Text #4070276

We know that there is not one person who, after hearing these words, would deny their truth and say that he wanted something else, but he would believe that he had heard exactly what he had desired for a long time - namely, to be melted in unison with his beloved, and the two of them become one. The reason is that our ancient nature was thus and we were whole. And so love is merely the name for the desire and pursuit of the whole.

—from Symposium, a book by Plato, translated by Unknown

Active since April 19, 2019.
434 total characters in this text.

View Pit Stop page for this text

Leaders

View ranks through of 18,577
Rank Username WPM Accuracy Date
1671. G (gc3shadow) 125.75 99% 2021-12-27
1672. some dude (medio02) 125.72 98% 2024-07-04
1673. MUDAMUDAMUDA (likevin) 125.72 97% 2020-05-02
1674. Joseph (racecar56) 125.70 99% 2023-02-22
1675. Savaroni (savaroni) 125.70 96% 2023-02-19
1676. Xinny (noebuhdy) 125.69 99% 2025-09-09
1677. Julien Galons (jugalons) 125.66 98% 2024-04-21
1678. Aizrod (aizrod) 125.66 99% 2025-09-20
1679. PsychoSaeko (psychosaeko) 125.64 98% 2022-08-31
1680. how? (haotingz) 125.62 98.5% 2023-06-08
1681. Agung (udapalito) 125.61 99.3% 2023-10-19
1682. PR (mrprx) 125.60 99% 2020-02-16
1683. Qi (whathaha) 125.58 98% 2022-02-11
1684. (zealindaus) 125.58 99% 2021-05-05
1685. Skrami (skramie) 125.57 97% 2023-04-22
1686. Gene (mckuletzz) 125.56 97% 2021-10-21
1687. A (blobair) 125.55 99% 2022-02-04
1688. Minä (arabwinner) 125.55 98% 2021-11-28
1689. Ivan (assaultbearer) 125.55 99.3% 2021-02-03
1690. Cat (catcatcatcatcatcatcatcat) 125.53 99% 2021-11-18
1691. A (dragon02) 125.51 99% 2020-12-05
1692. Laggy (thefitfatass) 125.50 99% 2021-03-08
1693. Gifty (gifty_asmr) 125.49 97.6% 2025-03-06
1694. Disturbed (disturbed_accuracy) 125.49 96% 2022-04-30
1695. Marcus (marcusmandarin) 125.48 98% 2021-09-15
1696. ShukraTej (shukratej) 125.47 97% 2025-09-05
1697. Suge (lightofday) 125.47 98% 2022-12-17
1698. Loui (benesso_) 125.47 98% 2022-09-10
1699. Super Ranie (super_ranie) 125.46 99% 2025-03-06
1700. Ethan (nobodyj22) 125.46 99% 2020-11-15

Universes

Universe Races Average WPM First Race
Default (English) 32,196 96.61 April 19, 2019
Instant Death Mode 24 109.73 April 24, 2020
ᗜ Stenography 3 81.46 March 27, 2021