Text #3621586

Moses supposes his toeses are roses, but Moses supposes erroneously. Moses he knowses his toeses aren't roses as Moses supposes his toeses to be.

—from Singin' in the Rain, a movie by by Stanley Donen, Gene Kelly

Active since January 13, 2017.
145 total characters in this text.

View Pit Stop page for this text

Leaders

View ranks through of 22,953
Rank Username WPM Accuracy Date
3960. Oneness (dreamtime) 87.10 99% 2021-12-16
3961. ouchies (evilemmelina) 87.09 98% 2019-04-10
3962. THE JEWELL (wildhorsesthe2nd) 87.09 99% 2019-01-24
3963. Ege (pxlwlkr) 87.09 98% 2024-05-05
3964. 799 (khs4126428) 87.08 96% 2025-02-23
3965. madman (2one6) 87.07 99% 2022-05-07
3966. itsyvincyspidr (itsyvincysp... 87.07 96% 2023-01-06
3967. dean (geedud2) 87.07 98% 2019-02-01
3968. timmoz (timmoz) 87.07 97% 2020-05-04
3969. ju yun (schylarker) 87.06 99% 2017-05-04
3970. altermetax (altermetax) 87.05 99% 2022-08-15
3971. TheShulkerBox (theshulkerbox) 87.03 97.1% 2025-03-09
3972. dileepthoutam (dileepthoutam) 87.03 98% 2022-11-24
3973. chansol (tychu) 87.03 91% 2017-02-05
3974. x (derpzz) 87.03 96% 2017-08-28
3975. Cat (catcatcatcatcatcatcatcat) 87.02 98% 2021-11-14
3976. Hououin Kyouma (makise_kuri... 87.01 95% 2023-10-09
3977. Hang (hangpham93) 87.01 97% 2019-07-21
3978. Get (get_out) 87.01 98% 2020-03-31
3979. Samsore (samsore) 87.00 96% 2022-10-14
3980. Brandon (brandono2000) 87.00 100% 2022-11-15
3981. Kisa (kysh1a) 86.98 97% 2024-11-25
3982. Grenek (grenek) 86.98 96% 2021-12-22
3983. Love you john (iliketotypef... 86.98 97% 2020-11-05
3984. dennis (ludennis0606) 86.97 98% 2021-08-16
3985. Azem (peja) 86.97 100% 2017-12-22
3986. Abhishek Jain (abhi_the_typer) 86.96 97% 2025-06-22
3987. Zeke (zekealo) 86.96 98% 2022-12-30
3988. Hex (amroph) 86.96 98.1% 2025-05-26
3989. 🅹🅰🆅🅴 (killer8hy... 86.96 97.5% 2023-11-18

Universes

Universe Races Average WPM First Race
Default (English) 37,503 72.39 January 13, 2017
Instant Death Mode 194 78.00 August 25, 2017
ᗜ Stenography 2 82.16 September 24, 2021
All TypeRacer Texts 1 55.13 April 21, 2022