zelo_0348)	13	37.63	43.08	0	0.00
16198.	Lawrence (zekaeski)	13	52.26	67.67	3	23.08
16199.	Yan (zeezyy)	13	48.62	56.88	12	92.31
16200.	Yuuto (yuutofood)	13	77.91	95.80	4	30.77
16201.	Yohan (yoyo65)	13	32.47	35.84	0	0.00
16202.	Lenny (yourboylenny)	13	78.30	92.04	9	69.23
16203.	Markus (yoshicp)	13	75.52	92.36	6	46.15
16204.	Yoav (yoav24681)	13	63.22	71.62	2	15.38
16205.	yjuk (yjuk)	13	79.05	90.37	6	46.15
16206.	yinlor (yinlor)	13	75.14	99.66	5	38.46
16207.	V (xgerr)	13	76.04	87.99	6	46.15
16208.	Darren (xdeclipseee)	13	93.43	114.22	5	38.46
16209.	Mintful (worst_typist11)	13	65.97	74.52	2	15.38
16210.	Jeff (witlessbox)	13	88.24	94.78	0	0.00
16211.	Wil$on (wilsonlee123)	13	103.74	123.18	4	30.77
16212.	NotAn0boe (whackygrub)	13	113.79	129.09	9	69.23
16213.	wenxers (wenxers)	13	94.46	102.06	1	7.69
16214.	weddies (weddies)	13	85.55	95.84	3	23.08
16215.	Daniel (weabutakku)	13	64.48	82.18	4	30.77
16216.	Tony (watery_tony)	13	40.97	49.03	0	0.00
16217.	Nathan (watameelon)	13	38.81	45.78	1	7.69
16218.	waryburger (waryburger)	13	81.41	94.80	4	30.77
16219.	Waleed (waleedminer)	13	113.72	138.81	4	30.77
16220.	WaFik (wafik)	13	66.06	78.01	3	23.08
16221.	Nazarii (vyleet)	13	73.37	90.29	6	46.15
16222.	AJ (vvatti@gmail.com)	13	82.79	92.11	1	7.69
16223.	Casper (volvoracer87)	13	44.21	51.63	1	7.69
16224.	Daniel (voiss)	13	94.49	109.50	7	53.85
16225.	vocal (vocal)	13	72.84	97.74	3	23.08
16226.	Vanellope (vio_melancholy)	13	69.70	84.53	2	15.38
16227.	Vikram (vikram031)	13	104.44	120.78	5	38.46
16228.	Viggi (viggi_002)	13	39.79	47.24	0	0.00
16229.	vibhu (vibhuviv)	13	37.24	44.36	0	0.00
16230.	Liny (veronasie)	13	64.79	76.08	3	23.08
16231.	Blaise (veresb14)	13	91.06	112.12	6	46.15
16232.	ℑ𝔫𝔢𝔵𝔢𝔠𝔯...	13	71.40	78.73	4	30.77
16233.	Alex (veifario)	13	29.09	35.68	3	23.08
16234.	Marcin (vaster_then_you)	13	69.74	79.24	0	0.00
16235.	Vasil (vasito123)	13	86.99	99.08	2	15.38
16236.	André (valp)	13	77.09	87.81	3	23.08
16237.	randall (valleyy)	13	90.09	103.65	5	38.46
16238.	Valdo (valdo_)	13	79.37	93.09	0	0.00
16239.	vid (usernem)	13	94.74	117.45	4	30.77
16240.	Samuel (upgraded_skilly)	13	72.48	83.88	3	23.08
16241.	cooler (unpluged)	13	85.33	95.68	3	23.08
16242.	umer (umer901)	13	74.07	96.04	2	15.38
16243.	Umbi (umbe10)	13	75.32	87.85	7	53.85
16244.	Bat-Ulzii (ulziibox)	13	66.22	79.15	12	92.31
16245.	Uno (typesmacker)	13	69.70	80.69	5	38.46
16246.	bob (typemaster512)	13	87.10	99.29	4	30.77
16247.	Tukanoo (tukano)	13	62.60	71.68	2	15.38
16248.	Petros (trakis_pe)	13	53.00	69.23	6	46.15
16249.	Noob (touchhyper)	13	87.13	120.50	5	38.46
16250.	byronze (toqoz)	13	107.54	115.32	4	30.77
16251.	J (tooeasyeh)	13	122.87	139.71	5	38.46
16252.	Race (tomatoripper)	13	45.31	50.79	4	30.77
16253.	Tree (tmoh)	13	100.73	121.31	12	92.31
16254.	Tippy (tippytaptyper)	13	100.41	126.30	3	23.08
16255.	nht- (tiny20061)	13	112.21	149.77	4	30.77
16256.	Martin (the_martin)	13	86.27	115.21	8	61.54
16257.	maple (the_maple_syrup)	13	107.03	118.56	5	38.46
16258.	Marlo (the_law_ph)	13	73.30	84.36	3	23.08
16259.	Brian (the_bc)	13	70.75	80.04	5	38.46
16260.	Evan (thewhailure)	13	75.16	85.95	3	23.08
16261.	Bryan (thesilican)	13	93.33	107.78	6	46.15
16262.	Nobody (therealtrudeau)	13	113.63	135.05	6	46.15
16263.	Talos (therealtalos21)	13	83.21	93.99	3	23.08
16264.	TheProperAsian (theproperas...	13	74.01	86.30	7	53.85
16265.	- (thegoldentiger)	13	96.32	110.06	4	30.77
16266.	Jack (theboakey)	13	72.48	82.02	3	23.08
16267.	Iason (thebabo)	13	66.00	76.03	7	53.85
16268.	Fox (that_fox)	13	90.40	104.25	2	15.38
16269.	Davis (thatrednismo)	13	100.59	118.93	4	30.77
16270.	Th3Frog (th3frog)	13	48.68	55.40	3	23.08
16271.	tempo (tempoxyz)	13	88.39	109.89	6	46.15
16272.	Tehb (tehbb)	13	41.60	51.87	1	7.69
16273.	Calvin (teddycom1)	13	66.22	73.30	3	23.08
16274.	Ted (ted3x)	13	62.58	71.51	6	46.15
16275.	Yếm Hồng (tdinh33)	13	64.78	76.37	1	7.69
16276.	Ryan (tazayuki)	13	108.42	117.02	7	53.85
16277.	na (syncix)	13	91.64	111.96	9	69.23
16278.	sriram (svb1)	13	68.66	74.00	3	23.08
16279.	tstats[suraj_hs] (suraj_hs)	13	54.41	66.78	0	0.00
16280.	slowpoke (wpm4life)	13	46.29	55.27	2	15.38
16281.	Ethan (summerpizza5508)	13	90.03	107.47	7	53.85
16282.	Suhan (suhan_pradhan)	13	71.27	85.49	2	15.38
16283.	Duirky (sublollipop)	13	64.45	73.22	4	30.77
16284.	Rapunzel (subash_)	13	67.85	74.34	2	15.38
16285.	Scott (stxiii)	13	79.21	88.43	5	38.46
16286.	fries (spotifries)	13	80.11	89.57	3	23.08
16287.	Alvin M. (spoderman2100)	13	55.37	65.27	3	23.08
16288.	spiros (spiros_gal)	13	91.33	109.29	3	23.08
16289.	William (speier70)	13	78.76	84.82	3	23.08
16290.	Riyad (spectrumftw)	13	89.78	107.24	8	61.54
16291.	ellie (spaghellie)	13	112.65	136.50	8	61.54
16292.	Jacob (spacelamar)	13	84.87	96.05	3	23.08
16293.	Pavel (sonaru)	13	65.96	72.84	7	53.85
16294.	Mevious (someguy)	13	119.00	129.41	5	38.46
16295.	GG (smrndmgy)	13	80.99	100.57	9	69.23
16296.	stinkass (smitopot)	13	113.33	142.50	6	46.15
16297.	pingu (slowpokeboy)	13	104.14	122.03	5	38.46
16298.	skydoi (skydoi)	13	69.10	87.80	3	23.08
16299.	Hien (skrubtical)	13	115.88	129.87	8	61.54
16300.	P (skoop8)	13	104.09	117.68	7	53.85
16301.	Skerolt (skerolt)	13	78.60	95.62	7	53.85
16302.	Loser (sisyphus_69)	13	84.26	92.56	3	23.08
16303.	JIS filco stingray (sigel)	13	149.07	171.38	12	92.31
16304.	eden (shoutynubs)	13	83.51	91.18	4	30.77
16305.	Hamster (shmex_hamster)	13	89.93	99.81	8	61.54
16306.	かりつた (shizuyoru)	13	67.01	73.74	2	15.38
16307.	Shirito (shirito)	13	70.54	79.82	2	15.38
16308.	Top (sheilsarda)	13	89.10	102.88	6	46.15
16309.	Sheenu (sheenz)	13	113.38	130.83	7	53.85
16310.	Bauyrzhan (shaykan)	13	61.17	77.26	7	53.85
16311.	Shawn (shawnyw)	13	93.42	105.36	4	30.77
16312.	shamol (shamolali)	13	47.96	56.89	3	23.08
16313.	Shafy (shafy)	13	71.49	83.43	2	15.38
16314.	Petar (sevihasanidjos)	13	42.60	50.92	1	7.69
16315.	iza (servoracc)	13	117.48	143.33	6	46.15
16316.	(secw)	13	90.24	107.21	5	38.46
16317.	Sandra (sbs96)	13	116.07	136.37	7	53.85
16318.	Sarah (sarahday)	13	100.45	117.75	7	53.85
16319.	S (sarahac)	13	100.89	119.16	8	61.54
16320.	Sara (sarachespara)	13	60.32	69.77	5	38.46
16321.	Saad (saadeldeen)	13	91.41	102.52	3	23.08
16322.	Xi (rozaana)	13	86.65	93.34	6	46.15
16323.	Roy (roylee0912)	13	123.73	158.29	6	46.15
16324.	rory (roryinnit)	13	82.00	96.40	2	15.38
16325.	Rocky (rocky_whale)	13	84.04	111.66	7	53.85
16326.	robert (robertford)	13	52.75	60.62	1	7.69
16327.	Gabe (roastedleather)	13	73.79	88.67	4	30.77
16328.	RB3 (rlbryant1982)	13	63.48	70.94	1	7.69
16329.	Ralo (rindt_)	13	76.18	84.63	3	23.08
16330.	Riggy (rigorodolico)	13	88.76	100.45	6	46.15
16331.	Chris (rialac)	13	91.10	111.96	4	30.77
16332.	Rennard (rennard)	13	80.85	93.38	5	38.46
16333.	Joshua (redscool)	13	102.89	115.96	5	38.46
16334.	Redking344 (redking344)	13	64.27	77.27	13	100.00
16335.	Xavier (redanky)	13	62.82	69.36	3	23.08
16336.	GEORGE (reburm)	13	135.01	152.28	10	76.92
16337.	Gio (raskid)	13	71.85	93.26	3	23.08
16338.	Paul (randomnoob1)	13	124.39	149.25	8	61.54
16339.	random (randomnoob07)	13	51.43	63.13	3	23.08
16340.	Ramdizzle (ramdizzle)	13	59.79	69.14	5	38.46
16341.	Ralph John (ralph_saintaugu...	13	53.99	63.37	2	15.38
16342.	rajus (rajusthedarklord)	13	66.82	71.70	2	15.38
16343.	Rainfluff (rainfluff)	13	74.35	84.86	7	53.85
16344.	kaedyn (rainbowdad)	13	82.61	101.70	3	23.08
16345.	Rahil (rahil3108)	13	69.02	77.45	5	38.46
16346.	Hunter (ragingtimebomb)	13	66.51	79.48	2	15.38
16347.	Olivier (racoon9009)	13	46.84	51.10	2	15.38
16348.	Rab (rabuhana)	13	71.85	76.09	3	23.08
16349.	Viktor (quicksorting)	13	73.69	87.08	2	15.38
16350.	Al (quicksilver95)	13	112.01	131.81	11	84.62
16351.	Qualified (qualified98)	13	98.11	111.73	6	46.15
16352.	Theodor (prospitianknightma...	13	88.00	106.00	7	53.85
16353.	Prizy (prizypower)	13	54.74	67.99	8	61.54
16354.	aiden (poscowsm)	13	86.03	96.87	7	53.85
16355.	Posa2000 (posa2000)	13	63.51	74.50	0	0.00
16356.	Kelsey (pokewolf)	13	61.38	75.16	3	23.08
16357.	Jade (pokemonluv98)	13	86.72	104.05	3	23.08
16358.	Myles (pixelen)	13	81.26	99.86	3	23.08
16359.	PISSPAINTING (pisspainting)	13	82.48	94.83	6	46.15
16360.	miko (pisleo)	13	70.83	81.82	1	7.69
16361.	rey (pieri)	13	121.70	146.25	4	30.77
16362.	bacon (peter_1860)	13	59.77	71.72	5	38.46
16363.	Petr (petajupik)	13	38.52	42.54	1	7.69
16364.	bruh (peplee_)	13	87.43	105.78	2	15.38
16365.	Pear (pear_smo)	13	64.33	75.18	2	15.38
16366.	pb64 (pb64)	13	71.94	78.38	12	92.31
16367.	Pavlo (pavelko)	13	45.63	53.63	3	23.08
16368.	Paddy (paddyl)	13	76.89	85.30	4	30.77
16369.	Owen (owenecollins)	13	84.74	96.24	3	23.08
16370.	Cezar (outstanding29wpm)	13	84.19	89.72	4	30.77
16371.	oribiya-chan (oribiya)	13	50.90	58.97	1	7.69
16372.	☔️ (orella)	13	88.56	106.74	3	23.08
16373.	ayush (orange_master)	13	77.23	88.57	3	23.08
16374.	Oobi (oobixyz)	13	85.18	103.29	5	38.46
16375.	Chris (ohkaychris)	13	95.85	114.48	5	38.46
16376.	Nuge (nugemcgee)	13	106.89	120.44	8	61.54
16377.	Norps (norps)	13	70.94	80.82	2	15.38
16378.	Nolan (nolanporty)	13	68.81	84.85	1	7.69
16379.	nadav (nmcat)	13	19.20	24.70	4	30.77
16380.	Nikolas (nkaiser)	13	82.50	97.15	4	30.77
16381.	NJ (njc99)	13	69.26	83.05	5	38.46
16382.	nikax (nixa202)	13	105.09	118.07	5	38.46
16383.	Nivalis (nivalis11)	13	92.24	105.02	3	23.08
16384.	Nishal (nishalns)	13	43.95	54.06	1	7.69
16385.	Vegard (ninjawegard)	13	59.92	67.88	3	23.08
16386.	niko (nikuruuuuu)	13	92.39	100.87	6	46.15
16387.	Nikhil Sharma (nikhil_bolt)	13	86.97	93.36	3	23.08
16388.	Bash (nidaljaafar1)	13	58.01	71.52	3	23.08
16389.	Nick (nickpat)	13	94.52	117.70	4	30.77
16390.	nick (nickpanda44)	13	97.19	108.49	8	61.54
16391.	Abdul (netf121212)	13	45.29	52.81	2	15.38
16392.	Nazmin (naz_1212)	13	72.29	98.19	2	15.38
16393.	п8 ʅ(｡◔‸◔｡)ʃ ...	13	95.42	131.06	5	38.46
16394.	Nathaniel (nathaniel999)	13	58.48	64.92	4	30.77
16395.	Fran (narfornothing)	13	103.19	146.78	3	23.08
16396.	Chamnann (nannostar)	13	62.19	74.09	4	30.77
16397.	vinicius (nagahori)	13	70.78	79.14	3	23.08
16398.	RED (naga30)	13	29.42	45.73	1	7.69
16399.	Daulet (m_daulet)	13	45.34	54.88	2	15.38
16400.	Mubtasim (mubtasim91)	13	67.67	83.87	2	15.38
16401.	Spencer (mr_rigid)	13	67.81	80.76	4	30.77
16402.	Jakob (mrsuperhorse)	13	41.30	46.20	1	7.69
16403.	power (mrpowerstudiesyt)	13	86.31	105.22	4	30.77
16404.	Matt (mplumado)	13	67.89	80.38	3	23.08
16405.	mousie (mousiecandy)	13	73.33	87.29	2	15.38
16406.	muhammad (moulizax)	13	57.91	69.42	1	7.69
16407.	Gareth (morpen8)	13	110.28	126.83	6	46.15
16408.	Petar (monkeypants274)	13	62.91	68.32	3	23.08
16409.	MO$$ (monilyn)	13	84.82	96.79	5	38.46
16410.	Molly (molgreen)	13	94.71	111.20	10	76.92
16411.	Mohammad (mohammadkhosravi)	13	50.17	54.27	0	0.00
16412.	Mohamed (mohamedsobhi777)	13	72.88	87.88	3	23.08
16413.	Mike (mmiller_52)	13	55.77	63.65	1	7.69
16414.	MLGIN (mlgin)	13	86.96	122.81	9	69.23
16415.	Anon (mklegend)	13	123.10	143.98	11	84.62
16416.	Matt (misterc)	13	105.42	121.12	5	38.46
16417.	Mischa (mischapotter)	13	88.80	106.34	5	38.46
16418.	Miko (mikofinland)	13	65.53	74.90	3	23.08
16419.	Mikechun (mikechun)	13	89.23	107.40	3	23.08
16420.	mike1808 (mike1808)	13	93.77	106.87	6	46.15
16421.	Michael (mike1232b)	13	93.63	116.06	5	38.46
16422.	Maggie (migggggie)	13	110.14	121.51	4	30.77
16423.	Sofia (michael_bjordy)	13	81.58	91.72	4	30.77
16424.	MewX (mewx)	13	78.62	104.09	10	76.92
16425.	Samar (mesam22)	13	52.80	61.53	1	7.69
16426.	naser (memel0rd420)	13	72.27	86.80	3	23.08
16427.	Nur (mehedyhassan865)	13	44.05	59.49	2	15.38
16428.	ollie (mech_typer)	13	94.76	105.07	9	69.23
16429.	MD Gaziur Rahman Noor (mdga...	13	77.33	96.84	6	46.15
16430.	Maven (mavenz)	13	95.69	105.57	5	38.46
16431.	Matt (mattlo)	13	107.39	125.03	9	69.23
16432.	killerkoli (mattiemb)	13	63.87	75.90	2	15.38
16433.	Matan (matan_ati)	13	87.28	99.25	7	53.85
16434.	FunkyChicken (mastalampe)	13	73.39	80.82	4	30.77
16435.	Mark (markparadise)	13	49.76	58.13	1	7.69
16436.	marciano (marcboss06)	13	41.22	48.94	2	15.38
16437.	Marcago (marcago)	13	81.49	94.53	3	23.08
16438.	mapieko (mapieko)	13	45.00	52.55	1	7.69
16439.	Rushikesh (manwatkar)	13	43.24	50.75	0	0.00
16440.	Manikkavel (manikkavel_s)	13	70.47	79.85	2	15.38
16441.	[Bl4nk] (mahneymchef)	13	84.37	90.18	6	46.15
16442.	Mahir (mahirafnan)	13	46.45	52.94	2	15.38
16443.	Mad Lad (madlad1)	13	61.12	75.27	0	0.00
16444.	Migs (m1gs)	13	50.56	57.45	3	23.08
16445.	JA (l_ja)	13	54.87	70.36	11	84.62
16446.	lyu (lyurisu)	13	100.09	117.94	9	69.23
16447.	Larry (lunchspecial)	13	81.38	100.32	5	38.46
16448.	luca (luc_vr_04)	13	98.91	128.97	7	53.85
16449.	Buddy (lucedes27)	13	109.34	122.13	8	61.54
16450.	Vijay S (lord_viju)	13	45.66	53.24	1	7.69
16451.	Logiq (logiqq)	13	61.61	73.55	1	7.69
16452.	Joshua Peirce (lodgevirus)	13	90.67	110.87	8	61.54
16453.	Ajeje (locreee)	13	56.22	75.48	4	30.77
16454.	Andres (lobosolitario)	13	82.84	108.57	8	61.54
16455.	Liz (lizard117)	13	69.01	82.68	2	15.38
16456.	Joe (littlejoeward)	13	67.41	78.05	2	15.38
16457.	Kacper (lilfridge69)	13	60.87	71.86	2	15.38
16458.	Travis (lightningslow)	13	68.12	95.23	3	23.08
16459.	Liban (liban711)	13	91.91	102.89	6	46.15
16460.	Marco (leungtc20001124)	13	87.91	96.30	3	23.08
16461.	Lestro-+) (lestroboy)	13	28.98	36.85	1	7.69
16462.	Leonard (lentan)	13	119.61	135.15	7	53.85
16463.	Barel (lenshom)	13	64.99	79.09	9	69.23
16464.	Laxman (laxman_)	13	72.15	80.25	8	61.54
16465.	Jake (kyrien)	13	115.71	127.15	9	69.23
16466.	Kyle (kyles0610)	13	113.04	124.22	4	30.77
16467.	James (kuznecoff)	13	76.69	90.62	2	15.38
16468.	Kuba (kubzas)	13	42.00	46.55	3	23.08
16469.	guest (ks3rr)	13	76.17	83.50	4	30.77
16470.	Kristin (krisis7)	13	65.81	73.89	2	15.38
16471.	Justin (krakken858)	13	106.82	121.39	5	38.46
16472.	Stephen (korankye)	13	98.29	119.89	11	84.62
16473.	Dakota (kodaworms)	13	97.72	110.10	8	61.54
16474.	Kritim (kkr_)	13	77.52	87.83	5	38.46
16475.	Kanha (kjewels)	13	69.85	83.96	1	7.69
16476.	kit (kitsinc11)	13	94.17	116.47	2	15.38
16477.	Brando (kingozymandias2)	13	88.31	98.78	6	46.15
16478.	Kif (kifm)	13	51.03	57.81	0	0.00
16479.	Khoa (khoa1811)	13	96.24	107.19	3	23.08
16480.	Raven (kfaulk1216)	13	96.45	107.78	6	46.15
16481.	Quick Fox (key_of_boards)	13	79.21	90.87	1	7.69
16482.	Kenley (kenfunky32)	13	93.55	109.17	4	30.77
16483.	kenestrophic (kenestrophic)	13	63.66	78.12	3	23.08
16484.	kevin (kelvinscale)	13	51.94	60.85	3	23.08
16485.	kelonline (kelonline)	13	55.38	60.60	0	0.00
16486.	Kedolind (kedolind)	13	82.14	93.92	4	30.77
16487.	Kamron (kbegmatov96)	13	67.10	76.24	5	38.46
16488.	Luna (kavuko_)	13	56.40	65.72	3	23.08
16489.	James (kasprovy)	13	56.47	62.01	0	0.00
16490.	Karcinogen (karsenj05)	13	73.55	82.67	3	23.08
16491.	Kalybay (kalybai)	13	54.54	59.02	2	15.38
16492.	Kaleeyse (kaleeysem)	13	61.67	70.94	2	15.38
16493.	Eyrton (kalaxee)	13	98.63	112.90	7	53.85
16494.	Khadija (kaijaaa)	13	34.63	42.90	3	23.08
16495.	kadyn (kadynnn)	13	52.38	62.29	4	30.77
16496.	Angel (kablockacha)	13	48.79	59.98	2	15.38
16497.	K4_keyChan_ (k4_keychan_)	13	89.51	112.89	6	46.15
16498.	Justin (justintam556)	13	85.70	106.00	5	38.46
16499.	justinhylee (justinhylee)	13	109.09	130.57	13	100.00
16500.	Julio Jose (julioisdaman)	13	68.18	94.06	3	23.08
16501.	JudgementCole (judgementcole)	13	48.40	55.99	2	15.38
16502.	juan (juanjaho)	13	75.70	91.69	2	15.38
16503.	KookyMonster🍪🍪🍪 (j...	13	111.41	131.48	9	69.23
16504.	Jellybean (jojo00vvv)	13	104.51	121.24	6	46.15
16505.	Joe (joejoeparen)	13	70.60	95.76	9	69.23
16506.	James (jimmyt50)	13	79.84	95.11	1	7.69
16507.	Dim (jimmylei)	13	88.89	104.80	3	23.08
16508.	jim (jimmyl02)	13	113.91	129.08	9	69.23
16509.	Alex (jigglytophat)	13	55.92	64.94	2	15.38
16510.	patoo (jiahao8)	13	104.55	116.42	6	46.15
16511.	JCGP (jgcp)	13	79.09	88.83	5	38.46
16512.	Jeritens (jensrichter)	13	82.35	94.34	3	23.08
16513.	JDSpark (jdspark)	13	87.89	111.01	4	30.77
16514.	Jamie (jcpopp)	13	111.26	125.91	7	53.85
16515.	JayGMZ (jaygmz)	13	39.08	47.93	2	15.38
16516.	Javla (javlafan)	13	87.76	106.19	5	38.46
16517.	Chukwuka (javalon007)	13	71.43	85.21	5	38.46
16518.	Jaunty (jaunty_jalopy)	13	88.70	96.64	5	38.46
16519.	Jared (jarbarw)	13	96.07	111.62	7	53.85
16520.	Debashade Roo (japanese_map...	13	93.01	103.02	6	46.15
16521.	Jandre (jandre1028)	13	122.32	152.23	8	61.54
16522.	Jan (jan3112)	13	61.52	71.74	3	23.08
16523.	Jafer (jafer2000)	13	62.85	78.09	1	7.69
16524.	Jack (jackwhitten238)	13	82.05	96.47	3	23.08
16525.	JJJ (jaakko1)	13	106.64	127.78	8	61.54
16526.	Vraj (i_type_really_slow_ok)	13	97.31	107.09	3	23.08
16527.	Timothy (iyamdeanser)	13	78.88	90.54	4	30.77
16528.	Apithat Sombatsiri (itsmek4nz)	13	92.91	109.05	4	30.77
16529.	Itscol (itscol)	13	69.43	82.14	4	30.77
16530.	irumpel (irumpelstiltskin)	13	78.28	91.59	6	46.15
16531.	Ronan (ironan)	13	140.55	179.95	11	84.62
16532.	Im kinda cute (im_kinda_cut...	13	89.65	103.64	3	23.08
16533.	Nawaf (iinkz)	13	76.24	83.79	3	23.08
16534.	Shino (id_acey)	13	81.84	107.06	1	7.69
16535.	Samuel (ichigancs)	13	85.51	98.51	5	38.46
16536.	IBRAIM5URFER (ibrahimpro)	13	86.44	103.27	4	30.77
16537.	Robert (hypersnitch)	13	75.28	95.13	2	15.38
16538.	Huy (huygtran123)	13	76.23	81.73	5	38.46
16539.	Nguyen (hungnguyen2912)	13	36.37	43.03	1	7.69
16540.	Hugh (hughmarch)	13	103.59	134.62	7	53.85
16541.	David (hugger69)	13	80.71	87.96	3	23.08
16542.	Putra (hoodedproxy)	13	71.01	81.07	4	30.77
16543.	Lingxun (hommieinuw)	13	91.32	101.85	5	38.46
16544.	Eduard (holykill)	13	102.17	120.24	5	38.46
16545.	Holden (holdcop)	13	91.32	105.67	7	53.85
16546.	Muhamed (hjewdjsdjsdjs)	13	45.66	50.38	1	7.69
16547.	Hi3rra (hi3rra)	13	40.96	47.74	0	0.00
16548.	Jake (hero7785)	13	79.81	88.50	4	30.77
16549.	script/script (henville12)	13	102.34	115.54	6	46.15
16550.	Hehsbb (hehsbb)	13	72.35	91.82	3	23.08
16551.	Phan (hed_wig)	13	90.20	101.46	5	38.46
16552.	cat (hecknolol2)	13	73.64	102.17	3	23.08
16553.	POCARI (hdpocari)	13	76.03	87.72	6	46.15
16554.	haytch (haytch)	13	42.91	58.66	1	7.69
16555.	Hans5958 (hans5958)	13	80.77	99.43	4	30.77
16556.	Halifay (halifay)	13	80.01	88.26	1	7.69
16557.	Haduu (hadiysd)	13	98.94	103.27	7	53.85
16558.	GrimRaven26 (grim_raven26)	13	56.31	63.56	1	7.69
16559.	amber (gremlinx8)	13	101.55	112.83	8	61.54
16560.	Kevin (greenleafy)	13	131.59	152.44	8	61.54
16561.	Patryk (grayek)	13	83.97	89.76	0	0.00
16562.	Brad (godspeed99)	13	86.12	91.93	4	30.77
16563.	Kenneth (godfetus)	13	104.78	117.83	6	46.15
16564.	glucose (glucose)	13	111.95	137.51	9	69.23
16565.	Robert (glixzor)	13	105.94	115.21	5	38.46
16566.	twitch.tv/giankid (gianthet...	13	160.27	173.69	11	84.62
16567.	Josh (ghostrider5346)	13	54.72	62.87	3	23.08
16568.	TMGAMING (ggatorade)	13	71.57	81.81	4	30.77
16569.	Gary (ggaarryy12340)	13	65.96	76.03	3	23.08
16570.	George (georgepj)	13	58.03	67.45	1	7.69
16571.	gian (geefuco)	13	79.75	96.84	3	23.08
16572.	Газиз (gazizaskar_)	13	47.45	56.19	0	0.00
16573.	Garv (garvgopalia)	13	45.62	52.92	2	15.38
16574.	Garrett (garrettn1899)	13	60.09	67.62	2	15.38
16575.	TypeLX (gamerleelxo)	13	123.49	135.39	6	46.15
16576.	Gabe (gabrielbj29)	13	64.19	83.31	4	30.77
16577.	oof (fyestrietser101)	13	125.36	145.57	9	69.23
16578.	^_^ (fuuje)	13	79.57	94.16	5	38.46
16579.	Albert (frequentflyer123)	13	100.18	108.17	5	38.46
16580.	jurj (fredkag)	13	98.63	115.99	3	23.08
16581.	Fedrick (freddybofte)	13	65.10	83.39	0	0.00
16582.	Saleh (foxtheonly)	13	50.91	65.86	1	7.69
16583.	foveacapitus (foveacapitus)	13	26.63	54.50	8	61.54
16584.	Ford Mustang (ford_mustang)	13	38.68	48.34	1	7.69
16585.	Dante (flukierclient)	13	70.92	84.30	4	30.77
16586.	Ivan (floki12_)	13	62.13	78.83	6	46.15
16587.	m (flashyyy)	13	104.09	123.15	13	100.00
16588.	fishy15 (fishy15)	13	115.48	138.64	6	46.15
16589.	Filipo (filipomarcel)	13	98.07	109.76	8	61.54
16590.	Fernando (fer_8888)	13	56.44	67.73	2	15.38
16591.	Luao (fencerperson)	13	76.13	88.62	3	23.08
16592.	Femosis (femosis)	13	103.45	123.63	6	46.15
16593.	Tim (fast_but_not_the_fastest)	13	101.62	117.33	6	46.15
16594.	Basil (falaedor)	13	85.00	95.00	4	30.77
16595.	m3dou_ (faheemmeharaj123)	13	46.49	84.24	6	46.15
16596.	Eva (evyrose2008)	13	55.97	70.18	1	7.69
16597.	Ethan (ethanxiaoful)	13	98.08	108.49	5	38.46
16598.	Eskooty (eskooty)	13	94.93	105.58	4	30.77
16599.	LilCup (epoli0319)	13	60.30	70.53	3	23.08
16600.	Epic (epicgamesceo)	13	85.18	102.89	5	38.46
16601.	Emilyyyy (emilyyyy26)	13	46.53	58.56	2	15.38
16602.	mle (emilyliz)	13	129.23	150.17	8	61.54
16603.	Elxius (elxius)	13	81.83	103.07	2	15.38
16604.	El (elnotelanor)	13	55.15	61.23	1	7.69
16605.	elay (elaytyping)	13	32.59	36.44	1	7.69
16606.	Elandaleb (elandaleb)	13	37.08	43.84	0	0.00
16607.	Glooberson (eifersucht)	13	82.02	93.90	3	23.08
16608.	efradagod (efradagod)	13	86.53	101.75	11	84.62
16609.	matu (eepilinemangur1)	13	128.77	174.03	5	38.46
16610.	zvgz (eclfppcmommarsuwof)	13	76.38	83.94	5	38.46
16611.	Ronnie (ebedebeds)	13	118.51	128.10	6	46.15
16612.	Drei (dy539)	13	78.64	85.29	2	15.38
16613.	darius (dxriuzs)	13	96.03	107.46	8	61.54
16614.	Chuck (dvorakmrcharles)	13	58.20	66.18	1	7.69
16615.	Anthony (duragsensei)	13	103.93	117.66	6	46.15
16616.	Martin (drudi1902)	13	64.32	73.50	3	23.08
16617.	DrPoppyseed (drpoppyseed)	13	81.84	90.50	3	23.08
16618.	Nikola (dropndrag)	13	61.55	72.51	2	15.38
16619.	Carrot (dreamsode)	13	108.17	116.62	6	46.15
16620.	Dream (dreamsnake)	13	96.93	125.37	5	38.46
16621.	DrDynamic (drdynamic)	13	82.69	100.98	1	7.69
16622.	dqwlol (dqwlol)	13	77.75	89.56	4	30.77
16623.	Perfection (doxxx)	13	133.28	159.55	11	84.62
16624.	Austin (dorrzun)	13	107.37	135.05	5	38.46
16625.	doodezpz (doodezpz)	13	93.59	111.47	5	38.46
16626.	Donnkey (donnkey)	13	103.55	119.67	5	38.46
16627.	nhentai (dongpo_pork)	13	98.81	113.21	7	53.85
16628.	Xian (doggy2021)	13	88.85	100.31	3	23.08
16629.	Troy (dogepowers)	13	89.80	102.53	2	15.38
16630.	Pisti (doctorstave)	13	100.31	110.87	8	61.54
16631.	DoctorN0gloff (doctorn0gloff)	13	134.38	156.19	9	69.23
16632.	David (dlefarth)	13	60.31	68.44	2	15.38
16633.	Do-Hyun (dkim00)	13	89.30	101.32	6	46.15
16634.	dirtydan (dirtyjdan)	13	67.19	71.63	4	30.77
16635.	Digo (digocorbellini)	13	81.62	94.34	4	30.77
16636.	Nash (digitalnash)	13	127.34	144.25	10	76.92
16637.	Diego (diego190401)	13	68.92	84.56	2	15.38
16638.	Diaa (diaa001)	13	55.58	73.80	2	15.38
16639.	Jacob (destroyer183)	13	75.06	90.90	4	30.77
16640.	Delviurge (delviurge)	13	102.58	110.24	7	53.85
16641.	JR (deltav)	13	98.75	112.00	4	30.77
16642.	Bang (dbgt0008)	13	91.03	106.12	8	61.54
16643.	Jepps (dazzle919)	13	117.86	149.79	6	46.15
16644.	david (davtet1)	13	88.39	109.42	6	46.15
16645.	Bebo (dark__knight_pro)	13	51.52	59.49	3	23.08
16646.	DarkLight (darklight17)	13	76.79	89.70	1	7.69
16647.	SWAPAN (dapana610)	13	45.30	53.35	1	7.69
16648.	Dan (danslaps)	13	84.49	98.58	3	23.08
16649.	Daniel (danielstep65)	13	93.19	108.37	3	23.08
16650.	Eric (dango499)	13	121.65	136.25	8	61.54
16651.	Adam (damadamadamm)	13	76.45	81.23	3	23.08
16652.	Matthew (d3f1n3d)	13	113.96	132.83	6	46.15
16653.	Nana (cypher404)	13	87.61	109.59	4	30.77
16654.	Cynthia (cynthiaparkk)	13	74.68	93.23	5	38.46
16655.	ethxn (cxntrxl)	13	88.01	99.79	4	30.77
16656.	cupnode (cupnode)	13	51.74	69.65	1	7.69
16657.	ymdsji (crostovik)	13	86.58	95.24	5	38.46
16658.	Himanshu (crestfalln)	13	54.40	58.65	2	15.38
16659.	Craig (craigo76)	13	60.95	72.70	1	7.69
16660.	coolslowboy (coolslowboy)	13	67.69	75.14	4	30.77
16661.	CoolGuyConnor (coolguyconnor)	13	81.76	91.61	3	23.08
16662.	Abrar (computernerdgenius)	13	64.70	75.47	4	30.77
16663.	RIP Zyzz (codecub)	13	159.43	187.60	10	76.92
16664.	Mike Oxlong (cmc_05)	13	43.77	50.10	4	30.77
16665.	Claire (claire_t_bear)	13	75.06	95.21	4	30.77
16666.	Mike (chomeror)	13	64.00	74.22	0	0.00
16667.	Chirag (chirag2907)	13	49.44	54.35	2	15.38
16668.	chipotle06 (chipotle06)	13	96.94	106.80	8	61.54
16669.	Chewing (chewing_bever)	13	98.84	118.01	7	53.85
16670.	slow typer (chessbobble)	13	85.40	104.26	6	46.15
16671.	Charles (charlesdickson1)	13	124.84	136.88	11	84.62
16672.	Charlie (chardlz)	13	100.54	118.24	6	46.15
16673.	Chandler (chandlerbing123)	13	72.93	82.38	4	30.77
16674.	chander (chanderpal)	13	49.40	54.75	0	0.00
16675.	Yuri (ceaseless_melon)	13	88.00	104.21	6	46.15
16676.	Charlie (cdicey)	13	85.15	103.93	4	30.77
16677.	Ententente (carousell)	13	88.43	99.89	6	46.15
16678.	Captain (captainrich)	13	69.88	83.92	4	30.77
16679.	canwithbeans (canikomaniko1)	13	59.28	72.87	2	15.38
16680.	cake (cake0)	13	142.24	163.49	13	100.00
16681.	Busky (buskyhusk)	13	94.03	105.56	7	53.85
16682.	Minh Kiet (buimonkey)	13	102.66	124.55	4	30.77
16683.	Bucky (buhcky)	13	96.70	123.39	5	38.46
16684.	Jacky (bubberducky209)	13	94.65	109.74	5	38.46
16685.	Ali (bronzor16)	13	95.10	105.99	1	7.69
16686.	Brecken (breckenmueller)	13	63.55	72.29	3	23.08
16687.	Bosco (bqscopog)	13	93.62	109.18	6	46.15
16688.	Borislav (borko_panterata)	13	73.10	85.99	3	23.08
16689.	boom (boompotato123)	13	79.20	93.78	3	23.08
16690.	serg (bobanuts)	13	81.39	93.33	7	53.85
16691.	Bernard's (bmadayag)	13	100.66	118.59	6	46.15
16692.	Mary (bloody_mary)	13	69.99	85.40	3	23.08
16693.	🤠👌🏿 (blackclaw)	13	96.85	108.05	6	46.15
16694.	bl731mang (bl731mang)	13	93.63	125.60	6	46.15
16695.	Hassan (bipedalfrog)	13	39.21	48.49	1	7.69
16696.	ed (bigponpon)	13	88.15	102.64	1	7.69
16697.	Slobodan (bekca)	13	96.48	111.74	4	30.77
16698.	Matthew (befurl)	13	75.52	97.63	5	38.46
16699.	Bedilbek (bedilbek)	13	58.52	66.75	4	30.77
16700.	Quang (baoquanggogreen)	13	58.03	73.96	2	15.38
16701.	NeverLucky (bambooaxe)	13	83.34	94.10	4	30.77
16702.	Balka (balka)	13	77.83	91.39	1	7.69
16703.	Dulguun (b180950039)	13	52.50	56.00	2	15.38
16704.	Aziz (azizxushvaqtov07)	13	53.68	66.45	4	30.77
16705.	John (avantegarden)	13	81.53	102.73	4	30.77
16706.	Ast (astrxse)	13	85.37	107.56	3	23.08
16707.	Ashish (ashish_m)	13	45.45	49.79	3	23.08
16708.	B A L O CH (ashfaq4730)	13	100.40	124.31	5	38.46
16709.	Arti (artifictional)	13	117.14	129.05	6	46.15
16710.	Arissa (arissahsu)	13	101.95	117.19	8	61.54
16711.	Arevilov (arevilov_3)	13	77.46	87.21	3	23.08
16712.	Aquatic (aquache)	13	84.36	101.05	1	7.69
16713.	Mr.Pickles (ap_ultra)	13	93.28	116.72	4	30.77
16714.	Andy (andym04)	13	116.29	139.85	9	69.23
16715.	Andrew (andvorak)	13	60.50	65.81	3	23.08
16716.	Ridge (anawesomefry)	13	85.84	104.82	6	46.15
16717.	Allen (analogaio)	13	112.25	139.19	6	46.15
16718.	amr (amr_el7afy)	13	33.98	38.98	1	7.69
16719.	AmirrezA (amirrezase7en)	13	92.80	106.89	5	38.46
16720.	Amiro (amiro74)	13	47.60	52.70	7	53.85
16721.	aluminae (aluminae)	13	99.41	113.80	5	38.46
16722.	h3llo (alowqo)	13	49.67	57.54	3	23.08
16723.	Abdulaziz (aligonijr)	13	59.45	73.40	3	23.08
16724.	AKW (alice1120)	13	77.12	86.74	3	23.08
16725.	AlexAustria (alexaustria)	13	81.69	88.06	5	38.46
16726.	Ayush (akushwaha11)	13	54.92	65.68	1	7.69
16727.	Akram (akrammiru)	13	53.00	59.55	1	7.69
16728.	akmal (akmalhisyam)	13	42.18	45.43	2	15.38
16729.	Akhil (akhillasrado)	13	82.01	96.98	3	23.08
16730.	Aidan (aidan9500)	13	84.38	94.46	3	23.08
16731.	Alan (affectedmelon)	13	91.60	106.27	4	30.77
16732.	Aye (aexerz)	13	69.52	89.08	3	23.08
16733.	Adam (aeoff72)	13	84.04	110.68	4	30.77
16734.	Adhitya (adhityanugraha96)	13	61.70	69.17	1	7.69
16735.	Adedhuman (adedhuman)	13	77.79	86.45	3	23.08
16736.	Marco (acopazzo)	13	81.33	91.74	8	61.54
16737.	Ace (ace_dragonheart)	13	79.00	103.32	2	15.38
16738.	abdullakh (abdullakh)	13	39.67	45.82	5	38.46
16739.	Tchaqazbilla (abdesslam47)	13	74.61	81.75	2	15.38
16740.	Issaranuwat (aatsaranuwis)	13	60.38	78.48	4	30.77
16741.	Danial (6reload)	13	50.07	55.97	4	30.77
16742.	Danillo/Avant (60ppm)	13	104.89	118.71	4	30.77
16743.	Esso (3sso)	13	85.81	104.02	0	0.00
16744.	itchyaminoacid (335080673)	13	89.93	98.40	3	23.08
16745.	1time (1time4da1time)	13	95.75	105.68	4	30.77
16746.	173adrimor (173adrimor)	13	55.76	69.79	4	30.77
16747.	Amanda (111_amanda_111)	13	45.06	59.62	0	0.00
16748.	ekrem. (100percentnonquit)	13	123.55	150.38	6	46.15
16749.	Dominic (dominic127)	13	83.64	94.70	5	38.46
16750.	Maizzie (maizzie)	13	109.94	133.04	4	30.77
16751.	QcDaark (qcdaark)	13	59.45	71.61	4	30.77
16752.	Harishan (hari1111)	13	98.34	113.50	5	38.46
16753.	brendan (brendan4t)	13	61.63	70.27	3	23.08
16754.	Metallic Pea (cooler420)	13	87.15	97.30	3	23.08
16755.	Keith (fingers_skills)	13	70.91	77.66	4	30.77
16756.	Gonen (gonengazit)	13	78.60	96.60	1	7.69
16757.	JSU (mr_funiman)	13	68.69	85.03	5	38.46
16758.	Matt (dabagraham)	13	84.69	102.39	2	15.38
16759.	Knight (knightbedo)	13	59.19	70.44	2	15.38
16760.	vasu (vasu021191)	13	75.66	86.67	6	46.15
16761.	granola (granolagobbler)	13	67.88	74.76	1	7.69
16762.	Kong (denusklo)	13	47.19	51.55	2	15.38
16763.	kaden (hobby273broken)	13	39.60	56.70	9	69.23
16764.	Rasmus (seglats)	13	48.31	56.65	0	0.00
16765.	AyK3r (junior_mlg12)	13	49.76	60.32	1	7.69
16766.	Kritika (phoenix_1307)	13	51.42	60.90	1	7.69
16767.	Jorge (sheparddow)	13	59.10	68.44	3	23.08
16768.	Welton (wxavier)	13	73.88	84.54	3	23.08
16769.	Shin (overgeared_god_grid)	13	71.08	80.88	1	7.69
16770.	CrayonMuncher (shanejefferson)	13	91.00	99.99	4	30.77
16771.	Zeph (zeph_)	13	74.89	92.66	13	100.00
16772.	forCodeIns (synowcode)	13	44.80	56.76	3	23.08
16773.	Marco (makoko)	13	39.81	45.73	4	30.77
16774.	Castlekeepers (castlekeepers)	13	86.68	98.30	2	15.38
16775.	Demon (demon_rocrip)	13	69.51	78.58	2	15.38
16776.	Alonso (lazerblade14)	13	60.81	80.25	1	7.69
16777.	Sigma.Driver (thotslayerron)	13	62.24	72.37	3	23.08
16778.	sunil (sunil1990)	13	51.14	57.45	2	15.38
16779.	Sophie (sophienguyen2004)	13	65.46	83.49	4	30.77
16780.	Gabriel (gabo16quito)	13	62.10	68.07	2	15.38
16781.	Adler (adlerbrin)	13	50.54	64.87	1	7.69
16782.	Typing_King (typing_king_123)	13	91.22	111.67	8	61.54
16783.	wooksen. (wooksen)	13	75.24	86.95	7	53.85
16784.	Simon (simon1293)	13	93.03	109.94	3	23.08
16785.	josesi (nuevetails)	13	56.75	76.96	2	15.38
16786.	Morsbøl (morsboel)	13	83.94	103.84	2	15.38
16787.	Marcie (dinkteam)	13	80.82	109.74	6	46.15
16788.	arrathore (arrathore)	13	95.57	120.72	4	30.77
16789.	jym (jjimjjam)	13	91.92	102.53	3	23.08
16790.	Max (rebel_dog)	13	47.88	56.44	0	0.00
16791.	Franco (franco404)	13	47.66	56.07	1	7.69
16792.	Tachy_Bunker (lo23co7mcpe)	13	90.54	99.66	8	61.54
16793.	Roronoa (roronoa_zoro007)	13	51.56	60.45	1	7.69
16794.	Alfonso (aagtyperacer)	13	47.98	61.58	2	15.38
16795.	Boy Wonder (coding_ninja)	13	54.05	67.96	4	30.77
16796.	Nook (nookydoki)	13	70.44	95.02	1	7.69
16797.	Charlie (charlzalan)	13	88.31	101.96	5	38.46
16798.	The_mayo (rilven)	13	56.97	63.30	1	7.69
16799.	Jerome (jerometan)	13	55.34	69.31	3	23.08
16800.	Harsh (captain_booga)	13	43.97	52.66	1	7.69
16801.	Sabila (sabilaferisya)	13	70.66	85.41	3	23.08
16802.	Kevyn (k3vsk1)	13	82.28	102.06	6	46.15
16803.	AntMan (antmanreis)	13	86.04	103.89	6	46.15
16804.	Audrey (aubreerybak)	13	90.64	101.24	4	30.77
16805.	Caitlin (lemoniio)	13	77.96	89.56	6	46.15
16806.	breadstick (main32134)	13	88.78	102.46	9	69.23
16807.	William (willythewilly)	13	65.98	85.78	1	7.69
16808.	Oussama (kappachier)	13	94.06	116.55	6	46.15
16809.	faizal (faizal104)	13	33.77	43.55	2	15.38
16810.	Darel (dareeellll)	13	73.12	84.09	3	23.08
16811.	Hashim (pheonixflame77)	13	41.19	48.56	0	0.00
16812.	Ilmari (kaljis)	13	45.59	50.37	2	15.38
16813.	Michael (michaeltol)	13	48.48	56.85	2	15.38
16814.	Khalifa (justkhalifa)	13	82.19	99.62	6	46.15
16815.	Jason Oh (sohleil)	13	75.24	82.93	3	23.08
16816.	Jun Kai (phangseafood)	13	50.28	59.67	1	7.69
16817.	Manjeet (manjeet1528)	13	48.72	61.91	1	7.69
16818.	FlameMage (flamemage)	13	98.44	111.62	4	30.77
16819.	Markee (itsmarkee)	13	75.95	98.86	7	53.85
16820.	Jasmine (jazzqt)	13	71.38	92.33	5	38.46
16821.	Ash (ashgen10)	13	38.15	42.65	1	7.69
16822.	takki (liltakki)	13	60.11	83.78	4	30.77
16823.	Himanshu (aatransh)	13	45.13	58.27	0	0.00
16824.	Kenkz (kenkodstark)	13	65.36	77.32	2	15.38
16825.	Nick (christophermarto)	13	54.43	64.79	4	30.77
16826.	Jakub (piorunpl)	13	65.07	75.70	2	15.38
16827.	DK (dkbozz)	13	65.81	70.99	4	30.77
16828.	Sky (_kuraaiii)	13	56.64	79.25	4	30.77
16829.	Sergio (sergio91)	13	53.91	59.98	3	23.08
16830.	CeepTheMaker101 (ceepthemak...	13	91.98	110.60	5	38.46
16831.	seashell (seashell508)	13	39.12	46.87	5	38.46
16832.	Dylan (ap0k)	13	91.31	101.09	5	38.46
16833.	BraveBer (braveber)	13	66.32	78.32	2	15.38
16834.	jiwanshu (jiwanshu_rajput)	13	44.12	62.01	3	23.08
16835.	Bintang (bintangdace)	13	91.02	100.30	1	7.69
16836.	Ahmed (__ahmed__)	12	80.03	87.58	6	50.00
16837.	Zoniax (_zephr)	12	87.77	111.96	4	33.33
16838.	Rodrigo (zurrion)	12	101.43	118.53	12	100.00
16839.	Zuhes (zuhes7)	12	81.14	89.96	5	41.67
16840.	zach (zinfinte57)	12	58.10	62.94	3	25.00
16841.	InVerse (zenmonkinverse)	12	90.34	101.06	5	41.67
16842.	zehvvu (zehvvu)	12	72.89	77.47	6	50.00
16843.	Zeerox (zeerox)	12	61.77	73.61	1	8.33
16844.	William (yuwan1)	12	52.70	77.01	2	16.67
16845.	Josh (yungjosh)	12	117.69	132.51	6	50.00
16846.	APPLE (ytfox_roller)	12	68.59	90.86	5	41.67
16847.	andy (yourmumgey)	12	100.25	128.97	5	41.67
16848.	Johannes (yoshgasm)	12	48.13	54.04	0	0.00
16849.	yellow (yellow00)	12	42.58	51.61	2	16.67
16850.	Ayaan Iftikhar YT (yeet_ayaan)	12	39.63	46.20	3	25.00
16851.	Yakti (yaktithewise)	12	91.10	104.10	8	66.67
16852.	Lorenzo (xxx69420xxx)	12	60.99	77.93	7	58.33
16853.	XXV6 (xxv6)	12	54.99	61.17	2	16.67
16854.	Hassan (xxhassanixx)	12	93.18	112.44	4	33.33
16855.	Erik (xuj1)	12	73.67	78.63	2	16.67
16856.	xLukeAzade (xlukeazade123)	12	57.70	67.27	1	8.33
16857.	xelopan (xelopan)	12	92.75	104.82	4	33.33
16858.	Xbeeft (xbeeft)	12	79.01	95.87	9	75.00
16859.	Jakub (xaneth)	12	100.80	115.61	4	33.33
16860.	レンゾ (wrenji)	12	81.74	92.88	2	16.67
16861.	Ryan (wow963)	12	146.26	164.67	11	91.67
16862.	David (wookiewarrior07)	12	85.79	100.54	3	25.00
16863.	Willie (williecubed)	12	104.27	116.34	4	33.33
16864.	William (willezur)	12	99.30	127.88	5	41.67
16865.	Wildan (wildan_fachriz24)	12	67.22	81.35	4	33.33
16866.	John (wegelius)	12	77.75	102.18	3	25.00
16867.	Arvid (warpzep)	12	51.29	68.22	0	0.00
16868.	Eric the Topre King (wanger...	12	130.59	155.96	9	75.00
16869.	Walfel (walfel)	12	83.54	97.39	3	25.00
16870.	Wahid (wahidhamidi707)	12	51.94	63.58	1	8.33
16871.	Dorime (vojing)	12	112.59	123.22	6	50.00
16872.	Vlad (vlados_shikos)	12	73.28	91.62	0	0.00
16873.	Viper (viper04)	12	74.65	89.52	5	41.67
16874.	Vigeous (vigeous)	12	38.24	51.93	2	16.67
16875.	Vin (vibnarcus)	12	72.33	80.35	4	33.33
16876.	Kyle (vertwon)	12	60.42	68.26	2	16.67
16877.	Steven (venste_)	12	72.17	79.59	1	8.33
16878.	Alexander (vennor)	12	81.58	95.82	3	25.00
16879.	Josh (velocity92c)	12	121.23	140.43	7	58.33
16880.	Javi (vatojavier)	12	42.78	54.57	2	16.67
16881.	violet (validfingers)	12	95.95	106.56	12	100.00
16882.	uxvb (uxvb)	12	109.36	143.83	5	41.67
16883.	Unknownbean (unknownbean)	12	67.85	84.27	0	0.00
16884.	Bojack (uberjoe)	12	110.99	133.12	7	58.33
16885.	in (uaqlover)	12	36.33	43.17	1	8.33
16886.	default car (typingslowly)	12	99.12	112.92	6	50.00
16887.	Typing (typinglegend16)	12	76.95	88.29	3	25.00
16888.	karl (type_of_all_types)	12	67.49	76.69	5	41.67
16889.	S (typer78)	12	28.90	32.21	2	16.67
16890.	Tom (twmc)	12	99.92	128.89	8	66.67
16891.	(tulasaeueng)	12	92.33	101.58	2	16.67
16892.	Zoomies (tthuang1998)	12	98.73	116.31	5	41.67
16893.	Rudolf (trudo)	12	71.18	78.48	4	33.33
16894.	TroulM (troulm)	12	88.06	102.85	4	33.33
16895.	TrainTrains (traintrains)	12	71.73	89.48	4	33.33
16896.	Arthur Toppenberg (tpperware)	12	49.18	57.57	7	58.33
16897.	Eric (toniseo)	12	73.60	81.10	6	50.00
16898.	Nadhim (tnadhim)	12	58.71	75.78	1	8.33
16899.	Alex B (tisan05)	12	69.28	87.33	6	50.00
16900.	Stifmeister (the_stifmeister)	12	107.67	133.41	8	66.67
16901.	. (the_ohioan)	12	90.98	100.23	2	16.67
16902.	yoshi (themune)	12	84.49	95.79	1	8.33
16903.	Seth (thefoxarmy)	12	77.35	90.64	4	33.33
16904.	Daan (thedr3aded)	12	78.57	96.17	4	33.33
16905.	Amy (thedoctastardis)	12	51.45	64.22	1	8.33
16906.	cring (thatguyyoudontknow)	12	69.17	86.43	4	33.33
16907.	A (terrible_penguin)	12	56.35	68.76	1	8.33
16908.	Terkozz (terkozz)	12	67.85	88.89	3	25.00
16909.	Tom (tcrman)	12	70.41	82.95	1	8.33
16910.	tangjm5 (tangjm5)	12	107.36	117.43	8	66.67
16911.	TacticalTux (tacticaltux)	12	119.20	130.15	9	75.00
16912.	Tosic (t0sic)	12	86.94	95.09	6	50.00
16913.	Arles (synthicalarles)	12	61.38	73.45	12	100.00
16914.	swxh89 (swxh89)	12	109.35	124.45	8	66.67
16915.	Sweefty (sweefty)	12	71.76	79.31	2	16.67
16916.	Allen (swaggerinooo)	12	112.18	135.99	11	91.67
16917.	Benjie (superbench03)	12	76.98	92.94	2	16.67
16918.	Duc (sungjinwoo2001)	12	48.47	56.11	1	8.33
16919.	sungit2g (sungit2g)	12	80.75	96.03	3	25.00
16920.	May (suddy)	12	52.24	60.03	2	16.67
16921.	Josh (cuddlysamurai)	12	46.52	56.58	0	0.00
16922.	Strudle (strudlepoodel)	12	102.98	113.01	8	66.67
16923.	frog (strawfrog)	12	86.49	94.62	5	41.67
16924.	Manuel (stonesitter)	12	70.11	79.12	2	16.67
16925.	Stewhog (stewhog)	12	55.94	76.50	2	16.67
16926.	Steve (steve5731)	12	84.63	95.64	4	33.33
16927.	Stella (stellaoctangula)	12	80.60	99.24	1	8.33
16928.	Sergey (steelassasin)	12	68.54	77.77	1	8.33
16929.	Marshall (stackattack14)	12	100.80	118.15	7	58.33
16930.	📵 (sstormwolf22)	12	105.66	123.30	2	16.67
16931.	u slow (spyie)	12	37.62	44.36	3	25.00
16932.	Splash (splashcc)	12	108.27	119.15	7	58.33
16933.	Faleye Slaven (speedhell)	12	30.04	35.12	2	16.67
16934.	Spafa (spafa)	12	93.66	110.95	5	41.67
16935.	spacehrt (spacebop)	12	73.52	90.84	2	16.67
16936.	Ui (so_ta)	12	83.25	96.75	7	58.33
16937.	Soul (soul_eater22)	12	77.10	98.34	2	16.67
16938.	soopasoop (soopasoop)	12	48.16	54.91	1	8.33
16939.	sompur (sompurkrz)	12	86.85	95.24	4	33.33
16940.	(solov)	12	168.86	215.13	11	91.67
16941.	Daniel (smurfzilla)	12	76.26	101.05	5	41.67
16942.	Stacie (slyfoxxli)	12	72.27	88.64	4	33.33
16943.	shams (slo_shams)	12	29.44	34.82	1	8.33
16944.	MrBoombastic (sloth_express)	12	60.39	66.59	0	0.00
16945.	sanic (sleepmoar)	12	118.63	141.66	11	91.67
16946.	Pau (skuhls)	12	58.29	63.18	1	8.33
16947.	Nicolas (skinny13timmy)	12	90.68	98.98	2	16.67
16948.	taichi (sjwsl)	12	59.41	68.42	2	16.67
16949.	Ofir (sipthesoup)	12	86.30	99.05	4	33.33
16950.	Simmons2 (simmonsgarbageacc...	12	72.26	91.07	9	75.00
16951.	Chris (silentshot64)	12	89.97	99.38	6	50.00
16952.	Sierra (sierrasetliff)	12	62.12	73.14	3	25.00
16953.	Siddarth (siddthekid1)	12	41.74	50.66	2	16.67
16954.	Justin (shouganai_1243)	12	63.69	79.47	1	8.33
16955.	Oscar (shopsketch)	12	59.79	65.19	1	8.33
16956.	Shoden (shoden)	12	69.63	77.54	4	33.33
16957.	Shilo (shilomazouz)	12	72.08	78.43	4	33.33
16958.	Shayaan (shayaan206)	12	52.64	65.44	0	0.00
16959.	Shantanu (shatanu)	12	58.18	70.27	1	8.33
16960.	Sharon (sharon102)	12	42.97	49.98	1	8.33
16961.	Aran (sharon032588)	12	96.54	122.38	5	41.67
16962.	Big Booty T (sexy_dino)	12	87.42	95.92	2	16.67
16963.	sen (senoryx)	12	47.24	55.93	4	33.33
16964.	Sendy (sendyakbar)	12	79.93	88.87	3	25.00
16965.	SAIF (sci_fi_saif)	12	59.07	66.34	2	16.67
16966.	ScanCode (scancode8)	12	59.72	74.49	1	8.33
16967.	solsol (scakes)	12	72.18	83.36	2	16.67
16968.	Sam (sbush)	12	57.09	69.86	1	8.33
16969.	Sausage (sausage_person)	12	77.39	89.43	3	25.00
16970.	Saruwatori (saruwatori)	12	81.49	87.18	4	33.33
16971.	sara (saramcr)	12	44.16	49.02	0	0.00
16972.	Indic (sanatanify)	12	73.33	81.29	4	33.33
16973.	tstats[sajald77] (sajald77)	12	79.65	92.69	1	8.33
16974.	sacresful (sacresful)	12	86.21	94.95	3	25.00
16975.	btst (sabelle_)	12	129.72	145.29	5	41.67
16976.	sıןʌɥɹ (s1lvhr)	12	88.52	95.56	3	25.00
16977.	Vali (ryuzul)	12	100.03	129.08	9	75.00
16978.	Jeremy (ryusaki626)	12	80.28	93.91	7	58.33
16979.	Rudra (ryder_on_the_storm)	12	96.72	112.66	9	75.00
16980.	R (ry20)	12	93.30	101.85	7	58.33
16981.	Run (runring)	12	63.51	74.68	3	25.00
16982.	T Lewis (runnamok)	12	61.28	67.08	5	41.67
16983.	Ralph (rotifer_)	12	47.40	65.63	2	16.67
16984.	Shamsuddin (rony0092)	12	43.88	49.68	1	8.33
16985.	Tí cần không bạn (ron...	12	59.27	74.33	2	16.67
16986.	Hi (rom_s)	12	56.47	64.92	1	8.33
16987.	Sergi (rolodophone)	12	74.01	86.62	4	33.33
16988.	Jem (rollingapple)	12	101.51	123.10	8	66.67
16989.	Rokuazery (rokuazery)	12	83.90	92.04	2	16.67
16990.	Rohan (rohan625)	12	54.45	63.51	0	0.00
16991.	Julian (rocky_succ)	12	82.66	94.01	2	16.67
16992.	robby (robby27)	12	71.86	82.56	4	33.33
16993.	Arminda (rmnduhh)	12	93.04	109.23	5	41.67
16994.	Jim (rl_magikz)	12	55.28	68.01	4	33.33
16995.	John (rlawldjs)	12	64.96	72.23	2	16.67
16996.	Ritam (ritam_123)	12	79.23	87.23	6	50.00
16997.	Rikos99 (rikos_omegalul)	12	68.44	80.83	4	33.33
16998.	e (revengepug)	12	102.07	123.96	8	66.67
16999.	George (relaxed_20)	12	58.75	69.93	1	8.33
17000.	gabe (rasalguhl)	12	99.53	106.76	2	16.67
17001.	Yokaii (rartiko)	12	63.10	75.81	0	0.00
17002.	Caio (raposo)	12	62.19	70.93	3	25.00
17003.	Alex (ramini0000)	12	62.71	68.95	2	16.67
17004.	Grant (ragecandybar)	12	86.97	102.86	5	41.67
17005.	aerar (raale)	12	82.18	102.49	5	41.67
17006.	Attican (r4ne)	12	76.82	86.53	2	16.67
17007.	rocky (r0ckyy)	12	61.53	71.32	1	8.33
17008.	Desh (quickzero)	12	106.92	121.52	3	25.00
17009.	julian (quasiker)	12	84.08	104.05	4	33.33
17010.	punj (punj)	12	76.80	87.62	2	16.67
17011.	cockn (pugzip)	12	59.59	71.73	4	33.33
17012.	oleg (prot64)	12	76.76	92.01	3	25.00
17013.	Pratham (pratham522)	12	43.90	49.01	1	8.33
17014.	gb (practicegb)	12	92.37	110.48	4	33.33
17015.	Prabhu (prabhusengal)	12	85.06	97.14	4	33.33
17016.	Param (pparam5241)	12	77.95	89.41	6	50.00
17017.	posaidon (posaidon0802)	12	86.34	97.37	4	33.33
17018.	poparaliais (poparaliais)	12	80.15	95.19	4	33.33
17019.	Jared (pizzj)	12	74.63	85.20	3	25.00
17020.	pizzapablo (pizzapablo)	12	71.87	82.45	12	100.00
17021.	Pine (pinechristmas)	12	68.57	79.11	4	33.33
17022.	pigeon (pigeon_kun)	12	90.08	108.60	2	16.67
17023.	Phobic (phobic21)	12	65.71	81.82	7	58.33
17024.	Duy (phamanhduy1990)	12	72.38	80.25	0	0.00
17025.	petnob (petnob1987)	12	57.65	65.15	2	16.67
17026.	Vicky (person4115)	12	99.10	122.86	2	16.67
17027.	Andrew (penguingm1)	12	114.55	129.62	8	66.67
17028.	Pika (paxn)	12	89.83	104.69	4	33.33
17029.	Mr nyash (paw_sensei)	12	62.53	71.78	2	16.67
17030.	Paulian (paulian7)	12	90.39	117.59	2	16.67
17031.	Arttu (patu556)	12	57.07	63.03	0	0.00
17032.	Parag (paranolverizer)	12	50.82	61.17	4	33.33
17033.	Dejan (paranoid112122)	12	44.78	52.58	2	16.67
17034.	Pan con Palta (panconpalta123)	12	70.42	91.34	2	16.67
17035.	Padwes (padz_kurawa)	12	79.39	96.53	5	41.67
17036.	Owen (owentemp)	12	40.26	50.02	1	8.33
17037.	Osso (ossobuko)	12	61.42	66.17	2	16.67
17038.	HM (opwpahfohuaehiodbfaiwvb...	12	67.15	76.08	2	16.67
17039.	omnomnomnom (omnomnomnomnom...	12	68.97	79.26	3	25.00
17040.	Omar (omar_letaief)	12	81.85	92.54	2	16.67
17041.	Nathan (oliblish)	12	82.42	100.42	1	8.33
17042.	twin (oiaao)	12	55.65	63.02	2	16.67
17043.	prince (ohnoheisgoodxd)	12	78.09	87.80	12	100.00
17044.	ochko (ochkofficial)	12	72.45	85.87	6	50.00
17045.	Pepper (ocean_orca)	12	51.35	56.35	2	16.67
17046.	VietCoffee (nytrogen99)	12	117.63	134.00	10	83.33
17047.	Nyle (nyle_14)	12	80.47	87.87	4	33.33
17048.	Nghia (ntn20112006)	12	87.16	102.93	3	25.00
17049.	spoon (noyoureaspoon)	12	88.43	101.69	5	41.67
17050.	not a typerace account (not...	12	49.01	59.35	4	33.33
17051.	Aaron (noobschizz)	12	64.73	72.41	2	16.67
17052.	Andrew (noobhunter)	12	124.72	143.32	4	33.33
17053.	Nicholas (nkaechele)	12	80.21	89.26	3	25.00
17054.	ninguart (ninguart)	12	102.79	126.68	6	50.00
17055.	Much (nikitin)	12	86.27	92.06	4	33.33
17056.	Liema (nidoc)	12	77.07	86.73	12	100.00
17057.	Nick (nickjj)	12	66.59	83.92	3	25.00
17058.	Van (nickislit14)	12	77.99	87.63	7	58.33
17059.	Niaz (niaztypist)	12	36.34	43.80	0	0.00
17060.	Phuc (nholoinhoi)	12	85.42	97.66	5	41.67
17061.	Qwerty (nhaye23)	12	58.55	69.03	0	0.00
17062.	wen (neverwen)	12	96.38	116.49	5	41.67
17063.	Serena (nerdyjoker)	12	108.08	122.70	6	50.00
17064.	Neil (neilprime16)	12	84.25	106.10	4	33.33
17065.	Vickus (natowns24)	12	81.22	96.81	3	25.00
17066.	Nils Backman (naip12)	12	63.54	87.15	4	33.33
17067.	Krombaa (nadergharsallah)	12	54.67	64.51	4	33.33
17068.	Midhun (mythicalun)	12	112.51	132.93	8	66.67
17069.	Blake (mysticz8)	12	59.78	71.07	2	16.67
17070.	Mike (mybroom10)	12	85.86	112.61	3	25.00
17071.	Rohit (murphy053)	12	64.21	71.45	0	0.00
17072.	Mason (mtyperxd)	12	66.84	79.98	5	41.67
17073.	Slowpez (mr_slowpez)	12	98.31	110.93	1	8.33
17074.	barrack (mr_sandwich1871)	12	105.97	128.25	6	50.00
17075.	Marc (mrthegreattypist)	12	55.62	64.08	1	8.33
17076.	lhagvaag0d (mr4thousands_)	12	36.67	44.30	5	41.67
17077.	Anton (mountainhills)	12	77.38	96.28	2	16.67
17078.	austin (monkey648)	12	103.11	119.17	5	41.67
17079.	Moniba (moniba)	12	52.39	58.81	0	0.00
17080.	mohamed (mohamed_rekaya)	12	57.85	75.60	2	16.67
17081.	Steven (misterpear)	12	117.04	128.88	4	33.33
17082.	migueles (miqriba)	12	61.78	69.03	3	25.00
17083.	Peter (minend)	12	104.07	127.43	9	75.00
17084.	jhon (millkman)	12	35.21	40.15	1	8.33
17085.	mildlyaggressivecherry (mil...	12	101.87	112.28	6	50.00
17086.	Mike (mikystevan)	12	81.37	91.93	3	25.00
17087.	Mike (mike6)	12	54.16	64.34	0	0.00
17088.	Mikayla (mikaylahumphrey)	12	107.79	128.47	6	50.00
17089.	Micah (micahnical)	12	82.19	107.52	1	8.33
17090.	Nikolaj (mexination)	12	52.88	65.16	0	0.00
17091.	Mexero (mexero)	12	37.40	41.43	1	8.33
17092.	Prakhar (menate)	12	64.49	81.58	4	33.33
17093.	Melo (melolem)	12	67.48	75.52	4	33.33
17094.	bokonet (mehrshadk05)	12	66.23	74.85	7	58.33
17095.	platnot (mega2053)	12	86.92	103.35	8	66.67
17096.	Mbenga (mbenga)	12	80.01	100.05	2	16.67
17097.	Sofia (mayi_o4)	12	70.49	87.51	7	58.33
17098.	Julian (mataleao)	12	64.98	71.78	2	16.67
17099.	patrick (mastercraft33)	12	58.01	67.78	3	25.00
17100.	Magister (masterbert02)	12	60.39	66.97	6	50.00
17101.	Perestoronina (mashavtnke)	12	54.17	65.45	1	8.33
17102.	Martin (martin_juan)	12	75.41	85.51	3	25.00
17103.	Martin (martinthebest)	12	103.41	121.64	6	50.00
17104.	Kayla (martina1155)	12	30.41	36.54	1	8.33
17105.	Marie (marsiepatootie)	12	77.96	99.61	4	33.33
17106.	TyperRacer (marccraft)	12	86.73	100.84	3	25.00
17107.	Manraj (man_123lama)	12	78.18	90.53	3	25.00
17108.	Manish (manishspot)	12	56.44	62.18	2	16.67
17109.	Manguy McPersonface (manguy...	12	66.43	79.78	3	25.00
17110.	Kyunghwan (mallardk0h)	12	84.37	100.22	2	16.67
17111.	M (maddyjune)	12	86.11	104.51	2	16.67
17112.	Mada (mada_)	12	94.57	106.51	1	8.33
17113.	Manoj (m00npie)	12	55.65	62.73	3	25.00
17114.	thompson (lulugaming_da_pro...	12	79.78	88.35	7	58.33
17115.	LUka (lukazmaj)	12	54.74	62.67	3	25.00
17116.	(luclukiluc)	12	82.23	94.99	3	25.00
17117.	lubi222 (lubi222)	12	124.09	140.97	6	50.00
17118.	LordxChongo (lordxchongo)	12	47.86	62.71	7	58.33
17119.	Locklyn (locky_)	12	84.08	102.31	2	16.67
17120.	Lori (ljflute)	12	95.72	119.38	4	33.33
17121.	Lizard (lizardk99)	12	95.42	108.46	4	33.33
17122.	fusaishi (litaoge)	12	81.11	93.13	7	58.33
17123.	Le Linh (linhkhanhslee)	12	46.29	55.39	1	8.33
17124.	Lily (lilythemc)	12	63.14	73.81	0	0.00
17125.	Nandies (lilnandies)	12	64.93	73.44	3	25.00
17126.	Hisoka (lev872)	12	30.98	35.61	2	16.67
17127.	Lila_lut (lei_ruth)	12	73.36	84.32	4	33.33
17128.	Iota (legendary_alpha)	12	57.61	65.15	7	58.33
17129.	Leang (leangsopoar)	12	48.69	55.53	0	0.00
17130.	britney (leah8jean)	12	47.68	62.05	2	16.67
17131.	Jan (latino_dino)	12	47.18	54.15	0	0.00
17132.	cyamon (kuthiphenchodi)	12	92.39	109.87	5	41.67
17133.	Christian (kunuc)	12	89.37	102.39	5	41.67
17134.	Krutik (krutikp)	12	66.51	74.50	3	25.00
17135.	kovi (kovizzz)	12	100.88	121.63	4	33.33
17136.	Koshi (koshigaming)	12	94.69	110.80	5	41.67
17137.	Knot (knotcj)	12	69.81	85.89	4	33.33
17138.	Klog (klog53)	12	104.94	122.64	5	41.67
17139.	matt (kingspyfox)	12	60.34	68.35	3	25.00
17140.	BingBong (kingcaiden66)	12	99.10	110.18	5	41.67
17141.	Orban (killhorizon23)	12	73.32	87.90	2	16.67
17142.	Kebee (kevwickz)	12	92.10	100.49	7	58.33
17143.	Herb (kellzer)	12	82.23	99.03	4	33.33
17144.	Kean (kean_saneki)	12	71.48	89.26	2	16.67
17145.	Kunal (kc596)	12	69.64	75.23	1	8.33
17146.	John (kasi95)	12	68.28	78.22	4	33.33
17147.	Kanav (kanav__trying)	12	55.41	64.20	0	0.00
17148.	Chris Jozef Cad (kamireign)	12	98.72	112.05	5	41.67
17149.	Kacper (kacpix2000)	12	109.17	145.07	8	66.67
17150.	Lev (kaberan)	12	34.27	39.64	0	0.00
17151.	🤜🏻 (k1s_darya)	12	89.14	101.98	2	16.67
17152.	Joe (jych0)	12	83.20	95.53	6	50.00
17153.	jwt4517 (jwt4517)	12	99.82	111.07	8	66.67
17154.	L (just_a_random_guy_123)	12	71.39	83.11	2	16.67
17155.	isaac (justisaac5)	12	76.17	87.24	0	0.00
17156.	Julian (julianjelfs)	12	59.49	69.87	1	8.33
17157.	JuanDeag111 (juandeag111)	12	83.82	94.58	3	25.00
17158.	n (jtrondy)	12	90.49	103.76	6	50.00
17159.	Flank (jtall4747)	12	81.07	99.94	1	8.33
17160.	JOSH (jo_dpe)	12	82.15	96.48	3	25.00
17161.	jonathan (joschio_o)	12	66.32	79.17	1	8.33
17162.	Jonathan (jon_daub)	12	82.43	105.17	2	16.67
17163.	Esketit (jony1525)	12	95.47	112.09	7	58.33
17164.	Johnny (johnnytct)	12	73.89	87.05	6	50.00
17165.	Joel (joel10)	12	48.79	54.87	3	25.00
17166.	Joseph (joegoldman)	12	105.40	115.18	8	66.67
17167.	Jared (jm1289)	12	58.36	66.30	3	25.00
17168.	jimi (jimi79)	12	92.85	108.58	10	83.33
17169.	Jay (jgupta)	12	98.32	116.83	6	50.00
17170.	asldjf (jfulle3518)	12	111.62	132.32	6	50.00
17171.	Jess (jessnguy)	12	58.42	72.71	1	8.33
17172.	A (jenniesana)	12	74.03	91.46	5	41.67
17173.	Triết (jean2002)	12	40.42	47.63	4	33.33
17174.	Jd (jdthebeanbag)	12	58.85	67.14	1	8.33
17175.	Jatin (jcsteelbender)	12	95.83	106.89	6	50.00
17176.	Michael (javamorris)	12	101.73	114.63	6	50.00
17177.	Debbie (jaedee_debbie)	12	68.42	82.96	4	33.33
17178.	Tim (jackychan564)	12	100.98	129.47	4	33.33
17179.	Jackson (jacksons123)	12	94.99	109.82	2	16.67
17180.	jachym (jachymneumipsat)	12	41.89	48.44	0	0.00
17181.	Justin (iukekini)	12	105.57	115.53	6	50.00
17182.	Bryle (itsbrytastic)	12	100.16	114.74	7	58.33
17183.	sasuke_uchihha (ironman1123)	12	61.57	67.97	0	0.00
17184.	Duy (invinduy)	12	82.24	100.94	10	83.33
17185.	Intesar (intesar)	12	61.83	71.13	3	25.00
17186.	InfiniteCows (infinitecows)	12	98.50	113.08	8	66.67
17187.	Azer (imranovazer)	12	38.50	53.02	0	0.00
17188.	tstats[ilyadancshp] (ilyada...	12	66.42	72.36	3	25.00
17189.	Alonso (igoalonso)	12	63.20	75.70	3	25.00
17190.	Moatasem (idolzy_123)	12	104.84	119.14	5	41.67
17191.	Erin (iceflake)	12	84.59	101.62	3	25.00
17192.	Daniel (ibedacaptainofdaship)	12	103.05	121.60	4	33.33
17193.	VPK (iamvpk)	12	87.11	103.12	6	50.00
17194.	Adam (iadam368)	12	72.36	81.95	10	83.33
17195.	yoyo (i0y0)	12	53.17	60.04	0	0.00
17196.	Andrew (hurricaneandrewbs)	12	85.44	96.96	2	16.67
17197.	Hunter (hunterschool22)	12	103.35	116.33	8	66.67
17198.	Hramich (hramich)	12	57.22	64.07	2	16.67
17199.	Name (housewren)	12	112.40	140.47	8	66.67
17200.	houka (houka)	12	79.15	97.01	6	50.00
17201.	Peter (hoopla27)	12	75.09	89.49	3	25.00
17202.	Juan Raphael (homonovus97)	12	51.72	56.83	1	8.33
17203.	awesome (hobo223)	12	91.43	101.80	5	41.67
17204.	I_will_not_tell (hitme1111)	12	24.34	28.31	1	8.33
17205.	doubt (hightness)	12	86.25	95.30	3	25.00
17206.	xi (highrizery)	12	70.30	78.21	2	16.67
17207.	hhh (hhhaaahhhaa)	12	74.95	89.15	3	25.00
17208.	Alex (heikale)	12	59.56	75.92	1	8.33
17209.	Afifu (healme)	12	60.81	74.00	4	33.33
17210.	Henry (hchen1021)	12	79.60	92.97	3	25.00
17211.	Janet (hasuhime)	12	70.31	85.99	4	33.33
17212.	Hashrin (hashrin)	12	75.83	94.51	4	33.33
17213.	Harsha (harshatalla)	12	64.98	79.11	3	25.00
17214.	Ahsan (haris_ahmed)	12	95.76	106.06	11	91.67
17215.	harcipulyka (harcipulyka)	12	71.02	79.90	3	25.00
17216.	Haotian (haotianxu)	12	106.70	120.85	4	33.33
17217.	j (hanjam)	12	81.19	88.20	4	33.33
17218.	Maurice (halpibad)	12	49.23	60.22	1	8.33
17219.	cleve. (haipong)	12	123.17	137.28	8	66.67
17220.	Kevin (hadoukevin)	12	90.48	101.56	4	33.33
17221.	Joseph (gov_issued)	12	97.35	108.56	0	0.00
17222.	Zack (goodguyzack)	12	79.52	94.65	9	75.00
17223.	GIMLY98 (gimly98)	12	88.01	111.61	5	41.67
17224.	Giancarlo (giancarlo_sturla7)	12	97.75	108.17	5	41.67
17225.	George (georgedmi)	12	74.83	83.00	0	0.00
17226.	Deepak (gdn_td)	12	77.74	92.49	5	41.67
17227.	Jayden (gaminglz)	12	85.41	101.85	3	25.00
17228.	Michel (gamerz026)	12	93.80	108.63	5	41.67
17229.	Friz64 (friz64)	12	78.36	95.91	0	0.00
17230.	FrankSauve (franksauve)	12	67.65	80.68	4	33.33
17231.	Foxrumor (foxrumor)	12	67.18	81.98	5	41.67
17232.	Joel (fonke)	12	80.04	100.64	4	33.33
17233.	Matt (flamingbear)	12	79.98	89.80	7	58.33
17234.	Filip (filipge)	12	47.53	54.71	1	8.33
17235.	Finch (ficxjo)	12	117.93	146.31	6	50.00
17236.	fetix (feticks)	12	93.82	121.63	2	16.67
17237.	Hien (feederchuluc96)	12	50.59	58.26	1	8.33
17238.	Fangxing (fangoling)	12	56.85	64.79	3	25.00
17239.	A (fancy_potato)	12	61.59	85.97	3	25.00
17240.	Fabian (fabiangomez)	12	94.60	100.93	4	33.33
17241.	etienne (etiennne)	12	113.02	122.45	6	50.00
17242.	Ethan (ethantai)	12	110.88	125.60	8	66.67
17243.	Robert (ert00034)	12	114.90	128.85	4	33.33
17244.	Eric (ericplayz132)	12	122.99	133.87	7	58.33
17245.	Elvar (elvar333)	12	71.39	89.57	2	16.67
17246.	Mohamed (elhedeq)	12	35.60	38.65	0	0.00
17247.	Cristian (electpit)	12	57.95	65.71	0	0.00
17248.	Ekshore (ekshore)	12	75.81	92.10	3	25.00
17249.	Faquarl (ekrpat)	12	93.98	111.49	6	50.00
17250.	Eichi (eichitenshouin)	12	100.26	120.58	5	41.67
17251.	Egyptian (egyptianlion)	12	105.79	114.46	7	58.33
17252.	Zac (eastunder)	12	70.03	90.83	7	58.33
17253.	dylan (dywan)	12	85.80	98.00	5	41.67
17254.	Daniel (dxnielz)	12	94.70	109.15	12	100.00
17255.	David (dwang05)	12	102.53	117.43	4	33.33
17256.	Durga (durga32670)	12	47.57	56.48	2	16.67
17257.	Adrianus (dungonmahshoe)	12	93.93	116.48	4	33.33
17258.	duncs (duncs)	12	89.21	103.95	9	75.00
17259.	Duke (dukemagnum)	12	80.68	94.56	1	8.33
17260.	D (ducktypist)	12	104.02	116.06	5	41.67
17261.	Insub (dskumpf)	12	99.00	110.10	7	58.33
17262.	Ariel (drofniarg)	12	101.03	120.51	7	58.33
17263.	D1eg8 (drm86)	12	74.85	86.61	5	41.67
17264.	Dennis (doxalite)	12	61.95	80.44	4	33.33
17265.	Ian (doughs)	12	102.48	125.26	5	41.67
17266.	Doug (dougdimmadan)	12	102.07	114.00	6	50.00
17267.	DosU (dosu)	12	40.23	44.69	0	0.00
17268.	Kevin (dostoyevksy)	12	28.83	36.73	3	25.00
17269.	Dodi (dodic)	12	100.89	108.01	5	41.67
17270.	David (djtm)	12	70.48	76.98	4	33.33
17271.	Dexter (dextergamer)	12	61.71	68.56	4	33.33
17272.	something (destroyer27777)	12	81.05	92.11	1	8.33
17273.	Deron (deron_09)	12	48.17	66.68	3	25.00
17274.	Derek (derekyeh)	12	44.24	53.35	0	0.00
17275.	denzel (dennzzz)	12	73.39	79.80	2	16.67
17276.	DenDu (dendu_respekt)	12	50.81	61.92	6	50.00
17277.	deej (deej195)	12	86.26	96.76	1	8.33
17278.	Declan (dec13)	12	52.64	61.24	6	50.00
17279.	not_that (darkmaster_30)	12	71.51	82.43	7	58.33
17280.	Daniel (danoco)	12	46.37	53.78	0	0.00
17281.	dankerkys (dankerkys)	12	59.02	79.64	7	58.33
17282.	Dani (danivideda)	12	74.27	91.47	4	33.33
17283.	Daniel (dalord)	12	61.61	70.51	2	16.67
17284.	Dakize (dakice)	12	90.18	102.49	5	41.67
17285.	daebro (daebro)	12	80.87	95.02	6	50.00
17286.	CybrZero (cybrzero)	12	53.43	65.98	2	16.67
17287.	Curtis (curtisz)	12	85.90	97.64	3	25.00
17288.	Zxar (cubercubed)	12	72.37	82.10	4	33.33
17289.	Nico (cuber)	12	117.67	148.73	4	33.33
17290.	JP (cryoblivious)	12	83.90	97.12	5	41.67
17291.	Crescendo (crescendot)	12	97.38	115.50	6	50.00
17292.	CrazyhourXD (crazyhourxd)	12	72.11	79.77	3	25.00
17293.	gaoshan (crazydonkehhhhh)	12	77.15	92.17	3	25.00
17294.	Crafty (craftywastaken)	12	92.45	113.34	6	50.00
17295.	aziz (cornea)	12	50.33	55.42	1	8.33
17296.	Bean (cornbreadman)	12	81.02	106.92	9	75.00
17297.	Eric (cool_armadillo)	12	85.35	100.25	5	41.67
17298.	Tyson (cooldude1800)	12	68.23	76.51	4	33.33
17299.	Val (codehacker707)	12	98.69	113.89	6	50.00
17300.	clout (clouted)	12	80.25	97.03	3	25.00
17301.	Clarissa (clarissaclaa)	12	68.30	75.16	1	8.33
17302.	Citizen404 (citizen404)	12	89.07	97.79	6	50.00
17303.	StickInMyButt (chungi)	12	104.01	116.08	5	41.67
17304.	CHRISTIAN (chris7ka)	12	87.65	107.84	4	33.33
17305.	choppery (choppery)	12	74.00	82.39	3	25.00
17306.	Chipper (chipperdiglett)	12	79.61	91.71	7	58.33
17307.	chino (chino69)	12	68.44	77.35	3	25.00
17308.	ching (chingchongchangchink)	12	63.87	85.01	1	8.33
17309.	Danh (chetdanh)	12	97.51	112.73	2	16.67
17310.	50wpm (chengyangz)	12	83.16	89.65	2	16.67
17311.	Sangga (chemicalchaos291)	12	67.91	77.48	2	16.67
17312.	chasing (chasingfastpoker9995)	12	103.74	120.10	2	16.67
17313.	ChaosNuggets (chaosnuggets)	12	97.81	114.68	3	25.00
17314.	chanon (chanonlatt)	12	50.48	54.81	3	25.00
17315.	cathy (cathyyyyy)	12	54.37	63.02	1	8.33
17316.	Carson (carson_a_r)	12	65.70	74.98	7	58.33
17317.	William (caraxd)	12	105.53	118.93	6	50.00
17318.	captain357 (captaincool357)	12	88.26	111.57	7	58.33
17319.	Candace (candacefumeh)	12	39.52	45.60	10	83.33
17320.	callicco (calllicco)	12	111.85	129.29	5	41.67
17321.	Cactus (cactus_jones)	12	95.16	106.08	8	66.67
17322.	Connor (c42855)	12	87.61	101.10	4	33.33
17323.	Bumsu (bumsu)	12	62.03	74.68	3	25.00
17324.	Joshua (brothersquid123)	12	84.81	100.59	2	16.67
17325.	Bob (bromanswagboy)	12	92.95	118.20	3	25.00
17326.	cuki 🍪 (brewlux)	12	107.02	120.42	6	50.00
17327.	Rafael (brafs165)	12	63.60	74.44	3	25.00
17328.	Anthony (boxa)	12	74.82	87.84	6	50.00
17329.	allie (bokutobro)	12	69.92	85.31	3	25.00
17330.	tstats[bobfish] (bobfish)	12	32.84	48.64	0	0.00
17331.	Narwal (bnarwal)	12	50.22	66.76	4	33.33
17332.	BlueTrip (bluetrip)	12	107.94	126.38	8	66.67
17333.	Bluefire (bluefire828)	12	95.75	107.40	5	41.67
17334.	Sujay (bluebeetle)	12	58.27	66.64	1	8.33
17335.	ok (biscuitalex)	12	95.87	114.40	4	33.33
17336.	ol (billturbo)	12	82.29	97.99	6	50.00
17337.	Chris (bigzaddy)	12	78.39	96.94	0	0.00
17338.	cameron (bigmoon)	12	28.91	38.12	3	25.00
17339.	mrbasts10000dollarrefrigera...	12	99.54	111.08	5	41.67
17340.	Gabor (bgabor)	12	79.39	90.01	5	41.67
17341.	Berny (bernyboi)	12	73.81	79.65	3	25.00
17342.	Dennis (bejdenn)	12	65.86	78.17	3	25.00
17343.	Bayu (bayufajariyanto)	12	50.86	60.25	1	8.33
17344.	Rizky (battle_hooks12)	12	82.02	98.34	6	50.00
17345.	Balloon (balloon75)	12	47.57	55.91	2	16.67
17346.	Ben (bakchansoo)	12	77.53	100.28	5	41.67
17347.	Aziron (aziron)	12	122.91	135.91	4	33.33
17348.	azhi (azhi_i)	12	28.89	32.84	1	8.33
17349.	Avy (avygorg)	12	34.69	47.45	0	0.00
17350.	George (ausp1c1ous)	12	93.84	103.92	3	25.00
17351.	Tropticl (aupsidedowncup)	12	54.88	63.74	7	58.33
17352.	AtticusB (atticusb)	12	85.46	98.34	3	25.00
17353.	Accuracy (attempts_at_accur...	12	84.13	94.08	6	50.00
17354.	Brian (atrospecter)	12	94.69	115.15	6	50.00
17355.	ashtunu (ashtunu)	12	64.43	72.57	5	41.67
17356.	Ashraya (ashrayas)	12	59.74	68.86	2	16.67
17357.	Ashish (ashishpatel0720)	12	69.53	84.02	4	33.33
17358.	ASHISH YADAV (ashish001)	12	28.68	32.92	0	0.00
17359.	Sherzod (asdfgh5889)	12	79.57	104.19	6	50.00
17360.	Arath (arathjz)	12	87.59	98.17	5	41.67
17361.	Apple Magic (applemagic4life)	12	127.45	149.73	8	66.67
17362.	Anugrah (anugrahdwikusuma)	12	92.68	116.31	4	33.33
17363.	tstats[anotherbandkid] (ano...	12	80.81	91.66	3	25.00
17364.	Anit (anit2007)	12	75.54	87.36	5	41.67
17365.	angel (angelllfoo)	12	86.07	103.03	4	33.33
17366.	Andrew (andrewfbr)	12	101.38	121.86	6	50.00
17367.	Andrew (andrewdvorak)	12	96.12	106.30	6	50.00
17368.	Abdullah (anarkhos)	12	95.25	101.73	4	33.33
17369.	陳 (amybmy)	12	59.88	73.50	2	16.67
17370.	Nafiul (aminafi)	12	82.16	89.77	4	33.33
17371.	alex (alexllc)	12	70.10	125.48	6	50.00
17372.	Alex (alexlava)	12	78.85	90.18	2	16.67
17373.	Al (alexkjenkins)	12	67.26	78.04	1	8.33
17374.	Albion (albionthegreat)	12	85.25	96.46	1	8.33
17375.	Mohammed (alazzouny)	12	52.53	65.41	1	8.33
17376.	Alarming (alarmngracer)	12	72.15	88.97	4	33.33
17377.	aka49 (aka49)	12	95.90	114.39	5	41.67
17378.	AJspeedy (ajspeedy5)	12	87.08	98.11	5	41.67
17379.	Aishuak (aishonnnn)	12	50.90	57.67	9	75.00
17380.	hadi (airsmite)	12	78.35	91.25	11	91.67
17381.	lelo (aie1900)	12	72.14	84.86	2	16.67
17382.	Aggro (aggro_typer)	12	106.92	121.03	5	41.67
17383.	The (afsanster)	12	41.56	47.57	3	25.00
17384.	Ajitesh (adji2057)	12	61.24	71.33	4	33.33
17385.	adibhehe (adibhehe)	12	67.08	81.21	12	100.00
17386.	henryk (adeczek)	12	113.85	141.77	2	16.67
17387.	Adarsh (adarshkr)	12	76.60	85.31	4	33.33
17388.	Ezra (account_name)	12	117.84	128.04	4	33.33
17389.	Abhiram (abhiramravi)	12	107.30	120.45	6	50.00
17390.	Abdallah (abdallah7)	12	73.04	93.08	3	25.00
17391.	Aakash (aakash3697)	12	79.14	92.07	4	33.33
17392.	Andy (a1i3n0)	12	108.85	129.46	7	58.33
17393.	meme (7fingers)	12	94.00	121.66	5	41.67
17394.	swagfish (4thunion)	12	90.56	104.94	5	41.67
17395.	Osyrs (3556)	12	66.77	76.57	2	16.67
17396.	2qbingxuan (2qbingxuan)	12	68.62	82.92	1	8.33
17397.	2dnas (2dnas)	12	76.40	86.96	2	16.67
17398.	MD (123onick)	12	35.98	42.97	3	25.00
17399.	Owen (123ojb)	12	101.26	109.43	0	0.00
17400.	Arne (11bricks)	12	86.25	102.59	3	25.00
17401.	Jason (j93_quinn)	12	81.14	102.08	3	25.00
17402.	Batman (wellin)	12	76.37	87.25	4	33.33
17403.	Allen (livehappily16)	12	59.72	76.85	2	16.67
17404.	Caboj (dvoraklearner123)	12	86.46	104.00	6	50.00
17405.	Triet (triet228)	12	66.16	81.54	1	8.33
17406.	Yūgen (yugenamane)	12	76.48	87.47	3	25.00
17407.	Rogue_Panda (sanchit___)	12	49.76	60.15	2	16.67
17408.	Ja (jarenmatthew)	12	70.34	81.30	4	33.33
17409.	soft (shattered_lens)	12	88.35	111.38	6	50.00
17410.	matcha (matchanapkin)	12	96.71	112.01	4	33.33
17411.	Sagun (sagunmdr)	12	60.23	71.06	4	33.33
17412.	Kyle (akilies2401)	12	63.41	72.64	6	50.00
17413.	kushal (cheesecakebtw)	12	67.92	76.64	0	0.00
17414.	Allen (enigma_801)	12	125.24	135.88	11	91.67
17415.	Elias (elreylocro)	12	59.47	71.37	6	50.00
17416.	Erik (erhuht)	12	73.79	86.34	2	16.67
17417.	kryeohs (kryeohs)	12	50.29	59.75	3	25.00
17418.	Tantai (tantai115)	12	56.26	62.47	3	25.00
17419.	Mr. (pedley)	12	76.12	85.60	7	58.33
17420.	Cesar (lentil_salad)	12	47.97	52.83	1	8.33
17421.	london (londonxxx)	12	73.63	88.07	4	33.33
17422.	Muhammad (wakype)	12	46.46	51.99	3	25.00
17423.	isniffsharpies (isniffsharp...	12	83.19	99.92	3	25.00
17424.	Phelix (phelix23)	12	102.14	117.35	9	75.00
17425.	Nathalie (larreanathalie)	12	59.18	72.30	1	8.33
17426.	lj (yzthesimp)	12	46.36	55.56	3	25.00
17427.	spongebob (royalespongebob)	12	86.49	102.73	4	33.33
17428.	John (bonsaifarm)	12	89.95	108.77	2	16.67
17429.	Nguyen (nguyenminhtri)	12	37.31	48.31	0	0.00
17430.	chloe (musical_kittycat)	12	98.10	112.24	2	16.67
17431.	Edd (christenlanger)	12	94.37	117.14	5	41.67
17432.	bibney (bibney)	12	88.84	98.33	4	33.33
17433.	ryan (ambush_)	12	73.75	89.93	4	33.33
17434.	Kenshee (knshnsrz)	12	73.58	86.79	4	33.33
17435.	Chris (c4fernandez)	12	82.40	97.97	4	33.33
17436.	novice (kai1234567890)	12	34.69	37.95	0	0.00
17437.	airkool (airkool)	12	57.49	68.36	2	16.67
17438.	Rick (agira)	12	36.21	61.76	0	0.00
17439.	John (khoryl)	12	88.85	100.89	2	16.67
17440.	Rafi (sirtheo)	12	48.59	56.33	3	25.00
17441.	Hunter (htrautz)	12	67.77	76.63	1	8.33
17442.	Dianne (diannutella)	12	86.27	101.56	12	100.00
17443.	Joel (joelitoelisha)	12	71.57	86.94	5	41.67
17444.	An Existing Person (technon...	12	102.25	117.15	9	75.00
17445.	Son Nguyen (xpinpin)	12	70.23	79.38	8	66.67
17446.	Lexie (lexie120)	12	72.16	82.91	2	16.67
17447.	Callum (lemurple)	12	59.71	70.40	0	0.00
17448.	Trying to get to 75wmp (in_...	12	88.74	98.71	5	41.67
17449.	Elizabeth (theatribeth)	12	65.35	73.68	3	25.00
17450.	Jack (jackkaranjan)	12	81.73	94.01	2	16.67
17451.	Prakash (prakash_18)	12	24.03	30.38	4	33.33
17452.	Allee (hayyallee)	12	63.79	95.08	10	83.33
17453.	Peachy (peachynotsimp)	12	55.62	67.63	0	0.00
17454.	ABsuperX (anuraagbarde)	12	57.54	68.49	5	41.67
17455.	Aditya (adishegde)	12	80.35	98.94	3	25.00
17456.	Monke (monke_with_a_keyboard)	12	61.66	74.88	3	25.00
17457.	Mario (marioloop)	12	32.92	38.39	0	0.00
17458.	SandTinx (sandtinx)	12	61.19	70.97	4	33.33
17459.	Aubrey (aubreylynn14)	12	99.27	125.92	4	33.33
17460.	Ridley (ridlz)	12	76.00	83.87	1	8.33
17461.	Hafsa (hafsamohammed200)	12	70.16	80.93	3	25.00
17462.	Alex (chualexchu)	12	91.14	106.65	4	33.33
17463.	Huong (__ian)	12	65.75	73.60	1	8.33
17464.	Mucha (mucha_)	12	78.04	89.06	5	41.67
17465.	spookydoggo (spookydoggo)	12	91.87	119.67	10	83.33
17466.	Manges (friendzonecamper)	12	88.97	112.63	5	41.67
17467.	tony (bananaboyy)	12	82.25	92.68	6	50.00
17468.	malix (malangi)	12	82.54	94.56	3	25.00
17469.	Aeddon (a3ddon)	12	97.18	110.83	3	25.00
17470.	Erick (erickis300)	12	96.91	110.45	9	75.00
17471.	Ley (leeeeymm)	12	70.72	87.91	1	8.33
17472.	Phillip (philyphil)	12	71.55	85.72	2	16.67
17473.	Lisa (xoxfko)	12	42.70	61.61	0	0.00
17474.	Meh Zall (mehzall)	12	90.60	104.21	7	58.33
17475.	mclrn (mclrn)	12	80.67	91.96	3	25.00
17476.	Kaeji (kaeji404)	12	62.59	70.21	0	0.00
17477.	diamond (diamondthecat)	12	48.46	61.02	0	0.00
17478.	Jordi (jordi333)	12	41.36	46.38	11	91.67
17479.	David (davethebravemicrowave)	12	72.24	82.79	9	75.00
17480.	Blake (weekesy)	12	65.33	72.68	0	0.00
17481.	Meister (bmmeister)	12	45.39	53.44	1	8.33
17482.	AthenaHuss (mountainhusky)	12	32.61	35.73	0	0.00
17483.	Riley (kellerxll)	12	82.24	93.46	4	33.33
17484.	Noel (psychoimpulse)	12	70.95	82.02	3	25.00
17485.	Chclo (chclo)	12	105.05	121.88	7	58.33
17486.	Aaron (dunclapicus)	12	106.70	125.80	7	58.33
17487.	Joe (hey__joe)	12	81.13	100.00	12	100.00
17488.	8990 (sinanae)	12	72.84	99.09	4	33.33
17489.	Frozenrings (frozenrings)	12	64.18	79.01	9	75.00
17490.	Jordan (alienshockz)	12	53.00	63.03	1	8.33
17491.	Niam (ninicanuck)	12	79.81	93.59	3	25.00
17492.	yamp (yamp)	12	91.03	100.83	2	16.67
17493.	Cedar (pumpkin_racer)	12	86.75	102.28	2	16.67
17494.	moon (moonrace)	12	77.46	88.89	3	25.00
17495.	Lennox (lennoxn)	12	57.28	64.58	3	25.00
17496.	antorr (_donpablo)	12	29.58	37.60	1	8.33
17497.	Sameen (ninogasuki)	12	86.28	95.63	4	33.33
17498.	Puma (bigfast26)	12	40.20	46.93	0	0.00
17499.	Shidori (shidori)	12	70.08	79.18	4	33.33
17500.	Tonkata (_tonkata_)	11	53.24	63.97	2	18.18
17501.	bruh (_sidnair2003_)	11	107.38	130.59	11	100.00
17502.	guitrstrngscr (_resh_)	11	66.09	80.60	2	18.18
17503.	Pendi (_pendi)	11	120.63	131.72	8	72.73
17504.	Daniela (_noodleynoodles_)	11	114.29	131.76	6	54.55
17505.	Nilesh (_nex_)	11	76.47	85.69	1	9.09
17506.	Mick (_mickey_)	11	69.76	83.82	1	9.09
17507.	Jeff (_jeff_)	11	54.02	59.42	1	9.09
17508.	MrClumzzy (zxgod)	11	68.80	85.94	4	36.36
17509.	Josh (zumoariri)	11	59.00	67.80	2	18.18
17510.	Ronnie (zoroaki)	11	51.24	70.59	2	18.18
17511.	Zuja (zoojah)	11	95.21	108.76	5	45.45
17512.	Zmiester0828 (zmeister0828)	11	76.96	100.75	3	27.27
17513.	zoey (zjskating)	11	72.61	83.33	3	27.27
17514.	jorje (zhonti)	11	51.97	67.79	4	36.36
17515.	ZapSlow (zapadobo)	11	102.26	123.97	5	45.45
17516.	tstats[zanies07] (zanies07)	11	48.29	52.62	2	18.18
17517.	Jonathan (z33nine)	11	49.12	54.47	0	0.00
17518.	lixiang (yuan_yuan)	11	97.55	107.85	5	45.45
17519.	yuan (yuanyangty)	11	111.08	122.62	4	36.36
17520.	R. (yeetertheskeeter)	11	113.49	146.91	1	9.09
17521.	YeetedOrca (yeetedorca)	11	66.87	78.91	1	9.09
17522.	Zalvy (ydnav)	11	97.09	116.23	4	36.36
17523.	Husain (yahyahusain)	11	87.22	102.47	9	81.82
17524.	Dan (x_danma)	11	70.87	82.87	2	18.18
17525.	XXRobzz (xxr0bzz)	11	80.51	91.83	5	45.45
17526.	OOF (xpinoyx)	11	98.29	111.55	4	36.36
17527.	Gunn (xg88)	11	90.34	129.16	7	63.64
17528.	Kyle (xdestroyer83)	11	88.98	99.67	4	36.36
17529.	Alex (xanfan01)	11	117.46	133.76	7	63.64
17530.	oTk (wulongi)	11	86.68	103.71	6	54.55
17531.	Khaled (wtcherr)	11	54.03	58.00	0	0.00
17532.	wowzaa (wowzaa1)	11	70.57	85.53	1	9.09
17533.	kellogg's (wnluqmnn)	11	87.78	109.92	4	36.36
17534.	lee (wndnjs4389)	11	59.47	71.56	2	18.18
17535.	wlitchw (wlitchw)	11	52.59	63.68	3	27.27
17536.	Will (윌) (willwang)	11	91.93	104.42	4	36.36
17537.	william (williamivandy)	11	79.62	91.90	2	18.18
17538.	wigglyworm (wigglyworm)	11	75.04	92.04	2	18.18
17539.	whynottt (whynottt)	11	74.84	98.81	4	36.36
17540.	Tray (whitefalcon684)	11	88.29	102.25	3	27.27
17541.	WhaleVomit (whalevomit)	11	123.29	129.60	9	81.82
17542.	TomCeria (wertyboy)	11	91.84	103.24	6	54.55
17543.	weidel (weidel)	11	58.41	70.42	1	9.09
17544.	jasmin (wawfles)	11	81.25	93.03	3	27.27
17545.	wango (wango)	11	94.11	119.47	7	63.64
17546.	Walden (walnutwaldo20)	11	75.81	122.35	3	27.27
17547.	Wakeel (wakeel_ahmed)	11	36.68	45.52	1	9.09
17548.	wael (wael2)	11	58.65	67.80	1	9.09
17549.	Chalach (waddee)	11	89.12	103.93	1	9.09
17550.	Omar (v_omar11)	11	88.49	94.30	2	18.18
17551.	Ayesha (vogue212)	11	83.73	93.65	2	18.18
17552.	Visa (visatron)	11	91.63	119.18	4	36.36
17553.	Aashrya (virtualvector)	11	85.97	101.12	10	90.91
17554.	Vihaan (vilecn2609)	11	20.52	24.16	10	90.91
17555.	V (viktiro)	11	109.72	132.25	8	72.73
17556.	Gravity (vgravity)	11	74.46	86.75	0	0.00
17557.	Ritika Garg (ve_ronica)	11	40.07	44.80	1	9.09
17558.	Vanu (vanu88)	11	56.99	68.98	2	18.18
17559.	Sonia (vannvilla)	11	97.03	106.55	8	72.73
17560.	Dard (vaderking)	11	69.34	79.72	11	100.00
17561.	Vadacurry (vadacurry)	11	74.53	86.71	3	27.27
17562.	v1ruso (v1ruso)	11	101.70	110.57	7	63.64
17563.	ivﾠonﾠutube (unreaii)	11	117.70	135.11	7	63.64
17564.	unowildcard (unowildcard)	11	101.41	112.47	6	54.55
17565.	Trevor (uneasythrower24)	11	59.88	65.69	1	9.09
17566.	Mythical (ultrabow)	11	73.84	88.39	2	18.18
17567.	Tzo (tzoatplay)	11	59.94	66.31	2	18.18
17568.	Tys0100 (tys0100)	11	67.58	74.94	0	0.00
17569.	matthew (typeredemption)	11	30.09	36.12	3	27.27
17570.	Jesse Klaver (typeracernoob...	11	78.39	93.18	4	36.36
17571.	typeracer (typeracer550)	11	73.46	82.87	3	27.27
17572.	Colin (typeofwhey)	11	87.14	101.16	3	27.27
17573.	Miles (txlore)	11	83.65	99.57	6	54.55
17574.	turutupa (turutupa)	11	96.07	110.66	6	54.55
17575.	Turtley (turtleyjk)	11	89.54	105.84	6	54.55
17576.	Tu (tuawesome)	11	81.48	96.84	5	45.45
17577.	T (tt147)	11	100.46	113.00	5	45.45
17578.	MoDX (trollcannon)	11	84.94	92.93	2	18.18
17579.	Thomas (trinitymeister)	11	54.31	64.41	2	18.18
17580.	Travis (travis4d)	11	67.83	78.73	5	45.45
17581.	T (toompaxd)	11	83.70	92.55	0	0.00
17582.	Toast (toastmaster127)	11	85.87	116.65	4	36.36
17583.	professor (tm_professor)	11	64.81	72.98	8	72.73
17584.	Dinmarc (tmlololol)	11	53.71	62.56	0	0.00
17585.	Scaught (tiktoks)	11	91.91	104.11	4	36.36
17586.	Asd (thinedes)	11	101.51	132.88	5	45.45
17587.	Captn (the_nobody3786)	11	60.38	80.89	2	18.18
17588.	The (the_learning_savage)	11	82.21	104.96	2	18.18
17589.	Ayush (the_dealer)	11	75.06	89.50	2	18.18
17590.	The Try (thetryhardguy01_)	11	57.31	67.01	3	27.27
17591.	Undisclosed (thetechnicalfox)	11	108.24	129.67	3	27.27
17592.	Ryan (theryanshan)	11	65.87	72.83	1	9.09
17593.	Shreshth (thefoxwithanelytra)	11	93.75	100.26	4	36.36
17594.	TheFoodMan52 (thefoodman52)	11	90.44	111.04	7	63.64
17595.	steelmonkey (thecornhobble)	11	124.84	149.12	3	27.27
17596.	THATGUYtm (thatguytm)	11	79.60	96.61	6	54.55
17597.	butterfingers (th3panda)	11	82.47	97.20	2	18.18
17598.	Tejas (tejasfarera)	11	64.54	74.75	3	27.27
17599.	Teerapat (teerapatlaongdee)	11	69.68	85.94	3	27.27
17600.	Joseph (techvideomaster)	11	89.02	103.44	4	36.36
17601.	Andy (teaestaye)	11	90.09	108.13	3	27.27
17602.	tdrewek (tdrewek)	11	81.66	90.83	1	9.09
17603.	Tasnimul Hasan Rafid (tasni...	11	48.80	56.60	0	0.00
17604.	Nishant (tarzanjunior)	11	63.51	73.05	4	36.36
17605.	Tarun (tarun_valasa)	11	54.23	71.25	2	18.18
17606.	Tarashankar (tarashankar)	11	50.61	59.65	0	0.00
17607.	Jay (taragine)	11	98.71	111.63	5	45.45
17608.	Owen (taenguar)	11	106.90	124.38	5	45.45
17609.	Patrik (tacticalnuke)	11	86.78	103.16	3	27.27
17610.	Ben (tabman)	11	92.29	104.67	9	81.82
17611.	taylor (taayloor)	11	125.82	140.41	5	45.45
17612.	ស៊ីថេ (sythe_net)	11	38.04	47.70	2	18.18
17613.	Malik (sweetbubblegum_50)	11	85.23	98.80	2	18.18
17614.	Swati (swati0609)	11	53.52	63.87	1	9.09
17615.	SuperDucky1875 (superducky1...	11	48.45	58.20	2	18.18
17616.	a (suk_)	11	97.04	126.01	8	72.73
17617.	Suchit (suchit_reddi)	11	48.62	57.44	3	27.27
17618.	Filip (sucicf7)	11	93.69	105.34	1	9.09
17619.	steven (styper3030)	11	46.85	60.78	1	9.09
17620.	Stuart (sturay)	11	99.55	111.77	6	54.55
17621.	flyingcakes (strx_)	11	78.93	93.42	2	18.18
17622.	#EndCars (stratmann)	11	96.70	102.56	5	45.45
17623.	Storm (stormheezen)	11	56.84	61.01	3	27.27
17624.	Hayden (stoptake)	11	79.95	96.38	5	45.45
17625.	Dan (stefanstef)	11	99.42	114.15	7	63.64
17626.	Rong Liew (springbaron)	11	129.63	141.02	8	72.73
17627.	Peter (spinbot)	11	63.77	75.08	3	27.27
17628.	Shivam (sorcerer626)	11	89.54	107.50	6	54.55
17629.	Sophie (sophie0413)	11	87.65	102.92	2	18.18
17630.	Travis (sonicspeed06)	11	64.39	71.09	5	45.45
17631.	Prosper Solomon (solomontz)	11	53.03	60.65	2	18.18
17632.	bjonk (sojho)	11	121.80	133.00	6	54.55
17633.	Zoom Zoom (soccerman12345)	11	106.97	124.28	7	63.64
17634.	smmbam (smmbam)	11	79.53	88.35	3	27.27
17635.	Tamer (smartlead)	11	36.89	42.45	4	36.36
17636.	kek (slongdongbong)	11	62.17	68.98	2	18.18
17637.	tim (slipperyreptile)	11	106.67	131.41	9	81.82
17638.	Ilias (skysrex)	11	78.45	95.94	5	45.45
17639.	Skreemmy (skreemmy)	11	56.22	63.71	2	18.18
17640.	Aditya (skaarfacee)	11	54.52	59.44	1	9.09
17641.	Tyler (silver_typer)	11	103.01	114.24	5	45.45
17642.	busshyzDRill (silvercrow0)	11	50.51	54.85	2	18.18
17643.	Anthony (sildreon)	11	81.78	94.05	1	9.09
17644.	Suienish (sikoesch)	11	69.14	74.55	2	18.18
17645.	Nicola (shougt)	11	61.18	71.48	2	18.18
17646.	Sharos (sharos)	11	53.66	60.31	2	18.18
17647.	hello (sharkyboy)	11	124.91	134.90	6	54.55
17648.	Shark (sharkbeargator)	11	92.17	104.85	3	27.27
17649.	Shafiq (shafiq7911)	11	78.21	88.78	1	9.09
17650.	Andrew (sertria)	11	93.49	100.08	3	27.27
17651.	sergieric (sergieric)	11	58.71	68.94	3	27.27
17652.	SjåDæmSjøgølls (seethem...	11	63.76	76.19	2	18.18
17653.	SeCre (secre13)	11	72.45	84.37	2	18.18
17654.	long bus (sealegs)	11	141.36	154.43	9	81.82
17655.	Corrin (scynth)	11	98.60	105.44	4	36.36
17656.	Kurtis (sauceypubes)	11	104.45	123.40	4	36.36
17657.	Sargis (sargispro)	11	77.43	90.66	1	9.09
17658.	Sarah (sarahnivans)	11	66.77	75.36	1	9.09
17659.	Alix (sarahallisa)	11	66.34	73.78	3	27.27
17660.	Sargis (saqo1997)	11	52.31	57.47	0	0.00
17661.	Samdo (sammematt)	11	122.10	134.74	6	54.55
17662.	Sajan (sajancpatel)	11	91.99	105.72	5	45.45
17663.	Saffron (saffronayy)	11	92.21	118.29	10	90.91
17664.	Saea (saeamak)	11	86.29	96.53	3	27.27
17665.	Sans (s4nsx)	11	62.98	73.17	4	36.36
17666.	Shannon (s0lanum)	11	53.02	59.06	2	18.18
17667.	James (ryandaryno)	11	63.35	75.88	3	27.27
17668.	Raven (rvnfx)	11	71.17	90.00	9	81.82
17669.	Ruslan (ruslan_osmanov)	11	93.64	105.18	3	27.27
17670.	Panagiotis (rulisogeranoulis)	11	83.22	97.54	6	54.55
17671.	Ron (ronald2)	11	81.42	99.70	6	54.55
17672.	Free Palestine (rollno14)	11	103.90	125.89	4	36.36
17673.	Rolandas (rolandas)	11	24.91	32.26	0	0.00
17674.	Roko (rokoroks)	11	79.80	89.47	3	27.27
17675.	pentti (rocket_boi)	11	43.82	50.60	3	27.27
17676.	Robbie (robbietrimble)	11	104.68	134.38	6	54.55
17677.	Absolut (rluyen)	11	82.79	99.44	0	0.00
17678.	Ridge (ritzchu)	11	92.40	101.35	11	100.00
17679.	Kenny (riggedcontingency)	11	100.61	110.49	5	45.45
17680.	ninja (riddickbr)	11	95.04	121.16	4	36.36
17681.	Ricky (rickyyeung)	11	83.89	93.13	4	36.36
17682.	Rickith (rickith)	11	58.23	63.72	0	0.00
17683.	Jeremy (rice_cream)	11	96.18	107.97	5	45.45
17684.	ango (rfthefinal)	11	73.00	86.16	4	36.36
17685.	red (redwastaken)	11	95.35	104.86	2	18.18
17686.	ReddyIsHere (reddy_is_here)	11	58.19	66.40	1	9.09
17687.	Rebel (rebelaj)	11	92.81	99.78	2	18.18
17688.	D A R K Z (reaching130wpm)	11	56.45	66.84	0	0.00
17689.	Rodrigo (rdcmdev)	11	81.67	93.77	2	18.18
17690.	Ray (ray_mond)	11	83.78	95.10	3	27.27
17691.	RAWs (raws)	11	95.06	108.25	4	36.36
17692.	guts (ramosjoshua214)	11	72.67	85.27	3	27.27
17693.	Ajwad Hameem (rajin100000)	11	69.33	81.13	1	9.09
17694.	Exquisition (raimi)	11	98.84	140.33	5	45.45
17695.	Rahmen (rahmennoodles)	11	105.77	136.93	6	54.55
17696.	qweasdyxc (qweasdyxc)	11	64.12	73.23	1	9.09
17697.	Papa (quamthebomb)	11	97.29	114.43	5	45.45
17698.	Pyro (pyromaniac_from_the_sun)	11	78.97	92.43	2	18.18
17699.	tapan (psydelix)	11	71.23	79.97	2	18.18
17700.	Psycho (psychobrainman)	11	78.36	85.98	3	27.27
17701.	Mike (primike)	11	85.69	94.79	6	54.55
17702.	Vorakan (ppaaul_)	11	67.86	81.65	2	18.18
17703.	Hoang (poulet0306)	11	74.22	85.22	4	36.36
17704.	Patric (potric)	11	68.46	88.98	2	18.18
17705.	Potato (potatooe)	11	43.82	59.47	0	0.00
17706.	PenTest-duck (pokemontypist)	11	114.61	128.35	4	36.36
17707.	Cookies (poeannn)	11	70.59	80.58	5	45.45
17708.	Nick (pletlibo)	11	104.51	128.68	7	63.64
17709.	tstats[pkmkb] (pkmkb)	11	63.75	70.73	0	0.00
17710.	Jacob (pinpoint)	11	63.57	74.22	5	45.45
17711.	Phungtastic (phungtastic)	11	73.53	78.86	2	18.18
17712.	Alex (pheudo)	11	72.90	90.30	6	54.55
17713.	nah (phamhuyhuy2005)	11	91.61	108.92	2	18.18
17714.	Peter (petero)	11	87.19	96.06	2	18.18
17715.	Gavin (perfectgavinator)	11	106.97	124.27	6	54.55
17716.	Matous (pelisek16)	11	75.06	85.32	4	36.36
17717.	ama (pcfcace)	11	75.39	83.51	2	18.18
17718.	Phillip (pc15pdx)	11	51.19	59.15	2	18.18
17719.	Payette (payette420)	11	92.78	108.64	1	9.09
17720.	paul (paularoni)	11	64.35	77.32	1	9.09
17721.	Connor (paintrain23)	11	70.26	88.50	3	27.27
17722.	Pinny (p1nny_)	11	65.51	73.05	8	72.73
17723.	ozzy (ozzyk)	11	56.30	70.90	1	9.09
17724.	Squeak (oweozz)	11	78.03	95.34	2	18.18
17725.	Omar (oshnatour)	11	84.73	107.29	2	18.18
17726.	opal (opalisbored)	11	53.30	61.93	2	18.18
17727.	Lou (onyok2010)	11	60.85	71.22	11	100.00
17728.	John (omster83)	11	93.45	111.06	5	45.45
17729.	Saul (old_grandma)	11	104.81	124.11	4	36.36
17730.	officialpm (officialpm)	11	111.79	131.70	3	27.27
17731.	ocodile (ocodile)	11	114.03	132.18	6	54.55
17732.	Gabi (ockra_)	11	55.45	69.33	3	27.27
17733.	np80658 (np80658)	11	68.96	79.11	2	18.18
17734.	Erdal (notasingleduck)	11	58.41	65.39	3	27.27
17735.	Vladimir (nolmegar)	11	124.16	145.61	9	81.82
17736.	Nobu (nobuhiro777)	11	72.12	86.47	3	27.27
17737.	NK (nkpathak1)	11	36.79	51.42	2	18.18
17738.	niven (niven_11)	11	74.08	86.80	4	36.36
17739.	soraya (nilanjona)	11	36.16	42.76	1	9.09
17740.	notjustmetal (nightway11)	11	86.24	95.46	5	45.45
17741.	Nick (nickxz)	11	128.64	143.48	6	54.55
17742.	Nicholas (nicholas_r)	11	98.30	111.36	7	63.64
17743.	Jusuf (nerdtyper)	11	92.29	106.65	7	63.64
17744.	Neptune (neptune_22)	11	85.47	98.08	3	27.27
17745.	Just (needhelpintyping)	11	96.39	112.93	4	36.36
17746.	Jonathan (nebulium)	11	59.21	70.68	2	18.18
17747.	Nathan (nbx3k)	11	101.12	114.88	5	45.45
17748.	Nathan (nathanpg)	11	93.71	108.44	5	45.45
17749.	Nasir (nasir_hussain)	11	62.33	73.65	3	27.27
17750.	narqo (narqo)	11	101.53	122.65	8	72.73
17751.	Night Fury (naimur_rahman)	11	79.08	84.74	3	27.27
17752.	RS (nahor)	11	107.30	129.17	8	72.73
17753.	Nada (nada2004)	11	50.53	58.89	1	9.09
17754.	MZA (mzakm)	11	98.76	120.68	8	72.73
17755.	Mytx (mythflashx)	11	69.39	75.72	3	27.27
17756.	diana (mxclfld)	11	84.25	94.38	5	45.45
17757.	Muntazar (muntazer1)	11	69.63	78.11	6	54.55
17758.	Matthew (msloehr)	11	75.53	84.88	2	18.18
17759.	kailh pinks (mrdooks)	11	104.03	132.76	8	72.73
17760.	Thiemen (mohouzeg)	11	95.14	108.39	9	81.82
17761.	Mohammed (mohammedamarnah)	11	91.80	113.28	4	36.36
17762.	mohammadreza (mohammadrezae...	11	71.81	79.62	0	0.00
17763.	Kacper (mlociak)	11	58.04	63.38	2	18.18
17764.	manjeet (mjydv4548)	11	61.76	69.53	1	9.09
17765.	Mr.GrayBoi (mistergrayboi)	11	77.50	89.76	3	27.27
17766.	Felzii (missartemis_97)	11	63.92	74.53	2	18.18
17767.	mire (mire_kr)	11	88.90	113.26	2	18.18
17768.	gannicus (milaikilaiki)	11	108.16	123.06	5	45.45
17769.	Mohamed (midoukl)	11	50.55	53.40	0	0.00
17770.	Michael Angelo (micky15)	11	101.45	111.12	6	54.55
17771.	Michal (micha13)	11	85.05	96.29	2	18.18
17772.	Matt (mhorsfield)	11	55.66	67.88	3	27.27
17773.	Bob (metsandcavs)	11	77.81	87.78	2	18.18
17774.	Aashish kumar (messy84)	11	39.15	43.07	3	27.27
17775.	Memresable (memresable)	11	66.98	78.90	3	27.27
17776.	Mark Jonathan (max_peterson10)	11	102.79	113.80	4	36.36
17777.	Max (max_evans)	11	86.70	100.65	1	9.09
17778.	john (maxwelllllllllll)	11	66.25	81.59	4	36.36
17779.	Mathias (mattitheguy)	11	77.04	98.32	6	54.55
17780.	Matt3k (matt3k)	11	84.49	108.69	5	45.45
17781.	matex72 (matex72)	11	74.49	85.32	1	9.09
17782.	Marc (marxotkin)	11	98.31	110.15	5	45.45
17783.	Marcus (marqueshark)	11	89.81	137.77	10	90.91
17784.	Jordan (marceless)	11	131.19	140.70	9	81.82
17785.	TOP (man_stop)	11	105.64	115.68	5	45.45
17786.	Manuel (mansrz)	11	76.53	87.52	3	27.27
17787.	Sean (manbeervark)	11	78.85	91.44	3	27.27
17788.	Nitesh (malster)	11	61.21	65.03	3	27.27
17789.	Malo (malodrome)	11	43.73	50.29	2	18.18
17790.	Adam (maldoren)	11	103.81	126.82	0	0.00
17791.	Max (macksx)	11	68.19	80.97	3	27.27
17792.	maciej (maciek3290)	11	59.80	66.69	2	18.18
17793.	Daniel (macguffinstv)	11	94.67	108.87	3	27.27
17794.	Peerawitch (maaaai)	11	57.72	62.67	0	0.00
17795.	Tyler (m4rshm4)	11	110.93	131.10	10	90.91
17796.	Luxson (luxsonx)	11	40.16	50.54	1	9.09
17797.	Luthriel (luthriel)	11	101.53	110.31	8	72.73
17798.	Luis (luis_vs_the_world)	11	60.82	71.17	2	18.18
17799.	Luis (luisyt)	11	76.17	88.39	3	27.27
17800.	jason (luckiestluckster)	11	95.12	105.93	8	72.73
17801.	Luke (ltuite)	11	82.09	94.67	6	54.55
17802.	Louie (louie4825)	11	101.20	119.26	8	72.73
17803.	Louai (louai_zahran)	11	46.60	51.98	0	0.00
17804.	No (loisk1)	11	78.48	90.18	6	54.55
17805.	Little (littlesailor123)	11	74.15	89.09	1	9.09
17806.	Lior (liorg225)	11	66.51	77.57	4	36.36
17807.	Lilly (lilly713)	11	105.68	122.20	6	54.55
17808.	🤑 (liljasonmoney)	11	74.77	81.68	4	36.36
17809.	Lilikoi (lilikoiv)	11	70.18	92.10	4	36.36
17810.	IllIllIllIll (liliiilil)	11	123.47	136.20	5	45.45
17811.	Lucius (lightwastaken)	11	91.57	110.97	2	18.18
17812.	Christina (libermay)	11	73.28	79.37	2	18.18
17813.	Thomas (ldsg99999)	11	56.41	64.43	2	18.18
17814.	Flame On Me (lamtrinhan1503)	11	51.70	58.03	1	9.09
17815.	Laiyon (laiyon)	11	58.16	63.98	2	18.18
17816.	Luke (laaa)	11	105.47	114.56	4	36.36
17817.	l0gically (l0gically)	11	73.19	80.82	5	45.45
17818.	Alish (kzmadcat)	11	70.46	84.59	0	0.00
17819.	Kaptain K (kxdang)	11	82.63	104.52	5	45.45
17820.	star (kuuym)	11	93.13	113.74	6	54.55
17821.	Speedy (kuulex)	11	71.92	82.73	2	18.18
17822.	Lukas (kukess)	11	77.98	84.74	7	63.64
17823.	ktns (ktns)	11	71.53	77.39	3	27.27
17824.	lai (krylite)	11	82.27	89.49	0	0.00
17825.	yes but (krosis2706)	11	70.10	85.72	5	45.45
17826.	Derek (kroni)	11	61.48	75.12	1	9.09
17827.	Eren (krishi__)	11	50.89	57.46	1	9.09
17828.	Ali (kraken_wrath)	11	62.20	76.04	2	18.18
17829.	KOROCO (koroconotu)	11	88.79	108.38	1	9.09
17830.	Andrew (kooey_u)	11	48.35	53.86	3	27.27
17831.	KIXK (kixk)	11	69.71	76.53	3	27.27
17832.	Kivon (kivonsclipz)	11	76.86	91.87	3	27.27
17833.	cat (kitkat79)	11	62.04	73.21	2	18.18
17834.	Dimas (kirito_69)	11	43.62	50.84	0	0.00
17835.	Ayden (king_nedya)	11	88.24	102.11	3	27.27
17836.	Ferret (kingko)	11	47.40	55.87	1	9.09
17837.	MA1T8 (kingking540)	11	91.68	99.43	4	36.36
17838.	bo (kibums)	11	86.24	104.75	3	27.27
17839.	Kent (kfreezen)	11	98.87	113.59	4	36.36
17840.	Kevin (kevinliu050505)	11	93.01	102.71	4	36.36
17841.	Kevin (kevindkao)	11	100.17	118.18	4	36.36
17842.	Kev (kev9933)	11	106.44	117.78	4	36.36
17843.	KenDvorak (kensan73dvorak)	11	67.83	83.35	1	9.09
17844.	Kenny (kenny1232)	11	68.00	86.22	3	27.27
17845.	Kennedy (kennedykozak)	11	72.51	88.09	4	36.36
17846.	fover (keitotrash)	11	108.12	127.08	8	72.73
17847.	Kate (kate_haha)	11	54.50	62.95	5	45.45
17848.	kasra (kasra44)	11	69.15	80.61	1	9.09
17849.	Kasra (kasra15)	11	59.30	69.25	1	9.09
17850.	kaelan (kae1)	11	110.17	128.14	5	45.45
17851.	James (jvlasak)	11	70.12	78.89	2	18.18
17852.	Justin (justin000)	11	93.00	103.09	4	36.36
17853.	Justa (justaboss101)	11	60.90	69.75	2	18.18
17854.	jumpscarez the fox (jumpsca...	11	39.62	50.22	1	9.09
17855.	Juan (juanpadoodle)	11	74.55	85.11	3	27.27
17856.	Joshua (joshuajoshuak)	11	121.70	133.12	8	72.73
17857.	Jonathan (jonathanatx)	11	73.02	86.93	5	45.45
17858.	Jo (jojoey21)	11	109.08	125.92	7	63.64
17859.	johny2021 (johny2021)	11	48.23	55.17	2	18.18
17860.	JohnsDog (johnsdog)	11	114.49	131.45	3	27.27
17861.	Johnnybib (johnnybib)	11	103.72	127.20	5	45.45
17862.	John (johndzxu)	11	62.64	71.05	2	18.18
17863.	Joey (joeygetthedoughy)	11	86.18	99.96	8	72.73
17864.	Jonathan (jnybo)	11	72.66	88.55	4	36.36
17865.	Jacob (jlagarespo)	11	106.85	122.31	9	81.82
17866.	Jeff (jjj11x)	11	93.14	107.04	4	36.36
17867.	JTL (jimthelegend)	11	82.45	87.52	3	27.27
17868.	jimmhealer (jimmyhealer)	11	60.38	74.08	2	18.18
17869.	Jim (jimdavia99)	11	62.93	69.59	2	18.18
17870.	jiirrarr (jiirrarr)	11	58.24	67.54	3	27.27
17871.	JeffJeff (jeffjeffgames)	11	51.31	59.72	0	0.00
17872.	Pierce (jedipierce)	11	102.71	123.72	6	54.55
17873.	Jakob (jdwalburger)	11	87.36	104.42	7	63.64
17874.	John (jctad)	11	89.69	101.69	5	45.45
17875.	Shlim (javah1)	11	80.44	93.36	1	9.09
17876.	Jared (jaredtypist)	11	95.77	113.08	6	54.55
17877.	Z (jaredezane)	11	102.21	116.20	7	63.64
17878.	Hikaru (japism)	11	82.16	104.44	5	45.45
17879.	Clive (jadenm770)	11	13.45	18.63	2	18.18
17880.	Jacky (jackyjac)	11	72.73	85.78	4	36.36
17881.	John (jacks3141)	11	64.42	74.66	2	18.18
17882.	Jack (jackkieny)	11	59.92	68.80	3	27.27
17883.	i (ivantse2)	11	100.12	111.79	7	63.64
17884.	Taken (itztaken)	11	101.37	115.39	6	54.55
17885.	Games (itzbond)	11	86.41	101.01	5	45.45
17886.	jay! (its_jay_)	11	108.82	117.20	0	0.00
17887.	NewbPianist (instantnoodles...	11	111.54	126.39	7	63.64
17888.	s3lec (inputselec)	11	64.06	75.39	1	9.09
17889.	started from 50 now we here...	11	120.38	146.76	7	63.64
17890.	Owen (innitbruv)	11	54.33	64.21	3	27.27
17891.	John (infzer0)	11	78.05	88.10	3	27.27
17892.	Jayden (infamousphoenix)	11	110.64	134.65	11	100.00
17893.	Indiana Mitko (indianamitko)	11	34.61	42.97	1	9.09
17894.	Farzad (impulsion)	11	70.10	83.00	4	36.36
17895.	Mr. Qwerty (imnotawimpykid)	11	86.22	94.93	4	36.36
17896.	DW (immortal_tree)	11	98.78	107.08	6	54.55
17897.	Richard (iliveinthexu)	11	147.55	158.38	9	81.82
17898.	Michael (idobemikey)	11	63.99	73.06	4	36.36
17899.	idkwhojamesis (idkwhojamesis)	11	87.14	99.92	1	9.09
17900.	Moko (iamspeedkachiga)	11	83.60	98.05	4	36.36
17901.	Player_II (iamplayer)	11	86.52	92.20	4	36.36
17902.	Hxrry (hxrry)	11	65.76	93.48	4	36.36
17903.	Pady (hundertzwoelf)	11	87.68	104.13	1	9.09
17904.	Max (hooterr)	11	83.26	90.09	6	54.55
17905.	seanghong (hongracer)	11	87.55	100.47	3	27.27
17906.	Dominic (hobomonkey5)	11	76.98	93.29	3	27.27
17907.	minnie (hiitzmemini)	11	63.85	76.15	2	18.18
17908.	Hessel (hessel_s)	11	80.09	87.86	3	27.27
17909.	Santiago (helix_02)	11	80.88	101.02	4	36.36
17910.	Skyler (hausky)	11	96.40	109.75	6	54.55
17911.	Nayan (hatke42)	11	60.39	71.07	4	36.36
17912.	harambe (harambetypes)	11	43.18	57.80	1	9.09
17913.	UE (hanue)	11	40.76	53.32	0	0.00
17914.	Hana (hanatf2)	11	104.18	118.41	4	36.36
17915.	Han (han3)	11	93.14	109.55	3	27.27
17916.	Jason (haisaru)	11	76.64	90.30	5	45.45
17917.	Haiden (haidenb10)	11	91.73	103.94	4	36.36
17918.	Aldrich (gwaldrich)	11	97.00	112.03	3	27.27
17919.	gegg (guy_sama)	11	73.63	85.42	3	27.27
17920.	vinnie (gun_xox)	11	58.23	78.34	2	18.18
17921.	Guest (guest002)	11	79.70	86.69	2	18.18
17922.	grossdesign (grossdesign)	11	114.74	129.30	9	81.82
17923.	Colin (grolxe_1)	11	91.75	107.52	3	27.27
17924.	Clayton (grizzleybear62)	11	57.56	67.18	2	18.18
17925.	Grifit (grifit)	11	47.99	61.03	3	27.27
17926.	Griffin (grider1)	11	91.97	102.35	2	18.18
17927.	GreatLama (greatlama)	11	80.31	93.50	4	36.36
17928.	Vin (gracien)	11	62.19	69.47	2	18.18
17929.	George (gpa138)	11	93.66	112.81	7	63.64
17930.	Hcaz (gosuperzach)	11	46.38	55.27	3	27.27
17931.	Cheap (gorid)	11	64.52	77.33	1	9.09
17932.	Mar (gonefishing123)	11	94.36	109.68	5	45.45
17933.	Jared (going2prison)	11	66.43	81.00	2	18.18
17934.	William (godliam)	11	51.13	62.24	4	36.36
17935.	godaberi (godaberi)	11	67.26	76.93	4	36.36
17936.	Virtuoso™ (gkarthick)	11	93.87	100.39	3	27.27
17937.	gi (gi_prim)	11	44.29	53.95	1	9.09
17938.	Willy (gfif01)	11	72.60	82.65	5	45.45
17939.	alem (gewaltxd)	11	75.63	91.61	7	63.64
17940.	Get Racc'd (getraccd_)	11	58.70	67.67	2	18.18
17941.	GerDi (gerdii)	11	61.75	80.20	5	45.45
17942.	Genie (genielee)	11	111.77	137.01	6	54.55
17943.	Griffin (gdawg_10)	11	70.58	81.07	7	63.64
17944.	Sam (garuda1221)	11	86.23	98.47	8	72.73
17945.	Gaphnix (gaphnix)	11	63.68	66.80	4	36.36
17946.	Galib (galib2051)	11	70.49	77.81	4	36.36
17947.	Gabber (gabbergandalf)	11	62.84	67.87	3	27.27
17948.	Gochu (g0inginsqne)	11	108.43	116.69	5	45.45
17949.	UppedFusion (fusion_)	11	110.27	119.53	6	54.55
17950.	FusionHimSelf (fusionraider1)	11	53.87	66.54	2	18.18
17951.	Fromitz (fromitz)	11	94.25	111.14	1	9.09
17952.	Wilson (friwilly)	11	72.60	85.46	3	27.27
17953.	Frat (fratios)	11	113.67	139.61	6	54.55
17954.	Lank (franklank)	11	76.14	84.40	1	9.09
17955.	Forsegle (forsegle)	11	54.41	59.54	3	27.27
17956.	Pog (fooooood)	11	105.56	136.14	6	54.55
17957.	Cody (foggen)	11	95.64	113.96	5	45.45
17958.	Michal (fly_you_fools)	11	75.15	85.18	6	54.55
17959.	Mark Hightower (flytower69)	11	118.65	140.41	9	81.82
17960.	Benson (flowery_robot)	11	71.83	88.55	6	54.55
17961.	hi (florzie_101)	11	73.52	91.20	4	36.36
17962.	floffy (floffyunicorn)	11	100.18	116.69	4	36.36
17963.	saar (flappy_dude)	11	66.08	79.26	1	9.09
17964.	NotFlame (flameon0703)	11	60.21	65.97	1	9.09
17965.	Michael (fkafkaneko)	11	80.11	99.04	4	36.36
17966.	Rishabh (fire_tornado3)	11	72.34	80.86	2	18.18
17967.	Ferresmash (ferdinandohrn)	11	65.85	81.88	5	45.45
17968.	Sasan (farnasirim)	11	107.13	120.43	7	63.64
17969.	tuan (fajerso)	11	78.85	97.62	1	9.09
17970.	Faded (fadedcrown95)	11	54.00	65.66	3	27.27
17971.	Faded7 (faded7)	11	85.11	98.58	3	27.27
17972.	Fabrizio (fab_)	11	81.01	99.69	4	36.36
17973.	Grant (eyz11327)	11	108.02	116.83	6	54.55
17974.	Evan (eyatri)	11	91.43	101.15	4	36.36
17975.	sudden (explosionsarenice)	11	75.65	87.12	3	27.27
17976.	Pepeg (evolvingpepeg)	11	101.79	123.42	6	54.55
17977.	Steeferino (evlpacman)	11	113.55	136.51	7	63.64
17978.	Evan250250 (evan250250)	11	97.51	130.91	3	27.27
17979.	Eugene (eugene1)	11	73.53	93.31	4	36.36
17980.	Roland (errur)	11	90.53	110.90	4	36.36
17981.	Champion (error404_winner)	11	59.86	69.21	2	18.18
17982.	Not Fast (ernmanke)	11	65.16	71.85	4	36.36
17983.	Erim (erimmos)	11	65.49	72.94	6	54.55
17984.	Eric (eric_05)	11	76.73	88.25	6	54.55
17985.	Alex (equidorian)	11	110.30	116.86	5	45.45
17986.	a (eqnzio)	11	100.53	115.31	5	45.45
17987.	Eoghan (eoghanshox420)	11	56.81	63.23	3	27.27
17988.	deon (emonemoemo)	11	107.96	125.57	3	27.27
17989.	Liam (emissions)	11	110.28	136.40	7	63.64
17990.	elnino (elnio2803)	11	87.29	104.24	2	18.18
17991.	Elibay (elibay98)	11	72.91	79.15	5	45.45
17992.	Electro (electrotech17)	11	58.24	67.01	2	18.18
17993.	victor (einzu)	11	46.44	56.55	0	0.00
17994.	asdfhuiosdfgshiodfhji (efrd...	11	116.06	131.87	10	90.91
17995.	eenterr (eenterr)	11	81.27	88.20	2	18.18
17996.	Bob (echonex)	11	74.98	85.88	6	54.55
17997.	Dekaj (d_kaj)	11	69.73	82.56	11	100.00
17998.	dtn (dvdn)	11	106.28	117.93	6	54.55
17999.	Davi (dusk_09)	11	137.41	152.87	7	63.64
18000.	Daulet (dtk6)	11	48.86	62.58	4	36.36
18001.	dsa8 (dsa8)	11	91.00	98.21	2	18.18
18002.	Máté (drunkendegroot)	11	84.25	93.99	4	36.36
18003.	Hugh (drhugh)	11	68.16	77.81	3	27.27
18004.	drew (drewthejedi)	11	75.95	82.44	4	36.36
18005.	ha (drchill)	11	90.64	103.58	1	9.09
18006.	Deric Lewis (dragon760)	11	24.40	36.49	3	27.27
18007.	Jan (draggonnfs)	11	81.42	97.90	2	18.18
18008.	Shrig (dracon7260)	11	101.73	116.98	4	36.36
18009.	dorj (dorjoo)	11	64.42	76.18	2	18.18
18010.	doremy (doremypuyotet)	11	152.03	180.08	9	81.82
18011.	dom (domxrare)	11	57.61	68.66	2	18.18
18012.	Carl (doctorkohaku)	11	104.75	118.50	4	36.36
18013.	ttvdivertingwhale (divertin...	11	116.18	137.66	10	90.91
18014.	Dio (dio_b_)	11	73.13	81.35	11	100.00
18015.	Diogo (diogosilva)	11	45.58	51.08	1	9.09
18016.	Benedikt (dikt73)	11	79.04	93.16	6	54.55
18017.	Dennis (dheitinga)	11	78.38	91.00	7	63.64
18018.	Dev (devparkk)	11	63.25	73.30	4	36.36
18019.	devendra (devendra303)	11	36.48	48.45	0	0.00
18020.	Derhein (derhein24)	11	51.97	68.52	2	18.18
18021.	Yoshimitsu (deep_impact)	11	64.62	71.69	3	27.27
18022.	Deathwish (death_wish)	11	86.53	94.15	2	18.18
18023.	Ahmed (dd3x)	11	69.70	78.90	1	9.09
18024.	Aman Daudung (daudung_5)	11	43.02	47.92	1	9.09
18025.	Anthony (daslayer05)	11	73.30	81.53	2	18.18
18026.	Poop (danukas155)	11	91.30	115.60	4	36.36
18027.	Daniel (danucu22)	11	37.10	52.04	2	18.18
18028.	Salzpanik (daniely1160)	11	86.00	132.61	5	45.45
18029.	Spavid (dadkos34)	11	81.34	115.73	7	63.64
18030.	Jay (cyber_ace)	11	50.30	58.69	1	9.09
18031.	Cris (ctietsort)	11	107.86	121.79	4	36.36
18032.	albert (csnake)	11	99.79	106.64	5	45.45
18033.	csgo (csaddict)	11	61.71	73.47	1	9.09
18034.	Charlie (crystal_gamer)	11	67.12	75.96	3	27.27
18035.	Vincent (cruhm)	11	98.49	131.80	3	27.27
18036.	NATURELOVER (crafting112)	11	99.43	115.91	3	27.27
18037.	CPawx (cpawx)	11	102.32	118.71	2	18.18
18038.	Cow (cowscantype)	11	103.44	113.26	4	36.36
18039.	Hugo (cortexior)	11	75.95	82.43	3	27.27
18040.	Jose (cornjose877)	11	82.48	97.85	2	18.18
18041.	CoolMan14 (coolman14)	11	71.27	83.27	8	72.73
18042.	Converto (converto)	11	69.20	78.99	3	27.27
18043.	ocean man (clickbaitt)	11	89.41	97.74	2	18.18
18044.	ㅤ (clarified)	11	131.02	145.38	4	36.36
18045.	lord (cintrixity)	11	83.95	97.12	7	63.64
18046.	clicky (cinadeeye)	11	114.69	129.14	6	54.55
18047.	Christian (christianwells)	11	72.56	85.43	4	36.36
18048.	Hyx (christianmoises)	11	88.19	96.78	0	0.00
18049.	Luis (chiklay)	11	100.08	123.09	1	9.09
18050.	Jason (cherryitbruhnarutojizz)	11	103.38	117.90	4	36.36
18051.	Nurbek (cheburekkek)	11	62.87	72.12	2	18.18
18052.	Sahil (chazos)	11	46.44	51.71	3	27.27
18053.	Wei (charles2007)	11	79.79	94.12	10	90.91
18054.	Vei (cengi)	11	97.79	123.29	5	45.45
18055.	Cel (celad0n)	11	104.50	118.85	5	45.45
18056.	*** (ccccalvinn)	11	73.38	89.03	2	18.18
18057.	Carlos (carloshdelreal)	11	55.42	62.57	1	9.09
18058.	Cameron (camma)	11	69.10	82.30	1	9.09
18059.	c4th0d3 (c4th0d3)	11	97.98	121.30	2	18.18
18060.	Heriberto (c4rt4sbarajas)	11	54.12	68.73	2	18.18
18061.	Marcus (byteeater)	11	93.96	107.39	7	63.64
18062.	ByamB4 (byamb4)	11	81.91	95.61	6	54.55
18063.	Benjamin (bxrivx)	11	106.33	125.89	2	18.18
18064.	mikey (buzzpmikey)	11	101.24	123.45	7	63.64
18065.	Andrew (buttmann64)	11	102.89	126.59	6	54.55
18066.	bunkered (bunkeredgame)	11	90.83	109.38	6	54.55
18067.	Nicholas (bsg8)	11	55.83	65.16	2	18.18
18068.	Bryce (bryce_verberne)	11	76.86	93.82	7	63.64
18069.	Marko (bru_)	11	63.90	72.94	1	9.09
18070.	Brian (briannstiven)	11	51.77	55.70	5	45.45
18071.	brady (bradyone)	11	79.20	92.22	2	18.18
18072.	Bradley (bradley_brown)	11	94.94	105.48	1	9.09
18073.	Hannah (bored_hannah)	11	53.18	63.25	1	9.09
18074.	Not as fast as Reckful (bol...	11	93.92	104.09	6	54.55
18075.	bob (bobobb)	11	142.93	169.74	10	90.91
18076.	m (bluesiren)	11	96.41	120.45	5	45.45
18077.	Richard (blitzd2020)	11	91.19	100.04	3	27.27
18078.	Bucecean (blaskowiscz)	11	144.46	189.80	7	63.64
18079.	Black (black_pineapple)	11	64.98	76.86	3	27.27
18080.	bitte (bitteschnell)	11	85.40	106.22	8	72.73
18081.	bishwash (bishwash_patel)	11	42.02	62.78	2	18.18
18082.	Bishwash (bishwashadhikari)	11	58.92	75.13	3	27.27
18083.	bill (bill_hunt22)	11	29.01	32.41	0	0.00
18084.	Brian (bgan)	11	93.49	100.79	6	54.55
18085.	Musharaf (benthorzm)	11	86.39	100.82	3	27.27
18086.	Ben (bendoman_)	11	107.93	119.29	6	54.55
18087.	Borky (beckysingasong)	11	104.20	122.71	6	54.55
18088.	Grayson (beanbagman)	11	57.67	70.21	8	72.73
18089.	Bdog (bdogblue)	11	50.90	56.78	2	18.18
18090.	Batuhan (batuhan_tbb)	11	61.24	74.25	4	36.36
18091.	voidtab (battini)	11	68.17	74.50	3	27.27
18092.	Bogdan (bartfast42)	11	46.30	51.02	1	9.09
18093.	Bartek (barteker19)	11	69.79	80.29	1	9.09
18094.	brendan (barnold2)	11	97.31	114.78	4	36.36
18095.	li (badplayer970)	11	97.71	118.29	4	36.36
18096.	Kyle (badadc)	11	92.70	112.81	5	45.45
18097.	Baby (babyfacedassassin)	11	79.15	97.84	1	9.09
18098.	Bryan (b27i5n)	11	111.95	129.52	5	45.45
18099.	Nany (a_nany)	11	43.09	48.62	1	9.09
18100.	ayy (ayy_cocotype17)	11	56.44	69.27	10	90.91
18101.	Caleb (awsumbabysnarl)	11	86.55	100.30	2	18.18
18102.	Avlotis (avlotis)	11	106.81	114.95	4	36.36
18103.	Turbo (avash101)	11	64.56	75.66	1	9.09
18104.	Auiyin (auiyin)	11	89.27	99.72	6	54.55
18105.	choi (ateezofficial)	11	71.82	83.52	2	18.18
18106.	Ahmad (asz13)	11	99.75	109.87	5	45.45
18107.	AC (astralcalamity)	11	96.24	107.48	3	27.27
18108.	Panagiotis (asifo)	11	47.14	59.28	0	0.00
18109.	Living (asianliving)	11	92.14	100.35	2	18.18
18110.	Thuan (asianboiii)	11	61.00	81.28	0	0.00
18111.	Ashiquzzaman (ashiquzzaman33)	11	70.98	78.21	1	9.09
18112.	Buster (artistinthehoodie)	11	48.78	61.22	0	0.00
18113.	Artur (arthurisit)	11	86.23	100.30	4	36.36
18114.	Adam (armorcle)	11	108.97	122.99	7	63.64
18115.	Arjuna (arjuna_)	11	84.63	95.21	3	27.27
18116.	NewKeyboardDontLaugh (arisk...	11	86.71	102.38	6	54.55
18117.	Ariful (ariful_farhad)	11	52.79	59.37	0	0.00
18118.	ayu (areyouayu)	11	91.72	107.20	4	36.36
18119.	null (apstamp45)	11	58.80	65.36	1	9.09
18120.	DC (applespammer)	11	74.80	89.84	0	0.00
18121.	Abhinay (apasunuri)	11	86.04	94.80	0	0.00
18122.	Anthony (anthony_787)	11	83.99	99.74	1	9.09
18123.	Anthony (ant333man)	11	75.33	83.16	3	27.27
18124.	anoniman (anoniman_0001)	11	102.18	117.96	1	9.09
18125.	Andrewb (andrewbb)	11	89.42	97.02	7	63.64
18126.	Leroy (ancientnoodles)	11	78.17	84.74	7	63.64
18127.	Ahmet (amutlugun)	11	75.39	83.73	2	18.18
18128.	Aman (amanminerulez)	11	67.63	75.29	2	18.18
18129.	Bryo (alta1r)	11	47.85	70.23	7	63.64
18130.	AJ (alquinso_)	11	87.43	100.61	3	27.27
18131.	alisa (alisalmao)	11	76.27	89.83	5	45.45
18132.	Alexander (alexanderfzz)	11	69.53	81.17	4	36.36
18133.	Alaa (alaaalmasri00)	11	75.38	84.42	3	27.27
18134.	Akitolight (akitolight)	11	106.91	113.86	6	54.55
18135.	aki (akiiiwashere)	11	79.68	98.76	5	45.45
18136.	Gabriel (akgabe)	11	63.76	69.70	4	36.36
18137.	Aidan (aidan605)	11	70.64	78.33	2	18.18
18138.	Ahmad (ahmad_a_0)	11	86.22	104.28	2	18.18
18139.	ahgirl (ahgirl123)	11	74.29	90.03	2	18.18
18140.	Aubrey (ahensley)	11	83.32	95.49	1	9.09
18141.	Vincent (aetherxd)	11	94.91	115.81	4	36.36
18142.	Aedrick (aedrick)	11	69.19	83.49	1	9.09
18143.	Advaanture (advaanture)	11	60.17	71.62	2	18.18
18144.	(adma)	11	153.99	186.35	11	100.00
18145.	Adam (adam1101)	11	79.14	95.26	5	45.45
18146.	Marc (ackermanick)	11	67.46	76.19	2	18.18
18147.	Ace (aceofcaps)	11	74.37	89.36	2	18.18
18148.	Abyo (abyo)	11	60.68	69.98	1	9.09
18149.	Mahmudul Hasan🕋🕌 (abo...	11	62.76	76.06	0	0.00
18150.	Dominique - Axl (able_04)	11	54.08	61.96	0	0.00
18151.	Fyroo (abelkarbel)	11	60.41	68.47	5	45.45
18152.	Homieboy (abcjohnabdjohn)	11	48.20	58.06	2	18.18
18153.	TTTT (aa7608327)	11	56.64	65.96	3	27.27
18154.	Vikas (a4atom)	11	83.98	94.00	3	27.27
18155.	7zephyr (7zephyr)	11	104.30	117.19	6	54.55
18156.	yanna (7yanna)	11	115.49	132.08	4	36.36
18157.	Random (65h1000)	11	104.57	111.26	5	45.45
18158.	Cody (5niffles)	11	87.78	100.34	4	36.36
18159.	Pixel (2pixles)	11	61.99	76.25	4	36.36
18160.	Liam (2020lhall)	11	67.81	78.57	2	18.18
18161.	Afik (afikrazanafi)	11	33.74	38.78	0	0.00
18162.	MeeM (memepolice)	11	73.50	86.96	8	72.73
18163.	Amit (_amit_)	11	75.16	84.49	2	18.18
18164.	joefromfamilyguy (joefromfa...	11	91.40	111.61	7	63.64
18165.	Chris (kringlepringle)	11	85.24	99.34	1	9.09
18166.	Alex (yettibvc)	11	41.16	48.33	0	0.00
18167.	Kitzia (kavila7)	11	56.11	76.16	0	0.00
18168.	ITZZAC (itzzac_youtube)	11	44.20	57.78	2	18.18
18169.	Tim (twitchanbumaniac)	11	52.48	65.24	5	45.45
18170.	salah (salah1406)	11	66.96	77.88	1	9.09
18171.	Phindoll (philosopher_phun)	11	71.35	87.03	4	36.36
18172.	Tissue (tissuenoob)	11	55.84	61.56	2	18.18
18173.	Participant (_chethan18)	11	55.80	62.71	4	36.36
18174.	JMoneyThug (jthugmoney)	11	77.84	92.86	2	18.18
18175.	Ryyn (ryyn_isr)	11	71.24	78.30	2	18.18
18176.	Firestar162 (firestar162)	11	45.57	61.54	3	27.27
18177.	Christian (campi)	11	100.13	122.09	6	54.55
18178.	rin (rieiode)	11	65.49	79.40	2	18.18
18179.	Ronin (ronin_1)	11	63.07	71.11	3	27.27
18180.	Jiyon (johnrhey324)	11	36.21	46.20	0	0.00
18181.	Falin (falin224)	11	49.74	59.24	5	45.45
18182.	Luke (sirlukeoiv)	11	61.39	70.19	4	36.36
18183.	Guillaume (bilaptor)	11	51.39	55.81	0	0.00
18184.	AJ (applepie314)	11	66.19	80.74	1	9.09
18185.	nht (nhtonmoy)	11	58.53	64.48	5	45.45
18186.	Jachin (optimal_husky)	11	85.20	94.15	5	45.45
18187.	Dave (jungolo)	11	80.78	90.20	2	18.18
18188.	Jason (jpbascon)	11	87.29	95.28	4	36.36
18189.	Morgen (germansdfsd)	11	58.46	69.83	2	18.18
18190.	Vilgot (fido_mandem)	11	73.35	87.04	4	36.36
18191.	Matus (zlatovlasko)	11	67.62	79.36	3	27.27
18192.	Steph (stephsim)	11	55.76	65.05	1	9.09
18193.	BurntBac0n (burnt_bacon08)	11	91.35	105.66	6	54.55
18194.	AcroniX (acronix_iom)	11	83.50	92.33	4	36.36
18195.	Rain (ghetsis)	11	66.77	72.26	0	0.00
18196.	EdmiszTheProto (edmisz1000)	11	62.85	74.49	1	9.09
18197.	Grant (grant_types)	11	66.01	78.26	2	18.18
18198.	Philip (philipisawesome4)	11	76.64	91.91	1	9.09
18199.	Saif (littleboy291)	11	42.28	48.69	0	0.00
18200.	Sam (caldeen)	11	73.42	84.40	3	27.27
18201.	Axel (axless)	11	32.49	35.46	1	9.09
18202.	hououin (hououinkyouma10)	11	61.43	68.99	2	18.18
18203.	Jackson (saintpepsi)	11	44.00	55.47	0	0.00
18204.	cameron (cammyteo)	11	99.78	114.25	6	54.55
18205.	Ammar (shaikh_ammar)	11	89.97	97.04	6	54.55
18206.	Eduard Felipe (efmorab)	11	67.11	75.91	2	18.18
18207.	Edris (babyheaven)	11	80.24	101.26	5	45.45
18208.	Ehm (doubleuehm)	11	84.13	108.04	2	18.18
18209.	Herf (heerf)	11	72.34	84.70	3	27.27
18210.	Pai (paipai00)	11	72.03	86.70	1	9.09
18211.	Ferdie (ferdiepie)	11	84.78	110.51	7	63.64
18212.	Antoni (fixyyy)	11	48.56	52.79	0	0.00
18213.	Josh (joshuayu12)	11	85.23	106.68	5	45.45
18214.	Bob (bob_the_driver)	11	75.76	95.63	3	27.27
18215.	Axrorbek (abduxolikov_axror)	11	41.66	49.07	1	9.09
18216.	Vansh (vansh_)	11	85.17	93.02	5	45.45
18217.	daniel (danniel_29)	11	71.19	77.94	4	36.36
18218.	Jewel (jcpenguin168)	11	94.57	113.21	9	81.82
18219.	R (treeondirt)	11	79.65	89.52	3	27.27
18220.	LaikaX2 (laikax2)	11	75.05	87.31	4	36.36
18221.	Burakki (burakki)	11	90.88	104.60	7	63.64
18222.	Rezaul (rezaulhsagar)	11	72.41	87.43	5	45.45
18223.	Buggati Beetle (dwiil)	11	103.98	122.95	6	54.55
18224.	mikolah (gruby1265)	11	74.80	84.61	1	9.09
18225.	Faisal (faisal_eub)	11	39.14	47.61	3	27.27
18226.	Imam (imam_droubi)	11	55.76	71.37	2	18.18
18227.	Omar (omar963963)	11	50.49	58.01	0	0.00
18228.	muffnbuttn (muffnbuttn)	11	69.03	82.46	3	27.27
18229.	Michaella Alessandra (bling...	11	68.19	74.36	3	27.27
18230.	tongs (skglo)	11	79.57	89.78	5	45.45
18231.	Richard (ziveria)	11	47.32	58.10	0	0.00
18232.	Džiugas (xdziugas)	11	41.43	50.36	1	9.09
18233.	Sai (nikhil_nikky_1221)	11	30.53	37.50	1	9.09
18234.	Troy (yeahaha010)	11	68.95	82.31	7	63.64
18235.	Julian (julian72cr)	11	41.58	50.87	3	27.27
18236.	ked (kedary3)	11	37.15	45.84	2	18.18
18237.	TJ (planee)	11	51.16	60.47	8	72.73
18238.	asdf (cyber_gny)	11	65.66	85.52	3	27.27
18239.	Martin (waldoska)	11	67.07	80.76	4	36.36
18240.	Sina (sinaakh)	11	54.83	62.78	3	27.27
18241.	Weegee (littleweegee)	11	102.88	119.92	5	45.45
18242.	Miya (miya11)	11	54.13	60.55	1	9.09
18243.	Nazmul Haque (codebyred)	11	59.34	69.27	3	27.27
18244.	Mizuto- (yull)	11	55.29	63.06	0	0.00
18245.	tomer (tomerkligman)	11	50.00	60.50	2	18.18
18246.	Jun (unicornsandrainbows)	11	82.94	94.31	2	18.18
18247.	i write code (_yay)	10	84.83	105.36	8	80.00
18248.	Mr.Buttons (_tanuuuu)	10	85.05	93.72	3	30.00
18249.	Megatypist (_megatypist_)	10	120.16	138.55	7	70.00
18250.	Eoyzyc (_eoyzyc_)	10	34.94	46.27	2	20.00
18251.	Fabian (zyzyx)	10	80.93	88.70	4	40.00
18252.	Marz (zuchan)	10	94.41	109.12	6	60.00
18253.	zoomrickyyy (zoomricky)	10	75.97	87.21	5	50.00
18254.	Zachary (zjroote)	10	79.09	89.99	1	10.00
18255.	Zir0 (ziiro)	10	93.75	105.60	4	40.00
18256.	Tony (zhukant)	10	109.46	121.48	5	50.00
18257.	Zen (zencreepz)	10	91.79	110.60	4	40.00
18258.	zanydruid (zanydruid)	10	72.35	85.14	2	20.00
18259.	Zak (zak1388)	10	73.24	96.74	5	50.00
18260.	Cojo (zagoat)	10	62.27	70.51	1	10.00
18261.	Tim (yutuyt)	10	112.35	132.08	8	80.00
18262.	Zach (yo_zs)	10	58.60	73.16	1	10.00
18263.	Aleksandar (yoursis)	10	53.68	62.93	3	30.00
18264.	Yothin (yothinix)	10	60.75	66.75	0	0.00
18265.	Kevin (yolonce)	10	50.65	57.92	2	20.00
18266.	Yerkegul (yerkesha)	10	41.44	45.16	2	20.00
18267.	Yelzhan (yelzhansky)	10	36.92	39.88	0	0.00
18268.	yamrawr (yamrawr)	10	148.98	167.45	7	70.00
18269.	yoshiking (y05h1k1ng)	10	57.82	70.64	2	20.00
18270.	huge (xxxtentaciontrippiere...	10	46.31	58.45	2	20.00
18271.	Ted (xted)	10	111.56	131.99	6	60.00
18272.	Noah (xsonorous)	10	92.38	103.55	2	20.00
18273.	xsharawi (xsharawi)	10	64.10	84.60	2	20.00
18274.	Nick (xogtwo)	10	49.53	63.35	2	20.00
18275.	xLikely (xlikely1)	10	113.72	124.99	7	70.00
18276.	Lian (xlian)	10	84.26	106.87	4	40.00
18277.	Zach (xachg)	10	70.92	79.00	4	40.00
18278.	Hoesmad (woshinidie123)	10	74.32	86.93	2	20.00
18279.	Fluffster (wlmao)	10	74.76	105.39	2	20.00
18280.	Witre (witred)	10	74.31	91.50	6	60.00
18281.	William (willkosasih)	10	66.58	71.19	1	10.00
18282.	Nathaniel (wiiman)	10	59.41	68.13	4	40.00
18283.	Walter (whunt5757)	10	93.70	115.67	4	40.00
18284.	what (what_what_what)	10	97.06	114.98	4	40.00
18285.	50 Year Old Girl (whatsthis)	10	83.47	108.09	3	30.00
18286.	Zachary (weiser)	10	83.35	97.23	4	40.00
18287.	Wanizame (wanizame)	10	76.44	92.92	2	20.00
18288.	TheDecentPretender (wamsly)	10	90.50	99.97	2	20.00
18289.	Dean (wahrheit)	10	84.12	102.85	3	30.00
18290.	V (vy171)	10	100.35	130.17	1	10.00
18291.	Average (vuzid)	10	92.14	119.27	10	100.00
18292.	Vojtěch (vojtar)	10	72.44	85.03	1	10.00
18293.	Vic (vicjen)	10	99.60	114.09	6	60.00
18294.	han (vapour_)	10	106.13	116.04	5	50.00
18295.	van (van8878)	10	45.29	54.38	0	0.00
18296.	Kevin (v3rmillian)	10	82.26	96.98	0	0.00
18297.	Mats (uxorialrook)	10	85.40	94.79	3	30.00
18298.	uska95 (uska95)	10	55.56	67.71	1	10.00
18299.	Denni (uramazing)	10	102.08	114.44	7	70.00
18300.	Smooth (undeadplayer)	10	49.55	54.41	1	10.00
18301.	Orlando (ultraonlinexd)	10	46.47	61.79	0	0.00
18302.	Esther (ueatmypoop)	10	58.68	70.63	1	10.00
18303.	Typing (typotyper1738)	10	59.69	80.18	1	10.00
18304.	Rider (typerrider)	10	116.04	132.79	6	60.00
18305.	Andrew (typegad)	10	54.25	63.49	4	40.00
18306.	Matthew (twixinator)	10	96.81	110.68	2	20.00
18307.	Felix (twiizy)	10	71.51	82.27	4	40.00
18308.	Daniel (turnercommadan)	10	66.83	71.80	3	30.00
18309.	Jim (turkeyfetish)	10	90.03	103.33	5	50.00
18310.	Mike (tsunami21)	10	93.91	105.94	1	10.00
18311.	Taush (tsampley)	10	85.62	103.19	4	40.00
18312.	TREMAINE (tremaine_m)	10	67.97	83.15	1	10.00
18313.	Tour2738 (tour2738)	10	42.08	46.69	1	10.00
18314.	ToncaIlPunta (toncailpunta)	10	77.57	89.05	4	40.00
18315.	Token (token_typer)	10	77.47	91.63	3	30.00
18316.	Isaac (tkdwarrior)	10	63.51	70.53	3	30.00
18317.	hihihi (tjddb123456)	10	137.77	149.04	7	70.00
18318.	Timmy (tjdaroya1)	10	99.07	115.95	9	90.00
18319.	Tinky (tinkywinkyy)	10	82.77	94.14	2	20.00
18320.	TinklyBell (tinklybell1608)	10	77.21	85.94	4	40.00
18321.	Stewart (timberland9x)	10	63.05	83.95	0	0.00
18322.	tilen (tilen219)	10	51.07	61.54	2	20.00
18323.	Ella (tigger1854)	10	76.37	98.85	4	40.00
18324.	TRUMP (tiepin)	10	93.01	102.01	2	20.00
18325.	Mrigank (tickatron)	10	40.03	53.52	1	10.00
18326.	@itz_ramy (thugsheep)	10	82.12	94.94	3	30.00
18327.	Thooq (thooq)	10	57.53	61.23	2	20.00
18328.	Lan (thien_hai13)	10	56.25	66.09	1	10.00
18329.	Nikolas (the_sleepy)	10	75.89	79.36	1	10.00
18330.	the_redcar (the_redcar)	10	93.67	123.69	6	60.00
18331.	themar (themar)	10	57.26	66.13	1	10.00
18332.	not_inte2 (theinte)	10	93.97	105.12	4	40.00
18333.	Thang (thangvu7)	10	83.26	102.39	4	40.00
18334.	Patrick (tepill)	10	100.76	116.87	4	40.00
18335.	Teo (teotheterminator)	10	56.76	65.88	3	30.00
18336.	Sean (tensai888)	10	80.92	97.21	3	30.00
18337.	Templeton (templetontsai)	10	63.50	68.46	0	0.00
18338.	funky (teletubbystan)	10	59.22	65.18	3	30.00
18339.	Caleb (tekksic)	10	61.68	76.23	3	30.00
18340.	Harshit (techallbyharshit)	10	67.15	80.30	2	20.00
18341.	Tcoman (tcoman1)	10	67.27	72.54	6	60.00
18342.	Luke (tbsky92)	10	93.15	110.75	9	90.00
18343.	Tavora (tavora)	10	108.41	127.19	6	60.00
18344.	Tatsky (tatskynuki)	10	151.19	191.75	6	60.00
18345.	Andrew (taroth)	10	101.23	119.97	4	40.00
18346.	Talbiya (talbiya)	10	37.12	43.09	4	40.00
18347.	takeoutfoo (takeoutfoo)	10	102.43	121.23	6	60.00
18348.	Andy (tactilegangriseup)	10	109.47	134.41	5	50.00
18349.	Tasman (t4sm4n)	10	66.82	73.75	1	10.00
18350.	Sybetron (sybetron)	10	34.21	43.97	1	10.00
18351.	Sweeter (sweetervanilla)	10	96.29	112.21	5	50.00
18352.	swat (swatxian)	10	64.59	74.83	5	50.00
18353.	Sushanth (sushanthgeorgesur...	10	54.02	67.00	3	30.00
18354.	Huy (xthyax)	10	58.98	68.01	3	30.00
18355.	Sultan (sultanai)	10	92.68	109.64	4	40.00
18356.	me (suited4hike)	10	126.04	143.15	10	100.00
18357.	lior (sudden_lee)	10	57.22	66.57	0	0.00
18358.	deegl0rd (stimoze)	10	93.61	100.85	4	40.00
18359.	Sticfigure (sticfigure)	10	45.19	50.61	1	10.00
18360.	Starmaster (starmasterx)	10	63.52	71.88	7	70.00
18361.	Venice (starbucks272)	10	99.48	107.79	4	40.00
18362.	StaliaN (stalian)	10	77.50	88.68	0	0.00
18363.	Ok (ss__)	10	69.11	82.56	1	10.00
18364.	Soph (sssoooppphhh)	10	85.18	98.02	1	10.00
18365.	ssofia (ssofia_bas)	10	28.29	33.91	2	20.00
18366.	speed (speed_boiiii)	10	64.70	76.25	3	30.00
18367.	Speed (speedarmstrong)	10	95.73	119.65	3	30.00
18368.	Specter (spectergrrim)	10	99.12	112.11	2	20.00
18369.	Spammer (spammerforlife)	10	100.47	112.48	7	70.00
18370.	K. (spacewalker)	10	111.10	128.77	5	50.00
18371.	ejay (spacebars_)	10	79.53	86.11	2	20.00
18372.	Moz (soul3n)	10	98.47	114.00	4	40.00
18373.	mooth (sooruva)	10	80.87	90.19	4	40.00
18374.	Sonic (sonicaks)	10	83.87	90.68	1	10.00
18375.	bruh (sojucravings)	10	92.60	109.15	4	40.00
18376.	Soggy (soggydog)	10	93.02	106.75	2	20.00
18377.	SockYeh (sockyeh)	10	84.99	97.81	5	50.00
18378.	void (soberr)	10	75.10	84.99	3	30.00
18379.	saumitra (smtrd3)	10	38.89	44.76	0	0.00
18380.	tiffany (skipperdee)	10	76.90	94.64	3	30.00
18381.	Chris P. (sirjean_pepper)	10	97.28	109.39	4	40.00
18382.	Sidveed (sidveed)	10	96.63	116.44	2	20.00
18383.	shxvnk (shxvnk)	10	80.55	87.17	3	30.00
18384.	Shivam Kumar (shivam51)	10	71.23	84.01	3	30.00
18385.	(shinobukocho)	10	126.55	167.48	7	70.00
18386.	TWICE Dahyun (sheenic)	10	83.58	100.25	5	50.00
18387.	quit=trash (shatapfajjat69)	10	82.41	100.21	3	30.00
18388.	Shashank (shanky92)	10	82.23	92.25	2	20.00
18389.	Shania (shaniacans)	10	57.49	66.15	1	10.00
18390.	Alan (sexillamasexi)	10	84.22	98.33	6	60.00
18391.	sebastian (seviago)	10	48.51	54.96	2	20.00
18392.	I_love_seulgi (seulgischurro)	10	94.57	103.17	1	10.00
18393.	Sergio (sergio96c)	10	91.70	102.53	5	50.00
18394.	Summer (sccb_14)	10	46.89	54.56	8	80.00
18395.	Acetaminophen (savirbaas)	10	108.32	128.24	2	20.00
18396.	Saurus (saurus)	10	77.64	86.30	4	40.00
18397.	princeton (santabiii)	10	55.99	62.80	2	20.00
18398.	Sanmeel (sanmeel)	10	70.31	85.01	4	40.00
18399.	Samz (samzgm)	10	86.70	98.70	6	60.00
18400.	Sam (samh410)	10	86.25	101.18	4	40.00
18401.	Ezona (sambumbuslayer)	10	67.42	91.04	5	50.00
18402.	Rose (salemluna)	10	68.98	74.28	4	40.00
18403.	Sadaq (sadaq)	10	59.91	66.25	2	20.00
18404.	Saagster (saagster)	10	73.79	86.21	3	30.00
18405.	David (ryzeros)	10	94.27	111.16	3	30.00
18406.	Ricky (ryckler)	10	87.68	100.95	5	50.00
18407.	Rem (ryanz778)	10	117.40	129.51	5	50.00
18408.	Robert (rwschuster)	10	122.74	147.40	6	60.00
18409.	Antti (rustling)	10	81.53	94.06	4	40.00
18410.	Russell (russell_t3ap)	10	98.44	113.24	4	40.00
18411.	IMZA (runawayse)	10	71.26	79.33	1	10.00
18412.	Yash (rubikstyper)	10	69.76	84.41	1	10.00
18413.	Rsijlowpez (rsijlowpez)	10	120.08	131.44	6	60.00
18414.	Maroy (roymaaa)	10	107.23	127.22	3	30.00
18415.	lap (roeloflucka2)	10	74.99	85.86	2	20.00
18416.	Mohammad (robin420024)	10	16.03	19.82	2	20.00
18417.	Thint (rma251209)	10	58.41	69.25	2	20.00
18418.	Rafi (rkyum)	10	71.88	79.04	2	20.00
18419.	hplr (rkg0612)	10	105.27	119.21	3	30.00
18420.	Ricky (riyu22)	10	90.37	108.13	3	30.00
18421.	Rinat (rinatzh)	10	64.82	77.10	1	10.00
18422.	Rim (rimkyul)	10	59.66	69.25	7	70.00
18423.	Riggles (riggles)	10	89.74	103.38	1	10.00
18424.	ridan (ridanrekas)	10	67.81	75.92	2	20.00
18425.	Ricky (rickythedude)	10	61.55	68.54	1	10.00
18426.	Rickard (rickyspr)	10	69.67	84.42	4	40.00
18427.	I am cool (ribombee_mobile)	10	82.09	104.05	1	10.00
18428.	Removeris (removeris)	10	78.83	92.67	1	10.00
18429.	Relletro (relletro)	10	65.69	77.66	3	30.00
18430.	Relja Bulat (relja0804)	10	48.39	56.28	2	20.00
18431.	Krsman (rektix)	10	85.80	93.21	1	10.00
18432.	Simon (rehy)	10	41.78	46.28	2	20.00
18433.	Regan (regank1)	10	67.02	74.49	2	20.00
18434.	Raynei (raynei)	10	90.04	107.34	4	40.00
18435.	Ravindi (rav2525)	10	71.95	89.92	4	40.00
18436.	Zain (rasnouk)	10	76.14	86.30	2	20.00
18437.	Rania (rania_mostafak)	10	40.61	45.85	0	0.00
18438.	Rana (rana2706)	10	49.39	57.20	1	10.00
18439.	Teddy (rampagingteddy)	10	62.78	69.10	1	10.00
18440.	Ramson (rammun)	10	69.27	80.89	0	0.00
18441.	Ralph (ralphcyrus0015)	10	68.85	80.67	2	20.00
18442.	MD ASHIQUL (rajib470)	10	58.94	66.19	0	0.00
18443.	weiss (rag_penguin)	10	107.08	135.37	3	30.00
18444.	t (raccoon_emoji)	10	57.76	71.48	4	40.00
18445.	Giovanni (qwertyg01)	10	66.18	75.37	3	30.00
18446.	tadeo (qwerm)	10	74.58	87.66	3	30.00
18447.	Eequla (quintaboy)	10	105.36	120.60	4	40.00
18448.	Lucas (pythonvx)	10	84.62	93.26	6	60.00
18449.	phasawat (puppaprubchok)	10	46.89	52.78	3	30.00
18450.	pun (punoar)	10	65.96	76.07	1	10.00
18451.	PulseAD (pulsead)	10	96.75	109.70	7	70.00
18452.	ProBlasters (pro_blasters)	10	63.06	76.56	4	40.00
18453.	Alexander (prayforwinter)	10	96.59	114.63	5	50.00
18454.	Prajwal10s (prajwal10s)	10	49.24	60.50	2	20.00
18455.	Molasses (practice12_3)	10	89.22	95.90	3	30.00
18456.	Mish (powerpuffgirl23)	10	57.04	66.98	5	50.00
18457.	Pouya (pouyav)	10	66.28	79.53	2	20.00
18458.	Nick (potatoshavings)	10	104.43	131.26	9	90.00
18459.	kyle (popedude22)	10	106.51	127.90	4	40.00
18460.	krisztofer (poofartmaster)	10	59.35	65.80	1	10.00
18461.	Jakis (polishboy12221)	10	74.07	78.86	2	20.00
18462.	Matt (pointlesspostulate)	10	84.60	90.94	7	70.00
18463.	podolsero (podolsero)	10	57.92	67.14	4	40.00
18464.	Grape (plrplrplr12345)	10	82.19	96.82	4	40.00
18465.	Kailh BOX Jade (plixxreeb)	10	101.52	119.95	5	50.00
18466.	Joe (playspout)	10	98.11	106.64	3	30.00
18467.	Gustavo (pizza_water)	10	68.32	75.34	2	20.00
18468.	P (pizzapita)	10	79.71	85.24	2	20.00
18469.	Daredevil (piyush_123)	10	66.93	71.86	3	30.00
18470.	Piyush (piyushc)	10	71.75	78.77	1	10.00
18471.	Phantom (phantomzamber)	10	56.38	67.12	2	20.00
18472.	Tim (penguins178)	10	81.76	100.58	3	30.00
18473.	peedmypants420 (peedmypants...	10	80.98	95.32	4	40.00
18474.	RIP Byron ❤ (pdnegreiros)	10	93.77	105.58	1	10.00
18475.	Willy (paxson2008)	10	87.28	96.04	4	40.00
18476.	Blagoj (pauc_99)	10	89.23	96.50	1	10.00
18477.	Francisco (patleitao)	10	93.37	109.07	7	70.00
18478.	Baki (p4n7r0n1c)	10	56.40	63.13	0	0.00
18479.	Alex (p08r)	10	86.21	95.15	3	30.00
18480.	oTTo (otto43)	10	67.20	83.26	1	10.00
18481.	Martin (ostlangarn)	10	62.88	68.66	2	20.00
18482.	Josh (orceun)	10	94.98	101.56	3	30.00
18483.	hyungjin (optimizion)	10	72.70	80.84	3	30.00
18484.	Drapanji (onedrapo)	10	74.75	83.68	1	10.00
18485.	Kenneth (omgkenken)	10	104.95	121.10	5	50.00
18486.	Olivia (olivisthecow)	10	97.42	112.02	6	60.00
18487.	Erwin (oldskoollogik)	10	80.11	94.16	4	40.00
18488.	Andy (okiandy)	10	106.40	125.70	6	60.00
18489.	Nush (nush98)	10	92.27	108.47	4	40.00
18490.	nurmyrza (nurzoik)	10	58.03	68.49	4	40.00
18491.	Numpunk (numpunk)	10	75.21	89.86	4	40.00
18492.	numdegased (numdegased)	10	96.37	102.96	3	30.00
18493.	I'm Bad (nssv101)	10	124.71	143.55	3	30.00
18494.	Tintallë (nparadigm)	10	68.96	73.79	2	20.00
18495.	Note (note_r)	10	89.86	113.95	5	50.00
18496.	kevin (noob98)	10	60.43	66.98	4	40.00
18497.	noniino (noniino)	10	53.41	57.38	2	20.00
18498.	DirtyDan.jpeg (nomar_76)	10	64.93	84.43	3	30.00
18499.	NoFace (nofacecastle)	10	52.07	68.97	1	10.00
18500.	Bryan (noddlersnorm)	10	97.08	105.17	4	40.00
18501.	Noah (noahbradderz)	10	75.01	90.58	1	10.00
18502.	Nitin (nitinaturdsk)	10	60.70	66.78	0	0.00
18503.	Sef (niktarera)	10	95.18	122.14	5	50.00
18504.	Nightmare (nightmare_foxy)	10	64.67	79.04	2	20.00
18505.	Nicholas (nicshoe13)	10	90.99	104.88	1	10.00
18506.	Nicholas (nichbillcliff)	10	90.84	93.57	3	30.00
18507.	BountifulFever5 (nguyenanhn...	10	47.38	50.27	1	10.00
18508.	NeVMiku (nevmiku)	10	67.23	81.07	3	30.00
18509.	mat (netman)	10	85.96	99.03	3	30.00
18510.	Neil (neil3110)	10	35.53	38.45	2	20.00
18511.	aaron (naruto2141)	10	92.08	103.96	2	20.00
18512.	nyaa~ (nakkooo)	10	131.02	173.70	6	60.00
18513.	Cát Gia (nahidk)	10	67.24	77.31	2	20.00
18514.	Nadia Gonzalez (nadiaig)	10	82.94	94.92	5	50.00
18515.	danielwolf (n3kro)	10	89.14	103.47	2	20.00
18516.	Louay (n0break)	10	36.50	42.85	0	0.00
18517.	Michael (m_soutar3)	10	108.35	122.09	6	60.00
18518.	Angela (mytypingskillsarent...	10	74.17	85.14	2	20.00
18519.	Michael (myki21)	10	70.18	84.68	3	30.00
18520.	Mustang (mustangmaster)	10	54.14	62.65	0	0.00
18521.	Mukul (mukul27wno)	10	41.53	47.22	0	0.00
18522.	M (mttt001)	10	80.94	90.24	4	40.00
18523.	Martin (mr_pandabear)	10	92.31	100.75	5	50.00
18524.	mr. (mr_maam)	10	91.37	107.29	4	40.00
18525.	Cara (mrsham)	10	81.91	104.28	9	90.00
18526.	MrLolu (mrlolux)	10	54.95	62.36	1	10.00
18527.	Michael (mrgryph0n)	10	104.48	114.33	2	20.00
18528.	Jordan (mrempyrean)	10	113.14	125.37	9	90.00
18529.	Jack (mopex)	10	63.66	75.95	2	20.00
18530.	Light (moory5)	10	86.95	93.18	1	10.00
18531.	tstats[montedeu] (montedeu)	10	61.55	69.85	1	10.00
18532.	Free Palestine (mohamad01)	10	58.24	66.06	1	10.00
18533.	TheScientist (mixalocyber)	10	67.24	79.98	2	20.00
18534.	Mistermanfith (mistermanfith)	10	35.31	40.73	0	0.00
18535.	Aidana (missboss77)	10	27.51	34.67	0	0.00
18536.	Wong (mioky)	10	33.11	38.21	1	10.00
18537.	mingw (mingw)	10	105.19	111.82	6	60.00
18538.	Mikael (mikael_abe)	10	61.37	71.25	1	10.00
18539.	Miday (miday)	10	106.31	118.04	4	40.00
18540.	Michael (michaell018)	10	63.28	74.19	3	30.00
18541.	SeeStarz (mfahrim)	10	94.22	115.43	4	40.00
18542.	Mentafind (mentafind)	10	79.73	93.59	5	50.00
18543.	XFootballManX (meme_licker_21)	10	45.30	53.26	0	0.00
18544.	Lil (memebigboy69xx)	10	79.03	86.52	5	50.00
18545.	Zsombor (melidon)	10	41.43	54.56	1	10.00
18546.	melau (melau)	10	105.46	125.84	5	50.00
18547.	Laisvidas (meizind)	10	55.14	59.71	1	10.00
18548.	Caba (megiorr69)	10	57.96	64.52	3	30.00
18549.	Meeze (meeze)	10	98.14	117.00	2	20.00
18550.	slow. (meeper24)	10	97.95	109.55	5	50.00
18551.	Max (mcm20)	10	94.68	102.52	0	0.00
18552.	Max (max_adagio)	10	104.11	121.32	1	10.00
18553.	Max (maxies)	10	57.63	65.60	3	30.00
18554.	Max (maxbro)	10	85.05	100.12	5	50.00
18555.	Matthew (mawalker66)	10	81.90	90.90	9	90.00
18556.	Groot (marcogroot)	10	106.35	122.64	4	40.00
18557.	bbl_drizzy (marcofia)	10	78.87	89.46	3	30.00
18558.	Marvin (marbinelyo)	10	65.49	74.64	3	30.00
18559.	Manuel (mannymnz)	10	80.52	96.89	4	40.00
18560.	Madhusudan (mainali449)	10	56.01	63.04	2	20.00
18561.	RoyMcGround (maggyroyrowins...	10	25.99	28.60	1	10.00
18562.	Orion (maggiea718)	10	73.58	82.82	3	30.00
18563.	Mae (maeeeeee)	10	143.25	168.65	10	100.00
18564.	Nagy (lurgul)	10	49.45	58.65	3	30.00
18565.	Luke (lukep421)	10	82.94	94.89	1	10.00
18566.	Gabe (lukeimyourdaddy)	10	76.45	82.42	6	60.00
18567.	Lucite (lucite)	10	103.77	111.64	5	50.00
18568.	Lucifer (lucifer_96)	10	47.04	55.74	2	20.00
18569.	Lucas (lucaz_)	10	57.71	64.45	2	20.00
18570.	Lowell (lowellfailingenglish)	10	95.59	120.25	3	30.00
18571.	Loukas (loukatar)	10	77.81	86.97	1	10.00
18572.	Lorky (lorkylav)	10	63.14	71.86	4	40.00
18573.	ju (lordofthecoochie)	10	52.19	56.78	0	0.00
18574.	最靚嘅仔 (lookingdepres...	10	82.89	92.44	2	20.00
18575.	Doc (lolnice)	10	97.78	125.18	6	60.00
18576.	Stephen (lollidude)	10	81.66	94.58	1	10.00
18577.	Lluna (lluna)	10	80.55	89.98	1	10.00
18578.	lluis (lluissuros)	10	25.73	28.15	1	10.00
18579.	simsimhae yagi (ljd1)	10	122.08	137.10	5	50.00
18580.	liv (livlyf_)	10	62.58	68.75	1	10.00
18581.	lisa (lisa99116)	10	79.07	106.05	1	10.00
18582.	Linda (lindaslabbert)	10	31.42	38.61	0	0.00
18583.	Youngbin (limesoda14)	10	74.71	80.37	1	10.00
18584.	Giannis (lil_spani)	10	74.65	89.88	6	60.00
18585.	boomer (lightaway)	10	51.13	62.66	0	0.00
18586.	lea (leyley01)	10	37.13	41.61	0	0.00
18587.	Francesco (lews_)	10	109.63	120.81	5	50.00
18588.	Justin (leslav)	10	114.99	144.04	6	60.00
18589.	leakcentral (leakcentral)	10	100.67	112.41	4	40.00
18590.	always_choking (leadmen4y)	10	131.65	145.12	9	90.00
18591.	Jason (laysonchillz)	10	73.61	83.60	3	30.00
18592.	Veronica (latenightpizza)	10	97.51	111.20	6	60.00
18593.	LastStar (laststar)	10	71.49	88.90	4	40.00
18594.	Larry (larryquartz)	10	100.91	116.63	7	70.00
18595.	Logan (larmack)	10	111.70	129.13	7	70.00
18596.	Chris (kyoriosity)	10	99.24	114.65	10	100.00
18597.	Sunny (kukie5)	10	90.00	97.39	4	40.00
18598.	Chris (kryss_404)	10	63.75	72.70	2	20.00
18599.	You're Slow (kronosxfleet)	10	69.01	79.82	2	20.00
18600.	Christian (krisco)	10	136.47	156.38	4	40.00
18601.	Big (kralefegaming)	10	62.39	72.87	2	20.00
18602.	Koiysn (koiysn)	10	59.62	75.71	1	10.00
18603.	Koii (koii2003)	10	80.97	89.35	5	50.00
18604.	Richard (killerscotchy)	10	73.29	94.07	5	50.00
18605.	kiki (kikifrederique)	10	37.05	41.82	3	30.00
18606.	KickBull (kickbull)	10	89.99	106.69	3	30.00
18607.	Abdulhamid (khamidsultan)	10	59.38	70.55	3	30.00
18608.	Not telling (kevinveinein)	10	105.76	120.63	3	30.00
18609.	Kevin (kevinchang823)	10	53.78	60.36	1	10.00
18610.	Kevin (kevinator314)	10	91.26	95.74	5	50.00
18611.	Kenshin (kenshin47)	10	96.10	110.85	7	70.00
18612.	Kei 100 (kei100)	10	83.01	95.03	4	40.00
18613.	bean (keenheen)	10	94.03	106.32	3	30.00
18614.	Keanu (keanu72)	10	88.66	101.26	4	40.00
18615.	Kyle (kbuschy)	10	89.16	104.87	1	10.00
18616.	Kaz (kaz_the_kuz)	10	90.42	103.73	1	10.00
18617.	Dennis (kavalier)	10	108.28	131.66	8	80.00
18618.	kang (kasusuwowo)	10	86.52	104.14	6	60.00
18619.	karim (karimkohel)	10	75.93	79.71	2	20.00
18620.	kamikadze (kamikadze009)	10	69.94	76.05	1	10.00
18621.	King of Pirates (kaizokuouu...	10	67.79	72.49	1	10.00
18622.	Minh (kaishj91)	10	70.45	77.99	2	20.00
18623.	Ka (kafong_0123)	10	39.09	45.10	0	0.00
18624.	kae (kaelul)	10	52.52	63.96	5	50.00
18625.	Joseph (jwkeating99)	10	98.84	108.93	5	50.00
18626.	Just (justdandy_)	10	117.85	141.63	5	50.00
18627.	lucy (justarat90)	10	73.84	84.60	4	40.00
18628.	Jure (jujecat)	10	87.79	103.05	1	10.00
18629.	Sid (judgementdey)	10	74.64	82.74	3	30.00
18630.	Judd (judd123)	10	86.70	100.55	1	10.00
18631.	jsve (jsve)	10	82.66	97.43	3	30.00
18632.	Josh (jrc23)	10	83.11	96.44	4	40.00
18633.	Jason (jpngfile)	10	99.99	113.57	4	40.00
18634.	Josh (joshtegart)	10	112.08	145.91	3	30.00
18635.	Nicholas (joshjoshjoshjosh)	10	107.75	145.27	5	50.00
18636.	joey (josephb20252)	10	103.67	115.00	4	40.00
18637.	bonsii (jorhlo)	10	88.39	99.19	3	30.00
18638.	Jonathan (joni1234)	10	61.63	82.52	3	30.00
18639.	Jonathan (jonathan_200605)	10	80.18	94.41	8	80.00
18640.	Jonathan Justin (jonathanjw05)	10	96.91	102.67	4	40.00
18641.	jolene (jolenech)	10	73.25	85.18	2	20.00
18642.	Gamer (joksb2k)	10	44.27	47.89	2	20.00
18643.	Sanjay (joker979)	10	62.11	78.00	3	30.00
18644.	Ivan (john_the_unigoat)	10	51.11	64.19	0	0.00
18645.	Garrett (joejoefriez)	10	79.31	98.91	2	20.00
18646.	Kev (joebob1235)	10	90.70	106.24	5	50.00
18647.	Antonio (joancoma05)	10	41.74	45.85	1	10.00
18648.	Sep (jltariman)	10	63.53	71.43	1	10.00
18649.	J (jkim55k)	10	64.57	72.18	5	50.00
18650.	I can't type anymore (jjwiz...	10	77.73	95.37	5	50.00
18651.	Josh (jjrandle1013)	10	63.92	72.34	1	10.00
18652.	Joey (jj4ster)	10	104.42	129.76	6	60.00
18653.	Jin (jinjohn)	10	50.41	55.92	2	20.00
18654.	Jwarchild (jimmyhaffaren)	10	76.17	93.27	3	30.00
18655.	Tim (jimbo112)	10	91.23	111.91	4	40.00
18656.	Josh (jgeoppo)	10	59.19	68.05	2	20.00
18657.	Joosep (jet_e)	10	80.51	88.84	2	20.00
18658.	TheLegend27 (jethro2003)	10	99.95	107.66	6	60.00
18659.	Jv (jemish_variya)	10	43.76	48.84	0	0.00
18660.	KaptainFroggy_YT (jellybean...	10	74.92	86.08	1	10.00
18661.	Jo (jelli017)	10	50.89	60.38	2	20.00
18662.	jedishong (jedishong)	10	85.80	114.03	6	60.00
18663.	Jon (jcrossley)	10	84.35	93.39	4	40.00
18664.	Jin (jchoi1994)	10	134.88	152.29	9	90.00
18665.	jboog (jboog)	10	79.87	91.88	8	80.00
18666.	Bubbz (jaydenfiesta)	10	61.61	70.96	3	30.00
18667.	Tom (javor)	10	76.74	83.89	5	50.00
18668.	e (javascriptdude)	10	131.29	156.50	6	60.00
18669.	Jamiel (jamiel_exe)	10	71.61	81.78	1	10.00
18670.	Jamie (jam8554)	10	68.78	80.90	2	20.00
18671.	Johann (jalohann)	10	111.07	136.35	8	80.00
18672.	Jacob (jacobru)	10	54.58	66.40	0	0.00
18673.	Jack (jack_tran04)	10	93.90	100.62	6	60.00
18674.	M (izzyissad)	10	68.69	79.71	2	20.00
18675.	neverbreaking170 (ivan28283)	10	140.80	161.28	6	60.00
18676.	its_zaaid (its_zaaid)	10	42.63	48.50	0	0.00
18677.	Tony (itsonlytony)	10	71.52	82.11	1	10.00
18678.	kat (itskat_boba)	10	54.74	59.60	0	0.00
18679.	Islam (islam_anwer)	10	47.14	55.32	1	10.00
18680.	isaacgoe (isaacgoe)	10	97.45	118.71	3	30.00
18681.	Instynkt (instynkt)	10	101.97	120.98	5	50.00
18682.	InSaein (insaein)	10	49.26	56.55	1	10.00
18683.	Kat (inoobo)	10	67.06	79.48	1	10.00
18684.	Inferno2332 (inferno2332)	10	105.27	132.41	8	80.00
18685.	Il Capitano (ilcapitano)	10	93.13	103.39	3	30.00
18686.	creative (idoofus123)	10	144.74	158.69	5	50.00
18687.	Ido (idodobird)	10	83.90	100.63	4	40.00
18688.	Alexander (idkwhatimdoin9)	10	59.57	71.31	1	10.00
18689.	icy (icyxo)	10	75.00	84.26	4	40.00
18690.	hi (ibadattyping)	10	105.97	121.16	2	20.00
18691.	Smith (iamhablo)	10	59.50	62.24	1	10.00
18692.	Daniel (hyunholee13)	10	102.93	123.62	4	40.00
18693.	Icy_Istanbul (hypzx_x)	10	82.00	95.95	0	0.00
18694.	hydroPUMP (hydropump)	10	58.88	68.14	1	10.00
18695.	kvin (hwkhoa)	10	82.04	93.97	5	50.00
18696.	Howbtard (howbtard)	10	113.92	147.90	5	50.00
18697.	HotTubStream (hottubstream)	10	88.49	97.80	4	40.00
18698.	Patrick (hongkongfui)	10	90.03	107.85	2	20.00
18699.	HK_BAKA (hkuzumaki)	10	50.52	60.59	2	20.00
18700.	Henry (henrytidholm)	10	65.72	72.10	5	50.00
18701.	hello1900 (hello1900)	10	18.77	20.99	4	40.00
18702.	haylie (hayizme)	10	44.21	53.93	0	0.00
18703.	Jan (hautix)	10	53.31	63.27	0	0.00
18704.	Kakashi (hatakeclan)	10	87.93	112.81	4	40.00
18705.	hasan (hasan2000)	10	75.98	85.32	2	20.00
18706.	Zach (hardtoki11)	10	99.13	126.66	3	30.00
18707.	Wellington (happydonut)	10	104.28	134.45	5	50.00
18708.	Hannah (hannityyy)	10	98.45	117.13	3	30.00
18709.	Harry (hajohlay)	10	110.67	130.13	4	40.00
18710.	HeMAN (h3m4n)	10	37.31	44.26	0	0.00
18711.	Gurman (gurmns)	10	83.82	99.71	1	10.00
18712.	Gunel (gunel12)	10	41.96	46.67	1	10.00
18713.	Gurveer (gundo_1)	10	64.60	76.70	0	0.00
18714.	Smoto (grozmot)	10	57.45	62.65	2	20.00
18715.	Godstime (gozi3)	10	51.44	60.81	4	40.00
18716.	Robert (gorilla710)	10	92.43	103.15	6	60.00
18717.	Gongster (gongster1)	10	95.01	109.13	5	50.00
18718.	ishan (gmd_cuber)	10	60.68	66.53	3	30.00
18719.	OblivionGlisor (gliscor2004)	10	86.32	100.85	6	60.00
18720.	WHEN THE IMPOSTER IS SUS SU...	10	29.39	30.66	0	0.00
18721.	Gino (gino758)	10	61.25	69.78	2	20.00
18722.	Gianmarco (gianma)	10	63.02	75.96	0	0.00
18723.	Superfast (ghoststop)	10	126.97	143.68	7	70.00
18724.	GGanon (gganon)	10	88.49	97.85	5	50.00
18725.	tian (gfriend)	10	90.23	99.62	5	50.00
18726.	GeeBee_29 (geebee29)	10	60.33	71.57	1	10.00
18727.	Jacob (gaycob)	10	75.69	83.48	1	10.00
18728.	Gat (gatmonke)	10	62.63	69.69	0	0.00
18729.	Gary (gary_dahmer)	10	75.04	86.38	2	20.00
18730.	garin (garinholiyana)	10	57.29	60.52	0	0.00
18731.	garbyal ✌(-‿-)✌ (garb...	10	104.05	115.62	7	70.00
18732.	GamersFTV (gamersftv)	10	38.64	45.32	0	0.00
18733.	Funnier04 (funnier04)	10	71.79	82.51	5	50.00
18734.	Lauto (fuji_puji)	10	98.54	109.35	3	30.00
18735.	Pavel (fugives)	10	62.92	77.97	7	70.00
18736.	Franz (franzl_fang)	10	48.41	56.11	1	10.00
18737.	Force (foce3954)	10	41.38	45.94	1	10.00
18738.	Jacob (floodedcodeboy)	10	69.15	77.93	4	40.00
18739.	sgfd (fish_speckle)	10	61.78	73.27	3	30.00
18740.	Fifi (fififishcake)	10	76.80	87.30	3	30.00
18741.	Felipe (felipekde)	10	60.51	69.68	1	10.00
18742.	Felipe (felipeav2)	10	27.37	34.51	1	10.00
18743.	Elio (fcasper)	10	69.24	76.63	5	50.00
18744.	Alan (faux_ray)	10	97.73	121.10	6	60.00
18745.	Eric (fastestfatfingers)	10	102.40	115.57	6	60.00
18746.	IlhanKhayru (fangian)	10	85.14	103.71	2	20.00
18747.	Х. (falcon0338)	10	75.82	86.27	5	50.00
18748.	FadedSpirits (fadedspirits)	10	87.29	100.25	2	20.00
18749.	Cece (e_m_p_t_y)	10	79.64	91.52	1	10.00
18750.	igig (eztau)	10	56.62	61.33	1	10.00
18751.	Ezra (ezratyping)	10	89.78	103.39	5	50.00
18752.	eyedin (eyedin)	10	115.21	132.12	5	50.00
18753.	Eve (evehelin)	10	85.50	96.81	2	20.00
18754.	Adrian (evadetoxinz)	10	44.52	55.32	2	20.00
18755.	Ethan (ethro)	10	56.44	76.27	1	10.00
18756.	Walter (eskaytee)	10	52.55	64.00	0	0.00
18757.	Ashfaque (eshan_)	10	59.83	64.80	9	90.00
18758.	typing (errors_intesify)	10	82.87	95.78	3	30.00
18759.	Eric (erictie)	10	80.54	107.49	2	20.00
18760.	Eric (ericboyce)	10	103.60	115.56	6	60.00
18761.	eRFoRever (erforever)	10	110.79	135.13	9	90.00
18762.	Henri (enzzzx)	10	112.20	131.47	5	50.00
18763.	Renz (enriqatron52)	10	99.77	109.99	5	50.00
18764.	Lior (endlease)	10	91.40	103.24	5	50.00
18765.	i am Dog (endi_69)	10	66.26	77.61	4	40.00
18766.	Sky (elucentx)	10	103.55	116.33	7	70.00
18767.	Aron (ellipsoul)	10	111.48	121.77	4	40.00
18768.	Elias (elias_17)	10	62.68	76.26	3	30.00
18769.	Elias (eliasura)	10	110.99	129.28	8	80.00
18770.	el (elchupo)	10	37.35	60.87	2	20.00
18771.	ahmed (elberawy)	10	23.72	27.94	1	10.00
18772.	Evan (eh30)	10	55.79	62.67	1	10.00
18773.	愛する (ecstxsy)	10	93.99	112.48	0	0.00
18774.	Shamil (echonaut)	10	97.00	103.34	4	40.00
18775.	Ori (echoloche)	10	56.56	63.57	4	40.00
18776.	P. Leboid (eccentricpleboid)	10	44.91	56.60	0	0.00
18777.	Dennis (dya26)	10	116.21	134.19	4	40.00
18778.	mazen (dweedar)	10	74.71	84.17	2	20.00
18779.	Diana (dustystar96)	10	60.21	69.18	0	0.00
18780.	Aashish (dunsman)	10	43.74	50.15	1	10.00
18781.	speed (druggedrice)	10	121.63	136.81	2	20.00
18782.	j (droozyayayaya)	10	143.83	161.89	8	80.00
18783.	Matthew (drogoton)	10	63.40	75.90	3	30.00
18784.	José (dqcheetqh)	10	67.58	75.03	4	40.00
18785.	Dinesh (dineshkandy)	10	77.39	98.37	1	10.00
18786.	Dimitris (dimgag)	10	63.63	72.21	2	20.00
18787.	Dimfred (dimfred)	10	83.03	98.18	3	30.00
18788.	ayd (diamond)	10	22.41	30.47	5	50.00
18789.	Dylan (dhatx13)	10	97.43	117.67	4	40.00
18790.	1 (desser2)	10	88.75	96.90	3	30.00
18791.	despaciko (despaciko)	10	81.66	90.12	4	40.00
18792.	deniz (dendiz)	10	75.50	91.80	2	20.00
18793.	Tom (demarini)	10	104.95	117.71	4	40.00
18794.	rudraksh (delusionaloptimist)	10	60.76	70.58	2	20.00
18795.	Do (dekul1205)	10	79.54	92.60	1	10.00
18796.	Osama (default_1011)	10	71.20	81.14	4	40.00
18797.	Rui (deathnight1234)	10	73.11	83.53	8	80.00
18798.	asdfasdf (ddgg007)	10	73.89	94.26	2	20.00
18799.	David (dchoboy)	10	74.37	85.77	2	20.00
18800.	Đejms (db007)	10	72.10	87.18	4	40.00
18801.	Luyene (dauxsis)	10	103.82	120.41	1	10.00
18802.	DatMoonGamer (datmoongamer)	10	115.74	139.38	7	70.00
18803.	Khaeran S. (dark_ze7en)	10	56.83	69.45	0	0.00
18804.	DarkZplays (darkzplays_qwerty)	10	88.60	96.90	5	50.00
18805.	Kadie (darkskies0107)	10	80.32	86.44	3	30.00
18806.	DarkPrinceGandalf (darkprin...	10	91.81	103.95	5	50.00
18807.	stabby stab (darkholdwizerd)	10	78.93	95.12	3	30.00
18808.	Dannica (danni_bear_)	10	48.41	56.20	1	10.00
18809.	Daniel (dankasu)	10	34.45	40.06	1	10.00
18810.	Daniel (daniel1212)	10	75.25	80.90	2	20.00
18811.	Danchik (danchikg)	10	73.09	82.78	3	30.00
18812.	Can't (daddaaddad)	10	105.94	118.19	2	20.00
18813.	Cyrus (cyrus19)	10	76.98	92.04	5	50.00
18814.	Cyden (cyden)	10	58.26	99.51	3	30.00
18815.	Adrian (cui3e)	10	99.61	111.93	9	90.00
18816.	Colby (ctgap)	10	140.01	152.06	8	80.00
18817.	Wall (csgoscam)	10	66.55	88.01	2	20.00
18818.	CatToTheFour (cryptica)	10	97.46	112.20	4	40.00
18819.	Lau (cryptextinct)	10	83.77	96.70	3	30.00
18820.	Crossland (crossjbeer)	10	102.70	122.77	6	60.00
18821.	Michael (crecious)	10	99.98	128.13	6	60.00
18822.	Cream Of (creamofroach)	10	102.00	113.85	8	80.00
18823.	cozy (cozy_c)	10	65.32	85.84	6	60.00
18824.	Corin (corlexc)	10	76.72	93.20	0	0.00
18825.	rsd.com.au (cooper1289)	10	131.18	143.88	5	50.00
18826.	C (cmmg1)	10	78.70	89.17	2	20.00
18827.	Connor (cmcl)	10	60.82	68.27	2	20.00
18828.	Cole (cmacd)	10	87.84	97.88	2	20.00
18829.	CJP (yes-quit) (cjasonp)	10	106.38	119.02	3	30.00
18830.	unit (chuwii)	10	74.28	82.53	1	10.00
18831.	Darkchuby (chubyxdxd)	10	47.13	60.03	2	20.00
18832.	Chris... (chrishollow7)	10	98.78	108.92	4	40.00
18833.	Chris (chrishene)	10	71.26	80.98	2	20.00
18834.	Cyrus (chonky_garfield)	10	48.83	58.08	4	40.00
18835.	Chiggas (chinesecodingmaster)	10	59.02	66.03	1	10.00
18836.	chetanya (cheti)	10	67.32	76.32	2	20.00
18837.	han (chenhan)	10	46.69	51.66	0	0.00
18838.	Bruce Mang (cheeseburger_98)	10	93.35	118.59	2	20.00
18839.	Chatic (chatic)	10	79.77	92.56	1	10.00
18840.	Person (chaon7)	10	80.45	93.79	8	80.00
18841.	JOn (chaomeister986)	10	121.06	143.79	6	60.00
18842.	Chad (chadley69)	10	53.45	64.49	1	10.00
18843.	Cefe (cefe_origol)	10	64.10	68.13	4	40.00
18844.	Cat (cat_tanks_mod_maker)	10	68.62	78.82	2	20.00
18845.	BigBoss (catalin2522)	10	57.65	63.67	0	0.00
18846.	Josh (cantmakemoney)	10	90.34	99.56	2	20.00
18847.	Californium (californium)	10	65.32	75.11	2	20.00
18848.	Caddar (caddar)	10	117.74	147.15	5	50.00
18849.	crowdofworkmen (bu_te)	10	87.22	96.34	5	50.00
18850.	Butter (butterfingers_)	10	95.61	105.75	4	40.00
18851.	burritorolls-royce (burrito...	10	82.09	96.89	2	20.00
18852.	Budder40 (budder40)	10	49.06	55.03	1	10.00
18853.	Saran (bssarankumar)	10	66.56	77.50	0	0.00
18854.	Bra Steve (bra_steve)	10	66.29	74.10	3	30.00
18855.	Brandon (brandonsg)	10	87.19	100.23	2	20.00
18856.	Joël (bongo13)	10	94.23	103.06	4	40.00
18857.	Bobby (bobnfuz)	10	64.57	78.62	1	10.00
18858.	Ezra 🖤⛓ (blurr_yfa_ce)	10	46.77	51.09	1	10.00
18859.	Ekko (blue9995566)	10	60.90	65.76	0	0.00
18860.	blekekok (blekekok)	10	80.42	118.74	1	10.00
18861.	blademagic (blademagic)	10	107.64	115.22	6	60.00
18862.	Bruh (blackbacon08)	10	96.75	105.76	5	50.00
18863.	bingcheng45 (bingcheng45)	10	93.78	108.87	5	50.00
18864.	Hoa (billybobstuff)	10	69.24	73.58	3	30.00
18865.	Bharat Kumar (bharat12345)	10	47.48	53.78	1	10.00
18866.	Brian (bgriffeth)	10	61.15	76.62	3	30.00
18867.	berserker02 (berserker02)	10	61.47	73.12	3	30.00
18868.	Daniele (berdelicious)	10	77.45	86.86	1	10.00
18869.	benny (bennythecow)	10	69.07	80.10	3	30.00
18870.	Benny (bennyni101)	10	62.97	70.58	1	10.00
18871.	Benko (benkay)	10	78.00	96.20	6	60.00
18872.	Bob (benjiboy970)	10	84.54	90.58	1	10.00
18873.	beefchow (beefchow)	10	67.52	79.17	2	20.00
18874.	Austin (bear666)	10	61.94	70.19	5	50.00
18875.	Kevin (baven)	10	57.33	69.97	3	30.00
18876.	:) (bavadin)	10	118.62	129.59	4	40.00
18877.	Gus (battm4n)	10	62.68	75.55	2	20.00
18878.	Baris (baris23)	10	94.79	104.60	0	0.00
18879.	_ (baga_rashy)	10	37.79	43.20	0	0.00
18880.	Kaelyn (badpun56)	10	94.35	106.46	2	20.00
18881.	Bad (badminton87)	10	47.34	65.76	2	20.00
18882.	bachira (bachira)	10	59.55	65.03	2	20.00
18883.	Babon (babonbunting)	10	56.27	68.82	2	20.00
18884.	Anto (babafroga)	10	75.43	82.58	6	60.00
18885.	Robert (b0ssofthisgym)	10	63.65	70.73	3	30.00
18886.	Cootsynanus (a_yellow_evan)	10	87.16	100.35	3	30.00
18887.	Michael (azumifan)	10	81.39	88.88	4	40.00
18888.	Never (azasal)	10	93.15	109.57	2	20.00
18889.	SPREAD DVORAK PROPAGANDA (a...	10	87.46	109.44	2	20.00
18890.	Mudit (awesomenessmax)	10	69.92	81.44	7	70.00
18891.	Anthony (avald30)	10	75.41	86.72	3	30.00
18892.	🐐 (auaomamm)	10	96.91	108.41	5	50.00
18893.	BigMan (attel)	10	80.03	89.70	4	40.00
18894.	Isse (attalion)	10	74.81	83.32	3	30.00
18895.	ather (athrnls)	10	128.04	150.66	4	40.00
18896.	Atakan (atakannguven)	10	54.59	70.02	4	40.00
18897.	Jairo (asophiel)	10	63.89	80.53	2	20.00
18898.	David (asian_masterium)	10	77.82	92.39	0	0.00
18899.	Destiny (asaak)	10	46.72	55.39	0	0.00
18900.	Arul (arulseth1998)	10	70.51	83.86	2	20.00
18901.	Daniel (arpsteid)	10	83.73	98.08	5	50.00
18902.	arman_ferdous (arman_ferdous)	10	85.30	92.64	2	20.00
18903.	tstats[armanto] (armanto)	10	80.17	91.01	4	40.00
18904.	Anonymous (argong1)	10	100.81	127.62	5	50.00
18905.	syed (areeb290805)	10	66.53	86.01	4	40.00
18906.	rumi (archsun)	10	94.84	108.34	3	30.00
18907.	Aravinthan (aravinthan)	10	47.00	60.79	2	20.00
18908.	Aravind (aravindsreeram)	10	100.47	115.86	6	60.00
18909.	Aqib (aqib1990)	10	64.55	73.11	1	10.00
18910.	TERT (antonhsu)	10	101.45	118.99	5	50.00
18911.	anpan (anpann)	10	44.80	55.90	3	30.00
18912.	Another (anotherkaneki)	10	88.89	109.66	3	30.00
18913.	ANKIT (ankit_2002)	10	22.80	27.29	3	30.00
18914.	Doe (animitz)	10	101.74	114.22	3	30.00
18915.	Animal (animalracional)	10	105.33	114.54	2	20.00
18916.	Anil (anil1631988)	10	46.29	57.44	2	20.00
18917.	Angelo (angeloanan)	10	86.51	102.51	2	20.00
18918.	Angel (angeldavinci)	10	107.71	125.72	4	40.00
18919.	andrucc (andrucc)	10	124.90	137.56	7	70.00
18920.	Andrea (andrea_oboe)	10	56.90	70.35	2	20.00
18921.	Anastacia (anastaciagurina)	10	43.99	50.57	0	0.00
18922.	manizman (amznima)	10	46.88	58.82	1	10.00
18923.	Amirun (amumrzmh)	10	49.23	55.98	1	10.00
18924.	Amr (amr_alnas)	10	63.57	75.60	2	20.00
18925.	chi (amaz1n)	10	122.68	137.95	4	40.00
18926.	Amaru (amaruescalante)	10	73.70	86.36	2	20.00
18927.	Nux (amades)	10	82.24	93.43	4	40.00
18928.	allLuck (allluck)	10	51.71	63.43	0	0.00
18929.	M (allinnn)	10	70.00	84.05	4	40.00
18930.	Alistair (alistairmross)	10	49.91	56.06	1	10.00
18931.	Alif (aliftheruslan)	10	64.30	72.04	2	20.00
18932.	Alfie (alfiefogg)	10	68.46	76.79	1	10.00
18933.	Aryan (alemantrix)	10	80.47	97.33	1	10.00
18934.	Alec Gian (alecgian)	10	59.96	74.87	2	20.00
18935.	Ajay (ajaygunacr7)	10	82.83	97.64	1	10.00
18936.	noneov (aidentypefast)	10	64.38	72.27	7	70.00
18937.	Ahmad (ah_abualrob)	10	39.15	45.42	1	10.00
18938.	Ahnaf (ahnaf_habib)	10	72.62	82.00	4	40.00
18939.	Annette (ahhooah)	10	53.37	57.11	0	0.00
18940.	Diana (agent_artemis)	10	84.30	104.84	2	20.00
18941.	Keenan (agentk9)	10	72.52	77.13	4	40.00
18942.	muhammad afiq (afiq101)	10	77.69	84.78	3	30.00
18943.	Tim (afferin_)	10	127.97	151.63	7	70.00
18944.	Fher (aether78)	10	28.93	36.77	3	30.00
18945.	Eric (aerran)	10	105.47	113.92	8	80.00
18946.	Adhyay (adyr_152)	10	43.35	56.80	1	10.00
18947.	Adromrial (adromrial)	10	94.00	103.21	5	50.00
18948.	Percy (adladd)	10	78.94	89.23	1	10.00
18949.	acidxburn87 (acidxburn87)	10	49.97	56.93	2	20.00
18950.	Dr_ (abrarsikder_123)	10	50.19	66.71	2	20.00
18951.	primrose (abigaillll)	10	56.10	62.15	2	20.00
18952.	gwen (abcdbga)	10	107.73	119.09	4	40.00
18953.	Aaryan sharma (aaryan21)	10	54.40	61.02	1	10.00
18954.	Mani (93z9a)	10	59.36	68.10	1	10.00
18955.	Jason (921jason921)	10	79.21	104.20	3	30.00
18956.	Jack (666jack)	10	39.20	47.99	0	0.00
18957.	Shalin (29wpm)	10	60.71	65.34	0	0.00
18958.	skies (17phantom)	10	103.77	124.70	3	30.00
18959.	1015634 (1015634)	10	103.28	121.34	5	50.00
18960.	Masood (004993)	10	74.33	88.86	10	100.00
18961.	Alinoo (alinooo)	10	34.19	40.77	0	0.00
18962.	i (iiooddaa)	10	67.57	73.94	3	30.00
18963.	Avijeet (avijeet_03)	10	46.57	51.59	2	20.00
18964.	Colby (kerble)	10	107.38	140.65	6	60.00
18965.	JC (alicawj)	10	87.28	96.66	3	30.00
18966.	Allen (applausingallen)	10	58.80	73.35	2	20.00
18967.	Dante (drogers279)	10	89.42	99.00	5	50.00
18968.	Harmony (harms)	10	73.79	88.69	0	0.00
18969.	Aito (aitogod)	10	52.85	61.08	1	10.00
18970.	Joksa (joksa_19)	10	59.06	65.74	2	20.00
18971.	paper (paperhead)	10	65.50	72.42	4	40.00
18972.	Daksh (daksh_10)	10	47.21	51.41	0	0.00
18973.	matt (skizxo)	10	88.32	106.36	5	50.00
18974.	Ryan (cryptopulse)	10	89.04	102.56	4	40.00
18975.	Kamshat (jklsyk)	10	36.49	40.58	3	30.00
18976.	Leo (leonidas_)	10	89.78	104.85	2	20.00
18977.	Terry (terry77)	10	70.37	81.93	10	100.00
18978.	phoenix (phoenix_mint)	10	67.76	75.91	2	20.00
18979.	_ (ovorampage)	10	81.92	94.75	3	30.00
18980.	Aayan (aayanali808)	10	82.24	98.40	3	30.00
18981.	Abdelrahman (abdelrahman247...	10	39.49	49.00	0	0.00
18982.	john (scholarbackmarathanee)	10	103.34	110.19	8	80.00
18983.	Slayer (slayerontwitch)	10	108.23	122.97	5	50.00
18984.	mado (mado_sam)	10	29.25	38.25	0	0.00
18985.	Tomaz (mali_frodo)	10	53.06	58.54	1	10.00
18986.	Fynn (fynn__)	10	86.79	96.39	3	30.00
18987.	Sh0t.0 (sudhanshu8302)	10	54.33	61.49	3	30.00
18988.	Eric (vulbex)	10	54.75	79.16	1	10.00
18989.	50wpm (verynoob)	10	114.44	139.50	6	60.00
18990.	Álvaro (ashsan98)	10	83.41	92.40	6	60.00
18991.	Nacca (nacca47)	10	73.74	83.22	4	40.00
18992.	Darkn (darkn_yt)	10	120.59	160.37	8	80.00
18993.	Mary (maryxo)	10	84.29	98.76	8	80.00
18994.	: (lazering_death)	10	74.91	96.09	1	10.00
18995.	Someone (arilaro)	10	62.86	68.30	5	50.00
18996.	cool cat! (kid_apollo)	10	45.25	50.50	0	0.00
18997.	Ronak (raun707)	10	52.14	60.75	0	0.00
18998.	Nicholas (nicocook)	10	91.24	103.51	2	20.00
18999.	BC190 (bc190)	10	65.08	70.66	3	30.00
19000.	Synplet (synplet)	10	79.04	103.57	8	80.00
19001.	DADE (dad_ee)	10	71.23	83.45	1	10.00
19002.	Leon (dutchwarrior)	10	57.20	62.32	1	10.00
19003.	Sul (mrsul_)	10	82.90	92.14	8	80.00
19004.	Lorenzo (gr8monk3ys)	10	87.69	95.23	3	30.00
19005.	Chapman (sevenagueroes)	10	53.56	57.77	1	10.00
19006.	yens_ (jens8732)	10	72.52	79.29	3	30.00
19007.	Jonten (jrpx9)	10	43.83	61.77	1	10.00
19008.	Brendan (typingtops)	10	65.67	78.87	2	20.00
19009.	Vicki (vickil)	10	62.13	72.52	4	40.00
19010.	Hamilton (hammer3000)	10	69.46	85.72	1	10.00
19011.	Michelle (chickzor)	10	51.09	56.88	1	10.00
19012.	tstats[mmh49] (mmh49)	10	55.83	67.23	0	0.00
19013.	Brugarin (brugarin)	10	67.50	78.98	4	40.00
19014.	Ayberk (ayberkt)	10	101.41	119.10	5	50.00
19015.	abua (chelian)	10	84.25	92.77	2	20.00
19016.	CleverB (cleverboo)	10	46.75	56.46	0	0.00
19017.	Kelvin (amdabest)	10	46.45	63.05	3	30.00
19018.	Alec (dhracergc)	10	68.95	87.00	8	80.00
19019.	James (james_f)	10	94.04	114.58	9	90.00
19020.	lethimcook (aahiiks)	10	39.73	46.17	0	0.00
19021.	gamer (rkiks)	10	45.73	53.81	1	10.00
19022.	finity (finity_dvorak)	10	26.85	33.74	3	30.00
19023.	U-Jean (sedimaster007)	10	93.37	105.36	5	50.00
19024.	IIan (ilan7411_)	10	73.09	86.53	3	30.00
19025.	Gangnam (andreselcashete)	10	124.52	154.32	8	80.00
19026.	Duck (wubbaduck)	10	50.25	63.62	1	10.00
19027.	Pedro (pdbaroni)	10	63.63	86.81	4	40.00
19028.	Alexander (kiknalex)	10	94.65	114.66	2	20.00
19029.	Human (ame5057)	10	79.03	95.48	2	20.00
19030.	Sarah (skutti)	10	115.61	122.62	8	80.00
19031.	Karan (karan_2505)	10	40.10	45.80	0	0.00
19032.	Yamp4 (yamp4)	10	41.41	55.97	1	10.00
19033.	arion (arion_)	10	64.19	80.27	7	70.00
19034.	Kanon (krsr23)	10	53.30	62.91	0	0.00
19035.	Not (notbeluga)	10	73.33	84.05	5	50.00
19036.	Mohd (mohdbilal)	10	45.59	50.48	1	10.00
19037.	neo (neosylph)	10	85.19	96.97	3	30.00
19038.	mehzad (meiyotaco)	10	58.09	67.88	2	20.00
19039.	Typeternel (typeternel)	10	92.27	102.07	3	30.00
19040.	Fancy_Dog (fancy_dog)	10	43.95	48.67	2	20.00
19041.	H (tyrfing)	10	67.36	71.94	1	10.00
19042.	DaFishBoi (dafishboi)	10	66.61	75.17	5	50.00
19043.	frustration (bczsalba)	10	69.94	80.13	4	40.00
19044.	Tyler (tylergm1)	10	60.53	72.05	2	20.00
19045.	kim (jasmins3r)	10	40.09	46.00	2	20.00
19046.	Omar (meowot)	10	43.53	50.03	0	0.00
19047.	H5%hz (h5hztype)	10	47.60	60.09	1	10.00
19048.	javier (lechon2103)	10	40.71	46.29	0	0.00
19049.	kajal (kajall)	10	29.04	58.48	1	10.00
19050.	Bobby (mistabobby)	10	62.18	65.57	10	100.00
19051.	Mark (macdalo)	10	60.70	76.80	4	40.00
19052.	Ash (lillemann)	10	65.98	82.05	0	0.00
19053.	Mahbub (mahasayz)	10	69.72	83.31	5	50.00
19054.	LC (64tiananmen)	10	105.80	111.78	5	50.00
19055.	C (stormdrain)	10	95.72	110.88	5	50.00
19056.	Suspicious McGee (suspiciou...	10	66.87	77.04	4	40.00
19057.	Mostafa (3400mostafa)	10	60.40	70.71	1	10.00
19058.	10exer (spartibartfast)	10	72.83	85.18	0	0.00
19059.	AN (combaker)	10	56.11	63.28	1	10.00
19060.	Petar (crimenibba69)	10	83.83	97.33	7	70.00
19061.	Y.S (petitpotat)	10	75.15	88.03	2	20.00
19062.	sugar (sugarcqnes)	10	76.34	99.56	0	0.00
19063.	Brandon (stokesbro)	10	60.59	65.56	2	20.00
19064.	steff (_stuf)	9	114.16	129.16	5	55.56
19065.	Iftekharul (_sayeed)	9	66.07	88.91	2	22.22
19066.	Kuna (_kuna)	9	85.54	96.44	2	22.22
19067.	Adam (_adam_bomb)	9	60.48	66.79	1	11.11
19068.	Zven (zven69)	9	109.96	135.73	6	66.67
19069.	Daniel (zuse90)	9	61.38	67.11	2	22.22
19070.	Violet (znn7)	9	56.76	64.14	2	22.22
19071.	adam (zingerbox460)	9	92.88	106.40	4	44.44
19072.	zien (ziensoo)	9	50.06	54.64	2	22.22
19073.	zenzurie (zenzurie)	9	58.53	65.35	2	22.22
19074.	Stefan (zekan)	9	100.55	112.93	3	33.33
19075.	boris (zekaida)	9	98.71	106.91	1	11.11
19076.	Zia (zeeya)	9	115.44	139.04	4	44.44
19077.	Zed (zed_op)	9	29.98	33.93	2	22.22
19078.	Naz (zdkraner)	9	77.21	93.95	1	11.11
19079.	Yxjou (yxjou)	9	44.13	51.90	0	0.00
19080.	💎 (yx3_darya)	9	83.02	96.36	3	33.33
19081.	Alan (yuzhi)	9	84.90	99.45	1	11.11
19082.	Yuki (yukisitu)	9	88.45	111.39	5	55.56
19083.	Yuich (yuichi123)	9	67.71	80.79	2	22.22
19084.	Ryan (ysys9)	9	83.18	93.44	5	55.56
19085.	Jarek (yorrickus)	9	77.96	85.98	5	55.56
19086.	Yuvraj (yoowee)	9	47.89	52.61	3	33.33
19087.	zahra (yoonoh)	9	73.93	85.12	6	66.67
19088.	Yo (yongb)	9	68.86	82.26	2	22.22
19089.	Yash (yomat)	9	75.98	84.35	2	22.22
19090.	ben (yngtwbabd)	9	94.56	100.70	2	22.22
19091.	STONES (yiminggg)	9	90.71	103.38	3	33.33
19092.	Andrew (yertssbm)	9	123.44	135.13	6	66.67
19093.	Korey (yellowdozer)	9	105.45	116.58	2	22.22
19094.	Yams (yams_)	9	56.25	62.87	1	11.11
19095.	Yamajac (yamajac)	9	153.74	166.82	0	0.00
19096.	yaeda (yaeda)	9	100.09	110.97	4	44.44
19097.	Josh (xxldaddy69)	9	132.97	139.32	9	100.00
19098.	cope (xucolite)	9	90.05	105.69	3	33.33
19099.	John (xtrospective)	9	54.54	63.01	1	11.11
19100.	Evan (xtremeelectrix)	9	109.03	128.53	4	44.44
19101.	Ray (xray2)	9	109.62	118.72	1	11.11
19102.	Swaggy (xiarnaq)	9	134.08	172.10	8	88.89
19103.	Tony (xiao_hong)	9	61.82	70.94	0	0.00
19104.	Xetin (xetin)	9	100.58	117.42	1	11.11
19105.	xavier (xavieregan)	9	49.24	53.80	5	55.56
19106.	Turtle (xarenox)	9	94.94	109.38	8	88.89
19107.	Willem (woosterum)	9	40.55	53.05	0	0.00
19108.	Woffy (woffy888)	9	83.42	110.18	6	66.67
19109.	William (wmilberry)	9	81.30	90.18	0	0.00
19110.	M&W (wmichaelwhitlock)	9	108.99	129.85	4	44.44
19111.	Tate (wizard5)	9	56.73	65.88	2	22.22
19112.	48%SuicideRate (wint4r)	9	120.22	144.87	9	100.00
19113.	Ryan (wilderrw)	9	84.98	105.01	2	22.22
19114.	wiku (wiku025)	9	64.15	73.00	4	44.44
19115.	Victor (whitenecro21)	9	93.10	100.26	2	22.22
19116.	samantha (whalieninluv)	9	104.84	112.79	6	66.67
19117.	Jake (wetfart1738)	9	63.58	71.90	4	44.44
19118.	werdnalliw (werdnalliw)	9	80.71	97.37	3	33.33
19119.	William (wei9798)	9	73.47	79.52	1	11.11
19120.	William (wazambelina)	9	77.33	83.45	2	22.22
19121.	wabdeali (wabdeali)	9	99.11	116.19	2	22.22
19122.	Vyas (vyas_123)	9	105.88	125.94	4	44.44
19123.	Vrum (vrumvrum56)	9	65.28	73.57	0	0.00
19124.	dunno (vokunsahvoz)	9	36.44	40.66	1	11.11
19125.	Viktor (vixtorr)	9	65.62	76.38	6	66.67
19126.	Vipul (vipulr)	9	80.01	100.98	4	44.44
19127.	Vinson (vinsonbudiman)	9	76.07	92.56	1	11.11
19128.	Victor (victorfaarvang)	9	100.62	121.34	1	11.11
19129.	Peter (vettel_)	9	69.61	73.17	4	44.44
19130.	Vertennn (vertennn_)	9	100.02	112.50	6	66.67
19131.	d'un vecchio caminetto inga...	9	119.41	134.34	5	55.56
19132.	Vitalie (veeveeoh)	9	43.27	53.45	1	11.11
19133.	Giovanni (vecchiogio)	9	58.14	67.38	1	11.11
19134.	BJ (unusualgoose)	9	69.56	82.01	1	11.11
19135.	James (unbranded)	9	127.86	142.50	8	88.89
19136.	ultraXD (ultragamersss)	9	99.44	109.42	2	22.22
19137.	Ultraa (ultrabladez)	9	59.75	73.02	2	22.22
19138.	UltimaticCatz (ultimaticcatz)	9	78.20	97.07	6	66.67
19139.	Jason (ultimatehumungousaur)	9	89.93	96.32	5	55.56
19140.	Toby (ueue_)	9	84.40	102.87	6	66.67
19141.	Ucheely (ucheely)	9	124.10	134.89	4	44.44
19142.	McClout (type_69_master)	9	96.84	117.44	6	66.67
19143.	Johannes (typerjojo)	9	70.83	83.59	0	0.00
19144.	TyperDood (typerdoodz)	9	103.60	113.13	2	22.22
19145.	Steven (txp2037)	9	65.38	78.27	3	33.33
19146.	tuvumba (tuvumba)	9	61.07	66.94	7	77.78
19147.	Tubby (tubbsters)	9	141.61	160.84	8	88.89
19148.	Joshua (ttemingyu)	9	111.78	138.65	4	44.44
19149.	Meinte (trinityy6)	9	61.11	69.72	3	33.33
19150.	Trial (trial_name)	9	69.09	84.44	2	22.22
19151.	Trevor (trev_23)	9	72.47	90.02	0	0.00
19152.	shashank (trash_typer_74)	9	64.28	73.35	2	22.22
19153.	Antonín (toniczech)	9	59.90	65.92	2	22.22
19154.	Tom (tom020900)	9	91.79	99.17	3	33.33
19155.	Tode (todengaard)	9	126.07	146.45	8	88.89
19156.	Tinh (tinh1000000)	9	89.54	97.70	4	44.44
19157.	Tina (tinangu272)	9	89.48	97.19	3	33.33
19158.	Tino (timppara)	9	77.22	92.41	1	11.11
19159.	Edwin Chiriboga (tilt_ed)	9	61.23	72.37	0	0.00
19160.	trash (thiccumthebig)	9	52.68	64.20	0	0.00
19161.	ReRo (the_rero)	9	72.45	92.42	3	33.33
19162.	Max (the_maxinater)	9	63.79	72.65	2	22.22
19163.	Brandon (theyimi)	9	101.56	112.39	4	44.44
19164.	Emery (thetruffinmuffin)	9	53.73	61.37	1	11.11
19165.	Henri (therealkanyeeast)	9	113.08	129.45	3	33.33
19166.	pbj (thepbj)	9	59.65	75.79	2	22.22
19167.	TheMates (themates)	9	43.33	52.72	0	0.00
19168.	M (thefastlightningtyper)	9	78.25	89.43	4	44.44
19169.	ThatCoolCoder (thatcoolcoder)	9	91.73	104.25	2	22.22
19170.	Ethan (thandrew)	9	68.39	84.41	2	22.22
19171.	Leo (teslaomega)	9	71.91	83.98	3	33.33
19172.	Teriyaki (teriyaki03)	9	92.49	104.13	0	0.00
19173.	taramysh (tentech)	9	49.66	55.46	3	33.33
19174.	Mark (tenseimaa)	9	90.91	100.79	1	11.11
19175.	tasha (tbrown_89)	9	98.63	115.30	4	44.44
19176.	Sebastian (tbgseb)	9	70.92	80.55	3	33.33
19177.	Eren Yeager (tarzan_19)	9	53.60	62.16	2	22.22
19178.	Kevin (taow)	9	102.84	108.55	4	44.44
19179.	Tanuj (tanuj23)	9	105.30	114.20	4	44.44
19180.	Tanamr (tanamr)	9	99.71	106.19	5	55.56
19181.	Kevin (tactictorn)	9	111.81	122.55	6	66.67
19182.	S Aditya (s_aditya)	9	60.40	63.90	2	22.22
19183.	Vroom (synphade)	9	85.87	96.27	2	22.22
19184.	ok doinb (superex23)	9	85.24	89.81	3	33.33
19185.	supe (supe56)	9	83.20	93.63	5	55.56
19186.	Jordan (sugarytaco)	9	82.39	99.03	8	88.89
19187.	NO ONE (subhroxeon)	9	86.74	103.14	1	11.11
19188.	Sterling (stvrling)	9	89.38	103.97	5	55.56
19189.	Ahri (strylas)	9	104.01	125.85	4	44.44
19190.	Strike (strike_elite)	9	103.08	116.86	3	33.33
19191.	JL (strikewolfgg)	9	116.34	134.28	5	55.56
19192.	Stretch (stretch_flex)	9	77.88	87.90	2	22.22
19193.	stream (stream_cipher)	9	48.16	61.11	1	11.11
19194.	Stefarno (stefarno)	9	48.32	58.00	1	11.11
19195.	Stefan (stefan_t)	9	117.11	128.66	7	77.78
19196.	Steel (steeltissue)	9	80.74	92.51	2	22.22
19197.	Steady (steady32)	9	80.61	90.08	2	22.22
19198.	Stanley (stanley_gogo)	9	56.14	68.06	1	11.11
19199.	Josh (standedjoshh)	9	80.65	99.62	8	88.89
19200.	St1nk (st1nkk)	9	63.29	78.74	4	44.44
19201.	joni (squire2264)	9	86.17	92.80	2	22.22
19202.	Kimikazee (squalo101)	9	102.93	121.14	4	44.44
19203.	Rafael (spyhard12)	9	114.84	132.90	6	66.67
19204.	Jim (sprinks41)	9	80.55	93.60	2	22.22
19205.	shaq$ (springrollgod)	9	82.82	93.87	4	44.44
19206.	Ayush Hazarika (ayush_hazar...	9	42.55	49.71	0	0.00
19207.	Peter (speedyboi95)	9	91.97	115.19	5	55.56
19208.	John (speedking456)	9	86.76	102.05	3	33.33
19209.	Sourav (souravdey_1)	9	32.78	37.54	1	11.11
19210.	xy (soox0001)	9	86.47	113.42	3	33.33
19211.	Someone (someonetyping)	9	90.51	101.64	1	11.11
19212.	UnoriginalName (someguywhoh...	9	100.91	121.82	8	88.89
19213.	Marcus (snuskbulle)	9	87.36	97.23	2	22.22
19214.	Snafu (snafudk)	9	92.25	104.17	3	33.33
19215.	Sam (smtype100)	9	94.40	104.50	4	44.44
19216.	spoon (smallspoon)	9	85.95	109.88	4	44.44
19217.	Phuong Anh (smallcat2020)	9	45.14	50.55	6	66.67
19218.	smakkacow (smakkacow)	9	70.71	77.11	0	0.00
19219.	Slow Spider (slow_spider)	9	58.08	64.00	0	0.00
19220.	ur (slowtyperfromcz)	9	59.04	65.63	3	33.33
19221.	snail_twin_turbo (sloth_99)	9	54.73	59.47	1	11.11
19222.	Simonas (slapukas321)	9	55.81	66.77	1	11.11
19223.	Shadow (skyronman)	9	71.79	82.75	3	33.33
19224.	SkillfulRheyme4 (skillfulrh...	9	55.88	71.53	2	22.22
19225.	Luis (siulul)	9	60.73	71.15	2	22.22
19226.	René (sirrene)	9	76.93	90.16	9	100.00
19227.	$ (sirenss)	9	124.44	134.81	3	33.33
19228.	Sioun (sioun)	9	94.99	102.81	4	44.44
19229.	Sindre| (sinros01)	9	63.87	71.75	5	55.56
19230.	Sindri (sindri300)	9	72.91	81.04	4	44.44
19231.	Silk (silkdragon)	9	50.79	58.69	2	22.22
19232.	⁶⁶⁶ (siign)	9	93.48	98.48	3	33.33
19233.	Siddharth28 (siddharth28)	9	49.75	71.43	1	11.11
19234.	Shubham (shubham_112013)	9	61.53	65.26	0	0.00
19235.	Glenn (shroom_slice)	9	73.26	92.67	3	33.33
19236.	shrimp (shrimpcraackers)	9	64.52	69.11	2	22.22
19237.	Nate (shortysama)	9	63.38	70.06	3	33.33
19238.	Marcus (shock598x)	9	85.68	106.34	3	33.33
19239.	Ab (shk_faysal)	9	57.91	66.70	3	33.33
19240.	sarthak (shivasarthak)	9	48.28	61.59	0	0.00
19241.	karim (shinobikarim)	9	44.35	51.56	2	22.22
19242.	Nathan (sharkking487)	9	81.45	95.08	6	66.67
19243.	Khalilur (shafiq_02)	9	41.05	50.25	1	11.11
19244.	Luke (sfv_)	9	88.99	95.80	3	33.33
19245.	Shay (sewer_rat)	9	103.76	111.01	4	44.44
19246.	Accuracy (servesh)	9	67.74	84.12	1	11.11
19247.	Sergio (sergiorbuge)	9	115.34	129.98	7	77.78
19248.	Serenitea (serenitea)	9	91.19	102.50	3	33.33
19249.	Patrick (senseiblaze)	9	78.79	94.77	0	0.00
19250.	Bobby (senseibets)	9	86.17	103.15	4	44.44
19251.	Player (sellnox)	9	71.41	77.53	2	22.22
19252.	see you dont bump his head ...	9	86.53	96.00	5	55.56
19253.	Ginger (seanwho42)	9	68.93	84.94	2	22.22
19254.	Sean (seanshawn198)	9	132.20	146.32	8	88.89
19255.	Saral (scrummaster)	9	71.49	78.66	2	22.22
19256.	Reynaldi (script303)	9	103.33	120.34	3	33.33
19257.	Nate (scourse)	9	65.15	78.22	0	0.00
19258.	Scotty (scoma)	9	104.29	124.69	2	22.22
19259.	Samantha (sbscruton)	9	50.92	59.48	0	0.00
19260.	Kittatro (saysikerightnow)	9	71.67	79.31	2	22.22
19261.	NEM0 (saybloo)	9	97.75	113.64	6	66.67
19262.	grubres (saveall)	9	117.89	128.94	1	11.11
19263.	Saugat (saugat2003)	9	41.90	47.18	0	0.00
19264.	saturn (sat3rns)	9	62.02	79.21	9	100.00
19265.	sasmit_qwerty (sasmit_neogi)	9	83.95	120.35	3	33.33
19266.	Sasha (sasha_satanenko)	9	67.88	80.08	3	33.33
19267.	IDK (sarpain)	9	59.21	64.14	2	22.22
19268.	Phrog (sargent_frog)	9	86.74	138.49	7	77.78
19269.	ChlamydiaHaver (sarcasmx)	9	130.08	137.71	6	66.67
19270.	Saph (saphie)	9	85.38	98.76	4	44.44
19271.	Jose (sand62)	9	65.70	78.27	3	33.33
19272.	sam (samx90s)	9	45.05	53.84	1	11.11
19273.	mikduc (samurai_dodo)	9	76.41	90.47	2	22.22
19274.	sammito1 (sammito1)	9	106.47	115.74	3	33.33
19275.	Samuel (sambg)	9	100.49	109.81	6	66.67
19276.	ahmed (sakakill)	9	48.93	53.72	0	0.00
19277.	sahil (sahil9057)	9	57.70	68.34	1	11.11
19278.	Sahil (sahilmandoliya)	9	45.37	53.15	0	0.00
19279.	James (sagpro_23)	9	73.62	80.70	2	22.22
19280.	Saeed (saeed247)	9	70.17	83.12	2	22.22
19281.	suki (sackclothandashes)	9	99.51	110.88	2	22.22
19282.	Guo (s9723)	9	58.50	66.42	1	11.11
19283.	siddhanth (s1ddhxnth)	9	69.08	79.43	2	22.22
19284.	A (russ1anrock3t)	9	84.38	95.63	9	100.00
19285.	Roi (rugh)	9	65.92	72.25	2	22.22
19286.	Ethan (rtdrtd)	9	117.42	132.54	3	33.33
19287.	Robert (rpmulligan)	9	86.65	105.40	1	11.11
19288.	Yash (royal_ralhi)	9	28.17	33.08	2	22.22
19289.	Changnam (rotoflemf)	9	55.50	60.24	1	11.11
19290.	Roshan (roshan_)	9	73.57	88.07	4	44.44
19291.	Ultralord (ronelijahruiz)	9	98.31	119.82	2	22.22
19292.	Callum (rockwallaby)	9	51.39	59.32	0	0.00
19293.	Alessandro (rocchia)	9	80.82	94.54	2	22.22
19294.	Ronald (roanlds12345)	9	91.50	102.23	3	33.33
19295.	Quang Trung (rikateamovt1)	9	69.27	76.74	3	33.33
19296.	Richard (richyk1)	9	95.96	111.11	3	33.33
19297.	Rice (rice363)	9	86.16	92.56	3	33.33
19298.	rhyno3d (rhyno3d)	9	92.50	110.80	6	66.67
19299.	Randy (rhomusic)	9	96.62	104.47	4	44.44
19300.	Tyler (rhodetyl000)	9	79.18	82.95	5	55.56
19301.	rhinoracer (rhinoracer)	9	46.84	51.71	1	11.11
19302.	Keyan (rezor)	9	95.16	110.85	6	66.67
19303.	Zhaparka (retsinnal)	9	47.80	57.95	0	0.00
19304.	Red (redsharp)	9	69.27	85.58	3	33.33
19305.	Redox (redox_p)	9	96.58	109.27	2	22.22
19306.	Raostrich (raostrich)	9	87.82	98.57	2	22.22
19307.	Rafa (rafimm)	9	41.68	50.41	2	22.22
19308.	S3LVA (r06ramanat)	9	76.74	81.92	4	44.44
19309.	qwerty443 (qwerty443)	9	46.58	54.27	1	11.11
19310.	Quzrin (quzrin)	9	99.10	107.09	2	22.22
19311.	qusdty (qusdty)	9	36.51	43.04	1	11.11
19312.	Quer (queroin)	9	61.91	83.24	0	0.00
19313.	hand (quarterpastnine)	9	119.33	129.45	5	55.56
19314.	quackstuff (quackstuff)	9	84.67	87.80	3	33.33
19315.	Riley (qpixel)	9	92.24	101.64	3	33.33
19316.	Pupill (pupill)	9	63.64	71.95	7	77.78
19317.	Puleva (puleva)	9	77.33	93.73	2	22.22
19318.	Tom (pugsay)	9	92.57	101.92	2	22.22
19319.	pudge (pudge_phatt)	9	90.53	100.48	4	44.44
19320.	Proxima (proxima009)	9	62.27	66.39	4	44.44
19321.	Protik (protiknag)	9	59.13	67.77	0	0.00
19322.	David (prosic723)	9	49.56	53.39	0	0.00
19323.	Project (project_racer)	9	103.99	121.45	6	66.67
19324.	Kasper (probablykasper)	9	95.43	104.78	4	44.44
19325.	Powerid (poweriddd)	9	85.93	97.13	3	33.33
19326.	Matthew (potqto)	9	87.28	102.53	1	11.11
19327.	Potate (potatocloud)	9	64.00	69.77	2	22.22
19328.	bill nye (pokepo6)	9	91.52	103.48	2	22.22
19329.	p (poke1)	9	153.24	171.45	9	100.00
19330.	plupl (pluppypluplplupus)	9	72.13	88.91	1	11.11
19331.	Plommon (plommon)	9	98.81	108.22	4	44.44
19332.	PKDDDroid (pkdddroid)	9	79.21	88.71	3	33.33
19333.	egg (pipidozer)	9	63.86	76.25	2	22.22
19334.	Nathan (pimpleton)	9	106.14	127.60	2	22.22
19335.	pigeonistic (pigeonistic)	9	121.98	133.64	6	66.67
19336.	K (phua8686)	9	50.39	54.70	0	0.00
19337.	Amangus (phsycomonkek1)	9	81.66	91.47	3	33.33
19338.	Phoebe (phoebek99)	9	91.79	113.15	5	55.56
19339.	Peyton (peytondk)	9	102.21	112.74	9	100.00
19340.	Pernesz (pery)	9	81.24	95.08	5	55.56
19341.	penguiny2001 (penguiny2001)	9	98.61	106.98	4	44.44
19342.	Peak (peak_dvorak)	9	114.77	139.35	9	100.00
19343.	Pcgnome (pcgnome)	9	95.14	115.51	5	55.56
19344.	Tappy_333 (pat29403)	9	65.96	73.36	2	22.22
19345.	Brendan (partyhipster)	9	108.85	127.06	6	66.67
19346.	Gaurav (parthbudds)	9	68.18	76.20	2	22.22
19347.	Parhy (parhy)	9	94.45	108.99	3	33.33
19348.	Max (parabalt)	9	99.12	120.18	6	66.67
19349.	JazzyP (pandawarrior101)	9	92.35	109.71	0	0.00
19350.	Gabriel Owen (owen2)	9	40.64	48.23	2	22.22
19351.	OMG (omgawannabe)	9	92.45	103.01	6	66.67
19352.	Daniel (omegadan_)	9	78.89	89.95	2	22.22
19353.	Paolo (oloapss)	9	78.26	95.17	5	55.56
19354.	Oliver (oliver_22_11)	9	42.50	46.92	3	33.33
19355.	🦈 (okamiro)	9	55.77	63.11	2	22.22
19356.	Ohad (ohadshwartzman)	9	94.91	114.46	2	22.22
19357.	totnamjoon (off_the_page)	9	81.30	90.70	2	22.22
19358.	yellow car (oddsorcery)	9	99.55	109.44	9	100.00
19359.	iGeo (oddhampton)	9	76.54	81.87	1	11.11
19360.	Plato (observer_02)	9	103.20	114.06	5	55.56
19361.	XxBairyHallsxX (nwalker1129)	9	113.63	135.62	3	33.33
19362.	Tushar (nutzingfork)	9	28.72	39.76	0	0.00
19363.	Riley (nulll)	9	91.82	105.29	4	44.44
19364.	Nullius (nullius)	9	58.93	63.36	2	22.22
19365.	Anh (nta1207)	9	92.77	99.75	4	44.44
19366.	Novotny (novynevi)	9	63.66	75.49	2	22.22
19367.	Minideez (novadeez)	9	50.22	58.49	1	11.11
19368.	Nour (nourokbi)	9	44.63	54.69	2	22.22
19369.	Elvis (noratic)	9	108.39	128.23	3	33.33
19370.	brendi (noobgodbrendi)	9	59.61	75.59	2	22.22
19371.	Noober (noobest_noober)	9	103.85	129.11	4	44.44
19372.	(nonquitwarrior)	9	114.25	146.90	3	33.33
19373.	whutthiphon (nongmai)	9	26.95	31.02	0	0.00
19374.	nikole (nmkxos)	9	46.03	53.71	2	22.22
19375.	Nicholas (nkt8256)	9	113.08	130.31	3	33.33
19376.	njwn (njwnsr)	9	73.71	80.62	2	22.22
19377.	Nikolaj (nikolaj808)	9	88.68	95.72	2	22.22
19378.	Roberto (neowolf)	9	79.26	89.16	4	44.44
19379.	Neo-lap (neolaptop)	9	80.36	100.56	1	11.11
19380.	Roland (nemvagyokolyangyors)	9	70.20	80.93	2	22.22
19381.	NEKROME2.0 (nekrometwo)	9	60.66	69.28	4	44.44
19382.	Name (needevidence)	9	114.72	134.44	2	22.22
19383.	Nawfox (nawfox)	9	72.60	76.53	3	33.33
19384.	cryptid (naturalcryptid)	9	145.91	174.37	8	88.89
19385.	Existential Explorer (natmac4)	9	91.62	110.65	3	33.33
19386.	Natalie (natatat48)	9	73.30	87.92	0	0.00
19387.	nat2980 (nat2980)	9	65.32	76.01	1	11.11
19388.	Nasos (nasos2311)	9	76.86	88.92	2	22.22
19389.	Nan (nantuzi)	9	88.35	96.68	3	33.33
19390.	naman (naman14)	9	60.78	71.23	1	11.11
19391.	Nabalazs (nabalazs)	9	68.39	78.04	3	33.33
19392.	Mystree (mystree)	9	86.20	96.90	4	44.44
19393.	Cyberbullet (mstfelq)	9	83.06	98.49	4	44.44
19394.	Mr (mrghost_yes)	9	65.82	71.83	3	33.33
19395.	Amar (mrfartboss)	9	80.11	96.47	7	77.78
19396.	Simon (mosie)	9	45.20	53.26	3	33.33
19397.	Morshedul (morshedul)	9	36.48	40.19	0	0.00
19398.	sadaf (morphinefather)	9	88.59	117.71	4	44.44
19399.	Rosewill RK-9000V2 (morphin...	9	111.91	128.04	3	33.33
19400.	moonlight (moonlight_21)	9	87.94	103.69	5	55.56
19401.	monster (monster)	9	115.57	134.20	5	55.56
19402.	Monotype2 (monotype2)	9	83.31	101.23	7	77.78
19403.	Fickle (mongolo123)	9	104.96	119.91	2	22.22
19404.	Nate (mmmcac)	9	59.89	68.24	1	11.11
19405.	mllm (mllm1771)	9	57.42	75.24	0	0.00
19406.	Michelle (mktsoprano2)	9	103.87	111.62	6	66.67
19407.	Muhammed Murad (mkmusafir)	9	49.51	56.04	1	11.11
19408.	diya (mixxanber)	9	134.14	167.32	6	66.67
19409.	SystemOfAKitty (mischi334)	9	84.72	95.01	1	11.11
19410.	Mis (miscellaneous)	9	74.27	100.99	1	11.11
19411.	Miranite (Dvorak) (miranite)	9	105.06	125.42	9	100.00
19412.	Kaan (mirackhle)	9	53.54	64.81	2	22.22
19413.	Mayank (minkk777)	9	87.71	99.60	3	33.33
19414.	Jonathan (minifoke)	9	55.09	63.01	0	0.00
19415.	Miki (miki888)	9	89.58	93.47	2	22.22
19416.	Michael (michaeleh_colemak)	9	69.06	77.07	3	33.33
19417.	Hai (michaeldp)	9	77.76	84.77	3	33.33
19418.	Mevin (mevinn)	9	75.37	87.74	3	33.33
19419.	metrodous (metrodous_yt_6)	9	72.42	89.79	3	33.33
19420.	biggestkrug139 (mentalpatient)	9	129.52	145.36	6	66.67
19421.	melvynAIDS (melvynaids)	9	92.76	104.00	5	55.56
19422.	Matthew (meloooche)	9	82.79	92.65	4	44.44
19423.	Oleg (meidebshy)	9	31.40	36.86	1	11.11
19424.	Mohit (meeoww)	9	53.90	65.82	1	11.11
19425.	Michael (mdstumpfy123)	9	84.59	91.61	4	44.44
19426.	Marcus (mckhaann)	9	78.58	88.93	2	22.22
19427.	M (mchang416)	9	92.14	103.23	2	22.22
19428.	maxigus (maxigus_mcfly)	9	99.46	109.39	6	66.67
19429.	maxf (maxf8)	9	87.51	100.12	5	55.56
19430.	Alex (maveriiic)	9	67.25	72.41	1	11.11
19431.	Matthew (matty_venus)	9	75.69	88.12	2	22.22
19432.	Mat (matrix303)	9	74.34	84.46	2	22.22
19433.	Henry (matrixial)	9	103.27	123.43	5	55.56
19434.	Made Dandy (mathzie)	9	65.31	77.06	3	33.33
19435.	harih (masterharish)	9	57.17	64.92	4	44.44
19436.	Oyo (marauder316)	9	64.47	71.11	2	22.22
19437.	MangalicA (mangalica)	9	64.99	78.08	1	11.11
19438.	freelo (majoreuphoria)	9	89.80	94.96	4	44.44
19439.	siti (mahmudahsiti)	9	94.76	107.84	4	44.44
19440.	mahmud (mahmoudtahaa111)	9	27.37	31.27	3	33.33
19441.	Donovan (maggigorengayam)	9	71.78	79.00	2	22.22
19442.	Max (maexxx)	9	88.31	93.30	2	22.22
19443.	Lycarions (lycarions)	9	93.86	102.32	5	55.56
19444.	Luther (luthermanhole)	9	111.09	133.20	4	44.44
19445.	poopycock17 (luigi65536)	9	86.12	95.60	2	22.22
19446.	Dhruv (loneninja__)	9	70.62	79.54	2	22.22
19447.	Hunter (lokitypingusa)	9	91.28	103.40	3	33.33
19448.	Ioishi (loishi)	9	59.04	64.67	3	33.33
19449.	Logan (loganthewizkid)	9	49.52	56.04	3	33.33
19450.	lockheed (lock_heed)	9	78.06	87.35	2	22.22
19451.	Lochan (lochanr)	9	68.98	80.18	4	44.44
19452.	Misael (llillill)	9	70.74	80.59	3	33.33
19453.	liwmus (liwmu)	9	95.38	104.57	4	44.44
19454.	Victor (liucow)	9	103.28	129.44	1	11.11
19455.	Sam (litesam)	9	79.30	89.82	1	11.11
19456.	Óskar (lillibilli)	9	69.52	82.91	0	0.00
19457.	Lilith (lilith333)	9	97.17	103.44	8	88.89
19458.	from brazil (liech)	9	107.74	114.69	5	55.56
19459.	Your (lftam319)	9	67.61	72.18	1	11.11
19460.	Ramsha (lexi25)	9	37.58	49.10	0	0.00
19461.	tstats[levo2001] (levo2001)	9	58.71	68.94	3	33.33
19462.	Levi (levimeijer)	9	57.12	63.73	1	11.11
19463.	luce (leuvis)	9	54.87	61.26	1	11.11
19464.	(leunn)	9	70.73	81.49	3	33.33
19465.	lemon (lemongrabbb)	9	61.17	74.87	1	11.11
19466.	FleshEyes (lejitt)	9	95.14	101.02	4	44.44
19467.	Legacy (legacylegacy)	9	96.81	111.54	3	33.33
19468.	Learning Bone (learning_bone)	9	66.73	71.89	4	44.44
19469.	Lewis (lcole)	9	71.90	88.28	1	11.11
19470.	chandu (lavinyoutube)	9	32.06	41.84	1	11.11
19471.	James Ethan (laszerbeam)	9	91.41	105.22	6	66.67
19472.	alex (larrythesnail82)	9	55.24	64.03	2	22.22
19473.	laptop (laptopsakti)	9	44.72	46.66	2	22.22
19474.	tstats[lapakatapulta] (lapa...	9	120.36	133.32	3	33.33
19475.	lahmacun (lahmacun228)	9	61.56	67.50	2	22.22
19476.	Sandesh (labradoodle)	9	74.35	82.33	1	11.11
19477.	Denis (l2p200iqplays)	9	100.28	110.25	3	33.33
19478.	KonoKono (kzunderscoresamao...	9	101.58	114.24	5	55.56
19479.	Kyle (kyjasa88)	9	96.78	110.03	3	33.33
19480.	Charles (kyaw12)	9	62.11	75.40	4	44.44
19481.	kweg (kweg)	9	131.43	148.79	4	44.44
19482.	Kai (kulturekiah)	9	56.27	64.13	2	22.22
19483.	kuino, (kuino)	9	103.97	124.18	9	100.00
19484.	×͜×KRISHNA _ (krishna00)	9	48.72	54.87	1	11.11
19485.	Jano (kossvk)	9	92.03	100.85	4	44.44
19486.	Kyle (koshu)	9	64.37	77.50	0	0.00
19487.	konvay (konvay)	9	124.85	140.92	9	100.00
19488.	Koji (kojinb)	9	90.05	99.46	3	33.33
19489.	Luca (kodzack)	9	84.43	98.71	3	33.33
19490.	kodzy (kodzy)	9	88.53	101.89	2	22.22
19491.	Allen (kochengoren)	9	72.48	83.08	1	11.11
19492.	Kleuz (kleuz)	9	64.45	75.81	3	33.33
19493.	Aly (kixiris)	9	55.66	68.66	9	100.00
19494.	(kingshmoo)	9	75.16	91.79	2	22.22
19495.	Kai (kingkaikster)	9	69.08	76.25	1	11.11
19496.	thia (kingbarney)	9	65.00	81.63	2	22.22
19497.	kiara (kia_via_dia_arara)	9	50.97	66.15	2	22.22
19498.	kiannu (kiannaj)	9	68.95	84.09	2	22.22
19499.	Khende (khende)	9	64.07	71.29	9	100.00
19500.	ionlytype60wpm (keyboardssl...	9	99.10	111.57	5	55.56
19501.	Kevin (kevbobbly)	9	83.57	97.22	2	22.22
19502.	hmmm (kesh______)	9	108.45	119.33	5	55.56
19503.	k (ker1ne)	9	72.02	82.34	3	33.33
19504.	Ken (kennoji)	9	83.27	117.87	8	88.89
19505.	William (keneth10)	9	65.65	79.01	1	11.11
19506.	Kempo (kempochinois)	9	55.10	63.60	0	0.00
19507.	Kelopio (kelopio)	9	127.15	149.49	4	44.44
19508.	Deni Avdjia fanboy (kelethe...	9	77.09	87.22	4	44.44
19509.	Kin (kccchiu)	9	87.65	93.20	2	22.22
19510.	kb (kbaccam)	9	94.78	110.08	4	44.44
19511.	Katie (kaytay0111)	9	100.69	123.25	1	11.11
19512.	kensen (kawatashi)	9	66.25	74.89	1	11.11
19513.	Kavita (kavita_chaubey)	9	45.48	50.76	0	0.00
19514.	Xero (kataclysm)	9	91.38	102.59	3	33.33
19515.	ben (kashikura)	9	49.56	56.28	0	0.00
19516.	kap (kappow)	9	107.99	121.44	5	55.56
19517.	MySpaceBarIsBroken (kanto)	9	117.10	128.74	6	66.67
19518.	kanacurry (kanacurry)	9	104.70	116.92	7	77.78
19519.	Kamiye (kamiye)	9	91.75	101.05	2	22.22
19520.	kamea (kamea)	9	95.58	111.27	2	22.22
19521.	kaka (kakaburra)	9	89.44	102.81	4	44.44
19522.	joy (jyyjng)	9	77.63	88.30	3	33.33
19523.	Ben (jynn7)	9	107.38	127.64	5	55.56
19524.	christine (just_trying_to_g...	9	62.59	77.94	1	11.11
19525.	Justin (justin_ephemeral)	9	101.14	112.54	8	88.89
19526.	John (jspar)	9	92.30	104.97	2	22.22
19527.	jasmine (jsmine)	9	100.76	117.23	1	11.11
19528.	j (jrdib57)	9	105.92	121.59	5	55.56
19529.	Barokah (jowotulen)	9	94.56	102.40	3	33.33
19530.	Josh (joshindahood)	9	92.86	102.89	2	22.22
19531.	José (josehenrique91)	9	61.39	77.13	1	11.11
19532.	joris (jorisss)	9	86.63	96.08	5	55.56
19533.	Jordan (jordansmithnz)	9	81.29	99.18	2	22.22
19534.	Jordi (joorrrrrrrr)	9	58.22	68.81	4	44.44
19535.	Jon (jonlee17)	9	70.51	81.22	3	33.33
19536.	Johann (jona_die_jood)	9	60.50	69.16	0	0.00
19537.	John (jolomaho)	9	59.58	63.47	1	11.11
19538.	Jo (joemamma_38)	9	125.99	144.88	3	33.33
19539.	jnnwn (jnnwn)	9	101.37	108.01	6	66.67
19540.	Jordan (jmoneymyer)	9	67.88	75.83	0	0.00
19541.	Jeremy (jmetzger55)	9	75.99	94.88	1	11.11
19542.	Matin (jivago)	9	63.71	73.39	2	22.22
19543.	Jennifer (jinglebingo)	9	92.53	102.49	3	33.33
19544.	jimmy (jimnish)	9	44.62	49.44	1	11.11
19545.	JIHAD (jihad_14)	9	63.91	68.29	4	44.44
19546.	Jerry (jerry_licious)	9	107.24	114.24	5	55.56
19547.	Jerry (jerry300)	9	77.28	82.85	1	11.11
19548.	jeans (jelowo)	9	72.95	95.07	2	22.22
19549.	Jed (jed_)	9	69.46	78.42	1	11.11
19550.	Jay (jaysalvi)	9	94.18	108.54	2	22.22
19551.	Jayden (jaydensar)	9	96.25	113.87	3	33.33
19552.	jawes (jawes123)	9	97.79	114.78	6	66.67
19553.	jasmine (jasminneee)	9	68.07	73.03	2	22.22
19554.	Jan (janm2001)	9	76.08	87.25	2	22.22
19555.	jam (jamola)	9	101.22	113.25	5	55.56
19556.	James (james000)	9	71.21	80.42	0	0.00
19557.	deskrabbit (jalaymie)	9	74.28	83.95	3	33.33
19558.	jaemy (jaemywest)	9	50.65	57.32	0	0.00
19559.	acjk (jackolant199)	9	69.38	80.23	1	11.11
19560.	Jack (j4ck6643)	9	75.54	82.97	5	55.56
19561.	I3B (i_3b)	9	56.39	62.30	8	88.89
19562.	Eren Yeager (itzadit)	9	65.06	73.43	1	11.11
19563.	Kevin Jeonghun (itskevinjeong)	9	71.94	77.38	5	55.56
19564.	ir4un (ir4un)	9	53.48	67.08	2	22.22
19565.	IQ1537 (iq1537)	9	131.41	146.28	7	77.78
19566.	Libby (inkgenious)	9	68.29	74.25	2	22.22
19567.	Vincent (indronna)	9	82.07	90.70	4	44.44
19568.	imsynthex (imsynthex)	9	77.92	96.36	5	55.56
19569.	aerora (imqyuu)	9	140.41	157.78	9	100.00
19570.	Sam (ilikeyourcutghee)	9	86.16	99.33	2	22.22
19571.	Reece (iifuze)	9	104.45	122.73	4	44.44
19572.	IGO (igo_)	9	65.32	77.18	3	33.33
19573.	Igor (igotim)	9	72.58	80.97	2	22.22
19574.	Icecuber (icecuber)	9	102.37	112.78	3	33.33
19575.	ICANNOTLOSE (icannotlose)	9	134.63	169.24	6	66.67
19576.	konnie (ibeatonwhitewomen)	9	76.58	84.53	3	33.33
19577.	pillows (hyluu)	9	149.61	167.97	8	88.89
19578.	John (hylkinator)	9	108.96	128.62	5	55.56
19579.	HY (hygh)	9	33.02	37.45	0	0.00
19580.	Hunter (hunterup)	9	98.79	106.96	4	44.44
19581.	hunter (hunter667)	9	75.57	86.09	4	44.44
19582.	Vlad (hunter4858)	9	80.93	94.16	1	11.11
19583.	HUng (hunggnuh0407)	9	78.69	93.25	2	22.22
19584.	Who (hunatank)	9	79.83	97.18	1	11.11
19585.	Roni (human_ro)	9	85.21	93.70	7	77.78
19586.	Shohid (humangod)	9	87.06	112.97	2	22.22
19587.	hoku✨ (hokuyato)	9	89.45	96.01	2	22.22
19588.	Van Hoang (hoangelec)	9	92.71	106.70	3	33.33
19589.	Hmed (hmed_belgassem)	9	34.52	38.20	1	11.11
19590.	HiDa (hiida)	9	111.03	129.89	4	44.44
19591.	The (hermaninator)	9	64.91	72.20	4	44.44
19592.	Adrian (hellfi_18)	9	50.07	55.41	3	33.33
19593.	hela (helabwr)	9	49.23	52.41	2	22.22
19594.	healy (healy1453)	9	88.82	101.70	3	33.33
19595.	headtr1p (headtr1p)	9	100.16	118.12	6	66.67
19596.	Typer (haydyn49)	9	77.03	83.65	1	11.11
19597.	Kevin (havek)	9	107.76	119.43	5	55.56
19598.	Taika (hariyoshi41)	9	84.93	92.65	4	44.44
19599.	HARI (hariom_01)	9	49.78	54.01	1	11.11
19600.	harbeanger (harbeanger)	9	97.64	102.42	4	44.44
19601.	Torben (hansi36)	9	62.88	71.73	7	77.78
19602.	Hansel (hansels)	9	65.95	73.11	2	22.22
19603.	Hannah (hannahwagner)	9	82.80	92.61	3	33.33
19604.	Hannah Mei (hannahmei_steury)	9	52.08	64.05	2	22.22
19605.	Michael (hangene92)	9	108.98	128.88	9	100.00
19606.	Hamburgahh (hamburgahh)	9	91.93	108.91	2	22.22
19607.	Gabriel (halamawala)	9	109.15	118.68	5	55.56
19608.	HackzPlayz (hackzplayz)	9	71.99	79.63	3	33.33
19609.	Turkey (habibiturkey)	9	84.09	104.57	5	55.56
19610.	Anakin (gunmoon)	9	97.60	104.53	5	55.56
19611.	Gum (gumwrapper)	9	80.23	85.30	3	33.33
19612.	Kevin (gudern)	9	95.59	119.75	6	66.67
19613.	ed sheeran (guccigangtae)	9	61.50	73.34	0	0.00
19614.	John (gryndal)	9	81.57	88.55	5	55.56
19615.	Alexander Grill (grill__alex)	9	57.13	64.94	1	11.11
19616.	Gribbit (gribbit)	9	60.39	69.26	2	22.22
19617.	Gaby (grebliale)	9	90.58	106.62	3	33.33
19618.	Pandaru (grancrackerr)	9	87.79	97.68	5	55.56
19619.	Vamsi Krishna (gordongecko)	9	71.72	78.42	4	44.44
19620.	Josh (goldfingerer)	9	87.52	98.80	5	55.56
19621.	Nguyen (gohweiz)	9	50.87	70.08	6	66.67
19622.	mike (godlykanadian)	9	81.60	86.07	2	22.22
19623.	GM (gmbao)	9	94.98	104.53	4	44.44
19624.	Letsy (glitchyletsy)	9	70.89	95.09	4	44.44
19625.	glenn (glenneroo)	9	104.33	119.98	7	77.78
19626.	Ghost (gh0st3423)	9	73.09	91.53	2	22.22
19627.	Tamjid (getrektfab)	9	47.59	54.10	2	22.22
19628.	Max (getmackt)	9	80.22	88.06	6	66.67
19629.	Greg (gecko231)	9	89.89	108.17	3	33.33
19630.	Gauley (gauley)	9	70.21	77.94	6	66.67
19631.	Gansukh (gansuh)	9	40.95	48.44	2	22.22
19632.	gamesgant313 (gamesgant313)	9	91.57	112.00	9	100.00
19633.	Gallagher (gallaghercat11)	9	60.49	70.36	1	11.11
19634.	Owen (furyng)	9	65.30	71.37	9	100.00
19635.	Furaha (furfur_beast)	9	71.25	78.95	1	11.11
19636.	Mike (fuccuppo)	9	75.26	88.22	1	11.11
19637.	Pink Mutt (frugalmussel)	9	70.13	83.31	1	11.11
19638.	Adimas (frostyslr)	9	100.43	117.67	7	77.78
19639.	Freddo (freddo7)	9	97.82	110.25	3	33.33
19640.	Freddie (freddiesanchez)	9	92.55	106.87	2	22.22
19641.	Ferrari (fluidcoder)	9	70.62	76.95	4	44.44
19642.	Ruth (flirtatiouswizard)	9	90.79	100.16	2	22.22
19643.	FlippLoki (flipploki)	9	94.69	114.83	4	44.44
19644.	Franklin (flipfloppm)	9	122.47	149.35	7	77.78
19645.	297 (flightsim297)	9	132.29	161.89	8	88.89
19646.	Kuldip (flash007)	9	69.22	74.44	3	33.33
19647.	Flappy (flappysnake)	9	47.57	54.12	0	0.00
19648.	Slow_AF (flaming_gladius)	9	77.42	85.15	1	11.11
19649.	Jeremiah (fiveminus1)	9	101.73	129.45	3	33.33
19650.	fintelia (fintelia)	9	79.08	85.71	2	22.22
19651.	Oliwer (financialojay)	9	46.88	52.64	3	33.33
19652.	Fred (fcbsd)	9	45.81	55.29	3	33.33
19653.	Farkhan (farkhann)	9	56.75	72.20	0	0.00
19654.	Kai حيادي (famboy32)	9	92.41	111.00	5	55.56
19655.	Levi (fajpaj)	9	96.29	113.61	2	22.22
19656.	Amaranth (fadingamaranth)	9	93.06	110.89	3	33.33
19657.	EXT YOYO (ext_yoyo)	9	41.78	59.87	2	22.22
19658.	Nathan (exodus_king)	9	82.32	89.43	4	44.44
19659.	Fingerkart sweat (exford0)	9	110.26	115.59	5	55.56
19660.	daddy (evilaristotle)	9	61.23	66.51	2	22.22
19661.	John (everderp)	9	93.64	115.67	4	44.44
19662.	Evanz (evanzyt)	9	70.44	78.16	4	44.44
19663.	espo (espooooo)	9	86.12	105.37	3	33.33
19664.	Nick (escalt)	9	104.43	125.88	6	66.67
19665.	(erny2)	9	105.42	115.30	5	55.56
19666.	epicgamer412 (epicgamer412)	9	109.23	124.34	5	55.56
19667.	Endku (endku)	9	75.43	85.21	1	11.11
19668.	Mohammed (enchantful)	9	90.75	99.95	2	22.22
19669.	Elvy (elvy_)	9	48.93	57.40	3	33.33
19670.	Elemental (elementl)	9	99.68	116.69	3	33.33
19671.	Eldin (eldin_)	9	59.86	74.36	2	22.22
19672.	Elaine (elainehuang)	9	53.83	63.11	0	0.00
19673.	Ethan (egoldman)	9	99.80	122.89	5	55.56
19674.	Edward (edwmai18)	9	75.64	98.80	3	33.33
19675.	https//typer.news (eduard20)	9	102.88	116.06	4	44.44
19676.	engie (edrian_a)	9	106.12	126.44	3	33.33
19677.	EddieVonShmeddie (eddievons...	9	84.17	102.75	2	22.22
19678.	Ecila246 (ecila246)	9	47.14	50.78	0	0.00
19679.	Echo (echoet)	9	65.59	81.47	4	44.44
19680.	DZ_no (dzeano)	9	83.26	91.09	3	33.33
19681.	Dylan (dyl0e)	9	96.31	101.90	3	33.33
19682.	Drake (dunkchai)	9	83.34	97.78	4	44.44
19683.	Sam Luke (ducksako)	9	82.32	95.95	2	22.22
19684.	Shamit (dr_neshmitz)	9	88.28	96.80	3	33.33
19685.	Drixppy (drixppy)	9	49.75	57.11	2	22.22
19686.	John (driftan)	9	103.20	115.61	3	33.33
19687.	Dries (driesvanspauwen)	9	91.16	101.75	4	44.44
19688.	John (drchase)	9	106.53	114.90	3	33.33
19689.	Kris (doyouthink)	9	92.81	108.90	4	44.44
19690.	DottyShark31762 (dottyshark...	9	52.74	64.56	2	22.22
19691.	Juan (dostoevsky)	9	64.14	73.59	1	11.11
19692.	Sophie Feldman (doodlefinny)	9	96.19	114.65	4	44.44
19693.	Kyle (donttouchmyrice)	9	90.05	110.61	6	66.67
19694.	Dominikus (dnk_dom)	9	36.33	43.04	2	22.22
19695.	Keegan (djkeegs)	9	84.51	96.04	2	22.22
19696.	Ian (disnailandd)	9	107.33	133.79	6	66.67
19697.	Velislav (disaster_veli)	9	45.01	49.39	1	11.11
19698.	J (dingkid)	9	117.45	125.49	5	55.56
19699.	Alan (dick_licker666)	9	90.00	116.87	2	22.22
19700.	DewWhite (dewwhite)	9	68.70	75.98	6	66.67
19701.	Devin (devingalway)	9	107.27	123.56	2	22.22
19702.	Deux (deuxgrosman)	9	94.51	105.34	2	22.22
19703.	joanna (deulseobs)	9	120.97	137.00	6	66.67
19704.	Domenic (denenfx)	9	110.88	127.07	3	33.33
19705.	Tobi (demizu_)	9	110.75	122.39	4	44.44
19706.	delfador42 (delfador42)	9	80.34	86.20	4	44.44
19707.	Roxx III (deathsoul117004)	9	58.37	66.05	2	22.22
19708.	Samson (deathreturns)	9	43.31	49.54	1	11.11
19709.	David (davidt585)	9	97.34	108.11	1	11.11
19710.	David (davidsayshello)	9	80.25	92.81	3	33.33
19711.	DavidFinlForm (davidfinalform)	9	49.17	55.02	0	0.00
19712.	DankAlzein (dankalzein)	9	121.93	140.08	6	66.67
19713.	arin (dakotubbs)	9	51.07	65.90	0	0.00
19714.	nunya (daintyfawn)	9	82.09	111.87	9	100.00
19715.	Dauniverse (daimabao2003)	9	60.49	67.96	3	33.33
19716.	D (daikuri)	9	103.76	117.24	4	44.44
19717.	Mark (cyclingguy536)	9	80.26	92.96	1	11.11
19718.	Nid (cyanid_)	9	81.45	97.80	2	22.22
19719.	tyler (cyanamethyst)	9	95.11	113.83	3	33.33
19720.	Christian (cwoo)	9	93.67	107.64	6	66.67
19721.	O (cvxnjopsad)	9	86.62	98.82	2	22.22
19722.	Ryan (cuoituoi1996)	9	92.33	114.57	4	44.44
19723.	Cody (cuday)	9	91.07	104.44	4	44.44
19724.	halloo (crystaalsnow)	9	57.34	66.08	2	22.22
19725.	shoop (crimmsy)	9	87.53	98.64	4	44.44
19726.	Oual (crankcrash)	9	71.65	90.64	3	33.33
19727.	Charly (cpn29)	9	43.98	51.26	1	11.11
19728.	Edvin (cowsmacker69)	9	64.44	79.56	4	44.44
19729.	Cotle (cotle)	9	53.48	66.33	2	22.22
19730.	Fast (cooloppo)	9	88.40	96.81	4	44.44
19731.	Ian (coocooman3)	9	84.60	93.28	2	22.22
19732.	Wilko (colacake84)	9	83.94	92.95	3	33.33
19733.	Cole (cmrrockstar85)	9	106.09	121.38	5	55.56
19734.	Bassim. (cmpleteidiot)	9	94.30	113.83	3	33.33
19735.	Clit (cliffcatastrophe)	9	146.20	161.46	4	44.44
19736.	Xenomorph (claygnot10)	9	88.86	104.48	1	11.11
19737.	charlie (cl23456)	9	86.68	101.74	2	22.22
19738.	Classical (cl123)	9	47.53	56.91	1	11.11
19739.	Cole (ckoehler)	9	77.42	93.98	3	33.33
19740.	Cijarot (cijarot)	9	70.86	81.09	2	22.22
19741.	Chub (chubbyhands)	9	67.47	80.70	3	33.33
19742.	Christian (christian9182)	9	72.74	78.95	4	44.44
19743.	Chris (chrisbones)	9	70.86	83.97	2	22.22
19744.	Christopher (chrisaua)	9	83.18	101.31	5	55.56
19745.	Kevin (chqu7424)	9	91.83	104.08	6	66.67
19746.	Chlebíček (chlebicek)	9	36.31	42.49	0	0.00
19747.	Lii4 (chjh21005)	9	71.67	79.78	2	22.22
19748.	tstats[chihayafuru] (chihay...	9	123.78	134.07	6	66.67
19749.	Kachika (chickhicks_)	9	112.09	137.74	4	44.44
19750.	cherub (cherub)	9	111.89	126.79	4	44.44
19751.	Eduardo (chekedu)	9	47.38	63.29	0	0.00
19752.	Jordan (cheetoburritoes)	9	88.22	95.72	3	33.33
19753.	LOL (cheesecakeisgud)	9	117.74	129.25	5	55.56
19754.	chedted (chedted)	9	78.93	91.73	2	22.22
19755.	Chaws5 (chaws5)	9	111.36	120.37	6	66.67
19756.	Manos (chatzakes)	9	68.39	77.44	2	22.22
19757.	Charmen (charmen)	9	56.03	64.20	3	33.33
19758.	charles (charles1106)	9	60.34	70.96	2	22.22
19759.	chakuch (chakuch)	9	62.90	84.18	1	11.11
19760.	Cian (ceol93)	9	110.76	123.00	6	66.67
19761.	Ce (celineusa)	9	86.45	100.96	3	33.33
19762.	Carl (cbho73)	9	105.52	112.55	2	22.22
19763.	Tika (catluvr543)	9	124.67	146.60	7	77.78
19764.	Jason (cathayjason)	9	104.97	115.34	6	66.67
19765.	Cassius (cassius_vlok)	9	53.82	62.37	0	0.00
19766.	Carbon (carbon28)	9	69.28	80.51	3	33.33
19767.	Cao Sy Hai (caosyhailong99)	9	95.29	110.17	2	22.22
19768.	Sniffff (can_i_sniffff)	9	67.05	81.71	4	44.44
19769.	Cameron (cameron__)	9	78.78	91.76	4	44.44
19770.	Lia (calumhood_)	9	76.38	90.15	4	44.44
19771.	Calsuis (calsuis)	9	86.29	98.13	3	33.33
19772.	mechanical (cakesogood)	9	95.11	132.97	4	44.44
19773.	Type (cainvelasquez)	9	75.01	87.46	6	66.67
19774.	LongGone (byejack123)	9	64.72	72.28	0	0.00
19775.	BWho? (bwho)	9	90.91	97.48	3	33.33
19776.	Alex (buttonmeister)	9	75.73	88.94	4	44.44
19777.	Topher (burritopher)	9	70.28	82.76	3	33.33
19778.	Burner (burnerburner)	9	78.43	89.24	4	44.44
19779.	Bucketboi (bucketheadmit13)	9	81.99	94.34	3	33.33
19780.	Jason (buckbuck5646)	9	113.50	133.74	7	77.78
19781.	brian (bsill)	9	56.65	68.00	2	22.22
19782.	Bruce (bs99)	9	54.51	59.89	1	11.11
19783.	Bryan (bryangne)	9	75.80	92.70	2	22.22
19784.	aaron (brwnmn6)	9	92.35	109.24	3	33.33
19785.	bronts (brontus)	9	86.86	103.34	2	22.22
19786.	Matt (britzkrieg)	9	91.66	105.60	3	33.33
19787.	Brekzit (brekzit__)	9	73.13	86.55	2	22.22
19788.	Brandon (brandongva)	9	63.86	70.24	4	44.44
19789.	Francisca (borg58hd)	9	65.61	76.23	3	33.33
19790.	Tristan (bombomb)	9	57.38	80.13	5	55.56
19791.	Max (bolognacolonel)	9	84.16	90.25	5	55.56
19792.	dead (bob_mcbobberbob)	9	71.57	81.53	3	33.33
19793.	Borislav (bobun)	9	83.91	94.33	1	11.11
19794.	Bobby (bobbydhiman69)	9	92.90	104.62	3	33.33
19795.	BlueSlimeX (blueslimex)	9	85.02	94.74	8	88.89
19796.	blues (blues856)	9	110.14	127.86	3	33.33
19797.	blublueagle (blublueagle)	9	58.83	66.49	2	22.22
19798.	Bilguun (blgn94)	9	57.30	63.92	2	22.22
19799.	Jesse (bleedobsidian)	9	73.46	91.01	4	44.44
19800.	Eejay (blazesfolife)	9	80.50	87.33	4	44.44
19801.	Daniel (blastanks)	9	100.53	117.49	2	22.22
19802.	Saul Goodman (blarg_23)	9	74.44	82.07	2	22.22
19803.	frederik (birgerbrosa)	9	90.27	105.17	3	33.33
19804.	biotox (biotoxz)	9	112.61	134.34	5	55.56
19805.	bincent (bincentlife)	9	85.66	103.39	6	66.67
19806.	emmanuel (bigginer20)	9	25.54	29.23	2	22.22
19807.	Big Bird (bigbird61)	9	34.39	38.47	0	0.00
19808.	bido (bidoteima)	9	97.94	121.84	7	77.78
19809.	batmunkh (batmunkh)	9	56.13	61.46	0	0.00
19810.	Son (baby_hanz)	9	95.57	109.26	3	33.33
19811.	¯\_(ツ)_/¯ (babanin)	9	73.46	82.31	5	55.56
19812.	A Newbie (a_newbie_a)	9	55.38	62.64	1	11.11
19813.	Azhar (azhartyper123)	9	43.80	52.03	2	22.22
19814.	envy (ayytsklmao)	9	103.06	117.62	1	11.11
19815.	AyuAnchor (ayu_anchor)	9	28.25	33.97	3	33.33
19816.	Emilio (ayasesenpai)	9	75.94	85.47	4	44.44
19817.	Paul (axxmodeus)	9	69.89	80.52	4	44.44
19818.	Abigayle (awesomeness2470)	9	42.39	53.24	0	0.00
19819.	Alex (awb101)	9	81.75	95.16	3	33.33
19820.	Blyon (avocado_punched)	9	78.41	88.34	2	22.22
19821.	Vignesh (avkvignesh)	9	68.25	73.88	2	22.22
19822.	Avil (avilvineko)	9	55.40	60.77	0	0.00
19823.	au_hermit (au_hermit)	9	72.53	85.28	4	44.44
19824.	Hugh (atticush99)	9	86.37	96.13	4	44.44
19825.	[][][][] (atomskk)	9	116.09	141.12	5	55.56
19826.	Blitz (athul)	9	112.43	124.12	4	44.44
19827.	Dustin (athleticsaddict)	9	95.38	108.03	5	55.56
19828.	Atabek (atabekarapov14)	9	73.22	91.25	2	22.22
19829.	Samit (astro_0)	9	69.62	84.19	3	33.33
19830.	Andre (astrothetypist)	9	96.93	107.09	3	33.33
19831.	panda bear (astronicus)	9	137.42	147.81	6	66.67
19832.	cody (astro8192)	9	65.97	69.41	3	33.33
19833.	Alex (aspectings)	9	96.74	123.99	9	100.00
19834.	あしくさい (asikusai)	9	77.09	86.21	2	22.22
19835.	Asian (asiansupremacy)	9	102.95	119.02	7	77.78
19836.	😷 (ashraaf_k)	9	59.64	71.64	2	22.22
19837.	Arvid (arvid_a)	9	54.16	60.78	0	0.00
19838.	aiman (armm)	9	27.96	33.26	1	11.11
19839.	Cam (archlinuxuser)	9	71.92	81.60	3	33.33
19840.	Aqualuma (aqualuma1)	9	97.17	114.43	3	33.33
19841.	APR (apr_fernando)	9	39.01	48.84	2	22.22
19842.	Alexandre (apeloquin)	9	50.28	55.18	0	0.00
19843.	Anthony (anto_onwuka)	9	87.36	92.89	1	11.11
19844.	Anton (antonidas)	9	66.98	73.92	3	33.33
19845.	Benedek (antokben)	9	78.04	89.53	4	44.44
19846.	ante321 (ante321)	9	43.87	48.62	1	11.11
19847.	Anoop (anooprajreddym)	9	49.42	62.38	1	11.11
19848.	Anmol (anmolmb)	9	37.76	47.07	1	11.11
19849.	Aniket (aniiket)	9	66.55	69.93	3	33.33
19850.	jon (angbunehneh)	9	71.18	79.16	3	33.33
19851.	anepik (anepik)	9	84.90	101.51	7	77.78
19852.	𝐃𝐫𝐞𝐰 (andreanfi...	9	65.91	78.16	3	33.33
19853.	Andi (andi_m)	9	47.48	54.84	2	22.22
19854.	Someone (anamedplayer)	9	92.43	99.23	4	44.44
19855.	zzzzz (amzzzz771)	9	75.58	91.75	0	0.00
19856.	Amy (amy159)	9	94.55	109.66	6	66.67
19857.	Seeker (amer1996)	9	28.96	31.71	2	22.22
19858.	AmbrosiA (ambrosialeeann)	9	62.39	70.58	2	22.22
19859.	Amazing (amazinghedgehog)	9	115.15	137.85	7	77.78
19860.	Amal (amal_ronak)	9	81.72	97.50	6	66.67
19861.	Aluumina (aluumina)	9	73.48	84.41	1	11.11
19862.	Jason (altaria13)	9	102.03	114.65	3	33.33
19863.	František (alphabettt)	9	61.16	73.38	1	11.11
19864.	Nelson (alkatzer)	9	85.85	98.98	2	22.22
19865.	alixsch (alixsch)	9	62.77	76.70	5	55.56
19866.	Ali (alimann)	9	39.43	48.29	6	66.67
19867.	Alfredo (alfredosojr)	9	77.07	96.34	0	0.00
19868.	Alex (alextheo)	9	59.94	66.13	1	11.11
19869.	Alek (alexno)	9	54.47	58.19	0	0.00
19870.	Alex (alexdaguy)	9	89.49	105.29	1	11.11
19871.	Hadi (alcatroz)	9	98.91	107.61	6	66.67
19872.	ALAKI (alaki_uka)	9	54.03	68.52	1	11.11
19873.	Akshay (akshay2604)	9	62.13	78.22	3	33.33
19874.	Pash (akratics)	9	54.41	68.42	1	11.11
19875.	Sheeky (akiyoto)	9	69.29	80.79	3	33.33
19876.	Akshay (ak63)	9	34.58	43.64	2	22.22
19877.	aj (ajpingol)	9	94.63	118.95	8	88.89
19878.	Ajim (ajimgram)	9	24.64	30.69	1	11.11
19879.	Sinon (ajey_de_shadow)	9	88.02	94.17	3	33.33
19880.	Corgious (aiwoon)	9	58.98	65.71	1	11.11
19881.	Airree (airree)	9	75.81	81.59	4	44.44
19882.	aidil (aidilqayyim)	9	81.42	91.31	0	0.00
19883.	Agah (agah)	9	52.13	56.95	1	11.11
19884.	Becz (adosz_56)	9	43.41	52.12	0	0.00
19885.	Shadab (acclr8)	9	77.43	86.85	4	44.44
19886.	Alex (abohac99)	9	57.09	63.74	2	22.22
19887.	ab (abhi800)	9	55.74	67.88	0	0.00
19888.	Aarohi (aarohi24)	9	50.30	59.76	2	22.22
19889.	Alex (aalleexx1)	9	46.38	56.81	0	0.00
19890.	Ocean (975miles)	9	81.04	87.61	0	0.00
19891.	Parikshit (7767064953)	9	64.27	73.04	2	22.22
19892.	74R45 (74r45)	9	112.46	139.83	4	44.44
19893.	AJ (5onn)	9	84.75	96.37	2	22.22
19894.	WeiChen (50wpmbtw)	9	80.51	92.35	4	44.44
19895.	jck (404jmre)	9	99.17	108.03	6	66.67
19896.	3DegreeK (3degreek)	9	82.04	87.24	2	22.22
19897.	32587 (32587cj)	9	78.13	85.48	2	22.22
19898.	Amelia (2sidedpolygon)	9	111.51	126.33	6	66.67
19899.	mike (1749mike)	9	66.50	84.60	3	33.33
19900.	Andrew (10001k)	9	79.57	91.21	2	22.22
19901.	Rory (typertypertyping)	9	62.40	75.19	3	33.33
19902.	shmuck (devrajwashereyt)	9	72.52	90.81	8	88.89
19903.	Sophie (milk8080)	9	62.81	75.51	2	22.22
19904.	lulu (lofineedmint)	9	92.28	116.98	1	11.11
19905.	Sadge (sadge_da_amateur)	9	89.60	100.50	3	33.33
19906.	plusp (plusp)	9	45.95	52.61	2	22.22
19907.	marshal (marshalstrakencz)	9	44.13	55.50	4	44.44
19908.	harith (hrthtypo_310)	9	47.91	56.71	1	11.11
19909.	Nick (flakesflakes)	9	77.25	89.21	7	77.78
19910.	Red. (yesbutactuallyno21)	9	78.96	105.33	3	33.33
19911.	A (traplordadan)	9	118.83	132.24	6	66.67
19912.	tstats[annapal_9288] (annap...	9	60.31	78.70	9	100.00
19913.	Speeps (keyzkieidan)	9	74.65	86.29	5	55.56
19914.	bry400 (andromeda64)	9	80.91	93.00	2	22.22
19915.	Petrowl (rainspringwell)	9	45.95	49.96	0	0.00
19916.	Paige (twtvpaigelol)	9	149.65	168.04	5	55.56
19917.	Michał (michal2287)	9	79.50	92.87	3	33.33
19918.	Jason (hhheeeelllpppp)	9	74.97	84.89	4	44.44
19919.	Manish (manish_17)	9	81.20	99.02	0	0.00
19920.	Shokhrukhbek (incredible_sy)	9	60.25	66.15	1	11.11
19921.	Mellow (mellophor)	9	81.48	91.67	2	22.22
19922.	Yiyang (applehuner)	9	102.03	112.22	3	33.33
19923.	Variares (variares)	9	59.45	64.76	0	0.00
19924.	RyderWxnted#5380 (ryderwxnted)	9	84.58	106.36	2	22.22
19925.	Madeline (madee0325)	9	98.94	118.86	5	55.56
19926.	elliellielliellie (eventual...	9	69.56	79.34	2	22.22
19927.	Taki (patini)	9	62.30	71.21	2	22.22
19928.	junhan (junhanlee)	9	52.93	59.38	0	0.00
19929.	Elah (elaaaaah)	9	66.01	74.52	1	11.11
19930.	Justin Thomas (justin_bijoy)	9	56.50	62.13	1	11.11
19931.	Jonathan (leadsaf11)	9	98.19	118.77	4	44.44
19932.	Pco (pcorow)	9	66.43	74.67	3	33.33
19933.	masderryl (masderryl)	9	50.04	57.95	1	11.11
19934.	Rūdolfs (rudolfs_w)	9	34.86	37.27	0	0.00
19935.	EpikHerolol (epikherolol)	9	57.15	63.77	4	44.44
19936.	Isaac (iceman8083)	9	60.14	71.66	3	33.33
19937.	Chandramouli (chandramoulig)	9	44.47	55.35	1	11.11
19938.	ChoweeXCookie1879 (dojapusa...	9	44.72	49.55	1	11.11
19939.	lol (moto31005)	9	76.00	88.57	3	33.33
19940.	Jupp (cryt4x)	9	52.14	58.27	2	22.22
19941.	Upsideman (upsideman)	9	73.09	85.99	2	22.22
19942.	Saleh (salahiano)	9	53.91	60.99	0	0.00
19943.	lieky (liekyw)	9	69.19	76.86	0	0.00
19944.	Tudor (lad23)	9	67.02	78.82	1	11.11
19945.	Wouter (walterdankers)	9	84.03	96.06	1	11.11
19946.	Donn (dickies1)	9	49.39	57.72	1	11.11
19947.	Zack (kazsz)	9	90.81	101.78	3	33.33
19948.	Aaditys (aadityagiri_bis)	9	57.98	64.83	1	11.11
19949.	svetina (hotxpuns)	9	81.14	98.30	4	44.44
19950.	BQ (bayanda)	9	47.53	62.65	4	44.44
19951.	Robert (robmal1)	9	73.10	79.43	2	22.22
19952.	Blabbermouth (blabbermouth_)	9	74.74	88.71	3	33.33
19953.	Ryan (rns86)	9	89.46	111.38	3	33.33
19954.	Sherwin (sherwin_24)	9	39.35	46.80	3	33.33
19955.	Mary (kassywithac)	9	57.31	64.90	0	0.00
19956.	Amisently (amisently)	9	106.80	127.99	6	66.67
19957.	b1nga (b1nga)	9	75.03	94.37	3	33.33
19958.	johnlex1k (dark_eclipse)	9	57.91	70.37	1	11.11
19959.	Brandon (2fasteyes)	9	78.89	86.87	2	22.22
19960.	Bloppy (smurfy_03)	9	47.21	51.08	0	0.00
19961.	Antoine (loser3172)	9	75.32	93.00	2	22.22
19962.	Kazzzi (kazzzi)	9	26.58	31.18	1	11.11
19963.	Joey (lashawna)	9	77.95	89.61	2	22.22
19964.	Yeah (donojang)	9	126.68	139.17	5	55.56
19965.	Alec (alec935)	9	84.43	93.06	2	22.22
19966.	coastal (coastalrookie)	9	78.91	96.56	4	44.44
19967.	Washdude7 (yashvarde)	9	80.15	90.40	5	55.56
19968.	Blue (blueballerz)	9	62.78	76.24	4	44.44
19969.	Noobbkour (noobbykour)	9	72.05	81.74	2	22.22
19970.	Hooward (hooward)	9	49.04	55.47	0	0.00
19971.	Atomic_Typh00n (star_gaming...	9	111.08	143.43	6	66.67
19972.	Peter (pitabreadd)	9	92.78	106.68	1	11.11
19973.	adzenny (adzenny)	9	83.54	105.46	5	55.56
19974.	shinji-llorica-kun (shinji_...	9	63.16	70.63	7	77.78
19975.	Drainyyy (drainyyy)	9	84.35	91.49	4	44.44
19976.	Nicolas (itsnickxd1)	9	85.81	110.91	9	100.00
19977.	rautji (divyanshrautji123)	9	53.90	60.04	3	33.33
19978.	Colt (barksonq)	9	111.84	141.49	9	100.00
19979.	John (neptuneposiedon)	9	104.93	127.45	4	44.44
19980.	Lovelace (lovelacelovesc)	9	93.38	111.94	7	77.78
19981.	Annie (annievalentinekuo)	9	87.36	106.13	4	44.44
19982.	zac (tylerblevins43)	9	93.37	100.48	4	44.44
19983.	LimiTrix (limitrix)	9	86.61	96.00	4	44.44
19984.	Taylor (tayl)	9	80.31	90.32	2	22.22
19985.	opmj5 (opmj5)	9	46.33	57.16	3	33.33
19986.	Bryan (bryan_shao)	9	85.41	96.14	4	44.44
19987.	Severus (surajchopra002)	9	87.47	102.72	2	22.22
19988.	Nyuminzt (nyuminzt)	9	33.83	41.52	1	11.11
19989.	Nate (fastfingerer1984)	9	71.08	83.56	2	22.22
19990.	Jason (jason_n)	9	102.12	118.55	3	33.33
19991.	Joe (joe_mama_speed_at_typing)	9	63.85	68.89	1	11.11
19992.	cl0ud (hykroz)	9	51.43	59.73	0	0.00
19993.	Swag (swagsanji)	9	75.62	81.10	6	66.67
19994.	Edmund (edmndfx)	9	54.56	66.85	1	11.11
19995.	Keenan (km1nd)	9	67.62	87.97	3	33.33
19996.	kat (tehkraft)	9	92.98	115.32	3	33.33
19997.	Anjalie :) (cra0009)	9	43.70	53.57	1	11.11
19998.	Tatsam (tatsam_03)	9	77.23	87.88	2	22.22
19999.	Capeman (godzhell22)	9	57.31	70.91	0	0.00
20000.	Ebenezer (ebenezeryu)	9	72.32	84.43	4	44.44
20001.	ClassAMaverick (classamaver...	9	76.77	83.27	8	88.89
20002.	Eduardo (eder_vs)	9	70.46	87.60	4	44.44
20003.	brad (bradpaul525)	9	63.10	70.12	4	44.44
20004.	Will (zalear)	9	73.62	81.85	2	22.22
20005.	Lilgovo (lilgovo)	9	58.30	72.53	5	55.56
20006.	ForGe (dccvx)	9	93.23	114.51	2	22.22
20007.	Sammy (virtualtyper)	9	109.76	130.14	3	33.33
20008.	Cyborg (cyborg112)	9	51.79	62.16	1	11.11
20009.	brateboi (brateboi)	9	77.05	85.38	3	33.33
20010.	Blunt (bluntsam)	9	68.29	73.13	2	22.22
20011.	Dexter Martin (dexterguilalas)	9	48.14	52.22	4	44.44
20012.	Qiyuan (keonjoe)	9	108.36	121.91	3	33.33
20013.	Husker (husker9)	9	61.62	71.90	3	33.33
20014.	Brisseira (mintdaisy101)	9	51.08	63.96	1	11.11
20015.	Matthias (yotuhyper)	9	16.16	33.06	2	22.22
20016.	BoomBa (boombaman)	9	74.19	82.98	1	11.11
20017.	Fastasfackboi (fast_as_fack...	9	56.72	65.83	3	33.33
20018.	tstats[ahmedmhm2024] (ahmed...	9	42.98	47.04	0	0.00
20019.	Shambhu (veganshambhu)	9	66.89	73.17	4	44.44
20020.	abksabermaster (abksabermas...	9	67.86	81.29	3	33.33
20021.	Rafael (rafaelrs)	9	88.00	99.84	3	33.33
20022.	birb (smallbirb2)	9	109.74	121.43	4	44.44
20023.	fzerty (shreyasminocha)	9	97.30	109.00	5	55.56
20024.	Kit (karma_88)	9	65.35	74.66	0	0.00
20025.	Lakshya (smashed_potato)	9	23.92	29.22	4	44.44
20026.	Start slow (sancriuse)	9	58.58	66.60	2	22.22
20027.	JelyRenee' (jelybely_21)	9	55.01	60.54	2	22.22
20028.	_ (freshnewname)	9	65.20	80.47	1	11.11
20029.	song yuqi (ralkinho)	9	65.71	68.88	0	0.00
20030.	WdMalus (_wdmalus31_)	9	36.33	41.21	3	33.33
20031.	meerbay (meerbay)	9	60.37	68.58	2	22.22
20032.	Sáng (supersentaj)	9	46.04	48.85	3	33.33
20033.	Oliver (oliververandus)	9	100.08	117.40	8	88.89
20034.	Kayne (kayne256)	9	96.36	116.31	4	44.44
20035.	OmNommy (_omnommy)	9	55.35	59.14	1	11.11
20036.	Suchanya (suchayann)	9	40.47	46.39	7	77.78
20037.	rj (bruh_momento364)	9	70.98	79.36	2	22.22
20038.	Seam (shademaster69)	9	67.50	79.47	3	33.33
20039.	Einkie (qtr_typer)	9	55.05	60.82	0	0.00
20040.	chocolate (chocolate1111)	9	54.57	65.41	3	33.33
20041.	Sunil (sunildev)	9	41.68	44.95	5	55.56
20042.	Emma (skunkiii)	9	42.49	46.22	1	11.11
20043.	Eric (__eric__f__)	8	81.84	90.34	1	12.50
20044.	zensei (_zensei_)	8	75.30	82.15	0	0.00
20045.	sexyman (_may_)	8	64.30	78.92	2	25.00
20046.	Eternap (_eternal_)	8	76.28	87.02	6	75.00
20047.	Chris (_c3a)	8	82.45	98.61	0	0.00
20048.	zuritor (zuritor)	8	53.47	73.04	8	100.00
20049.	Michael (zoyp)	8	84.69	117.43	0	0.00
20050.	Kevin (zolt4r)	8	103.30	109.37	2	25.00
20051.	Jillian (zolemnx)	8	51.25	59.15	0	0.00
20052.	Dwarf (znagol)	8	69.06	72.66	1	12.50
20053.	Sanity (zjhaun)	8	61.28	67.37	3	37.50
20054.	ZiyanTheZink (ziyan_the_zink)	8	79.73	87.71	8	100.00
20055.	Ziron (ziron)	8	86.42	102.86	0	0.00
20056.	Zilla1218 (zilla1218)	8	74.28	81.82	2	25.00
20057.	Zia (zia__)	8	31.87	35.61	5	62.50
20058.	Zeta (zetanegativeone)	8	96.33	109.51	5	62.50
20059.	todayis_WanD (zeropatience)	8	84.87	107.43	2	25.00
20060.	zerg (zerggirl)	8	110.98	140.14	6	75.00
20061.	zenyatta (zenyattamondatta)	8	79.50	95.48	2	25.00
20062.	Zekken (zekken12345)	8	89.03	105.94	6	75.00
20063.	Jack (zbroooksy)	8	102.35	126.77	2	25.00
20064.	ZAKARIAAAAAAAAAAAAAAAAAAAAA...	8	52.20	60.56	0	0.00
20065.	tepps (zachtepp)	8	114.85	125.75	5	62.50
20066.	Zach (zachninjakiller6)	8	48.80	56.09	1	12.50
20067.	Yuuki (yuukiy)	8	75.78	86.79	3	37.50
20068.	Yuliana (yuli_a)	8	73.35	83.05	0	0.00
20069.	CHONG YU JIE (yujie_is_typing)	8	80.46	88.27	1	12.50
20070.	y (ys26908)	8	58.72	67.24	0	0.00
20071.	YowzaH (yowzah)	8	131.38	146.23	6	75.00
20072.	Jack (yourmomahhahaahaha)	8	106.55	126.79	3	37.50
20073.	your mom (yourmother369)	8	114.15	129.26	4	50.00
20074.	Yomie (yomie)	8	71.30	82.02	7	87.50
20075.	yinho (yinhotype)	8	58.11	74.04	2	25.00
20076.	Yimin (yimindvorak)	8	124.97	139.37	5	62.50
20077.	Yi-Chen (yichenlo)	8	58.41	72.91	1	12.50
20078.	Yasif (yasif345)	8	65.45	71.95	1	12.50
20079.	Greg (yaohan)	8	117.51	136.77	8	100.00
20080.	yannick (yannickbaze)	8	57.80	62.95	1	12.50
20081.	Time (yaboiiiwill)	8	104.20	111.59	3	37.50
20082.	six (y33t3r)	8	72.91	86.79	2	25.00
20083.	XYZ (xyzabc1799)	8	77.09	83.44	1	12.50
20084.	Fabian (xylia_fabian)	8	70.23	77.20	3	37.50
20085.	xxxodarap (xxxodarap)	8	40.76	48.25	1	12.50
20086.	RelaxCozy (xxodus999)	8	89.77	95.95	3	37.50
20087.	Moritz (xp0s31d0nx99)	8	69.88	76.74	2	25.00
20088.	jonny (xjboix)	8	93.48	115.36	3	37.50
20089.	Rohit (xdeadly)	8	51.20	60.89	2	25.00
20090.	charli (xdbiscuits)	8	61.98	70.96	2	25.00
20091.	Jeffrey (xcjeffrey)	8	50.21	60.42	0	0.00
20092.	Bryan (xarga)	8	103.87	117.26	8	100.00
20093.	Jason (xaraer)	8	69.74	78.38	2	25.00
20094.	Will (wwwong)	8	97.51	111.79	4	50.00
20095.	Fabio (wrist_strength)	8	82.08	89.54	3	37.50
20096.	Nicky (wownickywow)	8	75.37	83.30	3	37.50
20097.	parker (withouthue)	8	44.95	55.55	0	0.00
20098.	C (windyreed)	8	115.71	130.55	3	37.50
20099.	Wilson (wilson_ang)	8	74.78	81.57	2	25.00
20100.	Tjerk (whiz_nl)	8	102.26	113.59	5	62.50
20101.	Hunter (whdahl)	8	94.56	103.93	5	62.50
20102.	Erik (whatafuas)	8	94.94	106.61	1	12.50
20103.	Michael (whalee)	8	93.14	97.70	2	25.00
20104.	Owen (wertls)	8	69.55	82.07	7	87.50
20105.	w (wenjun)	8	127.12	144.75	4	50.00
20106.	Leonardo (wenjiedrick)	8	93.88	111.36	4	50.00
20107.	Jay (wenisknees)	8	88.37	109.67	1	12.50
20108.	Shantanu (wckd1)	8	47.41	51.30	1	12.50
20109.	James (waterpuree)	8	70.04	80.53	3	37.50
20110.	Waterghosteus (waterghosteus)	8	82.03	96.10	3	37.50
20111.	Ethan (waitblock)	8	103.17	109.96	0	0.00
20112.	Adam (waffelele)	8	71.28	79.81	8	100.00
20113.	Cuong (vucuong21)	8	76.46	83.94	2	25.00
20114.	vslip (vslipyt)	8	57.64	64.28	3	37.50
20115.	Van Philip (vppexis)	8	89.52	97.18	2	25.00
20116.	VK (vk_7)	8	41.47	56.71	5	62.50
20117.	Visionss (visionss)	8	89.56	108.91	3	37.50
20118.	Forrest (verybigpenguin)	8	112.06	128.90	4	50.00
20119.	Looking For GF (veiven)	8	113.63	129.48	4	50.00
20120.	Vedang (vedang1312)	8	38.52	43.28	2	25.00
20121.	Doug (vastvincent)	8	93.25	107.52	6	75.00
20122.	josh (vapeypoo)	8	80.36	88.94	1	12.50
20123.	Philip (vanp)	8	121.78	138.16	7	87.50
20124.	Peter (vajco)	8	66.13	71.40	1	12.50
20125.	Hiyam (v1ctor1x)	8	99.43	109.21	4	50.00
20126.	v0lkoff (v0lkoff)	8	101.29	119.61	4	50.00
20127.	Aya (uwub)	8	108.68	117.48	7	87.50
20128.	Prakhar (username_copied)	8	52.73	65.56	2	25.00
20129.	999 WPM (usedarktheme)	8	67.32	77.84	0	0.00
20130.	Daniel (unreal_beam)	8	65.78	72.61	1	12.50
20131.	unpr0gr4mm3d (unpr0gr4mm3d)	8	91.83	101.90	1	12.50
20132.	unnat (unnat)	8	85.55	98.23	2	25.00
20133.	ULUSHA (ulugbek0602)	8	70.17	82.16	2	25.00
20134.	K Sooraj (ultron_ksk)	8	39.98	47.39	0	0.00
20135.	Ultrabooby (ultranooby)	8	125.94	136.62	4	50.00
20136.	Ivan Richard (ugololeivan)	8	58.18	64.31	1	12.50
20137.	⌨️🖱️ (t_0nio)	8	116.53	137.06	8	100.00
20138.	Split keeeeeb (tzbob)	8	112.45	122.74	6	75.00
20139.	Chris (typistgod14)	8	51.38	65.34	3	37.50
20140.	typing pro (typingze)	8	38.53	44.27	2	25.00
20141.	typing (typingmr)	8	82.88	89.13	2	25.00
20142.	bob (typer_bob)	8	100.72	114.41	2	25.00
20143.	bhrigu (typer_21)	8	70.24	80.19	6	75.00
20144.	Tyler (tylermsmith199)	8	89.89	103.12	2	25.00
20145.	TUwU (tuwu)	8	108.84	115.83	1	12.50
20146.	Andrej (tunas1337)	8	104.03	120.00	4	50.00
20147.	Thomas (tszkoda)	8	48.67	52.40	3	37.50
20148.	Grayson (troydenite)	8	86.02	94.62	3	37.50
20149.	tay (trongaus)	8	110.90	121.31	4	50.00
20150.	MIr (triple_mmm)	8	41.62	47.02	0	0.00
20151.	🇵🇸 (' _ゝ') (trickroom)	8	117.94	126.35	3	37.50
20152.	Towbie (towbie)	8	94.34	111.14	3	37.50
20153.	Touhid (touhid23du)	8	45.55	52.03	0	0.00
20154.	Ofek (too_slow_to_go)	8	81.20	88.83	2	25.00
20155.	Toni (tony_playz)	8	79.57	98.36	8	100.00
20156.	Tony (tonyngu)	8	95.59	112.14	1	12.50
20157.	Antonio (tonibudal)	8	50.46	54.72	1	12.50
20158.	TommiTMX (tommitmx)	8	99.43	110.75	5	62.50
20159.	Thomas (tmsopogi)	8	90.28	102.85	3	37.50
20160.	Tahar (tmasmaliyev)	8	35.56	50.80	0	0.00
20161.	tken (tken_tokyo)	8	58.20	66.17	0	0.00
20162.	Tyler (tinss619)	8	85.36	91.65	3	37.50
20163.	Meeper (timelysaucer)	8	97.99	102.20	1	12.50
20164.	Tim (timbob5380)	8	77.20	89.26	4	50.00
20165.	testo (tillman1981)	8	79.42	91.89	3	37.50
20166.	tilko (tilko)	8	97.09	105.31	3	37.50
20167.	Tiberius (tiberiusceter)	8	101.50	121.55	5	62.50
20168.	Joshua (the_rockstar)	8	57.92	61.96	3	37.50
20169.	The (the_phoenix)	8	46.92	52.48	0	0.00
20170.	Sabrina (the_ice_within)	8	119.47	148.60	8	100.00
20171.	perky (theperkiestpotato)	8	87.18	96.22	2	25.00
20172.	ThePCJakub (thepcjakub)	8	103.07	113.63	5	62.50
20173.	Svetlin (thepb)	8	54.35	64.09	1	12.50
20174.	0rz0rz (thenine)	8	99.25	104.58	3	37.50
20175.	­ (thelurkerman)	8	112.37	138.14	2	25.00
20176.	Theo (thelogdude)	8	88.65	98.42	2	25.00
20177.	JJ (thejapie)	8	100.69	107.24	5	62.50
20178.	Michael (thedoctor506)	8	81.16	88.77	1	12.50
20179.	bee (tggb)	8	43.92	46.47	0	0.00
20180.	Nhat Anh (texward)	8	90.77	98.97	5	62.50
20181.	Tor (temyrvang)	8	82.89	89.55	2	25.00
20182.	temmo (temmo)	8	121.23	141.89	4	50.00
20183.	Benjamin (telekinesis)	8	74.05	90.41	5	62.50
20184.	teenpro (teenpro)	8	59.64	76.47	4	50.00
20185.	Ted (tednation)	8	86.88	96.54	1	12.50
20186.	Alex (tec9rushb)	8	80.59	89.70	2	25.00
20187.	Logan (tcalogan)	8	95.31	102.89	5	62.50
20188.	mati (taux)	8	95.85	107.35	4	50.00
20189.	Umair (tastyorange)	8	68.26	83.37	1	12.50
20190.	Tasty (tastytomato)	8	75.97	81.83	5	62.50
20191.	TasteOfCancer (tasteofcancer)	8	91.31	107.65	2	25.00
20192.	Tam (tamlee573)	8	86.99	95.87	2	25.00
20193.	Luis (tallwhitestck)	8	100.13	107.71	7	87.50
20194.	Mikasa (tahabashar11)	8	71.92	86.20	3	37.50
20195.	Tom (tacocatdeboss)	8	100.34	115.50	2	25.00
20196.	swim (swammmy)	8	83.50	100.43	5	62.50
20197.	Swah (swahaha)	8	61.26	76.45	1	12.50
20198.	Ryan (suzerainy)	8	97.62	109.94	2	25.00
20199.	Kachow (suvigya)	8	61.62	70.75	1	12.50
20200.	sussy (sussybaka11)	8	58.97	65.35	0	0.00
20201.	surdyyy (surdyyy)	8	52.21	57.70	1	12.50
20202.	koen (super_stinky)	8	44.20	55.33	1	12.50
20203.	eurobeats (super0)	8	75.66	103.85	1	12.50
20204.	Suigikawa (suigikawa)	8	85.14	95.97	4	50.00
20205.	subhojeet (subho12134)	8	61.59	69.23	0	0.00
20206.	Pui (suaingam)	8	47.57	61.61	0	0.00
20207.	Stuge (stugefin)	8	58.55	64.99	0	0.00
20208.	George (stoptheads)	8	114.25	122.47	4	50.00
20209.	Stephy (stephy2202)	8	74.75	86.71	0	0.00
20210.	stepbrother69 (stepbrother69)	8	101.68	124.57	4	50.00
20211.	Suraj (st1ck14)	8	62.07	70.68	3	37.50
20212.	sszebrat (sszebrat)	8	78.67	92.96	4	50.00
20213.	Sukh Singh (ssothegreat)	8	62.62	77.47	8	100.00
20214.	squirrelslow (squirrelslow)	8	94.47	114.35	2	25.00
20215.	Michael (infinity34)	8	64.92	74.16	5	62.50
20216.	Maximus (sprachzarathustra)	8	96.26	110.52	2	25.00
20217.	Brandon (spookybees)	8	86.26	104.31	3	37.50
20218.	Wayne (spollox)	8	88.37	97.55	3	37.50
20219.	Tim (speedy_neutron)	8	60.53	65.61	1	12.50
20220.	Lul (spammeh)	8	93.96	106.60	3	37.50
20221.	Macaroni (spacial_macaroni)	8	77.25	82.60	1	12.50
20222.	spacebagel (spacebagel)	8	107.50	132.70	3	37.50
20223.	SoupThyme (soupthyme)	8	74.88	88.17	6	75.00
20224.	soufiane (soufianebth)	8	42.05	47.20	4	50.00
20225.	Sophie (sophiebrown6)	8	56.44	62.10	0	0.00
20226.	Redugo (somebodyelse)	8	84.69	99.11	5	62.50
20227.	anonRED (somebody_red)	8	46.49	54.12	1	12.50
20228.	Barry (somalisam)	8	101.19	114.59	4	50.00
20229.	Snek (snekking)	8	89.17	93.85	2	25.00
20230.	Anders (snazzy)	8	76.44	86.72	1	12.50
20231.	SmokR (smokeydbear)	8	89.84	105.39	1	12.50
20232.	Shane (smokedbread)	8	68.37	77.59	4	50.00
20233.	Nafeez (smileywee)	8	84.62	97.21	4	50.00
20234.	kaydence (smhkaydence)	8	45.66	51.97	1	12.50
20235.	Mel (smelons)	8	104.67	117.57	0	0.00
20236.	Slow (slow_keyboard)	8	53.61	61.35	1	12.50
20237.	I am speed (slowhand18)	8	95.16	111.07	4	50.00
20238.	Sam (slimwhit)	8	63.63	66.68	1	12.50
20239.	Karthik (slickfalcon)	8	63.74	71.56	3	37.50
20240.	Edwin (skitargduva)	8	66.46	77.75	1	12.50
20241.	Skillet (skillet18)	8	125.21	136.42	7	87.50
20242.	Nhan (skhylines)	8	85.53	109.55	3	37.50
20243.	SJ (sjmoon110718)	8	47.72	55.17	0	0.00
20244.	Sir (sirnoodles05)	8	93.23	103.52	2	25.00
20245.	Gal (sirdouchebag)	8	73.56	92.70	0	0.00
20246.	Sinan (sinan)	8	121.62	148.27	4	50.00
20247.	Pedro (simplypedro)	8	76.24	90.72	3	37.50
20248.	Simas (simgint)	8	77.42	88.72	3	37.50
20249.	Josh (shwahhh)	8	111.83	122.70	4	50.00
20250.	Shub (shubhamgoel352)	8	69.30	75.60	1	12.50
20251.	Denny (shizkr)	8	86.42	98.56	4	50.00
20252.	Rey x MountainStride (shinr...	8	83.03	95.82	0	0.00
20253.	Mubarak (sgtcuredpanda)	8	48.86	52.03	0	0.00
20254.	クローエ (seyasoya)	8	84.33	92.63	2	25.00
20255.	Seth (sethbangerter)	8	115.42	127.14	2	25.00
20256.	Serji (serji)	8	57.40	65.22	2	25.00
20257.	Senseiparks (senseiparks)	8	100.67	111.55	3	37.50
20258.	kayla (senlin)	8	72.35	86.69	5	62.50
20259.	senara (senara124)	8	91.99	100.10	3	37.50
20260.	George (sellers1234)	8	63.87	70.09	1	12.50
20261.	seb (sebbbbbbb)	8	82.05	92.54	3	37.50
20262.	Bastian (sebastianovoam)	8	71.87	77.67	2	25.00
20263.	Shane (sdoyle4499)	8	64.68	78.52	1	12.50
20264.	Scorbutsale (scorbutsale)	8	78.13	85.23	1	12.50
20265.	BoiledAir7 (sawt)	8	79.91	90.67	0	0.00
20266.	Sagar (saucy_d)	8	70.30	80.95	3	37.50
20267.	Sarvottam (sarvottampriyada...	8	95.94	112.10	1	12.50
20268.	Sarah (sara_g)	8	124.44	132.05	7	87.50
20269.	Sara (sarasmile)	8	30.78	45.61	2	25.00
20270.	Santiago (santpp85)	8	31.17	35.22	0	0.00
20271.	Santosh (santoshm33)	8	58.00	68.89	2	25.00
20272.	Sander (sander5151)	8	86.15	93.40	2	25.00
20273.	(samuraipie)	8	122.12	144.36	5	62.50
20274.	Sam (samschreibt)	8	100.18	112.68	4	50.00
20275.	Sami (samihasaspine)	8	102.43	123.84	3	37.50
20276.	Patrick (saboe)	8	71.99	82.65	3	37.50
20277.	اعجاذ حسين (s183ds...	8	61.89	70.76	2	25.00
20278.	Ryley (r_sand11)	8	48.61	63.35	0	0.00
20279.	Ryan (ryanmc99)	8	112.00	125.67	3	37.50
20280.	Aditya (rust_eze)	8	54.36	67.70	1	12.50
20281.	ABtech19 (rushildhar)	8	40.30	44.99	4	50.00
20282.	Rushil (rushil13579)	8	68.89	83.54	2	25.00
20283.	Joe (rufu)	8	131.46	158.41	7	87.50
20284.	Ruben (rubennijhuis)	8	64.25	98.57	2	25.00
20285.	RSCArne (rscarne)	8	68.68	81.69	2	25.00
20286.	roywastaken (roywastaken)	8	37.25	41.76	1	12.50
20287.	Rotem (rotemsela)	8	102.55	124.70	4	50.00
20288.	xRoshx (roshdip)	8	60.51	68.25	2	25.00
20289.	Ron (ron107)	8	31.25	40.21	0	0.00
20290.	Romin (rominpasa)	8	63.18	70.54	1	12.50
20291.	Yessir (romans828)	8	111.10	136.56	3	37.50
20292.	Viki (roastedice)	8	99.94	121.66	6	75.00
20293.	6fingers (rktspcr)	8	72.87	89.26	2	25.00
20294.	Sadia (riyan_sadia)	8	54.90	64.09	0	0.00
20295.	RISE (riseee)	8	57.16	73.20	1	12.50
20296.	rickythedino (rickythedino)	8	96.12	115.32	3	37.50
20297.	Ricky (rickyb663)	8	89.70	100.14	5	62.50
20298.	garry (richgarry)	8	82.12	100.81	4	50.00
20299.	★ d (retronub)	8	125.87	145.37	5	62.50
20300.	Islam ❤ (respectedfeeds)	8	102.54	107.54	3	37.50
20301.	Yangyang (renasceim)	8	78.77	87.42	2	25.00
20302.	Josh (remember000this)	8	80.44	87.38	1	12.50
20303.	Reed (reedhaffner)	8	99.63	114.12	2	25.00
20304.	Brendo (rebelx)	8	75.01	82.25	0	0.00
20305.	real (realscav)	8	111.64	125.61	4	50.00
20306.	Roman (rdprice)	8	84.13	95.19	3	37.50
20307.	Mikey (rctyogo)	8	72.38	77.07	0	0.00
20308.	Heem (rayhim)	8	58.87	64.19	2	25.00
20309.	pogron (rawhnald)	8	97.90	113.05	3	37.50
20310.	Ian (raveian)	8	49.00	58.79	1	12.50
20311.	Rall (raullll)	8	84.73	97.68	2	25.00
20312.	Jefferson (rasmus06)	8	109.13	127.46	4	50.00
20313.	too_slow (rakki7)	8	76.82	83.32	2	25.00
20314.	Prathamesh (rajputprathames...	8	56.46	62.47	3	37.50
20315.	rai_10101 (rai_10101)	8	81.62	101.30	5	62.50
20316.	Ayuxh (raix29)	8	41.40	45.76	2	25.00
20317.	rainmaker (rainmaker6)	8	62.72	70.53	0	0.00
20318.	Fred (raijinpanda)	8	103.88	114.91	5	62.50
20319.	Quang (quanglc00)	8	52.92	56.00	4	50.00
20320.	Pieter (pvanuffelen)	8	66.70	78.27	3	37.50
20321.	Angela (purplehalo3)	8	81.63	93.81	0	0.00
20322.	Dave (punskilled)	8	117.34	128.92	3	37.50
20323.	Jedidiah (puisanberg)	8	102.08	116.63	8	100.00
20324.	Puffone (puffone)	8	28.18	32.27	2	25.00
20325.	sc4x (pucymae)	8	84.33	93.67	2	25.00
20326.	Ben (pro_benny)	8	90.55	106.89	1	12.50
20327.	blue (primaryblu)	8	125.52	158.22	2	25.00
20328.	Connor (pressurr)	8	94.56	103.15	2	25.00
20329.	PRANJAL (pranjalgogoi1999)	8	51.13	56.26	0	0.00
20330.	Jeremy (potrainer)	8	102.66	123.84	3	37.50
20331.	potato_pig12 (potato_pig12)	8	106.74	118.89	6	75.00
20332.	potato0329 (potato0329)	8	66.25	70.44	5	62.50
20333.	Eric (potatcs)	8	84.71	99.01	4	50.00
20334.	PossiblyRandom (possiblyran...	8	104.68	118.50	4	50.00
20335.	Porsit (porsit)	8	68.33	83.04	2	25.00
20336.	Dai ca (porrydeptrai)	8	62.73	83.67	7	87.50
20337.	. (popdon990)	8	70.16	85.74	3	37.50
20338.	Poopy4757 (poopy4757)	8	56.74	69.62	1	12.50
20339.	Kom (poobscoob)	8	95.78	113.51	2	25.00
20340.	Polyatomic (polyatomic)	8	113.14	126.18	6	75.00
20341.	Sid (pokecrater1)	8	99.76	108.81	3	37.50
20342.	Lee (pohsien)	8	30.64	39.85	0	0.00
20343.	podlesk (podlesk)	8	64.29	74.83	2	25.00
20344.	Patrick (pmurfdesign)	8	54.68	61.91	0	0.00
20345.	Mads (planntt)	8	53.54	59.53	2	25.00
20346.	Patrick (pjawesomegaming)	8	80.20	104.78	4	50.00
20347.	Sciencio (pinkdiam0nd)	8	72.11	84.67	0	0.00
20348.	Jonas (piglin)	8	67.36	76.75	2	25.00
20349.	Goal: 70wpm average (pietpo...	8	28.01	31.29	0	0.00
20350.	Pichu (pichu_pals)	8	76.45	89.63	8	100.00
20351.	Tim (phuc131)	8	71.96	80.07	0	0.00
20352.	Philip (philiplu7777)	8	98.92	109.62	2	25.00
20353.	Joseph (phantom5k)	8	75.83	82.85	4	50.00
20354.	Patrik (pgdth)	8	62.88	70.45	3	37.50
20355.	fastfingas (petryk21)	8	80.09	91.38	0	0.00
20356.	Petit (petitjuju)	8	104.89	126.64	3	37.50
20357.	alex (peopel)	8	69.89	78.43	0	0.00
20358.	Kaleb (penguinunreal)	8	85.57	90.64	3	37.50
20359.	black google (peeperin)	8	83.94	105.64	3	37.50
20360.	paul (peazie)	8	114.22	122.24	5	62.50
20361.	lit (paul615)	8	57.56	64.58	2	25.00
20362.	patembe (patembe)	8	72.29	82.45	4	50.00
20363.	Brandon (pastaneko)	8	87.24	95.54	1	12.50
20364.	Adem (paramone)	8	89.33	102.20	5	62.50
20365.	Paper (paperstache)	8	84.57	89.97	1	12.50
20366.	Zephaniah (pandu11)	8	79.01	92.13	5	62.50
20367.	Palta (palta_hass05)	8	70.38	79.93	1	12.50
20368.	Andy (paingle)	8	93.73	104.79	3	37.50
20369.	Stelios (paff)	8	103.14	126.46	3	37.50
20370.	Speedo (pacmaniac)	8	68.19	76.34	2	25.00
20371.	Bill (p0werc0rd0fjustice)	8	83.21	97.00	2	25.00
20372.	Barbo (o_mon)	8	117.98	132.50	4	50.00
20373.	Ozark (ozarkian)	8	117.78	137.75	7	87.50
20374.	Chelsea (oxfordkarma)	8	74.69	84.46	4	50.00
20375.	Rick (outrunwolf)	8	82.47	86.41	0	0.00
20376.	ONRAGE (onrage)	8	94.12	103.51	2	25.00
20377.	onel (onel11)	8	76.54	88.84	2	25.00
20378.	omajez (omajez)	8	71.84	86.98	5	62.50
20379.	𝖔𝖑𝖎𝖜𝖆𝖗�...	8	121.79	139.65	6	75.00
20380.	Okhelloandhi (okhelloandhi)	8	61.96	73.06	2	25.00
20381.	rai (ohrai)	8	103.51	128.91	8	100.00
20382.	ohad (ohad8353)	8	64.12	82.33	3	37.50
20383.	OG3G (og3g)	8	76.12	91.46	0	0.00
20384.	Sophia (officialsophiagarman)	8	69.50	72.49	2	25.00
20385.	sul (ofb_hunted)	8	42.46	46.61	0	0.00
20386.	Arshad (o0arshad0o)	8	46.25	50.76	0	0.00
20387.	Kucing (nyandesuyo)	8	56.43	67.79	1	12.50
20388.	Hugo (nuvions)	8	54.78	61.70	0	0.00
20389.	NukeADS (nukeads101)	8	26.06	31.23	0	0.00
20390.	Shanks (nuggetxd)	8	102.13	118.68	4	50.00
20391.	Noz (nozz)	8	119.78	132.19	7	87.50
20392.	nousmh (nousmh)	8	91.76	106.29	3	37.50
20393.	namie (notyournamie)	8	57.99	64.04	1	12.50
20394.	SchizoKami (notaniki)	8	74.90	80.70	2	25.00
20395.	Jorden (nostera)	8	65.59	71.12	1	12.50
20396.	Henry (noodles10)	8	77.28	90.74	2	25.00
20397.	Noah (noahboa1234)	8	71.99	82.40	2	25.00
20398.	Nneeku (nneeku)	8	80.86	95.55	2	25.00
20399.	b1shop (nnebsi)	8	67.13	80.40	1	12.50
20400.	nitro (nitrocircus)	8	62.39	71.19	2	25.00
20401.	H (nin9zer0)	8	55.73	63.56	1	12.50
20402.	Viktor (niktor76)	8	45.31	53.59	1	12.50
20403.	Niko (nikolearnstotype)	8	102.22	123.40	4	50.00
20404.	Late (nikolaholmes)	8	77.44	88.48	1	12.50
20405.	nikita (nikitapelagecha)	8	74.45	87.92	4	50.00
20406.	Niheee (niheee)	8	91.01	108.38	8	100.00
20407.	♛ Nick...	8	103.98	118.18	3	37.50
20408.	Phuc (nhphucqt)	8	60.94	67.42	2	25.00
20409.	Nerret (nerr3t)	8	58.50	67.27	4	50.00
20410.	NeoX (neoxbit)	8	72.43	84.81	0	0.00
20411.	Rowan (neonowlbar)	8	60.54	66.98	2	25.00
20412.	Bendegúz (negyzetracs)	8	40.87	50.07	1	12.50
20413.	Adam (nefrepitou)	8	71.21	80.53	6	75.00
20414.	Cin_min (needs_alife)	8	74.40	81.97	1	12.50
20415.	Hoo (navvvz)	8	82.88	100.38	2	25.00
20416.	nathan (nathanfrenzel)	8	104.14	123.72	5	62.50
20417.	Matheus (narrogai)	8	57.81	65.51	4	50.00
20418.	Narix (narix)	8	88.50	98.33	4	50.00
20419.	nailfc (nailfc)	8	75.86	80.54	3	37.50
20420.	Nadia (nadiapun)	8	46.78	57.72	1	12.50
20421.	Nacho (nachofry)	8	113.98	127.86	4	50.00
20422.	Vuh (n00bmaster_69_)	8	61.24	66.70	0	0.00
20423.	Kevin (mystified)	8	92.27	106.94	3	37.50
20424.	draven (mutable)	8	111.26	127.88	4	50.00
20425.	Jasmine (mustardsucks)	8	113.63	140.10	4	50.00
20426.	mushi (musfiq)	8	61.40	68.23	1	12.50
20427.	Leo (murkymurky)	8	83.85	89.13	3	37.50
20428.	Munta (munta)	8	59.55	73.23	2	25.00
20429.	Mukhamejan (mukhamejan)	8	48.86	54.17	1	12.50
20430.	Marios (mr_kk13)	8	61.83	70.13	4	50.00
20431.	Iboo (mriboo)	8	90.64	104.50	2	25.00
20432.	Cayke (mrcayke)	8	89.71	99.22	1	12.50
20433.	Bara (mrbobby)	8	104.67	125.01	3	37.50
20434.	Extreme Bass Tester (mrbass...	8	96.44	110.99	5	62.50
20435.	Trevor (mouspe)	8	68.83	83.37	2	25.00
20436.	Ike (mouseandkeyboard)	8	97.81	104.87	2	25.00
20437.	Motan (motanrobert)	8	52.07	63.52	1	12.50
20438.	Mostafa (mostafadelgouda)	8	60.16	69.22	4	50.00
20439.	K (mosspath16)	8	97.13	111.19	6	75.00
20440.	Koneko (moon_l1ght)	8	65.20	73.77	2	25.00
20441.	Petr (monsterkick123)	8	70.18	78.54	2	25.00
20442.	Dan (monkyman12)	8	76.73	88.56	2	25.00
20443.	Moogii (mongoljan)	8	70.27	72.70	0	0.00
20444.	Shiyue (molllllllly)	8	54.78	62.52	2	25.00
20445.	Nikita (mohwai)	8	73.12	86.14	2	25.00
20446.	محمد (mohammed_mourad)	8	36.03	43.63	0	0.00
20447.	Foxes (moazkhaled)	8	51.78	54.48	1	12.50
20448.	Mo (moahmed0987)	8	65.36	77.42	8	100.00
20449.	Brandon (mo0nfire)	8	69.18	80.56	0	0.00
20450.	Matthew (mmcjoynt)	8	84.86	99.79	4	50.00
20451.	Miro7543 (miro7543)	8	47.54	56.35	1	12.50
20452.	Mindjolt (mindjolt)	8	93.39	105.49	2	25.00
20453.	Mik (miks1)	8	92.30	111.71	3	37.50
20454.	Mike (mikethompsontech)	8	98.59	106.99	4	50.00
20455.	at my own pace (mijacim)	8	129.22	153.46	5	62.50
20456.	Midas Gold (midasgold)	8	99.73	131.65	5	62.50
20457.	Michael (michaelskyba)	8	135.44	149.16	3	37.50
20458.	Michael (michaelshahin2)	8	124.34	159.15	5	62.50
20459.	fynn (metallicbow)	8	65.20	73.53	2	25.00
20460.	Stanislaw (mestreponas)	8	93.89	100.08	1	12.50
20461.	Meppou (meppou)	8	82.55	96.10	3	37.50
20462.	Mendyng (mendyng)	8	73.52	85.40	3	37.50
20463.	A (melori)	8	49.47	62.82	1	12.50
20464.	Melvin (mellikyun)	8	89.72	100.67	1	12.50
20465.	mason (meezusxd)	8	82.14	92.61	2	25.00
20466.	Subahan (mdsubahan)	8	28.89	33.99	2	25.00
20467.	uwu (mdby_enn)	8	68.49	76.33	1	12.50
20468.	jumpingjilligan (maxy97322)	8	80.81	101.56	4	50.00
20469.	Max (maxstacks)	8	43.02	48.25	2	25.00
20470.	Max (maxlau09)	8	100.16	104.42	5	62.50
20471.	Mathias (mathi2912)	8	93.20	102.10	3	37.50
20472.	mathan (mathanha)	8	111.81	133.04	6	75.00
20473.	Marco (marquouo)	8	63.36	69.56	2	25.00
20474.	Cream (marom)	8	63.83	78.03	4	50.00
20475.	Tiffany (mangles)	8	82.40	94.09	1	12.50
20476.	Josue (mangalarge)	8	56.75	73.75	1	12.50
20477.	Mohammed (manchi)	8	47.98	53.35	0	0.00
20478.	Maxim (malincik)	8	66.70	74.99	5	62.50
20479.	Mikhail (maklaya)	8	105.23	117.24	6	75.00
20480.	marvin (magnimarve)	8	125.98	147.93	3	37.50
20481.	maestro (maestro2048)	8	62.29	69.90	3	37.50
20482.	Hina (lyraxh)	8	80.48	92.54	2	25.00
20483.	LULU (luluthecow)	8	101.55	119.44	5	62.50
20484.	Luke (lukejr0123)	8	61.73	70.77	3	37.50
20485.	Luisovc1812 (luisovc1812)	8	59.57	70.10	0	0.00
20486.	Luin (luingear)	8	66.64	78.72	1	12.50
20487.	Jacob (lugia1572)	8	65.90	72.20	1	12.50
20488.	Tachanka (lordtachankatm)	8	102.66	112.19	5	62.50
20489.	Guest (lolteamtroll)	8	59.76	70.84	4	50.00
20490.	Lachlan (lochstar)	8	51.42	57.58	2	25.00
20491.	ellyboycott (localhinatakin...	8	105.16	120.81	4	50.00
20492.	liu (liuluil)	8	105.15	114.58	6	75.00
20493.	Andrew (littlefleece)	8	108.81	120.14	8	100.00
20494.	Litevex (litevvx)	8	133.00	150.02	5	62.50
20495.	nic (limpehordlo)	8	98.97	110.58	3	37.50
20496.	limdaepicpber (limdaepicpber)	8	59.56	67.50	4	50.00
20497.	Erdnaxela (lil_toogood)	8	52.34	62.00	2	25.00
20498.	LilTexan (lil_texan)	8	79.07	85.81	3	37.50
20499.	Cameron (lilcamwin)	8	46.69	54.35	0	0.00
20500.	Liko (likofortino)	8	62.75	75.78	5	62.50
20501.	Sam An (liasss)	8	47.43	53.44	0	0.00
20502.	Fabian (lgtrushzhm)	8	113.78	130.38	4	50.00
20503.	Le' (letyper_)	8	72.68	84.41	2	25.00
20504.	NIcola (lenh)	8	84.27	92.20	2	25.00
20505.	Itsbuddy⌨ (legendarybeast...	8	35.70	45.72	1	12.50
20506.	Lefos (lefos357)	8	44.79	49.90	1	12.50
20507.	Dvorak (learningdvorak101)	8	67.47	72.03	2	25.00
20508.	Laz (lazzo)	8	71.21	79.05	1	12.50
20509.	randint (lawlombie)	8	92.18	103.20	4	50.00
20510.	nina (lavendee)	8	94.14	98.09	3	37.50
20511.	Laurence (laurencee_desu)	8	80.52	89.34	1	12.50
20512.	Jackie (laserelite)	8	115.51	126.20	6	75.00
20513.	laobiz (laobiz)	8	88.38	103.29	5	62.50
20514.	La (lanumu)	8	78.62	97.21	4	50.00
20515.	Malcolm (lampshadess)	8	82.13	91.82	4	50.00
20516.	Slow Typist (lammian)	8	98.54	105.07	1	12.50
20517.	IckyPixel (kyoneoran)	8	70.18	88.59	4	50.00
20518.	Pro (kvis)	8	55.97	60.53	1	12.50
20519.	KJ (kushagra_j)	8	55.64	73.52	1	12.50
20520.	Kurt (kurtv13)	8	80.49	87.66	1	12.50
20521.	kati (ktiisler)	8	52.41	59.32	3	37.50
20522.	Rohit (krullun)	8	59.45	64.83	0	0.00
20523.	kristjon (kristjon)	8	77.13	81.04	0	0.00
20524.	idkhi (krisstesink)	8	74.61	83.99	8	100.00
20525.	Krishan Pal (kris987)	8	47.06	52.15	1	12.50
20526.	Sandpiper (krafty)	8	113.35	130.01	6	75.00
20527.	котакбассик (kot...	8	99.44	113.18	8	100.00
20528.	klima7 (klima7)	8	82.65	91.23	1	12.50
20529.	Jon (kixoidiot)	8	49.41	59.15	1	12.50
20530.	kingcabrams (kingcabrams)	8	103.60	106.82	2	25.00
20531.	kimi (kimboli)	8	86.78	116.64	7	87.50
20532.	kie (kieret25)	8	95.57	108.13	4	50.00
20533.	Christian (kickstyping4thewin)	8	80.33	89.03	3	37.50
20534.	khye (khyelerk)	8	100.82	129.55	3	37.50
20535.	khem (khemsadon)	8	69.52	76.49	3	37.50
20536.	khadie (khadiekun)	8	77.81	90.53	4	50.00
20537.	Khabibkhanov (khabibkhanov)	8	43.93	48.86	1	12.50
20538.	Kushagra (kgtypes)	8	72.93	84.36	2	25.00
20539.	kev2k (kev2k)	8	92.99	110.05	4	50.00
20540.	Kenny (kenjeo)	8	103.30	116.46	3	37.50
20541.	Keigo (keigo_yoshiura)	8	73.16	81.53	2	25.00
20542.	KC (kc2002)	8	95.29	107.30	2	25.00
20543.	Katie (katielemaster)	8	79.54	96.49	2	25.00
20544.	Katie (kat41911)	8	106.23	117.39	7	87.50
20545.	🍁 (kaspars)	8	105.85	120.86	4	50.00
20546.	ryan jason (kapsutka)	8	45.12	53.59	0	0.00
20547.	Jonathan (kamikazecupcake)	8	99.70	111.58	4	50.00
20548.	kalvin (kalvin2171)	8	40.33	54.57	0	0.00
20549.	Daniel (kald3s)	8	93.66	109.88	5	62.50
20550.	holymoly (kajohnny)	8	104.91	112.68	5	62.50
20551.	abdul (kaium55)	8	49.53	71.85	1	12.50
20552.	Kaijou (kaijou)	8	72.01	87.79	6	75.00
20553.	skrtskrt (kad832000)	8	103.08	116.94	6	75.00
20554.	khai (kaariee)	8	82.20	97.57	4	50.00
20555.	Jayshil (just_chillll)	8	49.21	54.26	1	12.50
20556.	Jurre (jurrevonk)	8	101.42	131.85	6	75.00
20557.	Josh (jshearer34)	8	62.72	72.81	1	12.50
20558.	Jorge (jquiroz728)	8	78.19	89.73	2	25.00
20559.	jpow (jpowwow)	8	82.73	97.24	3	37.50
20560.	Jacob (jpoopy)	8	100.41	108.05	4	50.00
20561.	Jimmy (jphan98)	8	104.69	120.40	2	25.00
20562.	sakuraphael (joseraphael)	8	67.21	85.28	2	25.00
20563.	Jorunn (jorunn)	8	109.60	115.92	5	62.50
20564.	JJ (joojoob1004)	8	104.57	121.30	4	50.00
20565.	victor (jontakenols)	8	69.52	89.51	0	0.00
20566.	jonathanirvings (jonathanir...	8	104.49	124.52	2	25.00
20567.	Gjon (johnmanga)	8	78.52	84.30	1	12.50
20568.	J0hn (johnjonez23)	8	100.21	107.31	2	25.00
20569.	Jomama (johanwashere)	8	110.66	123.18	4	50.00
20570.	Johannes (jogameshd)	8	82.26	97.47	2	25.00
20571.	Joesph (joecool3)	8	62.89	74.02	1	12.50
20572.	Jake (jmp2814)	8	77.82	87.63	1	12.50
20573.	jf (jkkl)	8	102.15	122.61	4	50.00
20574.	jawad (jiqlsh)	8	50.46	58.64	1	12.50
20575.	jip (jipgg)	8	37.05	42.94	0	0.00
20576.	Azriel (jing_long)	8	47.65	54.03	1	12.50
20577.	guan (jgbiggy96)	8	88.71	98.10	2	25.00
20578.	Joe (jfratello)	8	82.21	100.09	3	37.50
20579.	Yulia (jewels04)	8	36.17	39.76	0	0.00
20580.	Jerry (jernjej)	8	82.36	91.01	3	37.50
20581.	Jedwidz (jedwidz)	8	101.81	113.07	4	50.00
20582.	Jayden (jay62)	8	85.14	101.12	5	62.50
20583.	Jason (jasonledrika)	8	102.50	119.94	4	50.00
20584.	Andrew (jargazes)	8	108.56	115.49	5	62.50
20585.	JJ (japie4life)	8	106.05	124.82	5	62.50
20586.	James (jamvng)	8	127.42	137.77	3	37.50
20587.	J (jakobam)	8	132.40	144.90	6	75.00
20588.	JackSparrow (jack__sparrow)	8	66.62	74.43	0	0.00
20589.	Jack (jacktypeman)	8	68.00	79.52	4	50.00
20590.	Jack (jackthehuman)	8	88.73	92.75	4	50.00
20591.	EddyEndo (jackpoteddie)	8	56.04	63.51	1	12.50
20592.	jackn11 (jackn11)	8	94.30	103.88	2	25.00
20593.	Sonny (j3dmosly)	8	90.09	94.74	1	12.50
20594.	Jeff (i_bad)	8	40.31	47.83	0	0.00
20595.	Elizabeth (i_am_piece_of_tr...	8	54.52	62.50	2	25.00
20596.	iwannabebee (iwannabebee)	8	16.65	21.56	1	12.50
20597.	honey (ivan_avr)	8	90.03	103.01	4	50.00
20598.	BadAtTyping (itzsecretive)	8	83.28	91.09	2	25.00
20599.	Khushal (its_warhead)	8	52.79	59.54	1	12.50
20600.	forg (itsmetimwastaken)	8	114.75	129.57	5	62.50
20601.	Average (isuckattypoing)	8	64.88	69.93	5	62.50
20602.	Tobias (iseeicetea)	8	44.35	54.29	0	0.00
20603.	Incognito (im_incognito)	8	83.29	92.95	2	25.00
20604.	David (imdaveed)	8	51.57	59.76	1	12.50
20605.	ilyassq (illiazo)	8	60.13	71.24	2	25.00
20606.	Illayne (illayne)	8	71.47	89.95	0	0.00
20607.	Zudio (ildosrel)	8	83.08	90.09	3	37.50
20608.	Kennie (ikentalk)	8	50.91	59.56	3	37.50
20609.	Shut (ihavekillaura)	8	113.45	123.58	6	75.00
20610.	oshan (ice_cold)	8	73.99	83.66	1	12.50
20611.	glizzy (icecreamgoblin)	8	99.05	121.51	7	87.50
20612.	Ibrokhimjon (ibrokhimjon23)	8	30.67	35.55	2	25.00
20613.	Ivan (iamiam)	8	78.83	84.94	0	0.00
20614.	Daniel (hylianwarrior)	8	111.50	142.52	8	100.00
20615.	Hydrix (hydrix03)	8	71.03	79.63	2	25.00
20616.	Khanh Hung (hungnkuon)	8	86.45	96.57	2	25.00
20617.	Teddy (hulksgreenass)	8	109.47	117.17	6	75.00
20618.	Hermogenes (hrivas)	8	41.88	52.28	0	0.00
20619.	chubby (hoocub)	8	36.55	45.60	1	12.50
20620.	Rionil (holyshock)	8	104.38	134.83	5	62.50
20621.	HoldShift (holdshift)	8	69.46	80.32	1	12.50
20622.	AAAAAAAAAAAAAAAAAAAAAAAAAAA...	8	84.50	92.14	4	50.00
20623.	AZNDAD (hmoth84)	8	94.32	104.22	0	0.00
20624.	Hjalte (hjaltebuch)	8	89.97	107.50	4	50.00
20625.	Hit360D (hit360d)	8	57.45	73.98	5	62.50
20626.	Mari (hisokaslave)	8	78.64	96.98	0	0.00
20627.	Anshul (hindu_123)	8	84.18	92.18	4	50.00
20628.	henry 🎩 (henzolo)	8	104.03	110.87	3	37.50
20629.	Heaven (heavenx)	8	74.17	82.09	4	50.00
20630.	Lan (heatblaze)	8	93.44	103.61	3	37.50
20631.	Haven (havenjd)	8	85.82	98.84	4	50.00
20632.	Mufassir (hashtag_pro)	8	63.32	72.68	0	0.00
20633.	Roy (harlos9090)	8	66.17	72.42	2	25.00
20634.	coc (han_duo)	8	92.08	111.52	3	37.50
20635.	2Lenne (hannaloresa)	8	67.63	75.08	3	37.50
20636.	HamsterSales (hamstersales)	8	75.01	88.02	2	25.00
20637.	Khai (haikhaiphan)	8	70.14	79.99	2	25.00
20638.	han (hahhan)	8	23.36	26.23	1	12.50
20639.	Hashmia (haaashmiah)	8	56.10	67.50	3	37.50
20640.	Nicolas (ha27)	8	80.02	84.55	4	50.00
20641.	Yifan (gyyy1995)	8	70.98	80.34	3	37.50
20642.	:Talpiie (gwaporosh)	8	73.41	87.51	3	37.50
20643.	Gusklipsch (gusklipsch)	8	54.41	58.33	0	0.00
20644.	gurzil (gurzil)	8	63.15	72.90	0	0.00
20645.	Dan (gunpowdergolem)	8	95.64	103.75	7	87.50
20646.	gunga (gungafarts)	8	79.98	87.75	1	12.50
20647.	guy (guius)	8	80.56	85.80	4	50.00
20648.	La (guinea_peeg_1234)	8	93.10	99.65	1	12.50
20649.	guid (guid07)	8	74.73	95.01	5	62.50
20650.	grantgoosten (grantgoosten22)	8	82.60	93.78	2	25.00
20651.	Marko (gragole)	8	94.68	104.44	1	12.50
20652.	grac (gracthegrac)	8	63.00	77.21	4	50.00
20653.	Yellow (gracet_b)	8	49.50	57.33	1	12.50
20654.	Eddie (goombah1)	8	107.83	112.88	4	50.00
20655.	dheeraj (goldsnort)	8	68.63	75.03	4	50.00
20656.	Leloush (goal9871231st)	8	36.01	41.57	2	25.00
20657.	glip (glip014)	8	91.73	102.52	3	37.50
20658.	Jack (ginganinjajack)	8	115.15	120.57	4	50.00
20659.	Connor Gil (gillionayre)	8	57.35	64.39	2	25.00
20660.	Giich (giich)	8	88.95	96.60	2	25.00
20661.	Judah (ghostboyjude)	8	48.85	56.79	1	12.50
20662.	Bonne (ggraznpv)	8	28.30	30.09	1	12.50
20663.	Jaden (ggjaden)	8	75.01	88.57	1	12.50
20664.	Geo (geojumper)	8	67.12	72.43	2	25.00
20665.	Ray (gelastical)	8	85.37	95.68	2	25.00
20666.	Artemida (gayswordfish)	8	87.80	104.77	3	37.50
20667.	Gareth (gathlic)	8	57.85	66.68	4	50.00
20668.	Garfield (garfield_fluff_jr)	8	78.18	83.92	1	12.50
20669.	gamer (gamer_2002)	8	31.91	37.37	0	0.00
20670.	Gabryel John (gabryeljison)	8	67.81	81.97	4	50.00
20671.	Kevin (fvnction)	8	73.47	89.17	2	25.00
20672.	Poop_57 (fuzzydestroyer)	8	55.25	72.68	2	25.00
20673.	fuzzed (fuzionite)	8	91.35	116.92	5	62.50
20674.	Kenneth (furball728)	8	110.01	122.91	3	37.50
20675.	Ronald (funnyturtles)	8	54.76	59.50	3	37.50
20676.	f (fulmerformal)	8	101.12	109.90	4	50.00
20677.	fuadul (fuadul)	8	38.73	42.20	2	25.00
20678.	FruityCigar (fruitycigar)	8	60.22	71.49	3	37.50
20679.	Frozen_Robot (frozen_robot)	8	80.27	90.84	1	12.50
20680.	Determined (frosty_flame)	8	94.62	99.82	2	25.00
20681.	Freshanatha (freshanatha)	8	61.92	68.83	4	50.00
20682.	Fran (frannyg)	8	46.76	60.90	1	12.50
20683.	rose (fr0gspawnn)	8	108.87	115.68	2	25.00
20684.	Fowwer (fowwer)	8	78.34	96.78	2	25.00
20685.	Foofmeister (foofmeister)	8	117.45	137.42	3	37.50
20686.	Cole (fluke1890)	8	80.68	89.23	1	12.50
20687.	flora (flora1111)	8	123.70	144.91	6	75.00
20688.	Elvis (flareblu_workman)	8	67.40	81.95	3	37.50
20689.	bigdad (fillmeupdaddy)	8	81.90	89.99	2	25.00
20690.	El Psy Kongroo (fiive_starboy)	8	67.42	91.53	3	37.50
20691.	fffd (fffd)	8	82.89	98.33	5	62.50
20692.	Ferris (ferrisprimanugraha)	8	88.49	94.87	4	50.00
20693.	Fernando (fedevegili)	8	102.17	115.14	5	62.50
20694.	Feakl (feakl)	8	41.73	51.64	1	12.50
20695.	Diego (faustian_nero)	8	55.09	61.86	0	0.00
20696.	FastTypist448 (fast_typist448)	8	57.00	67.21	2	25.00
20697.	Aminul (fardin1bd)	8	55.85	63.03	0	0.00
20698.	Austin (fallow64)	8	107.29	124.23	4	50.00
20699.	Regent (fagol)	8	74.03	86.91	3	37.50
20700.	Danial (fadyboi)	8	87.24	92.22	3	37.50
20701.	ChiBai (f0rg0tten)	8	68.55	87.19	1	12.50
20702.	Eyal (eyalnir7)	8	58.54	72.15	4	50.00
20703.	e (evzh)	8	35.01	42.05	0	0.00
20704.	Morgan (evirabbi)	8	100.53	115.46	1	12.50
20705.	Sidewalk (euantis)	8	77.05	87.09	3	37.50
20706.	Evan (etiger)	8	66.09	77.21	0	0.00
20707.	Eternal (eternai)	8	84.47	125.48	3	37.50
20708.	Erna (ernasolberg69)	8	80.55	96.66	0	0.00
20709.	Erik (eriklvalentin)	8	97.31	111.27	3	37.50
20710.	bruh (erik2405_)	8	104.92	115.21	6	75.00
20711.	Epsile (epsilian)	8	124.83	149.06	7	87.50
20712.	Owen (epic_own_gamer)	8	69.57	78.08	2	25.00
20713.	Enamul (enamul)	8	32.31	38.06	2	25.00
20714.	Elrohir (elrohirtypo)	8	71.28	78.21	0	0.00
20715.	ellowell (ellowell)	8	125.79	150.31	4	50.00
20716.	Elius H Himel (eliushhimel)	8	45.91	52.79	0	0.00
20717.	Adridri (eidorian)	8	83.07	133.33	4	50.00
20718.	Eric (ehshark)	8	108.49	120.03	5	62.50
20719.	mrspaghettimeatballs (ehreg...	8	84.00	91.23	2	25.00
20720.	Snowbear (ehj1258)	8	90.27	103.86	3	37.50
20721.	edward (edwardkarra)	8	47.70	66.00	5	62.50
20722.	Ed (ed2005)	8	65.40	74.19	2	25.00
20723.	Fee (dylanfee)	8	127.42	137.84	5	62.50
20724.	Isa (dxnamic_)	8	70.23	78.77	1	12.50
20725.	areyouagirloraguymonkey (dw...	8	151.90	166.24	8	100.00
20726.	gale (dwah)	8	86.69	103.85	3	37.50
20727.	AAA (duraszess)	8	91.18	99.15	5	62.50
20728.	Tung (dungtang)	8	112.38	130.06	3	37.50
20729.	🌷 (dumplinling)	8	52.61	59.24	0	0.00
20730.	teethmc (dudeboi63589)	8	85.49	110.97	3	37.50
20731.	Per (dubgeiser)	8	81.20	84.91	1	12.50
20732.	Sasha (dtelesman1)	8	75.24	86.18	1	12.50
20733.	Kristof (driftydifty)	8	53.70	56.53	2	25.00
20734.	droo (drew215)	8	112.11	128.22	5	62.50
20735.	Dregni (dregni)	8	61.25	66.52	1	12.50
20736.	Khondokar (draenor06)	8	70.84	90.06	4	50.00
20737.	Manan (dpmanan)	8	57.64	64.80	2	25.00
20738.	Kris (doubleace5747)	8	98.16	104.21	3	37.50
20739.	1337 (dotnet)	8	74.91	83.01	3	37.50
20740.	Aang (dorjeaang)	8	62.01	71.21	1	12.50
20741.	Doodle (doodle_doot)	8	67.83	79.27	4	50.00
20742.	sam_sep10l (don_simon)	8	69.26	80.62	1	12.50
20743.	Donzelle (donnie12)	8	78.42	85.42	0	0.00
20744.	Danish (donish)	8	61.59	65.09	3	37.50
20745.	dongster (dongster)	8	96.34	121.51	1	12.50
20746.	Dominik (domynig)	8	65.35	79.25	3	37.50
20747.	ziomek (dombrol)	8	77.35	88.43	1	12.50
20748.	Doctorgreenyou (doctorgreen...	8	88.72	102.66	5	62.50
20749.	Daniel (dkincorperated)	8	52.06	61.59	2	25.00
20750.	djole (djole)	8	60.26	64.04	2	25.00
20751.	Dylan (dillyv)	8	86.07	93.84	3	37.50
20752.	Nick (diggle)	8	121.25	146.89	6	75.00
20753.	DaRealZubyy (dexisnothome)	8	37.08	48.48	2	25.00
20754.	Mart (devli)	8	18.16	19.86	0	0.00
20755.	Detha (detha_)	8	63.36	70.97	2	25.00
20756.	Neil Adrian (destroyer_46)	8	109.75	119.03	4	50.00
20757.	Desmond (desmondspeedy)	8	90.94	107.19	6	75.00
20758.	twitch.tv/YasuoNA (denigratez)	8	98.26	110.61	3	37.50
20759.	Jack (delysid)	8	100.80	119.46	3	37.50
20760.	DeltaDraco (delta_draco)	8	100.90	108.01	3	37.50
20761.	Dan (deltaenergy)	8	73.21	78.37	0	0.00
20762.	sugi (dea_agent)	8	106.95	119.70	5	62.50
20763.	Jeaffffffffffffff (deadvull)	8	66.81	78.62	0	0.00
20764.	David (davylern)	8	104.12	114.36	5	62.50
20765.	Davin (davinnnnn)	8	78.01	86.51	0	0.00
20766.	David (davidm_2020)	8	125.02	138.03	4	50.00
20767.	Brian (dataslayer)	8	107.03	122.57	5	62.50
20768.	Darkplayer3 (darkplayer3)	8	89.02	97.34	5	62.50
20769.	Revolt (darkestrevolt)	8	85.25	92.99	3	37.50
20770.	Darapsas (darapsas)	8	84.48	97.03	5	62.50
20771.	TIN (daons)	8	85.51	88.53	2	25.00
20772.	Daniel (danyu1)	8	86.18	96.88	2	25.00
20773.	Jack (dante17)	8	75.08	82.12	1	12.50
20774.	danny (dannyvokje)	8	86.14	96.59	3	37.50
20775.	Daniel (danielstebbins)	8	68.17	74.75	3	37.50
20776.	Russell (dalenu)	8	120.94	138.45	3	37.50
20777.	da (dahanci)	8	118.37	127.75	7	87.50
20778.	BathTime (daddysbathtime)	8	58.49	71.26	1	12.50
20779.	ab (dabglob)	8	99.85	110.67	3	37.50
20780.	D3LTA (d3lta)	8	98.10	101.28	4	50.00
20781.	G (cyutie__g)	8	91.37	107.47	8	100.00
20782.	Cyan (cyan_cloud)	8	66.67	78.62	3	37.50
20783.	cyan (cyanaspect)	8	91.08	97.99	2	25.00
20784.	Colin (cwreath43)	8	89.69	102.53	3	37.50
20785.	curtythurty (curtythurty)	8	45.09	51.56	1	12.50
20786.	cursedgandhi (cursedgandhi)	8	93.03	100.32	4	50.00
20787.	ravi (culdesaccer)	8	60.51	80.93	1	12.50
20788.	Andrew (cuetime)	8	39.88	43.97	1	12.50
20789.	cse_kyle (cse_kyle)	8	71.73	85.69	2	25.00
20790.	Hoppy (crunchydog)	8	70.91	77.43	1	12.50
20791.	Dran (creyon)	8	74.28	78.86	1	12.50
20792.	Campbell (cphalen)	8	97.28	120.36	2	25.00
20793.	rashawn (corthas)	8	103.14	121.98	3	37.50
20794.	Corey (corrreyjay)	8	123.72	147.82	7	87.50
20795.	Rainnier (corrby)	8	108.82	166.75	5	62.50
20796.	Timothy (cornmono)	8	83.79	95.40	1	12.50
20797.	Lorenzo (cool_and_good)	8	62.52	67.34	1	12.50
20798.	Helena (coolister3)	8	102.27	119.77	6	75.00
20799.	Emmet (contrambulance)	8	92.12	106.25	1	12.50
20800.	Alice (communistbean)	8	71.48	84.65	4	50.00
20801.	Cole (cole_denson)	8	84.80	90.34	5	62.50
20802.	Colemak User (colemak_behbear)	8	92.31	111.37	3	37.50
20803.	wEN (coldblacktea)	8	83.53	95.00	3	37.50
20804.	ここ (coco_jumbo)	8	72.76	80.08	6	75.00
20805.	Coalpi (coalpi)	8	79.82	94.02	3	37.50
20806.	CMcK (cmck)	8	89.17	94.95	3	37.50
20807.	Clever (cleverdom)	8	61.59	65.90	0	0.00
20808.	Clare (clareb31)	8	77.00	89.86	3	37.50
20809.	Charles (ckypros)	8	74.46	87.07	4	50.00
20810.	Christina (cjkoikara)	8	64.05	66.55	0	0.00
20811.	Simon (ciscomalware)	8	67.71	76.06	6	75.00
20812.	Bryjeen (chronoalpha)	8	85.35	92.98	4	50.00
20813.	ma3ke (chromoplast)	8	84.88	94.54	0	0.00
20814.	Chong Shan (chong_shan)	8	69.12	77.89	1	12.50
20815.	Oluwatomi (chidori21)	8	42.56	51.56	0	0.00
20816.	Calvin (cheekuan321)	8	100.67	121.60	5	62.50
20817.	Chayse (chaysegr)	8	90.56	100.62	3	37.50
20818.	SpongeBob (cerealkila)	8	67.94	76.72	1	12.50
20819.	Athos (cdelafere)	8	74.93	83.14	1	12.50
20820.	Jam (cayajam)	8	72.80	86.99	1	12.50
20821.	s (caustlc)	8	96.47	110.54	5	62.50
20822.	Alex (carrot_ironfoundersson)	8	54.17	59.41	1	12.50
20823.	Rystian (cap_redhawk)	8	58.61	65.51	2	25.00
20824.	Captain2 (captain_)	8	58.35	66.17	8	100.00
20825.	s. (capslooock)	8	91.53	106.68	4	50.00
20826.	Cam (camtain)	8	52.29	63.81	2	25.00
20827.	Cade (cadelanktree)	8	74.41	94.52	4	50.00
20828.	Cache (cachemonet)	8	87.58	95.61	2	25.00
20829.	b (b_rabbit019)	8	58.34	71.40	0	0.00
20830.	buzz (buzzdale2)	8	80.62	88.17	2	25.00
20831.	punk (bulatefishballs)	8	92.53	103.35	2	25.00
20832.	Bubbles (bubbles81833)	8	124.80	145.87	6	75.00
20833.	Brian (btgrant76)	8	69.31	87.74	3	37.50
20834.	AJ (bsptc)	8	105.46	117.64	5	62.50
20835.	Brett (brettshaw)	8	85.44	112.11	2	25.00
20836.	Brenden (brenden_2021)	8	57.76	68.21	2	25.00
20837.	Myth (brendanlai1999)	8	61.19	71.81	2	25.00
20838.	Brecken (breck1234)	8	95.91	117.44	3	37.50
20839.	boxxibis (boxxibis)	8	102.70	122.70	3	37.50
20840.	Bovinova (bovinovain)	8	72.08	82.86	3	37.50
20841.	Adhitya (borakx007)	8	90.31	95.59	4	50.00
20842.	Alias (boinkus)	8	124.05	145.98	6	75.00
20843.	boby (bobybomby)	8	59.97	77.34	3	37.50
20844.	Bob (bobanton02)	8	113.36	129.87	4	50.00
20845.	Minleg (bminleg)	8	67.03	77.46	2	25.00
20846.	Billy (blipdip)	8	59.92	71.11	3	37.50
20847.	blitter (blitter56)	8	60.69	72.16	2	25.00
20848.	Joshua (blink180dude)	8	81.14	95.14	1	12.50
20849.	camille (bleuish)	8	94.77	106.19	5	62.50
20850.	Black (blacksiderino)	8	91.79	100.97	3	37.50
20851.	Sean (blackandwhitemuppet)	8	142.09	155.35	5	62.50
20852.	Christian (bl0btypes)	8	82.78	98.86	1	12.50
20853.	bitter (bitternightmares100)	8	100.55	112.57	4	50.00
20854.	Bertil (bingobertil)	8	98.53	109.60	3	37.50
20855.	Mack (bigmack10)	8	82.25	91.73	1	12.50
20856.	bigburd (bigburd)	8	99.23	104.96	4	50.00
20857.	Marshall (bigboycold)	8	78.50	88.30	3	37.50
20858.	BIdi (bidi)	8	100.67	109.33	4	50.00
20859.	Bibek (bibek77)	8	42.56	49.39	0	0.00
20860.	Bheta (bheta)	8	122.97	149.14	5	62.50
20861.	bhavya (bhav_)	8	50.74	58.27	4	50.00
20862.	Kevin (besnier)	8	82.20	87.44	2	25.00
20863.	Azerty 0w0 (benz_)	8	94.23	100.95	3	37.50
20864.	ben (benlee27)	8	56.79	68.79	3	37.50
20865.	Ben (bencyi)	8	122.27	151.75	6	75.00
20866.	bench (bench0)	8	101.75	114.50	1	12.50
20867.	Bempe (bempe)	8	96.72	106.03	3	37.50
20868.	Bektur (bektur8888)	8	31.82	37.47	3	37.50
20869.	Tristan (beckonez)	8	92.26	101.51	3	37.50
20870.	Elizabeth (bebecam)	8	115.28	129.70	6	75.00
20871.	beastboy (beastboy1787)	8	57.09	68.76	0	0.00
20872.	batwayne1 (batwayne1)	8	71.57	79.54	4	50.00
20873.	Bartacus (bartacus)	8	72.37	79.63	3	37.50
20874.	Joseph (barcaftw05)	8	102.33	110.19	6	75.00
20875.	Balint (balint2004)	8	79.69	92.34	2	25.00
20876.	Bagel (baegirl)	8	122.87	131.75	3	37.50
20877.	Baby (baby3am)	8	49.74	62.94	1	12.50
20878.	Felix (babford)	8	69.74	73.92	1	12.50
20879.	xtian (babbageclunk)	8	48.48	54.31	1	12.50
20880.	Zheng Hao (a_random_slow_ty...	8	49.48	61.31	1	12.50
20881.	Anubhav (a_a_pandey)	8	52.24	64.04	2	25.00
20882.	Ayush (ayushnanda14)	8	82.31	88.96	2	25.00
20883.	ayumiii (ayumiii)	8	55.07	70.19	1	12.50
20884.	A (axeborn)	8	48.98	56.06	0	0.00
20885.	awesomedude1440 (awesomedud...	8	85.04	116.53	5	62.50
20886.	Avi (avi_130)	8	95.43	119.89	4	50.00
20887.	AvD (avd3369)	8	58.57	67.07	1	12.50
20888.	Vladimir (av1ty)	8	69.09	77.19	2	25.00
20889.	Austin (austinwc)	8	82.49	97.10	0	0.00
20890.	Daniel (aussiegrillgamr)	8	65.06	71.39	2	25.00
20891.	Aureus (aureuswastaken)	8	113.08	130.32	5	62.50
20892.	Ambrose (astrealix)	8	95.57	105.18	3	37.50
20893.	Jason (ason6678)	8	56.29	65.87	6	75.00
20894.	Shahariar (ashikkkkk)	8	71.84	90.08	1	12.50
20895.	Asher (asher_xxi)	8	52.33	58.09	0	0.00
20896.	arti (artiarti)	8	73.02	79.65	1	12.50
20897.	Acwyg (arjung0055)	8	39.21	48.40	0	0.00
20898.	apexstrada (apexstrada)	8	91.12	118.51	4	50.00
20899.	Anzac (anxan)	8	82.24	91.78	3	37.50
20900.	Anush Rao (anushrao)	8	40.21	48.49	0	0.00
20901.	Anthony (anthonydsr)	8	75.75	87.91	3	37.50
20902.	Aniq (aniq_asd)	8	67.91	73.26	1	12.50
20903.	Andrius (andriusius)	8	78.51	87.19	1	12.50
20904.	Andrew (andmarek)	8	119.37	129.35	5	62.50
20905.	jay (anakanjay)	8	74.74	86.20	0	0.00
20906.	Amr (amr_emara)	8	48.03	54.59	0	0.00
20907.	Amir (amir_bc)	8	71.21	84.87	2	25.00
20908.	Amanda (amandaaaa_)	8	71.47	87.00	0	0.00
20909.	Altra (altra)	8	86.54	111.43	6	75.00
20910.	Alpha (alpha_atk)	8	72.37	89.76	5	62.50
20911.	CaccMann (aloned)	8	109.44	139.12	2	25.00
20912.	Almonds (almonds_and_nutella)	8	43.10	51.67	1	12.50
20913.	Allen (allen8811)	8	56.40	63.85	2	25.00
20914.	Alan (allanafdn)	8	136.62	153.43	3	37.50
20915.	Alfian (alfianzv)	8	83.86	112.21	2	25.00
20916.	Alex (alexk123)	8	58.41	66.35	0	0.00
20917.	Aleksandar (alexg2003)	8	87.84	101.49	2	25.00
20918.	Alejandra (alejandrabruh29)	8	31.70	38.65	3	37.50
20919.	Osama (aldemeery)	8	72.65	79.15	1	12.50
20920.	alan (alanthebest1212)	8	74.03	86.16	5	62.50
20921.	Alamgir (alamgirvigu)	8	51.77	61.15	1	12.50
20922.	Alvin (al04)	8	114.28	126.08	7	87.50
20923.	Aaron (akuch32)	8	63.13	68.59	2	25.00
20924.	Jun (akiboard)	8	110.91	129.44	7	87.50
20925.	AK (ak24)	8	61.69	72.46	4	50.00
20926.	Tryin to make a change :-\ ...	8	115.03	131.62	4	50.00
20927.	fdgojasfd (ajaypokharel)	8	39.63	46.76	2	25.00
20928.	Romil (aidag)	8	93.12	101.29	3	37.50
20929.	DevGuyAhnaf (ahnafzamil)	8	101.23	120.12	8	100.00
20930.	Arnel II (agujathis)	8	98.77	110.48	5	62.50
20931.	Fretzeldurmf (agent_gametur...	8	102.13	115.30	2	25.00
20932.	Ahmad Gamal (agazzaz)	8	62.88	68.58	1	12.50
20933.	Advit Upadhyay (advit0708)	8	56.18	60.59	2	25.00
20934.	Adora (adorablebanana)	8	131.86	145.81	7	87.50
20935.	adithedon (adithedon)	8	32.82	36.11	1	12.50
20936.	Adhy (adhy)	8	81.43	94.29	0	0.00
20937.	Adfrian (adfrianrais)	8	52.81	56.34	0	0.00
20938.	Adam (adamxlofaro)	8	88.14	100.30	3	37.50
20939.	Adam (adamisspeed)	8	100.32	133.51	3	37.50
20940.	Adaephon (adaephon)	8	111.53	120.41	6	75.00
20941.	acewiz (acewiz)	8	94.16	98.14	1	12.50
20942.	Raiyantstats[accursed_] (ac...	8	82.94	95.76	1	12.50
20943.	Abuela (abuela)	8	65.15	74.33	1	12.50
20944.	Alex (abrown516)	8	113.04	125.44	8	100.00
20945.	Aarya (aaryatambe)	8	58.15	70.37	0	0.00
20946.	Aakash (aakash_rp_621)	8	70.32	75.38	4	50.00
20947.	Aaron (aaaronnguyen)	8	83.22	93.86	2	25.00
20948.	a3533 (a3533)	8	85.41	93.80	1	12.50
20949.	jordan (7jrdn)	8	65.17	73.99	3	37.50
20950.	Ren (6cdh)	8	72.40	85.76	1	12.50
20951.	K (4pple)	8	60.37	77.79	2	25.00
20952.	ariel (44tech_)	8	57.22	66.09	0	0.00
20953.	Naresh (303nash)	8	100.22	105.30	3	37.50
20954.	Ivan (1v4n)	8	60.07	69.24	3	37.50
20955.	Zero (0gundam)	8	145.45	169.58	7	87.50
20956.	Giuseppe Bottazzi (051znn)	8	66.35	79.92	1	12.50
20957.	emanuel (emumu)	8	78.70	91.68	5	62.50
20958.	Olivier (opet)	8	90.39	105.69	2	25.00
20959.	Yash (kumar02)	8	48.52	59.68	1	12.50
20960.	Bluee (blueegamer)	8	128.86	151.91	8	100.00
20961.	D2 (dtsu)	8	94.81	117.98	8	100.00
20962.	Pulkit (dinodude17)	8	62.81	80.28	1	12.50
20963.	Philo (philophobic)	8	65.79	77.01	3	37.50
20964.	Nic (nchlsh)	8	80.19	91.39	0	0.00
20965.	Ace (acedawg123)	8	72.33	79.41	1	12.50
20966.	peepee (gamerman2000)	8	92.47	100.07	4	50.00
20967.	brm (brmstr)	8	75.94	85.33	3	37.50
20968.	Lucifer (lucifermorningstar...	8	60.69	66.84	0	0.00
20969.	longshot (longshot19)	8	37.22	43.52	0	0.00
20970.	Tony (dnacid)	8	66.83	88.31	3	37.50
20971.	André (aistcold)	8	89.32	103.73	5	62.50
20972.	olivia (oliviadance)	8	56.59	64.54	2	25.00
20973.	Sretnik (vedran3)	8	99.26	116.38	4	50.00
20974.	Hackyeah (hackyeah)	8	69.19	94.64	3	37.50
20975.	Yehonatan (yonac)	8	55.77	63.44	0	0.00
20976.	Raven (veintan23)	8	62.19	69.92	2	25.00
20977.	Bakhtiyar (baha123)	8	30.89	33.62	0	0.00
20978.	Longlegdog (longlegdog)	8	103.84	117.53	5	62.50
20979.	Jack (wapow811_official)	8	30.65	35.19	4	50.00
20980.	Thanh (ncthanh2000)	8	74.13	85.96	5	62.50
20981.	Neeraj (nerdarrow)	8	73.47	87.35	3	37.50
20982.	raVen (raven01)	8	74.74	81.53	2	25.00
20983.	WishICouldLiveLongerThanMyW...	8	70.29	85.79	4	50.00
20984.	Matthew (sharen0904)	8	37.59	42.19	0	0.00
20985.	Alex (2abc6)	8	66.85	73.54	3	37.50
20986.	SP (spider_swing)	8	46.07	48.94	0	0.00
20987.	Jacob (wooperking)	8	85.03	94.18	4	50.00
20988.	Space (space_bound)	8	60.57	64.67	0	0.00
20989.	Evan (alien_lover)	8	132.32	138.57	5	62.50
20990.	Nikkulet (nikkulet)	8	70.63	78.03	3	37.50
20991.	William (donwee88)	8	59.77	70.47	3	37.50
20992.	Gambit (zereth09)	8	82.48	94.42	3	37.50
20993.	Alexis (alunesp15)	8	61.29	68.16	1	12.50
20994.	LONESTAR (lone_star)	8	49.51	59.85	2	25.00
20995.	jisoo (jisoooleee)	8	90.10	117.73	3	37.50
20996.	Sky (skyking1484)	8	59.09	65.67	7	87.50
20997.	Thanakrit (mnchtnk)	8	46.08	50.39	1	12.50
20998.	Mecin Man (mecin_man3011)	8	51.51	56.88	0	0.00
20999.	Alexander (sheeplordz)	8	61.19	67.44	0	0.00
21000.	Snowman (snowmanisgood)	8	77.23	84.63	0	0.00
21001.	Hriju (hriju)	8	55.10	62.96	3	37.50
21002.	OrangeJuicer (arskiir)	8	74.42	86.27	2	25.00
21003.	Menace (menace101)	8	102.18	107.11	4	50.00
21004.	fida (ferarida)	8	82.20	94.65	7	87.50
21005.	Winda (windamrtrn)	8	59.23	69.58	8	100.00
21006.	Speky (speky)	8	46.28	55.01	1	12.50
21007.	Master (medo2006)	8	77.37	95.17	3	37.50
21008.	لركيد (lorchid)	8	68.59	74.81	5	62.50
21009.	Andrew (thekirkendall)	8	89.90	101.73	7	87.50
21010.	Milos (kaoss14)	8	72.13	86.05	3	37.50
21011.	Barfo (barfo)	8	80.00	89.96	2	25.00
21012.	Dominic (dominicp97)	8	75.53	81.75	1	12.50
21013.	Seth (sandwichseth)	8	62.27	81.15	2	25.00
21014.	Mikrit (mickey035)	8	92.40	103.38	1	12.50
21015.	Jessica (jessi_p3)	8	74.58	87.33	2	25.00
21016.	Anlanther (anlanther)	8	81.59	89.58	4	50.00
21017.	Sergio (dallmyt)	8	36.87	48.89	0	0.00
21018.	Andrew (andrewawesome04)	8	113.01	132.13	7	87.50
21019.	axari (axari)	8	70.78	82.70	1	12.50
21020.	Rionne (aeolus27)	8	84.66	89.24	2	25.00
21021.	pastapirate (pastapirate)	8	98.54	114.14	7	87.50
21022.	Dcoldburn (dcoldburn)	8	73.87	80.85	4	50.00
21023.	MedicalMuscle (medicalmuscle)	8	55.82	70.68	2	25.00
21024.	Prince (prince_sangwan)	8	49.35	56.89	0	0.00
21025.	Christian (kirisuto)	8	99.32	118.67	7	87.50
21026.	REEE (tiucoken77)	8	91.67	108.78	2	25.00
21027.	sw0shy (sw0shy)	8	46.38	66.26	7	87.50
21028.	Lukas (tumultlol)	8	76.16	93.14	3	37.50
21029.	Jamin (hoonji)	8	74.56	97.15	1	12.50
21030.	Rentib (rentib)	8	45.15	52.83	0	0.00
21031.	dekfins (usernameistaken03)	8	66.42	84.17	8	100.00
21032.	swak (swak_za)	8	48.49	60.01	0	0.00
21033.	Dev Akhilesh (devakhil06)	8	65.23	75.98	3	37.50
21034.	vishesh (vishesh312)	8	60.99	66.91	5	62.50
21035.	David (vapordew)	8	62.96	74.38	3	37.50
21036.	Daniel (daw9801)	8	128.25	135.93	5	62.50
21037.	$now (oldsnow)	8	74.33	83.49	4	50.00
21038.	mostafa (just_dreamer)	8	56.10	63.75	1	12.50
21039.	Mi Co (greeds)	8	61.45	68.32	2	25.00
21040.	Joseph (mintypenguin)	8	60.81	73.63	0	0.00
21041.	Casper-Drawz-Stuff (mrdrawz)	8	44.07	48.48	1	12.50
21042.	Jerry Henry Rose (jerryrose89)	8	101.22	114.25	4	50.00
21043.	Sergio (sergio_gardella)	8	49.18	54.73	0	0.00
21044.	Dan (danpdx)	8	83.82	105.14	5	62.50
21045.	ahammed (ahammed_saeed)	8	55.01	74.13	2	25.00
21046.	Joshua (krotaku)	8	52.45	59.86	1	12.50
21047.	Hans (hjensen)	8	81.79	103.74	3	37.50
21048.	Ayana (mangoez)	8	89.57	98.07	3	37.50
21049.	lawrence (lawrenc)	8	73.60	93.45	1	12.50
21050.	Lis (lussss)	8	64.29	77.15	6	75.00
21051.	chair (chairtypingshit)	8	48.34	55.21	3	37.50
21052.	Snowbat (snowbat)	8	66.69	73.44	2	25.00
21053.	nem (nem2k18)	8	67.31	78.12	3	37.50
21054.	colahhh (colahhh)	8	67.70	80.74	5	62.50
21055.	Nico (bynixo)	8	58.67	69.52	3	37.50
21056.	G M Sohanur Rahman (th3r0b0t)	8	31.46	35.42	0	0.00
21057.	Yash (yashkul)	8	63.78	70.98	0	0.00
21058.	Pierce (fiercepierce123)	8	79.54	89.87	6	75.00
21059.	Akash (kuekuatsu)	8	46.40	57.13	0	0.00
21060.	Alex (x731)	8	93.26	100.84	3	37.50
21061.	Suka (sukatoho)	8	77.73	84.97	2	25.00
21062.	Qasim (qoofbop)	8	66.80	81.57	5	62.50
21063.	Brad (braynie)	8	31.40	50.59	1	12.50
21064.	Isaiah (icongamingyt)	8	62.38	71.31	0	0.00
21065.	Corbyn (skibbity)	8	91.20	107.38	3	37.50
21066.	Nashiruddien (diditsadidnsm)	8	34.29	44.61	5	62.50
21067.	Guy (need4speed_)	8	55.42	59.45	1	12.50
21068.	Hasnat (hasnat79)	8	67.55	74.54	4	50.00
21069.	Louis (giantshlong)	8	102.33	116.55	5	62.50
21070.	Amir (spaghetti_wolf)	8	42.64	51.90	1	12.50
21071.	sunny (mishmish34)	8	77.42	97.55	3	37.50
21072.	Raneth (raneth)	8	28.99	32.86	3	37.50
21073.	slowaf (slowaf66552)	8	33.83	36.62	0	0.00
21074.	willn5702 (willn5702)	8	94.49	106.15	3	37.50
21075.	Kq_al (kqal)	8	80.43	87.08	4	50.00
21076.	LION784 (lion784)	8	50.84	59.03	1	12.50
21077.	acadia (acadiaskye)	8	70.21	74.97	1	12.50
21078.	Akash (akashsaxena2308)	8	48.40	64.55	0	0.00
21079.	Awak3 (_awak3_)	8	68.97	78.46	2	25.00
21080.	Ronni (thepinhead)	8	52.00	65.10	2	25.00
21081.	hunnidbens (benrito)	8	102.25	122.87	5	62.50
21082.	Why Are We (why_are_we_stil...	8	71.88	85.95	2	25.00
21083.	Mátyás (matyas646)	8	41.04	51.73	8	100.00
21084.	Matthew (kaisermk)	8	69.83	83.77	3	37.50
21085.	Lavi (lavirinea)	8	80.97	92.37	2	25.00
21086.	Everton (hissyfits)	8	92.38	101.51	6	75.00
21087.	Isaad (colguy123)	8	76.74	88.42	3	37.50
21088.	Giancarlo (glitch3890)	8	63.43	69.95	3	37.50
21089.	Geoffrey (colleqtivity)	8	105.12	122.11	1	12.50
21090.	lucy (royaltoe)	8	92.83	101.31	1	12.50
21091.	Epic (foxonlaptop)	8	77.68	90.14	5	62.50
21092.	. (__random__)	7	92.20	103.03	2	28.57
21093.	damn (_victor667_)	7	55.93	65.76	0	0.00
21094.	Dewey (_dewey)	7	108.43	114.06	2	28.57
21095.	Federico (_cali)	7	99.78	112.45	4	57.14
21096.	Alex (_alwang_)	7	77.83	89.12	2	28.57
21097.	Ales (_ales)	7	103.05	111.37	4	57.14
21098.	Zimri (zygnus)	7	111.24	133.26	4	57.14
21099.	Zyan25 (zyan2525)	7	78.27	84.26	6	85.71
21100.	Hans (zozo800)	7	70.36	76.21	0	0.00
21101.	joe (zoybls)	7	63.07	75.77	0	0.00
21102.	zoomfrog (zoomfrog)	7	95.54	104.62	3	42.86
21103.	HollowAri (zokkuu)	7	65.03	70.72	1	14.29
21104.	ziolson (ziolo1)	7	66.16	81.41	2	28.57
21105.	e (zimboboys)	7	96.91	103.31	3	42.86
21106.	jack (zero18)	7	73.99	79.36	1	14.29
21107.	Khanon (zero1010_)	7	61.53	69.61	2	28.57
21108.	Hopelezz (zerloth)	7	85.98	97.59	1	14.29
21109.	Loong (zenloong)	7	94.58	100.84	3	42.86
21110.	Zed (zedhabibi)	7	59.44	64.52	6	85.71
21111.	Zeddy (zeddyx)	7	90.15	99.18	4	57.14
21112.	Zchob (zchob)	7	70.82	77.31	5	71.43
21113.	Neeraj (zapidox)	7	42.35	48.05	1	14.29
21114.	Zajd (zajd36)	7	105.34	114.52	3	42.86
21115.	Zaid (zaid_ansari)	7	47.99	54.72	1	14.29
21116.	Ho (zahid11704023)	7	43.05	49.77	1	14.29
21117.	Dwi (yvbinjk)	7	77.39	95.27	3	42.86
21118.	Rataro (yuugokku)	7	79.86	97.29	1	14.29
21119.	Michael (yt_m1gamer2020)	7	65.59	71.76	3	42.86
21120.	Aaron (yoyoyonono)	7	106.82	120.28	3	42.86
21121.	Sasuke (yosasuke)	7	103.89	120.84	4	57.14
21122.	yian (yian31415)	7	68.98	74.87	3	42.86
21123.	Yenthe (yenthefromghent)	7	43.94	47.18	2	28.57
21124.	Yeldos (yeldosmanap)	7	76.44	80.53	2	28.57
21125.	Rohan (yeetarted)	7	103.44	109.45	4	57.14
21126.	Sam (ye3et)	7	64.96	67.42	1	14.29
21127.	Yaye (yaye2002)	7	29.52	34.47	2	28.57
21128.	Yatin (yatin18)	7	53.85	58.46	2	28.57
21129.	Yashvir (yashvir_kothari)	7	36.89	41.83	2	28.57
21130.	XxDarkSIdexX (xxdarksidexx)	7	30.67	42.46	2	28.57
21131.	Eli (xutt)	7	74.13	85.84	6	85.71
21132.	reduce (xreduce)	7	150.44	163.72	7	100.00
21133.	Steve (xenoxinius)	7	104.09	114.56	5	71.43
21134.	Barton (xbarton)	7	101.12	107.24	0	0.00
21135.	Jacob (xavior_x)	7	93.81	100.00	4	57.14
21136.	Jake (wyol)	7	71.74	77.83	2	28.57
21137.	Alex (wu2481632)	7	124.21	134.39	4	57.14
21138.	Gerlat (wtcher1066)	7	53.21	57.79	1	14.29
21139.	yung (woahthereyungman)	7	67.27	88.61	0	0.00
21140.	Wo1v3r (wo1v3r)	7	113.37	120.62	3	42.86
21141.	Wissa (wissaa)	7	36.33	47.37	2	28.57
21142.	wabi (wisabi)	7	109.43	123.80	7	100.00
21143.	Willie (williewho)	7	77.83	89.60	0	0.00
21144.	Wikedtik (wikedtik)	7	101.88	107.37	1	14.29
21145.	glo (whytho_)	7	92.84	102.78	1	14.29
21146.	Llihcon (whoflayslikeme)	7	84.97	89.42	2	28.57
21147.	Sarp (whitechocolatee)	7	69.65	75.99	3	42.86
21148.	Dots (wheremydots)	7	85.20	101.81	1	14.29
21149.	N3gativeZero (whatsupbrandon)	7	85.03	106.44	3	42.86
21150.	Wesley (wesilii)	7	103.14	115.49	3	42.86
21151.	Warren (warlover94)	7	93.58	101.12	0	0.00
21152.	Damian (waninggibbous)	7	70.76	73.86	3	42.86
21153.	Wallace (wallacetwo)	7	99.12	104.72	4	57.14
21154.	Walker (walkersutton)	7	91.06	116.01	3	42.86
21155.	Wacky (wakcy)	7	84.69	101.41	4	57.14
21156.	SRW (waifuthebest)	7	36.37	43.20	0	0.00
21157.	WaffleAbs (waffleabs)	7	88.64	105.28	1	14.29
21158.	Chris (w1ndow)	7	115.14	130.51	3	42.86
21159.	Varun (vslala)	7	83.45	94.94	2	28.57
21160.	​ (vonunov)	7	144.33	164.03	2	28.57
21161.	thach (vngoct1)	7	68.98	79.18	0	0.00
21162.	Vlada (vlaki)	7	74.30	82.40	4	57.14
21163.	Patrick (violaissimmo)	7	94.20	104.66	3	42.86
21164.	Villads (vilmk)	7	35.96	42.64	0	0.00
21165.	Viktor (viktro_touch_type)	7	86.03	95.44	1	14.29
21166.	Vivek (viivek)	7	114.71	131.04	5	71.43
21167.	NO (veryaveragetyper)	7	59.44	63.19	2	28.57
21168.	Hello (venox11)	7	50.03	57.26	3	42.86
21169.	Darcy (vendus13)	7	60.55	70.42	1	14.29
21170.	Dias (vdios)	7	65.47	70.89	3	42.86
21171.	Revil (vasat401)	7	43.28	48.83	0	0.00
21172.	Amara (vainguardian29)	7	45.69	53.44	0	0.00
21173.	Eva (vagabionda)	7	64.37	70.41	1	14.29
21174.	Narkotik (vacban)	7	83.22	96.84	1	14.29
21175.	Ikhbayar (u_mad_bruh_ikhee)	7	66.22	69.75	1	14.29
21176.	uwunation (uwunation)	7	99.29	109.24	3	42.86
21177.	Usurious (usurious_disc730)	7	88.58	99.43	6	85.71
21178.	usu (usufails)	7	65.77	75.78	1	14.29
21179.	datmeko (uralbeking)	7	80.60	86.83	2	28.57
21180.	undeclared (undeclared)	7	104.71	130.83	6	85.71
21181.	Ultrabars- (ultrabars)	7	65.90	94.79	0	0.00
21182.	Uksza (uksza)	7	74.54	93.15	1	14.29
21183.	Tomo (tzxb018)	7	84.36	92.88	1	14.29
21184.	Mohaimenul (typun)	7	31.20	37.67	0	0.00
21185.	typo11 (typo11)	7	58.04	67.57	2	28.57
21186.	mu (typetypetypetypetype)	7	48.66	56.53	0	0.00
21187.	Nibir (typer_de_random)	7	94.76	99.43	2	28.57
21188.	Christian (typeger)	7	116.20	132.72	5	71.43
21189.	kyel (txkyel)	7	87.24	91.33	1	14.29
21190.	TuxKnight (tuxknight)	7	64.39	73.77	1	14.29
21191.	Tuomas (tumaas)	7	84.34	93.45	3	42.86
21192.	yuan (ttkomalake)	7	34.31	37.41	0	0.00
21193.	Tom (ttaffy)	7	97.77	112.93	2	28.57
21194.	Tycho (tspider4)	7	94.09	114.46	2	28.57
21195.	Ahmad (truemagix)	7	49.51	53.77	1	14.29
21196.	Always (tromin)	7	103.01	120.73	3	42.86
21197.	Triz (triz)	7	111.87	125.87	6	85.71
21198.	_trillbits_ (trillbits)	7	62.36	66.87	1	14.29
21199.	tran (tranwantdie)	7	92.79	105.74	3	42.86
21200.	Tomas (tomas_649)	7	52.72	61.73	0	0.00
21201.	Tumarbek (tom4ke)	7	58.53	67.92	1	14.29
21202.	János (tokumeikun)	7	64.73	77.99	1	14.29
21203.	Michael (todfelton)	7	59.60	64.53	0	0.00
21204.	Tj0027 (tj0027)	7	39.14	43.81	0	0.00
21205.	Tim (timmaayyt)	7	71.10	86.30	0	0.00
21206.	Tim (tigothy)	7	95.89	111.92	2	28.57
21207.	PianOreo (thunderoreoz)	7	105.25	122.36	6	85.71
21208.	Thunder (thunder2910)	7	74.30	83.17	2	28.57
21209.	thummachart (thummachart)	7	55.76	61.91	0	0.00
21210.	Thomas (thomastran02)	7	73.90	84.27	0	0.00
21211.	Virginia (thomas11)	7	76.53	88.27	2	28.57
21212.	The Ro Driver (the_ro_driver)	7	76.87	92.27	2	28.57
21213.	David (the_pursuit)	7	102.72	118.36	7	100.00
21214.	Willow (the_kirin_master)	7	106.09	132.64	6	85.71
21215.	Hali (the_holy_hali)	7	61.18	67.79	7	100.00
21216.	Elias (the_dovah)	7	63.95	70.04	0	0.00
21217.	Derek (thewarrior_13th)	7	71.91	84.58	1	14.29
21218.	Joe (therunner09)	7	98.37	107.42	3	42.86
21219.	Alex (therodge)	7	63.62	76.47	1	14.29
21220.	Jesse (thepaperman)	7	48.95	57.55	4	57.14
21221.	Nam (thenewdawn97)	7	46.49	55.32	1	14.29
21222.	thelegendary08 (thelegendar...	7	77.81	85.36	4	57.14
21223.	Andrew (thedeathlyhallows)	7	122.77	142.17	4	57.14
21224.	TheDasher (thedasherz)	7	54.02	61.00	1	14.29
21225.	thatguy (thatguy577)	7	53.73	59.78	1	14.29
21226.	thatchipz (thatchipz)	7	77.53	90.88	4	57.14
21227.	BEST 54 wpm (terass)	7	33.18	37.55	2	28.57
21228.	Tentic (tentic)	7	99.02	108.18	5	71.43
21229.	Tellenar (tellenar)	7	82.36	100.00	2	28.57
21230.	moyu (teledodol)	7	70.27	86.32	3	42.86
21231.	Tea (teawee)	7	63.59	73.30	2	28.57
21232.	Troy (tdserapio)	7	100.62	108.22	5	71.43
21233.	Nurlan (tasmaev)	7	27.05	30.54	1	14.29
21234.	venus (taroxtaroxtaro)	7	101.89	127.88	5	71.43
21235.	Tarneem (tarneem)	7	73.38	85.76	3	42.86
21236.	Cory (tarisant)	7	136.49	148.05	7	100.00
21237.	Tanwa (tanwa)	7	71.42	83.53	1	14.29
21238.	tanami (tanami)	7	130.19	154.79	7	100.00
21239.	Tamuna (tamuna314)	7	58.30	61.79	1	14.29
21240.	Slow (tal4565)	7	49.02	59.93	0	0.00
21241.	B (tajooki)	7	87.16	105.37	3	42.86
21242.	Ahmed (taftaf)	7	69.68	80.93	2	28.57
21243.	Tachibana (tachibanayui)	7	60.83	79.17	2	28.57
21244.	Ruiji (taburnalluigi)	7	49.66	65.68	4	57.14
21245.	TeeCee (taboka)	7	36.80	44.45	1	14.29
21246.	Tom (t0mas_colemak)	7	77.85	90.98	2	28.57
21247.	Luke (synthsequence)	7	97.74	105.93	3	42.86
21248.	Symawi (symawi)	7	73.11	82.84	1	14.29
21249.	ed (sxxos)	7	79.35	88.26	3	42.86
21250.	sentim3ntal1 (sweet_malaak)	7	84.88	97.78	1	14.29
21251.	Sway (swaycuisway)	7	106.54	122.22	2	28.57
21252.	Zihaku (swarmfirehd)	7	62.94	74.83	5	71.43
21253.	Maggie (swagmag)	7	85.26	96.60	2	28.57
21254.	Kartswag (swagkid)	7	100.40	109.29	5	71.43
21255.	svime (svime)	7	87.48	111.91	3	42.86
21256.	Chibichan (supersam317)	7	100.77	110.70	4	57.14
21257.	Ashish (superman_11)	7	58.08	63.14	1	14.29
21258.	Drew (supercoolgamer2)	7	31.64	45.15	0	0.00
21259.	sirloc (sunsinghny19)	7	90.91	96.34	5	71.43
21260.	sumukha_puranik (sumukha)	7	62.00	73.24	0	0.00
21261.	suleman (suleman33)	7	101.30	126.05	5	71.43
21262.	Subeesh (subeesh18)	7	70.84	76.99	2	28.57
21263.	EMILYMYGODDESS (crlsh_)	7	88.75	102.60	5	71.43
21264.	Struedelcat (struedelcat)	7	119.39	131.99	4	57.14
21265.	Martin (stroj)	7	71.93	92.01	2	28.57
21266.	stoozy (stoozy)	7	90.46	96.92	2	28.57
21267.	rat (stinkypissboy)	7	93.40	112.05	6	85.71
21268.	Steven (stevie03)	7	108.49	127.12	3	42.86
21269.	Stephanie (stephycatz69)	7