Text #3621586

Moses supposes his toeses are roses, but Moses supposes erroneously. Moses he knowses his toeses aren't roses as Moses supposes his toeses to be.

—from Singin' in the Rain, a movie by by Stanley Donen, Gene Kelly

Active since January 13, 2017.
145 total characters in this text.

View Pit Stop page for this text

Leaders

View ranks through of 19,869
Rank Username WPM Accuracy Date
3366. timmoz (timmoz) 87.07 97% 2020-05-04
3367. ju yun (schylarker) 87.06 99% 2017-05-04
3368. altermetax (altermetax) 87.05 99% 2022-08-15
3369. Jacob (jkhindo64) 87.04 99% 2022-04-19
3370. chansol (tychu) 87.03 91% 2017-02-05
3371. x (derpzz) 87.03 96% 2017-08-28
3372. Cat (catcatcatcatcatcatcatcat) 87.02 98% 2021-11-14
3373. Hououin Kyouma (makise_kuri... 87.01 95% 2023-10-09
3374. Hang (hangpham93) 87.01 97% 2019-07-21
3375. Get (get_out) 87.01 98% 2020-03-31
3376. Samsore (samsore) 87.00 96% 2022-10-14
3377. Brandon (brandono2000) 87.00 100% 2022-11-15
3378. Grenek (grenek) 86.98 96% 2021-12-22
3379. Love you john (iliketotypef... 86.98 97% 2020-11-05
3380. dennis (ludennis0606) 86.97 98% 2021-08-16
3381. Azem (peja) 86.97 100% 2017-12-22
3382. Zeke (zekealo) 86.96 98% 2022-12-30
3383. Jave (killer8hyper) 86.96 97.5% 2023-11-18
3384. johnbutactuallynotjohn (yes... 86.95 99% 2021-09-14
3385. Eicy (eicymores) 86.93 97% 2024-01-15
3386. Ayaz (ayazkhan) 86.93 98% 2021-05-06
3387. leakcentral (leakcentral) 86.93 98% 2018-11-09
3388. 🌠Rubby🌠 (mikerubby) 86.93 99% 2018-05-22
3389. Eldin (oktea) 86.92 96% 2021-02-23
3390. Sam (yaboisam_) 86.91 97% 2022-03-28
3391. Ion (incode4it) 86.91 98.1% 2021-02-03
3392. ham (haaaaaaaam) 86.91 96% 2021-04-21
3393. Lane (daymond) 86.89 99% 2019-11-21
3394. Rarely type in my job (catc... 86.89 99% 2022-04-01
3395. zyn (zezyn) 86.89 97% 2021-03-06

Universes

Universe Races Average WPM First Race
Default (English) 31,956 71.84 January 13, 2017
Instant Death Mode 173 78.29 August 25, 2017
ᗜ Stenography 2 82.16 September 24, 2021
All TypeRacer Texts 1 55.13 April 21, 2022