Moses supposes his toeses are roses, but Moses supposes erroneously. Moses he knowses his toeses aren't roses as Moses supposes his toeses to be.
—from Singin' in the Rain, a movie by by Stanley Donen, Gene Kelly
Active since January 13, 2017.
145 total characters in this text.
View Pit Stop page for this text
Rank | Username | WPM | Accuracy | Date |
---|---|---|---|---|
3366. | timmoz (timmoz) | 87.07 | 97% | 2020-05-04 |
3367. | ju yun (schylarker) | 87.06 | 99% | 2017-05-04 |
3368. | altermetax (altermetax) | 87.05 | 99% | 2022-08-15 |
3369. | Jacob (jkhindo64) | 87.04 | 99% | 2022-04-19 |
3370. | chansol (tychu) | 87.03 | 91% | 2017-02-05 |
3371. | x (derpzz) | 87.03 | 96% | 2017-08-28 |
3372. | Cat (catcatcatcatcatcatcatcat) | 87.02 | 98% | 2021-11-14 |
3373. | Hououin Kyouma (makise_kuri... | 87.01 | 95% | 2023-10-09 |
3374. | Hang (hangpham93) | 87.01 | 97% | 2019-07-21 |
3375. | Get (get_out) | 87.01 | 98% | 2020-03-31 |
3376. | Samsore (samsore) | 87.00 | 96% | 2022-10-14 |
3377. | Brandon (brandono2000) | 87.00 | 100% | 2022-11-15 |
3378. | Grenek (grenek) | 86.98 | 96% | 2021-12-22 |
3379. | Love you john (iliketotypef... | 86.98 | 97% | 2020-11-05 |
3380. | dennis (ludennis0606) | 86.97 | 98% | 2021-08-16 |
3381. | Azem (peja) | 86.97 | 100% | 2017-12-22 |
3382. | Zeke (zekealo) | 86.96 | 98% | 2022-12-30 |
3383. | Jave (killer8hyper) | 86.96 | 97.5% | 2023-11-18 |
3384. | johnbutactuallynotjohn (yes... | 86.95 | 99% | 2021-09-14 |
3385. | Eicy (eicymores) | 86.93 | 97% | 2024-01-15 |
3386. | Ayaz (ayazkhan) | 86.93 | 98% | 2021-05-06 |
3387. | leakcentral (leakcentral) | 86.93 | 98% | 2018-11-09 |
3388. | 🌠Rubby🌠(mikerubby) | 86.93 | 99% | 2018-05-22 |
3389. | Eldin (oktea) | 86.92 | 96% | 2021-02-23 |
3390. | Sam (yaboisam_) | 86.91 | 97% | 2022-03-28 |
3391. | Ion (incode4it) | 86.91 | 98.1% | 2021-02-03 |
3392. | ham (haaaaaaaam) | 86.91 | 96% | 2021-04-21 |
3393. | Lane (daymond) | 86.89 | 99% | 2019-11-21 |
3394. | Rarely type in my job (catc... | 86.89 | 99% | 2022-04-01 |
3395. | zyn (zezyn) | 86.89 | 97% | 2021-03-06 |
Universe | Races | Average WPM | First Race |
---|---|---|---|
Default (English) | 31,956 | 71.84 | January 13, 2017 |
Instant Death Mode | 173 | 78.29 | August 25, 2017 |
ᗜ Stenography | 2 | 82.16 | September 24, 2021 |
All TypeRacer Texts | 1 | 55.13 | April 21, 2022 |