November 2021

Sorted by average speed this month

Rank Username Races Month Best Race Wins Win %
1. FlaTrix (flatrix) 19 312.06 448.52 19 100.00
2. MTH (michaeltrayvonheckman) 3 245.46 258.67 3 100.00
3. 𒀱 make love, no war❤... 67 225.23 249.45 63 94.03
4. (joshua728) 762 221.42 310.07 728 95.54
5. iza (arabianghosthaunting) 215 220.94 281.09 147 68.37
6. Psylo (lysergico) 5 212.20 218.72 2 40.00
7. Firefingers (birthdaykids) 18 211.50 234.71 17 94.44
8. Jammie (typos_z) 249 203.76 273.89 245 98.39
9. (slowghost) 36 201.90 242.96 34 94.44
10. Chris Klenø (chrisnk) 4 194.26 199.94 3 75.00
11. Bailey (quitless) 1,394 191.68 251.98 1,346 96.56
12. the ë (inconsistency) 500 189.99 233.65 448 89.60
13. fish and chips (heavenseer) 113 185.62 220.51 96 84.96
14. unban me (flaneur) 1,822 184.67 282.30 795 43.63
15. Seph (hazedlol) 1 184.37 184.37 1 100.00
16. Sean Wrona (arenasnow2) 200 183.61 226.45 182 91.00
17. eiko (eikomaniac) 1 182.58 182.58 1 100.00
18. Rest in peace (michaeltrayv... 98 179.97 215.41 95 96.94
19. Izanagi (baguettianmysticism) 45 179.78 210.49 45 100.00
20. (0018) 1 178.99 178.99 1 100.00
21. rocket (mythicalrocket) 589 178.50 222.91 516 87.61
22. Vielle (arc_sec) 115 178.39 220.10 9 7.83
23. chillin (slekap) 14 177.62 218.43 10 71.43
24. Precarious, (precariousgray) 1 176.93 176.93 1 100.00
25. Supporting Israel (zombiesw... 606 176.20 256.87 436 71.95
26. Jammie (nonquit) (typos_zzz) 31 176.19 217.38 22 70.97
27. precarious (preciousgravy) 7 175.62 191.68 4 57.14
28. zzzr (zzzr) 1 175.47 175.47 1 100.00
29. Xeogran (xeogran) 38 172.82 198.75 35 92.11
30. Kelvin (syraxius) 3 172.04 173.66 3 100.00
31. Henry Ruggs (henryruggs) 14 171.65 188.95 13 92.86
32. flaneur (flaneurnq) 75 171.49 203.98 71 94.67
33. john (nothisisjohn) 738 170.54 205.37 687 93.09
34. stained (fartunderwear) 126 170.19 200.25 0 0.00
35. Chris (theavocado) 1 169.93 169.93 1 100.00
36. Andrei (_son_) 126 169.89 194.72 118 93.65
37. Andrei (elpelaodank) 121 169.24 204.35 101 83.47
38. (solov) 12 168.86 215.13 11 91.67
39. n (carlibou) 471 168.11 215.48 416 88.32
40. Volhosis (v... 2 167.94 169.73 0 0.00
41. tstats[freshfastjashe] (fre... 1,029 167.66 212.33 826 80.27
42. v3 (_v3_) 18 166.98 187.28 16 88.89
43. Abhi (abhib22) 6 166.97 176.33 6 100.00
44. leonidas (awsomaw) 16 166.65 190.62 5 31.25
45. 🏎️Zermist (90wpmomg) 2 166.07 173.27 1 50.00
46. chopper (chopper111) 1 166.04 166.04 1 100.00
47. Vignesh (vigneshc) 1 165.79 165.79 1 100.00
48. RadicalMacaroni (radicalmac... 1 165.57 165.57 1 100.00
49. angelo on mac (angeio) 21 164.89 183.93 19 90.48
50. S1 (s1s1s1) 1 164.65 164.65 1 100.00
51. Ibexus (ibexus) 421 164.27 208.60 388 92.16
52. 🇵🇸 (residober) 477 163.40 213.85 260 54.51
53. Josiah (josiahforever) 1 162.85 162.85 1 100.00
54. incendiary (returnoftheince... 197 162.81 196.84 177 89.85
55. nightingale (add4line) 178 162.62 213.93 150 84.27
56. ✨MTH Insane Typer✨ (jos... 66 162.40 201.84 57 86.36
57. Benjamin (bw1625) 3 162.26 164.03 0 0.00
58. Calculus (uchihalol) 106 162.20 196.11 8 7.55
59. Jordan (jordan2380) 116 161.91 196.32 0 0.00
60. 👀👀👀 (idakk) 1 161.70 161.70 1 100.00
61. Shoemaker-Levy 9 (atthetop) 325 161.64 231.45 227 69.85
62. nya (saber_ye) 4 161.48 172.15 1 25.00
63. ANDREA (andreaak00) 1 161.38 161.38 1 100.00
64. Sha (anything_goes) 6 161.35 166.37 3 50.00
65. tstats[ikjoshh] (ikjoshh) 2 161.31 173.89 2 100.00
66. Red (reddened) 4 160.54 170.77 4 100.00
67. Rohit (rogiti) 1 160.36 160.36 1 100.00
68. gian (gianthetaco) 13 160.27 173.69 11 84.62
69. rain (firewolfrain) 16 159.90 217.71 14 87.50
70. KFXSANDDLE (sandle) 2 159.72 168.17 2 100.00
71. 22Raptors (twentytworaptors) 1 159.68 159.68 1 100.00
72. YG Adam (adamallerton12) 5 159.45 168.59 0 0.00
73. RIP Zyzz (codecub) 13 159.43 187.60 10 76.92
74. (quadroopl) 43 159.40 185.48 27 62.79
75. LMFAOOOOOOOOOOOOOOOOOOOOOOO... 1 158.72 158.72 1 100.00
76. #FREEFLANEUR (oatzs) 435 158.71 203.40 372 85.52
77. (e6f4e37l) 602 158.13 213.08 533 88.54
78. Discord Bot: tinyurl.com/Ty... 1 157.83 157.83 1 100.00
79. (macieje) 309 157.48 206.11 264 85.44
80. ucsd_kid (trainermax) 22 157.18 183.32 19 86.36
81. vinnii (slowvinni) 147 157.12 193.00 119 80.95
82. 手很冷 (traben) 2,569 156.92 224.33 756 29.43
83. uks4nddl3 (accuracy2) 6 156.74 166.09 5 83.33
84. Aiden (kula_) 4 156.63 172.20 4 100.00
85. Leo (leo8786) 196 156.46 178.66 167 85.20
86. sierra (sierra05) 286 156.11 202.05 243 84.97
87. Tony (fluttersparkl) 1 155.83 155.83 1 100.00
88. (daniel598) 378 155.48 205.79 308 81.48
89. Guest (solovf) 36 155.36 205.65 32 88.89
90. Dowon (dowon) 348 155.29 193.47 298 85.63
91. Fouracle (fouracle) 299 155.23 188.96 265 88.63
92. Hiyoshi (hiyochan) 45 155.20 182.66 40 88.89
93. 🐍🐍🐍🐍🐍e (despot) 993 154.99 222.45 755 76.03
94. derusting (paradoxpigeon) 722 154.93 195.52 652 90.30
95. rain (rainnonquit) 20 154.92 178.95 18 90.00
96. (wildlife) 1 154.67 154.67 0 0.00
97. Brandon (brandinothefilipino) 3 154.55 167.75 1 33.33
98. Sam (sf424) 1 154.19 154.19 1 100.00
99. annac777 (annachiang4) 1 154.12 154.12 1 100.00
100. SaggiSponge (saggisponge) 5 154.12 168.68 5 100.00
101. leon (leonzalion) 169 154.03 211.71 28 16.57
102. (adma) 11 153.99 186.35 11 100.00
103. Miles (miles223) 75 153.98 185.62 62 82.67
104. Yamajac (yamajac) 9 153.74 166.82 0 0.00
105. Hafma (somaliangirl) 16 153.60 169.53 14 87.50
106. urchin (urchinonquit) 5 153.58 166.93 5 100.00
107. (ghall) 155 153.46 209.53 64 41.29
108. miss index (plorksauce) 1 153.26 153.26 1 100.00
109. (poke1) 9 153.24 171.45 9 100.00
110. Daniel (ssund) 1 153.11 153.11 1 100.00
111. Ella (chawahir) 171 152.94 181.26 114 66.67
112. Eugene (ptes77) 280 152.93 192.14 240 85.71
113. 🤫 (semajames) 202 152.85 195.47 162 80.20
114. bruh (bruhmoment8964) 54 152.60 172.84 47 87.04
115. Highly unskilled (intenseag... 32 152.54 201.70 20 62.50
116. Austin (chewzy) 3 152.43 167.58 1 33.33
117. (keegant) 22 152.27 180.56 4 18.18
118. [YT] toby (toby_is_fluffy) 1 152.22 152.22 0 0.00
119. Manfred (manfredxu99) 18 152.20 179.09 17 94.44
120. Ishark (ishark) 1 152.14 152.14 1 100.00
121. doremy (doremypuyotet) 11 152.03 180.08 9 81.82
122. areyouagirloraguymonkey (dw... 8 151.90 166.24 8 100.00
123. Steve (stev_cubed) 688 151.84 189.63 595 86.48
124. Kevin (moffitt) 70 151.74 173.14 61 87.14
125. Victor (jesuschrist2003) 1 151.73 151.73 1 100.00
126. не встретил бо... 38 151.56 166.12 34 89.47
127. Liban (hujala) 469 151.52 200.60 337 71.86
128. Anch (anch159) 6 151.47 160.57 5 83.33
129. amanogawa (lhykv) 74 151.47 186.27 60 81.08
130. wolff (gwolff) 31 151.40 175.67 25 80.65
131. RPUSam (rpusam) 19 151.38 160.44 18 94.74
132. Joshua (joshuawn) 54 151.28 180.63 43 79.63
133. cowsaysmoo2 (cowsaysmoo1) 1 151.21 151.21 1 100.00
134. Tatsky (tatskynuki) 10 151.19 191.75 6 60.00
135. Debunked (debunked) 1 150.87 150.87 1 100.00
136. spectating (minhxuan2507) 7 150.77 187.12 7 100.00
137. pausechamp (dindondoe) 244 150.76 221.67 172 70.49
138. Lawrence (drlawc2) 658 150.74 191.10 553 84.04
139. gluon (veryslowracer) 1 150.63 150.63 1 100.00
140. E (weihceinre) 670 150.57 202.92 558 83.28
141. reduce (xreduce) 7 150.44 163.72 7 100.00
142. Brandon (hereisausername2) 39 150.39 178.38 19 48.72
143. (dev_rec) 32 150.31 185.43 17 53.13
144. Huy (fobo911) 1 150.03 150.03 1 100.00
145. Tony (mysticalchime) 3 150.00 156.65 3 100.00
146. Jeffrey (descraton) 1 149.94 149.94 1 100.00
147. WatchDominion.org (lithox2) 2,573 149.93 207.24 1,095 42.56
148. Yu Chen (gohyuchen) 1 149.92 149.92 1 100.00
149. B (bz___) 39 149.86 196.51 26 66.67
150. dva main (thedragonemperor) 631 149.76 209.71 486 77.02
151. flaneur simp (inariii) 41 149.68 183.65 8 19.51
152. hotmama (enscarr) 331 149.63 231.98 244 73.72
153. pillows (hyluu) 9 149.61 167.97 8 88.89
154. Nikolas (nikolaslim) 3 149.60 167.18 3 100.00
155. 🌹 Black Rose 🌹 (rosew... 755 149.54 184.99 600 79.47
156. - (elliottmozley) 4 149.46 162.62 4 100.00
157. Sumit (smtchahal2) 1,628 149.44 193.79 1,348 82.80
158. Маершон (timeandsoul2) 190 149.41 196.34 158 83.16
159. Telekonesis (eirchue) 4 149.20 158.88 4 100.00
160. sfl (streetfighterlan123) 27 149.16 192.98 15 55.56
161. JIS filco stingray (sigel) 13 149.07 171.38 12 92.31
162. yamrawr (yamrawr) 10 148.98 167.45 7 70.00
163. Suzie (psychosuzie) 2 148.89 149.66 2 100.00
164. Shanon (shadowyshadows) 31 148.71 179.84 24 77.42
165. Serhii (skyiea) 5 148.66 158.86 4 80.00
166. Solomon (donutrk) 45 148.65 187.49 34 75.56
167. Ronnie (allyosaugh) 3 148.64 152.81 3 100.00
168. (pepeworm_colemak) 36 148.60 217.82 10 27.78
169. Elvis (krewe11a) 57 148.59 166.93 0 0.00
170. pasta (pastashapes) 1,075 148.50 269.30 757 70.42
171. brianbear (briand724080) 4 148.42 155.07 4 100.00
172. monkaS (ajcsphotos) 1 148.41 148.41 1 100.00
173. Qwerty (qwerty91994) 2 148.37 148.89 2 100.00
174. .georgy (add_me_on_discord) 2 148.31 151.40 1 50.00
175. YouTube: 8shaz8 (nonquit) 15 148.28 166.20 13 86.67
176. ♥ (boundaries) 403 148.18 222.61 5 1.24
177. Danan (dananbookworm) 4 148.18 150.82 4 100.00
178. Goomba (dragoomba) 14 148.16 166.18 7 50.00
179. de (paradoxpigeonlaptop) 57 147.99 193.51 35 61.40
180. jimjom (jimysucks) 150 147.98 187.38 122 81.33
181. Petar (petars) 47 147.81 192.88 30 63.83
182. Luna (lunamai) 2 147.77 174.55 2 100.00
183. TypingSince2017 (expeditive) 129 147.70 184.96 98 75.97
184. Maydup (maydup_naim) 1 147.64 147.64 1 100.00
185. zealody (zackrobot) 1 147.55 147.55 0 0.00
186. Richard (iliveinthexu) 11 147.55 158.38 9 81.82
187. Babyoven (babyoven) 1 147.53 147.53 1 100.00
188. Alex (sphincture) 1 147.34 147.34 1 100.00
189. M A T I A S (praise_duarte) 7 147.33 178.53 5 71.43
190. Vincent (v1ncent) 93 147.32 174.95 74 79.57
191. Jessveness (jessiveness) 2 147.27 154.89 2 100.00
192. Penguino (cspenguino) 62 147.26 168.97 50 80.65
193. BESTYINA (vdud3) 21 146.90 165.68 17 80.95
194. Bbbbbbbbb (boohaw) 105 146.80 185.10 80 76.19
195. ㅤ (irlgoob) 2 146.79 155.93 2 100.00
196. Rest Easy Byron (keatonsmith) 102 146.73 178.11 83 81.37
197. Bobae (bobaec) 1 146.70 146.70 1 100.00
198. laptopwinterpro (justanothe... 117 146.69 168.37 84 71.79
199. Johnny (bananabonger) 4 146.64 165.54 3 75.00
200. Hide (hide_on_bush_ml) 1 146.53 146.53 1 100.00
201. Rui (leonsuper) 1 146.49 146.49 1 100.00
202. Leonardo (hreppy) 2 146.46 160.04 2 100.00
203. andy (andytixn) 75 146.44 194.75 55 73.33
204. tsukasa chan and nasa kun (... 40 146.36 223.70 25 62.50
205. Ryan (wow963) 12 146.26 164.67 11 91.67
206. asdfjkl; (deskripper) 704 146.26 201.84 536 76.14
207. Justin (dunklioscious) 268 146.23 185.85 196 73.13
208. Clit (cliffcatastrophe) 9 146.20 161.46 4 44.44
209. soundcloud.com/sitara4ever ... 293 146.15 188.92 233 79.52
210. Eggnog (y0ink) 3 146.11 161.84 1 33.33
211. cryptid (naturalcryptid) 9 145.91 174.37 8 88.89
212. cody (jiji247) 30 145.81 163.33 23 76.67
213. CrispTea (distance) 5 145.73 161.47 5 100.00
214. accongero (geononquit) 271 145.64 196.28 183 67.53
215. NightOwl (nightowl2312) 2 145.63 151.52 2 100.00
216. meow (xrelative) 1,743 145.56 202.54 1,387 79.58
217. Renardo (renarded) 66 145.50 188.54 34 51.52
218. improving (gumbolaya) 91 145.49 170.49 14 15.38
219. Zero (0gundam) 8 145.45 169.58 7 87.50
220. RIP BYRON (sk8terboi723) 715 145.43 187.97 540 75.52
221. hi im merm!! (mermed) 3 145.28 150.69 3 100.00
222. Aqua (aquablitz11) 1 145.23 145.23 0 0.00
223. John666695 (john666695) 5 145.06 158.92 4 80.00
224. quack (shinonin) 382 145.05 166.00 287 75.13
225. hi klist (iamslow103) 396 145.03 217.38 367 92.68
226. Iris (irxs_q) 17 145.02 168.48 14 82.35
227. king (kingstealth) 1 144.95 144.95 1 100.00
228. Jacob (pieceofjake) 1 144.90 144.90 1 100.00
229. nothing (galaxiedhomerow) 24 144.83 178.11 18 75.00
230. creative (idoofus123) 10 144.74 158.69 5 50.00
231. Lauren (lauren) 5 144.67 157.65 4 80.00
232. lokar (lokar123) 22 144.66 178.80 13 59.09
233. Julian (disclo5ure) 3 144.65 146.39 3 100.00
234. john (goinbr0ke) 1 144.60 144.60 1 100.00
235. Marm (slayerxy) 97 144.59 172.00 69 71.13
236. Bucecean (blaskowiscz) 11 144.46 189.80 7 63.64
237. ​ (vonunov) 7 144.33 164.03 2 28.57
238. Liban (hujala1) 60 144.19 173.54 45 75.00
239. Calistus (calistus) 1 144.17 144.17 0 0.00
240. Hreyfill Hreyfill (hreyfill) 42 144.13 180.23 35 83.33
241. Doyle (dzhsck) 1 144.13 144.13 1 100.00
242. J (iwantmedals) 1 144.09 144.09 1 100.00
243. cetewyn (cetewyn_) 1 143.98 143.98 0 0.00
244. Sanji (sanjiwatsuki) 1 143.97 143.97 1 100.00
245. disheyo (shakura) 1 143.94 143.94 1 100.00
246. hu (crediblez) 124 143.90 190.09 89 71.77
247. mm (613sadnesses) 23 143.84 171.05 15 65.22
248. j (droozyayayaya) 10 143.83 161.89 8 80.00
249. Gary (traeyoung) 28 143.78 171.50 20 71.43
250. shuffled neurons (spicytuna1) 1,036 143.75 194.81 69 6.66
251. TTMo1 (ttmer) 37 143.58 187.08 30 81.08
252. Sachin (ragemodeon) 473 143.57 198.77 363 76.74
253. (timjeffery44) 219 143.55 268.06 183 83.56
254. zetria (primalknight) 49 143.50 169.47 33 67.35
255. edweenie (edweenie) 1 143.47 143.47 1 100.00
256. Timothy (12tqian) 1 143.45 143.45 1 100.00
257. Disco (shellahfellah) 1 143.44 143.44 0 0.00
258. Tommy (cowgoesbawk) 1 143.40 143.40 1 100.00
259. Ryan (relaxin) 213 143.23 181.36 131 61.50
260. Alpine (relambrien) 144 143.20 176.50 106 73.61
261. guy (grayeyes) 433 143.11 179.37 319 73.67
262. bob (bobobb) 11 142.93 169.74 10 90.91
263. Caffebar kb lmao! (baccupacc) 237 142.80 172.17 182 76.79
264. akira (hoshinoakira) 1 142.69 142.69 1 100.00
265. ukimub (ukimub) 64 142.68 157.77 44 68.75
266. Ed (ewardabaus) 3 142.66 154.93 3 100.00
267. 😳hotmama😫 (h0tmama) 300 142.56 185.24 229 76.33
268. kitty (hiimakitty) 2 142.51 145.56 2 100.00
269. Jester (jestertyper) 40 142.46 175.43 24 60.00
270. jsc (cjs0712) 1 142.36 142.36 1 100.00
271. cake (cake0) 13 142.24 163.49 13 100.00
272. S (saifxhatem) 1 142.11 142.11 1 100.00
273. buljangnan (springrolls) 6 142.10 148.14 5 83.33
274. Sean (blackandwhitemuppet) 8 142.09 155.35 5 62.50
275. Graf (graf) 2 142.04 145.79 0 0.00
276. Marco (marcotheboy) 6 142.00 161.45 6 100.00
277. Go Easy on Me (ripparian) 1 141.90 141.90 1 100.00
278. Kowala Bear (gaverpro) 29 141.83 168.60 20 68.97
279. jivanf (jivan108) 60 141.79 178.93 47 78.33
280. snackmancer (snackmancer) 122 141.77 165.38 93 76.23
281. average rice enjoyer (kireg... 96 141.68 190.60 33 34.38
282. Tubby (tubbsters) 9 141.61 160.84 8 88.89
283. swagatron (swagatron7000) 181 141.61 169.56 123 67.96
284. Jean (xjean) 2 141.56 146.50 1 50.00
285. Fillmoore (fillmoore) 2 141.53 145.64 2 100.00
286. wy (randumbtyper) 15 141.49 160.75 13 86.67
287. J (juuhhhstin) 323 141.41 166.88 263 81.42
288. munkeontop (revvitt) 263 141.39 169.47 180 68.44
289. long bus (sealegs) 11 141.36 154.43 9 81.82
290. Hywell (cryotalis) 5 141.30 151.00 4 80.00
291. Dipslox (disciple_yt) 1 141.28 141.28 1 100.00
292. Sean (poisonlance) 1 141.27 141.27 1 100.00
293. Feris (merelyaferis) 157 141.26 179.23 119 75.80
294. Tony (tpark1218) 1 141.22 141.22 1 100.00
295. paoseirjaspeiojr (chqnges) 203 141.14 173.40 150 73.89
296. hahah (hahahahahahaaaaa) 16 141.12 156.61 15 93.75
297. V (tall_in_spirit) 16 141.07 158.97 12 75.00
298. Anon (jeff10) 69 141.02 173.22 63 91.30
299. aaaaaaaaaaa (mintlyowo) 94 140.93 185.41 71 75.53
300. d-Raww (swagtyper123) 2 140.93 147.11 1 50.00
301. Meruem (meruem1919) 32 140.92 173.02 23 71.88
302. slowpacito (slowpacito) 50 140.91 173.35 40 80.00
303. (boy_314) 150 140.89 169.64 101 67.33
304. neverbreaking170 (ivan28283) 10 140.80 161.28 6 60.00
305. ¯\_(ツ)_/¯ (nopatno) 44 140.74 189.90 31 70.45
306. Max (maxattack) 1 140.70 140.70 1 100.00
307. Greg (vertcanard) 1 140.68 140.68 1 100.00
308. T (rumikasa) 17 140.68 168.01 17 100.00
309. s3rez (s3rez) 1,238 140.65 186.85 967 78.11
310. Rye (riett) 4 140.65 161.70 2 50.00
311. (bribe) 4 140.64 150.40 4 100.00
312. Ricky (ricky54326) 3 140.59 146.98 3 100.00
313. Heaven (defintelynotjah) 5 140.59 152.55 5 100.00
314. Ronan (ironan) 13 140.55 179.95 11 84.62
315. paperboy ditty (wordracer888) 2,864 140.45 191.79 1,968 68.72
316. aerora (imqyuu) 9 140.41 157.78 9 100.00
317. RIP Byron (sir_rebral_palsy) 194 140.36 180.69 139 71.65
318. erakai (erakai) 70 140.34 171.34 48 68.57
319. csgo (professorxwing) 475 140.33 186.56 331 69.68
320. Jason (weekly5112) 2 140.18 144.46 1 50.00
321. Vinh (vinhpham8598nt) 5 140.12 148.17 3 60.00
322. Mrotaku (mrotaku) 4 140.09 156.19 3 75.00
323. Hansol (hansol) 6 140.05 160.25 3 50.00
324. Colby (ctgap) 10 140.01 152.06 8 80.00
325. sdfsdf (frogchan) 1 139.99 139.99 1 100.00
326. 🧀 Chez (super_not_pro) 279 139.94 174.14 213 76.34
327. New - by Present (vfctyrant) 27 139.91 159.73 24 88.89
328. HyattOcto (hyattocto) 5 139.88 165.68 3 60.00
329. AJ (sacrificials) 3 139.86 173.58 2 66.67
330. michael (ngmich) 3 139.84 151.51 3 100.00
331. Ryan Kim (gardenhoe) 3 139.83 151.42 0 0.00
332. Rohan B. (linuxman_linux) 94 139.79 174.64 78 82.98
333. xvi (mrasianboy) 25 139.76 164.00 17 68.00
334. Dylan (dr_gammaray) 399 139.68 173.28 282 70.68
335. sherry (serulii) 1 139.65 139.65 1 100.00
336. leah (leannah) 3 139.63 161.94 2 66.67
337. ნიცკა ✌ (nickga... 5 139.45 146.04 5 100.00
338. Jee Hoon (jeehoonoh) 322 139.43 193.61 243 75.47
339. Giovanni (giosda) 35 139.36 179.94 23 65.71
340. cosmix (cosmix) 3 139.32 156.32 3 100.00
341. MadsFuldGhoul (swaax) 19 139.32 160.32 17 89.47
342. Tsukasa@dvorak (melot) 2 139.30 141.07 2 100.00
343. Ben (intenex) 1 139.29 139.29 1 100.00
344. user (user199012) 15 139.21 190.97 11 73.33
345. Don (dpease7894) 7 139.14 149.05 5 71.43
346. how 2 type faster? (not_seg... 317 139.14 169.93 247 77.92
347. Thomas (palsgod) 57 138.99 164.84 46 80.70
348. brindobob (brindobob) 34 138.97 160.83 27 79.41
349. k3n (k3nnn) 27 138.95 152.38 20 74.07
350. Hannah (hann5h) 15 138.88 157.75 10 66.67
351. Lando Commando (360curve) 2 138.88 144.25 1 50.00
352. Zagorath (zagorath) 1 138.86 138.86 1 100.00
353. Henry (ablacksmoothie) 1 138.68 138.68 1 100.00
354. hengoat (bagnana) 1 138.65 138.65 1 100.00
355. Wesley (hyperwes) 3 138.63 154.78 2 66.67
356. Roadsweeper Dropping D; (ka... 476 138.53 183.12 344 72.27
357. (mononym_jisoo) 1,862 138.50 228.44 1,803 96.83
358. No quitting mid race (ersatz) 6 138.45 144.41 5 83.33
359. Justin (trudeaucooks) 29 138.37 195.76 22 75.86
360. Mok (mokmoon) 2 138.35 146.30 0 0.00
361. Stuart (crazystu) 1 138.34 138.34 1 100.00
362. Satis (angpogikotalaga123) 25 138.05 156.29 15 60.00
363. Noah (noah_o_n) 2 138.03 139.85 0 0.00
364. Alex (pentalex) 4 137.96 152.98 4 100.00
365. NiteCyperTTV (nitecyper2) 774 137.90 180.98 555 71.71
366. Lewis (znake) 5 137.80 140.57 3 60.00
367. hihihi (tjddb123456) 10 137.77 149.04 7 70.00
368. Rico (hehel3x) 1 137.73 137.73 1 100.00
369. Kevin (ashret) 22 137.70 169.02 19 86.36
370. Triklino (triklino) 255 137.66 183.78 183 71.76
371. Saso McDaso (justtypefast) 16 137.64 161.47 13 81.25
372. Creamy (cheesebutt69) 3 137.62 145.91 3 100.00
373. Danny (beegd) 189 137.62 184.50 154 81.48
374. basic (paperscraps) 1 137.59 137.59 0 0.00
375. (klaritix) 16 137.58 167.33 12 75.00
376. (ginoo75) 1,427 137.55 249.12 1,057 74.07
377. LY (ngly) 4 137.46 150.08 4 100.00
378. panda bear (astronicus) 9 137.42 147.81 6 66.67
379. me type gud (coltvhd) 3 137.42 142.83 3 100.00
380. Davi (dusk_09) 11 137.41 152.87 7 63.64
381. (nnas) 204 137.39 164.68 165 80.88
382. Kingreformed (kingreformed) 1 137.38 137.38 1 100.00
383. stay fresh cheese bags (maw... 30 137.38 157.12 22 73.33
384. ℮ (nicepal) 29 137.30 155.75 22 75.86
385. ♠️ lastofspades (lastof... 15 137.26 150.45 11 73.33
386. Huskiez (husky123) 1 137.24 137.24 0 0.00
387. eat my dust, quitters! (pla... 750 137.21 170.19 515 68.67
388. vck3000 (vck3000) 1 137.21 137.21 1 100.00
389. Gamer (reallyrandomname) 25 137.14 168.63 21 84.00
390. Epzilon (epzilonn) 46 137.12 163.22 38 82.61
391. nakkooo (kuudere) 130 137.10 183.15 90 69.23
392. akelok (akelok) 2 137.07 138.76 2 100.00
393. Zach (jugglinguy) 5 137.05 145.88 4 80.00
394. Howard (papertofu) 99 137.01 164.59 75 75.76
395. and we light up the sky (th... 102 136.97 169.28 77 75.49
396. Ram (moonify) 3 136.91 142.44 2 66.67
397. groundbeaf (groundbeaf) 4 136.88 157.41 3 75.00
398. Lee (cytokid101) 19 136.80 159.07 13 68.42
399. Procrastinator (the_procras... 6 136.74 151.37 4 66.67
400. road_to_150wpm (road_2_150wpm) 7 136.73 147.45 5 71.43
401. Jiahui (jumban) 4 136.69 146.33 3 75.00
402. enfonius (wssh) 15 136.68 162.85 0 0.00
403. Alan (allanafdn) 8 136.62 153.43 3 37.50
404. nmyo (nmyo) 3 136.60 143.73 3 100.00
405. Mauro (chunkerchunk) 53 136.58 156.01 36 67.92
406. Jinho (jinh0) 2 136.53 143.23 1 50.00
407. Joseph (rhubarbasia) 2 136.51 144.32 1 50.00
408. Josh (joshuazhu516) 16 136.50 165.95 6 37.50
409. Cory (tarisant) 7 136.49 148.05 7 100.00
410. tstats[shishoro] (shishoro) 2 136.48 149.17 1 50.00
411. Christian (krisco) 10 136.47 156.38 4 40.00
412. Dream (dreamscorcherx) 1 136.46 136.46 0 0.00
413. CVH (cvh_) 140 136.45 163.05 106 75.71
414. PIXI (pixipixi) 19 136.43 176.90 11 57.89
415. snails (hovermind) 6 136.40 145.44 6 100.00
416. Benj (noodlicious) 1 136.36 136.36 0 0.00
417. Edward (edwardw21) 115 136.32 167.24 74 64.35
418. Rin (komorebi2) 87 136.26 191.51 48 55.17
419. Gene (mckuletzz) 186 136.17 164.93 141 75.81
420. ky (kyajin) 3 136.12 144.74 0 0.00
421. u8y7541 (u8y7541) 37 136.10 160.55 25 67.57
422. रोहित सिं... 14 136.08 156.85 10 71.43
423. Kalap (zenithorigin) 17 135.99 160.74 14 82.35
424. Daniel (intangiblesniper) 25 135.94 167.94 18 72.00
425. . (chocolatina) 456 135.90 190.73 297 65.13
426. Adwyn (dkmplz) 4 135.88 150.91 4 100.00
427. elongated (supreme10001) 110 135.84 161.43 67 60.91
428. pepe (pepesaiko) 2 135.78 147.73 2 100.00
429. Thank you, (maintrack) 122 135.72 176.94 78 63.93
430. Justin (agent_jl) 18 135.69 149.06 11 61.11
431. Brocli (brocli) 1 135.68 135.68 1 100.00
432. nwieuv (nwieuv) 68 135.68 162.53 51 75.00
433. Identitylessness (power_punch) 484 135.67 209.17 456 94.21
434. phlofy (phlofy) 687 135.66 183.84 479 69.72
435. Vladimir (vladimirrl) 3 135.66 154.38 3 100.00
436. SalmanMKC (hellothen) 61 135.57 177.10 9 14.75
437. Cygnus (cygnuss) 45 135.57 161.12 32 71.11
438. kream (remmie2k) 2 135.57 135.65 1 50.00
439. chefshatonyou (chefshatonyou) 1 135.53 135.53 0 0.00
440. slow account (pasta2) 51 135.47 167.58 21 41.18
441. beachill (beachill) 2 135.45 147.80 2 100.00
442. Michael (michaelskyba) 8 135.44 149.16 3 37.50
443. Elon (elonzenub) 1 135.40 135.40 1 100.00
444. Esophose (esophose) 14 135.36 157.28 9 64.29
445. I'm so slow (beastasfiist) 21 135.35 162.32 14 66.67
446. bryan (bczw) 220 135.33 162.62 173 78.64
447. Chris Klenø (sircw) 36 135.33 172.14 29 80.56
448. Daquavian (flygoat) 2 135.33 148.03 2 100.00
449. Zaniac (zaniac10) 4 135.31 145.45 2 50.00
450. MB (mbmasher) 5 135.30 155.21 3 60.00
451. Albert (oomydoomers) 2 135.25 151.67 2 100.00
452. Pikachu (pikachutron3000) 2 135.24 142.16 2 100.00
453. Brandon (killercucumber) 2 135.24 139.17 1 50.00
454. Angry Birds (tixwmmy) 1 135.22 135.22 1 100.00
455. Jon (jlachney) 141 135.20 174.23 96 68.09
456. Ryekane🖤 (lechepapu) 22 135.03 164.86 8 36.36
457. Juudge (reburm) 13 135.01 152.28 10 76.92
458. Gene (orange_oldfish) 7 134.99 153.78 6 85.71
459. John (johnmarquez1706) 1 134.94 134.94 1 100.00
460. IHnanah (hanahaoha) 19 134.92 176.36 16 84.21
461. Hnnnnngh (frostequinox) 91 134.89 157.74 66 72.53
462. Jin (jchoi1994) 10 134.88 152.29 9 90.00
463. Ali (medtype) 83 134.87 164.68 55 66.27
464. Whitley (gingersnack) 2 134.83 148.82 2 100.00
465. (egahbh) 42 134.81 153.40 28 66.67
466. Jo (whiffking) 6 134.79 149.52 3 50.00
467. anntaylor (anntaylorn) 20 134.77 172.29 17 85.00
468. my fingers hurt (voltwitz) 24 134.71 151.91 18 75.00
469. (poem) 3,453 134.69 207.30 2,183 63.22
470. ICANNOTLOSE (icannotlose) 9 134.63 169.24 6 66.67
471. Jumpye (jumpye) 26 134.62 157.71 18 69.23
472. Adam (xuxiym) 14 134.62 158.63 12 85.71
473. michael (slowtypist199) 368 134.61 170.94 214 58.15
474. Mitch (toddlerdust) 26 134.49 149.07 0 0.00
475. noise (dp123) 73 134.48 177.15 52 71.23
476. alex (disappointd) 2 134.44 138.83 1 50.00
477. Amelia (littlebighaha) 2 134.43 136.80 2 100.00
478. Minh (fingies_thingies) 1 134.41 134.41 1 100.00
479. DoctorN0gloff (doctorn0gloff) 13 134.38 156.19 9 69.23
480. Jamie (fryo) 4 134.35 151.23 2 50.00
481. Mr. lee's expository writin... 20 134.35 148.58 15 75.00
482. FREE PALESTINE (barfing) 141 134.32 168.93 96 68.09
483. Auralis (auralis) 2 134.30 155.08 2 100.00
484. kiyeo (kiyeo) 1 134.27 134.27 1 100.00
485. giovane thug (giovvah) 44 134.25 147.90 29 65.91
486. Troy (troyvimala) 1 134.21 134.21 1 100.00
487. matt (drakkus) 3 134.21 141.25 2 66.67
488. EMCL (emcl) 3 134.19 146.90 3 100.00
489. qwerty (love2sing) 5 134.15 147.26 5 100.00
490. diya (mixxanber) 9 134.14 167.32 6 66.67
491. North (0azimuth) 2 134.12 153.02 2 100.00
492. Jason (jihoon222) 21 134.10 150.88 19 90.48
493. Clare (cygrnt) 1 134.10 134.10 0 0.00
494. Swaggy (xiarnaq) 9 134.08 172.10 8 88.89
495. itypeabove130only (itypeabo... 31 134.05 157.89 19 61.29
496. pat (trikster) 146 134.05 164.96 100 68.49
497. 🌈 (shug_op) 1 134.04 134.04 1 100.00
498. SHO (shoganeko) 1 134.01 134.01 1 100.00
499. 🎈 (typing_badly) 95 133.99 162.56 55 57.89
500. Silent_One (get_a_lif3) 298 133.97 170.26 219 73.49
501. ✔️▄◘🚀!new_luca@y... 56 133.95 214.36 34 60.71
502. Joshua (j1_kkk) 3 133.95 151.22 1 33.33
503. Thomas (loboru) 146 133.92 168.71 109 74.66
504. Harry (h3h3pul4t0r) 7 133.87 139.02 4 57.14
505. strange (strangeeggs) 19 133.86 165.74 8 42.11
506. 🚀 (aqua_desu) 28 133.79 158.94 18 64.29
507. Jacob (bizarrecake) 1 133.76 133.76 1 100.00
508. Alexander (timmy542) 1 133.75 133.75 1 100.00
509. Charlotte (videogame_hacker) 34 133.74 161.56 28 82.35
510. abigail (abigail_w) 113 133.72 151.26 71 62.83
511. (welltwell) 384 133.70 177.19 279 72.66
512. kintsukuroi (jae_san) 2 133.66 138.96 1 50.00
513. inconsistent (potangina666) 477 133.64 169.88 357 74.84
514. Kyle (rasktastatur) 1 133.63 133.63 1 100.00
515. inhalement (roger4190) 5 133.60 155.92 3 60.00
516. Alpha (alpha5466) 3 133.58 146.31 3 100.00
517. VY (india_vikas_yadav) 119 133.58 160.68 88 73.95
518. Ahmad (slayman19) 42 133.57 168.27 27 64.29
519. jawn (turtlesrule) 200 133.51 173.00 125 62.50
520. napkin (call_me_napkin) 70 133.51 169.54 41 58.57
521. chanden (chanden) 6 133.48 144.92 5 83.33
522. david (dafearn) 4 133.42 159.48 3 75.00
523. Samuel (minikloon) 2 133.33 141.16 1 50.00
524. Michael (fl4mx) 3 133.32 148.59 3 100.00
525. F (veneda24) 2 133.31 140.40 1 50.00
526. shack (shacklos) 1 133.23 133.23 1 100.00
527. (g_fruit) 85 133.21 157.55 60 70.59
528. Arya (aryas) 1 133.21 133.21 1 100.00
529. hugh jass (milkyxing) 1 133.19 133.19 0 0.00
530. Chris (chrishewson) 1,402 133.17 169.84 988 70.47
531. Jun (impressed) 3 133.16 142.46 1 33.33
532. tstats[siriusvega] (siriusv... 648 133.15 168.96 452 69.75
533. ray16k (ray16k) 14 133.09 146.29 10 71.43
534. 👺John Lachney (valikor) 3 133.05 138.87 3 100.00
535. ok (laggyfeetshake123) 74 133.01 161.00 49 66.22
536. M310N (leomelonseeds) 1 133.00 133.00 0 0.00
537. Litevex (litevvx) 8 133.00 150.02 5 62.50
538. Josh (xxldaddy69) 9 132.97 139.32 9 100.00
539. Eric (appleipad556) 20 132.93 147.26 17 85.00
540. Kasper (kaspertypes) 79 132.91 168.48 58 73.42
541. Trying (sakurya) 155 132.87 163.14 102 65.81
542. Ian (ian1806) 28 132.87 150.74 15 53.57
543. Jonathan (insanegamerwow) 240 132.85 167.10 173 72.08
544. fhbjnrng (fhbjnrng) 144 132.83 164.66 115 79.86
545. Marcelo Gomes (asyeok) 2 132.79 136.46 0 0.00
546. (paceyq) 845 132.77 172.58 547 64.73
547. Dominic (dominiccarroll) 7 132.77 151.08 3 42.86
548. Thege (thegenericbanana) 4 132.76 139.31 3 75.00
549. follow (deleonhle) 7 132.74 145.94 4 57.14
550. rookie (rookiespade) 1 132.73 132.73 1 100.00
551. Liz (liasokol) 513 132.68 189.86 328 63.94
552. Ayden (keetchi3) 4 132.65 145.32 3 75.00
553. (zealindaus) 105 132.64 164.72 87 82.86
554. redzic (super33) 1 132.63 132.63 1 100.00
555. Kevin (kevinity) 7 132.62 141.05 7 100.00
556. 🐟🐟🐟🐟hn (deliber... 3,509 132.61 171.45 2,279 64.95
557. Your Mom (imgonnalose69) 7 132.60 141.30 6 85.71
558. Joshua (windpiggy) 1 132.50 132.50 1 100.00
559. Daniel (d_nny) 1 132.48 132.48 1 100.00
560. J (jakobam) 8 132.40 144.90 6 75.00
561. Benjamin (benjaminwu) 4 132.40 140.89 4 100.00
562. Travis (sixyn) 3 132.39 154.93 2 66.67
563. Arlene (arlenieeweenie) 49 132.39 165.75 35 71.43
564. Oxoxrut (oxoxrut) 1 132.38 132.38 1 100.00
565. Aakash (srinivasan41) 64 132.37 167.18 49 76.56
566. Niko (varial) 21 132.33 154.77 17 80.95
567. 297 (flightsim297) 9 132.29 161.89 8 88.89
568. work in (work_in_progress) 3 132.28 150.10 3 100.00
569. race_me_now (I miss Czy) (r... 3 132.23 150.32 3 100.00
570. DogHole (doghole) 25 132.23 176.60 14 56.00
571. dexdexdex (dexdexdex) 2 132.21 139.81 1 50.00
572. Sean (seanshawn198) 9 132.20 146.32 8 88.89
573. aoeu (dengzacd) 38 132.19 152.75 21 55.26
574. t (tomn114) 27 132.18 154.88 16 59.26
575. Caleb (miniso0987) 128 132.14 164.26 53 41.41
576. Rika (infric) 735 132.11 161.68 36 4.90
577. Brian (a_job_well_done) 16 132.07 141.19 12 75.00
578. kekw (kekwomegalul) 920 132.07 173.98 638 69.35
579. (accelerated) 23 132.06 150.16 18 78.26
580. Rafael (fegelein1234) 226 132.02 169.54 167 73.89
581. Matthew (courtreporter) 1 132.01 132.01 1 100.00
582. Radius (d4iry) 51 131.99 172.61 35 68.63
583. Kevin (kchoy) 5 131.94 148.01 3 60.00
584. hi (watlok) 37 131.93 159.04 20 54.05
585. (charlieog) 1,428 131.92 224.05 1,052 73.67
586. (c_xor) 438 131.90 179.93 293 66.89
587. - (airplane100) 4 131.89 146.83 3 75.00
588. Curtis (obeseocean) 3 131.88 136.05 2 66.67
589. Adora (adorablebanana) 8 131.86 145.81 7 87.50
590. marsh (yepeyi) 55 131.86 155.37 34 61.82
591. Sara (alphathealpha) 2 131.86 140.13 2 100.00
592. Jesse (myoga) 1 131.81 131.81 1 100.00
593. 16/f/cali (ultrashibe) 357 131.80 171.33 233 65.27
594. Phil (miss_you_reck) 122 131.79 153.07 91 74.59
595. Nick (anc708) 3 131.78 141.41 3 100.00
596. wrists parallel (cheffray) 1,929 131.77 177.70 1,257 65.16
597. chobo (hi_im_chobo) 1 131.76 131.76 1 100.00
598. wojtek (kwojtek14) 6 131.74 136.20 4 66.67
599. electricas (electricas) 1 131.71 131.71 1 100.00
600. Rarw. (zambodia) 4 131.71 133.63 1 25.00
601. waxman (waxman69) 2 131.70 135.34 1 50.00
602. Raledude (raledude) 1 131.69 131.69 1 100.00
603. Justin (justinjd) 7 131.66 146.02 5 71.43
604. HTT (diamond99007) 4 131.66 135.41 3 75.00
605. always_choking (leadmen4y) 10 131.65 145.12 9 90.00
606. Pawi (pawiboy36) 6 131.63 152.13 3 50.00
607. Tokugawa (tokugawapants) 28 131.61 152.08 17 60.71
608. Kevin (greenleafy) 13 131.59 152.44 8 61.54
609. G (runnerbeany) 1 131.48 131.48 1 100.00
610. Joe (rufu) 8 131.46 158.41 7 87.50
611. scapegoat (realscapegoat) 3 131.45 144.43 3 100.00
612. Cepheus's 🌌 (parkevan27) 1,434 131.43 175.04 881 61.44
613. kweg (kweg) 9 131.43 148.79 4 44.44
614. IQ1537 (iq1537) 9 131.41 146.28 7 77.78
615. YowzaH (yowzah) 8 131.38 146.23 6 75.00
616. Migsgd (migelawan123) 34 131.34 151.21 27 79.41
617. Bob (jeusushimself) 2 131.34 141.96 0 0.00
618. Adrian (orangebase) 21 131.34 147.57 15 71.43
619. RJ (rjem) 1 131.32 131.32 1 100.00
620. L (easymoneysniper1) 920 131.31 184.00 556 60.43
621. Chaos (numerodos) 101 131.30 161.81 70 69.31
622. Kevin (skarl) 1 131.29 131.29 1 100.00
623. e (javascriptdude) 10 131.29 156.50 6 60.00
624. Enzoo (enderboyx200) 14 131.27 140.68 11 78.57
625. steveleeb (steveleeb) 43 131.27 152.07 22 51.16
626. Kyle (kcoppola19) 4 131.25 135.96 3 75.00
627. RIP Byron (enriquecollin) 19 131.24 155.19 11 57.89
628. Resync (resync) 3 131.24 141.57 1 33.33
629. Jordan (marceless) 11 131.19 140.70 9 81.82
630. cooper1289 (cooper1289) 10 131.18 143.88 5 50.00
631. (jannis) 5 131.15 141.14 2 40.00
632. something (kaibaboi) 442 131.14 171.34 47 10.63
633. jude (judepls) 18 131.14 147.02 11 61.11
634. José Luis (jlxip) 1 131.14 131.14 1 100.00
635. Jake (truejake) 3 131.07 143.87 3 100.00
636. ㅤ (clarified) 11 131.02 145.38 4 36.36
637. nyaa~ (nakkooo) 10 131.02 173.70 6 60.00
638. luap (nocturnalzek) 1 131.01 131.01 1 100.00
639. (evestay) 6 130.98 147.14 4 66.67
640. Justin (juicet1n2) 46 130.98 155.08 27 58.70
641. Keyma.sh is better (ryleyx... 154 130.92 155.77 93 60.39
642. Airee (fillyharmonica) 2 130.91 133.91 2 100.00
643. intermediate 2029 (darkis99) 6 130.83 147.02 3 50.00
644. Evan (ezb2661) 1 130.80 130.80 1 100.00
645. (dispidi) 430 130.75 179.62 287 66.74
646. Rip reckful (moudizg) 3 130.73 138.30 3 100.00
647. (fafadoodle) 3 130.71 146.05 3 100.00
648. Joshua (thesensinator) 3 130.71 134.10 2 66.67
649. Jay (thelawsofjay) 41 130.68 155.15 29 70.73
650. Christian (chrisshaw) 43 130.65 154.63 29 67.44
651. artahian (aram90) 7 130.61 148.08 4 57.14
652. :^) (kyeavnign) 212 130.60 176.13 148 69.81
653. Eric the Topre King (wanger... 12 130.59 155.96 9 75.00
654. Niklas (bigerius) 1 130.57 130.57 1 100.00
655. w (wonton2) 142 130.54 155.90 93 65.49
656. Hawky (itshawky) 92 130.54 158.53 62 67.39
657. skippi (skippie) 788 130.53 175.06 490 62.18
658. (bummered) 20 130.52 168.87 10 50.00
659. Brian (bchoy1994) 1 130.52 130.52 1 100.00
660. Kyle (kapleer) 1 130.52 130.52 0 0.00
661. gokewho (gokewho) 20 130.52 150.37 12 60.00
662. Luke (menace13) 1 130.50 130.50 1 100.00
663. slow-af (rohilverma) 105 130.45 152.08 73 69.52
664. TJ (wtfitst2daj) 1 130.44 130.44 1 100.00
665. Ronny (poseidonhk) 2 130.43 133.66 2 100.00
666. Robert (wobert_) 79 130.41 165.59 52 65.82
667. click clack (albert471) 120 130.40 160.14 74 61.67
668. arijan (arijan_dh) 1,134 130.38 189.19 775 68.34
669. Jim (legerity) 5 130.33 152.98 3 60.00
670. (scaphism) 58 130.32 166.57 39 67.24
671. crocotyper (crocotyper) 25 130.29 154.74 17 68.00
672. (╯°□°)╯ (aaltra) 1 130.28 130.28 1 100.00
673. KirBei (kirbei) 1 130.27 130.27 1 100.00
674. Kinesis (kinesis_quake) 2,032 130.27 159.09 1,331 65.50
675. FREE PALESTINE (dawittymidget) 2,139 130.27 165.29 1,310 61.24
676. sherimori (sherimori) 1 130.26 130.26 1 100.00
677. zeropollyvtuber (zeppi) 30 130.25 151.08 23 76.67
678. John (azaza909) 7 130.25 147.14 5 71.43
679. Alex (alexvesepog) 1 130.25 130.25 1 100.00
680. Calvin (calvinguy) 182 130.25 177.11 127 69.78
681. Vincent (tokiix) 3 130.22 133.44 3 100.00
682. Jack (jack8888) 28 130.20 178.00 1 3.57
683. tanami (tanami) 7 130.19 154.79 7 100.00
684. bobby (trowlazer) 86 130.14 149.72 63 73.26
685. katsuna (bolt0009) 2 130.14 137.78 2 100.00
686. Jeff (yenemy) 4 130.14 139.38 1 25.00
687. ChlamydiaHaver (sarcasmx) 9 130.08 137.71 6 66.67
688. Luke (d357r0y3r) 2 130.03 138.67 1 50.00
689. kbeast (kbeast) 3 130.02 143.89 3 100.00
690. Non-quit acc (escri) 49 130.01 146.04 32 65.31
691. BigBreadBaker (bigbreadbaker) 27 130.01 158.06 19 70.37
692. Mayreel (mayreel) 7 130.00 151.62 7 100.00
693. (4lsi3w544lwi4lk) 118 129.99 155.49 78 66.10
694. Slatt. (nonquitpracticing) 441 129.96 181.44 276 62.59
695. (floofyaltaria) 618 129.92 169.97 390 63.11
696. Matthew (matthewarous) 14 129.84 147.29 14 100.00
697. Aaron (aaronjeng) 1 129.83 129.83 0 0.00
698. L (forcherie3) 6 129.82 150.15 2 33.33
699. huessy (independencyy) 16 129.82 149.98 10 62.50
700. Michael (onyxite) 1 129.77 129.77 0 0.00
701. . (watertastegoood) 2 129.74 132.71 0 0.00
702. jse (dragoncityjose) 2 129.73 153.52 1 50.00
703. btst (sabelle_) 12 129.72 145.29 5 41.67
704. Torsten (thorman42) 6 129.70 147.40 3 50.00
705. Zambrix (zambrix) 1 129.69 129.69 1 100.00
706. 7 wpm (plaayer17) 2 129.69 132.20 1 50.00
707. Song (zombieswap3) 2 129.68 139.74 1 50.00
708. (cnremilia55) 18 129.67 140.93 11 61.11
709. Victor (notvector) 7 129.66 145.40 5 71.43
710. Nino (ninospvp) 105 129.65 156.97 66 62.86
711. Ahmed (nesbmido) 231 129.65 168.18 142 61.47
712. kei (impeeverything) 41 129.64 165.19 25 60.98
713. Jack (ikombo) 35 129.63 144.11 23 65.71
714. Ghost (ghost999) 1 129.63 129.63 1 100.00
715. Rong Liew (springbaron) 11 129.63 141.02 8 72.73
716. erc (flamingllamas) 2 129.63 137.82 0 0.00
717. G (hyperglide) 38 129.62 152.16 22 57.89
718. kim (kimblimblimz) 46 129.61 169.76 32 69.57
719. IMSL (moonrabbit) 145 129.58 154.95 95 65.52
720. biggestkrug139 (mentalpatient) 9 129.52 145.36 6 66.67
721. nice'nslow (annoyingkid) 231 129.49 159.10 141 61.04
722. Zoran (newslowkeyboard) 15 129.48 148.30 11 73.33
723. bad (_dingus) 3 129.45 139.98 3 100.00
724. b lmao (matt16861) 17 129.39 144.72 12 70.59
725. Andrew (honeyman) 121 129.37 159.68 79 65.29
726. Daniel (teraminx) 31 129.32 142.46 25 80.65
727. Joe (carrotdrill) 1 129.29 129.29 1 100.00
728. Charles (jawlz) 2 129.27 133.73 1 50.00
729. mle (emilyliz) 13 129.23 150.17 8 61.54
730. at my own pace (mijacim) 8 129.22 153.46 5 62.50
731. Bob (blooperboy) 3 129.20 139.42 2 66.67
732. Cedra (cedra) 2 129.18 142.97 1 50.00
733. vyst (vystoric) 22 129.17 141.71 16 72.73
734. Rachel (rmsitar) 1,597 129.15 164.89 935 58.55
735. John (ztriplez) 1 129.14 129.14 0 0.00
736. Ivan (bbqhehe) 82 129.14 152.00 50 60.98
737. Luminescent (lumiines) 1 129.13 129.13 1 100.00
738. boat (narwhalinz) 109 129.12 161.38 72 66.06
739. Alex (_solace) 5 129.09 136.65 5 100.00
740. Dog acc (vick02) 212 129.05 154.08 130 61.32
741. kkgbyn (slyle) 3 129.04 140.10 1 33.33
742. Austin (austins350) 7 129.04 142.17 3 42.86
743. numba 1 (royalocean5) 6 129.02 139.74 5 83.33
744. Lue (iamoofu) 1 128.99 128.99 1 100.00
745. Honey_Beef (honey_beef) 1 128.96 128.96 0 0.00
746. Wenjie (pervysama) 148 128.96 147.46 104 70.27
747. jom (borezu) 14 128.89 145.31 11 78.57
748. Matthew (mattpeles) 2 128.87 130.90 0 0.00
749. Taran (tarankloty) 16 128.87 148.23 7 43.75
750. . (judger_) 2 128.85 135.34 2 100.00
751. Napples (napples181) 6 128.84 139.82 4 66.67
752. Andy (andyyy68) 6 128.83 141.43 6 100.00
753. Brofist (bhyper) 2 128.82 139.29 2 100.00
754. Helix (helixspiral) 1 128.78 128.78 1 100.00
755. Shane (slee23) 2 128.78 131.31 1 50.00
756. Name (buttface69) 35 128.77 151.17 18 51.43
757. Nemsi (nemsii) 38 128.77 145.52 23 60.53
758. matu (eepilinemangur1) 13 128.77 174.03 5 38.46
759. Razvan (forreckful) 4 128.76 137.74 3 75.00
760. obs (obskurrel) 3 128.71 144.26 2 66.67
761. pen (penlume) 4 128.70 134.06 1 25.00
762. Sumeo-Okami (paolo321) 1 128.69 128.69 1 100.00
763. veirt (exlog) 257 128.69 165.61 158 61.48
764. x (mxlxdx) 60 128.65 175.95 24 40.00
765. DNGZ (dangiuz) 4 128.65 151.83 3 75.00
766. Aurel (big_boss1) 190 128.64 170.37 114 60.00
767. Ming (yangming) 1 128.64 128.64 1 100.00
768. Nick (nickxz) 11 128.64 143.48 6 54.55
769. brian (dhafjkskjh) 3 128.62 132.61 1 33.33
770. no ring finger (denebaltair) 23 128.61 145.74 15 65.22
771. Doge (inteldoge) 2 128.61 135.36 2 100.00
772. ryan (anonymousboy321) 213 128.60 154.10 149 69.95
773. Light (lightpuma) 1 128.56 128.56 0 0.00
774. Element (elementnl) 1 128.54 128.54 1 100.00
775. Daniel (nomnomdaniel) 2 128.54 130.25 1 50.00
776. Cal (calbar) 1 128.53 128.53 1 100.00
777. TYPESTARS (nightprobe) 5 128.52 136.88 4 80.00
778. accorn (accorn279) 42 128.51 145.35 28 66.67
779. Kelsier (tkelsier) 2 128.51 132.04 1 50.00
780. nether (nethersynth) 7 128.47 158.21 3 42.86
781. Jerry (heatsflamesman) 17 128.45 149.57 14 82.35
782. Henry (codaassasin) 7 128.44 141.20 3 42.86
783. Daniel (crossfittypist) 7 128.43 140.59 4 57.14
784. ET (etdreamsofsleep) 4 128.43 141.81 2 50.00
785. Jono (jonodvorak) 21 128.40 142.72 13 61.90
786. Jason (jbb817) 81 128.39 154.54 54 66.67
787. Louis (xchampionx) 17 128.38 152.00 14 82.35
788. ♥ (erokopes) 28 128.36 144.59 16 57.14
789. Speed Typing (speedytypingyt) 3 128.34 137.63 3 100.00
790. break in kb (actuallysoup) 1 128.30 128.30 0 0.00
791. Garrett (garrettchu) 18 128.28 164.03 14 77.78
792. cow (cowerino) 1 128.26 128.26 0 0.00
793. Austin (walktomordor) 5 128.25 139.49 1 20.00
794. Zedrick (zedrickbr) 33 128.24 152.60 25 75.76
795. Arnold (10wpmtyper) 107 128.21 162.27 69 64.49
796. Joel (joelthesuperior) 15 128.21 150.94 6 40.00
797. 👶 (a_baby) 646 128.20 159.59 417 64.55
798. Kevin (siacker) 39 128.18 160.52 28 71.79
799. Knight_Oikos (knight_oikos) 580 128.17 166.09 320 55.17
800. Elo (elovvv) 6 128.16 152.52 6 100.00
801. Alex (unggoy2235) 1 128.16 128.16 0 0.00
802. be nice slunt (jokii) 236 128.12 162.13 152 64.41
803. Dongles (dongles) 39 128.11 159.88 28 71.79
804. Mia (lkortebe) 25 128.11 164.11 18 72.00
805. Tyler (thizzpwnt) 5 128.10 142.50 4 80.00
806. Hadge (hadgeoriginal) 17 128.08 166.42 7 41.18
807. nw3x (nw3x) 162 128.05 160.53 110 67.90
808. victor (swegboi) 70 128.05 162.64 47 67.14
809. 💉 (milan_) 64 128.05 159.47 45 70.31
810. STAN JISOO (3kawaii5u) 3 128.05 139.96 1 33.33
811. Scott (oooops) 6 128.04 133.30 4 66.67
812. atnernal (athrnls) 10 128.04 150.66 4 40.00
813. Macaibay (macz1991) 58 128.03 153.35 26 44.83
814. gavinc (klontz) 4 128.01 142.19 3 75.00
815. Keep pushing, don't give up... 96 128.01 148.87 75 78.13
816. Tim (afferin_) 10 127.97 151.63 7 70.00
817. Peter (slapchop18) 7 127.96 134.92 5 71.43
818. Sweaty (josef_stylin) 20 127.95 151.37 11 55.00
819. adol (adoll) 2 127.93 133.25 2 100.00
820. the solution to pollution i... 7 127.93 184.40 5 71.43
821. Boris (goat_56) 54 127.92 199.81 33 61.11
822. 🦉Strix🦉 (strigibae) 246 127.91 160.99 154 62.60
823. Chris (bunkieme) 67 127.90 155.44 47 70.15
824. Indiance (bois_sux_101) 1 127.90 127.90 1 100.00
825. James (unbranded) 9 127.86 142.50 8 88.89
826. Bracador (bracador) 1 127.85 127.85 1 100.00
827. fishy (foshe) 2 127.84 130.55 1 50.00
828. WinterCore (wintercore) 145 127.82 161.42 89 61.38
829. Chris (cronox) 3 127.79 133.62 2 66.67
830. Benito (sevilre) 3 127.75 128.83 2 66.67
831. ISuckAtTyperacer (im_bad_at... 2 127.75 130.76 1 50.00
832. .¿¿?epzilon?=?¿ (nekokaw... 66 127.74 152.18 49 74.24
833. Eli (elithesped) 80 127.72 167.40 54 67.50
834. Sorgair (sorgair) 6 127.71 142.77 4 66.67
835. Type (joex1011) 2 127.69 134.24 1 50.00
836. Dre (atarez) 17 127.68 151.29 16 94.12
837. Ozan (remnant) 3 127.66 132.74 1 33.33
838. Garbage (nerdballer) 33 127.63 151.31 22 66.67
839. anagolr (eagle0523) 7 127.62 136.94 6 85.71
840. Alaska Young (soner) 35 127.62 155.63 21 60.00
841. Brandon (boredintern123) 51 127.60 151.95 40 78.43
842. Axzyte (axzyte) 4 127.56 139.03 3 75.00
843. mwizard (mwizard) 311 127.55 157.21 192 61.74
844. zoidburger (adamczh1) 77 127.52 149.36 49 63.64
845. Apple Magic (applemagic4life) 12 127.45 149.73 8 66.67
846. James (jamvng) 8 127.42 137.77 3 37.50
847. Fee (dylanfee) 8 127.42 137.84 5 62.50
848. Ore (orediamond) 47 127.41 153.94 30 63.83
849. Daniel (blazin_) 1 127.41 127.41 1 100.00
850. Neanderthal (alacrity95) 52 127.41 170.60 27 51.92
851. marsha (marsha_socks) 1 127.40 127.40 1 100.00
852. toweringdoor (toweringdoor) 1 127.34 127.34 0 0.00
853. pawncheaux (pawncheaux) 3 127.34 152.47 0 0.00
854. Nash (digitalnash) 13 127.34 144.25 10 76.92
855. Josh (theunknownhero) 4 127.33 135.33 4 100.00
856. Leia (s_leia) 26 127.32 167.05 17 65.38
857. Rango (chucknorrisauresrex) 2 127.32 128.26 1 50.00
858. (notcayden) 6 127.32 140.13 3 50.00
859. uwu (whihi) 55 127.31 145.90 29 52.73
860. ay (d3b1) 2 127.31 143.45 1 50.00
861. Keith (keithlor) 32 127.22 147.69 18 56.25
862. Daniel (theoretic) 2 127.18 129.76 1 50.00
863. Flash (flashyflashy) 67 127.18 146.45 45 67.16
864. 🐱👤 (loomi) 3 127.16 140.22 2 66.67
865. Kelopio (kelopio) 9 127.15 149.49 4 44.44
866. Kieran (kahinjin) 156 127.13 164.65 119 76.28
867. Rohan (rohanr) 2 127.12 128.56 1 50.00
868. w (wenjun) 8 127.12 144.75 4 50.00
869. lithium's after image (lith... 48 127.09 148.68 30 62.50
870. madmikexxl (madmikexxl) 1 127.08 127.08 0 0.00
871. saku (sukasa) 18 127.08 148.34 10 55.56
872. Kevin (zhengfeilong) 908 127.07 167.55 539 59.36
873. (vivector) 6 127.06 139.32 4 66.67
874. Fingers (fingersgofast) 3 127.01 131.98 2 66.67
875. Superfast (ghoststop) 10 126.97 143.68 7 70.00
876. Rapha (anakin1178) 2 126.97 128.02 2 100.00
877. George (georgewang615) 1 126.95 126.95 1 100.00
878. Gh0sterino (gh0sterino) 2 126.85 135.75 2 100.00
879. Jesse (cliev) 19 126.82 150.33 13 68.42
880. Juprai (juprai) 17 126.78 155.21 10 58.82
881. ihateonyou (ihateonyou) 40 126.77 156.08 27 67.50
882. Jack (bgbfurey) 1 126.76 126.76 1 100.00
883. 🚗💨 (miredirex) 7 126.76 143.55 4 57.14
884. dumbosity (dumbosity) 167 126.75 162.99 110 65.87
885. arijan (arijan) 5 126.74 161.82 2 40.00
886. zhz (haohauz) 51 126.73 156.22 35 68.63
887. Hao (omegazz) 2 126.71 128.14 1 50.00
888. hi lol (overdosednq) 23 126.70 158.63 17 73.91
889. WhatIsLowkey (ihorsedyou) 20 126.67 144.83 12 60.00
890. Fametime (fametime) 51 126.59 166.10 34 66.67
891. Nikhil (benesch) 4 126.58 133.65 2 50.00
892. (´・ω・`) (gahama) 973 126.57 172.14 643 66.08
893. Dogshit school keyboard (sh... 10 126.55 167.48 7 70.00
894. Jacob (shrimploin) 85 126.54 159.24 46 54.12
895. Melvin (melli06) 6 126.53 136.87 3 50.00
896. new kb time (jlam55555colemak) 1,000 126.53 170.26 631 63.10
897. lumpsofwheat (pileofpaper) 1 126.50 126.50 1 100.00
898. Patrick (crimson_talon) 3 126.50 128.04 1 33.33
899. cabin (camdcn) 271 126.49 176.47 183 67.53
900. Joe (seph_of_joe) 64 126.47 158.93 39 60.94
901. Nozune (nostar) 574 126.46 178.53 353 61.50
902. chang (chang1) 217 126.46 155.13 121 55.76
903. Joseph (neonjc) 7 126.43 143.06 5 71.43
904. Kiki (kikichan86) 1 126.42 126.42 1 100.00
905. kyletsetse (kyletsetse) 29 126.40 150.80 26 89.66
906. twitch.tv/klokkismann (klok... 32 126.39 151.08 8 25.00
907. Brendyy (sabtooth) 29 126.39 141.21 18 62.07
908. Dana (danayi) 758 126.37 173.49 491 64.78
909. I play tetris too (hkgwife) 469 126.36 163.71 289 61.62
910. Ben (softaco) 16 126.34 142.89 4 25.00
911. Plotinus (plotinusdickens) 61 126.32 154.93 40 65.57
912. Trent (uninterested) 148 126.29 166.70 95 64.19
913. acc (agglomeration) 146 126.28 155.93 98 67.12
914. soadsuey (soadsuey) 1 126.28 126.28 1 100.00
915. steven (steventran334) 1 126.27 126.27 0 0.00
916. yuukinoe (zaxavien) 5 126.25 143.12 4 80.00
917. Left (ozcelllist) 5 126.23 137.67 5 100.00
918. Kyle (pickles3201) 44 126.22 150.77 26 59.09
919. nuate (nuate) 3 126.20 138.49 3 100.00
920. frank (ftguo) 2 126.20 128.31 2 100.00
921. Kevin (2erhabanana) 5 126.19 139.25 4 80.00
922. Stephen (installed) 20 126.09 167.79 9 45.00
923. Tode (todengaard) 9 126.07 146.45 8 88.89
924. Andrew (sirbobcat2836) 2 126.06 126.12 0 0.00
925. Will (willtang) 3 126.05 133.57 2 66.67
926. me (suited4hike) 10 126.04 143.15 10 100.00
927. beew (yeetit) 2 126.03 133.49 1 50.00
928. Jiten (jiten123) 1 126.02 126.02 0 0.00
929. Jo (joemamma_38) 9 125.99 144.88 3 33.33
930. Mehdi (badcrc) 1 125.98 125.98 1 100.00
931. marvin (magnimarve) 8 125.98 147.93 3 37.50
932. Paul (yangaapaul) 19 125.98 149.66 13 68.42
933. Ultrabooby (ultranooby) 8 125.94 136.62 4 50.00
934. (lwycsrc) 141 125.92 156.81 86 60.99
935. Poochi (poochizoom) 20 125.91 153.61 13 65.00
936. Dill (dillz_weed) 3 125.88 138.86 1 33.33
937. ★ d (retronub) 8 125.87 145.37 5 62.50
938. foM (da1scrub) 2 125.86 130.89 2 100.00
939. Benjie (xbenjie) 121 125.82 170.31 84 69.42
940. taylor (taayloor) 11 125.82 140.41 5 45.45
941. ellowell (ellowell) 8 125.79 150.31 4 50.00
942. pearslice (mark42isawesome) 1 125.77 125.77 0 0.00
943. ⠀ (aragorn_the_snake) 20 125.75 136.98 1 5.00
944. Lapis (lapis_pislapis) 22 125.74 176.13 15 68.18
945. Kurtis (kurtino) 3 125.73 153.40 3 100.00
946. aaron (doxxa) 24 125.72 140.91 12 50.00
947. Nicole (xxnicolexx) 3 125.72 135.67 3 100.00
948. Koala (koalazoo) 16 125.71 145.49 12 75.00
949. (chromehearts) 7 125.68 135.58 6 85.71
950. Chinatsu (tsuremodose_jp) 1 125.67 125.67 1 100.00
951. misumi (kazytypes) 1 125.66 125.66 1 100.00
952. Kraven (kraven_lupei) 16 125.64 143.02 6 37.50
953. Marathon (marath0ngaming) 2 125.58 137.87 2 100.00
954. csnormie (nerfedcookie) 5 125.55 143.94 5 100.00
955. Shan (shanrauf) 6 125.55 146.62 1 16.67
956. kim (kim_1409) 1,109 125.54 185.81 706 63.66
957. now colemak! (jlam55555nonq... 44 125.54 145.63 32 72.73
958. John (johnphan05) 14 125.54 144.56 8 57.14
959. Racecar (racecar_lettuce) 34 125.54 137.37 22 64.71
960. dead account (ribombee) 66 125.53 163.64 25 37.88
961. (aus10_) 24 125.53 142.02 18 75.00
962. blue (primaryblu) 8 125.52 158.22 2 25.00
963. Pina (pina_pog) 29 125.50 156.11 23 79.31
964. TearyPanda (tearypanda) 6 125.50 139.42 6 100.00
965. KnowItAllKing (knowitallking) 1 125.50 125.50 1 100.00
966. Unidentified (themunchkin3) 150 125.50 146.39 80 53.33
967. caleb (caleb123456) 86 125.48 151.84 48 55.81
968. Nick (beansymcgee) 2 125.47 143.70 1 50.00
969. mdlu (mdlu) 1 125.47 125.47 0 0.00
970. John (thegangplankgod) 44 125.47 152.02 31 70.45
971. Raphael (razmataz99) 14 125.46 168.56 6 42.86
972. Perry ᗜˬᗜ (perryok) 125 125.45 151.72 77 61.60
973. Moses (moses_) 1 125.43 125.43 1 100.00
974. Mooles (mooles) 14 125.42 139.39 10 71.43
975. Luca (lucadwong) 1 125.42 125.42 1 100.00
976. FatPanduh (fatpanduh) 16 125.40 136.50 9 56.25
977. Rainbow (rainbowdudebh) 29 125.39 157.75 19 65.52
978. Rinat (veryshortnamewithspa... 5 125.36 130.04 5 100.00
979. oof (fyestrietser101) 13 125.36 145.57 9 69.23
980. Just a (mrmuawa) 5 125.35 134.47 3 60.00
981. Hannah (hlbentz) 37 125.33 143.54 22 59.46
982. Bún bò Huế (wynos) 20 125.29 139.48 17 85.00
983. Jam (jamelele) 19 125.27 145.60 13 68.42
984. Elias (gottabefast) 7 125.26 137.17 4 57.14
985. vivi (soulace) 18 125.25 153.26 8 44.44
986. Is me Tonyyyyy (tw4040nonquit) 2 125.24 125.60 2 100.00
987. Jon (kiryu610) 1 125.24 125.24 1 100.00
988. Jubbers (jlin526) 45 125.23 144.28 31 68.89
989. Cadspen (cadspen) 1 125.22 125.22 1 100.00
990. Skillet (skillet18) 8 125.21 136.42 7 87.50
991. TheProdigyHenry (henryv70) 113 125.20 164.70 63 55.75
992. Afraidofthebomb (afraidofth... 55 125.16 159.29 38 69.09
993. Kit (kesuki) 63 125.16 149.89 42 66.67
994. noob (nonquitburner) 23 125.11 146.23 10 43.48
995. itsgohtime (itsgohtime) 19 125.10 134.80 13 68.42
996. Dana (dana_cardinal) 17 125.09 141.84 13 76.47
997. jonny (jlun23) 258 125.09 155.88 173 67.05
998. Kantel (kantel) 5 125.07 136.25 3 60.00
999. will_t (will_t) 46 125.05 150.82 26 56.52
1000. Amit (amitsetty) 31 125.04 144.79 11 35.48
1001. David (davidm_2020) 8 125.02 138.03 4 50.00
1002. Itamar K. (itakor9) 5 125.02 143.15 4 80.00
1003. Leona (onale) 148 125.00 153.06 95 64.19
1004. Sami (samitariq94) 34 125.00 142.96 27 79.41
1005. Renkon (renkon) 4 124.97 138.90 4 100.00
1006. Yimin (yimindvorak) 8 124.97 139.37 5 62.50
1007. no (humeunculus) 44 124.97 146.82 24 54.55
1008. lol (luv_you) 76 124.96 150.16 50 65.79
1009. J (jcob123) 2 124.96 126.68 1 50.00
1010. DearCows (dearcows) 4 124.93 140.42 4 100.00
1011. Manvir (manvir) 2 124.93 128.62 2 100.00
1012. Snipers (cozyshack) 1 124.91 124.91 0 0.00
1013. hello (sharkyboy) 11 124.91 134.90 6 54.55
1014. andrucc (andrucc) 10 124.90 137.56 7 70.00
1015. neotoky0 (neotoky0) 4 124.87 139.48 1 25.00
1016. Azaro (azaroarazenka) 55 124.86 157.57 45 81.82
1017. Mistey (mistey) 15 124.86 145.31 14 93.33
1018. konvay (konvay) 9 124.85 140.92 9 100.00
1019. steelmonkey (thecornhobble) 11 124.84 149.12 3 27.27
1020. Charles (charlesdickson1) 13 124.84 136.88 11 84.62
1021. Epsile (epsilian) 8 124.83 149.06 7 87.50
1022. No (speedracetypist) 5 124.82 140.67 4 80.00
1023. Riverspirit (riverspirit) 2 124.81 138.61 1 50.00
1024. Bubbles (bubbles81833) 8 124.80 145.87 6 75.00
1025. Olaf (p1stachiofurioso) 15 124.79 137.77 7 46.67
1026. sync (convictedfelon123) 1 124.74 124.74 1 100.00
1027. Andrew (noobhunter) 12 124.72 143.32 4 33.33
1028. David (hybridlikesrice) 16 124.72 133.70 7 43.75
1029. I'm Bad (nssv101) 10 124.71 143.55 3 30.00
1030. Kerb (kerby_berby) 827 124.71 175.80 468 56.59
1031. Remotay (remotay) 1 124.69 124.69 1 100.00
1032. Tom (typewritertom) 1 124.69 124.69 1 100.00
1033. Jim (pokemontcg2) 86 124.68 152.34 51 59.30
1034. Ethan (yaboinugget) 37 124.67 152.04 18 48.65
1035. George (linkopen) 3 124.65 135.96 2 66.67
1036. Connor (ctw0611) 29 124.64 146.89 22 75.86
1037. Earlvin (earlvin14) 191 124.62 146.79 111 58.12
1038. Nikki (niksta95) 16 124.62 154.84 13 81.25
1039. Brussels (brussels11) 179 124.62 146.36 113 63.13
1040. Chaicow (chaicow) 6 124.59 140.97 1 16.67
1041. kepler1729 (kepler1729) 1 124.58 124.58 0 0.00
1042. Tan (tim0909) 19 124.53 140.79 12 63.16
1043. PreciousStats (precious_stats) 113 124.52 166.49 75 66.37
1044. Jacob (drummerjacob) 2 124.52 139.30 2 100.00
1045. ChimChimChim (chimchimchim) 348 124.49 150.62 208 59.77
1046. Callum (cal_dis) 3 124.49 138.60 2 66.67
1047. Geno (geno20) 5 124.47 134.04 3 60.00
1048. Chicken (chickenhide) 45 124.47 155.65 29 64.44
1049. bum_fluff (dritt) 27 124.47 137.60 18 66.67
1050. Osteo (emiglio) 1 124.45 124.45 1 100.00
1051. NiglaciousXII (glaedrlol) 1 124.45 124.45 0 0.00
1052. Sarah (sara_g) 8 124.44 132.05 7 87.50
1053. $ (sirenss) 9 124.44 134.81 3 33.33
1054. Boris (bb667) 4 124.43 134.92 1 25.00
1055. William (williamc7879) 39 124.41 158.72 33 84.62
1056. Ryan (shiroeraiyn) 5 124.40 146.05 4 80.00
1057. Ilz (ilzwalrus) 1 124.40 124.40 1 100.00
1058. Paul (randomnoob1) 13 124.39 149.25 8 61.54
1059. Torpor (thesilliest) 1 124.39 124.39 1 100.00
1060. Angelo (angelo123123) 38 124.38 149.20 26 68.42
1061. Se (stopclimatechange) 2 124.38 125.81 2 100.00
1062. John (johnmonday) 2 124.38 126.48 1 50.00
1063. s (wildbanana3000) 5 124.37 127.22 3 60.00
1064. Ω (tunfisk) 453 124.36 169.71 250 55.19
1065. Michael (michaelshahin2) 8 124.34 159.15 5 62.50
1066. nick (nickderp) 6 124.33 137.45 5 83.33
1067. Pumpy (pumpytudors) 1 124.26 124.26 1 100.00
1068. Rygah (rygah) 2 124.25 145.27 1 50.00
1069. Alex (wu2481632) 7 124.21 134.39 4 57.14
1070. Fitz (dylab) 3 124.17 128.57 3 100.00
1071. Grosh (groshgoratz) 1 124.16 124.16 1 100.00
1072. Vladimir (nolmegar) 11 124.16 145.61 9 81.82
1073. twitter.com/jidoreuu (tfuef... 52 124.15 149.30 34 65.38
1074. Kasper (yckf2) 70 124.15 155.13 50 71.43
1075. Samuel (sroh8140) 1 124.15 124.15 1 100.00
1076. sirpotatojoe (sirpotatojoe) 3 124.11 128.54 2 66.67
1077. Ucheely (ucheely) 9 124.10 134.89 4 44.44
1078. lubi222 (lubi222) 12 124.09 140.97 6 50.00
1079. tstats[typhoid] (typhoid) 16 124.08 147.07 10 62.50
1080. q (qtyps) 2 124.06 133.05 2 100.00
1081. Demian Volkov (demianwolf) 160 124.06 150.14 102 63.75
1082. Alias (boinkus) 8 124.05 145.98 6 75.00
1083. Justin (quick2diddle) 3 124.04 130.73 2 66.67
1084. LordBanana23 (lordbanana23) 1 124.04 124.04 1 100.00
1085. typeracist (moron212) 62 124.04 149.22 41 66.13
1086. Speed Cola (zdj361) 63 124.04 134.17 30 47.62
1087. shot607 (shot607) 24 124.03 142.11 19 79.17
1088. megan (meaogan) 4 124.02 138.11 3 75.00
1089. Ilyanna (ilygoesboom) 5 124.02 129.39 5 100.00
1090. (chugjugwithyou) 4 124.01 143.60 3 75.00
1091. Bryan (bryan675) 15 123.99 145.33 12 80.00
1092. brandan (uepuejq) 3 123.96 137.92 2 66.67
1093. Amy (amydakao) 2 123.96 130.34 2 100.00
1094. Wilford (wilfordjason) 63 123.95 149.81 32 50.79
1095. Eyas (eyasmodhesh) 1 123.94 123.94 1 100.00
1096. Sean (bigdinky) 23 123.94 145.59 13 56.52
1097. Enxyon (enxyon) 565 123.93 150.60 361 63.89
1098. new account fenno4 (fennomak) 117 123.90 157.15 71 60.68
1099. Ashley (fattass) 2 123.90 132.33 1 50.00
1100. Ossi (xyeet) 14 123.84 138.78 8 57.14
1101. Yak-4-President (craznevil) 2 123.84 135.85 2 100.00
1102. Gunner (pie621) 2 123.83 134.19 0 0.00
1103. jewels (jewelsboyfriend) 18 123.81 139.71 11 61.11
1104. Patrick (pzuknome) 14 123.80 140.23 6 42.86
1105. Brandon (branick) 2 123.79 130.56 2 100.00
1106. nurse (nurse1) 2 123.79 124.13 2 100.00
1107. Bettina (awkventurer) 67 123.78 194.62 45 67.16
1108. tstats[chihayafuru] (chihay... 9 123.78 134.07 6 66.67
1109. Sam (honeyteacakes) 4 123.75 140.42 4 100.00
1110. Roy (roylee0912) 13 123.73 158.29 6 46.15
1111. Corey (corrreyjay) 8 123.72 147.82 7 87.50
1112. flora (flora1111) 8 123.70 144.91 6 75.00
1113. EndlessNebulous (endlessneb... 2 123.67 130.33 1 50.00
1114. shortrug (shortrug) 2 123.67 134.50 2 100.00
1115. Sebastian (sebipagura) 6 123.66 136.50 3 50.00
1116. hallelujah (veil) 17 123.66 153.37 6 35.29
1117. Badri (bxdri) 140 123.66 167.54 70 50.00
1118. Chris (fhondubity) 3 123.62 125.41 3 100.00
1119. chad (pokeman34) 100 123.58 144.18 49 49.00
1120. Conrad (conradkay) 3 123.57 131.83 2 66.67
1121. trapinch_ (fortissim2) 17 123.57 138.15 10 58.82
1122. Daniel (niggusted) 7 123.56 135.68 7 100.00
1123. ekrem. (100percentnonquit) 13 123.55 150.38 6 46.15
1124. Dragon (dragonking0712) 2 123.55 123.82 2 100.00
1125. Yuan (lydxlx) 23 123.54 130.87 4 17.39
1126. choco (cchoki) 5 123.54 132.57 2 40.00
1127. benhalfpap (happypappy21) 7 123.53 131.53 3 42.86
1128. Chris (ckinto) 5 123.52 129.70 1 20.00
1129. Cuthbert (cuthybert) 131 123.51 163.01 86 65.65
1130.   (jlpt) 4 123.50 134.12 2 50.00
1131. TypeLX (gamerleelxo) 13 123.49 135.39 6 46.15
1132. Qi (whathaha) 256 123.49 165.41 157 61.33
1133. Ben (thisisbenmanley) 1 123.48 123.48 0 0.00
1134. Mephy (mephy) 1 123.47 123.47 1 100.00
1135. DiscoOrc (discoorc) 16 123.47 138.08 6 37.50
1136. IllIllIllIll (liliiilil) 11 123.47 136.20 5 45.45
1137. Guillermo (schobzax) 28 123.46 154.23 21 75.00
1138. tomoi (colemak_muzukashii) 2 123.46 130.40 1 50.00
1139. Andrew (yertssbm) 9 123.44 135.13 6 66.67
1140. dq (dqmaniac) 21 123.44 139.80 14 66.67
1141. Martin (demonakinale) 46 123.40 147.90 29 63.04
1142. 안녕하세요 (noogie13) 2 123.39 126.41 0 0.00
1143. Amy (amytypes123) 7 123.38 134.86 5 71.43
1144. ばにらー tired goodby... 51 123.37 177.82 21 41.18
1145. richardhead (richardhed) 23 123.35 148.55 13 56.52
1146. banvotesgames (x_adware) 41 123.34 153.41 16 39.02
1147. sykelolxd (sykelolxd) 3,192 123.32 170.24 1,918 60.09
1148. mobo (mobo) 20 123.31 150.55 13 65.00
1149. Scotty (scottypills) 2 123.31 126.96 2 100.00
1150. Hadise (hadise) 48 123.30 161.15 31 64.58
1151. WhaleVomit (whalevomit) 11 123.29 129.60 9 81.82
1152. door (door_qwerty) 1 123.28 123.28 1 100.00
1153. Claire (thisisforfun) 2 123.27 130.25 2 100.00
1154. uwudestroyer69 (slownoobtyper) 7 123.27 138.12 4 57.14
1155. Gav (gav576) 7 123.26 141.02 4 57.14
1156. David (nunyobusiness) 16 123.26 142.17 9 56.25
1157. Aiden (acer564) 4 123.22 133.54 4 100.00
1158. cleve. (haipong) 12 123.17 137.28 8 66.67
1159. triplealpha (knytehawke) 1 123.16 123.16 0 0.00
1160. Josh (dpjoshy) 1 123.14 123.14 1 100.00
1161. Todd (ttran65) 2 123.10 123.94 1 50.00
1162. Anon (mklegend) 13 123.10 143.98 11 84.62
1163. Coder100 (coder_onehundred) 245 123.08 150.37 134 54.69
1164. Sunny (sunnylee0123) 27 123.07 146.10 20 74.07
1165. Kaeble (dirtyearl) 1 123.06 123.06 1 100.00
1166. Dark (lewpur) 3 123.06 139.74 3 100.00
1167. nac (naxx_colemak) 5 123.05 156.25 1 20.00
1168. Rikka (rikka_takanashi) 31 123.04 152.90 18 58.06
1169. Anton (antonchen) 28 123.04 151.91 27 96.43
1170. Eric (ericplayz132) 12 122.99 133.87 7 58.33
1171. Mackyy. (mackipecko) 26 122.99 138.37 23 88.46
1172. Mohamed (byfarag) 20 122.98 144.18 12 60.00
1173. Bheta (bheta) 8 122.97 149.14 5 62.50
1174. Peaches (devastated) 271 122.95 154.23 141 52.03
1175. alieb (alieb) 23 122.95 151.74 14 60.87
1176. Kay (miniaturepenguin) 2 122.94 127.77 1 50.00
1177. Dimitar (dimitard) 6 122.93 140.97 4 66.67
1178. Aziron (aziron) 12 122.91 135.91 4 33.33
1179. Chet (chetbaker) 5 122.90 137.20 4 80.00
1180. argo (argoneus) 3 122.89 125.79 3 100.00
1181. Daniel (metalspork) 5 122.88 131.14 5 100.00
1182. mmmagalex (nonquit4ever) 497 122.87 175.93 267 53.72
1183. J (tooeasyeh) 13 122.87 139.71 5 38.46
1184. Bagel (baegirl) 8 122.87 131.75 3 37.50
1185. Nick (nickoftime146) 2 122.86 127.35 1 50.00
1186. Logi K380 (kedr0n) 70 122.84 144.65 37 52.86
1187. 22ru (mayushy) 4 122.83 132.75 4 100.00
1188. allan (zhangerbanger) 339 122.82 154.71 198 58.41
1189. albert (albert_d) 5 122.81 133.16 5 100.00
1190. armin (fx_skrrt) 4 122.80 136.45 1 25.00
1191. Andrew (thedeathlyhallows) 7 122.77 142.17 4 57.14
1192. Gabe (derumisis) 1 122.76 122.76 0 0.00
1193. nullchilly (tuwuna) 77 122.76 274.05 39 50.65
1194. Jonathan (imprettysaxy) 25 122.74 149.46 15 60.00
1195. Robert (rwschuster) 10 122.74 147.40 6 60.00
1196. lorenzo (lorenzo2131) 4 122.72 133.45 3 75.00
1197. . (shrekenberg) 7 122.72 137.22 3 42.86
1198. samren (walker452) 3 122.72 131.87 3 100.00
1199. DVORAK Dell KB522/Asus G01K... 3 122.70 136.86 2 66.67
1200. Vivian (vesperine) 3 122.70 144.38 2 66.67
1201. ABC (funnelcake9) 34 122.69 137.00 17 50.00
1202. typelord (nerif) 79 122.69 158.35 43 54.43
1203. Kuzel (kuzel) 2 122.68 124.30 2 100.00
1204. chi (amaz1n) 10 122.68 137.95 4 40.00
1205. axe (axeh) 1 122.67 122.67 1 100.00
1206. == Klub (blueclub) 1 122.66 122.66 0 0.00
1207. Jason (jthayer09) 4 122.66 128.46 4 100.00
1208. Max (antmanmax) 39 122.66 141.91 24 61.54
1209. Joe (joegung77) 6 122.66 136.53 3 50.00
1210. tailcatch (tailcatch) 147 122.63 158.31 92 62.59
1211. Palmer (emrysite) 2 122.63 127.27 2 100.00
1212. Joshua (shmucky) 47 122.61 137.88 24 51.06
1213. Nemo (35603560) 1 122.61 122.61 0 0.00
1214. Anthony (lukiilegend) 1 122.60 122.60 1 100.00
1215. Charles (doubleqin) 70 122.60 145.35 40 57.14
1216. Laggy (thefitfatass) 138 122.59 146.03 97 70.29
1217. Typer Shark (teodorrd27) 263 122.58 144.05 154 58.56
1218. Vincent (bhangjiwon) 112 122.56 153.53 76 67.86
1219. ritvik (ritvikrustagi) 2 122.54 127.69 2 100.00
1220. xelfeR (armez) 108 122.53 199.14 60 55.56
1221. George (ssbatch) 15 122.52 136.55 8 53.33
1222. 水色#0001 (shirogane_ao) 3 122.47 128.26 1 33.33
1223. Franklin (flipfloppm) 9 122.47 149.35 7 77.78
1224. Mony The G (skull_slayer) 86 122.45 161.09 52 60.47
1225. gsus152 (gsus152) 4 122.42 143.36 3 75.00
1226. Davx_d (davx_d) 16 122.41 152.13 12 75.00
1227. wolfBream (wolfbream45) 46 122.41 139.13 29 63.04
1228. Michael (clutch69master69) 14 122.41 135.03 11 78.57
1229. Sole (soleduck) 34 122.41 152.43 14 41.18
1230. Simeon (sim80) 32 122.38 148.29 17 53.13
1231. Evan (evndude) 1 122.38 122.38 0 0.00
1232. Limited (limited_atonement) 6 122.38 132.97 4 66.67
1233. no accuracy. can't type (gr... 18 122.34 158.63 9 50.00
1234. nuh uh (iwanna_typefast) 424 122.33 164.47 214 50.47
1235. Kyle (rachel_camarena) 1 122.33 122.33 0 0.00
1236. take care of ur wrists bae!... 105 122.33 154.11 63 60.00
1237. Caitlin (cmonjeau) 4 122.33 139.28 4 100.00
1238. Chi (chiphan1993) 29 122.33 138.40 16 55.17
1239. https://youtu.be/dQw4w9WgXc... 246 122.33 152.12 136 55.28
1240. Jandre (jandre1028) 13 122.32 152.23 8 61.54
1241. S (fear4321) 4 122.32 139.32 2 50.00
1242. yung (shwn) 29 122.29 148.27 17 58.62
1243. Anirudh (apie) 3 122.29 122.65 2 66.67
1244. Adam (adamhawkins) 115 122.29 151.49 73 63.48
1245. dank nissan (osubora) 1 122.28 122.28 1 100.00
1246. Ben (bencyi) 8 122.27 151.75 6 75.00
1247. Small (2pacaklypse) 3 122.26 143.93 3 100.00
1248. FMURTADHO (fmurtadho) 112 122.26 151.11 64 57.14
1249. Larry (tcaer) 5 122.24 135.85 3 60.00
1250. Sentinel (greatsentinel) 184 122.23 151.95 116 63.04
1251. Savannah (snowyaussie) 3 122.19 131.82 3 100.00
1252. Meep (meeeep) 2 122.18 126.52 0 0.00
1253. John (nixne) 6 122.18 137.54 4 66.67
1254. Raadek (knr24) 1 122.17 122.17 0 0.00
1255. Jovel (enyalio) 1 122.17 122.17 1 100.00
1256. David (divdav) 2 122.17 130.74 0 0.00
1257. Will (willydale) 2 122.16 134.17 2 100.00
1258. Matthew (m1234d) 20 122.16 146.89 12 60.00
1259. Rayf (rayfisfast) 2 122.13 139.51 1 50.00
1260. vroom💤 (noprop) 153 122.12 145.40 78 50.98
1261. Lily (russiantorts) 3 122.12 136.54 3 100.00
1262. (samuraipie) 8 122.12 144.36 5 62.50
1263. Theo (theodoretliu) 480 122.11 158.69 257 53.54
1264. Mvck (d3mon666) 2 122.11 139.17 1 50.00
1265. 찬우 (inphinity) 27 122.11 163.87 14 51.85
1266. Samdo (sammematt) 11 122.10 134.74 6 54.55
1267. Billy (billydoesgaming) 3 122.08 125.78 2 66.67
1268. simsimhae yagi (ljd1) 10 122.08 137.10 5 50.00
1269. Steven (stevenxie) 1 122.08 122.08 1 100.00
1270. d (hirundinidae) 15 122.08 138.62 12 80.00
1271. armenn (armenn) 1 122.06 122.06 1 100.00
1272. Minjae (minjaesong) 6 122.06 130.19 5 83.33
1273. - (trashmanvlogs) 1 122.02 122.02 1 100.00
1274. Kevin (zerstu) 6 122.02 134.24 6 100.00
1275. Dan (maddolis) 7 122.00 139.12 6 85.71
1276. HASHTAG (talk_is_cheap_like... 32 121.98 141.39 17 53.13
1277. pigeonistic (pigeonistic) 9 121.98 133.64 6 66.67
1278. Eric (circador) 1 121.97 121.97 1 100.00
1279. Just a man in a hotdog van ... 102 121.94 164.51 56 54.90
1280. tstats[pumpkinsoup1] (pumpk... 61 121.94 159.47 36 59.02
1281. Rosy (rosyport) 108 121.93 159.76 55 50.93
1282. DankAlzein (dankalzein) 9 121.93 140.08 6 66.67
1283. Ludvig (lochecho) 67 121.93 146.19 45 67.16
1284. Teh (tehtehteh) 24 121.91 135.93 16 66.67
1285. Sporadic (howsporadic) 36 121.90 154.98 26 72.22
1286. Joe (mobinman69) 2 121.90 123.62 2 100.00
1287. Chuzz (chuzzilla) 5 121.90 141.41 3 60.00
1288. newjeans fan (xooflo) 24 121.89 140.19 8 33.33
1289. Mylow (mylow) 5 121.89 132.04 3 60.00
1290. Yelxuh (yelxuh) 89 121.86 162.95 51 57.30
1291. _batonnoir (_batonnoir) 4 121.85 126.06 1 25.00
1292. Colemak Lost (_champ_) 1,111 121.84 175.75 622 55.99
1293. Edvinas (bull3tf) 65 121.84 144.56 36 55.38
1294. aida (cloudywithachanceofme... 168 121.82 160.09 95 56.55
1295. 3ymsdet (3ymsdet) 75 121.82 160.85 54 72.00
1296. Joshua (lyodd90) 3 121.81 131.45 1 33.33
1297. bjonk (sojho) 11 121.80 133.00 6 54.55
1298. tambii (aid1337) 323 121.80 162.76 164 50.77
1299. (slowandinaccurate) 33 121.79 164.93 19 57.58
1300. 𝖔𝖑𝖎𝖜𝖆𝖗... 8 121.79 139.65 6 75.00
1301. Philip (vanp) 8 121.78 138.16 7 87.50
1302. Simon Kubica (kubica) 2 121.78 127.33 1 50.00
1303. Priscilla (simplyscience) 29 121.78 150.53 23 79.31
1304. Nathan (nathanbotas) 28 121.77 155.23 15 53.57
1305. Cogan (ngcogan) 2 121.77 130.19 2 100.00
1306. Lelu (laku_) 41 121.76 143.02 24 58.54
1307. Vroom Vroom (ajgriffy) 5 121.73 133.89 2 40.00
1308. Sangyoung (ddragoons) 38 121.72 154.36 24 63.16
1309. Maya (maya_prowers) 3 121.71 129.03 3 100.00
1310. Joshua (joshuajoshuak) 11 121.70 133.12 8 72.73
1311. rey (pieri) 13 121.70 146.25 4 30.77
1312. Hari (baby1_jimmy) 33 121.69 145.25 17 51.52
1313. Nino (ninodoko) 26 121.66 137.50 14 53.85
1314. Eric (dango499) 13 121.65 136.25 8 61.54
1315. StallmanWasRight (misterhotel) 177 121.64 151.77 93 52.54
1316. speed (druggedrice) 10 121.63 136.81 2 20.00
1317. Ryan (ryanssd) 46 121.63 152.33 27 58.70
1318. Sinan (sinan) 8 121.62 148.27 4 50.00
1319. Danny (flowburst) 71 121.61 153.26 42 59.15
1320. heng (xshadowlegendx) 4 121.61 134.69 4 100.00
1321. (loom981) 28 121.60 145.51 13 46.43
1322. Sub to spenzalo (hi_shoemaker) 28 121.59 145.52 15 53.57
1323. Pearl (pearlescent) 15 121.59 137.60 10 66.67
1324. terrace (terrace2fast) 73 121.56 169.58 35 47.95
1325. Khadea (charter) 235 121.56 154.55 131 55.74
1326. Andrew (mikzzu) 4 121.54 127.34 3 75.00
1327. Rafid (demo_admin) 44 121.53 143.36 21 47.73
1328. B (btype123) 15 121.53 135.16 10 66.67
1329. Kelvin (typingkelvin) 1 121.52 121.52 1 100.00
1330. SOGGY (soggybigbooty) 4 121.52 142.13 1 25.00
1331. Financier (financier) 35 121.50 141.06 16 45.71
1332. tstats[isakooooo] (isakooooo) 42 121.50 144.23 21 50.00
1333. Brendan (panikooooos) 62 121.50 148.43 33 53.23
1334. Sisi (sisiamor) 19 121.49 141.02 13 68.42
1335. John (johnratchet3) 2 121.49 127.23 0 0.00
1336. Gascoigne (correctionhaha) 105 121.47 158.77 59 56.19
1337. Fish (fishtent) 6 121.47 132.59 4 66.67
1338. burrito1 (jacobef2) 59 121.46 142.15 29 49.15
1339. Chuck (helicopter123) 35 121.45 140.37 25 71.43
1340. J (jdizzla) 19 121.45 149.63 8 42.11
1341. Joe Mama (musicalsquire) 40 121.44 148.43 20 50.00
1342. :( (altrocality_dvorak_acc) 201 121.44 145.99 108 53.73
1343. PKRZ Bright Red Hats (doesi... 2 121.43 122.39 2 100.00
1344. Bradley (tgun) 3 121.41 128.07 1 33.33
1345. erk (estalow) 115 121.40 139.61 71 61.74
1346. Dom (disfordom) 5 121.40 145.73 5 100.00
1347. Trigabyte (trigabyte) 4 121.40 132.86 4 100.00
1348. Memer (macisasandwich) 1 121.39 121.39 1 100.00
1349. Caegan (caegana) 166 121.39 158.07 87 52.41
1350. Andrew (nosingaround) 59 121.38 142.54 29 49.15
1351. icanttypeaccuratelyconsiste... 5 121.36 129.75 2 40.00
1352. affnah (affnah) 20 121.36 134.76 6 30.00
1353. Raikyryu (raikyryu) 2 121.36 129.54 2 100.00
1354. Évi (pinglei) 488 121.33 151.15 308 63.11
1355. Sian Caleb (promechanics) 573 121.26 151.03 336 58.64
1356. Nick (diggle) 8 121.25 146.89 6 75.00
1357. jazon (jazonandes) 17 121.24 160.25 7 41.18
1358. Josh (velocity92c) 12 121.23 140.43 7 58.33
1359. temmo (temmo) 8 121.23 141.89 4 50.00
1360. Thundering (electricbiscuit) 37 121.21 139.26 16 43.24
1361. (altrocality) 221 121.19 154.58 117 52.94
1362. Samuel (samtsullivan) 73 121.17 149.61 31 42.47
1363. (ノ◕ヮ◕)ノ*:・゚... 139 121.17 159.34 79 56.83
1364. Kelly Blows Doods (moyyom2) 2 121.16 127.66 1 50.00
1365. ty (tbtbtbt) 20 121.15 154.58 13 65.00
1366. Elden (bloab) 106 121.10 150.45 86 81.13
1367. Karl (kzlotn2) 1 121.08 121.08 0 0.00
1368. Lyons (lyoons) 29 121.07 150.05 24 82.76
1369. David (squeetus) 3 121.06 126.17 2 66.67
1370. JOn (chaomeister986) 10 121.06 143.79 6 60.00
1371. Stephen (kibasa) 3 121.04 137.87 2 66.67
1372. Koga (koganeicchi) 1 121.02 121.02 0 0.00
1373. PancakeDAWGZ (pancakedawgz) 37 121.02 139.42 19 51.35
1374. Kevin (bigtimetyperacer) 3 121.01 129.43 2 66.67
1375. Aviv (burgerhex) 1 121.00 121.00 1 100.00
1376. ruby (ruby_lu) 3 120.98 129.95 3 100.00
1377. Aviv (avivbn263) 37 120.97 132.93 19 51.35
1378. joanna (deulseobs) 9 120.97 137.00 6 66.67
1379. Daniel (dsun23) 1 120.96 120.96 1 100.00
1380. Robert (lonewulf92) 35 120.96 156.81 19 54.29
1381. ଘ(੭ˊᵕˋ)੭* ੈ✩... 13 120.96 133.01 12 92.31
1382. George (graddiences) 1 120.94 120.94 1 100.00
1383. Alexa (lexalexa100) 95 120.94 141.71 67 70.53
1384. Russell (dalenu) 8 120.94 138.45 3 37.50
1385. (vixt) 5,134 120.93 187.30 2,738 53.33
1386. wil (wilruns) 599 120.92 159.14 339 56.59
1387. Yuji (gugox10) 24 120.92 139.53 16 66.67
1388. Sydney (sydmarie) 4 120.91 136.72 3 75.00
1389. Biasface (biasface) 3 120.91 125.24 2 66.67
1390. Fonts (quierojeva) 2 120.91 127.02 2 100.00
1391. dylan_9802 (dylan_9802) 142 120.90 155.93 73 51.41
1392. Sannas (sannas) 1 120.89 120.89 1 100.00
1393. Christler (blastydog) 14 120.86 140.91 10 71.43
1394. Dat (dvorakprodigy) 25 120.86 137.28 12 48.00
1395. Wilmore (nonquitchad) 1 120.84 120.84 1 100.00
1396. Patrick (patwang123) 4 120.82 124.80 3 75.00
1397. Sam (aleuznelav2) 1 120.81 120.81 1 100.00
1398. Alan (durland) 1 120.72 120.72 1 100.00
1399. can we have some simple sho... 39 120.72 162.37 23 58.97
1400. Ritardo (ett5252) 91 120.68 152.90 48 52.75
1401. Apartheid Regime (sanicdehe... 116 120.67 152.33 73 62.93
1402. Drifter (drifter103) 20 120.66 133.80 8 40.00
1403. Kevin (noimkevin) 54 120.65 137.04 31 57.41
1404. 🍋 (lemoncrush) 1 120.64 120.64 1 100.00
1405. Pendi (_pendi) 11 120.63 131.72 8 72.73
1406. switchedtocolemak (switched... 159 120.63 144.18 75 47.17
1407. Dankey Kang (shabooty) 24 120.61 137.05 14 58.33
1408. LA LUNA, LA BELLA LUNA (fee... 211 120.60 161.68 125 59.24
1409. random (thelastprime) 6 120.59 134.88 1 16.67
1410. Calvin (taintedducky) 5 120.59 138.55 3 60.00
1411. xuehua (noquitnrooom) 19 120.57 144.58 12 63.16
1412. Cowbell (morris_l) 1,763 120.55 188.85 995 56.44
1413. Luna (lewisw60) 4 120.55 132.21 2 50.00
1414. Principle (principle105) 97 120.53 149.70 51 52.58
1415. peace in byron (driveroncall) 16 120.53 156.84 9 56.25
1416. Jha (jha94) 34 120.52 145.78 22 64.71
1417. Sanket (maskii) 180 120.48 160.69 116 64.44
1418. Bob (theasiansherlock) 1 120.48 120.48 1 100.00
1419. Mujeeb's (jeffyglue) 59 120.48 151.67 39 66.10
1420. Hari (harisund) 66 120.47 164.12 44 66.67
1421. Silver (silverknights1) 5 120.46 134.79 4 80.00
1422. Akshay (aksseet) 28 120.43 147.47 19 67.86
1423. sojo (sojoyes) 2 120.43 123.41 2 100.00
1424. Anish (danishanish) 2 120.43 130.74 2 100.00
1425. Jack (arcinae) 41 120.42 152.31 27 65.85
1426. untechno (fersist) 7 120.42 134.31 3 42.86
1427. Aidan (zoreoam) 6 120.41 137.60 5 83.33
1428. ref (rwef) 6 120.41 131.24 3 50.00
1429. rhombus (rhombus3) 5 120.40 126.68 4 80.00
1430. zlyzah (zlyzah123) 1 120.39 120.39 1 100.00
1431. started from 50 now we here... 11 120.38 146.76 7 63.64
1432. tstats[lapakatapulta] (lapa... 9 120.36 133.32 3 33.33
1433. Jacob (jwill420) 168 120.35 151.96 104 61.90
1434. ckl (ckl33) 2 120.35 122.15 0 0.00
1435. Jester (murvayne) 117 120.32 149.46 61 52.14
1436. Johir (johir) 16 120.30 133.41 10 62.50
1437. (peaceinchrist) 1,027 120.30 160.56 577 56.18
1438. Speed (thenimblefinger) 48 120.29 166.50 22 45.83
1439. (onah) 108 120.27 150.72 60 55.56
1440. Yango (typerix) 1 120.27 120.27 1 100.00
1441. John (juseonghan) 44 120.26 149.15 22 50.00
1442. N (natejam) 519 120.26 182.62 347 66.86
1443. Rafael (qwertyspade) 5 120.24 129.16 3 60.00
1444. Cody (tfwarcry) 2 120.24 122.14 2 100.00
1445. 48%SuicideRate (wint4r) 9 120.22 144.87 9 100.00
1446. Goat (goatjohnson) 2 120.22 121.60 1 50.00
1447. Gitxen (gitxen) 1 120.21 120.21 0 0.00
1448. Zach (skoopy) 1 120.20 120.20 0 0.00
1449. Michael (clayjar) 38 120.20 137.27 22 57.89
1450. Megatypist (_megatypist_) 10 120.16 138.55 7 70.00
1451. Mokegang420 (mokegang420) 7 120.15 130.28 4 57.14
1452. snow leopard (truechaos) 73 120.15 157.43 39 53.42
1453. Spencer (spenciepoo) 63 120.14 148.39 39 61.90
1454. glucose (aesenix) 5 120.13 151.67 3 60.00
1455. Derex (derexd) 5 120.12 139.48 3 60.00
1456. susan (kf7hdw) 25 120.10 140.31 13 52.00
1457. Aelius (aelius_l) 35 120.10 146.43 16 45.71
1458. Esther (esthersanti1600) 6 120.09 148.13 5 83.33
1459. Rsijlowpez (rsijlowpez) 10 120.08 131.44 6 60.00
1460. syuuu (syuuu) 4 120.06 123.38 1 25.00
1461. Marcus (evanitez) 30 120.04 143.45 15 50.00
1462. Michael (redwings20) 45 120.01 151.43 22 48.89
1463. Adam (ediggity152005) 42 120.01 135.57 24 57.14
1464. Landon (floont) 14 120.00 127.79 6 42.86
1465. oriom (orionrw) 16 119.99 138.57 11 68.75
1466. chan (blackstarnova) 15 119.99 136.45 11 73.33
1467. habhibhi (habhibhi) 2 119.99 131.08 2 100.00
1468. fiddlesticks (acadiantaco) 99 119.98 162.91 53 53.54
1469. shcal (shcal) 17 119.96 135.41 7 41.18
1470. anonym_igelkott (anonym_ige... 291 119.96 143.19 163 56.01
1471. Josh (shrekker) 30 119.95 141.48 13 43.33
1472. ogamiseta (samarthos) 34 119.95 129.56 12 35.29
1473. joey (joeraps) 143 119.95 139.13 102 71.33
1474. mat (greenode) 4 119.94 135.01 4 100.00
1475. pogchamp (the_frog_champ) 19 119.92 164.12 11 57.89
1476. peter (pbang) 1 119.91 119.91 0 0.00
1477. vurple (vurple) 1 119.90 119.90 0 0.00
1478. Leonard (shutupleonard) 2 119.90 123.59 2 100.00
1479. Arjun (atc6505) 1 119.88 119.88 0 0.00
1480. Ryan (rya_nly) 16 119.87 145.86 11 68.75
1481. isaacyoshimario (isaacyoshi... 2 119.86 125.58 2 100.00
1482. Moonblast YT (axemalt) 4 119.85 125.23 4 100.00
1483. que (jhavul) 77 119.85 153.20 48 62.34
1484. Chad (dr_salfish) 1 119.85 119.85 1 100.00
1485. Saschamz (saschamz) 3 119.84 121.55 2 66.67
1486. Sophie (ururunwolf) 1 119.82 119.82 0 0.00
1487. (reallyam) 4 119.82 134.84 3 75.00
1488. rajendra (tillaraj) 1 119.79 119.79 1 100.00
1489. bwian (brianschao) 6 119.79 131.46 4 66.67
1490. Noz (nozz) 8 119.78 132.19 7 87.50
1491. Troy (n1x377) 5 119.77 132.19 5 100.00
1492. Jason (transcendentaltypist) 1 119.76 119.76 0 0.00
1493. Cenk (lambdaa) 1 119.76 119.76 1 100.00
1494. KirinChibi (k4nna) 26 119.76 139.44 21 80.77
1495. King (kingcrumple) 246 119.75 153.64 157 63.82
1496. ansix (an66) 51 119.74 138.91 29 56.86
1497. Ahmed (dropheart) 2 119.74 124.72 2 100.00
1498. Igor (igorjosifoski) 1 119.73 119.73 1 100.00
1499. Kataalyst (litextreme) 3 119.73 129.25 3 100.00
1500. Terrance (notterrancehuang) 27 119.71 137.82 16 59.26
1501. Jeffy (jeffyl) 94 119.71 150.35 57 60.64
1502. Peanut (peanutpocket) 23 119.70 135.69 8 34.78
1503. Combo (combospag) 3 119.70 126.52 2 66.67
1504. Dan Jeryll (almadendj) 58 119.68 133.30 32 55.17
1505. Aman (fifafanz) 2 119.66 123.31 2 100.00
1506. Smiggy (chillnye) 5 119.66 126.27 4 80.00
1507. Maddie (forbearance) 3 119.65 130.91 2 66.67
1508. Aloïs (scribbleempire) 5 119.65 136.08 4 80.00
1509. Tiffany (tylietz) 2 119.65 122.42 2 100.00
1510. Adam (wallboy) 1 119.64 119.64 1 100.00
1511. Snactus (snactus) 1 119.63 119.63 1 100.00
1512. David (electro2020) 19 119.63 143.48 9 47.37
1513. Leonard (lentan) 13 119.61 135.15 7 53.85
1514. Isaac (hyperkids) 42 119.60 142.62 18 42.86
1515. James (2janghoon) 45 119.58 152.64 24 53.33
1516. Kris (kris_z) 15 119.57 141.02 6 40.00
1517. Krispy (krispytypes) 238 119.56 144.01 129 54.20
1518. bourque (iketype) 2 119.56 126.61 1 50.00
1519. Chris (papadroop1) 48 119.52 144.28 23 47.92
1520. buoyancy (masqueworld) 118 119.51 141.86 66 55.93
1521. Avery (avery11821) 2 119.51 139.04 0 0.00
1522. Tim (idiotaaa) 4 119.48 122.40 4 100.00
1523. FL (trumpetrockslol) 2 119.48 126.78 2 100.00
1524. Sabrina (the_ice_within) 8 119.47 148.60 8 100.00
1525. Lokki (lokkicubes) 4 119.45 127.24 0 0.00
1526. Mateusz (mattinato21) 170 119.43 154.89 3 1.76
1527. Garrett (gdiegnan147) 118 119.43 144.32 65 55.08
1528. turbocell48 (turbocell48) 95 119.43 145.23 57 60.00
1529. Keanu (thesinistershadow) 1 119.43 119.43 1 100.00
1530. Victor (iusearchbtw) 3 119.42 124.47 0 0.00
1531. d'un vecchio caminetto inga... 9 119.41 134.34 5 55.56
1532. (khronic) 873 119.40 154.56 522 59.79
1533. Struedelcat (struedelcat) 7 119.39 131.99 4 57.14
1534. Andrew (andmarek) 8 119.37 129.35 5 62.50
1535. Keith (emblazin) 4 119.35 135.41 3 75.00
1536. NB (purple_turkey) 3 119.35 126.08 1 33.33
1537. hand (quarterpastnine) 9 119.33 129.45 5 55.56
1538. Jian Feng (bosprimigenius) 1 119.32 119.32 0 0.00
1539. Jinkas (jinkas) 1 119.32 119.32 1 100.00
1540. Lotus (lotuspirate) 5 119.32 127.13 2 40.00
1541. Kevin (shocky79420) 1 119.29 119.29 0 0.00
1542. yst (taro311) 3 119.28 125.21 3 100.00
1543. J (jyorange) 20 119.26 154.48 12 60.00
1544. Jarvi (jarvireneil) 4 119.24 128.28 1 25.00
1545. George (georgeracer1) 2 119.23 120.89 1 50.00
1546. stop! (ademke) 708 119.21 164.85 387 54.66
1547. TacticalTux (tacticaltux) 12 119.20 130.15 9 75.00
1548. DownOnMe (twindracula) 4 119.18 125.46 3 75.00
1549. A (1s1t1r) 1 119.17 119.17 0 0.00
1550. sweet chili (darinoee) 24 119.17 137.10 20 83.33
1551. tch (tchstf) 2 119.15 122.81 2 100.00
1552. Ned (kokainegun) 4 119.12 126.21 3 75.00
1553. Ani (secretary_ani) 4 119.12 124.09 3 75.00
1554. Cameron (camerong123) 34 119.11 143.68 19 55.88
1555. Rae (raedog) 17 119.09 138.95 6 35.29
1556. no (nothanksgiving) 632 119.05 168.51 314 49.68
1557. AGTNurat (agtnurat) 33 119.05 142.35 20 60.61
1558. eBright (ebright) 2 119.05 127.29 1 50.00
1559. Degoldie (digim) 2 119.05 130.84 2 100.00
1560. tofu (reversytofu) 89 119.04 150.16 54 60.67
1561. Eric (avocadopineapple) 2 119.02 126.74 1 50.00
1562. Alpha (alphatyper123) 3 119.01 125.35 2 66.67
1563. Owen (owenxc1234) 86 119.00 160.43 49 56.98
1564. Mevious (someguy) 13 119.00 129.41 5 38.46
1565. PsychoSaeko (psychosaeko) 1 118.97 118.97 1 100.00
1566. Jacob (vanosgaming2014) 29 118.97 138.04 17 58.62
1567. Hehe (decahexatrix) 2 118.97 125.36 0 0.00
1568. sb (sb_unoriginal) 1 118.95 118.95 1 100.00
1569. Gaz (garrickgsn) 1 118.95 118.95 1 100.00
1570. Anthony (gphobes) 36 118.94 148.08 21 58.33
1571. Max (mafab1) 63 118.94 148.45 38 60.32
1572. Matthew (matthewmics77) 1 118.94 118.94 1 100.00
1573. Porpoise (porpoisefantasy) 3 118.94 120.87 3 100.00
1574. Val (luv2swimv) 16 118.93 148.05 10 62.50
1575. Anthony (mantipula) 2 118.91 120.00 0 0.00
1576. Iura (newbeginnings) 6 118.90 129.03 2 33.33
1577. index finger spacebar user ... 28 118.89 138.17 10 35.71
1578. Charlie (requiem2048) 1 118.88 118.88 0 0.00
1579. NotRyan (arthritispacked) 5 118.88 128.85 4 80.00
1580. Bryan (tylanstor) 3 118.87 131.00 2 66.67
1581. Andreas (legendmeadow) 2 118.87 119.85 1 50.00
1582. Bernard (siko_lick) 1 118.86 118.86 1 100.00
1583. coolfission (coolfission) 41 118.84 130.70 21 51.22
1584. It's Davda ✅👣 (meetdavda) 39 118.84 137.59 25 64.10
1585. Davi (davi_v) 108 118.83 141.52 52 48.15
1586. Bob (bobtehguy) 64 118.82 139.20 44 68.75
1587. Josh (itztaayoooo) 1 118.81 118.81 1 100.00
1588. George (dolias) 3 118.77 124.24 2 66.67
1589. Kai (uploz) 1 118.76 118.76 0 0.00
1590. Baba (bobabo) 18 118.76 135.94 7 38.89
1591. ❤❤❤ (lavenenoz) 25 118.75 133.57 4 16.00
1592. stand against genocide! (_n... 13 118.74 124.74 6 46.15
1593. Noel (twicetzuyu) 1 118.72 118.72 0 0.00
1594. Linda (craygirl) 2 118.71 119.62 1 50.00
1595. den (d3niska) 6 118.69 131.94 2 33.33
1596. Poogen (wolfer50000) 2 118.68 127.06 2 100.00
1597. pc (prankster5546) 4 118.67 121.39 2 50.00
1598. Randall (rdox10) 139 118.65 156.39 83 59.71
1599. Marky (flytower69) 11 118.65 140.41 9 81.82
1600. Nick (adyingwalrus) 89 118.64 141.06 38 42.70
1601. sanic (sleepmoar) 12 118.63 141.66 11 91.67
1602. Carrot (carrotocn) 1 118.63 118.63 1 100.00
1603. :) (bavadin) 10 118.62 129.59 4 40.00
1604. Maybe (maybe413) 44 118.62 129.97 22 50.00
1605. Nixibeaver (nixibeaver) 1 118.62 118.62 1 100.00
1606. Snowy (snowyhessh) 3 118.62 127.46 2 66.67
1607. Walter (junkbaby) 35 118.61 147.69 21 60.00
1608. Nigel (intrexion) 4 118.61 131.91 4 100.00
1609. Joseph (joseph_468) 155 118.59 140.23 90 58.06
1610. B (kinfthaderp) 28 118.59 136.09 12 42.86
1611. keker (yash117) 3 118.58 121.96 1 33.33
1612. Slow (noob) 2 118.58 120.23 0 0.00
1613. Anna (misslua1) 1 118.56 118.56 1 100.00
1614. John (qui505092) 155 118.55 144.55 86 55.48
1615. Chris (lilchrisbmw) 6 118.55 134.26 5 83.33
1616. brandon (kbseah) 17 118.52 133.97 7 41.18
1617. TGNYC (tgnyc) 15 118.51 128.45 7 46.67
1618. Ronnie (ebedebeds) 13 118.51 128.10 6 46.15
1619. (eikig) 1 118.49 118.49 1 100.00
1620. Berny (syrupsandwich) 85 118.48 155.73 41 48.24
1621. prison mate pete (petermh) 7 118.48 152.98 5 71.43
1622. noob (fear_ed) 30 118.48 135.71 22 73.33
1623. Rigno (redbubba) 73 118.44 144.70 37 50.68
1624. Weegeepootis (weegeepootis) 19 118.44 135.06 8 42.11
1625. Fox (zzhenry) 6 118.43 145.34 4 66.67
1626. Bakugo (respiro72) 32 118.43 136.95 22 68.75
1627. Max (17maxklivans) 305 118.42 158.87 165 54.10
1628. Winston (zywinston) 17 118.41 138.79 10 58.82
1629. Andy (parachuteguy500) 3 118.40 128.55 3 100.00
1630. Harrison (harryblueberry) 83 118.40 158.91 51 61.45
1631. tstats[tshafer3] (tshafer3) 2,586 118.39 149.72 1,481 57.27
1632. da (dahanci) 8 118.37 127.75 7 87.50
1633. samore (samore) 4 118.36 137.95 4 100.00
1634. Kaleb (realkaleb) 5 118.35 123.60 5 100.00
1635. Austin (_8(|) (atrain742) 236 118.35 156.30 115 48.73
1636. Lrip#0001 (lrip) 137 118.35 145.35 59 43.07
1637. Peppito (peppito) 26 118.34 147.12 18 69.23
1638. Grace (gracecatan) 32 118.34 131.73 14 43.75
1639. saefwaqefr (monkethattypesf... 1 118.33 118.33 1 100.00
1640. Rooster (darkjdm) 16 118.33 142.83 11 68.75
1641. Samuel (knightsight) 95 118.33 154.88 68 71.58
1642. Justin (shaowen) 23 118.31 131.49 12 52.17
1643. barack (shming) 27 118.31 135.06 20 74.07
1644. sameer (sameerlol) 7 118.30 129.28 4 57.14
1645. Justin (zexcel) 28 118.30 128.91 13 46.43
1646. salmonjerky (salmonjerky) 24 118.30 137.98 12 50.00
1647. saizenG (saizen) 2 118.29 126.92 1 50.00
1648. TheyGotAlex (harshbarger.a@... 272 118.28 164.34 142 52.21
1649. Harry (pandasboob) 69 118.28 143.54 34 49.28
1650. DELA CRUZ (delacruzz) 2 118.28 124.10 2 100.00
1651. Kelvin (aerochow) 2 118.27 125.43 2 100.00
1652. Sherlock (caramel1995) 83 118.25 143.37 45 54.22
1653. Jake (drjakeman) 26 118.24 133.71 21 80.77
1654. Eli (elewint) 3 118.22 133.43 3 100.00
1655. Mark (markf0cu5) 3 118.22 128.40 1 33.33
1656. michael (banane_1) 529 118.21 161.69 285 53.88
1657. Stinky Balls (slow znerwill... 14 118.18 127.84 4 28.57
1658. KC (hotdogkc) 159 118.17 160.13 39 24.53
1659. Ziwei (dongryeollee) 5 118.16 131.07 3 60.00
1660. Slow мΘşħΞ (letype613) 5 118.16 125.51 3 60.00
1661. javonte (javonteslow) 31 118.15 153.82 22 70.97
1662. ShadowTenshii (shadowtenshii) 1 118.14 118.14 1 100.00
1663. quite fast (edonn) 282 118.13 148.06 125 44.33
1664. deadend (shiroku) 14 118.13 133.33 9 64.29
1665. blaine (frikker) 19 118.12 151.78 15 78.95
1666. chopst1cksss (chopst1cksss) 1,134 118.12 147.30 660 58.20
1667. tstats[ericliu17] (ericliu17) 286 118.11 155.92 173 60.49
1668. MOIST (aznboy578) 1 118.10 118.10 1 100.00
1669. twitch.tv/cellytherosebush ... 1 118.06 118.06 0 0.00
1670. tyenavatyen (zombiewgoku77) 52 118.05 148.84 31 59.62
1671. Adrian (afbslacker) 1 118.03 118.03 1 100.00
1672. joorie (joorie) 6 118.02 131.21 3 50.00
1673. Pein (haha8065) 2 118.02 120.31 1 50.00
1674. Destiny (snowpenguin2) 2 118.01 119.13 1 50.00
1675. Chris (fogcityroller) 3 117.99 126.86 2 66.67
1676. Barbo (o_mon) 8 117.98 132.50 4 50.00
1677. Kaz (kazuerdos) 1 117.97 117.97 1 100.00
1678. The cute girl likes pink (o... 895 117.96 152.37 506 56.54
1679. Nicole (nicolemt) 2 117.96 119.05 1 50.00
1680. Kei (auvere) 2 117.95 120.13 1 50.00
1681. Grace (sprang1) 2 117.95 118.60 1 50.00
1682. 🇵🇸 (' _ゝ') (trickroom) 8 117.94 126.35 3 37.50
1683. DONATETOWATERAID (donatetow... 39 117.94 141.04 28 71.79
1684. ((: (yeeyeehehe) 28 117.94 135.53 13 46.43
1685. Finch (ficxjo) 12 117.93 146.31 6 50.00
1686. Koji (kojji) 1 117.92 117.92 1 100.00
1687. mine (diamondminer939) 2 117.91 127.89 1 50.00
1688. grubres (saveall) 9 117.89 128.94 1 11.11
1689. Daniel (dwang18) 3 117.89 119.34 1 33.33
1690. Lebaidin (lebaidin) 4 117.89 128.22 3 75.00
1691. Stalin (notdavidcameron) 32 117.89 146.39 18 56.25
1692. S (sestevens) 18 117.88 131.73 6 33.33
1693. Victor (helixidron) 7 117.87 137.34 3 42.86
1694. Sinavestos (optictears) 3 117.87 131.17 1 33.33
1695. Jepps (dazzle919) 13 117.86 149.79 6 46.15
1696. Stan (odeathdragon) 3 117.85 124.09 2 66.67
1697. Just (justdandy_) 10 117.85 141.63 5 50.00
1698. Ezra (account_name) 12 117.84 128.04 4 33.33
1699. Bart (hubba485) 37 117.82 136.26 17 45.95
1700. joshuawh (sh1nobie) 28 117.80 150.35 8 28.57
1701. U (tgod12345) 5 117.79 130.05 5 100.00
1702. Evan (gemofevan) 21 117.78 145.51 8 38.10
1703. Ozark (ozarkian) 8 117.78 137.75 7 87.50
1704. JustMonotone (justmonotone) 17 117.77 131.15 12 70.59
1705. Andrew (andrewgoat) 6 117.76 137.72 1 16.67
1706. TQ (_tq_) 5 117.76 123.20 5 100.00
1707. 🌸Peaches & Cream (easy_g... 198 117.75 143.53 90 45.45
1708. Caddar (caddar) 10 117.74 147.15 5 50.00
1709. LOL (cheesecakeisgud) 9 117.74 129.25 5 55.56
1710. Unsolved (unsolvedcypher) 4 117.73 137.78 3 75.00
1711. Eldergod of the Universe (l... 249 117.72 157.37 118 47.39
1712. Chynna (chynnatown) 1 117.72 117.72 0 0.00
1713. elaine (elainezhu) 15 117.72 130.56 10 66.67
1714. ARW🔴 (appleredwarrior) 227 117.71 152.17 132 58.15
1715. Μάξιμε (macmo) 14 117.70 129.27 8 57.14
1716. ivᅠonᅠutube (unreaii) 11 117.70 135.11 7 63.64
1717. David (random_lee) 4 117.69 133.45 2 50.00
1718. Josh (yungjosh) 12 117.69 132.51 6 50.00
1719. Luka (sercasm) 66 117.68 136.84 43 65.15
1720. E (njpwstardomfan) 1 117.68 117.68 1 100.00
1721. Nico (cuber) 12 117.67 148.73 4 33.33
1722. Dylan (uuind) 23 117.66 134.81 11 47.83
1723. Sam (dakiller234) 4 117.65 134.18 3 75.00
1724. Gillian (gilz242) 4 117.65 132.44 3 75.00
1725. OvenHeat (ovenheat) 56 117.64 163.03 37 66.07
1726. VietCoffee (nytrogen99) 12 117.63 134.00 10 83.33
1727. ⠈⠁ᵀ ᴱ ᴵ ᴸ ᴼ... 724 117.63 154.07 364 50.28
1728. Alex (cantthingofusernameyay) 1 117.62 117.62 1 100.00
1729. David (davidliu323) 15 117.62 135.93 7 46.67
1730. Elie (eliepr0) 51 117.57 142.10 24 47.06
1731. rama (ramaseta) 1 117.57 117.57 1 100.00
1732. Mew (mw46) 14 117.57 137.64 6 42.86
1733. Mark (mariktypes) 29 117.56 141.94 16 55.17
1734. Smudge (cuteboi) 372 117.55 161.05 202 54.30
1735. Greg (yaohan) 8 117.51 136.77 8 100.00
1736. Steven (lander5) 2 117.51 129.95 1 50.00
1737. The (dhemagicianking) 32 117.51 140.75 14 43.75
1738. m (microlmao) 1 117.50 117.50 1 100.00
1739. xiaobai (superbarnie) 3 117.49 120.79 1 33.33
1740. Mishi (mickimouse) 3 117.48 125.96 2 66.67
1741. iza (servoracc) 13 117.48 143.33 6 46.15
1742. Jonathan (jonc2002) 18 117.48 136.88 9 50.00
1743. Disambiguous (disambiguous) 1 117.48 117.48 1 100.00
1744. Darth (darthbetterthanyou) 1 117.48 117.48 1 100.00
1745. KJ (snthaoeu) 36 117.46 136.94 16 44.44
1746. Alex (xanfan01) 11 117.46 133.76 7 63.64
1747. Garett (assaulted) 71 117.46 140.33 39 54.93
1748. J (dingkid) 9 117.45 125.49 5 55.56
1749. Foofmeister (foofmeister) 8 117.45 137.42 3 37.50
1750. Jebediah (jebediah123) 179 117.44 140.40 117 65.36
1751. Runescape Spam Bot (homer_s... 1 117.44 117.44 1 100.00
1752. (dafler) 66 117.44 135.05 36 54.55
1753. (dragusprime) 339 117.43 152.77 178 52.51
1754. chunky (wbcracer) 346 117.42 143.58 199 57.51
1755. Ethan (rtdrtd) 9 117.42 132.54 3 33.33
1756. Julia (348753021) 52 117.41 139.09 33 63.46
1757. Rem (ryanz778) 10 117.40 129.51 5 50.00
1758. Aidan (biccythiccy) 7 117.39 124.07 5 71.43
1759. ez (kobe2605) 6 117.39 123.50 4 66.67
1760. BOz (hyund0) 36 117.38 133.49 22 61.11
1761. Chris (papadroop) 3 117.36 128.29 2 66.67
1762. David (zzandland) 5 117.36 124.14 3 60.00
1763. benihana (ledecade) 7 117.35 120.82 4 57.14
1764. Dave (punskilled) 8 117.34 128.92 3 37.50
1765. BupsterWavelength (bupsterw... 4 117.34 130.49 2 50.00
1766. PRACTICE (practicecar) 32 117.33 143.37 19 59.38
1767. Pawaox (pawaox) 7 117.33 135.84 4 57.14
1768. Tony (forthawhur) 3 117.31 127.58 2 66.67
1769. Logan (theperson60) 1,206 117.30 151.69 612 50.75
1770. morgan (morganidk) 1 117.29 117.29 0 0.00
1771. Chris (nukesterz) 3 117.28 137.67 1 33.33
1772. slowass (senseyf) 1 117.28 117.28 0 0.00
1773. Brandon (basukaviru) 1 117.28 117.28 0 0.00
1774. 🐵🙈🙉🙊🐒🦍... 61 117.27 151.95 33 54.10
1775. taseh (taseh) 26 117.27 129.91 14 53.85
1776. Barry (barry011) 265 117.27 148.10 140 52.83
1777. billy (bzmq) 16 117.24 131.02 12 75.00
1778. Crew (crewmate_sus) 418 117.22 159.37 224 53.59
1779. So Slow (quantum1) 18 117.22 137.54 9 50.00
1780. rethya (reimogi) 39 117.21 142.62 18 46.15
1781. (atypicaltypist) 62 117.21 152.11 34 54.84
1782. Biscuit. (kiokuru) 3 117.20 127.12 3 100.00
1783. Dana (icantthinkofausername) 30 117.19 135.51 20 66.67
1784. salad fingers (guuul) 43 117.18 138.03 20 46.51
1785. a (tinle1307) 5 117.17 128.07 3 60.00
1786. goodbye, heather. (unbeliev... 48 117.17 138.36 25 52.08
1787. Adrian (adrianlee196) 49 117.16 133.24 26 53.06
1788. Nuboo (nuboo) 23 117.15 142.94 14 60.87
1789. Arti (artifictional) 13 117.14 129.05 6 46.15
1790. jeremyWINZ (jeremiah_munguia) 234 117.12 156.06 110 47.01
1791. Aron (skillervv) 5 117.11 123.71 4 80.00
1792. Stefan (stefan_t) 9 117.11 128.66 7 77.78
1793. Whispie (whispie_) 6 117.10 120.53 4 66.67
1794. MySpaceBarIsBroken (kanto) 9 117.10 128.74 6 66.67
1795. Lunchlady (xg33kx) 4 117.10 132.05 2 50.00
1796. Austin (artannenbaum) 18 117.09 145.07 10 55.56
1797. (rayer) 856 117.09 168.57 459 53.62
1798. JB (wtfhowareyousofast) 60 117.09 151.56 35 58.33
1799. d1ff1cult (apysch) 27 117.08 128.54 15 55.56
1800. Krg (username_example125259) 273 117.07 142.63 155 56.78
1801. Paolo (mcnugget25) 51 117.05 137.82 32 62.75
1802. Steven (misterpear) 12 117.04 128.88 4 33.33
1803. ilysm (angelkiro) 6 117.04 123.12 6 100.00
1804. (rontran) 2 117.03 125.84 1 50.00
1805. Jeffrey (jeffro1230) 2 117.02 124.82 2 100.00
1806. Ay (aydint222) 5 117.01 132.83 4 80.00
1807. Rasea (rasea) 4 117.00 118.60 3 75.00
1808. bie (bumblebie) 4 117.00 121.32 3 75.00
1809. George (dooglplex) 1 116.99 116.99 0 0.00
1810. Kent (kent777) 5 116.99 129.18 2 40.00
1811. Brandon (kirbyfan107) 173 116.98 151.71 98 56.65
1812. A (dragon02) 1 116.97 116.97 0 0.00
1813. Gina (ginadoerp) 5 116.94 132.79 2 40.00
1814. Roham (rohamhasbadaim) 5 116.94 133.63 4 80.00
1815. Whinnie (whinnie) 2 116.94 120.17 2 100.00
1816. MasterDebater (masterdebate... 5 116.93 125.56 4 80.00
1817. Ghost (djinxkay) 17 116.93 146.25 10 58.82
1818. Kitty (kxkixi) 84 116.91 135.95 46 54.76
1819. Ben (tt_ben) 5 116.91 121.39 4 80.00
1820. -ⲘᎯᖇⲕ⋎⟆- (mark4... 5,686 116.91 163.77 2,084 36.65
1821. winterml3on (winterm3lon) 16 116.90 131.08 7 43.75
1822. HHKBest (jywh91) 1 116.90 116.90 1 100.00
1823. Lulu (shade_senpai) 140 116.89 150.30 77 55.00
1824. ryan (hopedarklord1) 34 116.89 140.38 20 58.82
1825. Henry (drwolf) 2 116.85 123.52 1 50.00
1826. Victor (victorhz) 6 116.84 127.80 4 66.67
1827. lolwut9001 (lolwut9001) 40 116.83 148.85 24 60.00
1828. Nikola (zatharel) 2 116.83 122.06 2 100.00
1829. Krampi (krampi) 5 116.82 137.58 5 100.00
1830. Thew (5_years_old) 4 116.80 126.52 1 25.00
1831. asdf (intheoryno) 4 116.80 129.24 1 25.00
1832. Steven (muppo) 6 116.77 128.49 1 16.67
1833. DUFOUR (dufour) 20 116.76 139.05 10 50.00
1834. wiiiiiiiiiiiiiiiiiiiiiiiiii... 3 116.76 125.25 3 100.00
1835. Aftiii (aftiii) 1 116.75 116.75 1 100.00
1836. Wesley (wesleymelon) 27 116.75 145.46 13 48.15
1837. Brian (bv_altxps) 78 116.73 146.24 40 51.28
1838. David (bubberducky) 1 116.73 116.73 0 0.00
1839. Noah (noaahhh) 3 116.70 118.70 1 33.33
1840. Choco (choco314) 2 116.69 127.10 2 100.00
1841. Ellie (senimoo) 23 116.68 150.67 11 47.83
1842. Michael (michhael) 6 116.66 130.74 2 33.33
1843. PixelatedFungus (pixelatedf... 5 116.65 130.09 5 100.00
1844. Jason (energetichay) 7 116.63 136.38 3 42.86
1845. Dein (deinfreund) 27 116.63 136.95 27 100.00
1846. Neil Franco (neilprangko) 226 116.63 158.38 130 57.52
1847. Rui (youngjaerui) 1 116.62 116.62 0 0.00
1848. (needforaccuracy) 183 116.62 143.37 96 52.46
1849. Chawin (chawintree) 6 116.61 127.58 4 66.67
1850. frank (fastfingersfrank) 24 116.56 137.60 12 50.00
1851. EmiNation | (emingamer) 6 116.55 134.02 4 66.67
1852. Jacob (jq231) 17 116.54 138.78 9 52.94
1853. ⌨️🖱️ (t_0nio) 8 116.53 137.06 8 100.00
1854. Sydney (sydneykimbell) 91 116.52 134.15 47 51.65
1855. 🔥Varcious🔥 (varcious) 2 116.52 118.97 1 50.00
1856. Kathryn (katiehughesspaz) 4 116.52 153.22 3 75.00
1857. Edge (edgekaos) 1 116.51 116.51 1 100.00
1858. Dmitry (voidpointer64) 2 116.51 121.80 1 50.00
1859. bindyy (bindyy) 24 116.48 136.98 16 66.67
1860. ahmir (ahmir123) 3 116.47 120.98 2 66.67
1861. Toyota (websitejunkie) 70 116.46 158.88 43 61.43
1862. Pepijn (goatism) 2 116.46 118.84 0 0.00
1863. ants (fr4nc3) 59 116.43 138.27 30 50.85
1864. Laura (lgmorse) 4 116.43 126.03 4 100.00
1865. teabiscuit (teabiscuit1) 6 116.42 124.30 1 16.67
1866. Chagil (chagil) 89 116.39 152.38 41 46.07
1867. sky (lumihime) 17 116.36 130.91 9 52.94
1868. Tiffany (xaelium) 5 116.36 125.42 1 20.00
1869. Ethan (ethant772) 141 116.35 156.80 79 56.03
1870. Aaron (daggertye) 3 116.35 131.93 0 0.00
1871. klystt (klystt) 1 116.35 116.35 1 100.00
1872. JL (strikewolfgg) 9 116.34 134.28 5 55.56
1873. theunnoticable (theunnotica... 15 116.34 138.53 8 53.33
1874. bool3max (bolemax_accuracy) 1 116.33 116.33 1 100.00
1875. natetron (toasterboy5) 3 116.33 131.99 1 33.33
1876. (sura5) 2,161 116.32 176.11 1,252 57.94
1877. cc (cclin130) 1 116.30 116.30 1 100.00
1878. ༼ʘ̚ل͜ʘ̚༽ (happyno) 5 116.30 131.65 1 20.00
1879. Catering (sneevy) 31 116.30 131.33 14 45.16
1880. Andy (andym04) 13 116.29 139.85 9 69.23
1881. day (thedvoraktypist) 3 116.29 118.59 1 33.33
1882. THE ONE PIECE IS REAL (herm... 6 116.29 120.63 6 100.00
1883. elizabeth (elizabeth1ee) 36 116.29 136.46 21 58.33
1884. Adam (zamn) 2 116.27 120.68 0 0.00
1885. rip reckful (fictorian) 108 116.23 145.75 56 51.85
1886. lyricaldeadversion (4l3y) 99 116.23 148.85 58 58.59
1887. Jacob (siskonwich) 3 116.23 124.82 1 33.33
1888. Jeff (jeff_howson) 2 116.22 126.03 1 50.00
1889. Dennis (dya26) 10 116.21 134.19 4 40.00
1890. viRo (virosnes) 16 116.21 143.24 7 43.75
1891. Christian (typeger) 7 116.20 132.72 5 71.43
1892. Daniel (amai727) 36 116.19 146.70 20 55.56
1893. tstats[wardenod17] (wardeno... 3 116.19 124.18 1 33.33
1894. C (sneakyperryplat) 24 116.19 141.11 11 45.83
1895. ttvdivertingwhale (divertin... 11 116.18 137.66 10 90.91
1896. Salted (salted_mangoes) 2 116.18 120.42 2 100.00
1897. Bruce (bruceboy1985) 14 116.16 131.86 8 57.14
1898. Maxwell (999maxwell) 3 116.16 129.37 2 66.67
1899. Chris (chrisdave) 1 116.14 116.14 1 100.00
1900. Nero was here (correct_fing... 20 116.13 132.59 11 55.00
1901. Tadej (reyalpdab2) 69 116.12 138.26 41 59.42
1902. sonny (sonnyb_) 2 116.12 124.99 1 50.00
1903. Wayne (dennynukes) 1 116.11 116.11 1 100.00
1904. Alireza (thealireza) 122 116.11 154.94 76 62.30
1905. [][][][] (atomskk) 9 116.09 141.12 5 55.56
1906. Celine (salamiii) 5 116.09 132.51 2 40.00
1907. R (ryanteebag) 17 116.09 129.02 12 70.59
1908. DanielP (daniel504) 4 116.09 121.91 1 25.00
1909. Envy (turbo_envy) 1 116.08 116.08 1 100.00
1910. caseyclosed (caseyclosedxd) 2 116.08 125.14 1 50.00
1911. shiru (shiruetto68) 37 116.07 142.18 19 51.35
1912. Sandra (sbs96) 13 116.07 136.37 7 53.85
1913. Duncan (dkbrk) 349 116.06 138.06 178 51.00
1914. Sarthak (arseeus_not_arkius) 2 116.06 119.91 1 50.00
1915. jj (ponygaryelow) 1 116.06 116.06 0 0.00
1916. asdfhuiosdfgshiodfhji (efrd... 11 116.06 131.87 10 90.91
1917. catfree (catfree) 41 116.05 130.95 21 51.22
1918. Aria (juicyhaluja) 36 116.04 156.76 18 50.00
1919. Bonjomon (asian_driver) 5 116.04 124.40 4 80.00
1920. Poops (poops_magee) 262 116.04 140.37 153 58.40
1921. passivestar (passivestar) 45 116.04 141.98 45 100.00
1922. Onionkreb (onionkreb) 25 116.04 130.43 15 60.00
1923. Kentaro (k3n74r0) 16 116.04 127.59 6 37.50
1924. Rider (typerrider) 10 116.04 132.79 6 60.00
1925. ssshanto (ssshanto) 48 116.03 150.32 21 43.75
1926. nothx (crassmonkey) 2 116.02 116.19 2 100.00
1927. Vitres (irving1234028) 37 116.00 142.93 18 48.65
1928. Cyrush (cyrus_h) 17 115.97 134.19 11 64.71
1929. (records) 94 115.97 147.13 50 53.19
1930. Coco (copilot17) 1 115.96 115.96 1 100.00
1931. tstats[s2dent] (s2dent) 2 115.96 119.06 1 50.00
1932. skitter315 (skitter315) 106 115.95 134.67 63 59.43
1933. Dan (hwip) 5 115.95 134.75 4 80.00
1934. kemiy (kemiy) 58 115.95 139.01 30 51.72
1935. dav (candyslug) 346 115.94 148.21 160 46.24
1936. Mahmood Thompson (mat_i) 365 115.94 155.42 209 57.26
1937. Uniphy (unitatoruler) 1 115.92 115.92 1 100.00
1938. Howdy (abinder) 532 115.90 160.24 318 59.77
1939. Hien (skrubtical) 13 115.88 129.87 8 61.54
1940. emczuk (emczuk) 26 115.87 130.68 8 30.77
1941. Ethan (ethanthecuber) 1 115.85 115.85 1 100.00
1942. Serenity (seerenityy) 34 115.84 134.37 21 61.76
1943. Alan (alanfortlink) 2 115.84 123.29 2 100.00
1944. Peter (duhburry) 4 115.84 126.50 2 50.00
1945. Kill (killyourself1234) 1 115.82 115.82 0 0.00
1946. i like to type (chuggaaconr... 63 115.80 141.01 37 58.73
1947. pjja (pjja) 22 115.79 145.30 14 63.64
1948. Exojay (exojay) 5 115.76 120.46 4 80.00
1949. Harry (harry_b0ss) 2 115.76 118.64 1 50.00
1950. DatMoonGamer (datmoongamer) 10 115.74 139.38 7 70.00
1951. Matthew (lesterholster) 1 115.74 115.74 0 0.00
1952. John Andrew (santiagoja_rog) 3 115.74 118.80 2 66.67
1953. Jia (icecoldpillow) 108 115.74 139.23 43 39.81
1954. Brandon (retrogamer56) 90 115.72 138.81 54 60.00
1955. Thunderstorm (thunderst0rm27) 65 115.72 137.66 51 78.46
1956. Jake (kyrien) 13 115.71 127.15 9 69.23
1957. Emil (awsomeemil25) 108 115.71 151.35 70 64.81
1958. C (windyreed) 8 115.71 130.55 3 37.50
1959. Chris (christrilling) 20 115.70 128.49 15 75.00
1960. Matt (wavytypesfastafbrah) 1 115.70 115.70 1 100.00
1961. Michael (micecheese) 1 115.70 115.70 1 100.00
1962. Cal (wiscahhhhnsin) 139 115.70 151.88 76 54.68
1963. Martina (martinaon) 17 115.70 140.90 12 70.59
1964. Hersh (hbhargava) 308 115.69 145.44 165 53.57
1965. Bal (belgianwaffle) 62 115.69 144.43 35 56.45
1966. Dickerlicker (dickerlicker) 1 115.69 115.69 1 100.00
1967. mustard maiden (mustardmaiden) 31 115.69 135.64 16 51.61
1968. Kasey (estrobe) 1 115.67 115.67 1 100.00
1969. Averie (afbanix) 1 115.67 115.67 1 100.00
1970. hoonman (hoonman) 1 115.66 115.66 1 100.00
1971. Abstraxions (abstraxions) 128 115.66 141.64 65 50.78
1972. Jacob (author_) 3 115.66 121.81 1 33.33
1973. Nicholas (fryingpan) 5 115.65 135.05 2 40.00
1974. zHekLeR (zhekler) 1 115.65 115.65 0 0.00
1975. Abuumin (zemonix) 5 115.64 141.29 2 40.00
1976. Tyrone (fastesthackertyper) 7 115.64 132.63 4 57.14
1977. Retro (fullretro) 2 115.64 123.26 2 100.00
1978. TapTapTappy (tomcolemak) 19 115.63 136.22 9 47.37
1979. Shion (shionaster) 1 115.62 115.62 0 0.00
1980. BobDaAsianBuilda (fortnitef... 76 115.62 134.70 32 42.11
1981. Edmund (edmundtyw1) 48 115.60 146.08 39 81.25
1982. Dioscene (dioscene) 28 115.59 135.34 15 53.57
1983. monster (monster) 9 115.57 134.20 5 55.56
1984. Juggle (juggle6) 26 115.56 133.86 16 61.54
1985. Sam (advil) 21 115.56 128.76 12 57.14
1986. Serg (drgsus) 623 115.54 156.18 305 48.96
1987. MoralCharity (ethicalgivings) 84 115.54 158.96 47 55.95
1988. nonquitvinpho (nonquitrainb... 740 115.53 164.74 324 43.78
1989. go easy (nielsenco) 34 115.51 139.69 27 79.41
1990. Sabrina (sabrinastangler) 1 115.51 115.51 0 0.00
1991. 드루와 (jinyt911) 1 115.51 115.51 0 0.00
1992. Jackie (laserelite) 8 115.51 126.20 6 75.00
1993. Kevin (kevgod48) 17 115.50 126.71 9 52.94
1994. yanna (7yanna) 11 115.49 132.08 4 36.36
1995. Spadger (spadgerr) 16 115.49 128.23 15 93.75
1996. Alenygam (provola23) 789 115.48 154.43 425 53.87
1997. fishy15 (fishy15) 13 115.48 138.64 6 46.15
1998. Jordan (jorsian) 3 115.47 126.39 0 0.00
1999. Ren (renrob13) 15 115.47 132.15 12 80.00
2000. yo (demailman) 7 115.46 131.05 4 57.14
2001. Kayden (russiangangsta) 2 115.45 122.06 1 50.00
2002. That One Guy (zbomber21) 22 115.45 142.54 21 95.45
2003. Kyle Me (poledancerz) 5 115.45 126.51 3 60.00
2004. Zia (zeeya) 9 115.44 139.04 4 44.44
2005. heyitsalec (heyitsalec) 115 115.44 140.53 75 65.22
2006. Destory (mexicanpikeman) 2 115.43 120.91 1 50.00
2007. Seth (sethbangerter) 8 115.42 127.14 2 25.00
2008. Ben (stormfalcon32) 2 115.40 121.86 1 50.00
2009. 👻 (damoru) 211 115.39 158.97 102 48.34
2010. rpyx (rpyx) 19 115.39 131.24 13 68.42
2011. purplefr|ction (tesla_diesel) 58 115.38 149.11 28 48.28
2012. not your dad (buthee) 75 115.38 139.38 44 58.67
2013. Whelps (whelps) 31 115.37 152.09 18 58.06
2014. jp (slowpractice) 1 115.37 115.37 1 100.00
2015. Ivysaur (ivysaureg) 5 115.36 130.74 4 80.00
2016. et (edcolemak) 25 115.35 130.77 12 48.00
2017. PenguinTypist (penguinfun) 6 115.35 130.17 3 50.00
2018. Sergio (sergiorbuge) 9 115.34 129.98 7 77.78
2019. Jack (jack90001) 55 115.33 139.33 28 50.91
2020. Myles (mylessucks) 160 115.32 146.62 79 49.38
2021. Clint (clint_kun) 59 115.32 135.10 25 42.37
2022. JuantonomoeTTV (juantonomoe) 30 115.30 131.74 18 60.00
2023. Neil (defecto) 4 115.29 124.94 3 75.00
2024. Elizabeth (bebecam) 8 115.28 129.70 6 75.00
2025. Tuan (tuan_nguyen) 90 115.28 140.83 49 54.44
2026. I'm bad at this :( (rl27) 17 115.27 125.03 12 70.59
2027. Casual (casual_penguin) 3 115.27 123.73 2 66.67
2028. ben (chompytheturtle) 53 115.27 141.68 37 69.81
2029. skyler (skyblake01) 6 115.23 122.41 3 50.00
2030. Tonels (tonels) 19 115.23 141.30 10 52.63
2031. HATE LAG! (11fingerstypist) 230 115.23 144.48 192 83.48
2032. Noatak (noatak_) 4 115.23 144.34 2 50.00
2033. Joshuasdf (qwertoid) 7 115.23 122.30 5 71.43
2034. Jack (jman777) 2 115.22 119.12 1 50.00
2035. chupapi (chupapimunyanyo69420) 1 115.22 115.22 1 100.00
2036. hi (notarock) 14 115.21 130.38 8 57.14
2037. Jeff (litboi101) 3 115.21 132.66 2 66.67
2038. eyedin (eyedin) 10 115.21 132.12 5 50.00
2039. Rey (reycuadrado) 17 115.20 147.96 8 47.06
2040. Lloyd (milanh) 50 115.19 139.21 31 62.00
2041. . (cope_and_seethe) 90 115.19 147.17 49 54.44
2042. Lam (catposter1) 146 115.19 153.74 129 88.36
2043. Gabe (dyrozang) 662 115.18 158.61 335 50.60
2044. Jonas (whatisupyou) 22 115.18 129.92 14 63.64
2045. Shiyyo (shiyyo) 4 115.17 126.75 2 50.00
2046. Delros (delros) 3 115.17 121.22 3 100.00
2047. Manny (manny_rm) 2 115.17 138.62 1 50.00
2048. Procrastiracer (racerrob) 110 115.16 147.26 55 50.00
2049. Xelieu (xelieu) 4 115.16 129.37 4 100.00
2050. AntPlayz (antplayz) 1 115.16 115.16 1 100.00
2051. Jack (ginganinjajack) 8 115.15 120.57 4 50.00
2052. Kevin (kevinisgay) 1 115.15 115.15 1 100.00
2053. Amazing (amazinghedgehog) 9 115.15 137.85 7 77.78
2054. Marius (mariusbucur) 2 115.15 119.76 2 100.00
2055. Jackson (jks0810) 2 115.14 135.70 1 50.00
2056. Chris (w1ndow) 7 115.14 130.51 3 42.86
2057. Sian-Yang (rgnerdplayer) 415 115.13 145.78 229 55.18
2058. nehal (nehal1337) 51 115.13 134.72 28 54.90
2059. Ibrahim (ibrahimtyper) 351 115.12 142.41 173 49.29
2060. Deddie (deddie_1) 4 115.11 134.41 3 75.00
2061. Minn Swan (motherlovesyou) 2 115.10 117.75 0 0.00
2062. Stella (stellafav) 3 115.09 128.84 1 33.33
2063. rob (dydtaylor) 18 115.09 129.40 10 55.56
2064. Charlie (generalfich) 2 115.09 118.02 2 100.00
2065. Nordaxion (nordaxion) 5 115.08 129.29 2 40.00
2066. Davis (bengalman447) 460 115.06 140.51 218 47.39
2067. Praise (praisehim) 29 115.05 130.41 11 37.93
2068. Radioactive (denharsh) 14 115.05 134.52 11 78.57
2069. Alexander (typelanterne) 53 115.05 134.66 21 39.62
2070. YJ (hanguoren) 2 115.05 123.37 2 100.00
2071. iStealthy (istealthy) 7 115.03 138.84 6 85.71
2072. Silent G (silentgisback) 29 115.03 135.93 15 51.72
2073. Tryin to make a change :-\ ... 8 115.03 131.62 4 50.00
2074. ratbastard (mattbierwirth) 25 115.02 136.19 16 64.00
2075. Z (vivethemodder) 4 115.02 125.61 4 100.00
2076. Jacob (jacobjuras) 133 115.01 141.86 77 57.89
2077. giann (giannperez123) 15 115.00 124.24 7 46.67
2078. Brian (bv_225) 2 115.00 123.82 1 50.00
2079. Noam (noamaster88) 5 114.99 120.94 2 40.00
2080. Cadence (cadence_workman) 35 114.99 135.64 24 68.57
2081. Tony (aarup) 7 114.99 140.07 5 71.43
2082. RC (tandiaman) 4 114.99 125.51 4 100.00
2083. Justin (leslav) 10 114.99 144.04 6 60.00
2084. Camilo (cgiraldo_) 2 114.98 118.45 0 0.00
2085. quoc (quoclahn) 4 114.97 129.37 2 50.00
2086. Cocoa (hotococoa) 2 114.96 129.51 0 0.00
2087. iaxx (iaxx) 7 114.95 131.69 3 42.86
2088. I'm so trash (peepolove) 63 114.94 129.41 28 44.44
2089. 🐸bingus🐸 (dearmr) 88 114.93 136.42 49 55.68
2090. Tia (tiaaakayyy) 18 114.93 131.27 9 50.00
2091. AaronIsADonkey (_gg_ez_) 32 114.93 137.46 14 43.75
2092. Isaac (th54) 2 114.93 126.03 1 50.00
2093. balls (faygodreams) 108 114.92 140.98 48 44.44
2094. Dexton (dextonjl) 978 114.92 160.00 489 50.00
2095. Angel (kyngbui) 29 114.91 149.41 15 51.72
2096. Mike (vual_) 1 114.91 114.91 1 100.00
2097. Brian (briank91) 3 114.91 125.72 1 33.33
2098. CHT (cht64) 14 114.91 139.55 11 78.57
2099. Robert (ert00034) 12 114.90 128.85 4 33.33
2100. spiky (spikyy) 3 114.88 120.34 2 66.67
2101. swag (swaglord1) 1 114.88 114.88 0 0.00
2102. Fayr (fayr) 1 114.88 114.88 1 100.00
2103. Salmonax (salmonax) 5 114.87 127.37 3 60.00
2104. Delphi/Z (jbroman) 4 114.86 123.77 4 100.00
2105. Zach (zachtepp) 8 114.85 125.75 5 62.50
2106. Rafael (spyhard12) 9 114.84 132.90 6 66.67
2107. Zbd (zobad) 17 114.84 139.60 10 58.82
2108. mg (mgperson) 20 114.81 131.83 11 55.00
2109. Joy (joyisawesome) 7 114.81 127.60 4 57.14
2110. PogChamp (raziqphantomz) 135 114.80 134.82 77 57.04
2111. . (z_edward) 4 114.79 122.05 2 50.00
2112. Cynical (cynicalentity) 1 114.79 114.79 1 100.00
2113. Shawn (cubershz) 37 114.78 137.62 19 51.35
2114. Hakan (cooperdevi) 1 114.77 114.77 1 100.00
2115. will (ywhh) 1 114.77 114.77 1 100.00
2116. Peak (peak_dvorak) 9 114.77 139.35 9 100.00
2117. Alex (m3hran80) 2 114.76 123.53 1 50.00
2118. pepega hands (itsmetimwasta... 8 114.75 129.57 5 62.50
2119. William (poutine08) 4 114.74 134.65 3 75.00
2120. DR (dekesta_) 38 114.74 144.22 28 73.68
2121. grossdesign (grossdesign) 11 114.74 129.30 9 81.82
2122. Kenneth (iflippy) 7 114.74 134.16 3 42.86
2123. Putu (boostedwrx) 32 114.72 145.23 17 53.13
2124. Jqmfg (jqmfg) 1 114.72 114.72 1 100.00
2125. Name (needevidence) 9 114.72 134.44 2 22.22
2126. Vivek (viivek) 7 114.71 131.04 5 71.43
2127. dorianmodemusic (djdorian1) 6 114.71 124.57 4 66.67
2128. Tien (thetientran) 608 114.70 181.20 331 54.44
2129. RainbowDude (rainbowdudenon... 231 114.69 159.45 93 40.26
2130. Westly (wslafleur) 36 114.69 133.06 19 52.78
2131. clicky (cinadeeye) 11 114.69 129.14 6 54.55
2132. A (suleil) 324 114.68 146.08 147 45.37
2133. Andreas (kukkaa) 1 114.68 114.68 1 100.00
2134. Jim (wrldsmine) 5 114.68 120.88 3 60.00
2135. melina (halfxheart) 1 114.67 114.67 1 100.00
2136. Charles (charlesduran27) 1,452 114.66 144.45 731 50.34
2137. Dale (livestrong12) 414 114.66 145.30 221 53.38
2138. Will (elwoodbear7) 1 114.65 114.65 1 100.00
2139. Johan (kankertypen) 16 114.65 137.40 7 43.75
2140. Garret (minecraftkid2007) 3 114.62 131.30 2 66.67
2141. PenTest-duck (pokemontypist) 11 114.61 128.35 4 36.36
2142. Sean (seanzie) 6 114.61 133.88 1 16.67
2143. Daniel (irrrlrvant) 65 114.61 147.10 12 18.46
2144. virtualflames#1011 (virtual... 2 114.61 132.14 2 100.00
2145. Alexa (drawnblue) 1 114.60 114.60 0 0.00
2146. Jamie (jamiegre) 51 114.59 141.98 25 49.02
2147. BRING THEM HOME (omerboner) 3 114.59 129.11 2 66.67
2148. Patrik (itsuberrr) 4 114.58 118.14 1 25.00
2149. Timmy (pakuyg) 3 114.57 116.95 3 100.00
2150. Matt (lightning_mcqueef) 48 114.57 136.02 26 54.17
2151. Andy (mouldy_peanut) 4 114.56 118.91 1 25.00
2152. Kupo (shinymoogle) 2 114.56 114.85 1 50.00
2153. gyani (arugyani) 1 114.56 114.56 1 100.00
2154. Hehe (gagokarin) 86 114.55 158.63 46 53.49
2155. Andrew (penguingm1) 12 114.55 129.62 8 66.67
2156. Pawel (pawelpro) 5 114.54 122.37 5 100.00
2157. xSora (xsora) 348 114.54 155.76 220 63.22
2158. Lawrence Leones (leonnids) 123 114.52 150.73 64 52.03
2159. yeet (yeetanut) 86 114.52 159.17 37 43.02
2160. Morris (reinheart) 16 114.51 124.60 7 43.75
2161. JohnsDog (johnsdog) 11 114.49 131.45 3 27.27
2162. Baked and Buttered (mcallen... 730 114.48 167.97 338 46.30
2163. 🏅🏅🏅 (naod_1225) 107 114.48 146.10 50 46.73
2164. Kaylee (mcpie87) 1 114.47 114.47 0 0.00
2165. Jim (ifeelhyper) 19 114.46 134.56 11 57.89
2166. Charles (chazzzle) 2 114.46 127.92 1 50.00
2167. Keepito (keepito1337) 3 114.45 121.60 2 66.67
2168. Jun (jyl6198) 5 114.45 121.66 4 80.00
2169. Finiten (finiten) 2 114.45 130.65 1 50.00
2170. harry (orekkles) 4 114.45 118.63 2 50.00
2171. Jean-Michel (safturento) 3 114.44 122.35 3 100.00
2172. Carl (draori) 3 114.44 120.06 1 33.33
2173. Johnny (gonzales_x_dumpy) 23 114.43 131.08 11 47.83
2174. Etalm (walter_gilbert) 38 114.43 142.09 22 57.89
2175. Noct (nocturnally_) 1 114.42 114.42 1 100.00
2176. slip (sliiiip) 4 114.42 127.65 1 25.00
2177. nah (determination_) 30 114.42 136.75 14 46.67
2178. Darryl (250wpm) 5 114.42 124.08 5 100.00
2179. unfalsent (typowriter16) 18 114.41 135.36 11 61.11
2180. Liam (nattilife) 2 114.41 121.08 2 100.00
2181. Miguel (quevangel) 550 114.40 158.59 301 54.73
2182. Robert (robertherrera13) 1 114.39 114.39 1 100.00
2183. jeff (cqyimo42) 78 114.39 133.67 34 43.59
2184. Virgin (virginchimp) 14 114.37 147.02 7 50.00
2185. Ray (ray1829) 29 114.37 144.37 18 62.07
2186. Jessica (jessicapeng) 7 114.37 125.38 4 57.14
2187. Danny (colby_brian) 6 114.37 121.31 4 66.67
2188. Noir (noirrime) 3 114.36 125.21 2 66.67
2189. Alyan (alyanm) 30 114.36 135.84 5 16.67
2190. Alex (purpleauro) 3 114.36 120.11 3 100.00
2191. Jacob (fastjacob) 28 114.36 133.91 15 53.57
2192. bliss (ninjakk) 2 114.36 119.45 2 100.00
2193. Nunya (nunyab) 5 114.35 133.51 3 60.00
2194. on earth, as it is in heave... 113 114.35 145.07 58 51.33
2195. Colin (blank9167) 48 114.35 141.20 26 54.17
2196. Judeisbad (4123) 1 114.34 114.34 0 0.00
2197. N (ortizn) 6 114.33 127.58 6 100.00
2198. MrButtersworth (flapjackstax) 626 114.33 137.22 300 47.92
2199. James (jameslroll) 33 114.33 134.74 19 57.58
2200. ihatepunc (manbanana) 1 114.33 114.33 0 0.00
2201. Lauren (lauren_conrad) 3 114.32 126.88 0 0.00
2202. Grizzly (growling_grizzly) 1 114.30 114.30 1 100.00
2203. praxZ (praxz) 14 114.30 131.11 6 42.86
2204. Daniela (_noodleynoodles_) 11 114.29 131.76 6 54.55
2205. MiNTy (thriller24) 5 114.29 121.80 4 80.00
2206. Jwad (jaziz) 318 114.29 146.78 171 53.77
2207. Alvin (al04) 8 114.28 126.08 7 87.50
2208. aurora (e4monn) 15 114.26 132.85 11 73.33
2209. George (stoptheads) 8 114.25 122.47 4 50.00
2210. Shiasuni (shiasuni) 32 114.25 138.24 20 62.50
2211. (nonquitwarrior) 9 114.25 146.90 3 33.33
2212. k (kabirpuri) 6 114.24 127.13 3 50.00
2213. Dan (subprime) 34 114.23 143.24 21 61.76
2214. Louie (lewieee) 394 114.23 147.34 228 57.87
2215. Khai (khaikhai2) 223 114.23 149.44 120 53.81
2216. paul (peazie) 8 114.22 122.24 5 62.50
2217. Dan (videogamewarriortv) 19 114.21 144.77 11 57.89
2218. samuel (samuelfung123) 5 114.21 124.70 2 40.00
2219. jason (falminfingaz) 6 114.19 127.33 1 16.67
2220. Jam (jamtri) 48 114.19 134.91 26 54.17
2221. Nikan (xnikan) 3 114.18 124.59 2 66.67
2222. ben (liubenjamin) 1 114.18 114.18 0 0.00
2223. zatoichi (zatoishwan) 48 114.17 143.04 21 43.75
2224. Kevin (mrtrololo) 2 114.17 124.42 2 100.00
2225. faith (flatypus) 43 114.16 146.48 28 65.12
2226. Martin (cydrox) 1 114.16 114.16 1 100.00
2227. steff (_stuf) 9 114.16 129.16 5 55.56
2228. Flip (flip2theleft) 60 114.16 144.58 32 53.33
2229. your mom (yourmother369) 8 114.15 129.26 4 50.00
2230. Michael (justatyperforfun) 1 114.13 114.13 1 100.00
2231. Polly (pajberman) 16 114.12 134.28 8 50.00
2232. Elskrim (important) 20 114.11 138.77 12 60.00
2233. 4D (4d2233) 1 114.10 114.10 1 100.00
2234. Duy (anthonytom) 24 114.09 128.06 10 41.67
2235. Chimaera (excalibur4212) 16 114.09 143.13 9 56.25
2236. Anthony (zhengant) 6 114.08 127.84 3 50.00
2237. Alex (rednaxt) 14 114.07 129.29 4 28.57
2238. Taxx (taxx) 14 114.07 133.41 5 35.71
2239. dvorshark 🦈 (strongly_ty... 15 114.06 140.93 4 26.67
2240. Peyton (turtledude48) 1 114.06 114.06 0 0.00
2241. JB (lookitsjb) 1 114.06 114.06 0 0.00
2242. melon (yoonity_) 31 114.05 131.49 21 67.74
2243. llameow (llameoww) 42 114.04 134.83 25 59.52
2244. ocodile (ocodile) 11 114.03 132.18 6 54.55
2245. arstdhneio (colemak_arst) 1 114.00 114.00 1 100.00
2246. Jason (jbourget87) 2 114.00 117.53 0 0.00
2247. Auto (autocats) 2 113.99 131.27 2 100.00
2248. Princh (mvprinch) 41 113.99 135.75 24 58.54
2249. Andre (andretx) 5 113.98 140.08 3 60.00
2250. Maddy (teruteru2116) 19 113.98 152.51 12 63.16
2251. wuz (echang95) 6 113.98 138.46 2 33.33
2252. Nacho (nachofry) 8 113.98 127.86 4 50.00
2253. Johnny (thatbigboy) 26 113.97 129.71 13 50.00
2254. criasier (criasier) 51 113.97 138.02 31 60.78
2255. Will (mockingod) 2 113.97 120.31 0 0.00
2256. Tarek (aqertis) 1 113.96 113.96 0 0.00
2257. Matthew (d3f1n3d) 13 113.96 132.83 6 46.15
2258. Spas (crsorsmth) 3 113.96 131.16 2 66.67
2259. ㅤ (spou) 7 113.95 122.31 4 57.14
2260. kifumi (kifumi) 39 113.94 129.96 19 48.72
2261. Ken (kenkenken_) 114 113.93 131.35 74 64.91
2262. Howbtard (howbtard) 10 113.92 147.90 5 50.00
2263. jim (jimmyl02) 13 113.91 129.08 9 69.23
2264. Julie (chowoww) 4 113.91 129.52 2 50.00
2265. go (donkeyblaster69) 2 113.91 118.87 2 100.00
2266. Veraxanity (veraxanity) 6 113.90 123.32 5 83.33
2267. Spiren (spirenz) 20 113.89 134.49 10 50.00
2268. Joe (elisouthworth) 20 113.89 143.88 13 65.00
2269. Antek (apilat) 5 113.89 119.20 2 40.00
2270. myle (myle_7894) 1 113.88 113.88 0 0.00
2271. Jeon (owokunn) 146 113.88 138.74 74 50.68
2272. Ravi (ravi15a) 2 113.85 118.39 2 100.00
2273. Juuzou (juuzou__) 1 113.85 113.85 1 100.00
2274. henryk (adeczek) 12 113.85 141.77 2 16.67
2275. Fideon (fideon) 7 113.84 133.33 4 57.14
2276. Daniel (dani3lju777) 18 113.84 141.89 9 50.00
2277. Julian (julianwonghi) 3 113.83 119.05 2 66.67
2278. Damien (zahx666) 4 113.83 120.65 4 100.00
2279. 💀💀💀 (gospell) 970 113.82 162.29 486 50.10
2280. John Wick (asr123) 2 113.82 120.89 2 100.00
2281. Meowzer (sd_surfer4) 6 113.81 147.71 2 33.33
2282. Shrek Of Justice (shrek_of_... 7 113.81 127.95 4 57.14
2283. philip (philiptokareff) 4 113.81 119.96 4 100.00
2284. a (allorang) 7 113.80 134.36 4 57.14
2285. bool3max (bolemax) 4 113.80 120.87 2 50.00
2286. (scraex) 2,633 113.80 191.09 2,076 78.85
2287. Guest (sebastiuon) 2 113.80 117.77 0 0.00
2288. ariel (maiableeds) 1 113.80 113.80 1 100.00
2289. finityfly (finity_fly) 59 113.79 131.06 26 44.07
2290. NotAn0boe (whackygrub) 13 113.79 129.09 9 69.23
2291. eunhyun (eunhyun) 143 113.79 145.88 73 51.05
2292. Fabian (lgtrushzhm) 8 113.78 130.38 4 50.00
2293. DickK (saltybokchoy) 6 113.78 131.00 6 100.00
2294. Jack (tzak) 36 113.77 132.42 15 41.67
2295. Amarjot (apandher) 933 113.77 155.82 465 49.84
2296. Trabota (trabota) 177 113.77 138.25 85 48.02
2297. din (nonquitdondoe) 7 113.77 138.15 7 100.00
2298. Bobby (rradhak1) 5 113.76 121.82 4 80.00
2299. Paul (pkanas) 73 113.76 150.25 40 54.79
2300. Tommy (kamuimaru) 81 113.75 145.12 41 50.62
2301. deceptiveVI (dsaldana711) 156 113.75 145.60 82 52.56
2302. Nima (cosmocrat) 7 113.74 129.92 3 42.86
2303. akshat (akxs) 18 113.73 127.28 8 44.44
2304. xLikely (xlikely1) 10 113.72 124.99 7 70.00
2305. sheeshsheesh (johnnyboi321) 2 113.72 116.40 1 50.00
2306. tstats[itchyhuman] (itchyhu... 120 113.72 148.03 62 51.67
2307. tstats[bilayer] (bilayer) 3 113.72 139.02 1 33.33
2308. Waleed (waleedminer) 13 113.72 138.81 4 30.77
2309. ExpensiveDinner (expensived... 24 113.72 131.93 8 33.33
2310. PH23NIX (ph23nix) 5 113.71 120.15 3 60.00
2311. Jeronimo (_slowmotion_) 13 113.70 125.63 5 38.46
2312. Cuthalion (cuthalion) 3 113.70 122.01 1 33.33
2313. Ricky (blazed_ricardo) 1 113.69 113.69 1 100.00
2314. Ragged (raggedstar) 3 113.68 116.47 3 100.00
2315. Jason (jasoone) 2 113.67 119.77 1 50.00
2316. sly (slymaster11) 283 113.67 145.75 132 46.64
2317. Zerokles (zerokles) 3 113.67 118.75 2 66.67
2318. Frat (fratios) 11 113.67 139.61 6 54.55
2319. AshKetchup (asheketchup) 1 113.66 113.66 1 100.00
2320. XxhairyballsXx (nwalker1129) 9 113.63 135.62 3 33.33
2321. Looking For GF (veiven) 8 113.63 129.48 4 50.00
2322. Nobody (therealtrudeau) 13 113.63 135.05 6 46.15
2323. Jasmine (mustardsucks) 8 113.63 140.10 4 50.00
2324. Oromis (oromis1) 2 113.63 115.04 2 100.00
2325. grasstang (grasstang) 6 113.62 138.61 4 66.67
2326. R (nuoiea) 2 113.62 118.66 1 50.00
2327. Diego (diego12719) 1 113.61 113.61 1 100.00
2328. A (ag2718) 90 113.61 145.09 40 44.44
2329. Zito (zrelova) 95 113.61 138.39 52 54.74
2330. Slow мΘşħΞ alt (shadow... 14 113.60 133.21 9 64.29
2331. CJ (entrity_screamr) 16 113.60 136.53 7 43.75
2332. Macen (macen) 5 113.58 121.08 4 80.00
2333. johnn2 (johnn2) 2 113.58 114.57 2 100.00
2334. Beaster (deeznutshagotch) 24 113.57 132.84 14 58.33
2335. white (mrwhiteee) 2 113.57 113.78 2 100.00
2336. Erik (merkinmeerkats) 2 113.57 125.16 1 50.00
2337. Lego (lamborgotii) 76 113.57 147.64 65 85.53
2338. Frank (y0l0sweq) 2 113.56 114.61 2 100.00
2339. Steeferino (evlpacman) 11 113.55 136.51 7 63.64
2340. cruise control (terminator_... 562 113.55 148.85 275 48.93
2341. Nicholas (creamycarrots) 61 113.55 139.24 35 57.38
2342. LetsdothisEpic (letsdothise... 2 113.54 124.00 1 50.00
2343. A (soh_cah_toa) 4 113.53 129.73 1 25.00
2344. congrats on 1M club (23kuzn... 50 113.52 154.39 27 54.00
2345. Jeriah (jeriahcariahmessiah) 1 113.51 113.51 1 100.00
2346. Jason (buckbuck5646) 9 113.50 133.74 7 77.78
2347. mags (moopymags) 24 113.50 143.99 21 87.50
2348. chom (chomchomchomchomchom) 2,172 113.50 170.78 1,083 49.86
2349. R. (yeetertheskeeter) 11 113.49 146.91 1 9.09
2350. Allen (pfzhengs) 5 113.48 130.16 4 80.00
2351. Christian (flaze07) 16 113.46 136.79 7 43.75
2352. h7ti(discord) (eternality) 229 113.46 155.26 98 42.79
2353. :(: (sara_ks) 5 113.45 127.04 3 60.00
2354. Eric (sivade) 250 113.45 168.75 129 51.60
2355. Pontus (ponhav) 224 113.45 142.15 114 50.89
2356. Shut (ihavekillaura) 8 113.45 123.58 6 75.00
2357. Boris (redsnake07) 20 113.45 132.75 8 40.00
2358. Davey (gujin) 17 113.45 139.35 5 29.41
2359. Ring (ringtackyeet) 2 113.44 118.94 2 100.00
2360. ximecat (ximecat) 21 113.44 133.08 14 66.67
2361. Kai (tidalove) 1 113.43 113.43 0 0.00
2362. P (pianomyn) 1 113.43 113.43 0 0.00
2363. Senyuu (senyuu) 2 113.43 118.31 1 50.00
2364. Felix (promeneraren) 740 113.42 162.61 337 45.54
2365. Alex (hollums) 5 113.41 119.30 2 40.00
2366. telorbuzzu (telorbusu) 28 113.40 133.37 15 53.57
2367. Teodoras (teoyessir) 111 113.39 141.84 57 51.35
2368. Johnny (glassharmonica) 1 113.39 113.39 1 100.00
2369. SirCanaanDoyle (elevayshun) 32 113.39 143.05 18 56.25
2370. Sheenu (sheenz) 13 113.38 130.83 7 53.85
2371. afafaf (tkuo42) 132 113.38 139.23 79 59.85
2372. Aaron (diesirae91) 1 113.38 113.38 1 100.00
2373. Alexa (axela33) 4 113.38 125.85 0 0.00
2374. Wo1v3r (wo1v3r) 7 113.37 120.62 3 42.86
2375. Inferno (mohmadrid0) 236 113.37 144.09 191 80.93
2376. Bob (bobanton02) 8 113.36 129.87 4 50.00
2377. Sandpiper (krafty) 8 113.35 130.01 6 75.00
2378. John (cyal8er) 3 113.35 124.58 1 33.33
2379. JSS (xcloretg) 5 113.35 127.48 3 60.00
2380. connie (conniexlee) 5 113.35 121.90 4 80.00
2381. Norton (nortonmon) 3 113.35 116.37 2 66.67
2382. Cole (jojjj5) 4 113.35 121.59 2 50.00
2383. SpicyBoi (aedsman) 2 113.35 116.29 0 0.00
2384. . (aspens) 1 113.34 113.34 1 100.00
2385. stinkass (smitopot) 13 113.33 142.50 6 46.15
2386. Gridcoin (gabeneweii) 48 113.33 158.10 30 62.50
2387. throw (bomnom) 230 113.31 147.38 129 56.09
2388. Dale (owenone) 27 113.31 127.97 20 74.07
2389. J (jv8111) 3 113.28 119.55 3 100.00
2390. S (stu217) 3 113.28 122.78 2 66.67
2391. Madfox (ilkerb) 33 113.26 133.30 18 54.55
2392. poorjar (amgminequality) 22 113.26 133.05 9 40.91
2393. Owen (owen5560) 2 113.26 125.98 2 100.00
2394. $insy (sinsy) 6 113.25 126.73 4 66.67
2395. Howard (hwd15508) 15 113.25 134.39 11 73.33
2396. Isaac (caelstrasza) 5 113.25 120.00 0 0.00
2397. Matthew (gruzzlybear) 2 113.25 120.90 2 100.00
2398. M (sasoriza) 1 113.24 113.24 1 100.00
2399. Judas Escargot (looneyjuice) 116 113.23 148.90 61 52.59
2400. Joe (shmooo) 26 113.22 131.36 13 50.00
2401. deshawn (greenspringer) 1 113.22 113.22 0 0.00
2402. tstats[massive_man4] (massi... 16 113.21 144.84 6 37.50
2403. Ingyou (ingsta) 35 113.21 126.20 15 42.86
2404. Ethan (terean) 30 113.21 126.72 18 60.00
2405. Joe (srittenhouse) 1 113.19 113.19 1 100.00
2406. fan de Iknash (pedrou) 30 113.19 139.72 15 50.00
2407. Asto (ukikunz) 51 113.19 139.74 26 50.98
2408. Gil (violetgil) 49 113.18 124.64 21 42.86
2409. Zach (zchen717) 47 113.17 135.80 24 51.06
2410. Ji (urzz4eva) 1,074 113.17 157.52 544 50.65
2411. Josh (nocase) 14 113.17 139.80 11 78.57
2412. no one cares (speedyant) 83 113.17 141.69 37 44.58
2413. Ҝ丨𝓝G𝕆 (hasnatahmad) 492 113.16 155.20 282 57.32
2414. omar (wizard24h) 1 113.14 113.14 0 0.00
2415. Grace (duriangray) 1 113.14 113.14 1 100.00
2416. Speedy (flux2k) 21 113.14 134.10 12 57.14
2417. Be (deathpulse) 22 113.14 133.46 9 40.91
2418. Jordan (mrempyrean) 10 113.14 125.37 9 90.00
2419. Polyatomic (polyatomic) 8 113.14 126.18 6 75.00
2420. Tootels (joenasha10) 232 113.12 151.52 92 39.66
2421. Salle (dating92) 1 113.11 113.11 1 100.00
2422. eqwt (whuhu) 22 113.08 136.02 17 77.27
2423. Henri (therealkanyeeast) 9 113.08 129.45 3 33.33
2424. Nicholas (nkt8256) 9 113.08 130.31 3 33.33
2425. Aureus (aureuswastaken) 8 113.08 130.32 5 62.50
2426. Seth (ninjashark121) 5 113.08 120.55 3 60.00
2427. :D (marz__s) 3 113.07 126.59 1 33.33
2428. Ryan (bossmanryan) 4 113.05 121.92 3 75.00
2429. Kyle (kyles0610) 13 113.04 124.22 4 30.77
2430. ouchies (evilemmelina) 96 113.04 147.57 47 48.96
2431. Alex (abrown516) 8 113.04 125.44 8 100.00
2432. Pierrot (pierrotplays) 63 113.03 132.39 39 61.90
2433. Trevor (trevorstamour) 4 113.03 155.87 3 75.00
2434. etienne (etiennne) 12 113.02 122.45 6 50.00
2435. liquidii (liqueady) 5 113.01 119.13 2 40.00
2436. Samuel (king_anuus) 154 113.00 139.64 89 57.79
2437. Bob (cakesenpie) 57 113.00 138.65 28 49.12
2438. Lark (sirhaxbard) 275 112.99 146.15 127 46.18
2439. Yan (nyanyan12_1) 1 112.98 112.98 0 0.00
2440. Chris (thrash3r) 4 112.98 117.66 2 50.00
2441. Aur (bobharley) 2 112.97 121.42 1 50.00
2442. Antoine (antiwaniwan) 2 112.97 116.57 2 100.00
2443. dever (deverart) 18 112.96 129.98 9 50.00
2444. Usman (x1itachi) 35 112.96 143.34 17 48.57
2445. Technoblade (awppenheimer) 2 112.96 122.26 0 0.00
2446. Jordan (feelingsreal) 18 112.95 131.82 9 50.00
2447. Jennie (jeniibearr) 67 112.93 144.88 39 58.21
2448. Steven (df1337) 19 112.93 138.38 9 47.37
2449. typeracer1295 (cryna) 2 112.93 116.89 2 100.00
2450. Jeffrey (jebbythepanda) 7 112.92 126.00 3 42.86
2451. Will (wgomez1025) 1 112.92 112.92 1 100.00
2452. man (speedweeweeman) 67 112.92 139.02 40 59.70
2453. Boi (disnoob) 6 112.91 125.22 3 50.00
2454. Ryan (alphaorionis) 5 112.90 120.61 4 80.00
2455. Andrew (mcentag) 48 112.89 140.75 20 41.67
2456. Jake (izable) 5 112.86 132.07 3 60.00
2457. Typo (wlofails) 105 112.86 148.63 72 68.57
2458. Oikawa (chillypeppermint) 1 112.84 112.84 0 0.00
2459. Bobby (slowtyper557) 27 112.83 128.22 13 48.15
2460. Charleston (charlestongrays) 2 112.83 114.64 1 50.00
2461. Michael (mscott3) 75 112.82 137.34 30 40.00
2462. kytan (kyte11) 1 112.82 112.82 1 100.00
2463. arman (arman_types) 27 112.81 145.96 13 48.15
2464. FeN11x (fen11x) 7 112.81 125.04 4 57.14
2465. Isaac (isaacchen_cool) 112 112.81 141.64 57 50.89
2466. ROCKSTAR008 (mrbest6000) 145 112.81 145.72 77 53.10
2467. Tane (husquin) 145 112.80 142.52 74 51.03
2468. Justin (kinglebron23) 1 112.80 112.80 1 100.00
2469. Lily (tiptaptyping) 109 112.79 139.23 47 43.12
2470. Ahmer (ahmergondal) 18 112.79 142.58 6 33.33
2471. https://www.tiktok.com/@for... 197 112.78 149.72 86 43.65
2472. bee (bee0) 15 112.76 138.95 14 93.33
2473. Thuan (deadlydragon100) 3 112.76 130.82 1 33.33
2474. Koi (koisoysauce) 3 112.75 118.48 0 0.00
2475. Ato (atorization123) 3 112.75 123.93 3 100.00
2476. Siddhant (code_talker) 93 112.74 134.56 42 45.16
2477. qwerty (anoop208) 14 112.74 131.85 11 78.57
2478. s a d b o y (a51nx) 6 112.74 117.63 2 33.33
2479. Jay (jayhuang123) 2 112.74 124.82 1 50.00
2480. slayerofthend (slayerofthend) 54 112.72 144.10 35 64.81
2481. (tyleryoung210) 4 112.72 121.70 3 75.00
2482. Jerichaux (jerichaux) 56 112.70 134.50 28 50.00
2483. kinwaki (kinwaki) 2 112.70 116.21 1 50.00
2484. J (allobubu) 2 112.69 117.41 1 50.00
2485. Raimondo Horton (nize) 16 112.69 146.74 6 37.50
2486. Junion (jun1on) 3 112.68 130.60 3 100.00
2487. Justin (blamuro) 2 112.68 121.73 2 100.00
2488. diana (dianatran) 1 112.66 112.66 0 0.00
2489. Gad (gad2443) 251 112.66 140.67 120 47.81
2490. Josh (joshcantypefast) 15 112.65 140.89 13 86.67
2491. Caleb (prismiasma) 30 112.65 128.97 11 36.67
2492. ellie (spaghellie) 13 112.65 136.50 8 61.54
2493. 𒅃 (hdgamez) 54 112.64 134.23 30 55.56
2494. Pogfrog (pogfrog1) 197 112.62 137.89 92 46.70
2495. biotox (biotoxz) 9 112.61 134.34 5 55.56
2496. twitch.tv/darkmatterv4 (blo... 18 112.61 132.11 6 33.33
2497. Gregory (contrum) 167 112.60 139.83 87 52.10
2498. Andrew (warden99) 3 112.59 118.18 3 100.00
2499. Piggie (piggiepoop) 18 112.59 136.34 8 44.44
2500. Dorime (vojing) 12 112.59 123.22 6 50.00
2501. Gary (garyboo) 5 112.59 127.58 0 0.00
2502. Anthony (a_rebello_type_hello) 2 112.59 116.97 0 0.00
2503. ✨( ͡° ͜ʖ ͡°) (giuse... 4 112.58 123.61 3 75.00
2504. earlprotyper (beamerboyy) 25 112.58 127.01 13 52.00
2505. Shromeone (shromeone) 2 112.58 117.84 2 100.00
2506. tstats[marin049] (marin049) 152 112.57 151.03 84 55.26
2507. Bill Tinn (tearsinrain) 1,518 112.56 164.30 782 51.52
2508. Kostboss (okostas) 39 112.56 127.64 18 46.15
2509. Nuts (sumguy69) 15 112.53 125.23 8 53.33
2510. Jyxmix (jyxmix) 6 112.52 119.24 3 50.00
2511. Will (munce) 1 112.51 112.51 0 0.00
2512. Midhun (mythicalun) 12 112.51 132.93 8 66.67
2513. Naidru (naidru) 5 112.51 133.42 2 40.00
2514. Nick (eco_frendly) 1 112.50 112.50 1 100.00
2515. can't type :) (void7750) 17 112.49 126.53 10 58.82
2516. Mouse cursor that hides the... 89 112.48 139.43 36 40.45
2517. Quốc (cangu07042006) 43 112.48 132.39 22 51.16
2518. Kevin (kevinu) 20 112.48 126.59 8 40.00
2519. Oseph (getoutofmyhouse) 3 112.47 117.37 3 100.00
2520. Drug (thisisscandalous) 4 112.47 120.56 3 75.00
2521. Star (star_sailorx) 7 112.46 133.25 4 57.14
2522. Jason (jasonf2001) 1 112.46 112.46 0 0.00
2523. 74R45 (74r45) 9 112.46 139.83 4 44.44
2524. T_nology (tnology) 3 112.46 121.31 3 100.00
2525. Chris (tomatohead21) 47 112.45 136.42 18 38.30
2526. Split keeeeeb (tzbob) 8 112.45 122.74 6 75.00
2527. Jason (alpacaaviator) 2 112.45 113.49 1 50.00
2528. Tony (kevinneeraj) 19 112.44 130.81 11 57.89
2529. Evan (stars6413) 5 112.43 117.18 3 60.00
2530. Blitz (athul) 9 112.43 124.12 4 44.44
2531. fmailscammer (fmailscammer) 2 112.43 123.31 1 50.00
2532. Made In (kosowarner) 54 112.42 133.99 47 87.04
2533. Faster than (fasterthanshlok) 4 112.40 126.80 2 50.00
2534. Ryu (ryusong) 5 112.40 125.83 2 40.00
2535. Name (housewren) 12 112.40 140.47 8 66.67
2536. intermediate 2027 (darkis) 31 112.39 144.41 21 67.74
2537. sonic (sonic_the_hedgehog_lol) 2 112.39 123.27 1 50.00
2538. Tung (dungtang) 8 112.38 130.06 3 37.50
2539. Nerx (rshield) 3 112.38 115.77 2 66.67
2540. eric (eric5000) 22 112.38 136.04 16 72.73
2541. Lan (bubbleangel33) 3 112.38 121.94 1 33.33
2542. ­ (thelurkerman) 8 112.37 138.14 2 25.00
2543. Corlex (dani356d) 3 112.37 116.32 2 66.67
2544. M (springfield12) 229 112.36 134.83 135 58.95
2545. polt (poltt) 1 112.36 112.36 1 100.00
2546. . (hanthedude) 70 112.36 129.95 40 57.14
2547. some_dude (jad_) 3 112.36 119.79 1 33.33
2548. Soren (sorennoob) 2 112.35 118.24 1 50.00
2549. Brian (scorpyyy) 1 112.35 112.35 0 0.00
2550. Tim (yutuyt) 10 112.35 132.08 8 80.00
2551. Erik (erky1952) 3 112.34 120.79 2 66.67
2552. Hunter (hunterwho43) 68 112.33 131.19 31 45.59
2553. duckie (ducknoodles25) 3 112.33 125.89 2 66.67
2554. Tanapat (jekkiechan) 6 112.33 119.55 3 50.00
2555. Josh (joshmankey7) 25 112.32 142.50 15 60.00
2556. Chase (nootnamed) 1 112.31 112.31 1 100.00
2557. Aaron (insertwordshere) 46 112.30 144.74 39 84.78
2558. Oliver (soonsy) 1 112.28 112.28 1 100.00
2559. stuff423 (stuff423) 14 112.26 126.77 4 28.57
2560. Bobbie (bobbieshroom) 1 112.26 112.26 0 0.00
2561. Cloud (blackcloud010) 25 112.26 127.79 15 60.00
2562. Allen (analogaio) 13 112.25 139.19 6 46.15
2563. पलविंदर स... 409 112.24 140.54 230 56.23
2564. thocky caps (floodvalve) 65 112.24 128.89 32 49.23
2565. Kaphran (kaphran) 7 112.23 126.12 6 85.71
2566. tylerthsss (tylerths) 61 112.23 131.21 28 45.90
2567. Non-quit (hitman2207) 202 112.21 136.72 106 52.48
2568. nht- (tiny20061) 13 112.21 149.77 4 30.77
2569. David (davecoolkid) 14 112.21 135.94 7 50.00
2570. fred (foop1) 19 112.20 128.19 10 52.63
2571. Henri (enzzzx) 10 112.20 131.47 5 50.00
2572. Kristjan (krissimoney) 17 112.19 128.37 5 29.41
2573. Ryan (pingu51472) 7 112.18 124.08 3 42.86
2574. Pach (pachslayer) 88 112.18 137.70 39 44.32
2575. Allen (swaggerinooo) 12 112.18 135.99 11 91.67
2576. Rory (redder_colemak) 2 112.18 119.13 2 100.00
2577. Zaid (zzzaid) 17 112.17 146.06 10 58.82
2578. Tushar (tusharsingh) 1 112.17 112.17 0 0.00
2579. Jason (njasow) 19 112.17 123.39 12 63.16
2580. B (jixlimmy) 16 112.16 133.80 12 75.00
2581. Gerry (gl701) 92 112.15 137.96 46 50.00
2582. Sam (momomcds) 3 112.14 116.92 0 0.00
2583. N (sserium) 2 112.14 116.70 0 0.00
2584. jeff (blawalaw) 21 112.14 131.27 11 52.38
2585. Adin (nightmarexe) 6 112.13 130.92 3 50.00
2586. droo (drew215) 8 112.11 128.22 5 62.50
2587. Chad (nicwin) 54 112.10 139.29 26 48.15
2588. tstats[glebby] (glebby) 2 112.09 124.61 1 50.00
2589. Kachika (chickhicks_) 9 112.09 137.74 4 44.44
2590. Josh (joshtegart) 10 112.08 145.91 3 30.00
2591. JONALD (jzwhale) 5 112.07 118.67 2 40.00
2592. Eric (thicc_ricc) 354 112.07 145.63 160 45.20
2593. Jun (vegetto1126) 19 112.07 129.66 12 63.16
2594. Forrest (verybigpenguin) 8 112.06 128.90 4 50.00
2595. William (willmart16) 230 112.05 134.19 120 52.17
2596. J (antiduckdude24) 1 112.05 112.05 0 0.00
2597. Nootch (nootch) 214 112.05 146.02 122 57.01
2598. Thewsomeguy (thewsomeguy) 2 112.05 113.06 0 0.00
2599. Bjorn (bjornbaboon) 5 112.03 129.40 3 60.00
2600. Pseudo (psuedo) 1 112.03 112.03 0 0.00
2601. tebond (tebond) 2,014 112.03 158.67 1,054 52.33
2602. Artur (lepayo) 20 112.02 137.72 9 45.00
2603. Sadiuh (sadiuh) 1 112.02 112.02 1 100.00
2604. 1234 (perfect_practice) 35 112.01 132.53 17 48.57
2605. Al (quicksilver95) 13 112.01 131.81 11 84.62
2606. vain (vaininsanity) 1 112.01 112.01 0 0.00
2607. Fry (uncle_youtube) 2 112.01 115.49 2 100.00
2608. Caesium0810 (caesium0810) 1 112.01 112.01 0 0.00
2609. Derrick (derrickha) 5 112.01 135.87 1 20.00
2610. Ryan (ryanmc99) 8 112.00 125.67 3 37.50
2611. Austin (austinsnow) 3 112.00 115.09 0 0.00
2612. thetacosmurgf (smurfer1121) 44 112.00 131.52 22 50.00
2613. Verve81 (verve81) 156 111.96 136.49 89 57.05
2614. losing hope (charmx) 468 111.96 166.24 3 0.64
2615. Boom (moeroach) 1 111.96 111.96 1 100.00
2616. glucose (glucose) 13 111.95 137.51 9 69.23
2617. Bryan (b27i5n) 11 111.95 129.52 5 45.45
2618. Leeh (leeh2002) 2 111.94 116.12 1 50.00
2619. Travis (travis3372) 1 111.94 111.94 1 100.00
2620. Ante (houci) 17 111.93 131.37 7 41.18
2621. kelvin (kefun) 1 111.93 111.93 0 0.00
2622. HotZin (hotzin) 1 111.93 111.93 1 100.00
2623. timothy (timmysuh904) 2 111.93 119.67 1 50.00
2624. aztiokir (aztiokir) 6 111.93 128.74 6 100.00
2625. Wade (wadewilson) 1 111.92 111.92 1 100.00
2626. Link (link_hyrule) 53 111.91 140.37 30 56.60
2627. Rosewill RK-9000V2 (morphin... 9 111.91 128.04 3 33.33
2628. Victor (newbeavictoryhase) 6 111.91 124.64 4 66.67
2629. kaytec (kaytec) 4 111.91 121.09 1 25.00
2630. Andy (tyranttick) 3 111.91 115.40 1 33.33
2631. deon (deontan) 16 111.90 124.47 9 56.25
2632. adelina (zzzyawn) 1 111.90 111.90 0 0.00
2633. t (ttha) 3 111.90 112.54 2 66.67
2634. cherub (cherub) 9 111.89 126.79 4 44.44
2635. Yuki (hiavl) 5 111.88 120.37 1 20.00
2636. Thug (thugboat) 1 111.88 111.88 1 100.00
2637. Will (duowill) 2 111.88 113.28 0 0.00
2638. Triz (triz) 7 111.87 125.87 6 85.71
2639. citrus (citrustrack) 35 111.85 131.40 21 60.00
2640. Allison (calllicco) 12 111.85 129.29 5 41.67
2641. Ice (legacyst) 1 111.84 111.84 1 100.00
2642. Josh (shwahhh) 8 111.83 122.70 4 50.00
2643. Weiqi (abwuhd) 1 111.83 111.83 0 0.00
2644. pearce (09mantaray) 57 111.83 150.57 31 54.39
2645. Ivan (ipenipent) 34 111.82 131.82 23 67.65
2646. Kevin (tactictorn) 9 111.81 122.55 6 66.67
2647. Kelly (kellyyah) 3 111.81 113.58 1 33.33
2648. mathan (mathanha) 8 111.81 133.04 6 75.00
2649. Lynnette (its_lynnie27) 33 111.80 173.89 19 57.58
2650. zefanya24k (zefanya24k) 41 111.80 132.29 18 43.90
2651. Roro (azuirith100wpm) 2 111.80 112.37 2 100.00
2652. officialpm (officialpm) 11 111.79 131.70 3 27.27
2653. Mason (unelevate) 49 111.79 136.11 32 65.31
2654. Joshua (ttemingyu) 9 111.78 138.65 4 44.44
2655. Nick (1truelipstick) 895 111.78 161.78 436 48.72
2656. krane (moozies) 3 111.77 126.55 2 66.67
2657. Genie (genielee) 11 111.77 137.01 6 54.55
2658. InsaneBiff (insanebiff) 1 111.77 111.77 1 100.00
2659. Ahro (2easy) 1 111.77 111.77 1 100.00
2660. Mitchell (godekm) 102 111.76 147.90 44 43.14
2661. Kevin (whatsyourtype) 19 111.75 131.84 8 42.11
2662. Sam (numberonemega) 282 111.74 146.05 169 59.93
2663. Captain Constance (wyattcs) 1 111.74 111.74 1 100.00
2664. Tim (littlesprinklesjersey) 112 111.73 141.62 59 52.68
2665. Ben (benf999) 3 111.73 113.36 1 33.33
2666. Unigen (id3n) 53 111.73 133.11 30 56.60
2667. Ken (tzekenster) 3 111.72 113.64 3 100.00
2668. feelsclapman (sprenkelz) 106 111.70 137.67 47 44.34
2669. Logan (larmack) 10 111.70 129.13 7 70.00
2670. swaggin (shuutori) 1 111.70 111.70 1 100.00
2671. 0x045f (0x045f) 56 111.70 142.33 33 58.93
2672. 144p 1998 VW Beetle (stryke... 945 111.69 156.19 467 49.42
2673. rengmain (rengmain) 14 111.67 129.03 13 92.86
2674. Purple (komnambongo) 19 111.67 143.82 8 42.11
2675. yeowo (bunnypenguin) 112 111.66 143.38 53 47.32
2676. Adam (kmine) 4 111.64 120.01 0 0.00
2677. real (realscav) 8 111.64 125.61 4 50.00
2678. asldjf (jfulle3518) 12 111.62 132.32 6 50.00
2679. Kelvin (winlost2) 164 111.60 129.80 86 52.44
2680. no (jonah1357) 5 111.59 120.15 4 80.00
2681. Alexander (ceverion) 3 111.59 117.50 2 66.67
2682. vanessa (dumdimsum) 5 111.59 119.67 2 40.00
2683. Stanley (stanleyzhang9) 54 111.58 135.86 33 61.11
2684. Duzzy (vladieboi) 1 111.58 111.58 1 100.00
2685. Onion (x__onion__x) 160 111.57 173.99 76 47.50
2686. Turning 14 in 2 Weeks! (spe... 154 111.57 163.48 55 35.71
2687. Kevin (infern0) 1 111.56 111.56 0 0.00
2688. Ted (xted) 10 111.56 131.99 6 60.00
2689. Alex (ask496) 72 111.56 126.42 30 41.67
2690. Rachel (rrachell) 6 111.55 122.24 5 83.33
2691. Old Theme Rocks (dthp32776) 60 111.55 139.01 30 50.00
2692. RAPdawg (rapdawg530) 7 111.55 128.78 3 42.86
2693. NewbPianist (instantnoodles... 11 111.54 126.39 7 63.64
2694. Karl (themoopavra) 1 111.54 111.54 1 100.00
2695. Adaephon (adaephon) 8 111.53 120.41 6 75.00
2696. Niels (nielsjensen) 229 111.52 153.85 106 46.29
2697. vulture (typinguntilcompute... 81 111.52 133.09 45 55.56
2698. Ivan (idjuric) 162 111.51 135.94 82 50.62
2699. T-Bird (spartakick) 16 111.51 125.07 6 37.50
2700. Amelia (2sidedpolygon) 9 111.51 126.33 6 66.67
2701. qwerty (qwertyuser3) 2 111.51 118.29 1 50.00
2702. Daniel (hylianwarrior) 8 111.50 142.52 8 100.00
2703. Ovidiu (ofydd) 979 111.49 136.99 469 47.91
2704. Louie (louietien) 5 111.49 130.71 4 80.00
2705. Aron (ellipsoul) 10 111.48 121.77 4 40.00
2706. Zephyr (zephyrkai) 14 111.48 121.24 8 57.14
2707. Donald (dhonuill) 115 111.47 134.80 53 46.09
2708. tehfatpanduh (kb47) 2 111.47 121.35 1 50.00
2709. BEN (hermanatorpc) 6 111.47 125.21 2 33.33
2710. freezefreeze (freezefreeze) 1 111.46 111.46 1 100.00
2711. Josh (jojothewarrior) 4 111.46 140.70 4 100.00
2712. Andrew (awand0806) 23 111.45 129.11 13 56.52
2713. Butiful Black girl in train... 282 111.44 145.48 154 54.61
2714. Seán (whaamp) 2 111.44 117.29 2 100.00
2715. Spring (rabeeh97) 2 111.43 115.54 1 50.00
2716. Gregory (awesome1000988) 2 111.41 119.46 2 100.00
2717. Argon (argon11110) 7 111.41 126.28 3 42.86
2718. KookyMonster🍪🍪🍪 (j... 13 111.41 131.48 9 69.23
2719. InHuMaN (yminag123) 37 111.41 127.49 16 43.24
2720. Nalchee (nalchee1) 28 111.41 131.99 7 25.00
2721. Andy (nycnets15) 40 111.38 143.47 19 47.50
2722. Thomas (uedoh) 3 111.38 113.91 1 33.33
2723. Nazarbek (na2a_) 32 111.38 125.58 15 46.88
2724. Sander (xtyseth) 5 111.38 131.03 4 80.00
2725. Carmel (m_carmel) 1,008 111.38 147.10 489 48.51
2726. Brian (btong) 20 111.37 135.12 7 35.00
2727. Chaws5 (chaws5) 9 111.36 120.37 6 66.67
2728. Not_Orious (not_computer) 24 111.36 132.76 10 41.67
2729. Drift King (jackyyang09) 5 111.36 126.32 1 20.00
2730. Savantik (savantik) 251 111.36 146.26 123 49.00
2731. guy (submer) 14 111.35 133.03 5 35.71
2732. Grizzle (grizzlemonk) 3 111.35 119.01 2 66.67
2733. Tyler (tko42) 318 111.35 141.93 147 46.23
2734. Louis (hlouis) 27 111.34 131.18 16 59.26
2735. Jeremy (imleafing) 5 111.32 115.33 4 80.00
2736. Sienna (sfdragon) 18 111.31 136.81 9 50.00
2737. Teho (tehoo) 17 111.31 129.74 12 70.59
2738. Plinkiplonk (plinkiplonk) 1,325 111.30 156.63 610 46.04
2739. geniusface1234 (geniusface1... 1 111.29 111.29 1 100.00
2740. Amin (thyfoeracer) 3 111.29 118.74 1 33.33
2741. Michael (jimmychim) 4 111.27 123.08 4 100.00
2742. matcha (matchamacchiato) 118 111.26 137.29 67 56.78
2743. Jamie (jcpopp) 13 111.26 125.91 7 53.85
2744. steli2 (steli2) 7 111.26 127.07 5 71.43
2745. David (fuzzycheeks) 19 111.26 130.23 8 42.11
2746. draven (mutable) 8 111.26 127.88 4 50.00
2747. Gabe (gsoares026) 27 111.25 143.58 22 81.48
2748. Zimri (zygnus) 7 111.24 133.26 4 57.14
2749. Alex (alex7r360) 14 111.24 133.00 8 57.14
2750. Josh (joshsd) 2 111.24 115.00 2 100.00
2751. A (processivity) 1 111.23 111.23 0 0.00
2752. Asura (asura_yt) 160 111.23 141.19 66 41.25
2753. Nice (pranavkum123) 84 111.22 136.61 35 41.67
2754. Gaurav (hisdudeness) 17 111.21 124.07 4 23.53
2755. Welcome to Brazil (thunder02) 139 111.20 146.30 84 60.43
2756. ptt (potatodogg) 14 111.20 126.51 8 57.14
2757. Jamal (murrsielago) 2 111.19 113.43 0 0.00
2758. Agassi (shogekiha) 78 111.18 134.25 58 74.36
2759. Ian (agenti23) 23 111.18 127.96 11 47.83
2760. fruit (special_vegetable) 480 111.18 145.79 214 44.58
2761. Felix (flashy123) 6 111.17 119.39 1 16.67
2762. Melvin (peekachoo) 3 111.16 122.56 0 0.00
2763. name (anson001) 659 111.15 152.57 289 43.85
2764. Manu (basuramanu) 125 111.15 159.27 65 52.00
2765. Chingsung (conelead) 1 111.15 111.15 1 100.00
2766. minnie (aceycanttype) 3 111.15 113.63 3 100.00
2767. Joshua (mrteeentee) 51 111.15 137.62 23 45.10
2768. Vlad (vlasuo) 16 111.14 138.59 8 50.00
2769. Grant (datasianguy23) 33 111.13 136.03 17 51.52
2770. Sub-Par (typerslower) 22 111.13 121.25 12 54.55
2771. Cramp (crampdg) 31 111.13 130.71 16 51.61
2772. trash 22424242424 (y6_chris) 254 111.12 137.91 125 49.21
2773. Cool (mrcoolguy69) 147 111.12 138.61 72 48.98
2774. ThisIsHowWeRoll!! (another_... 553 111.12 134.44 279 50.45
2775. tania (tlee120) 53 111.12 123.95 22 41.51
2776. εiз (13uttercup) 4 111.11 131.45 3 75.00
2777. Jean (akrinias) 21 111.10 126.87 11 52.38
2778. Yessir (romans828) 8 111.10 136.56 3 37.50
2779. Hyclonic (hyclonic) 4 111.10 119.62 2 50.00
2780. Albert (aastefanov) 4 111.10 121.07 3 75.00
2781. 79eL (79el) 2 111.10 116.88 0 0.00
2782. K. (spacewalker) 10 111.10 128.77 5 50.00
2783. Abby (aeheffington) 233 111.10 135.39 116 49.79
2784. Luther (luthermanhole) 9 111.09 133.20 4 44.44
2785. Speedswiper (speedswiper) 26 111.08 128.03 12 46.15
2786. SparklMastr (mastrsparkl) 7 111.08 124.96 3 42.86
2787. (jonsport) 3 111.08 123.45 3 100.00
2788. yuan (yuanyangty) 11 111.08 122.62 4 36.36
2789. Johann (jalohann) 10 111.07 136.35 8 80.00
2790. leonissenbaum (leonissenbaum) 4 111.07 126.08 0 0.00
2791. Ole Martin (flidrip) 2 111.07 113.34 1 50.00
2792. Daggerpov (read_my_name) 164 111.06 133.77 82 50.00
2793. Harrison (hbguy1234) 1 111.06 111.06 0 0.00
2794. jaacouub (fsnxward) 7 111.06 123.22 3 42.86
2795. Michael (mchu519) 249 111.05 131.80 133 53.41
2796. me again (urdogwateruwu) 102 111.04 145.55 49 48.04
2797. Tyler (xtios) 75 111.04 130.89 36 48.00
2798. BakesChamp (bakes1223) 40 111.03 132.62 23 57.50
2799. 🖤 R.I.P. reckful ❤️ ... 3 111.03 114.65 1 33.33
2800. HiDa (hiida) 9 111.03 129.89 4 44.44
2801. ∞ (gatewaydrug) 59 111.03 125.60 29 49.15
2802. Foster (fluzii) 4 111.03 119.03 2 50.00
2803. Ink (lordcubes) 1 111.02 111.02 0 0.00
2804. snelvinger (monarchist) 2 111.02 111.18 1 50.00
2805. Dian (slyr77) 6 111.01 118.21 1 16.67
2806. Guest (catg0ty0urlung) 401 111.00 137.13 219 54.61
2807. Elias (eliasura) 10 110.99 129.28 8 80.00
2808. Bojack (uberjoe) 12 110.99 133.12 7 58.33
2809. Nathan (glanzer) 1 110.99 110.99 1 100.00
2810. George (wiliu) 65 110.98 161.04 36 55.38
2811. zerg (zerggirl) 8 110.98 140.14 6 75.00
2812. Salmon (pillowend) 345 110.97 151.27 181 52.46
2813. Jacquelin (jmillard821) 1 110.97 110.97 0 0.00
2814. Karthik (skarthik01) 1 110.95 110.95 1 100.00
2815. Alex (shmixers) 1 110.95 110.95 1 100.00
2816. Max (winstonlisa) 25 110.94 130.31 12 48.00
2817. 🏎️frank (__slowtypist__) 38 110.93 128.20 14 36.84
2818. Tyler (m4rshm4) 11 110.93 131.10 10 90.91
2819. Me (something_s) 94 110.92 144.29 42 44.68
2820. aWiltedRhythm (mbh38) 45 110.92 125.84 25 55.56
2821. Liz (lizchu413) 3 110.92 141.51 1 33.33
2822. JC (joco302) 6 110.92 126.68 1 16.67
2823. Jun (akiboard) 8 110.91 129.44 7 87.50
2824. nyehhh (riskirw) 48 110.90 130.05 27 56.25
2825. Felix (felfel92) 2 110.90 112.93 2 100.00
2826. Matthew (mbryantms) 37 110.89 130.70 19 51.35
2827. Markus (markusmanbro) 1 110.89 110.89 0 0.00
2828. not (hayso) 31 110.89 130.44 15 48.39
2829. Domenic (denenfx) 9 110.88 127.07 3 33.33
2830. Ethan (ethantai) 12 110.88 125.60 8 66.67
2831. Hi (aspenink) 90 110.87 142.96 58 64.44
2832. Taetra (taetra) 1 110.86 110.86 0 0.00
2833. Kevin (kev011701) 15 110.86 126.85 10 66.67
2834. Tony (tmor2012) 1 110.84 110.84 1 100.00
2835. Burger (burgercheese) 38 110.84 134.18 24 63.16
2836. Param (paramt) 6 110.82 120.15 6 100.00
2837. Isaiah (wijiisaiah) 5 110.82 124.59 0 0.00
2838. RecoH86 (recoh86) 5 110.82 126.91 2 40.00
2839. James (nothisisjames) 5 110.82 114.78 2 40.00
2840. Andrew (irvie) 2 110.82 121.20 0 0.00
2841. Hatandriya (tiko270303) 260 110.82 142.51 126 48.46
2842. Elliott (shim3107) 4 110.81 123.68 1 25.00
2843. Talby (talby) 54 110.80 143.36 26 48.15
2844. Jaxson (jaxxxson) 17 110.79 123.81 7 41.18
2845. eRFoRever (erforever) 10 110.79 135.13 9 90.00
2846. Jen (ethima) 67 110.79 132.29 33 49.25
2847. David (king_cao1) 109 110.79 133.79 51 46.79
2848. PelMeni (pelmeni) 46 110.78 124.62 24 52.17
2849. -_- (kxs5) 32 110.77 124.92 24 75.00
2850. Ben (blister99) 27 110.76 126.13 19 70.37
2851. gtg dinner (ijikman) 47 110.76 133.69 18 38.30
2852. Cian (ceol93) 9 110.76 123.00 6 66.67
2853. Tobi (demizu_) 9 110.75 122.39 4 44.44
2854. cab (cab23) 5 110.75 122.39 1 20.00
2855. tstats[ioannisvrynios] (ioa... 80 110.75 148.15 36 45.00
2856. Jos (asiangei) 3 110.73 121.72 3 100.00
2857. Trihedral (trihedral) 3 110.72 116.22 1 33.33
2858. Gnomeツ (raging_gnome) 29 110.72 142.00 14 48.28
2859. Kukk (knightpikachu) 1 110.72 110.72 0 0.00
2860. I×Blazar×I (lblazarl) 62 110.71 134.43 38 61.29
2861. ya BOI (beasted6969) 83 110.71 139.32 32 38.55
2862. Ryder (mrdrumsuno) 2 110.71 111.73 1 50.00
2863. Little (amisupreme) 17 110.70 130.11 9 52.94
2864. Adm1n (vilius8) 222 110.69 136.11 109 49.10
2865. Sam (disasterlooms) 92 110.69 133.50 38 41.30
2866. Harrison (happyg) 7 110.69 124.54 4 57.14
2867. HecTiic (hectiicow) 2 110.68 116.45 1 50.00
2868. F u r u y á (furuya) 23 110.67 129.36 10 43.48
2869. Harry (hajohlay) 10 110.67 130.13 4 40.00
2870. Jomama (johanwashere) 8 110.66 123.18 4 50.00
2871. Donald (hotdognalds) 55 110.66 151.30 30 54.55
2872. Matthew (juanspoon) 58 110.65 135.70 39 67.24
2873. tehmbot (timu) 4 110.65 126.32 3 75.00
2874. :)) (brokenslowhand) 340 110.64 143.75 171 50.29
2875. Brett (mrmahn) 49 110.64 125.97 33 67.35
2876. Tean (tean) 18 110.64 141.60 17 94.44
2877. Jayden (infamousphoenix) 11 110.64 134.65 11 100.00
2878. Shingo (shingoshoji) 76 110.63 134.63 36 47.37
2879. kyeroh (kyeroh) 6 110.62 119.17 4 66.67
2880. Justin (justinliu2000) 1 110.62 110.62 1 100.00
2881. prints (ichigopurin) 293 110.60 154.59 167 57.00
2882. Keegan (klav) 1 110.60 110.60 0 0.00
2883. Drewski (drdrewski) 6 110.60 137.95 2 33.33
2884. John (wolman511) 28 110.58 133.39 12 42.86
2885. Kiiryuu (kiiryuu) 40 110.57 127.39 19 47.50
2886. audrey (crustish) 4 110.57 116.10 4 100.00
2887. Rein (reindlsu) 3 110.57 121.43 3 100.00
2888. No one (howardog0707) 16 110.57 132.96 4 25.00
2889. Alex (arandazzo829) 4 110.57 129.45 2 50.00
2890. Ryan (flamepopo) 16 110.56 130.41 7 43.75
2891. Blake :) (labercrombie36) 74 110.55 132.20 38 51.35
2892. Leifman (leifman) 3 110.54 113.45 2 66.67
2893. KILLA (longhin_mark) 7 110.53 122.49 3 42.86
2894. Jimmy (jimbozeubuen) 4 110.53 117.70 1 25.00
2895. Mike (mmanzinger) 3 110.53 117.32 2 66.67
2896. David (vicksdawg) 1 110.52 110.52 1 100.00
2897. IG/FB @ Jivuls (xhyperize) 5 110.51 127.37 3 60.00
2898. Wave (waveclipping) 277 110.51 147.56 140 50.54
2899. Yam (metrictensor) 99 110.51 133.98 46 46.46
2900. cvs (cvs_pharmacy) 72 110.51 143.33 32 44.44
2901. dayqpi (dayqpi) 16 110.50 130.36 8 50.00
2902. Zemo (zemo77) 21 110.47 124.05 9 42.86
2903. Monkeyjwzd (monkeyjwzd) 3 110.47 121.02 1 33.33
2904. Andrea (arachnedefiant) 4 110.47 113.78 2 50.00
2905. Cameron (camchang) 1 110.46 110.46 1 100.00
2906. Diego (zem0nic) 4 110.45 114.89 1 25.00
2907. raz🐢 (razman) 377 110.44 145.03 173 45.89
2908. big (hyperdoggo) 2 110.44 117.77 0 0.00
2909. andy (lihanou) 1 110.43 110.43 0 0.00
2910. Eukalyptusbonbon (vogel_adler) 1,364 110.42 138.48 668 48.97
2911. Yuelia (yuelia) 17 110.42 126.50 13 76.47
2912. jan (micaelaishot123) 5 110.42 118.57 3 60.00
2913. Jordi (jordityper) 16 110.42 126.60 9 56.25
2914. Eric (heeric) 45 110.41 123.99 19 42.22
2915. Sexy Mark (jay_cartwright) 157 110.38 142.76 69 43.95
2916. Nigel Yul (nigelyul) 87 110.38 131.05 49 56.32
2917. Aidin (aidin177) 48 110.38 129.08 21 43.75
2918. Syie (shinze) 131 110.37 139.79 59 45.04
2919. John (tempocount) 14 110.37 126.93 6 42.86
2920. Jared (mrfatguy227) 5 110.37 118.71 2 40.00
2921. Jumz (mrpaperman) 5 110.37 124.04 2 40.00
2922. Mecha (mechadestroyer) 1 110.36 110.36 1 100.00
2923. Omar (postmodernpostman) 26 110.35 134.30 14 53.85
2924. Peter (beepseeker) 30 110.35 142.20 14 46.67
2925. Skrub (nonametomake) 6 110.34 136.12 1 16.67
2926. Adam (ya_boi27) 4 110.34 120.48 1 25.00
2927. adam (armorcle__) 33 110.31 132.16 15 45.45
2928. Joe (neimad7) 259 110.31 144.78 106 40.93
2929. Elkotte (elkotte) 1,495 110.31 143.76 775 51.84
2930. Free Free Palestine (ergosolo) 348 110.30 171.84 283 81.32
2931. Neatrianty (neatrianty) 172 110.30 147.24 93 54.07
2932. Alex (equidorian) 11 110.30 116.86 5 45.45
2933. Marikyuun (bananaking121) 49 110.29 154.91 32 65.31
2934. Wan (zenag) 2 110.29 118.13 2 100.00
2935. Lily (lilell) 25 110.29 123.69 6 24.00
2936. Neekon (neekon) 3 110.29 121.64 2 66.67
2937. igs (x7041) 200 110.28 136.78 101 50.50
2938. Maverick Jan (umbracato) 5 110.28 112.99 2 40.00
2939. Limbo (trulylimbogene) 3 110.28 115.28 1 33.33
2940. i cant type (o_o_f) 14 110.28 136.86 8 57.14
2941. Gareth (morpen8) 13 110.28 126.83 6 46.15
2942. Liam (emissions) 11 110.28 136.40 7 63.64
2943. UppedFusion (fusion_) 11 110.27 119.53 6 54.55
2944. Fingerkart sweat (exford0) 9 110.26 115.59 5 55.56
2945. Jakub (wasiul) 6 110.26 120.70 4 66.67
2946. Jeron (pivotwind) 1 110.25 110.25 1 100.00
2947. Fudge (furdge) 2 110.25 112.42 2 100.00
2948. Rafael (rafmonster) 2 110.24 110.86 1 50.00
2949. Gabriel (spellingisstupid) 1 110.24 110.24 0 0.00
2950. Miz (miztypes) 34 110.23 125.64 16 47.06
2951. Zerlinda (chazer) 2 110.23 116.58 2 100.00
2952. Jawn (yavvaios) 2 110.23 118.18 1 50.00
2953. Erwin (erwinisgoodenough) 6 110.21 122.68 6 100.00
2954. B (billus) 4 110.21 123.42 0 0.00
2955. jack (golduckz) 17 110.21 131.92 8 47.06
2956. eggs979 (eggs979) 2 110.21 114.55 2 100.00
2957. SoundtrackDan (soundtrackdan) 3 110.21 120.70 2 66.67
2958. pi (schi678) 7 110.19 119.55 4 57.14
2959. Rishi (rishiosaur) 3 110.19 117.44 2 66.67
2960. Manny (mefinitelydanny) 2 110.18 114.89 2 100.00
2961. [FRLA] Frank Admirer (ciaer... 105 110.17 134.30 81 77.14
2962. anty (antyboi) 618 110.17 149.30 285 46.12
2963. Chen Yik (xxmlgsniperxx) 1,264 110.17 148.36 595 47.07
2964. kaelan (kae1) 11 110.17 128.14 5 45.45
2965. Iamslow (softshui) 3 110.16 114.53 2 66.67
2966. mayo (mayo_tp01) 24 110.16 137.78 3 12.50
2967. Joshua (type_god_1466) 1 110.15 110.15 0 0.00
2968. Max (bortie) 2 110.15 127.51 2 100.00
2969. Maggie (migggggie) 13 110.14 121.51 4 30.77
2970. Joseph (josephyunzz) 1 110.14 110.14 1 100.00
2971. fusionguy100 (fusionguy200) 1 110.14 110.14 1 100.00
2972. Captain (bobispro2) 48 110.13 124.54 25 52.08
2973. ジョン (johnr_) 39 110.11 150.97 21 53.85
2974. Rockodile (rockodile) 435 110.11 137.95 198 45.52
2975. Kristijan (invisibleloki) 20 110.11 118.74 11 55.00
2976. Dolan (dudey7ftw) 2 110.11 118.54 2 100.00
2977. Brett (kermin) 7 110.10 133.03 5 71.43
2978. Fabio (prosfearme) 5 110.09 124.22 1 20.00
2979. Cythrix (boment) 260 110.09 135.59 125 48.08
2980. Andrew (momoterraw) 3 110.09 125.72 1 33.33
2981. kev (kev_wins_again) 6 110.09 126.44 5 83.33
2982. Charles (candydaniel) 6 110.09 132.42 3 50.00
2983. Benjamin (kingtutking) 6 110.08 115.92 3 50.00
2984. Snapdragon (snapdragonsounds) 2 110.08 110.90 1 50.00
2985. NoNo (nonoesimposible) 31 110.07 126.26 15 48.39
2986. Minä (arabwinner) 216 110.06 128.48 96 44.44
2987. Dakeku (dakeku123) 7 110.06 120.76 5 71.43
2988. a (herecomedatb0i) 2 110.05 116.60 1 50.00
2989. Ryan (xxhiny) 51 110.05 125.01 25 49.02
2990. Azar (maxentium) 1 110.03 110.03 1 100.00
2991. Ray (viruz789) 14 110.02 125.55 7 50.00
2992. brandon (wadawdawdw) 6 110.02 122.14 1 16.67
2993. cana (cnry) 20 110.02 125.26 12 60.00
2994. aorer (aorer) 16 110.01 133.44 9 56.25
2995. Kenneth (furball728) 8 110.01 122.91 3 37.50
2996. Joshua (scpectre) 7 110.00 123.17 3 42.86
2997. Jacques (volterxien) 28 110.00 126.69 14 50.00
2998. Regin (yoloburgerking) 19 109.99 122.59 9 47.37
2999. Evan (jahad) 6 109.98 124.54 2 33.33
3000. Ampheline (younes_feline) 4 109.98 116.68 3 75.00
3001. NEVER RESET (typing_is_hard... 3 109.98 113.16 0 0.00
3002. (fbilikestotype) 33 109.97 127.47 15 45.45
3003. Rajan (340900190) 2 109.97 118.42 1 50.00
3004. Zven (zven69) 9 109.96 135.73 6 66.67
3005. zheqe (zheqe) 291 109.95 133.42 148 50.86
3006. Jacob (jeepers_jake) 38 109.95 134.13 22 57.89
3007. Will (karl__marx) 24 109.94 144.74 18 75.00
3008. Nick (checksind) 223 109.93 133.91 106 47.53
3009. shaked (kknify) 3 109.93 121.10 3 100.00
3010. Lokyin (lqkii) 14 109.93 138.81 4 28.57
3011. 21337R (poptart128) 16 109.92 131.56 10 62.50
3012. Michael (bannable_) 6 109.92 116.14 0 0.00
3013. Schuyler (captainsky03) 31 109.90 131.60 15 48.39
3014. Yash (yashedp) 2 109.89 113.17 1 50.00
3015. Cory (chamblin) 7 109.87 116.98 3 42.86
3016. Medi (_medi) 17 109.87 127.94 6 35.29
3017. Lars (kung_fu_kenny) 1 109.87 109.87 1 100.00
3018. Lai (laiyr) 154 109.87 136.95 67 43.51
3019. Rajiv (johnnymaboi) 4 109.87 120.88 3 75.00
3020. ajrv (aamodvarma) 247 109.86 146.08 118 47.77
3021. Darrix (darrixl) 3 109.86 119.17 3 100.00
3022. SPEED (speedbear) 26 109.86 128.32 11 42.31
3023. Samuel (samuel86) 1 109.85 109.85 1 100.00
3024. M Stew (mstew354) 2 109.84 114.56 0 0.00
3025. Joe (2513134) 92 109.83 131.26 39 42.39
3026. Jeff (chiefjeef) 125 109.83 136.78 75 60.00
3027. Yoshi (gogurtpie) 2 109.83 114.02 1 50.00
3028. shylingg (dyingllama) 21 109.82 125.47 11 52.38
3029. tstats[omegaman] (omegaman) 1 109.82 109.82 1 100.00
3030. Aaron (amares200) 1 109.82 109.82 0 0.00
3031. Rod (twors_colemak) 66 109.81 133.80 31 46.97
3032. tech (thetechboy) 3 109.80 114.70 1 33.33
3033. Alexander (dawgsrlife) 3 109.80 110.54 0 0.00
3034. Timothy Tiew (timothytiew123) 337 109.80 142.59 157 46.59
3035. Ashley (ashleya9790) 3 109.79 117.55 3 100.00
3036. stealthevan (stealthevan) 18 109.78 140.70 9 50.00
3037. Ruben (streakwind) 4 109.78 122.60 4 100.00
3038. thanos (thanosmpath) 438 109.78 134.83 205 46.80
3039. Onu Kajita (torek87) 406 109.76 145.81 287 70.69
3040. dzizuz (blakayn) 2 109.76 110.40 1 50.00
3041. Neil Adrian (destroyer_46) 8 109.75 119.03 4 50.00
3042. Aidan (sirrahnadia) 100 109.73 137.79 44 44.00
3043. SoopaKhell (soopakhell) 19 109.73 129.87 14 73.68
3044. BR (brdiesel) 223 109.73 131.32 93 41.70
3045. Sean (sean33333) 1 109.73 109.73 1 100.00
3046. Evan (guin366) 4 109.73 114.34 0 0.00
3047. Ern Cheng (ernchenghoo) 14 109.72 131.73 8 57.14
3048. V (viktiro) 11 109.72 132.25 8 72.73
3049. Mikey (miket349) 130 109.71 147.61 55 42.31
3050. Mulosh (mulosh) 36 109.71 125.93 16 44.44
3051. Alexander (chokoboy3) 2 109.71 115.59 2 100.00
3052. Emre (mr3mr3) 27 109.70 126.43 17 62.96
3053. neil (neil_da_nub) 6 109.70 120.06 4 66.67
3054. W (world_hello) 6 109.69 118.36 1 16.67
3055. deckador (deckador) 3 109.69 115.90 2 66.67
3056. (zesty11) 44 109.68 135.33 14 31.82
3057. Jed (shreyasgm) 7 109.68 118.85 4 57.14
3058. Roei (rapidroei) 5 109.67 117.22 3 60.00
3059. H (vigilantvillian_colemak) 259 109.67 130.65 135 52.12
3060. Ross (pyramidgg) 289 109.67 146.18 125 43.25
3061. Gustavo (xevki) 1 109.66 109.66 1 100.00
3062. jen (chennyjen) 137 109.65 136.50 69 50.36
3063. Jacob (jasdfnam) 4 109.65 120.54 2 50.00
3064. Leif (electricronny) 31 109.64 127.83 16 51.61
3065. Ronald (macaroonie) 2 109.64 110.05 1 50.00
3066. wRadion (wradion) 14 109.63 129.61 6 42.86
3067. reem (bacil123) 292 109.63 139.38 132 45.21
3068. Francesco (lews_) 10 109.63 120.81 5 50.00
3069. joe biden (slowtyper_222) 5 109.62 119.22 4 80.00
3070. Ray (xray2) 9 109.62 118.72 1 11.11
3071. Real (not_available_name) 5 109.62 115.28 2 40.00
3072. Edisa (snoopy34) 65 109.62 129.08 37 56.92
3073. Quittance (quittance) 2 109.61 120.55 0 0.00
3074. Jorunn (jorunn) 8 109.60 115.92 5 62.50
3075. Fauzan (ozaenzenzen) 18 109.59 122.36 6 33.33
3076. Kowalski (kowalski_) 31 109.59 129.52 15 48.39
3077. Free Gaza From Hamas (missa... 6 109.59 118.22 3 50.00
3078. Tork (hork) 1 109.58 109.58 0 0.00
3079. Ocean (oceanlim) 396 109.58 165.26 190 47.98
3080. Emir (emirthetyper) 6 109.58 114.14 5 83.33
3081. Snowy (snowysauce) 27 109.57 130.15 12 44.44
3082. Rex (rexsauce) 6 109.57 123.45 2 33.33
3083. Luna (vexara) 201 109.56 141.93 95 47.26
3084. Zain (zainali23) 1 109.56 109.56 1 100.00
3085. Tobs (tobzs) 2 109.56 119.75 1 50.00
3086. Jerod (jeroddddd) 29 109.54 129.55 14 48.28
3087. Tilm (duqq) 1 109.53 109.53 1 100.00
3088. amoz r (amoz11) 501 109.53 145.57 227 45.31
3089. Mike (wikemazowski) 16 109.51 139.65 6 37.50
3090. Ben (meh_guy) 52 109.51 128.84 34 65.38
3091. Joke (justjokeing) 7 109.51 117.11 5 71.43
3092. Joshua (lckjosh) 171 109.51 130.91 78 45.61
3093. hi cutie (an66atwork) 5 109.51 124.20 1 20.00
3094. c (nb888) 26 109.49 125.02 11 42.31
3095. Gabi (gabitzuxxl) 19 109.49 121.68 7 36.84
3096. bimmm (jdrbvgserg) 3 109.48 116.46 3 100.00
3097. Cheska (cheesekuh) 3 109.47 119.21 2 66.67
3098. Andy (tactilegangriseup) 10 109.47 134.41 5 50.00
3099. Teddy (hulksgreenass) 8 109.47 117.17 6 75.00
3100. Paolo (invelt) 929 109.46 139.53 484 52.10
3101. Tony (zhukant) 10 109.46 121.48 5 50.00
3102. Scott (theking55555) 2 109.46 113.09 1 50.00
3103. M (poptropica979) 6 109.46 124.96 2 33.33
3104. Justin (jjallday13) 7 109.46 123.84 5 71.43
3105. Seal (seal5059) 3 109.45 121.64 3 100.00
3106. CaccMann (aloned) 8 109.44 139.12 2 25.00
3107. bog (flamesthecat) 2 109.44 144.65 1 50.00
3108. wabi (wisabi) 7 109.43 123.80 7 100.00
3109. Thomas (t_chow) 6 109.43 125.81 2 33.33
3110. Orange (orange_oranges) 3 109.42 120.14 2 66.67
3111. lunarcoffee (lunarcoffee) 2 109.42 117.13 1 50.00
3112. Jay (jaykimchi) 6 109.42 128.49 3 50.00
3113. Logan (freamish) 5 109.40 121.22 3 60.00
3114. Nocturnal_Tofu (entity_01) 1 109.40 109.40 1 100.00
3115. Isaac (iy4717) 2 109.40 109.79 0 0.00
3116. SheLuvRui (rushabh161) 14 109.39 118.57 7 50.00
3117. Hugh (mrpiface101) 23 109.38 124.66 11 47.83
3118. Kwait (kwait) 1 109.38 109.38 1 100.00
3119. Shaurya (ssen12) 1 109.38 109.38 1 100.00
3120. Daniel (dchomtl) 2 109.38 111.60 2 100.00
3121. wae (wae_da_algae) 3 109.37 121.46 3 100.00
3122. Miguel (vansterrgod) 1 109.37 109.37 0 0.00
3123. Eli (bobfrankie) 3 109.36 124.95 3 100.00
3124. uxvb (uxvb) 12 109.36 143.83 5 41.67
3125. Anu (typeradha) 84 109.36 128.27 36 42.86
3126. Mighty (saranb) 3 109.36 116.43 3 100.00
3127. Michael (symmbowl) 5 109.35 111.83 3 60.00
3128. swxh89 (swxh89) 12 109.35 124.45 8 66.67
3129. Lukiji (hempasaur) 3 109.35 125.37 2 66.67
3130. Buddy (lucedes27) 13 109.34 122.13 8 61.54
3131. Harry (feeshgang) 21 109.34 127.77 12 57.14
3132. Fabijan (bifazg) 71 109.33 132.81 38 53.52
3133. Franky (zyrefe) 20 109.33 128.60 10 50.00
3134. Mason (zadeos) 2 109.32 116.29 0 0.00
3135. C (sirbop) 4 109.31 116.89 3 75.00
3136. Hajun (improve_ever) 56 109.30 135.29 39 69.64
3137. carve (carve) 573 109.30 144.78 269 46.95
3138. Phish (phishphishphish) 361 109.30 136.14 165 45.71
3139. FreakinNickP (freakinnickp) 371 109.29 141.27 173 46.63
3140. Octo (octophobia) 190 109.29 151.94 87 45.79
3141. Brockton (ztgstover) 100 109.28 138.83 48 48.00
3142. SuperFire92 (superfire92) 5 109.28 115.88 4 80.00
3143. Alex (eggstreme) 5 109.28 115.64 4 80.00
3144. Rishabh (rdmighty_i) 47 109.28 132.87 22 46.81
3145. Tony (artemisu) 3 109.28 126.88 0 0.00
3146. Nolie65 (nolie65) 2 109.27 124.05 1 50.00
3147. R Dizzle (ridzilla) 7 109.27 126.14 2 28.57
3148. Orlando (orlandor3) 6 109.26 124.35 3 50.00
3149. mp3hunters.com (rubyist) 6 109.26 120.79 2 33.33
3150. Max (maxma_69) 51 109.26 139.68 32 62.75
3151. Oliver (noodle3) 2 109.25 111.45 2 100.00
3152. Neo (shinryu1324) 4 109.25 113.80 1 25.00
3153. Manuel (asdfero) 5 109.25 117.63 5 100.00
3154. exodia (exodiaa) 212 109.24 129.60 106 50.00
3155. epicgamer412 (epicgamer412) 9 109.23 124.34 5 55.56
3156. TotalledZebra (totalledzebra) 25 109.22 129.34 17 68.00
3157. L (t3rraa) 5 109.21 117.67 3 60.00
3158. Filip (filis93) 3 109.21 118.62 3 100.00
3159. Haikuno (haikuno) 2 109.21 110.82 1 50.00
3160. Brody (yuumi) 22 109.20 135.14 14 63.64
3161. Serge (lolegend) 1 109.20 109.20 1 100.00
3162. jello_jello (jello_jello) 885 109.20 137.06 454 51.30
3163. Nick (nicklong1599) 41 109.19 127.53 21 51.22
3164. Arxidon (arxidon) 2 109.18 114.68 1 50.00
3165. liz (hamid__) 767 109.18 136.27 373 48.63
3166. Adrian (dinfus) 353 109.18 140.43 191 54.11
3167. Gus (lookitup) 4 109.18 127.71 1 25.00
3168. Andrew (poler10) 1 109.17 109.17 1 100.00
3169. Kacper (kacpix2000) 12 109.17 145.07 8 66.67
3170. Darkleonard (darkleonard) 32 109.16 124.14 12 37.50
3171. Ivan (blindingangel) 426 109.16 141.70 238 55.87
3172. NQ (nq_neilprangko) 185 109.16 139.86 92 49.73
3173. Will (williamwang) 275 109.16 140.26 120 43.64
3174. Gabriel (halamawala) 9 109.15 118.68 5 55.56
3175. Jonowo (trainerjono) 27 109.15 126.95 15 55.56
3176. isaiah (isaiahturnip) 28 109.15 135.05 14 50.00
3177. Adam (george_williams14798) 27 109.14 131.04 14 51.85
3178. Trenten (guitars12) 2 109.14 115.43 2 100.00
3179. willmtx (willmtx) 1 109.14 109.14 0 0.00
3180. aidan (typingusername) 1 109.14 109.14 0 0.00
3181. tippy (tippytypo) 17 109.14 122.69 10 58.82
3182. Mister (shiriou) 14 109.13 138.23 9 64.29
3183. Jefferson (rasmus06) 8 109.13 127.46 4 50.00
3184. Ivan (ichauster) 17 109.09 137.19 7 41.18
3185. justinhylee (justinhylee) 13 109.09 130.57 13 100.00
3186. AJ (theloafingone) 41 109.08 131.73 28 68.29
3187. Jo (jojoey21) 11 109.08 125.92 7 63.64
3188. Morgan (morgbot) 52 109.06 139.30 26 50.00
3189. chom (chom2474) 91 109.06 164.41 51 56.04
3190. Jonathan (comeonet) 1 109.04 109.04 1 100.00
3191. Kaitlyn (kaitlyam) 1 109.04 109.04 1 100.00
3192. Vanq5 (vanquisher5) 1 109.03 109.03 1 100.00
3193. Evan (xtremeelectrix) 9 109.03 128.53 4 44.44
3194. Me (perfectaim) 5 109.03 116.63 1 20.00
3195. Shawn (rcvroom) 41 109.02 128.62 25 60.98
3196. Wilfred (wilfredfraser) 2 109.02 115.31 0 0.00
3197. Empurrer Meow (wolfbream) 1 109.00 109.00 0 0.00
3198. rocket (rocketmantyper) 1 109.00 109.00 1 100.00
3199. odie (odiemoley) 2 109.00 117.05 0 0.00
3200. M&W (wmichaelwhitlock) 9 108.99 129.85 4 44.44
3201. Michael (hangene92) 9 108.98 128.88 9 100.00
3202. Jon (mystikj) 5 108.97 119.47 2 40.00
3203. Adam (armorcle) 11 108.97 122.99 7 63.64
3204. Brennen (uglyer) 15 108.96 120.27 7 46.67
3205. Hian Zing (peperon321) 3 108.96 110.68 1 33.33
3206. speed demon (quickity) 3 108.96 115.64 3 100.00
3207. John (hylkinator) 9 108.96 128.62 5 55.56
3208. Will (will_colemak) 5 108.94 117.10 3 60.00
3209. Lukas (s018296) 23 108.94 124.90 12 52.17
3210. Diwangkoro (serperone) 4 108.94 115.33 2 50.00
3211. Nicholas (nicktanasianman) 6 108.94 128.08 3 50.00
3212. Caroline (karialyn) 7 108.94 119.95 5 71.43
3213. bepis (bepis_pebis) 22 108.94 125.47 8 36.36
3214. Tobi (fastestflash) 68 108.93 137.98 39 57.35
3215. e2blu (yellowe2) 28 108.93 126.84 11 39.29
3216. Jake (jakeypancakey) 21 108.93 129.44 11 52.38
3217. Ryan (_rhou_) 101 108.93 144.95 60 59.41
3218. DIO (fengy1747) 2 108.93 111.94 0 0.00
3219. Sergey (snich) 16 108.92 116.17 8 50.00
3220. Brandon (birdysofly) 14 108.91 134.94 11 78.57
3221. SPEXINDER (forest7) 1,129 108.91 152.46 561 49.69
3222. McMac2 (sjm46) 198 108.91 134.41 97 48.99
3223. Antoni (aachh) 16 108.91 128.50 8 50.00
3224. Benjamin (blaptypes) 6 108.90 119.25 5 83.33
3225. 🎈bm (redly) 473 108.90 136.39 223 47.15
3226. rose (fr0gspawnn) 8 108.87 115.68 2 25.00
3227. KPS (kingkps) 1 108.87 108.87 1 100.00
3228. fishy (roadto135wpm) 5 108.87 117.28 4 80.00
3229. Brendan (partyhipster) 9 108.85 127.06 6 66.67
3230. Ivan (ivansucksattyping) 7 108.85 130.11 4 57.14
3231. Andy (parkourmaster302) 91 108.85 137.31 57 62.64
3232. BetTheDerp (betthederp) 40 108.85 140.35 27 67.50
3233. Andy (a1i3n0) 12 108.85 129.46 7 58.33
3234. TUwU (tuwu) 8 108.84 115.83 1 12.50
3235. nauyu (nauyusimi_) 770 108.83 133.43 351 45.58
3236. Justin (teeheeheeheehee) 2 108.83 110.04 2 100.00
3237. Rustem (rus101) 16 108.82 125.69 6 37.50
3238. Rainnier (corrby) 8 108.82 166.75 5 62.50
3239. Victor (its_shadow) 16 108.82 127.36 10 62.50
3240. jay! (its_jay_) 11 108.82 117.20 0 0.00
3241. Andrew (littlefleece) 8 108.81 120.14 8 100.00
3242. Rai (kaythox) 14 108.80 125.70 5 35.71
3243. Hovok (hovok) 147 108.79 148.39 69 46.94
3244. AxiomDestroyer (axiomdestro... 772 108.78 135.73 368 47.67
3245. FlyingFlamingo (deinna222) 4 108.78 119.07 1 25.00
3246. [SCC] Ignis (ignis_sphaera) 15 108.78 120.83 7 46.67
3247. Breeze (driftbreeze) 92 108.76 126.84 44 47.83
3248. anvildorms (anvildorms) 2 108.76 117.06 1 50.00
3249. Rice Chan (rice_chan) 144 108.76 131.97 103 71.53
3250. immikeylee (immikeylee) 90 108.76 126.99 49 54.44
3251. alex (chinese69) 26 108.75 127.44 14 53.85
3252. Luka (jomanji) 6 108.75 113.40 3 50.00
3253. Tozu (tozu2) 3 108.74 117.28 1 33.33
3254. Alex (aqin24) 35 108.74 121.43 19 54.29
3255. Ketchup (polterg3ist) 94 108.73 132.01 37 39.36
3256. Francis (emeritusninoy) 7 108.72 117.53 4 57.14
3257. Jesus (keeemstarr) 5 108.72 118.15 4 80.00
3258. YAS62kbdfans5 (ksydry6) 16 108.70 119.22 11 68.75
3259. David (leepictrollexd) 27 108.70 126.26 16 59.26
3260. eril (eril) 25 108.69 119.51 11 44.00
3261. James (the_swan) 31 108.69 127.33 21 67.74
3262. 5000600 (5000600) 114 108.69 171.39 87 76.32
3263. Aya (uwub) 8 108.68 117.48 7 87.50
3264. Awzzz (awzzz) 6 108.68 122.84 1 16.67
3265. David (d8vidherrera) 22 108.67 131.91 12 54.55
3266. Appel (appeltert) 1 108.67 108.67 1 100.00
3267. aman (amanostrich) 3 108.67 115.41 1 33.33
3268. Space Cowboy (booqueefius69... 7 108.67 135.16 5 71.43
3269. Drovor (wwinder) 227 108.66 143.11 110 48.46
3270. lou (mikubeez) 15 108.65 120.68 3 20.00
3271. Joe (clauser) 1 108.65 108.65 1 100.00
3272. Nyora (dvorak_mode) 78 108.65 130.69 41 52.56
3273. George (ryallanrya) 15 108.64 127.06 9 60.00
3274. l502x (l502x) 356 108.64 136.01 160 44.94
3275. Bryan (blcm123) 49 108.64 120.88 21 42.86
3276. Celios (celios) 1 108.63 108.63 1 100.00
3277. Brantly (brantlyd) 4 108.63 113.66 2 50.00
3278. dude (udead1) 124 108.62 124.60 58 46.77
3279. 2fast4u (russell12345) 75 108.62 134.93 36 48.00
3280. Kasiourasg (kasiourasg) 56 108.62 133.06 33 58.93
3281. Joni (jonijohn) 2 108.62 114.40 2 100.00
3282. abraham (shewdiebro) 5 108.61 121.94 2 40.00
3283. Angelic (angelic_devil) 1,549 108.59 146.70 791 51.07
3284. yusuf (maleky) 5 108.59 125.55 0 0.00
3285. fedja (fedza) 45 108.59 123.14 20 44.44
3286. Chris (chrisdapula) 2 108.59 131.79 1 50.00
3287. s (dapawner) 3 108.58 120.39 2 66.67
3288. mergaza (chiboub) 3 108.58 118.39 2 66.67
3289. Conning (conning) 45 108.58 127.67 22 48.89
3290. spuffin (spuffin) 6 108.58 121.40 5 83.33
3291. abdullah (abdullah_ui) 897 108.58 149.91 461 51.39
3292. Kevin (xertheon) 23 108.57 129.11 7 30.43
3293. Pranav (preyneyv) 7 108.57 133.32 5 71.43
3294. Jeff (ekuplosion) 5 108.56 120.31 5 100.00
3295. Andrew (jargazes) 8 108.56 115.49 5 62.50
3296. person (person625) 41 108.56 121.97 18 43.90
3297. Devin (lundrity) 5 108.55 125.16 1 20.00
3298. Daniel (d0eza) 5 108.55 121.78 3 60.00
3299. ur boy (msinghh) 7 108.54 125.00 2 28.57
3300. Lindsay (math314) 16 108.54 125.96 14 87.50
3301. Juniper (junipergd) 19 108.54 144.84 12 63.16
3302. Zy (gmzydra) 2 108.54 111.55 1 50.00
3303. SirShrek69 (puffers23) 141 108.53 124.51 59 41.84
3304. Greg (lolzface) 3 108.53 111.85 2 66.67
3305. Mythknight (nolfwin) 2 108.53 109.11 1 50.00
3306. ear (earmold) 14 108.52 121.65 7 50.00
3307. Stephen (canasferatu) 2 108.52 114.22 1 50.00
3308. matthew (mshau) 7 108.52 124.73 5 71.43
3309. Ivan (ivan_liang51) 2 108.50 116.38 1 50.00
3310. Steven (stevie03) 7 108.49 127.12 3 42.86
3311. Eric (ehshark) 8 108.49 120.03 5 62.50
3312. Connor (connor12568) 4 108.49 112.11 4 100.00
3313. Bilal (chaudhryb) 5 108.48 125.93 4 80.00
3314. rozetina (rozetina) 14 108.46 139.41 7 50.00
3315. bloop 💫 (bloopedyblap) 4 108.46 130.58 1 25.00
3316. youtube.com/martinkirilov (... 26 108.46 120.89 17 65.38
3317. Christian (amici117) 226 108.45 141.44 113 50.00
3318. Pink Tissue (abdalmoez) 3 108.45 117.39 3 100.00
3319. hmmm (kesh______) 9 108.45 119.33 5 55.56
3320. Kelvin - Colemak (winlost) 29 108.44 122.12 14 48.28
3321. Ryan (ryantanglikesmath) 1 108.44 108.44 0 0.00
3322. Preston (prestomation) 1 108.44 108.44 0 0.00
3323. Aseemru (aseemru) 2 108.44 110.16 2 100.00
3324. William (xenosaints) 17 108.43 125.59 7 41.18
3325. Tortol (tortol) 3 108.43 112.23 0 0.00
3326. Gochu (g0inginsqne) 11 108.43 116.69 5 45.45
3327. Dewey (_dewey) 7 108.43 114.06 2 28.57
3328. Ryan (tazayuki) 13 108.42 117.02 7 53.85
3329. Jo (typermac) 143 108.42 150.36 67 46.85
3330. Tavora (tavora) 10 108.41 127.19 6 60.00
3331. NeverRage (solid_raiden) 67 108.41 129.75 37 55.22
3332. M (musketeertypist) 132 108.41 130.35 68 51.52
3333. Marshall (marshallmaofr) 15 108.39 127.06 8 53.33
3334. Dylan (xdylkay) 34 108.39 122.85 20 58.82
3335. Joseph (josqu) 5 108.39 125.70 2 40.00
3336. Elvis (noratic) 9 108.39 128.23 3 33.33
3337. Tyler (tybow99) 20 108.39 117.49 6 30.00
3338. Tree (raaaaaaaku) 1 108.37 108.37 1 100.00
3339. David (mm12345) 1 108.37 108.37 0 0.00
3340. Pai Sho (paisho) 4 108.37 125.39 4 100.00
3341. Cizzo (mrcizzo) 4 108.37 133.39 2 50.00
3342. Taylor (tayylorngo) 3 108.36 113.84 2 66.67
3343. Noah (noahc3) 15 108.36 119.54 4 26.67
3344. Evan (evang12) 15 108.35 127.03 6 40.00
3345. Mike (unforgotten) 30 108.35 134.75 17 56.67
3346. Albert (albertthedy) 2 108.35 119.16 1 50.00
3347. Michael (m_soutar3) 10 108.35 122.09 6 60.00
3348. Nick (blafl) 5 108.34 114.39 2 40.00
3349. Mads (gismodyret) 2 108.34 112.60 0 0.00
3350. Jocho Muaguadabo (alezander... 221 108.33 136.99 98 44.34
3351. LKB (lkb1) 3 108.33 133.24 1 33.33
3352. Khastro (peterakd) 56 108.33 144.60 26 46.43
3353. Acetaminophen (savirbaas) 10 108.32 128.24 2 20.00
3354. Cory (corydean) 3 108.32 121.15 2 66.67
3355. hwalters360 (hwalters360) 17 108.32 133.34 10 58.82
3356. Nathan (lanza21) 2 108.32 121.37 0 0.00
3357. Sander (sanderbot66) 2 108.31 113.44 0 0.00
3358. tstats[n0body] (nobody01) 16 108.31 122.11 7 43.75
3359. Ollie (revvylo) 2 108.30 116.79 0 0.00
3360. Jeremy (daddystravinsky) 7 108.30 132.03 3 42.86
3361. Justin (flamingoed02) 48 108.30 122.62 21 43.75
3362. enigma_mf (enigma_mf) 470 108.29 147.65 231 49.15
3363. Sawah :3 (sth2127) 1 108.29 108.29 1 100.00
3364. Olivia Scott Welch can run ... 22 108.28 122.26 6 27.27
3365. Yuvraj (yuvisinghie) 1 108.28 108.28 1 100.00
3366. Moo (mafaraxas) 4 108.28 116.73 3 75.00
3367. nikhil (forceablebean6) 110 108.28 126.19 61 55.45
3368. Splash (splashcc) 12 108.27 119.15 7 58.33
3369. Andreas Vida (johnbonham) 154 108.27 138.95 75 48.70
3370. ponkl (ponkl) 4 108.26 114.90 4 100.00
3371. Michael (mwik) 17 108.25 122.23 8 47.06
3372. Shady (shadyhippo) 4 108.25 111.93 2 50.00
3373. Undisclosed (thetechnicalfox) 11 108.24 129.67 3 27.27
3374. piimpj (pjcrowley) 4 108.23 120.86 0 0.00
3375. Tyler (numbermunch3r) 1 108.23 108.23 1 100.00
3376. zeko (zekoo) 34 108.22 124.54 13 38.24
3377. Ian but less cool (vcap36) 1 108.22 108.22 0 0.00
3378. Solomann (kuttamma01) 19 108.22 127.85 10 52.63
3379. Bruno (armitageb) 31 108.22 132.01 14 45.16
3380. ASG (asg1997) 2 108.22 119.51 1 50.00
3381. Jiayan (jiayanluo) 3 108.21 127.49 1 33.33
3382. Inakoto (inakoto) 6 108.21 117.84 4 66.67
3383. Lawrence (wattfox) 483 108.20 132.28 199 41.20
3384. Carrot (dreamsode) 13 108.17 116.62 6 46.15
3385. David (2mill) 17 108.17 131.18 7 41.18
3386. Hoopty (phantommonk) 24 108.17 121.28 18 75.00
3387. gannicus (milaikilaiki) 11 108.16 123.06 5 45.45
3388. ✔️▄◘🚀!new_luca@y... 62 108.16 134.95 32 51.61
3389. Yuseph (yuseph) 5 108.16 129.07 1 20.00
3390. cruderustle (cruderustle) 1 108.16 108.16 1 100.00
3391. OREO (reocraft) 16 108.15 138.98 9 56.25
3392. poop (stanloon1231) 3 108.14 118.13 1 33.33
3393. The Milkman (captain_noodle) 16 108.14 125.59 8 50.00
3394. Silent (silent_solous) 27 108.13 129.46 20 74.07
3395. bram (super_r23) 1 108.13 108.13 0 0.00
3396. Tim (guiganator) 5 108.13 119.91 2 40.00
3397. fover (keitotrash) 11 108.12 127.08 8 72.73
3398. Colin (cuken) 4 108.12 114.72 4 100.00
3399. Tomas (sumtinlazy) 42 108.11 126.92 19 45.24
3400. Blazian444 (blazian444) 45 108.11 129.57 14 31.11
3401. Owen (owenc1272) 6 108.11 122.28 1 16.67
3402. firedarkS (firedarks) 3 108.10 115.24 1 33.33
3403. Yami (yamiph) 51 108.10 145.23 33 64.71
3404. Nooyag (priceisright2) 64 108.10 132.53 31 48.44
3405. . (vectorale) 66 108.10 136.54 26 39.39
3406. martin (lovestotype) 2 108.09 118.00 2 100.00
3407. Serena (nerdyjoker) 12 108.08 122.70 6 50.00
3408. Joey (sjuney) 3 108.08 118.29 2 66.67
3409. Dragon (menacingdragon) 7 108.07 118.27 6 85.71
3410. Joseph (jolow) 4 108.07 120.26 4 100.00
3411. Alex (krim19) 17 108.07 120.27 11 64.71
3412. Kai Wei (fortissimo) 21 108.06 132.69 12 57.14
3413. jenga (smokythunder) 18 108.06 137.08 5 27.78
3414. Johnny (k5kk) 14 108.05 142.62 9 64.29
3415. Sam (crapslock) 6 108.05 113.67 3 50.00
3416. Howard (howardpx2016) 31 108.04 123.93 9 29.03
3417. Aidan (trabpukcip) 30 108.04 129.04 16 53.33
3418. Mangekyou (double_mangekyou) 24 108.04 131.85 13 54.17
3419. Laet (laet99) 24 108.03 124.61 12 50.00
3420. Grant (eyz11327) 11 108.02 116.83 6 54.55
3421. sally (creamdonut) 141 108.02 146.97 69 48.94
3422. Rain Kirby (weebwithadog67) 15 108.00 123.71 9 60.00
3423. Randy (randylee) 3 108.00 116.60 0 0.00
3424. Peter (ptnguyen) 268 108.00 143.19 135 50.37
3425. Aidan (aidanmccomsey) 15 108.00 129.23 6 40.00
3426. kap (kappow) 9 107.99 121.44 5 55.56
3427. Ultimate_Coder (ultimate_co... 31 107.99 122.04 17 54.84
3428. M8l8th (glitchsolo) 499 107.99 149.00 225 45.09
3429. Joshua (buwan) 64 107.99 128.71 31 48.44
3430. usstudent101 (usstudent101) 42 107.97 140.13 22 52.38
3431. Paulie (paulie_) 19 107.96 126.80 7 36.84
3432. emon (emonemoemo) 11 107.96 125.57 3 27.27
3433. Dylan (dddking) 7 107.96 119.34 4 57.14
3434. Sc0rxh (sc0rxh) 19 107.95 123.16 6 31.58
3435. LmaoUrTrash (bruhmoment2341... 1 107.93 107.93 1 100.00
3436. Ben (bendoman_) 11 107.93 119.29 6 54.55
3437. Reyque (reyquexd) 31 107.93 129.88 10 32.26
3438. Lőrinc (mbalazs) 42 107.93 119.31 24 57.14
3439. naclytyper (nikhila) 3 107.92 110.35 1 33.33
3440. Erik (strezz) 4 107.92 118.48 2 50.00
3441. slow typer (_________o_____... 2 107.92 108.11 0 0.00
3442. Tyler Spruill (fightingox) 16 107.91 125.09 6 37.50
3443. josh (joshtypes1) 117 107.91 145.30 51 43.59
3444. mcbtay (mcbtay) 6 107.91 123.37 5 83.33
3445. Erdo (erdo897) 1 107.90 107.90 1 100.00
3446. Skylos (skylos) 20 107.90 136.79 7 35.00
3447. Heino (hsirvio) 23 107.90 117.42 16 69.57
3448. JRD (yesjrd) 17 107.88 123.19 7 41.18
3449. Sadman (prant0) 1 107.88 107.88 0 0.00
3450. Tesseus (tesseus) 3 107.87 123.16 1 33.33
3451. Epic (epic_gamer2834) 16 107.87 133.62 9 56.25
3452. bruh (jqzz) 1 107.87 107.87 0 0.00
3453. Xander (xandejesus) 594 107.86 133.61 264 44.44
3454. Cris (ctietsort) 11 107.86 121.79 4 36.36
3455. BEECEE (nukecee) 117 107.85 131.53 63 53.85
3456. Swiftie (aes222) 160 107.84 141.06 73 45.63
3457. Eddie (goombah1) 8 107.83 112.88 4 50.00
3458. Ian (typer_goose) 1 107.83 107.83 0 0.00
3459. Joe (siyyy) 40 107.83 132.28 17 42.50
3460. powerofmooogiza (powerofmoo... 18 107.83 125.10 7 38.89
3461. Bouba (breadbake) 72 107.82 124.47 39 54.17
3462. swooshmcgoosh (swooshmcgoosh) 29 107.82 133.38 14 48.28
3463. Ayon (apaul23) 30 107.81 124.59 14 46.67
3464. Shikhraj (shikhrajsingh) 59 107.81 129.86 25 42.37
3465. Edward (edwoodxd) 1 107.81 107.81 1 100.00
3466. batbold (bb__) 412 107.80 154.85 193 46.84
3467. Hibird (hibird) 20 107.80 118.76 15 75.00
3468. Fopuy (fopuy) 28 107.80 124.49 14 50.00
3469. caesthetis (caesthetis) 22 107.79 128.13 11 50.00
3470. Jason (jachian) 84 107.79 133.84 51 60.71
3471. Mikayla (mikaylahumphrey) 12 107.79 128.47 6 50.00
3472. Ric (drrz) 2 107.79 110.37 1 50.00
3473. k1mbap (beaned_fish) 44 107.78 129.52 29 65.91
3474. Max (triangl12) 53 107.78 132.10 24 45.28
3475. Joran (turkeyman) 18 107.78 126.42 9 50.00
3476. colaclanth (colaclanth) 6 107.77 118.37 1 16.67
3477. Czar (czarlol) 14 107.77 124.78 6 42.86
3478. Kevin (havek) 9 107.76 119.43 5 55.56
3479. lol (formulol) 4 107.76 135.46 2 50.00
3480. wrentay (wrentay) 21 107.76 140.48 6 28.57
3481. Fidelity (fidelityssj) 28 107.76 119.34 11 39.29
3482. Ali (bahjatia) 5 107.75 114.45 4 80.00
3483. Joseph (slurpherpderp) 6 107.75 139.70 3 50.00
3484. Nicholas (joshjoshjoshjosh) 10 107.75 145.27 5 50.00
3485. Yioryis (giorgis) 20 107.75 130.73 13 65.00
3486. Jeffrey (clickk) 1 107.75 107.75 0 0.00
3487. lo gartiquero (liech) 9 107.74 114.69 5 55.56
3488. Nightwong (thfw00) 1 107.74 107.74 1 100.00
3489. Alan (alan2021233) 4 107.74 136.92 3 75.00
3490. Henry (henry2) 16 107.74 116.29 9 56.25
3491. gwen (abcdbga) 10 107.73 119.09 4 40.00
3492. Raimi (limeykun) 3 107.73 126.42 1 33.33
3493. Ethan (bewilderex63) 27 107.72 136.22 12 44.44
3494. Nabil (nabil_aldihni) 39 107.72 132.51 20 51.28
3495. NZ (n0tninjaz) 5 107.72 117.22 3 60.00
3496. erty (someone8888) 54 107.72 139.67 29 53.70
3497. carline (muffintart) 4 107.72 111.69 1 25.00
3498. chelz (slowcolt) 2 107.71 109.62 1 50.00
3499. Angel (angeldavinci) 10 107.71 125.72 4 40.00
3500. zeeee (zeeebra) 265 107.71 146.21 142 53.58
3501. Bingy (waesoph) 6 107.70 121.26 1 16.67
3502. Vaishnav (thecookingcardsman) 1 107.70 107.70 0 0.00
3503. Lucas (ceebzz) 25 107.69 118.37 10 40.00
3504. shay (shaaaay) 6 107.68 122.51 5 83.33
3505. James (m33pit) 3 107.68 115.46 2 66.67
3506. Rafael (locher) 4 107.67 110.59 4 100.00
3507. Jotaro (commandercuber) 5 107.67 110.36 2 40.00
3508. Stifmeister (the_stifmeister) 12 107.67 133.41 8 66.67
3509. Sardar Taha (dice111) 21 107.66 123.58 9 42.86
3510. Rick (rickthetyper) 15 107.66 141.38 4 26.67
3511. Charles (themythicalvlad) 43 107.64 118.91 22 51.16
3512. blademagic (blademagic) 10 107.64 115.22 6 60.00
3513. arno (boxhill) 61 107.64 138.59 33 54.10
3514. CARDEER (cardeer) 489 107.64 136.82 229 46.83
3515. tstats[MonsterTaco] (monste... 2 107.64 118.53 2 100.00
3516. EthanDennisttv (ethandennis) 38 107.63 130.94 14 36.84
3517. makaio (neosifr) 7 107.62 135.36 3 42.86
3518. Squall (akaisquall) 7 107.61 126.48 5 71.43
3519. JollyImpulse (jollyimpulse) 694 107.61 140.92 303 43.66
3520. Jason (terminatorer) 5 107.60 118.25 2 40.00
3521. shua (shuaskies) 3 107.60 109.15 2 66.67
3522. silvik (silvik_) 172 107.60 143.36 86 50.00
3523. Devids (theneo) 21 107.59 126.89 8 38.10
3524. Angela (academicworkspace) 1 107.59 107.59 1 100.00
3525. noobboy (debiggay) 3 107.59 134.56 1 33.33
3526. Archery (archeryiskey) 28 107.58 124.80 9 32.14
3527. Newland (oldwutter) 1 107.58 107.58 1 100.00
3528. Tortle (megahentai) 66 107.57 126.61 27 40.91
3529. Miguel (thewittywarlock) 1 107.56 107.56 1 100.00
3530. Filip (filiplass) 6 107.56 114.53 6 100.00
3531. wonder wave (wonderwave2) 196 107.55 130.46 90 45.92
3532. Kevin (kevzjhu) 47 107.54 131.16 18 38.30
3533. byronze (toqoz) 13 107.54 115.32 4 30.77
3534. Xander (shuuk1) 1 107.53 107.53 1 100.00
3535. Spanner (spanner77) 7 107.52 112.93 2 28.57
3536. zhem_ (zhem) 29 107.52 130.10 14 48.28
3537. Daniel (dannyxo) 4 107.52 109.78 1 25.00
3538. Adam (w0nsh) 3 107.50 117.14 3 100.00
3539. spacebagel (spacebagel) 8 107.50 132.70 3 37.50
3540. Andy (andyjg47) 39 107.49 140.00 19 48.72
3541. Cat (catcatcatcatcatcatcatcat) 88 107.48 129.09 61 69.32
3542. bofa (xxx_bofa_xxx) 34 107.48 118.74 12 35.29
3543. 6969 (silky_) 27 107.48 118.55 13 48.15
3544. Alberti (albertibass) 2 107.48 107.62 1 50.00
3545. D A M A G E D (dama_ged) 69 107.47 129.73 28 40.58
3546. Adzenys XR-ODT (iromuanya) 536 107.47 144.95 252 47.01
3547. Adam (azonite) 76 107.47 139.99 45 59.21
3548. PrinceRemielAleks (aisakata... 2 107.47 117.03 1 50.00
3549. Tina (tinanuggi) 3 107.46 115.52 0 0.00
3550. Ring (ringtack) 22 107.46 124.21 13 59.09
3551. Tandy (tandysu) 23 107.46 134.62 12 52.17
3552. Richard (zzzcha10) 73 107.46 128.12 38 52.05
3553. Bauyrzhan (baurtokenov) 133 107.45 130.06 66 49.62
3554. Deactrals (deactralsyt) 18 107.45 138.29 6 33.33
3555. Runa Peru (runaperu) 2 107.45 108.66 1 50.00
3556. tstats[ebenezer13579] (eben... 33 107.44 132.69 7 21.21
3557. Clement (clement_ps) 21 107.44 129.20 6 28.57
3558. Dequantrius (dequantrius) 2 107.44 116.45 0 0.00
3559. Gray (evlyra) 3 107.43 112.63 3 100.00
3560. Under (polish_underdog) 35 107.43 119.89 22 62.86
3561. Kersey (strythio) 33 107.43 125.43 23 69.70
3562. Karimu (karimuosman) 36 107.43 122.79 21 58.33
3563. trepan (trepan) 4 107.42 121.69 2 50.00
3564. fen (fen10) 39 107.41 155.44 22 56.41
3565. mike (jazz_hands) 130 107.40 130.48 60 46.15
3566. Fineson (fineson) 14 107.40 138.13 7 50.00
3567. MilkhoundTTV (milkhound) 35 107.39 140.66 12 34.29
3568. Matt (mattlo) 13 107.39 125.03 9 69.23
3569. Dante (infern03) 4 107.39 120.73 2 50.00
3570. bruh (_sidnair2003_) 11 107.38 130.59 11 100.00
3571. K (quakk) 3 107.38 111.13 2 66.67
3572. Ben (jynn7) 9 107.38 127.64 5 55.56
3573. Massi (massi_goat) 7 107.37 119.52 3 42.86
3574. Austin (dorrzun) 13 107.37 135.05 5 38.46
3575. hugo (21_hugo) 4 107.37 122.72 2 50.00
3576. Alex (alex1124) 18 107.36 134.69 10 55.56
3577. tangjm5 (tangjm5) 12 107.36 117.43 8 66.67
3578. David (david0524) 3 107.36 125.71 3 100.00
3579. Nift (niviman) 15 107.36 120.40 7 46.67
3580. i can't be asked (perfectio... 354 107.35 145.13 165 46.61
3581. kerdo (kerdoqt) 5 107.33 118.34 3 60.00
3582. Lotad (quirkylotad) 1 107.33 107.33 1 100.00
3583. a (aidan2021) 2 107.33 119.89 0 0.00
3584. meme (ahchai) 1 107.33 107.33 1 100.00
3585. Aeiphera (aeiphera) 15 107.33 120.90 6 40.00
3586. Thomas (lqserbeans) 4 107.33 121.90 2 50.00
3587. Teresa (iilxvelycrystal) 3 107.33 114.55 3 100.00
3588. Ian (disnailandd) 9 107.33 133.79 6 66.67
3589. datoucai (datoucai) 2 107.33 117.01 0 0.00
3590. Kittyman10 (kittyman10) 5 107.32 116.89 5 100.00
3591. Steve (addictedtoendorphins) 130 107.32 124.01 68 52.31
3592. Phin (uncleshelby) 4 107.32 118.67 2 50.00
3593. Louis (meenepo) 39 107.31 137.45 15 38.46
3594. fish (fishoverlord) 2 107.31 111.57 1 50.00
3595. Erion (erionz) 1 107.31 107.31 0 0.00
3596. Michael (angeles_cabilao) 4 107.31 114.95 4 100.00
3597. Marius (ghebu) 15 107.31 131.63 9 60.00
3598. RS (nahor) 11 107.30 129.17 8 72.73
3599. Abhiram (abhiramravi) 12 107.30 120.45 6 50.00
3600. Austin (fallow64) 8 107.29 124.23 4 50.00
3601. Jackalope (jackalopy) 699 107.29 131.11 329 47.07
3602. Steve (sanptyper) 28 107.28 118.97 11 39.29
3603. Morris on break (h0nny) 76 107.28 144.14 26 34.21
3604. dominique (derangedwedding) 1 107.28 107.28 0 0.00
3605. Spaghetti (spaghetti_au_pot) 6 107.28 124.20 4 66.67
3606. Mr (littyzm) 18 107.27 125.48 4 22.22
3607. Djaenk (djaenk) 27 107.27 147.99 16 59.26
3608. Devin (devingalway) 9 107.27 123.56 2 22.22
3609. John (xxcooldudexx) 398 107.26 144.22 179 44.97
3610. Demancer (demancer) 111 107.25 140.13 46 41.44
3611. General (generalmalorn) 172 107.24 128.61 74 43.02
3612. Jerry (jerry_licious) 9 107.24 114.24 5 55.56
3613. Jerviz (jerviz) 143 107.24 133.46 80 55.94
3614. Slow (neolemon) 4 107.24 122.13 2 50.00
3615. chrissie911 (chrissie911) 3 107.24 111.05 0 0.00
3616. Maroy (roymaaa) 10 107.23 127.22 3 30.00
3617. TJ (tjasmus) 5 107.22 118.73 5 100.00
3618. Kirk (murb_) 2 107.22 111.81 2 100.00
3619. Sauce (lolplox123) 27 107.22 148.79 9 33.33
3620. Robin (stapler8) 7 107.22 124.52 4 57.14
3621. Shapes (yshapes) 5 107.20 123.97 4 80.00
3622. Justin (loremasterginger) 1 107.20 107.20 1 100.00
3623. Mateo (winggomateo) 1 107.18 107.18 1 100.00
3624. Billy (beel00) 4 107.18 111.26 0 0.00
3625. Travis (drdream23) 5 107.17 118.95 2 40.00
3626. Bob (octopus32) 283 107.17 128.89 153 54.06
3627. Chhilz (chhilz) 5 107.17 118.64 4 80.00
3628. SharkTed (sharkted) 5 107.16 129.05 5 100.00
3629. John (tmikelburg) 37 107.16 137.61 10 27.03
3630. JackBurst (jackburst) 32 107.16 125.24 12 37.50
3631. Andrew (astrel) 29 107.15 123.81 10 34.48
3632. David (davidjohnston20) 80 107.15 134.68 32 40.00
3633. Chase (viper681) 1 107.15 107.15 0 0.00
3634. Blake (theengi321) 4 107.15 123.43 2 50.00
3635. ghostdrain (ghostdrain) 6 107.14 112.32 2 33.33
3636. eri (cactus622) 1 107.14 107.14 1 100.00
3637. Colin (geosyog) 2,117 107.14 150.55 987 46.62
3638. Lizard (somber_lizard76) 4 107.14 120.07 3 75.00
3639. Sasan (farnasirim) 11 107.13 120.43 7 63.64
3640. Vinnie (vinniethegooch) 5 107.12 118.59 2 40.00
3641. eric (ericliu04) 454 107.12 133.41 25 5.51
3642. sultan (sultan_sasangka) 1 107.12 107.12 0 0.00
3643. Vladimír (froggz) 33 107.11 124.04 23 69.70
3644. ジョーヨ (joeyo) 50 107.11 123.30 24 48.00
3645. BeaT (anutorn) 2 107.11 108.39 2 100.00
3646. Liu (liusbl) 198 107.11 125.47 90 45.45
3647. Taiken (taiken) 5 107.10 117.55 4 80.00
3648. therealed777 (handwritingch... 3 107.10 115.73 3 100.00
3649. dissonantly (dissonantly) 36 107.10 130.99 18 50.00
3650. (anumon6395) 4 107.10 112.15 2 50.00
3651. Hal (hals11) 200 107.09 139.62 90 45.00
3652. mazer (mazer706) 7 107.09 116.10 4 57.14
3653. weiss (rag_penguin) 10 107.08 135.37 3 30.00
3654. Abi (abz135) 1 107.07 107.07 0 0.00
3655. Logan (frigidgaming) 4 107.07 119.66 0 0.00
3656. sam (samchez) 3 107.06 114.80 2 66.67
3657. Alpha (alphaomegaepsilon) 2 107.06 122.68 0 0.00
3658. Joe (joeyang1962) 2 107.05 110.96 0 0.00
3659. Renson (renson1) 38 107.05 137.45 16 42.11
3660. Stanislav🍆 (stanislav2000) 1 107.04 107.04 0 0.00
3661. maple (the_maple_syrup) 13 107.03 118.56 5 38.46
3662. Brian (dataslayer) 8 107.03 122.57 5 62.50
3663. Falco (falconil) 2 107.02 113.01 2 100.00
3664. Eduardo (shleepez) 6 107.02 118.11 2 33.33
3665. Pavle (pajle) 2 107.02 108.22 0 0.00
3666. BOss (goldere) 6 107.02 127.45 3 50.00
3667. bobva (bobva) 17 107.02 128.74 9 52.94
3668. I type (carsftw) 318 107.02 137.06 160 50.31
3669. gianni (slowasf99) 25 107.02 131.46 10 40.00
3670. cuki 🍪 (brewlux) 12 107.02 120.42 6 50.00
3671. Jenna (janengai123) 2 107.01 117.91 2 100.00
3672. HARDCORE (sailingboat) 2 107.01 112.58 1 50.00
3673. micur (micur) 40 107.00 125.57 21 52.50
3674. Kabera (rcdude27) 36 107.00 123.88 15 41.67
3675. not (omgtheworst) 6 107.00 123.04 6 100.00
3676. Ineluctable (ineluctable) 56 107.00 141.31 27 48.21
3677. noctnight (noctnight) 17 107.00 128.26 13 76.47
3678. JOHN (bb5k) 4 106.99 114.78 2 50.00
3679. n o t h i n g (whyme__) 1,461 106.98 147.95 647 44.28
3680. fixing my (fixing_bad_habits) 88 106.98 124.44 37 42.05
3681. Gavin (perfectgavinator) 11 106.97 124.27 6 54.55
3682. Zoom Zoom (soccerman12345) 11 106.97 124.28 7 63.64
3683. Glen (foxdigits) 44 106.96 136.93 20 45.45
3684. Nicole (nicoleogden) 7 106.95 114.03 5 71.43
3685. sugi (dea_agent) 8 106.95 119.70 5 62.50
3686. falsz (falsz) 1 106.95 106.95 0 0.00
3687. Alex (aorliei) 1 106.94 106.94 1 100.00
3688. Fábio (xred13) 5 106.92 115.30 4 80.00
3689. soldano (soldano) 430 106.92 139.05 205 47.67
3690. coen (coencidence) 14 106.92 132.61 3 21.43
3691. Neel (ravastar) 1 106.92 106.92 0 0.00
3692. Ausar (ausar0) 44 106.92 124.00 22 50.00
3693. tstats[jacktheboy211] (jack... 1,180 106.92 144.66 547 46.36
3694. Desh (quickzero) 12 106.92 121.52 3 25.00
3695. Aggro (aggro_typer) 12 106.92 121.03 5 41.67
3696. Lance (firball62) 4 106.91 116.54 1 25.00
3697. SaucySeas (saucy_seas) 4 106.91 116.94 2 50.00
3698. _____ (husixu1) 417 106.91 134.04 177 42.45
3699. Akitolight (akitolight) 11 106.91 113.86 6 54.55
3700. Yanni (moronicmetalman) 273 106.90 127.47 118 43.22
3701. oddblob3000 (oddblob3000) 209 106.90 134.00 98 46.89
3702. Owen (taenguar) 11 106.90 124.38 5 45.45
3703. Water (jeffersonjap) 21 106.89 117.84 14 66.67
3704. Dvorak (blazeencryption) 639 106.89 151.58 259 40.53
3705. Nuge (nugemcgee) 13 106.89 120.44 8 61.54
3706. 65best (65best) 140 106.89 134.49 61 43.57
3707. ahmed (ahmedfouad) 1 106.88 106.88 1 100.00
3708. FurretMastr (furretmastr) 34 106.88 126.24 12 35.29
3709. Peter Paul "Paulie Walnuts"... 17 106.88 117.44 12 70.59
3710. Cactus (tehcrazycactus) 4 106.88 132.05 1 25.00
3711. Greg (gkup8) 3 106.88 111.49 0 0.00
3712. aleph (alephyphen) 51 106.87 129.77 21 41.18
3713. Alfie (theaqualord) 27 106.87 134.87 19 70.37
3714. Braylin (atlasrising) 44 106.87 117.08 24 54.55
3715. Eli (peytoneli) 7 106.87 114.22 2 28.57
3716. ZeroNine (dtrix) 37 106.86 137.44 11 29.73
3717. emule (emily2h) 1 106.85 106.85 1 100.00
3718. Jacob (jlagarespo) 11 106.85 122.31 9 81.82
3719. why 🇮🇱 (believeable) 429 106.84 178.19 203 47.32
3720. tuffghost (namtap) 16 106.84 117.14 7 43.75
3721. Lemons (bhan1115) 18 106.84 122.40 10 55.56
3722. Fierce (littlekitten7) 473 106.84 136.02 269 56.87
3723. Shroomer (zergkiller) 494 106.84 136.90 234 47.37
3724. Julie (hamcheese) 4 106.84 119.05 4 100.00
3725. Evening (eveningtaco) 5 106.83 129.98 3 60.00
3726. Wasshi- (wasshi) 3 106.83 111.96 0 0.00
3727. Calvin (doyotko) 44 106.83 134.44 18 40.91
3728. Justin (krakken858) 13 106.82 121.39 5 38.46
3729. naveen (regretfulsalsa) 164 106.82 134.37 88 53.66
3730. Clarence (ha_saahn) 1,412 106.82 152.80 660 46.74
3731. Aaron (yoyoyonono) 7 106.82 120.28 3 42.86
3732. Aayush (imqwerty) 40 106.82 123.26 21 52.50
3733. Avlotis (avlotis) 11 106.81 114.95 4 36.36
3734. Deceime (applebabycare) 7 106.81 115.02 4 57.14
3735. Slow Slow Slow Slow (dukka_) 19 106.81 121.46 7 36.84
3736. Neodymium (neodytrium) 611 106.81 143.76 269 44.03
3737. Jordan (jordatypist) 36 106.80 132.79 13 36.11
3738. Landen (duklin) 3 106.79 110.98 1 33.33
3739. Daniel (danielrk) 1 106.79 106.79 0 0.00
3740. Axel (axox) 1 106.79 106.79 1 100.00
3741. Felix (ganc56141) 17 106.79 130.87 8 47.06
3742. Randy (ryanrules428) 3 106.78 110.03 1 33.33
3743. Mason (captainmom7) 4 106.78 116.52 3 75.00
3744. uzu (uzuiiske) 86 106.77 135.37 47 54.65
3745. Michael (nevado247) 5 106.77 120.17 3 60.00
3746. Nadchen (nadchen) 6 106.77 110.71 4 66.67
3747. Joshua (jkim0206) 7 106.77 124.38 7 100.00
3748. Kevin (kapoofin) 4 106.77 124.30 3 75.00
3749. ☼_☼ (temuramir) 148 106.75 132.19 56 37.84
3750. Jess (jessnixon94) 22 106.75 129.75 7 31.82
3751. Kono Dio Da (nankan6111) 90 106.75 130.09 39 43.33
3752. Simo (thespeedoflight) 14 106.75 121.83 8 57.14
3753. potato_pig12 (potato_pig12) 8 106.74 118.89 6 75.00
3754. davidbird764 (davidbird764) 29 106.74 125.03 13 44.83
3755. alipboy (tragicbronson) 109 106.73 131.85 55 50.46
3756. Zilong (zhziong) 4 106.73 110.63 2 50.00
3757. Dave (davidkim123) 26 106.72 123.96 14 53.85
3758. TW (twwu) 1 106.72 106.72 1 100.00
3759. eugene (eugenethreat) 3 106.72 121.53 1 33.33
3760. jserv23 (jserv23) 15 106.71 115.91 9 60.00
3761. Dan (danmarculet) 26 106.71 115.70 14 53.85
3762. Sung (sungsangthesong) 14 106.71 125.27 14 100.00
3763. MamyPoko (mamypoko) 7 106.71 113.62 6 85.71
3764. Haotian (haotianxu) 12 106.70 120.85 4 33.33
3765. husq (husq) 95 106.70 132.36 46 48.42
3766. Kirsten (qupidd) 2 106.70 115.09 2 100.00
3767. Christ (slowasf1) 38 106.69 132.84 16 42.11
3768. Derick (lolman1312) 1 106.69 106.69 1 100.00
3769. Thursday (thursdays) 21 106.69 123.77 9 42.86
3770. James (kwequay) 3 106.69 109.93 0 0.00
3771. Guest (minusawpm) 4 106.68 113.66 2 50.00
3772. hotmama (jaggid) 5 106.68 115.84 1 20.00
3773. Anderson (thekandycinema) 1 106.68 106.68 1 100.00
3774. Magykti (magykting) 6 106.68 122.54 3 50.00
3775. Alexandra (sashoela) 1 106.67 106.67 0 0.00
3776. Shaurya (shaurya2399) 656 106.67 131.36 365 55.64
3777. tim (slipperyreptile) 11 106.67 131.41 9 81.82
3778. Bradly (thetamtm) 6 106.66 117.24 4 66.67
3779. gegs921 (gegs921) 72 106.65 129.69 30 41.67
3780. Ares (silentglare) 2 106.65 109.72 2 100.00
3781. E (mosanbrick) 45 106.64 124.13 20 44.44
3782. Hugh (a_very_hughjanus) 3 106.64 122.09 2 66.67
3783. JJJ (jaakko1) 13 106.64 127.78 8 61.54
3784. ‹/hex› (linguistic) 28 106.64 123.08 14 50.00
3785. Arasu (arasu) 197 106.63 137.73 94 47.72
3786. Papa (papawadee) 7 106.63 113.25 2 28.57
3787. rylzu (rylzu) 1 106.61 106.61 1 100.00
3788. augustus (guslee) 129 106.61 130.85 57 44.19
3789. Joshua (jkbestgamer) 19 106.60 138.24 18 94.74
3790. Logan (maestrobroccoli) 1 106.60 106.60 1 100.00
3791. Christopher (mybudgiegus) 1 106.59 106.59 1 100.00
3792. Justin (disney6) 20 106.59 136.70 13 65.00
3793. Jim (jingon93) 5 106.58 117.95 5 100.00
3794. J0kerJ4y (j0kerj4y) 40 106.58 124.16 18 45.00
3795. beans (squirtly) 44 106.58 126.96 21 47.73
3796. J (jduncanlee) 22 106.58 132.33 11 50.00
3797. Praveen (awesomeroks) 6 106.58 123.01 2 33.33
3798. Victor (inkpiernofingla) 1 106.57 106.57 1 100.00
3799. FreeHongKong (aquaficial) 22 106.55 130.75 7 31.82
3800. Cryp_ted (crypted06) 19 106.54 121.42 19 100.00
3801. Sway (swaycuisway) 7 106.54 122.22 2 28.57
3802. Keqings Left Pinky (penguin... 7 106.54 120.26 4 57.14
3803. Z (zxxzus) 2 106.54 107.71 2 100.00
3804. John (drchase) 9 106.53 114.90 3 33.33
3805. greefy (greefy) 4 106.53 117.62 1 25.00
3806. Lynn (lynnkaek) 4 106.53 111.58 1 25.00
3807. Carlos (mongrelion) 6 106.52 113.90 5 83.33
3808. Duc (trungducdeptrai) 486 106.52 133.66 244 50.21
3809. Tom (thekryken) 1 106.52 106.52 1 100.00
3810. Melody (melody313) 7 106.52 111.76 3 42.86
3811. kyle (popedude22) 10 106.51 127.90 4 40.00
3812. ekoadipg (ekoadipg) 61 106.51 135.01 23 37.70
3813. Zach (nordwez) 1 106.51 106.51 1 100.00
3814. Charlie (cduong04) 301 106.51 137.61 107 35.55
3815. GOBLIN (xgoblin) 130 106.50 146.84 60 46.15
3816. Yehezkiel Raymundo (yehezki... 70 106.50 129.36 25 35.71
3817. winner (winner11) 129 106.50 132.17 72 55.81
3818. bdam (bdam) 1 106.49 106.49 1 100.00
3819. Leviathan (furyx) 101 106.49 157.52 26 25.74
3820. Severin (sevo4a) 16 106.49 132.97 6 37.50
3821. Luke (lukedood) 37 106.48 137.71 21 56.76
3822. Ruse (seforius) 18 106.48 129.41 11 61.11
3823. Ben (samuraiknuth) 6 106.47 120.29 5 83.33
3824. sammito1 (sammito1) 9 106.47 115.74 3 33.33
3825. kasper (kapser1) 2 106.47 113.38 0 0.00
3826. Aviral (aviral_uchiha) 537 106.46 133.74 198 36.87
3827. cheruiyot (son_of_man) 14 106.46 122.63 3 21.43
3828. Kev (kev9933) 11 106.44 117.78 4 36.36
3829. Delphie (delphie_) 52 106.44 127.60 27 51.92
3830. liz (lizkebab) 159 106.43 130.83 56 35.22
3831. Sami Wilf (samiwilf) 399 106.42 139.17 180 45.11
3832. Marcel (thiccer_marc) 80 106.42 137.36 42 52.50
3833. (´▽`ʃ♡ƪ) (froggy_y) 18 106.42 128.90 10 55.56
3834. tlbi (tla109) 36 106.41 135.72 24 66.67
3835. Wr (wrish) 2 106.41 112.99 1 50.00
3836. Andy (okiandy) 10 106.40 125.70 6 60.00
3837. sretsaM (sretsam) 16 106.40 126.97 5 31.25
3838. Daniel (randomgamer1017) 20 106.39 132.92 10 50.00
3839. Andrew (zengwendian) 53 106.39 120.56 24 45.28
3840. Paracoax (paracoax) 29 106.39 128.42 13 44.83
3841. OobertsTyping (oobertstyping) 16 106.38 124.11 7 43.75
3842. Gary (garybryan) 2 106.38 107.30 1 50.00
3843. sdjikalmd (falcony) 1 106.38 106.38 1 100.00
3844. ciwlx (ciwlx) 2 106.38 107.38 1 50.00
3845. cjp but ghost (cjasonp) 10 106.38 119.02 3 30.00
3846. Niccolo (nthperez) 4 106.38 112.78 2 50.00
3847. dennerrr (dennymin) 6 106.36 124.67 5 83.33
3848. Carly (huniee) 1 106.36 106.36 1 100.00
3849. Groot (marcogroot) 10 106.35 122.64 4 40.00
3850. Alexander (greenocelot26_dv... 140 106.35 130.44 58 41.43
3851. GiftedOtter (giftedotter) 686 106.35 144.88 298 43.44
3852. Sunho (sunhokwon) 4 106.34 107.90 3 75.00
3853. i like turtles (mrmlgturtle) 1 106.34 106.34 0 0.00
3854. buruum (buruum) 65 106.34 130.68 36 55.38
3855. Jason (jasonw1121) 124 106.33 134.77 80 64.52
3856. Benjamin (bxrivx) 11 106.33 125.89 2 18.18
3857. Zaynski (zaynium) 158 106.32 128.89 74 46.84
3858. chimp (phucktyping) 16 106.31 131.82 7 43.75
3859. Jon Clarence (jclh127) 6 106.31 126.75 2 33.33
3860. Alex (qwertyesque) 2 106.31 114.13 0 0.00
3861. PegaS (pegas) 1 106.31 106.31 1 100.00
3862. wendy fan (nabong) 24 106.31 129.27 20 83.33
3863. Miday (miday) 10 106.31 118.04 4 40.00
3864. Tony 🐱👤 (demon0192) 43 106.30 128.51 23 53.49
3865. bub (bubmaley) 742 106.29 138.33 333 44.88
3866. Amos (amosbird) 1 106.29 106.29 1 100.00
3867. Brad (beardedbradtv) 7 106.28 116.52 7 100.00
3868. No (yygt777) 1 106.28 106.28 0 0.00
3869. Julie (juliehuynh654252) 1 106.28 106.28 1 100.00
3870. dtn (dvdn) 11 106.28 117.93 6 54.55
3871. Tay (quiettoonix) 1 106.27 106.27 0 0.00
3872. Joaquin (zevolish) 86 106.27 129.98 45 52.33
3873. Leonshekre (leonshekre) 2 106.26 110.19 1 50.00
3874. iAmMichael (iammichael) 4 106.26 121.56 1 25.00
3875. Asharab (8krinkels) 5 106.25 119.79 1 20.00
3876. Lawrence (imetsia) 19 106.25 116.13 8 42.11
3877. JimDeezy (jimdeezy) 35 106.25 145.37 14 40.00
3878. Apol (apolmiguel) 6 106.24 114.02 3 50.00
3879. Ako ay (walangpera) 57 106.23 128.27 18 31.58
3880. Alasdair (aisaem) 31 106.23 121.14 15 48.39
3881. Katie (kat41911) 8 106.23 117.39 7 87.50
3882. Chetan (ch374n) 192 106.22 136.03 85 44.27
3883. Dzlandis (dzlandis) 18 106.22 138.61 15 83.33
3884. Squill (squill098) 2 106.22 108.85 2 100.00
3885. Darren (darrentheboi) 61 106.21 130.61 24 39.34
3886. Ammar (ammarthetyper) 21 106.19 120.25 9 42.86
3887. Ethan (redmac135) 4 106.18 112.63 2 50.00
3888. Siming (simingrox) 1 106.18 106.18 1 100.00
3889. Jayden (y4nrui) 27 106.17 125.97 14 51.85
3890. Warren (craggles) 5 106.17 113.41 5 100.00
3891. Jarco (jarcokers2) 2 106.16 108.11 0 0.00
3892. Avery (avidavi) 18 106.16 125.54 6 33.33
3893. Jimmy (jimmmy193) 151 106.15 145.66 67 44.37
3894. Adi (ech0star) 6 106.15 118.12 0 0.00
3895. 원숭이 (dweaji) 257 106.15 131.30 116 45.14
3896. gab (ggzl1998) 128 106.15 128.38 72 56.25
3897. Krisu (krisu_the_legend) 1 106.15 106.15 0 0.00
3898. Stratos (ztratos) 2 106.15 111.27 1 50.00
3899. Nathan (pimpleton) 9 106.14 127.60 2 22.22
3900. Noah (noahlee) 3 106.14 111.98 1 33.33
3901. Allen (xs_ageart) 239 106.14 131.82 109 45.61
3902. ballentine (drinkitup) 40 106.14 130.07 24 60.00
3903. Joseph (jsph273) 38 106.14 124.34 21 55.26
3904. han (vapour_) 10 106.13 116.04 5 50.00
3905. engie (edrian_a) 9 106.12 126.44 3 33.33
3906. Kyle (mydoricon) 3 106.12 115.60 2 66.67
3907. Terairk (terairk) 26 106.12 121.79 2 7.69
3908. rachel (clxudyss) 4 106.12 121.78 2 50.00
3909. Chrys (kenielf) 2 106.12 112.58 1 50.00
3910. Trey (pgneal3) 1 106.11 106.11 1 100.00
3911. sofL (colemak_is_poggers) 6 106.11 113.25 3 50.00
3912. Alex (eu_dk) 1 106.10 106.10 1 100.00
3913. Afker (oryginalnyitsme) 3 106.09 114.87 2 66.67
3914. Willow (the_kirin_master) 7 106.09 132.64 6 85.71
3915. Cole (cmrrockstar85) 9 106.09 121.38 5 55.56
3916. rycechckn (ultimategammer) 16 106.09 120.29 10 62.50
3917. cecilia (plumerias) 5 106.08 119.79 3 60.00
3918. Joze (el_lobe) 41 106.08 127.65 18 43.90
3919. hehe (blazeclash) 68 106.08 130.40 29 42.65
3920. Zeke (zekedroid) 4 106.07 114.33 1 25.00
3921. Darren (meodaze) 27 106.07 122.82 16 59.26
3922. Piplup (caitcat) 4 106.06 121.62 3 75.00
3923. Meme Page (butsuky) 15 106.06 117.46 11 73.33
3924. Mr (dacookieboy) 6 106.05 116.13 4 66.67
3925. Bri (b_marli) 3 106.05 119.61 0 0.00
3926. kalski (kalski) 5 106.05 111.99 2 40.00
3927. JJ (japie4life) 8 106.05 124.82 5 62.50
3928. Ian (nelson_kempkey) 52 106.04 133.29 17 32.69
3929. ufoludek (ufoludek) 6 106.04 117.71 3 50.00
3930. Cecilio (cecilio16) 2 106.04 117.55 0 0.00
3931. LittleTub (littletub) 6 106.04 132.12 3 50.00
3932. APMAPMAPM (slowtyperbtw) 1 106.03 106.03 0 0.00
3933. Kriso (krischoo276) 6 106.03 124.11 4 66.67
3934. Ethan (thatonepear) 28 106.02 117.46 10 35.71
3935. Xavier (gshizzahs) 60 106.01 127.62 28 46.67
3936. toki_crush (boom_51) 78 105.99 128.68 46 58.97
3937. NinjR (gingerninjr) 7 105.98 115.99 1 14.29
3938. sixfalls (sixfalls) 1 105.98 105.98 1 100.00
3939. Tyler (oktherefella) 58 105.98 131.93 29 50.00
3940. barrack (mr_sandwich1871) 12 105.97 128.25 6 50.00
3941. JimBob (jasperjimbob) 538 105.97 142.13 272 50.56
3942. hi (ibadattyping) 10 105.97 121.16 2 20.00
3943. Michael (mike_racer) 6 105.96 135.79 5 83.33
3944. Darix (tf_light) 1 105.96 105.96 0 0.00
3945. Capricorn (mangosquirrel) 23 105.95 119.65 9 39.13
3946. Hải (mymomismad) 7 105.95 118.97 4 57.14
3947. Alan (alansanchez) 7 105.95 118.36 4 57.14
3948. Alex (eagles1106) 37 105.95 151.99 22 59.46
3949. Jave (killer8hyper) 411 105.94 143.49 183 44.53
3950. Habib (habibjajawie) 15 105.94 125.85 9 60.00
3951. choco (chocolateblocks) 92 105.94 146.75 45 48.91
3952. Can't (daddaaddad) 10 105.94 118.19 2 20.00
3953. Dat (mrpiggy123) 4 105.94 114.77 3 75.00
3954. Robert (glixzor) 13 105.94 115.21 5 38.46
3955. Themis (reitgg) 19 105.94 127.35 13 68.42
3956. Ren Hariren (hari623) 56 105.94 123.27 36 64.29
3957. JiGsaW (homeboy2603) 175 105.93 134.06 77 44.00
3958. Icarus (_extremely_bored) 63 105.92 127.77 20 31.75
3959. Jon (customabilities) 28 105.92 127.12 14 50.00
3960. * (ngong19) 7 105.92 125.61 1 14.29
3961. Azikiro (azikiro) 4 105.91 128.52 1 25.00
3962. frontier64 (frontier64) 4 105.91 117.38 3 75.00
3963. heartbeats (jack777) 864 105.91 145.75 366 42.36
3964. pugman (thepugpro) 119 105.91 142.64 56 47.06
3965. J (deathnoters) 4 105.90 114.60 3 75.00
3966. Gregory (gregoryshen212) 5 105.90 113.43 2 40.00
3967. Josh (hoverdoge) 22 105.89 133.96 10 45.45
3968. Vyas (vyas_123) 9 105.88 125.94 4 44.44
3969. Devin (spratty) 4 105.87 121.80 1 25.00
3970. Bruce (brucecccccc) 106 105.86 127.84 48 45.28
3971. We (aquadye) 5 105.85 120.43 3 60.00
3972. 🍁 (kaspars) 8 105.85 120.86 4 50.00
3973. Tsuki (akirisakura) 1 105.84 105.84 1 100.00
3974. Jacob (monkeybenq) 35 105.83 129.58 18 51.43
3975. bassoon (bassoon_38) 5 105.83 118.57 4 80.00
3976. Corey (corkster) 2 105.82 109.56 2 100.00
3977. Khaled (kerolyte) 1 105.82 105.82 0 0.00
3978. Arthur (arturopakastur) 36 105.82 120.88 14 38.89
3979. Lee (tec001) 2 105.81 124.51 1 50.00
3980. RJ (lufulu) 15 105.81 130.68 8 53.33
3981. Andree (ntuanson97) 141 105.81 127.04 71 50.35
3982. Amethyst (artesoscuras) 6 105.80 125.62 3 50.00
3983. Kyle (kthom925) 2 105.79 114.11 1 50.00
3984. Pyrouge (pyrouge) 7 105.79 117.22 5 71.43
3985. Bartek (batek_kierownik) 83 105.79 143.15 47 56.63
3986. Egyptian (egyptianlion) 12 105.79 114.46 7 58.33
3987. kax (nobodyl0vesme) 2 105.79 110.55 1 50.00
3988. Jard (dogspa) 33 105.78 122.95 17 51.52
3989. Cole (coleb117) 17 105.78 114.90 0 0.00
3990. Vengence99 (vengence99) 4 105.78 119.00 2 50.00
3991. Dan (radio_falcon) 53 105.77 128.97 24 45.28
3992. Rahmen (rahmennoodles) 11 105.77 136.93 6 54.55
3993. sk (skkk) 20 105.77 116.94 6 30.00
3994. jr (lukrix) 1 105.76 105.76 1 100.00
3995. Not telling (kevinveinein) 10 105.76 120.63 3 30.00
3996. Vinz (hexxel7) 17 105.75 115.95 8 47.06
3997. Jack (jackthetyper) 3 105.75 114.59 1 33.33
3998. Spencer (soliloquial) 4 105.75 113.36 1 25.00
3999. tgb524 (_yuno) 35 105.75 128.14 18 51.43
4000. trans rights 🏳️⚧️ ... 4 105.74 114.34 2 50.00
4001. Ryoma (ryomak) 2 105.74 112.90 1 50.00
4002. Ludicrous (ludicrouslevo) 1 105.74 105.74 1 100.00
4003. mickey (c2sulli) 17 105.74 116.05 9 52.94
4004. Joe (edwardstewart69) 108 105.73 153.37 43 39.81
4005. Eli (uvafan) 21 105.73 123.51 11 52.38
4006. LDVBC (alexouou136) 18 105.73 130.03 9 50.00
4007. Alex (sunzu432) 1 105.72 105.72 0 0.00
4008. Kriime (kriime) 1 105.72 105.72 1 100.00
4009. hello :) (heyimalexsmileyface) 131 105.71 134.81 51 38.93
4010. Hexishu (hexishu) 17 105.70 119.66 17 100.00
4011. Ivan (ivanplaystr) 30 105.69 116.85 16 53.33
4012. Ele (anemoia) 15 105.68 119.62 5 33.33
4013. d (dafeiji) 18 105.68 132.57 8 44.44
4014. Buo YU (koh100) 7 105.68 117.30 4 57.14
4015. Lilly (lilly713) 11 105.68 122.20 6 54.55
4016. SeniorMomo (seniormomo) 17 105.68 131.57 8 47.06
4017. oivee (oivee) 3 105.68 121.41 3 100.00
4018. Isaac (newtion) 2 105.68 110.40 1 50.00
4019. Thomas (tammis) 78 105.67 121.13 39 50.00
4020. tnn21 (tnn21) 30 105.67 140.90 8 26.67
4021. Pannz (pannz) 1 105.67 105.67 1 100.00
4022. Benjamin (bnje1) 97 105.67 139.94 41 42.27
4023. Daniel (danielnmr) 6 105.67 123.79 6 100.00
4024. 📵 (sstormwolf22) 12 105.66 123.30 2 16.67
4025. NoobMaster (anakwibu04) 53 105.66 121.57 36 67.92
4026. Ethan (ecannoy) 15 105.65 115.28 8 53.33
4027. TakeASui (kevinsui) 2 105.65 115.16 2 100.00
4028. Jake (lakejund) 14 105.65 126.08 6 42.86
4029. TOP (man_stop) 11 105.64 115.68 5 45.45
4030. Lux (lux_winters) 35 105.64 127.96 23 65.71
4031. Alex (headadmiral) 4 105.64 110.87 3 75.00
4032. Nolwen (neb0003) 1 105.63 105.63 0 0.00
4033. h (kenthios) 7 105.62 122.29 2 28.57
4034. Brandon (ivantt) 17 105.62 125.86 9 52.94
4035. edot (speedymandan) 2 105.62 106.46 2 100.00
4036. Mo (mrmo) 6 105.61 125.74 5 83.33
4037. AR4444 (ar4444) 5 105.60 123.72 2 40.00
4038. Marcus (marcusmandarin) 59 105.60 132.55 29 49.15
4039. wunyan (wunyannie) 79 105.59 128.12 31 39.24
4040. derdier (derdier) 3 105.59 117.93 2 66.67
4041. enrique (fugitivecloud) 20 105.59 121.62 9 45.00
4042. avalanche (drsnuffulupacis) 2 105.59 108.73 2 100.00
4043. Adam RIP Byron (kurfew) 7 105.58 111.22 2 28.57
4044. Laziness (karinoshuka) 3 105.58 108.73 2 66.67
4045. Justin (iukekini) 12 105.57 115.53 6 50.00
4046. EINSWOOD (solaire119) 3 105.57 113.22 1 33.33
4047. Pog (fooooood) 11 105.56 136.14 6 54.55
4048. Alexander (olekpark) 61 105.56 124.46 26 42.62
4049. Nafre (nafre) 18 105.55 118.92 10 55.56
4050. over_loadcode (over_loadcode) 1 105.55 105.55 1 100.00
4051. Niamh (crystalniamh) 115 105.55 135.83 41 35.65
4052. Jai (jaideepjr) 50 105.54 122.79 16 32.00
4053. Eric (qwarts) 230 105.53 138.65 83 36.09
4054. William (caraxd) 12 105.53 118.93 6 50.00
4055. luke (lukehaoshuai) 5 105.53 119.11 1 20.00
4056. Russian (russianemu27) 316 105.53 141.66 130 41.14
4057. MINH (shinmyou) 439 105.52 137.03 189 43.05
4058. kenboi (_kenboi) 3 105.52 117.50 2 66.67
4059. Carl (cbho73) 9 105.52 112.55 2 22.22
4060. logicism (logicism) 40 105.52 123.76 17 42.50
4061. Lynn (skebi) 2 105.52 111.99 2 100.00
4062. Yuhang (yuhang0722) 210 105.51 137.06 96 45.71
4063. Alex (alexkylelee) 44 105.51 138.04 22 50.00
4064. Pog (randomguy2005) 5 105.51 117.55 3 60.00
4065. Daniel (dantheman0509) 1 105.51 105.51 1 100.00
4066. Emily (octopanda4) 3 105.51 110.44 2 66.67
4067. Martin (codetheidiot) 4 105.51 116.06 2 50.00
4068. Nour (nourxcx) 135 105.50 135.10 66 48.89
4069. Jord (skaterjord) 5 105.50 115.03 0 0.00
4070. e00d (e00d) 90 105.49 135.41 47 52.22
4071. ndr2 (ndr2) 300 105.49 128.13 131 43.67
4072. Slerpasaur (bagasfirdaus) 1 105.48 105.48 1 100.00
4073. J (jacktwamb52) 35 105.48 120.56 12 34.29
4074. zach (zacaroniandcheese) 4 105.48 134.06 3 75.00
4075. Luke (laaa) 11 105.47 114.56 4 36.36
4076. Eric (aerran) 10 105.47 113.92 8 80.00
4077. Khoi Nguyen (vukhoinguyen8492) 19 105.47 117.36 8 42.11
4078. Martin (martafiixek) 1 105.47 105.47 1 100.00
4079. Ty (_pj1) 2 105.47 109.27 0 0.00
4080. Brandon (bandantran) 24 105.46 128.80 12 50.00
4081. carlos (mecsczek) 22 105.46 117.89 11 50.00
4082. melau (melau) 10 105.46 125.84 5 50.00
4083. AJ (bsptc) 8 105.46 117.64 5 62.50
4084. Korey (yellowdozer) 9 105.45 116.58 2 22.22
4085. Sander (cubit33) 2 105.45 107.20 2 100.00
4086. Robby (robstersgaming) 4 105.45 112.50 3 75.00
4087. Jimmy (zen529) 488 105.44 138.04 408 83.61
4088. Stadics (stadics) 5 105.44 116.78 1 20.00
4089. Conner (jabronee) 7 105.43 111.55 1 14.29
4090. 9fingerstyle (readjust) 66 105.43 126.68 31 46.97
4091. Avery (purplat) 134 105.43 141.72 49 36.57
4092. Seymour (heroofnow) 6 105.43 111.24 4 66.67
4093. Ross (trickydick6) 101 105.42 135.11 37 36.63
4094. Matt (misterc) 13 105.42 121.12 5 38.46
4095. zakilegs (mulgor) 1 105.42 105.42 0 0.00
4096. (erny2) 9 105.42 115.30 5 55.56
4097. Rafa (farmahorro) 7 105.41 119.43 2 28.57
4098. Joseph (joegoldman) 12 105.40 115.18 8 66.67
4099. Adam (adamjason804) 1,719 105.40 151.08 744 43.28
4100. Arturo (skikdo) 3 105.40 123.83 1 33.33
4101. deep (lamborghene) 183 105.40 143.67 88 48.09
4102. yah-yeet (dingdong768) 122 105.40 125.98 58 47.54
4103. Dylan Smith (dylanfromwinni... 7 105.39 119.66 4 57.14
4104. alex (aj25) 2 105.38 105.87 0 0.00
4105. Jayden (jripic137) 86 105.38 123.23 57 66.28
4106. Tom (i_hate_yext) 5 105.38 132.02 3 60.00
4107. epigee (epigee) 49 105.37 128.88 17 34.69
4108. Andreas (addekallstrom) 1 105.37 105.37 0 0.00
4109. Nate (hoopstrings) 21 105.36 118.88 9 42.86
4110. 1,3,7-Trimethylpurine-2,6-d... 1 105.36 105.36 0 0.00
4111. Eequla (quintaboy) 10 105.36 120.60 4 40.00
4112. Seneca (senecamanu) 3 105.35 112.14 3 100.00
4113. Gooby (goobytheturtle) 1 105.35 105.35 1 100.00
4114. bioboy246 (bioboy246) 51 105.35 131.73 23 45.10
4115. Zajd (zajd36) 7 105.34 114.52 3 42.86
4116. Adam (sticknleaf) 54 105.34 129.21 28 51.85
4117. Animal (animalracional) 10 105.33 114.54 2 20.00
4118. Supersonic Omar (omarthefast) 3 105.33 114.81 0 0.00
4119. DisclosedVector (disclosed_... 1 105.32 105.32 1 100.00
4120. themommajeans (spammaam) 103 105.31 139.84 50 48.54
4121. SpicyAsianBoy (spicyasianboy) 1 105.31 105.31 0 0.00
4122. Alex (magictrick) 4 105.31 106.96 1 25.00
4123. ⚡DVORAK (dvorak_mg) 229 105.31 139.59 107 46.72
4124. Pog (deftst) 6 105.30 145.78 1 16.67
4125. Tanuj (tanuj23) 9 105.30 114.20 4 44.44
4126. Rachel (rachel85881) 32 105.30 118.79 21 65.63
4127. Samantha (sam7597) 6 105.30 116.96 4 66.67
4128. David (slezterp) 2 105.30 139.13 1 50.00
4129. Axel (setomi) 6 105.30 117.24 4 66.67
4130. Joel (easynoob) 62 105.29 124.13 22 35.48
4131. djagof (zuccandsucc) 235 105.29 134.07 149 63.40
4132. Michael (mickyyyr) 3 105.28 114.14 0 0.00
4133. BigPoopBoy (posit1v3) 1 105.27 105.27 1 100.00
4134. Julian (inferno2332) 10 105.27 132.41 8 80.00
4135. tstats[sinkingecstasies] (s... 28 105.27 128.78 10 35.71
4136. hplr (rkg0612) 10 105.27 119.21 3 30.00
4137. FIGBERT (figbert) 4 105.27 110.69 4 100.00
4138. Reason (reasonspecter) 5 105.27 116.74 3 60.00
4139. PianOreo (thunderoreoz) 7 105.25 122.36 6 85.71
4140. Z (tiredtyper) 2 105.25 113.80 2 100.00
4141. Alexa (alexa72) 14 105.24 126.98 6 42.86
4142. w (speeder_skrr) 3 105.24 119.81 1 33.33
4143. Mikhail (maklaya) 8 105.23 117.24 6 75.00
4144. Brian (eeyjnairb) 20 105.23 119.26 8 40.00
4145. Reuben (reureu) 4 105.22 121.43 1 25.00
4146. Bruno (tresco) 86 105.21 143.04 33 38.37
4147. Lorum (rexicide) 34 105.21 136.33 14 41.18
4148. bronze (thebronzesword) 91 105.21 130.79 52 57.14
4149. Savitar (savitarramen) 2 105.21 107.26 0 0.00
4150. Ted (macfan) 18 105.20 115.53 9 50.00
4151. Gmorcad (gmorcad) 189 105.20 134.39 85 44.97
4152. Alex (alexsun) 4 105.20 115.38 3 75.00
4153. A1MPlayz (a1mplayz) 4 105.20 118.48 4 100.00
4154. James (james702) 62 105.20 129.72 23 37.10
4155. mingw (mingw) 10 105.19 111.82 6 60.00
4156. aditya (yusifer_zendric) 276 105.19 130.38 130 47.10
4157. Finn (wildducktca) 2 105.18 109.69 2 100.00
4158. Marek (ksydry) 145 105.17 126.62 59 40.69
4159. Wuchereria (wuchereria) 34 105.17 121.56 19 55.88
4160. Justin (justinpatrick1011) 1 105.17 105.17 0 0.00
4161. J (leunidus) 300 105.17 130.86 115 38.33
4162. Shania (localhinatakinnie) 8 105.16 120.81 4 50.00
4163. Jamx (jamxjam) 1 105.16 105.16 1 100.00
4164. donkey (_donkey) 1 105.16 105.16 1 100.00
4165. Steven (shb123) 5 105.15 135.54 3 60.00
4166. Will (willist) 5 105.15 117.52 3 60.00
4167. liu (liuluil) 8 105.15 114.58 6 75.00
4168. Jonhan (jonhan) 6 105.15 115.22 6 100.00
4169. shootagain (shootadiditagain) 5 105.15 118.72 0 0.00
4170. sdf (delta23) 88 105.14 132.70 42 47.73
4171. oskar (osny19) 43 105.14 123.12 18 41.86
4172. Kendall (skeletonsinc) 26 105.14 123.79 13 50.00
4173. Jonathan (ilaghardcore) 154 105.13 134.02 70 45.45
4174. Vandy (desmaid) 34 105.13 124.53 18 52.94
4175. Gabriel (caluya) 1 105.13 105.13 1 100.00
4176. Guest (__guest_) 3 105.13 120.28 1 33.33
4177. Will (wsger) 1 105.13 105.13 1 100.00
4178. M5 (mariahendrikx) 24 105.13 129.64 10 41.67
4179. fat ape (miltox) 2 105.13 113.06 2 100.00
4180. JAWN (johnsusername) 4 105.13 110.92 2 50.00
4181. Josh (joshybigmac) 1 105.12 105.12 1 100.00
4182. Alex (athensguy) 2 105.12 110.55 1 50.00
4183. Shlock (shlockington) 38 105.12 124.56 19 50.00
4184. wilson ;~; (aaahrgrhh) 109 105.12 135.22 44 40.37
4185. yoy (joy000) 6 105.11 135.00 1 16.67
4186. Hmm (sironronron) 20 105.10 123.82 11 55.00
4187. Shaun (shaunjohnathon) 1 105.10 105.10 1 100.00
4188. cringer (typecringe) 35 105.10 120.44 14 40.00
4189. Leo (yasuomaster) 6 105.10 114.93 3 50.00
4190. kent (zxcvbnmqwertyuiopasdf... 5 105.09 123.29 4 80.00
4191. nikax (nixa202) 13 105.09 118.07 5 38.46
4192. Robert (bonsai_aus) 19 105.08 132.89 7 36.84
4193. Steven (stevensenjaya8) 1 105.08 105.08 0 0.00
4194. blob_mister (blob_mister) 25 105.08 122.74 9 36.00
4195. User (redytedy) 3 105.07 109.56 2 66.67
4196. how? (haotingz) 118 105.06 129.65 57 48.31
4197. Mike (jewunit) 16 105.06 131.60 4 25.00
4198. Alessandro (asterlr) 53 105.06 130.77 13 24.53
4199. Miranite (Dvorak) (miranite) 9 105.06 125.42 9 100.00
4200. Kanye (pangoliar) 3 105.06 109.53 0 0.00
4201. jA_eur0 (ja_eur0) 7 105.05 119.46 4 57.14
4202. Bensie (bensie1) 17 105.05 124.32 14 82.35
4203. EmiRoseMoore (emirosemoore) 3 105.05 128.67 2 66.67
4204. N o y b (jet1k) 40 105.04 120.75 19 47.50
4205. Rides (rides1283man) 4 105.04 136.43 4 100.00
4206. Tommy (snoopyisop) 50 105.03 148.25 21 42.00
4207. m0nsteR (m0nsta321) 200 105.03 128.90 98 49.00
4208. Aris! (pazturized) 2 105.02 109.66 1 50.00
4209. Joel (joel6677) 1,103 105.01 138.08 490 44.42
4210. Hachikachi (hachikachi) 33 105.01 123.28 18 54.55
4211. chachasoba (chachasoba) 192 104.99 126.14 101 52.60
4212. ArchiveAnon (archiveanon) 3 104.99 113.84 2 66.67
4213. Alex (extreme360) 6 104.99 113.76 3 50.00
4214. Dylan (dkonquerer) 14 104.98 118.53 2 14.29
4215. Adrian (whyisthisnotavailable) 42 104.98 135.56 26 61.90
4216. santol (santol69) 6 104.98 120.03 4 66.67
4217. andrew (weirdna) 1 104.98 104.98 0 0.00
4218. WELOVELAIN (suzuyajuuzou) 191 104.98 133.70 82 42.93
4219. Hi (coarse) 3 104.98 106.54 3 100.00
4220. kym (kym2006) 15 104.97 123.81 12 80.00
4221. Amanda (pluufi) 39 104.97 125.56 34 87.18
4222. xena (scogx3281) 316 104.97 135.36 123 38.92
4223. Jason (cathayjason) 9 104.97 115.34 6 66.67
4224. coal_town (cat_guy) 4 104.97 111.25 3 75.00
4225. Marc (mwahab_) 78 104.96 137.18 39 50.00
4226. Soulhae (soulhae) 2 104.96 122.30 0 0.00
4227. Fickle (mongolo123) 9 104.96 119.91 2 22.22
4228. Typing is fun!!! (hebibuki) 1,096 104.96 142.13 454 41.42
4229. Shenen (shenenjump) 37 104.95 122.65 20 54.05
4230. Sheen (sheendinner) 3 104.95 112.43 3 100.00
4231. Edwin (edweezy) 16 104.95 120.12 4 25.00
4232. Jonatan (gustesmil) 451 104.95 148.46 198 43.90
4233. Nate (nate11) 7 104.95 113.94 3 42.86
4234. Kenneth (omgkenken) 10 104.95 121.10 5 50.00
4235. Tom (demarini) 10 104.95 117.71 4 40.00
4236. Klog (klog53) 12 104.94 122.64 5 41.67
4237. Nathan (mrsodacan) 4 104.94 113.01 4 100.00
4238. Alnoor (snowkoan) 5 104.94 112.51 2 40.00
4239. vice versa (no_dice) 6 104.94 135.54 3 50.00
4240. Michael (meta1) 65 104.94 135.65 28 43.08
4241. Matthew (crucifix13) 7 104.92 116.16 3 42.86
4242. Arthur (ajdem) 59 104.92 125.03 29 49.15
4243. bruh (erik2405_) 8 104.92 115.21 6 75.00
4244. Tacos (tacosforthem) 2 104.91 106.34 2 100.00
4245. holymoly (kajohnny) 8 104.91 112.68 5 62.50
4246. Jairel (jairel) 5 104.89 107.60 2 40.00
4247. Danillo (60ppm) 13 104.89 118.71 4 30.77
4248. Natte (nattel) 1 104.89 104.89 1 100.00
4249. Petit (petitjuju) 8 104.89 126.64 3 37.50
4250. 1step (narcindin) 42 104.88 130.93 14 33.33
4251. Nic (scylla1) 66 104.88 129.69 30 45.45
4252. ydem2nir9tag (ydem2nir9tag) 153 104.87 132.43 75 49.02
4253. tstats[daball] (daball) 14 104.87 127.48 6 42.86
4254. ProGamerXDFTW (progamerxdftw) 2 104.85 125.47 2 100.00
4255. Pikshu (pikashu02) 1 104.85 104.85 1 100.00
4256. Brennen (you_arent_my_type) 1 104.85 104.85 0 0.00
4257. Andrew (dewdew7) 5 104.85 113.22 3 60.00
4258. samantha (whalieninluv) 9 104.84 112.79 6 66.67
4259. Moatasem (idolzy_123) 12 104.84 119.14 5 41.67
4260. A (aa1729) 2 104.84 108.88 0 0.00
4261. Baush (baush) 2 104.83 109.21 1 50.00
4262. Tom (noviamagna) 17 104.82 123.16 5 29.41
4263. mani (bigmeat_) 92 104.82 140.49 48 52.17
4264. Saul (old_grandma) 11 104.81 124.11 4 36.36
4265. Francesca (francesca34369) 4 104.81 112.33 4 100.00
4266. Jesper (dwingx) 84 104.79 136.37 28 33.33
4267. 𝔽₃₁ (2802) 51 104.78 124.05 30 58.82
4268. Kenneth (godfetus) 13 104.78 117.83 6 46.15
4269. Nisse (nissevex) 5 104.77 115.23 1 20.00
4270. Kurt (thydark) 33 104.77 124.55 19 57.58
4271. Agnes-Joker (guitarbed) 80 104.77 130.99 44 55.00
4272. reeeeeee (________e________) 2 104.77 106.90 2 100.00
4273. Toodles (toodles678) 99 104.77 151.44 43 43.43
4274. adam (n0tracist) 19 104.77 122.42 11 57.89
4275. Richard (redjoe) 244 104.77 134.29 112 45.90
4276. Jake (aurelias) 38 104.76 128.77 12 31.58
4277. Chris (itseverydaybro) 1 104.76 104.76 1 100.00
4278. Carl (doctorkohaku) 11 104.75 118.50 4 36.36
4279. Whiffing (fxdk) 4 104.75 128.11 3 75.00
4280. Anderson (broccoliman) 1 104.74 104.74 0 0.00
4281. Steve (stevestupidface) 89 104.73 124.59 44 49.44
4282. sakhaprox (rportnoy) 485 104.72 151.12 167 34.43
4283. undeclared (undeclared) 7 104.71 130.83 6 85.71
4284. name999 (name_999) 1 104.71 104.71 1 100.00
4285. 🚀 (wildreamz) 134 104.71 114.06 46 34.33
4286. Isaiah (isaluteya) 3 104.70 105.04 1 33.33
4287. Gr0undhog_x (gr0undhog) 20 104.70 125.68 10 50.00
4288. kanacurry (kanacurry) 9 104.70 116.92 7 77.78
4289. Jimmy (jphan98) 8 104.69 120.40 2 25.00
4290. Robbie (robbietrimble) 11 104.68 134.38 6 54.55
4291. ¯\_(ツ)_/¯ (glandock1) 2,095 104.68 140.81 941 44.92
4292. PossiblyRandom (possiblyran... 8 104.68 118.50 4 50.00
4293. a (oimanquan) 398 104.68 139.10 194 48.74
4294. Mel (smelons) 8 104.67 117.57 0 0.00
4295. Round (aboutaroundabout) 54 104.67 124.39 26 48.15
4296. Weeee (k1ngsman) 15 104.67 123.31 6 40.00
4297. Lamb (sharkk) 2 104.67 107.21 1 50.00
4298. Bara (mrbobby) 8 104.67 125.01 3 37.50
4299. Vincent (vincback) 17 104.67 117.42 5 29.41
4300. deez (biggy2) 84 104.66 121.02 30 35.71
4301. Joey (rosuoammdo) 2 104.66 107.66 0 0.00
4302. Carbarrawr (carbarrawr) 2 104.66 106.27 1 50.00
4303. skippie (itsskippie) 40 104.65 123.50 21 52.50
4304. Jean (cummywummy) 2 104.65 108.30 1 50.00
4305. Bahador (ghostnod) 15 104.65 115.18 8 53.33
4306. Cody (pikachuisyellow) 4 104.64 114.93 2 50.00
4307. Faith (faithy3) 3 104.64 113.02 2 66.67
4308. 1980 (1980ops) 31 104.63 119.28 14 45.16
4309. William (williamusa) 3 104.62 114.21 1 33.33
4310. Natalie (natcard) 78 104.62 130.00 36 46.15
4311. David (irrelevantging) 2 104.62 110.58 2 100.00
4312. Zuhaib (zuhaibdam) 135 104.61 135.29 63 46.67
4313. sskhynix (sskhynix) 404 104.61 136.54 199 49.26
4314. Yellow (siunam963) 2 104.61 104.90 2 100.00
4315. SnaccAllister (mactrey) 3 104.61 109.50 3 100.00
4316. me slow (brandon69eduardo) 390 104.61 131.78 178 45.64
4317. Ryan (rmahon27) 1 104.60 104.60 0 0.00
4318. Horrendous (horrendousness) 1 104.60 104.60 1 100.00
4319. Not (not_cracked_) 20 104.60 120.01 6 30.00
4320. alaon (nahbro123) 2 104.59 113.05 1 50.00
4321. scampe (scampe) 26 104.59 119.87 16 61.54
4322. J (akntmzjtj) 47 104.59 130.52 24 51.06
4323. Anton (alejendaryguy) 33 104.58 121.95 1 3.03
4324. Huang.zy (amwzhenyu) 63 104.58 134.70 28 44.44
4325. Zev (zevaverbach) 107 104.58 146.82 51 47.66
4326. Tedward (tedward765) 4 104.58 108.01 2 50.00
4327. dane (gratedane) 2 104.58 105.52 2 100.00
4328. jrnc (intellimouseftw) 6 104.58 114.63 1 16.67
4329. KetanaBlade (ketanablade) 66 104.57 125.71 9 13.64
4330. Random (65h1000) 11 104.57 111.26 5 45.45
4331. JJ (joojoob1004) 8 104.57 121.30 4 50.00
4332. Conner (connerfitz) 3 104.56 110.31 2 66.67
4333. Brandon (cube00) 2 104.55 118.00 1 50.00
4334. patoo (jiahao8) 13 104.55 116.42 6 46.15
4335. dove (yohello11) 2 104.55 110.50 1 50.00
4336. Jeff (aeoiuf) 6 104.55 115.78 3 50.00
4337. Ozan (clutchupmate) 26 104.55 130.95 11 42.31
4338. Adam (adamfriska) 1 104.54 104.54 1 100.00
4339. GreatKing (greatking) 72 104.54 120.48 31 43.06
4340. Bartłomiej (y3v4d) 91 104.54 119.31 41 45.05
4341. Matthew (mcluzar) 19 104.53 127.32 10 52.63
4342. Bagus (asparagoes) 1 104.53 104.53 0 0.00
4343. Cylindian (cylindian) 56 104.53 123.73 21 37.50
4344. ArtyGaming (artygaming) 7 104.52 116.99 7 100.00
4345. ALostKorean (alostkorean) 39 104.52 132.05 16 41.03
4346. スレトロン (slethron) 1,371 104.52 132.69 607 44.27
4347. Jellybean (jojo00vvv) 13 104.51 121.24 6 46.15
4348. Seymour (cheapsunglasses) 5 104.51 110.68 4 80.00
4349. Nick (pletlibo) 11 104.51 128.68 7 63.64
4350. Ben (androminous) 2 104.51 104.96 0 0.00
4351. Erik (goldfrankenstein) 5 104.51 112.71 0 0.00
4352. nic (rainbowarsenal) 15 104.51 130.97 6 40.00
4353. Joshua (mrjoshy) 3 104.50 114.66 1 33.33
4354. Meade (jmkling) 1 104.50 104.50 1 100.00
4355. Cel (celad0n) 11 104.50 118.85 5 45.45
4356. Elfuun (elfuun) 6 104.50 119.63 4 66.67
4357. Elin (lileazi) 2 104.50 106.58 2 100.00
4358. Shadow (shadowkitten) 251 104.49 146.52 111 44.22
4359. superkhau (superkhau) 85 104.49 142.57 34 40.00
4360. Jay (jayssa2) 3 104.49 109.15 1 33.33
4361. jonathanirvings (jonathanir... 8 104.49 124.52 2 25.00
4362. Kerschel (asdfjklsemic0lon) 4 104.49 117.32 1 25.00
4363. TheChosenOne (askthewizard) 7 104.49 119.80 3 42.86
4364. Tristan (tristandavoulas) 3 104.48 108.52 2 66.67
4365. Michael (mrgryph0n) 10 104.48 114.33 2 20.00
4366. Hai Dang (c0smological) 2 104.48 105.61 2 100.00
4367. Aidan (aidanpr) 4 104.48 114.11 1 25.00
4368. Bryan (iduhowpeopledo150wpm) 147 104.47 128.20 62 42.18
4369. LionMane (lion_mane_jellyfish) 7 104.46 122.17 3 42.86
4370. Parker (tsayp) 3 104.45 116.60 3 100.00
4371. Reece (iifuze) 9 104.45 122.73 4 44.44
4372. Kurtis (sauceypubes) 11 104.45 123.40 4 36.36
4373. okyescool (lc0291) 4 104.45 120.81 3 75.00
4374. a (coolguy73) 22 104.45 124.54 19 86.36
4375. anhar (_anhar) 141 104.45 127.91 51 36.17
4376. Steven (stoveoveoven) 2 104.45 112.81 1 50.00
4377. Vikram (vikram031) 13 104.44 120.78 5 38.46
4378. Bonzi (bonzibuddy420) 37 104.44 148.88 15 40.54
4379. Mr. (stealthykoalaber) 18 104.44 125.68 7 38.89
4380. jan Mase (brasidas422) 18 104.44 114.84 7 38.89
4381. Nick (escalt) 9 104.43 125.88 6 66.67
4382. Nick (potatoshavings) 10 104.43 131.26 9 90.00
4383. (royaljaat) 450 104.43 145.45 285 63.33
4384. david (mrriceeater) 14 104.43 123.95 5 35.71
4385. Vanessa (v4nv4n) 17 104.42 123.82 9 52.94
4386. Joey (jj4ster) 10 104.42 129.76 6 60.00
4387. Noah (hvon) 42 104.42 125.19 19 45.24
4388. Sebastian (sev___) 49 104.42 136.40 20 40.82
4389. Ian (s0ft3n) 324 104.42 138.84 143 44.14
4390. A (dicktucker) 1,371 104.41 137.52 621 45.30
4391. yes (easytoremember1) 17 104.41 116.65 3 17.65
4392. Dhayanandh (ken_adams) 231 104.41 121.91 91 39.39
4393. sub2 (kevlu8) 2 104.41 108.70 1 50.00
4394. David (dtowers) 1 104.39 104.39 0 0.00
4395. Say My Name (notreallyasteve) 25 104.38 138.14 10 40.00
4396. Nathan (nparque03) 1 104.38 104.38 1 100.00
4397. tomtom (tomtomm) 3 104.38 124.57 1 33.33
4398. Rionil (holyshock) 8 104.38 134.83 5 62.50
4399. Bruh (bruh432) 15 104.37 117.80 9 60.00
4400. Justin (nutmeg_0) 1 104.37 104.37 1 100.00
4401. Aaron (nightcreators) 43 104.37 127.86 16 37.21
4402. Maynard (mftrumpet) 54 104.36 133.63 27 50.00
4403. Brandon (bardnon) 6 104.36 108.60 4 66.67
4404. TheAcc (use_r_name) 1 104.36 104.36 1 100.00
4405. Ket (ket93) 6 104.35 118.67 5 83.33
4406. N (nitruo) 1 104.35 104.35 0 0.00
4407. William (michaelp_2222) 53 104.34 129.28 29 54.72
4408. Svan (svanstedt) 1 104.34 104.34 0 0.00
4409. JS (shadyshadez) 30 104.34 122.15 14 46.67
4410. Empress Irisu (empress_irisu) 18 104.34 124.87 8 44.44
4411. glenn (glenneroo) 9 104.33 119.98 7 77.78
4412. Job (job007) 49 104.33 122.28 22 44.90
4413. MNM (mnmnour) 297 104.33 128.37 135 45.45
4414. tstats[kafuu] (kafuu) 37 104.33 140.60 20 54.05
4415. Lydia (shiruzu) 253 104.32 123.05 96 37.94
4416. Wint3rr (wint3r) 1 104.32 104.32 0 0.00
4417. deckard (hell_bovine) 7 104.32 112.37 4 57.14
4418. Luis (duelistone) 62 104.32 122.92 31 50.00
4419. Kevslinger (kevslinger) 4 104.32 109.90 2 50.00
4420. Joshua (jellyjosh) 2 104.32 112.36 2 100.00
4421. 1myvar (chowchunfu) 30 104.31 121.99 15 50.00
4422. The Doofus (chalkshortage) 2 104.31 112.98 2 100.00
4423. good (elquines4) 15 104.31 127.97 7 46.67
4424. Jakab (schttj) 311 104.31 140.58 128 41.16
4425. Ben (mister_ghillie) 4 104.30 115.74 1 25.00
4426. Zak (7zephyr) 11 104.30 117.19 6 54.55
4427. Agustin (agusvelisone) 1 104.29 104.29 1 100.00
4428. Scotty (scoma) 9 104.29 124.69 2 22.22
4429. dox (bloxyshark) 3 104.29 109.11 3 100.00
4430. Wellington (happydonut) 10 104.28 134.45 5 50.00
4431. Arjun (arjun_0004) 25 104.28 116.76 11 44.00
4432. Roberto (mrgarri) 5 104.28 111.80 4 80.00
4433. cdolivera (cdolivera) 5 104.28 114.02 2 40.00
4434. Willie (williecubed) 12 104.27 116.34 4 33.33
4435. Wouter (victorylion97) 3 104.25 105.75 0 0.00
4436. code_brains (coderider) 194 104.25 138.57 92 47.42
4437. timgan (timgan) 117 104.24 126.95 51 43.59
4438. bruh_momentum (travis358) 225 104.24 126.13 112 49.78
4439. Tyler (yppah) 34 104.24 117.27 18 52.94
4440. kyle (kylesch) 39 104.23 115.48 13 33.33
4441. Alex (alextamago) 21 104.23 125.63 7 33.33
4442. SmiIe (smiie) 16 104.22 115.28 6 37.50
4443. ☺ AASHRU... (Business Ana... 4 104.22 110.02 2 50.00
4444. M (cymiyabe) 1 104.22 104.22 0 0.00
4445. Borky (beckysingasong) 11 104.20 122.71 6 54.55
4446. 18K.ca (hunterwoodchase) 321 104.20 131.33 134 41.74
4447. Time (yaboiiiwill) 8 104.20 111.59 3 37.50
4448. Melvin (melvinhedman) 1 104.20 104.20 0 0.00
4449. Maestro (meessus) 23 104.19 131.62 20 86.96
4450. Royce (royck) 3 104.19 108.59 1 33.33
4451. Hana (hanatf2) 11 104.18 118.41 4 36.36
4452. a1ways (pi___) 22 104.18 127.50 9 40.91
4453. 👺 Rina (rina23) 344 104.18 154.58 177 51.45
4454. Sheckla (sheckla) 6 104.18 116.77 4 66.67
4455. iAmPardi (iampardi) 20 104.16 123.76 11 55.00
4456. তন্ময়_2 (better_t... 1,349 104.16 139.74 635 47.07
4457. AHEN (henneberg) 32 104.15 138.74 12 37.50
4458. Xavier (plourde27) 5 104.15 118.21 3 60.00
4459. pingu (slowpokeboy) 13 104.14 122.03 5 38.46
4460. Ron (thtguyovrthr) 14 104.14 115.39 7 50.00
4461. Shan (debayon4545) 30 104.14 139.38 16 53.33
4462. Ankur (ankurgoel) 2 104.14 114.51 2 100.00
4463. nathan (nathanfrenzel) 8 104.14 123.72 5 62.50
4464. Bog (bogjip) 2 104.13 110.13 0 0.00
4465. Rahil (rahilu14) 7 104.13 118.09 6 85.71
4466. bk (thebriankwon) 3 104.12 114.85 0 0.00
4467. Poch (eezoink) 2 104.12 119.76 2 100.00
4468. David (davylern) 8 104.12 114.36 5 62.50
4469. Max (max_adagio) 10 104.11 121.32 1 10.00
4470. FSH (kevm8888) 3 104.10 106.87 0 0.00
4471. m (flashyyy) 13 104.09 123.15 13 100.00
4472. Steve (xenoxinius) 7 104.09 114.56 5 71.43
4473. P (skoop8) 13 104.09 117.68 7 53.85
4474. Invictus (drokovian) 2 104.08 110.32 1 50.00
4475. Moshmello (moshmello) 4 104.08 111.39 3 75.00
4476. Peter (akr0nik) 7 104.07 115.23 6 85.71
4477. Hamza π (hamzza_) 129 104.07 125.08 55 42.64
4478. Peter (minend) 12 104.07 127.43 9 75.00
4479. LB (man_onatree) 708 104.07 139.93 324 45.76
4480. junior (sukachik3n) 6 104.07 113.46 1 16.67
4481. Justin (1mmure) 4 104.05 109.64 3 75.00
4482. garbyal ✌(-‿-)✌ (garb... 10 104.05 115.62 7 70.00
4483. JoaoPauluu (joaopauluu) 93 104.05 137.39 50 53.76
4484. dude_BrahMan (dudebrahman) 69 104.05 131.45 36 52.17
4485. Pablo (pablurp) 16 104.04 133.30 10 62.50
4486. Brian (brianyounq) 46 104.03 126.73 22 47.83
4487. Andrej (tunas1337) 8 104.03 120.00 4 50.00
4488. kailh pinks (mrdooks) 11 104.03 132.76 8 72.73
4489. henry 🎩 (henzolo) 8 104.03 110.87 3 37.50
4490. Ton (2001or2) 2,023 104.03 147.28 905 44.74
4491. D (ducktypist) 12 104.02 116.06 5 41.67
4492. Ahri (strylas) 9 104.01 125.85 4 44.44
4493. StickInMyButt (chungi) 12 104.01 116.08 5 41.67
4494. Granted (granted8) 4 104.00 112.96 1 25.00
4495. Project (project_racer) 9 103.99 121.45 6 66.67
4496. Michael (1851917) 1 103.99 103.99 0 0.00
4497. Joerg (jabra11) 16 103.99 115.17 5 31.25
4498. Bray (erasleeps) 68 103.98 136.28 34 50.00
4499. Blastoise (blastoise24) 3 103.98 112.54 1 33.33
4500. JQuez (jquez) 7 103.98 115.87 5 71.43
4501. ♛ Nick... 8 103.98 118.18 3 37.50
4502. RiceBOI111 (riceboi111) 15 103.98 128.26 9 60.00
4503. tommy (err0reverafter) 28 103.97 122.15 16 57.14
4504. kuino, (kuino) 9 103.97 124.18 9 100.00
4505. Nate (nateog) 54 103.97 134.72 23 42.59
4506. CiscoAdmin (kaszanka12) 3 103.96 107.70 1 33.33
4507. ivanchrome (watonearth) 15 103.96 119.73 7 46.67
4508. MusicSounds (musicsounds) 15 103.96 125.62 5 33.33
4509. Meagan (gazzoo) 15 103.96 129.02 8 53.33
4510. daneil (piggasauwus) 5 103.95 114.56 4 80.00
4511. Anthony (duragsensei) 13 103.93 117.66 6 46.15
4512. Jeffrey (sorisque) 3 103.93 106.67 0 0.00
4513. cal (achildslaughter) 53 103.93 127.60 20 37.74
4514. Tu (anhtu96) 7 103.93 122.11 2 28.57
4515. ._. (remiiix) 1 103.92 103.92 1 100.00
4516. yuh (yuhyeetyaw) 78 103.92 130.74 33 42.31
4517. David (d4v1dh) 150 103.91 131.43 62 41.33
4518. Sorton101 (sorton101) 2 103.91 112.03 0 0.00
4519. Free Palestine (rollno14) 11 103.90 125.89 4 36.36
4520. Sasuke (yosasuke) 7 103.89 120.84 4 57.14
4521. Taco (tacobandit) 40 103.89 125.83 12 30.00
4522. w (artemisfowl3rd) 22 103.89 130.94 11 50.00
4523. Fred (raijinpanda) 8 103.88 114.91 5 62.50
4524. Jack (giglioroninomicon) 30 103.88 126.94 10 33.33
4525. Igor (skeef79) 433 103.88 130.35 210 48.50
4526. z0rp (z0rp) 94 103.87 131.46 47 50.00
4527. Tristan (timmychikin) 15 103.87 115.71 7 46.67
4528. chloe (derpfacedan) 1 103.87 103.87 1 100.00
4529. Bryan (xarga) 8 103.87 117.26 8 100.00
4530. BreadForAll (hollowshadow) 54 103.87 126.93 20 37.04
4531. Matthew (neweleven) 6 103.87 121.51 4 66.67
4532. Michelle (mktsoprano2) 9 103.87 111.62 6 66.67
4533. Elias (9elias) 7 103.86 112.31 4 57.14
4534. MtDewaholic (mtdewaholic) 30 103.85 123.99 8 26.67
4535. Noober (noobest_noober) 9 103.85 129.11 4 44.44
4536. CHEESE (chromatickhaled) 122 103.85 121.28 50 40.98
4537. Bob (typocheck) 1 103.85 103.85 1 100.00
4538. trailmix (trialtest) 15 103.85 117.29 10 66.67
4539. Matthew (matt_daemond) 166 103.84 134.99 73 43.98
4540. tee (blerz) 19 103.84 117.38 16 84.21
4541. Julius (solenopsis) 1,705 103.83 131.54 730 42.82
4542. Luyene (dauxsis) 10 103.82 120.41 1 10.00
4543. Spy (spy12150) 28 103.82 118.52 13 46.43
4544. whatdoesfingerdo (piggo1228) 40 103.82 123.80 16 40.00
4545. dakota (camissonia) 4 103.82 109.26 2 50.00
4546. JJ (luddeus) 2 103.82 104.52 1 50.00
4547. Adam (maldoren) 11 103.81 126.82 0 0.00
4548. revoosh (revoosh) 30 103.80 119.42 14 46.67
4549. foo (hotemup) 1 103.80 103.80 1 100.00
4550. training hard (slj111) 4 103.80 113.55 3 75.00
4551. Wojtek (wojtexpl) 6 103.79 116.06 3 50.00
4552. Issac (njchicken) 5 103.79 123.66 0 0.00
4553. oswin (glitterji) 4 103.79 117.38 3 75.00
4554. Michael (hit2u) 64 103.78 148.42 25 39.06
4555. chaos (chaos0312) 1 103.78 103.78 1 100.00
4556. Zane (capricitor) 26 103.78 124.44 14 53.85
4557. Marek (lypa) 349 103.78 125.50 167 47.85
4558. joe (17phantom) 10 103.77 124.70 3 30.00
4559. Nick (nidzoni) 378 103.77 131.82 178 47.09
4560. Lucite (lucite) 10 103.77 111.64 5 50.00
4561. Davelkling (davelkling) 5 103.76 115.73 3 60.00
4562. Shay (sewer_rat) 9 103.76 111.01 4 44.44
4563. D (daikuri) 9 103.76 117.24 4 44.44
4564. Kostas (orange_inc) 5 103.75 115.15 3 60.00
4565. chicken (crossedhands) 3 103.74 109.45 3 100.00
4566. Lets Go Oilers! (wilsonlee123) 13 103.74 123.18 4 30.77
4567. chasing (chasingfastpoker9995) 12 103.74 120.10 2 16.67
4568. Mmm coffee (orchdork7926) 91 103.73 123.15 36 39.56
4569. lex (lex_isamess) 20 103.73 134.40 12 60.00
4570. Seb (sebb7y) 135 103.73 120.46 73 54.07
4571. Uxna (uxna) 56 103.73 127.16 26 46.43
4572. help (mango_mango_mango) 83 103.73 124.72 44 53.01
4573. Chris (cccxxxl) 19 103.73 116.44 19 100.00
4574. kira (mysticpupper) 6 103.73 124.10 6 100.00
4575. starsick (ardentauthoress) 33 103.72 122.72 18 54.55
4576. terdywerks (terdywerks) 1 103.72 103.72 1 100.00
4577. Johnnybib (johnnybib) 11 103.72 127.20 5 45.45
4578. junaid (junaidbaloch) 6 103.72 119.54 5 83.33
4579. ░ (_warrior_) 91 103.71 120.83 41 45.05
4580. JtG (jaylegee) 47 103.70 121.30 22 46.81
4581. Josh (tributedajerk) 19 103.69 128.82 10 52.63
4582. Peemie (shdwrv) 2 103.69 108.61 0 0.00
4583. keychronk6 (theonlydvorakguy) 42 103.68 121.06 18 42.86
4584. Suhas (suhoos) 29 103.68 125.67 16 55.17
4585. RamenWizard (ramenwizard) 6 103.67 118.55 3 50.00
4586. joey (josephb20252) 10 103.67 115.00 4 40.00
4587. David (klydden) 28 103.67 115.12 10 35.71
4588. Marco (holystorm) 4 103.66 110.40 1 25.00
4589. mangled (dyslectic) 3 103.66 109.24 2 66.67
4590. Andrew (trazer) 28 103.66 112.63 8 28.57
4591. GTank (gtank) 3 103.65 120.59 2 66.67
4592. Hugo (hchang800) 3 103.65 115.45 3 100.00
4593. Daniel (uheardmetrick) 2 103.65 110.59 1 50.00
4594. Daniel (siichotic) 19 103.64 121.78 3 15.79
4595. SolidSonicTH (solidsonicth) 1 103.64 103.64 1 100.00
4596. Kevin (thehobokid) 6 103.63 115.72 1 16.67
4597. Ryder (highryder18) 1 103.62 103.62 1 100.00
4598. ki (slutsupreme) 22 103.61 127.97 6 27.27
4599. Timothy (dingamer) 1 103.61 103.61 0 0.00
4600. Guggles (guggles) 135 103.60 130.08 71 52.59
4601. TyperDood (typerdoodz) 9 103.60 113.13 2 22.22
4602. Eric (ericboyce) 10 103.60 115.56 6 60.00
4603. Big (pookpok) 2 103.60 107.76 1 50.00
4604. Dylan (dmc71298) 48 103.60 129.06 27 56.25
4605. myanimelist.net/profile/kin... 8 103.60 106.82 2 25.00
4606. leaf (leafblower174) 49 103.59 139.80 32 65.31
4607. Hugh (hughmarch) 13 103.59 134.62 7 53.85
4608. Jimmy (jx297) 51 103.59 117.21 24 47.06
4609. SURFΛCΞ (surface) 268 103.58 138.80 129 48.13
4610. Andre (jahraccoon69) 23 103.57 115.33 10 43.48
4611. Eli (incarnis1) 7 103.57 113.66 2 28.57
4612. Chris (guffar) 16 103.57 120.70 5 31.25
4613. Marcus (mjtsquared) 1 103.57 103.57 1 100.00
4614. Dodger (racedodger) 3 103.56 112.90 3 100.00
4615. McLovin (tappytyper) 35 103.56 121.86 11 31.43
4616. Oli (oli94) 98 103.56 138.37 42 42.86
4617. 獣耳尻尾 (kemomimishippo) 1 103.56 103.56 0 0.00
4618. Donnkey (donnkey) 13 103.55 119.67 5 38.46
4619. Burger (burger_man) 1 103.55 103.55 0 0.00
4620. Sky (elucentx) 10 103.55 116.33 7 70.00
4621. Misha (ladyvander) 288 103.54 129.93 125 43.40
4622. yentup (yentup) 2 103.53 104.21 2 100.00
4623. Lucy (nemurinemuri) 16 103.52 112.55 8 50.00
4624. John (notjohn5) 4 103.52 110.57 4 100.00
4625. Snow (forgotmypassword) 16 103.51 116.87 11 68.75
4626. rai (ohrai) 8 103.51 128.91 8 100.00
4627. Yihoi (equation) 23 103.49 117.20 15 65.22
4628. Sean (igetass) 1 103.49 103.49 1 100.00
4629. Wybie (wybiehamster) 1 103.49 103.49 1 100.00
4630. Eran (umm_eran) 136 103.49 131.26 54 39.71
4631. Blake (backflip25) 6 103.49 110.92 1 16.67
4632. Rica (xx_peitapave_xx) 2 103.49 115.43 2 100.00
4633. Kenneth (kensan73) 27 103.48 118.68 18 66.67
4634. Liz (lizfrizzle) 22 103.48 133.88 8 36.36
4635. Jakob (lokiloki19) 5 103.48 140.21 1 20.00
4636. Mihir (mihir1125) 5 103.47 109.47 2 40.00
4637. Marco (marcomilo) 169 103.47 129.32 70 41.42
4638. 🥇 Evan C. (evancnavarro) 35 103.47 118.45 13 37.14
4639. Rocky (spookiestmeme) 2 103.47 105.81 1 50.00
4640. Nika (tinysalmon90) 698 103.46 130.39 299 42.84
4641. DvorakRacer (higginsishere) 7 103.46 120.27 3 42.86
4642. Naren (bearcum) 4 103.46 111.64 2 50.00
4643. Chowda (chowda) 246 103.45 131.08 100 40.65
4644. Femosis (femosis) 13 103.45 123.63 6 46.15
4645. Paweł (malzeer) 4 103.45 124.24 4 100.00
4646. burgir. (sub10cuber) 39 103.45 126.27 14 35.90
4647. Cow (cowscantype) 11 103.44 113.26 4 36.36
4648. Vincent (not_a_robot) 134 103.44 130.90 59 44.03
4649. Fox (slowlightning) 2 103.44 111.18 1 50.00
4650. Lightning (lightning486) 4 103.44 111.69 1 25.00
4651. Rohan (yeetarted) 7 103.44 109.45 4 57.14
4652. big (bigfinger420) 35 103.43 122.40 13 37.14
4653. Filip (necr0nz) 5 103.43 127.14 2 40.00
4654. paul [nZk] (igaikaze) 1 103.43 103.43 0 0.00
4655. yoyojuice (yoyojuice) 63 103.42 146.22 21 33.33
4656. Dylan (dyllin) 1 103.42 103.42 1 100.00
4657. Eric (errriclee) 2 103.42 116.28 0 0.00
4658. Clawzer (clawzer) 4 103.41 107.89 1 25.00
4659. Bradley (lil_mayoe) 1 103.41 103.41 1 100.00
4660. Joseph (jv33zy) 20 103.41 118.82 9 45.00
4661. Akela (akela123) 17 103.41 118.51 9 52.94
4662. Martin (martinthebest) 12 103.41 121.64 6 50.00
4663. Jmam (jmam) 28 103.40 125.90 10 35.71
4664. sunfishho (sunfishho) 6 103.40 110.15 4 66.67
4665. Haroon (haroon_shah) 1 103.39 103.39 1 100.00
4666. null (sectest) 70 103.39 115.33 30 42.86
4667. kraklo (kraklo) 5 103.39 107.42 2 40.00
4668. Xelicus (xelicus_gamingyt) 2 103.39 112.79 2 100.00
4669. Matt (mattymarsh) 192 103.38 126.53 89 46.35
4670. Olivia (oliviali) 1 103.38 103.38 1 100.00
4671. Jason (cherryitbruhnarutojizz) 11 103.38 117.90 4 36.36
4672. Q (kwhan) 49 103.38 124.09 27 55.10
4673. big (aboxofkleenex) 2 103.38 104.85 1 50.00
4674. Hello (blakeiv) 1 103.37 103.37 1 100.00
4675. V3RN0N (v3rn0n) 24 103.37 120.03 12 50.00
4676. negev (negev_lover) 1 103.37 103.37 0 0.00
4677. Kenn (kenn_double_n) 190 103.36 127.01 76 40.00
4678. Hunter (hunterschool22) 12 103.35 116.33 8 66.67
4679. Sebastian (yugireo) 1 103.35 103.35 0 0.00
4680. Ryan (turtleboy1017) 17 103.35 112.65 6 35.29
4681. BE4ST (jb2k1) 4 103.35 107.73 2 50.00
4682. Biggus (drthunderface) 62 103.34 120.55 35 56.45
4683. tstats[harveycoolestkid69] ... 17 103.34 125.94 5 29.41
4684. Dingus (dingus2000) 6 103.34 107.89 2 33.33
4685. Reynaldi (script303) 9 103.33 120.34 3 33.33
4686. Anh (billybean__) 215 103.32 131.33 83 38.60
4687. Key (hus9) 2 103.32 110.45 0 0.00
4688. yath (yyatt) 4 103.32 109.29 0 0.00
4689. FoTGbigGhost (fotg_reckless) 916 103.31 130.51 388 42.36
4690. Camden (mypenguinbuddy) 35 103.31 132.65 14 40.00
4691. Travis (tjgrant309) 3 103.31 122.71 2 66.67
4692. Khin (khin101) 2 103.31 106.43 2 100.00
4693. Phoenix (phoenixwolfer) 51 103.30 132.55 26 50.98
4694. Kenny (kenjeo) 8 103.30 116.46 3 37.50
4695. Kevin (zolt4r) 8 103.30 109.37 2 25.00
4696. Jack (oakinsyphon) 3 103.29 109.04 1 33.33
4697. 1015634 (1015634) 10 103.28 121.34 5 50.00
4698. Alloysius (alloysius) 3 103.28 106.66 2 66.67
4699. Zakk (z_boi) 13 103.28 119.10 4 30.77
4700. Kat (k4t3) 3 103.28 111.86 1 33.33
4701. Victor (liucow) 9 103.28 129.44 1 11.11
4702. Edwin (pawncastle) 1 103.27 103.27 1 100.00
4703. Willie (paiswillie) 4 103.27 111.08 1 25.00
4704. Kevin (yungwang) 2 103.27 110.04 0 0.00
4705. Ryan (direwolf05) 637 103.27 131.52 227 35.64
4706. Henry (matrixial) 9 103.27 123.43 5 55.56
4707. Matt (mlamm) 1 103.26 103.26 0 0.00
4708. jeff (jeffdujon) 7 103.26 120.64 2 28.57
4709. Pi (pilover) 5 103.26 111.23 2 40.00
4710. bog (gabongtenco) 1 103.25 103.25 1 100.00
4711. Bintang (bintung) 18 103.25 116.43 6 33.33
4712. RIP yomps (dtfps) 19 103.24 122.17 18 94.74
4713. mew (cheeboard) 7 103.24 110.14 4 57.14
4714. Jay (jayl2303) 15 103.23 122.89 6 40.00
4715. Josh (cloudworks) 6 103.23 124.34 2 33.33
4716. Ben (god0nline) 45 103.23 142.45 25 55.56
4717. Weber (hcehce419) 2 103.23 103.94 2 100.00
4718. candyyyyyyy (andewa_05) 16 103.22 121.01 13 81.25
4719. Mrs.lechuga (mrslechuga) 7 103.22 121.61 6 85.71
4720. Nerd Typist (accuracy_goddess) 4 103.21 114.99 0 0.00
4721. Teddy (chookee) 1 103.21 103.21 1 100.00
4722. YoloSwag (unicornbronie) 16 103.20 117.87 7 43.75
4723. John (driftan) 9 103.20 115.61 3 33.33
4724. Meeb (meeb24) 28 103.20 134.60 12 42.86
4725. Plato (observer_02) 9 103.20 114.06 5 55.56
4726. V (kiritoyang) 21 103.19 131.43 7 33.33
4727. Bailey (swagoneering) 44 103.19 122.40 14 31.82
4728. A Person (gelatintypist) 1 103.19 103.19 1 100.00
4729. Fran (narfornothing) 13 103.19 146.78 3 23.08
4730. Brandon (bradenpatoni) 3 103.19 106.63 1 33.33
4731. Joe (joeythedice) 3 103.19 111.96 2 66.67
4732. Lactophenol Cotton Blue (tp... 901 103.18 140.58 389 43.17
4733. Phillip (phillardb) 2 103.18 112.08 2 100.00
4734. zach (zacc2285) 81 103.18 124.04 35 43.21
4735. Duck (duckmasteral) 2 103.18 106.68 1 50.00
4736. yess (notavailabe) 36 103.17 124.76 15 41.67
4737. Zwe (shizzlemanizzle_) 1 103.17 103.17 0 0.00
4738. Ethan (waitblock) 8 103.17 109.96 0 0.00
4739. Imam (imhidayat) 747 103.16 145.43 300 40.16
4740. Harvey (sw99) 1 103.16 103.16 1 100.00
4741. Chloro (chlorowins) 3 103.16 107.20 2 66.67
4742. pc1400 (pc1400) 2 103.16 109.01 1 50.00
4743. Abdullah (thegamerx20) 15 103.16 116.81 7 46.67
4744. Porkyy (porkyp10) 26 103.15 129.61 14 53.85
4745. Marcellus (krouthen) 72 103.15 135.31 24 33.33
4746. Darko (huskycrafter) 4 103.15 109.33 3 75.00
4747. David (delkos) 4 103.15 109.07 2 50.00
4748. Conor (speedyscientist) 1 103.15 103.15 0 0.00
4749. Evan (evang_dvorak) 19 103.15 120.28 12 63.16
4750. Wesley (wesilii) 7 103.14 115.49 3 42.86
4751. Aiden (aidmfc) 4 103.14 112.05 4 100.00
4752. Stelios (paff) 8 103.14 126.46 3 37.50
4753. Scott (icerune) 2 103.13 111.07 1 50.00
4754. Surkhab (s606) 3 103.12 116.34 2 66.67
4755. Beket (bayemirov) 186 103.12 126.40 66 35.48
4756. Qi (qitang) 44 103.12 115.91 12 27.27
4757. Pehz (pehz) 3 103.12 115.42 0 0.00
4758. austin (monkey648) 12 103.11 119.17 5 41.67
4759. minion (theminiongod21) 5 103.10 112.90 2 40.00
4760. Jiuena (jiuena) 5 103.09 109.67 3 60.00
4761. THATCHILD (thatchild) 108 103.08 125.76 98 90.74
4762. Dimian (want_dimsum) 4 103.08 114.59 2 50.00
4763. Strike (strike_elite) 9 103.08 116.86 3 33.33
4764. Benjamin (idioticben05) 7 103.08 114.05 4 57.14
4765. Ahsan (ahsanhussain) 34 103.08 119.64 13 38.24
4766. skrtskrt (kad832000) 8 103.08 116.94 6 75.00
4767. Person (improbhighnotgonnalie) 433 103.08 137.22 187 43.19
4768. Tyler (tylerota2) 3 103.07 111.88 2 66.67
4769. Hamlet (typing__words) 15 103.07 130.29 9 60.00
4770. Alonzo (alonrodrigu) 1 103.07 103.07 1 100.00
4771. ThePCJakub (thepcjakub) 8 103.07 113.63 5 62.50
4772. NU (nusensei) 48 103.07 133.53 26 54.17
4773. envy (ayytsklmao) 9 103.06 117.62 1 11.11
4774. Marcus (x5starmodding) 1 103.06 103.06 0 0.00
4775. Eujean (eujean) 52 103.06 119.70 26 50.00
4776. Aecor (aecor) 27 103.06 114.74 7 25.93
4777. Ryan (bravefrontier) 2 103.05 106.29 1 50.00
4778. John (blazian11111) 219 103.05 143.47 81 36.99
4779. THE JEWELL (wildhorsesthe2nd) 28 103.05 137.92 15 53.57
4780. Ales (_ales) 7 103.05 111.37 4 57.14
4781. Daniel (ibedacaptainofdaship) 12 103.05 121.60 4 33.33
4782. Moronic Typer (yong955143) 614 103.04 127.30 278 45.28
4783. Christopher (cprice4124) 18 103.04 122.15 4 22.22
4784. orde (orde) 37 103.03 129.43 10 27.03
4785. C (meektaco) 1 103.03 103.03 0 0.00
4786. autism (autismboy) 6 103.03 106.47 4 66.67
4787. Jake (jaydez) 2 103.03 104.05 1 50.00
4788. Adam (musterling) 20 103.03 119.91 16 80.00
4789. Ayong (larrylarogapro) 403 103.03 139.09 179 44.42
4790. mineschweppes (minescheppes) 5 103.03 121.06 2 40.00
4791. - (fullswingtango) 3 103.03 112.42 1 33.33
4792. nico yes nico (nic_o_nic) 16 103.02 140.12 5 31.25
4793. MR (mrsystem) 1 103.02 103.02 0 0.00
4794. StraightUpLuck (straightupl... 1,866 103.02 144.83 813 43.57
4795. Always (tromin) 7 103.01 120.73 3 42.86
4796. Tyler (silver_typer) 11 103.01 114.24 5 45.45
4797. hat (hatensemble) 2 103.01 109.57 1 50.00
4798. lilvic (vickty) 94 102.99 125.62 45 47.87
4799. Victo (victo_sn) 175 102.99 144.99 81 46.29
4800. Diana (typinglover1023) 14 102.98 116.39 8 57.14
4801. cimbraien (cimbraien) 4 102.98 109.86 3 75.00
4802. Strudle (strudlepoodel) 12 102.98 113.01 8 66.67
4803. John (jhakala) 155 102.97 118.58 53 34.19
4804. Justin (rogreat) 7 102.97 117.10 4 57.14
4805. Rafael (arroxa) 5 102.96 124.22 2 40.00
4806. Andraž Gradišnik (andgrad) 56 102.96 123.32 25 44.64
4807. Lazer (lawins) 21 102.96 114.07 3 14.29
4808. Trey (treytech3) 1 102.96 102.96 0 0.00
4809. disgusting pig (morytain) 5 102.96 108.99 1 20.00
4810. Asian (asiansupremacy) 9 102.95 119.02 7 77.78
4811. Dave (erose524) 1 102.94 102.94 1 100.00
4812. Lizzie (lfilart) 6 102.94 116.33 2 33.33
4813. DrSnackary (drsnackary) 5 102.94 121.34 0 0.00
4814. Nathanael (tunahead) 66 102.94 121.45 37 56.06
4815. George (kyrite) 7 102.93 119.15 4 57.14
4816. Stefan (ringding) 41 102.93 122.57 12 29.27
4817. Kimikazee (squalo101) 9 102.93 121.14 4 44.44
4818. John (jodingus) 1 102.93 102.93 1 100.00
4819. Daniel (hyunholee13) 10 102.93 123.62 4 40.00
4820. ᕕ༼ ; •̀︿•́༽... 20 102.93 122.52 18 90.00
4821. Nick (bballnick2k2) 2 102.93 108.51 1 50.00
4822. Locky (lockygamer) 2 102.90 103.91 2 100.00
4823. Dude (48023984) 24 102.90 113.97 14 58.33
4824. Elliot_1980_UK (elliot_notts) 155 102.90 126.92 66 42.58
4825. Suhas (suhasmaddali007) 294 102.90 126.79 112 38.10
4826. Andrew (buttmann64) 11 102.89 126.59 6 54.55
4827. Tom (phantom74) 4 102.89 110.51 0 0.00
4828. Joshua (redscool) 13 102.89 115.96 5 38.46
4829. Ryan (dab_city) 1 102.88 102.88 0 0.00
4830. Eduard (eduard20) 9 102.88 116.06 4 44.44
4831. Elysium (eclipser) 2 102.87 104.70 0 0.00
4832. Omar (versohnne_1) 3 102.86 116.00 3 100.00
4833. Jonathan (vczne) 6 102.85 122.27 2 33.33
4834. Sapah (sapah) 6 102.85 118.95 3 50.00
4835. Brigid (riniti) 25 102.85 115.10 15 60.00
4836. xd (huskyyy) 21 102.85 122.23 12 57.14
4837. Ben (greentshirtboy) 6 102.84 119.36 4 66.67
4838. Kevin (taow) 9 102.84 108.55 4 44.44
4839. Moy (moy280) 441 102.84 134.96 159 36.05
4840. kylotastic (kylotastic) 2 102.84 104.09 0 0.00
4841. Zack (zackjwilk) 19 102.83 122.54 9 47.37
4842. John McCarthy (providerone) 52 102.83 118.87 25 48.08
4843. Be (be_wise) 5 102.82 109.98 0 0.00
4844. MoresVance (moresvance) 29 102.82 125.22 15 51.72
4845. siri (sag339) 16 102.81 135.23 5 31.25
4846. rahmu (rahmu) 3 102.81 103.62 0 0.00
4847. They Don't Know That (theyd... 106 102.81 131.71 39 36.79
4848. Hello (jadensmith7) 7 102.80 114.86 1 14.29
4849. hamin (hamin) 31 102.80 129.19 16 51.61
4850. ninguart (ninguart) 12 102.79 126.68 6 50.00
4851. Mark Jonathan (max_peterson10) 11 102.79 113.80 4 36.36
4852. addy (epicshibexd) 352 102.79 131.79 154 43.75
4853. Michael (mercury28) 114 102.79 131.22 49 42.98
4854. tsapi (tsapi) 91 102.78 129.25 31 34.07
4855. zuwuz (zuwuz) 3 102.78 103.64 1 33.33
4856. Elgeo (saladin_pulverz) 4 102.78 117.28 1 25.00
4857. Dr. (drtulung) 1 102.78 102.78 1 100.00
4858. Joseph (jnml19) 5 102.78 110.31 4 80.00
4859. Jagger (jagswag28) 1 102.77 102.77 1 100.00
4860. EatingFromTrashcan (namtrac... 515 102.75 137.40 202 39.22
4861. Yuri (json223) 78 102.75 129.88 39 50.00
4862. Hah (verdaderopan) 31 102.75 119.17 11 35.48
4863. D (dmaulish) 3 102.74 109.68 2 66.67
4864. Maidenless (bigguy12) 1 102.74 102.74 1 100.00
4865. Erick (fishywasabi) 4 102.74 111.74 1 25.00
4866. ginteaa (ginteaa) 22 102.74 116.36 7 31.82
4867. truecoatcrew (truecoatcrew) 18 102.73 118.66 12 66.67
4868. Nolan (nolanelwood) 4 102.73 115.51 2 50.00
4869. DOS (microdos) 1 102.73 102.73 1 100.00
4870. bruhmoment (victorio_) 27 102.73 129.15 7 25.93
4871. Ian (e__n) 26 102.73 120.81 8 30.77
4872. David (the_pursuit) 7 102.72 118.36 7 100.00
4873. Nguyen Truong (racing_typer... 109 102.72 136.72 55 50.46
4874. Jacob (horenzo) 14 102.72 117.13 7 50.00
4875. Sara (kookiebeagle) 5 102.71 110.28 3 60.00
4876. Vivioxide (vivioxide) 2 102.71 104.25 2 100.00
4877. Pierce (jedipierce) 11 102.71 123.72 6 54.55
4878. van (cakeblanket) 7 102.70 110.40 2 28.57
4879. boxxibis (boxxibis) 8 102.70 122.70 3 37.50
4880. Mafuso (mafuso) 4 102.70 115.17 0 0.00
4881. Brandon (bgrospe) 71 102.70 128.55 35 49.30
4882. Crossland (crossjbeer) 10 102.70 122.77 6 60.00
4883. Ty Toriyama-sensei anime4ev... 261 102.70 144.79 102 39.08
4884. payn (paynnn_) 74 102.70 123.30 32 43.24
4885. Matthew (m9thew) 2 102.69 105.15 1 50.00
4886. fastboi (speedofwhite) 3 102.69 119.60 2 66.67
4887. Slavic (slavicfedora) 14 102.69 124.13 3 21.43
4888. DFA (dj2119) 23 102.69 123.25 9 39.13
4889. Arrogant (dkaocka) 19 102.68 120.91 6 31.58
4890. Victor (sravn) 3 102.68 114.55 2 66.67
4891. Max (max2004awesome) 27 102.66 119.10 9 33.33
4892. wake up!! (psychic7195) 73 102.66 133.30 62 84.93
4893. Jeremy (potrainer) 8 102.66 123.84 3 37.50
4894. Tachanka (lordtachankatm) 8 102.66 112.19 5 62.50
4895. HawksCardinals (hawkscardin... 113 102.66 129.36 52 46.02
4896. Minh Kiet (buimonkey) 13 102.66 124.55 4 30.77
4897. Zachary (zachary3352) 14 102.65 119.61 9 64.29
4898. ngoc huy nam (destroy_the_w... 188 102.65 133.57 79 42.02
4899. Memming (qwerty) (memming) 314 102.65 130.16 147 46.82
4900. a (waahello) 18 102.64 119.21 5 27.78
4901. Fluff (afluffyflamingo) 14 102.64 133.27 5 35.71
4902. sync (kjh2196) 42 102.63 116.28 17 40.48
4903. Karina (guyrina) 21 102.62 123.44 9 42.86
4904. Drew (drewsalem) 3 102.62 124.20 2 66.67
4905. Batyrkhan (batyyr) 2 102.62 112.42 0 0.00
4906. Sid (sidch) 1 102.62 102.62 0 0.00
4907. pew (vynxr) 2 102.62 110.54 1 50.00
4908. Troy (atheropods) 6 102.61 117.94 4 66.67
4909. Richard (rcasey88) 1 102.60 102.60 1 100.00
4910. BigShow (mrkrakenthe1st) 15 102.60 114.75 6 40.00
4911. Jpeg blue car (nebbeh) 1 102.59 102.59 0 0.00
4912. Mike (migpok35) 5 102.59 117.34 5 100.00
4913. Nick (rageemy) 21 102.59 114.32 14 66.67
4914. Gooper (thijswillemsen) 4 102.59 110.63 3 75.00
4915. Xanafer (xanafer630) 1 102.58 102.58 1 100.00
4916. Delviurge (delviurge) 13 102.58 110.24 7 53.85
4917. Adam (whalsey1) 6 102.58 108.83 1 16.67
4918. Ferga12345 (ferga12345) 2 102.57 104.62 1 50.00
4919. Joseph (baggs33) 25 102.56 125.20 10 40.00
4920. sssssssssssssss (sssssnake) 79 102.56 131.47 38 48.10
4921. Macrene (macrene) 16 102.56 118.82 8 50.00
4922. Matthew (mattyhassett) 104 102.56 141.91 44 42.31
4923. Sarah Bisher (sarahbisher) 25 102.55 111.72 12 48.00
4924. Rotem (rotemsela) 8 102.55 124.70 4 50.00
4925. M.Verstappen (gameroubas) 27 102.55 119.64 12 44.44
4926. Islam ❤ (respectedfeeds) 8 102.54 107.54 3 37.50
4927. Adrian (guncr4ft3r) 6 102.53 114.74 3 50.00
4928. Jyotirmoy (jyotirmoy_halder) 7 102.53 114.20 4 57.14
4929. Mike (michaelomh) 4 102.53 110.13 2 50.00
4930. David (dwang05) 12 102.53 117.43 4 33.33
4931. Ryan (carefullyslow) 329 102.53 132.54 153 46.50
4932. crow (ph4tomz) 3 102.52 115.78 1 33.33
4933. Milos (milosj) 3 102.52 112.65 1 33.33
4934. sməxy (smexyflako) 910 102.52 136.70 361 39.67
4935. Phil (philwinnem) 114 102.51 127.62 46 40.35
4936. Hamlet (hamabaya) 19 102.51 115.47 5 26.32
4937. severed_toast (severedtoast) 43 102.50 140.59 15 34.88
4938. Mouse (shenx) 14 102.50 113.12 8 57.14
4939. Jason (jasonledrika) 8 102.50 119.94 4 50.00
4940. Odyn (odynlol) 2 102.49 110.92 0 0.00
4941. Senin (senin8pagi) 15 102.48 110.91 7 46.67
4942. Ian (doughs) 12 102.48 125.26 5 41.67
4943. Phenos (phenos) 27 102.48 126.47 10 37.04
4944. Sheel (sheel) 22 102.48 113.80 12 54.55
4945. Evan (elin4046) 63 102.48 123.48 22 34.92
4946. Endstyle (endstylegg) 101 102.47 123.30 34 33.66
4947. Robert (karayicki) 266 102.47 124.31 117 43.98
4948. Michwael Redpants (endlessm... 2 102.47 108.42 0 0.00
4949. Zaim (zaimanator) 4 102.47 118.33 4 100.00
4950. Chip (chip_king) 1 102.45 102.45 0 0.00
4951. Double (doublemichael) 4 102.44 107.83 2 50.00
4952. Eshelmen (drguru) 7 102.44 112.79 4 57.14
4953. Ryan (ryguyd505) 1 102.44 102.44 1 100.00
4954. Slethron (fastslethron) 689 102.44 133.57 295 42.82
4955. ariel (arielsoko) 28 102.43 124.20 15 53.57
4956. Jacqui (takeoutfoo) 10 102.43 121.23 6 60.00
4957. Sami (samihasaspine) 8 102.43 123.84 3 37.50
4958. jar jar binks (jrong97) 2 102.43 111.70 0 0.00
4959. Edward (slappyedward) 4 102.42 112.12 1 25.00
4960. Nuub (1brasil) 126 102.42 131.43 51 40.48
4961. asdf (meagar) 6 102.42 113.76 3 50.00
4962. Pro (cheater_0) 6 102.42 110.99 3 50.00
4963. timko (razorsharprust) 1 102.41 102.41 1 100.00
4964. Jason (manjova) 3 102.41 106.92 1 33.33
4965. Kanvaro (kanvaro) 3 102.40 112.00 2 66.67
4966. Grenek (grenek) 73 102.40 122.27 30 41.10
4967. (avazl) 1 102.40 102.40 0 0.00
4968. Eric (fastestfatfingers) 10 102.40 115.57 6 60.00
4969. deohanz (fierywormz) 6 102.39 109.44 3 50.00
4970. mieszko (mieszkomieszko) 17 102.39 114.73 11 64.71
4971. Josh (coherentwalrus) 1 102.39 102.39 1 100.00
4972. Chichukin (chichukin) 2 102.39 121.21 1 50.00
4973. Chubby (chubbykidseating) 109 102.38 133.89 41 37.61
4974. Adam (beakerthe1st) 1 102.38 102.38 0 0.00
4975. Yuk (littleyuk) 5 102.38 111.12 2 40.00
4976. Icecuber (icecuber) 9 102.37 112.78 3 33.33
4977. Barış (epokhe) 1 102.36 102.36 0 0.00
4978. Ora Ora (eddyyang2003) 29 102.36 115.96 19 65.52
4979. Dal (astronerd) 1,688 102.36 146.26 656 38.86
4980. Daniel (scumset) 116 102.35 126.87 52 44.83
4981. Laura (laurga) 122 102.35 125.82 45 36.89
4982. Forrest (forrest_p) 1 102.35 102.35 0 0.00
4983. tstats[pook_dvorak] (pook_d... 43 102.35 125.57 15 34.88
4984. Wyatt (millybay) 1 102.35 102.35 1 100.00
4985. André (andrepascoa) 15 102.35 111.19 8 53.33
4986. Jack (zbroooksy) 8 102.35 126.77 2 25.00
4987. Dustin (a_drunk_carry) 5 102.35 111.87 1 20.00
4988. Xin (giorgi1123) 2 102.35 106.88 0 0.00
4989. script/script (henville12) 13 102.34 115.54 6 46.15
4990. Bee (beejbeeabeey) 53 102.34 124.50 16 30.19
4991. Ming (swamis) 6 102.34 116.87 3 50.00
4992. Billy (oatmeal417) 698 102.34 131.49 319 45.70
4993. Fedwig (fedwig) 53 102.34 125.93 23 43.40
4994. Stoian (creep_fire97) 50 102.34 117.42 15 30.00
4995. Alex (citricdolphin) 15 102.34 115.84 7 46.67
4996. Marshall (tekuin) 6 102.34 113.04 2 33.33
4997. Nicolai (nicolair222) 21 102.33 114.36 5 23.81
4998. Edward (foqsi) 21 102.33 122.45 9 42.86
4999. Joseph (barcaftw05) 8 102.33 110.19 6 75.00
5000. CPawx (cpawx) 11 102.32 118.71 2 18.18
5001. Jarod (terminuszwei) 776 102.32 149.66 323 41.62
5002. Kristof (silentreveries) 1 102.32 102.32 1 100.00
5003. 浩丁 (kusogedane) 99 102.32 125.13 43 43.43
5004. Kevin (kevinmeseeyou) 29 102.31 114.28 9 31.03
5005. Weston (dubax) 2 102.31 105.92 1 50.00
5006. Timothy (disapointing) 5 102.31 114.98 3 60.00
5007. autzmn (autzmn) 6 102.30 127.25 3 50.00
5008. GGEZ (altris) 2 102.30 102.42 2 100.00
5009. Sonia (swagaholik) 3 102.30 110.68 1 33.33
5010. :( (magtraxer) 43 102.29 134.71 15 34.88
5011. logitech g613 sucks (g613) 1 102.28 102.28 1 100.00
5012. David (thedaveed) 14 102.28 124.43 10 71.43
5013. ... (the_sesquipedalienist) 77 102.27 137.30 36 46.75
5014. Dilectiss (dilektislav) 1 102.27 102.27 0 0.00
5015. Helena (coolister3) 8 102.27 119.77 6 75.00
5016. Literature (20120623) 4 102.27 104.88 0 0.00
5017. You (littlebabybear) 2 102.27 108.36 1 50.00
5018. Tjerk (whiz_nl) 8 102.26 113.59 5 62.50
5019. france (nabyounab) 1 102.26 102.26 0 0.00
5020. TC (mstngt) 2 102.26 106.39 1 50.00
5021. ZapSlow (zapadobo) 11 102.26 123.97 5 45.45
5022. dawdad (darkschore) 23 102.26 116.38 12 52.17
5023. ceejay (shijei) 4 102.26 113.87 0 0.00
5024. Chutney 🏹 (marchtovalinor) 2 102.26 106.45 1 50.00
5025. costin (acostin643) 14 102.24 116.31 3 21.43
5026. Nectarios (locomolotov) 176 102.24 138.66 59 33.52
5027. Scryp (scryp) 96 102.24 125.66 41 42.71
5028. GLX (glxep) 4 102.24 109.34 1 25.00
5029. Niko (nikolearnstotype) 8 102.22 123.40 4 50.00
5030. Digital (digitalrico) 6 102.22 123.99 4 66.67
5031. ret (retiarius) 4 102.22 111.52 4 100.00
5032. Stefan (stefradjen) 70 102.22 125.99 37 52.86
5033. Charlie (swordmole) 65 102.22 116.90 29 44.62
5034. Charles (xx_white_racer_xx) 14 102.21 117.92 6 42.86
5035. Max (maximyss) 5 102.21 109.17 2 40.00
5036. Peyton (peytondk) 9 102.21 112.74 9 100.00
5037. Z (jaredezane) 11 102.21 116.20 7 63.64
5038. Eric (unfazedglitch) 56 102.20 118.23 25 44.64
5039. Justin (keehyu) 15 102.20 113.59 9 60.00
5040. Arthur (lelface) 78 102.19 131.80 36 46.15
5041. Mitsuo (sp33d1sk3y) 34 102.19 118.46 14 41.18
5042. anoniman (anoniman_0001) 11 102.18 117.96 1 9.09
5043. Fernando (fedevegili) 8 102.17 115.14 5 62.50
5044. Yakiniku (bigmeatball) 139 102.17 128.79 44 31.65
5045. Eduard (holykill) 13 102.17 120.24 5 38.46
5046. jf (jkkl) 8 102.15 122.61 4 50.00
5047. Faustino (tinoriffic) 19 102.15 112.77 7 36.84
5048. Eddie_NP (eddie023) 144 102.15 123.87 69 47.92
5049. Steven (gamma_knife17) 96 102.14 123.55 40 41.67
5050. Rony (cleff) 23 102.14 125.57 22 95.65
5051. Fretzeldurmf (agent_gametur... 8 102.13 115.30 2 25.00
5052. Muhammad (mhasan01) 21 102.13 113.66 6 28.57
5053. Daniel (dninja96) 14 102.13 116.79 4 28.57
5054. Shanks (nuggetxd) 8 102.13 118.68 4 50.00
5055. Josh (jctilton03) 1 102.12 102.12 1 100.00
5056. Chirpy (pandress) 53 102.12 128.83 25 47.17
5057. Last (thelastmuffin) 38 102.12 118.05 14 36.84
5058. chris (chrispfries) 2 102.11 103.35 0 0.00
5059. Aayush (jerry_dank) 1 102.11 102.11 0 0.00
5060. Lien (acut3_racy) 90 102.11 134.06 34 37.78
5061. Jayuke (jontrask) 29 102.10 125.30 13 44.83
5062. Sam (samb11) 126 102.09 126.16 53 42.06
5063. Garry (megatroop) 16 102.09 108.94 5 31.25
5064. tstats[illblowurmind] (illb... 118 102.09 131.91 43 36.44
5065. Juicedit (juicedit) 30 102.09 127.72 10 33.33
5066. Roizor (roizor) 2 102.09 110.58 2 100.00
5067. Jedidiah (puisanberg) 8 102.08 116.63 8 100.00
5068. Case (arsonistlol) 2 102.08 104.86 0 0.00
5069. Nathan (slowbo12) 4 102.08 115.86 1 25.00
5070. Denni (uramazing) 10 102.08 114.44 7 70.00
5071. Chris (christaborg) 3 102.07 109.90 2 66.67
5072. Zeph (zeezallo) 2 102.07 105.31 1 50.00
5073. e (revengepug) 12 102.07 123.96 8 66.67
5074. Doug (dougdimmadan) 12 102.07 114.00 6 50.00
5075. David (dlreed27) 39 102.06 116.07 21 53.85
5076. josh (jshg) 72 102.06 127.78 24 33.33
5077. budda (theblackeye) 21 102.05 120.58 9 42.86
5078. ARTAN (begaal97) 46 102.05 117.47 17 36.96
5079. Alex (nr1771) 1 102.05 102.05 0 0.00
5080. Itay (itay4430) 28 102.05 127.04 14 50.00
5081. Sadra (sadra17) 34 102.04 121.03 15 44.12
5082. J'hamed (chouthe2nd) 1 102.04 102.04 0 0.00
5083. Ribub (mercury_millpond) 7 102.03 110.44 3 42.86
5084. Kamil (replikant) 6 102.03 110.77 6 100.00
5085. Mojave (mojave) 1 102.03 102.03 0 0.00
5086. Liwamster (liwamster15) 1 102.03 102.03 0 0.00
5087. Jason (altaria13) 9 102.03 114.65 3 33.33
5088. bo (biznessmun) 22 102.03 116.88 15 68.18
5089. Willey (shadowheart123) 3 102.03 103.13 1 33.33
5090. ⭕⃤ (carmatain) 59 102.02 140.32 24 40.68
5091. Ryan (potatoz10) 1,498 102.01 137.06 700 46.73
5092. CARL (carlkwan) 7 102.01 113.55 4 57.14
5093. Ruicky8 (ruicky8) 5 102.01 117.87 3 60.00
5094. Amir (nao.paladin@yahoo.com) 48 102.00 121.34 24 50.00
5095. akash (phantom_07) 1 102.00 102.00 1 100.00
5096. anyou (asianguy2816) 3 102.00 111.30 0 0.00
5097. Cream Of (creamofroach) 10 102.00 113.85 8 80.00
5098. Darvydas (darwyb) 2 101.99 110.50 2 100.00
5099. Everett (istorm_light) 7 101.98 110.42 6 85.71
5100. Jason (jasonjat) 6 101.98 121.98 2 33.33
5101. Arun (arun808) 36 101.98 122.81 16 44.44
5102. RUConfuzzled (andre_raj) 1 101.98 101.98 1 100.00
5103. Jason (jwatkins) 6 101.98 112.66 1 16.67
5104. ㅤ (toptied) 17 101.98 133.73 7 41.18
5105. Geoffrey (yerffoeg) 2 101.98 107.55 0 0.00
5106. Sim (luckytosnort) 1 101.97 101.97 0 0.00
5107. Instynkt (instynkt) 10 101.97 120.98 5 50.00
5108. Linfeng (llinfeng) 142 101.97 132.48 59 41.55
5109. Tin (asianzhang) 6 101.96 117.12 2 33.33
5110. reddit keyboard warior (spy... 211 101.96 139.93 101 47.87
5111. Henry (frostyedits) 3 101.96 106.54 2 66.67
5112. Erza (erzaskill) 18 101.95 112.74 8 44.44
5113. Dominus (dominuslucifer) 7 101.95 111.97 5 71.43
5114. Arissa (arissahsu) 13 101.95 117.19 8 61.54
5115. Jack (elbowlick) 2 101.95 102.69 0 0.00
5116. vroom (rott3n) 24 101.95 118.48 11 45.83
5117. Jacktes (funnyperson) 4 101.94 117.85 3 75.00
5118. csAxer8 (csaxer) 20 101.94 126.48 9 45.00
5119. Joel (phitsuh) 40 101.94 121.32 19 47.50
5120. laZorbeamZ (lazorbeamz) 116 101.93 125.27 46 39.66
5121. no (theovive) 126 101.92 128.87 60 47.62
5122. Zoey (soeyzandiego) 47 101.92 126.17 19 40.43
5123. Extrode (crazytrends) 3 101.92 116.72 1 33.33
5124. ElkTF2 (elktf2) 2 101.92 107.08 2 100.00
5125. birdy (zazu7765) 2 101.92 112.64 1 50.00
5126. Delve (delve17) 28 101.91 117.42 19 67.86
5127. Alon (alon276) 20 101.91 113.72 12 60.00
5128. Seth (cucookid) 4 101.91 102.51 3 75.00
5129. Osama (obokanan) 1 101.91 101.91 0 0.00
5130. noobnoob (garblovian) 4,051 101.91 143.99 1,525 37.65
5131. Yerry (yerryracer) 5 101.91 117.52 1 20.00
5132. Ron (rounakc18) 82 101.90 117.16 24 29.27
5133. platno (platno) 75 101.90 116.72 33 44.00
5134. Sam (bananaman923) 3 101.90 115.90 1 33.33
5135. Ben (essequattro) 17 101.90 116.36 12 70.59
5136. K (sunfalls) 25 101.90 116.00 13 52.00
5137. Timoxa (mita57) 119 101.90 122.26 51 42.86
5138. venus (taroxtaroxtaro) 7 101.89 127.88 5 71.43
5139. Isra-to-Hell (skyarchbeast) 15 101.89 113.33 7 46.67
5140. Rico (ricoencabo) 6 101.88 123.06 4 66.67
5141. Wikedtik (wikedtik) 7 101.88 107.37 1 14.29
5142. BearJere (bearjere) 21 101.88 112.78 12 57.14
5143. zyn (zezyn) 3 101.88 112.66 1 33.33
5144. Mikhail (mikhail0620) 2 101.87 102.62 0 0.00
5145. tstats[mildlyaggressivecher... 12 101.87 112.28 6 50.00
5146. Benjamin (dokdo_korea) 6 101.86 111.91 3 50.00
5147. Ryan (rchoi34) 5 101.84 108.23 2 40.00
5148. J (falsekrakk808) 15 101.84 119.18 7 46.67
5149. winnifred (thepeppery_one) 2 101.84 104.44 1 50.00
5150. sean (sgdth) 4 101.84 118.43 1 25.00
5151. Kieran (kshawarma) 1 101.84 101.84 1 100.00
5152. Severin (elmo96) 256 101.84 120.95 109 42.58
5153. 2002hondaaccord (gamingboss... 105 101.83 131.47 45 42.86
5154. Marcus (mwcx) 5 101.83 104.91 4 80.00
5155. Kevin (kevinparkit) 92 101.82 121.72 35 38.04
5156. iCheese (icheese23) 21 101.81 117.49 10 47.62
5157. DiscordMod (sheevpalpatine66) 4 101.81 123.75 2 50.00
5158. Laurence (amphora) 3 101.81 106.59 0 0.00
5159. robdude22 (robodude22) 98 101.81 126.07 52 53.06
5160. Jedwidz (jedwidz) 8 101.81 113.07 4 50.00
5161. potato (potato42069) 75 101.81 132.72 46 61.33
5162. rilee_h443 (rilee_h443) 2,109 101.80 152.48 900 42.67
5163. Robbie (roadcasted) 18 101.80 129.76 6 33.33
5164. Luigi (jorge_da_borracha) 447 101.80 152.34 218 48.77
5165. Jonathon (goodstuff11) 852 101.79 148.11 347 40.73
5166. Gavin (ligerblubber) 2 101.79 103.45 1 50.00
5167. Buttjuice (orangebruce) 1 101.79 101.79 0 0.00
5168. Emil (emild90) 4 101.79 109.10 1 25.00
5169. Kurowa (treefighterh) 6 101.79 124.98 6 100.00
5170. Fez (iamsuperspeed) 21 101.79 110.26 9 42.86
5171. Pepeg (evolvingpepeg) 11 101.79 123.42 6 54.55
5172. Thunderz (thunderz2016) 25 101.78 118.21 12 48.00
5173. rmanz (rmanz) 4 101.78 116.11 2 50.00
5174. Noah (bobapplepie) 60 101.78 117.34 26 43.33
5175. M (myles_jb) 47 101.78 124.37 20 42.55
5176. 𝕃𝕦𝕗𝕗𝕪 (techon) 15 101.77 113.52 8 53.33
5177. Beige (beigedaddy) 582 101.76 143.24 270 46.39
5178. Deiru (deiru) 14 101.76 121.54 3 21.43
5179. Scott (holyomgida) 27 101.76 118.87 10 37.04
5180. Carlos (babageniuz007) 1 101.76 101.76 1 100.00
5181. Mia (miadotcx) 2 101.76 102.70 0 0.00
5182. StewieGriffin (stewiegriffi... 114 101.76 141.45 49 42.98
5183. Martin (megdal02) 131 101.75 123.95 58 44.27
5184. bench (bench0) 8 101.75 114.50 1 12.50
5185. Frank (floturcocantsee) 5 101.75 114.23 2 40.00
5186. yuvirayz (yuvirayz) 6 101.74 110.63 3 50.00
5187. Shrig (dracon7260) 11 101.73 116.98 4 36.36
5188. Michael (javamorris) 12 101.73 114.63 6 50.00
5189. Josh (healingjoe) 4 101.73 106.13 3 75.00
5190. Izzy (ishey) 39 101.73 126.32 14 35.90
5191. Jeremiah (fiveminus1) 9 101.73 129.45 3 33.33
5192. Ayyyyyy (lmaoooooo) 2 101.73 109.44 0 0.00
5193. K (ksil_surface) 245 101.72 127.98 106 43.27
5194. Brian (brianyosua) 25 101.71 120.60 11 44.00
5195. v1ruso (v1ruso) 11 101.70 110.57 7 63.64
5196. Mr. (serallfreedbear) 196 101.70 128.68 91 46.43
5197. Kaybe (kaybnde) 20 101.70 117.87 8 40.00
5198. 123 (mrgumball) 2 101.70 107.13 2 100.00
5199. Asters (typer1typer) 21 101.69 117.57 9 42.86
5200. Devin (deviniity) 4 101.69 105.73 0 0.00
5201. revaN (ashun) 20 101.69 114.79 6 30.00
5202. lolow (neworange999) 70 101.69 129.58 32 45.71
5203. stepbrother69 (stepbrother69) 8 101.68 124.57 4 50.00
5204. Olav (tocke) 2 101.68 116.26 1 50.00
5205. (bicycleman) 143 101.68 162.95 59 41.26
5206. Tselmeg (tselmegkh) 23 101.67 126.54 15 65.22
5207. Luka (propalica) 6 101.67 110.69 5 83.33
5208. dewy (dewydh) 16 101.67 121.07 6 37.50
5209. (◠‿◠✿) (nyafuu) 2 101.67 101.78 2 100.00
5210. Ronak (ronakkaria) 40 101.66 138.65 20 50.00
5211. Daniel (masterfiregg) 7 101.66 125.37 7 100.00
5212. Steven (xuqc01) 58 101.65 122.96 24 41.38
5213. Jeemin (jeemini) 29 101.64 124.15 13 44.83
5214. Rosa (rrosie1213) 2 101.64 107.21 2 100.00
5215. Dustin (belyea) 29 101.63 127.62 12 41.38
5216. Courtney (clc0778clc) 28 101.63 126.57 11 39.29
5217. uty (tisurend) 771 101.63 145.17 315 40.86
5218. Adam (adumbsun) 51 101.63 134.43 23 45.10
5219. Andeh (calluxdapotato) 64 101.63 117.42 27 42.19
5220. Tim (fast_but_not_the_fastest) 13 101.62 117.33 6 46.15
5221. Joel (joel_w2) 20 101.62 112.56 5 25.00
5222. gloria (glorialostthegame) 90 101.62 126.49 32 35.56
5223. Billy (battlefieldragon) 130 101.62 119.08 50 38.46
5224. InterLude (interlude) 22 101.61 145.49 10 45.45
5225. Scarrrz (scarrrz) 1 101.61 101.61 0 0.00
5226. Jini (jinilee07) 5 101.61 114.58 3 60.00
5227. Zen (zenchan123) 236 101.60 147.96 94 39.83
5228. spiky (spiky228) 145 101.60 119.92 69 47.59
5229. Robert (rwa102455) 44 101.59 119.88 17 38.64
5230. panacotta (panacotta) 15 101.58 114.35 6 40.00
5231. One last time (ubershah) 280 101.58 136.59 139 49.64
5232. Joyce (20emilywang20) 5 101.58 112.91 2 40.00
5233. KonoKono (kzunderscoresamao... 9 101.58 114.24 5 55.56
5234. 똑똑히 받아 (varnontyp... 760 101.57 133.09 302 39.74
5235. Joseph (schmo_) 110 101.57 129.70 48 43.64
5236. Josh (p0mm) 2 101.57 113.17 2 100.00
5237. Marco (marc7202) 3 101.56 106.06 2 66.67
5238. Brandon (theyimi) 9 101.56 112.39 4 44.44
5239. Ruu (sun_voca) 21 101.55 116.09 5 23.81
5240. Steven (stuvun) 67 101.55 118.23 35 52.24
5241. LULU (luluthecow) 8 101.55 119.44 5 62.50
5242. Allan (allandallon) 400 101.55 131.59 176 44.00
5243. amber (gremlinx8) 13 101.55 112.83 8 61.54
5244. Griffin (speedyboi4506) 30 101.55 129.61 14 46.67
5245. dannsy (dannsy) 21 101.54 115.13 8 38.10
5246. Ted (ted21) 1 101.54 101.54 1 100.00
5247. bbcola18 (bbcola18) 37 101.54 130.91 17 45.95
5248. Reg (reggg) 182 101.53 126.94 70 38.46
5249. loiyus (fuzxy) 29 101.53 121.95 10 34.48
5250. Bone (bonezybeats) 6 101.53 119.55 3 50.00
5251. Luthriel (luthriel) 11 101.53 110.31 8 72.73
5252. narqo (narqo) 11 101.53 122.65 8 72.73
5253. mlhhsid (mlhhsid) 448 101.52 120.29 178 39.73
5254. Kailh BOX Jade (plixxreeb) 10 101.52 119.95 5 50.00
5255. Ruben (nitrosabre) 4 101.52 112.44 2 50.00
5256. Omer (om3rrr) 81 101.52 128.03 32 39.51
5257. Jem (rollingapple) 12 101.51 123.10 8 66.67
5258. Asd (thinedes) 11 101.51 132.88 5 45.45
5259. Tiberius (tiberiusceter) 8 101.50 121.55 5 62.50
5260. danielllll! (ayyitsdan) 2 101.50 101.90 2 100.00
5261. booger (boogerbuttcheeks) 3 101.49 103.03 0 0.00
5262. Darda (babyonbaby) 45 101.49 126.74 21 46.67
5263. Jackee (lilbully) 1 101.49 101.49 1 100.00
5264. Will (r_u_sure) 14 101.49 113.88 5 35.71
5265. Eric (draydere) 46 101.48 115.04 14 30.43
5266. dave (mercurz) 3 101.48 119.64 1 33.33
5267. 스티븐 (ishes) 21 101.48 109.94 9 42.86
5268. Kill (2fast4yall) 2 101.48 105.38 1 50.00
5269. Alvin (ayesizzle) 39 101.47 116.01 17 43.59
5270. Maddy (mlong) 22 101.46 116.75 11 50.00
5271. jill (toshiba_jill) 2 101.46 107.95 1 50.00
5272. Cosmic (aji3) 1,440 101.46 151.88 596 41.39
5273. James (james494) 14 101.46 112.99 8 57.14
5274. A (djakl) 22 101.45 114.86 8 36.36
5275. Nikk (white13) 77 101.45 123.63 34 44.16
5276. H. (mousegeek) 2 101.45 103.53 1 50.00
5277. Michael Angelo (micky15) 11 101.45 111.12 6 54.55
5278. TERT (antonhsu) 10 101.45 118.99 5 50.00
5279. Jahed (jahed100) 484 101.44 122.47 264 54.55
5280. adam (adumyumyum) 3 101.44 120.63 2 66.67
5281. Hkishi (hkishi) 1 101.44 101.44 0 0.00
5282. Lubo (lubokkanev) 26 101.44 117.88 10 38.46
5283. Owen (owenl131) 18 101.44 113.32 10 55.56
5284. JusticeEX (justiceex) 249 101.43 149.19 97 38.96
5285. Miguel (anckael) 130 101.43 122.90 61 46.92
5286. CHeezs (cheezs) 258 101.43 135.09 174 67.44
5287. Delgerskhn (thege) 145 101.43 121.67 54 37.24
5288. Rodrigo (zurrion) 12 101.43 118.53 12 100.00
5289. Jurre (jurrevonk) 8 101.42 131.85 6 75.00
5290. Terrance (terrance1120) 2 101.42 111.35 2 100.00
5291. Teen (teenunicorn) 24 101.42 122.26 9 37.50
5292. ChosilogRTX (chosilogrtx) 313 101.42 143.77 136 43.45
5293. Dovi (dovi1337) 1 101.41 101.41 0 0.00
5294. unowildcard (unowildcard) 11 101.41 112.47 6 54.55
5295. Katherine (kleesaunders) 15 101.41 127.75 3 20.00
5296. hayde (oofba) 14 101.40 118.87 8 57.14
5297. ZlotZ (zlotz) 3 101.40 109.38 0 0.00
5298. G (gc3shadow) 71 101.39 126.70 38 53.52
5299. Joseph (jkc7) 25 101.39 113.25 5 20.00
5300. Adam (goodboyadam) 33 101.39 130.26 9 27.27
5301. Johnathan (jellyowar308) 68 101.39 122.61 27 39.71
5302. iGodShark (igodshark) 2 101.39 102.23 2 100.00
5303. Lent√es (lemoninapie) 60 101.38 135.48 28 46.67
5304. Andrew (andrewfbr) 12 101.38 121.86 6 50.00
5305. Danny (dannyzzzzz) 197 101.38 128.31 76 38.58
5306. CJB314 (cjb314) 5 101.37 103.84 5 100.00
5307. Taken (itztaken) 11 101.37 115.39 6 54.55
5308. Kevin (kpark0421) 1 101.37 101.37 0 0.00
5309. Nicolas (kingofpandas) 1 101.37 101.37 0 0.00
5310. jnnwn (jnnwn) 9 101.37 108.01 6 66.67
5311. Johnny (onireves) 18 101.36 126.07 10 55.56
5312. Adam (toaadam) 1 101.36 101.36 0 0.00
5313. Krittiphum (100508274) 127 101.36 122.35 54 42.52
5314. Type like never before! (re... 932 101.36 143.82 393 42.17
5315. Andy (6arb) 14 101.36 115.57 7 50.00
5316. Kalle (kekeldur1) 6 101.35 123.57 2 33.33
5317. Aviatato (aviatato) 3 101.35 110.10 1 33.33
5318. jiin (jiinko11) 1 101.34 101.34 0 0.00
5319. Actinom (actinom) 2 101.34 107.26 1 50.00
5320. soraZ (fusionn) 7 101.34 115.63 3 42.86
5321. Neil (neilborde) 35 101.33 122.55 12 34.29
5322. Dankest (dankesttt) 4 101.32 114.66 0 0.00
5323. monochrome (artemis_05) 910 101.32 132.00 361 39.67
5324. Michael (meowmeowmikey) 19 101.32 131.15 9 47.37
5325. abhimanyu (cvfz) 6 101.32 114.29 2 33.33
5326. anubha (agoop) 1 101.31 101.31 1 100.00
5327. suleman (suleman33) 7 101.30 126.05 5 71.43
5328. Jamie (mac785) 2 101.30 104.22 2 100.00
5329. cade (lunacy_) 7 101.29 108.30 3 42.86
5330. Austin (austinmarton) 73 101.29 123.85 27 36.99
5331. lawnardo (lawnardo) 3 101.29 114.98 3 100.00
5332. CHIEN (chient) 29 101.29 112.36 10 34.48
5333. skeleton (skeleton0) 28 101.29 117.20 13 46.43
5334. v0lkoff (v0lkoff) 8 101.29 119.61 4 50.00
5335. Dirix (dirix1219) 3 101.29 115.95 2 66.67
5336. Albert (alb3rth3nry) 33 101.29 118.77 14 42.42
5337. fwEWE (edward3001) 23 101.29 134.56 18 78.26
5338. j (jas1yne) 26 101.29 114.99 9 34.62
5339. (nalyd_on_colemak) 44 101.29 156.07 0 0.00
5340. Cobra (cobra03) 7 101.28 115.45 3 42.86
5341. pathhologic (pathhologic) 52 101.27 141.13 23 44.23
5342. ashley (ashleyybbae) 14 101.27 113.53 10 71.43
5343. Typing (drained_typist) 21 101.27 114.27 11 52.38
5344. Vein (pluflmufn) 2 101.27 119.67 1 50.00
5345. RaV (rav_the_writer) 147 101.26 124.74 61 41.50
5346. Owen (123ojb) 12 101.26 109.43 0 0.00
5347. Justin (xpirep) 17 101.26 119.19 6 35.29
5348. Byran (byran_tech) 6 101.26 121.67 4 66.67
5349. Chauncey (hauncey) 2 101.25 102.02 2 100.00
5350. Lauren (merpling) 7 101.25 113.31 5 71.43
5351. Noah (slankynoah) 4 101.25 107.88 4 100.00
5352. tracy (viscassia) 2 101.25 110.12 1 50.00
5353. Andrew (cinderwisp) 2 101.25 118.63 1 50.00
5354. mikey (buzzpmikey) 11 101.24 123.45 7 63.64
5355. chopsueyrice (chopsueyrice) 6 101.23 109.21 2 33.33
5356. Cam (cambrown) 4 101.23 111.90 3 75.00
5357. DevGuyAhnaf (ahnafzamil) 8 101.23 120.12 8 100.00
5358. Andrew (taroth) 10 101.23 119.97 4 40.00
5359. emily (swimmerpenguin) 17 101.22 118.35 10 58.82
5360. jam (jamola) 9 101.22 113.25 5 55.56
5361. Luke (generalna13) 1 101.22 101.22 0 0.00
5362. Bradley (xerius1234) 1 101.22 101.22 0 0.00
5363. Griffin (asdwz458) 3 101.22 114.32 3 100.00
5364. Tommy (tortipous) 6 101.22 117.79 4 66.67
5365. Cameron (cameronicheese) 199 101.22 137.52 81 40.70
5366. BytePride (bytepride) 2 101.22 108.53 1 50.00
5367. Miles (jetblxckwalls) 126 101.21 126.02 57 45.24
5368. TaxKween (sadiek) 5 101.21 108.31 4 80.00
5369. bruuuh (bruhxfish) 36 101.21 120.41 12 33.33
5370. Michael (eilreivax) 23 101.20 117.91 4 17.39
5371. Nicolas (yulkbbq) 24 101.20 113.42 7 29.17
5372. Darrel (darrelyap) 2 101.20 104.28 1 50.00
5373. Louie (louie4825) 11 101.20 119.26 8 72.73
5374. lmao (nate11111) 43 101.19 119.32 15 34.88
5375. Barry (somalisam) 8 101.19 114.59 4 50.00
5376. Luan (yoitsluan) 4 101.18 111.77 3 75.00
5377. Harrison (160810601) 5 101.18 108.39 4 80.00
5378. Joe (alux) 1 101.17 101.17 0 0.00
5379. Joseph (peterepeat) 6 101.17 103.47 0 0.00
5380. Yu (sadochist) 112 101.16 119.90 50 44.64
5381. CelerySticks (whatan0b) 119 101.15 123.16 47 39.50
5382. Norris (xcnorris) 2 101.15 111.36 0 0.00
5383. exqlouuebnfpgts (spitemim) 45 101.14 124.09 32 71.11
5384. Justin (justin_ephemeral) 9 101.14 112.54 8 88.89
5385. doniee (doniee) 33 101.14 114.70 12 36.36
5386. Mickey (m_qwerty) 7 101.13 109.32 2 28.57
5387. Steven (drominar) 1 101.13 101.13 0 0.00
5388. f (fulmerformal) 8 101.12 109.90 4 50.00
5389. Barton (xbarton) 7 101.12 107.24 0 0.00
5390. banana (intrepid_banana) 15 101.12 119.10 8 53.33
5391. Will (theracer69) 2 101.12 107.30 0 0.00
5392. gtyf10 (aloserthatcanonlyty... 1 101.12 101.12 1 100.00
5393. Nathan (nbx3k) 11 101.12 114.88 5 45.45
5394. AouiGui (andersgrymer) 146 101.12 126.27 64 43.84
5395. altaire (notchrubble) 64 101.11 123.13 23 35.94
5396. Silver (silveryue) 1 101.11 101.11 1 100.00
5397. Abdullah (azaidrahman13) 2 101.11 105.53 1 50.00
5398. Ghazanfer (ghazanfer) 5 101.10 115.97 1 20.00
5399. karen (lvl100karen) 16 101.10 111.96 9 56.25
5400. Electronic (emil2107) 3 101.09 110.25 1 33.33
5401. Abhi (theabhster) 2 101.09 108.62 1 50.00
5402. AuroraSpirix (auroraspirit) 19 101.08 130.84 8 42.11
5403. James (js921) 5 101.08 110.64 2 40.00
5404. Catroomba (cat_roomba) 4 101.08 111.31 2 50.00
5405. Arkinator (arkinator) 7 101.07 117.82 5 71.43
5406. Cog (baritune) 6 101.07 107.35 3 50.00
5407. HiHowIsYourDay (hihowisyour... 24 101.07 125.45 3 12.50
5408. Heathe (hwhl) 24 101.06 119.39 9 37.50
5409. Mihir (mihirthecoolboi) 3 101.05 106.73 3 100.00
5410. Evan (swang88) 4 101.05 108.63 1 25.00
5411. Slobky (lmaoxdlolrofl) 14 101.04 121.76 5 35.71
5412. Nick (nick12342) 2 101.04 114.04 1 50.00
5413. adsf (max_m7) 1,182 101.04 144.36 467 39.51
5414. Brian (krayons) 2 101.03 104.08 1 50.00
5415. Choco (choco22) 586 101.03 159.91 241 41.13
5416. Ariel (drofniarg) 12 101.03 120.51 7 58.33
5417. u03 (u03_colemak) 6 101.02 113.31 1 16.67
5418. abel (lessthanthirtyfive) 25 101.02 110.57 10 40.00
5419. iRqx (irex_) 7 101.02 108.75 5 71.43
5420. Andrew (gremlinbaby) 1 101.02 101.02 1 100.00
5421. Gustavo Fring (cxmpy) 28 101.01 119.25 11 39.29
5422. bob (gongster) 2 101.01 114.57 2 100.00
5423. Keane (flaminbanana) 4 101.00 115.21 1 25.00
5424. Philip (theworstracer) 2 101.00 101.73 1 50.00
5425. Stephen (snivithefox) 2 101.00 101.12 1 50.00
5426. jasepa (tyreesepapi) 2 100.99 102.15 2 100.00
5427. Max (thisismydrive1997) 135 100.99 117.51 43 31.85
5428. Tim (jackychan564) 12 100.98 129.47 4 33.33
5429. Rui (adranos) 7 100.98 108.05 4 57.14
5430. Julien (mrroy3) 2 100.97 101.79 0 0.00
5431. beehah (beehahem) 14 100.96 115.92 7 50.00
5432. Christina (chrxstina) 2 100.96 103.37 2 100.00
5433. Shane (shane_woosh) 80 100.95 123.02 38 47.50
5434. Cyn (cyphex) 30 100.95 118.61 9 30.00
5435. glaucomer (glaucomer) 2 100.94 104.64 1 50.00
5436. Justin (bothon21) 26 100.93 122.88 12 46.15
5437. karina (kiinqdom) 1 100.93 100.93 1 100.00
5438. Chad (sixpacksexy) 51 100.92 119.79 16 31.37
5439. Fat Squirrel (neihs) 184 100.92 129.56 87 47.28
5440. Brendan (barefootcatfish) 1 100.92 100.92 1 100.00
5441. TypeLearner21 (typelearner21) 298 100.91 124.99 141 47.32
5442. Benjamin (justaregularnerd) 1 100.91 100.91 1 100.00
5443. halfwet (halfwet) 2 100.91 102.52 2 100.00
5444. waterismagnificent (wateris... 704 100.91 136.98 299 42.47
5445. Kevin (pekkanator1) 89 100.91 124.15 39 43.82
5446. Craig (crvig) 5 100.91 111.75 4 80.00
5447. DeltaDraco (delta_draco) 8 100.90 108.01 3 37.50
5448. BadScam (badscam) 1 100.90 100.90 0 0.00
5449. daniel (dsong56) 7 100.89 113.23 2 28.57
5450. Floopy (floopy__) 30 100.89 122.19 16 53.33
5451. Zuramaru (helena_meta) 6 100.89 112.75 3 50.00
5452. Keziah (kookiru) 15 100.89 116.46 7 46.67
5453. Giorgi (0_alien) 5 100.89 120.59 1 20.00
5454. S (sarahac) 13 100.89 119.16 8 61.54
5455. Dodi (dodic) 12 100.89 108.01 5 41.67
5456. kovi (kovizzz) 12 100.88 121.63 4 33.33
5457. Rivalnegro (rivalnegro) 1 100.88 100.88 1 100.00
5458. Björn Orri (bjornorri) 1 100.88 100.88 1 100.00
5459. Juan (isayuno) 19 100.88 114.53 10 52.63
5460. edward (bloodyrainbow) 54 100.88 125.12 15 27.78
5461. ronaldo (ronaldo_gao) 48 100.88 131.04 18 37.50
5462. To (tomo01) 3 100.87 106.20 1 33.33
5463. Ernest (ernestl_lalo) 1 100.86 100.86 0 0.00
5464. Michael (v3spula) 77 100.86 131.40 19 24.68
5465. QLONA 🥵 (yeyas) 14 100.86 126.92 5 35.71
5466. B (nonemorenegative) 30 100.86 144.79 12 40.00
5467. Radek (fssx) 6 100.86 116.57 2 33.33
5468. Carter (thecartel) 495 100.86 131.59 201 40.61
5469. Ali (dracius16) 7 100.85 115.26 2 28.57
5470. deicius (vantaclock) 1 100.85 100.85 0 0.00
5471. Varaug (varaug33) 20 100.85 110.33 11 55.00
5472. Joe (bop1000) 40 100.84 116.67 16 40.00
5473. goober (megumin00) 1 100.84 100.84 0 0.00
5474. Alper (skroas) 1 100.84 100.84 1 100.00
5475. Marko (polarbear1229) 375 100.84 132.74 147 39.20
5476. Chelsea (cakeling) 4 100.84 108.75 3 75.00
5477. Baslay (baslay) 2 100.83 103.56 2 100.00
5478. joel (ibeatjoeleverytime) 25 100.83 123.26 7 28.00
5479. Ricky (rickyr) 4 100.83 113.97 1 25.00
5480. AhmedSalem (mrtempo) 4 100.82 104.00 2 50.00
5481. khye (khyelerk) 8 100.82 129.55 3 37.50
5482. Rosvaldas (27god) 2 100.82 110.06 1 50.00
5483. Colin (sticklin10) 5 100.82 105.71 1 20.00
5484. Roo (trepur349) 29 100.82 123.97 11 37.93
5485. Kevin (zenicide) 19 100.81 120.76 8 42.11
5486. Anonymous (argong1) 10 100.81 127.62 5 50.00
5487. wantingpawer (wantingpawer) 14 100.81 120.30 8 57.14
5488. Aymscird (aymscird) 109 100.81 121.18 45 41.28
5489. Jeydin (jjthejetship) 1 100.81 100.81 1 100.00
5490. Conrad (conrad7) 18 100.80 117.00 8 44.44
5491. Marshall (stackattack14) 12 100.80 118.15 7 58.33
5492. Majd (scrollchamp) 2 100.80 105.39 1 50.00
5493. Jakub (xaneth) 12 100.80 115.61 4 33.33
5494. HiroHero (hirohero89) 33 100.80 121.10 13 39.39
5495. Jack (delysid) 8 100.80 119.46 3 37.50
5496. Jack (handsomejam) 15 100.79 114.51 6 40.00
5497. Death (deathexploit) 16 100.79 116.71 16 100.00
5498. Alex (alexswearingen) 4 100.79 102.01 3 75.00
5499. Ben (izeben) 54 100.78 122.07 17 31.48
5500. CrazyNeighbor (5qcheng007) 49 100.78 121.85 20 40.82
5501. alex (aalextr) 3 100.78 110.42 2 66.67
5502. Masuikai (masuikai) 1 100.78 100.78 1 100.00
5503. robloxyboy1212 (robloxyboy2... 110 100.78 136.54 43 39.09
5504. Oscar (peccary) 3 100.77 114.85 1 33.33
5505. Noman (middlero) 1 100.77 100.77 0 0.00
5506. Sam (supersam317) 7 100.77 110.70 4 57.14
5507. CHRON (chronnie) 3 100.77 108.93 1 33.33
5508. Werdna (werdnawerd) 3 100.77 104.22 2 66.67
5509. jasmine (jsmine) 9 100.76 117.23 1 11.11
5510. william (thefastest69) 76 100.76 134.25 23 30.26
5511. watchdominion.com (leegunner) 42 100.76 125.28 14 33.33
5512. B (hulk800) 1 100.76 100.76 1 100.00
5513. chuu (chuuceae) 40 100.76 127.19 36 90.00
5514. Zach (zman30533) 2 100.76 112.94 1 50.00
5515. Typinator (candymn3) 49 100.75 124.45 17 34.69
5516. Brownie (generalbrownie) 1 100.75 100.75 1 100.00
5517. galei (galei) 230 100.75 139.88 92 40.00
5518. Rikesh (rikesh) 44 100.75 129.96 25 56.82
5519. TheMayoTyrant (themayotyran... 2 100.74 131.53 1 50.00
5520. Mathias (doomthunder) 1 100.73 100.73 0 0.00
5521. Youri (yourischuur) 28 100.73 125.78 9 32.14
5522. Tree (tmoh) 13 100.73 121.31 12 92.31
5523. sheep (theonesheep) 127 100.72 129.58 53 41.73
5524. Ariel (aricori21) 1 100.72 100.72 0 0.00
5525. bob (typer_bob) 8 100.72 114.41 2 25.00
5526. ??? (5apphire) 2 100.72 100.93 0 0.00
5527. W (wbhizzle7) 29 100.71 122.04 6 20.69
5528. Joseph (alatar) 1 100.71 100.71 0 0.00
5529. Lin (lin_ming) 454 100.70 128.79 190 41.85
5530. Radeyz (pineapples2925) 4 100.70 113.53 0 0.00
5531. Top (tophatjones) 21 100.70 114.45 21 100.00
5532. Matt (choofkoof) 17 100.69 112.59 10 58.82
5533. fingers hurt (cxyym) 20 100.69 116.49 10 50.00
5534. Kariem (unpluggedzors) 5 100.69 110.84 2 40.00
5535. Katie (kaytay0111) 9 100.69 123.25 1 11.11
5536. Mythrick (mythrick) 66 100.69 122.52 27 40.91
5537. JJ (thejapie) 8 100.69 107.24 5 62.50
5538. sophia (sophiacav) 25 100.69 111.74 7 28.00
5539. DENYS (denysesjs) 21 100.68 114.35 13 61.90
5540. Mike (ascential) 4 100.68 111.74 3 75.00
5541. lebron (lebron_mccain) 1 100.68 100.68 1 100.00
5542. kerokero (urechila) 1 100.68 100.68 0 0.00
5543. TypingMaster3 (typingmaster... 938 100.68 136.27 384 40.94
5544. zero (ozero) 26 100.68 117.30 11 42.31
5545. bids (donuxes) 4 100.68 117.26 2 50.00
5546. Matthais (maciejosas2012) 18 100.67 116.74 5 27.78
5547. curious (allodic) 19 100.67 116.07 11 57.89
5548. Gerard (ultimagnusv2) 5 100.67 107.57 1 20.00
5549. Senseiparks (senseiparks) 8 100.67 111.55 3 37.50
5550. car (nostalgiatest) 90 100.67 130.51 40 44.44
5551. Sonatry (danyannang) 115 100.67 116.91 43 37.39
5552. Calvin (cheekuan321) 8 100.67 121.60 5 62.50
5553. BIdi (bidi) 8 100.67 109.33 4 50.00
5554. Josh (jdh4211) 3 100.67 113.92 1 33.33
5555. leakcentral (leakcentral) 10 100.67 112.41 4 40.00
5556. Petr (bigbang1112) 21 100.66 116.10 9 42.86
5557. Timothy (timataio) 4 100.66 109.77 2 50.00
5558. Bernard's (bmadayag) 13 100.66 118.59 6 46.15
5559. Frederik (dobobay) 5 100.65 116.14 2 40.00
5560. Anthony (ianozia) 1 100.65 100.65 1 100.00
5561. Free Palestine 🩸🫸 (mo... 832 100.64 141.61 304 36.54
5562. Nutalie (frostybeep) 5 100.64 107.84 4 80.00
5563. Tahir (tahir_iqbal) 210 100.63 129.73 88 41.90
5564. BananaLieutenant (bananalie... 5 100.63 104.06 2 40.00
5565. Martin (therealmartin) 2 100.63 101.43 2 100.00
5566. Victor (victorfaarvang) 9 100.62 121.34 1 11.11
5567. Troy (tdserapio) 7 100.62 108.22 5 71.43
5568. Mewi (metalwihen) 1 100.62 100.62 0 0.00
5569. Danyon (gasperdb) 3 100.62 116.41 1 33.33
5570. Leo (waoping) 2 100.62 105.03 2 100.00
5571. Harsit (baral) 4 100.62 115.73 2 50.00
5572. Guillermo (andragoner) 19 100.61 128.04 3 15.79
5573. Kenny (riggedcontingency) 11 100.61 110.49 5 45.45
5574. Maruberry (maruberry) 43 100.61 126.75 15 34.88
5575. Jun Jie (lemontea387) 54 100.60 124.17 22 40.74
5576. Allistare (shinryu1324alt) 313 100.60 119.41 139 44.41
5577. sael (saeleths) 4 100.60 105.08 1 25.00
5578. Davis (thatrednismo) 13 100.59 118.93 4 30.77
5579. I can't type!!! (roychan1) 25 100.59 129.92 12 48.00
5580. Narut (blowingbubbles) 59 100.59 124.78 22 37.29
5581. milan (milansep27) 15 100.59 115.28 14 93.33
5582. dimash (dsquared_210t93) 2 100.59 103.17 1 50.00
5583. ( ͡° ͜ʖ ͡°) (zarthax69) 39 100.58 125.44 19 48.72
5584. Comfy_Kitten (comfykitten) 35 100.58 119.53 13 37.14
5585. Isaac (carokann09) 17 100.58 113.60 1 5.88
5586. Xetin (xetin) 9 100.58 117.42 1 11.11
5587. Tar (typer_noob) 139 100.58 126.19 47 33.81
5588. King (kjarr) 1 100.57 100.57 1 100.00
5589. BLURB (snowq) 25 100.56 117.44 12 48.00
5590. David (puchando) 3 100.56 110.50 1 33.33
5591. King (king_gamesbr) 2 100.56 106.45 2 100.00
5592. zn (ittahb) 7 100.56 117.45 3 42.86
5593. bitter (bitternightmares100) 8 100.55 112.57 4 50.00
5594. Stefan (zekan) 9 100.55 112.93 3 33.33
5595. nitewaver (spita) 1 100.55 100.55 1 100.00
5596. CJ (sansaic) 1 100.54 100.54 0 0.00
5597. Charlie (chardlz) 13 100.54 118.24 6 46.15
5598. Dookie Shoes (dookie_shoes) 19 100.54 124.57 6 31.58
5599. Daniel (blastanks) 9 100.53 117.49 2 22.22
5600. Morgan (evirabbi) 8 100.53 115.46 1 12.50
5601. Iris (iris) 6 100.53 115.23 1 16.67
5602. Jack (yolomcswag56) 1 100.53 100.53 1 100.00
5603. a (eqnzio) 11 100.53 115.31 5 45.45
5604. Fresca (reifresca) 76 100.53 115.84 19 25.00
5605. Marc (mghale_215) 117 100.52 126.40 45 38.46
5606. Dex (dexister) 3 100.52 108.93 2 66.67
5607. s (siscari) 2 100.52 110.65 2 100.00
5608. cam (cameron) 2 100.52 110.27 2 100.00
5609. i am (ashou) 209 100.51 141.45 82 39.23
5610. KampiiTV (noahmarvin) 1 100.51 100.51 0 0.00
5611. savannah (wiggywonka) 49 100.51 118.85 17 34.69
5612. Carlo (carlofletcher) 16 100.51 121.99 8 50.00
5613. Hik (hikjik) 2 100.51 105.94 1 50.00
5614. EgyptianTyper (emptybox34) 17 100.50 111.41 7 41.18
5615. Chet (chethus) 40 100.50 120.75 12 30.00
5616. Zerrox (zerrox) 33 100.50 116.99 16 48.48
5617. Nolan (pestanon23) 4 100.50 119.78 4 100.00
5618. Samuel (sambg) 9 100.49 109.81 6 66.67
5619. Birdacious (birdacious) 2 100.49 101.41 1 50.00
5620. poptarts (kwakyunk) 5 100.48 116.46 3 60.00
5621. The One (ridick_the_one) 4 100.48 110.42 2 50.00
5622. Aravind (aravindsreeram) 10 100.47 115.86 6 60.00
5623. æ (ac343) 16 100.47 118.13 7 43.75
5624. FrozenCroissant (frozencroi... 212 100.47 126.98 100 47.17
5625. ( ˙꒳​˙ ) (nizuu) 5 100.47 120.27 2 40.00
5626. jeakai (lolilo123) 25 100.46 125.39 7 28.00
5627. T (tt147) 11 100.46 113.00 5 45.45
5628. Lightning (nirajp) 14 100.45 109.62 5 35.71
5629. Craig (vitalagendas) 5 100.45 113.81 1 20.00
5630. Sarah (sarahday) 13 100.45 117.75 7 53.85
5631. 100% (100percentaccurate) 45 100.45 120.64 20 44.44
5632. Shikhar (shikhar_tyagi) 21 100.45 115.02 10 47.62
5633. Kevin (ibekevinn) 92 100.44 124.72 51 55.43
5634. SG Keyboard Warrior (singap... 7 100.44 120.56 3 42.86
5635. Chronopolize (chronopolize) 178 100.44 141.64 62 34.83
5636. Adimas (frostyslr) 9 100.43 117.67 7 77.78
5637. Pinkies (smile_typer) 29 100.43 115.66 15 51.72
5638. Alec (alxiang) 14 100.43 123.94 2 14.29
5639. Nishan (nishanepic) 3 100.43 101.91 1 33.33
5640. zyuken (spaceee) 90 100.43 143.40 35 38.89
5641. Exeadra (exeadra) 2 100.43 106.60 2 100.00
5642. F. (yrebainahs) 68 100.42 120.45 28 41.18
5643. Saber (saberspeed777) 35 100.41 121.44 13 37.14
5644. David (xpoes) 3 100.41 105.11 2 66.67
5645. Seth (syarb) 186 100.41 125.31 92 49.46
5646. Tippy (tippytaptyper) 13 100.41 126.30 3 23.08
5647. Khoi (khoitran) 565 100.41 128.62 253 44.78
5648. Jacob (jpoopy) 8 100.41 108.05 4 50.00
5649. yi hein (friends) 1 100.41 100.41 0 0.00
5650. Rezevic (rezevic) 1 100.41 100.41 1 100.00
5651. dick (pools2) 6 100.41 112.37 5 83.33
5652. Tunihorn (tunihorn) 20 100.40 131.37 11 55.00
5653. Kartswag (swagkid) 7 100.40 109.29 5 71.43
5654. B A L O CH (ashfaq4730) 13 100.40 124.31 5 38.46
5655. Bunda (bundapump) 4 100.40 109.19 4 100.00
5656. Kimchi (jrhee) 16 100.39 125.25 6 37.50
5657. Zuhaer (zaszuhaer) 64 100.38 115.91 22 34.38
5658. Tinumír (tinumir) 1,086 100.38 125.01 481 44.29
5659. Ardison (arddison) 139 100.37 116.73 50 35.97
5660. Iniquity (iniquityqt) 6 100.37 107.44 1 16.67
5661. pee (iluvuhi) 1 100.36 100.36 0 0.00
5662. Jeff (golddragon4) 1 100.36 100.36 1 100.00
5663. Efgeen (efgeen) 22 100.36 129.99 10 45.45
5664. shellyshellyshellyumm (blue... 35 100.35 114.97 13 37.14
5665. V (vy171) 10 100.35 130.17 1 10.00
5666. Jacob (necromuncher) 4 100.35 107.27 0 0.00
5667. Tom (tacocatdeboss) 8 100.34 115.50 2 25.00
5668. Viktor (wector77y) 322 100.33 157.78 118 36.65
5669. David (pherric0xide) 1 100.33 100.33 0 0.00
5670. MrSaand (mrsaand) 185 100.32 115.98 64 34.59
5671. Adam (adamisspeed) 8 100.32 133.51 3 37.50
5672. Pisti (doctorstave) 13 100.31 110.87 8 61.54
5673. Abay (lukcy) 4 100.30 123.06 4 100.00
5674. midi (midija) 2 100.30 110.10 1 50.00
5675. Eldin (oktea) 19 100.29 118.98 8 42.11
5676. Frostsights (frostsights) 37 100.29 119.34 11 29.73
5677. Leon (extremegamer116) 19 100.29 125.96 5 26.32
5678. nocchio (nocchio) 34 100.29 119.60 10 29.41
5679. Alex (majorfontes) 1 100.29 100.29 0 0.00
5680. kylie (bibiq) 1 100.29 100.29 1 100.00
5681. storpa (storpa26) 2 100.29 103.22 1 50.00
5682. bluesheep97 (bluesheep97) 3 100.28 102.64 3 100.00
5683. Denis (l2p200iqplays) 9 100.28 110.25 3 33.33
5684. ben (spirxt223) 4 100.27 105.73 3 75.00
5685. zackjh (zacharykjh) 4 100.27 112.56 2 50.00
5686. Theis (viggotheis) 2 100.27 112.54 1 50.00
5687. Kai (testphylean) 14 100.26 115.06 6 42.86
5688. Eichi (eichitenshouin) 12 100.26 120.58 5 41.67
5689. Nigerian (poobear_) 7 100.26 125.97 3 42.86
5690. Umbra (tratosian) 3 100.26 115.44 1 33.33
5691. andy (yourmumgey) 12 100.25 128.97 5 41.67
5692. Welcometomycrucifixion (tim... 101 100.24 118.66 35 34.65
5693. Tony (naka__) 87 100.23 129.84 32 36.78
5694. Naresh (303nash) 8 100.22 105.30 3 37.50
5695. Aki (agidaman) 5 100.22 109.18 2 40.00
5696. bp4dn (bp4dn) 30 100.22 121.91 11 36.67
5697. J0hn (johnjonez23) 8 100.21 107.31 2 25.00
5698. Olaf (vikingishly) 2 100.21 110.92 1 50.00
5699. Matthew (windowsmasherx5) 5 100.20 111.62 2 40.00
5700. Ed (selfe) 1 100.20 100.20 0 0.00
5701. Jasper (jasper_bee) 2 100.20 107.57 0 0.00
5702. Ngoc (maxq42) 250 100.19 121.94 78 31.20
5703. Kolock (kolock) 71 100.19 123.92 28 39.44
5704. Byron (byrontan) 203 100.19 125.81 99 48.77
5705. Drew (bigboisausage) 200 100.18 134.57 79 39.50
5706. floffy (floffyunicorn) 11 100.18 116.69 4 36.36
5707. Sam (samschreibt) 8 100.18 112.68 4 50.00
5708. Albert (frequentflyer123) 13 100.18 108.17 5 38.46
5709. 79 Camaro (79camaro737) 78 100.18 124.31 30 38.46
5710. BigChungus (vynzvynz) 517 100.17 142.68 223 43.13
5711. Kevin (kevindkao) 11 100.17 118.18 4 36.36
5712. Rohit (rvighne) 1 100.17 100.17 0 0.00
5713. Doggo (doggocz) 18 100.17 116.20 5 27.78
5714. hibbobibbo (hibbobibbo) 6 100.17 114.01 1 16.67
5715. Torrey (lavamob64) 73 100.17 123.80 35 47.95
5716. Bryle (itsbrytastic) 12 100.16 114.74 7 58.33
5717. headtr1p (headtr1p) 9 100.16 118.12 6 66.67
5718. that guy (judewastaken) 4 100.16 105.49 1 25.00
5719. Max (maxlau09) 8 100.16 104.42 5 62.50
5720. Lucky (bigowlyeyes) 24 100.16 112.93 7 29.17
5721. Ma (thyassasin98) 6 100.16 106.27 3 50.00
5722. Emma (cuddleeee) 1 100.15 100.15 0 0.00
5723. John (hakabubu) 5 100.15 109.92 3 60.00
5724. t0xy47 (t0xy47) 2 100.15 102.04 1 50.00
5725. autoelk (lukefly2) 3 100.14 110.32 2 66.67
5726. Pro (progeorge123) 51 100.13 131.70 24 47.06
5727. E (typemctypeface) 61 100.13 118.95 20 32.79
5728. Luis (tallwhitestck) 8 100.13 107.71 7 87.50
5729. i (ivantse2) 11 100.12 111.79 7 63.64
5730. Papa (solutional) 22 100.12 122.37 11 50.00
5731. skanda (skandarajeev) 6 100.12 114.33 5 83.33
5732. Bijji (thatboywulfric) 299 100.11 125.26 138 46.15
5733. Mauricio (maurizzzio) 3 100.11 112.26 0 0.00
5734. account deleted (concurrent) 889 100.10 137.17 21 2.36
5735. Ethan (ethan_5) 118 100.10 129.70 47 39.83
5736. lyu (lyurisu) 13 100.09 117.94 9 69.23
5737. yaeda (yaeda) 9 100.09 110.97 4 44.44
5738. Only typing will save the w... 7 100.09 106.25 2 28.57
5739. Abdullah (fe4rlesscloak) 16 100.09 119.65 8 50.00
5740. Michael (axaladyx) 646 100.08 134.50 259 40.09
5741. Sun (suncrusader) 3 100.08 109.49 2 66.67
5742. Mary (calamary) 4 100.08 111.40 1 25.00
5743. Luis (chiklay) 11 100.08 123.09 1 9.09
5744. Santiago (londono19) 56 100.08 123.36 16 28.57
5745. bub (_bubble) 187 100.08 125.38 82 43.85
5746. Brody (clocktoc) 5 100.06 109.22 2 40.00
5747. Dimitar (renoxtv) 3 100.06 111.22 1 33.33
5748. Allan (unknownfiles) 43 100.06 120.76 15 34.88
5749. Potato (ragingpotato711) 3 100.06 102.34 1 33.33
5750. Joe (bigboythrows) 20 100.06 113.95 9 45.00
5751. Dean (de4n_whit3) 41 100.06 127.57 25 60.98
5752. Im Hacker (im_hacker) 30 100.05 117.55 16 53.33
5753. ??? (teslacia) 18 100.05 110.46 10 55.56
5754. Kevin (kevin6ooo) 1 100.05 100.05 1 100.00
5755. Kimmie (bryan_kimmie) 1 100.05 100.05 0 0.00
5756. eric (ericsy) 60 100.04 118.32 23 38.33
5757. Connor (yowassuphomies) 4 100.04 117.06 1 25.00
5758. Garrin (garrins) 5 100.04 111.71 2 40.00
5759. Gett (gettnumbers) 2 100.04 101.60 1 50.00
5760. Punch (pognick) 17 100.03 111.93 6 35.29
5761. Colby (kronkler) 2 100.03 101.00 0 0.00
5762. Tyler (fffish) 1 100.03 100.03 1 100.00
5763. speedy (speedydemonguy) 2 100.03 108.57 2 100.00
5764. Vali (ryuzul) 12 100.03 129.08 9 75.00
5765. Lucas (supermug) 517 100.02 138.14 208 40.23
5766. Vertennn (vertennn_) 9 100.02 112.50 6 66.67
5767. Boeing (planetyper78) 56 100.02 117.84 25 44.64
5768. Mackenzie (sgxserenity) 1 100.01 100.01 1 100.00
5769. Joey (joey_v) 1 100.01 100.01 0 0.00
5770. Will (ghostal) 88 100.01 125.83 40 45.45
5771. pong (pongix) 2 100.00 107.70 2 100.00
5772. Jason (jpngfile) 10 99.99 113.57 4 40.00
5773. Ian (tinysilverfish) 20 99.99 144.27 5 25.00
5774. Michael (crecious) 10 99.98 128.13 6 60.00
5775. Andy (superchubs) 3 99.98 102.60 2 66.67
5776. kikiki (kiki02613) 117 99.98 117.11 48 41.03
5777. Kyle (kyman73) 41 99.97 127.06 16 39.02
5778. sage (sage78) 1 99.97 99.97 1 100.00
5779. franiel (franiel97) 2 99.97 108.97 0 0.00
5780. Samantha (samantha_314) 19 99.96 117.69 10 52.63
5781. Elisa (elisac00) 6 99.96 111.87 3 50.00
5782. PixelFog (pixelfog) 19 99.96 111.62 6 31.58
5783. TheLegend27 (jethro2003) 10 99.95 107.66 6 60.00
5784. Ranit (colemakgang) 81 99.95 132.39 32 39.51
5785. Viki (roastedice) 8 99.94 121.66 6 75.00
5786. `jakeeee_ (jakee_) 15 99.94 123.41 7 46.67
5787. Green Tea (2001186) 86 99.93 131.76 24 27.91
5788. Aquaris (ryankim834) 2 99.93 104.43 2 100.00
5789. CJ (bighiest) 587 99.93 139.10 266 45.32
5790. Tom (twmc) 12 99.92 128.89 8 66.67
5791. David (ddellspe) 4 99.91 108.97 2 50.00
5792. Lotus (lotus7) 39 99.91 118.74 14 35.90
5793. SapCK (sapck) 50 99.91 122.21 21 42.00
5794. Loma (pbaloma) 290 99.90 123.26 104 35.86
5795. REE (reeeeeeeeee3) 1 99.90 99.90 1 100.00
5796. sausage fingers (otterrr) 24 99.90 127.01 11 45.83
5797. Kawaii (saranghoe) 63 99.90 126.73 28 44.44
5798.   (nt_chill) 33 99.88 118.27 12 36.36
5799. James (mauricetheferret) 3 99.88 110.43 1 33.33
5800. o (seticl) 29 99.88 125.44 11 37.93
5801. Ethan (rubiks3) 4 99.87 105.33 2 50.00
5802. Giorgio (luigi123mad) 6 99.87 112.55 2 33.33
5803. Mers (mers_0412) 260 99.87 122.50 108 41.54
5804. Bilbo (bilboballins) 250 99.86 132.19 93 37.20
5805. Nicolas (lollipopmania) 1 99.85 99.85 0 0.00
5806. Kevin (kinqkevinn) 2 99.85 100.01 1 50.00
5807. Diego (aceplex) 3 99.85 104.81 1 33.33
5808. ab (dabglob) 8 99.85 110.67 3 37.50
5809. Ramen (blazingramen) 14 99.84 110.32 6 42.86
5810. Sam (samgang) 3 99.84 108.76 1 33.33
5811. Matthew (mk07320) 2 99.84 111.60 2 100.00
5812. Harrison (har150n) 4 99.84 119.19 0 0.00
5813. Sebastian (tulanir) 71 99.83 122.67 30 42.25
5814. Stevie (stevie_thee_shep) 51 99.82 130.06 24 47.06
5815. Farm (pandamkii) 16 99.82 115.63 9 56.25
5816. xcz (xcz05) 15 99.82 109.62 4 26.67
5817. Viran (viranp) 102 99.82 126.07 43 42.16
5818. jwt4517 (jwt4517) 12 99.82 111.07 8 66.67
5819. Eugene (entilaren) 36 99.82 121.37 21 58.33
5820. Bob (galacticwolf7) 2 99.82 106.90 1 50.00
5821. Nice (nicekcoc) 6 99.81 114.79 6 100.00
5822. DY (yuyue1) 26 99.80 120.07 13 50.00
5823. Nithin (useless_net) 369 99.80 147.25 163 44.17
5824. Ethan (egoldman) 9 99.80 122.89 5 55.56
5825. shimona (shimonas) 2 99.80 106.94 1 50.00
5826. ace (aceguarde) 17 99.80 118.14 16 94.12
5827. Jack (orka_qwerty) 7 99.80 122.40 1 14.29
5828. albert (csnake) 11 99.79 106.64 5 45.45
5829. Jared (jrod44) 1 99.79 99.79 0 0.00
5830. Joshua (typing_huh1) 28 99.79 120.59 14 50.00
5831. BUSH (bushtyperacer) 3 99.79 103.82 1 33.33
5832. Federico (_cali) 7 99.78 112.45 4 57.14
5833. Mohamed (nitrousgamer) 1 99.78 99.78 0 0.00
5834. asdasdf (211bazooka) 74 99.78 122.23 27 36.49
5835. Aldreich (aldreich) 14 99.77 121.66 8 57.14
5836. Erik (joezuu) 5 99.77 106.74 3 60.00
5837. Jun (jjjun) 7 99.77 125.09 6 85.71
5838. Rad (radandrei) 31 99.77 110.83 19 61.29
5839. Renz (enriqatron52) 10 99.77 109.99 5 50.00
5840. Tom (jeronex) 1 99.76 99.76 1 100.00
5841. Applesauce (garbagetm) 6 99.76 110.93 0 0.00
5842. Dankman (dedankman) 15 99.76 112.53 5 33.33
5843. Sid (pokecrater1) 8 99.76 108.81 3 37.50
5844. Ahmad (asz13) 11 99.75 109.87 5 45.45
5845. Sky man (koolienavy) 220 99.75 135.87 91 41.36
5846. William (willteee) 29 99.74 123.77 8 27.59
5847. Michael (czapka) 1 99.74 99.74 0 0.00
5848. Electronica__ (electronica__) 600 99.73 126.40 263 43.83
5849. Raunak (englishassignment) 200 99.73 130.78 81 40.50
5850. Midas Gold (midasgold) 8 99.73 131.65 5 62.50
5851. I type slow (itypeslowlol1) 21 99.73 117.98 9 42.86
5852. Krisztian (monsteq) 4 99.73 105.63 1 25.00
5853. Pablo (pabloberwig) 1 99.72 99.72 0 0.00
5854. Brent (btent) 1 99.72 99.72 1 100.00
5855. Ryo (ashida4) 621 99.72 132.69 246 39.61
5856. Berry (peter_parker15) 5 99.71 104.98 1 20.00
5857. Tanamr (tanamr) 9 99.71 106.19 5 55.56
5858. Calvin (fullrespect) 104 99.71 119.58 59 56.73
5859. Declan (doctordirl) 81 99.71 116.91 27 33.33
5860. Birdo (killersiete) 2 99.71 100.30 2 100.00
5861. ollir (ollir) 15 99.70 107.53 9 60.00
5862. Amanda (musseama) 1 99.70 99.70 1 100.00
5863. Aditya (adi20raj) 5 99.70 108.50 2 40.00
5864. Chew (chewyixin99) 1 99.70 99.70 0 0.00
5865. Ricky (muffinpotato) 41 99.70 116.99 23 56.10
5866. Andrew (bonusducky) 14 99.70 115.36 1 7.14
5867. Jonathan (kamikazecupcake) 8 99.70 111.58 4 50.00
5868. LockStock (lockstock) 1,170 99.69 129.66 442 37.78
5869. Proximo (elliotkoh) 6 99.69 113.35 3 50.00
5870. joshua (jawwshuaa) 14 99.68 116.47 6 42.86
5871. Dev (sident) 26 99.68 118.14 14 53.85
5872. Elemental (elementl) 9 99.68 116.69 3 33.33
5873. bike (ikenim) 3 99.68 107.43 1 33.33
5874. Ariffin (ariffin) 214 99.67 127.89 86 40.19
5875. amy (rose51203) 35 99.67 125.87 8 22.86
5876. Aleksandar (usernamegold) 91 99.66 119.74 38 41.76
5877. Ian (hobbr) 1 99.66 99.66 1 100.00
5878. Jaskirat (jaskiratsingh) 55 99.65 128.48 26 47.27
5879. Emma (whyitsjustatypingsite) 1 99.65 99.65 0 0.00
5880. Say1 (beenzino) 1 99.65 99.65 1 100.00
5881. AAAA (asdkjfn) 6 99.65 104.37 2 33.33
5882. j (jj_weeb) 6 99.64 107.16 3 50.00
5883. Kaintu (kaintu) 5 99.63 105.77 2 40.00
5884. Reed (reedhaffner) 8 99.63 114.12 2 25.00
5885. James (ryyuu) 25 99.63 120.99 13 52.00
5886. Quick Fingers 69 (quickfing... 1 99.62 99.62 0 0.00
5887. keiko (keiiko) 1 99.62 99.62 0 0.00
5888. updog (danielseow) 77 99.62 118.42 25 32.47
5889. Chris (chrisljiang) 4 99.61 117.16 1 25.00
5890. Srinivas (srini_iitkgp) 16 99.61 114.28 8 50.00
5891. Darius (stormmate) 2 99.61 114.31 1 50.00
5892. G (dseus4) 2 99.61 103.10 1 50.00
5893. Kerry (i8pp) 3 99.61 133.88 2 66.67
5894. Edreith (edreith) 2 99.61 102.90 2 100.00
5895. Adrian (cui3e) 10 99.61 111.93 9 90.00
5896. bartosz34ek (bartosz34ek) 5 99.60 111.14 3 60.00
5897. Vic (vicjen) 10 99.60 114.09 6 60.00
5898. Caroline (carmur) 4 99.60 101.96 3 75.00
5899. I'm_on_mobile (yeetusthyfetus) 45 99.60 126.08 23 51.11
5900. Adrian (adrian_kokot) 3 99.59 115.00 1 33.33
5901. Rafey (practicerace) 4 99.59 114.90 3 75.00
5902. Gibson (better_gibby) 42 99.59 120.04 13 30.95
5903. Sock (yourlocalsock) 6 99.58 113.16 4 66.67
5904. Isaac (inied) 148 99.58 133.35 56 37.84
5905. arigrate (mercury80) 178 99.57 124.59 80 44.94
5906. Marco (andrefan69) 1 99.57 99.57 1 100.00
5907. hyeonk (hyeonk) 29 99.56 122.70 12 41.38
5908. teraah (teraah) 70 99.56 133.44 33 47.14
5909. Stuart (sturay) 11 99.55 111.77 6 54.55
5910. RabbitFood (rabbitfood) 1 99.55 99.55 0 0.00
5911. Dum (getintherobotshinji) 29 99.55 118.62 17 58.62
5912. yellow car (oddsorcery) 9 99.55 109.44 9 100.00
5913. Russell (russellsapphire) 18 99.54 117.19 7 38.89
5914. Jeb (gwenigale) 6 99.54 108.83 4 66.67
5915. Adamite (adamite2k) 55 99.54 122.21 17 30.91
5916. someonewhoisntlikeyou (some... 118 99.54 119.89 57 48.31
5917. (jasimk) 1,889 99.54 170.13 740 39.17
5918. jonica (jonicailagan) 98 99.54 123.00 32 32.65
5919. mrbasts10000dollarrefrigera... 12 99.54 111.08 5 41.67
5920. Justin (flamebun) 34 99.54 118.83 16 47.06
5921. Phoebe (snicklepickles) 4 99.53 101.50 2 50.00
5922. gabe (rasalguhl) 12 99.53 106.76 2 16.67
5923. shamppo (literallyatyper1) 6 99.53 122.22 3 50.00
5924. Nox (nymanne) 30 99.52 117.69 16 53.33
5925. dulux23 (dulux23) 122 99.52 121.63 47 38.52
5926. Skyyy06 (skyyy06) 49 99.52 121.67 17 34.69
5927. retainerbox (retainerbox) 1 99.52 99.52 1 100.00
5928. bob (sami1010) 3 99.51 105.72 0 0.00
5929. Afonso (eatotronic) 4 99.51 106.19 0 0.00
5930. conquodS (cobraa) 85 99.51 123.47 39 45.88
5931. suki (sackclothandashes) 9 99.51 110.88 2 22.22
5932. daniel (dpainter) 125 99.51 118.59 57 45.60
5933. prplx (prplx) 257 99.51 133.39 113 43.97
5934. Gabriel (gabrielfear) 2 99.51 103.84 1 50.00
5935. Uriel (urielhainzl) 3 99.50 107.63 2 66.67
5936. ♡ (meretricious) 1 99.50 99.50 0 0.00
5937. Hans (phindy) 17 99.50 124.79 3 17.65
5938. Tyler (superkai65) 204 99.49 127.42 77 37.75
5939. Moist (moist_bread) 6 99.49 104.74 3 50.00
5940. Venice (starbucks272) 10 99.48 107.79 4 40.00
5941. Bridget (boomsey) 29 99.48 124.37 13 44.83
5942. Timothy (timothylee) 14 99.48 112.05 5 35.71
5943. Siddhartha (sid_tiw) 62 99.48 120.07 31 50.00
5944. Alix (anahlia) 2 99.48 102.77 1 50.00
5945. kj (crioyri) 14 99.47 115.05 8 57.14
5946. Omer (omerrrr) 1 99.47 99.47 1 100.00
5947. maxigus (maxigus_mcfly) 9 99.46 109.39 6 66.67
5948. yong (topcool) 1 99.46 99.46 0 0.00
5949. Nagaku (nagaku) 260 99.46 127.84 90 34.62
5950. Ryan (xryann_) 5 99.46 104.62 1 20.00
5951. Matthew (zoddiak) 1 99.45 99.45 1 100.00
5952. lindee (lindee) 1 99.45 99.45 0 0.00
5953. shaan (khem92) 68 99.45 110.39 26 38.24
5954. big peepee man (mravocadoman) 6 99.44 116.60 5 83.33
5955. ultraXD (ultragamersss) 9 99.44 109.42 2 22.22
5956. Danny (ecgab) 43 99.44 118.32 17 39.53
5957. котакбассик (kot... 8 99.44 113.18 8 100.00
5958. Amit (amiteshore) 466 99.43 124.76 173 37.12
5959. Hiyam (v1ctor1x) 8 99.43 109.21 4 50.00
5960. TommiTMX (tommitmx) 8 99.43 110.75 5 62.50
5961. HKER (crafting112) 11 99.43 115.91 3 27.27
5962. Gianmarco (plagioclasio) 1 99.43 99.43 0 0.00
5963. Tony (creampuffy) 7 99.43 123.38 3 42.86
5964. Dog (dogtyper500) 2 99.43 110.00 1 50.00
5965. Ali (oplo) 27 99.42 122.04 9 33.33
5966. Jan (elapid) 78 99.42 116.52 37 47.44
5967. Dan (stefanstef) 11 99.42 114.15 7 63.64
5968. Reckt (reckt) 1 99.42 99.42 0 0.00
5969. Cooper (cglavin) 4 99.42 107.30 4 100.00
5970. PK251 (espk251) 5 99.42 117.31 2 40.00
5971. I really like lettuce (domi... 15 99.42 117.13 8 53.33
5972. aluminae (aluminae) 13 99.41 113.80 5 38.46
5973. pipez (pipez) 44 99.41 116.53 16 36.36
5974. ^_^ (pippens_) 4 99.41 119.71 2 50.00
5975. Sacha (viperfang) 4 99.41 104.96 4 100.00
5976. Farameer (farameer1) 191 99.41 123.72 69 36.13
5977. Roy (sisalt) 128 99.40 123.30 47 36.72
5978. Domen (antreu) 449 99.40 139.81 246 54.79
5979. John (seaofnonsense) 23 99.40 118.28 10 43.48
5980. Cameron (sigmaimu) 832 99.40 134.70 284 34.13
5981. FatCat (fatcat2) 3 99.40 102.45 2 66.67
5982. Lolpikachu (lolpikachu45) 2 99.40 115.27 1 50.00
5983. Anna (ayyross) 2 99.39 102.14 0 0.00
5984. roadto120 (raiyan2423) 7 99.38 109.36 3 42.86
5985. WindSlashKing (bujkata) 173 99.36 156.18 73 42.20
5986. Inkus (sinuema) 6 99.36 125.79 4 66.67
5987. tstats[maxwelljones] (maxwe... 86 99.35 122.31 32 37.21
5988. Benjamin Netanyahu (tp0d) 17 99.35 122.33 7 41.18
5989. Parker (grasshopper_weeb) 5 99.34 105.66 3 60.00
5990. Richard (dicklash) 1,131 99.33 128.73 438 38.73
5991. e (ex21424) 7 99.33 108.35 3 42.86
5992. Czar (wolfga) 2 99.33 109.89 1 50.00
5993. Elham (rivalry_) 3 99.33 109.28 1 33.33
5994. framespersecond (indires) 2 99.33 110.21 1 50.00
5995. omer (sashasin) 3 99.32 107.31 1 33.33
5996. Fizzman (mintyballs) 1 99.32 99.32 0 0.00
5997. eyeliddy (eyeliddy) 19 99.32 119.86 11 57.89
5998. Dwat (dwat13) 1 99.30 99.30 0 0.00
5999. William (willezur) 12 99.30 127.88 5 41.67
6000. Patrick (darkpatrick00) 17 99.30 107.26 5 29.41
6001. B (blazingthunder30) 2 99.30 99.79 1 50.00
6002. Oxey (oxey_was_taken_smh) 306 99.29 130.39 123 40.20
6003. uwunation (uwunation) 7 99.29 109.24 3 42.86
6004. Hugh (mathimati) 27 99.29 126.17 17 62.96
6005. Melissa (wally88) 32 99.28 110.54 11 34.38
6006. Harley (legendharley) 43 99.28 118.65 19 44.19
6007. DucNguyen (cuberates) 5 99.27 117.17 1 20.00
6008. JDizzle (serinus) 33 99.27 132.74 13 39.39
6009. Waterman304 (waterman304) 41 99.27 111.75 12 29.27
6010. Marley (marley) 15 99.27 105.63 6 40.00
6011. Youssef (sec5x) 793 99.26 125.01 317 39.97
6012. Frank (weetbixkid) 1 99.26 99.26 1 100.00
6013. Caleb (caleb1243) 7 99.26 109.72 1 14.29
6014. Christian (chrillzen) 20 99.26 119.49 5 25.00
6015. Frank (enomooshiki) 2 99.25 114.65 1 50.00
6016. Jason (jb33000) 1 99.25 99.25 1 100.00
6017. 0rz0rz (thenine) 8 99.25 104.58 3 37.50
6018. Amit (amitdahan) 2 99.25 119.19 2 100.00
6019. Stefan (_tensor) 193 99.24 122.11 94 48.70
6020. Raghav (redsondude) 128 99.24 119.91 48 37.50
6021. Zachary (zacmanman) 18 99.24 114.50 3 16.67
6022. Chris (kyoriosity) 10 99.24 114.65 10 100.00
6023. Anguu (anguubeef) 760 99.23 125.22 301 39.61
6024. bigburd (bigburd) 8 99.23 104.96 4 50.00
6025. poopy (joyuri) 15 99.23 125.37 7 46.67
6026. Bilguun (xyniness) 2 99.23 113.81 1 50.00
6027. Andrew (andrew69314) 2 99.23 100.39 0 0.00
6028. ADFJEWI FF (weiyd) 311 99.22 129.90 138 44.37
6029. Dennis (xdmeneer) 3 99.22 106.34 2 66.67
6030. Даниел (freewaydani) 23 99.22 122.03 13 56.52
6031. Aj (toppingsplease) 23 99.22 107.59 11 47.83
6032. CK (ckokobean) 7 99.22 120.75 6 85.71
6033. Droxe (tierelutz) 6 99.22 105.16 4 66.67
6034. Denis (netsa) 4 99.22 107.08 4 100.00
6035. Owen (owenpatch) 17 99.21 115.02 6 35.29
6036. Kacper (kacperpro) 18 99.21 124.38 13 72.22
6037. Mack (tron__) 27 99.20 111.48 10 37.04
6038. Anita (anita0718) 20 99.20 119.83 8 40.00
6039. Peter (dletastar4) 5 99.19 105.17 3 60.00
6040. Jearcan (jearcan) 184 99.19 137.28 69 37.50
6041. jck (404jmre) 9 99.17 108.03 6 66.67
6042. Shuuin (rexvir) 1 99.17 99.17 1 100.00
6043. Concomitant (dvorakdork) 36 99.17 109.62 16 44.44
6044. Justin (saucypenguinwee) 4 99.16 105.16 3 75.00
6045. funny (tesseractbeyond) 4 99.16 113.62 1 25.00
6046. bok (bokk) 21 99.15 125.72 12 57.14
6047. TatTvamAsi (3e8wpm) 28 99.15 107.62 12 42.86
6048. Macintosh (macintosh_fan) 3 99.15 103.01 3 100.00
6049. Krish (krish108) 172 99.15 128.67 63 36.63
6050. LeBaby (funnypoopyeater) 679 99.14 133.88 268 39.47
6051. Tosti-ijzer (paupermongool) 38 99.14 112.80 10 26.32
6052. Vinstalia (vinstalia) 2 99.14 104.53 2 100.00
6053. Noximini (noximini) 4 99.14 103.49 2 50.00
6054. nexro (nexro44) 72 99.13 114.57 32 44.44
6055. Zach (hardtoki11) 10 99.13 126.66 3 30.00
6056. Wallace (wallacetwo) 7 99.12 104.72 4 57.14
6057. A7md (implore) 1 99.12 99.12 0 0.00
6058. August (appledoor) 1 99.12 99.12 1 100.00
6059. Max (parabalt) 9 99.12 120.18 6 66.67
6060. Specter (spectergrrim) 10 99.12 112.11 2 20.00
6061. default car (typingslowly) 12 99.12 112.92 6 50.00
6062. Surya (suryasunkari) 15 99.11 122.52 15 100.00
6063. Ryan (nuigit) 73 99.11 134.57 31 42.47
6064. wabdeali (wabdeali) 9 99.11 116.19 2 22.22
6065. Quzrin (quzrin) 9 99.10 107.09 2 22.22
6066. Chris (eb_p0pe) 41 99.10 136.65 14 34.15
6067. BingBong (kingcaiden66) 12 99.10 110.18 5 41.67
6068. Leo (leoc) 1 99.10 99.10 0 0.00
6069. Insight (insight) 1 99.10 99.10 0 0.00
6070. Fr33 (fr33_wifi) 1 99.10 99.10 1 100.00
6071. hannah (hannahq) 18 99.10 120.85 6 33.33
6072. Adam (schimoda) 161 99.10 121.29 53 32.92
6073. ionlytype60wpm (keyboardssl... 9 99.10 111.57 5 55.56
6074. Seny (mdeekay) 7 99.10 112.81 3 42.86
6075. Vicky (person4115) 12 99.10 122.86 2 16.67
6076. Travis (travisxball) 18 99.10 115.34 10 55.56
6077. P0neh (p0neh) 3 99.09 106.12 2 66.67
6078. toki (kizunajemini2205) 54 99.09 129.14 26 48.15
6079. Pouyan (hitic) 4 99.08 111.01 2 50.00
6080. Timmy (tjdaroya1) 10 99.07 115.95 9 90.00
6081. Marcus (mizormarcus) 6 99.07 112.78 4 66.67
6082. Mitchel (mitchthebaker) 14 99.07 116.95 7 50.00
6083. Komail (mr_broodbuck) 6 99.07 109.46 4 66.67
6084. nitrox (nitr0x) 25 99.06 117.44 14 56.00
6085. Cary Zhang (vrozone) 14 99.06 120.67 8 57.14
6086. Dusan (dusancar) 1 99.06 99.06 0 0.00
6087. Vanessa (abetterplace) 291 99.06 129.02 120 41.24
6088. Xmoonsheep (xmoonsheep) 144 99.06 125.13 65 45.14
6089. Kuczora (drael1024) 39 99.05 123.02 19 48.72
6090. glizzy (icecreamgoblin) 8 99.05 121.51 7 87.50
6091. Connor (chuggs1798) 3 99.05 116.90 1 33.33
6092. dozingoff (stopcomparing) 49 99.05 118.45 22 44.90
6093. Cole (nickocado) 2 99.05 99.19 0 0.00
6094. Ramit Inmah (moe_lester69_420) 2 99.05 101.64 0 0.00
6095. _(:3) ∠) (neco36) 3 99.05 105.50 0 0.00
6096. Andrew (123andrewli) 5 99.05 106.07 3 60.00
6097. Christian (dmrunner) 2 99.04 99.78 2 100.00
6098. Rob (robocat) 1 99.03 99.03 0 0.00
6099. VyPah (vypah) 17 99.03 113.82 12 70.59
6100. nets in 4 (eridpnc) 47 99.02 125.06 20 42.55
6101. yes (yesmaybeno) 73 99.02 123.37 42 57.53
6102. Charlie (eatsrice) 3 99.02 106.86 0 0.00
6103. Jeden Osiem L (jedenosieml) 147 99.02 117.42 57 38.78
6104. Tentic (tentic) 7 99.02 108.18 5 71.43
6105. Abdallah (ap0lo) 1 99.01 99.01 0 0.00
6106. isaac (cowwee90) 99 99.01 124.95 32 32.32
6107. Jack (ghoultree) 3 99.01 117.65 2 66.67
6108. Insub (dskumpf) 12 99.00 110.10 7 58.33
6109. Louis (advguy) 17 99.00 111.28 9 52.94
6110. Abtin (fada1) 25 98.99 116.54 13 52.00
6111. James (jepk67) 2 98.99 106.75 1 50.00
6112. storm (stooormmm) 90 98.97 124.15 39 43.33
6113. Nioex (yokytra) 6 98.97 112.31 2 33.33
6114. PJ (phuang) 3 98.97 104.54 1 33.33
6115. nic (limpehordlo) 8 98.97 110.58 3 37.50
6116. Melas (melas1) 43 98.97 117.14 12 27.91
6117. Chloe (chloegamedev) 3 98.97 106.19 2 66.67
6118. Artem (wopsmops) 2 98.96 104.22 1 50.00
6119. Bosko (bosko) 4 98.95 105.22 0 0.00
6120. ♥Uaena♥ (eddie110) 77 98.95 116.77 35 45.45
6121. Ozz (gravechill) 38 98.95 129.78 15 39.47
6122. Neo (neo7) 3 98.95 103.33 1 33.33
6123. Brandon (bqn0309) 67 98.95 131.40 23 34.33
6124. Nanashi (nanasheen) 26 98.95 128.05 9 34.62
6125. mariah (serialfriend) 61 98.94 124.75 21 34.43
6126. Haduu (hadiysd) 13 98.94 103.27 7 53.85
6127. supreme (_supremes) 18 98.94 109.30 6 33.33
6128. Eric (grqy) 3 98.94 107.46 3 100.00
6129. Marina (marniass) 47 98.94 117.84 15 31.91
6130. Emil (emle10) 17 98.94 118.12 3 17.65
6131. The Wok(+1000 social credit... 4 98.94 106.07 1 25.00
6132. Max (maxijazz) 799 98.93 132.55 361 45.18
6133. R (renxsis) 36 98.93 136.50 11 30.56
6134. Vinne (vinne10) 24 98.93 127.85 6 25.00
6135. Mint (mintalchemist) 2 98.93 100.88 1 50.00
6136. John (acg55678) 2 98.93 102.50 1 50.00
6137. Ryan (lionryan) 2 98.93 110.61 0 0.00
6138. Nejc (9likediamonds) 1 98.92 98.92 0 0.00
6139. Philip (philiplu7777) 8 98.92 109.62 2 25.00
6140. Ethan (creamycanoli) 15 98.92 126.26 6 40.00
6141. JumbaHumba (jumbahumba) 4 98.92 101.86 2 50.00
6142. luca (luc_vr_04) 13 98.91 128.97 7 53.85
6143. Mason (hyojin2k) 30 98.91 112.01 13 43.33
6144. Hadi (alcatroz) 9 98.91 107.61 6 66.67
6145. Jasmine (j12mapatac) 6 98.90 119.24 2 33.33
6146. SwordSwarm (swordswarm) 3 98.90 106.94 2 66.67
6147. tudorica1 (tudorel1234) 264 98.90 115.94 91 34.47
6148. Bojongkers (manqjayak) 41 98.90 122.33 18 43.90
6149. Snouto (snoutowo) 16 98.90 116.57 10 62.50
6150. Ronnie (onie12) 58 98.89 134.91 23 39.66
6151. Bread (breadandbuddha) 35 98.88 117.08 25 71.43
6152. Landon (sugamalia) 19 98.88 132.34 6 31.58
6153. Kaimetsu (kaimetsu) 30 98.88 127.08 11 36.67
6154. Zion (zionmegalion) 4 98.88 107.14 1 25.00
6155. Manny (mannypack) 164 98.88 139.13 65 39.63
6156. Kent (kfreezen) 11 98.87 113.59 4 36.36
6157. Vroom (saucypringle) 1 98.87 98.87 0 0.00
6158. Timmy (sillytimmy) 7 98.87 113.46 4 57.14
6159. Kai (kzhou6) 2 98.87 112.53 2 100.00
6160. Zakhar (3eldu) 2 98.87 103.50 1 50.00
6161. Brandon (brandonkheang) 2 98.87 103.56 2 100.00
6162. Terra (terranavis) 17 98.86 116.53 8 47.06
6163. Kylie (kyky_) 35 98.86 111.56 12 34.29
6164. sg my beloved (imperfect_qu... 102 98.86 123.84 44 43.14
6165. hydratedcat (hydratedcat) 1 98.85 98.85 1 100.00
6166. glenn (bukseng) 207 98.85 122.09 96 46.38
6167. Elvis (elvisnator) 6 98.84 111.96 2 33.33
6168. Chewing (chewing_bever) 13 98.84 118.01 7 53.85
6169. Joseph (jwkeating99) 10 98.84 108.93 5 50.00
6170. haifive (haifiveywivey) 22 98.84 118.78 12 54.55
6171. Exquisition (raimi) 11 98.84 140.33 5 45.45
6172. noob_slayer (noob_slayer) 16 98.83 111.37 7 43.75
6173. Pixel269 (pixeltwosixnine) 98 98.83 144.22 35 35.71
6174. Du (dukuch) 6 98.82 115.47 2 33.33
6175. n0neya (noneyaaa) 44 98.82 114.28 17 38.64
6176. dramorak (dramorak) 1 98.82 98.82 0 0.00
6177. Lucifer (lucifer179) 17 98.82 116.88 10 58.82
6178. Plommon (plommon) 9 98.81 108.22 4 44.44
6179. Khong (khong_eiei) 1 98.81 98.81 1 100.00
6180. nhentai (dongpo_pork) 13 98.81 113.21 7 53.85
6181. 종지 (jonge1124) 79 98.81 120.85 31 39.24
6182. Cowlor (cowlortyper1) 61 98.81 123.46 26 42.62
6183. tstats[gravityhurts] (gravi... 3 98.81 105.76 1 33.33
6184. Glenn (nnelg) 49 98.81 133.27 7 14.29
6185. Pretty Epic (zimbaycoleo) 24 98.80 125.18 11 45.83
6186. TidyTurtle (tidyturtle) 20 98.79 125.67 6 30.00
6187. Tamás (tamas) 94 98.79 136.90 44 46.81
6188. Chris... (chrishollow7) 10 98.78 108.92 4 40.00
6189. DW (immortal_tree) 11 98.78 107.08 6 54.55
6190. jake (jacobchh) 6 98.78 110.17 3 50.00
6191. Malt0 (godcream) 5 98.78 117.39 2 40.00
6192. Arnel II (agujathis) 8 98.77 110.48 5 62.50
6193. Percaimond (1cedheroine) 1 98.77 98.77 0 0.00
6194. lexi (leximeow) 24 98.77 119.99 10 41.67
6195. loungecore (loungecore) 52 98.76 116.52 21 40.38
6196. come (comecurry) 101 98.76 125.09 41 40.59
6197. piconeeks (piconeeks) 752 98.76 133.71 285 37.90
6198. Rikard (rikardny) 6 98.76 112.79 3 50.00
6199. Dan (yugurtz) 17 98.76 133.29 7 41.18
6200. Darrell (lastronus) 20 98.76 116.35 9 45.00
6201. MZA (mzakm) 11 98.76 120.68 8 72.73
6202. Person (relearner) 321 98.75 116.97 131 40.81
6203. JR (deltav) 13 98.75 112.00 4 30.77
6204. potato (kongkan_) 27 98.75 113.49 13 48.15
6205. Ryan (ryan_dicenzo) 2 98.75 108.26 0 0.00
6206. Hahohe (hahohe3) 21 98.74 123.62 9 42.86
6207. Sylptic (sylptic) 50 98.74 118.60 19 38.00
6208. Christian (chrischaostf2) 1 98.74 98.74 1 100.00
6209. Saber (saber2756) 27 98.74 128.74 12 44.44
6210. Zoomies (tthuang1998) 12 98.73 116.31 5 41.67
6211. Its (itstact) 19 98.73 114.36 8 42.11
6212. Dash (darkdash) 44 98.73 116.61 17 38.64
6213. Chris Jozef Cad (kamireign) 12 98.72 112.05 5 41.67
6214. Overpriced (overpriced) 7 98.72 104.14 1 14.29
6215. simbacaned (simbacaned) 5 98.71 123.09 2 40.00
6216. Yasir (ykhan9514) 6 98.71 109.10 6 100.00
6217. Kiva (kivattt) 6 98.71 113.12 3 50.00
6218. boris (zekaida) 9 98.71 106.91 1 11.11
6219. Jay (taragine) 11 98.71 111.63 5 45.45
6220. Joe (suqmadiqmann) 19 98.70 115.94 10 52.63
6221. relaxx (cloudkid) 58 98.70 121.45 21 36.21
6222. Yuval (yuvalalfa) 53 98.69 129.63 23 43.40
6223. Tiny Tank (anti_vax_cat) 299 98.69 127.80 106 35.45
6224. Henrique (hnrqe) 30 98.69 150.82 12 40.00
6225. Val (codehacker707) 12 98.69 113.89 6 50.00
6226. Anthony (aantho) 7 98.69 108.33 7 100.00
6227. Player (p1ayer_two) 2 98.68 103.94 1 50.00
6228. Choban (chombainer) 2 98.68 102.90 0 0.00
6229. beans (beansrandy) 1 98.68 98.68 1 100.00
6230. tstats[xoceankingx] (xocean... 502 98.68 132.58 221 44.02
6231. J (average_typer95) 115 98.67 124.41 42 36.52
6232. Matthew (matthewmob) 5 98.67 117.36 2 40.00
6233. Violet (nidtsg1113) 1 98.66 98.66 0 0.00
6234. lex (axemzo) 6 98.66 110.17 1 16.67
6235. Eli Ferdinand Edralin (elfe... 1,371 98.65 132.99 564 41.14
6236. typeyMcTypeFace (mslib9) 586 98.65 129.78 248 42.32
6237. Erdem (erdemhalil) 18 98.65 109.20 9 50.00
6238. Boris (voidnothing) 5 98.64 112.13 2 40.00
6239. iget30wpm (iget30wpm) 2 98.64 110.23 1 50.00
6240. Alex (fluffehpander) 25 98.64 111.18 14 56.00
6241. Eyrton (kalaxee) 13 98.63 112.90 7 53.85
6242. Lucas (lucasfah) 6 98.63 106.23 2 33.33
6243. Alex (alexstrang25) 45 98.63 116.63 17 37.78
6244. Yoda (booya51) 14 98.63 114.33 5 35.71
6245. jurj (fredkag) 13 98.63 115.99 3 23.08
6246. tasha (tbrown_89) 9 98.63 115.30 4 44.44
6247. ameerah (bluecandy) 32 98.63 109.51 16 50.00
6248. jie (xonjiex) 15 98.62 113.71 5 33.33
6249. Noah (cadhp) 6 98.62 118.61 2 33.33
6250. Adi (ayhone) 5 98.61 109.35 4 80.00
6251. Dennis (mizonex) 1 98.61 98.61 1 100.00
6252. penguiny2001 (penguiny2001) 9 98.61 106.98 4 44.44
6253. Wolfie (amrkhaled09) 20 98.61 127.33 10 50.00
6254. Rick (itzgamedude) 2 98.61 98.70 1 50.00
6255. obada (obada_yahya) 229 98.60 127.83 83 36.24
6256. Hazim (hazm) 19 98.60 116.91 13 68.42
6257. Corrin (scynth) 11 98.60 105.44 4 36.36
6258. 4aeon (4aeon) 7 98.60 109.53 1 14.29
6259. Emily (emerrin) 14 98.60 106.09 5 35.71
6260. Claudia (claudia215) 1 98.59 98.59 0 0.00
6261. A (furox) 6 98.59 105.49 3 50.00
6262. Mike (mikethompsontech) 8 98.59 106.99 4 50.00
6263. Blatzien (blatzien) 4 98.59 111.24 1 25.00
6264. Moulik (morocks) 14 98.58 116.77 2 14.29
6265. andrew (400wpmalphamale) 44 98.58 136.16 20 45.45
6266. geras (gerastv) 96 98.57 146.89 29 30.21
6267. Christian (christian_oudard) 15 98.57 117.46 6 40.00
6268. Cedric (sedorikku) 4 98.57 102.52 0 0.00
6269. NotRyan (ryantheexiled) 23 98.57 123.41 11 47.83
6270. Ele (luminelexx) 4 98.56 104.82 4 100.00
6271. Kevin (1kevstahz) 23 98.55 118.09 16 69.57
6272. dakszaksmom (dakszaksmom) 1 98.55 98.55 0 0.00
6273. r.mzl (muzzzle) 2 98.55 109.67 2 100.00
6274. Slow Typist (lammian) 8 98.54 105.07 1 12.50
6275. Lu (fuji_puji) 10 98.54 109.35 3 30.00
6276. Franco (pussay_wizard) 2 98.54 106.94 0 0.00
6277. a (3lim64) 627 98.54 128.37 221 35.25
6278. Bertil (bingobertil) 8 98.53 109.60 3 37.50
6279. MOON (frozenmoonage) 3 98.53 111.97 0 0.00
6280. Sarves (xmemestar420) 40 98.53 122.17 13 32.50
6281. yuhaocooper (yuhaocooper) 6 98.52 107.08 1 16.67
6282. Danat (danat_ayazbayev) 32 98.52 113.93 10 31.25
6283. Boncho (bochl1n) 7 98.51 114.12 5 71.43
6284. Benimaru (raphieldropout) 2 98.51 103.73 0 0.00
6285. Princeton (princetonjeffries) 3 98.51 116.59 1 33.33
6286. Snail (kelvin_paul) 833 98.50 122.83 306 36.73
6287. InfiniteCows (infinitecows) 12 98.50 113.08 8 66.67
6288. Kuy (rou168) 17 98.49 111.79 9 52.94
6289. Vincent (cruhm) 11 98.49 131.80 3 27.27
6290. Matthew (noobdestroyer69) 85 98.49 120.57 48 56.47
6291. Dominik (jazzon) 20 98.48 122.81 7 35.00
6292. jack (jack815) 57 98.48 125.58 25 43.86
6293. Gooby (goobygod) 42 98.48 123.90 25 59.52
6294. Alex (dubalpha) 3 98.48 107.33 3 100.00
6295. Neske (neske) 29 98.48 124.67 14 48.28
6296. yousuf (z3nko) 47 98.48 124.01 36 76.60
6297. Stephen (tape319) 2 98.48 100.17 1 50.00
6298. ImEhCanadian (imehcanadian) 6 98.47 112.02 3 50.00
6299. flopvx (flopvx) 28 98.47 123.70 8 28.57
6300. Moz (soul3n) 10 98.47 114.00 4 40.00
6301. Brown Bear (mjcortz) 2 98.47 104.24 2 100.00
6302. Aids (aids___) 22 98.46 107.91 5 22.73
6303. Fenix (isaac.hermens@gmail.... 6 98.46 104.36 2 33.33
6304. Brandon (bransap) 3 98.46 110.54 3 100.00
6305. Matthew (exiamu) 5 98.46 111.10 3 60.00
6306. katapi (catapie) 653 98.46 125.37 249 38.13
6307. blooks (aprinter) 19 98.46 115.85 12 63.16
6308. Hannah (hannityyy) 10 98.45 117.13 3 30.00
6309. Onii-Chan (lowtall2006) 52 98.45 116.52 22 42.31
6310. Noob (n0013gam3r) 1 98.45 98.45 1 100.00
6311. Temflakes (temflakes403) 6 98.45 116.73 3 50.00
6312. Andrew (narchio) 33 98.45 118.93 10 30.30
6313. Yzmael (yzmael156) 60 98.44 122.38 31 51.67
6314. Denis (denissined) 1 98.44 98.44 1 100.00
6315. Russell (russell_t3ap) 10 98.44 113.24 4 40.00
6316. ngmh (ngmh) 2 98.44 100.25 0 0.00
6317. Sonny (sonny3d) 1 98.43 98.43 0 0.00
6318. Jaris (xersai) 51 98.43 123.69 21 41.18
6319. owo :3 (playtoomuchgames) 38 98.43 127.26 10 26.32
6320. Chris (letring) 185 98.42 124.01 84 45.41
6321. Phil (themonk) 22 98.42 118.35 7 31.82
6322. Michelle (minspire) 25 98.42 115.84 12 48.00
6323. lowkeynotash (ashleer) 6 98.42 104.11 3 50.00
6324. Brie (briemobiel) 1 98.41 98.41 0 0.00
6325. Isaac (psachy) 76 98.41 128.40 31 40.79
6326. Thomas (thomasltran) 24 98.40 117.61 9 37.50
6327. Rear (rolotomassi) 1 98.40 98.40 0 0.00
6328. Jon (jonlauws) 7 98.40 106.06 3 42.86
6329. Reigen (freebies25) 2 98.40 102.37 2 100.00
6330. get_on_board (get_on_board) 41 98.39 114.39 21 51.22
6331. sofa (sofaaa) 51 98.39 129.19 15 29.41
6332. Pedro (timboly3) 129 98.39 131.60 61 47.29
6333. ZedHead01 (qdedmon87) 146 98.38 123.92 56 38.36
6334. Azaan (azstar) 3 98.38 101.29 2 66.67
6335. Kevinh (baconpool14) 45 98.38 129.56 17 37.78
6336. Master (smartax) 67 98.38 123.59 17 25.37
6337. Joe (therunner09) 7 98.37 107.42 3 42.86
6338. Mads (pythonmilk) 3 98.37 110.19 1 33.33
6339. Other_Pigeon (otherpigeon) 5 98.36 105.91 1 20.00
6340. liv (mesemi) 23 98.36 115.40 12 52.17
6341. Caitlin (caitlin3) 114 98.36 117.55 53 46.49
6342. Bleh (entropian) 6 98.36 110.15 4 66.67
6343. Benjamin (fatjammin) 502 98.35 131.87 187 37.25
6344. Momo (helloworldwhatniceday... 43 98.35 120.89 12 27.91
6345. Takumi (bilbobaggins440) 1 98.35 98.35 0 0.00
6346. David (dcohen91) 685 98.35 142.14 275 40.15
6347. Zach (11037) 6 98.34 108.00 1 16.67
6348. (◕‿◕✿) (idkbruv) 1 98.34 98.34 0 0.00
6349. Tweece (tweece) 2 98.34 100.47 1 50.00
6350. amy (fasttrainchoochoo) 3 98.34 100.17 2 66.67
6351. Ethan (thatprogrammer) 1 98.33 98.33 0 0.00
6352. Alex (jalexwhitman) 2 98.33 104.41 1 50.00
6353. Jay (jgupta) 12 98.32 116.83 6 50.00
6354. Adrian (aeroplaneking) 90 98.32 120.70 32 35.56
6355. Victor (victorsaurus) 3 98.32 105.99 1 33.33
6356. Sicoz (skyarc12) 85 98.32 120.03 30 35.29
6357. Alejandro (darkian) 5 98.32 110.84 0 0.00
6358. Megu (knightninja436) 2 98.32 99.21 1 50.00
6359. Marc (marxotkin) 11 98.31 110.15 5 45.45
6360. george (doctoras) 52 98.31 121.16 26 50.00
6361. James (frxction) 56 98.31 119.23 18 32.14
6362. Ultralord (ronelijahruiz) 9 98.31 119.82 2 22.22
6363. Josh (expiredvenom) 134 98.31 116.77 52 38.81
6364. Jakub (grajak) 5 98.31 111.58 4 80.00
6365. Lack (lackhammer) 90 98.31 118.20 34 37.78
6366. Slowpez (mr_slowpez) 12 98.31 110.93 1 8.33
6367. Bradley (bradleydavis) 2 98.31 109.39 1 50.00
6368. n8 (ttensu) 18 98.30 113.83 7 38.89
6369. Person (ali_666_) 85 98.30 118.07 36 42.35
6370. Jake (starbless) 85 98.30 123.66 33 38.82
6371. James (miztrjriii) 1 98.30 98.30 0 0.00
6372. Nicholas (nicholas_r) 11 98.30 111.36 7 63.64
6373. K3VIN (bootunstoppable) 6 98.29 103.36 1 16.67
6374. OOF (xpinoyx) 11 98.29 111.55 4 36.36
6375. Cris (schmidtolini) 127 98.29 123.88 52 40.94
6376. Stephen (korankye) 13 98.29 119.89 11 84.62
6377. hahnur (hahnurk) 42 98.28 116.57 16 38.10
6378. hugo (gikle) 1 98.28 98.28 1 100.00
6379. N (nsortur) 1 98.28 98.28 0 0.00
6380. Ethan (etwa) 30 98.27 115.34 16 53.33
6381. luzy (neptunehoney) 20 98.27 121.70 8 40.00
6382. Sanger (sanger) 4 98.27 112.75 2 50.00
6383. Jamie (jkelly21) 7 98.26 111.95 1 14.29
6384. S (skonzer) 5 98.26 103.97 0 0.00
6385. Andres (kerchingle) 3 98.26 103.36 0 0.00
6386. twitch.tv/YasuoNA (denigratez) 8 98.26 110.61 3 37.50
6387. Jerry (jwu56) 6 98.26 107.42 4 66.67
6388. Will (bigmac1time) 5 98.25 102.76 0 0.00
6389. Trinity (trinitysam) 1 98.23 98.23 0 0.00
6390. TheCrazyTree (thecrazytree) 1 98.23 98.23 1 100.00
6391. Emily (miffily) 16 98.22 109.64 12 75.00
6392. Nima (eramthgin) 478 98.21 133.44 168 35.15
6393. SilentHill (gosha666) 84 98.21 117.87 33 39.29
6394. Ronaldinho (odarealpeo321) 256 98.21 133.95 88 34.38
6395. bea (cbeae) 4 98.21 107.52 3 75.00
6396. Amy (aimeesongg) 3 98.20 109.01 2 66.67
6397. Ronzingz (ronzingz) 4 98.19 111.31 3 75.00
6398. Rodney (justrodneylee) 7 98.19 102.20 2 28.57
6399. Gerry (gchenfc) 7 98.18 103.49 3 42.86
6400. Brandon (brandonhariyanto) 3 98.18 100.12 2 66.67
6401. Jared (jaredblack) 70 98.18 117.10 56 80.00
6402. drywalleater34 (thiccblah_) 3 98.17 108.61 1 33.33
6403. bit lee (akazed) 4 98.17 111.76 1 25.00
6404. Jeff (mrblurbyyt) 6 98.17 103.09 3 50.00
6405. Rito (rito_nsj) 2 98.17 98.68 1 50.00
6406. nebula (nebula1402) 6 98.16 103.76 4 66.67
6407. Kris (doubleace5747) 8 98.16 104.21 3 37.50
6408. lelgetrekt (lelgetrekt) 484 98.15 127.27 181 37.40
6409. Burnt Piece (doomlad) 4 98.15 114.26 1 25.00
6410. Lush (lush_krom) 29 98.15 111.25 15 51.72
6411. Nando (frozgamingz) 28 98.15 121.77 12 42.86
6412. Rosie (rosiem) 5 98.14 105.01 4 80.00
6413. Meeze (meeze) 10 98.14 117.00 2 20.00
6414. Alexu (doctoralexu) 2 98.13 103.94 2 100.00
6415. David (bomely) 18 98.12 122.89 2 11.11
6416. Vroom (mariotaughtmetyping) 1 98.12 98.12 1 100.00
6417. Hans-Peter (hpgurke69) 2 98.12 101.78 2 100.00
6418. fdd (fdd1) 2 98.12 100.18 2 100.00
6419. John (parallaxjedi) 36 98.11 110.13 13 36.11
6420. Qualified (qualified98) 13 98.11 111.73 6 46.15
6421. Joe (playspout) 10 98.11 106.64 3 30.00
6422. Kate (katehashope) 6 98.11 112.37 2 33.33
6423. Mike (roguecurlybracket) 34 98.11 114.51 10 29.41
6424. Daniel (dannye014) 2 98.11 102.35 1 50.00
6425. Max (convie) 26 98.11 119.20 8 30.77
6426. D3LTA (d3lta) 8 98.10 101.28 4 50.00
6427. Ethan (ethanxiaoful) 13 98.08 108.49 5 38.46
6428. QwertyBaguette (smellybague... 817 98.07 121.63 330 40.39
6429. Gavin (qwertyparty) 35 98.07 121.19 14 40.00
6430. Filipo (filipomarcel) 13 98.07 109.76 8 61.54
6431. alyssa (alyyyssa) 31 98.07 113.14 9 29.03
6432. Ed (edhac) 49 98.06 123.46 16 32.65
6433. James (karonar) 22 98.06 110.94 6 27.27
6434. RG18 (rudolphgaming18) 5 98.06 111.80 1 20.00
6435. tstats[praneeth_07] (pranee... 1 98.06 98.06 1 100.00
6436. Xx_DiwaliGaming_xX (violert) 1 98.06 98.06 0 0.00
6437. JJ (xvitrix) 15 98.06 115.40 6 40.00
6438. Allan (itsgam3tyme) 7 98.06 105.41 3 42.86
6439. el (elanamax) 115 98.06 116.42 42 36.52
6440. Albert (tastiermite) 55 98.06 118.36 25 45.45
6441. Snowern (skiriius) 2 98.06 104.75 2 100.00
6442. nakkisoppa666 (nakkisoppa666) 32 98.04 131.34 9 28.13
6443. Chad (chad87) 20 98.04 115.80 11 55.00
6444. SCHMURK (schmurk) 160 98.04 124.69 63 39.38
6445. Trav (travm) 3 98.04 104.32 0 0.00
6446. Stay (stayscaffolded) 70 98.04 125.17 20 28.57
6447. Josh (bumbull) 1 98.03 98.03 1 100.00
6448. Drizzle (drizzle671) 1 98.02 98.02 0 0.00
6449. Pisser (minsuk7) 15 98.01 110.97 7 46.67
6450. Ramona (ramonaflowers101) 36 98.01 110.32 15 41.67
6451. Naufal (rashifff) 1 98.01 98.01 1 100.00
6452. IONIS (liaro0903) 28 98.01 109.08 5 17.86
6453. Sav (savcaruso) 307 98.01 146.87 126 41.04
6454. Cultist (kishore0305) 274 98.00 125.95 89 32.48
6455. hannah (hannahvilla) 25 98.00 118.17 15 60.00
6456. Mikel (wellthatwasfun) 15 98.00 114.07 11 73.33
6457. Chloe (bananatyper9) 39 98.00 125.69 14 35.90
6458. David (davidzocker3) 1 98.00 98.00 1 100.00
6459. Hunter (hawsonn) 6 97.99 109.53 3 50.00
6460. MooD (xslel) 32 97.99 125.49 11 34.38
6461. Meeper (timelysaucer) 8 97.99 102.20 1 12.50
6462. Memat (memat) 40 97.98 121.18 23 57.50
6463. Manjrnm (manjrnm) 164 97.98 124.87 68 41.46
6464. Somogyi (vincture) 280 97.98 126.12 94 33.57
6465. TypingGuy (iramus) 49 97.98 121.56 16 32.65
6466. Hunter (huntstyperacer) 1 97.98 97.98 1 100.00
6467. Hayawardh (hayawardh) 1 97.98 97.98 0 0.00
6468. John (ronjohnjamesbond) 1 97.98 97.98 1 100.00
6469. c4th0d3 (c4th0d3) 11 97.98 121.30 2 18.18
6470. Daniel (zdaniel02_) 62 97.98 115.77 25 40.32
6471. Shane (enahs_py) 90 97.97 119.82 39 43.33
6472. Ryan (rypenguin219) 6 97.97 108.66 1 16.67
6473. Jovan (jovannjt) 5 97.97 107.90 2 40.00
6474. Sourav (srax) 7 97.96 114.80 3 42.86
6475. Mati🅱IKL (mati2ooo) 49 97.95 116.03 20 40.82
6476. Khaled (khaled2252) 26 97.95 117.38 11 42.31
6477. Scuba (scubatank) 2 97.95 103.41 2 100.00
6478. Vinh (shadeomen) 92 97.95 120.17 39 42.39
6479. Scopic (scopic) 366 97.95 117.10 128 34.97
6480. Idas (aidasas) 21 97.95 117.92 10 47.62
6481. slow. (meeper24) 10 97.95 109.55 5 50.00
6482. Dust (rathard) 6 97.95 115.55 4 66.67
6483. Mark (loggsu) 119 97.94 135.32 47 39.50
6484. LEGO (cymiao2014) 1 97.94 97.94 0 0.00
6485. Max (mpegasus) 23 97.94 107.43 8 34.78
6486. chapo (mnxchapo) 54 97.94 120.79 16 29.63
6487. melon (melon_aid) 3 97.94 108.81 1 33.33
6488. Edward (supereduardus) 32 97.94 117.04 17 53.13
6489. bido (bidoteima) 9 97.94 121.84 7 77.78
6490. Enzo (enz0123) 164 97.93 120.64 72 43.90
6491. Daniel (delixx1) 4 97.93 103.38 2 50.00
6492. Saksham (0_lol_0) 24 97.92 109.86 17 70.83
6493. pomgie (achan66) 2 97.92 106.66 2 100.00
6494. Jay (jay_cubed22) 26 97.92 111.99 9 34.62
6495. Huts (huts1) 2 97.92 101.82 2 100.00
6496. William (rubrubmytubtub) 2 97.92 99.74 0 0.00
6497. Katilin (type_casting) 4 97.91 112.48 2 50.00
6498. Jeffrey (jeffrey3712) 3 97.91 105.08 3 100.00
6499. tstats[vrooooom1337] (vrooo... 1 97.90 97.90 0 0.00
6500. Bob (bushybrows) 20 97.90 118.49 9 45.00
6501. Elias (eliasy7) 25 97.90 125.05 23 92.00
6502. Speed (ututu222) 119 97.89 129.84 43 36.13
6503. EnkaOsaru (enkaosaru) 216 97.89 124.45 104 48.15
6504. kyubkubkubkubyub (kyubkubku... 208 97.89 136.78 88 42.31
6505. ISRAEL END 2025 (imtiaz123) 1,033 97.89 127.16 427 41.34
6506. TheTIger107 (thetiger107yt) 115 97.89 144.70 51 44.35
6507. Matt (inedibility) 267 97.89 122.48 100 37.45
6508. sensei455 (sensei455) 4 97.88 107.37 2 50.00
6509. V (alfredpennywrth) 54 97.88 113.98 19 35.19
6510. erayser (erayser) 3 97.88 104.06 0 0.00
6511. Zachary (zackfromstatefarm) 2 97.88 100.72 0 0.00
6512. Hal (nerus) 2 97.88 102.71 1 50.00
6513. Edward (mistaek) 25 97.87 119.58 13 52.00
6514. Filip (keyboardwarrior772) 51 97.87 133.91 18 35.29
6515. Andrew (sq_leonhart) 37 97.87 116.36 18 48.65
6516. albatross (awehiuaf) 28 97.87 120.13 15 53.57
6517. Jonathan (the_mechanical) 32 97.86 123.52 9 28.13
6518. Hot Cross Puns (hot_cross_p... 30 97.86 112.31 29 96.67
6519. Freddy (zoower) 5 97.86 104.34 2 40.00
6520. abatt (sas_1100) 24 97.85 118.70 8 33.33
6521. Colin (colinn02) 65 97.85 125.06 30 46.15
6522. ArticSeries (articseries) 17 97.85 106.92 6 35.29
6523. Matthew (mmeppelink20) 22 97.84 127.06 10 45.45
6524. Ryan (raisonfire) 15 97.84 112.90 9 60.00
6525. Anthony (an1hony) 26 97.84 116.86 6 23.08
6526. Jack (jacktheoven) 24 97.84 110.90 9 37.50
6527. David (dave_em) 231 97.84 120.33 45 19.48
6528. David (kandar4) 4 97.84 111.59 1 25.00
6529. Aiman (aiman_a) 23 97.84 110.38 10 43.48
6530. Dora (dorasmoothy) 3 97.83 101.86 2 66.67
6531. Reuben (reubensong) 54 97.82 136.15 26 48.15
6532. Noodle (noodle_master) 2 97.82 109.41 1 50.00
6533. Nep (nep_nepped_yuumi) 3 97.82 111.69 3 100.00
6534. Freddo (freddo7) 9 97.82 110.25 3 33.33
6535. ChaosNuggets (chaosnuggets) 12 97.81 114.68 3 25.00
6536. Roman (romaje_) 14 97.81 116.62 7 50.00
6537. Ike (mouseandkeyboard) 8 97.81 104.87 2 25.00
6538. Johnathan (starydy) 1 97.81 97.81 1 100.00
6539. Adam (adamsyaq) 260 97.81 123.46 108 41.54
6540. Rob (destructo91) 25 97.81 115.21 7 28.00
6541. Irish (irishgallowglass) 6 97.80 110.48 2 33.33
6542. ok (herbaltea) 19 97.80 121.03 9 47.37
6543. Darius (soo_hoo) 1 97.80 97.80 0 0.00
6544. Santiago (drebexler) 640 97.79 137.88 229 35.78
6545. jawes (jawes123) 9 97.79 114.78 6 66.67
6546. quat (quat) 21 97.79 112.47 7 33.33
6547. Vei (cengi) 11 97.79 123.29 5 45.45
6548. putss (putssimply) 7 97.79 110.24 3 42.86
6549. omejeyo (omejeyo) 2 97.79 106.50 1 50.00
6550. spowell398 (spowell398) 1 97.79 97.79 1 100.00
6551. Doc (lolnice) 10 97.78 125.18 6 60.00
6552. duncan (bobby29831) 70 97.78 112.17 26 37.14
6553. Jumpo (purplejumpo) 20 97.78 116.16 6 30.00
6554. Timothy (tmoux) 6 97.78 120.98 1 16.67
6555. AJ (captainlide) 2 97.78 100.48 1 50.00
6556. Tom (ttaffy) 7 97.77 112.93 2 28.57
6557. not a race (donut_gublor) 16 97.77 120.02 5 31.25
6558. Eric (paiement) 2 97.77 109.09 0 0.00
6559. Tyler (tyli) 2 97.76 98.11 0 0.00
6560. Soham (shadeoxide) 40 97.76 115.19 16 40.00
6561. Silver (pixel47) 22 97.76 112.47 7 31.82
6562. Jacob (slashingpuma) 63 97.75 114.51 26 41.27
6563. tstats[ssohrab] (ssohrab) 54 97.75 129.86 15 27.78
6564. NEM0 (saybloo) 9 97.75 113.64 6 66.67
6565. Giancarlo (giancarlo_sturla7) 12 97.75 108.17 5 41.67
6566. Eric (rickby) 2 97.75 100.48 1 50.00
6567. Luke (synthsequence) 7 97.74 105.93 3 42.86
6568. Elijah (too_ez_) 108 97.74 126.90 49 45.37
6569. Darren (darrrrrrr) 85 97.74 114.77 33 38.82
6570. CZ (derpiestme) 17 97.74 111.47 7 41.18
6571. Walker (walkers12) 3 97.74 103.12 1 33.33
6572. Alan (faux_ray) 10 97.73 121.10 6 60.00
6573. Antzlee (antzlee) 3 97.73 103.25 1 33.33
6574. Amritanshu (da_sikka_x) 3 97.73 105.64 1 33.33
6575. Invictus (invictus69) 48 97.73 108.84 15 31.25
6576. kottt (kweent182) 29 97.72 107.92 9 31.03
6577. Dakota (kodaworms) 13 97.72 110.10 8 61.54
6578. Anip (vibeth) 3 97.72 109.54 1 33.33
6579. Adzeyns (adzenys) 35 97.72 118.45 16 45.71
6580. li (badplayer970) 11 97.71 118.29 4 36.36
6581. Alonna (acannoy) 5 97.71 111.99 2 40.00
6582. Peter (zoodoo) 26 97.70 119.13 12 46.15
6583. weston (westonu) 44 97.70 121.73 20 45.45
6584. 200iq man (sovietgoose) 1 97.69 97.69 0 0.00
6585. Nikolas (typer99951) 2 97.69 102.61 1 50.00
6586. Douglas (lasdoug) 4 97.68 111.64 2 50.00
6587. Slueben (poijn) 7 97.68 117.80 6 85.71
6588. Dmitrijs (dhmitry) 5 97.68 109.84 5 100.00
6589. Ler (soospooky) 19 97.67 107.05 7 36.84
6590. Darlena (darlena) 28 97.67 124.57 9 32.14
6591. Baby Shark (toinfinity1) 83 97.67 120.18 32 38.55
6592. Andrew (alz2) 5 97.66 111.87 2 40.00
6593. Carlo (ccatiello) 2 97.66 111.33 1 50.00
6594. 🇲🇳 Mazaalai (goodgodk... 22 97.66 117.30 8 36.36
6595. Nick (ntst22) 6 97.65 109.53 2 33.33
6596. Min (minimizer123) 3 97.65 111.05 3 100.00
6597. Jack (iviagicjack) 19 97.65 113.23 7 36.84
6598. Rose (dkranzberg) 6 97.65 109.34 1 16.67
6599. Andy (realasianjesus) 24 97.65 109.93 7 29.17
6600. MyBihLuhDoCocaine (mybiluhd... 26 97.65 124.05 11 42.31
6601. Sven (zeverit) 91 97.65 118.18 35 38.46
6602. Ravon (ravonhenson) 4 97.65 105.72 3 75.00
6603. harbeanger (harbeanger) 9 97.64 102.42 4 44.44
6604. Charlie (celzuk) 6 97.64 114.67 3 50.00
6605. Allan (huangkong) 3 97.63 111.11 0 0.00
6606. Joseph (meshram2001) 62 97.63 118.48 24 38.71
6607. redhotdancer1821 (redhotdan... 21 97.62 114.59 6 28.57
6608. Maximus (asso2002) 110 97.62 125.83 46 41.82
6609. Ryan (suzerainy) 8 97.62 109.94 2 25.00
6610. Thpp (kulaspa) 27 97.62 114.51 13 48.15
6611. Merrick (skmq) 187 97.61 115.79 64 34.22
6612. Chumchum (aldzia) 232 97.61 127.89 148 63.79
6613. Light (lightneesan) 4 97.61 108.77 1 25.00
6614. Grant (grantly) 205 97.61 131.90 90 43.90
6615. Anthony (antoniotheslwotyper) 18 97.60 110.07 6 33.33
6616. toni (noilly) 7 97.60 121.93 2 28.57
6617. Anakin (gunmoon) 9 97.60 104.53 5 55.56
6618. Devin (devcappy) 792 97.60 146.50 297 37.50
6619. Jonathan (jjones0598) 1 97.59 97.59 0 0.00
6620. cortmarshal (cortmarshal) 35 97.59 122.44 12 34.29
6621. Erik (babyleaf) 5 97.59 112.72 1 20.00
6622. Babu (pinklamborghini) 24 97.58 120.02 17 70.83
6623. HoDaMoFoDor (hodamofodor) 20 97.57 119.63 11 55.00
6624. Evan (toastypoints) 28 97.57 119.97 15 53.57
6625. mko908 (mko908) 2 97.57 111.04 1 50.00
6626. Alex (ahouse101) 6 97.56 113.53 3 50.00
6627. Olof (sammipk) 7 97.56 116.87 5 71.43
6628. Stinkbean (nutloaf) 1 97.56 97.56 0 0.00
6629. doncheadle (timothyqian) 35 97.56 117.74 16 45.71
6630. aspirar (aspirar) 143 97.56 122.32 92 64.34
6631. Yap (yap_lee) 2 97.56 98.45 1 50.00
6632. Danny (taipmaster) 19 97.55 120.38 10 52.63
6633. Pointyepic (pointyepic) 30 97.55 118.78 13 43.33
6634. Yuan (yuan_yuan) 11 97.55 107.85 5 45.45
6635. Fast (greytwa) 4 97.55 103.62 0 0.00
6636. peepee (gamerlegion) 15 97.55 112.48 8 53.33
6637. Ricky (istartyper) 2 97.55 98.79 1 50.00
6638. Nvzhnn (nvzhnn) 19 97.54 113.19 9 47.37
6639. tont (tont) 2 97.54 100.37 2 100.00
6640. potato (jellaye) 6 97.54 123.40 3 50.00
6641. Bento (bento420) 153 97.53 121.99 77 50.33
6642. pluto (plut0_) 5 97.53 112.25 2 40.00
6643. BOBMAN4900tstats[bobman4900... 2 97.53 103.70 0 0.00
6644. Martin (martindungeon) 4 97.52 103.75 0 0.00
6645. GameChaos (game_chaos) 23 97.52 113.15 9 39.13
6646. Evan250250 (evan250250) 11 97.51 130.91 3 27.27
6647. simon (i_am_simon) 140 97.51 128.09 52 37.14
6648. Jordan (jordybird7) 6 97.51 116.46 3 50.00
6649. Danh (chetdanh) 12 97.51 112.73 2 16.67
6650. Veronica (latenightpizza) 10 97.51 111.20 6 60.00
6651. No (funky_wins) 2 97.51 98.27 1 50.00
6652. Romir (mod_rombus) 1 97.51 97.51 0 0.00
6653. Will (wwwong) 8 97.51 111.79 4 50.00
6654. huge (postmortem) 20 97.50 122.23 10 50.00
6655. BARAA (barrettshot) 52 97.50 113.90 16 30.77
6656. imbad (imbad789) 71 97.49 129.84 19 26.76
6657. gangreenie (gangreenie) 264 97.49 130.44 105 39.77
6658. Dario (baldoius) 7 97.49 113.25 7 100.00
6659. d (reformatic) 1 97.49 97.49 1 100.00
6660. vehemore (d4bb3r) 5 97.49 120.72 2 40.00
6661. vanhoghe (newbgenjiboy) 5 97.48 106.69 0 0.00
6662. coolzacboy (coolzacboy) 67 97.47 116.83 23 34.33
6663. Jon (jonnylauws) 14 97.47 104.53 4 28.57
6664. Adrian (adrianvn789) 975 97.47 132.01 423 43.38
6665. CatToTheFour (cryptica) 10 97.46 112.20 4 40.00
6666. Jackson (jtrainpdx1) 3 97.46 100.51 2 66.67
6667. Adam (assassinbred) 14 97.46 105.67 2 14.29
6668. Taylor (trob388) 4 97.46 103.11 3 75.00
6669. isaacgoe (isaacgoe) 10 97.45 118.71 3 30.00
6670. ben (panda_jellyfam) 50 97.44 117.27 25 50.00
6671. Terminator (dr_nefarious) 7 97.44 111.06 5 71.43
6672. Dylan (dhatx13) 10 97.43 117.67 4 40.00
6673. Olivia (olivisthecow) 10 97.42 112.02 6 60.00
6674. I ♥ Gym (2slow_2exist) 113 97.42 115.53 42 37.17
6675. Marc (ratshepard) 65 97.42 119.10 32 49.23
6676. John (johnho) 6 97.42 132.40 3 50.00
6677. Nicolas (nick4652) 15 97.41 113.93 10 66.67
6678. Flame (panutadk) 47 97.41 115.95 16 34.04
6679. Theo (theogv) 26 97.41 116.39 13 50.00
6680. Dan (drimilyon) 5 97.40 108.23 1 20.00
6681. Error (errorws) 3 97.40 98.70 3 100.00
6682. Jose (josethomas) 25 97.40 111.38 11 44.00
6683. Carlos (carandrod) 2 97.40 102.30 1 50.00
6684. a (aly394) 7 97.39 115.43 2 28.57
6685. Dakota (dakbell) 3 97.39 99.55 1 33.33
6686. Crescendo (crescendot) 12 97.38 115.50 6 50.00
6687. Ethan (sweethan) 25 97.38 113.11 4 16.00
6688. Sorin (tur7le0010) 23 97.38 119.31 14 60.87
6689. Leo (the_e_lemonator) 3 97.38 108.53 2 66.67
6690. Irene (queen5213) 1 97.38 97.38 0 0.00
6691. Ron(ald) (jellybeanman) 33 97.38 114.32 20 60.61
6692. Electric (cuitcuit) 22 97.38 114.19 12 54.55
6693. Griz (realgrizzle123) 7 97.38 107.46 1 14.29
6694. az4521 (az4521) 2 97.37 100.95 0 0.00
6695. Zaley (zaleykane) 6 97.37 117.32 5 83.33
6696. Derp (thelol) 57 97.37 119.01 43 75.44
6697. Jack (adc6768) 17 97.37 114.43 7 41.18
6698. Nick (alphaman3801) 4 97.37 105.04 3 75.00
6699. Jeremy (gamingbull) 4 97.37 100.53 2 50.00
6700. Devin (distortedharmony) 23 97.36 125.34 11 47.83
6701. Austin (splashtime) 29 97.36 109.88 14 48.28
6702. Johnnieboy (bently5102) 6 97.36 114.29 5 83.33
6703. Pizdonja (sule57) 78 97.36 115.38 22 28.21
6704. ムラサメ (murasamechan) 1 97.36 97.36 0 0.00
6705. Joseph (gov_issued) 12 97.35 108.56 0 0.00
6706. Loege (loege) 73 97.35 120.44 28 38.36
6707. Gregory (bobren) 20 97.35 106.42 5 25.00
6708. kir (kiranv1584) 4 97.35 101.52 2 50.00
6709. Johan (johanapa) 21 97.34 117.48 19 90.48
6710. Veteran1728 (frenzy1728) 109 97.34 116.55 35 32.11
6711. David (davidt585) 9 97.34 108.11 1 11.11
6712. Joshua (joshbenja) 29 97.33 110.35 9 31.03
6713. Nick (coyote96) 585 97.32 119.00 237 40.51
6714. Daniel (danielmini0101) 3 97.32 107.15 3 100.00
6715. Travis (tsmith112000) 2 97.32 100.48 1 50.00
6716. Tiger_Pop (tiger_pop) 1 97.32 97.32 1 100.00
6717. i am the slowest typer in t... 1 97.32 97.32 0 0.00
6718. Erik (eriklvalentin) 8 97.31 111.27 3 37.50
6719. Vraj (i_type_really_slow_ok) 13 97.31 107.09 3 23.08
6720. John (flyingraven) 28 97.31 116.68 11 39.29
6721. brendan (barnold2) 11 97.31 114.78 4 36.36
6722. Djordje (djo666) 16 97.31 110.20 7 43.75
6723. Horst (feanor) 294 97.30 120.28 107 36.39
6724. Andrea (andrealol) 2 97.30 113.13 0 0.00
6725. Chris (chee_ms) 7 97.30 106.97 1 14.29
6726. Appropriate (d0wny) 142 97.30 133.50 57 40.14
6727. twitch.tv/empyr1cal (fritte... 18 97.30 116.42 9 50.00
6728. patel to the metal (wildsv2) 2 97.30 102.17 1 50.00
6729. Papa (quamthebomb) 11 97.29 114.43 5 45.45
6730. huacheng (fallingfeather) 1 97.29 97.29 1 100.00
6731. Campbell (cphalen) 8 97.28 120.36 2 25.00
6732. Chris P. (sirjean_pepper) 10 97.28 109.39 4 40.00
6733. MrDiRamio (madiramio) 15 97.27 108.46 9 60.00
6734. Homie (metrically) 6 97.27 113.27 4 66.67
6735. Muslem (muslimomar) 1 97.27 97.27 0 0.00
6736. Bryan (h0tl1nebl1ng) 4 97.27 105.70 2 50.00
6737. Cade (ctw_) 18 97.27 119.72 8 44.44
6738. matt (mathster09) 2 97.26 106.65 0 0.00
6739. Tyler (tythal) 464 97.25 130.85 188 40.52
6740. Damyian (kight) 30 97.25 126.33 11 36.67
6741. majesticjojo (majesticjojo) 4 97.24 109.26 0 0.00
6742. kit (kitkatpaddywack) 16 97.24 110.89 5 31.25
6743. Christos (cros107) 3 97.23 111.97 0 0.00
6744. Lakshay (shaybas) 109 97.23 123.43 36 33.03
6745. poophead (watermelon69) 2 97.23 100.37 1 50.00
6746. Pidguit (pidguit) 14 97.23 112.03 5 35.71
6747. Jen (jenniferrocks07) 22 97.23 115.29 7 31.82
6748. nikimii (lemontrees) 6 97.22 107.23 2 33.33
6749. quibby (quibbytm) 6 97.22 109.90 4 66.67
6750. Benjamin (tryingtouse10fing... 1,250 97.22 131.83 487 38.96
6751. Jake (jakesk) 16 97.20 112.21 4 25.00
6752. hunzai (alihunzai) 429 97.20 135.81 156 36.36
6753. Wetetet (wetetet) 2 97.20 99.60 1 50.00
6754. shebaw (shebaw) 23 97.19 115.28 7 30.43
6755. nick (nickpanda44) 13 97.19 108.49 8 61.54
6756. Justin (justbh) 16 97.19 110.95 3 18.75
6757. Kushagra (kushagra_doodoo) 6 97.19 106.03 6 100.00
6758. Jus (nicememe12) 19 97.18 111.32 9 47.37
6759. Harold (who_da_penguin) 3 97.18 105.32 1 33.33
6760. smq (_smq) 100 97.18 124.93 44 44.00
6761. Ta-Wei (waynetu) 202 97.18 111.64 88 43.56
6762. Pratik (trippyhob) 57 97.17 116.47 25 43.86
6763. Ali (djsum) 5 97.17 113.45 0 0.00
6764. Aqualuma (aqualuma1) 9 97.17 114.43 3 33.33
6765. Komchan (komchan) 5 97.17 106.50 2 40.00
6766. TuffTofu (tufftofu) 16 97.17 115.19 9 56.25
6767. Lilith (lilith333) 9 97.17 103.44 8 88.89
6768. Cristian (cmatiasc) 26 97.16 112.43 13 50.00
6769. Zack PTIT (sieunhan283) 47 97.16 108.80 17 36.17
6770. Arturs (archey187) 4 97.16 108.52 2 50.00
6771. NickBwalley (nickbiiy) 124 97.16 122.02 52 41.94
6772. Alexander (alexkingen) 5 97.16 102.11 4 80.00
6773. flis (philip29) 66 97.16 124.86 28 42.42
6774. Reimar (reimarpb) 80 97.15 115.44 40 50.00
6775. pen (lock3r) 80 97.15 125.46 25 31.25
6776. Wojciech (irth) 6 97.15 104.74 4 66.67
6777. rachel (rsimonton94) 14 97.15 114.78 4 28.57
6778. Jonas (joltux) 7 97.14 100.75 3 42.86
6779. Dog (typing_doggo) 31 97.14 115.16 14 45.16
6780. phong (whatthephong) 2 97.14 99.86 0 0.00
6781. Albert (hsabove) 1 97.13 97.13 0 0.00
6782. K (mosspath16) 8 97.13 111.19 6 75.00
6783. Sanic (192378) 70 97.11 116.77 27 38.57
6784. CapoAgus (capoagus) 4 97.11 107.02 1 25.00
6785. Twillerdog (twillerdog) 2 97.11 97.83 0 0.00
6786. Unai (supernax) 5 97.11 108.89 3 60.00
6787. KillerK (khanhp4) 6 97.10 109.88 2 33.33
6788. t2fast4u (t2fast4u) 14 97.10 122.86 4 28.57
6789. yasmu? (keepitup) 345 97.10 129.84 131 37.97
6790. Cameron (camicazz475) 6 97.10 102.41 3 50.00
6791. Kirua (kirua99) 2 97.10 103.85 1 50.00
6792. tilko (tilko) 8 97.09 105.31 3 37.50
6793. Coconut (the_coconut) 19 97.09 107.15 6 31.58
6794. Zalvy (ydnav) 11 97.09 116.23 4 36.36
6795. Cornelius (salibzz) 197 97.09 120.56 68 34.52
6796. Jonathan (shoopdasoup) 7 97.09 133.50 6 85.71
6797. Lord (planta) 116 97.08 121.94 39 33.62
6798. The Papal State (loquiera) 38 97.07 113.06 11 28.95
6799. Cozmin (zethy03) 6 97.07 107.81 4 66.67
6800. Bremerton (bremerton) 6 97.07 111.43 6 100.00
6801. what (what_what_what) 10 97.06 114.98 4 40.00
6802. Declan (decmasta) 1 97.06 97.06 0 0.00
6803. Brendan (bfay) 31 97.06 119.12 10 32.26
6804. Luke (hakked) 2 97.06 109.53 1 50.00
6805. Jacob (flyingducky101) 2 97.06 100.62 0 0.00
6806. Michael (michaelch) 921 97.05 136.99 366 39.74
6807. Brian (taters613) 403 97.05 121.81 145 35.98
6808. Seth (sethrhcp) 2 97.05 104.39 1 50.00
6809. lobus (lobus_rec) 1,089 97.05 128.26 420 38.57
6810. a (suk_) 11 97.04 126.01 8 72.73
6811. Lil (liljuicy) 40 97.04 127.12 14 35.00
6812. Sonia (vannvilla) 11 97.03 106.55 8 72.73
6813. pastabooth (pastabooth) 7 97.03 115.68 5 71.43
6814. Spridic (spridic) 5 97.03 102.41 3 60.00
6815. Liz (easwans) 7 97.03 119.14 1 14.29
6816. uwos (artuist) 14 97.03 107.13 7 50.00
6817. Sir (tinapay) 2 97.03 101.97 1 50.00
6818. VYCanis (vycanis55) 32 97.03 105.75 15 46.88
6819. Marcus (safetymarcus) 2 97.03 103.61 1 50.00
6820. Andrew (greatfighter10) 77 97.02 110.56 27 35.06
6821. Andrei (headpats) 2 97.02 98.21 0 0.00
6822. Mantis (mantisplays) 36 97.02 127.43 8 22.22
6823. Johnathan Walter (luciferin) 18 97.01 108.78 5 27.78
6824. pat (teloi) 3 97.01 102.61 2 66.67
6825. Yadira (yadirairiz) 20 97.01 118.74 7 35.00
6826. Daniel (beamenace) 5 97.01 106.21 2 40.00
6827. hwi (hwi_two) 4 97.01 104.00 2 50.00
6828. Am1n (vividus) 1,973 97.01 121.10 791 40.09
6829. AHomieNucleus (galaxxyn1) 95 97.01 116.50 36 37.89
6830. Shamil (echonaut) 10 97.00 103.34 4 40.00
6831. alex (agogalex) 5 97.00 115.62 3 60.00
6832. 😳😳😳 (lanterex) 54 97.00 110.60 23 42.59
6833. Aldrich (gwaldrich) 11 97.00 112.03 3 27.27
6834. Jake (jake_tyler) 157 97.00 117.37 62 39.49
6835. Jason (illumathottie) 16 97.00 116.33 12 75.00
6836. Kagamine (kagamine_len) 38 97.00 120.45 9 23.68
6837. Jamo (thewindy) 233 97.00 123.03 93 39.91
6838. Sebastian (sfmiguez) 23 96.99 127.37 9 39.13
6839. I AM SPEED (xelestis) 18 96.99 114.84 6 33.33
6840. Virbox (web_user) 31 96.99 110.98 11 35.48
6841. RedEye (redeye) 7 96.99 112.63 3 42.86
6842. Lucas (veraluc) 29 96.99 119.25 8 27.59
6843. Ryan (ohlegends) 1 96.98 96.98 0 0.00
6844. Bread (breadmonkey) 25 96.98 114.94 9 36.00
6845. Crestyn (crestyn) 17 96.97 110.80 8 47.06
6846. blue (bluedragon_) 300 96.97 136.91 117 39.00
6847. Alf (the_destroyer_of_worlds) 166 96.96 123.49 68 40.96
6848. tivo (tivotavo) 1,287 96.96 147.87 518 40.25
6849. Rick (the_rick_astley) 1 96.96 96.96 1 100.00
6850. Mendel (mendeljacks) 40 96.96 113.57 20 50.00
6851. avery (stridersword) 5 96.96 107.60 3 60.00
6852. Korra (grandesonnerie) 334 96.95 142.25 130 38.92
6853. Jacob (zoloto67) 30 96.95 111.58 12 40.00
6854. Trihard (screwsps) 2 96.95 97.22 2 100.00
6855. Roman (romi14) 87 96.95 127.84 26 29.89
6856. Shinji (nagkagrabe7) 118 96.95 118.73 42 35.59
6857. chipotle06 (chipotle06) 13 96.94 106.80 8 61.54
6858. Dream (dreamsnake) 13 96.93 125.37 5 38.46
6859. Terence (tt9000) 3 96.93 107.28 3 100.00
6860. Hùng (kenkenkiota) 56 96.93 116.28 23 41.07
6861. Andre (astrothetypist) 9 96.93 107.09 3 33.33
6862. Mark (mesm) 7 96.93 114.34 2 28.57
6863. Jordan (xbeastyx) 2 96.93 99.74 2 100.00
6864. Matty (cannotdivideby0) 14 96.92 115.27 7 50.00
6865. honey (intheswampwithshrek) 4 96.92 107.53 1 25.00
6866. Christopher (jingping) 7 96.92 112.45 2 28.57
6867. 🐐 (auaomamm) 10 96.91 108.41 5 50.00
6868. Henry (barihenry) 38 96.91 114.69 15 39.47
6869. e (zimboboys) 7 96.91 103.31 3 42.86
6870. TypeBot (phycer) 14 96.91 110.97 5 35.71
6871. Jonathan Justin (jonathanjw05) 10 96.91 102.67 4 40.00
6872. Chelsea (aurialing) 21 96.90 105.57 5 23.81
6873. :) (coolkidswag) 61 96.90 121.66 15 24.59
6874. George (gecovin) 29 96.90 118.65 11 37.93
6875. Prasant (man_iac) 650 96.90 124.60 266 40.92
6876. Sweet Wort (sweetwort) 6 96.89 107.35 4 66.67
6877. Bill (trainingb4tests) 58 96.88 127.99 22 37.93
6878. marley (asianwonton) 4 96.88 102.76 2 50.00
6879. Hossen (galacticcheese1) 71 96.88 119.16 25 35.21
6880. slow (366665) 1 96.87 96.87 0 0.00
6881. Cinari (cinari) 29 96.87 108.54 6 20.69
6882. HubaFluba (hubafluba) 5 96.87 109.05 5 100.00
6883. Alex (azheng) 1 96.86 96.86 1 100.00
6884. Zet (zeathus) 2 96.86 102.15 1 50.00
6885. Sun (headedead) 438 96.86 124.04 170 38.81
6886. Gnetyx (gnetyx) 2 96.86 100.96 1 50.00
6887. Herbie (hjrand1005) 93 96.85 116.52 37 39.78
6888. Paul (retropixel99) 7 96.85 107.34 1 14.29
6889. 🤠👌🏿 (blackclaw) 13 96.85 108.05 6 46.15
6890. Wyman (speedy_boi420) 62 96.85 121.49 25 40.32
6891. Trpimira (m15k0) 64 96.85 113.98 28 43.75
6892. Apollyon (mik_apollyon) 104 96.84 122.30 46 44.23
6893. RasDingo (haroxdruiden) 5 96.84 110.40 3 60.00
6894. Fox (pineapplefun101) 1 96.84 96.84 1 100.00
6895. Kyle (sparrowfan101) 27 96.84 114.22 9 33.33
6896. McClout (type_69_master) 9 96.84 117.44 6 66.67
6897. Milky (milkxy) 29 96.83 115.09 19 65.52
6898. 4n2h0ny (4n2h0ny) 1 96.83 96.83 1 100.00
6899. Teuku (rhazzdawg) 2 96.83 100.14 2 100.00
6900. Andrew (swissarmyman) 2 96.83 104.85 1 50.00
6901. MeHdi (mehdiii8) 147 96.82 120.09 69 46.94
6902. Blake (skidaddle) 24 96.82 125.39 6 25.00
6903. Ricky (rickestsot) 39 96.82 118.33 19 48.72
6904. max (tekoh) 2 96.82 106.16 2 100.00
6905. William (freewille) 14 96.82 115.99 6 42.86
6906. Brian (thepinkelephantcar) 15 96.82 124.73 3 20.00
6907. Darin (notdvu) 5 96.82 125.12 2 40.00
6908. carlos (carlit0) 84 96.81 121.90 25 29.76
6909. backtozero (knuckledoritos) 5 96.81 105.55 2 40.00
6910. Matthew (twixinator) 10 96.81 110.68 2 20.00
6911. Legacy (legacylegacy) 9 96.81 111.54 3 33.33
6912. Ralph (triathreat) 17 96.80 124.46 9 52.94
6913. YoGurt (yogurt026) 1 96.80 96.80 0 0.00
6914. DuhMarquis (dmy3) 1 96.80 96.80 0 0.00
6915. Holder (arcanezer0) 56 96.80 122.33 21 37.50
6916. Rodrigo (rugoso) 50 96.80 113.73 22 44.00
6917. olajide olatunji (bulgelord) 3 96.80 103.32 2 66.67
6918. Ian (_iii_an) 3 96.80 105.75 2 66.67
6919. Lirei (lirei) 242 96.79 120.03 68 28.10
6920. Cihsa (oddlysatisfly) 54 96.79 115.65 20 37.04
6921. Cecil (goodie1857) 64 96.79 127.35 46 71.88
6922. Sml (cactusman215) 49 96.79 109.80 18 36.73
6923. JSKE25 (jske25) 18 96.79 119.19 10 55.56
6924. Raymond (raymo_nd) 2 96.79 99.35 0 0.00
6925. sushiwasabi (sushiwasabi) 4 96.79 104.57 3 75.00
6926. Kyle (kyjasa88) 9 96.78 110.03 3 33.33
6927. Quibz (white_fire) 47 96.78 125.01 19 40.43
6928. Martin (watchieboy) 229 96.77 128.67 87 37.99
6929. Eliud (inggoodface) 78 96.77 133.10 19 24.36
6930. Ibnu (ibenusina) 3 96.76 109.78 2 66.67
6931. Chanson (fistarmeister) 3 96.76 100.21 2 66.67
6932. Henry (rustylimbs) 3 96.76 101.65 0 0.00
6933. tsunamibro (tsunamibro) 5 96.75 109.34 3 60.00
6934. Kartavya (kartavyajain) 22 96.75 112.59 11 50.00
6935. JLocked (jlocked333) 2 96.75 99.71 1 50.00
6936. Bruh (blackbacon08) 10 96.75 105.76 5 50.00
6937. paper2222 (paper2222) 5 96.75 108.97 0 0.00
6938. ya (stfudesu) 39 96.75 125.33 15 38.46
6939. PulseAD (pulsead) 10 96.75 109.70 7 70.00
6940. Cristobal Zarco (boomer_tor... 1 96.74 96.74 1 100.00
6941. Alex (aspectings) 9 96.74 123.99 9 100.00
6942. Nathan (natem135) 50 96.73 126.65 17 34.00
6943. Zachary (zminuk) 6 96.73 104.77 3 50.00
6944. Roy (yoruio) 16 96.73 114.35 4 25.00
6945. HotClaw (hotclaw) 373 96.72 121.41 160 42.90
6946. cig (cigtype) 3 96.72 100.51 1 33.33
6947. Toastie (tjmck) 5 96.72 104.65 4 80.00
6948. Rudra (ryder_on_the_storm) 12 96.72 112.66 9 75.00
6949. ramoraros (ramoraros) 4 96.72 108.47 2 50.00
6950. Bempe (bempe) 8 96.72 106.03 3 37.50
6951. Satwik (satwik2708) 554 96.71 127.96 214 38.63
6952. transcontinentalrailroad (y... 1 96.71 96.71 0 0.00
6953. James (withdraw) 1 96.71 96.71 0 0.00
6954. Magnus Madsen (ersti) 1 96.71 96.71 0 0.00
6955. Дидакус (didacus) 43 96.71 110.21 17 39.53
6956. #EndCars (stratmann) 11 96.70 102.56 5 45.45
6957. Bucky (buhcky) 13 96.70 123.39 5 38.46
6958. Mike (mike_shen) 23 96.70 115.75 10 43.48
6959. only quit (sberens) 2 96.70 107.69 1 50.00
6960. 𝙺𝚊𝚒𝚝𝚊𝚕... 6 96.70 118.03 1 16.67
6961. Adam (sfdcoderaz) 6 96.70 106.92 3 50.00
6962. nilebr (nilebr) 17 96.69 108.73 2 11.76
6963. Norm (dwagner8) 1 96.69 96.69 1 100.00
6964. Pranav Abraham (pranavabe) 5 96.69 118.74 2 40.00
6965. Alvin (alwin630) 30 96.69 116.00 11 36.67
6966. Leon (leon22) 95 96.68 118.06 33 34.74
6967. i have no (miamam) 58 96.68 132.73 20 34.48
6968. Slowman (slowman101) 80 96.67 111.04 30 37.50
6969. Maya (periiwrinkles) 5 96.67 103.22 0 0.00
6970. Josh (joshjacks) 78 96.67 112.93 36 46.15
6971. BeckerGames.com (crazyninja... 4 96.67 104.77 1 25.00
6972. Andy (gunwing54) 19 96.66 114.89 4 21.05
6973. JanBa (pythonbyte) 192 96.66 127.46 68 35.42
6974. A (fdsjaklfdsaj) 41 96.66 113.91 16 39.02
6975. Galatia (xisnyang) 6 96.66 106.69 1 16.67
6976. Ryan (arstar) 5 96.66 104.74 2 40.00
6977. Kaushik (yeswekey) 55 96.65 112.10 16 29.09
6978. Kyozō (thegiantchip) 73 96.65 118.76 36 49.32
6979. gak (gakman) 4 96.65 109.20 2 50.00
6980. Duck (duok) 1 96.65 96.65 0 0.00
6981. Kilty (kilty) 7 96.65 108.20 5 71.43
6982. Ranger (rangerelk76) 2 96.65 104.46 0 0.00
6983. Lukas (achertin) 4 96.64 111.99 3 75.00
6984. Robert (rnschmidt) 4 96.64 104.75 1 25.00
6985. Winston (imonlytypingwithtw... 1 96.64 96.64 0 0.00
6986. .zyf (hinglect) 14 96.64 110.43 6 42.86
6987. J (jepster007) 4 96.64 106.33 3 75.00
6988. Pumpkin Raj (chillreksai) 92 96.63 115.98 44 47.83
6989. Sidveed (sidveed) 10 96.63 116.44 2 20.00
6990. Hannah (hpelay) 98 96.62 117.72 37 37.76
6991. Nathan (nathanv) 15 96.62 113.67 4 26.67
6992. Abbacchio (abbacchio) 45 96.62 115.66 14 31.11
6993. TTVronness_ (ronneclee) 192 96.62 119.91 63 32.81
6994. Randy (rhomusic) 9 96.62 104.47 4 44.44
6995. Albert (abt8601) 51 96.62 113.54 23 45.10
6996. Jonato (jonato) 5 96.61 112.63 1 20.00
6997. Walnert (walnert) 41 96.60 115.29 24 58.54
6998. TopGUN (wayhowma) 302 96.60 118.40 183 60.60
6999. atapi (pralaya) 340 96.59 121.04 188 55.29
7000. Alexander (prayforwinter) 10 96.59 114.63 5 50.00
7001. CortsTypist (cortsvan) 3 96.59 98.27 2 66.67
7002. Cochu (cochuu_) 2 96.59 98.05 2 100.00
7003. YW (tywee) 18 96.59 106.43 10 55.56
7004. Daniel (danguydudebro) 7 96.59 108.14 7 100.00
7005. Zod (1zod) 3 96.59 101.59 1 33.33
7006. SECsplitOND (secsplitond) 41 96.58 122.99 20 48.78
7007. Redox (redox_p) 9 96.58 109.27 2 22.22
7008. Matt (marvinhamlisch) 1 96.58 96.58 0 0.00
7009. Edward (ewc340) 3 96.57 100.78 1 33.33
7010. Mikel (meekay) 40 96.57 119.64 14 35.00
7011. vroom (junap) 21 96.56 116.70 8 38.10
7012. drowez1 (drowez1) 7 96.56 109.11 2 28.57
7013. Fishy_Types (fishy_types) 86 96.56 126.46 33 38.37
7014. They don't know me son (war... 63 96.55 133.65 30 47.62
7015. ignacio (ifarias25) 249 96.54 123.78 72 28.92
7016. Zohaib (leggoboyo) 2 96.54 108.14 2 100.00
7017. 😀 (brettkavanaughcj) 3 96.54 102.53 1 33.33
7018. Rajinikanth (rajini_macbook) 5 96.54 103.63 0 0.00
7019. Aran (sharon032588) 12 96.54 122.38 5 41.67
7020. Karma (nexus48) 6 96.54 114.40 3 50.00
7021. Davids (petally) 7 96.54 108.32 4 57.14
7022. Lucas (excorpse) 14 96.53 115.83 5 35.71
7023. Casey (thefearedturtle) 3 96.53 100.75 3 100.00
7024. nitrosquid (nitrosquid) 31 96.52 126.27 10 32.26
7025. Phillip (pjeong3120) 15 96.52 108.72 5 33.33
7026. XOR_ (wisetoad) 14 96.52 114.87 7 50.00
7027. Ricky (galvanize) 111 96.50 126.99 40 36.04
7028. Suddenly (suddenlynothing) 20 96.50 108.43 8 40.00
7029. Zi (asianzealand) 6 96.50 113.19 3 50.00
7030. mike (mikehawk12345) 70 96.50 129.78 29 41.43
7031. Panazios (panazios) 1 96.50 96.50 1 100.00
7032. Ponymouse (ponymous) 71 96.50 129.56 33 46.48
7033. kk (kkqu) 91 96.49 114.55 35 38.46
7034. Edward (jinsye) 21 96.48 115.18 6 28.57
7035. Haydn (mathlobster) 2 96.48 97.28 0 0.00
7036. Daner (dferha2) 1 96.48 96.48 0 0.00
7037. Ed (raptorofli) 325 96.48 129.30 129 39.69
7038. Daryll (daryll_ko) 23 96.48 110.29 13 56.52
7039. Slobodan (bekca) 13 96.48 111.74 4 30.77
7040. Gus (uberro) 99 96.47 121.70 40 40.40
7041. s (caustlc) 8 96.47 110.54 5 62.50
7042. H. (hblord) 38 96.47 110.06 21 55.26
7043. Jared (buckdancer) 57 96.47 115.20 21 36.84
7044. Tobi (obiaas) 15 96.46 108.49 6 40.00
7045. Isaac (saxxie) 6 96.46 106.81 6 100.00
7046. Hussain (sanpilot) 226 96.46 126.39 86 38.05
7047. Gio (gio_etche) 80 96.46 125.10 27 33.75
7048. Sophie (seulrene) 6 96.46 107.74 2 33.33
7049. Derek (thenyaz) 376 96.46 119.13 144 38.30
7050. Raven (kfaulk1216) 13 96.45 107.78 6 46.15
7051. Cornelius (corneliusyan) 3 96.44 101.86 3 100.00
7052. Tinnaphop (mistertfy64) 60 96.44 120.46 19 31.67
7053. Razor Red Rage (ayyaz_nemesis) 496 96.44 137.75 164 33.06
7054. Graham (gfoote) 32 96.44 108.33 12 37.50
7055. Borlagotch (19jonono) 1 96.44 96.44 1 100.00
7056. amos (amoooss88) 4 96.44 98.52 2 50.00
7057. Extreme Bass Tester (mrbass... 8 96.44 110.99 5 62.50
7058. ricko (ricklo7) 66 96.44 123.48 22 33.33
7059. Deadeye (banterbry) 2 96.43 99.73 0 0.00
7060. Bob (sydre2) 70 96.42 113.73 35 50.00
7061. InNeedOfName (inneedofname) 172 96.42 133.56 56 32.56
7062. TastyApple (tastyapple) 56 96.41 112.68 24 42.86
7063. Luke (lukell) 526 96.41 131.99 181 34.41
7064. m (bluesiren) 11 96.41 120.45 5 45.45
7065. bRIAn (brianlebrian) 6 96.40 108.86 0 0.00
7066. Mr (mr_otaku) 1 96.40 96.40 0 0.00
7067. Skyler (hausky) 11 96.40 109.75 6 54.55
7068. Just (needhelpintyping) 11 96.39 112.93 4 36.36
7069. sash (sashtypes) 3 96.39 119.17 1 33.33
7070. Zachy (ggohpks) 5 96.39 103.67 3 60.00
7071. lol (scdwcd) 1 96.39 96.39 0 0.00
7072. ⁹⁻¹⁰ᵍᵐ (green910) 539 96.39 121.75 215 39.89
7073. Ambien (bbcocaine) 3 96.39 99.11 1 33.33
7074. deez (salt_tea) 3 96.38 101.77 3 100.00
7075. tstats[neverwen] (neverwen) 12 96.38 116.49 5 41.67
7076. gabriel (gfox66) 7 96.38 104.54 6 85.71
7077. Rance (fxnc) 2 96.38 105.00 1 50.00
7078. Avi (_avi_) 55 96.38 112.36 20 36.36
7079. Bing (gamerbilplays) 104 96.38 133.28 45 43.27
7080. Kelli (klandry80) 6 96.38 116.08 2 33.33
7081. Jonathan (jbrich) 4 96.38 110.29 2 50.00
7082. numdegased (numdegased) 10 96.37 102.96 3 30.00
7083. Nik (nazeki) 33 96.37 123.41 19 57.58
7084. Aaron (atg2142) 7 96.37 114.41 1 14.29
7085. raf (anemonespotted) 4 96.36 103.59 3 75.00
7086. Erik (erikberik) 4 96.36 101.54 0 0.00
7087. lamok (mrgago) 19 96.36 123.72 13 68.42
7088. Aranyo (chimichenghiskhan) 82 96.35 114.45 36 43.90
7089. joe (samoyeet) 2 96.35 99.82 0 0.00
7090. dongster (dongster) 8 96.34 121.51 1 12.50
7091. Chessy (chescahi) 17 96.34 111.00 7 41.18
7092. Paul (palisfpauul) 26 96.34 107.97 11 42.31
7093. Kimo (kimota) 3 96.34 107.53 1 33.33
7094. John (imsoepic) 31 96.33 109.62 10 32.26
7095. Ryan (rvisich5) 2 96.33 98.89 1 50.00
7096. Abdullah (ghadanfar) 48 96.33 119.45 17 35.42
7097. Zeta (zetanegativeone) 8 96.33 109.51 5 62.50
7098. Kevin (windn6) 91 96.33 123.33 33 36.26
7099. Kawaguchi (h7karu) 2 96.33 97.07 0 0.00
7100. Vishal (vishalnehra) 6 96.32 99.66 1 16.67
7101. Ryan (thoughtpotato) 19 96.32 112.43 5 26.32
7102. EquityDeadlock (equitydeadl... 186 96.32 128.76 76 40.86
7103. Vroom! (laptopguy) 706 96.32 137.48 271 38.39
7104. - (thegoldentiger) 13 96.32 110.06 4 30.77
7105. Juggernaut (jugg07) 32 96.32 112.60 11 34.38
7106. Dylan (dyl0e) 9 96.31 101.90 3 33.33
7107. Dan (themanisdan) 20 96.31 108.87 7 35.00
7108. brobie (brobie747) 38 96.31 120.45 14 36.84
7109. Long Double E.T. (jackje) 15 96.31 116.62 6 40.00
7110. Caleb (zonicon) 2 96.31 105.26 2 100.00
7111. Anant (hero_shukla) 770 96.30 128.56 303 39.35
7112. Soqii (soqii) 5 96.30 104.49 5 100.00
7113. Wawa (wawa286) 1 96.30 96.30 0 0.00
7114. Exyiaevox (exyia) 112 96.30 132.03 46 41.07
7115. Jim (hockeyhead019) 41 96.29 110.93 14 34.15
7116. Maru (maruuu) 2 96.29 100.53 0 0.00
7117. Sweeter (sweetervanilla) 10 96.29 112.21 5 50.00
7118. John (john62180) 5 96.29 112.23 3 60.00
7119. Levi (fajpaj) 9 96.29 113.61 2 22.22
7120. Stephen (litedrizzle) 4 96.29 113.68 3 75.00
7121. Ya boi (thesmores) 6 96.28 116.23 2 33.33
7122. Cessa (cessactdm) 1 96.28 96.28 1 100.00
7123. Phil (philosphyphil) 1 96.28 96.28 1 100.00
7124. hamza (mizoxes) 140 96.28 118.55 58 41.43
7125. JRey (jreyranoco) 7 96.27 102.15 3 42.86
7126. lio (osybius) 105 96.27 118.76 46 43.81
7127. Antogs (antogs) 4 96.27 106.49 2 50.00
7128. Ivan (s017180) 44 96.27 116.60 15 34.09
7129. Noah (bhyldir) 2 96.27 97.25 1 50.00
7130. Clippy (jesspacito) 18 96.26 117.05 17 94.44
7131. Maximus (sprachzarathustra) 8 96.26 110.52 2 25.00
7132. Danny (danny1901) 69 96.26 116.94 29 42.03
7133. neuralscatted (neuralscatte... 2 96.26 100.34 1 50.00
7134. George (typing_bot) 2 96.26 97.61 1 50.00
7135. George (piehead567) 27 96.26 109.78 14 51.85
7136. Tyler (rockinrollo) 6 96.26 109.65 3 50.00
7137. Ojal (ojhhhal) 23 96.26 105.89 6 26.09
7138. Vbee (vb33) 147 96.25 121.00 63 42.86
7139. Jayden (jaydensar) 9 96.25 113.87 3 33.33
7140. Jenn (jenn_ahn) 1 96.25 96.25 1 100.00
7141. Vanshaj (torque_i_alpha) 1 96.25 96.25 1 100.00
7142. Fireworks (fireworkkss) 55 96.25 111.19 22 40.00
7143. sam (swissnetizen) 5 96.25 105.89 4 80.00
7144. Alex (alexlea444) 59 96.25 110.45 21 35.59
7145. annette (owannette) 18 96.24 109.07 9 50.00
7146. AC (astralcalamity) 11 96.24 107.48 3 27.27
7147. Khoa (khoa1811) 13 96.24 107.19 3 23.08
7148. Carter (therealwhiterice) 481 96.24 149.81 183 38.05
7149. beebooboop (beebooboop) 14 96.23 107.43 3 21.43
7150. Damon (pvdorginal) 58 96.23 117.74 20 34.48
7151. kevin (uwupork) 14 96.23 113.88 8 57.14
7152. Michael (michaelhau) 3 96.23 113.16 2 66.67
7153. Gabriel (gabrielsqw) 2 96.23 97.52 2 100.00
7154. lillu (lilluwu) 3 96.22 132.64 0 0.00
7155. peppy (peppersteaku) 16 96.22 120.21 4 25.00
7156. Ozzie (ga05july) 4 96.21 106.24 1 25.00
7157. Drake (drake251200) 4 96.21 108.12 2 50.00
7158. Nemika (nemika) 5 96.20 106.42 2 40.00
7159. Warren (slacker_xd) 173 96.19 117.65 71 41.04
7160. Sophie Feldman (doodlefinny) 9 96.19 114.65 4 44.44
7161. Michael (michaelchristian024) 197 96.19 131.46 76 38.58
7162. Rotala (rotala_macrandra) 7 96.19 106.34 3 42.86
7163. Jeremy (rice_cream) 11 96.18 107.97 5 45.45
7164. Youssef (flameyoyo64) 4 96.18 114.85 2 50.00
7165. Mike (specialized) 3 96.18 103.05 1 33.33
7166. beng (benguwu) 3 96.17 105.77 1 33.33
7167. John (beefysalad69) 174 96.17 124.10 84 48.28
7168. Han (hantheautist) 1 96.17 96.17 0 0.00
7169. Gegug (gegug) 3 96.17 107.55 1 33.33
7170. tstats[joshuarose] (joshuar... 1,982 96.17 137.15 730 36.83
7171. Karl (relentlesstyper) 643 96.16 124.88 238 37.01
7172. kanai (kanai) 6 96.16 106.80 0 0.00
7173. Instinct (instinct1) 50 96.16 130.93 20 40.00
7174. Qwerty (qwerty80801) 720 96.16 126.22 265 36.81
7175. Eugene (eugeneteoh) 30 96.15 122.21 12 40.00
7176. CheetahDude (ghysdd) 29 96.15 115.88 11 37.93
7177. leftovericecream (leftoveri... 290 96.14 121.75 125 43.10
7178. Khit (khitnay) 77 96.14 117.89 35 45.45
7179. Runbo (rumboe) 1 96.14 96.14 0 0.00
7180. carleel (menamesringo) 1 96.14 96.14 1 100.00
7181. knowagh (gnoweagh) 17 96.14 105.33 2 11.76
7182. alnexus (felipxkillerbr) 5 96.14 103.67 1 20.00
7183. Art (art_licis) 1 96.13 96.13 0 0.00
7184. Ozma (ozma0foz) 5 96.13 105.09 3 60.00
7185. alex (alexyan) 1 96.13 96.13 1 100.00
7186. Somanos (somanos) 19 96.13 109.36 8 42.11
7187. Talonted (talonabuser) 46 96.12 125.00 15 32.61
7188. Ahnaf (reverse_typist) 1 96.12 96.12 1 100.00
7189. rickythedino (rickythedino) 8 96.12 115.32 3 37.50
7190. Andrew (andrewdvorak) 12 96.12 106.30 6 50.00
7191. Tony (complex) 256 96.11 131.84 93 36.33
7192. ben (prizmoasd) 30 96.10 112.97 8 26.67
7193. Kenshin (kenshin47) 10 96.10 110.85 7 70.00
7194. bo1Sauce (then1g) 100 96.10 118.62 34 34.00
7195. (dev_origami) 44 96.10 117.05 15 34.09
7196. Harry (txharry) 15 96.09 106.71 3 20.00
7197. Dan (moochookaboo) 2 96.09 107.91 1 50.00
7198. BanjoBoss (banjoboss) 43 96.08 119.71 20 46.51
7199. Ace (semiace) 60 96.08 120.54 28 46.67
7200. Jared (jarbarw) 13 96.07 111.62 7 53.85
7201. qwer (qwertyuiop232) 2 96.07 97.85 0 0.00
7202. turutupa (turutupa) 11 96.07 110.66 6 54.55
7203. gabe (gabeeeeee) 237 96.06 140.01 87 36.71
7204. 2Centuries (marwankhaled) 132 96.06 118.42 49 37.12
7205. ableable (ableford) 25 96.05 109.43 14 56.00
7206. Alb (albinalbin) 1 96.05 96.05 0 0.00
7207. sedate (sedatekitten) 71 96.05 135.10 27 38.03
7208. Raaed (raaed_23) 81 96.05 127.39 33 40.74
7209. Lupi (thedogz) 5 96.05 102.98 2 40.00
7210. Eugene (taiwansfinest) 31 96.05 119.95 10 32.26
7211. justme (nightval) 40 96.04 126.08 15 37.50
7212. Christine (hugowolf) 36 96.04 115.77 19 52.78
7213. Kevin (logia) 1 96.04 96.04 0 0.00
7214. Greg (xpec824) 1 96.04 96.04 1 100.00
7215. Abdullah (massucksagaming) 1 96.04 96.04 1 100.00
7216. biady (biadyy) 14 96.04 101.54 5 35.71
7217. janzen (janzenc) 4 96.04 102.62 2 50.00
7218. darius (dxriuzs) 13 96.03 107.46 8 61.54
7219. Toller (imthetoller) 5 96.03 103.26 4 80.00
7220. meandblackie (meandblackie) 2 96.03 100.44 1 50.00
7221. hoangnam75 (hoagnnam75) 70 96.03 112.53 26 37.14
7222. yikes (yeknom) 16 96.03 110.54 7 43.75
7223. Cheng Loke (lordwiz) 4 96.03 105.42 1 25.00
7224. Ronit (juniorvid) 3 96.03 98.69 1 33.33
7225. varkiziotis (slow_like_ribas) 4 96.03 102.03 2 50.00
7226. WeariedCoffee2 (weariedcoff... 1 96.02 96.02 0 0.00
7227. Tony (tyin) 1 96.02 96.02 1 100.00
7228. Solst (solst) 1 96.02 96.02 1 100.00
7229. dustin (eyedi) 3 96.02 107.57 1 33.33
7230. Max (2zmaxx) 33 96.02 117.32 14 42.42
7231. William (williamxu78) 1 96.01 96.01 0 0.00
7232. sloth (mitchie98) 304 96.01 132.43 42 13.82
7233. Radmilo (radmilo) 105 96.01 114.88 40 38.10
7234. Kevin (kimchioncolemak) 50 96.01 109.53 21 42.00
7235. Thor (thor3101) 2 96.01 98.22 0 0.00
7236. Gislaa (gislaaa) 7 96.00 103.33 3 42.86
7237. Ryan (ryanm42) 7 96.00 115.87 3 42.86
7238. William (williamyang94) 1 96.00 96.00 1 100.00
7239. Andy (andykim18) 14 95.99 110.08 4 28.57
7240. VinceFX (vincefx) 1 95.99 95.99 1 100.00
7241. Toxi (toxi) 1 95.99 95.99 0 0.00
7242. Aubergine (pomergenes) 2 95.99 96.33 2 100.00
7243. Amelia (ahmillzah) 1 95.99 95.99 0 0.00
7244. Sage (neonfuz) 1 95.98 95.98 1 100.00
7245. Daniel (danielwaker) 2 95.98 103.45 1 50.00
7246. Benji (benjibennick) 4 95.98 105.32 0 0.00
7247. Will (wdoutreband) 3 95.97 107.95 1 33.33
7248. AnoeticTypist (shannen_04) 14 95.97 107.94 6 42.86
7249. Joel (joel5534) 2 95.97 101.70 1 50.00
7250. James (jeffinger38) 3 95.96 104.73 3 100.00
7251. Dragon (mrdragonplays) 1 95.96 95.96 1 100.00
7252. Ion (incode4it) 68 95.96 133.97 28 41.18
7253. Richard (richyk1) 9 95.96 111.11 3 33.33
7254. Mads (madsbv) 31 95.95 112.66 15 48.39
7255. Adam (merrth) 34 95.95 111.42 6 17.65
7256. Hadi (charaka) 70 95.95 117.81 25 35.71
7257. Blizzard (blizzardwindx) 5 95.95 102.49 1 20.00
7258. Kian (uls_sanch) 109 95.95 111.05 30 27.52
7259. violet (validfingers) 12 95.95 106.56 12 100.00
7260. Michael (koreanpower912) 2 95.95 96.87 1 50.00
7261. Pyraq (dokson) 6 95.95 106.75 1 16.67
7262. furzoz (furzoz) 7 95.95 105.95 3 42.86
7263. Henrik (iupgrade) 52 95.94 116.15 22 42.31
7264. linkai (linkailul) 150 95.94 125.50 56 37.33
7265. Bill (bill_slouch) 24 95.94 118.64 11 45.83
7266. Bam (phoenixthestral) 76 95.94 118.45 26 34.21
7267. Christian (gergoss) 16 95.94 117.24 11 68.75
7268. Abdulwahab (abdulwahabksa) 7 95.94 114.80 5 71.43
7269. Winter (winter_dawn) 73 95.94 116.60 27 36.99
7270. Sarvottam (sarvottampriyada... 8 95.94 112.10 1 12.50
7271. Sam (zoinks_sam) 45 95.93 121.16 20 44.44
7272. Matthew (matthew_hall2) 23 95.93 119.11 6 26.09
7273. juzerr (markopokupecc) 20 95.93 125.79 5 25.00
7274. Nitro (nitrocrate) 76 95.92 114.08 34 44.74
7275. Thai (despotron) 31 95.92 115.01 7 22.58
7276. Brecken (breck1234) 8 95.91 117.44 3 37.50
7277. Aloysius (dude101no) 121 95.91 114.58 42 34.71
7278. omigumo (omigumo) 4 95.91 121.87 1 25.00
7279. Thomas (koreo) 2 95.91 101.40 2 100.00
7280. glassbottle (chambonu) 3 95.91 100.81 1 33.33
7281. Kirragy (kirragy) 6 95.91 104.84 1 16.67
7282. Jacob (jacobtpl) 2 95.91 98.16 0 0.00
7283. David (sandshrew4) 2 95.91 99.58 1 50.00
7284. Sea (theglowingman) 2 95.91 109.25 0 0.00
7285. anya (monarchunder) 51 95.90 124.26 29 56.86
7286. aka49 (aka49) 12 95.90 114.39 5 41.67
7287. Tim (tigothy) 7 95.89 111.92 2 28.57
7288. Charles (tyuule) 38 95.89 122.28 21 55.26
7289. Kostas (kael89) 5 95.89 99.62 1 20.00
7290. Pheresint (pheresint) 196 95.89 117.26 68 34.69
7291. hogs (hogsman) 52 95.88 126.36 23 44.23
7292. Nícolas (nickdev) 1 95.88 95.88 1 100.00
7293. Will (boi1561) 2 95.88 103.53 0 0.00
7294. Aidyn (justaidyn) 21 95.87 105.53 6 28.57
7295. ok (biscuitalex) 12 95.87 114.40 4 33.33
7296. Pham (hitpointsss) 7 95.87 112.23 1 14.29
7297. Alex (epintus) 23 95.87 112.67 12 52.17
7298. Kimberly (kimboslice16) 70 95.86 120.63 36 51.43
7299. 3ntr0py (fr3udian) 62 95.86 112.32 20 32.26
7300. Jeffrey (jeffreyfeng) 14 95.86 115.79 5 35.71
7301. DemPlayz (demplayz) 1 95.86 95.86 0 0.00
7302. Law (skreeblenutz) 3 95.86 100.48 0 0.00
7303. Broken (sakambagal_aba) 2 95.86 102.27 0 0.00
7304. sidd (siddvader) 5 95.86 104.69 1 20.00
7305. Louis (lodero) 16 95.86 115.19 10 62.50
7306. Hynoh (hynoh) 20 95.85 116.56 4 20.00
7307. mati (taux) 8 95.85 107.35 4 50.00
7308. itbolt (itbolt) 34 95.85 128.38 17 50.00
7309. Chris (ohkaychris) 13 95.85 114.48 5 38.46
7310. Thanh (pr1metine) 1 95.84 95.84 0 0.00
7311. Cuong (c_nguyenthien) 375 95.84 118.83 144 38.40
7312. JR (lordjoshyy) 14 95.84 103.61 4 28.57
7313. Ugnius (popcorn325) 318 95.84 119.02 126 39.62
7314. E dog (evan819) 18 95.84 118.82 8 44.44
7315. Brian (brian3927) 30 95.84 118.26 11 36.67
7316. Dongwoo (dongwoo0504) 6 95.84 102.85 5 83.33
7317. John (johncha15724) 30 95.83 110.30 10 33.33
7318. Jatin (jcsteelbender) 12 95.83 106.89 6 50.00
7319. Andrew (andumpling) 213 95.82 118.37 91 42.72
7320. George (mega_type_racer) 95 95.82 114.07 44 46.32
7321. Gabe (gabuthebabu) 26 95.82 112.08 13 50.00
7322. Setu (ganjuitta) 3 95.82 102.87 2 66.67
7323. Raymando (raymando) 110 95.82 120.08 52 47.27
7324. Chirpzz (chirpzzlol) 2 95.82 101.66 2 100.00
7325. whale (lewist) 5 95.81 106.66 3 60.00
7326. plasma (theplasma) 2 95.81 110.50 1 50.00
7327. d4nielle (d4ni_typer) 3 95.81 108.06 3 100.00
7328. (yeekidd) 889 95.81 146.01 339 38.13
7329. Derek (xdirection) 34 95.80 117.24 14 41.18
7330. Niilo (snowyz) 1 95.80 95.80 0 0.00
7331. Prince (prince7589) 69 95.80 116.67 34 49.28
7332. tragiƘ (tragik) 49 95.80 121.53 45 91.84
7333. Alejandro (pimpsogreasy) 2 95.80 98.84 0 0.00
7334. BranClown611 (brandenclown) 5 95.79 110.06 3 60.00
7335. mike (doorman32) 46 95.79 117.62 20 43.48
7336. bruhlollol (bruhlollol) 6 95.79 102.46 3 50.00
7337. Lee Bing Bong (lee_bing_bong) 26 95.79 117.54 13 50.00
7338. Translator (trnsltr) 30 95.79 112.72 12 40.00
7339. Echo (zaffir) 6 95.79 108.52 2 33.33
7340. (ilii) (iili) 3 95.79 99.44 3 100.00
7341. typingmonster (greenmonster... 15 95.78 107.97 8 53.33
7342. Sorbble (sebby122) 1 95.78 95.78 0 0.00
7343. Ryan (prophetofregret) 3 95.78 98.14 1 33.33
7344. gonçalo (figados) 16 95.78 106.59 3 18.75
7345. Lucid (dldri) 3 95.78 111.95 1 33.33
7346. Kom (poobscoob) 8 95.78 113.51 2 25.00
7347. Lojants (lojants1) 32 95.77 111.65 10 31.25
7348. Jared (jaredtypist) 11 95.77 113.08 6 54.55
7349. Cameron (sebajun) 106 95.77 119.28 36 33.96
7350. Shagnik (shagnik) 3 95.77 102.33 1 33.33
7351. I am dumb (lucas_number_1) 2 95.77 98.97 1 50.00
7352. Patrick (manualsearch) 2 95.77 96.58 1 50.00
7353. 𝐊 𝐑 𝐀 𝐊 𝐄 ... 50 95.77 113.20 19 38.00
7354. Heysi ❤ (heysi) 3 95.77 103.92 2 66.67
7355. Mike (hipsterdufus) 21 95.76 106.32 12 57.14
7356. chillresident (chillresident) 31 95.76 109.58 8 25.81
7357. jeffrey (shocky147) 5 95.76 103.10 1 20.00
7358. Ahsan (haris_ahmed) 12 95.76 106.06 11 91.67
7359. Taco (taco_salsa) 2 95.76 106.03 2 100.00
7360. bam (iamsobald) 64 95.75 123.43 24 37.50
7361. HiFli (hifli) 1 95.75 95.75 0 0.00
7362. 1time (1time4da1time) 13 95.75 105.68 4 30.77
7363. Bluefire (bluefire828) 12 95.75 107.40 5 41.67
7364. Jonathan (jonathan081) 31 95.75 117.04 12 38.71
7365. yavor (janb99) 1 95.74 95.74 0 0.00
7366. pprav (potato69420) 80 95.74 120.51 23 28.75
7367. AsteroGamer (williamvalerian) 4 95.74 109.34 1 25.00
7368. MindstormL (mindstorml) 2 95.74 106.95 1 50.00
7369. Jonah (booshie) 6 95.74 117.78 4 66.67
7370. Iamsparta (void_snowy) 4 95.73 108.90 2 50.00
7371. Speed (speedarmstrong) 10 95.73 119.65 3 30.00
7372. Daniel (eldian) 1 95.72 95.72 0 0.00
7373. a (ierfth) 2 95.72 98.39 1 50.00
7374. Lori (ljflute) 12 95.72 119.38 4 33.33
7375. Ricky (rcheungwtf) 34 95.71 115.68 9 26.47
7376. Daniel (d123aniel) 42 95.71 118.96 18 42.86
7377. lyudmila (vityaz) 4 95.71 110.88 2 50.00
7378. yal (yyal) 14 95.71 118.89 6 42.86
7379. Jewnited States of America ... 625 95.70 146.30 230 36.80
7380. conjae (conjae) 7 95.70 106.14 4 57.14
7381. Linus (linusq) 4 95.70 107.50 1 25.00
7382. FredPerr (fredperr) 2 95.70 98.66 2 100.00
7383. Maven (mavenz) 13 95.69 105.57 5 38.46
7384. Mr. Presidentus (jyg108) 6 95.69 109.09 3 50.00
7385. farlig (farlig1) 3 95.69 103.78 2 66.67
7386. Sam (samblez) 3 95.68 103.03 1 33.33
7387. Nikhil (quill_workman) 2 95.68 95.92 1 50.00
7388. Vasil (777vasil) 3 95.68 98.07 0 0.00
7389. tstats[lunalululu] (lunalul... 186 95.67 115.28 74 39.78
7390. (naturaladoption) 719 95.67 156.42 234 32.55
7391. Graham (gracker) 1 95.67 95.67 0 0.00
7392. Preston (lantzer) 25 95.67 127.84 7 28.00
7393. Benjamin (saltysnit) 99 95.66 113.62 39 39.39
7394. bruh (ovecko) 1 95.66 95.66 1 100.00
7395. Raul (rincindishes) 4 95.66 109.30 2 50.00
7396. kinderblack (kinderblack) 17 95.66 106.97 2 11.76
7397. aron (aron25) 32 95.65 111.05 20 62.50
7398. 👋youtu.be/AXNeUMDP3no (o... 1,144 95.65 143.28 482 42.13
7399. leodelfo (leodelfo) 73 95.65 114.47 27 36.99
7400. Ognjennad (ognjennad) 7 95.65 104.79 3 42.86
7401. Dan (gunpowdergolem) 8 95.64 103.75 7 87.50
7402. Sarah (sh_milk) 1 95.64 95.64 1 100.00
7403. Kaden (dlabguy12345) 2 95.64 96.14 1 50.00
7404. Kyle (1cheeseisyummy5) 173 95.64 127.68 78 45.09
7405. Cody (foggen) 11 95.64 113.96 5 45.45
7406. Billy (badbikes) 4 95.63 113.51 3 75.00
7407. Farrel (i_i_c_h_e_n_i_i) 17 95.63 115.35 5 29.41
7408. Mycargoboom (hayadabest) 143 95.62 132.81 53 37.06
7409. Garry (gt_meister) 4 95.62 104.33 2 50.00
7410. Butter (butterfingers_) 10 95.61 105.75 4 40.00
7411. Emily (emstand) 28 95.61 105.47 12 42.86
7412. Subh (subhyj) 6 95.61 105.35 2 33.33
7413. Tommy (tom441) 14 95.61 107.77 5 35.71
7414. Dorothy (randomhoomanbean) 2 95.60 97.03 1 50.00
7415. James (itsbamble) 70 95.60 113.96 25 35.71
7416. Tyson (pajarito) 6 95.60 106.67 5 83.33
7417. Xzereath (xzereath) 22 95.59 119.47 11 50.00
7418. Tony (tonyngu) 8 95.59 112.14 1 12.50
7419. Lowell (lowellfailingenglish) 10 95.59 120.25 3 30.00
7420. soeliphilia (soeliphilia) 6 95.59 105.52 3 50.00
7421. Kevin (gudern) 9 95.59 119.75 6 66.67
7422. kamea (kamea) 9 95.58 111.27 2 22.22
7423. Aly UwU (h3mispher3) 1 95.58 95.58 1 100.00
7424. Hunter (mythichunter758) 1 95.58 95.58 1 100.00
7425. Evan (edawg525) 1 95.58 95.58 0 0.00
7426. D (d_4biden1) 23 95.58 107.47 4 17.39
7427. Etian (etian_) 2 95.58 96.66 1 50.00
7428. Christian (cjlax18) 2 95.58 99.60 1 50.00
7429. Son (baby_hanz) 9 95.57 109.26 3 33.33
7430. kie (kieret25) 8 95.57 108.13 4 50.00
7431. jerry (xmars) 2 95.57 105.61 1 50.00
7432. wuque pink (exanta) 23 95.57 122.83 7 30.43
7433. t̶̢̤͇̪̱̮̿̓̓̕͜ͅ... 746 95.57 132.42 273 36.60
7434. Jump (toadjump) 16 95.57 107.51 5 31.25
7435. Ambrose (astrealix) 8 95.57 105.18 3 37.50
7436. qqingcheng! 3 (jorjoresp) 15 95.56 109.29 5 33.33
7437. Dkaf (dkaf9497) 3 95.56 102.19 0 0.00
7438. Joshua (paper_astronaut) 542 95.55 119.46 170 31.37
7439. ali (199901) 1 95.55 95.55 1 100.00
7440. Lucas (lucas_a04) 1 95.55 95.55 0 0.00
7441. InsertNameHere (1ns3rtn4m3h... 21 95.55 117.13 4 19.05
7442. Jun Kang (junkang098) 92 95.55 128.22 33 35.87
7443. Lukas (filassy) 3 95.55 109.75 1 33.33
7444. Quack Werty (decadance) 1 95.54 95.54 1 100.00
7445. zoomfrog (zoomfrog) 7 95.54 104.62 3 42.86
7446. Potato (lovlieice) 23 95.54 119.07 13 56.52
7447. Grag (mahavir) 4 95.53 110.38 2 50.00
7448. Phillip (donutdeflector) 2 95.53 96.11 1 50.00
7449. for reckful (savioshadow) 22 95.53 107.49 8 36.36
7450. tyler (ssjtyru) 24 95.53 114.39 5 20.83
7451. mcqueen (jeremyyeh) 2 95.53 105.92 0 0.00
7452. Mini.S (billbang6) 4 95.52 101.86 3 75.00
7453. Evan can't pass the validat... 138 95.52 114.81 47 34.06
7454. Andrew (silverdotters) 104 95.51 115.24 42 40.38
7455. x0.25 speed (hazyy324) 35 95.51 113.07 12 34.29
7456. Random Guy (randompersonjci) 4 95.51 101.30 3 75.00
7457. joshua (jimpdashrimp) 173 95.51 126.13 62 35.84
7458. Michael (mihcael) 135 95.51 125.68 53 39.26
7459. John Clarence (kamoteforce) 3 95.51 105.26 0 0.00
7460. Chris (thunderhawk14) 1 95.51 95.51 1 100.00
7461. Julia (smallone4130) 1 95.51 95.51 1 100.00
7462. Cael (paile) 19 95.51 117.19 7 36.84
7463. Nirajan (strategist02) 5 95.51 110.39 1 20.00
7464. Raahil (ravana09) 184 95.51 127.53 63 34.24
7465. Koby (kobyhatton) 21 95.51 115.72 8 38.10
7466. SomeGuy (hexadecimal101) 14 95.51 118.05 7 50.00
7467. F (lawlnoodle) 610 95.50 123.72 220 36.07
7468. Kolya (iktm) 4 95.50 98.33 4 100.00
7469. rico (ricochandra13) 1 95.50 95.50 1 100.00
7470. Rameen (expoil) 2 95.50 101.51 0 0.00
7471. Slow (giorgiv4) 972 95.50 135.17 390 40.12
7472. inSomnia (auriskv) 3 95.48 100.89 3 100.00
7473. floof (flooffy) 617 95.48 127.40 211 34.20
7474. Geo (godex) 19 95.48 114.43 7 36.84
7475. Juan Martín (juanma2700) 675 95.47 117.95 226 33.48
7476. Esketit (jony1525) 12 95.47 112.09 7 58.33
7477. Melchorio (jcquints) 51 95.47 113.62 18 35.29
7478. Veedora (akuyepe) 7 95.46 103.41 7 100.00
7479. Preston (aguy27) 1 95.46 95.46 0 0.00
7480. Terry (big_tarray) 4 95.46 103.93 3 75.00
7481. The Fast (ratatuli) 1 95.46 95.46 0 0.00
7482. (andyjoekool) 45 95.46 159.17 17 37.78
7483. Mason (mason8008) 45 95.45 116.30 16 35.56
7484. i cant type im trash (darkn... 4 95.45 104.45 3 75.00
7485. Daniel (zebrapopcorn) 45 95.45 124.22 18 40.00
7486. a (jdlwahaha) 290 95.44 117.85 111 38.28
7487. Joey (bpextermin8) 57 95.44 117.10 24 42.11
7488. (clouhhd_) 146 95.44 141.96 4 2.74
7489. Avi (avi_130) 8 95.43 119.89 4 50.00
7490. Sai Srujan Kumar (chsrujan) 32 95.43 106.39 9 28.13
7491. jTactics (jtactics) 1 95.43 95.43 0 0.00
7492. alpha (alpha_stream) 5 95.43 103.90 0 0.00
7493. Rtyp (rktypes) 4 95.43 104.80 0 0.00
7494. Paino (painogamingyt) 1 95.43 95.43 1 100.00
7495. Kasper (probablykasper) 9 95.43 104.78 4 44.44
7496. random (waltersgo) 87 95.43 113.19 32 36.78
7497. Kebob (murikk) 6 95.43 107.67 2 33.33
7498. п8 ʅ(。◔‸◔。)ʃ ... 13 95.42 131.06 5 38.46
7499. absorb (abvorb) 5 95.42 103.30 2 40.00
7500. Abqw112 (abqw112) 20 95.42 112.34 8 40.00
7501. Lizard (lizardk99) 12 95.42 108.46 4 33.33
7502. King (lil_bygone) 33 95.41 117.08 7 21.21
7503. Mighty (mighty_kurac) 7 95.41 106.72 6 85.71
7504. Michael (mekel_elden) 4 95.40 99.59 3 75.00
7505. spycow27 (spycow27) 27 95.40 105.96 26 96.30
7506. Meghan (coolmegmc) 4 95.40 101.46 3 75.00
7507. Doctor (freakahontas) 1 95.39 95.39 0 0.00
7508. Aliff (aliffhakimi) 21 95.39 113.95 11 52.38
7509. Pijke (pijkeee) 3 95.39 100.01 0 0.00
7510. Nobody (pengfire) 23 95.39 116.62 10 43.48
7511. Dustin (athleticsaddict) 9 95.38 108.03 5 55.56
7512. Mitchell (mitchow) 3 95.38 98.66 2 66.67
7513. Peter (meffisto420) 2 95.38 97.36 2 100.00
7514. liwmus (liwmu) 9 95.38 104.57 4 44.44
7515. Pat (wareem) 20 95.38 114.41 7 35.00
7516. Yann (yooaaooy) 6 95.37 104.90 5 83.33
7517. Leimondu (roshia) 17 95.37 104.80 7 41.18
7518. pituf0 (pituf0) 94 95.36 123.92 34 36.17
7519. Josh (the_josh) 805 95.36 128.79 317 39.38
7520. PseudoNoise (pseudonoise) 4 95.36 101.31 3 75.00
7521. red (redwastaken) 11 95.35 104.86 2 18.18
7522. . (apeninspaaace) 380 95.34 123.10 147 38.68
7523. ReklessDragon (reklessdragon) 20 95.34 113.22 9 45.00
7524. fish (danf1) 47 95.34 112.09 19 40.43
7525. Romping (max61090) 17 95.33 107.19 9 52.94
7526. Peter (avezan) 38 95.33 127.93 14 36.84
7527. Dvorak (mesingel_dvorak) 1 95.33 95.33 1 100.00
7528. devinkhell (thesilverbrid) 3 95.33 101.51 1 33.33
7529. Ivan (ljakpa) 30 95.32 104.93 10 33.33
7530. tstats[barockt] (barockt) 763 95.32 119.99 279 36.57
7531. Liam (greensoldierman) 1 95.32 95.32 1 100.00
7532. Nikhil (qwertyiop56) 2 95.32 101.88 0 0.00
7533. Tara (tarav21h) 1 95.32 95.32 0 0.00
7534. XDXDXD (benskrrt) 18 95.32 114.70 9 50.00
7535. Mark (mose9634) 19 95.32 110.65 7 36.84
7536. Frxntize (frxntize) 64 95.31 131.30 27 42.19
7537. Yea (oulliac) 3 95.31 99.10 0 0.00
7538. Logan (tcalogan) 8 95.31 102.89 5 62.50
7539. Jiong Yang (yangfoo) 410 95.30 124.14 179 43.66
7540. TelFiRE (telfire) 2 95.30 98.31 0 0.00
7541. Harrius (harrius) 7 95.30 109.00 1 14.29
7542. Ian (iancook) 16 95.30 112.66 5 31.25
7543. KC (kc2002) 8 95.29 107.30 2 25.00
7544. Cao Sy Hai (caosyhailong99) 9 95.29 110.17 2 22.22
7545. Naba (naba0224) 34 95.28 106.29 15 44.12
7546. China nº1 (patato123) 3 95.28 109.00 1 33.33
7547. Pingbang (pbb_want_to_sleep) 4 95.28 104.11 0 0.00
7548. Addison (addisondj) 2 95.28 97.28 1 50.00
7549. Shunrai (shunrai1110) 22 95.27 123.25 9 40.91
7550. Wolfen (wolfenshroud) 6 95.27 107.88 2 33.33
7551. IFo (ifohancroft) 1 95.27 95.27 1 100.00
7552. egg (egg_soup) 5 95.27 100.36 2 40.00
7553. tylgo (tylgo) 24 95.26 108.43 10 41.67
7554. Taylor (taylorcuber717) 57 95.26 119.06 24 42.11
7555. Dog (flash2victory) 1 95.26 95.26 1 100.00
7556. Noodle (stayed) 79 95.26 153.12 38 48.10
7557. K (khanali2020) 317 95.26 116.17 129 40.69
7558. cuppajoeman.com (cuppajoeman) 21 95.25 109.17 8 38.10
7559. alldeux (alldeux) 2 95.25 97.57 2 100.00
7560. Abdullah (anarkhos) 12 95.25 101.73 4 33.33
7561. Advait (epik_guy1) 24 95.25 113.41 7 29.17
7562. Jonathan (potatowned) 2 95.25 112.00 0 0.00
7563. jules! (smeme) 18 95.24 117.46 13 72.22
7564. matej (matejck) 5 95.24 103.48 1 20.00
7565. mahmood (crazyiv) 1 95.24 95.24 0 0.00
7566. Elmer (elmerr) 21 95.24 105.94 7 33.33
7567. BreathlessTyperX (newtyperx) 1,016 95.23 131.95 370 36.42
7568. Marc (ayylmarc) 3 95.23 97.67 1 33.33
7569. Typing🤯🤯🤯 (sirsoup) 265 95.23 118.96 75 28.30
7570. (xxgamerprofunxx) 33 95.23 111.89 7 21.21
7571. Lasey (lasey) 17 95.22 109.65 9 52.94
7572. Noa (noamax) 5 95.22 101.86 3 60.00
7573. Dan (danisoz12) 24 95.22 111.24 12 50.00
7574. Keencar (keencar) 6 95.22 108.53 2 33.33
7575. HxntedRex (hxntedrex) 31 95.21 108.24 11 35.48
7576. Zuja (zoojah) 11 95.21 108.76 5 45.45
7577. Yasmin (yasminrusty) 1 95.21 95.21 1 100.00
7578. Evan (evon_schmidt) 2 95.21 105.56 2 100.00
7579. Nicholas (nich42) 1 95.20 95.20 1 100.00
7580. Voldemort (growthmindset) 166 95.20 114.26 63 37.95
7581. Ahead of you (wadehuangjr) 386 95.19 120.04 145 37.56
7582. Nymex (nymex67) 3 95.19 98.91 0 0.00
7583. Psychism (psychism) 15 95.19 128.84 7 46.67
7584. typingprogram (typingprogram) 2 95.19 97.24 2 100.00
7585. Jack (jr9810) 64 95.18 113.88 27 42.19
7586. Kareem (korosei) 1 95.18 95.18 0 0.00
7587. kellyfunk (kellyfunk) 3 95.18 112.01 1 33.33
7588. Sef (niktarera) 10 95.18 122.14 5 50.00
7589. Brandon (brandondodododo) 7 95.18 102.61 1 14.29
7590. rila (rilakuma) 3 95.18 104.32 2 66.67
7591. poqe8819 (poqe8819) 90 95.18 121.45 21 23.33
7592. Sotonation (akatrell) 196 95.17 113.40 67 34.18
7593. big (bigfudge14) 49 95.17 113.86 23 46.94
7594. Peter (crazynumnums) 15 95.17 109.38 9 60.00
7595. Nikki (niknak13) 7 95.17 117.43 1 14.29
7596. Ibrahim (platon) 136 95.16 124.36 52 38.24
7597. Mateo (pikksaar) 2 95.16 99.34 0 0.00
7598. Hiro (denis_bugle) 2 95.16 103.30 1 50.00
7599. Cactus (cactus_jones) 12 95.16 106.08 8 66.67
7600. Bryan (bryan6734) 1 95.16 95.16 1 100.00
7601. Kyla (kdawg22) 37 95.16 109.56 21 56.76
7602. James (jamesarino) 4 95.16 103.28 2 50.00
7603. I am speed (slowhand18) 8 95.16 111.07 4 50.00
7604. Keyan (rezor) 9 95.16 110.85 6 66.67
7605. whough (williamhough) 179 95.15 118.09 62 34.64
7606. TiltClock (tiltclock) 1 95.15 95.15 1 100.00
7607. Zong (helpmeplsss) 1 95.15 95.15 0 0.00
7608. ( ͡° ͜ʖ ͡°)🖕 (your... 15 95.15 111.89 4 26.67
7609. Angus (leanangusbeef) 5 95.15 103.12 4 80.00
7610. FiB0 (fiboss) 89 95.15 119.63 68 76.40
7611. Thiemen (mohouzeg) 11 95.14 108.39 9 81.82
7612. Pcgnome (pcgnome) 9 95.14 115.51 5 55.56
7613. LemonCatTAT (kiddie_sallie) 52 95.14 112.34 16 30.77
7614. Slowpoke (amisanthropist) 125 95.14 125.73 41 32.80
7615. D (deffenel_782) 3 95.14 103.90 1 33.33
7616. FleshEyes (lejitt) 9 95.14 101.02 4 44.44
7617. Faorle (faorle) 5 95.13 112.97 0 0.00
7618. Diego (tapetepato) 4 95.13 99.65 2 50.00
7619. Noman (khan_noman14) 200 95.13 115.12 65 32.50
7620. jason (luckiestluckster) 11 95.12 105.93 8 72.73
7621. Paul (mcbain788) 22 95.12 111.41 18 81.82
7622. henpenben (henpenben) 5 95.12 108.18 2 40.00
7623. mechanical (cakesogood) 9 95.11 132.97 4 44.44
7624. wub (wub_wub) 57 95.11 117.60 26 45.61
7625. tyler (cyanamethyst) 9 95.11 113.83 3 33.33
7626. Danger Guy (dangerguy) 23 95.11 116.06 9 39.13
7627. Andrew (get_hyped20) 32 95.11 115.36 17 53.13
7628. SkyleNexo (thaonenub) 4 95.11 102.71 1 25.00
7629. James (jhoffman1204) 65 95.10 119.43 18 27.69
7630. James (gemvoo) 7 95.10 109.62 4 57.14
7631. Ali (bronzor16) 13 95.10 105.99 1 7.69
7632. Gavin (gt3ch1) 19 95.10 118.12 8 42.11
7633. Samuel (maduhbee) 2 95.10 110.47 1 50.00
7634. Chris (chink344) 16 95.09 110.21 5 31.25
7635. Drew (drewsmithworkman) 16 95.09 107.22 5 31.25
7636. danniponcho (dponchos) 770 95.09 128.65 276 35.84
7637. J (superuby5) 18 95.09 107.52 7 38.89
7638. mesba (brgrkng) 5 95.08 102.30 3 60.00
7639. nielrenned (nielrenned) 5 95.08 98.29 3 60.00
7640. Rain (rainliofficial) 7 95.08 108.87 3 42.86
7641. Đức (dinhduc2601) 1 95.07 95.07 1 100.00
7642. capo (caporv) 23 95.06 108.50 9 39.13
7643. TheAluMinion (thealuminion) 3 95.06 98.14 1 33.33
7644. RAWs (raws) 11 95.06 108.25 4 36.36
7645. Dustin (dsthegold23) 69 95.06 117.12 23 33.33
7646. Warren (warrudd) 1 95.05 95.05 1 100.00
7647. neno (nenobid428) 2,189 95.05 129.29 956 43.67
7648. ninja (riddickbr) 11 95.04 121.16 4 36.36
7649. Mikhail (limedimenine) 53 95.04 115.51 18 33.96
7650. Jason (jasonjohnsj27) 922 95.03 141.27 378 41.00
7651. Pirapat (pirapatqwe) 15 95.03 114.25 5 33.33
7652. Space (spacedandy) 16 95.02 111.90 7 43.75
7653. chabe (halfu) 135 95.02 123.59 86 63.70
7654. Kite (saizuchi) 5 95.02 104.68 5 100.00
7655. misty (sprainedartery) 22 95.02 113.58 9 40.91
7656. Gongster (gongster1) 10 95.01 109.13 5 50.00
7657. Matt (xerth) 2 95.01 99.91 1 50.00
7658. CrisWick (kizzu137) 6 95.00 109.46 3 50.00
7659. Rohan (roankar) 1 95.00 95.00 1 100.00
7660. laezza (inimitabile) 130 95.00 130.55 51 39.23
7661. Tonchi (tonch1) 32 95.00 109.04 15 46.88
7662. longi (alongens) 139 95.00 107.29 40 28.78
7663. Peter (pieter_post) 18 95.00 116.17 14 77.78
7664. Sioun (sioun) 9 94.99 102.81 4 44.44
7665. Jackson (jacksons123) 12 94.99 109.82 2 16.67
7666. Timoteo (timoteothegreatest) 5 94.99 107.40 1 20.00
7667. Connor (connorjh) 1 94.99 94.99 1 100.00
7668. Phung (longphung151198) 199 94.99 117.37 89 44.72
7669. Sourav (rubberboa) 7 94.99 99.63 1 14.29
7670. fast_and_curious (asimali246) 23 94.99 109.94 7 30.43
7671. DistractedScam (distracteds... 2 94.99 96.25 2 100.00
7672. Ed (illuxionist) 26 94.99 113.70 16 61.54
7673. naviman (naviman) 16 94.98 114.02 7 43.75
7674. alex (alex3213213) 333 94.98 134.95 127 38.14
7675. GM (gmbao) 9 94.98 104.53 4 44.44
7676. ABe (abenms92) 17 94.98 120.62 3 17.65
7677. Josh (orceun) 10 94.98 101.56 3 30.00
7678. annop (viiorgmj) 4 94.98 100.62 3 75.00
7679. Brayden (braddin123) 29 94.97 114.42 11 37.93
7680. Mary (marymyers) 27 94.97 113.28 12 44.44
7681. Kem (ice_kem) 3 94.97 101.29 2 66.67
7682. i'm slow (pndspirit) 204 94.97 124.61 78 38.24
7683. Troy (troydaigneau) 29 94.96 118.90 5 17.24
7684. Aaron (novacado) 2 94.96 96.72 0 0.00
7685. Kevin (khuang891) 4 94.96 110.57 2 50.00
7686. Fang (fango_) 5 94.95 104.82 5 100.00
7687. Turtle (xarenox) 9 94.94 109.38 8 88.89
7688. Erik (whatafuas) 8 94.94 106.61 1 12.50
7689. Peter (petermc2007) 30 94.94 109.55 15 50.00
7690. Duc Anh (doc1997) 3 94.94 97.05 1 33.33
7691. Kyu (kyuche) 1 94.94 94.94 0 0.00
7692. Bradley (bradley_brown) 11 94.94 105.48 1 9.09
7693. tstats[inbredturtle] (inbre... 699 94.94 130.63 252 36.05
7694. Eric (isoh) 21 94.94 112.59 7 33.33
7695. Matt (mattyice445) 7 94.94 102.35 3 42.86
7696. N/A (mudatoxicity) 6 94.93 109.10 5 83.33
7697. oomikeyboy (oomikeyboy) 2 94.93 95.72 1 50.00
7698. Gustavo da Cruz (gustavodac... 15 94.93 123.27 6 40.00
7699. Hannah (donethat) 4 94.93 108.90 1 25.00
7700. Eskooty (eskooty) 13 94.93 105.58 4 30.77
7701. Jakub (serckle) 159 94.92 114.92 67 42.14
7702. Sizzled (sizzledbeans) 68 94.92 117.09 25 36.76
7703. Zethrian (zethrian) 4 94.92 103.97 3 75.00
7704. Ohad (ohadshwartzman) 9 94.91 114.46 2 22.22
7705. THE KID (nschattner) 29 94.91 118.90 10 34.48
7706. Jeoff (7dollarburrito) 3 94.91 102.48 3 100.00
7707. Vincent (aetherxd) 11 94.91 115.81 4 36.36
7708. rjlee (rjlee) 2 94.91 96.58 2 100.00
7709. Aji (ajiwahyuw) 34 94.90 109.00 17 50.00
7710. Colemax (sqxleaxes) 164 94.90 120.61 63 38.41
7711. Hålløw (rohanrules21) 3 94.90 97.49 1 33.33
7712. frustratedtyper (frustrated... 270 94.89 119.88 95 35.19
7713. Jacob (p2kk96) 1 94.89 94.89 0 0.00
7714. McKenna (mcassady13) 250 94.89 122.24 96 38.40
7715. Aisier (hfssma) 36 94.88 109.44 16 44.44
7716. A (kmos) 68 94.88 115.53 29 42.65
7717. Kranite (vg_infernozz) 20 94.88 115.29 9 45.00
7718. Grandpa (thedengue) 1,628 94.86 163.03 27 1.66
7719. Max (mpschorr) 23 94.86 111.25 2 8.70
7720. yeeth (yeeth_) 510 94.86 126.17 169 33.14
7721. UwU (vintiny) 1 94.85 94.85 0 0.00
7722. marvelousman (marvelousman) 2 94.85 102.81 1 50.00
7723. Ryan (mikeeei) 5 94.85 101.22 2 40.00
7724. Alexander (torphon) 252 94.84 115.80 86 34.13
7725. Paweł (lewapkon) 1 94.84 94.84 0 0.00
7726. Hermione (hermione2291) 1 94.84 94.84 0 0.00
7727. Random (randomhumanlmao) 4 94.84 106.02 1 25.00
7728. rumi (archsun) 10 94.84 108.34 3 30.00
7729. Jack (jack2905) 48 94.84 117.44 18 37.50
7730. oliver (sushiboyking) 44 94.83 114.58 14 31.82
7731. Tabs (aptex) 14 94.83 106.69 5 35.71
7732. Ian (call_me_lan) 5 94.83 109.83 1 20.00
7733. Jin (derherro) 3 94.83 103.23 3 100.00
7734. Marz (marzcovers) 4 94.83 105.63 1 25.00
7735. silver (gr0ff) 61 94.83 115.86 31 50.82
7736. StevesterH (stevesterh) 85 94.83 117.24 24 28.24
7737. attemptless (attemptless) 2 94.83 97.40 2 100.00
7738. Aviel (suxhe) 25 94.81 117.81 6 24.00
7739. Allay (noob_wrath) 39 94.81 111.10 12 30.77
7740. C (ccc123) 757 94.81 123.16 263 34.74
7741. Darren (baochun2) 26 94.81 115.47 11 42.31
7742. 😈 (topthis) 31 94.81 111.46 8 25.81
7743. S0R4 (omniores22) 21 94.80 110.64 8 38.10
7744. Atharva (non_geniosity) 2 94.80 97.10 0 0.00
7745. Adelio (adeliogaudi) 2 94.80 97.10 1 50.00
7746. Hassan (hassansajjad) 78 94.80 136.72 25 32.05
7747. Kusmir (kusmir) 234 94.80 120.97 78 33.33
7748. bantan (bantan) 15 94.79 103.12 9 60.00
7749. Amarpreet (ampit) 2 94.79 103.03 1 50.00
7750. Baris (baris23) 10 94.79 104.60 0 0.00
7751. no (tempotutor) 5 94.79 100.61 1 20.00
7752. Max (xsrvmy) 5 94.78 103.35 1 20.00
7753. Kevin (niveik) 48 94.78 126.50 17 35.42
7754. kb (kbaccam) 9 94.78 110.08 4 44.44
7755. camille (bleuish) 8 94.77 106.19 5 62.50
7756. Alan (fleekeazy) 1 94.77 94.77 0 0.00
7757. siti (mahmudahsiti) 9 94.76 107.84 4 44.44
7758. Nibir (typer_de_random) 7 94.76 99.43 2 28.57
7759. handshurt (ozzytheasian) 59 94.76 125.88 29 49.15
7760. ollie (mech_typer) 13 94.76 105.07 9 69.23
7761. Social Credit (usa_baby) 185 94.75 121.60 75 40.54
7762. spam (sammywammyllamma) 28 94.75 109.11 12 42.86
7763. Meditate (meditate) 25 94.75 113.63 6 24.00
7764. KENNETH (happydino) 56 94.75 120.14 24 42.86
7765. Beqa (crimsy8) 4 94.75 104.04 0 0.00
7766. Brady (bward62) 20 94.75 119.25 8 40.00
7767. Tiddy (tiddytwister) 721 94.75 128.19 250 34.67
7768. Glass (glass_crys) 267 94.75 130.10 97 36.33
7769. Jack (raspyspartan) 2 94.75 101.96 2 100.00
7770. vid (usernem) 13 94.74 117.45 4 30.77
7771. James (hot_panty_dropper) 23 94.74 104.77 5 21.74
7772. pica123 (yeeboi) 5 94.74 100.00 3 60.00
7773. Sam (whotoldyouthat) 1 94.74 94.74 0 0.00
7774. Ayush (ayush123460) 1 94.74 94.74 1 100.00
7775. Ethan (ethanchansk) 68 94.74 119.50 28 41.18
7776. Blake (25kangboyang) 26 94.73 116.77 9 34.62
7777. Cod Of Ages (codofages) 1 94.73 94.73 1 100.00
7778. yeet men (yeetmen) 1 94.72 94.72 0 0.00
7779. Killyan (killyan) 228 94.72 127.28 89 39.04
7780. The Guy (farthammer2k) 2 94.72 104.84 2 100.00
7781. Tej (tjoshi12) 19 94.71 108.84 7 36.84
7782. Christian (christiangodtdm) 4 94.71 100.63 3 75.00
7783. joe (gstakk) 1 94.71 94.71 0 0.00
7784. Molly (molgreen) 13 94.71 111.20 10 76.92
7785. Piss Boyy (ineedanickname) 249 94.71 138.47 75 30.12
7786. David (ebiswick) 5 94.70 102.25 2 40.00
7787. Adriel (stephencarry) 7 94.70 113.70 1 14.29
7788. Daniel (dxnielz) 12 94.70 109.15 12 100.00
7789. Toby (toby_) 5 94.70 105.03 3 60.00
7790. Brian (atrospecter) 12 94.69 115.15 6 50.00
7791. Koshi (koshigaming) 12 94.69 110.80 5 41.67
7792. Collin (code_gs) 7 94.69 102.42 4 57.14
7793. ravi (xdbanterman321) 3 94.69 101.63 0 0.00
7794. Will (greggaz) 393 94.69 132.09 144 36.64
7795. FlippLoki (flipploki) 9 94.69 114.83 4 44.44
7796. Stefan (fortress_king) 1,709 94.69 130.84 609 35.63
7797. Booba (drakonsio) 73 94.69 115.66 22 30.14
7798. Zach (zank0) 2 94.69 103.91 1 50.00
7799. a (levelupself) 6 94.68 103.69 4 66.67
7800. Benjamin (benjaminjam) 18 94.68 118.51 5 27.78
7801. Max (mcm20) 10 94.68 102.52 0 0.00
7802. Nathan (nxthantypes) 6 94.68 110.97 3 50.00
7803. seon (seon123) 1 94.68 94.68 1 100.00
7804. Lee (shriveledegg) 16 94.68 116.48 6 37.50
7805. Marko (gragole) 8 94.68 104.44 1 12.50
7806. Newton (nklflips) 107 94.67 123.18 45 42.06
7807. Shivashis (plant99) 25 94.67 111.69 5 20.00
7808. Daniel (macguffinstv) 11 94.67 108.87 3 27.27
7809. Mohamed (kidjunky) 4 94.67 104.92 3 75.00
7810. Marshall (stoppednile) 64 94.67 112.85 21 32.81
7811. Ken (kupperu) 2 94.67 96.99 0 0.00
7812. L0G0S (logos_) 79 94.67 114.69 40 50.63
7813. Hendo (slimshadylfc) 222 94.67 124.97 95 42.79
7814. Aaron Huang (aaronslept) 5 94.67 106.54 1 20.00
7815. Valzor (valzor) 3 94.66 97.69 2 66.67
7816. asottile (asottile) 4 94.66 111.19 1 25.00
7817. Jesse (sarrod) 437 94.65 128.76 152 34.78
7818. Kevin (zuperfire1) 104 94.65 111.91 27 25.96
7819. Jacky (bubberducky209) 13 94.65 109.74 5 38.46
7820. arnavf1 (arnavf1) 2 94.65 104.07 1 50.00
7821. Rohan (rohanrao) 2 94.64 98.98 1 50.00
7822. Nat (natrose) 1 94.64 94.64 0 0.00
7823. Joshua (mochi0607) 15 94.64 121.34 8 53.33
7824. Lia (reyi) 116 94.64 124.30 35 30.17
7825. declan (dekkiefish) 153 94.63 120.52 57 37.25
7826. Michael (coppinslinger) 5 94.63 101.74 2 40.00
7827. ali (ethyl_ethanoate) 1 94.63 94.63 0 0.00
7828. aj (ajpingol) 9 94.63 118.95 8 88.89
7829. Chumba1ba (chumba1ba) 127 94.62 118.73 43 33.86
7830. Maskedknight (edward5958) 20 94.62 117.06 7 35.00
7831. Ave (tessellatedtalent) 45 94.62 115.93 7 15.56
7832. Determined (frosty_flame) 8 94.62 99.82 2 25.00
7833. aj (peanut2004) 3 94.62 101.71 2 66.67
7834. [jtucci] (jtucci) 2 94.62 103.53 1 50.00
7835. Deus (deusseb) 2 94.62 102.68 2 100.00
7836. Wyatt (isometricman) 58 94.61 126.09 30 51.72
7837. zzr0t (sulj0o) 305 94.61 127.73 118 38.69
7838. typeracer2487 (typeracer2487) 4 94.61 97.59 1 25.00
7839. Ryan (fretmo) 6 94.61 107.26 1 16.67
7840. mike (mikeyfromqueens) 18 94.60 106.78 9 50.00
7841. Fabian (fabiangomez) 12 94.60 100.93 4 33.33
7842. zuramai (ogihek1) 1 94.60 94.60 1 100.00
7843. (xyztcube) 28 94.60 104.91 9 32.14
7844. Liam (yourmotherguy) 19 94.60 110.55 10 52.63
7845. rebecca (ionn) 94 94.59 114.24 33 35.11
7846. Dinmukhamed (pro005) 1 94.59 94.59 0 0.00
7847. Baris (adrik009) 6 94.59 108.99 3 50.00
7848. AspectOfTheNerd (aspectofth... 38 94.59 125.63 15 39.47
7849. yerimiese (johwee) 19 94.59 108.88 7 36.84
7850. De_Stroyed (de_molished) 3 94.59 104.68 2 66.67
7851. Dustin (dustindp99) 32 94.58 110.69 12 37.50
7852. Kmurbi23 (kmurbi23) 2 94.58 100.12 0 0.00
7853. Loong (zenloong) 7 94.58 100.84 3 42.86
7854. Atira (atirakun) 7 94.58 106.65 4 57.14
7855. 희성 (mttprk) 4 94.58 104.40 2 50.00
7856. niceu (nice_u) 193 94.58 122.22 62 32.12
7857. momodao (momodao) 3 94.57 104.41 1 33.33
7858. Elliot (mini_toh) 3 94.57 97.28 2 66.67
7859. I_love_seulgi (seulgischurro) 10 94.57 103.17 1 10.00
7860. Mada (mada_) 12 94.57 106.51 1 8.33
7861. King (king77) 1 94.57 94.57 1 100.00
7862. Shahryar (_shahryar_pjr) 58 94.57 124.23 31 53.45
7863. Connor (pressurr) 8 94.56 103.15 2 25.00
7864. Barokah (jowotulen) 9 94.56 102.40 3 33.33
7865. Jason (serenity47) 94 94.56 113.21 34 36.17
7866. Hunter (whdahl) 8 94.56 103.93 5 62.50
7867. ben (yngtwbabd) 9 94.56 100.70 2 22.22
7868. Xavier (xcperez) 2 94.56 94.75 1 50.00
7869. mike (oxfordcomma) 256 94.55 116.19 105 41.02
7870. Amy (amy159) 9 94.55 109.66 6 66.67
7871. Jerry (jerryr5279) 38 94.55 124.68 13 34.21
7872. Emmanuel (bodmas) 3 94.55 103.67 0 0.00
7873. (ilikeponyz20) 38 94.55 110.44 15 39.47
7874. tstats[pianisthassan] (pian... 5 94.55 102.57 0 0.00
7875. kate (wimbleimble) 23 94.55 122.00 5 21.74
7876. Pavel (patcm) 7 94.54 106.66 0 0.00
7877. Moth (unleashed_furai) 6 94.54 109.14 4 66.67
7878. Thunderwith (thunderwith) 34 94.54 130.13 14 41.18
7879. Mexikorn (mexikorn) 5 94.54 108.57 0 0.00
7880. Clarence (jeffdaddybezos) 1 94.54 94.54 1 100.00
7881. Ronalds (mrbonis) 7 94.53 101.10 4 57.14
7882. kevin (kevinstj) 33 94.53 127.61 11 33.33
7883. Richie (richiele_01) 34 94.53 119.92 15 44.12
7884. Eddie (eddiesn) 1 94.53 94.53 1 100.00
7885. Mari (maribun) 18 94.53 116.26 16 88.89
7886. Nick (nickpat) 13 94.52 117.70 4 30.77
7887. Ritvik (rockey000) 3 94.52 96.65 2 66.67
7888. EJ (tsukairin) 1 94.52 94.52 1 100.00
7889. Simiwag (simiwag) 447 94.52 134.21 156 34.90
7890. Thane (thaynt) 27 94.51 114.31 12 44.44
7891. Vladislove (vladislove) 48 94.51 108.65 10 20.83
7892. InnerPotat (innerpotat) 1 94.51 94.51 1 100.00
7893. georgebax (gbax) 41 94.51 112.69 14 34.15
7894. Deux (deuxgrosman) 9 94.51 105.34 2 22.22
7895. Michael (mikenike52899) 19 94.50 110.55 6 31.58
7896. tstats[slowtyperider] (slow... 1 94.50 94.50 1 100.00
7897. Harm (harmdebeuker) 2 94.50 97.63 1 50.00
7898. Fexo (fexer) 581 94.49 124.33 189 32.53
7899. Daniel (voiss) 13 94.49 109.50 7 53.85
7900. Poopy (c0hink) 2 94.48 96.34 1 50.00
7901. Zeeshan (zeeshan13) 220 94.47 131.94 74 33.64
7902. Garotto (uselessusername) 159 94.47 116.78 60 37.74
7903. squirrelslow (squirrelslow) 8 94.47 114.35 2 25.00
7904. wenxers (wenxers) 13 94.46 102.06 1 7.69
7905. will (whitedarko) 28 94.46 114.44 12 42.86
7906. Parhy (parhy) 9 94.45 108.99 3 33.33
7907. Mike (mikedoel85) 4 94.45 101.20 0 0.00
7908. Matthew (boebie) 1 94.45 94.45 0 0.00
7909. Farhan (farhan_op) 76 94.44 113.70 40 52.63
7910. Qianxu Guo (qianxug) 16 94.44 112.39 10 62.50
7911. johnnyboy (jstav) 3 94.43 100.84 2 66.67
7912. Chaddley (chadracer69) 719 94.43 129.14 240 33.38
7913. Zonic (zonic77) 25 94.43 105.51 14 56.00
7914. Julz (jhullzz) 1 94.43 94.43 0 0.00
7915. Siddhartha (gravito12345) 7 94.43 108.93 3 42.86
7916. Venderex (venderex) 49 94.43 139.23 25 51.02
7917. ang (angelah) 73 94.42 112.37 37 50.68
7918. Fuzusu (fuzusu) 194 94.42 122.97 79 40.72
7919. insane (sejal) 1 94.42 94.42 0 0.00
7920. Terence (dijkstras) 22 94.42 105.52 5 22.73
7921. Kareem (crashhadback) 5 94.41 118.38 2 40.00
7922. JL8 (liux888) 4 94.41 98.66 4 100.00
7923. PinkPepper (pinkpepper) 308 94.41 128.84 104 33.77
7924. Simon (imp4l3r) 14 94.41 121.23 7 50.00
7925. Liam (thecodingboy) 2 94.41 98.72 0 0.00
7926. Confetix (confetix) 41 94.40 118.53 14 34.15
7927. Rustylee (tairl) 3 94.40 105.59 3 100.00
7928. Bruh (chesswithmath) 61 94.40 126.73 27 44.26
7929. Anuvrat (anuvrat) 7 94.40 100.45 3 42.86
7930. Kelby (haulzy) 266 94.40 110.91 100 37.59
7931. Sam (smtype100) 9 94.40 104.50 4 44.44
7932. Jakob (kroelle_korean) 19 94.39 107.52 10 52.63
7933. RIP Byron (superfrik) 1 94.39 94.39 0 0.00
7934. W (w_v_) 37 94.39 120.43 18 48.65
7935. aqua (aqua_plays_bball) 2 94.39 98.82 1 50.00
7936. Airbender Aang (lolmode2) 149 94.38 115.62 40 26.85
7937. Jon (jrowephoto) 23 94.38 125.48 7 30.43
7938. Kier (kierr12) 5 94.38 101.98 1 20.00
7939. iguesspperson (ppersonas) 1 94.38 94.38 1 100.00
7940. Sander (sanderv3) 3 94.38 104.94 2 66.67
7941. R2bEEaton (r2beeaton) 2 94.38 98.77 0 0.00
7942. viridiAn (spacedooky) 4 94.38 98.16 2 50.00
7943. gradient (misaelmmorales06) 34 94.37 111.20 12 35.29
7944. Monkey (monkeydee) 2 94.37 105.83 1 50.00
7945. Kolsty (kolsty) 2 94.37 98.84 1 50.00
7946. nabil (nabl) 7 94.37 108.49 2 28.57
7947. Dan (rivalesque) 2 94.37 98.63 1 50.00
7948. 5k m1chael (mihai03) 70 94.36 110.00 21 30.00
7949. Simon (simnetz) 5 94.36 105.00 2 40.00
7950. spetterpoep (spetterpoep) 69 94.36 119.78 26 37.68
7951. its_Atrap (its_atrap) 36 94.36 111.53 15 41.67
7952. Tim (iamsmooth) 2 94.36 106.79 0 0.00
7953. Jingyue (koalawjy) 5 94.35 110.95 1 20.00
7954. Kaelyn (badpun56) 10 94.35 106.46 2 20.00
7955. Beluga (belugabetter) 16 94.35 105.86 3 18.75
7956. Simon (jangjun0901) 35 94.35 117.79 12 34.29
7957. mattfus (mattfus2) 161 94.35 112.55 47 29.19
7958. Devn (fishology) 1 94.34 94.34 1 100.00
7959. Gabe (gablikestacos) 186 94.34 120.22 69 37.10
7960. James (jamesnar) 4 94.34 99.21 2 50.00
7961. Towbie (towbie) 8 94.34 111.14 3 37.50
7962. Gyeoulie (yennie) 3 94.33 98.26 1 33.33
7963. nabileT (telibanalex) 20 94.33 108.61 9 45.00
7964. R1 (richthe1kid) 26 94.33 117.46 9 34.62
7965. Silen (silentyper) 4 94.32 109.86 3 75.00
7966. Rudolf (rutzzz) 83 94.32 119.98 33 39.76
7967. Arman (masterilluminati) 1 94.32 94.32 0 0.00
7968. Vaccination (roughandtumble) 22 94.32 106.16 5 22.73
7969. AZNDAD (hmoth84) 8 94.32 104.22 0 0.00
7970. Jeon (idnyhn) 29 94.31 117.29 12 41.38
7971. Phil (lordphil3) 6 94.31 117.74 3 50.00
7972. lolouo (lolouo) 5 94.31 105.11 2 40.00
7973. Bassim. (cmpleteidiot) 9 94.30 113.83 3 33.33
7974. 👺Wainie san (wxia) 135 94.30 124.37 49 36.30
7975. Nonstoplink (nonstoplink2) 87 94.30 136.60 42 48.28
7976. jackn11 (jackn11) 8 94.30 103.88 2 25.00
7977. clock (clockw0rk) 5 94.30 101.84 3 60.00
7978. Annie (bampy08) 1 94.30 94.30 1 100.00
7979. Viktor (pineapple212) 38 94.30 127.46 12 31.58
7980. Sophie (sophboph) 6 94.29 107.00 4 66.67
7981. Johnny (lordquan) 2 94.29 100.37 0 0.00
7982. fool (geekdud) 78 94.29 114.14 21 26.92
7983. Lara (goddess_111) 811 94.29 147.81 294 36.25
7984. Earth (earth_chan) 26 94.29 112.62 15 57.69
7985. Josh (joshlearnsdvorak) 3 94.28 102.83 0 0.00
7986. :/ (tweezers) 4 94.28 104.42 1 25.00
7987. fruitsauce (ghostspirit) 71 94.28 115.85 28 39.44
7988. Dala (dalarifat) 4 94.28 107.65 3 75.00
7989. Jay (eradekator) 241 94.28 116.24 72 29.88
7990. zombo (midgetmigerian) 58 94.27 110.90 24 41.38
7991. Bobert (k14robrad) 2 94.27 97.41 0 0.00
7992. Sylvester (sylvestertyper) 59 94.27 110.76 17 28.81
7993. David (ryzeros) 10 94.27 111.16 3 30.00
7994. Kevin (kevinkim) 4 94.27 108.74 2 50.00
7995. Danee (danee929) 1 94.26 94.26 1 100.00
7996. swoLee (swolee) 76 94.26 116.46 27 35.53
7997. Jun (jacketwithpockets) 64 94.26 126.42 21 32.81
7998. lakhey (antivenene) 139 94.26 117.50 49 35.25
7999. Ebok (kobe5623) 19 94.26 109.34 10 52.63
8000. Fromitz (fromitz) 11 94.25 111.14 1 9.09
8001. Zong (kingzong) 1 94.25 94.25 0 0.00
8002. Marc (maarcabiaad) 88 94.25 126.47 22 25.00
8003. love (skaldssss) 103 94.24 126.70 48 46.60
8004. ramirozz (ramirozz) 1 94.24 94.24 0 0.00
8005. Timo (ubulin) 25 94.24 111.36 10 40.00
8006. Colby (heebiejeebies) 6 94.24 112.30 3 50.00
8007. Azerty 0w0 (benz_) 8 94.23 100.95 3 37.50
8008. Sara (saraakre) 1 94.23 94.23 0 0.00
8009. Joël (bongo13) 10 94.23 103.06 4 40.00
8010. Varyemez✍️ (ziperz_the_... 15 94.23 103.40 5 33.33
8011. no (nomaybeyes) 121 94.22 121.67 40 33.06
8012. Avery (ba0z1) 57 94.22 120.99 35 61.40
8013. MFahriM (mfahrim) 10 94.22 115.43 4 40.00
8014. JTD845 (jtd845) 22 94.21 107.96 15 68.18
8015. laPampara (lapampara69) 511 94.20 125.71 164 32.09
8016. Patrick (violaissimmo) 7 94.20 104.66 3 42.86
8017. Leaderboard is (leaderboard... 36 94.19 139.30 10 27.78
8018. Enzo (hypertxters) 50 94.19 115.63 25 50.00
8019. vilo (viloo) 18 94.19 114.46 9 50.00
8020. Kevin (itsk3vin) 5 94.18 103.52 2 40.00
8021. Jay (jaysalvi) 9 94.18 108.54 2 22.22
8022. RoosterDunker (roosterdunker) 259 94.18 114.32 73 28.19
8023. AccidentalGrenade (accident... 4 94.18 102.21 2 50.00
8024. TooTired (oturan11) 86 94.18 130.42 24 27.91
8025. Puss (pussboi) 7 94.18 118.75 4 57.14
8026. kit (kitsinc11) 13 94.17 116.47 2 15.38
8027. PiranhaPig (piranhapig) 1 94.16 94.16 1 100.00
8028. acewiz (acewiz) 8 94.16 98.14 1 12.50
8029. Mark (datboi1771) 271 94.16 140.44 93 34.32
8030. ItsTurbo (itsturbo) 6 94.16 109.20 1 16.67
8031. uhhhhhh (gtiff71) 20 94.16 106.93 9 45.00
8032. Nishant (soccermaniac95) 6 94.16 105.60 2 33.33
8033. charegg1127 (charegg1127) 4 94.15 107.41 1 25.00
8034. tay (levelzero) 2 94.15 95.86 1 50.00
8035. Landers (landersex) 40 94.15 106.61 16 40.00
8036. Quintino (quintino123) 38 94.15 109.04 8 21.05
8037. Jason (r_matey) 36 94.14 110.31 11 30.56
8038. ivan (ivanchok) 42 94.14 118.25 15 35.71
8039. nina (lavendee) 8 94.14 98.09 3 37.50
8040. (sirreinz) 19 94.13 106.21 8 42.11
8041. Mitch (cbfworkin) 4 94.13 99.40 1 25.00
8042. ONRAGE (onrage) 8 94.12 103.51 2 25.00
8043. Rictor (rictormidgekin) 27 94.12 114.17 8 29.63
8044. Daniel (d4mage2k) 15 94.12 108.68 9 60.00
8045. race typing (jangyeeunnie616) 115 94.11 131.49 97 84.35
8046. Benjamin (benjaminlaptop) 1 94.11 94.11 0 0.00
8047. Ron (gambling_addict_69) 187 94.11 113.82 54 28.88
8048. wango (wango) 11 94.11 119.47 7 63.64
8049. Joel (joellimcy129) 19 94.11 111.97 15 78.95
8050. fast af (josh53___) 55 94.10 112.89 23 41.82
8051. Vladislav (atmsphrx) 95 94.10 121.16 35 36.84
8052. Rafsun (rafsunit) 4 94.09 99.98 2 50.00
8053. BUS (bus12) 27 94.09 108.94 8 29.63
8054. Erik (ezhou21) 31 94.09 116.92 13 41.94
8055. Tycho (tspider4) 7 94.09 114.46 2 28.57
8056. Andrew (monochromeocean) 564 94.09 122.02 195 34.57
8057. Shia (shiaushio) 6 94.07 108.61 2 33.33
8058. skyeblu7 (skyeblu7) 120 94.07 115.51 46 38.33
8059. chara (rin3) 296 94.07 125.59 113 38.18
8060. Mark (markmango) 20 94.07 112.28 7 35.00
8061. Vmanalt (vmanalt) 38 94.07 111.99 17 44.74
8062. Bane (djex808) 4 94.07 97.56 1 25.00
8063. rmbench (rmbench) 18 94.06 107.27 5 27.78
8064. Max (elsancho5) 35 94.06 112.56 10 28.57
8065. Jack (jayjaywatson) 2 94.06 98.61 1 50.00
8066. IndianGuy (fastindianguy) 60 94.05 107.45 31 51.67
8067. Gin (tonic_gin) 64 94.05 113.36 17 26.56
8068. TC Stinkey Mouse (thst4483) 70 94.05 119.24 19 27.14
8069. Accurate (accurate_typer) 4 94.05 103.85 4 100.00
8070. Lord (valharius) 93 94.05 112.48 37 39.78
8071. Hayden (zylixer) 1 94.04 94.04 0 0.00
8072. Joseph (fireguy1920) 1 94.04 94.04 1 100.00
8073. Ni (013ni) 130 94.04 119.56 50 38.46
8074. Nivekdood (nivekdood) 24 94.04 123.24 13 54.17
8075. Busky (buskyhusk) 13 94.03 105.56 7 53.85
8076. bean (keenheen) 10 94.03 106.32 3 30.00
8077. develsixteen (develsixteen) 96 94.03 112.32 26 27.08
8078. David (hiddenpants10) 14 94.03 104.33 4 28.57
8079. Zharfan (zharfanadli) 29 94.03 113.62 16 55.17
8080. alien_super (alien_super) 2 94.03 99.15 1 50.00
8081. nanoray (saliciti) 31 94.02 116.20 11 35.48
8082. Vinchenzo (qwertyuiopps) 22 94.02 112.89 11 50.00
8083. Shuyu (stevenqi) 400 94.02 129.09 149 37.25
8084. Icy (1see_1cy) 5 94.02 104.03 1 20.00
8085. Jacky (jclau299) 17 94.01 110.55 10 58.82
8086. Benjamin (xlr8or) 133 94.01 112.85 38 28.57
8087. da_B0mba (da_b0mba) 1 94.01 94.01 1 100.00
8088. Prasoon (prkharel) 102 94.01 125.70 36 35.29
8089. Adromrial (adromrial) 10 94.00 103.21 5 50.00
8090. meme (7fingers) 12 94.00 121.66 5 41.67
8091. garagdon (garagdon) 2 94.00 98.18 1 50.00
8092. Kensie (luxina) 5 94.00 112.39 0 0.00
8093. Adam (appeac) 4 94.00 104.15 3 75.00
8094. 愛する (ecstxsy) 10 93.99 112.48 0 0.00
8095. Abu (abushakeeb) 15 93.99 108.19 5 33.33
8096. Mohammad (zxelrate) 1 93.99 93.99 1 100.00
8097. prevolt (prevolt) 6 93.98 105.76 4 66.67
8098. sMarty (imrwonder2) 46 93.98 126.95 13 28.26
8099. Faquarl (ekrpat) 12 93.98 111.49 6 50.00
8100. Ethan (assassindgn) 1 93.98 93.98 0 0.00
8101. risu (risuto) 1 93.98 93.98 0 0.00
8102. PR (mrprx) 74 93.98 114.03 25 33.78
8103. Ada (fumingadam) 22 93.98 112.64 10 45.45
8104. Jordan (jagmasta259) 155 93.97 117.53 61 39.35
8105. Jerico (jericopulvera) 3 93.97 102.00 1 33.33
8106. Shawna (shawnanic856) 49 93.97 111.89 17 34.69
8107. not_inte2 (theinte) 10 93.97 105.12 4 40.00
8108. Alan (alany411) 1 93.97 93.97 1 100.00
8109. Matthew (yossarian_milo_22) 229 93.97 110.54 71 31.00
8110. henlojav (henlojav) 15 93.97 111.40 8 53.33
8111. Roger (blasticidin) 5 93.97 100.96 2 40.00
8112. AL1 (al1_16) 15 93.96 109.87 5 33.33
8113. Lul (spammeh) 8 93.96 106.60 3 37.50
8114. Duschi (duschi) 21 93.96 108.30 8 38.10
8115. sleepo (sleepotimer) 136 93.96 113.09 56 41.18
8116. Marcus (byteeater) 11 93.96 107.39 7 63.64
8117. ALCIONE (gel4ever) 4 93.96 108.13 3 75.00
8118. Luke (outlandish) 394 93.95 115.22 138 35.03
8119. mike (maykqwe) 30 93.95 114.04 11 36.67
8120. Circlestrafin (circlestrafin) 4 93.94 97.90 3 75.00
8121. Kisara (rock125zz) 2 93.94 95.02 2 100.00
8122. Naloxone (spark89) 2 93.94 101.27 2 100.00
8123. Kartoonpanda (kartoonpanda) 2 93.94 95.95 2 100.00
8124. Julia (bskdjewels) 7 93.93 108.10 3 42.86
8125. Adrianus (dungonmahshoe) 12 93.93 116.48 4 33.33
8126. sam (candle4) 20 93.93 116.23 6 30.00
8127. Markus (marcasrealaccount) 21 93.93 105.45 10 47.62
8128. Andreas (prosurvival_321) 4 93.93 124.27 3 75.00
8129. Sebastian (ssanso) 2 93.93 97.55 1 50.00
8130. jimmy (hireraprk) 6 93.92 98.66 3 50.00
8131. Not as fast as Reckful (bol... 11 93.92 104.09 6 54.55
8132. Klebb (klebbinet) 4 93.92 97.98 1 25.00
8133. deceptive (sergisreal) 50 93.92 109.54 16 32.00
8134. vaughn (youmomgae) 16 93.91 99.56 6 37.50
8135. Norbert (norbert515) 40 93.91 113.99 15 37.50
8136. shanranran (shanranran) 23 93.91 111.23 7 30.43
8137. Mike (tsunami21) 10 93.91 105.94 1 10.00
8138. Jack (jack_tran04) 10 93.90 100.62 6 60.00
8139. Badal Babu (bcube_nimble) 51 93.90 106.78 19 37.25
8140. Mitchell (mitchell807273) 7 93.90 113.03 2 28.57
8141. Simon (simonlee2216) 18 93.89 118.66 11 61.11
8142. Kenai Liam (pyro_kun) 1 93.89 93.89 1 100.00
8143. Jay (jay_soh) 124 93.89 109.92 41 33.06
8144. Stanislaw (mestreponas) 8 93.89 100.08 1 12.50
8145. Chris (xilteen) 2 93.89 108.47 0 0.00
8146. Ywq06 (ywq06) 74 93.88 122.54 26 35.14
8147. Jacob (mini_gaunt) 5 93.88 96.40 0 0.00
8148. Leonardo (wenjiedrick) 8 93.88 111.36 4 50.00
8149. Doubledealer (doubledealer) 5 93.88 106.39 3 60.00
8150. Colt (coltthenark) 7 93.88 107.73 3 42.86
8151. arctics (arctics) 1 93.88 93.88 1 100.00
8152. Konrad (cornyflakez) 15 93.88 105.85 8 53.33
8153. Alexandros (ale_pouroulllis) 14 93.88 111.88 9 64.29
8154. Heyhou (david73) 4 93.88 98.79 1 25.00
8155. decent (mstersierra) 1 93.87 93.87 1 100.00
8156. Virtuoso™ (gkarthick) 11 93.87 100.39 3 27.27
8157. potatu (ulgyscptato) 1 93.87 93.87 0 0.00
8158. Arjun (killerps) 4 93.87 101.30 2 50.00
8159. KJ (barraclaw) 21 93.87 107.18 5 23.81
8160. Anthony (sp333dy) 16 93.87 115.64 9 56.25
8161. Radu (horixyt21) 27 93.87 108.65 8 29.63
8162. Edward (xarvus) 28 93.86 111.93 9 32.14
8163. Lycarions (lycarions) 9 93.86 102.32 5 55.56
8164. COCO (sryulose) 3 93.85 99.64 0 0.00
8165. Abdulrahman (wasd1234) 3 93.85 100.70 2 66.67
8166. George (ausp1c1ous) 12 93.84 103.92 3 25.00
8167. Anjan (beaszt_nix) 28 93.84 111.28 9 32.14
8168. Goatinator (go4tinator) 6 93.84 100.38 2 33.33
8169. Quitalot (tylertylerooo) 1 93.84 93.84 0 0.00
8170. Eddie (diettea) 15 93.84 122.22 4 26.67
8171. juicebox (xsolstice) 14 93.83 111.36 4 28.57
8172. Timothy (zeevox) 4 93.83 100.00 2 50.00
8173. Sazeraq (sazeraq) 2 93.83 97.50 0 0.00
8174. Robert (epicsauce32) 5 93.82 101.26 3 60.00
8175. caden (okaydern) 36 93.82 107.72 18 50.00
8176. Sid (cynocid) 56 93.82 117.15 21 37.50
8177. eyeliddy (eyeliddy2) 3 93.82 98.04 2 66.67
8178. fetix (feticks) 12 93.82 121.63 2 16.67
8179. tstats[randomyr] (randomyr) 27 93.81 107.09 11 40.74
8180. Jacob (xavior_x) 7 93.81 100.00 4 57.14
8181. Knyq (knyq_626) 3 93.81 96.63 1 33.33
8182. SilverFox (silverfox13) 6 93.81 99.77 2 33.33
8183. Dizzi (dizzitypes) 30 93.80 116.00 8 26.67
8184. Helix (helix13_) 5 93.80 99.69 4 80.00
8185. Michel (gamerz026) 12 93.80 108.63 5 41.67
8186. PoopBug (poop_bug) 51 93.80 110.58 19 37.25
8187. Jon (jonathanloh02) 6 93.80 108.46 1 16.67
8188. Anti (anti8157) 3 93.80 98.42 1 33.33
8189. Egg boy (atobias28) 2 93.80 98.71 0 0.00
8190. Travis (lath) 6 93.79 103.48 1 16.67
8191. th (thanasis2002) 21 93.79 112.30 12 57.14
8192. Rez (xymomelum93) 6 93.78 99.76 2 33.33
8193. bingcheng45 (bingcheng45) 10 93.78 108.87 5 50.00
8194. Alex (alexkwon) 4 93.78 102.97 1 25.00
8195. Pogchamp (poggerchamps) 2 93.78 94.48 1 50.00
8196. Me (juicedcows) 30 93.78 117.64 5 16.67
8197. mike1808 (mike1808) 13 93.77 106.87 6 46.15
8198. Matt (rosettastoned) 97 93.77 113.84 39 40.21
8199. Mr. (dyldodyldo) 488 93.77 119.70 168 34.43
8200. Bumbly (canextro) 4 93.77 113.26 3 75.00
8201. RIP Byron ❤ (pdnegreiros) 10 93.77 105.58 1 10.00
8202. hao (haoatran) 33 93.76 106.25 18 54.55
8203. Saira (sairacraft) 2 93.76 94.07 0 0.00
8204. David (cuber988) 17 93.76 100.80 11 64.71
8205. Kevin (crazycranberry) 5 93.76 102.25 1 20.00
8206. Adrian (adrianc04) 332 93.75 120.00 89 26.81
8207. Shreshth (thefoxwithanelytra) 11 93.75 100.26 4 36.36
8208. wel (welneco) 6 93.75 103.39 6 100.00
8209. ben (benwestmercer) 5 93.75 99.94 1 20.00
8210. Zir0 (ziiro) 10 93.75 105.60 4 40.00
8211. MS (damanthc) 3,050 93.74 128.35 1,066 34.95
8212. Chuck (phreoq) 1 93.74 93.74 0 0.00
8213. HardeQ (hardeq) 2 93.74 100.70 2 100.00
8214. Will (pozzpyo) 33 93.73 104.39 13 39.39
8215. Andy (paingle) 8 93.73 104.79 3 37.50
8216. Nick (maddogitb) 3 93.73 96.63 3 100.00
8217. John (cryptx_) 14 93.73 117.81 8 57.14
8218. Martin (martinwong) 2,049 93.73 121.93 756 36.90
8219. J (itsjustj) 106 93.72 123.15 31 29.25
8220. Aespar (aespar) 79 93.72 114.27 28 35.44
8221. Dan (danvictor321) 464 93.71 118.95 163 35.13
8222. KingBaby (kingzeroiii) 47 93.71 110.78 14 29.79
8223. anon (nootathotep) 3 93.71 98.49 0 0.00
8224. Arnav (phoenixcrusher369) 7 93.71 105.77 3 42.86
8225. Nathan (nathanpg) 11 93.71 108.44 5 45.45
8226. Pranav (ps0505) 1 93.71 93.71 0 0.00
8227. Declan (deccazz) 93 93.71 112.19 40 43.01
8228. Casey (caseyjnguyen) 5 93.71 100.71 3 60.00
8229. Vyc (vyctor661) 51 93.70 115.49 17 33.33
8230. Simon (siarnt) 106 93.70 111.16 38 35.85
8231. MsPianomama (mspianomama) 80 93.70 121.18 28 35.00
8232. herman (herman159) 36 93.70 109.66 9 25.00
8233. Shahmir (shahmirishere) 21 93.70 115.57 10 47.62
8234. Anna (rabbitpickles69) 32 93.70 129.75 11 34.38
8235. GTedZ (gtedz) 1 93.70 93.70 0 0.00
8236. Aidan (b8its) 73 93.70 107.94 22 30.14
8237. Olivier (whiskyforagrownman) 17 93.70 116.56 6 35.29
8238. Carlos (nearbywaffle) 66 93.70 120.99 22 33.33
8239. praks (praks01) 2,233 93.70 124.74 813 36.41
8240. Walter (whunt5757) 10 93.70 115.67 4 40.00
8241. WSY (elyx_2302) 148 93.69 111.86 64 43.24
8242. Kayli (crackerjap) 7 93.69 98.46 6 85.71
8243. Filip (sucicf7) 11 93.69 105.34 1 9.09
8244. Roy (rwfeng72) 20 93.68 114.73 7 35.00
8245. aldrigon (aldrigon) 29 93.68 120.66 18 62.07
8246. Zephyr (lay_oreo) 368 93.68 131.18 120 32.61
8247. Yanterko (yanterko) 75 93.68 112.05 32 42.67
8248. Poo (pooopooo) 422 93.68 124.00 113 26.78
8249. the_redcar (the_redcar) 10 93.67 123.69 6 60.00
8250. Christian (cwoo) 9 93.67 107.64 6 66.67
8251. fastasf (anshisfast) 4 93.67 98.78 1 25.00
8252. Jeff (jeffracersf) 6 93.67 105.10 3 50.00
8253. my name (calmthyself) 175 93.67 107.85 55 31.43
8254. Vasanth Raja (vasanthraja) 668 93.67 121.98 214 32.04
8255. Andi (iacidna) 4 93.67 98.51 1 25.00
8256. Rod (compangit) 17 93.66 106.37 6 35.29
8257. Daniel (kald3s) 8 93.66 109.88 5 62.50
8258. George (gpa138) 11 93.66 112.81 7 63.64
8259. Spafa (spafa) 12 93.66 110.95 5 41.67
8260. Chili (chilipaneer) 5 93.65 99.76 2 40.00
8261. Dimitar (dimitar2424) 23 93.64 111.23 12 52.17
8262. Nguyen (rainfall1611) 1,187 93.64 129.59 450 37.91
8263. Julian72696 (julian72696) 27 93.64 119.37 7 25.93
8264. Ruslan (ruslan_osmanov) 11 93.64 105.18 3 27.27
8265. Pei Bin (cheongpeibin) 126 93.64 132.28 45 35.71
8266. road to 100wpm (getoar112) 60 93.64 115.53 26 43.33
8267. John (everderp) 9 93.64 115.67 4 44.44
8268. J (yzy1234) 3 93.64 100.44 1 33.33
8269. bl731mang (bl731mang) 13 93.63 125.60 6 46.15
8270. Brent (typer1987) 20 93.63 114.03 8 40.00
8271. darkll (darkll) 2 93.63 101.71 1 50.00
8272. Michael (mike1232b) 13 93.63 116.06 5 38.46
8273. Rasmus (r4zoth) 5 93.63 101.50 3 60.00
8274. Mazeppa (dynozawa) 19 93.63 103.35 4 21.05
8275. Taylor (tttaylor) 3 93.62 107.16 3 100.00
8276. Bosco (bqscopog) 13 93.62 109.18 6 46.15
8277. Nick (bopob) 43 93.62 114.99 22 51.16
8278. Hussein (rifath33) 3 93.62 104.66 1 33.33
8279. Rohit (r1walz) 2 93.62 98.91 1 50.00
8280. deegl0rd (stimoze) 10 93.61 100.85 4 40.00
8281. Tryhardest (tryhardest) 3 93.61 100.63 3 100.00
8282. sam (chillfilter) 1 93.61 93.61 0 0.00
8283. Ian (kfcdonutsandwich) 15 93.61 112.84 4 26.67
8284. Riley (amlockedinfridge) 69 93.61 116.41 26 37.68
8285. omegadeath88 (omegadeath88) 7 93.59 110.02 1 14.29
8286. Theodore (erodoeht) 23 93.59 111.28 8 34.78
8287. wyss (wyss) 3 93.59 102.26 1 33.33
8288. doodezpz (doodezpz) 13 93.59 111.47 5 38.46
8289. rugbyBREAD (rugbybread4free) 56 93.59 111.03 24 42.86
8290. 🐢🐢🐢🐢 (amogh1420) 36 93.58 109.06 16 44.44
8291. Warren (warlover94) 7 93.58 101.12 0 0.00
8292. Salman (blackstrobe) 70 93.58 112.97 26 37.14
8293. Randy (randonandoz) 20 93.58 107.02 12 60.00
8294. Victor (vlnash2002) 27 93.58 108.41 12 44.44
8295. Hans (extrem3typist) 4 93.58 109.35 0 0.00
8296. Joey (itzjoeyz) 15 93.56 114.66 5 33.33
8297. YT (inverxted) 16 93.56 125.60 9 56.25
8298. Thomas (tommy_wang) 4 93.56 99.74 1 25.00
8299. Inactiv (inactivak) 15 93.55 105.06 4 26.67
8300. RoachLok (roachlok) 2 93.55 97.97 1 50.00
8301. Kenley (kenfunky32) 13 93.55 109.17 4 30.77
8302. Wilson (wilsonthewinner) 150 93.55 117.14 44 29.33
8303. Zackyization (zackyization) 2 93.55 94.55 0 0.00
8304. Eaglekott (eaglekott) 149 93.54 114.39 48 32.21
8305. Nick (nick_txt) 50 93.53 120.25 23 46.00
8306. RicoBaby (ricoricoree_) 61 93.53 117.13 38 62.30
8307. Jem (jampr) 28 93.53 109.67 9 32.14
8308. Farey (farey0633) 1 93.53 93.53 0 0.00
8309. MJ (mj_02) 30 93.53 107.60 15 50.00
8310. Enrico (enricoaf) 134 93.53 133.42 58 43.28
8311. Mark (redblacktiger) 103 93.53 124.30 45 43.69
8312. Justin (leethelethal) 42 93.52 111.58 11 26.19
8313. farzan (farzanhges) 862 93.52 131.23 378 43.85
8314. Noxellar (noxellar) 21 93.52 108.09 7 33.33
8315. Mau (walfare_12) 132 93.52 122.64 50 37.88
8316. ToastyCPU (mynewuser) 3 93.51 96.14 1 33.33
8317. Memes (ethanlee70) 24 93.51 114.12 9 37.50
8318. raffa (scoradian) 34 93.51 103.55 15 44.12
8319. Zero (zerowaffles) 3 93.51 106.98 1 33.33
8320. Nick (thedragon252) 2 93.51 100.11 1 50.00
8321. Craving (romboowner) 7 93.50 100.25 2 28.57
8322. Kera (kera77) 4 93.50 108.30 2 50.00
8323. epic (epicrako123) 230 93.50 117.12 118 51.30
8324. K (k3nl4w) 1 93.50 93.50 0 0.00
8325. Arden (moo_o) 38 93.50 121.21 13 34.21
8326. scoopy (scoopyjohnson) 4 93.50 97.62 1 25.00
8327. Soog (beez23) 48 93.50 105.05 11 22.92
8328. Brian (bgan) 11 93.49 100.79 6 54.55
8329. Andrew (sertria) 11 93.49 100.08 3 27.27
8330. Redempt1on (redempt1on) 6 93.49 102.60 3 50.00
8331. Jonathan (lone_lee) 19 93.49 113.93 7 36.84
8332. Sébastien (reganisgod) 25 93.49 105.50 8 32.00
8333. Cau Be (caubelangthang) 24 93.49 111.02 10 41.67
8334. Kladdigt (sigius) 36 93.49 109.71 11 30.56
8335. Mirage (starry_mirage) 16 93.48 104.99 6 37.50
8336. Sigh (isigh) 22 93.48 110.71 11 50.00
8337. ⁶⁶⁶ (siign) 9 93.48 98.48 3 33.33
8338. Sumeru_ (kenteezyx) 417 93.48 126.43 159 38.13
8339. jonny (xjboix) 8 93.48 115.36 3 37.50
8340. Hamza (hamza8864) 4 93.47 102.02 3 75.00
8341. Emily (emilyk_3357) 32 93.47 114.49 12 37.50
8342. Conor (conargh) 1 93.47 93.47 0 0.00
8343. Dylan (dylanlikescake) 1 93.46 93.46 0 0.00
8344. Slimesito (bodhisteel) 1 93.46 93.46 1 100.00
8345. Ruben (rubenzhang) 42 93.46 108.15 15 35.71
8346. Alvex (gr_alvex) 2 93.46 104.31 1 50.00
8347. Joshua (joshua172) 42 93.45 115.21 17 40.48
8348. Daehan (vitamaxdh) 130 93.45 116.83 44 33.85
8349. eric_colemak (eric_colemak) 5 93.45 99.87 3 60.00
8350. John (omster83) 11 93.45 111.06 5 45.45
8351. Lan (heatblaze) 8 93.44 103.61 3 37.50
8352. Josh (h3hat3m3) 152 93.44 112.28 41 26.97
8353. Dunkmasta (dunkmasta) 41 93.44 114.21 21 51.22
8354. mike (captaincapitalism) 548 93.43 121.42 202 36.86
8355. Brandon (brandonzfu) 55 93.43 125.23 22 40.00
8356. Dallin (d4llin) 1 93.43 93.43 1 100.00
8357. s (qurtle) 1 93.43 93.43 0 0.00
8358. John (loki83jcg) 22 93.43 111.12 8 36.36
8359. Darren (xdeclipseee) 13 93.43 114.22 5 38.46
8360. too much radio, not enough ... 330 93.43 124.88 119 36.06
8361. Jason (kamesstory) 2 93.43 95.54 1 50.00
8362. Shawn (shawnyw) 13 93.42 105.36 4 30.77
8363. Aisuru (r_chin) 25 93.42 115.14 8 32.00
8364. Riley (examinedrumble7) 4 93.42 103.65 4 100.00
8365. migs12345 (deanfanboy) 5 93.42 105.22 1 20.00
8366. Ambi (dank_ambi) 272 93.41 127.75 114 41.91
8367. Stuart (psephos) 21 93.41 114.47 6 28.57
8368. Keira (keiradawn) 856 93.41 119.94 323 37.73
8369. Jeff (jeffwu1220) 45 93.41 110.12 13 28.89
8370. Hhhh (strawbirry) 41 93.41 116.88 14 34.15
8371. rat (stinkypissboy) 7 93.40 112.05 6 85.71
8372. 0 (gochoo) 38 93.39 107.68 13 34.21
8373. Persov (persov) 64 93.39 119.57 21 32.81
8374. isthislewz (isthislewz) 20 93.39 104.83 6 30.00
8375. Malondee (malondee) 28 93.39 107.95 8 28.57
8376. Mindjolt (mindjolt) 8 93.39 105.49 2 25.00
8377. Peter (ch9cken) 40 93.39 123.21 12 30.00
8378. hydro (hydrorynex) 4 93.38 102.03 2 50.00
8379. teeto (1005sv) 28 93.37 116.87 8 28.57
8380. Theo (theodosis_aga) 635 93.37 134.14 198 31.18
8381. Alex (galaxp1) 1 93.37 93.37 0 0.00
8382. Dri (dri96) 1 93.37 93.37 1 100.00
8383. Shriram (shrirammc55) 416 93.37 117.02 146 35.10
8384. Anh (fujiwarakazuki) 7 93.37 105.06 0 0.00
8385. Francisco (patleitao) 10 93.37 109.07 7 70.00
8386. Roberto (bertdog1995) 31 93.36 105.15 9 29.03
8387. Vab (vaheebee) 48 93.36 104.27 15 31.25
8388. Mooriah (marblesgalore) 1 93.36 93.36 0 0.00
8389. god (god_is_here) 279 93.36 117.04 93 33.33
8390. Egg (cocodong) 2 93.36 97.36 2 100.00
8391. epic gamer (dianalin2) 17 93.35 104.16 5 29.41
8392. Sean (crowded_keyboard) 108 93.35 119.68 52 48.15
8393. Bruce Mang (cheeseburger_98) 10 93.35 118.59 2 20.00
8394. Calvin (b1ack) 2 93.35 105.48 1 50.00
8395. Andrew (patatoed) 2 93.35 99.47 0 0.00
8396. owlsoup (owlsoup) 17 93.34 115.70 8 47.06
8397. Nate (poppafig) 5 93.34 100.37 5 100.00
8398. Ed (recht) 84 93.34 110.33 40 47.62
8399. Ayush (kanodiaayush) 19 93.33 111.13 5 26.32
8400. 123 (colemak163) 5 93.33 95.95 0 0.00
8401. Ashley (darlavsue12) 95 93.33 114.02 28 29.47
8402. Juls (juls22) 35 93.33 106.04 8 22.86
8403. Andres (defmaxer) 17 93.33 110.14 3 17.65
8404. Bryan (thesilican) 13 93.33 107.78 6 46.15
8405. Anthony (mike916) 76 93.32 112.55 37 48.68
8406. t (zyxx) 290 93.32 129.84 115 39.66
8407. nah (ministermeme) 32 93.31 111.67 9 28.13
8408. adsfjk (jbcabintoy14) 1,818 93.31 124.85 669 36.80
8409. Experiment 626 (eee01) 74 93.31 115.46 32 43.24
8410. Jason (jasongog) 1 93.31 93.31 1 100.00
8411. Daniel (jansson) 14 93.31 105.69 6 42.86
8412. Gabe (gabedal) 1 93.31 93.31 0 0.00
8413. Evan (westboys) 4 93.31 97.35 2 50.00
8414. Neko (nekonekokneecaps) 15 93.31 104.32 9 60.00
8415. andrew (washedtyper) 362 93.31 116.39 150 41.44
8416. R (ry20) 12 93.30 101.85 7 58.33
8417. FlamingPhoenix40 (thedoctor40) 1 93.30 93.30 0 0.00
8418. Deasy (deasnataly) 5 93.30 104.83 0 0.00
8419. Кирилл (life808) 44 93.29 118.20 15 34.09
8420. Jiaying (jiaying) 2 93.29 93.31 0 0.00
8421. L + (n1ckname152) 22 93.28 111.15 12 54.55
8422. Dorito (doritochip) 5 93.28 103.15 1 20.00
8423. Mohammad (speedyboi108) 4 93.28 105.62 1 25.00
8424. Mr.Pickles (ap_ultra) 13 93.28 116.72 4 30.77
8425. IAmAtomicツ (from_phlol) 17 93.28 111.95 9 52.94
8426. An (iaman) 783 93.27 118.91 282 36.02
8427. Viet Trung (viettrung9012) 38 93.27 106.99 18 47.37
8428. Matt (mattsmouse) 14 93.27 118.31 4 28.57
8429. davidpasion (davidpasion) 73 93.27 107.88 27 36.99
8430. Massimo (xasaza7) 6 93.27 111.78 3 50.00
8431. zulueta (zzxjoanw) 1 93.27 93.27 1 100.00
8432. aa (sup_chief) 112 93.27 139.40 41 36.61
8433. Conor (magevonor) 1 93.27 93.27 0 0.00
8434. Haggis (haggis) 1 93.27 93.27 0 0.00
8435. Jackelton (jackelton) 29 93.27 112.13 10 34.48
8436. Izy (ggizy) 2 93.27 94.35 0 0.00
8437. Zack (raichubuddy) 5 93.26 116.48 1 20.00
8438. Shichibukai (shichibukai2002) 20 93.26 103.38 8 40.00
8439. Slim (slimshady2000) 3 93.25 94.37 2 66.67
8440. Doug (vastvincent) 8 93.25 107.52 6 75.00
8441. L.in.k (xquyen) 1,442 93.24 123.99 534 37.03
8442. Efilio (yodigarcia) 6 93.24 101.46 3 50.00
8443. Ansh (anshghosh) 40 93.24 114.88 16 40.00
8444. school (modernmarauder) 220 93.24 132.42 81 36.82
8445. [[ Stropion (stropion) 2 93.24 94.92 2 100.00
8446. i hate people go away (sexh... 221 93.23 136.94 56 25.34
8447. Sir (sirnoodles05) 8 93.23 103.52 2 25.00
8448. Grigor (grigor) 2 93.23 95.85 2 100.00
8449. Hey (veeceebee) 34 93.23 116.89 18 52.94
8450. treje (treje) 1,535 93.23 143.68 687 44.76
8451. Ollie (oham) 6 93.23 114.02 2 33.33
8452. David (gitgudfast) 2 93.23 95.15 0 0.00
8453. Markycuh420 (theitfactor) 594 93.22 127.83 210 35.35
8454. snova (rickdiculous) 2 93.22 94.87 1 50.00
8455. David (koreanboy) 14 93.21 115.90 3 21.43
8456. Ethan (ethaaaaaaaaaan) 6 93.20 111.34 2 33.33
8457. Mathias (mathi2912) 8 93.20 102.10 3 37.50
8458. Lane (asdfedffd) 68 93.20 107.08 15 22.06
8459. typegud (desun) 1 93.19 93.19 0 0.00
8460. Daniel (danielstep65) 13 93.19 108.37 3 23.08
8461. Andrey (cheaterkin) 1 93.19 93.19 1 100.00
8462. Jion (jiondarien) 3 93.19 109.39 2 66.67
8463. akaseia (keikuuuu) 887 93.19 124.21 350 39.46
8464. Cody (hippolytus) 26 93.19 124.79 9 34.62
8465. Joshua (mr_mushroom_stew) 16 93.18 101.28 2 12.50
8466. The Cult Leader (thekingrises) 1 93.18 93.18 1 100.00
8467. Jason (cowlodger123) 26 93.18 127.93 18 69.23
8468. Hassan (xxhassanixx) 12 93.18 112.44 4 33.33
8469. George (geoioanid) 2 93.18 99.94 1 50.00
8470. Schalbuch (schalbuch) 3 93.17 97.73 1 33.33
8471. Matteo (matbon01) 6 93.17 96.47 4 66.67
8472. Etienne (etienne_bepo) 56 93.17 111.64 3 5.36
8473. Seri (vincent_aik) 56 93.17 109.08 22 39.29
8474. Jacob (soolseem) 7 93.16 105.03 1 14.29
8475. pri (prinni) 68 93.16 109.50 23 33.82
8476. Tyler (itztylrrtv) 2 93.16 95.71 2 100.00
8477. Saul (paulsaredes) 78 93.15 115.34 29 37.18
8478. tstats[orbitaltowel] (orbit... 89 93.15 126.41 38 42.70
8479. Nicolás (carcamo) 1 93.15 93.15 0 0.00
8480. Never (azasal) 10 93.15 109.57 2 20.00
8481. Matt (airkeeper) 3 93.15 101.30 1 33.33
8482. Luke (tbsky92) 10 93.15 110.75 9 90.00
8483. Tim (timoteo_lol) 25 93.15 109.98 9 36.00
8484. Jeff (jjj11x) 11 93.14 107.04 4 36.36
8485. Andrew (thelittleninja7) 4 93.14 106.17 2 50.00
8486. Han (han3) 11 93.14 109.55 3 27.27
8487. prophet muhammad (fucboi) 1 93.14 93.14 0 0.00
8488. Michael (whalee) 8 93.14 97.70 2 25.00
8489. Il Capitano (ilcapitano) 10 93.13 103.39 3 30.00
8490. heclord (heclord) 38 93.13 108.04 11 28.95
8491. atlas (kuuym) 11 93.13 113.74 6 54.55
8492. Hitscan (loonatick_src) 38 93.12 112.79 15 39.47
8493. ee (tally_dvorak) 20 93.12 103.56 10 50.00
8494. Bijay (moneybijay) 29 93.12 112.76 11 37.93
8495. Romil (aidag) 8 93.12 101.29 3 37.50
8496. Anthlone (blakley) 73 93.12 115.71 24 32.88
8497. The Write Tale (pchanbps1) 20 93.11 99.83 8 40.00
8498. Victor (whitenecro21) 9 93.10 100.26 2 22.22
8499. Muh. Habibi (agemagi) 7 93.10 101.12 1 14.29
8500. Brendan (brendanlo4) 41 93.10 109.18 19 46.34
8501. La (guinea_peeg_1234) 8 93.10 99.65 1 12.50
8502. Rachel (rlau) 1 93.10 93.10 0 0.00
8503. Chez (chezdude) 23 93.10 103.65 12 52.17
8504. Andrew (epiandrew) 3 93.10 100.64 1 33.33
8505. ObamaGaming (realobamagaming) 3 93.10 96.20 3 100.00
8506. kaatumanidhan (kattumanidhan) 171 93.09 140.29 71 41.52
8507. James (freetheguy2) 6 93.09 96.98 1 16.67
8508. Leo (hogsh9862) 177 93.09 121.54 59 33.33
8509. Ricky (vricky) 5 93.09 101.79 1 20.00
8510. 12Ethan! (towelette) 14 93.09 110.14 4 28.57
8511. Devin (eulertour) 4 93.09 103.12 1 25.00
8512. saladie (saladie) 6 93.08 111.18 4 66.67
8513. Kyle (sbm66) 1 93.08 93.08 0 0.00
8514. Jean (seawardsalmon6) 340 93.08 115.38 130 38.24
8515. Raymond (szlesh) 128 93.08 121.77 53 41.41
8516. Zeb (zebstrikal) 3 93.07 95.98 3 100.00
8517. Vladimir (galaxygameryay) 5 93.07 101.01 5 100.00
8518. Amaranth (fadingamaranth) 9 93.06 110.89 3 33.33
8519. Karmalegend (karmalegend) 5 93.06 95.96 1 20.00
8520. Josef (mcblyat2) 7 93.06 103.77 2 28.57
8521. lakshmi (lakshmi__) 2 93.06 97.67 0 0.00
8522. friwerowsky (friwerowsky) 3 93.05 96.52 2 66.67
8523. juswawawa (juswawawawawa) 970 93.05 133.28 368 37.94
8524. Bill (porousrock) 6 93.05 99.76 0 0.00
8525. Atif (atifzaheer2028) 254 93.05 116.16 103 40.55
8526. dawgy1 (dawgy1) 2 93.05 101.99 1 50.00
8527. Ludvig (luddez1) 56 93.04 113.82 23 41.07
8528. Myro Bryan (iskwagong) 49 93.04 113.96 19 38.78
8529. Ian (cigaweed) 3 93.04 101.05 1 33.33
8530. Caeden (caeden2008) 1 93.04 93.04 1 100.00
8531. pogfatherz (pogfatherz) 7 93.04 98.73 3 42.86
8532. Dimitri (penguinhams) 40 93.03 120.74 14 35.00
8533. Dan (dnor1313) 83 93.03 120.85 31 37.35
8534. cursedgandhi (cursedgandhi) 8 93.03 100.32 4 50.00
8535. adin (tappineapple) 35 93.02 121.86 13 37.14
8536. Emmy (emilyelaine) 90 93.02 112.10 31 34.44
8537. Soggy (soggydog) 10 93.02 106.75 2 20.00
8538. Cyberwolf (cyberwolf555) 3 93.02 99.87 1 33.33
8539. Sayauriee (japanese_maple_l... 13 93.01 103.02 6 46.15
8540. Kevin (kevinliu050505) 11 93.01 102.71 4 36.36
8541. Kuzma (rikoj02) 26 93.01 115.42 9 34.62
8542. TRUMP (tiepin) 10 93.01 102.01 2 20.00
8543. Connor (schellc) 5 93.01 100.62 2 40.00
8544. Mad (mad888) 42 93.01 117.10 28 66.67
8545. Questt (questtlee) 20 93.01 111.73 9 45.00
8546. Justin (justin000) 11 93.00 103.09 4 36.36
8547. bullyjuice (bullyjuice) 6 93.00 116.05 2 33.33
8548. Derek (doggish) 35 92.99 109.74 12 34.29
8549. Asian (sdf415) 3 92.99 96.93 0 0.00
8550. kev2k (kev2k) 8 92.99 110.05 4 50.00
8551. Matthew (matty_g) 4 92.99 99.52 3 75.00
8552. Robert (rrobertt3137) 200 92.99 122.84 75 37.50
8553. a (apno) 2 92.99 94.14 0 0.00
8554. Typing McQueen (sakram07) 5 92.98 100.26 3 60.00
8555. Zeb (cleavecamael) 3 92.98 101.37 2 66.67
8556. Michael (raczcar) 14 92.98 110.39 6 42.86
8557. Anonymous (ballistic_kraken) 3 92.97 104.66 0 0.00
8558. Zoot (chroniaro) 3 92.97 94.52 3 100.00
8559. Cayla (kalepark) 2 92.97 93.71 1 50.00
8560. Ryan (nayrx14) 7 92.96 110.29 3 42.86
8561. Jorn (dealermedic) 250 92.96 121.12 77 30.80
8562. Mateusz (ccre) 5 92.95 102.11 2 40.00
8563. richa (richa69) 2 92.95 96.49 1 50.00
8564. Bob (bromanswagboy) 12 92.95 118.20 3 25.00
8565. MithterMagma (mithtermagma) 117 92.95 112.79 43 36.75
8566. BNYKGDT (hopelessly_serious) 48 92.94 117.18 19 39.58
8567. Tom (imtp) 6 92.94 99.83 1 16.67
8568. Braden (barbuthnot) 76 92.94 108.45 30 39.47
8569. Stefaan (befferdw) 19 92.93 140.75 10 52.63
8570. Allen (agginham) 3 92.93 99.67 2 66.67
8571. Jay (rampagej5) 1 92.93 92.93 1 100.00
8572. Protoclasm (protoclasm) 5 92.93 101.24 3 60.00
8573. Tesla (teslalord) 36 92.93 112.83 16 44.44
8574. sudo (airpline1) 2 92.93 95.02 0 0.00
8575. Daniel (korice) 22 92.92 124.00 5 22.73
8576. neo (eliteneo) 31 92.92 110.74 7 22.58
8577. Kimberly (kimberlame) 1 92.92 92.92 1 100.00
8578. aleksi (speedysmurffi) 4 92.92 102.67 0 0.00
8579. David (phawkes21) 5 92.92 106.54 2 40.00
8580. Apithat Sombatsiri (itsmek4nz) 13 92.91 109.05 4 30.77
8581. Leukino (leukino) 61 92.91 127.78 20 32.79
8582. N0rmL (_mee_) 25 92.91 104.64 10 40.00
8583. Naafiyan (naafiyan) 3 92.91 101.13 1 33.33
8584. Whats (whatsderivative) 21 92.91 104.86 10 47.62
8585. berkay (berkayyalin) 29 92.91 107.45 13 44.83
8586. justavg (justavg) 7 92.90 99.87 2 28.57
8587. asd (asd135795jack) 1 92.90 92.90 1 100.00
8588. Bobby (bobbydhiman69) 9 92.90 104.62 3 33.33
8589. Katie (katie2096) 6 92.90 102.06 1 16.67
8590. Gavin (gavtoaster) 16 92.89 107.49 5 31.25
8591. Garrett (grgarrett) 79 92.89 112.73 24 30.38
8592. Vil (vil_) 60 92.89 117.03 20 33.33
8593. zion=overrated (ziongotnohops) 1 92.89 92.89 0 0.00
8594. Breanna (monettheturtle) 1 92.89 92.89 0 0.00
8595. marce (marcelojraj) 5 92.89 104.14 0 0.00
8596. joanne (joannekim63) 50 92.89 109.95 23 46.00
8597. Starry (starsky123) 30 92.88 111.53 13 43.33
8598. adam (zingerbox460) 9 92.88 106.40 4 44.44
8599. Keyser (whereskeyser) 28 92.87 116.61 11 39.29
8600. Maday (maday) 1 92.87 92.87 1 100.00
8601. Jeremy (mlgquikscopebruh) 14 92.87 127.49 6 42.86
8602. Davvy (daavvyy) 26 92.87 122.59 11 42.31
8603. touch grass (midca) 573 92.87 129.47 196 34.21
8604. cee (cxelle) 5 92.87 104.73 3 60.00
8605. Spare (spare1) 5 92.87 101.50 2 40.00
8606. No Mistakes (apsnacks) 31 92.86 114.27 7 22.58
8607. Josh (joshindahood) 9 92.86 102.89 2 22.22
8608. Josiah (josiah_wi2) 6 92.86 121.29 3 50.00
8609. Joe (joemama17) 17 92.86 113.57 5 29.41
8610. Ron (ronlaniado) 25 92.85 107.66 8 32.00
8611. Sumit (smromuec) 76 92.85 110.12 24 31.58
8612. Akisa (akisarazbu) 6 92.85 97.16 5 83.33
8613. SimplyOrange (simplyorange) 867 92.85 122.47 302 34.83
8614. ye ye (kermatt3) 23 92.85 130.16 10 43.48
8615. jimi (jimi79) 12 92.85 108.58 10 83.33
8616. Vik (yungcoolioth) 4 92.85 111.02 2 50.00
8617. vikalimo (anoba) 5 92.84 99.15 1 20.00
8618. Stefan (fendorian) 273 92.84 116.99 107 39.19
8619. glo (whytho_) 7 92.84 102.78 1 14.29
8620. Auveed (auveed) 189 92.83 110.82 65 34.39
8621. Wonhee (krwhlee15) 47 92.83 120.85 22 46.81
8622. PruXy. (pruxy) 4 92.83 103.15 4 100.00
8623. kenneth (tenick) 323 92.82 116.70 109 33.75
8624. Donovan (donovanle) 202 92.82 121.21 64 31.68
8625. Hugh (negoose) 3 92.82 94.31 1 33.33
8626. Isak (isapan) 51 92.82 110.48 18 35.29
8627. Conner (conmanb) 6 92.81 108.28 4 66.67
8628. Rebel (rebelaj) 11 92.81 99.78 2 18.18
8629. Liu (jazzkey) 326 92.81 112.40 129 39.57
8630. Whos (g3trekt) 5 92.81 105.27 5 100.00
8631. itssarcazm (itssarcazm) 36 92.81 115.14 10 27.78
8632. Kris (doyouthink) 9 92.81 108.90 4 44.44
8633. m (ogtong) 15 92.81 101.85 4 26.67
8634. weicer (weicer) 47 92.81 113.75 17 36.17
8635. AmirrezA (amirrezase7en) 13 92.80 106.89 5 38.46
8636. Young (so_many_errors) 17 92.80 112.55 7 41.18
8637. Jay (jdpthota) 7 92.80 101.39 2 28.57
8638. tran (tranwantdie) 7 92.79 105.74 3 42.86
8639. Jack (user85793) 132 92.79 123.43 47 35.61
8640. 👺 (confiscar) 36 92.79 113.27 10 27.78
8641. ambi (ambiidextrous) 80 92.79 120.58 38 47.50
8642. petey (pr69) 1 92.79 92.79 1 100.00
8643. Cactusmon (cactusmon) 4 92.79 105.48 1 25.00
8644. Jelmer (jelmerevers) 15 92.79 107.77 5 33.33
8645. OJ (saroisu) 3 92.78 94.52 1 33.33
8646. Marc Owen (marcowen20) 2 92.78 95.89 0 0.00
8647. Walter (walter1) 19 92.78 102.47 8 42.11
8648. QuietObedientConsent (arrow... 43 92.78 114.36 13 30.23
8649. Miguel (miguelkristian) 15 92.78 101.84 3 20.00
8650. I really suk (cornmaster0411) 302 92.78 117.42 100 33.11
8651. cole (coldmak) 185 92.78 129.16 64 34.59
8652. my fingers are slow (jay12310) 99 92.78 111.56 30 30.30
8653. Griffin (girfster) 5 92.78 97.79 4 80.00
8654. Monica (ricefun) 28 92.78 106.46 8 28.57
8655. Payette (payette420) 11 92.78 108.64 1 9.09
8656. ChurM8 (churm8) 53 92.77 125.59 38 71.70
8657. Sam (samdagoat32) 4 92.77 100.98 2 50.00
8658. Haoming (hm_002) 2 92.77 97.03 1 50.00
8659. Anh (nta1207) 9 92.77 99.75 4 44.44
8660. Johan (treeff) 71 92.77 119.30 21 29.58
8661. Torey (cyclops13) 2 92.77 97.95 0 0.00
8662. melvynAIDS (melvynaids) 9 92.76 104.00 5 55.56
8663. MasonColemak (masoncolemak) 91 92.76 114.15 26 28.57
8664. Lily (8o7wer) 1 92.76 92.76 0 0.00
8665. TN (47percent) 2 92.76 96.32 1 50.00
8666. Robert (privateer) 3 92.75 98.53 1 33.33
8667. xelopan (xelopan) 12 92.75 104.82 4 33.33
8668. beth (elizabethbrantt) 4 92.75 97.22 1 25.00
8669. Alex (bobpoopsalot8) 3 92.75 97.22 3 100.00
8670. Matt (maffhoo) 5 92.75 117.01 2 40.00
8671. Rami (nub_paws) 39 92.74 106.00 14 35.90
8672. tstats[sspaghettii] (sspagh... 29 92.74 108.16 9 31.03
8673. wet nightmare (daviddloco) 27 92.74 105.41 13 48.15
8674. Famesh (fampatel) 24 92.74 120.96 8 33.33
8675. Gabe (rubikcrube) 3 92.73 99.48 0 0.00
8676. Mathew (johnnyio) 18 92.73 107.68 7 38.89
8677. yoozernaim (yoozernaim) 146 92.73 108.20 49 33.56
8678. Lucas (mutenow) 2 92.73 101.27 1 50.00
8679. jayp (phrasez) 38 92.72 122.02 27 71.05
8680. sleepy (sleepy_tf) 28 92.72 117.76 10 35.71
8681. Ben (lalbtyd25) 3 92.72 104.86 2 66.67
8682. Mathijs (mathijsmaes) 18 92.72 108.10 7 38.89
8683. Blake (navy23rd) 1 92.72 92.72 1 100.00
8684. Damian (depek) 1 92.72 92.72 0 0.00
8685. Boltcrasher (boltcrasher) 1 92.72 92.72 0 0.00
8686. Basil (kaneki_k3n) 54 92.71 114.19 16 29.63
8687. Lidlidlid (lidlidlid) 2 92.71 93.37 0 0.00
8688. Gabriel (cashewsoda) 53 92.71 109.24 18 33.96
8689. Van Hoang (hoangelec) 9 92.71 106.70 3 33.33
8690. Kaeso (kaeso_krupp) 27 92.70 107.69 12 44.44
8691. Kyle (badadc) 11 92.70 112.81 5 45.45
8692. typingishard (dweepers) 30 92.70 112.60 7 23.33
8693. WolfTypist (wolftypist) 1 92.70 92.70 0 0.00
8694. tontin (tontinvicinta) 19 92.70 111.85 5 26.32
8695. JersH (0zmank) 1 92.70 92.70 0 0.00
8696. Inesh (69420nice) 65 92.70 110.06 21 32.31
8697. Zams0 (oofman666) 6 92.70 98.89 3 50.00
8698. Katappa (sim007) 17 92.69 123.35 13 76.47
8699. noah (randylehey) 212 92.69 119.81 74 34.91
8700. Asian (kiniiranai) 36 92.69 108.06 12 33.33
8701. Markus Solem (shrexy) 1 92.69 92.69 1 100.00
8702. sylk (sylk28) 3 92.69 104.14 2 66.67
8703. Krish (krish987) 4 92.68 112.14 3 75.00
8704. Sultan (sultanai) 10 92.68 109.64 4 40.00
8705. Anugrah (anugrahdwikusuma) 12 92.68 116.31 4 33.33
8706. Jimmy (carb0n13) 94 92.68 116.35 29 30.85
8707. Mike (chuangman) 2 92.68 94.16 0 0.00
8708. 🤝🤝 (joejiunn) 332 92.68 116.79 106 31.93
8709. Ice (icedevera) 5 92.67 101.03 4 80.00
8710. Ace (acepilot22) 6 92.67 102.58 2 33.33
8711. tstats[jancs] (jancs) 487 92.67 124.22 185 37.99
8712. Kevin (kevinyeh) 1 92.67 92.67 0 0.00
8713. Joshua (joshque) 32 92.67 110.35 4 12.50
8714. Trav (treiner) 2 92.66 94.48 1 50.00
8715. Amar (jebemtimater52) 3 92.65 102.26 3 100.00
8716. Yoshi (beegyoshifan) 6 92.65 101.40 1 16.67
8717. Ruan (rmontelo) 18 92.65 106.50 7 38.89
8718. coin (damasterofcoin) 5 92.65 102.26 1 20.00
8719. facenne (facenne) 15 92.64 110.25 7 46.67
8720. Seizoxu (xezious) 31 92.64 110.99 15 48.39
8721. Lance (lenzzyyy) 6 92.64 111.50 3 50.00
8722. Jake (jasala) 44 92.64 108.43 16 36.36
8723. William (willhyt) 1 92.63 92.63 0 0.00
8724. vroom (silimisim) 2 92.63 105.13 1 50.00
8725. Cecil (cecilw) 18 92.63 109.10 6 33.33
8726. Meredith (onemoremerry) 7 92.63 104.53 1 14.29
8727. Julian (julianalex2307) 51 92.63 129.17 21 41.18
8728. boas (boas) 3 92.63 96.96 2 66.67
8729. roodley (roodley) 5 92.62 103.36 2 40.00
8730. iTay (mengleten) 216 92.62 122.22 78 36.11
8731. Ekar (argetlam1) 17 92.62 101.56 4 23.53
8732. Adrianix (adrianixx) 190 92.61 120.48 68 35.79
8733. Elijah (amusingquill3) 3 92.61 100.50 1 33.33
8734. Daniel (dhaaq) 1 92.61 92.61 1 100.00
8735. Bot (348866896) 30 92.61 114.57 8 26.67
8736. Neel (neel19) 46 92.61 108.86 13 28.26
8737. Aimcist (iconic03) 4 92.61 101.43 3 75.00
8738. Paul (polley) 382 92.60 119.63 131 34.29
8739. bruh (sojucravings) 10 92.60 109.15 4 40.00
8740. Christopher (alexopoulosc) 152 92.60 114.78 55 36.18
8741. Pim (_pmirum) 46 92.60 108.15 18 39.13
8742. frog (fijixt) 16 92.60 117.46 12 75.00
8743. Duc (dukenhu) 50 92.60 108.83 16 32.00
8744. Fahrenheit (fahrenhite) 5 92.59 108.09 1 20.00
8745. Volta (vo1_ta) 24 92.59 110.97 15 62.50
8746. Ismail (ismailo) 201 92.59 122.04 85 42.29
8747. an0ma1y (an0ma1y) 23 92.59 107.97 9 39.13
8748. Dziobak (dziobak) 49 92.59 118.74 15 30.61
8749. Hmjo707 (hmjo) 28 92.59 122.09 13 46.43
8750. Joe mom (deroze) 37 92.58 106.58 9 24.32
8751. Ramseus (master_r) 542 92.58 113.93 180 33.21
8752. accurate (thenormalracer) 6 92.58 107.78 1 16.67
8753. _Eclipse (thesolareclipse) 1 92.58 92.58 1 100.00
8754. Balazs (pkobeast) 2 92.58 96.02 0 0.00
8755. Gabe (artemiaduch) 3 92.58 104.45 0 0.00
8756. Chrome (chroman00) 4 92.58 96.84 1 25.00
8757. Zexceed (shorif) 372 92.57 155.25 177 47.58
8758. Tom (pugsay) 9 92.57 101.92 2 22.22
8759. Edbert (berted) 6 92.56 100.45 0 0.00
8760. iks de (iksdebro) 37 92.56 117.83 13 35.14
8761. Koolis (koolisz) 94 92.55 110.01 38 40.43
8762. kitipat (kong0497) 1 92.55 92.55 1 100.00
8763. Freddie (freddiesanchez) 9 92.55 106.87 2 22.22
8764. Tenebrific (molkri) 51 92.55 107.25 17 33.33
8765. Guus (mr_leepel_) 14 92.55 102.57 7 50.00
8766. Tilly (tillyrose) 46 92.55 111.13 20 43.48
8767. Charlie (charlieeeee) 42 92.54 110.30 16 38.10
8768. I'm bad at typing (uzumakid... 109 92.53 120.77 39 35.78
8769. Jace (bigboyjones69) 1 92.53 92.53 1 100.00
8770. katy (koalatykaty) 1 92.53 92.53 0 0.00
8771. Jennifer (jinglebingo) 9 92.53 102.49 3 33.33
8772. Jacob (jkhindo64) 30 92.52 109.54 8 26.67
8773. youngboy (xthomasedwa) 4 92.52 99.05 2 50.00
8774. nizika (shouronpou) 70 92.52 118.80 22 31.43
8775. Rusterton (theeg3) 3 92.51 104.70 0 0.00
8776. Josiah (miitraa) 45 92.51 125.82 21 46.67
8777. jason (echefcy) 1 92.51 92.51 1 100.00
8778. Eri (bobtentencarracer) 97 92.51 115.87 34 35.05
8779. bob (kkgd) 36 92.51 105.43 16 44.44
8780. impostor (ilikepotatoesixty... 14 92.50 103.50 3 21.43
8781. rhyno3d (rhyno3d) 9 92.50 110.80 6 66.67
8782. Sam (samoc9549) 2 92.49 93.18 2 100.00
8783. Big Ole Deezer (bigoledeezer) 4 92.49 112.32 1 25.00
8784. Obatop (obatop) 83 92.49 122.31 26 31.33
8785. Kenyaaa~~~ (kenzaa) 164 92.49 123.11 52 31.71
8786. Teriyaki (teriyaki03) 9 92.49 104.13 0 0.00
8787. Joosep (aktos) 36 92.49 111.38 13 36.11
8788. Paka (_paka) 13 92.48 100.89 3 23.08
8789. Zedix (_zedix_) 1 92.48 92.48 0 0.00
8790. slow typer (imnotflamez) 226 92.48 143.48 74 32.74
8791. Andrew (sasamori) 33 92.48 110.11 12 36.36
8792. Astral (iamkoromon) 4 92.48 107.83 2 50.00
8793. Alina (alinag) 4 92.47 97.73 2 50.00
8794. John (jlavelle) 167 92.46 121.13 53 31.74
8795. OBsole (footcandilight) 5 92.46 95.33 1 20.00
8796. Toby (oisklet) 1 92.46 92.46 0 0.00
8797. Aestuosi (aestuosi) 185 92.46 113.22 56 30.27
8798. Erick (sockeymeow) 37 92.46 110.13 7 18.92
8799. Crafty (craftywastaken) 12 92.45 113.34 6 50.00
8800. OMG (omgawannabe) 9 92.45 103.01 6 66.67
8801. Xander (alex0824) 2 92.45 99.67 2 100.00
8802. Utkarsh (gbuckets30) 20 92.45 101.73 4 20.00
8803. Suren (strongsuren) 347 92.44 127.36 94 27.09
8804. Marlon (marlondestroyer) 15 92.44 101.71 4 26.67
8805. Someone (anamedplayer) 9 92.43 99.23 4 44.44
8806. Icy (icyexitium) 6 92.43 98.90 2 33.33
8807. 🎈k (konnomon) 1,000 92.43 115.84 357 35.70
8808. NCCFlame (dysfunctional_dra... 43 92.43 121.21 12 27.91
8809. Robert (gorilla710) 10 92.43 103.15 6 60.00
8810. tstats[jvixaychack] (jvixay... 5 92.43 102.17 1 20.00
8811. What (hunglatahb1) 171 92.43 113.13 51 29.82
8812. Hol (holster) 19 92.42 107.00 9 47.37
8813. William (bnuldun) 26 92.42 114.05 9 34.62
8814. Grigory (gregkhan) 21 92.42 110.96 12 57.14
8815. TheBossOfTheBoss (thebossof... 170 92.42 115.80 57 33.53
8816. Tom (mikeoxverylong) 103 92.42 112.47 46 44.66
8817. Calle (calle01) 2 92.42 98.50 2 100.00
8818. gc21 (giim_chyn) 47 92.42 115.53 17 36.17
8819. Kai حيادي (famboy32) 9 92.41 111.00 5 55.56
8820. Skyler (skylrrr) 4 92.41 95.52 2 50.00
8821. Linus (starhiro654) 26 92.41 115.72 9 34.62
8822. Emma (embunde7) 54 92.40 122.10 34 62.96
8823. Keyborn (keyborn) 2 92.40 93.24 0 0.00
8824. Ridge (ritzchu) 11 92.40 101.35 11 100.00
8825. f1_racer (f1_racer_car) 516 92.40 112.77 223 43.22
8826. gchenstephen (gchenstephen) 2 92.40 109.64 1 50.00
8827. cyamon (kuthiphenchodi) 12 92.39 109.87 5 41.67
8828. HalfaPencil (halfapencil) 4 92.39 95.52 2 50.00
8829. niko (nikuruuuuu) 13 92.39 100.87 6 46.15
8830. Muhammad (diehardboi) 1 92.39 92.39 0 0.00
8831. 初めは40wmp (hajime40) 610 92.39 118.60 212 34.75
8832. Dkippy (sirdunklenutsiii) 23 92.39 108.47 6 26.09
8833. Jon (jonrao) 3 92.38 108.22 2 66.67
8834. Noah (xsonorous) 10 92.38 103.55 2 20.00
8835. Blank (ct7567) 40 92.37 104.88 10 25.00
8836. gb (practicegb) 12 92.37 110.48 4 33.33
8837. Osh (elvor) 108 92.36 106.17 47 43.52
8838. Pepa (stefanborca) 1 92.36 92.36 0 0.00
8839. Feras (frsbg) 40 92.36 118.28 13 32.50
8840. jeremy_bearimy (jeremy_bear... 403 92.36 114.17 147 36.48
8841. Anuj (coder05) 73 92.36 112.89 32 43.84
8842. aaron (brwnmn6) 9 92.35 109.24 3 33.33
8843. JazzyP (pandawarrior101) 9 92.35 109.71 0 0.00
8844. Ryan (beefsoup) 6 92.35 103.92 3 50.00
8845. cathating89-dvorak (cathati... 23 92.34 116.60 7 30.43
8846. d0bu (d0bucookie) 7 92.34 111.39 3 42.86
8847. nimitz (nimitzpro) 333 92.34 119.17 127 38.14
8848. Akribes (akribes) 16 92.33 106.94 6 37.50
8849. Cora (cora_) 53 92.33 112.27 22 41.51
8850. Chikin (sailestial) 51 92.33 115.78 18 35.29
8851. Ryan (cuoituoi1996) 9 92.33 114.57 4 44.44
8852. (tulasaeueng) 12 92.33 101.58 2 16.67
8853. Andrew (dijkstra) 122 92.33 113.13 46 37.70
8854. n_bob (n_bob) 5 92.32 94.07 2 40.00
8855. Joy (joyjumper11) 53 92.32 115.39 23 43.40
8856. Kraust (kraust) 2 92.32 94.23 1 50.00
8857. Joe (ibelaxin) 1 92.32 92.32 0 0.00
8858. Nico (nico_e) 7 92.32 114.61 4 57.14
8859. bowlby (bowlby_) 5 92.32 103.07 3 60.00
8860. shubham (shubham1999) 38 92.32 115.66 15 39.47
8861. Luc (theshadowcuber) 19 92.31 111.84 4 21.05
8862. Martin (mr_pandabear) 10 92.31 100.75 5 50.00
8863. Colemak User (colemak_behbear) 8 92.31 111.37 3 37.50
8864. Valtsu (sgtvaltzu) 279 92.31 109.15 83 29.75
8865. Cliff (misfortunes) 2 92.31 92.47 0 0.00
8866. Isabella (sinnamonroll21) 14 92.31 106.18 6 42.86
8867. Anton (racketen) 6 92.31 108.44 2 33.33
8868. sid (parallelogrammed) 4 92.31 101.21 0 0.00
8869. Takumi (fractylz) 41 92.30 112.54 11 26.83
8870. veryfast (veryfastxd) 35 92.30 108.76 9 25.71
8871. Luke (nsaagent115) 33 92.30 112.83 12 36.36
8872. Mik (miks1) 8 92.30 111.71 3 37.50
8873. John (jspar) 9 92.30 104.97 2 22.22
8874. Imp (impm) 6 92.30 99.41 3 50.00
8875. Jon (jon_ackbar) 7 92.29 101.78 2 28.57
8876. Beth (creepmother) 215 92.29 114.01 71 33.02
8877. Ben (tabman) 11 92.29 104.67 9 81.82
8878. Jusuf (nerdtyper) 11 92.29 106.65 7 63.64
8879. Benton (lunarknight219) 1 92.29 92.29 1 100.00
8880. Daniel (shadebyte) 2 92.29 95.97 0 0.00
8881. Miki (pkong001) 2 92.29 97.38 2 100.00
8882. tehfu (brownmilk) 73 92.28 115.78 28 38.36
8883. Brian (ace213) 1 92.28 92.28 0 0.00
8884. medD (mistermask___) 198 92.28 132.69 74 37.37
8885. Miguel (jalb) 93 92.27 112.77 25 26.88
8886. Nush (nush98) 10 92.27 108.47 4 40.00
8887. Potato (mega_juicer) 41 92.27 115.41 9 21.95
8888. Kevin (mystified) 8 92.27 106.94 3 37.50
8889. Lars (sadtrash) 5 92.27 98.32 2 40.00
8890. Suyog (earthisflat) 7 92.27 104.73 0 0.00
8891. Bird (birdiesaurus) 2 92.27 93.81 2 100.00
8892. Roy (lordkite) 28 92.27 117.65 12 42.86
8893. Burrito (tgmburrito) 3 92.27 100.69 0 0.00
8894. Andre (mastergamernerd) 7 92.26 101.84 1 14.29
8895. Petar (ezscany) 2 92.26 94.88 2 100.00
8896. Gianfranco (discordes) 1 92.26 92.26 0 0.00
8897. Obama (underi7) 19 92.26 105.67 10 52.63
8898. Tristan (beckonez) 8 92.26 101.51 3 37.50
8899. Rony (ravneet_b) 222 92.25 120.73 81 36.49
8900. Snafu (snafudk) 9 92.25 104.17 3 33.33
8901. Michael Hunt (uhohpoopies) 1 92.25 92.25 0 0.00
8902. Nathan (hewittdallas) 6 92.25 103.73 1 16.67
8903. DoGe (doge_) 3 92.24 101.49 3 100.00
8904. Jason (duckyboi) 7 92.24 100.94 4 57.14
8905. Nivalis (nivalis11) 13 92.24 105.02 3 23.08
8906. Riley (qpixel) 9 92.24 101.64 3 33.33
8907. Andrew (grandpa2390) 1 92.24 92.24 1 100.00
8908. Stella (stellakitty7) 6 92.24 101.13 2 33.33
8909. Tomaz (tomaz1502) 75 92.23 108.57 25 33.33
8910. alex (ay1259) 154 92.23 123.32 64 41.56
8911. Nick (nickstar96) 2 92.23 94.12 1 50.00
8912. Dustin (dustywusty) 1 92.22 92.22 0 0.00
8913. jfiewogh (jfiewogh) 16 92.22 121.19 12 75.00
8914. Simon (simon_f1) 87 92.21 107.33 28 32.18
8915. Kevin (kjax) 6 92.21 108.08 4 66.67
8916. Glass (glassda) 4 92.21 108.91 2 50.00
8917. Shahan (shahanneda) 3 92.21 93.86 3 100.00
8918. JJ (jjbonta) 146 92.21 116.89 55 37.67
8919. jayden (fastest11yearoldtyp... 60 92.21 124.83 13 21.67
8920. Marcin (kawre) 40 92.21 117.08 14 35.00
8921. Saffron (saffronayy) 11 92.21 118.29 10 90.91
8922. twitch_NotDefense (bravedev... 122 92.21 114.26 31 25.41
8923. Star (playnslay69) 2 92.21 95.34 2 100.00
8924. . (__random__) 7 92.20 103.03 2 28.57
8925. Gavin (tictac67) 2 92.20 101.22 1 50.00
8926. Emanuel (google_me) 1 92.20 92.20 0 0.00
8927. Rodney (rodneyslafuente) 138 92.20 113.50 35 25.36
8928. johnballs (johnballs) 21 92.20 101.38 6 28.57
8929. Michael (fiftyfingers) 5 92.19 105.35 4 80.00
8930. Thomas (ashryx) 26 92.19 109.96 9 34.62
8931. OSUUUUUUUUUUUUUUUUUUUUU (ty... 1 92.19 92.19 0 0.00
8932. Travis (theboxiestbox) 5 92.19 103.16 1 20.00
8933. randint (lawlombie) 8 92.18 103.20 4 50.00
8934. Loz (rightytypey) 7 92.18 108.69 2 28.57
8935. Andrew (viper42usa) 28 92.18 101.89 6 21.43
8936. Pascal (darm4n) 31 92.18 106.22 8 25.81
8937. lumapools (lumapools) 44 92.18 107.46 16 36.36
8938. Do (doquannnn) 543 92.17 134.59 210 38.67
8939. mustang (mustang51) 4 92.17 103.24 2 50.00
8940. Shark (sharkbeargator) 11 92.17 104.85 3 27.27
8941. pigoopi (pigoopi) 3 92.17 104.92 0 0.00
8942. epicface (adowoable) 189 92.17 120.86 67 35.45
8943. Isak (izzeww) 14 92.16 108.62 5 35.71
8944. James (wnston) 150 92.16 134.71 54 36.00
8945. Gram (gramj_fw) 4 92.15 104.38 0 0.00
8946. SkyerZ (skyerz) 163 92.15 111.22 60 36.81
8947. Labib (l4bib) 7 92.15 106.53 0 0.00
8948. Average (vuzid) 10 92.14 119.27 10 100.00
8949. M (mchang416) 9 92.14 103.23 2 22.22
8950. Living (asianliving) 11 92.14 100.35 2 18.18
8951. Raiden Shogun (ntd_dll) 69 92.14 111.59 23 33.33
8952. Shelby (typo5) 312 92.13 121.69 95 30.45
8953. Adepttyper123 (adepttyper123) 88 92.13 118.09 37 42.05
8954. Abod (dhr_abod) 1 92.13 92.13 0 0.00
8955. Kuba (hackplack) 2 92.13 92.45 0 0.00
8956. Raffael (simonraffael) 1 92.12 92.12 0 0.00
8957. Emmet (contrambulance) 8 92.12 106.25 1 12.50
8958. Joshua (potatolemon123) 1 92.11 92.11 0 0.00
8959. Edison (notmercury) 1 92.11 92.11 0 0.00
8960. Jonathan (reverbcs) 2 92.11 92.68 0 0.00
8961. Justienz (justienz) 7 92.10 99.04 1 14.29
8962. Kebee (kevwickz) 12 92.10 100.49 7 58.33
8963. Davey (zenyatta_main) 3 92.10 98.43 2 66.67
8964. learn corne (tomgroenwoldt) 301 92.10 114.47 102 33.89
8965. EzBeau (ezbeau) 5 92.09 100.78 2 40.00
8966. Andrew (foruforu) 16 92.09 104.81 3 18.75
8967. vaintez (vaintez) 3 92.09 107.90 1 33.33
8968. Aidan (anguyenkn) 2 92.09 98.07 0 0.00
8969. aaron (naruto2141) 10 92.08 103.96 2 20.00
8970. Hasandi (sandipatriawan) 2 92.08 93.15 1 50.00
8971. Ace (ace_3506) 7 92.08 102.15 5 71.43
8972. Dyllan (dyllanbui) 92 92.08 118.40 38 41.30
8973. coc (han_duo) 8 92.08 111.52 3 37.50
8974. Mesotelioma (mesotelioma) 31 92.08 107.17 13 41.94
8975. Chad (godchad) 2 92.08 98.88 0 0.00
8976. GreatWhiteShark (black_b6969) 86 92.07 114.02 25 29.07
8977. Ethan (ninjabot5) 3 92.07 101.81 1 33.33
8978. atthespeedofcheeba (figilon) 2 92.07 102.92 1 50.00
8979. Nero (theneronex) 2 92.07 96.89 0 0.00
8980. Tommy (yungleeee) 1 92.06 92.06 0 0.00
8981. Alex (omggitsalphaa) 19 92.06 106.80 5 26.32
8982. Mike (fastneko) 156 92.05 132.37 55 35.26
8983. Mark (veltzer) 98 92.05 117.94 40 40.82
8984. hyp (hyprix) 640 92.05 136.22 193 30.16
8985. Steve (steveeeeeeeeeeee2) 3 92.05 100.02 0 0.00
8986. Love♥ (harshs99) 4 92.05 104.36 2 50.00
8987. lucktale (lucktale) 15 92.04 127.67 3 20.00
8988. denonderut (icybot) 15 92.04 106.11 7 46.67
8989. Allagance (allagance) 6 92.04 99.09 3 50.00
8990. maoam (maoamwins) 90 92.04 112.59 32 35.56
8991. StevieWonder (steviewonder69) 188 92.04 119.81 62 32.98
8992. G (squasy) 14 92.04 106.02 3 21.43
8993. askryuzaki (askryuzaki) 7 92.03 112.84 5 71.43
8994. Paweł (uuyy) 4 92.03 102.78 2 50.00
8995. Chen (megus) 1 92.03 92.03 0 0.00
8996. Jano (kossvk) 9 92.03 100.85 4 44.44
8997. Mark (kubfu891) 2 92.03 99.22 0 0.00
8998. Emil (pepepls) 5 92.02 96.05 2 40.00
8999. fistedpancake (fist3dpancake_) 3 92.02 96.53 2 66.67
9000. The (the_spookster) 2 92.02 103.12 2 100.00
9001. em (akosiem) 370 92.01 124.46 111 30.00
9002. Firebolt (firebolt__) 2 92.01 92.11 0 0.00
9003. Macklin (macklin123) 24 92.01 100.86 8 33.33
9004. Nenfal (nenfal) 3 92.01 94.71 0 0.00
9005. Sangi (sangi38) 43 92.00 103.88 13 30.23
9006. Rasmus (sbares) 60 92.00 109.14 22 36.67
9007. Ziobr (ziobr) 46 92.00 108.72 19 41.30
9008. Certex (certex) 2 92.00 94.08 2 100.00
9009. Lanz (lanz22) 7 92.00 111.05 1 14.29
9010. Ath (athuu) 14 92.00 109.48 5 35.71
9011. Jashua (stelless) 3 92.00 111.22 0 0.00
9012. Charles (cksabe) 2 92.00 108.50 0 0.00
9013. Swaraj (swarajpande4) 165 91.99 119.74 52 31.52
9014. Sajan (sajancpatel) 11 91.99 105.72 5 45.45
9015. Great (synergy__) 43 91.99 113.97 17 39.53
9016. Johnnie (jnednh) 1 91.99 91.99 0 0.00
9017. Jayden (gancube) 131 91.99 123.60 37 28.24
9018. senara (senara124) 8 91.99 100.10 3 37.50
9019. Conspiracy (realkingofgames) 206 91.98 112.54 65 31.55
9020. otto (ottocorrect) 122 91.98 114.45 39 31.97
9021. Curran (logbasepotato) 2 91.98 97.00 1 50.00
9022. Davide (deviltube98) 1 91.98 91.98 1 100.00
9023. Peter (speedyboi95) 9 91.97 115.19 5 55.56
9024. Griffin (grider1) 11 91.97 102.35 2 18.18
9025. Residential (agent_resident2) 21 91.97 102.54 8 38.10
9026. HiroM (hirom) 24 91.97 114.00 12 50.00
9027. Ella (amhaissup) 57 91.96 113.44 18 31.58
9028. tstats[darkhat13] (darkhat13) 15 91.96 114.60 6 40.00
9029. Ziggy (antioch) 2 91.96 102.00 1 50.00
9030. Zephy (zephy_yx) 2 91.96 102.82 1 50.00
9031. Will (w1llmcl) 135 91.95 138.79 49 36.30
9032. Miles (_kilometers_) 1 91.95 91.95 1 100.00
9033. Manu (manuwu) 1 91.95 91.95 1 100.00
9034. Samuel (samuelga) 106 91.95 115.58 44 41.51
9035. I'm fast (typeracerboisadge) 1 91.94 91.94 0 0.00
9036. Earl (1t_r3a11y_h4rtz) 3 91.94 100.23 3 100.00
9037. Eric (wernerosorio) 121 91.94 117.93 36 29.75
9038. Big (bigpoorboy) 4 91.93 100.98 3 75.00
9039. Hecks (hecksadecimal) 21 91.93 113.57 10 47.62
9040. Hamburgahh (hamburgahh) 9 91.93 108.91 2 22.22
9041. gcc42 (gcc42) 137 91.93 112.87 51 37.23
9042. Loay (loayahmed) 3 91.93 104.73 1 33.33
9043. Warren (berkshire) 1 91.93 91.93 0 0.00
9044. agyon (meikaina) 6 91.93 135.87 0 0.00
9045. Will (윌) (willwang) 11 91.93 104.42 4 36.36
9046. Pedro (pedro5370) 397 91.92 124.80 132 33.25
9047. Sebastian (proudpole) 58 91.92 115.47 19 32.76
9048. Daniel (altold) 88 91.92 107.52 29 32.95
9049. Lord Kuro (lordkuro) 120 91.92 117.59 39 32.50
9050. SamYouL (samyoul) 1 91.92 91.92 0 0.00
9051. Marcus (marcmadd15) 2 91.92 97.56 1 50.00
9052. gubbagooba (gubbagooba) 2 91.92 93.55 0 0.00
9053. Scaught (tiktoks) 11 91.91 104.11 4 36.36
9054. Jackson (united9jackson) 194 91.91 129.44 75 38.66
9055. Liban (liban711) 13 91.91 102.89 6 46.15
9056. Ali (lembugoreng) 57 91.91 111.30 15 26.32
9057. Jonah (workman04) 282 91.90 124.29 104 36.88
9058. Chi (chichung91) 4 91.90 97.25 2 50.00
9059. Lucca (9fingersonly) 1 91.90 91.90 1 100.00
9060. 🐢 (dzzz664) 3 91.89 93.04 1 33.33
9061. Abby (abbykiehlbauch) 2 91.89 98.88 2 100.00
9062. Jacob (jacobvaneyck) 5 91.89 107.19 1 20.00
9063. Tyler (pixel_ty) 6 91.89 101.63 1 16.67
9064. b (bonkadonks) 305 91.89 118.64 102 33.44
9065. Aimz (aimz123) 5 91.88 104.64 2 40.00
9066. Michael (ezykielue) 59 91.88 108.06 19 32.20
9067. Aamill (aamill) 118 91.88 117.59 34 28.81
9068. god (edgy14yearold) 1 91.88 91.88 0 0.00
9069. Loco (locomagoes) 3 91.88 96.83 2 66.67
9070. Irene (ireneprk) 2 91.88 92.46 2 100.00
9071. Alex Grace (attttyila) 17 91.88 101.88 7 41.18
9072. Neko (pippaola) 340 91.87 126.40 108 31.76
9073. Sky (lanprodn41) 83 91.87 110.35 28 33.73
9074. ninii (paniini) 32 91.87 110.12 17 53.13
9075. Demtros (demtros) 58 91.87 115.63 25 43.10
9076. Lise (elishevah) 15 91.86 104.53 9 60.00
9077. Nathaniel (wetaketolong) 20 91.86 106.82 5 25.00
9078. panuto2 (panuto2) 1 91.86 91.86 1 100.00
9079. Joshua (jh817) 3 91.86 101.87 0 0.00
9080. Dusan (dusanmilic95) 62 91.86 113.39 24 38.71
9081. Opmrph (opmrph) 102 91.86 124.98 48 47.06
9082. Ace (acechow) 32 91.85 113.51 10 31.25
9083. bowlmak (bowlingfan21317) 449 91.85 120.33 179 39.87
9084. Redox (riyaushino) 7 91.85 101.67 2 28.57
9085. JahJi (jahji) 76 91.85 115.21 27 35.53
9086. Saulius (zemfry) 793 91.84 115.31 256 32.28
9087. Allen (dirodoku) 105 91.84 112.34 38 36.19
9088. Michael (buckley12) 178 91.84 123.61 44 24.72
9089. Hoang (wertyboy) 11 91.84 103.24 6 54.55
9090. Alutic (alutic) 212 91.84 114.13 90 42.45
9091. Kinda (kindakind) 5 91.84 100.42 1 20.00
9092. IgrYphon (igryphon) 2 91.84 95.69 1 50.00
9093. Kevin (chqu7424) 9 91.83 104.08 6 66.67
9094. unpr0gr4mm3d (unpr0gr4mm3d) 8 91.83 101.90 1 12.50
9095. milkfoam (hiireath7654) 1 91.83 91.83 0 0.00
9096. Periwinkle (niknik2121) 2 91.83 104.99 0 0.00
9097. Jay Jo (jay20051209) 16 91.83 112.33 6 37.50
9098. Riley (nulll) 9 91.82 105.29 4 44.44
9099. Sphage (sphage) 48 91.82 117.10 18 37.50
9100. Peter (doc_chungles) 7 91.82 108.04 1 14.29
9101. owlxx (anonymous1229) 1 91.82 91.82 1 100.00
9102. Phil (sheffield712) 5 91.82 107.02 1 20.00
9103. Etan (probablylagging) 4 91.82 103.93 4 100.00
9104. DarkPrinceGandalf (darkprin... 10 91.81 103.95 5 50.00
9105. XaRuXu (xaruxu) 1 91.81 91.81 0 0.00
9106. صنديد (sundid) 50 91.81 114.46 14 28.00
9107. S (s2929) 2 91.81 98.05 2 100.00
9108. Alexander (need4speed402) 129 91.80 132.07 40 31.01
9109. Ryan (riceisgoodman) 121 91.80 115.72 40 33.06
9110. Mohammed (mohammedamarnah) 11 91.80 113.28 4 36.36
9111. Jeffrey (jeff7263) 321 91.80 119.44 89 27.73
9112. Delta (deltarl) 1 91.80 91.80 1 100.00
9113. GargoyleG (vitalstatistixg) 16 91.80 102.09 6 37.50
9114. Phoebe (phoebek99) 9 91.79 113.15 5 55.56
9115. Zen (zencreepz) 10 91.79 110.60 4 40.00
9116. Black (blacksiderino) 8 91.79 100.97 3 37.50
9117. Tom (tom020900) 9 91.79 99.17 3 33.33
9118. Khizer (khizlaw) 202 91.79 114.68 58 28.71
9119. bondservant (arenza) 293 91.78 121.57 108 36.86
9120. Jeff (jeformica) 58 91.78 115.38 20 34.48
9121. Terence (terence1234567) 14 91.78 104.61 6 42.86
9122. Robert (deeckie) 3 91.77 96.22 1 33.33
9123. Kana smurf (blackmind) 20 91.77 107.86 11 55.00
9124. nousmh (nousmh) 8 91.76 106.29 3 37.50
9125. Saba (junior6) 78 91.75 113.42 29 37.18
9126. Colin (grolxe_1) 11 91.75 107.52 3 27.27
9127. Kamiye (kamiye) 9 91.75 101.05 2 22.22
9128. vijay (pykethtitan) 26 91.74 111.58 10 38.46
9129. Michael (michael9009) 21 91.74 126.82 6 28.57
9130. Dat (jgatz) 80 91.74 107.81 29 36.25
9131. Kai (gigadelic) 294 91.74 120.65 99 33.67
9132. ThatCoolCoder (thatcoolcoder) 9 91.73 104.25 2 22.22
9133. Haiden (haidenb10) 11 91.73 103.94 4 36.36
9134. Jeremiah (jhmyint) 2 91.73 92.05 1 50.00
9135. glip (glip014) 8 91.73 102.52 3 37.50
9136. Creams4 (chadzuko) 42 91.72 120.01 10 23.81
9137. fastboi (boyfast) 64 91.72 110.08 35 54.69
9138. ayu (areyouayu) 11 91.72 107.20 4 36.36
9139. Brendan (btdevine) 1 91.72 91.72 0 0.00
9140. llarin (krypton1an) 6 91.72 102.90 3 50.00
9141. e-mili (speedy_007) 54 91.71 117.01 15 27.78
9142. Ethan (conanethan) 100 91.71 114.48 30 30.00
9143. SandoBanjo (sandobanjo) 2 91.71 97.75 1 50.00
9144. Sergio (sergio96c) 10 91.70 102.53 5 50.00
9145. Ezektor (ezecktor) 15 91.70 110.60 4 26.67
9146. Ben (mrjamminkearl) 119 91.69 120.85 41 34.45
9147. Said (saidenhide) 717 91.69 129.01 260 36.26
9148. Davis (dey1234) 6 91.69 106.04 1 16.67
9149. Rieko (rieko) 2 91.69 99.53 2 100.00
9150. kelly:)) (_kelly) 1 91.68 91.68 0 0.00
9151. Nicholas (nsabadicci) 54 91.68 117.88 17 31.48
9152. MA1T8 (kingking540) 11 91.68 99.43 4 36.36
9153. Austin (driedisland7766) 3 91.68 96.17 2 66.67
9154. Chicken (chicken807) 280 91.67 123.85 98 35.00
9155. Crowbot (crowbot) 1 91.67 91.67 0 0.00
9156. Mat (3nlist) 16 91.67 108.45 9 56.25
9157. Matt (britzkrieg) 9 91.66 105.60 3 33.33
9158. mcjohn_117 (mcjohn_117) 19 91.66 109.37 9 47.37
9159. T (tegicupala) 38 91.66 103.05 14 36.84
9160. Tyler (lydes) 7 91.65 103.18 2 28.57
9161. Ben (hutben) 7 91.65 107.36 4 57.14
9162. Stam (stammm) 6 91.65 100.32 2 33.33
9163. Christoffer (poetastrophe) 3 91.65 97.82 1 33.33
9164. Null (nullstring) 33 91.65 106.44 11 33.33
9165. Krissz (bish1k) 15 91.64 102.81 5 33.33
9166. steline (burntscones) 1 91.64 91.64 0 0.00
9167. Pacu (pacutv) 57 91.64 109.85 11 19.30
9168. na (syncix) 13 91.64 111.96 9 69.23
9169. Gabe (115162382) 15 91.64 105.36 7 46.67
9170. rraei (rraei) 2 91.64 93.23 1 50.00
9171. Visa (visatron) 11 91.63 119.18 4 36.36
9172. Frito (_frito) 3 91.63 100.92 0 0.00
9173. Cyxone (cyxone) 4 91.63 109.57 2 50.00
9174. projectfupagain (projectfup... 231 91.62 110.20 78 33.77
9175. Aron (aronbk) 132 91.62 112.41 44 33.33
9176. yan (shocker142) 34 91.62 105.78 12 35.29
9177. Existential Explorer (natmac4) 9 91.62 110.65 3 33.33
9178. 🫐🌺Ruby (reuben_yeager) 504 91.62 121.78 158 31.35
9179. Mr (mrmindgames) 30 91.61 109.83 25 83.33
9180. Micro (apm14) 117 91.61 116.19 28 23.93
9181. nah (phamhuyhuy2005) 11 91.61 108.92 2 18.18
9182. fr00t_l00ps (fr00t_l00ps) 18 91.61 99.37 8 44.44
9183. Toon (mojohamz) 2 91.61 100.25 1 50.00
9184. FGS (simo666) 193 91.60 121.46 63 32.64
9185. The (pseudotypist) 5 91.60 104.65 1 20.00
9186. Alan (affectedmelon) 13 91.60 106.27 4 30.77
9187. Ben (bennash13) 65 91.60 114.31 19 29.23
9188. Rendi (rendi_touchtype) 125 91.60 120.60 46 36.80
9189. Omar (infus3d) 1 91.59 91.59 0 0.00
9190. Huberio (huberio) 1 91.59 91.59 0 0.00
9191. william (iamzyva) 5 91.58 108.37 2 40.00
9192. Sparsh (sparsh123) 196 91.58 126.74 59 30.10
9193. Lucius (lightwastaken) 11 91.57 110.97 2 18.18
9194. Ditto (dittochang) 3 91.57 112.51 1 33.33
9195. Big (bigsmokeracer) 4 91.57 101.47 1 25.00
9196. gamesgant313 (gamesgant313) 9 91.57 112.00 9 100.00
9197. Johnofan (johnofan) 90 91.57 123.15 24 26.67
9198. Abhay (abhay_hadez) 577 91.57 124.55 227 39.34
9199. jared (sadtom) 2 91.57 99.78 0 0.00
9200. Ethan (hoid) 2 91.56 92.54 1 50.00
9201. TheZacher5645 (thezacher5645) 59 91.55 114.00 17 28.81
9202. thuyhan (tinathuyhan) 51 91.54 124.48 18 35.29
9203. Connor (robin_hearts) 6 91.53 96.28 3 50.00
9204. Colin (vondazel1) 5 91.53 104.79 2 40.00
9205. s. (capslooock) 8 91.53 106.68 4 50.00
9206. bill nye (pokepo6) 9 91.52 103.48 2 22.22
9207. Alex (tsaalex) 31 91.52 108.03 9 29.03
9208. Jens (bullercool) 18 91.52 108.83 8 44.44
9209. noonar (noonar) 4 91.52 97.97 3 75.00
9210. Gay (fujikage999) 64 91.52 109.18 31 48.44
9211. Alan (bigd_16_in) 3 91.52 108.53 1 33.33
9212. Chris (pwncyber) 4 91.51 102.21 3 75.00
9213. Việt Hùng (minkate) 1 91.51 91.51 0 0.00
9214. Marko (dbshard) 1 91.50 91.50 0 0.00
9215. Ronald (roanlds12345) 9 91.50 102.23 3 33.33
9216. Mercers (mercerslegend) 6 91.50 124.39 4 66.67
9217. mohi (mohiri) 2 91.48 97.41 1 50.00
9218. Aplukat (aplukat_69) 2 91.48 95.84 1 50.00
9219. IMcRoni (imcroni) 85 91.47 123.37 26 30.59
9220. levani (levanacixo) 14 91.47 105.73 7 50.00
9221. maliwan (maliwan) 1 91.47 91.47 1 100.00
9222. wiredShark (slamerpunch) 132 91.47 123.13 45 34.09
9223. Emin (eminspeedtyper) 7 91.47 108.61 3 42.86
9224. turgz (turgz) 62 91.46 112.05 20 32.26
9225. house (jrsp5) 93 91.46 107.59 28 30.11
9226. Typeracer Premium UI Chrome... 500 91.46 125.27 177 35.40
9227. Dylan (slumpgod) 1 91.45 91.45 0 0.00
9228. Nicholas (nicholaswong03) 657 91.45 148.10 236 35.92
9229. Mac (macthemountain) 14 91.45 115.08 8 57.14
9230. Albert (callmeal) 3 91.44 95.28 0 0.00
9231. Reflex1on (reflexion) 23 91.44 113.63 7 30.43
9232. dogstreet1 (dogstreet1) 2 91.44 93.45 1 50.00
9233. oldaccforpracticing (xsdream) 63 91.43 123.17 31 49.21
9234. Evan (eyatri) 11 91.43 101.15 4 36.36
9235. johan (pho777) 4 91.43 100.42 1 25.00
9236. awesome (hobo223) 12 91.43 101.80 5 41.67
9237. Zach (blurridge) 21 91.43 110.90 7 33.33
9238. Sewnkin (sewnkin23gg) 827 91.43 122.05 296 35.79
9239. Lasped (lasped) 31 91.43 109.67 7 22.58
9240. Cynthia (cynbin) 5 91.43 100.14 0 0.00
9241. Gerglee (333666666333) 3 91.43 96.59 1 33.33
9242. iCanBreathe (icanbreathe) 40 91.42 114.80 15 37.50
9243. Drake (likerofrisk) 1 91.42 91.42 1 100.00
9244. Exta (smintz) 180 91.42 130.58 77 42.78
9245. ItsKevin (kwilz) 17 91.42 103.59 10 58.82
9246. Duke (needdiscipline) 176 91.41 121.48 65 36.93
9247. James Ethan (laszerbeam) 9 91.41 105.22 6 66.67
9248. Meor (acnolog1a) 1 91.41 91.41 1 100.00
9249. Saad (saadeldeen) 13 91.41 102.52 3 23.08
9250. slr (con_d_oriano1) 5 91.40 118.44 1 20.00
9251. Lior (endlease) 10 91.40 103.24 5 50.00
9252. Tommy (treemantom) 3 91.40 100.54 0 0.00
9253. yzifioapj;;;🙈🙈 (pipur) 301 91.39 123.10 93 30.90
9254. retired... for now..? (clou... 42 91.39 104.90 16 38.10
9255. Xero (kataclysm) 9 91.38 102.59 3 33.33
9256. rae (thedarkoknight) 34 91.38 113.05 16 47.06
9257. Michael (kyrano) 3 91.38 100.69 1 33.33
9258. Lex (lex_g91) 5 91.38 112.73 2 40.00
9259. ThePiProgrammer (thepiprogr... 2 91.37 103.11 1 50.00
9260. G (cyutie__g) 8 91.37 107.47 8 100.00
9261. mr. (mr_maam) 10 91.37 107.29 4 40.00
9262. hunt (hmich) 26 91.37 105.25 15 57.69
9263. Kasim (kontromusic) 2 91.37 94.12 2 100.00
9264. Alex (aymlus) 15 91.36 105.05 6 40.00
9265. Marcus (mackan096) 4 91.36 105.61 3 75.00
9266. GqvTypeRacer (lazer_25) 2 91.36 92.16 0 0.00
9267. justin (sonzoffury) 3 91.35 97.79 1 33.33
9268. Lukeface (lukeface) 1 91.35 91.35 0 0.00
9269. fuzzed (fuzionite) 8 91.35 116.92 5 62.50
9270. Hussain (hussain_22) 3 91.34 103.50 0 0.00
9271. Nina (ninapez) 1 91.34 91.34 1 100.00
9272. Adrian (bigbadbui) 55 91.34 119.68 18 32.73
9273. Jun (junpoe) 5 91.33 102.50 1 20.00
9274. Dixie (zanarkind) 5 91.33 104.93 1 20.00
9275. Raffael (tschuebi) 3 91.33 101.50 3 100.00
9276. Tewtadle (tewtadledesktop) 767 91.33 123.96 263 34.29
9277. Chris (chrislh221) 29 91.33 103.66 13 44.83
9278. spiros (spiros_gal) 13 91.33 109.29 3 23.08
9279. Kebab (durum_kebab) 90 91.33 116.51 33 36.67
9280. v (vlxu) 183 91.33 115.25 66 36.07
9281. Holden (holdcop) 13 91.32 105.67 7 53.85
9282. Sumit (sumit_ghag) 353 91.32 130.18 122 34.56
9283. ray (afrojelly) 21 91.32 105.36 8 38.10
9284. Lingxun (hommieinuw) 13 91.32 101.85 5 38.46
9285. Azerniiiic (azernic) 21 91.31 109.40 6 28.57
9286. Bean (benchen123) 15 91.31 101.10 7 46.67
9287. TasteOfCancer (tasteofcancer) 8 91.31 107.65 2 25.00
9288. Poop (danukas155) 11 91.30 115.60 4 36.36
9289. romeo (rxmeo) 4 91.30 104.43 1 25.00
9290. Kevin (kevinhuo8941) 5 91.30 104.90 1 20.00
9291. Totus (thepenguin183) 28 91.30 117.94 11 39.29
9292. rachet 22 (rachet_22) 21 91.30 109.61 7 33.33
9293. Max (wafflless) 5 91.30 93.78 1 20.00
9294. crai (crai27) 139 91.29 110.11 43 30.94
9295. Sloth (senseisloth) 4 91.29 114.00 1 25.00
9296. Guy (doge_btw) 7 91.28 103.09 3 42.86
9297. Hunter (lokitypingusa) 9 91.28 103.40 3 33.33
9298. Eloona (wombatinmaison) 43 91.27 112.37 14 32.56
9299. Zayden (zayden_blaze) 50 91.27 121.91 18 36.00
9300. The (harit111200) 2 91.27 98.34 1 50.00
9301. Rick (rickga) 1 91.27 91.27 0 0.00
9302. Manal (skullcicator) 20 91.26 117.20 5 25.00
9303. Kevin (kevinator314) 10 91.26 95.74 5 50.00
9304. Shaleen (shaleenx) 7 91.26 97.49 1 14.29
9305. Hashim (sharkh) 3 91.26 93.04 1 33.33
9306. Dongo (dongodm) 16 91.25 129.99 5 31.25
9307. brad (soccerboyy) 19 91.25 120.56 8 42.11
9308. Androide (vforvali) 3 91.25 96.87 2 66.67
9309. Brandon (bachasdas) 5 91.25 109.23 2 40.00
9310. Evan (androidlegend) 4 91.25 105.63 2 50.00
9311. ImTrash (imreallytrash) 18 91.24 105.19 5 27.78
9312. Stella (ping470) 1 91.24 91.24 0 0.00
9313. Ryan (ryanhz) 48 91.23 113.77 18 37.50
9314. rxo (biglego) 2 91.23 104.49 0 0.00
9315. Patrick (patclark) 30 91.23 101.92 11 36.67
9316. Atticus crunch (fablesnfobb... 22 91.23 114.54 9 40.91
9317. Rika (16yoshino16) 3 91.23 98.41 0 0.00
9318. Tim (jimbo112) 10 91.23 111.91 4 40.00
9319. Hans (retrovibes_11) 21 91.23 105.41 11 52.38
9320. Takio (takioarima) 2 91.23 99.94 0 0.00
9321. Dalton (schnoook) 2 91.23 92.63 0 0.00
9322. Jimmy (motivatorman) 7 91.22 98.14 3 42.86
9323. Isaac (shepisaac) 1 91.22 91.22 1 100.00
9324. S (juicebox_27) 44 91.22 115.55 17 38.64
9325. jay (gayjayy) 1 91.22 91.22 0 0.00
9326. mellismacka (mellismacka) 55 91.21 108.15 21 38.18
9327. ¯\_(ツ)_/¯ (some_guy4444) 50 91.21 110.26 16 32.00
9328. Parsa (5barsa5seconds) 61 91.21 110.73 21 34.43
9329. Mohanad (mohanadahmd) 3 91.21 100.18 2 66.67
9330. iarezen (iarezen) 2 91.21 93.06 0 0.00
9331. Bryce (bryceweedz) 18 91.21 102.25 9 50.00
9332. Eddie (agzastrgath) 14 91.20 101.75 5 35.71
9333. Siegward (ghin) 15 91.20 112.18 13 86.67
9334. Dutch (shawnseb) 104 91.20 112.61 34 32.69
9335. Richard (blitzd2020) 11 91.19 100.04 3 27.27
9336. badplayer (idk213) 160 91.19 145.82 72 45.00
9337. Joseph (naughtyboy1337) 7 91.19 101.29 1 14.29
9338. Lagom (thelagom) 622 91.19 149.10 208 33.44
9339. viv (toastexee) 60 91.19 116.60 13 21.67
9340. Serenitea (serenitea) 9 91.19 102.50 3 33.33
9341. AAA (duraszess) 8 91.18 99.15 5 62.50
9342. Jonte (zitrex) 16 91.17 108.37 3 18.75
9343. Featfox (featfox) 3 91.17 97.33 0 0.00
9344. Andrea (andreavanderjagt) 772 91.17 128.19 250 32.38
9345. Joel (jsandyt9) 23 91.17 111.29 5 21.74
9346. Ved (ved619) 6 91.17 95.63 2 33.33
9347. Tom (limera2nn) 1 91.16 91.16 0 0.00
9348. qtq🐇🍊🍰 (qtqtq) 23 91.16 103.48 5 21.74
9349. Robert (nforcer) 340 91.16 117.96 116 34.12
9350. Dries (driesvanspauwen) 9 91.16 101.75 4 44.44
9351. Om3G4 (om3g4) 6 91.16 113.41 3 50.00
9352. kwonman99 (kwonman99) 26 91.15 112.54 8 30.77
9353. TRAraazze (traraazze) 5 91.14 104.33 1 20.00
9354. Yoongo (yoongo) 30 91.14 104.93 10 33.33
9355. Caleb (syfulis) 22 91.14 105.63 5 22.73
9356. Ben Asam (bemarc) 16 91.14 107.64 6 37.50
9357. tstats[indianpanda250] (ind... 4 91.14 94.55 1 25.00
9358. jam_xd_ (jam_xd_) 20 91.14 104.90 3 15.00
9359. Sam (jeff_the_pickle) 5 91.13 95.92 2 40.00
9360. Sarao Jeepney (kingoftheroad) 1 91.13 91.13 0 0.00
9361. Dylan (chrunchy) 137 91.13 117.66 44 32.12
9362. Dawid (dresik) 5 91.13 99.32 3 60.00
9363. michael (mikeyjohn) 4 91.13 103.25 1 25.00
9364. duckmoon99 (duckmoon99) 3 91.13 105.00 0 0.00
9365. Andi (dolphingarlic) 4 91.12 93.50 2 50.00
9366. Daniel (boichoi137) 1 91.12 91.12 0 0.00
9367. Verilly (verilly) 3 91.12 95.84 3 100.00
9368. apexstrada (apexstrada) 8 91.12 118.51 4 50.00
9369. Collin (temposchool) 16 91.12 113.20 6 37.50
9370. Kevin (spezzytv) 45 91.11 115.90 14 31.11
9371. William (william_wonka) 1 91.11 91.11 0 0.00
9372. James (jlightning) 15 91.11 100.22 5 33.33
9373. Johnny (johnnyquest30) 39 91.10 104.81 37 94.87
9374. æ (c_c_c) 27 91.10 126.62 10 37.04
9375. Matthew (matthewb83) 17 91.10 106.01 9 52.94
9376. Chris (rialac) 13 91.10 111.96 4 30.77
9377. Yakti (yaktithewise) 12 91.10 104.10 8 66.67
9378. Eryk (fatmamma) 34 91.09 102.49 8 23.53
9379. Drew (drewsworth) 3 91.09 103.34 1 33.33
9380. Reno (swifturtle) 3 91.09 92.75 2 66.67
9381. Shantnu (shantnu) 6 91.09 99.18 1 16.67
9382. Evan (ev_j) 3 91.08 96.61 0 0.00
9383. cyan (cyanaspect) 8 91.08 97.99 2 25.00
9384. Riptide (riptidetheta) 7 91.07 107.47 3 42.86
9385. Cody (cuday) 9 91.07 104.44 4 44.44
9386. 150 how? (minidraco) 5 91.07 103.51 2 40.00
9387. Shubham (srp3003) 108 91.07 115.55 35 32.41
9388. Aiden (ajargo2) 3 91.06 94.72 0 0.00
9389. Walker (walkersutton) 7 91.06 116.01 3 42.86
9390. Blaise (veresb14) 13 91.06 112.12 6 46.15
9391. MuffinMike (muffinmike) 50 91.06 108.87 13 26.00
9392. Ted (lucky_strike) 86 91.05 111.58 22 25.58
9393. Justin (jchen1923) 6 91.05 98.03 6 100.00
9394. qwerty_han (booboo_) 3 91.05 104.42 1 33.33
9395. Triloluc (triloluc) 22 91.05 105.85 11 50.00
9396. Red (redhood07) 24 91.05 104.71 8 33.33
9397. George (gbotev) 22 91.04 101.19 8 36.36
9398. Hubert (hubertle85639) 5 91.04 105.53 5 100.00
9399. Ante (ld77) 18 91.04 104.80 9 50.00
9400. simon (simonhor1) 50 91.04 118.59 16 32.00
9401. Alex (truxior) 73 91.04 108.33 23 31.51
9402. Andrew (xj04129) 449 91.04 112.85 155 34.52
9403. rani (lowersky) 2 91.03 92.78 1 50.00
9404. Bang (dbgt0008) 13 91.03 106.12 8 61.54
9405. hrsh (h3rs8) 70 91.03 117.22 20 28.57
9406. Thatisdifficult (thatisdiff... 2 91.03 95.26 1 50.00
9407. Vicodin (vicodin_freeman) 27 91.02 116.81 8 29.63
9408. Aarni (aarnib) 211 91.01 119.36 81 38.39
9409. king (kingkuzo) 85 91.01 111.53 30 35.29
9410. Aaron (unhuggity) 3 91.01 97.19 1 33.33
9411. Niheee (niheee) 8 91.01 108.38 8 100.00
9412. Joaquin (wakincloset) 240 91.00 110.57 92 38.33
9413. Mark (markieisfast) 2 91.00 102.98 0 0.00
9414. dsa8 (dsa8) 11 91.00 98.21 2 18.18
9415. Anica (oica) 3 91.00 97.32 2 66.67
9416. Gamer (gamer650xd) 20 91.00 110.73 9 45.00
9417. Harry (bonogo123) 107 90.99 114.05 28 26.17
9418. Nicholas (nicshoe13) 10 90.99 104.88 1 10.00
9419. Holo (aisha23__) 146 90.99 110.42 55 37.67
9420. SnakeTwix (snaketwix) 65 90.99 126.35 25 38.46
9421. Yagiz (yagizbahadiroglu) 3 90.99 96.37 3 100.00
9422. Salad (saladspoon) 14 90.99 102.84 6 42.86
9423. Turbo (turbo_typist) 48 90.98 142.68 15 31.25
9424. Nefko (nefko) 19 90.98 108.20 5 26.32
9425. Blue (blueberkeley) 44 90.98 124.32 13 29.55
9426. . (the_ohioan) 12 90.98 100.23 2 16.67
9427. Brian (brianbanri) 29 90.98 107.98 11 37.93
9428. Andrew (entranco) 26 90.97 108.58 9 34.62
9429. Caketin (caketin_cat) 5 90.97 103.74 2 40.00
9430. Andrea (kazari) 56 90.97 105.14 26 46.43
9431. Luis (lmorales) 131 90.97 113.07 49 37.40
9432. Andrew (andrewawsome122) 2 90.97 95.88 2 100.00
9433. Oleg (oleg27) 62 90.96 109.84 22 35.48
9434. MasterMind (master__mind) 36 90.96 104.25 17 47.22
9435. seqqie (pitufita) 3 90.96 115.71 1 33.33
9436. HuntedSlayer (huntedslayer) 4 90.96 97.99 2 50.00
9437. star (starstrider10) 1 90.96 90.96 0 0.00
9438. Gunner (gunner8) 145 90.96 115.49 59 40.69
9439. IFTClerk (iftclerk) 4 90.96 102.46 1 25.00
9440. iluvv (iluvv) 7 90.95 94.30 0 0.00
9441. Nathan (alteriffic) 76 90.95 113.46 29 38.16
9442. PAFxd (pafxd) 6 90.95 108.33 3 50.00
9443. Will (majorchaos) 4 90.94 101.40 1 25.00
9444. Fionalee (fionalee) 52 90.94 107.70 16 30.77
9445. telmac (telmacblack) 6 90.94 97.83 2 33.33
9446. Desmond (desmondspeedy) 8 90.94 107.19 6 75.00
9447. Terrence (tjwz) 5 90.93 103.11 0 0.00
9448. Salchica (machete24x) 34 90.93 117.34 9 26.47
9449. Mustafa (musthelegend) 29 90.93 106.47 7 24.14
9450. TANEdos (tanedos) 25 90.93 107.96 7 28.00
9451. Andy (djentalman) 386 90.92 124.90 129 33.42
9452. Jan (yentzeg) 18 90.92 107.46 8 44.44
9453. Alex (nobrakes58) 20 90.92 107.22 7 35.00
9454. Leo (ricecustomer) 1 90.92 90.92 0 0.00
9455. Ashley (bunnymama23) 3 90.92 97.86 1 33.33
9456. Joe (lanolin211) 66 90.92 120.45 28 42.42
9457. BWho? (bwho) 9 90.91 97.48 3 33.33
9458. Afanasiy (tenseimaa) 9 90.91 100.79 1 11.11
9459. Kyle (kstrozin) 2 90.91 104.07 1 50.00
9460. Surendra (frensuren) 1 90.91 90.91 0 0.00
9461. Moye (moyoka) 114 90.91 119.21 32 28.07
9462. sirloc (sunsinghny19) 7 90.91 96.34 5 71.43
9463. AtM5 (araconda) 7 90.91 101.71 2 28.57
9464. Franzvic (elbruh) 30 90.91 117.93 9 30.00
9465. lime (limelatte) 2 90.91 91.61 1 50.00
9466. Ahnaf Shahriar (asifthegreat) 49 90.90 110.00 21 42.86
9467. mrooogaboooga (foulackfoula... 29 90.90 114.56 4 13.79
9468. kion (kionkun1) 6 90.90 94.71 2 33.33
9469. Alstr (alstr) 34 90.90 118.69 15 44.12
9470. GoldenPotato (goldenpotato) 3 90.89 105.38 0 0.00
9471. Gamer (xmph) 1 90.89 90.89 1 100.00
9472. Mariyan (mimo200be) 18 90.87 97.98 8 44.44
9473. john (johnstamosfullhouse) 5 90.87 113.21 1 20.00
9474. Thai (thaiph244) 18 90.87 108.55 7 38.89
9475. Michael (tichaelman) 4 90.87 99.72 1 25.00
9476. Shivam (idi_cyka) 1 90.87 90.87 1 100.00
9477. David (davida693) 1 90.87 90.87 1 100.00
9478. Musa Bedirhan (musajoker) 1 90.87 90.87 0 0.00
9479. Andre (andreandreandre) 144 90.87 113.54 50 34.72
9480. Jimmy (jimmyr1027) 37 90.87 126.65 25 67.57
9481. Kypster (kypster) 17 90.86 111.69 5 29.41
9482. Jean (orangedrum) 547 90.86 119.89 178 32.54
9483. Bourdon 16' (thekeyofg) 39 90.86 103.39 14 35.90
9484. Jojuh (shojubruh) 37 90.86 112.81 19 51.35
9485. Luna (aicaya) 6 90.86 96.11 1 16.67
9486. tempo (hypergonzx) 5 90.86 98.26 2 40.00
9487. Bede (breadstickx) 19 90.85 99.44 4 21.05
9488. |)are2|_eap (cepetir) 30 90.85 109.02 7 23.33
9489. f4ww4z (f4ww4z) 3 90.85 95.23 1 33.33
9490. Jonathan (jonapedia) 217 90.85 121.23 62 28.57
9491. shrenik (shrenikr235) 42 90.85 128.02 16 38.10
9492. Johnny (jnguyen732) 16 90.84 101.61 7 43.75
9493. Vinay (spedman) 1 90.84 90.84 1 100.00
9494. Adrian (adriangat) 260 90.84 113.69 99 38.08
9495. Volxage (volxage) 59 90.84 110.32 17 28.81
9496. Ziad Zaki (ziadzaki) 49 90.83 133.52 23 46.94
9497. Isabella (bfbubblegum) 17 90.83 103.65 4 23.53
9498. bunkered (bunkeredgame) 11 90.83 109.38 6 54.55
9499. Jay (noj0ke) 78 90.83 122.71 22 28.21
9500. Anthony (anthonyk) 5 90.82 99.38 0 0.00
9501. ☞sondv (sondv) 43 90.82 111.04 16 37.21
9502. Jalen (dabesttypr) 86 90.82 111.40 25 29.07
9503. Shashank (kingshashank12) 3,036 90.82 147.10 1,061 34.95
9504. Rajish (rajish) 92 90.82 108.17 30 32.61
9505. K (thekman) 4 90.82 104.20 0 0.00
9506. ASIAN47 (asian47) 771 90.82 131.77 284 36.84
9507. Ryan (jellyzerg) 49 90.81 105.96 21 42.86
9508. Race (im_not_cheating_ur_wi... 34 90.80 107.34 13 38.24
9509. slow account (tabbed) 2 90.80 93.12 0 0.00
9510. Steven (sw66666) 3 90.80 94.32 1 33.33
9511. Rock (rockfrock) 1 90.80 90.80 1 100.00
9512. Wise (wiseuser) 1,952 90.79 133.60 532 27.25
9513. Khanh (aygentp) 159 90.79 119.87 51 32.08
9514. PropheticNPC (potencity) 32 90.79 110.76 8 25.00
9515. Robin (zeyphros) 5 90.79 99.67 2 40.00
9516. Leo (asdbooh) 273 90.79 116.85 87 31.87
9517. maufry (maufry) 39 90.79 112.64 11 28.21
9518. Ruth (flirtatiouswizard) 9 90.79 100.16 2 22.22
9519. bob (thot_slayer420) 23 90.78 107.58 3 13.04
9520. SadRoad (sadroad) 19 90.78 123.10 6 31.58
9521. sAjAn (sajansingh) 2 90.78 93.27 2 100.00
9522. plum (ploom) 1 90.78 90.78 0 0.00
9523. Henry (flamekata24) 75 90.78 109.08 33 44.00
9524. BP (a227673) 2 90.78 95.48 1 50.00
9525. Arie (buenobonsai) 19 90.77 105.44 5 26.32
9526. Abhi (abhishekmalle) 3 90.77 97.58 1 33.33
9527. Ivan (pop5a) 31 90.77 113.99 10 32.26
9528. Bryce (molohov) 16 90.77 116.36 5 31.25
9529. Rens (nismo_gtr) 4 90.77 94.40 0 0.00
9530. Milan (milanmalik) 6 90.77 96.10 1 16.67
9531. AnniK (anni_k) 31 90.77 111.53 13 41.94
9532. Nhat Anh (texward) 8 90.77 98.97 5 62.50
9533. Mawon (wonlee) 52 90.76 109.45 19 36.54
9534. Azamat (kayoshi) 3 90.76 93.75 3 100.00
9535. Egg (organicegg) 121 90.75 115.48 43 35.54
9536. Mohammed (enchantful) 9 90.75 99.95 2 22.22
9537. AKGD (akgd) 1,170 90.75 115.09 425 36.32
9538. Nacho (awooo) 107 90.75 109.37 44 41.12
9539. Yosapol (eji4h) 65 90.74 102.86 16 24.62
9540. woland (omario42) 5 90.74 112.68 2 40.00
9541. Victor (hueylouisnonews) 32 90.74 103.70 12 37.50
9542. Jenna (beannie22) 1 90.74 90.74 0 0.00
9543. skaoakeboarder (skaoakeboar... 2 90.74 93.64 1 50.00
9544. Snowy (it_was_lag) 126 90.74 127.61 40 31.75
9545. Josh (auto111032) 21 90.74 107.71 10 47.62
9546. ogkatumus (ogkatumus) 114 90.73 121.82 46 40.35
9547. Panther (panthernerd) 1 90.73 90.73 0 0.00
9548. Gemlingur (grommsi) 1 90.73 90.73 1 100.00
9549. Raveon (frozenpriest) 1 90.73 90.73 1 100.00
9550. Pizza (thepizzaman2013) 6 90.73 102.00 2 33.33
9551. Askefise (fast_as_sanic) 34 90.72 114.99 18 52.94
9552. Joe (zeppyg) 94 90.72 111.10 31 32.98
9553. humming (tajjyboyrutus) 2 90.72 95.35 0 0.00
9554. You don't (austin101123) 2 90.72 93.70 0 0.00
9555. Augustine (augustinec) 2 90.72 95.98 1 50.00
9556. Jaffri (jeffli2000) 16 90.71 103.54 9 56.25
9557. Typer4e (unbreakse) 81 90.71 106.26 21 25.93
9558. STONES (yiminggg) 9 90.71 103.38 3 33.33
9559. Daniel (incognitus) 252 90.71 105.98 103 40.87
9560. Mark (haxos) 34 90.70 104.82 13 38.24
9561. Away From Keyboard (AFK) (d... 536 90.70 111.32 209 38.99
9562. pablo (druglord) 1 90.70 90.70 0 0.00
9563. Palaladin (palaladin) 4 90.70 102.44 3 75.00
9564. tstats[roselaflesh] (rosela... 17 90.70 108.84 6 35.29
9565. ionut (ionut_red) 277 90.70 124.66 106 38.27
9566. Skylar (iamskyhawk) 19 90.70 101.64 11 57.89
9567. Kev (joebob1235) 10 90.70 106.24 5 50.00
9568. Sexy (kimochichinchin) 1 90.69 90.69 1 100.00
9569. hxroze (hirose1) 1 90.69 90.69 1 100.00
9570. Gustaf (gusco933) 1,214 90.69 132.95 382 31.47
9571. Nicolas (skinny13timmy) 12 90.68 98.98 2 16.67
9572. Olav (shikkou) 4 90.68 115.64 3 75.00
9573. Jay (jayser6) 84 90.68 116.99 30 35.71
9574. kosmanaut (kosmanaut) 34 90.68 107.06 10 29.41
9575. Inderpreet (indergnps) 1 90.68 90.68 1 100.00
9576. thomas (thoarell) 18 90.68 107.78 1 5.56
9577. Christian (loggityloglog) 94 90.68 116.23 29 30.85
9578. Simon (wizard_sheep) 350 90.68 127.80 116 33.14
9579. Carl Emil (carlokj) 2 90.68 105.44 2 100.00
9580. Robin (sulami) 5 90.67 98.89 3 60.00
9581. Abraham (emptypilot) 18 90.67 102.38 3 16.67
9582. WhatTheHotDog (tdsar102094) 425 90.67 122.65 145 34.12
9583. Mr.chops (mr_chops) 76 90.67 104.21 26 34.21
9584. Jongwon (aviationchief) 52 90.67 121.04 45 86.54
9585. Crystal (crystalwen) 3 90.67 95.47 3 100.00
9586. Joshua Peirce (lodgevirus) 13 90.67 110.87 8 61.54
9587. shota.b (shotiko8) 140 90.66 119.96 51 36.43
9588. Shawn (anotheronebitesthedust) 1 90.66 90.66 1 100.00
9589. arena (arenacloser204) 745 90.66 136.63 219 29.40
9590. lemmeclapdemcheeks (austen_... 31 90.65 116.11 12 38.71
9591. blendin (blendin11) 52 90.65 109.48 12 23.08
9592. Pere (unbreaksee) 48 90.65 104.53 15 31.25
9593. Thomas (pentaa) 6 90.65 96.74 3 50.00
9594. Iboo (mriboo) 8 90.64 104.50 2 25.00
9595. Nacio (olivier066) 2 90.64 99.95 1 50.00
9596. KPeep (kpeep) 4 90.64 105.78 1 25.00
9597. ha (drchill) 11 90.64 103.58 1 9.09
9598. Mainey dawg (mainey) 4 90.64 102.98 1 25.00
9599. Kay (hothandj) 22 90.64 110.42 4 18.18
9600. High (highbeach) 1 90.63 90.63 1 100.00
9601. Elmouradi (elmouradiamine) 4 90.63 93.24 0 0.00
9602. Sam (sam313) 5 90.62 96.10 1 20.00
9603. Denis Çerri (deniscerri) 26 90.62 109.04 10 38.46
9604. Clifton (charcoalfiltered) 1 90.62 90.62 0 0.00
9605. meme (mememem) 21 90.62 103.78 9 42.86
9606. Kareem (kareemserry) 4 90.61 100.80 2 50.00
9607. Zach (thecursedones) 5 90.61 93.57 1 20.00
9608. Kori (oxymoronictruth) 2 90.61 92.97 2 100.00
9609. Matt (chuckleschopstick) 3 90.60 117.00 1 33.33
9610. Marc (thespy7) 1 90.60 90.60 0 0.00
9611. Sedao (sedaolicious) 2 90.60 92.37 1 50.00
9612. Daniel (nicedanmonkey) 5 90.60 97.55 1 20.00
9613. Michae; (michaeldamianus) 5 90.60 113.45 1 20.00
9614. Steven (vosstingy) 3 90.59 93.44 1 33.33
9615. John (caduke) 22 90.58 115.83 9 40.91
9616. Harris (emagemag) 1 90.58 90.58 0 0.00
9617. Gaby (grebliale) 9 90.58 106.62 3 33.33
9618. King (king_amongthepigs) 2 90.58 92.82 1 50.00
9619. thpenther (sspenkerr) 6 90.58 99.50 2 33.33
9620. Desmond (desmond012) 6 90.58 97.97 3 50.00
9621. pqpqlaowosjkd (pqpqlaowosjkd) 6 90.57 96.24 3 50.00
9622. Bob (mrgeeses) 68 90.57 114.59 25 36.76
9623. Edward (buitrungbao) 5 90.57 96.75 5 100.00
9624. Chris (nasageek) 1 90.57 90.57 0 0.00
9625. an4rchy1925 (an4rchy1925) 380 90.57 130.90 137 36.05
9626. Logan (postlogan) 14 90.57 109.04 6 42.86
9627. Chayse (chaysegr) 8 90.56 100.62 3 37.50
9628. anguelo (anguelo) 1 90.56 90.56 0 0.00
9629. Chef Giuliano (gd27) 89 90.56 113.32 19 21.35
9630. SirAlhelm (iliur) 18 90.56 114.23 13 72.22
9631. swagfish (4thunion) 12 90.56 104.94 5 41.67
9632. Goldenpigg (goldenpigg123) 72 90.55 120.13 25 34.72
9633. :D (scottmorrisonmp) 112 90.55 112.47 30 26.79
9634. Zach (qwerty1221) 83 90.55 110.30 21 25.30
9635. Ben (pro_benny) 8 90.55 106.89 1 12.50
9636. Danny (ftm3) 2 90.55 93.56 2 100.00
9637. Christian (umadandrei) 3 90.54 93.23 1 33.33
9638. Fabian (fabii1309) 77 90.54 108.23 27 35.06
9639. tstats[yju98039] (yju98039) 1,258 90.54 141.59 452 35.93
9640. Poly (typingpoly) 147 90.53 118.52 46 31.29
9641. uchka (uchka0826) 1 90.53 90.53 1 100.00
9642. Roland (errur) 11 90.53 110.90 4 36.36
9643. Taejas (taejas) 280 90.53 107.68 101 36.07
9644. pudge (pudge_phatt) 9 90.53 100.48 4 44.44
9645. Paint (paintmeblue62) 4 90.52 96.94 1 25.00
9646. Nathan (nathan_cant_type) 102 90.52 108.51 30 29.41
9647. Arthur (asmv) 2 90.52 101.83 2 100.00
9648. warm (warmlettuce) 1 90.52 90.52 0 0.00
9649. Chris (chillstice) 2 90.52 95.87 0 0.00
9650. Taru (tarukwon) 296 90.51 114.16 102 34.46
9651. Gotcha (g0tcha) 23 90.51 116.77 7 30.43
9652. Kinasho (kinasho) 6 90.51 95.18 0 0.00
9653. Someone (someonetyping) 9 90.51 101.64 1 11.11
9654. Wes (wyvr) 2 90.51 103.65 1 50.00
9655. Matt (mattrmel) 7 90.50 117.89 3 42.86
9656. TheDecentPretender (wamsly) 10 90.50 99.97 2 20.00
9657. Salamander (20_minutes_per_... 81 90.50 108.41 47 58.02
9658. Alex (alkan137) 37 90.49 121.30 16 43.24
9659. n (jtrondy) 12 90.49 103.76 6 50.00
9660. Josh (joshywashyy) 1 90.49 90.49 0 0.00
9661. onlycleansnipes (onlycleans... 4 90.49 106.88 3 75.00
9662. Bruno (brbeans) 36 90.49 114.29 12 33.33
9663. Homie (kingtrammy) 71 90.48 119.57 25 35.21
9664. Michael (dodus) 82 90.48 106.40 17 20.73
9665. dak (dakn) 17 90.48 104.13 6 35.29
9666. Moe (tux101) 1 90.48 90.48 0 0.00
9667. mo (mobeats) 1 90.48 90.48 0 0.00
9668. Kevin (hadoukevin) 12 90.48 101.56 4 33.33
9669. Vlad (vladdycrz) 39 90.48 112.48 11 28.21
9670. MeguminQT (leonathor) 42 90.48 101.83 20 47.62
9671. Bún Bò (snowk49) 45 90.48 111.07 13 28.89
9672. Jason (jason314) 2 90.48 93.83 1 50.00
9673. Jason (saltybaskets) 37 90.47 106.31 10 27.03
9674. markzeras (mrkmat) 1 90.46 90.46 0 0.00
9675. GodPeanut (jingtian) 1 90.46 90.46 1 100.00
9676. Jasper (7essek) 17 90.46 98.08 4 23.53
9677. Alex (mysterybox) 39 90.46 115.68 20 51.28
9678. stoozy (stoozy) 7 90.46 96.92 2 28.57
9679. LolzLiamz (lolzliamz) 2 90.46 92.49 2 100.00
9680. Rachel (rachelbug) 2 90.46 91.55 1 50.00
9681. Jacob (gadekaja) 44 90.45 118.42 13 29.55
9682. TheFoodMan52 (thefoodman52) 11 90.44 111.04 7 63.64
9683. jawnnyp (jawnnyp) 1 90.44 90.44 0 0.00
9684. Zhenyu (adv000) 1 90.44 90.44 1 100.00
9685. Pink Guy (bleachuggr) 5 90.44 104.39 2 40.00
9686. Sylvaen (suggestedrp) 33 90.44 107.64 11 33.33
9687. Tom (mlgplayer) 23 90.44 109.65 7 30.43
9688. Tim (euclid221) 18 90.43 100.35 9 50.00
9689. tobin (amilliwpm) 3 90.43 97.36 2 66.67
9690. Sherlock (agatecard) 5 90.43 99.97 2 40.00
9691. David (cmagic_f) 46 90.43 107.61 12 26.09
9692. Saeasd (axol578) 6 90.43 101.09 2 33.33
9693. Sashaw (sashaww) 30 90.43 111.33 9 30.00
9694. Proximitynow (proximitynow) 6 90.43 115.54 3 50.00
9695. Ari (cuda_) 23 90.43 105.57 10 43.48
9696. Kaz (kaz_the_kuz) 10 90.42 103.73 1 10.00
9697. typinggawd (brandon934) 43 90.42 115.00 19 44.19
9698. Gōrudoai (auriculus1) 5 90.42 101.69 4 80.00
9699. Abby (leener999) 2 90.42 90.87 0 0.00
9700. Jordan (donkeywhistle) 18 90.42 101.17 7 38.89
9701. mukrohin (mukrohin) 32 90.41 109.08 9 28.13
9702. popsickles (popsickles) 18 90.41 102.77 12 66.67
9703. kajuna (kajuna) 81 90.41 123.14 30 37.04
9704. الأصابع (abdoh) 1 90.41 90.41 1 100.00
9705. Commander823 (commander823) 2 90.41 108.39 1 50.00
9706. Jia Quan (weejiaquan) 1 90.41 90.41 0 0.00
9707. UNSALEK #7379 discord (unsa... 215 90.41 123.61 55 25.58
9708. Tzemis (greekjames) 34 90.41 118.03 14 41.18
9709. Lamp (cjquillen) 2 90.41 94.59 1 50.00
9710. Hailey (bobthetem) 5 90.40 109.38 2 40.00
9711. Kevin (kevng2) 2 90.40 90.50 1 50.00
9712. Fox (that_fox) 13 90.40 104.25 2 15.38
9713. iCry (icry) 111 90.40 120.90 33 29.73
9714. Okan (baykalokandemir) 2 90.40 95.69 1 50.00
9715. 一向 (quan72io) 15 90.39 99.81 7 46.67
9716. Paulian (paulian7) 12 90.39 117.59 2 16.67
9717. Fred (spicesouls) 1 90.39 90.39 1 100.00
9718. Puppet (puppetsfingers) 16 90.39 114.61 6 37.50
9719. FlameFrost (flamefrost) 61 90.39 112.56 26 42.62
9720. Derek (vonarxd) 30 90.39 98.97 6 20.00
9721. brotherelric (brotherelric) 1 90.38 90.38 1 100.00
9722. daniel (nitezu) 157 90.38 118.56 53 33.76
9723. Jo (noone21) 197 90.38 134.96 84 42.64
9724. Ricky (riyu22) 10 90.37 108.13 3 30.00
9725. summeR (canadianruler) 3 90.37 100.78 1 33.33
9726. Ben (emeraldshield) 4 90.37 95.19 1 25.00
9727. A (ohyoturtles) 3 90.37 97.26 1 33.33
9728. Sara (saramarie722) 4 90.37 99.10 2 50.00
9729. Kyle (kyle_racer) 2 90.37 97.25 1 50.00
9730. Lagmybsf (sk0ttt) 33 90.36 109.44 13 39.39
9731. Max (maxshaw2411) 14 90.36 102.70 12 85.71
9732. typer_trainer (typer_trainer) 35 90.36 110.13 12 34.29
9733. Cassidy (cassidyfaith) 29 90.36 129.61 12 41.38
9734. nyouhas (nyouhas_) 38 90.35 112.45 20 52.63
9735. Dennis (waar_is_de_magnetron) 4 90.35 95.17 0 0.00
9736. Baxtiyor (iotype) 81 90.35 104.71 32 39.51
9737. Fite (squidderp) 23 90.35 107.36 7 30.43
9738. Damon (damonc89) 338 90.35 115.63 93 27.51
9739. Amr (amrhachicho) 7 90.34 101.38 4 57.14
9740. Karlsen (karlsenlopez18) 22 90.34 108.98 6 27.27
9741. Gunn (xg88) 11 90.34 129.16 7 63.64
9742. InVerse (zenmonkinverse) 12 90.34 101.06 5 41.67
9743. Bea (chilichanga) 117 90.34 119.24 37 31.62
9744. Josh (cantmakemoney) 10 90.34 99.56 2 20.00
9745. K (ohkat__) 2 90.34 94.16 0 0.00
9746. La (lafrans) 5 90.33 97.28 2 40.00
9747. Darkcryed (darkcryed) 19 90.33 106.41 5 26.32
9748. Sarah (swags20) 181 90.33 117.36 66 36.46
9749. Jet (jetchung) 4 90.33 112.66 2 50.00
9750. Ike (zike_ang) 2 90.33 96.20 0 0.00
9751. Anson (the_chill_templar) 19 90.32 109.31 10 52.63
9752. Joe (jqal) 20 90.32 105.39 6 30.00
9753. Stanislav (stanmkh) 233 90.32 124.68 64 27.47
9754. edz (edz81) 4 90.32 104.93 2 50.00
9755. Ben (mossdeep) 2 90.32 97.49 1 50.00
9756. Kirin (kirinichibannn) 4 90.32 91.56 3 75.00
9757. Pranman (pranman123) 7 90.32 94.69 6 85.71
9758. Matthew (zannon23) 52 90.32 108.55 14 26.92
9759. Jordy (testingkeyboard) 3 90.32 96.88 1 33.33
9760. WabberDabber (thingexplainer) 4 90.32 94.22 0 0.00
9761. Lara (bisharch) 2 90.32 96.91 1 50.00
9762. Liquid (liquidlemon) 4 90.32 98.00 1 25.00
9763. mcga (mcga) 271 90.31 114.29 101 37.27
9764. James (jbrain3000) 1 90.31 90.31 0 0.00
9765. Code (codename47) 6 90.31 96.55 3 50.00
9766. Adhitya (borakx007) 8 90.31 95.59 4 50.00
9767. Ree (wild_reemoo) 3 90.30 99.40 1 33.33
9768. seelan (seelan) 2 90.30 91.36 0 0.00
9769. FortnutGamur69 (c0ck_n_ba11s) 1 90.30 90.30 1 100.00
9770. Caven (caven) 3 90.30 94.87 3 100.00
9771. poopoo (rogue_pp) 4 90.30 105.81 2 50.00
9772. diva (vampirediva) 218 90.29 123.27 55 25.23
9773. aasdfa (awid) 49 90.29 104.59 16 32.65
9774. Brad (sulfernic) 2 90.29 90.96 0 0.00
9775. Reese (leeseree) 7 90.28 107.29 7 100.00
9776. Cameron (moliopp) 1 90.28 90.28 1 100.00
9777. i cant type (stan1) 6 90.28 105.17 3 50.00
9778. daniel (danielphantom) 159 90.28 118.92 57 35.85
9779. Thomas (tmsopogi) 8 90.28 102.85 3 37.50
9780. Dan (dcardoso12) 2 90.27 94.99 1 50.00
9781. MRSICKOMODE (jodiddy) 1 90.27 90.27 0 0.00
9782. Olav (thederpygod) 334 90.27 123.20 90 26.95
9783. Eddie (nightwing_eddie) 57 90.27 108.80 21 36.84
9784. Snowbear (ehj1258) 8 90.27 103.86 3 37.50
9785. frederik (birgerbrosa) 9 90.27 105.17 3 33.33
9786. Charts (charizardpotato) 59 90.26 106.06 27 45.76
9787. Jason (jasonpike) 15 90.26 98.80 1 6.67
9788. Timofey (timofey_s) 34 90.26 104.19 9 26.47
9789. Dave (nut4) 24 90.25 113.34 5 20.83
9790. Laurits (mclawrence) 2 90.25 94.98 0 0.00
9791. Luca (lucaro2708) 1 90.25 90.25 1 100.00
9792. Ziclue (ziclue) 21 90.25 109.52 8 38.10
9793. tonymmm1 (tonymmm1) 1 90.24 90.24 0 0.00
9794. se (secw) 13 90.24 107.21 5 38.46
9795. lemonade (agolemonade) 19 90.24 115.86 6 31.58
9796. Ernst (hopeofmercy) 69 90.24 117.23 27 39.13
9797. Tom (synikalle) 5 90.24 95.65 2 40.00
9798. Sahil (skulltroxx) 5 90.24 96.30 3 60.00
9799. (altroq) 49 90.23 111.20 17 34.69
9800. tian (gfriend) 10 90.23 99.62 5 50.00
9801. xDuskii (xduskii) 6 90.23 106.31 3 50.00
9802. Uroš (grujidis) 1 90.23 90.23 0 0.00
9803. Aodhan (brsijraz) 3 90.23 101.35 3 100.00
9804. Tarik (cevapmaster) 5 90.22 112.81 5 100.00
9805. molly (mollidae) 4 90.22 101.17 0 0.00
9806. Matt (iproz) 7 90.22 98.41 2 28.57
9807. Casey (novacainr) 150 90.22 112.12 61 40.67
9808. Mukeem (bilawat) 380 90.22 119.14 155 40.79
9809. The (the_typing_train) 91 90.21 113.02 34 37.36
9810. Adrian (adrianmonaghan) 25 90.21 110.85 6 24.00
9811. Ⓐⓝⓣⓞⓝ (racingisaw... 336 90.21 131.35 159 47.32
9812. RZ5D (rz5d) 28 90.21 113.32 16 57.14
9813. Phan (hed_wig) 13 90.20 101.46 5 38.46
9814. Zach (encasedthought) 65 90.20 113.76 23 35.38
9815. Gareth (garethlyh) 40 90.19 109.84 13 32.50
9816. Radwin (nosmirk) 115 90.19 122.23 51 44.35
9817. Kyle (kyleoh) 23 90.19 106.11 9 39.13
9818. justin (lookitsjustin) 35 90.19 110.67 15 42.86
9819. Provocative (provocativepig... 56 90.19 112.10 20 35.71
9820. HuisbaasJR (ofbasecfin) 143 90.19 116.40 50 34.97
9821. Greg (titogreg) 4 90.19 102.80 0 0.00
9822. Dakize (dakice) 12 90.18 102.49 5 41.67
9823. Dylan (yokamaa) 2 90.18 90.62 0 0.00
9824. Ufo23 (ufo23gg) 139 90.17 112.14 55 39.57
9825. Khen (khen2003) 7 90.17 96.41 1 14.29
9826. Floixman (floixman) 23 90.17 110.65 11 47.83
9827. Yuki (yuuuukii) 5 90.17 99.89 1 20.00
9828. Eric (queeric) 5 90.16 101.27 5 100.00
9829. nonaem (apansi) 123 90.16 119.95 39 31.71
9830. Galil (galil35) 16 90.16 111.41 7 43.75
9831. Sean (masian08) 32 90.16 105.90 5 15.63
9832. robbie (robbiemcfly) 380 90.16 120.28 132 34.74
9833. . (i_need_skillz) 1 90.16 90.16 0 0.00
9834. Someone (_some_one_) 295 90.16 120.02 95 32.20
9835. PhazedAU (phazedau) 4 90.16 91.44 3 75.00
9836. KimsterH (kimsterh) 16 90.16 110.11 3 18.75
9837. Ornstein (eliggett) 708 90.16 115.10 241 34.04
9838. Previous (previouslol) 19 90.15 112.20 5 26.32
9839. Ivandro (bigivel) 206 90.15 107.99 75 36.41
9840. Shypolarbear (shypolarbear) 552 90.15 131.15 178 32.25
9841. Chad (zeddyx) 7 90.15 99.18 4 57.14
9842. Tenzin (cleggmcmuffin) 130 90.15 120.53 45 34.62
9843. Matthew (yourtrashkld) 57 90.15 106.15 20 35.09
9844. Take (diesieben07) 2 90.15 91.49 1 50.00
9845. RandomDraco (randomdraco) 2 90.15 93.80 1 50.00
9846. Darren (darrensey) 204 90.14 122.16 73 35.78
9847. Fedor (fshabashev) 67 90.14 103.07 17 25.37
9848. Dennis (gardpm) 7 90.14 106.67 5 71.43
9849. Kruxey (kruxey) 1 90.14 90.14 0 0.00
9850. Leon (kahelleon) 2 90.14 100.84 1 50.00
9851. jSteez (jsteez) 6 90.14 100.10 3 50.00
9852. grace (koald) 16 90.13 103.63 4 25.00
9853. zzRouxfop_ (cryptic_blade) 4 90.13 103.14 0 0.00
9854. M4nk3y (raraownage) 1 90.13 90.13 0 0.00
9855. Daniel (dsonger20) 35 90.13 112.44 13 37.14
9856. Chris (chris89233) 1 90.12 90.12 1 100.00
9857. Sean (qpalzm123) 85 90.12 112.82 24 28.24
9858. Ivan (ivantakashi) 745 90.11 138.20 243 32.62
9859. Oscar (karos_uchiha) 16 90.11 105.00 4 25.00
9860. Duncan (thedunco) 28 90.11 104.30 9 32.14
9861. Santiago (santac) 3 90.10 97.93 2 66.67
9862. Cheesy (rikk_merp) 4 90.10 90.95 2 50.00
9863. singhvaibhav100@gmail.com (... 6 90.10 94.03 1 16.67
9864. randall (valleyy) 13 90.09 103.65 5 38.46
9865. Tony (feetiswhynocaps) 52 90.09 112.37 19 36.54
9866. Ninja (ninjaacat) 35 90.09 108.48 12 34.29
9867. James (mastakeyboard) 1 90.09 90.09 0 0.00
9868. Sonny (j3dmosly) 8 90.09 94.74 1 12.50
9869. Andy (teaestaye) 11 90.09 108.13 3 27.27
9870. pigeon (pigeon_kun) 12 90.08 108.60 2 16.67
9871. Huy (huyho1207) 50 90.08 118.18 27 54.00
9872. Stivang96 (janse122) 24 90.08 114.39 13 54.17
9873. Gábor (gazuru) 1 90.08 90.08 1 100.00
9874. Lokizypresse_902 (lokizypre... 7 90.07 118.07 4 57.14
9875. Leeisateam (leeisateam) 4 90.07 100.68 1 25.00
9876. Brandon (koalabearf) 5 90.07 100.28 2 40.00
9877. Ferbo (g_ferbo) 3 90.06 102.40 1 33.33
9878. George (georgesung25) 3 90.06 94.09 1 33.33
9879. Dave (dachalco) 14 90.06 99.40 2 14.29
9880. Zicheng (bin_laggin) 17 90.06 111.93 8 47.06
9881. (nenontank_) 29 90.05 135.08 10 34.48
9882. Koji (kojinb) 9 90.05 99.46 3 33.33
9883. cope (xucolite) 9 90.05 105.69 3 33.33
9884. Qazz (qazztheqazz) 18 90.05 104.07 8 44.44
9885. G (zger) 116 90.05 119.68 40 34.48
9886. KamilJan (kamil_jan) 18 90.05 100.97 7 38.89
9887. Kyle (donttouchmyrice) 9 90.05 110.61 6 66.67
9888. Rafi (rafi_levy) 1 90.04 90.04 1 100.00
9889. FunkyChunkyMon (funkychunky... 200 90.04 121.03 61 30.50
9890. Raynei (raynei) 10 90.04 107.34 4 40.00
9891. Glerou (tudesci) 1,058 90.04 124.52 339 32.04
9892. Daniel (semashe) 16 90.03 114.73 8 50.00
9893. Jeremy (turkeyfetish) 10 90.03 103.33 5 50.00
9894. honey (ivan_avr) 8 90.03 103.01 4 50.00
9895. Albert (albert239825) 4 90.03 97.85 2 50.00
9896. Avery (jythonscript) 17 90.03 99.44 5 29.41
9897. cty28137 (cty28137) 3 90.03 99.06 2 66.67
9898. chipmunk (tonyboi) 3 90.03 93.48 2 66.67
9899. Hyrum (anom4001) 263 90.03 115.87 91 34.60
9900. Ethan (summerpizza5508) 13 90.03 107.47 7 53.85
9901. Patrick (hongkongfui) 10 90.03 107.85 2 20.00
9902. rawr (cuddls) 2 90.03 100.27 1 50.00
9903. Nikhil (nikhil142) 18 90.02 106.58 6 33.33
9904. Kurtis (pandabear4774) 6 90.02 102.40 3 50.00
9905. Mazen (mazenayman) 4 90.02 94.51 2 50.00
9906. seal (sealtypes) 2 90.02 94.48 2 100.00
9907. lesseH (yung_lesseh1337) 2 90.01 92.87 0 0.00
9908. زياد (aatrox0_0) 7 90.01 105.44 3 42.86
9909. Gagan (gagan18) 768 90.01 132.29 269 35.03
9910. Jubax (jubax) 144 90.01 110.57 49 34.03
9911. Jawn (jawnblue) 3 90.01 93.49 3 100.00
9912. Drew (thecomedyne04) 20 90.00 115.35 7 35.00
9913. Ewan (dungcatcher) 1 90.00 90.00 0 0.00
9914. Awkward (awkward_fruitcake) 38 90.00 100.82 9 23.68
9915. Sunny (kukie5) 10 90.00 97.39 4 40.00
9916. Alan (dick_licker666) 9 90.00 116.87 2 22.22
9917. Nela (nelaach) 4 89.99 95.72 3 75.00
9918. Drawsten (drawsten) 2 89.99 99.20 1 50.00
9919. Aryan (aryanp) 1 89.99 89.99 1 100.00
9920. fastkid (notfastkid) 87 89.99 118.38 28 32.18
9921. KickBull (kickbull) 10 89.99 106.69 3 30.00
9922. Ben (01ben10) 23 89.98 108.67 6 26.09
9923. Ellie (ellieoo) 66 89.98 110.30 16 24.24
9924. David (cavestoryking64) 1 89.98 89.98 0 0.00
9925. Kelly (kellyhunter03) 1 89.98 89.98 1 100.00
9926. baha (bahakz) 24 89.98 101.85 9 37.50
9927. Oneness (dreamtime) 76 89.97 103.59 22 28.95
9928. treespirit (treespirit) 86 89.97 111.03 25 29.07
9929. Mytho (mythoskar) 4 89.97 94.58 3 75.00
9930. Hjalte (hjaltebuch) 8 89.97 107.50 4 50.00
9931. Cal (almostpoetic) 6 89.97 97.52 1 16.67
9932. Chris (silentshot64) 12 89.97 99.38 6 50.00
9933. H (curlwurl) 26 89.97 105.32 6 23.08
9934. Cant (cant_code) 5 89.97 108.55 1 20.00
9935. B (bnowba) 5 89.97 106.38 2 40.00
9936. derftastic (derftastic) 6 89.96 102.51 2 33.33
9937. Aren (tl8xv) 127 89.96 121.55 39 30.71
9938. Amar (supatypaxxx) 758 89.96 123.90 273 36.02
9939. Steve (srd93) 118 89.96 106.99 42 35.59
9940. fishmatt (fishmatt) 3 89.95 107.41 3 100.00
9941. syswinh (syswinh) 23 89.95 103.65 9 39.13
9942. Dan (danmusa562) 2 89.95 93.57 2 100.00
9943. Garrick (yanawanas) 47 89.94 130.48 12 25.53
9944. SiD (samueldim) 30 89.94 102.12 13 43.33
9945. Boshi (boshiwastaken) 7 89.93 102.69 7 100.00
9946. Arespi (arespi) 32 89.93 101.79 8 25.00
9947. Ami (lambchop01) 1 89.93 89.93 1 100.00
9948. Jezebelle (jezebe11e) 3 89.93 95.93 1 33.33
9949. Blaster (xx_assblaster_xx) 2 89.93 99.77 1 50.00
9950. Jason (ultimatehumungousaur) 9 89.93 96.32 5 55.56
9951. Hamster (shmex_hamster) 13 89.93 99.81 8 61.54
9952. itchyaminoacid (335080673) 13 89.93 98.40 3 23.08
9953. idk (shaham1) 2 89.93 92.35 2 100.00
9954. Daniel (danielsabox) 90 89.92 111.64 32 35.56
9955. Trixie (fantoro) 1 89.92 89.92 1 100.00
9956. Joe (joetelefair) 598 89.91 116.42 227 37.96
9957. Samvel (samveland) 210 89.91 125.32 62 29.52
9958. Brian (outremonde) 1 89.91 89.91 1 100.00
9959. oli (johnvenz16) 28 89.91 101.87 12 42.86
9960. Aditya (anonymoose17) 40 89.91 110.91 9 22.50
9961. Eustion (eustion) 17 89.91 103.00 7 41.18
9962. 1337 (samseks) 19 89.91 104.82 9 47.37
9963. tstats[brandonisstupid] (br... 1,048 89.91 126.27 355 33.87
9964. icecreamfilling (icecreamfi... 46 89.90 105.12 14 30.43
9965. nelmalu (nelimalu) 3 89.89 94.23 3 100.00
9966. the (thebaneet) 15 89.89 108.47 5 33.33
9967. Marcus (_flipz) 61 89.89 101.95 13 21.31
9968. Greg (gecko231) 9 89.89 108.17 3 33.33
9969. cod1r (cod1r) 118 89.89 120.20 41 34.75
9970. Florian (jordanbelfort) 115 89.89 108.87 35 30.43
9971. Tyler (tylermsmith199) 8 89.89 103.12 2 25.00
9972. Roy (royroyking) 31 89.89 113.16 10 32.26
9973. ig: __Alexxzh (alextyperop) 4 89.89 109.80 1 25.00
9974. B (bsauter29) 333 89.88 118.34 109 32.73
9975. oldweeb (uchiha_obito) 61 89.88 106.16 33 54.10
9976. Snayne (snayne) 2 89.88 92.29 1 50.00
9977. Shînta (chengos) 1 89.88 89.88 1 100.00
9978. Emerson (kasai_moyasu) 5 89.88 96.38 2 40.00
9979. ash (mikadole) 34 89.87 109.88 15 44.12
9980. David (klassmagicer17) 76 89.87 111.23 24 31.58
9981. Beksultan (bexultan) 39 89.87 107.06 16 41.03
9982. Gabriel (tacbacjack) 1,469 89.86 134.41 516 35.13
9983. Chase (otumo) 6 89.86 103.20 3 50.00
9984. Boltedツ (mchackerz) 16 89.86 102.58 6 37.50
9985. Tim (tymolc) 2 89.86 95.44 1 50.00
9986. Rafael (23woodyj) 42 89.86 108.01 13 30.95
9987. jm (sirpricebeach) 62 89.86 108.54 25 40.32
9988. Note (note_r) 10 89.86 113.95 5 50.00
9989. asdasd (chaizhengwen) 49 89.86 107.73 16 32.65
9990. Cody (catchytyper) 5 89.85 101.74 0 0.00
9991. Carlz (carlz19) 19 89.85 105.36 5 26.32
9992. SmokR (smokeydbear) 8 89.84 105.39 1 12.50
9993. Renato (ato2000) 31 89.83 106.89 10 32.26
9994. 𝒚𝒂 𝑨𝒍𝒍𝒂... 5 89.83 96.39 0 0.00
9995. Grace (baddestbich69) 23 89.83 101.59 6 26.09
9996. Audrey (pytho556) 2 89.83 92.61 2 100.00
9997. marmonjen (pawnracer) 1 89.83 89.83 0 0.00
9998. abetheunicorn (abetheunicorn) 1 89.83 89.83 1 100.00
9999. Jaden (ironic_) 3 89.83 103.57 1 33.33
10000. daniel (daniel8028) 7 89.83 104.06 4 57.14
10001. Pika (paxn) 12 89.83 104.69 4 33.33
10002. Luke (angelsfan) 16 89.83 105.57 15 93.75
10003. Pelli (pellikan) 17 89.82 104.26 4 23.53
10004. Caroline (murungu) 6 89.82 102.50 1 16.67
10005. CrpL (crippleed) 48 89.81 108.62 19 39.58
10006. Fardin (manzif) 14 89.81 102.34 8 57.14
10007. Marcus (marqueshark) 11 89.81 137.77 10 90.91
10008. S (therealslim69) 2 89.81 105.46 1 50.00
10009. Troy (dogepowers) 13 89.80 102.53 2 15.38
10010. Arturo (gharlock) 5 89.79 105.29 2 40.00
10011. JY (jy82828) 1 89.79 89.79 1 100.00
10012. Skullition (skullition) 1 89.79 89.79 0 0.00
10013. EncodedTyper (encodedtyper) 20 89.79 106.48 6 30.00
10014. Nepotism (xjqm_z) 17 89.79 107.80 3 17.65
10015. Viktor (knifenoob) 112 89.78 115.46 44 39.29
10016. Uku (lazzeri) 2 89.78 93.24 0 0.00
10017. Ezra (ezratyping) 10 89.78 103.39 5 50.00
10018. bruhhhelpla (bruhhhelpla) 6 89.77 104.95 2 33.33
10019. RelaxCozy (xxodus999) 8 89.77 95.95 3 37.50
10020. Yuzu (rice_senpai) 15 89.77 102.46 4 26.67
10021. Tuukka (sblankg) 228 89.77 110.74 83 36.40
10022. Josh (piggygaming1004) 3 89.77 98.02 1 33.33
10023. Hajar (hajar424) 38 89.76 113.89 10 26.32
10024. Eshen (eshenx) 2 89.76 92.79 1 50.00
10025. shinutsi (shinutsi) 40 89.76 104.62 17 42.50
10026. Petruccio (lolbraumm) 460 89.76 120.39 178 38.70
10027. Trevon (goodwithfingers) 6 89.76 95.05 3 50.00
10028. SilicGK (silicgk) 48 89.76 121.79 12 25.00
10029. shaolin_scrub (laydbak) 4 89.76 95.02 3 75.00
10030. Geukers (geukers) 3 89.75 100.88 1 33.33
10031. Pooh (5i1ver1ining) 1 89.75 89.75 0 0.00
10032. j2nkins (j2nkins) 3 89.75 96.14 1 33.33
10033. Dominik (monteymontey) 42 89.74 112.01 14 33.33
10034. albert (albertos13) 133 89.74 114.61 43 32.33
10035. Ben (hulkunleashed) 4 89.74 101.43 2 50.00
10036. Riggles (riggles) 10 89.74 103.38 1 10.00
10037. Nspace (nspace) 3 89.73 93.58 2 66.67
10038. Raizen (raizou) 5 89.73 104.19 2 40.00
10039. Chloe (c_stvr) 61 89.73 111.60 26 42.62
10040. Justin (maticulous) 7 89.72 106.16 4 57.14
10041. Jenerikk (jenerikk) 7 89.72 104.51 1 14.29
10042. Melvin (mellikyun) 8 89.72 100.67 1 12.50
10043. Hieu (larhral) 158 89.72 112.48 58 36.71
10044. brainuser5705 (brainuser5705) 15 89.72 101.72 4 26.67
10045. Cory (cory421) 4 89.72 99.63 3 75.00
10046. Cayke (mrcayke) 8 89.71 99.22 1 12.50
10047. Moe (mbillah4797) 2 89.71 90.30 0 0.00
10048. 四百二十 (chapuix) 6 89.71 102.91 4 66.67
10049. Arjun (k9cruncher) 168 89.70 112.42 55 32.74
10050. Apostolos (afmnt) 3 89.70 97.04 3 100.00
10051. Ricky (rickyb663) 8 89.70 100.14 5 62.50
10052. Yeeric (yeeric) 6 89.70 98.74 0 0.00
10053. Winson (wwang038) 30 89.70 107.27 15 50.00
10054. little uzi (valstroyer) 2 89.70 94.04 1 50.00
10055. No (noman75) 63 89.69 115.98 30 47.62
10056. Zint (_zint_) 24 89.69 121.84 7 29.17
10057. John (jctad) 11 89.69 101.69 5 45.45
10058. Wyatt (wyattaker) 4 89.69 115.43 3 75.00
10059. Colin (cwreath43) 8 89.69 102.53 3 37.50
10060. Magical (magical_yt) 4 89.69 96.84 4 100.00
10061. Duck (duckduckwhale) 4 89.69 102.86 2 50.00
10062. Eshan (e_khan) 17 89.68 105.35 8 47.06
10063. Kinst (swiftens) 51 89.68 110.73 16 31.37
10064. Leah (slanted_sunlight) 22 89.68 99.22 9 40.91
10065. Nicolas (morgoth890steno) 3 89.68 100.17 1 33.33
10066. William (william_david) 114 89.68 122.02 49 42.98
10067. Nikolai (nikovertus) 165 89.68 124.50 53 32.12
10068. xxneoxx (xxneoxx) 5 89.68 95.67 0 0.00
10069. Tashrif (tashrif_shahriar) 61 89.68 109.09 24 39.34
10070. Mirto (st4rb0y) 2 89.67 94.26 1 50.00
10071. Hyenitye (hyenite) 4 89.66 108.32 1 25.00
10072. fnf (whitezetra) 31 89.66 111.88 9 29.03
10073. Jacob (highlift) 2 89.66 95.83 1 50.00
10074. Kaushik (kaushik_nna) 50 89.65 107.14 18 36.00
10075. Im kinda cute (im_kinda_cut... 13 89.65 103.64 3 23.08
10076. idunno (idunno_) 3 89.65 96.66 0 0.00
10077. Douglas (djwtheman) 1 89.65 89.65 0 0.00
10078. Raging (ragingthunder) 55 89.65 107.19 21 38.18
10079. H (hdawg187) 5 89.65 97.01 1 20.00
10080. ttvnaaya786 (ttvnaaya786) 17 89.65 101.20 4 23.53
10081. Gilbie (gilbie) 4 89.65 93.29 2 50.00
10082. J (mr_wood) 44 89.64 112.44 15 34.09
10083. Kiara (katherynbane) 301 89.64 117.58 107 35.55
10084. Jack (awesomekiwi23) 21 89.63 104.01 13 61.90
10085. Glenn (glenn101107) 58 89.63 109.21 21 36.21
10086. Claire (claireeeieie) 4 89.62 97.93 0 0.00
10087. Alejandro (foreversick) 69 89.61 110.91 23 33.33
10088. PB (spic3) 2 89.61 100.97 2 100.00
10089. Vaibhav (vaibhav974) 20 89.61 102.56 5 25.00
10090. Mooshi (mooshiboy_dvorak) 388 89.61 118.19 104 26.80
10091. Ken (kyberken) 1 89.60 89.60 0 0.00
10092. CarelessInternet (carelessi... 4 89.60 95.48 1 25.00
10093. tserse (tserse) 70 89.60 104.09 14 20.00
10094. Ian (imatson9119) 24 89.60 102.90 8 33.33
10095. V (p3rplexed) 22 89.59 109.39 7 31.82
10096. Ryan (arkephonic) 18 89.59 111.57 5 27.78
10097. ThatLastWaffle (thatlastwaf... 79 89.59 117.02 31 39.24
10098. Duong (duong_n) 7 89.59 117.32 1 14.29
10099. Miles (hauskaz) 25 89.58 109.60 5 20.00
10100. R (ghostboy) 33 89.58 115.28 19 57.58
10101. Jakov (jpalikuca) 3 89.58 93.46 1 33.33
10102. Avikam (avikam) 2 89.58 92.08 2 100.00
10103. movingpoopscary (renzyr12) 6 89.58 98.18 3 50.00
10104. Miki (miki888) 9 89.58 93.47 2 22.22
10105. eri :) (eri0002) 18 89.58 113.44 8 44.44
10106. idell (notidell) 126 89.58 110.24 42 33.33
10107. ... (h01001010) 26 89.58 108.86 6 23.08
10108. Niuqaoj (niuqaoj_life) 1 89.57 89.57 0 0.00
10109. Abhigyan (abhigyan11) 3 89.57 93.27 2 66.67
10110. Goh (chuanhao) 2 89.57 97.99 0 0.00
10111. trer10 (trer10) 17 89.57 102.86 6 35.29
10112. Klash (klashghost) 7 89.57 95.81 3 42.86
10113. Joe (afromonkey) 2 89.57 93.08 0 0.00
10114. Joey (coxoncable) 59 89.56 112.69 19 32.20
10115. Visionss (visionss) 8 89.56 108.91 3 37.50
10116. Sonu (intellectualcreatures) 421 89.56 119.21 157 37.29
10117. Brent (brentdrns) 4 89.56 99.18 2 50.00
10118. Joshua (manch) 160 89.55 112.54 51 31.88
10119. OMEGALUL (bearingsea) 6 89.55 97.81 2 33.33
10120. Alex (liltypist44) 1 89.55 89.55 0 0.00
10121. Jason (jason_yessir) 1 89.55 89.55 0 0.00
10122. Erik (virumdreng) 17 89.55 102.66 11 64.71
10123. Tobias (akwhideki) 17 89.55 102.03 11 64.71
10124. Vache (vacheka) 3 89.54 96.38 0 0.00
10125. Dominic (ninjabean) 3 89.54 101.60 1 33.33
10126. kemosaf (kemosaf) 6 89.54 95.55 5 83.33
10127. jaso (jasocanfly) 957 89.54 133.61 316 33.02
10128. Turtley (turtleyjk) 11 89.54 105.84 6 54.55
10129. Tinh (tinh1000000) 9 89.54 97.70 4 44.44
10130. Shivam (sorcerer626) 11 89.54 107.50 6 54.55
10131. Mars (mars212163) 85 89.54 110.42 29 34.12
10132. J0bro (jobrocraftstep) 34 89.54 110.89 10 29.41
10133. Yo (azurewinter) 160 89.53 124.17 59 36.88
10134. txxs (kriiue) 2 89.53 93.76 2 100.00
10135. Vincentius (kinikiz) 2 89.53 96.01 2 100.00
10136. Carter (cartersaechoa92) 26 89.53 104.10 6 23.08
10137. scalt (scalt) 2 89.53 103.07 0 0.00
10138. Becca (niknup) 1 89.52 89.52 1 100.00
10139. Leah (leah_is_not_available) 25 89.52 103.68 9 36.00
10140. Ninth (ninth_player) 34 89.52 104.33 23 67.65
10141. Fadhil (qazsxdcfv) 15 89.52 111.85 7 46.67
10142. Van Philip (vppexis) 8 89.52 97.18 2 25.00
10143. Tao (litao91) 26 89.51 106.59 8 30.77
10144. Jacob (adudethattypes) 4 89.51 103.33 4 100.00
10145. K4_keyChan_ (k4_keychan_) 13 89.51 112.89 6 46.15
10146. speedy (speedy_speedster) 1 89.51 89.51 0 0.00
10147. RRKS (rrks43) 159 89.51 112.99 55 34.59
10148. HennesseyDrew (hennydrew) 7 89.51 104.09 2 28.57
10149. Owl (owlhidepants) 2 89.51 95.97 1 50.00
10150. anon (triphosphate) 25 89.50 106.49 10 40.00
10151. fishOil (afishoil) 2 89.50 95.20 1 50.00
10152. daniel (danieledward13) 522 89.50 131.62 165 31.61
10153. ahmed (lelarino1) 6 89.49 102.91 2 33.33
10154. Z (bootlicker1776) 2 89.49 90.63 0 0.00
10155. Mike (cherryot) 39 89.49 109.17 9 23.08
10156. Blablle (blablle) 19 89.49 107.16 19 100.00
10157. RashidTalib123 (rashid_tali... 28 89.49 105.99 13 46.43
10158. Toni (topityper) 78 89.49 110.77 26 33.33
10159. Rein (lilpotatopop) 18 89.48 112.50 13 72.22
10160. Tina (tinangu272) 9 89.48 97.19 3 33.33
10161. Lumberjack (lumberpython) 23 89.48 109.43 7 30.43
10162. DiscoveryAlpha (j2997) 1 89.48 89.48 0 0.00
10163. Garubles (themoistseacow) 2 89.48 91.58 2 100.00
10164. Filip (normalnie) 1 89.48 89.48 1 100.00
10165. achewytoffee (achewytoffee) 2 89.48 94.04 1 50.00
10166. khanh (lenguyenkhanh) 106 89.48 104.05 28 26.42
10167. Nelvin (nelvin27) 30 89.48 109.67 9 30.00
10168. SlowTyperT-T (krusty_krab10) 3 89.47 100.14 0 0.00
10169. Emma (emmasmith2005) 312 89.47 113.69 84 26.92
10170. road to 100 (roadtoglobalmc) 22 89.47 110.66 6 27.27
10171. thecourtneyv (thecourtneyv) 24 89.47 105.28 12 50.00
10172. DMack (dmack98) 249 89.47 114.53 88 35.34
10173. James (paynedeath) 3 89.46 101.98 2 66.67
10174. Zol (zoltac) 36 89.46 116.18 8 22.22
10175. William (williamforrester) 6 89.46 100.68 2 33.33
10176. Luka (lukoloz) 152 89.46 113.47 46 30.26
10177. Aritra (liquidator) 6 89.46 98.05 4 66.67
10178. e (eddyhack) 17 89.46 105.81 8 47.06
10179. no sweat (anduatm) 21 89.45 101.53 9 42.86
10180. hoku✨ (hokuyato) 9 89.45 96.01 2 22.22
10181. SPyofgame (spyofgame) 46 89.45 106.47 26 56.52
10182. Gina (nannelcam) 144 89.45 113.71 54 37.50
10183. Temple (mason_carlson) 231 89.44 127.78 90 38.96
10184. SMhd (smhd) 106 89.44 105.64 26 24.53
10185. betterscramblelikeanegg (be... 7 89.44 99.68 2 28.57
10186. Andrew (mhayes4701) 19 89.44 96.60 6 31.58
10187. kaka (kakaburra) 9 89.44 102.81 4 44.44
10188. Ba (injuredninjaz) 18 89.44 108.61 6 33.33
10189. Anthony (sora2848) 2 89.43 90.96 2 100.00
10190. w_mb1 (trundling) 42 89.42 106.40 23 54.76
10191. Jared (notjard) 1 89.42 89.42 1 100.00
10192. Andrewb (andrewbb) 11 89.42 97.02 7 63.64
10193. Faruk (megaracer_faruk17) 23 89.42 106.35 10 43.48
10194. Nick (nick1347) 16 89.42 102.84 8 50.00
10195. Alex (revl8er) 5 89.41 99.10 0 0.00
10196. James (xaxlox) 2 89.41 92.14 1 50.00
10197. Amelia (amelia03) 25 89.41 109.75 10 40.00
10198. ocean man (clickbaitt) 11 89.41 97.74 2 18.18
10199. PotatoMike (potatomike) 16 89.41 111.48 4 25.00
10200. godofchin (fiyet) 6 89.41 96.86 1 16.67
10201. Vladi (wacy11) 32 89.41 113.06 10 31.25
10202. Tristan (tristanhilton85) 3 89.41 92.17 0 0.00
10203. Weed (weeddinosaur) 191 89.41 112.39 87 45.55
10204. Steven (vivihuang) 73 89.41 118.28 22 30.14
10205. fcwaffles (shanice0427) 2 89.41 93.46 1 50.00
10206. sami (sami66) 106 89.40 109.23 27 25.47
10207. Collin (collin_felter) 63 89.40 107.20 19 30.16
10208. Niklas (niklash) 26 89.40 109.37 9 34.62
10209. deric (bplo) 1 89.40 89.40 0 0.00
10210. Mircox (mircozen) 110 89.40 108.32 32 29.09
10211. The Rainbow Dragon (broadwa... 18 89.40 97.72 4 22.22
10212. Nico (npvalerio8) 32 89.39 109.18 13 40.63
10213. Kosuke (ghostkk) 3 89.39 106.75 3 100.00
10214. Jordon (gimp_jimmy) 5 89.39 98.56 3 60.00
10215. Maddie (ciderto) 74 89.39 121.19 23 31.08
10216. kay (bbsaltlord) 113 89.39 114.12 45 39.82
10217. Sterling (stvrling) 9 89.38 103.97 5 55.56
10218. Lorenzo (leftovers1) 4 89.38 93.65 2 50.00
10219. Jacquelyn (mobear06) 22 89.38 115.20 6 27.27
10220. faith (phaithyy) 1 89.38 89.38 0 0.00
10221. Steven (agentsb024) 4 89.38 95.14 4 100.00
10222. Kai (cheongengkai) 59 89.38 109.45 15 25.42
10223. Tom (twrig144) 14 89.38 106.46 5 35.71
10224. Michael (sano459) 15 89.37 95.06 3 20.00
10225. Christian (kunuc) 12 89.37 102.39 5 41.67
10226. Antony (antonleghost) 49 89.37 116.44 15 30.61
10227. Alec (alecwest) 2 89.37 93.81 1 50.00
10228. Edward (1934__) 29 89.36 116.03 12 41.38
10229. Allison (zarfynn) 39 89.36 106.26 15 38.46
10230. Miles (eightmiles27) 7 89.36 103.69 3 42.86
10231. 🎃 (igorslow) 1 89.36 89.36 0 0.00
10232. Matthew (greatbun) 6 89.36 94.53 2 33.33
10233. rakesh_singh (rakesh_singh) 14 89.36 105.61 6 42.86
10234. KW (kiawa88) 4 89.36 95.41 1 25.00
10235. Sleepy (sleepy_torch) 5 89.36 96.38 1 20.00
10236. Druzie (zectrople) 4 89.35 93.58 2 50.00
10237. Eric (pawnnub) 243 89.35 131.88 86 35.39
10238. tjk113 (tjk113) 21 89.35 105.58 6 28.57
10239. Jeffrey (xxpreheattheoven) 218 89.35 110.06 82 37.61
10240. TheKRAM (thekram) 3 89.35 91.25 1 33.33
10241. fongof (fongof) 14 89.35 100.03 3 21.43
10242. Kavika (kavika30) 5 89.35 98.19 1 20.00
10243. murdershards (murdershards) 5 89.34 96.97 2 40.00
10244. Jacob (jsmith182) 29 89.34 102.31 14 48.28
10245. bruh (easiwin2) 1 89.34 89.34 0 0.00
10246. Niceable (niceable) 28 89.33 108.69 9 32.14
10247. ⠀⠀⠀ (bioluminescent) 7 89.33 99.67 2 28.57
10248. Nagai (nagaimatsuge) 267 89.33 111.87 94 35.21
10249. Adem (paramone) 8 89.33 102.20 5 62.50
10250. Hiroshi (buhiroshi0205) 6 89.33 102.06 3 50.00
10251. Jamie (destroyer_of_words) 5 89.33 120.03 0 0.00
10252. Cecil (cecil_behar64) 26 89.33 96.98 5 19.23
10253. Mottures (mottures) 1 89.32 89.32 0 0.00
10254. huddled (haraldgb) 95 89.32 106.25 27 28.42
10255. Hola (harebrained) 18 89.31 101.28 8 44.44
10256. Underworld (vnderworld) 4 89.31 102.62 3 75.00
10257. Assey (rockae) 18 89.31 109.10 9 50.00
10258. Huy (duchuynguyen94) 17 89.31 97.36 8 47.06
10259. Witox (witho567) 5 89.30 94.73 1 20.00
10260. Tomás (tomasero) 2 89.30 92.95 0 0.00
10261. Jessica (jeguar) 125 89.30 127.51 36 28.80
10262. Do-Hyun (dkim00) 13 89.30 101.32 6 46.15
10263. Kendra (kcviloria) 1 89.29 89.29 1 100.00
10264. homeslice (homeslic3) 1 89.29 89.29 0 0.00
10265. Minori (twoautumnleaf) 1 89.29 89.29 0 0.00
10266. Pyren (pyren83) 430 89.29 113.01 136 31.63
10267. Yakend (yakend) 1 89.28 89.28 0 0.00
10268. Hugi (hugi97) 14 89.28 100.07 5 35.71
10269. Kevin (vektronic) 488 89.27 124.15 152 31.15
10270. Lance (lancelot_29) 510 89.27 128.66 139 27.25
10271. Jonas (jonaslabryinth) 200 89.27 113.67 72 36.00
10272. viincent (viiincent) 24 89.27 119.39 7 29.17
10273. Peter (peasqueak) 4 89.27 99.26 1 25.00
10274. Auiyin (auiyin) 11 89.27 99.72 6 54.55
10275. absor (absor) 64 89.26 113.61 24 37.50
10276. jus102res (jus102res) 1 89.26 89.26 1 100.00
10277. Cristian (flanzeta) 1 89.26 89.26 1 100.00
10278. Khulugjin (aceno) 92 89.26 115.39 37 40.22
10279. Noah (nodigermanium) 694 89.25 118.09 207 29.83
10280. ジョンジョンジョン... 3 89.25 102.70 1 33.33
10281. Kajtebolikitica (patrik131) 66 89.25 108.16 21 31.82
10282. only 루비 (kxntzu) 5 89.25 96.51 1 20.00
10283. BJ (bjfoutz00) 40 89.25 115.49 8 20.00
10284. Anya (bonniebonbon) 2 89.25 94.73 0 0.00
10285. Fliqqr (fliqqr) 7 89.25 95.17 2 28.57
10286. Freowy (freowy) 28 89.25 106.94 6 21.43
10287. DDarWiz (ddarwiz) 2 89.25 89.48 1 50.00
10288. Racuuuch (rebbok2002) 1 89.24 89.24 1 100.00
10289. Josh (upaymeifixit) 1 89.24 89.24 1 100.00
10290. FoolSt0p (beanenthusiast) 35 89.24 114.63 12 34.29
10291. fae (faeswag) 4 89.24 96.33 2 50.00
10292. Matthew (matt_dj) 2 89.24 89.39 0 0.00
10293. Joshua (beastjg) 25 89.23 109.77 11 44.00
10294. Mikechun (mikechun) 13 89.23 107.40 3 23.08
10295. jacob (iljain) 94 89.23 112.89 29 30.85
10296. tris (trisywc) 222 89.23 116.94 57 25.68
10297. Blagoj (pauc_99) 10 89.23 96.50 1 10.00
10298. Molasses (practice12_3) 10 89.22 95.90 3 30.00
10299. Borna (bborna) 5 89.21 97.06 2 40.00
10300. Jack (dasher11) 6 89.21 98.84 0 0.00
10301. satwik (satwik_060) 517 89.21 127.11 175 33.85
10302. duncs (duncs) 12 89.21 103.95 9 75.00
10303. Shian (ytxiang1997) 19 89.20 101.87 2 10.53
10304. いつき (huywee) 480 89.20 142.06 134 27.92
10305. Andrew (dethzombi) 3 89.20 99.50 1 33.33
10306. MNL48 Frances DieHardSuppor... 151 89.20 109.59 60 39.74
10307. Filip (l4rry99) 157 89.20 120.59 46 29.30
10308. Hossein (hossein_nas) 7 89.19 103.81 4 57.14
10309. PlanckPractice (sage_of_stu... 1 89.19 89.19 0 0.00
10310. Atlas (ropsar) 1 89.19 89.19 0 0.00
10311. Jack (feloniousshmuck) 1 89.19 89.19 0 0.00
10312. Zovi (zovi) 391 89.19 118.74 114 29.16
10313. Kriss (kkright) 25 89.18 105.55 9 36.00
10314. Bill (proepicgamer101) 61 89.18 119.37 30 49.18
10315. Keyser (keyserrr) 7 89.18 94.13 2 28.57
10316. Daniel (xuanzang44) 5 89.18 103.72 1 20.00
10317. jack (jackerdd) 534 89.17 113.78 166 31.09
10318. Malcolm (malcolm_) 87 89.17 109.54 38 43.68
10319. sonny (sonnysixteen) 71 89.17 111.28 27 38.03
10320. Faizaan (nitroblast) 25 89.17 133.07 15 60.00
10321. Xavier (skittlez11) 1 89.17 89.17 0 0.00
10322. Samad (dr_drakonix) 7 89.17 98.19 2 28.57
10323. CMcK (cmck) 8 89.17 94.95 3 37.50
10324. Allyson (lumpylumplump) 2 89.17 91.82 1 50.00
10325. bloomy (atsu) 108 89.16 114.60 38 35.19
10326. Marc (maroenzo) 36 89.16 106.18 13 36.11
10327. Kyle (kbuschy) 10 89.16 104.87 1 10.00
10328. Tobie (tobberd) 3 89.16 94.55 0 0.00
10329. Dustin (dtrain586) 2 89.16 98.13 1 50.00
10330. Sevy (sevytiglao) 5 89.15 109.41 0 0.00
10331. Thnift (thnift) 4 89.15 97.70 1 25.00
10332. Jody (deekif) 14 89.15 102.81 8 57.14
10333. Luka (lukisav) 4 89.15 92.30 4 100.00
10334. Xeethra (xeethra) 33 89.14 105.31 15 45.45
10335. oukkat2 (oukkat2) 160 89.14 115.67 55 34.38
10336. Nathan (buddyurslow) 96 89.14 106.35 37 38.54
10337. danielwolf (n3kro) 10 89.14 103.47 2 20.00
10338. Will (winam777) 3 89.14 93.36 0 0.00
10339. tstats[unoriginalname] (uno... 45 89.14 102.08 21 46.67
10340. Lion (yellowlion321) 4 89.14 98.94 2 50.00
10341. 🤜🏻 (k1s_darya) 12 89.14 101.98 2 16.67
10342. Pablo (jsanc016) 4 89.14 92.17 1 25.00
10343. shrnayvi (shrnayvi) 109 89.13 100.30 33 30.28
10344. Bo (duckydigs) 2 89.13 89.32 0 0.00
10345. R3TURN (r3turn777) 6 89.13 102.66 3 50.00
10346. Marcin (keshy) 1 89.12 89.12 0 0.00
10347. Chalach (waddee) 11 89.12 103.93 1 9.09
10348. Ty (yomommafav) 107 89.11 113.40 31 28.97
10349. xAnzord (anzord) 6 89.11 91.67 1 16.67
10350. Slim (slimjesus2) 3 89.10 89.63 1 33.33
10351. Top (sheilsarda) 13 89.10 102.88 6 46.15
10352. Jacob (jmbreche) 540 89.10 121.49 198 36.67
10353. Abrar (abrar_al_samit) 2 89.10 90.43 0 0.00
10354. Jai Shri Ram (defone) 291 89.10 125.88 108 37.11
10355. ekoth (ekoth) 7 89.09 98.97 3 42.86
10356. Guillermo (shneme) 6 89.09 104.33 0 0.00
10357. Scalmole (scalmole) 124 89.09 112.16 47 37.90
10358. Nathan (natekruger) 79 89.09 116.01 28 35.44
10359. Soul (soulisgarb) 18 89.09 99.44 3 16.67
10360. sk (teslateslatesla) 38 89.09 108.60 7 18.42
10361. Nick (spirk) 2 89.09 98.01 1 50.00
10362. Kizu (kizuiyo) 35 89.08 111.26 10 28.57
10363. Ghislaine (ghislanemaxwell) 26 89.08 110.26 12 46.15
10364. Rick (rickssbm) 17 89.08 96.75 6 35.29
10365. zeek (zeek618) 4 89.07 100.50 0 0.00
10366. Robert (robertdchiodo) 5 89.07 98.16 0 0.00
10367. Citizen404 (citizen404) 12 89.07 97.79 6 50.00
10368. Acke (ackehjarn) 14 89.07 104.37 3 21.43
10369. AJ (bacon_is_life) 15 89.07 102.50 6 40.00
10370. lettel (lettel) 1,037 89.07 114.84 315 30.38
10371. Amo (santan_amzy) 83 89.07 101.49 26 31.33
10372. toudouche (seni42) 79 89.06 105.11 27 34.18
10373. dennis (ludennis0606) 44 89.06 107.72 11 25.00
10374. Dean (icysabr3) 5 89.06 98.98 2 40.00
10375. Daniel (fodderotter) 2 89.06 94.63 0 0.00
10376. BigDiqSix9 (bernazrei69) 23 89.05 105.44 10 43.48
10377. ApocJTL (apocjtl) 34 89.05 115.85 10 29.41
10378. Nathan (el_cap_i_tan) 48 89.05 102.98 23 47.92
10379. Membrane69 (keifermatthew) 27 89.05 109.14 9 33.33
10380. ironjill (ironjill) 7 89.05 98.59 4 57.14
10381. Park Shin Hye (yipaepaen) 1 89.05 89.05 0 0.00
10382. Wesley (c3tangies) 7 89.04 97.23 2 28.57
10383. Fauzan (fblues) 34 89.04 99.18 10 29.41
10384. Lord (lordaizen707) 4 89.04 94.29 1 25.00
10385. TheMining72 (themining72) 3 89.03 97.77 2 66.67
10386. John (karmetier) 15 89.03 108.25 5 33.33
10387. Spencer (sunflxwer9) 2 89.03 91.94 0 0.00
10388. Be At Peace (spacepajamas) 28 89.03 100.56 11 39.29
10389. Kevin (purplekev) 3 89.03 105.52 0 0.00
10390. Zekken (zekken12345) 8 89.03 105.94 6 75.00
10391. alpha (alphawoman) 153 89.03 121.05 51 33.33
10392. Darkplayer3 (darkplayer3) 8 89.02 97.34 5 62.50
10393. Khalid (weebsensation) 16 89.02 96.86 7 43.75
10394. Calen (calen64) 7 89.02 96.87 5 71.43
10395. Joseph (techvideomaster) 11 89.02 103.44 4 36.36
10396. Ethan Jeff (hypernacho) 28 89.01 115.96 9 32.14
10397. Sean (laggermc) 7 89.01 96.54 0 0.00
10398. Dumby (cooh) 19 89.01 100.38 5 26.32
10399. ​​yosefxlr8 (vaniix_) 84 89.01 111.07 22 26.19
10400. Winged (winged_shell) 1 89.00 89.00 0 0.00
10401. Ikeai0515 (uanea0516) 96 88.99 111.87 33 34.38
10402. Luke (sfv_) 9 88.99 95.80 3 33.33
10403. ㋡㋛☹ (chzeeshan) 71 88.99 104.67 29 40.85
10404. EvilNoodle (evilnoodle) 1 88.98 88.98 0 0.00
10405. Kyle (xdestroyer83) 11 88.98 99.67 4 36.36
10406. MikeB (mikebfromdk) 7 88.98 107.44 1 14.29
10407. Alex (alexthegamer281) 7 88.98 100.09 4 57.14
10408. Vincent (waldoo) 4 88.97 99.62 3 75.00
10409. Eden (edenthompson) 4 88.97 99.11 2 50.00
10410. hissi (hissi) 20 88.97 109.90 7 35.00
10411. Abhishek (abc_cs) 31 88.97 102.42 8 25.81
10412. Noah (noah187) 83 88.97 102.61 27 32.53
10413. 失败者 (palmtreeeee) 24 88.96 101.76 9 37.50
10414. ADF (aldf) 5 88.96 98.82 1 20.00
10415. Horny (bigben223) 474 88.96 115.14 154 32.49
10416. Brendan (lorsque) 2 88.96 90.56 1 50.00
10417. Kurtel (kurtel) 2 88.96 91.31 1 50.00
10418. Jan (janpaint4221) 24 88.96 106.81 6 25.00
10419. Kirtaph (kirtaph) 14 88.96 115.18 4 28.57
10420. Giich (giich) 8 88.95 96.60 2 25.00
10421. Lâm (lamisgosu11) 1 88.95 88.95 0 0.00
10422. Wolferwow (baime) 2 88.95 94.72 0 0.00
10423. Andrew (andrwrbnsn) 1 88.95 88.95 0 0.00
10424. UNTiTLED (pshy0) 2 88.95 95.24 2 100.00
10425. メラキくん (4146d0n) 3 88.94 94.60 1 33.33
10426. Andy (batt) 19 88.93 100.20 5 26.32
10427. Adarsh (addyempire) 5 88.93 96.18 1 20.00
10428. Mario (buggy_) 2 88.93 99.59 1 50.00
10429. Vivian (dojacatsfeet) 3 88.92 95.40 1 33.33
10430. Derek (derekcfop) 2 88.92 92.72 1 50.00
10431. ttv.guspenseful (gusm09) 307 88.91 116.33 86 28.01
10432. cool_whip (cool_whip) 55 88.91 106.04 12 21.82
10433. delfan (delfaaan) 368 88.91 113.30 118 32.07
10434. Robert (typeson) 1 88.91 88.91 0 0.00
10435. Jozef (lawalamp12) 39 88.91 101.58 20 51.28
10436. Ckh (theckh) 156 88.90 108.38 48 30.77
10437. Janindu (aokiesan) 17 88.90 104.16 6 35.29
10438. mire (mire_kr) 11 88.90 113.26 2 18.18
10439. Mark (markachuang) 38 88.90 108.64 16 42.11
10440. Altan (altan_twitchz) 2 88.90 95.54 0 0.00
10441. zen (zen181) 190 88.90 114.87 70 36.84
10442. amogus (amogusimposterr) 5 88.90 112.20 1 20.00
10443. josh (joshahk) 20 88.90 121.58 7 35.00
10444. because (because_123) 3 88.90 95.72 2 66.67
10445. salmi (salmitot) 34 88.90 105.94 15 44.12
10446. Tycho (tychobroucke) 20 88.89 104.79 5 25.00
10447. Emad Iqbal (racer47) 34 88.89 104.01 10 29.41
10448. IChun (lighttodie) 26 88.89 104.44 8 30.77
10449. Jeffrey (jshen13) 21 88.89 101.22 8 38.10
10450. Nate (npmaile) 1 88.89 88.89 1 100.00
10451. Another (anotherkaneki) 10 88.89 109.66 3 30.00
10452. Neko (stanoje) 153 88.89 110.81 41 26.80
10453. Dim (jimmylei) 13 88.89 104.80 3 23.08
10454. Jake (jujypop) 2 88.89 89.69 0 0.00
10455. Isaac (doodle_eldood) 2 88.89 91.06 0 0.00
10456. :) (yuuuhhh) 53 88.88 110.23 18 33.96
10457. Ian (copywright) 64 88.88 113.34 20 31.25
10458. Crystal (crystal_angelo) 100 88.88 116.41 33 33.00
10459. Akiro (akiroooo) 6 88.88 103.30 1 16.67
10460. Abdulaziz (mubailesh) 1,220 88.87 116.71 400 32.79
10461. Kacper (kacperkazan) 5 88.87 97.43 2 40.00
10462. Jarrod (jandojanderson) 1 88.87 88.87 1 100.00
10463. William (wdk5013) 39 88.87 111.65 16 41.03
10464. fastjohnny72 (soggylemon) 5 88.86 108.00 3 60.00
10465. Yonas (yonasthenerd) 5 88.86 94.55 2 40.00
10466. Sinatec (ttv_sinatec) 3 88.86 102.29 2 66.67
10467. Xenomorph (claygnot10) 9 88.86 104.48 1 11.11
10468. Oscar (scarigam) 38 88.85 102.08 3 7.89
10469. karina (wattisgone) 40 88.85 108.57 14 35.00
10470. Joshua (jhsieh10) 46 88.85 105.24 16 34.78
10471. Eru (flatoon) 2 88.85 98.99 1 50.00
10472. Jonas (supektibol) 271 88.85 106.32 64 23.62
10473. Xian (doggy2021) 13 88.85 100.31 3 23.08
10474. Sunaiart (sunaiart) 3 88.84 94.44 0 0.00
10475. Eugene (lilgene1) 147 88.84 114.97 45 30.61
10476. Dawson (funkemunky) 3 88.84 89.44 1 33.33
10477. Nathan (kenshido) 2 88.84 93.68 1 50.00
10478. Sam (yaboisam_) 29 88.83 108.16 11 37.93
10479. Bobby (bton) 526 88.83 121.07 192 36.50
10480. AHHH (chuckles1357) 49 88.83 110.67 11 22.45
10481. Nolan (kiwiq1) 309 88.83 104.64 83 26.86
10482. loser (badatenglish) 34 88.83 113.70 12 35.29
10483. qMark (renvanoss) 311 88.82 112.72 91 29.26
10484. healy (healy1453) 9 88.82 101.70 3 33.33
10485. Shaun (shaun_c) 78 88.82 107.67 22 28.21
10486. muchinchai (muchinchai) 134 88.82 103.57 43 32.09
10487. Ben (benjikimchi) 6 88.81 98.38 3 50.00
10488. jim (jimbosenior) 7 88.81 100.56 2 28.57
10489. heythisistej (lucknumber8_alt) 130 88.81 115.03 43 33.08
10490. Mymumswims (mymumswims) 18 88.81 106.97 6 33.33
10491. yooooooongi (utlyoongs) 17 88.80 107.74 5 29.41
10492. tstats[log1xmeister] (log1x... 70 88.80 113.85 26 37.14
10493. Mischa (mischapotter) 13 88.80 106.34 5 38.46
10494. Mipsy (mipsytheblue) 14 88.80 122.57 11 78.57
10495. KOROCO (koroconotu) 11 88.79 108.38 1 9.09
10496. neko (yabaicat) 3 88.79 97.10 3 100.00
10497. chekic (chekic) 82 88.79 114.60 27 32.93
10498. fe (ferkoaa) 1 88.79 88.79 0 0.00
10499. doorcrasher (doorcrasher) 1 88.79 88.79 0 0.00
10500. Bpandu (bpandu) 1 88.79 88.79 1 100.00
10501. Ken (waterlemon48) 15 88.79 106.11 7 46.67
10502. Nolan (nolangreub) 4 88.78 101.80 3 75.00
10503. tstats[kaitokidokuroba] (ka... 301 88.78 124.02 98 32.56
10504. Jojo (j_oey) 3 88.78 91.48 1 33.33
10505. Niftski (niftski) 14 88.78 109.74 9 64.29
10506. Pegtor (pegtor) 4 88.78 109.93 1 25.00
10507. keyboard (0001wpm) 6 88.78 98.35 1 16.67
10508. GitGawd (gitgawd) 17 88.77 104.30 10 58.82
10509. ILUVpwny (iluvpwny) 5 88.77 104.02 2 40.00
10510. Jeremy (thugapy) 2 88.77 96.55 1 50.00
10511. Eric (leftlaneeric) 14 88.77 100.43 12 85.71
10512. lol (nutmyballs) 24 88.76 96.67 10 41.67
10513. Riggy (rigorodolico) 13 88.76 100.45 6 46.15
10514. Justin (nexoloft) 1 88.76 88.76 0 0.00
10515. Eli (emeyer9) 6 88.76 101.85 3 50.00
10516. Max (maffiaboy65) 5 88.76 92.52 4 80.00
10517. Gabriel (gabrielfr2001) 18 88.76 102.17 5 27.78
10518. Luuk (dutchprojects) 17 88.76 108.99 7 41.18
10519. Leon (likarii) 16 88.75 108.00 6 37.50
10520. Caleb (meow4562) 23 88.75 106.76 5 21.74
10521. Ryan (ricenoodles01) 14 88.75 125.63 4 28.57
10522. 1 (desser2) 10 88.75 96.90 3 30.00
10523. Helios (heliosishot) 3 88.74 89.57 2 66.67
10524. zeon (zeon000) 5 88.74 111.06 2 40.00
10525. Kool (robozarp) 2 88.74 95.74 1 50.00
10526. Nicholas (nicholaspatrick) 17 88.73 105.12 2 11.76
10527. Driew (driew) 39 88.73 113.79 14 35.90
10528. Jack (jackthehuman) 8 88.73 92.75 4 50.00
10529. Arsennn (arsenn) 70 88.72 115.39 19 27.14
10530. glow2:wave: selling 3k shar... 6 88.72 96.55 4 66.67
10531. Micah (mjdomo) 19 88.72 101.04 8 42.11
10532. Doctorgreenyou (doctorgreen... 8 88.72 102.66 5 62.50
10533. Luis (luwec) 17 88.71 103.76 6 35.29
10534. guan (jgbiggy96) 8 88.71 98.10 2 25.00
10535. Prawny (enderduck247) 19 88.71 119.22 17 89.47
10536. TianHao (skydrag0n) 16 88.70 99.27 11 68.75
10537. keaten (keaten) 3 88.70 97.29 1 33.33
10538. JoYo (joyojo) 18 88.70 101.13 11 61.11
10539. Jaunty (jaunty_jalopy) 13 88.70 96.64 5 38.46
10540. angie :) (angwie) 115 88.69 117.79 33 28.70
10541. AngelCaveGTI (angelcavegtio... 352 88.69 121.31 107 30.40
10542. 000557A (tr1pl0) 1 88.69 88.69 0 0.00
10543. abc (1714245ctk41) 45 88.68 108.03 14 31.11
10544. david (snobellprize) 294 88.68 114.13 98 33.33
10545. _ (baoy) 39 88.68 111.98 12 30.77
10546. Nikolaj (nikolaj808) 9 88.68 95.72 2 22.22
10547. Anthony (euthanasia_) 6 88.68 98.16 1 16.67
10548. Cody (marshmink) 17 88.68 102.61 5 29.41
10549. Henrricos (henrricos) 15 88.67 102.35 3 20.00
10550. Vasja (artemis358) 1 88.67 88.67 0 0.00
10551. Connor (edgeburn) 17 88.67 102.77 5 29.41
10552. Hasan (notelex) 322 88.67 111.32 97 30.12
10553. Erich (br3ad) 1 88.66 88.66 0 0.00
10554. Lei (alnadnetrox) 336 88.66 117.22 120 35.71
10555. James (icecrusher) 450 88.66 125.10 144 32.00
10556. Nick (frogd) 14 88.66 105.54 2 14.29
10557. Sebastian (cloutimus) 26 88.66 104.95 12 46.15
10558. Kincaid (kincaida) 3 88.65 92.81 0 0.00
10559. Theo (thelogdude) 8 88.65 98.42 2 25.00
10560. Wusien (wusien) 546 88.65 120.61 172 31.50
10561. workman (isoon_workman) 4 88.65 102.41 4 100.00
10562. tje (tje04) 128 88.65 119.56 40 31.25
10563. lucas (joemama3) 2 88.65 96.96 0 0.00
10564. Jp (j12p21) 54 88.64 110.42 11 20.37
10565. Sebastian (sayferfordyce) 6 88.64 102.34 3 50.00
10566. King (maichen777) 30 88.64 100.11 8 26.67
10567. Justin (ribena_ais) 6 88.64 98.92 3 50.00
10568. Janc (psyy1234) 166 88.64 107.09 48 28.92
10569. Bog (bogdanovix) 4 88.64 99.44 1 25.00
10570. WaffleAbs (waffleabs) 7 88.64 105.28 1 14.29
10571. Skoma (skomawolf) 5 88.63 94.46 1 20.00
10572. r0hkx (r0hkx) 33 88.63 111.67 8 24.24
10573. Im not a country (taiwankim) 289 88.63 114.78 93 32.18
10574. Mauricio (gotsicile) 4 88.62 93.06 2 50.00
10575. patzer (tip3) 2 88.62 89.03 0 0.00
10576. Pepsi (bombchicken) 2 88.61 92.89 1 50.00
10577. Aufan (icepondx) 79 88.61 106.50 22 27.85
10578. Joshua (kerpoof) 4 88.61 91.30 2 50.00
10579. DarkZplays (darkzplays_qwerty) 10 88.60 96.90 5 50.00
10580. humberto torres (humbertoto... 272 88.60 108.76 86 31.62
10581. Paw (pawan42) 4 88.60 94.61 2 50.00
10582. sky (elsecaller) 37 88.60 98.93 6 16.22
10583. Kazuki (kazuki_kun) 19 88.60 99.76 6 31.58
10584. sadaf (morphinefather) 9 88.59 117.71 4 44.44
10585. Speed (omotola2004) 2 88.59 90.75 1 50.00
10586. Bahaa (its_bahaa_aea) 2 88.59 89.96 0 0.00
10587. david (davie04) 29 88.59 106.18 8 27.59
10588. hngggg (m4saki) 59 88.58 112.14 25 42.37
10589. padoru (padoru69) 1 88.58 88.58 1 100.00
10590. Gus (v1per41) 2 88.58 104.70 0 0.00
10591. Alex (your_pal_al) 24 88.58 111.47 11 45.83
10592. ayytimbo (ayytimbo) 3 88.58 99.22 1 33.33
10593. Vũ (khanhyeuquan) 43 88.58 108.08 13 30.23
10594. Usurious (usurious_disc730) 7 88.58 99.43 6 85.71
10595. Michael (mrk0508) 28 88.58 98.49 9 32.14
10596. Deko (deko_moon) 21 88.57 105.54 8 38.10
10597. Sparik (sparik) 3 88.57 89.95 1 33.33
10598. Matt (kirito3141) 165 88.57 126.81 43 26.06
10599. Jason (jason534f) 5 88.57 100.61 4 80.00
10600. Elijah (elijahbau) 2 88.57 93.44 1 50.00
10601. ☔️ (orella) 13 88.56 106.74 3 23.08
10602. Zach (zachstarattack) 6 88.56 101.50 4 66.67
10603. MantisTyping (mantistyping) 321 88.56 116.00 98 30.53
10604. Lettuce (rolesg) 74 88.56 133.31 25 33.78
10605. Ar (arpratama) 2 88.56 90.87 0 0.00
10606. Bendik (bibben) 6 88.55 93.27 3 50.00
10607. Tyler (tjking12) 641 88.55 121.87 208 32.45
10608. Richie (sovitou) 3 88.54 101.88 1 33.33
10609. AbsoluteZeroK (absolutezero... 40 88.54 105.39 15 37.50
10610. v (v____) 2 88.54 88.73 0 0.00
10611. donald balls (swag_man_unli... 3 88.54 93.10 1 33.33
10612. T^T (asylumchess) 4 88.54 103.55 1 25.00
10613. relative (relativemadlad) 6 88.54 95.20 0 0.00
10614. Valentina (genericwhitemale) 105 88.53 118.84 33 31.43
10615. Dolce (dolceparadise) 370 88.53 125.77 126 34.05
10616. will (mistywaves) 3 88.53 93.43 2 66.67
10617. kodzy (kodzy) 9 88.53 101.89 2 22.22
10618. SaltyHobo (saltyhobo) 21 88.53 105.36 6 28.57
10619. Tommy (cstommy) 2 88.53 91.22 0 0.00
10620. Igor (ikarus9393) 14 88.52 100.84 5 35.71
10621. sıןʌɥɹ (s1lvhr) 12 88.52 95.56 3 25.00
10622. troy (troysimpson) 2 88.52 91.71 1 50.00
10623. Boomer (boomer_typer) 41 88.51 111.75 9 21.95
10624. yan (ahugedistraction) 15 88.51 104.30 7 46.67
10625. Ramez (ramezraymond) 69 88.51 104.72 29 42.03
10626. Joshua (rjmaligaya) 1 88.51 88.51 0 0.00
10627. danny (protyperdanner) 2 88.51 89.89 0 0.00
10628. Eldon (1ick_your_nan) 1 88.51 88.51 0 0.00
10629. Billie (nappy2000) 2 88.51 97.93 0 0.00
10630. Isaac (dolemitesundae) 31 88.50 109.05 7 22.58
10631. Krisjanis (overcastace332) 15 88.50 104.05 5 33.33
10632. Adam (adam2002) 400 88.50 112.54 104 26.00
10633. Austin (melonyt10) 3 88.50 92.09 0 0.00
10634. Narix (narix) 8 88.50 98.33 4 50.00
10635. HotTubStream (hottubstream) 10 88.49 97.80 4 40.00
10636. mac☮✈ie← →k🥵 (ma... 25 88.49 98.01 9 36.00
10637. Andy (superchickeneat) 18 88.49 109.20 11 61.11
10638. Ferris (ferrisprimanugraha) 8 88.49 94.87 4 50.00
10639. Gabriel (dsgab) 5 88.49 102.76 2 40.00
10640. Reigina (reiginayari) 14 88.49 105.06 4 28.57
10641. Omar (v_omar11) 11 88.49 94.30 2 18.18
10642. GGanon (gganon) 10 88.49 97.85 5 50.00
10643. sanjul (s4njul) 4 88.48 93.76 1 25.00
10644. sevgik (soranges) 27 88.48 123.64 7 25.93
10645. ▄︻̷̿┻̿═━一 (h... 64 88.47 110.74 26 40.63
10646. Jason (jasonliang19) 17 88.47 111.54 5 29.41
10647. fischld (tokiwa) 90 88.47 109.82 25 27.78
10648. LLyn (llyn) 24 88.47 110.16 7 29.17
10649. Colin (infusionpc) 3 88.47 93.38 1 33.33
10650. An (ntan1210) 357 88.46 135.77 119 33.33
10651. Ma (kenma262) 31 88.46 101.82 9 29.03
10652. sergio (montyzing) 1 88.46 88.46 0 0.00
10653. Sjoerd (sjoerdofferhaus) 1 88.46 88.46 0 0.00
10654. Dhiva (dhivaa) 6 88.46 95.04 2 33.33
10655. Chris (shumtlc27) 5 88.46 97.42 1 20.00
10656. Munir (munirgkm) 402 88.46 116.12 135 33.58
10657. tony (nickjonaz) 5 88.46 96.92 4 80.00
10658. Sultan (hasanoji) 5 88.45 95.35 0 0.00
10659. Yuki (yukisitu) 9 88.45 111.39 5 55.56
10660. mitchell (fool1shdemxn) 68 88.45 109.59 26 38.24
10661. Alek (lucazoom) 6 88.45 105.38 3 50.00
10662. Acnologia (acnologia_123) 48 88.45 96.83 9 18.75
10663. Tom (gearsofvore) 3 88.44 94.73 1 33.33
10664. Alfred (alfredsando) 25 88.44 103.26 9 36.00
10665. NixNox (nixnox) 6 88.44 101.32 4 66.67
10666. spoon (noyoureaspoon) 12 88.43 101.69 5 41.67
10667. SinglePaper (singlepaper) 1 88.43 88.43 0 0.00
10668. Joshua (shaggymuffin23) 203 88.43 104.39 69 33.99
10669. Sophus (sophustypelikesheit) 6 88.43 109.23 1 16.67
10670. Someone (elderpotato) 17 88.42 104.55 6 35.29
10671. Nathan (axewtypes) 61 88.42 116.24 25 40.98
10672. flaskur (flaskur) 41 88.42 103.39 10 24.39
10673. ตาแดง (pitagorus) 21 88.42 99.17 5 23.81
10674. Harmonic (blitzzzz) 220 88.42 116.35 65 29.55
10675. brazil (brazilman2309) 2 88.41 88.71 2 100.00
10676. Denis (carvedseven) 4 88.41 91.76 1 25.00
10677. Proton (proton_rizing) 2 88.41 96.64 0 0.00
10678. Fast (cooloppo) 9 88.40 96.81 4 44.44
10679. Justin (lightningvoltix) 3 88.40 89.56 1 33.33
10680. Cole (csl2000) 1 88.40 88.40 1 100.00
10681. rope (rolnd) 4 88.40 97.90 1 25.00
10682. bonsii (jorhlo) 10 88.39 99.19 3 30.00
10683. david (davtet1) 13 88.39 109.42 6 46.15
10684. William (bobodahobo54) 239 88.39 105.80 65 27.20
10685. chubbypugs21 (chubbypugs21) 37 88.39 106.33 11 29.73
10686. tempo (tempoxyz) 13 88.39 109.89 6 46.15
10687. Aridia (aridia) 16 88.39 98.26 7 43.75
10688. Fiji (fijired2) 36 88.38 110.76 12 33.33
10689. sondosensei (sondosensei) 3 88.38 100.61 0 0.00
10690. laobiz (laobiz) 8 88.38 103.29 5 62.50
10691. Lock'd (lockd) 17 88.38 102.83 6 35.29
10692. deez (ishkena) 26 88.38 112.01 22 84.62
10693. Jaime Gabriel (_jetdoza) 231 88.38 123.70 76 32.90
10694. Crazzor (crazzor) 4 88.38 101.45 2 50.00
10695. dio (diocccc) 2 88.37 90.49 1 50.00
10696. Jay (wenisknees) 8 88.37 109.67 1 12.50
10697. ALixe (alix3) 2 88.37 89.45 1 50.00
10698. Stephen (nothamlet) 5 88.37 105.93 3 60.00
10699. Jewmo (jewmo) 40 88.37 107.20 24 60.00
10700. Wayne (spollox) 8 88.37 97.55 3 37.50
10701. B (batyrn) 5 88.37 106.10 4 80.00
10702. Lucifer (lucifer_kas) 49 88.36 116.04 23 46.94
10703. TC (snowboardnw) 6 88.36 107.25 1 16.67
10704. NRM (nrm87) 6 88.36 102.90 1 16.67
10705. Kevin (faelinvxd) 2 88.36 114.83 1 50.00
10706. ironmk11 (ironmk11) 70 88.36 107.27 21 30.00
10707. Chaerity (ssamurai) 51 88.36 101.99 14 27.45
10708. ¬Pianish (pnawan) 39 88.35 115.13 17 43.59
10709. Nan (nantuzi) 9 88.35 96.68 3 33.33
10710. Hyunjun (junct127) 4 88.35 100.54 2 50.00
10711. Zak (bazingazak_v2) 4 88.35 95.71 1 25.00
10712. Gio (giniguy) 7 88.34 98.66 3 42.86
10713. rg2005 (rg2005) 22 88.34 111.94 8 36.36
10714. KouTypin (kou_typingood) 1 88.34 88.34 1 100.00
10715. Tobiloba (thetobitron) 44 88.34 105.42 9 20.45
10716. Damn kid (dezzer_legend) 24 88.33 101.94 9 37.50
10717. Wzq (3125114) 26 88.32 100.52 6 23.08
10718. Tommy (pnkflwrs) 15 88.32 102.25 6 40.00
10719. oscar (ansgar92314) 82 88.32 106.83 27 32.93
10720. sun (september28) 1 88.32 88.32 0 0.00
10721. KM9 (kunal2795) 120 88.32 127.09 65 54.17
10722. Theroarx (theroarx) 156 88.32 112.14 53 33.97
10723. Jason (addictedtobacon) 6 88.32 106.61 4 66.67
10724. scubtle (scrubsworth) 41 88.31 100.20 15 36.59
10725. Brando (kingozymandias2) 13 88.31 98.78 6 46.15
10726. Max (maexxx) 9 88.31 93.30 2 22.22
10727. Julia (juliazc) 19 88.30 101.75 4 21.05
10728. Rebecca (221btimelord) 14 88.30 102.26 4 28.57
10729. amir (ioio) 19 88.30 113.80 13 68.42
10730. Gay Toyholi (l3hargav) 17 88.30 98.37 4 23.53
10731. Ian (arlybadgamer) 5 88.30 91.62 1 20.00
10732. Shivinder (shivindernarr) 1 88.30 88.30 1 100.00
10733. Zeb (foghorn) 3 88.30 95.14 2 66.67
10734. Tray (whitefalcon684) 11 88.29 102.25 3 27.27
10735. meli (meli0604) 61 88.29 109.28 18 29.51
10736. BaldricLinus (baldriclinus) 18 88.29 119.02 9 50.00
10737. Chris P. Bacon (spicy_toast) 28 88.28 104.95 11 39.29
10738. David (dstran) 4 88.28 103.08 4 100.00
10739. Nick (neepwithin) 392 88.28 108.08 150 38.27
10740. Stephen (stephen_g19) 2 88.28 94.15 2 100.00
10741. Konstantine (luke_erdman) 16 88.27 96.56 5 31.25
10742. Aidan (ireallylovehockey) 7 88.27 99.05 1 14.29
10743. Mythic (mythicsane) 4 88.27 90.97 0 0.00
10744. ratgirl (0pter) 4 88.27 95.01 3 75.00
10745. raymond (raymondrazer) 14 88.26 107.88 3 21.43
10746. captain357 (captaincool357) 12 88.26 111.57 7 58.33
10747. HedgeLow (hedgelow) 1 88.25 88.25 0 0.00
10748. Alex (longliveharambe) 6 88.25 97.40 2 33.33
10749. Sensei (jjxjacpot) 200 88.24 114.16 76 38.00
10750. Debojoti Das (debojoti_soumya) 16 88.24 98.70 7 43.75
10751. d'toe 😎😎😎😎 (det... 46 88.24 117.04 12 26.09
10752. Mar (aqancake) 58 88.24 107.34 22 37.93
10753. Tom (calder27) 3 88.24 104.73 2 66.67
10754. Jeff (witlessbox) 13 88.24 94.78 0 0.00
10755. Ayden (king_nedya) 11 88.24 102.11 3 27.27
10756. Arief (valliante) 69 88.24 105.53 31 44.93
10757. Kenneth (thedas) 72 88.23 109.79 25 34.72
10758. Enoch (jenks12) 1 88.23 88.23 1 100.00
10759. Kai (leavelux) 15 88.23 99.67 8 53.33
10760. ok (galaxybiscuit) 4 88.23 111.03 2 50.00
10761. kent (kenttranle) 1 88.22 88.22 0 0.00
10762. Bulky Hulk (avg_typist) 2 88.22 94.29 1 50.00
10763. ad (quqquqqqu) 5 88.22 97.06 2 40.00
10764. Jordan (cheetoburritoes) 9 88.22 95.72 3 33.33
10765. Paul (bunkerking) 4 88.22 99.88 1 25.00
10766. Brotolios (brotolios) 2 88.22 89.32 0 0.00
10767. Colin (typemaster612) 2 88.22 99.23 1 50.00
10768. Ko (__lo) 66 88.21 119.28 23 34.85
10769. com (sin_ical) 3 88.21 90.05 2 66.67
10770. Gilbert (sigalingging_23) 33 88.21 102.77 7 21.21
10771. BLU (glitterblonde) 170 88.20 110.31 57 33.53
10772. Jorgle (jorgleframpleton) 34 88.20 99.62 13 38.24
10773. Roma (useflame) 42 88.20 103.80 12 28.57
10774. Andy (saucycedo) 1 88.20 88.20 1 100.00
10775. Dylan (dtg32148) 165 88.20 111.68 61 36.97
10776. Abn0rmalzzz (abn0rmalzzz) 5 88.19 92.94 0 0.00
10777. dean (aydeano) 42 88.19 117.73 10 23.81
10778. Hyx (christianmoises) 11 88.19 96.78 0 0.00
10779. Keyzard (qwertyzard) 3 88.18 96.58 2 66.67
10780. Chanel (pandabean) 27 88.18 109.16 6 22.22
10781. justin (yourmuther) 2 88.18 122.12 1 50.00
10782. wasituf (wasit12348) 2 88.18 100.50 0 0.00
10783. Pisit (compisit) 162 88.17 112.69 48 29.63
10784. Darjinero (darjinero) 20 88.17 99.41 9 45.00
10785. Mustafa (mustafaalyagoub) 26 88.16 101.69 5 19.23
10786. Jannyx (nyxal) 91 88.15 111.97 31 34.07
10787. ed (bigponpon) 13 88.15 102.64 1 7.69
10788. Zapphy (ronaldlincon) 40 88.15 114.57 27 67.50
10789. Morgan (morche202) 4 88.15 97.50 1 25.00
10790. Fiona (fiona55) 48 88.15 104.17 13 27.08
10791. Shiba (jasjaapdua) 35 88.15 105.05 17 48.57
10792. Teddy (teddyhol) 6 88.15 101.00 2 33.33
10793. Elizabeth (downbeat) 2 88.15 97.92 1 50.00
10794. N (crazycalm007) 41 88.14 105.61 9 21.95
10795. Lance (gulickle) 3 88.14 90.82 1 33.33
10796. Russ (russcoder) 55 88.14 115.91 20 36.36
10797. Adam (adamxlofaro) 8 88.14 100.30 3 37.50
10798. Speed (speed_demon_123) 6 88.13 107.24 2 33.33
10799. Ben (iamveryslowlol) 1 88.13 88.13 0 0.00
10800. A (andrewg124) 4 88.13 101.47 1 25.00
10801. Eder (edertyper) 29 88.13 103.04 10 34.48
10802. Raj (raj__) 31 88.12 106.16 10 32.26
10803. Steven (boomkat) 31 88.12 113.59 9 29.03
10804. Khai (superoiishi) 205 88.12 106.31 78 38.05
10805. Jonathan (blue_blobfish) 21 88.11 104.88 5 23.81
10806. Corey (i_dont_like_anime) 21 88.11 113.44 7 33.33
10807. Craig (jitterjuicegaming) 66 88.11 104.12 18 27.27
10808. Fealing (typistboy) 29 88.11 104.98 6 20.69
10809. randy (randy022) 2 88.11 98.79 1 50.00
10810. Keegan (kekky) 3 88.10 95.59 0 0.00
10811. Abhisek (_typing_) 1,284 88.10 113.56 411 32.01
10812. pylori (pylori) 66 88.10 108.75 24 36.36
10813. Blake (bpermenter) 1 88.10 88.10 0 0.00
10814. Parker (ghxstie) 3 88.10 92.92 0 0.00
10815. Chris (aschlar) 15 88.09 119.53 3 20.00
10816. Shubham (omnissan) 1 88.08 88.08 0 0.00
10817. Sakib (mahmud1) 7 88.08 102.66 2 28.57
10818. Andrej (akithereaper8) 1 88.08 88.08 0 0.00
10819. andrei (uncleandre) 23 88.08 119.52 8 34.78
10820. Amanda (simplesecretsauce) 66 88.07 107.94 18 27.27
10821. 6226 (6226) 89 88.07 104.02 26 29.21
10822. Alden (obeezy) 4 88.07 93.90 3 75.00
10823. Wepeel (wepeel) 58 88.07 122.85 22 37.93
10824. TroulM (troulm) 12 88.06 102.85 4 33.33
10825. Ahmad (itsahmd25) 6 88.05 106.32 3 50.00
10826. Tanel (xax1) 1 88.05 88.05 0 0.00
10827. Mike (mferger92) 3 88.05 98.62 1 33.33
10828. Muaj17 (muaj17) 54 88.04 110.32 36 66.67
10829. Saucter (saucter) 920 88.03 118.87 296 32.17
10830. Yani (311yani) 1 88.03 88.03 0 0.00
10831. Em (cookie666) 133 88.03 111.19 93 69.92
10832. Sinon (ajey_de_shadow) 9 88.02 94.17 3 33.33
10833. Hyunsu (onlyu0923) 562 88.02 115.31 161 28.65
10834. vamsi (vamsivadrevu) 28 88.02 109.34 8 28.57
10835. lRaml (lsomeonel) 59 88.02 108.63 23 38.98
10836. Nidzi (nidzi) 1 88.02 88.02 1 100.00
10837. Saurav (sauravdeore) 75 88.01 103.92 22 29.33
10838. Zak (zak_roger) 327 88.01 109.38 113 34.56
10839. GIMLY98 (gimly98) 12 88.01 111.61 5 41.67
10840. Uros (uroskrunic1988) 40 88.01 100.11 13 32.50
10841. ethxn (cxntrxl) 13 88.01 99.79 4 30.77
10842. Zach (morcheeba) 6 88.01 97.87 2 33.33
10843. Sheldon (rooksword3393) 72 88.01 106.47 15 20.83
10844. Jacob (jacobf01) 5 88.01 95.17 1 20.00
10845. Hunter (hunter_da_man11) 270 88.01 112.47 81 30.00
10846. Theodor (prospitianknightma... 13 88.00 106.00 7 53.85
10847. Joemama (captainpj) 6 88.00 108.08 2 33.33
10848. Liz (l1gh73r) 2 88.00 92.22 2 100.00
10849. Yuri (ceaseless_melon) 13 88.00 104.21 6 46.15
10850. yo (fruitjuices) 4 88.00 98.30 2 50.00
10851. Henry (fastypr) 27 88.00 106.38 15 55.56
10852. Nieid (nieid) 32 87.99 116.68 14 43.75
10853. Joy (joyyang810035) 22 87.99 118.20 8 36.36
10854. Ryan (rinselmann) 210 87.99 103.57 70 33.33
10855. Mark (maolson97) 21 87.98 107.89 6 28.57
10856. Sigmund (sir_renardwil) 153 87.98 109.61 49 32.03
10857. 3.14 (rom3_141592) 202 87.98 118.75 47 23.27
10858. Tyler (djfjt93) 6 87.98 103.48 0 0.00
10859. Deen (deenibsyed) 33 87.98 99.50 9 27.27
10860. serdna (idfwpercs) 2 87.98 90.26 2 100.00
10861. Emmanuel (ugochuku2000) 18 87.97 105.64 9 50.00
10862. Nick (cluelessneep) 165 87.96 101.08 46 27.88
10863. Michael (hulkmagnet) 23 87.96 99.42 6 26.09
10864. Chuanyao (finalconflux) 32 87.96 111.04 13 40.63
10865. Rafael (syrena) 43 87.96 109.14 13 30.23
10866. Luciano (wizing) 1 87.96 87.96 1 100.00
10867. Marek (mp4mero) 1 87.96 87.96 1 100.00
10868. Just (justalittlewolf) 3 87.96 91.82 1 33.33
10869. Lil Mama (ckennedy07) 839 87.95 109.80 232 27.65
10870. slowAf (slow_af_dvorak) 31 87.95 113.67 6 19.35
10871. moonlight (moonlight_21) 9 87.94 103.69 5 55.56
10872. Noemi (tsunommi) 16 87.94 119.76 0 0.00
10873. sumuttaja (sumuttaja) 6 87.94 95.26 4 66.67
10874. Rodrigo (rodrigoferrer) 44 87.93 101.55 17 38.64
10875. Aaron (aarone123) 54 87.93 101.01 16 29.63
10876. Ken (leei) 6 87.93 107.82 2 33.33
10877. Kakashi (hatakeclan) 10 87.93 112.81 4 40.00
10878. Big Pop (broguyman) 113 87.93 110.12 26 23.01
10879. Wouter (wouter_kuijk) 128 87.93 106.98 40 31.25
10880. lol (_harmandeep16) 2 87.93 90.10 1 50.00
10881. CuddleCookie (cuddlecookie) 1 87.93 87.93 1 100.00
10882. josh (cubuff8) 3 87.93 103.19 1 33.33
10883. Jacob (phlid) 2 87.93 91.78 1 50.00
10884. . (kestrel342) 1 87.93 87.93 1 100.00
10885. Tanvir (tanvir187) 36 87.92 110.45 9 25.00
10886. Marco (leungtc20001124) 13 87.91 96.30 3 23.08
10887. Liz (lizzyshoe) 1 87.91 87.91 0 0.00
10888. Julian (julbball) 1 87.91 87.91 0 0.00
10889. Grey (grey2) 44 87.91 109.70 12 27.27
10890. Veedek (veedek) 25 87.91 111.31 8 32.00
10891. Justin (kingtempo) 1 87.90 87.90 0 0.00
10892. TheUltimateMeme (theultimat... 2 87.90 90.16 0 0.00
10893. Zachery (zacca113) 6 87.89 95.02 2 33.33
10894. JDSpark (jdspark) 13 87.89 111.01 4 30.77
10895. tstats[saduman] (saduman) 183 87.89 111.70 67 36.61
10896. Dark (monevtna) 1 87.89 87.89 0 0.00
10897. Epoch (epochisepic) 16 87.89 104.51 4 25.00
10898. 😳 (expertgeneralist) 118 87.89 111.31 35 29.66
10899. asdf (itz_pvp1235) 140 87.89 110.30 50 35.71
10900. Earnest (redwhirl) 40 87.88 97.91 15 37.50
10901. Zhikouan (mikelee543) 20 87.88 101.44 7 35.00
10902. Artem (gushinartem) 1,071 87.88 135.69 364 33.99
10903. Use an appropriate name (ne... 1 87.88 87.88 0 0.00
10904. Apathy (apathyy) 29 87.88 103.90 8 27.59
10905. Brody (bingbongbottledong) 5 87.87 98.34 1 20.00
10906. Zils (zils_) 101 87.87 101.96 29 28.71
10907. Minnie (minniemouselondon) 228 87.86 111.45 75 32.89
10908. Superior (brother_v) 2 87.86 103.90 1 50.00
10909. derp (gavzzz) 1 87.86 87.86 0 0.00
10910. tstats[sivert_ivert] (siver... 19 87.85 112.44 5 26.32
10911. a (shibss) 7 87.85 100.10 3 42.86
10912. Nathan (papapapow) 1 87.85 87.85 0 0.00
10913. Neal (newbcake) 1 87.85 87.85 1 100.00
10914. ks (sempiedram) 50 87.85 108.68 11 22.00
10915. Shayne (shayneacasio) 242 87.85 124.52 81 33.47
10916. Siavash (siavash3) 4 87.85 97.29 1 25.00
10917. Edward (batskater1234) 75 87.84 135.94 20 26.67
10918. Joe (__joe___mama__) 235 87.84 119.29 62 26.38
10919. Cole (cmacd) 10 87.84 97.88 2 20.00
10920. Alyssa (clarrissa) 1 87.84 87.84 1 100.00
10921. scary (superdry) 1 87.84 87.84 1 100.00
10922. Che (che247) 5 87.84 90.53 1 20.00
10923. Aleksandar (alexg2003) 8 87.84 101.49 2 25.00
10924. Himeko (woahhhhhhhhh) 5 87.84 103.23 5 100.00
10925. Paul (___paul___) 17 87.84 102.23 5 29.41
10926. Tunmsie (tunmi_dev) 71 87.84 104.96 26 36.62
10927. lame (lamellae) 2 87.84 93.96 0 0.00
10928. AlittleJuku (alittlegook) 3 87.83 91.24 2 66.67
10929. Torrin (t0rr1n) 301 87.83 110.24 96 31.89
10930. Wayne (retroweezy) 73 87.83 105.91 29 39.73
10931. Keshav (waldotheonlyone) 1 87.83 87.83 0 0.00
10932. ehe (aeronsic) 105 87.83 100.26 30 28.57
10933. Rokas (rokasa369) 62 87.82 106.82 25 40.32
10934. Raostrich (raostrich) 9 87.82 98.57 2 22.22
10935. Omar (omareffat) 4 87.82 100.21 1 25.00
10936. Andreas (sgtreent) 31 87.81 105.61 15 48.39
10937. Anders (andersranum) 3 87.81 89.26 3 100.00
10938. Filip (sodic) 24 87.81 105.04 13 54.17
10939. Evan (eflem32) 6 87.81 100.24 2 33.33
10940. RIP RECKFUL (zyphal) 2 87.80 91.72 1 50.00
10941. hoang viet (waniku) 1 87.80 87.80 1 100.00
10942. Artemida (gayswordfish) 8 87.80 104.77 3 37.50
10943. Lena (lena2020345) 6 87.80 97.19 1 16.67
10944. Stijn (capslockstuck) 2 87.80 88.41 0 0.00
10945. Pandaru (grancrackerr) 9 87.79 97.68 5 55.56
10946. Jure (jujecat) 10 87.79 103.05 1 10.00
10947. Minerstove (minerstove) 4 87.79 106.44 2 50.00
10948. Aviram (adsherun) 16 87.78 107.68 4 25.00
10949. Cody (5niffles) 11 87.78 100.34 4 36.36
10950. tstats[catpuplover] (catpup... 2 87.78 97.73 0 0.00
10951. (razor11223344) 58 87.78 100.28 23 39.66
10952. kellog's (wnluqmnn) 11 87.78 109.92 4 36.36
10953. Andres (avillarreal14) 44 87.77 99.35 8 18.18
10954. Mistah (mistahd) 1 87.77 87.77 0 0.00
10955. Richard (mrm3man) 7 87.77 97.74 2 28.57
10956. Zoniax (_zephr) 12 87.77 111.96 4 33.33
10957. Carter (carter44502) 41 87.76 102.10 10 24.39
10958. Marcus Armstrong (down_with... 14 87.76 101.08 2 14.29
10959. Jacob (hydrogenation) 126 87.76 116.76 40 31.75
10960. Javla (javlafan) 13 87.76 106.19 5 38.46
10961. Kon (bagelkat) 5 87.76 97.39 3 60.00
10962. Farid (faridmusayev) 70 87.75 118.17 24 34.29
10963. Dexter (dexter2fast) 21 87.75 105.81 8 38.10
10964. paffy (paffy77) 23 87.75 103.31 8 34.78
10965. a (poopeater10231) 3 87.74 96.50 3 100.00
10966. Dustin (dustin099) 32 87.74 104.16 12 37.50
10967. Jole (sliceoflife) 87 87.74 103.19 33 37.93
10968. Max (maxlikesstuff) 5 87.74 92.58 3 60.00
10969. Dasha (thedashaier) 38 87.73 100.44 17 44.74
10970. Mack (mackimations) 19 87.73 100.76 7 36.84
10971. Gilbert (ooblek) 35 87.73 106.44 10 28.57
10972. Neil (neilt_) 63 87.73 103.71 17 26.98
10973. Arvin (vin_ar) 520 87.72 113.94 190 36.54
10974. lukman (kopimaniz) 261 87.72 104.81 87 33.33
10975. Bluey (blu_ey) 7 87.72 97.46 1 14.29
10976. Nanos (nanos) 6 87.72 100.88 1 16.67
10977. jeremiah (jeremiah12345) 97 87.72 106.98 32 32.99
10978. Edwin (minsil) 16 87.72 104.94 8 50.00
10979. ivan (electro27) 2 87.72 91.53 1 50.00
10980. vineel (vineel) 16 87.71 102.11 4 25.00
10981. Alex (silverax3) 40 87.71 101.78 13 32.50
10982. Jack (senteran) 2 87.71 89.84 2 100.00
10983. Pablo (praguevara) 1 87.71 87.71 0 0.00
10984. Mayank (minkk777) 9 87.71 99.60 3 33.33
10985. Nathanael James (dyemz) 21 87.71 98.70 7 33.33
10986. Math (faster_babe) 253 87.70 103.38 69 27.27
10987. ark (arkundu) 59 87.70 111.76 41 69.49
10988. Steve (jack_of_all_trades) 64 87.70 103.39 23 35.94
10989. Hoang (hoang26hoang) 1 87.70 87.70 1 100.00
10990. Valtra (palap0n) 1 87.70 87.70 1 100.00
10991. Jerm (professional_keyboard... 99 87.70 123.50 36 36.36
10992. PJR (petrosyan_jr) 156 87.70 104.82 56 35.90
10993. shiba inu (bamboozledshibe) 104 87.70 124.01 32 30.77
10994. Could be you (cycosniper) 22 87.69 113.71 6 27.27
10995. Suken (x_suken_x) 17 87.69 102.04 4 23.53
10996. Arvid (arvid220u) 2 87.69 98.41 0 0.00
10997. acrymoore (acrymoore) 45 87.69 101.48 15 33.33
10998. Armtz (knotavink) 4 87.69 93.90 2 50.00
10999. Ricky (ryckler) 10 87.68 100.95 5 50.00
11000. Keno (kmoreland1) 4 87.68 101.19 1 25.00
11001. Nick (nickstoni) 1 87.68 87.68 0 0.00
11002. Pady (hundertzwoelf) 11 87.68 104.13 1 9.09
11003. Thi (rodingersmg) 38 87.67 107.95 11 28.95
11004. Lucas (maxicalcio) 1 87.67 87.67 0 0.00
11005. Che (cherry3330) 6 87.67 97.24 4 66.67
11006. Florin (florsis) 2 87.67 89.89 2 100.00
11007. Dant (dancal22) 5 87.66 94.81 2 40.00
11008. Jarrett (jarrettedward) 1 87.66 87.66 0 0.00
11009. Golden guy (aggressor2007) 5 87.66 94.31 3 60.00
11010. CHRISTIAN (chris7ka) 12 87.65 107.84 4 33.33
11011. Sophie (sophie0413) 11 87.65 102.92 2 18.18
11012. Spritly (spritly) 88 87.65 106.65 30 34.09
11013. Callum (specktome26) 162 87.65 111.02 40 24.69
11014. Kin (kccchiu) 9 87.65 93.20 2 22.22
11015. Ryan (ryan_ng1234) 2 87.65 103.72 2 100.00
11016. Chris (gatoroid37) 142 87.64 111.93 39 27.46
11017. Dominic (t4dominic) 4 87.64 92.45 2 50.00
11018. icosaedru (achimia) 24 87.64 98.29 6 25.00
11019. (kloodah) 6 87.64 107.03 0 0.00
11020. Minaricano (minaricano) 153 87.63 113.61 43 28.10
11021. Derrick (wnorad) 4 87.63 97.49 3 75.00
11022. Ramses (boinkey) 1,179 87.63 125.10 335 28.41
11023. Alonne (freeman_1337) 16 87.63 95.44 8 50.00
11024. Dayna (daynarrr) 273 87.63 122.42 93 34.07
11025. TheStyne (fixinit1) 50 87.63 120.50 17 34.00
11026. Kyle (evilone2654) 4 87.63 92.07 4 100.00
11027. Neptium (dan_neptium) 2 87.63 90.95 1 50.00
11028. 𝖘𝖆𝖙𝖗𝖙𝖒... 2 87.63 94.32 1 50.00
11029. trashbin (ennoch) 5 87.62 95.16 3 60.00
11030. chunchunmaru (mr_mystery4896) 78 87.62 116.87 30 38.46
11031. Sydney (sydholla) 298 87.62 115.41 82 27.52
11032. horyzen1 nq (lucknumber8) 137 87.62 119.49 44 32.12
11033. Connor (c42855) 12 87.61 101.10 4 33.33
11034. Miko (kimonoso) 23 87.61 102.17 8 34.78
11035. Nana (cypher404) 13 87.61 109.59 4 30.77
11036. Aj (x2happy123) 1 87.61 87.61 0 0.00
11037. Wokboi (wokboi) 1 87.61 87.61 1 100.00
11038. tstats[liljuicebox491] (lil... 60 87.61 126.63 16 26.67
11039. Ev (complexion) 25 87.61 106.21 9 36.00
11040. Alex (arint) 214 87.60 113.16 71 33.18
11041. Jaden (dissolver) 1 87.60 87.60 0 0.00
11042. Alanna (alannafey) 1 87.60 87.60 0 0.00
11043. clarence (zerogly) 108 87.60 104.87 39 36.11
11044. trut (trut) 20 87.60 100.61 4 20.00
11045. Josef (mcblyat) 4 87.60 95.10 1 25.00
11046. John (ihavebigpen15) 1 87.59 87.59 0 0.00
11047. Arath (arathjz) 12 87.59 98.17 5 41.67
11048. ashbellebsha (ashbel_g) 36 87.59 113.25 9 25.00
11049. Cache (cachemonet) 8 87.58 95.61 2 25.00
11050. CornPacs (cornpacs) 258 87.58 107.48 79 30.62
11051. Best WiFi (bestwifi) 37 87.58 101.64 19 51.35
11052. Not (notpeo) 1 87.58 87.58 0 0.00
11053. Patches (mr_bear101) 5 87.57 98.22 1 20.00
11054. Monroe (monroeshindelar) 211 87.57 111.47 53 25.12
11055. Dileep (dileepnk) 34 87.57 117.66 11 32.35
11056. Godrod (god_of_rods) 394 87.57 111.22 111 28.17
11057. Ben (bv_nie) 29 87.57 112.42 8 27.59
11058. Lasi (lasileuka) 436 87.57 110.10 141 32.34
11059. David (donkykong2008) 3 87.57 94.62 2 66.67
11060. Erek-Shin (t0sh1ro) 3 87.56 91.39 1 33.33
11061. Ian (iboletchek) 3 87.56 89.74 1 33.33
11062. Ceres (the445guy) 97 87.56 115.48 38 39.18
11063. abukoj (abukoj) 2 87.56 87.92 0 0.00
11064. seanghong (hongracer) 11 87.55 100.47 3 27.27
11065. Jacob Miko (makoton815) 3 87.55 91.96 2 66.67
11066. Jess (zhoujt23) 3 87.55 97.56 0 0.00
11067. Wen (legendxiang) 33 87.54 105.84 11 33.33
11068. Toasted (toastedsunglasses) 1 87.54 87.54 1 100.00
11069. Mae (maesmith) 3 87.54 91.16 1 33.33
11070. Fishy (fishyshocks) 2 87.54 93.21 0 0.00
11071. shoop (crimmsy) 9 87.53 98.64 4 44.44
11072. Suhas (suhaskurup) 46 87.53 101.81 13 28.26
11073. Eli (eberger03) 70 87.53 110.01 23 32.86
11074. RoundCustard (dragontunglam) 4 87.53 97.12 3 75.00
11075. Jason (nhtiger) 7 87.53 105.42 2 28.57
11076. skream² (galil_gaben) 3 87.53 93.02 1 33.33
11077. taco (hehehetacos) 2 87.53 87.54 1 50.00
11078. Rosie (rosepose90) 6 87.52 101.03 1 16.67
11079. Jamal (xflash) 276 87.52 116.42 92 33.33
11080. Mo (mosidhom) 44 87.52 109.37 13 29.55
11081. Muzakki (muzakkiha) 30 87.52 104.02 6 20.00
11082. Anonymous (mntlprblm) 42 87.52 113.60 17 40.48
11083. noahrwilly (noahrwilly) 26 87.52 99.28 9 34.62
11084. Jovan (zer0neon) 6 87.52 95.83 3 50.00
11085. PicturingFrames (frame_abil... 750 87.51 135.92 235 31.33
11086. Jan (zeekat) 61 87.51 118.47 16 26.23
11087. Biggus (biggboii18) 338 87.51 117.49 94 27.81
11088. iCursedReaper (icursedreaper) 2 87.51 105.27 1 50.00
11089. maxf (maxf8) 9 87.51 100.12 5 55.56
11090. hehe (spicyaim) 3 87.50 90.70 1 33.33
11091. Kato (mkatoh) 41 87.50 108.43 15 36.59
11092. Nol (iileeper) 3 87.50 93.74 2 66.67
11093. bruh (diablodvorak) 141 87.49 106.53 35 24.82
11094. slowmxbrowns (slowmxbrowns) 32 87.49 103.65 10 31.25
11095. johnny :P (johnny234) 128 87.49 108.27 39 30.47
11096. Price (chickenpowerftw) 77 87.49 115.77 19 24.68
11097. John (wilde1) 16 87.49 107.82 6 37.50
11098. RyanNXD0120 (xuanduy1269) 66 87.49 109.80 27 40.91
11099. Joakim (eraji) 1 87.49 87.49 0 0.00
11100. PNBLVN (pnblvn) 17 87.49 101.95 5 29.41
11101. Justin (ustinj) 147 87.49 112.07 44 29.93
11102. neo (eliteneo_dvo) 30 87.49 101.05 8 26.67
11103. svime (svime) 7 87.48 111.91 3 42.86
11104. James (jpnjpn6) 51 87.48 109.54 22 43.14
11105. eeya (eeya) 1 87.48 87.48 0 0.00
11106. Pooky! (poooooky) 2 87.48 96.96 2 100.00
11107. ton (tonton31) 97 87.47 110.43 32 32.99
11108. Kishore (kishorep) 3 87.47 92.82 2 66.67
11109. Tony (nomind) 1 87.47 87.47 0 0.00
11110. Dan (114_ddo) 2 87.47 95.63 0 0.00
11111. Louis (loucru1) 70 87.47 106.02 21 30.00
11112. tstats[borzoian40] (borzoia... 41 87.46 106.13 18 43.90
11113. BEing VinCI (ppubalo) 140 87.46 112.12 49 35.00
11114. ayden 🍓 (aydenkm) 10 87.46 109.44 2 20.00
11115. Ivan (evanmico) 26 87.46 96.71 19 73.08
11116. Seb (sebastiancv) 59 87.46 106.19 19 32.20
11117. Hao (truonganhhao) 23 87.45 107.82 8 34.78
11118. Rolling Thunder (barkingside) 4 87.45 90.23 0 0.00
11119. Hanseol (observance) 6 87.45 101.31 1 16.67
11120. pizza (jsoccerdude@msn.com) 260 87.45 118.20 79 30.38
11121. mv0 (the_oko) 243 87.45 104.09 75 30.86
11122. mrow (statim) 146 87.44 111.09 54 36.99
11123. Mohamad (mhmd_khlf) 30 87.44 95.75 5 16.67
11124. Henry (7enry) 2 87.44 97.72 1 50.00
11125. Shin (shinfx) 51 87.44 106.58 20 39.22
11126. Isabelle (isabook) 18 87.44 100.53 7 38.89
11127. AJ (alquinso_) 11 87.43 100.61 3 27.27
11128. bruh (peplee_) 13 87.43 105.78 2 15.38
11129. eljugadormejor (mxntal) 2 87.43 97.49 1 50.00
11130. Tidez (tidez3) 3 87.42 89.43 1 33.33
11131. Big Booty T (sexy_dino) 12 87.42 95.92 2 16.67
11132. Y (ydelirious) 16 87.42 106.82 4 25.00
11133. Sompang (mplegato) 19 87.42 98.32 5 26.32
11134. drew (drewg2009) 15 87.41 103.29 5 33.33
11135. Balraj (noob_racer_96) 4 87.41 93.79 0 0.00
11136. Frederich (acerx032) 48 87.41 106.71 18 37.50
11137. Joshua (0forphysics) 4 87.41 88.45 1 25.00
11138. Marco (deggamargo) 4 87.41 93.59 2 50.00
11139. Your (bossspy75) 4 87.41 91.19 1 25.00
11140. vekikornjaca (vekikornjaca) 35 87.41 109.11 17 48.57
11141. Shonade (mr_overclocked) 125 87.40 128.17 32 25.60
11142. Yash (yashshingade28) 921 87.40 116.14 341 37.02
11143. Requiem (requiemsolution) 4 87.40 93.25 1 25.00
11144. Michael (rucc) 17 87.40 109.99 9 52.94
11145. Asado (asado) 2 87.40 88.37 1 50.00
11146. Daedalus (daedalusmahda) 27 87.39 98.46 14 51.85
11147. Sheraz (toruowo) 23 87.39 109.15 8 34.78
11148. sliptok (sliptok) 135 87.39 115.91 38 28.15
11149. Shan (liushanen) 15 87.38 97.44 4 26.67
11150. Ryan (theguy985) 33 87.38 119.70 14 42.42
11151. Sike (creme_egg) 4 87.38 93.46 3 75.00
11152. Newtan (newtan) 2 87.38 97.50 1 50.00
11153. Francisco (cdt1) 272 87.38 112.78 80 29.41
11154. Miles (milesgendreau) 15 87.38 108.00 5 33.33
11155. Ankit Kumar (ankitnain) 889 87.38 119.81 612 68.84
11156. Dawg (goon_goonster) 37 87.37 104.00 13 35.14
11157. Gordon (boboiv) 32 87.37 114.90 8 25.00
11158. Jakob (jdwalburger) 11 87.36 104.42 7 63.64
11159. Marcus (snuskbulle) 9 87.36 97.23 2 22.22
11160. Anthony (anto_onwuka) 9 87.36 92.89 1 11.11
11161. Its Me (infinityyt) 15 87.35 107.34 8 53.33
11162. Mike (mhaimowitz) 7 87.35 91.89 2 28.57
11163. Gabriel (chocolate_dude) 1 87.35 87.35 0 0.00
11164. Wok (wok_e) 1 87.35 87.35 0 0.00
11165. Zach (malkyie) 16 87.34 110.30 6 37.50
11166. Trim (tuechombe) 3 87.34 90.00 2 66.67
11167. Lu-Wai (luhyphenwai) 1 87.34 87.34 1 100.00
11168. cody (ocdy1001) 198 87.34 109.40 65 32.83
11169. Logan (toast_scrubber) 15 87.34 104.49 4 26.67
11170. zhen (zhen_pei) 57 87.34 118.40 16 28.07
11171. NextGoal Avg. 115WPM (redjhon) 455 87.33 123.02 162 35.60
11172. bob (zirx2) 18 87.33 100.02 3 16.67
11173. Kevin (kevinstark10) 17 87.33 103.82 5 29.41
11174. Joshua (joshuasymes) 18 87.33 105.68 8 44.44
11175. A (a_goldfish) 4 87.32 94.91 2 50.00
11176. Gordon (gordon_ramsay) 203 87.32 106.13 63 31.03
11177. Jacob (bruh3323) 1 87.32 87.32 1 100.00
11178. Cyrus (zombie_kid_likes_tur... 19 87.32 114.42 5 26.32
11179. Nooby (noobythenoob) 144 87.32 110.70 51 35.42
11180. krt_ (krt_) 3 87.31 95.91 1 33.33
11181. jonjonbon (jonjonbon) 3 87.31 96.59 1 33.33
11182. Mert (mertle) 5 87.31 90.74 0 0.00
11183. FadedSpirits (fadedspirits) 10 87.29 100.25 2 20.00
11184. Chaos (chaoszed) 237 87.29 112.28 80 33.76
11185. Daito (blucantrell) 234 87.29 112.94 65 27.78
11186. elnino (elnio2803) 11 87.29 104.24 2 18.18
11187. lemonwaterr (lemonwaterr) 3 87.29 91.74 1 33.33
11188. Willy (paxson2008) 10 87.28 96.04 4 40.00
11189. Matthew (potqto) 9 87.28 102.53 1 11.11
11190. Robert (typefingerpl) 3 87.28 89.54 0 0.00
11191. 799 (khs4126428) 102 87.28 111.52 31 30.39
11192. Gnarly (gnarlydawg) 205 87.28 110.08 53 25.85
11193. Matan (matan_ati) 13 87.28 99.25 7 53.85
11194. double (doubleliftisgod) 5 87.28 96.82 0 0.00
11195. Clickau (clickau) 7 87.28 90.88 1 14.29
11196. Splint (osamabinsmokin) 6 87.28 103.24 2 33.33
11197. Nicholas (nemath) 30 87.27 106.65 10 33.33
11198. ungabunga (ungabungaoobunga) 19 87.27 110.66 4 21.05
11199. Seann (seanntastic) 2 87.27 93.61 2 100.00
11200. Spidget finger (djurancigan) 16 87.26 104.95 3 18.75
11201. galactic (galacticpig) 1 87.26 87.26 0 0.00
11202. Karl (xillionpro) 336 87.26 121.99 105 31.25
11203. Anel (anelbeads) 15 87.26 104.19 6 40.00
11204. ronald (ronaldalbarn) 32 87.25 105.65 7 21.88
11205. arun (noobtyperarun) 103 87.25 119.05 53 51.46
11206. Type (csong03) 2 87.25 94.66 0 0.00
11207. Danial (fadyboi) 8 87.24 92.22 3 37.50
11208. Eden (sunkmantis) 3 87.24 92.32 1 33.33
11209. Rylan (moonraker505) 27 87.24 110.10 17 62.96
11210. sk (skdreams) 15 87.24 97.31 5 33.33
11211. Grant (gbuff) 7 87.24 94.80 1 14.29
11212. kyel (txkyel) 7 87.24 91.33 1 14.29
11213. Eric (envyhope) 32 87.24 103.21 9 28.13
11214. マット (mat_rusty) 5 87.24 90.98 1 20.00
11215. T (dolphintail902) 4 87.24 95.66 1 25.00
11216. Brandon (pastaneko) 8 87.24 95.54 1 12.50
11217. Ben (benjermanloo) 2 87.24 96.33 1 50.00
11218. learning djorjak (blondebois) 37 87.23 110.52 14 37.84
11219. Isaac (ipohzw) 20 87.23 111.04 8 40.00
11220. Joerty (joertsy) 3 87.23 102.40 1 33.33
11221. Night (nightvc) 6 87.23 96.89 3 50.00
11222. Zheng_Dao (marmot0814) 15 87.22 104.07 5 33.33
11223. Leroy (fazecringe) 59 87.22 107.09 20 33.90
11224. Kyle (dragonvids) 2 87.22 91.53 1 50.00
11225. Reshoup (reshoup) 3 87.22 93.12 1 33.33
11226. Brodie (iambrodie) 1 87.22 87.22 1 100.00
11227. crowdofworkmen (bu_te) 10 87.22 96.34 5 50.00
11228. Gremble (gremble) 3 87.22 91.20 1 33.33
11229. Husain (yahyahusain) 11 87.22 102.47 9 81.82
11230. pho (chagio) 2 87.22 97.96 1 50.00
11231. O]]!! (prvlg) 20 87.21 104.01 8 40.00
11232. amalia (chowdergirl) 33 87.21 108.56 10 30.30
11233. CHKR (chkr) 7 87.21 94.53 2 28.57
11234. Mohit (mohitisgreat) 5 87.21 93.49 4 80.00
11235. Char (char_meleon) 23 87.21 108.28 5 21.74
11236. Phi (ze_phi) 43 87.20 102.13 16 37.21
11237. jim (pstengyawa) 388 87.20 120.04 133 34.28
11238. Justin (liontan) 67 87.20 104.74 28 41.79
11239. oShado (shadowwalker15) 23 87.20 108.25 6 26.09
11240. mrbean (mrbean1) 243 87.20 104.54 95 39.09
11241. William (guccihavarti) 1 87.20 87.20 0 0.00
11242. Patrick (patbl) 29 87.20 108.40 14 48.28
11243. Lars (aaberg) 30 87.20 100.60 5 16.67
11244. swirly (swirlybump) 5 87.20 98.19 2 40.00
11245. Peter (petero) 11 87.19 96.06 2 18.18
11246. Kenzo (raindropping) 5 87.19 100.01 3 60.00
11247. jeremy (grrmee) 7 87.19 94.18 3 42.86
11248. Rich (r1hh) 30 87.19 108.99 10 33.33
11249. Brandon (brandonsg) 10 87.19 100.23 2 20.00
11250. Kael (wshuwshuwshi) 14 87.19 97.01 4 28.57
11251. ramennoodles924 (ramennoodl... 14 87.19 108.40 3 21.43
11252. Jo (jococonutty) 265 87.19 110.79 90 33.96
11253. MIKA (oniichan69) 184 87.18 125.42 63 34.24
11254. ayush (rocky1708) 495 87.18 116.52 158 31.92
11255. Felipe (felipegomes) 1 87.18 87.18 0 0.00
11256. Nicolas (silwr) 1 87.18 87.18 0 0.00
11257. perky (theperkiestpotato) 8 87.18 96.22 2 25.00
11258. Dustin (sdustink) 14 87.17 100.05 7 50.00
11259. N W (niwore) 182 87.17 109.82 57 31.32
11260. Etesam (smogchalk) 6 87.17 101.50 3 50.00
11261. Noah (bobothechimpanzee) 49 87.17 100.86 15 30.61
11262. Nghia (ntn20112006) 12 87.16 102.93 3 25.00
11263. Brady (tajooki) 7 87.16 105.37 3 42.86
11264. Cootsynanus (a_yellow_evan) 10 87.16 100.35 3 30.00
11265. Christian (thermikk) 26 87.16 113.86 7 26.92
11266. Kimber (kjmlink) 2 87.16 94.09 0 0.00
11267. Ashwin (ashwinkey04) 1 87.15 87.15 0 0.00
11268. bubu (cgfu) 5 87.14 94.40 4 80.00
11269. Colin (typeofwhey) 11 87.14 101.16 3 27.27
11270. Ryan (bluesquirrel) 37 87.14 109.97 12 32.43
11271. Derf (fredboi) 5 87.14 111.62 2 40.00
11272. idkwhojamesis (idkwhojamesis) 11 87.14 99.92 1 9.09
11273. K (duhhhhhhhhhhh) 21 87.14 106.22 8 38.10
11274. Chris (chris_9001) 31 87.13 107.14 19 61.29
11275. Workman (dagl200) 786 87.13 115.06 245 31.17
11276. Andy (mrfoggz) 20 87.13 95.69 2 10.00
11277. Noob (touchhyper) 13 87.13 120.50 5 38.46
11278. Jc (jcjcjc_1) 4 87.12 96.73 1 25.00
11279. m_j (dontlistentome) 80 87.12 115.94 25 31.25
11280. Ansh (anshr) 4 87.12 97.59 1 25.00
11281. tstats[legendarybbk] (legen... 103 87.11 109.36 38 36.89
11282. Cole (coles_lambo_15) 60 87.11 110.85 22 36.67
11283. Naisargi (mehtaphysicalfool) 18 87.11 99.48 5 27.78
11284. Sagi (sagi73) 1,383 87.11 125.20 440 31.81
11285. VPK (iamvpk) 12 87.11 103.12 6 50.00
11286. Ramsey (tackheads) 2,221 87.10 123.05 684 30.80
11287. Aviral (aviralbh1) 40 87.10 103.01 17 42.50
11288. Owen (opio2000) 1 87.10 87.10 0 0.00
11289. bob (typemaster512) 13 87.10 99.29 4 30.77
11290. r (richiedeo) 3 87.10 95.29 0 0.00
11291. tristen (unitristen) 505 87.10 103.87 163 32.28
11292. Victor (bigetou) 2 87.10 89.84 0 0.00
11293. ugga (ugga_ugga) 105 87.09 108.20 42 40.00
11294. John (ittakesavillage) 1 87.08 87.08 1 100.00
11295. Rahul (jakatir) 20 87.08 106.50 7 35.00
11296. ꧁༒☬刀Ξ℣ł₦ ☬... 7 87.08 104.07 3 42.86
11297. Harry (harrycc3000) 40 87.08 100.23 16 40.00
11298. AJspeedy (ajspeedy5) 12 87.08 98.11 5 41.67
11299. jesper (anneflank) 2 87.08 89.12 1 50.00
11300. lhdk2712 (lhdk2712) 572 87.07 110.19 178 31.12
11301. (19wpmavg) 40 87.07 104.79 16 40.00
11302. Anas (anas11) 1 87.07 87.07 0 0.00
11303. 2muchdmg (2muchdmg) 3 87.07 89.98 1 33.33
11304. Alan (taialan) 19 87.07 99.83 17 89.47
11305. Martin (mewix) 18 87.07 101.44 1 5.56
11306. Roy (royzz) 40 87.06 108.36 16 40.00
11307. Greatman (jimmy_x) 70 87.06 102.30 16 22.86
11308. Marcel (lingman) 6 87.06 101.27 2 33.33
11309. Thomas (eshes) 1 87.06 87.06 0 0.00
11310. Shohid (humangod) 9 87.06 112.97 2 22.22
11311. Hikaru (fadilach) 3 87.06 103.39 3 100.00
11312. (singalong_monkey) 34 87.06 102.70 14 41.18
11313. Tong (tongvu) 306 87.05 113.20 110 35.95
11314. Atos (wolfcash) 56 87.05 100.56 15 26.79
11315. idk_hii (idk_hii) 100 87.05 108.17 28 28.00
11316. Xyexs (xyexs) 62 87.05 105.23 16 25.81
11317. 707 (jujutsu_sorcerer) 6 87.05 104.50 2 33.33
11318. Doug (dougly) 3 87.05 91.55 1 33.33
11319. Addy (egglols) 3 87.04 90.96 0 0.00
11320. LIGHTNING MEKQUEEN (aftrmg) 3 87.04 94.16 3 100.00
11321. June (avvieey) 56 87.04 111.21 15 26.79
11322. Rodrigo (alang217) 2 87.04 95.03 1 50.00
11323. Can (cazzed) 1,279 87.04 124.04 388 30.34
11324. wazzzaah (dzejkobb) 4 87.04 99.04 3 75.00
11325. Jon (jonjcp) 2 87.04 99.48 1 50.00
11326. Brian (briansu) 67 87.03 112.70 14 20.90
11327. midtrac (midtrac) 6 87.03 96.36 4 66.67
11328. cr0wfgt (cr0wfgt) 2 87.03 94.90 1 50.00
11329. shufi (shufi2) 2 87.03 88.18 0 0.00
11330. Matthew (gelahn) 1 87.02 87.02 1 100.00
11331. Sk1tt (sk1tt) 58 87.02 115.22 14 24.14
11332. Charlotte (chazish) 6 87.02 93.01 2 33.33
11333. Sandro🇬🇪 (jolskey) 1,069 87.02 128.17 338 31.62
11334. Tess (i_miss_club_penguin) 4 87.02 111.96 3 75.00
11335. t_lea (t_lea) 15 87.01 104.62 3 20.00
11336. Keex (keex) 3 87.01 96.53 1 33.33
11337. Andrei (artoorie312) 2 87.01 88.79 1 50.00
11338. Green (sir_onion) 2 87.01 87.10 0 0.00
11339. Sinful Sam (sinfulsam) 183 87.01 108.02 61 33.33
11340. Sahil (sahil21db) 58 87.01 106.76 10 17.24
11341. Sam (sam3456) 42 87.01 110.61 10 23.81
11342. m (xxxaliaxxx) 344 87.00 106.02 94 27.33
11343. OnlyStanz (tanni) 32 87.00 104.98 12 37.50
11344. bryan (bryan1111) 64 87.00 122.09 23 35.94
11345. Type (typespeed2020_) 15 87.00 107.07 5 33.33
11346. Axel (sector7) 65 87.00 108.14 19 29.23
11347. chloe (comradebiden) 4 87.00 97.84 2 50.00
11348. eric (eric8) 324 86.99 108.57 92 28.40
11349. Tam (tamlee573) 8 86.99 95.87 2 25.00
11350. Gabriel (gabrielbutu) 22 86.99 102.97 8 36.36
11351. ben (benwu1) 158 86.99 110.02 42 26.58
11352. Oli (piasekoli) 167 86.99 105.28 44 26.35
11353. Jj (issajacob) 1 86.99 86.99 1 100.00
11354. Vasil (vasito123) 13 86.99 99.08 2 15.38
11355. k (mc0sta) 2,283 86.99 116.13 704 30.84
11356. Rikki (rikki_leo) 332 86.98 118.22 101 30.42
11357. RedRashGrain (improvising_m... 58 86.98 101.13 19 32.76
11358. lucas (lucas757) 39 86.98 104.17 9 23.08
11359. PenguiNerd1000 (penguinerd1... 2 86.98 104.19 1 50.00
11360. Michael (pixelatedmike) 5 86.97 94.76 2 40.00
11361. Grant (ragecandybar) 12 86.97 102.86 5 41.67
11362. Omar (omarabzd) 37 86.97 106.78 15 40.54
11363. Bryce (brycetifer) 62 86.97 120.45 20 32.26
11364. Nikhil Sharma (nikhil_bolt) 13 86.97 93.36 3 23.08
11365. reiden (typingreiden) 21 86.97 104.82 6 28.57
11366. Cole (colemathew) 2 86.97 89.19 0 0.00
11367. Aryaman (aryaman04) 74 86.96 111.64 25 33.78
11368. Noridomi (noridomi) 50 86.96 102.83 14 28.00
11369. MLGIN (mlgin) 13 86.96 122.81 9 69.23
11370. Muhammad (muhammad_pak) 27 86.96 106.06 9 33.33
11371. Light (moory5) 10 86.95 93.18 1 10.00
11372. Jeff (bandihoot) 5 86.95 109.38 1 20.00
11373. Jericho (typersimon) 34 86.95 98.30 10 29.41
11374. Mathias (math225r) 3 86.95 88.80 2 66.67
11375. Jason (cookja2000) 51 86.95 109.56 11 21.57
11376. TJ (timothyjan) 129 86.95 105.65 43 33.33
11377. Mohit (mohit2208) 520 86.95 115.51 162 31.15
11378. Ahmad (gmg12) 66 86.95 113.26 12 18.18
11379. Raymond (flexray) 19 86.94 108.85 7 36.84
11380. IntangiblePri (intangible_pri) 18 86.94 101.21 4 22.22
11381. Tom (spritelad) 7 86.94 95.91 3 42.86
11382. Tosic (t0sic) 12 86.94 95.09 6 50.00
11383. Christopher (lord_pretzel) 32 86.94 109.25 7 21.88
11384. Lil🔥💯 (jifhacks) 2 86.94 87.88 2 100.00
11385. Allergic to (vanillahamster) 14 86.93 111.93 7 50.00
11386. Heather (feedtheflames) 3 86.93 98.96 1 33.33
11387. Akash (speedy_acj) 85 86.93 104.73 32 37.65
11388. Isaah (isaahtan_21) 2 86.93 91.72 2 100.00
11389. UncleBoobs (beyonderr) 62 86.93 102.81 27 43.55
11390. Thắng (pvthg) 32 86.92 109.81 12 37.50
11391. platnot (mega2053) 12 86.92 103.35 8 66.67
11392. AmazingKitchen (amazingkitc... 38 86.92 100.85 10 26.32
11393. Quinten (qspuijman) 74 86.92 102.82 27 36.49
11394. Nishanth (nishanthswaminathan) 4 86.91 90.96 3 75.00
11395. orphysca (orphysca) 5 86.91 96.48 1 20.00
11396. Leo (1_typer_boy_1) 32 86.91 101.78 8 25.00
11397. Eric (eric007) 4 86.91 99.41 2 50.00
11398. shui (sammi76) 591 86.91 115.49 193 32.66
11399. travis (skyrevolutionz) 6 86.91 104.47 2 33.33
11400. EHHH (ehhh_) 5 86.90 96.55 2 40.00
11401. Heemy (asdfm) 7 86.90 106.61 3 42.86
11402. Kiko (kikozz) 65 86.90 109.04 20 30.77
11403. Kevin (popanto) 47 86.90 109.61 12 25.53
11404. Earl (furankuring) 20 86.90 98.00 9 45.00
11405. pacmansghost (pacmansghost) 3 86.90 94.09 3 100.00
11406. boseph (zolorf) 2 86.90 102.51 1 50.00
11407. anntz (reaction__) 73 86.89 108.05 26 35.62
11408. Martine (martinee) 6 86.89 101.03 2 33.33
11409. SRI (sr71) 110 86.89 99.82 34 30.91
11410. David (dafweeda) 3 86.89 92.74 0 0.00
11411. CelestialAmber (celestialam... 26 86.88 101.97 10 38.46
11412. Ted (tednation) 8 86.88 96.54 1 12.50
11413. Callum (yuihirasawa) 30 86.87 101.63 14 46.67
11414. mateo (yaboimateo) 74 86.86 115.01 23 31.08
11415. lol (oknoted) 1 86.86 86.86 1 100.00
11416. acg (acg26) 232 86.86 118.16 63 27.16
11417. bronts (brontus) 9 86.86 103.34 2 22.22
11418. Rodrigo (banr_) 2 86.86 89.98 0 0.00
11419. sompur (sompurkrz) 12 86.85 95.24 4 33.33
11420. JH (hou32hou) 204 86.85 107.88 59 28.92
11421. SlowBoy (slow_boy_neen) 68 86.85 109.35 17 25.00
11422. Chicken (bbqsauceonmytitties) 23 86.85 103.33 9 39.13
11423. NitroOrb (nitroorb) 60 86.85 112.81 21 35.00
11424. kiv (kivv) 49 86.85 108.88 20 40.82
11425. PogChamperino (tutsandallthat) 2 86.85 95.87 0 0.00
11426. Vlad (vladiu5an) 5 86.84 97.44 1 20.00
11427. Pokeman (poke_man) 201 86.84 113.97 64 31.84
11428. Aaron (theredspartan) 19 86.84 101.98 5 26.32
11429. Ramon (jick_wipe) 1 86.84 86.84 1 100.00
11430. k (kperez755) 53 86.84 116.22 19 35.85
11431. King (kingthiccness) 1,626 86.84 116.41 508 31.24
11432. Adrian (ajwong123) 6 86.83 92.81 0 0.00
11433. Alex (tra_pz) 91 86.83 114.38 24 26.37
11434. van (toofasthoot) 74 86.83 103.87 13 17.57
11435. alis (aliss) 47 86.82 98.01 14 29.79
11436. GodOfTheMetal (godofthemetal) 6 86.82 92.32 3 50.00
11437. Cross (crosscarrier) 1 86.81 86.81 0 0.00
11438. narze (narze) 56 86.80 123.42 15 26.79
11439. sir (zenzir) 704 86.80 119.30 222 31.53
11440. 👻 (james7890) 191 86.80 118.32 53 27.75
11441. Jeremy (definee) 30 86.80 104.16 5 16.67
11442. Jake (slimypeanut) 2 86.80 89.20 2 100.00
11443. Guðjón (krotari) 164 86.79 109.75 67 40.85
11444. Fabian (tay0w) 20 86.79 110.68 7 35.00
11445. Huoi (huy_truong_le) 142 86.79 117.60 48 33.80
11446. Marcus (boopbeepboopboop) 100 86.79 108.85 30 30.00
11447. OddlySerious (oddlyserious) 3 86.79 102.43 1 33.33
11448. Irham (irhamdinataa) 110 86.79 110.28 39 35.45
11449. Lê Việt Bảo (lebao) 6 86.79 98.91 1 16.67
11450. Omer (okirnap) 37 86.79 102.96 9 24.32
11451. Patrik (tacticalnuke) 11 86.78 103.16 3 27.27
11452. Emma (emmaish) 5 86.78 91.33 3 60.00
11453. kimi (kimboli) 8 86.78 116.64 7 87.50
11454. TM22 (hanschen96) 3 86.77 97.26 1 33.33
11455. Julian (juliansmile) 175 86.77 105.69 51 29.14
11456. Bricen (nowyouseeme1233) 5 86.76 95.57 2 40.00
11457. Learner (learner_dawg) 183 86.76 117.86 48 26.23
11458. S (zotus) 4 86.76 90.36 1 25.00
11459. John (speedking456) 9 86.76 102.05 3 33.33
11460. Naaman (nae26) 45 86.76 113.08 16 35.56
11461. Charlotte (truest) 14 86.75 101.72 5 35.71
11462. From the river to the sea (... 39 86.75 111.10 11 28.21
11463. Taco (i_the_sausage) 42 86.74 108.92 8 19.05
11464. senpai (chottomatte) 43 86.74 117.60 10 23.26
11465. ItsInsanity (itsinsanity) 1 86.74 86.74 0 0.00
11466. NO ONE (subhroxeon) 9 86.74 103.14 1 11.11
11467. Phrog (sargent_frog) 9 86.74 138.49 7 77.78
11468. ninja (ninja_op) 50 86.74 104.12 20 40.00
11469. Dharma (dharmatycoon) 6 86.74 98.10 1 16.67
11470. Tom (bobtom8482) 31 86.73 109.19 12 38.71
11471. Poultry (poultryman) 4 86.73 90.65 4 100.00
11472. kork (marccraft) 12 86.73 100.84 3 25.00
11473. abelrobot (abelrobot) 23 86.72 104.85 7 30.43
11474. sleepyhead (1983civic) 1 86.72 86.72 0 0.00
11475. Orr (orr10c) 5 86.72 102.45 5 100.00
11476. Felmer (rustycookieee) 22 86.72 96.63 8 36.36
11477. Jade (pokemonluv98) 13 86.72 104.05 3 23.08
11478. Cedric (vlako) 20 86.72 102.77 5 25.00
11479. Synth (quantum88) 2 86.72 93.29 0 0.00
11480. NewKeyboardDontLaugh (arisk... 11 86.71 102.38 6 54.55
11481. Scalbi (scalbi47yrsold) 3 86.71 94.32 1 33.33
11482. Kiun (kiunkim) 1 86.71 86.71 0 0.00
11483. Fadosa (fadosa) 115 86.71 104.40 33 28.70
11484. Snail's Pace (hardtack) 87 86.71 108.35 32 36.78
11485. Phoeniix (xiineo) 105 86.71 115.02 37 35.24
11486. Samz (samzgm) 10 86.70 98.70 6 60.00
11487. Max (max_evans) 11 86.70 100.65 1 9.09
11488. Judd (judd123) 10 86.70 100.55 1 10.00
11489. Charlie (darklemon33) 2 86.70 97.90 2 100.00
11490. Star (bintangsatwika) 1 86.70 86.70 1 100.00
11491. Arik (arikuu) 2 86.70 88.56 2 100.00
11492. Felix (tresflex) 27 86.70 107.76 9 33.33
11493. sir (sirhelp) 40 86.70 100.98 10 25.00
11494. dewgong (fingerlocked) 6 86.69 97.60 1 16.67
11495. Facundo (facundof13) 3 86.69 105.42 1 33.33
11496. gale (dwah) 8 86.69 103.85 3 37.50
11497. David (ogwoohoo) 7 86.69 96.30 1 14.29
11498. Sarah (realgirlgoodhands) 4 86.69 92.81 4 100.00
11499. ヴィエット (hsdpa365) 135 86.69 112.36 38 28.15
11500. Truvius (truvius) 19 86.68 107.89 4 21.05
11501. Thebe (hikwon) 17 86.68 98.31 5 29.41
11502. Marcus (flowerskullbeige) 217 86.68 115.24 61 28.11
11503. charlie (cl23456) 9 86.68 101.74 2 22.22
11504. Ayvan (dharmablade) 761 86.68 118.34 231 30.35
11505. oTk (wulongi) 11 86.68 103.71 6 54.55
11506. Eli (elijahbu) 15 86.67 97.68 5 33.33
11507. ARGENTINA WORLD CHAMPION (l... 1 86.67 86.67 1 100.00
11508. moose (3biggiantmoose) 3 86.67 93.79 0 0.00
11509. Matthew (kylehyde) 997 86.67 116.61 279 27.98
11510. DustySheep (smowbog) 540 86.66 120.04 150 27.78
11511. Filip (fifal) 1 86.66 86.66 0 0.00
11512. StorMBasilisK (stormbasilisk) 6 86.66 98.31 1 16.67
11513. Roshan (noob_master9901) 188 86.66 124.71 55 29.26
11514. Robert (rpmulligan) 9 86.65 105.40 1 11.11
11515. Xi (rozaana) 13 86.65 93.34 6 46.15
11516. CeriumG (ceriumg) 1 86.65 86.65 1 100.00
11517. Daniel (sea_sick) 150 86.65 102.46 53 35.33
11518. Massimo (massir) 14 86.64 95.87 2 14.29
11519. Zoe (riverz) 26 86.64 105.31 7 26.92
11520. Tianchang (tcliao) 250 86.64 109.02 73 29.20
11521. Almighty (almightysosaakatu... 163 86.64 115.26 59 36.20
11522. tstats[guest_typists] (gues... 20 86.64 114.30 6 30.00
11523. CurryAbalone (careycai) 74 86.64 124.36 27 36.49
11524. paulo (pauliii) 3 86.63 89.15 0 0.00
11525. Jerome (jerome_ctq) 73 86.63 106.52 11 15.07
11526. joris (jorisss) 9 86.63 96.08 5 55.56
11527. Enzo (60wpmwhat) 21 86.62 99.85 8 38.10
11528. Martin (mpgo13) 50 86.62 110.34 15 30.00
11529. Rudy III (dther99) 6 86.62 95.57 4 66.67
11530. O (cvxnjopsad) 9 86.62 98.82 2 22.22
11531. Brae (cooride) 2 86.62 92.47 0 0.00
11532. Area0 (bing_b0ng) 2 86.62 87.54 0 0.00
11533. J.T. (javajohn29) 1 86.62 86.62 0 0.00
11534. Havel (havel29) 3 86.61 90.25 0 0.00
11535. I don't feel the pressure (... 1,231 86.60 123.33 397 32.25
11536. Polar (polishpolarbear) 22 86.60 111.42 9 40.91
11537. Emily (ellajournal13) 72 86.60 104.45 16 22.22
11538. Shoe (shoebox004) 142 86.60 124.31 47 33.10
11539. Nolan (nolan_f) 2 86.60 92.77 2 100.00
11540. Arvin Jay (sushisancat) 4 86.59 96.94 1 25.00
11541. Teddy (wazazaby) 16 86.59 96.98 1 6.25
11542. Adam (ninjapadam) 3 86.59 99.29 3 100.00
11543. hehe (shindo333) 48 86.58 100.18 20 41.67
11544. ymdsji (crostovik) 13 86.58 95.24 5 38.46
11545. Keigo (ogiekako) 3 86.58 88.60 1 33.33
11546. Manley (manley716) 3 86.57 93.87 3 100.00
11547. marc (nightowl) 16 86.57 102.19 5 31.25
11548. Ian (bunnyian) 39 86.56 106.28 8 20.51
11549. Kaiden (zentacle) 15 86.56 97.07 4 26.67
11550. nick (kicknenton) 28 86.56 97.76 11 39.29
11551. Nikita (loginezz) 1 86.56 86.56 1 100.00
11552. Boof (zmoney0805) 1 86.56 86.56 0 0.00
11553. Ant (ynosky) 2 86.56 87.71 1 50.00
11554. visual (visual9) 1 86.56 86.56 0 0.00
11555. nana (goomi) 498 86.55 118.31 143 28.71
11556. Iron Man (007_speed) 325 86.55 107.41 116 35.69
11557. Caleb (awsumbabysnarl) 11 86.55 100.30 2 18.18
11558. Julia (julsaguaro) 4 86.55 94.08 2 50.00
11559. Jenette (jenetttte) 1 86.55 86.55 0 0.00
11560. Martin (ightbet) 6 86.55 93.51 5 83.33
11561. Quinn (peea) 80 86.55 107.10 23 28.75
11562. mairzydoats_mason (mairzydo... 7 86.55 98.15 1 14.29
11563. Matthew (mstracy) 115 86.54 104.90 35 30.43
11564. Altra (altra) 8 86.54 111.43 6 75.00
11565. Zafir (lethalpuppy) 6 86.54 108.71 3 50.00
11566. (っ◔◡◔)っ ♥ Tyoma... 24 86.54 93.48 7 29.17
11567. Roi (sibo532) 23 86.54 102.02 6 26.09
11568. Dong (dongggg) 86 86.54 108.41 29 33.72
11569. Biohazard (b10hazard_) 54 86.54 106.23 7 12.96
11570. see you dont bump his head ... 9 86.53 96.00 5 55.56
11571. Mitchell (mdyer44) 33 86.53 107.17 11 33.33
11572. Deathwish (death_wish) 11 86.53 94.15 2 18.18
11573. seth (firewolf_2001) 5 86.53 93.37 1 20.00
11574. efradagod (efradagod) 13 86.53 101.75 11 84.62
11575. Dominic (kerbalnaught) 6 86.53 92.73 3 50.00
11576. Matthew (jconne3646) 6 86.53 95.42 2 33.33
11577. Ayden (aydensonline) 244 86.53 120.83 67 27.46
11578. dexterj (dexterj) 78 86.52 109.44 20 25.64
11579. Biggs (jobobhi) 45 86.52 104.73 14 31.11
11580. Andrew (amao01) 2 86.52 91.82 0 0.00
11581. Jinf931 (jinf931) 96 86.52 108.58 31 32.29
11582. Mike (micko34) 23 86.52 116.26 5 21.74
11583. Player_II (iamplayer) 11 86.52 92.20 4 36.36
11584. lotok (lotok_14) 31 86.52 108.30 8 25.81
11585. kang (kasusuwowo) 10 86.52 104.14 6 60.00
11586. Smoke (smoke91) 28 86.52 102.11 6 21.43
11587. Ivan (budabudimir) 37 86.51 102.15 12 32.43
11588. bob (mypotatoflies) 5 86.51 92.43 1 20.00
11589. Jake (faljake) 33 86.51 112.38 16 48.48
11590. Angelo (angeloanan) 10 86.51 102.51 2 20.00
11591. Jaxon (baenayeon) 1 86.51 86.51 1 100.00
11592. Skraap (elskrapo) 34 86.51 104.59 7 20.59
11593. Sanyeet (sanyeet) 42 86.50 104.89 14 33.33
11594. Sub (subtilklokkismann) 5 86.50 104.96 0 0.00
11595. Benjamin (genracemen) 1 86.50 86.50 0 0.00
11596. sparda (kamoess0) 28 86.50 101.62 8 28.57
11597. blu (bluberryy) 2 86.50 88.47 1 50.00
11598. Naing Htoo Aung (devii92) 68 86.49 103.50 23 33.82
11599. frog (strawfrog) 12 86.49 94.62 5 41.67
11600. Tomek (kemor) 14 86.48 105.26 4 28.57
11601. Naman (naman1601) 600 86.48 133.22 295 49.17
11602. tstats[franklin31113] (fran... 3 86.48 90.63 1 33.33
11603. Blair (cratman9) 1 86.48 86.48 0 0.00
11604. TripleMean (triplemean) 14 86.48 101.66 8 57.14
11605. Toru (kir6meki) 7 86.48 99.26 4 57.14
11606. Jotaro (udetha) 23 86.48 106.69 6 26.09
11607. Mitchell (mitchellmisayah) 5 86.48 93.95 3 60.00
11608. Nivan (nivanr06) 398 86.47 117.26 95 23.87
11609. Nate (nhanzel) 27 86.47 105.54 7 25.93
11610. Laco (koomp) 152 86.47 103.84 46 30.26
11611. (_darya_) 25 86.47 105.95 6 24.00
11612. xy (soox0001) 9 86.47 113.42 3 33.33
11613. Jake (superduperjake) 33 86.47 100.04 12 36.36
11614. Mia (yalllikefeet) 2 86.47 96.65 0 0.00
11615. Chris (lumms) 72 86.46 116.02 28 38.89
11616. nika (nika07) 5 86.46 90.58 0 0.00
11617. Ethna (ethna) 39 86.46 103.72 11 28.21
11618. Richard (elevatecrazy_yt) 36 86.46 104.02 11 30.56
11619. Paul (llamaking86) 7 86.45 101.94 2 28.57
11620. Khanh Hung (hungnkuon) 8 86.45 96.57 2 25.00
11621. Blub (blub0) 14 86.45 106.36 8 57.14
11622. mika (jonassenghaas) 5 86.45 90.04 2 40.00
11623. Aniket (aniketsanghi) 180 86.45 107.57 51 28.33
11624. Bailey (nob0dy) 5 86.45 93.62 1 20.00
11625. Ce (celineusa) 9 86.45 100.96 3 33.33
11626. Shota San (zsbzsb) 71 86.44 106.76 26 36.62
11627. Zai (zaibeez) 16 86.44 97.38 12 75.00
11628. Ella (bubble0176) 4 86.44 94.21 0 0.00
11629. ankit (ankitthegreat) 1,160 86.44 109.88 361 31.12
11630. IBRAIM5URFER (ibrahimpro) 13 86.44 103.27 4 30.77
11631. Jack (gleesonj) 6 86.43 95.21 6 100.00
11632. W8 4ME (pmarci9810) 18 86.43 98.50 3 16.67
11633. anjumaaa (zenda254) 491 86.43 124.80 150 30.55
11634. Ziron (ziron) 8 86.42 102.86 0 0.00
11635. Denny (shizkr) 8 86.42 98.56 4 50.00
11636. light (drawyeh) 7 86.42 94.69 3 42.86
11637. Omnia (omnitypewriter) 23 86.42 105.44 6 26.09
11638. Greg (gregdahwhale) 52 86.42 108.14 13 25.00
11639. TK (filfirst) 53 86.42 100.81 17 32.08
11640. Alex (dippyshere) 16 86.41 108.72 12 75.00
11641. Emma (missbennett) 104 86.41 108.71 25 24.04
11642. Henry (henburger) 7 86.41 99.17 0 0.00
11643. Games (itzbond) 11 86.41 101.01 5 45.45
11644. Brennan (brennanminns) 32 86.41 104.38 12 37.50
11645. Helena (evanalfred0817) 80 86.40 111.77 42 52.50
11646. Bibba (bibba27) 2 86.40 91.28 1 50.00
11647. B.A.D. (keylimeshortcake) 1 86.40 86.40 1 100.00
11648. George (peposss) 43 86.40 94.96 12 27.91
11649. Nguyễn Trần (dattran03) 363 86.39 110.96 115 31.68
11650. Devon (cheeky_sneakster) 19 86.39 101.79 8 42.11
11651. Luis (burningpsycho) 1 86.39 86.39 1 100.00
11652. Musharaf (benthorzm) 11 86.39 100.82 3 27.27
11653. AntiChronic (antichronic) 14 86.39 111.40 8 57.14
11654. Miguel (spideyj) 5 86.38 96.06 2 40.00
11655. Daniel (kimster773) 139 86.38 108.56 46 33.09
11656. Robsonwp (robsonwp) 34 86.38 102.34 9 26.47
11657. Jason (poleam) 40 86.38 112.95 15 37.50
11658. ybf (ybflewis) 163 86.38 118.67 42 25.77
11659. Weston (wwalker1) 4 86.38 99.58 1 25.00
11660. 💾 PROGRESS IS NOT LINEAR... 105 86.37 104.14 29 27.62
11661. Kelvin (itscatsu) 1 86.37 86.37 0 0.00
11662. Hugh (atticush99) 9 86.37 96.13 4 44.44
11663. Kirin (emptomatoketchup) 270 86.36 129.62 82 30.37
11664. Shashank (shashank_typer) 3 86.36 90.73 2 66.67
11665. ptrickr (gabriel7patrick) 1 86.36 86.36 1 100.00
11666. micah (mickeylmao) 7 86.36 102.57 3 42.86
11667. Connor Craig (conn_fused1) 59 86.36 102.10 13 22.03
11668. Niclas (aegzor) 3 86.36 96.88 0 0.00
11669. Mase (maseabd) 3 86.35 95.90 1 33.33
11670. NekokeN (hr47) 3 86.35 93.90 2 66.67
11671. R (sevenexpert) 71 86.35 99.99 26 36.62
11672. not rage (sadge47) 194 86.35 105.72 50 25.77
11673. Dragon99999 (dragon99999) 444 86.35 118.84 139 31.31
11674. The (codingazn) 1 86.35 86.35 0 0.00
11675. Ali (alishyper12) 28 86.35 105.83 15 53.57
11676. Shashank (shashank204) 195 86.34 102.23 43 22.05
11677. Zack (zack_mitkin) 6 86.34 99.22 0 0.00
11678. Kaylin (boomba506) 5 86.34 92.83 3 60.00
11679. posaidon (posaidon0802) 12 86.34 97.37 4 33.33
11680. Jalen (jaalen21) 34 86.33 102.57 12 35.29
11681. Slender (r_slender) 3 86.33 93.00 2 66.67
11682. Bruh (nicesuu) 18 86.33 95.84 5 27.78
11683. Elliot (gofire8) 43 86.32 106.30 7 16.28
11684. OblivionGlisor (gliscor2004) 10 86.32 100.85 6 60.00
11685. Hope (hopefullee) 1 86.32 86.32 1 100.00
11686. Mflop (lolgetmoorekt) 3 86.32 94.62 1 33.33
11687. Reverend Poo Poo Bum (poopy... 229 86.31 114.32 66 28.82
11688. power (mrpowerstudiesyt) 13 86.31 105.22 4 30.77
11689. George (linnypurple) 378 86.31 108.75 112 29.63
11690. 6hwh6 (6hwh6) 6 86.31 96.78 3 50.00
11691. Gustav (gustavelmqvist) 37 86.31 107.77 12 32.43
11692. Arjun (sarjunt) 5 86.31 92.20 2 40.00
11693. ginginggaang (cremleme) 593 86.30 120.33 181 30.52
11694. Stalking (stalkingdog) 15 86.30 103.51 1 6.67
11695. Andrew (completespud) 76 86.30 107.72 25 32.89
11696. Good Vibe Tribe (lucas_lm) 15 86.30 101.09 7 46.67
11697. Ofir (sipthesoup) 12 86.30 99.05 4 33.33
11698. 🧋origin 👉 (chelsie999) 232 86.29 110.21 64 27.59
11699. Williawar (williawar) 66 86.29 105.63 20 30.30
11700. j_ (typeracerjay1) 6 86.29 95.21 2 33.33
11701. Howard (howien) 2 86.29 91.03 0 0.00
11702. Alexdebassman (alexdebassman) 1 86.29 86.29 1 100.00
11703. Ed (pelly1863) 33 86.29 99.87 6 18.18
11704. Calsuis (calsuis) 9 86.29 98.13 3 33.33
11705. Saea (saeamak) 11 86.29 96.53 3 27.27
11706. ray (magicsticks) 3 86.28 96.82 1 33.33
11707. Theodor (thimius) 22 86.28 101.63 10 45.45
11708. Gabriely (gabrielyzz) 2 86.28 99.21 1 50.00
11709. Argo (arks200) 3 86.27 96.42 2 66.67
11710. Much (nikitin) 12 86.27 92.06 4 33.33
11711. Martin (the_martin) 13 86.27 115.21 8 61.54
11712. Graham (rizyyyy) 6 86.27 101.50 6 100.00
11713. Eric (eric_loves_adrian) 2 86.27 89.52 2 100.00
11714. pythagoras (123pythagoras123) 1,134 86.27 119.93 309 27.25
11715. Brandon (spookybees) 8 86.26 104.31 3 37.50
11716. deej (deej195) 12 86.26 96.76 1 8.33
11717. KTH (kthmanish) 127 86.25 115.89 42 33.07
11718. ILikeCars07 (gruhith) 49 86.25 97.81 12 24.49
11719. Joshua (lysergicdie) 1 86.25 86.25 0 0.00
11720. Arne (11bricks) 12 86.25 102.59 3 25.00
11721. The Hunter (the_hunter_) 72 86.25 104.30 28 38.89
11722. Sapphire (sapphirexsky) 19 86.25 129.24 5 26.32
11723. doubt (hightness) 12 86.25 95.30 3 25.00
11724. Sam (samh410) 10 86.25 101.18 4 40.00
11725. Eddie (zorrpan) 4 86.25 89.79 3 75.00
11726. ET (bearington_45) 2 86.25 90.15 1 50.00
11727. akzhol (atomixa) 268 86.24 111.93 89 33.21
11728. notjustmetal (nightway11) 11 86.24 95.46 5 45.45
11729. kralty ツ (kralty) 1 86.24 86.24 0 0.00
11730. bo (kibums) 11 86.24 104.75 3 27.27
11731. Sesame (sesamebagel) 2 86.24 91.10 2 100.00
11732. lolitsgow (lolitsgow) 89 86.23 100.23 26 29.21
11733. Xavier (justxav) 3 86.23 92.37 3 100.00
11734. Sam (garuda1221) 11 86.23 98.47 8 72.73
11735. Artur (arthurisit) 11 86.23 100.30 4 36.36
11736. Callmequick (spellings) 2 86.23 90.79 1 50.00
11737. beans (rlbeans) 51 86.22 106.81 19 37.25
11738. Ahmad (ahmad_a_0) 11 86.22 104.28 2 18.18
11739. Mr. Qwerty (imnotawimpykid) 11 86.22 94.93 4 36.36
11740. Tahbro (tahbro) 14 86.22 100.23 5 35.71
11741. Harvey (harveyqqq) 44 86.21 101.28 12 27.27
11742. Alex (p08r) 10 86.21 95.15 3 30.00
11743. Timix (faketimix) 1 86.21 86.21 1 100.00
11744. Mirkhad (cmirkhad) 1,825 86.21 129.22 659 36.11
11745. Daniel (goldncore) 5 86.21 101.71 2 40.00
11746. sacresful (sacresful) 12 86.21 94.95 3 25.00
11747. David (westie) 1 86.20 86.20 0 0.00
11748. Mystree (mystree) 9 86.20 96.90 4 44.44
11749. Aaron (atoponce) 5 86.20 94.38 2 40.00
11750. eloise (eeloise) 3 86.20 87.77 2 66.67
11751. Jay (finikin) 25 86.19 99.98 6 24.00
11752. supernoob (krcellucci) 7 86.19 90.76 3 42.86
11753. Dagareth (mindcrime) 35 86.19 105.25 8 22.86
11754. Michael (val_slow) 35 86.18 102.59 14 40.00
11755. chetty (lilchetty_x3) 30 86.18 95.87 11 36.67
11756. Kalash (kalz25) 20 86.18 101.63 2 10.00
11757. Len (lennonisbest) 3 86.18 90.93 0 0.00
11758. Velyro (velyro) 21 86.18 96.86 7 33.33
11759. Tyler (pardue) 1 86.18 86.18 1 100.00
11760. FREE PALESTINE discord#unsa... 427 86.18 112.91 123 28.81
11761. Joey (joeygetthedoughy) 11 86.18 99.96 8 72.73
11762. Daniel (danyu1) 8 86.18 96.88 2 25.00
11763. Ferotiq (ferotiq) 3 86.17 99.86 1 33.33
11764. willy (willywongker69) 14 86.17 99.23 3 21.43
11765. sarah (hahaimsmart) 42 86.17 106.76 15 35.71
11766. katie (katie2807) 5 86.17 100.91 1 20.00
11767. joni (squire2264) 9 86.17 92.80 2 22.22
11768. Bobby (senseibets) 9 86.17 103.15 4 44.44
11769. ur done, ur done (diszanne) 2 86.17 96.04 2 100.00
11770. Sam (ilikeyourcutghee) 9 86.16 99.33 2 22.22
11771. Riley (wulfmane) 17 86.16 122.06 5 29.41
11772. Rice (rice363) 9 86.16 92.56 3 33.33
11773. xrTForces (xrtforces) 2 86.16 90.29 0 0.00
11774. Abu (kabu22) 567 86.16 113.28 154 27.16
11775. Newman (newmanhere) 6 86.15 91.96 2 33.33
11776. yo (callmeford) 154 86.15 110.00 47 30.52
11777. superepic (superepicpig) 1 86.15 86.15 0 0.00
11778. Sander (sander5151) 8 86.15 93.40 2 25.00
11779. Mo. (mo_rehan24) 2 86.15 89.33 1 50.00
11780. dhikshith (dhikshith) 527 86.14 109.90 131 24.86
11781. danny (dannyvokje) 8 86.14 96.59 3 37.50
11782. AdventureStorm (adventurest... 5 86.14 92.79 2 40.00
11783. Ernesto (venkinta) 51 86.14 103.46 21 41.18
11784. Ignacy (bombylius) 3 86.14 90.03 0 0.00
11785. Shekhar (shekharchikara) 6 86.13 94.81 2 33.33
11786. tinkureddy (tinkureddy) 26 86.13 104.35 13 50.00
11787. Jake (jakexx) 27 86.12 113.90 9 33.33
11788. poopycock17 (luigi65536) 9 86.12 95.60 2 22.22
11789. Ralph (silyy097) 5 86.12 102.32 0 0.00
11790. espo (espooooo) 9 86.12 105.37 3 33.33
11791. Joe (cobiejoe96) 55 86.12 102.87 14 25.45
11792. Brad (godspeed99) 13 86.12 91.93 4 30.77
11793. Shannon (caseius) 213 86.11 110.22 78 36.62
11794. M (maddyjune) 12 86.11 104.51 2 16.67
11795. Nieves (cheezy_butter) 17 86.10 104.35 4 23.53
11796. vee (veedoze) 39 86.09 107.14 10 25.64
11797. Aaditya Pal (ninjaadi7903) 131 86.09 114.24 31 23.66
11798. wael (wael64) 5 86.09 88.17 0 0.00
11799. Shashank (shashu1509) 60 86.09 107.58 15 25.00
11800. Jessica (jesshe183) 71 86.09 102.41 12 16.90
11801. Adil (adilmamed0v) 16 86.08 101.23 6 37.50
11802. Nurul (mnislam) 19 86.08 93.35 8 42.11
11803. Alex (blueninja11103) 7 86.08 102.51 1 14.29
11804. NRC_131_G (nrc_131_g) 19 86.08 104.15 16 84.21
11805. Amelia (piclo7) 437 86.08 117.08 145 33.18
11806. Mihovil (mladabobica) 64 86.08 106.40 27 42.19
11807. Socrates (socratesbatis) 2 86.08 89.03 0 0.00
11808. Randhy (randhy456) 24 86.07 99.27 7 29.17
11809. Dyer_Colemak (dyer500) 214 86.07 124.41 63 29.44
11810. robert1003 (robert1003) 4 86.07 89.40 1 25.00
11811. Tuxtampa (tuxtampa) 5 86.07 94.75 5 100.00
11812. lkary (lkary) 1 86.07 86.07 1 100.00
11813. Dylan (dillyv) 8 86.07 93.84 3 37.50
11814. angel (angelllfoo) 12 86.07 103.03 4 33.33
11815. C (cpandar) 17 86.06 101.40 3 17.65
11816. bambang (breakingkeyboards) 228 86.06 106.73 77 33.77
11817. Joshua (joshnah) 29 86.06 105.44 11 37.93
11818. HTD (htdbarsii) 1 86.06 86.06 1 100.00
11819. Evan (evanr10190) 6 86.06 92.87 3 50.00
11820. Ketchup (ketchupsokies) 3 86.05 89.95 1 33.33
11821. Anshorullah (imugetsu6) 7 86.05 102.25 2 28.57
11822. Priscilla (priscillaaa) 46 86.05 107.03 10 21.74
11823. Benji (ijneb) 21 86.04 111.12 5 23.81
11824. Rustam (rustam687) 60 86.04 111.45 20 33.33
11825. Freundschaft Bus (freundsch... 98 86.04 105.66 34 34.69
11826. Peetor (milleniumpoo) 51 86.04 114.36 13 25.49
11827. Pranto (pranto2722) 78 86.04 103.59 23 29.49
11828. Abhinay (apasunuri) 11 86.04 94.80 0 0.00
11829. Type (mm66) 2 86.04 88.54 1 50.00
11830. aiden (poscowsm) 13 86.03 96.87 7 53.85
11831. Viktor (viktro_touch_type) 7 86.03 95.44 1 14.29
11832. George (jempii) 1 86.03 86.03 1 100.00
11833. TiTi (partiti) 3 86.03 88.14 0 0.00
11834. smolPixie (extraprincess) 56 86.03 105.21 18 32.14
11835. Tyler (isharity) 7 86.03 92.62 3 42.86
11836. Vishal (fieryhydra) 7 86.02 102.50 4 57.14
11837. Nashpotato (nashpotat0) 2 86.02 86.63 1 50.00
11838. MDevil - (yt_mdevil) 4 86.02 105.73 3 75.00
11839. Grayson (troydenite) 8 86.02 94.62 3 37.50
11840. mikey (snicker861) 145 86.01 107.37 50 34.48
11841. Andreas (latteinator) 6 86.01 102.41 1 16.67
11842. chie (lotusimpact) 22 86.01 110.87 7 31.82
11843. Trixie1018 (trixie1018) 2 86.01 87.70 0 0.00
11844. serien (serien_) 120 86.00 113.62 28 23.33
11845. Salzpanik (daniely1160) 11 86.00 132.61 5 45.45
11846. Dr Pepper (artistp) 2 86.00 92.00 2 100.00
11847. Cooper (coopy498) 3 86.00 90.82 2 66.67
11848. Daniel (danielf55) 2 86.00 90.87 0 0.00
11849. Zyrin (captainzyrin1024) 45 85.99 106.12 15 33.33
11850. Doiv (doiv23) 209 85.99 112.45 62 29.67
11851. Kishore (kishorep1) 5 85.99 93.24 2 40.00
11852. Chicony osu! (leva_russian) 31 85.99 98.85 11 35.48
11853. Jesus (johangodinho123) 114 85.98 123.80 37 32.46
11854. pablo (unicorngaming) 1 85.98 85.98 1 100.00
11855. Sanchit (sanchitsharma21) 103 85.98 101.95 35 33.98
11856. Hopelezz (zerloth) 7 85.98 97.59 1 14.29
11857. Mark (requiem__) 256 85.98 109.78 67 26.17
11858. Aashrya (virtualvector) 11 85.97 101.12 10 90.91
11859. Chatpisut (uwu_werkmaine) 368 85.97 113.42 113 30.71
11860. mat (netman) 10 85.96 99.03 3 30.00
11861. Timothy (chuzzz) 187 85.96 116.62 48 25.67
11862. Alex (khanis1) 54 85.96 102.06 15 27.78
11863. Patrick (rick_pat) 7 85.96 96.45 5 71.43
11864. Thomas (buttnuggetchiu) 2 85.95 87.87 1 50.00
11865. Jacques (jacquesp) 29 85.95 104.94 3 10.34
11866. Brendan (brendalandan) 900 85.95 115.72 218 24.22
11867. Alfabetica (alfabetica) 270 85.95 105.95 77 28.52
11868. spoon (smallspoon) 9 85.95 109.88 4 44.44
11869. Aarif (aarif_a) 23 85.94 99.37 5 21.74
11870. buynaa (kamikaze0612) 119 85.94 109.04 26 21.85
11871. XpORPID (xporpid) 20 85.94 104.79 6 30.00
11872. Felipe (felipet) 21 85.93 98.76 4 19.05
11873. alexander (yummyspiderman) 3 85.93 102.56 0 0.00
11874. Powerid (poweriddd) 9 85.93 97.13 3 33.33
11875. JuanimelsPH (juanimels) 51 85.92 103.86 9 17.65
11876. Juan (juanpunch) 3 85.92 91.64 1 33.33
11877. GaGi (gagiiiii) 1 85.92 85.92 0 0.00
11878. Marcus (mb_2001) 4 85.92 89.33 1 25.00
11879. MIMSY (paddydingus) 4 85.92 99.26 2 50.00
11880. Tiffany Hwang (tiffany_hwang) 3 85.92 99.28 1 33.33
11881. Klunky (liamrob) 18 85.92 107.44 11 61.11
11882. Highwire (highwire) 2 85.92 91.94 0 0.00
11883. Owen (stoveovenowen) 4 85.91 94.41 2 50.00
11884. Miguel (gheed22) 21 85.91 98.79 8 38.10
11885. Tyler (tyster02) 60 85.91 98.57 20 33.33
11886. Nim (nim1chimpsky) 141 85.91 111.93 45 31.91
11887. Ben (thisisben) 268 85.91 105.82 62 23.13
11888. Type (granwizard) 1,046 85.91 117.41 376 35.95
11889. ali-goes (alibookie) 52 85.91 117.12 15 28.85
11890. Jacob (jacquesz) 3 85.90 97.95 0 0.00
11891. Tracking Time (trackingtime) 146 85.90 111.15 45 30.82
11892. Conner (tropicul) 3 85.90 106.08 2 66.67
11893. Roman (the__one) 1 85.90 85.90 0 0.00
11894. Curtis (curtisz) 12 85.90 97.64 3 25.00
11895. Eric (erichamers) 87 85.90 106.76 34 39.08
11896. Jonathan (jah_n_i) 111 85.90 113.25 45 40.54
11897. Khang (hophopkangaroo) 4 85.90 92.21 0 0.00
11898. Macedonian King (ijittqerr_) 298 85.89 113.04 76 25.50
11899. Jhoe (cookiemeeps) 5 85.89 94.46 1 20.00
11900. Daniel (vugla1994) 6 85.89 93.92 1 16.67
11901. devin (devinekadeni) 2 85.89 86.52 2 100.00
11902. sussybaka (fknneeow) 58 85.88 104.85 14 24.14
11903. Jack (sharku) 1 85.88 85.88 0 0.00
11904. Damn (dammmson) 64 85.88 106.04 15 23.44
11905. Suh dude (jaykwon) 26 85.88 106.84 6 23.08
11906. Frisk00 (frisk00) 7 85.88 105.93 2 28.57
11907. tstats[kayeii] (kayeii) 196 85.87 105.89 56 28.57
11908. Toast (toastmaster127) 11 85.87 116.65 4 36.36
11909. Vroom (synphade) 9 85.87 96.27 2 22.22
11910. Nick (nickbanderson) 21 85.87 111.20 12 57.14
11911. ryo (ryolate) 58 85.87 101.85 19 32.76
11912. ZMod (kenortinez) 4 85.86 101.75 2 50.00
11913. Panic (panicswitch07) 126 85.86 131.07 44 34.92
11914. NorthernNinja (northernninj... 2 85.86 86.64 1 50.00
11915. Mike (mybroom10) 12 85.86 112.61 3 25.00
11916. Eric (yuurrrrr) 22 85.86 95.75 5 22.73
11917. Jacob (a_cheesy_wotsit) 15 85.86 114.16 5 33.33
11918. Kentson (raykaa) 1 85.85 85.85 0 0.00
11919. . (matetea) 2 85.85 88.40 1 50.00
11920. Nelson (alkatzer) 9 85.85 98.98 2 22.22
11921. Balazs (nb666) 5 85.84 93.88 1 20.00
11922. Reniar (ulaner1_) 3 85.84 91.66 2 66.67
11923. Trevor (thetrevormonreal) 96 85.84 115.48 25 26.04
11924. Poonpipob (wheatley001) 6 85.84 91.71 1 16.67
11925. Sebastian (schmiffy) 2 85.84 88.70 0 0.00
11926. Aayush (pandaayush) 1 85.84 85.84 1 100.00
11927. Michael (michaelmalgapo10) 3 85.84 97.33 2 66.67
11928. Ridge (anawesomefry) 13 85.84 104.82 6 46.15
11929. firxe (firxe139) 28 85.84 100.80 8 28.57
11930. Anderson (andarson) 16 85.84 96.60 5 31.25
11931. Kenan (gamingkenan) 5 85.83 106.41 3 60.00
11932. Gasp (gasps) 4 85.83 94.50 0 0.00
11933. Tom (quickfingerz) 4 85.82 99.86 2 50.00
11934. @smile.hnts on twitter (hyp... 111 85.82 108.35 33 29.73
11935. Eugene (mineugene) 20 85.82 95.65 9 45.00
11936. Haven (havenjd) 8 85.82 98.84 4 50.00
11937. Anthony (funger99) 57 85.82 101.31 10 17.54
11938. copter28 (copter28) 23 85.82 104.20 9 39.13
11939. Esso (3sso) 13 85.81 104.02 0 0.00
11940. Jon (jonc5201) 34 85.81 100.11 13 38.24
11941. Lorenzu (zecim) 5 85.81 95.11 2 40.00
11942. Krsman (rektix) 10 85.80 93.21 1 10.00
11943. flavouredpig (flavouredpig) 4 85.80 102.85 2 50.00
11944. Dio (slado122) 392 85.80 108.63 130 33.16
11945. Mahar (maharkamran01) 3 85.80 89.10 1 33.33
11946. dylan (dywan) 12 85.80 98.00 5 41.67
11947. jedishong (jedishong) 10 85.80 114.03 6 60.00
11948. Gaurab (catinpajamas) 6 85.79 99.86 2 33.33
11949. Jacob (addthenine) 19 85.79 98.73 5 26.32
11950. Duck (duckmedic) 1 85.79 85.79 1 100.00
11951. David (wookiewarrior07) 12 85.79 100.54 3 25.00
11952. Pryl (pryl) 45 85.79 107.65 12 26.67
11953. touchtypepracticer69 (touch... 48 85.79 97.33 12 25.00
11954. Tammie (tamxd) 6 85.78 97.50 2 33.33
11955. Shorba (shorba) 1 85.78 85.78 1 100.00
11956. Ray (ray_maddox) 2 85.78 90.29 0 0.00
11957. HauntedMop (boss_mario) 3 85.78 93.34 3 100.00
11958. Hououin Kyouma (makise_kuri... 145 85.77 118.00 58 40.00
11959. Andija (gingerpolk) 5 85.77 88.28 3 60.00
11960. Josh (vaximus) 28 85.77 100.73 7 25.00
11961. Kyotz (kyotz) 1 85.77 85.77 0 0.00
11962. HGud (hgudtk) 92 85.77 116.81 23 25.00
11963. Liam (bonkatronk) 159 85.77 101.76 56 35.22
11964. Hossein (dustylamia) 266 85.77 126.90 108 40.60
11965. HDoll (hdoll) 2 85.77 97.36 2 100.00
11966. Mato (matoxz) 482 85.76 118.25 156 32.37
11967. Emmett (notfunnyorange) 4 85.76 92.16 2 50.00
11968. GD (degeemon21) 5 85.76 94.34 3 60.00
11969. MOP (moplock2093) 6 85.76 96.75 4 66.67
11970. Benji (benbind1) 241 85.75 109.55 69 28.63
11971. Anduin (anduin2017) 23 85.75 97.34 6 26.09
11972. Guest (whoyoung99) 135 85.75 113.78 37 27.41
11973. Christopher X Wu (cw86459) 16 85.75 112.41 1 6.25
11974. Vasi (vasi1333) 15 85.74 95.75 6 40.00
11975. Ali (aloche) 1 85.74 85.74 0 0.00
11976. William (jt_001) 1 85.74 85.74 0 0.00
11977. Finite Automaton (jerry_nyae) 44 85.74 104.88 7 15.91
11978. Floris (redmachine) 6 85.74 90.34 1 16.67
11979. Jiang (jghjianghan) 23 85.73 109.53 6 26.09
11980. Stupid (stupididiot9) 1,651 85.73 121.00 525 31.80
11981. Will (iyeiye_captain_) 24 85.73 102.82 5 20.83
11982. ᴛᴀxɪ ᴅʀɪᴠᴇʀ ... 301 85.73 117.24 94 31.23
11983. Said (saidahror_2021) 17 85.73 97.57 8 47.06
11984. Reefer (reefer_rr) 6 85.73 107.76 2 33.33
11985. Tomáš (eyzi25) 216 85.72 108.09 52 24.07
11986. christian (chriz411) 15 85.72 97.46 6 40.00
11987. Dillon (dillon_p) 2 85.72 87.88 0 0.00
11988. Alex (alexisstillalive) 5 85.71 91.26 4 80.00
11989. Domo (dasuxosu) 49 85.71 116.49 20 40.82
11990. Nathaniel (engage) 3 85.71 87.06 2 66.67
11991. Cele (cele0530) 2 85.71 89.62 2 100.00
11992. Justin (justintam556) 13 85.70 106.00 5 38.46
11993. Bailey (bailwillharr) 5 85.70 94.42 2 40.00
11994. Speedy (pindakaaspot123) 19 85.70 109.01 6 31.58
11995. Nave (naveboy34) 2 85.70 111.18 0 0.00
11996. don (dandhi) 50 85.70 102.46 20 40.00
11997. Lane (laneondvorak) 691 85.70 130.96 193 27.93
11998. Ja-kobe (jrutz26) 1,456 85.69 119.89 413 28.37
11999. ooo (inout) 22 85.69 105.84 7 31.82
12000. Colton (cmerri) 2 85.69 93.83 1 50.00
12001. Michael (sapient) 19 85.69 106.89 4 21.05
12002. k (mkoo) 7 85.69 97.31 3 42.86
12003. Reto (reddo) 67 85.68 104.21 21 31.34
12004. Banana (banmanan) 4 85.68 87.57 0 0.00
12005. Marcus (shock598x) 9 85.68 106.34 3 33.33
12006. I am in school rn (typingin... 37 85.68 98.66 15 40.54
12007. Danny (cyicro75366) 18 85.68 111.10 2 11.11
12008. kripp (hotdoghunter) 91 85.68 120.03 29 31.87
12009. Einno (einno) 246 85.68 107.64 81 32.93
12010. Colemak (half_as_fizzy) 54 85.68 105.61 18 33.33
12011. Bitgalle (bitgalle) 28 85.67 95.41 11 39.29
12012. Sam (samwilkie) 6 85.67 104.18 2 33.33
12013. Donked (cyrany) 83 85.67 105.71 26 31.33
12014. Victoria (azureale) 18 85.67 108.98 6 33.33
12015. Robin (adraqi) 5 85.67 91.99 1 20.00
12016. Mochaeri (mochaeri) 3 85.66 95.40 1 33.33
12017. Peter (peter12253) 1 85.66 85.66 0 0.00
12018. Dev (dmookerjee) 1 85.66 85.66 1 100.00
12019. Benjo (barbanzo) 1 85.66 85.66 0 0.00
12020. Jacob (derr1) 3 85.66 96.45 1 33.33
12021. Evangelos (es305) 70 85.66 110.82 26 37.14
12022. bincent (bincentlife) 9 85.66 103.39 6 66.67
12023. Zaire (vamsire) 3 85.65 94.92 1 33.33
12024. Nicki (nickisusanalex) 161 85.65 99.13 39 24.22
12025. João (jvvv) 3 85.65 89.34 1 33.33
12026. Arthur (sagman) 113 85.64 134.41 20 17.70
12027. wayne (nonlimit) 20 85.64 98.87 4 20.00
12028. Shadow (shadow_monarch) 280 85.64 116.41 79 28.21
12029. Abbey (abbey240901) 130 85.64 101.67 30 23.08
12030. sam (swalden) 139 85.63 104.07 51 36.69
12031. . (lun_rix) 133 85.63 103.70 29 21.80
12032. Jonas (jonasj2001) 117 85.63 105.41 37 31.62
12033. Rafi (brownvitalik) 1 85.63 85.63 0 0.00
12034. Temu (temex) 27 85.63 92.55 12 44.44
12035. Ksizzzzz (ksiz) 90 85.63 107.03 32 35.56
12036. tstats[acedragonheart] (ace... 22 85.62 99.25 9 40.91
12037. Taush (tsampley) 10 85.62 103.19 4 40.00
12038. Zhen Qing (lim0721lim) 16 85.62 98.34 3 18.75
12039. Adam (aplesin) 3 85.61 89.44 3 100.00
12040. Chris (datapointchris) 21 85.61 102.99 5 23.81
12041. Noah (noahebe) 2 85.61 102.36 1 50.00
12042. Montu (axom_shochwave) 99 85.61 104.05 22 22.22
12043. ggzor (ggzor) 4 85.61 87.94 0 0.00
12044. Roboute (robosote) 17 85.61 96.18 8 47.06
12045. Alien (half_alien) 1,181 85.60 117.04 366 30.99
12046. Matt 🐌 (mattg54321) 1 85.60 85.60 0 0.00
12047. Kyle Johnson (rickharrisoncoc) 43 85.60 102.58 16 37.21
12048. Jalil (jac28088788) 6 85.59 94.11 4 66.67
12049. reever (ssamu) 42 85.59 108.09 11 26.19
12050. bobby (bobbyo) 18 85.59 99.06 4 22.22
12051. WHH (whitehoodhacker) 5 85.59 95.36 3 60.00
12052. subham (subhamrawat) 1,054 85.59 120.22 269 25.52
12053. Alex (dexiple) 3 85.59 89.52 1 33.33
12054. Zack (ford_festiva) 2 85.59 92.00 0 0.00
12055. Robert (rzyao) 55 85.58 108.27 16 29.09
12056. varuvaru (vividkun) 1 85.58 85.58 0 0.00
12057. Regulus ❄ (yo_yo_honey_si... 60 85.58 105.10 16 26.67
12058. Honza (honza2535) 104 85.57 101.78 26 25.00
12059. pistonsnick (pistonsnick) 3 85.57 93.62 0 0.00
12060. Kyle (kuronkuu) 77 85.57 121.30 23 29.87
12061. Kaleb (penguinunreal) 8 85.57 90.64 3 37.50
12062. Richard (rgoulterbm40dsk) 18 85.57 98.34 6 33.33
12063. MiazMe (pmax) 30 85.57 102.28 9 30.00
12064. Rounak (rouvai) 44 85.56 102.53 12 27.27
12065. Tri Dung (phantridung123) 499 85.56 119.36 124 24.85
12066. Emlyn (e_typist_112) 1 85.56 85.56 0 0.00
12067. i'm a band kid (imabandkid) 69 85.55 107.60 41 59.42
12068. weddies (weddies) 13 85.55 95.84 3 23.08
12069. Bread (bread_store) 23 85.55 102.27 5 21.74
12070. unnat (unnat) 8 85.55 98.23 2 25.00
12071. Al Jade (c00k1e) 64 85.55 106.05 21 32.81
12072. Mahmoud (opssheesh) 53 85.54 110.30 11 20.75
12073. Kuna (_kuna) 9 85.54 96.44 2 22.22
12074. shoobb (shooby28) 24 85.54 102.51 7 29.17
12075. Eddie (premeditate) 1 85.53 85.53 0 0.00
12076. try (tipewriter123) 15 85.53 103.31 7 46.67
12077. Ahmed (backslashero) 7 85.53 95.45 3 42.86
12078. Nhan (skhylines) 8 85.53 109.55 3 37.50
12079. paul (paulb20071106) 24 85.52 99.95 8 33.33
12080. ahmed (puzite) 151 85.52 108.20 37 24.50
12081. . (ggsnipes) 39 85.52 103.00 14 35.90
12082. andy (drewpickett) 1 85.52 85.52 1 100.00
12083. RI (speedraceriyer) 200 85.52 119.92 50 25.00
12084. Katie (ktdubbs93) 5 85.52 90.10 2 40.00
12085. 86hawks (86hawks) 7 85.51 94.48 2 28.57
12086. Matthew (matthewdilks) 34 85.51 111.09 17 50.00
12087. Royal (royalman) 3 85.51 96.23 0 0.00
12088. Madie (picassy) 6 85.51 92.12 5 83.33
12089. Samuel (ichigancs) 13 85.51 98.51 5 38.46
12090. pp (phlyingturtle) 5 85.51 93.94 2 40.00
12091. TIN (daons) 8 85.51 88.53 2 25.00
12092. 🔰Rayster (rayster1) 660 85.51 117.06 197 29.85
12093. Myles (myles_morris) 5 85.50 90.18 1 20.00
12094. Eve (evehelin) 10 85.50 96.81 2 20.00
12095. Darwisy (motoofast) 3 85.50 90.40 2 66.67
12096. Timothy (adral) 296 85.50 121.46 84 28.38
12097. HHKB (okkonishi) 1 85.50 85.50 0 0.00
12098. Maciej (m4v3r) 4 85.50 90.87 3 75.00
12099. Kiet (kiethuynh) 2 85.50 85.76 1 50.00
12100. Magz (magzse7en) 67 85.49 106.77 25 37.31
12101. teethmc (dudeboi63589) 8 85.49 110.97 3 37.50
12102. mikey (mikelikes) 2 85.49 98.79 0 0.00
12103. Cheechu (cheechu) 394 85.49 114.06 113 28.68
12104. Brittany (bhunter9) 5 85.49 91.76 1 20.00
12105. Nitta (nitta814) 28 85.49 96.19 7 25.00
12106. Ibo (ibosaka) 1 85.48 85.48 1 100.00
12107. Stepman5 (stepman5) 2 85.48 85.81 0 0.00
12108. ThySpoon (thyspoon) 6 85.48 95.99 0 0.00
12109. TheMatsValk (thematsvalk) 5 85.47 94.21 0 0.00
12110. Empirix (empirix) 3 85.47 90.95 0 0.00
12111. 516 (sig_sauers) 7 85.47 99.28 4 57.14
12112. Neptune (neptune_22) 11 85.47 98.08 3 27.27
12113. naileuX (naileux) 26 85.47 110.45 10 38.46
12114. AM (freae) 244 85.46 108.13 87 35.66
12115. Philip (plip_1021) 43 85.46 94.17 12 27.91
12116. vakilral (vakilral) 28 85.46 99.12 7 25.00
12117. AtticusB (atticusb) 12 85.46 98.34 3 25.00
12118. Cedric (cedrilicity) 44 85.46 126.57 15 34.09
12119. Sarah (sarahmae123) 102 85.46 116.53 31 30.39
12120. Leon (leonakerz) 1 85.46 85.46 1 100.00
12121. Manne (epicblueberry) 135 85.46 106.74 37 27.41
12122. Jack (quertx) 2 85.46 90.04 0 0.00
12123. Rex (redrex) 7 85.45 96.29 1 14.29
12124. kevin (kongdonglong32) 144 85.45 112.20 45 31.25
12125. Ryan (ryan767898) 3 85.45 89.13 0 0.00
12126. tstats[clob1414] (clob1414) 6 85.45 95.72 1 16.67
12127. Jeremy (fairyballyt) 21 85.45 98.80 4 19.05
12128. Gabriel (gabp) 65 85.45 99.62 17 26.15
12129. Alish (dek_u) 24 85.45 106.09 9 37.50
12130. ༄༊࿆Faith࿐ (adaling369) 68 85.44 106.26 16 23.53
12131. Brett (brettshaw) 8 85.44 112.11 2 25.00
12132. Andrew (hurricaneandrewbs) 12 85.44 96.96 2 16.67
12133. Alex (alexkyo) 7 85.44 102.28 2 28.57
12134. XD (budgettypo) 16 85.44 102.27 3 18.75
12135. drakcorian (drakcorian) 6 85.44 98.62 3 50.00
12136. James (jamesks) 21 85.44 96.74 7 33.33
12137. Micha (derpeus) 5 85.43 97.19 1 20.00
12138. Glenn (glennthemaster) 4 85.43 93.59 0 0.00
12139. marvic (itsmarvic) 40 85.43 106.94 12 30.00
12140. Papa (papaosmurf) 4 85.43 93.77 0 0.00
12141. Evan (notrabe) 2 85.42 86.44 0 0.00
12142. Phuc (nholoinhoi) 12 85.42 97.66 5 41.67
12143. Harishraj (chintubro) 7 85.42 92.36 1 14.29
12144. a3533 (a3533) 8 85.41 93.80 1 12.50
12145. rrt (even_faster) 4 85.41 91.58 2 50.00
12146. WayLay (waylay17) 47 85.41 121.96 15 31.91
12147. mike (brons48) 55 85.41 125.15 19 34.55
12148. M (maxopie) 27 85.41 97.79 6 22.22
12149. Jayden (gaminglz) 12 85.41 101.85 3 25.00
12150. Cxlt (fujimaaa) 398 85.41 117.00 133 33.42
12151. Mickey (m_dvorak) 5 85.41 102.10 1 20.00
12152. Jim (problemset) 83 85.40 106.37 27 32.53
12153. M Ali +923104362942 (35wppm) 2 85.40 87.20 0 0.00
12154. slow typer (chessbobble) 13 85.40 104.26 6 46.15
12155. Mats (uxorialrook) 10 85.40 94.79 3 30.00
12156. bitte (bitteschnell) 11 85.40 106.22 8 72.73
12157. jazzy (jazzy_trojan) 22 85.39 102.61 8 36.36
12158. Alyx (sezzag) 6 85.39 88.80 2 33.33
12159. mosho (sidosido) 51 85.39 102.59 12 23.53
12160. Ikuya (eternal198) 1 85.39 85.39 0 0.00
12161. Breadman (breadman0123) 16 85.39 96.55 5 31.25
12162. lpd11 (lpd11) 28 85.39 93.21 9 32.14
12163. Jose (hosey_) 22 85.38 104.71 5 22.73
12164. Unnamed (unnamedflower) 1,701 85.38 110.81 515 30.28
12165. Krypto (krypto406) 6 85.38 95.60 2 33.33
12166. Saph (saphie) 9 85.38 98.76 4 44.44
12167. tobias (thandschin) 116 85.38 102.31 31 26.72
12168. Crackersontheshelf (taejung... 47 85.38 101.96 16 34.04
12169. July (phi4069) 2 85.37 92.53 0 0.00
12170. Ray (gelastical) 8 85.37 95.68 2 25.00
12171. Pj (orchrist) 24 85.37 106.57 2 8.33
12172. Inox (inox) 19 85.37 97.25 6 31.58
12173. Alexei (alexiedad) 66 85.37 109.09 13 19.70
12174. Alexandre (malfortune) 3 85.37 91.05 1 33.33
12175. Douglas (douglasmm24) 3 85.37 93.24 1 33.33
12176. Ast (astrxse) 13 85.37 107.56 3 23.08
12177. SirAlig (siralig) 207 85.37 107.31 57 27.54
12178. Doven (doven) 29 85.36 104.01 13 44.83
12179. Andre (dreson03) 120 85.36 114.59 36 30.00
12180. apple (app1esauce) 1 85.36 85.36 0 0.00
12181. Tyler (tinss619) 8 85.36 91.65 3 37.50
12182. Hey (adksljfaslkfjsaf) 5 85.36 98.11 3 60.00
12183. Mac (327type) 3 85.36 96.98 0 0.00
12184. bri (greased_lightning10) 165 85.36 113.05 60 36.36
12185. Vedran (veco98) 2 85.36 87.24 1 50.00
12186. Hayden (the_dizzler) 21 85.35 99.55 8 38.10
12187. Bryjeen (chronoalpha) 8 85.35 92.98 4 50.00
12188. Eric (cool_armadillo) 12 85.35 100.25 5 41.67
12189. nim (nimen) 3 85.35 90.21 0 0.00
12190. ⁦⁧Mukundan (mukundan314) 79 85.35 106.49 23 29.11
12191. Retro (ghostggum) 4 85.35 92.93 3 75.00
12192. Jane (sarf) 231 85.35 113.61 81 35.06
12193. Home (homeloverboy) 5 85.35 91.98 0 0.00
12194. Prosper (prosperhuang) 120 85.35 105.89 30 25.00
12195. Dan (zizochefe) 1 85.35 85.35 1 100.00
12196. Taka (takatyper) 4 85.35 91.14 0 0.00
12197. D4Backdoor (keskin) 24 85.35 103.85 4 16.67
12198. Radek (radecekwriter) 56 85.35 99.32 18 32.14
12199. mky (mky1) 33 85.35 101.89 13 39.39
12200. Sitraka (tsukimurphy) 45 85.34 100.63 9 20.00
12201. A (ad1217) 3 85.34 89.45 1 33.33
12202. jz (kokosha) 49 85.34 107.02 19 38.78
12203. Zach (zacuum) 19 85.34 105.06 5 26.32
12204. Crystal (arcee143) 135 85.34 113.45 97 71.85
12205. Jamie (jamietyper90) 153 85.33 110.22 45 29.41
12206. cooler (unpluged) 13 85.33 95.68 3 23.08
12207. nik (nikoloose) 3 85.32 94.23 1 33.33
12208. RioDa (bleachinq) 54 85.32 103.50 12 22.22
12209. God (godlevel) 52 85.32 102.04 43 82.69
12210. MD (sarfaraz008) 156 85.32 120.76 63 40.38
12211. Blu (blu_0) 21 85.31 101.64 12 57.14
12212.   (yewk) 16 85.31 101.39 8 50.00
12213. Jacob (rath130) 1 85.31 85.31 1 100.00
12214. just bored (psychosam1337) 2 85.31 91.77 0 0.00
12215. Trent (opman335) 3 85.31 91.14 1 33.33
12216. jacky (jacky32) 1 85.31 85.31 0 0.00
12217. Mahmoud (sayed1) 429 85.31 106.58 106 24.71
12218. Brian (hydrobox) 19 85.30 96.46 2 10.53
12219. Andy (nuudle) 1 85.30 85.30 0 0.00
12220. Mana (mannaa) 4 85.30 92.15 0 0.00
12221. dylan (crspy) 144 85.30 118.61 29 20.14
12222. arman_ferdous (arman_ferdous) 10 85.30 92.64 2 20.00
12223. nougatsoup (nougatsoup) 2 85.30 86.75 0 0.00
12224. Bradley (bradt30h) 3 85.29 87.45 1 33.33
12225. MarioCrafter (mariocrafter101) 6 85.29 98.64 1 16.67
12226. Erik (soggybutter) 1 85.29 85.29 0 0.00
12227. pintoa (pintoa) 15 85.29 98.73 5 33.33
12228. damList (damanthm) 400 85.28 114.45 119 29.75
12229. Dean (tennis2002) 2 85.28 96.35 1 50.00
12230. sgbiscuits (snailzzy) 314 85.28 98.23 111 35.35
12231. Norris (norris_is_fat) 3 85.28 90.76 2 66.67
12232. tstats[_jamin_] (_jamin_) 48 85.27 102.65 25 52.08
12233. Dio (waterboyz) 3 85.27 91.01 2 66.67
12234. Calvin (xmonkeymonk) 2 85.27 86.42 1 50.00
12235. Prabh (prabh1601) 88 85.27 103.95 31 35.23
12236. Ralph Angelo (slow_penguin) 232 85.27 111.21 53 22.84
12237. Товарищ (hamkor) 22 85.26 97.15 9 40.91
12238. Hunter (wizardhunter11) 130 85.26 108.99 35 26.92
12239. Tom (minitom) 1 85.26 85.26 1 100.00
12240. Karol (kerol0) 3 85.26 89.81 1 33.33
12241. Lynxi (notmystik_) 4 85.26 89.92 1 25.00
12242. Maggie (swagmag) 7 85.26 96.60 2 28.57
12243. macura (bobbygreg) 98 85.25 122.65 36 36.73
12244. Albion (albionthegreat) 12 85.25 96.46 1 8.33
12245. darkestrevolt (darkestrevolt) 8 85.25 92.99 3 37.50
12246. josiah (mangofeline) 18 85.25 113.55 7 38.89
12247. ok doinb (superex23) 9 85.24 89.81 3 33.33
12248. Jonathan (jonathantf2) 1 85.24 85.24 1 100.00
12249. Matías (colocolo91) 15 85.24 94.37 4 26.67
12250. Yevhenii (prinzeugen) 37 85.23 100.44 14 37.84
12251. Malik (sweetbubblegum_50) 11 85.23 98.80 2 18.18
12252. Kid (zenfire9001) 83 85.23 107.71 20 24.10
12253. R1ng (r1ng) 15 85.23 103.94 4 26.67
12254. mona (matuska) 1 85.23 85.23 1 100.00
12255. chumchumlol (chumchumlol) 7 85.23 90.24 3 42.86
12256. sloth (illeatyou) 4 85.23 88.89 1 25.00
12257. BobbyWasabi (bobby_wasabi_) 64 85.23 109.33 18 28.13
12258. Fly1nthe5ky (fly1nthe5ky) 30 85.23 100.80 9 30.00
12259. fbabylemon (fbabylemon) 20 85.22 96.15 7 35.00
12260. Joe (bot_joe) 15 85.22 92.19 4 26.67
12261. 𓇋𓋴𓆑𓏏𓅪 (infer... 244 85.22 122.49 78 31.97
12262. pebble (pebblewebble) 22 85.22 100.32 7 31.82
12263. Keyon (keyonhanjani) 5 85.22 99.62 4 80.00
12264. be (besalt) 44 85.22 105.90 10 22.73
12265. The (thedetails) 6 85.22 93.96 2 33.33
12266. ph (phmi) 16 85.22 103.23 6 37.50
12267. Jayden (grapes_2005) 6 85.21 95.94 0 0.00
12268. ▄︻̷̿┻̿═━一 (h... 1 85.21 85.21 0 0.00
12269. hahaha (hahaha6969) 7 85.21 101.09 2 28.57
12270. anthony (freesubs) 1 85.21 85.21 0 0.00
12271. Chase (ccummins) 14 85.21 103.73 4 28.57
12272. ramen (lightning_poliwag) 288 85.21 119.12 98 34.03
12273. peepee (hehehe_yup) 4 85.21 88.45 0 0.00
12274. Nistiarius (nistiarius) 536 85.21 122.20 134 25.00
12275. Emmanuel (khwarz) 6 85.21 95.81 1 16.67
12276. Roni (human_ro) 9 85.21 93.70 7 77.78
12277. azenia (azenia) 2 85.21 87.45 2 100.00
12278. blobfish (blobfishk) 7 85.20 94.16 1 14.29
12279. Dots (wheremydots) 7 85.20 101.81 1 14.29
12280. Hung (rxpython) 1 85.20 85.20 0 0.00
12281. Rekordea (rekordea) 37 85.20 113.35 13 35.14
12282. Shoaib Akbar (ma_boi619) 5 85.20 91.63 4 80.00
12283. Hans (hansyu7) 17 85.19 92.18 6 35.29
12284. BeGood (notideal) 27 85.19 106.40 6 22.22
12285. wii (nobodylovesraymond) 22 85.19 98.52 7 31.82
12286. enton (enton420) 5 85.19 91.45 3 60.00
12287. Oobi (oobixyz) 13 85.18 103.29 5 38.46
12288. Epic (epicgamesceo) 13 85.18 102.89 5 38.46
12289. Soph (sssoooppphhh) 10 85.18 98.02 1 10.00
12290. Shaiyaan (infinitysc) 1 85.18 85.18 0 0.00
12291. Krzysztof (tygryz) 15 85.18 102.49 4 26.67
12292. McKle (mckle7) 55 85.17 101.79 14 25.45
12293. Ben (thebkway) 5 85.17 92.84 0 0.00
12294. ARTHUR (4rthur) 34 85.17 107.92 12 35.29
12295. Chris (chrdex789) 6 85.17 97.37 1 16.67
12296. Vu (3nim3) 124 85.17 108.17 31 25.00
12297. Afaq (afaqkhan) 50 85.17 103.64 14 28.00
12298. alf (unocha) 2 85.17 93.20 2 100.00
12299. Andre (lordesupremo) 2 85.17 90.52 1 50.00
12300. Noah (excell) 72 85.16 107.70 21 29.17
12301. godofpainTR (godofpaintr) 7 85.16 99.10 7 100.00
12302. tan (tnttant) 18 85.15 98.13 8 44.44
12303. Maxi (swimincircles) 19 85.15 104.47 8 42.11
12304. tak power (langsungg) 27 85.15 96.64 7 25.93
12305. George (geoju) 39 85.15 106.75 13 33.33
12306. Jude (judead05) 2 85.15 93.78 1 50.00
12307. Sean (skimchi) 2 85.15 87.71 1 50.00
12308. Charlie (cdicey) 13 85.15 103.93 4 30.77
12309. antifragile (antifragile) 142 85.15 126.32 42 29.58
12310. Avi (avi_1301) 3 85.15 86.53 1 33.33
12311. Isaac (whosisaac) 3 85.15 89.38 2 66.67
12312. Stanley (shidanley) 4 85.15 91.18 1 25.00
12313. Suigikawa (suigikawa) 8 85.14 95.97 4 50.00
12314. IlhanKhayru (fangian) 10 85.14 103.71 2 20.00
12315. Michael (mikell) 1 85.14 85.14 0 0.00
12316. JetroCuber (jetrocuber) 2 85.14 88.15 2 100.00
12317. Parker (iamrex) 6 85.14 92.37 5 83.33
12318. chandara (chan92) 47 85.14 105.93 21 44.68
12319. Jayden (jay62) 8 85.14 101.12 5 62.50
12320. Yash (yash1402_) 123 85.14 108.74 28 22.76
12321. Arnold (argoat) 2 85.14 88.86 1 50.00
12322. ss (ssdel) 127 85.13 116.43 48 37.80
12323. Kasey (kaseshib) 26 85.13 105.36 6 23.08
12324. Dusa (enjdusan) 7 85.13 95.77 1 14.29
12325. Kamalesh (brrrr_007) 16 85.12 105.84 4 25.00
12326. Sherwin (zafiros) 2 85.12 91.06 1 50.00
12327. Bibi (omusubee) 1 85.12 85.12 1 100.00
12328. Type (quic_qwerty) 7 85.12 93.38 2 28.57
12329. mrid13211 (mrid1321) 2 85.12 97.02 2 100.00
12330. Drews (drwsmnlpg) 1,253 85.11 113.22 373 29.77
12331. Faded7 (faded7) 11 85.11 98.58 3 27.27
12332. Thomas (unc4me4568) 2 85.11 93.10 1 50.00
12333. Rarely type in my job (catc... 35 85.10 106.68 14 40.00
12334. Alex (laralex) 56 85.10 100.32 21 37.50
12335. Caco (cacopholey) 35 85.09 111.00 11 31.43
12336. Adnan (adnanzami) 3 85.09 89.50 1 33.33
12337. Nebula (nebakki) 7 85.09 104.04 4 57.14
12338. Basel (baselhatata) 77 85.09 108.70 30 38.96
12339. Kenneth (kpphamdao) 4 85.09 97.34 3 75.00
12340. Graham (grayham11) 32 85.08 99.76 9 28.13
12341. Sapphire (wl23) 47 85.08 106.14 14 29.79
12342. Alex (poop_guy) 22 85.08 98.32 3 13.64
12343. Bronze (bronzefrakk) 16 85.08 94.34 5 31.25
12344. Filip (fichomaster) 18 85.08 100.42 14 77.78
12345. Taiwan is a country (17lingh1) 220 85.07 109.13 65 29.55
12346. IAmSpeed (iamspeed3015) 1 85.07 85.07 1 100.00
12347. Jose Manuel (slowmanl0l) 177 85.07 115.70 49 27.68
12348. James (jayuplink) 28 85.07 98.82 8 28.57
12349. fastboi (ooofooo) 15 85.07 96.79 3 20.00
12350. sam (samxkl) 4 85.06 91.30 1 25.00
12351. babao (babao) 79 85.06 114.66 23 29.11
12352. JOJ (not2gud) 4 85.06 90.56 2 50.00
12353. ace (pressctrlandw) 153 85.06 101.23 44 28.76
12354. Prabhu (prabhusengal) 12 85.06 97.14 4 33.33
12355. Michal (micha13) 11 85.05 96.29 2 18.18
12356. Aryan (arcuh) 219 85.05 112.37 76 34.70
12357. Mr.Buttons (_tanuuuu) 10 85.05 93.72 3 30.00
12358. ¯\_(ツ)_/¯ (raredutchkil... 23 85.05 103.87 6 26.09
12359. Max (maxbro) 10 85.05 100.12 5 50.00
12360. Chris (___chris) 85 85.05 106.74 24 28.24
12361. Kitzuney (kitzuney) 41 85.05 95.74 13 31.71
12362. Nikola (nikola5056) 5 85.05 94.88 2 40.00
12363. Taylor Ray (taylorrayhoward) 2 85.05 88.76 0 0.00
12364. Viet (vietvhcr) 4 85.04 94.49 1 25.00
12365. Akhil (cheetahoo7) 21 85.04 95.98 7 33.33
12366. notkailey (notkailey) 21 85.04 98.50 9 42.86
12367. awesomedude1440 (awesomedud... 8 85.04 116.53 5 62.50
12368. Steven (corilx) 5 85.04 90.43 0 0.00
12369. Tricky (trickydot) 2 85.04 87.94 0 0.00
12370. Andy (drancio) 3 85.03 89.96 1 33.33
12371. val (valerieso) 5 85.03 87.18 4 80.00
12372. Charlie (charlibre) 24 85.03 107.31 8 33.33
12373. N3gativeZero (whatsupbrandon) 7 85.03 106.44 3 42.86
12374. Matthew (mjthekandyman) 5 85.02 102.58 2 40.00
12375. Kevin (flash98765) 3 85.02 90.85 3 100.00
12376. amanullah (amanullah32) 626 85.02 115.39 208 33.23
12377. BlueSlimeX (blueslimex) 9 85.02 94.74 8 88.89
12378. Joël (jenol) 1 85.02 85.02 1 100.00
12379. Thomas (onlyphams) 26 85.02 112.28 7 26.92
12380. Enclosed (enclosedletter) 49 85.02 103.09 17 34.69
12381. Jeffrey (jebbrey) 5 85.01 99.70 3 60.00
12382. ItsMega (itzmega) 2 85.01 90.21 2 100.00
12383. Jason (randombananazz) 2 85.01 88.91 0 0.00
12384. Pho (phobreze) 18 85.01 104.16 2 11.11
12385. Delirious (deliriousbadger) 3 85.00 90.55 0 0.00
12386. shawty (pogchampion1969) 188 85.00 101.06 47 25.00
12387. Basil (falaedor) 13 85.00 95.00 4 30.77
12388. Uncle Jim (krispysox) 2 85.00 93.03 0 0.00
12389. SockYeh (sockyeh) 10 84.99 97.81 5 50.00
12390. Adam (adamcoch) 25 84.99 95.52 7 28.00
12391. natc (natc2) 16 84.99 97.86 7 43.75
12392. Edward (kailhreds) 924 84.99 109.75 269 29.11
12393. will (zootzootie) 26 84.98 103.06 8 30.77
12394. Austin (illumi97) 1 84.98 84.98 0 0.00
12395. Ide (reyybruh) 1 84.98 84.98 0 0.00
12396. Ryan (wilderrw) 9 84.98 105.01 2 22.22
12397. Youssef (youssef1781) 5 84.97 99.56 2 40.00
12398. Giuseppe (shmebulock2) 457 84.97 123.86 171 37.42
12399. Shaggy (remrem0) 16 84.97 100.30 3 18.75
12400. ObiWanKeyboardobi (obiwanke... 137 84.97 119.84 36 26.28
12401. Atticus (plutakis) 3 84.97 93.77 0 0.00
12402. eldon (smile4dasight) 3 84.97 89.22 1 33.33
12403. EonDuoLatios (eonduolatios) 3 84.97 86.24 3 100.00
12404. Llihcon (whoflayslikeme) 7 84.97 89.42 2 28.57
12405. Perich (perich) 100 84.96 108.33 33 33.00
12406. Jasper (itsjasper) 1 84.96 84.96 1 100.00
12407. Kanti (gunjique) 4 84.96 93.05 2 50.00
12408. GoldenSnitch (goldensnitch73) 32 84.96 103.83 7 21.88
12409. Riddy (songridv) 139 84.96 120.42 43 30.94
12410. Syo (_syo_) 2 84.96 88.28 0 0.00
12411. Samuel (spiriteater) 49 84.95 96.81 15 30.61
12412. Jesse (jessechu) 4 84.95 94.20 1 25.00
12413. Argo (argonautika) 118 84.95 108.49 30 25.42
12414. FlyAtNight (flyonkeyboard) 63 84.95 101.06 22 34.92
12415. Kuhaku (0kuhaku1) 3 84.94 94.64 2 66.67
12416. MoDX (trollcannon) 11 84.94 92.93 2 18.18
12417. blueturtle (esraels) 3 84.94 89.56 0 0.00
12418. pineapple (pineappleink) 7 84.94 96.30 5 71.43
12419. Termite (termite04) 2 84.94 103.60 1 50.00
12420. José Miguel (mikel2077) 18 84.93 101.22 6 33.33
12421. Anonymous (ghajik) 14 84.93 101.58 13 92.86
12422. piglet (orangepig111) 17 84.93 100.29 6 35.29
12423. Taika (hariyoshi41) 9 84.93 92.65 4 44.44
12424. Kalin (kamarel) 33 84.93 104.81 13 39.39
12425. Ghost racing medalists suck... 2,550 84.93 117.14 733 28.75
12426. Tahsin (drevil13) 40 84.92 99.19 12 30.00
12427. Emilio (emilioc) 229 84.92 118.58 54 23.58
12428. Zaid (zaids) 149 84.92 108.42 34 22.82
12429. Sithu (siaung) 3 84.92 89.42 1 33.33
12430. Fish (labia_majora) 6 84.92 93.67 2 33.33
12431. pwned (16wpm) 27 84.91 95.55 4 14.81
12432. Brent (brvnt) 61 84.91 103.09 20 32.79
12433. York (yorkay) 304 84.91 110.84 95 31.25
12434. Spark (5parkmark) 45 84.91 102.04 15 33.33
12435. cookie (timecookie) 18 84.91 95.48 8 44.44
12436. Marco (yougottachill) 2 84.91 85.70 1 50.00
12437. David (traummann2157) 1 84.91 84.91 1 100.00
12438. Maki (mxki) 3 84.91 99.06 0 0.00
12439. Nicholas Dimitrov (nickytyp... 61 84.91 131.20 20 32.79
12440. Splonk (splonk) 181 84.90 108.20 70 38.67
12441. Blue Alps, baby! (model_m_k... 165 84.90 111.41 60 36.36
12442. slow (anjal23) 97 84.90 107.48 32 32.99
12443. anepik (anepik) 9 84.90 101.51 7 77.78
12444. Alan (yuzhi) 9 84.90 99.45 1 11.11
12445. norush (norush) 244 84.90 102.24 66 27.05
12446. jlsyber (jlsyber) 15 84.90 98.26 6 40.00
12447. Marcus (marcuseon) 2 84.90 86.40 1 50.00
12448. Kai (ckai) 36 84.89 109.76 6 16.67
12449. Albert (certikbertik) 108 84.89 109.43 33 30.56
12450. Cres (crespear) 78 84.89 105.63 19 24.36
12451. yesman (yesman9527) 1,314 84.89 141.81 412 31.35
12452. bart (bartfart) 15 84.88 92.08 3 20.00
12453. Jonathan (sharkeyyy) 4 84.88 93.62 0 0.00
12454. koen (chromoplast) 8 84.88 94.54 0 0.00
12455. sentim3ntal1 (sweet_malaak) 7 84.88 97.78 1 14.29
12456. Dan (dgallerz) 44 84.88 106.43 14 31.82
12457. zach (slickzach) 3 84.87 89.55 2 66.67
12458. kawion (kawion) 1 84.87 84.87 0 0.00
12459. todayis_WanD (zeropatience) 8 84.87 107.43 2 25.00
12460. Jacob (spacelamar) 13 84.87 96.05 3 23.08
12461. Kaloyan (kokicha120) 168 84.86 110.16 49 29.17
12462. Bodie (bodejazz) 30 84.86 98.14 10 33.33
12463. Stephen (bloodwineskg) 2 84.86 91.12 0 0.00
12464. Matthew (mmcjoynt) 8 84.86 99.79 4 50.00
12465. J (jiffan) 18 84.86 96.30 4 22.22
12466. Kimie (lil_pulsar) 177 84.86 118.73 53 29.94
12467. Artorias (artorias_) 25 84.85 101.15 0 0.00
12468. pepperooni (papipepperooni) 51 84.85 100.56 22 43.14
12469. penrose (penrosecat) 513 84.85 117.05 169 32.94
12470. Boba (tapiocaman) 231 84.85 110.28 71 30.74
12471. Bodhi$attiva (ptran) 40 84.85 107.19 11 27.50
12472. Coda (coda06) 2 84.85 86.63 1 50.00
12473. advu_ (advu_) 2 84.85 85.50 0 0.00
12474. Bear (pr0d19y) 7 84.84 89.43 1 14.29
12475. Izad (superlative) 5 84.84 94.38 3 60.00
12476. i write code (_yay) 10 84.83 105.36 8 80.00
12477. Evan (evan1167) 2 84.83 87.57 0 0.00
12478. Corny (cornyy) 5 84.82 96.60 2 40.00
12479. Charlie (hypotrance) 6 84.82 98.43 2 33.33
12480. MO$$ (monilyn) 13 84.82 96.79 5 38.46
12481. Ken (keni98) 15 84.82 99.92 5 33.33
12482. Preston (ziphyy) 3 84.82 91.29 2 66.67
12483. Rick Astley (beardybeardy) 358 84.81 115.83 88 24.58
12484. Nima (nimayaqmuri) 281 84.81 105.96 81 28.83
12485. Joshua (brothersquid123) 12 84.81 100.59 2 16.67
12486. SHU (shu_ik) 41 84.80 107.25 14 34.15
12487. Mathieu (leginacl) 4 84.80 91.57 0 0.00
12488. Mujahid (chaos_knight) 5 84.80 91.43 1 20.00
12489. Cole (cole_denson) 8 84.80 90.34 5 62.50
12490. Hypatia (aelhypatia) 3 84.80 94.23 1 33.33
12491. StantheAsian90 (stantheasia... 15 84.79 99.35 4 26.67
12492. Leriut (leriut) 1 84.79 84.79 1 100.00
12493. Kyi Phyu (crystal_emerson) 18 84.78 95.34 6 33.33
12494. Girl (piemaniac) 227 84.78 113.74 63 27.75
12495. Bazingas (shinyy) 1 84.78 84.78 0 0.00
12496. nizam (nizamovicxi) 75 84.78 103.27 19 25.33
12497. Uncreeperble (uncreeperble) 32 84.78 117.56 10 31.25
12498. none (lyuseg) 5 84.78 104.23 1 20.00
12499. Matthew (rush_a) 87 84.77 109.02 25 28.74
12500. Arr (htunkyaw) 73 84.77 107.43 17 23.29
12501. Protein (rsandland) 38 84.77 98.75 9 23.68
12502. Erika (frenzymania) 19 84.77 101.64 3 15.79
12503. Lapis (lapisor) 3 84.77 94.80 3 100.00
12504. Okiiiieee (acharyas) 270 84.76 111.42 72 26.67
12505. ashalisalamdanam (ashalisal... 52 84.76 96.24 16 30.77
12506. Kevin (keviniskevy) 16 84.76 101.07 4 25.00
12507. S (sima0502) 77 84.76 103.66 22 28.57
12508. sasd (fallenlarry) 15 84.76 104.10 7 46.67
12509. AJ (5onn) 9 84.75 96.37 2 22.22
12510. lush (lush) 5 84.75 91.18 0 0.00
12511. Albert (aneuck) 25 84.75 110.62 11 44.00
12512. A (__a_) 21 84.75 101.27 6 28.57
12513. Josh (jtaube) 26 84.75 97.01 7 26.92
12514. Brian (powerraider064) 2 84.75 95.47 1 50.00
12515. no (noob1720) 77 84.74 98.03 21 27.27
12516. Owen (owenecollins) 13 84.74 96.24 3 23.08
12517. Missy (lovelydy) 237 84.73 104.69 62 26.16
12518. Kotaro (kotaro_qwerty) 397 84.73 108.81 114 28.72
12519. Rall (raullll) 8 84.73 97.68 2 25.00
12520. Omar (oshnatour) 11 84.73 107.29 2 18.18
12521. Candlelight (candlelight8) 40 84.72 103.65 12 30.00
12522. Andrew (ddrone) 5 84.72 88.06 1 20.00
12523. SystemOfAKitty (mischi334) 9 84.72 95.01 1 11.11
12524. Praveen (praveen3791) 48 84.72 98.48 11 22.92
12525. Mark (mark427) 6 84.72 96.58 2 33.33
12526. James (paintballonu) 4 84.72 93.23 1 25.00
12527. NZY (janghanseok) 179 84.72 109.36 49 27.37
12528. Bean (beansbeansbeans) 207 84.71 106.33 41 19.81
12529. bjonk biggest fan (pengeuin) 4 84.71 93.17 1 25.00
12530. Fatnot (fatnot) 152 84.71 112.01 39 25.66
12531. ACC [99 - 100] (dinoh_sandys) 100 84.70 105.20 44 44.00
12532. Gibby (papimonster69) 20 84.70 94.25 7 35.00
12533. dann (raclino) 1 84.70 84.70 0 0.00
12534. Caio (caiobatman) 1 84.70 84.70 0 0.00
12535. zlyxx (zlyxx) 21 84.70 110.47 6 28.57
12536. gandastik (gandsatik) 36 84.70 98.82 11 30.56
12537. Regz (regz84) 17 84.70 99.49 8 47.06
12538. Joshua (mvpalmighty) 7 84.70 94.24 1 14.29
12539. Maheriniaina tstats[kevinrs... 205 84.69 111.69 54 26.34
12540. TBo (tbo_) 118 84.69 110.32 30 25.42
12541. Shontay (spacestayshon) 5 84.69 99.51 1 20.00
12542. Jonathan (trintrun2) 3 84.69 91.20 3 100.00
12543. Edgey (tedge) 1 84.69 84.69 0 0.00
12544. Redugo (somebodyelse) 8 84.69 99.11 5 62.50
12545. Rebekah (rkatter) 1 84.69 84.69 1 100.00
12546. Poopy (linch8) 667 84.69 109.53 192 28.79
12547. Michael (zoyp) 8 84.69 117.43 0 0.00
12548. pavle (hello_kittyy) 120 84.68 101.04 34 28.33
12549. Andre (smallchicken) 113 84.68 113.03 40 35.40
12550. Miguel (migzkulitz05) 1 84.68 84.68 0 0.00
12551. quackstuff (quackstuff) 9 84.67 87.80 3 33.33
12552. qria (qria) 18 84.67 97.91 5 27.78
12553. David (m0zlik) 6 84.67 95.34 0 0.00
12554. nivedh (n43527) 131 84.66 103.44 38 29.01
12555. jaeg3r (jaeg3r) 57 84.66 99.32 14 24.56
12556. Nate (lobdog) 29 84.66 106.23 8 27.59
12557. William (wrneale) 1 84.66 84.66 0 0.00
12558. Arjun (asterbot) 5 84.66 87.53 3 60.00
12559. Glennis (biotic_god) 362 84.65 117.43 90 24.86
12560. Youssef (jo1999) 62 84.65 99.36 15 24.19
12561. Mehti (lylehti) 367 84.64 113.21 96 26.16
12562. Hanny (monson312) 401 84.64 111.60 128 31.92
12563. prisky (prisky) 3 84.64 86.98 1 33.33
12564. Krzysztof (scythonsoul) 4 84.64 93.90 1 25.00
12565. Daffa (daffagusmara31) 7 84.64 90.19 2 28.57
12566. A (sir_riot) 14 84.64 97.03 11 78.57
12567. Nathan (nzmaster0516) 3 84.63 101.25 1 33.33
12568. Steve (steve5731) 12 84.63 95.64 4 33.33
12569. Cat (theveryboredcat) 1 84.63 84.63 0 0.00
12570. Megan (megy147) 2 84.63 85.78 1 50.00
12571. Joseph (cronul) 7 84.63 96.14 4 57.14
12572. JC (invoicingkarma) 60 84.63 103.69 16 26.67
12573. Arjuna (arjuna_) 11 84.63 95.21 3 27.27
12574. For_real (mailindra) 58 84.63 106.18 18 31.03
12575. Lucas (pythonvx) 10 84.62 93.26 6 60.00
12576. T (wish_i_could_type) 3 84.62 89.03 1 33.33
12577. Baran (baranomania) 20 84.62 101.33 5 25.00
12578. Nafeez (smileywee) 8 84.62 97.21 4 50.00
12579. Ben (benw12) 4 84.62 95.84 1 25.00
12580. Com (neon1087) 160 84.62 100.07 48 30.00
12581. Finnnnnnn (bigfinsfananza) 17 84.61 101.64 6 35.29
12582. PERO (pero_op) 1 84.61 84.61 1 100.00
12583. ozamandias (orbman_) 3 84.61 92.09 1 33.33
12584. Max (kinginthenorth78) 65 84.61 99.88 22 33.85
12585. Waleed (waleed_sawalhi) 4 84.60 89.59 0 0.00
12586. Rdmm (rdmm) 149 84.60 102.30 46 30.87
12587. Kristoffer (krioxia) 7 84.60 97.12 5 71.43
12588. James (jarmez) 1 84.60 84.60 0 0.00
12589. Ian (coocooman3) 9 84.60 93.28 2 22.22
12590. Matt (pointlesspostulate) 10 84.60 90.94 7 70.00
12591. tstats[jason823] Jason (jas... 53 84.59 110.92 17 32.08
12592. Erin (iceflake) 12 84.59 101.62 3 25.00
12593. Michael (mdstumpfy123) 9 84.59 91.61 4 44.44
12594. D (chubbieveggie) 20 84.59 96.01 5 25.00
12595. abs0lutz3r0c007 (abs0lutz3r... 354 84.58 105.74 83 23.45
12596. Jax (jacksonn131) 19 84.58 107.12 4 21.05
12597. ZorPieu_FoXXRay-HKM-37 (pet... 205 84.58 103.20 48 23.41
12598. Maria (mariatran9) 3 84.58 90.51 0 0.00
12599. Trap (trapv) 4 84.58 91.72 1 25.00
12600. Frank (franktank840) 1 84.58 84.58 0 0.00
12601. Ryan (ronethenorseman) 204 84.57 102.86 47 23.04
12602. new (quitting101) 5 84.57 94.47 2 40.00
12603. Bill (billxnye) 1 84.57 84.57 0 0.00
12604. Spookee (spookee) 3 84.57 93.50 1 33.33
12605. TypingAway (typinggggggg) 49 84.57 99.95 15 30.61
12606. Paper (paperstache) 8 84.57 89.97 1 12.50
12607. moofasa (macywood) 166 84.56 116.59 57 34.34
12608. typeO (otaku_ish) 2 84.56 91.26 0 0.00
12609. Emryys (whako1337) 3 84.56 102.47 1 33.33
12610. Winnie (win_) 834 84.55 104.38 228 27.34
12611. Thymme (thymme) 63 84.55 108.82 26 41.27
12612. Ali (amizan8653) 87 84.54 104.56 27 31.03
12613. XIN (tem_per) 102 84.54 109.25 18 17.65
12614. Bob (benjiboy970) 10 84.54 90.58 1 10.00
12615. Dylan (dylanthenerd) 1 84.53 84.53 0 0.00
12616. Watrdos (watrdos) 31 84.52 103.12 8 25.81
12617. Kenny (rtootskie) 1 84.52 84.52 0 0.00
12618. Dan (qwerty235) 1,509 84.51 105.98 461 30.55
12619. Mohammad (alamin_typist) 16 84.51 98.83 6 37.50
12620. Gene (senseieggroll) 6 84.51 96.85 1 16.67
12621. BOB (mroglan) 48 84.51 96.49 12 25.00
12622. Ћира (cira12345) 145 84.51 105.40 48 33.10
12623. Keegan (djkeegs) 9 84.51 96.04 2 22.22
12624. Mohamed (mohamed_ayman) 5 84.51 89.03 1 20.00
12625. Allen (allenxxx) 4 84.51 94.44 0 0.00
12626. Hello (julius1331) 290 84.50 109.01 87 30.00
12627. Badral (badralz) 7 84.50 90.14 6 85.71
12628. AAAAAAAAAAAAAAAAAAAAAAAAAAA... 8 84.50 92.14 4 50.00
12629. Sean (seansdb6) 5 84.50 88.58 3 60.00
12630. boniu (wincentbugs) 512 84.49 122.79 151 29.49
12631. Alikhan (realikh) 27 84.49 97.77 9 33.33
12632. Sidharth (iamsidman17) 299 84.49 110.54 85 28.43
12633. Varun (varun2) 1 84.49 84.49 1 100.00
12634. yoshi (themune) 12 84.49 95.79 1 8.33
12635. Dan (danslaps) 13 84.49 98.58 3 23.08
12636. Matt3k (matt3k) 11 84.49 108.69 5 45.45
12637. kunal (kunalmachra) 612 84.49 113.10 181 29.58
12638. d'Ar-apps (darapsas) 8 84.48 97.03 5 62.50
12639. Small (amaro123) 34 84.48 103.96 7 20.59
12640. Francesco (billyboe) 2 84.48 86.61 0 0.00
12641. Dr.D (donghuh601) 7 84.47 99.24 2 28.57
12642. Eternal (eternai) 8 84.47 125.48 3 37.50
12643. NiarbOn (niarbon) 4 84.47 89.80 2 50.00
12644. Hugh (huuugh18) 5 84.46 98.45 1 20.00
12645. taj (taj256) 445 84.46 111.75 106 23.82
12646. My name is Walter Hartwell ... 1 84.46 84.46 1 100.00
12647. Adarsh (adarshtopno) 6 84.46 88.65 2 33.33
12648. Kenny (mckennythekid) 6 84.46 99.45 1 16.67
12649. Zelymm (toxicmyles) 16 84.46 124.71 14 87.50
12650. Walter (chimken1234) 28 84.45 106.70 10 35.71
12651. oneguardsam (oneguardsam) 2,000 84.45 120.98 526 26.30
12652. Ian (zzstatixzz) 1 84.45 84.45 0 0.00
12653. asdf (asdf3) 14 84.44 92.33 2 14.29
12654. gabe (gabersnake) 17 84.44 92.84 4 23.53
12655. Matthew (binko) 16 84.44 95.56 4 25.00
12656. jakub (jakub177) 133 84.44 106.17 37 27.82
12657. Archie (rchieallen) 4 84.44 102.10 0 0.00
12658. ﱞﱞﱞﱞﱞﱞﱞﱞﱞ... 27 84.43 98.55 14 51.85
12659. ryan (10thdentist) 3 84.43 86.70 0 0.00
12660. Luca (kodzack) 9 84.43 98.71 3 33.33
12661. Jack (jackb1379) 1 84.43 84.43 1 100.00
12662. Deep (deepp) 2 84.43 87.84 1 50.00
12663. Molly (notevenhalf2000) 20 84.43 103.16 3 15.00
12664. Smine (sminerino) 3 84.43 98.79 0 0.00
12665. Kevin (kevb0) 6 84.43 98.84 1 16.67
12666. Keshav (keshavisdabeast) 2 84.43 89.51 0 0.00
12667. simon (simon_racer) 2 84.43 84.71 0 0.00
12668. Daniel (xdanielx456) 5 84.42 92.07 2 40.00
12669. Shai (shaichon) 117 84.42 102.94 37 31.62
12670. Sam (monkeh_type_fast) 106 84.41 113.81 37 34.91
12671. Meerkat (mrmeerkat) 4 84.41 98.89 2 50.00
12672. Ammar (marsicus) 21 84.41 101.86 10 47.62
12673. Jayden (nephewjayden) 113 84.41 104.24 31 27.43
12674. Noukarin (noukarin) 38 84.41 106.47 10 26.32
12675. Allen (itzhelix) 3 84.40 86.64 1 33.33
12676. Tala (another_ostrich) 21 84.40 95.69 7 33.33
12677. Scott (nikolasvallesteros) 4 84.40 90.61 3 75.00
12678. Toby (ueue_) 9 84.40 102.87 6 66.67
12679. Darrick (mapleroasted) 26 84.40 108.73 10 38.46
12680. David (cydmium) 7 84.40 92.97 3 42.86
12681. g (merelymyself) 2 84.40 85.98 1 50.00
12682. Eetu (mandarilleri) 399 84.39 116.75 96 24.06
12683. Remy (rmds_dln) 48 84.39 121.02 23 47.92
12684. tstats[xeg28] (xeg28) 32 84.39 94.88 11 34.38
12685. Ludvig (lelzarenn) 3 84.39 91.42 0 0.00
12686. Annabelle (annaballlzz) 22 84.39 96.57 4 18.18
12687. A.S.M.777 (a_s_m_777) 23 84.39 102.56 7 30.43
12688. Yui (nekootoko) 3 84.39 90.98 1 33.33
12689. Alex (sebvettel5) 5 84.38 91.63 2 40.00
12690. Sean (drherpdederp) 111 84.38 106.59 36 32.43
12691. Ramiei (elli_y) 115 84.38 112.88 38 33.04
12692. A (russ1anrock3t) 9 84.38 95.63 9 100.00
12693. H4ndss (h4ndss1) 50 84.38 105.87 16 32.00
12694. Aidan (aidan9500) 13 84.38 94.46 3 23.08
12695. Bea (bearainbow) 24 84.38 100.32 6 25.00
12696. Kyunghwan (mallardk0h) 12 84.37 100.22 2 16.67
12697. [Bl4nk] (mahneymchef) 13 84.37 90.18 6 46.15
12698. Taeyang (taeta3) 73 84.37 107.41 16 21.92
12699. DaRealSiri (darealsiri) 2 84.37 86.37 1 50.00
12700. Desmond (desmond27) 109 84.37 102.03 28 25.69
12701. Tomo (tzxb018) 7 84.36 92.88 1 14.29
12702. Armando (mandy1339) 43 84.36 98.47 12 27.91
12703. abhi (cheapcoder) 63 84.36 104.67 21 33.33
12704. Korbin (auvvia) 20 84.36 102.42 7 35.00
12705. Aquatic (aquache) 13 84.36 101.05 1 7.69
12706. Viktoras (haeven) 214 84.35 113.10 69 32.24
12707. Jon (jcrossley) 10 84.35 93.39 4 40.00
12708. Rb (rbdota2) 1 84.35 84.35 1 100.00
12709. Speed_Reader (nagy_ssbm) 356 84.35 110.01 92 25.84
12710. Gianni (general_patches) 49 84.34 96.13 21 42.86
12711. Tuomas (tumaas) 7 84.34 93.45 3 42.86
12712. Smith (pucymae) 8 84.33 93.67 2 25.00
12713. Mateusz (krakeusz) 7 84.33 94.43 2 28.57
12714. Oliwier (olix04) 159 84.33 102.75 38 23.90
12715. Veer (the_veer) 292 84.33 108.93 79 27.05
12716. Jay (wolfjay757) 60 84.33 105.30 21 35.00
12717. クローエ (seyasoya) 8 84.33 92.63 2 25.00
12718. Tom (krarc) 89 84.31 110.46 20 22.47
12719. Adamowich (adamowich) 16 84.31 102.65 3 18.75
12720. pulux (pulux) 1 84.31 84.31 0 0.00
12721. Laith (blissterrz) 5 84.31 96.81 0 0.00
12722. Alessio (syrius00) 1 84.30 84.30 0 0.00
12723. eehoS (lovespacedreams) 2 84.30 86.11 0 0.00
12724. Adrem (akratic_adrem) 402 84.30 119.87 113 28.11
12725. Diana (agent_artemis) 10 84.30 104.84 2 20.00
12726. coolror (coolroru) 14 84.30 105.01 4 28.57
12727. Gustas (guzhazi) 38 84.29 114.28 13 34.21
12728. Zovar (zovar) 5 84.28 91.94 2 40.00
12729. Kiyo (misterkiyo) 25 84.28 100.88 5 20.00
12730. matt (mattyyc) 2 84.28 86.58 1 50.00
12731. Jack (jaciepierdole) 2 84.28 86.79 0 0.00
12732. NIcola (lenh) 8 84.27 92.20 2 25.00
12733. Andrew (markinandrew) 1 84.27 84.27 1 100.00
12734. ChickenMaster (chickenmaster1) 3 84.27 99.03 0 0.00
12735. Booty (bootykhan) 2 84.27 96.99 1 50.00
12736. Sharkbait (sharkydabnab) 38 84.27 106.53 13 34.21
12737. Simon (sgoldins) 6 84.27 93.32 1 16.67
12738. logan (lacton44) 197 84.27 110.76 70 35.53
12739. P. (psilva00) 300 84.27 108.41 96 32.00
12740. Blake (blaketrombone) 51 84.26 108.56 19 37.25
12741. Francisco (faac98) 6 84.26 87.21 2 33.33
12742. Lian (xlian) 10 84.26 106.87 4 40.00
12743. Nick (bluepenredpen) 178 84.26 112.33 43 24.16
12744. Bill (raaydon) 1 84.26 84.26 0 0.00
12745. Loser (sisyphus_69) 13 84.26 92.56 3 23.08
12746. Nicholas (nickowski) 5 84.26 98.44 0 0.00
12747. Jason (goosejuice) 35 84.26 98.60 6 17.14
12748. Kristin (kweeston) 2 84.26 93.51 2 100.00
12749. Esk (99tester) 2 84.26 93.02 1 50.00
12750. Máté (drunkendegroot) 11 84.25 93.99 4 36.36
12751. Brock (brockbnntt) 41 84.25 110.86 15 36.59
12752. diana (mxclfld) 11 84.25 94.38 5 45.45
12753. Sean (metrognome12) 107 84.25 105.10 40 37.38
12754. Neil (neilprime16) 12 84.25 106.10 4 33.33
12755. Russellazy (russellazy) 68 84.24 111.76 20 29.41
12756. Enkh-Och (mglstew) 39 84.24 110.74 26 66.67
12757. Mark (lemon________) 60 84.24 116.00 19 31.67
12758. cuong (cuongbt91) 23 84.24 92.52 8 34.78
12759. Bekkhan (bkun) 92 84.24 107.57 22 23.91
12760. Lulu (def__init__) 23 84.24 101.67 6 26.09
12761. Ahnaf (ahnaf75) 191 84.24 101.52 53 27.75
12762. Hayward (vhenom) 2 84.23 84.53 1 50.00
12763. Jan (smilingjan) 7 84.23 96.91 1 14.29
12764. YZZUB (chuang010896) 30 84.23 103.25 10 33.33
12765. Carter (cartersaechao92) 4 84.22 105.98 1 25.00
12766. _i_am_flash (_i_am_flash_) 6 84.22 92.76 0 0.00
12767. Jorge (jdominguezzz) 49 84.22 104.45 17 34.69
12768. One (onebyte) 1 84.22 84.22 0 0.00
12769. Zack (zt44king) 6 84.22 89.85 2 33.33
12770. Alan (sexillamasexi) 10 84.22 98.33 6 60.00
12771. Ravenwolf (rvenwolf) 71 84.21 101.37 22 30.99
12772. Stafford (staffordv) 125 84.21 111.88 29 23.20
12773. Frederick (liquidfyre) 17 84.21 100.27 5 29.41
12774. Zerieox (zerieox) 22 84.21 105.14 5 22.73
12775. Alexander (alexxela12345) 6 84.21 94.54 5 83.33
12776. Srihari (crazysriharii) 3 84.20 90.13 0 0.00
12777. Babylons (babylons) 3 84.20 86.04 1 33.33
12778. Cube (cubedefender) 133 84.20 111.91 37 27.82
12779. Jan (ingenieur) 40 84.19 97.98 12 30.00
12780. Jonathan (jonyaa) 114 84.19 105.72 33 28.95
12781. Kaebin (kaebin) 2 84.19 133.79 1 50.00
12782. Jio (jioo) 1 84.19 84.19 0 0.00
12783. Cezar (outstanding29wpm) 13 84.19 89.72 4 30.77
12784. Jenny (jenny_02) 60 84.19 107.92 13 21.67
12785. Tenny (tennykim) 2 84.19 90.46 0 0.00
12786. Anshul (hindu_123) 8 84.18 92.18 4 50.00
12787. Matin (matin_pasargad) 20 84.18 98.41 5 25.00
12788. Itay (itaylol) 1 84.18 84.18 1 100.00
12789. Jaron (jaronli) 4 84.18 103.24 0 0.00
12790. John (danred12344) 7 84.17 96.93 5 71.43
12791. Nicolai (nicolaimanev) 4 84.17 92.22 2 50.00
12792. Nix (nix_) 1 84.17 84.17 0 0.00
12793. Brn (meslowlmao) 1 84.17 84.17 0 0.00
12794. space 65 (jacob1361) 25 84.17 111.16 8 32.00
12795. Sasang (aerialstunt) 90 84.17 102.22 29 32.22
12796. tstats[folgue] (folgue) 27 84.17 99.42 9 33.33
12797. EddieVonShmeddie (eddievons... 9 84.17 102.75 2 22.22
12798. ozaninator (ozaninator) 4 84.16 93.22 2 50.00
12799. Rob (nanijau) 1 84.16 84.16 0 0.00
12800. Vinzel (dukeofweselton) 4 84.16 97.14 1 25.00
12801. nothisisleo (leofire) 483 84.16 108.02 143 29.61
12802. Max (bolognacolonel) 9 84.16 90.25 5 55.56
12803. Benjamin (benhundos) 34 84.16 96.81 8 23.53
12804. Hyena (wildhyena) 135 84.16 114.03 31 22.96
12805. Richard (tbone001) 220 84.15 105.43 57 25.91
12806. Bella (organicsooshi) 3 84.15 87.56 0 0.00
12807. Tim (codingmaster) 3 84.15 89.16 1 33.33
12808. Broodje (broodjebal74) 3 84.15 91.60 2 66.67
12809. aero (aeroagg15) 123 84.14 110.91 38 30.89
12810. Martin (nyborg) 1 84.14 84.14 1 100.00
12811. Paitpan (mixptp) 1 84.14 84.14 1 100.00
12812. Kevki (kevki_) 111 84.14 104.61 34 30.63
12813. Adi (diddly_doo) 35 84.13 95.31 7 20.00
12814. m&m (egyz) 126 84.13 101.55 43 34.13
12815. Ross (pogchammp) 22 84.13 111.07 7 31.82
12816. Accuracy (attempts_at_accur... 12 84.13 94.08 6 50.00
12817. Roman (rdprice) 8 84.13 95.19 3 37.50
12818. Quinn (dewdrive101) 5 84.12 93.13 1 20.00
12819. Night (nighterror) 5 84.12 91.61 3 60.00
12820. JerseySlums (jerseyslums) 19 84.12 113.47 7 36.84
12821. Dean (wahrheit) 10 84.12 102.85 3 30.00
12822. pranked (pranker666) 54 84.12 102.91 18 33.33
12823. Tudi (tudipym) 2 84.12 86.46 0 0.00
12824. Phinix (soaringphinix) 43 84.11 99.62 10 23.26
12825. Caal (recumbent) 14 84.11 97.48 2 14.29
12826. Vincent (jvgcalites) 77 84.11 102.02 18 23.38
12827. Dingus Fish (dingusfish) 107 84.11 101.97 35 32.71
12828. Vit (denysvit) 27 84.10 94.97 12 44.44
12829. Miryoku (miryokucolemakdh) 38 84.10 106.25 20 52.63
12830. KOCHENGOREN (renasha) 18 84.10 97.67 7 38.89
12831. Moishi (moishi) 47 84.10 102.73 14 29.79
12832. Majdi (freuud) 82 84.10 97.35 27 32.93
12833. Diego (divarela) 2,505 84.10 111.84 730 29.14
12834. Turkey (habibiturkey) 9 84.09 104.57 5 55.56
12835. Calvin (blindpainter) 3 84.09 87.10 1 33.33
12836. Daniel (dark0nee) 73 84.09 96.25 20 27.40
12837. julian (quasiker) 12 84.08 104.05 4 33.33
12838. Omar (omarkalii) 1 84.08 84.08 0 0.00
12839. Locklyn (locky_) 12 84.08 102.31 2 16.67
12840. True (truefalse) 2 84.08 87.75 2 100.00
12841. uday (uday12381) 15 84.07 99.02 2 13.33
12842. Quiq (quiqmeng) 1 84.07 84.07 0 0.00
12843. Lynn (lynnhanananer1) 103 84.07 103.86 24 23.30
12844. Munyoudoum (munyoudoum) 7 84.07 93.88 1 14.29
12845. Jemma (jmmstvnsn) 384 84.07 106.19 93 24.22
12846. Eduardo (airplane_cakes) 20 84.07 109.36 5 25.00
12847. adrianna (adriannna) 51 84.06 115.52 8 15.69
12848. Giles (gga_) 5 84.06 88.59 1 20.00
12849. tstats[troutmaan] (troutmaan) 1 84.06 84.06 0 0.00
12850. (thereayou) 26 84.06 99.22 8 30.77
12851. Darius (lovefirecrackers) 3 84.06 98.52 1 33.33
12852. e (officialinsert) 3 84.06 93.62 1 33.33
12853. veryfatman (frankknight23) 15 84.06 101.27 5 33.33
12854. Keviism (keviism) 6 84.06 89.21 4 66.67
12855. yousuf (yousufmanikfan) 2 84.05 86.76 1 50.00
12856. Jack (modesties) 40 84.05 100.25 14 35.00
12857. Rocky (rocky_whale) 13 84.04 111.66 7 53.85
12858. Shaun (shaunlooi) 32 84.04 99.07 11 34.38
12859. Cakers (pvpcakers) 489 84.04 111.14 163 33.33
12860. June (lumierevi) 31 84.04 98.72 9 29.03
12861. egork1dd (egorkidd) 4 84.04 88.92 1 25.00
12862. Ezra (papu7505) 3 84.04 97.17 1 33.33
12863. Adam (aeoff72) 13 84.04 110.68 4 30.77
12864. NANI (aurimuxasltgg) 4 84.03 89.43 2 50.00
12865. Ad4mxp (ad4mxp) 3 84.03 86.54 0 0.00
12866. qwerty (jowk) 82 84.03 107.27 22 26.83
12867. Bae (baenimbae12) 44 84.02 105.70 13 29.55
12868. Griffin (glkannberg) 2 84.02 86.60 2 100.00
12869. Sasa (sasamaster) 1 84.02 84.02 0 0.00
12870. Josh (raybanned) 17 84.02 108.86 3 17.65
12871. Karston (karstonjim) 17 84.02 93.11 17 100.00
12872. The D Legend (the_d_legend) 59 84.02 97.02 14 23.73
12873. 🟣⚪🟣 (duckz__) 2 84.02 84.37 1 50.00
12874. Eobard (abdouhamel) 46 84.01 111.08 15 32.61
12875. Amila (n0wtype) 16 84.01 90.37 8 50.00
12876. Tyler (imthe13055) 1 84.01 84.01 1 100.00
12877. shum (michaelshumshum) 38 84.01 101.00 12 31.58
12878. wobba (wobba) 67 84.00 99.25 21 31.34
12879. Jeff (websterjs) 20 84.00 94.12 3 15.00
12880. Phillip (phillip_kim) 128 84.00 124.64 45 35.16
12881. Nam (nchu027) 34 84.00 111.22 14 41.18
12882. Wayne (samehadenough) 1,128 84.00 114.53 342 30.32
12883. Tájpolósch (gunnhallur) 7 84.00 90.48 3 42.86
12884. mrspaghettimeatballs (ehreg... 8 84.00 91.23 2 25.00
12885. Tristan (bluekidcrazy) 2 84.00 93.98 1 50.00
12886. hv21ll (quinixod) 1 83.99 83.99 0 0.00
12887. TMW98 (themostwanted98) 6 83.99 94.15 0 0.00
12888. Flare (flareix) 2 83.99 96.18 2 100.00
12889. Anthony (anthony_787) 11 83.99 99.74 1 9.09
12890. Alfred (bestluxeu) 7 83.98 88.85 2 28.57
12891. Vikas (a4atom) 11 83.98 94.00 3 27.27
12892. EM_K (em_k) 58 83.98 100.82 18 31.03
12893. mjlambrechtje (mjlambrechtje) 5 83.97 88.68 0 0.00
12894. okki (okkiniikko) 6 83.97 92.81 2 33.33
12895. desyncgod (43243264) 3 83.97 88.23 0 0.00
12896. Stef (stefmx) 6 83.97 89.02 3 50.00
12897. Cooper (bannanaman9000) 6 83.97 88.87 1 16.67
12898. Patryk (grayek) 13 83.97 89.76 0 0.00
12899. xdxd (townpregic) 1 83.96 83.96 1 100.00
12900. crappyper (crappyper) 3 83.96 89.96 0 0.00
12901. Malvin (malleballen) 6 83.96 100.26 2 33.33
12902. Nikee (nikee25) 26 83.96 97.95 11 42.31
12903. Divaox (divaoxhd) 6 83.95 90.38 1 16.67
12904. lord (cintrixity) 11 83.95 97.12 7 63.64
12905. chubbylc (chubbylc) 3 83.95 90.73 0 0.00
12906. Rika (z3us99) 64 83.95 101.85 23 35.94
12907. jittery (jittertypes) 140 83.95 105.23 45 32.14
12908. sasmit_qwerty (sasmit_neogi) 9 83.95 120.35 3 33.33
12909. itsmin (itsminbin) 642 83.95 112.02 182 28.35
12910. Wilko (colacake84) 9 83.94 92.95 3 33.33
12911. Heufy (heufy) 279 83.94 105.54 90 32.26
12912. JCRueco (shizile) 710 83.94 113.44 223 31.41
12913. Raz (adashi) 28 83.94 107.08 12 42.86
12914. Mhark (mharkmharkmhark) 258 83.94 105.77 64 24.81
12915. black google (peeperin) 8 83.94 105.64 3 37.50
12916. talia (sllvio) 2 83.94 88.99 2 100.00
12917. Jehar (rakhunb) 469 83.93 109.73 146 31.13
12918. Wayne (xwang4) 145 83.93 114.96 42 28.97
12919. Vilmer (vien0701) 336 83.93 108.01 104 30.95
12920. ℱ𝔯𝔢𝔢𝔡𝔬𝔪... 50 83.93 102.78 13 26.00
12921. Umer (programmer_1) 136 83.92 101.79 48 35.29
12922. Stefan (superman0904) 3 83.92 88.50 0 0.00
12923. speedguy1 (speedguy1) 7 83.92 89.35 4 57.14
12924. 𝙣_𝙞_𝙩_𝙧_𝙤 (r... 3 83.92 86.41 1 33.33
12925. Blue._. (bluewaves54) 16 83.91 98.85 6 37.50
12926. Dilan (carnage2) 403 83.91 132.76 127 31.51
12927. James (jamesyeer) 2 83.91 87.31 0 0.00
12928. Jon (bdnoj618) 16 83.91 96.67 2 12.50
12929. Borislav (bobun) 9 83.91 94.33 1 11.11
12930. JP (cryoblivious) 12 83.90 97.12 5 41.67
12931. Rokuazery (rokuazery) 12 83.90 92.04 2 16.67
12932. Vincent (filtertype) 585 83.90 114.07 188 32.14
12933. Ido (idodobird) 10 83.90 100.63 4 40.00
12934. Marc (marcmalha) 564 83.90 102.94 167 29.61
12935. Sylvie (eat_my_dust_batches) 1,259 83.90 118.84 387 30.74
12936. Serenity (turkaturka) 154 83.89 103.53 43 27.92
12937. Ricky (rickyyeung) 11 83.89 93.13 4 36.36
12938. mogi (mogspls) 1 83.89 83.89 0 0.00
12939. Ryan (lilchicken) 76 83.89 99.38 17 22.37
12940. EJ (clarencedc) 80 83.89 114.34 30 37.50
12941. Pengu (lilpengu) 30 83.88 100.25 10 33.33
12942. Vally (vallyofagility) 5 83.88 95.98 1 20.00
12943. Ish (theblessedgalaxy) 4 83.87 90.14 3 75.00
12944. Timothy (timply) 314 83.87 117.01 96 30.57
12945. German (wat_germy) 3 83.87 112.38 1 33.33
12946. Sonic (sonicaks) 10 83.87 90.68 1 10.00
12947. Ashley (aswenson3907) 3 83.87 94.29 1 33.33
12948. Mello (melancholic_god) 3 83.86 96.32 2 66.67
12949. Jwickblack (hellwood) 591 83.86 114.22 185 31.30
12950. KOOKOWACKYDUCK (kookowackyd... 15 83.86 101.48 6 40.00
12951. Paul (obtrunco) 40 83.86 95.04 9 22.50
12952. bbbbb333 (bbbbb333) 5 83.86 87.66 5 100.00
12953. Alfian (alfianzv) 8 83.86 112.21 2 25.00
12954. Noah (scone) 4 83.86 90.00 2 50.00
12955. Taso (tas123) 135 83.85 108.49 62 45.93
12956. Connor (cbec32) 6 83.85 91.90 3 50.00
12957. Bob (john_the_racer) 1 83.85 83.85 0 0.00
12958. PikaChris (foforin112) 1 83.85 83.85 1 100.00
12959. Leo (murkymurky) 8 83.85 89.13 3 37.50
12960. T (omega5002) 69 83.84 98.25 19 27.54
12961. Thug_TwisterzZ (thug_twiste... 2 83.84 87.60 1 50.00
12962. patztablook22 (patztablook22) 15 83.83 95.97 5 33.33
12963. i (ifixlss) 102 83.83 99.42 28 27.45
12964. Quang (ionlyvayne) 7 83.83 101.67 4 57.14
12965. donkeysbanana (donkeysbanana) 48 83.83 105.76 18 37.50
12966. Xassie (xassie) 66 83.82 102.02 24 36.36
12967. Hobo (hobo_rapper) 32 83.82 101.30 8 25.00
12968. Ollie (cheerfulnihilist) 55 83.82 108.08 16 29.09
12969. JuanDeag111 (juandeag111) 12 83.82 94.58 3 25.00
12970. Bone (bonepriest) 54 83.81 119.60 16 29.63
12971. Kenan (kenan_) 2 83.81 84.73 0 0.00
12972. Simonas (nags) 1 83.81 83.81 0 0.00
12973. Gordon (99m9) 1 83.81 83.81 0 0.00
12974. Niels (dekleinekabouter) 17 83.80 99.35 2 11.76
12975. emmy (stannisbaratheon) 1 83.80 83.80 1 100.00
12976. Gada go FAAASST (seesawsi) 76 83.80 97.31 17 22.37
12977. johnni (gleaned) 7 83.80 93.60 1 14.29
12978. willybear (willybear) 22 83.79 100.03 5 22.73
12979. Louie John (loumexx12) 20 83.79 97.61 10 50.00
12980. Shivam (shivam543) 18 83.79 98.69 5 27.78
12981. gabe (gaberhone) 6 83.78 90.45 1 16.67
12982. R (get0ut0fmywaay) 2 83.78 90.02 0 0.00
12983. Ray (ray_mond) 11 83.78 95.10 3 27.27
12984. Konrad (konradgoldammer) 55 83.78 100.95 16 29.09
12985. Eru (eru2) 173 83.78 110.95 48 27.75
12986. Lau (cryptextinct) 10 83.77 96.70 3 30.00
12987. Jak (phrl) 2 83.77 84.70 1 50.00
12988. Tyler (exilereject) 1,458 83.76 125.50 405 27.78
12989. Chris (chris979) 25 83.76 105.04 5 20.00
12990. nuzzlebuddy (danieldan937) 17 83.76 97.71 3 17.65
12991. Dux (duxviii) 1 83.76 83.76 0 0.00
12992. TheCaptainBuster (thecaptai... 160 83.76 136.32 90 56.25
12993. ws (wdsyywd) 150 83.75 114.60 35 23.33
12994. samir (_samir) 30 83.75 107.13 25 83.33
12995. jaybird (j__j) 1 83.75 83.75 1 100.00
12996. Abe (abefqy) 15 83.74 116.82 6 40.00
12997. Sanchi (pachi_sanchi) 144 83.74 110.65 47 32.64
12998. rainbowcow (rainbowcoww) 6 83.74 105.06 2 33.33
12999. Matrix (ss005) 236 83.74 104.55 68 28.81
13000. Evan (__evab__) 352 83.74 113.47 88 25.00
13001. Locksley (locksng12) 34 83.74 99.40 13 38.24
13002. Dev (doberay) 2 83.74 85.84 1 50.00
13003. Hi (jxjx) 77 83.73 97.99 28 36.36
13004. Ryan (ryanandros) 1 83.73 83.73 0 0.00
13005. Ayesha (vogue212) 11 83.73 93.65 2 18.18
13006. javoscript (javoscript) 17 83.73 90.36 6 35.29
13007. Daniel (arpsteid) 10 83.73 98.08 5 50.00
13008. andrew (potatoh) 37 83.73 102.11 11 29.73
13009. nara (naraaa) 18 83.73 97.27 3 16.67
13010. Roberto (ajaxlord28) 7 83.72 99.91 3 42.86
13011. carpathian (carpathian) 20 83.72 103.11 5 25.00
13012. kp (kennethputra) 20 83.72 100.05 4 20.00
13013. R0L3eX (r0l3ex) 18 83.72 109.01 4 22.22
13014. Michael (tibbitin) 4 83.71 104.47 1 25.00
13015. Eric (yellowblankets) 109 83.71 111.98 23 21.10
13016. Laird (lairdandrew) 1 83.71 83.71 0 0.00
13017. Blake (bcdelrey) 7 83.71 91.84 2 28.57
13018. Brendan (brenakin) 67 83.71 104.98 23 34.33
13019. Lucas (wollmyth) 20 83.70 97.11 2 10.00
13020. Steyl (steyl) 2 83.70 84.80 2 100.00
13021. T (toompaxd) 11 83.70 92.55 0 0.00
13022. HUONO (gghuono) 31 83.70 95.90 13 41.94
13023. Hammy (h4mmy) 6 83.69 89.34 2 33.33
13024. Marvin (malvolio) 95 83.69 99.39 27 28.42
13025. Gordon (gorlee2013) 4 83.69 90.03 0 0.00
13026. Joseph (josefmcbrosef) 55 83.68 112.11 21 38.18
13027. 𝕬𝖛𝖊𝖗𝖆𝖌... 49 83.68 111.21 41 83.67
13028. clpz (clpz) 5 83.68 87.58 4 80.00
13029. Kushal (kushaltrivedi5) 7 83.68 89.77 2 28.57
13030. Rockey (rockey_3) 2 83.68 88.82 1 50.00
13031. Missile Input (breadlump) 81 83.67 104.08 21 25.93
13032. thebeesknees (thebeesknees_) 34 83.67 104.44 16 47.06
13033. Ivan (expl1icity) 1,098 83.66 107.49 301 27.41
13034. Chris (chrissquid) 28 83.66 104.28 9 32.14
13035. WheelieTron3000 (wheelietro... 1,686 83.66 109.68 502 29.77
13036. Jan (robi21mlg) 7 83.66 97.21 5 71.43
13037. Marwan (steelman) 4 83.66 90.98 1 25.00
13038. b!g (b_i_g_em) 178 83.66 99.71 51 28.65
13039. damon (damonliv) 164 83.66 106.75 42 25.61
13040. Ethan (ethfer_77) 66 83.66 100.03 21 31.82
13041. angelo (angeloripple) 1 83.66 83.66 0 0.00
13042. sean (tak32) 41 83.66 99.97 5 12.20
13043. mt (mtutunchi) 14 83.66 93.01 6 42.86
13044. Onur (onur0591) 17 83.66 99.52 8 47.06
13045. JAK (osraild) 5 83.65 88.53 0 0.00
13046. Miles (txlore) 11 83.65 99.57 6 54.55
13047. David (dtnero) 165 83.65 103.73 51 30.91
13048. Dhruv (dhruvs301) 16 83.65 91.16 5 31.25
13049. CheemCreem (cheemcreem) 167 83.65 100.60 43 25.75
13050. G (jaden) 16 83.65 93.91 6 37.50
13051. luca (einsluca) 14 83.65 97.07 1 7.14
13052. Sishir (goon72) 15 83.65 88.36 4 26.67
13053. mathisvan (mashipeas123) 4 83.64 87.32 2 50.00
13054. neyo (neyoka) 132 83.64 104.49 43 32.58
13055. Bob (rayell) 1 83.64 83.64 0 0.00
13056. Zhivko (zikica97) 4 83.64 94.14 2 50.00
13057. rai (siomaipusa) 22 83.64 109.85 12 54.55
13058. Sara (pluto13x) 3 83.64 87.55 0 0.00
13059. Blaze (klblaz) 119 83.64 106.50 29 24.37
13060. saarim (saarim) 2 83.64 84.36 0 0.00
13061. Sriram (nvsriram) 130 83.63 99.69 40 30.77
13062. Cobra (devanshj) 55 83.63 98.97 16 29.09
13063. Andrew (quantified_null) 2 83.63 85.80 0 0.00
13064. Lian (paullian) 214 83.63 104.78 55 25.70
13065. Tran (envyriviere) 15 83.63 91.60 3 20.00
13066. Sentinel (fedayeen) 37 83.62 98.49 12 32.43
13067. Nongus (nongus_42) 1 83.62 83.62 0 0.00
13068. Not a dog (i_am_learning_to... 1 83.62 83.62 1 100.00
13069. ChiefSec (chiefsec) 6 83.62 104.65 5 83.33
13070. zhata1234 (zhata) 248 83.62 111.42 57 22.98
13071. Ian (llamasquad) 60 83.61 105.32 19 31.67
13072. Andrew (wongsifu) 29 83.61 99.08 16 55.17
13073. panzer (avitastic) 1 83.61 83.61 0 0.00
13074. LadaSedan (ladasedan) 29 83.61 94.63 3 10.34
13075. Jai (jais) 48 83.61 99.55 12 25.00
13076. stop quitting (phrosnite) 20 83.60 106.42 3 15.00
13077. Cordell (_dadstype_) 46 83.60 103.24 12 26.09
13078. deez (ahntahrees) 2 83.60 85.95 1 50.00
13079. Tuan (kllerman25620) 6 83.60 100.88 2 33.33
13080. Moko (iamspeedkachiga) 11 83.60 98.05 4 36.36
13081. Jakeyboi (00hike) 80 83.59 102.87 25 31.25
13082. Anthony S. (anthonyjshuey) 290 83.59 119.01 80 27.59
13083. ilove cheese142 (ktylol) 181 83.59 129.56 47 25.97
13084. Rem (remroid66) 139 83.59 104.89 44 31.65
13085. Daniel (sn1054) 1 83.58 83.58 1 100.00
13086. TWICE Dahyun (sheenic) 10 83.58 100.25 5 50.00
13087. dedendje (dedendje) 35 83.58 94.95 8 22.86
13088. DerpVos (derpvos) 14 83.57 103.12 6 42.86
13089. Jake (failura) 2 83.57 85.29 1 50.00
13090. andre (pizzamista) 2 83.57 87.02 2 100.00
13091. hsa (hsa_) 2 83.57 95.81 1 50.00
13092. Lamonte (chinpo) 6 83.57 97.74 1 16.67
13093. Mark (markidak) 2 83.57 99.47 0 0.00
13094. Ivan (ibanisanog) 4 83.56 102.75 2 50.00
13095. Harashta (harashtaw) 4 83.56 92.94 2 50.00
13096. severed (severedhand) 264 83.56 115.71 66 25.00
13097. Asim (_asim_) 28 83.56 94.47 10 35.71
13098. Evans (xerodo) 35 83.56 95.13 13 37.14
13099. Sreshta Kamya (nikitha) 120 83.55 104.52 37 30.83
13100. Tashima (tashima42) 38 83.55 109.79 13 34.21
13101. tai (sharpblader) 1 83.55 83.55 0 0.00
13102. Nick (aaaywhatup) 19 83.55 98.76 4 21.05
13103. Micah (dramaticpineapple47) 6 83.55 94.07 2 33.33
13104. Erik (erik4) 98 83.55 102.73 31 31.63
13105. Tai (weakmee) 114 83.54 109.52 38 33.33
13106. Kyle (chynkii) 6 83.54 97.02 3 50.00
13107. Nobu (nobunakamura) 423 83.54 112.28 142 33.57
13108. Joshua (joshuajunhee) 33 83.54 116.76 10 30.30
13109. Averie (aveeeriiieee) 3 83.54 88.55 2 66.67
13110. Adi (adi321456) 4 83.54 97.61 1 25.00
13111. mael (maelstrom00) 1 83.54 83.54 0 0.00
13112. steve (21steven_) 21 83.54 111.00 3 14.29
13113. Walfel (walfel) 12 83.54 97.39 3 25.00
13114. Josh (yummy4skin) 18 83.54 112.40 5 27.78
13115. Clare (radioclare) 19 83.53 102.79 5 26.32
13116. wEN (coldblacktea) 8 83.53 95.00 3 37.50
13117. baekd (baekde) 37 83.53 110.69 10 27.03
13118. Anomaly (an_anomaly) 1 83.53 83.53 0 0.00
13119. SPICY (spicynote) 168 83.53 101.41 56 33.33
13120. Hani (imonster_22) 35 83.52 109.15 16 45.71
13121. FREE PALESTINE (needlepaws) 49 83.52 94.36 19 38.78
13122. Jello (jellomoto) 1 83.52 83.52 0 0.00
13123. KIARA (atherynbane) 1,202 83.52 123.90 357 29.70
13124. Beybaris (zstorm_rd) 76 83.52 101.77 21 27.63
13125. eden (shoutynubs) 13 83.51 91.18 4 30.77
13126. Basil (basil2077) 1 83.51 83.51 0 0.00
13127. Mykhailo (mishok) 4 83.51 87.99 0 0.00
13128. Couldn't be you (malthekr) 33 83.50 95.89 29 87.88
13129. Coru (coru12) 49 83.50 101.33 15 30.61
13130. fatih (webfox) 2,281 83.50 113.09 732 32.09
13131. swim (swammmy) 8 83.50 100.43 5 62.50
13132. Bloggo (bloggowo) 5 83.49 90.47 2 40.00
13133. (rektbydoge21) 34 83.49 99.87 8 23.53
13134. kynght (kd1157) 15 83.49 102.90 4 26.67
13135. Jecong (jecong) 7 83.49 100.89 2 28.57
13136. Matthew (mattyb_) 5 83.49 90.92 3 60.00
13137. Cole (colejay) 5 83.49 93.76 2 40.00
13138. UReal (chc39615) 61 83.49 100.80 15 24.59
13139. Mo (filnaei) 2 83.49 84.00 1 50.00
13140. Steven (styledaddy) 5 83.48 86.27 1 20.00
13141. Ox (oxtookbronze) 201 83.48 103.85 59 29.35
13142. henry (luckyhenry) 278 83.48 99.64 71 25.54
13143. Karol (adobonimama) 16 83.48 99.08 3 18.75
13144. Maffin (m4ff1n) 50 83.47 98.10 13 26.00
13145. Jon (jonlivestrong) 84 83.47 106.21 32 38.10
13146. keith (skagod02) 4 83.47 89.94 0 0.00
13147. NELiXERY (nelixery) 1 83.47 83.47 1 100.00
13148. 50 Year Old Girl (whatsthis) 10 83.47 108.09 3 30.00
13149. Tim (dreamaz) 89 83.46 99.54 26 29.21
13150. Chara (sig_num) 7 83.45 89.94 3 42.86
13151. Varun (vslala) 7 83.45 94.94 2 28.57
13152. coffeebottle (coffeebottle1) 1 83.45 83.45 0 0.00
13153. juni (jooun) 1 83.45 83.45 0 0.00
13154. Steven (stevencd) 112 83.45 102.17 34 30.36
13155. Joshua (insanelol) 30 83.44 99.02 9 30.00
13156. lquenti (lquenti) 1 83.44 83.44 1 100.00
13157. Yosua (unclepo) 2 83.44 84.28 0 0.00
13158. SharkThatBlue (blueshark000) 2 83.44 105.30 2 100.00
13159. Damiano (fullomen) 36 83.43 93.28 6 16.67
13160. MZ (mbzz) 21 83.43 99.29 8 38.10
13161. sura (suraflux) 146 83.43 100.09 47 32.19
13162. owen (sushisynth12) 29 83.43 102.45 5 17.24
13163. TheUnMin (theunmin) 3 83.43 90.43 3 100.00
13164. Rocco (not_that_great) 2 83.43 85.39 0 0.00
13165. Shahana (shahanas) 71 83.42 102.21 21 29.58
13166. Pallav (pallav123goyal) 5 83.42 94.08 2 40.00
13167. azu (azux) 108 83.42 111.49 47 43.52
13168. bruh (alexe1093) 1 83.42 83.42 0 0.00
13169. Alex (ace_alex) 1 83.42 83.42 0 0.00
13170. Woffy (woffy888) 9 83.42 110.18 6 66.67
13171. yuzuru (yuzuruace) 2 83.42 89.97 1 50.00
13172. Jaydotsun (jaydotsun) 2 83.42 84.27 0 0.00
13173. Hector (hg088) 1 83.41 83.41 0 0.00
13174. Roh (uzu23) 1 83.41 83.41 1 100.00
13175. tstats[marcko042] (marcko042) 3 83.41 93.04 2 66.67
13176. Dimituri (dimituri) 5 83.41 94.62 1 20.00
13177. John (unikmask) 6 83.41 91.14 2 33.33
13178. Thomas (thomas_t) 4 83.41 91.12 2 50.00
13179. তৌসিফুল ফ... 86 83.40 99.30 25 29.07
13180. Faiq (faiq57) 72 83.40 101.80 28 38.89
13181. :) (brueashear) 2 83.40 84.46 0 0.00
13182. Skyler (skylerlsx) 3 83.39 89.85 0 0.00
13183. Deyl (daleaparejado) 7 83.39 94.28 3 42.86
13184. Zeztix (zeztix) 6 83.39 92.32 2 33.33
13185. Jusuf (kz99) 59 83.38 103.40 17 28.81
13186. TaeHyoung (aqweds1) 4 83.38 85.32 3 75.00
13187. Marcus (marcusvang1234) 4 83.38 93.74 1 25.00
13188. Marcie (u53rn4m374k3n) 6 83.38 90.13 3 50.00
13189. schru (schru) 17 83.37 90.75 8 47.06
13190. Rex (rexcaliber_115) 91 83.37 111.23 28 30.77
13191. Stephan (shadwgod) 3 83.37 95.21 1 33.33
13192. Manmit (manny_the_potato) 1,247 83.36 116.64 327 26.22
13193. Aidan (kubachi) 155 83.36 106.45 48 30.97
13194. Farhan M. (farhanmasud) 35 83.36 95.04 8 22.86
13195. Bleedy Basket! (ninjismo) 1,921 83.36 110.71 556 28.94
13196. tenzin (hopeful_engineer) 17 83.35 95.89 4 23.53
13197. Zachary (weiser) 10 83.35 97.23 4 40.00
13198. Rubber (rubberduckcolemak) 31 83.35 110.28 10 32.26
13199. Kevin (lgloo) 2 83.35 87.56 1 50.00
13200. Miku (undeadninja) 59 83.34 96.63 15 25.42
13201. $$$$ (for_fun) 190 83.34 107.18 49 25.79
13202. Harriet (swipathetypa) 5 83.34 93.49 1 20.00
13203. Drake (dunkchai) 9 83.34 97.78 4 44.44
13204. Raagaception (raagaception) 32 83.33 105.41 11 34.38
13205. iquee (jeptha) 18 83.32 94.27 5 27.78
13206. Aubrey (ahensley) 11 83.32 95.49 1 9.09
13207. nav (sugondese123) 1 83.32 83.32 0 0.00
13208. Pinoy (pinoytypist01) 29 83.32 99.34 3 10.34
13209. Monotype2 (monotype2) 9 83.31 101.23 7 77.78
13210. JV (jibs12) 215 83.31 98.14 61 28.37
13211. Zuhair (zishraq) 194 83.31 97.62 43 22.16
13212. baqazan (baqazan) 1 83.31 83.31 0 0.00
13213. Moon (aquacharles) 3 83.30 88.36 2 66.67
13214. Wahh (lazydude1) 7 83.30 103.27 2 28.57
13215. Siracha (sirachaman) 5 83.30 92.18 2 40.00
13216. Awalid (awalid) 5 83.30 90.68 2 40.00
13217. Jonathan (jonathankim1999) 36 83.29 100.04 9 25.00
13218. sn (gunshp) 2 83.29 84.79 0 0.00
13219. person guy (dotta_dotta) 2 83.29 85.93 2 100.00
13220. Martin (speedonthestreet) 7 83.29 89.86 7 100.00
13221. Mark (mark2912) 4 83.29 95.66 0 0.00
13222. Incognito (im_incognito) 8 83.29 92.95 2 25.00
13223. Mac (mac123456) 175 83.29 104.05 59 33.71
13224. midnightsimon (midnightsimon) 18 83.28 104.80 0 0.00
13225. ^o^ (thasial) 160 83.28 111.19 48 30.00
13226. BadAtTyping (itzsecretive) 8 83.28 91.09 2 25.00
13227. Trey (trey113) 3 83.28 87.08 0 0.00
13228. Oleg (braga01) 19 83.28 92.31 7 36.84
13229. Akrish (akrish) 6 83.28 91.29 3 50.00
13230. Joshua (snabic) 2 83.28 94.19 0 0.00
13231. Ken (kennoji) 9 83.27 117.87 8 88.89
13232. Pana (pana_miguel) 14 83.27 100.01 5 35.71
13233. Enosh (watahec) 40 83.27 101.76 13 32.50
13234. guest_typist_new (guest_typ... 46 83.27 106.82 12 26.09
13235. David (butterdawg) 7 83.27 86.98 2 28.57
13236. Aldir (faway) 82 83.26 100.62 19 23.17
13237. Max (hooterr) 11 83.26 90.09 6 54.55
13238. Emmanouil (emzoumpo) 2 83.26 88.20 1 50.00
13239. elclid (elclid) 4 83.26 97.28 2 50.00
13240. Made (aryx) 3 83.26 87.83 1 33.33
13241. Thang (thangvu7) 10 83.26 102.39 4 40.00
13242. DZ_no (dzeano) 9 83.26 91.09 3 33.33
13243. Robbe (robbelbobel) 219 83.25 106.91 72 32.88
13244. Ui (so_ta) 12 83.25 96.75 7 58.33
13245. Redsteel (redsteel87) 14 83.25 105.24 2 14.29
13246. Hoang (feelsdankman_1) 87 83.25 105.65 13 14.94
13247. David (depgai) 1 83.24 83.24 1 100.00
13248. Ryan (rdeorio) 175 83.23 101.49 47 26.86
13249. Guest (guest2703) 5 83.23 92.07 2 40.00
13250. zombie gaming (galaxybiscui... 47 83.23 105.32 17 36.17
13251. Aaron (aaaronnguyen) 8 83.22 93.86 2 25.00
13252. Panagiotis (rulisogeranoulis) 11 83.22 97.54 6 54.55
13253. kaffarell (kaffarell) 573 83.22 117.51 150 26.18
13254. David (abush635) 2 83.22 97.66 0 0.00
13255. Narkotik (vacban) 7 83.22 96.84 1 14.29
13256. MaxMul (maxmul) 23 83.22 106.89 11 47.83
13257. Mary (frailmary) 22 83.21 94.18 6 27.27
13258. Talos (therealtalos21) 13 83.21 93.99 3 23.08
13259. Charvin (archavint) 6 83.21 99.27 2 33.33
13260. Muhammed (iosonoosha) 35 83.21 100.62 8 22.86
13261. Nom (slower_than_shrimp) 4 83.21 88.69 0 0.00
13262. Bill (p0werc0rd0fjustice) 8 83.21 97.00 2 25.00
13263. Mohammad Rizwaan (freshkebab) 565 83.21 113.21 155 27.43
13264. Meredith (murdith) 2 83.21 90.45 0 0.00
13265. Nick (skillofnoob) 2 83.21 87.52 0 0.00
13266. aaaaaa (hagemanto) 658 83.20 107.44 173 26.29
13267. Joe (jych0) 12 83.20 95.53 6 50.00
13268. GoldenGamer9002 (goldengamer) 1 83.20 83.20 1 100.00
13269. kaitlyn (katieostrander) 376 83.20 111.33 82 21.81
13270. Peter (ptrmai) 35 83.20 95.56 9 25.71
13271. Arnold (wiktor172003) 30 83.19 99.28 6 20.00
13272. Cyrus (xk0ul) 2 83.19 98.66 0 0.00
13273. Ryan (ysys9) 9 83.18 93.44 5 55.56
13274. Rayyan (rayyanyusuph) 1 83.18 83.18 0 0.00
13275. Andrew (axcelcr) 1 83.18 83.18 1 100.00
13276. Christopher (chrisaua) 9 83.18 101.31 5 55.56
13277. Hay3den_00 (hay3den_00) 5 83.18 91.02 2 40.00
13278. Andrew (andrewlllee) 14 83.17 100.21 4 28.57
13279. hyper riper viper typer (ku... 1 83.17 83.17 0 0.00
13280. J (jebss) 1 83.17 83.17 1 100.00
13281. ep1c (hololiveweeb24) 2 83.17 86.04 2 100.00
13282. lol (lolspedicey) 362 83.17 121.19 109 30.11
13283. goe (goeeeeeeee) 43 83.16 99.75 0 0.00
13284. Matin (matinkh) 19 83.16 96.89 7 36.84
13285. Chris (ckim11) 1 83.16 83.16 1 100.00
13286. 50wpm (chengyangz) 12 83.16 89.65 2 16.67
13287. Dillon (peak3433) 67 83.16 108.36 12 17.91
13288. Drizzy (dreazy) 14 83.16 104.71 5 35.71
13289. Claudia (claudsipoo) 2 83.16 83.77 0 0.00
13290. Regan (reginalld) 1 83.15 83.15 0 0.00
13291. Colemak (road2work100) 26 83.15 98.16 7 26.92
13292. tstats[jpatrocinio5436] (jp... 18 83.14 94.87 9 50.00
13293. Michael (meikey) 1 83.14 83.14 1 100.00
13294. !! (zzzoodle) 20 83.14 103.95 3 15.00
13295. Connor DVORAK (deepwaterbus) 359 83.14 116.59 101 28.13
13296. Manzood (manzood) 23 83.14 93.34 7 30.43
13297. Max (max_pinc) 148 83.14 108.27 38 25.68
13298. V (chris_keum_9) 18 83.13 94.41 7 38.89
13299. Nick (sidj0n) 4 83.13 90.30 0 0.00
13300. POOKR (pookr) 2 83.13 89.41 0 0.00
13301. Maia (maia_egg) 6 83.13 96.14 2 33.33
13302. Maple (maplesyrup789) 35 83.13 101.69 17 48.57
13303. Ongasm (nong321) 5 83.13 96.93 1 20.00
13304. Hai (ky0ka) 140 83.13 107.77 34 24.29
13305. Nope (_sav) 205 83.13 98.60 61 29.76
13306. Charlie (xharlie) 26 83.12 101.41 5 19.23
13307. Daniel (doctorfm3) 1 83.12 83.12 0 0.00
13308. Tristan (devyl) 51 83.12 95.54 13 25.49
13309. Isaac (newton6674) 369 83.12 101.65 94 25.47
13310. Josh (jrc23) 10 83.11 96.44 4 40.00
13311. Dulappy (dulappy) 7 83.11 89.25 2 28.57
13312. (typist215) 21 83.10 97.00 10 47.62
13313. Ayokk (ayokk) 52 83.10 110.76 10 19.23
13314. Dhruv (droxx76) 6 83.10 109.82 2 33.33
13315. Goven (gmbarrera) 5 83.10 99.94 0 0.00
13316. ppgg (pp__gg) 3 83.10 86.16 2 66.67
13317. Aalpesh (aalpesh) 6 83.10 86.95 3 50.00
13318. puthin_p2n (bugsmasher) 290 83.09 116.97 80 27.59
13319. Jen (jen_23) 39 83.09 108.86 18 46.15
13320. 中学 (randomguyhe) 38 83.09 100.15 9 23.68
13321. kkobuk (kkobukchipp) 490 83.09 107.87 154 31.43
13322. Trent (priyank45) 23 83.09 109.37 14 60.87
13323. Meet (meet27) 99 83.09 100.61 27 27.27
13324. Anda (_anda_) 65 83.08 104.52 21 32.31
13325. Sadi (kandeemusic) 52 83.08 103.97 21 40.38
13326. Zudio (ildosrel) 8 83.08 90.09 3 37.50
13327. InCredH (harsh_hegishte) 762 83.08 132.63 231 30.31
13328. Wing (thewing_) 18 83.08 114.78 2 11.11
13329. M (mostafam) 36 83.07 102.81 11 30.56
13330. Morin (lordgroovy) 210 83.07 106.02 67 31.90
13331. Eddie (yogurtdan) 17 83.07 121.00 1 5.88
13332. FoundSquid (yeetpp) 1 83.07 83.07 0 0.00
13333. Big Boy Diamonds (waist) 1 83.07 83.07 1 100.00
13334. Adridri (eidorian) 8 83.07 133.33 4 50.00
13335. Astroe (astroe) 6 83.07 93.04 5 83.33
13336. Phoenyx (1013482) 2 83.07 86.36 0 0.00
13337. Esmeralda (niccon) 29 83.07 97.44 5 17.24
13338. Alexander (taklit) 3 83.07 91.94 2 66.67
13339. Cyberbullet (mstfelq) 9 83.06 98.49 4 44.44
13340. Michael (grumos) 22 83.06 92.24 5 22.73
13341. Charlie (losttaco) 2 83.05 87.81 0 0.00
13342. Rohit (m5ar123) 1 83.05 83.05 0 0.00
13343. Mad_Dog (darkus_dragonoid) 31 83.05 94.86 11 35.48
13344. Megaracer BTW (erkytyper) 43 83.04 95.27 14 32.56
13345. kalxed_mac (kalxed_mac) 2 83.04 85.62 0 0.00
13346. Dylan (typedylan) 5 83.04 91.37 3 60.00
13347. Yut (poominb) 15 83.04 94.71 3 20.00
13348. Frangsinatra (addaxer) 34 83.04 105.83 10 29.41
13349. Anceint (anceint) 28 83.04 101.10 10 35.71
13350. breh (duclc) 3 83.04 88.01 1 33.33
13351. Captain (scrubwrecker666) 327 83.04 107.18 95 29.05
13352. cock and (tmolls312) 14 83.03 94.81 8 57.14
13353. Bachiri (bachiri) 74 83.03 95.29 15 20.27
13354. isaiah (wamuuuu) 3 83.03 94.66 1 33.33
13355. Rey x MountainStride (shinr... 8 83.03 95.82 0 0.00
13356. Dimfred (dimfred) 10 83.03 98.18 3 30.00
13357. Jeremy (jerbear27) 85 83.03 102.97 31 36.47
13358. Ewan (ewan121) 287 83.03 111.91 78 27.18
13359. Musa (greatwarrior235) 148 83.02 103.21 39 26.35
13360. 💎 (yx3_darya) 9 83.02 96.36 3 33.33
13361. Check (checkmunza) 46 83.02 100.23 11 23.91
13362. presto (presto3000) 18 83.02 94.49 4 22.22
13363. Kei 100 (kei100) 10 83.01 95.03 4 40.00
13364. Jesper (jespersch) 4 83.01 89.32 1 25.00
13365. Velocitys (mikesyeet) 27 83.01 102.79 8 29.63
13366. lav (lav01) 2 83.01 85.77 0 0.00
13367. Sebastian (seba2500) 5 83.00 87.62 1 20.00
13368. Subarno (subarno) 1 83.00 83.00 0 0.00
13369. Alice (arisuchan1) 1 83.00 83.00 0 0.00
13370. Omsin (omsinkrissada) 21 83.00 96.80 8 38.10
13371. SServe (sserve) 4 82.99 88.19 2 50.00
13372. shubham (shubham0007) 14 82.99 97.02 2 14.29
13373. Scooby (scoobydoo0919) 1 82.99 82.99 0 0.00
13374. Christian (oneetian) 1 82.99 82.99 0 0.00
13375. Muntasir Billah (lights_on_me) 1 82.99 82.99 1 100.00
13376. Nicholas (t0903591) 52 82.99 98.44 10 19.23
13377. Jay (dflkn4900s4) 49 82.99 99.21 16 32.65
13378. Same (obsoletepotato) 3 82.98 91.78 1 33.33
13379. Jacob (q2q1wwe) 23 82.98 96.92 6 26.09
13380. Bonbon (bonbontherabbit) 1 82.98 82.98 1 100.00
13381. Julia (jjin2005) 1 82.98 82.98 0 0.00
13382. Josh (syztyqus) 41 82.97 94.64 14 34.15
13383. Bob (bobychen) 5 82.97 92.81 1 20.00
13384. Sam (lingbing) 25 82.97 94.90 10 40.00
13385. spelling (spellingglitch) 3 82.96 84.74 0 0.00
13386. Nate (somemoresmors) 74 82.96 106.63 20 27.03
13387. Trent (tdavis23540) 202 82.96 109.41 55 27.23
13388. Golf GTI (typeracer_user_) 122 82.96 102.56 35 28.69
13389. nagz (naxumi) 31 82.96 113.98 10 32.26
13390. Mohammad (mr_loooop) 420 82.96 109.89 106 25.24
13391. john (sharks445) 149 82.96 107.29 41 27.52
13392. Quyen (tsaiduk) 25 82.96 102.11 8 32.00
13393. Nate (natekid11) 168 82.95 100.32 42 25.00
13394. cimsunf (nhtai) 2 82.95 84.32 1 50.00
13395. LuciD (luci_d) 33 82.95 94.26 15 45.45
13396. ibm model m (qpaper) 24 82.95 97.82 7 29.17
13397. Herin (bluxygurl) 5 82.95 96.54 2 40.00
13398. Nynnf (nynnf) 19 82.95 96.11 15 78.95
13399. Mac (rubixgeek101) 4 82.95 99.47 2 50.00
13400. Asad (asad104khan) 116 82.94 100.38 31 26.72
13401. Raiyan (accursed_) 8 82.94 95.76 1 12.50
13402. Luke (lukep421) 10 82.94 94.89 1 10.00
13403. Nadia Gonzalez (nadiaig) 10 82.94 94.92 5 50.00
13404. E (evan_30) 257 82.93 103.25 81 31.52
13405. Adrian (mangojuice_) 28 82.93 95.93 9 32.14
13406. Zachary (showmanthemoney) 15 82.93 89.94 3 20.00
13407. Sammy (sammykiller) 17 82.93 97.08 4 23.53
13408. Daniel (gismo359) 19 82.93 92.81 8 42.11
13409. kazden (kazdenetienne) 49 82.92 105.86 18 36.73
13410. Sisyphus (gnurlbash) 6 82.91 86.21 1 16.67
13411. Junle (junlez) 24 82.91 99.31 10 41.67
13412. holsoma (holsoma) 81 82.91 97.42 26 32.10
13413. Mid Racer (kaosfear) 1 82.91 82.91 1 100.00
13414. Fabio (fabiososo) 1 82.91 82.91 1 100.00
13415. aCreativeUsername (acreativ... 3 82.90 84.83 2 66.67
13416. Red (redromel) 6 82.90 92.21 5 83.33
13417. pP poopoo (red_five) 4 82.90 92.92 0 0.00
13418. Andrei (dalacul) 2 82.90 87.17 1 50.00
13419. Logan (fudge500) 3 82.90 86.12 1 33.33
13420. Robyn (realtcc) 2 82.90 94.94 0 0.00
13421. 最靚嘅仔 (lookingdepres... 10 82.89 92.44 2 20.00
13422. Patrick (healingtrout) 1 82.89 82.89 1 100.00
13423. Tor (temyrvang) 8 82.89 89.55 2 25.00
13424. fffd (fffd) 8 82.89 98.33 5 62.50
13425. Angkana (ployyjen) 166 82.88 102.83 38 22.89
13426. Rob (airgo32) 7 82.88 94.37 3 42.86
13427. Hoo (navvvz) 8 82.88 100.38 2 25.00
13428. Zzzzzz (zokey) 15 82.88 90.68 4 26.67
13429. Evan (qasem_soleimani) 5 82.88 96.98 1 20.00
13430. Joe (eoj05) 6 82.88 95.50 2 33.33
13431. Daniel (dlarocque) 3 82.87 91.30 3 100.00
13432. cloasies (cloasies) 1 82.87 82.87 0 0.00
13433. AURRUM (aurrum007) 3 82.87 89.32 1 33.33
13434. pail (angertyper) 1 82.87 82.87 1 100.00
13435. typing (errors_intesify) 10 82.87 95.78 3 30.00
13436. Mrinal (_tt_) 65 82.86 99.48 15 23.08
13437. GWTNess (gwtness) 247 82.86 109.27 79 31.98
13438. Jason (jason3103) 3 82.86 88.40 1 33.33
13439. Hampton (frozeninthesnow) 2 82.86 84.24 0 0.00
13440. Jeff (eggdropsoup3) 1 82.86 82.86 1 100.00
13441. Sammy (sammyaxel) 1 82.86 82.86 0 0.00
13442. Seed (pikubu) 2 82.86 92.76 1 50.00
13443. Master (masterdvorak) 54 82.86 98.28 12 22.22
13444. a (alextheman49) 2 82.86 86.45 0 0.00
13445. Zeep (zeeppt) 411 82.85 100.87 95 23.11
13446. Shaikh (sinosco) 5 82.85 91.95 1 20.00
13447. Andres (lobosolitario) 13 82.84 108.57 8 61.54
13448. Flake (dukebiscko22) 4 82.84 90.83 0 0.00
13449. Kady's Tofu (turtlespeedster) 1 82.84 82.84 1 100.00
13450. itypeforbyron (remez) 14 82.84 95.44 2 14.29
13451. Christian (bobbyjrrocks) 35 82.84 108.76 6 17.14
13452. Junho (junebug14) 5 82.83 94.00 3 60.00
13453. Hezekiah (htplayz2107) 14 82.83 93.69 1 7.14
13454. Ajay (ajaygunacr7) 10 82.83 97.64 1 10.00
13455. Brantley (rezxbl) 4 82.83 90.21 1 25.00
13456. Vihas (datlightning) 30 82.83 102.74 8 26.67
13457. Lynn (pvequalsnrt) 320 82.82 105.61 99 30.94
13458. noob (rayat) 2 82.82 88.39 1 50.00
13459. Mimi (merrymolly23) 4 82.82 88.75 2 50.00
13460. Kimmo (kimorasa) 376 82.82 105.76 92 24.47
13461. shaq$ (springrollgod) 9 82.82 93.87 4 44.44
13462. Bálint (diabolokiller) 136 82.82 102.88 30 22.06
13463. Please use an appropriate n... 49 82.81 99.26 18 36.73
13464. Jens (justjens) 7 82.81 95.11 0 0.00
13465. Lilmanband (lilmanband) 6 82.81 96.69 4 66.67
13466. Lucas (kuttey) 1 82.81 82.81 1 100.00
13467. MM (blunderingpeon12) 49 82.81 99.86 12 24.49
13468. Keago (keago) 3 82.81 87.19 1 33.33
13469. Andres (pickandres) 4 82.81 86.42 0 0.00
13470. Nah (typereally) 3 82.80 89.35 3 100.00
13471. Hannah (hannahwagner) 9 82.80 92.61 3 33.33
13472. Guest (jun16) 33 82.80 96.27 11 33.33
13473. Max (maximusprime70) 1 82.80 82.80 1 100.00
13474. Varun (varuns924) 23 82.79 105.18 6 26.09
13475. Absolut (rluyen) 11 82.79 99.44 0 0.00
13476. Adrian (revi_10) 3 82.79 93.27 1 33.33
13477. AJ (vvatti@gmail.com) 13 82.79 92.11 1 7.69
13478. Thickspinach (thickspinach) 92 82.79 102.18 25 27.17
13479. Þorsteinn (duddij) 6 82.79 94.65 2 33.33
13480. Matthew (meloooche) 9 82.79 92.65 4 44.44
13481. Christian (bl0btypes) 8 82.78 98.86 1 12.50
13482. Dragonhart (leophidian) 7 82.78 88.47 4 57.14
13483. anne (strawberrybannenana) 18 82.78 104.31 10 55.56
13484. A.H.M. (arceen) 335 82.78 102.85 83 24.78
13485. niamh (neemogozoom) 5 82.78 106.72 0 0.00
13486. Jimrey (filipinoboi) 23 82.78 108.07 8 34.78
13487. dakota (iceey) 2 82.78 83.27 1 50.00
13488. Dastan (dastangosu) 200 82.77 102.99 71 35.50
13489. Tinky (tinkywinkyy) 10 82.77 94.14 2 20.00
13490. Zleper8Q (zleper) 2 82.77 83.78 0 0.00
13491. Brenda (brendaiscool) 3 82.77 91.66 3 100.00
13492. Daan (macdann6) 26 82.77 97.00 7 26.92
13493. Jason (jwangbang) 31 82.76 95.45 8 25.81
13494. Richard (jorimi) 171 82.76 119.49 47 27.49
13495. Payu (payu_w) 22 82.76 91.26 1 4.55
13496. Zach (zach_htet) 16 82.76 94.64 3 18.75
13497. Two - (twojokers) 3 82.75 89.67 2 66.67
13498. Ceramic (caleb_2000) 19 82.75 92.77 5 26.32
13499. Dragon (susuthichansushi) 26 82.74 98.26 6 23.08
13500. Saynon (saynon) 1 82.74 82.74 0 0.00
13501. Jonathan (jdamico) 1 82.74 82.74 0 0.00
13502. Mr. A (itsabhi01) 210 82.74 106.91 90 42.86
13503. Nikola (flomaster_) 112 82.73 106.83 34 30.36
13504. jpow (jpowwow) 8 82.73 97.24 3 37.50
13505. rosana (rosina_24) 7 82.73 90.24 1 14.29
13506. Yazeed (snake69) 46 82.73 106.03 15 32.61
13507. Jim (jumsey) 44 82.73 106.62 13 29.55
13508. Yhannis (yhannis) 91 82.73 101.70 25 27.47
13509. Arnold (arnoldlek) 63 82.73 103.99 22 34.92
13510. Ohm (ohmstar123) 20 82.72 98.34 9 45.00
13511. Tom (originaliteit) 6 82.72 90.31 2 33.33
13512. Jack (furcifer) 4 82.72 88.54 2 50.00
13513. Austin (austinparkk) 3 82.71 88.06 0 0.00
13514. DrDynamic (drdynamic) 13 82.69 100.98 1 7.69
13515. Liam (ph3zz) 3 82.69 93.77 0 0.00
13516. Donkey (crazybraden) 20 82.69 97.28 4 20.00
13517. Cédrik Paquin (cedpaq01) 1 82.69 82.69 0 0.00
13518. luke (lukeritos) 1 82.69 82.69 0 0.00
13519. xdom (xdomiino) 59 82.69 106.41 21 35.59
13520. miles (milesgreensmith) 15 82.69 92.83 3 20.00
13521. Chazador (chazador) 2 82.69 88.12 1 50.00
13522. Aarondn34 (aarondn34) 40 82.68 98.97 6 15.00
13523. Timothy (thekoreanbanana) 32 82.68 97.09 14 43.75
13524. Angel (ninjasneak543) 39 82.67 97.77 13 33.33
13525. Cameron (xerxes_backwards) 4 82.67 87.05 0 0.00
13526. opecks (opecks) 51 82.67 99.03 19 37.25
13527. William (lazerpie) 3 82.67 87.18 2 66.67
13528. Donee (volts5) 65 82.67 115.86 16 24.62
13529. Julian (rocky_succ) 12 82.66 94.01 2 16.67
13530. Joe (fireflygrave) 30 82.66 105.98 5 16.67
13531. ZeRandom (fastnt) 5 82.66 91.90 4 80.00
13532. jsve (jsve) 10 82.66 97.43 3 30.00
13533. Gina (borbinon) 6 82.66 92.12 3 50.00
13534. ore (orezee) 4 82.65 87.40 1 25.00
13535. :) (pennani) 36 82.65 95.46 17 47.22
13536. basil (screamingsavannah) 1 82.65 82.65 0 0.00
13537. klima7 (klima7) 8 82.65 91.23 1 12.50
13538. Sharif (sharif4747) 1,350 82.64 129.37 421 31.19
13539. Iliyan (proto0o) 14 82.64 93.69 3 21.43
13540. jonas (idoseggs) 6 82.63 91.95 0 0.00
13541. JustBoyM8 (justboym8) 1 82.63 82.63 1 100.00
13542. William (beholder92) 7 82.63 99.48 2 28.57
13543. Kaptain K (kxdang) 11 82.63 104.52 5 45.45
13544. h (vondo28) 48 82.62 108.53 9 18.75
13545. Onni (alchem) 278 82.62 121.20 65 23.38
13546. Bryce (satlight) 95 82.62 107.18 30 31.58
13547. Free Palestine (tidy400) 115 82.62 103.71 28 24.35
13548. Erin (erinchipppppppp) 5 82.62 88.11 2 40.00
13549. Stefan (eisenzelle) 2 82.62 91.92 0 0.00
13550. Veritas (bobo347844) 3 82.61 86.41 1 33.33
13551. kaedyn (rainbowdad) 13 82.61 101.70 3 23.08
13552. CreepySusie (mole22) 2 82.61 83.99 2 100.00
13553. Vince (vietzerg) 3 82.60 85.46 0 0.00
13554. grantgoosten (grantgoosten22) 8 82.60 93.78 2 25.00
13555. Benny (typervain) 210 82.60 106.18 44 20.95
13556. Matt (mattserblo) 28 82.59 99.42 15 53.57
13557. Moe (moeb1us) 19 82.59 107.02 10 52.63
13558. Aria (spaceface32) 19 82.59 98.42 3 15.79
13559. Sam (cattheory) 18 82.59 99.87 4 22.22
13560. Aaron (unrealapex) 23 82.59 102.30 11 47.83
13561. Alpha147258 (alpha147258) 5 82.59 96.78 1 20.00
13562. Fitz (kulaizki) 2 82.59 93.58 2 100.00
13563. Reuben (phyterjet) 2 82.59 85.42 0 0.00
13564. ╰(▔∀▔)╯ (naufalm02) 4 82.58 91.86 3 75.00
13565. Sander (5andos) 570 82.57 103.60 146 25.61
13566. kelvin (actualcarton782) 6 82.57 102.85 3 50.00
13567. Jim (jimnguyen) 14 82.57 97.80 5 35.71
13568. kulau (kulau04) 1 82.57 82.57 1 100.00
13569. Salted (whyisitsohardto) 155 82.57 111.59 46 29.68
13570. Sophia (sophia2020) 37 82.57 101.88 4 10.81
13571. . (solorex_) 37 82.57 120.32 25 67.57
13572. Stefan (thebeaver5) 18 82.57 93.64 3 16.67
13573. Jimmy (jimjimr) 4 82.56 98.98 2 50.00
13574. Justin (my_friend_justin) 4 82.56 84.59 1 25.00
13575. Timothy (timothyp823) 17 82.56 89.56 2 11.76
13576. Mihir (plibither8) 50 82.56 95.41 20 40.00
13577. Gray (grayhollow) 7 82.56 94.82 3 42.86
13578. david (vinegar__) 6 82.56 92.93 2 33.33
13579. Anaru (anaru797) 16 82.56 92.37 2 12.50
13580. Jesse (pinec0ne) 30 82.55 94.40 8 26.67
13581. Matthew (mattyssss) 6 82.55 89.95 6 100.00
13582. Salman (xinvoker) 70 82.55 109.90 23 32.86
13583. Cahid Enes (sirceness) 2 82.55 85.35 0 0.00
13584. Khoi (khoile9) 4 82.55 91.29 4 100.00
13585. Meppou (meppou) 8 82.55 96.10 3 37.50
13586. . (doomslug5) 21 82.55 91.03 4 19.05
13587. Gravity (gravity_eyes) 3 82.55 86.37 3 100.00
13588. Soumyajeet (s0umyajeet) 27 82.55 89.03 13 48.15
13589. hollup (frankzzzzzzz) 16 82.54 89.60 1 6.25
13590. Alex (alexlizx) 30 82.54 98.45 6 20.00
13591. JE (jem5268) 5 82.54 99.28 1 20.00
13592. tony (toeknee0) 18 82.54 95.32 4 22.22
13593. Owen (chaostypefast) 2 82.54 90.79 0 0.00
13594. Wealthycentro (wealthycentro) 40 82.54 103.51 18 45.00
13595. Jimmy (ratjesus) 100 82.53 110.51 27 27.00
13596. Vinay (vinaynani92) 28 82.53 98.85 11 39.29
13597. surferdude (surferdudepr86) 2 82.52 85.40 0 0.00
13598. Nathan (craizar) 104 82.52 99.42 29 27.88
13599. An (anhanpro2k) 133 82.52 102.76 40 30.08
13600. Sen (senjaeger) 2 82.52 87.68 0 0.00
13601. Radamasz (madarasz) 445 82.51 104.80 116 26.07
13602. Benji (nepzy) 26 82.51 98.96 13 50.00
13603. mayarixx (mayarixx) 2 82.51 84.31 0 0.00
13604. Ghosy (ghosy) 3 82.51 89.37 0 0.00
13605. Kianoosh (kia_wp) 429 82.51 107.36 121 28.21
13606. Bailey (bbrusca98) 22 82.51 98.68 6 27.27
13607. ZeppelinRG (plasmapig) 3 82.51 91.34 1 33.33
13608. Nicholas (atticcraft) 2 82.50 83.91 0 0.00
13609. Nikolas (nkaiser) 13 82.50 97.15 4 30.77
13610. Jordan (jordanguyen1) 2 82.50 82.69 2 100.00
13611. Macro (macro225) 294 82.49 99.74 60 20.41
13612. return NULL; (honor12) 186 82.49 100.00 47 25.27
13613. Alexander (codec4) 44 82.49 94.72 8 18.18
13614. Argo (argosteelshield) 1 82.49 82.49 0 0.00
13615. Abhijeet (abhinitinkale) 3 82.49 85.64 2 66.67
13616. NickyPP (weenniecat) 367 82.49 117.47 118 32.15
13617. Austin (austinwc) 8 82.49 97.10 0 0.00
13618. Jose (cornjose877) 11 82.48 97.85 2 18.18
13619. SpleF (felipeadn) 6 82.48 92.07 3 50.00
13620. Yeesh (yeesh) 1 82.48 82.48 0 0.00
13621. PISSPAINTING (pisspainting) 13 82.48 94.83 6 46.15
13622. Sam (samjm) 4 82.48 88.52 4 100.00
13623. butterfingers (th3panda) 11 82.47 97.20 2 18.18
13624. Vosse (vosse) 2 82.47 86.45 1 50.00
13625. Rick (outrunwolf) 8 82.47 86.41 0 0.00
13626. Nameless (nameless_pixel) 3 82.47 84.66 2 66.67
13627. Shrimpo (shrimpo) 20 82.47 98.82 7 35.00
13628. Welame (welame) 32 82.47 96.96 0 0.00
13629. Benjamin (frostdeee) 4 82.47 90.24 0 0.00
13630. Fishcat (fishcat) 6 82.45 93.69 2 33.33
13631. Chris (_c3a) 8 82.45 98.61 0 0.00
13632. JTL (jimthelegend) 11 82.45 87.52 3 27.27
13633. Clayton (azpinballer) 6 82.45 96.13 2 33.33
13634. Heorhii (heorhii_hryhorov) 36 82.44 99.96 8 22.22
13635. craster (yaboiedgy) 23 82.44 96.16 11 47.83
13636. Kitt (kmet5) 1 82.44 82.44 0 0.00
13637. Aayush (aayushm8) 1 82.44 82.44 0 0.00
13638. Kwan (ckksimon) 2 82.44 86.35 1 50.00
13639. methodiical (methodiical) 26 82.44 104.61 3 11.54
13640. Petter (ph140) 30 82.44 108.59 13 43.33
13641. Jonathan (jon_daub) 12 82.43 105.17 2 16.67
13642. David (spurgeon) 33 82.43 107.54 4 12.12
13643. Michael (lastobelus) 293 82.43 97.70 66 22.53
13644. Chocolate (chocolatekid) 3 82.43 87.79 0 0.00
13645. Ahpoo (ahpoo) 42 82.43 103.29 12 28.57
13646. Nathan (oliblish) 12 82.42 100.42 1 8.33
13647. Bartek (unua) 3 82.42 85.43 0 0.00
13648. Jess (dragonfire24) 25 82.42 103.42 12 48.00
13649. Ickooo (gamerchancer) 30 82.41 96.04 8 26.67
13650. Tyrone (chidorimove) 1 82.41 82.41 0 0.00
13651. Justin (asparaguswater) 2 82.41 84.67 1 50.00
13652. Th3BossC (th3bossc) 135 82.41 112.55 34 25.19
13653. quit=trash (shatapfajjat69) 10 82.41 100.21 3 30.00
13654. Quinn (flyinfox) 1 82.40 82.40 1 100.00
13655. Owen (owenhayes) 3 82.40 98.41 1 33.33
13656. Ted (crompnickton) 1 82.40 82.40 0 0.00
13657. Tiffany (mangles) 8 82.40 94.09 1 12.50
13658. Joosh (jewsh) 95 82.40 103.13 28 29.47
13659. Mohammed (mohammed55555) 43 82.39 93.10 14 32.56
13660. Julia (julezreid) 6 82.39 99.69 0 0.00
13661. Xavier Rich (xavier_0818) 1 82.39 82.39 0 0.00
13662. Jordan (sugarytaco) 9 82.39 99.03 8 88.89
13663. timas (timastimas) 92 82.39 98.06 30 32.61
13664. Adam (hodowcaowiec) 33 82.38 93.37 8 24.24
13665. tstats[azhy_01] (azhy_01) 67 82.38 98.71 25 37.31
13666. Jerry24562 (jerry24562) 21 82.38 92.03 0 0.00
13667. Nape (nape_) 2 82.38 84.14 0 0.00
13668. ferris (ferrisiscool) 38 82.37 100.06 13 34.21
13669. bruh (jakubd) 108 82.37 106.92 37 34.26
13670. Areeb (your_avg_aaa) 115 82.37 104.92 36 31.30
13671. hello (imfeelingunlucky) 170 82.37 113.68 37 21.76
13672. Cameron (ballsinyourface) 72 82.37 109.35 19 26.39
13673. Vãi Trí (minhtrihard) 19 82.37 96.02 3 15.79
13674. Oscar (pla3ma) 3 82.36 93.29 2 66.67
13675. Jerry (jernjej) 8 82.36 91.01 3 37.50
13676. Eric (ericcand) 143 82.36 103.14 35 24.48
13677. Stuipedd (stuipedd) 213 82.36 106.68 62 29.11
13678. Tellenar (tellenar) 7 82.36 100.00 2 28.57
13679. Zakaria (zackzack1224) 29 82.35 98.31 11 37.93
13680. d (flindocks) 3 82.35 86.16 0 0.00
13681. Jeritens (jensrichter) 13 82.35 94.34 3 23.08
13682. dog (ginasmocha) 31 82.35 118.51 11 35.48
13683. Leon (flopasd) 48 82.34 108.73 11 22.92
13684. Souhardya (souhardya98) 56 82.34 100.67 20 35.71
13685. celes (celescastro) 14 82.34 97.53 5 35.71
13686. Katie (kantielope) 21 82.34 99.20 4 19.05
13687. papryczan (olgi69) 7 82.33 91.55 3 42.86
13688. John (stevie123) 4 82.33 91.39 1 25.00
13689. Nathan (exodus_king) 9 82.32 89.43 4 44.44
13690. isaac (caasiooj) 2 82.32 82.53 1 50.00
13691. Sam Luke (ducksako) 9 82.32 95.95 2 22.22
13692. imnotanygood (handicaped) 3 82.32 86.17 2 66.67
13693. Jackie (jackiechan816) 160 82.32 110.90 47 29.38
13694. wao (sendnudesplease) 3 82.31 96.66 1 33.33
13695. (shaun022) 295 82.31 112.14 90 30.51
13696. Ayush (ayushnanda14) 8 82.31 88.96 2 25.00
13697. Sebastian (grommonon) 501 82.31 110.37 143 28.54
13698. Jeffrey (jlhart1717) 3 82.31 86.71 2 66.67
13699. GidbinN (gidbinn) 7 82.31 88.95 3 42.86
13700. Aytac (aytac_neigel27) 158 82.30 102.21 49 31.01
13701. huu duy (huu_duy99) 548 82.30 107.22 145 26.46
13702. Mykola (nikoliazekter) 5 82.30 85.81 3 60.00
13703. Rohit (rohiitt) 1 82.30 82.30 0 0.00
13704. Bruce (cybwong) 6 82.30 90.13 4 66.67
13705. Sadie (thotchakra) 203 82.29 108.05 70 34.48
13706. ol (billturbo) 12 82.29 97.99 6 50.00
13707. Nicolas (nickolishous) 1 82.29 82.29 1 100.00
13708. sheik (clubs_) 15 82.29 104.20 7 46.67
13709. Lucy (lucyd266) 20 82.28 92.52 9 45.00
13710. Ky (thaediir) 17 82.28 98.11 6 35.29
13711. Klaus26 (26klaus) 1 82.28 82.28 1 100.00
13712. Tran (newstrung) 18 82.28 91.04 2 11.11
13713. Nathanael (tinkerer_nat) 46 82.28 102.93 12 26.09
13714. Chris (chrislowe) 35 82.27 100.06 12 34.29
13715. lai (krylite) 11 82.27 89.49 0 0.00
13716. Martin (typeracist_) 91 82.27 104.54 47 51.65
13717. Wietse (stroopwafel123) 3 82.27 88.08 0 0.00
13718. Brutale (benvan) 7 82.26 91.53 4 57.14
13719. Kevin (v3rmillian) 10 82.26 96.98 0 0.00
13720. rey (reyreyes) 6 82.26 88.09 3 50.00
13721. MazzaM (typingproxyz) 283 82.26 131.52 71 25.09
13722. Johannes (jogameshd) 8 82.26 97.47 2 25.00
13723. Krowa (krowa) 58 82.26 100.05 17 29.31
13724. Lasse (imlasse) 75 82.26 100.42 20 26.67
13725. ronan (fibbit) 14 82.26 94.06 3 21.43
13726. Dulguun (dulguun_) 422 82.25 117.37 120 28.44
13727. Mack (bigmack10) 8 82.25 91.73 1 12.50
13728. Augmas (augmas) 1 82.25 82.25 0 0.00
13729. Tur (tops620) 1 82.25 82.25 1 100.00
13730. abe (404abe) 5 82.25 90.83 1 20.00
13731. James Li (diffkey) 6 82.24 97.75 3 50.00
13732. Azure (b1izzard) 1 82.24 82.24 0 0.00
13733. Duy (invinduy) 12 82.24 100.94 10 83.33
13734. Osian (osian) 5 82.24 97.82 2 40.00
13735. NOJ8 (noj8) 138 82.24 109.33 44 31.88
13736. Nux (amades) 10 82.24 93.43 4 40.00
13737. Anzac (anxan) 8 82.24 91.78 3 37.50
13738. Rajesh (rajesh110494) 58 82.23 100.87 16 27.59
13739. Moritz (mogottsch) 60 82.23 96.97 23 38.33
13740. Dat (mralex101) 1 82.23 82.23 0 0.00
13741. Herb (kellzer) 12 82.23 99.03 4 33.33
13742. (luclukiluc) 12 82.23 94.99 3 25.00
13743. Alex (alexhell) 17 82.23 96.30 3 17.65
13744. Shashank (shanky92) 10 82.23 92.25 2 20.00
13745. Puymieyches (puymieyches) 14 82.23 94.20 3 21.43
13746. Emil (genjimaster) 35 82.23 93.90 13 37.14
13747. Michelangelo (michelangeio) 2 82.23 92.07 0 0.00
13748. Jon (jon56) 14 82.22 98.58 7 50.00
13749. Danel (hi_daniell) 1 82.22 82.22 0 0.00
13750. Cute (rabbit4549) 15 82.22 99.80 4 26.67
13751. Knight (14_knights) 5 82.22 103.21 2 40.00
13752. ayumu (ayumuxe) 15 82.22 94.62 12 80.00
13753. Joe (jfratello) 8 82.21 100.09 3 37.50
13754. Mimi (virtuamima) 4 82.21 89.30 2 50.00
13755. Nils (nosta_06) 72 82.21 101.43 25 34.72
13756. Lukas (zeduke14) 2 82.21 85.93 1 50.00
13757. Kelsey (kelseysd) 15 82.21 111.16 7 46.67
13758. The (the_learning_savage) 11 82.21 104.96 2 18.18
13759. otomen (nurul_liayana) 87 82.20 104.63 29 33.33
13760. Fernando (ferthekiller6_) 80 82.20 107.16 27 33.75
13761. Le Quan (hacbachmaquan) 19 82.20 97.58 8 42.11
13762. khai (kaariee) 8 82.20 97.57 4 50.00
13763. Blue (terry25031069) 796 82.20 105.56 210 26.38
13764. Rahul (rsrahul1000) 162 82.20 107.42 51 31.48
13765. Mees (meeszon) 7 82.20 89.61 2 28.57
13766. Kevin (besnier) 8 82.20 87.44 2 25.00
13767. Dan (bupkisdaddy) 21 82.19 107.02 11 52.38
13768. Jared (varmitz1) 48 82.19 103.45 14 29.17
13769. Micah (micahnical) 12 82.19 107.52 1 8.33
13770. Grape (plrplrplr12345) 10 82.19 96.82 4 40.00
13771. QHadron (jack2980) 1 82.19 82.19 1 100.00
13772. aerar (raale) 12 82.18 102.49 5 41.67
13773. Ashish (obnox33) 3 82.18 88.44 1 33.33
13774. Hugo (glaucon) 20 82.18 92.54 5 25.00
13775. Japonizm (showhey0705) 2 82.18 92.30 0 0.00
13776. Dylan (exordium) 1 82.17 82.17 1 100.00
13777. John (amhacking) 7 82.17 86.54 1 14.29
13778. sw0rd (sw0rd) 42 82.17 101.65 15 35.71
13779. Carlton (wizardhero) 84 82.17 96.74 18 21.43
13780. Steven (tasgu) 3 82.17 99.82 0 0.00
13781. horney (titansmakemehorney) 109 82.17 104.33 27 24.77
13782. odannnnnnn (quietkid) 209 82.17 111.19 53 25.36
13783. DaturdMig (migueldathird) 16 82.16 91.11 5 31.25
13784. Fearo (fearowastaken) 203 82.16 107.84 64 31.53
13785. Nafiul (aminafi) 12 82.16 89.77 4 33.33
13786. Big (3igbrain) 1 82.16 82.16 1 100.00
13787. Hikaru (japism) 11 82.16 104.44 5 45.45
13788. Luis (luismiguelcopadiaz) 21 82.16 92.75 7 33.33
13789. Shibasis (ship9x) 216 82.16 104.50 73 33.80
13790. aoxiang (cuiaoxiang) 16 82.16 98.00 6 37.50
13791. Adam (dwindleflip) 3 82.15 86.12 1 33.33
13792. Draven (dravenator) 4 82.15 94.76 4 100.00
13793. Aaron (lil_bamboo) 1 82.15 82.15 1 100.00
13794. JOSH (jo_dpe) 12 82.15 96.48 3 25.00
13795. John (gakbo) 44 82.15 108.68 10 22.73
13796. Jack (jsdsparky) 3 82.15 92.77 1 33.33
13797. Kedolind (kedolind) 13 82.14 93.92 4 30.77
13798. Bill (destroyer_2) 269 82.14 117.00 79 29.37
13799. mason (meezusxd) 8 82.14 92.61 2 25.00
13800. Malcolm (lampshadess) 8 82.13 91.82 4 50.00
13801. Raja (mmahmoodh) 617 82.13 105.68 184 29.82
13802. Ken (kenzymazy) 91 82.13 99.39 28 30.77
13803. Sherman (takozuchi) 1 82.13 82.13 0 0.00
13804. Lars (larzz_z) 21 82.13 100.31 10 47.62
13805. RA (hayhayhay111) 2 82.13 86.93 0 0.00
13806. Nicholas (nicszerman) 54 82.12 100.65 19 35.19
13807. Tru (jhake_1) 116 82.12 110.49 26 22.41
13808. Ivan (ivannechaiev) 845 82.12 106.77 230 27.22
13809. Thomas (tommyspo) 4 82.12 89.23 1 25.00
13810. Cosmos (cosmosatlas) 1 82.12 82.12 0 0.00
13811. Nyaruko (tatrz) 171 82.12 108.42 63 36.84
13812. Kok Kun (kokkun92) 664 82.12 117.99 188 28.31
13813. @itz_ramy (thugsheep) 10 82.12 94.94 3 30.00
13814. garry (richgarry) 8 82.12 100.81 4 50.00
13815. Hai (haiender288) 4 82.11 88.99 2 50.00
13816. Humphrey (humfurie) 2 82.11 83.46 1 50.00
13817. Mac (immaculatemac) 5 82.10 87.06 2 40.00
13818. Tomasz (elpero) 1 82.10 82.10 0 0.00
13819. SpeedTrain (speedtraintyper) 110 82.09 114.90 26 23.64
13820. Martina (qkmartina) 7 82.09 99.53 1 14.29
13821. Luke (ltuite) 11 82.09 94.67 6 54.55
13822. Armon (airtyper_11) 43 82.09 109.59 11 25.58
13823. burritorolls-royce (burrito... 10 82.09 96.89 2 20.00
13824. nunya (daintyfawn) 9 82.09 111.87 9 100.00
13825. I am cool (ribombee_mobile) 10 82.09 104.05 1 10.00
13826. Fabio (wrist_strength) 8 82.08 89.54 3 37.50
13827. m (miomo) 3 82.08 90.66 1 33.33
13828. Stepan (a_s_v) 80 82.08 94.77 25 31.25
13829. JD (ruminant_robot) 542 82.08 102.72 144 26.57
13830. Muhammad (donnyutsman) 154 82.08 98.98 28 18.18
13831. xX-St3voNY-Xx (snuggets619) 1 82.08 82.08 1 100.00
13832. Squabbi (squabbi) 6 82.07 93.06 0 0.00
13833. Vincent (indronna) 9 82.07 90.70 4 44.44
13834. Alex (zipphys) 40 82.07 101.67 10 25.00
13835. Tiago (doodoo11) 643 82.06 111.89 169 26.28
13836. ayoub50 (ayoub50) 7 82.06 89.97 3 42.86
13837. pablo (pablo_rm1197) 122 82.06 109.61 31 25.41
13838. Max (max_6058) 31 82.06 95.36 10 32.26
13839. Jack (jackwhitten238) 13 82.05 96.47 3 23.08
13840. ChangeS (changes99) 554 82.05 115.97 154 27.80
13841. 🔰Cosmeen (mcpotato) 3 82.05 87.96 0 0.00
13842. Alexey (actually_available_... 3 82.05 88.62 2 66.67
13843. Sinc02 (sinc02) 224 82.05 104.25 71 31.70
13844. seb (sebbbbbbb) 8 82.05 92.54 3 37.50
13845. Lucifer (lucifer97) 2 82.05 83.97 0 0.00
13846. Mons (monstoonix) 36 82.05 94.42 11 30.56
13847. tameflame (gabrieljohngabri... 43 82.04 95.82 9 20.93
13848. Anmol (anmolsaraswat) 253 82.04 121.64 87 34.39
13849. Arnav (cricketman360) 5 82.04 92.20 3 60.00
13850. Based (riceater) 5 82.04 86.24 4 80.00
13851. Beret (boina) 165 82.04 106.52 51 30.91
13852. 3DegreeK (3degreek) 9 82.04 87.24 2 22.22
13853. Atahan (atahan) 5 82.04 92.17 2 40.00
13854. kvin (hwkhoa) 10 82.04 93.97 5 50.00
13855. Bratke (bratke) 3 82.03 89.58 2 66.67
13856. griV (griv) 1,489 82.03 117.63 384 25.79
13857. IamUrs (i_am_urs) 29 82.03 102.77 5 17.24
13858. Hehe (hehenaicha) 3 82.02 88.73 2 66.67
13859. Rizky (battle_hooks12) 12 82.02 98.34 6 50.00
13860. Andy (pilotplater) 4 82.02 88.23 1 25.00
13861. adamski (adast1337) 5 82.02 109.25 2 40.00
13862. Ethan (ethanangg) 5 82.02 90.55 4 80.00
13863. Glooberson (eifersucht) 13 82.02 93.90 3 23.08
13864. Ya (slow_typist123) 4 82.02 85.95 0 0.00
13865. MLM (madlittlemods) 5 82.01 86.84 2 40.00
13866. Giovanni (elgiov) 3 82.01 88.77 0 0.00
13867. . (lv23) 82 82.01 106.78 20 24.39
13868. GusFring (funnyvalentine) 4 82.01 85.50 2 50.00
13869. Akhil (akhillasrado) 13 82.01 96.98 3 23.08
13870. Chris (craastad) 15 82.01 93.16 4 26.67
13871. Chris (chrisjordan23) 75 82.01 102.30 22 29.33
13872. rory (roryinnit) 13 82.00 96.40 2 15.38
13873. Icy_Istanbul (hypzx_x) 10 82.00 95.95 0 0.00
13874. Eli (elikgeneral) 28 82.00 94.11 5 17.86
13875. George (esvee) 1 82.00 82.00 0 0.00
13876. Danail (dansarch) 2 82.00 85.41 1 50.00
13877. Slim (avietnamesedude) 1 82.00 82.00 0 0.00
13878. Cool (creepycumber) 45 82.00 99.28 12 26.67
13879. Philluminati (philluminati) 17 81.99 95.35 5 29.41
13880. Bucketboi (bucketheadmit13) 9 81.99 94.34 3 33.33
13881. Colin (galaxyytr) 14 81.99 94.31 4 28.57
13882. spark (sparkkk) 60 81.99 121.23 19 31.67
13883. wingman41 (wingman41) 34 81.99 98.53 9 26.47
13884. jantheman (jantheman21) 22 81.99 119.73 21 95.45
13885. auerabreak (auera) 48 81.98 98.06 11 22.92
13886. john (tacozmanz) 17 81.98 94.05 1 5.88
13887. Oktoroden (oktoroden) 5 81.98 91.82 0 0.00
13888. Del (dellieran) 66 81.98 99.02 19 28.79
13889. Violet (rxviolet) 27 81.98 100.89 8 29.63
13890. Eric (ealouie) 2 81.98 85.36 0 0.00
13891. Sam (imeowyou) 583 81.97 112.16 183 31.39
13892. Gidean (gidean) 69 81.97 98.01 15 21.74
13893. Liam (jjaegui) 3 81.97 84.26 0 0.00
13894. Marek (baumeef) 1 81.97 81.97 0 0.00
13895. Angel (seal_gel) 1 81.97 81.97 0 0.00
13896. Bambi (nanoperceptoin) 3 81.97 90.01 0 0.00
13897. MyNameIsGodzLol (mynameisgo... 16 81.97 97.31 7 43.75
13898. Matt (piza01134) 53 81.96 104.04 13 24.53
13899. repeatt (repeatt) 26 81.96 101.96 7 26.92
13900. Anton (boisingkit) 4 81.96 90.43 1 25.00
13901. aculeasis (aculeasis) 137 81.96 117.87 37 27.01
13902. Nathan (nat179) 62 81.96 107.05 55 88.71
13903. Adam (oadaam) 6 81.95 89.80 3 50.00
13904. RedXIII (red_xiii) 23 81.95 94.40 7 30.43
13905. Dakota (iccerus) 2 81.95 84.46 0 0.00
13906. Joris (129828) 3 81.94 84.51 0 0.00
13907. Jacob (nutsak) 227 81.94 110.00 60 26.43
13908. Libby (libbyrozzi) 3 81.94 85.31 1 33.33
13909. Morpheus14 (atilla_14) 32 81.94 95.50 13 40.63
13910. funny (funnybus) 7 81.93 100.71 3 42.86
13911. CoveredInBees (coveredinbees) 461 81.93 123.19 137 29.72
13912. MUPH (muphine) 1,724 81.93 119.83 470 27.26
13913. Anye (farmerfred) 124 81.93 100.57 44 35.48
13914. Andrei (belearau) 133 81.93 101.65 34 25.56
13915. Marcelo (amsua99) 3 81.92 85.70 0 0.00
13916. Arnaud (armatt) 350 81.92 106.17 104 29.71
13917. ByamB4 (byamb4) 11 81.91 95.61 6 54.55
13918. Philip (pengzz) 16 81.91 95.23 5 31.25
13919. Jin (wongzi) 1 81.91 81.91 0 0.00
13920. Cara (mrsham) 10 81.91 104.28 9 90.00
13921. Taylor (taylor_1121) 632 81.90 114.09 193 30.54
13922. Robby (roweki21) 41 81.90 100.17 14 34.15
13923. Patrick (pgosser01) 1 81.90 81.90 0 0.00
13924. OctavianRo (octavianro) 1 81.90 81.90 1 100.00
13925. Moag (zefoos) 2 81.90 87.62 1 50.00
13926. bigdad (fillmeupdaddy) 8 81.90 89.99 2 25.00
13927. Matthew (mawalker66) 10 81.90 90.90 9 90.00
13928. N (jaripozz) 62 81.90 94.87 19 30.65
13929. Joshua (joshuahd) 36 81.89 98.99 14 38.89
13930. leah (69leah) 3 81.89 87.70 0 0.00
13931. Walker (walkerthehat) 1 81.89 81.89 0 0.00
13932. kushkus (zefirokouz) 19 81.89 96.51 6 31.58
13933. musratte (musratte) 73 81.89 100.11 21 28.77
13934. reall (reall) 74 81.88 97.36 21 28.38
13935. Jayden (jayballr) 29 81.88 102.68 7 24.14
13936. Novas (novas_arcos) 35 81.88 94.14 7 20.00
13937. |I|I|I|I|I|I| (iknowwhatimd... 35 81.88 97.84 11 31.43
13938. Vince (venvince) 6 81.88 110.12 3 50.00
13939. Anh (_azh_) 1,402 81.87 124.74 410 29.24
13940. J (jellyfiszh) 197 81.87 114.28 60 30.46
13941. gekyou (hbk_rain) 1 81.86 81.86 0 0.00
13942. Alex (alex005) 3 81.86 82.82 1 33.33
13943. Jesse (jholwell) 4 81.86 88.70 4 100.00
13944. alvarado (im_wilin) 19 81.86 95.99 5 26.32
13945. k (ahhhjk) 80 81.85 107.21 22 27.50
13946. sika (sikathenub) 120 81.85 109.22 52 43.33
13947. MistakesWereMade (workmanty... 42 81.85 99.00 16 38.10
13948. Omar (omar_letaief) 12 81.85 92.54 2 16.67
13949. DrPoppyseed (drpoppyseed) 13 81.84 90.50 3 23.08
13950. Shino (id_acey) 13 81.84 107.06 1 7.69
13951. Eric (__eric__f__) 8 81.84 90.34 1 12.50
13952. Elxius (elxius) 13 81.83 103.07 2 15.38
13953. pwoi (pwoi) 6 81.83 99.71 3 50.00
13954. M (mmanhar) 4 81.83 94.58 2 50.00
13955. Bruh (bruhmoem) 3 81.82 89.68 1 33.33
13956. AranKz (arankz) 27 81.82 97.26 7 25.93
13957. Bram (bramdk) 21 81.82 99.02 10 47.62
13958. Museum (museum25) 7 81.82 92.56 1 14.29
13959. PickleCork (proogle_can) 52 81.82 96.34 16 30.77
13960. Martynas (peepeeman42069) 14 81.81 94.51 10 71.43
13961. Henry (henrybutschool) 69 81.81 97.75 20 28.99
13962. lol (sngtx) 30 81.81 103.50 8 26.67
13963. air (hopeberries) 7 81.81 103.18 4 57.14
13964. Harper (harpermh) 5 81.81 89.07 3 60.00
13965. tstats[ayush_] (ayush_) 64 81.81 101.69 26 40.63
13966. justin (itsjustinz) 15 81.80 94.75 6 40.00
13967. refrshrs (refrshrs) 5 81.80 86.54 0 0.00
13968. good (afternoonracer) 32 81.80 101.02 14 43.75
13969. H_24 (h_24) 15 81.80 105.70 3 20.00
13970. Sidiq (sidiqbheem) 3 81.79 85.58 2 66.67
13971. House (houses) 23 81.79 96.42 3 13.04
13972. Zachry (zachwn) 27 81.79 98.67 6 22.22
13973. beansnboges (beansnboges) 7 81.78 97.15 2 28.57
13974. Ichiro (theanalyst9344) 3 81.78 87.81 0 0.00
13975. Anthony (sildreon) 11 81.78 94.05 1 9.09
13976. rei (airyuki) 6 81.77 90.04 1 16.67
13977. calum (calousime) 155 81.77 112.56 61 39.35
13978. Kia (kiabin) 2 81.77 86.09 2 100.00
13979. Parsa (parsal) 18 81.76 92.77 5 27.78
13980. CoolGuyConnor (coolguyconnor) 13 81.76 91.61 3 23.08
13981. Tim (penguins178) 10 81.76 100.58 3 30.00
13982. CM (specialize) 4 81.76 89.59 3 75.00
13983. Alex (awb101) 9 81.75 95.16 3 33.33
13984. forty-one hex (41hex) 1 81.75 81.75 1 100.00
13985. Ollie (olijf) 19 81.75 95.49 8 42.11
13986. Parker (parqr) 24 81.75 97.38 6 25.00
13987. mrklein (mrklein) 2 81.75 91.14 2 100.00
13988. Qwerty (qwertyazerty) 22 81.74 94.82 7 31.82
13989. レンゾ (wrenji) 12 81.74 92.88 2 16.67
13990. John (jimminyyy) 27 81.73 108.41 9 33.33
13991. Mark (kooliokek) 5 81.73 94.73 2 40.00
13992. jcm (jan500) 151 81.73 104.17 45 29.80
13993. Amal (amal_ronak) 9 81.72 97.50 6 66.67
13994. Greg (grrg) 67 81.72 97.72 17 25.37
13995. vedanttoke20 (vedanttoke20) 4 81.72 89.58 1 25.00
13996. krisr17 (kk017) 95 81.71 101.16 35 36.84
13997. Daan (lemonob) 3 81.71 89.03 1 33.33
13998. Sebastian (nichtmonti) 7 81.71 101.71 1 14.29
13999. Nicolas (fruscianterules) 80 81.71 112.68 27 33.75
14000. Murphy (murphsmurf) 7 81.71 87.54 3 42.86
14001. Piotr (snooppiotr) 436 81.71 104.07 93 21.33
14002. Cep (alhabiblidinillah) 424 81.71 100.26 99 23.35
14003. Chy (chy_) 4 81.71 95.74 0 0.00
14004. Daan (skunki) 19 81.70 91.72 7 36.84
14005. Jebaited (raizzel) 25 81.70 94.99 8 32.00
14006. SuperHyperbole (superhyperb... 2 81.70 86.14 2 100.00
14007. M. (apolexius) 1 81.70 81.70 1 100.00
14008. Timo (karuso33) 1 81.70 81.70 1 100.00
14009. Bertra (bertraml) 29 81.70 93.04 8 27.59
14010. Luminious (luminious) 14 81.70 95.13 2 14.29
14011. AlirezA (alirezaslayer) 4 81.70 88.08 2 50.00
14012. Super (cookiecrusader) 2 81.70 83.54 0 0.00
14013. Josh (johnjena93045) 5 81.69 90.80 1 20.00
14014. AlexAustria (alexaustria) 13 81.69 88.06 5 38.46
14015. FisH...MaN (fish_man) 26 81.69 101.21 26 100.00
14016. Jermaine (mj_procuber) 2 81.69 85.03 0 0.00
14017. Chaitanya (spcspeedracer) 2 81.69 84.26 0 0.00
14018. Sameer (socoolsameer) 4 81.69 98.86 1 25.00
14019. Avinash (avinash625) 19 81.68 95.29 2 10.53
14020. Chris (rykthos) 581 81.68 109.52 158 27.19
14021. Mirochi (nobitad) 3 81.68 86.97 0 0.00
14022. Matthew (happychau0v0) 3 81.68 84.68 3 100.00
14023. JP (freshlumpia) 265 81.68 112.19 79 29.81
14024. 3DMakerKid (makerkid) 3 81.68 96.77 1 33.33
14025. S (cryten56) 4 81.68 89.59 0 0.00
14026. sm (qdbs) 3 81.67 98.34 3 100.00
14027. Nico (gomifune) 6 81.67 88.00 0 0.00
14028. Rodrigo (rdcmdev) 11 81.67 93.77 2 18.18
14029. Mitchell (shlo) 5 81.67 92.08 1 20.00
14030. Jimmy (user39_on_dvorak) 53 81.67 99.58 10 18.87
14031. Amangus (phsycomonkek1) 9 81.66 91.47 3 33.33
14032. michael (michaelabdi) 5 81.66 87.22 2 40.00
14033. slowboiken (fastken) 39 81.66 98.93 9 23.08
14034. NecroCW (necrocw) 367 81.66 109.46 107 29.16
14035. Ben (benspeedin) 3 81.66 83.00 1 33.33
14036. Mocha (tdrewek) 11 81.66 90.83 1 9.09
14037. Dr (despaciko) 10 81.66 90.12 4 40.00
14038. Stephen (lollidude) 10 81.66 94.58 1 10.00
14039. Jason (jd_istooshort) 3 81.65 88.23 0 0.00
14040. Johanna (johanna9813) 23 81.65 91.67 8 34.78
14041. Marc (ninja221100) 6 81.65 94.77 2 33.33
14042. x (sealnot123) 30 81.65 97.84 9 30.00
14043. greed (greedthelazy) 175 81.65 106.85 67 38.29
14044. Alexis (alexxxisk) 18 81.64 97.19 4 22.22
14045. Maxwell (mc2006) 114 81.64 98.64 33 28.95
14046. workmanLayout (mustelad) 26 81.64 95.42 8 30.77
14047. zeldaplayergl (zeldaplayergl) 2 81.64 90.23 0 0.00
14048. K (strongballs) 352 81.63 125.00 107 30.40
14049. Geirdriful (geirdriful) 23 81.63 99.21 4 17.39
14050. anatoly (popovanatoly) 1 81.63 81.63 1 100.00
14051. Angela (purplehalo3) 8 81.63 93.81 0 0.00
14052. Mohcine (dictatox) 4 81.63 92.83 3 75.00
14053. AxelDT (axman292) 26 81.63 93.97 6 23.08
14054. matyus (matyus) 2 81.63 81.76 0 0.00
14055. Googolplex (googolplex05) 4 81.63 89.11 4 100.00
14056. tirehtööri (benracer) 19 81.62 102.58 4 21.05
14057. rai_10101 (rai_10101) 8 81.62 101.30 5 62.50
14058. Digo (digocorbellini) 13 81.62 94.34 4 30.77
14059. Generic.exe (generic_exe) 49 81.62 95.19 16 32.65
14060. Jacob (jacob643) 14 81.61 90.57 4 28.57
14061. Dan (sirdanofthedirt) 43 81.61 99.37 11 25.58
14062. Atif (pakistan_786) 110 81.61 109.17 22 20.00
14063. Rev (revcows) 2 81.61 91.98 0 0.00
14064. print("Desconocid0h")#0482 ... 1 81.61 81.61 1 100.00
14065. 光次郎 (koujiro) 120 81.61 109.93 33 27.50
14066. Horique (horique) 4 81.60 86.39 4 100.00
14067. Ryan (rlee20) 1 81.60 81.60 0 0.00
14068. mike (godlykanadian) 9 81.60 86.07 2 22.22
14069. Filip (fifi_wilk) 19 81.60 94.37 6 31.58
14070. Ryan (rjbunge99) 734 81.59 105.25 190 25.89
14071. Grandjudge (talonted) 38 81.59 102.17 11 28.95
14072. Nikhil (nikhilaii93) 5 81.59 85.93 1 20.00
14073. Ethan (cmfridays) 1 81.59 81.59 0 0.00
14074. Direwolf (abdelmoezhj) 92 81.59 100.89 20 21.74
14075. Corn Philips (cornphilips) 46 81.59 101.27 15 32.61
14076. Lennox (datshall) 28 81.59 99.21 3 10.71
14077. Harald (updatin) 53 81.59 90.47 13 24.53
14078. Winson (weezy_winson) 26 81.59 120.74 11 42.31
14079. Alexander (vennor) 12 81.58 95.82 3 25.00
14080. Raunak (aabbccdd4444) 97 81.58 97.53 25 25.77
14081. Sofia (michael_bjordy) 13 81.58 91.72 4 30.77
14082. Ethan (etstein) 188 81.58 103.47 49 26.06
14083. Mateie (mateie) 6 81.57 91.16 1 16.67
14084. Daan (kantelaardaan) 4 81.57 92.05 3 75.00
14085. Mahima (mahima_) 1 81.57 81.57 0 0.00
14086. Mohammed (fermatslastaccount) 1 81.57 81.57 0 0.00
14087. badfaith (badfaith) 14 81.57 95.22 3 21.43
14088. Karel (kareldang) 7 81.57 86.83 2 28.57
14089. John (gryndal) 9 81.57 88.55 5 55.56
14090. Red (redchristian16) 130 81.57 100.60 42 32.31
14091. Forehead (foreheadq) 15 81.56 96.02 7 46.67
14092. Stephen (laddlez) 50 81.56 109.76 13 26.00
14093. Zoljargal (itsnotzoloo) 1 81.56 81.56 0 0.00
14094. Zach (markertassel) 5 81.56 93.16 0 0.00
14095. Santiago (forero) 5 81.56 88.45 1 20.00
14096. Kat (oh_that_one_person) 6 81.55 100.00 2 33.33
14097. Cobri420 (cobrili420) 1 81.55 81.55 0 0.00
14098. kkwong (kkwong2003) 2 81.55 90.82 0 0.00
14099. Harold (realmagilla) 7 81.55 102.04 6 85.71
14100. Josh (joshbochuan2020) 2 81.55 82.32 2 100.00
14101. Hesh (heshg) 176 81.54 107.55 49 27.84
14102. Ding (yesisd) 5 81.54 86.48 1 20.00
14103. ig@ (fainterkitten) 2 81.54 83.49 0 0.00
14104. Omar (omar_ziada) 133 81.54 113.59 42 31.58
14105. pwp (fickypw) 288 81.54 99.24 64 22.22
14106. A-A-RON (hihyooka) 3 81.54 88.58 0 0.00
14107. HD (hdcodecj) 1,347 81.54 108.18 362 26.87
14108. Rice (speedtoggled) 17 81.54 93.88 7 41.18
14109. Tu (vuanhtu52) 3 81.53 90.12 0 0.00
14110. Jimbo (bugprostate) 84 81.53 101.40 26 30.95
14111. John (avantegarden) 13 81.53 102.73 4 30.77
14112. arz (arzr) 1 81.53 81.53 0 0.00
14113. Murka (wassupbuddy) 21 81.53 100.14 13 61.90
14114. Nomig (nomig) 1 81.53 81.53 0 0.00
14115. Lost (losthalo) 1 81.53 81.53 0 0.00
14116. Antti (rustling) 10 81.53 94.06 4 40.00
14117. Niko Zhang (neko23) 26 81.53 98.14 7 26.92
14118. Zhroon (znub) 34 81.52 103.73 9 26.47
14119. Not_Stable (not_stable) 364 81.52 123.08 121 33.24
14120. Kai (kaitheguy_) 21 81.52 97.75 7 33.33
14121. Dekita (dekita123) 1 81.52 81.52 0 0.00
14122. sAnideos (sanideos) 74 81.51 97.78 15 20.27
14123. Hunt (huntzhang) 7 81.51 96.84 5 71.43
14124. huh (noirblnqqq) 53 81.51 100.22 18 33.96
14125. Unai (unaiberis) 26 81.51 92.29 12 46.15
14126. Noriphe (noriphe) 7 81.51 92.10 2 28.57
14127. Mazin (mmazincham) 360 81.50 101.33 73 20.28
14128. Alex Miller (amiller13) 5 81.50 99.37 4 80.00
14129. keelsveb (keelsveb) 1 81.50 81.50 0 0.00
14130. Igel (igelwithdeagle) 2 81.50 81.74 1 50.00
14131. SWAPNIL (swapnil326) 30 81.50 94.58 12 40.00
14132. Saruwatori (saruwatori) 12 81.49 87.18 4 33.33
14133. Uncle John Jr. the 5th (che... 206 81.49 108.86 51 24.76
14134. Marcago (marcago) 13 81.49 94.53 3 23.08
14135. miniman1706 (miniman1706) 2 81.49 85.05 2 100.00
14136. grieves (mmcph36) 34 81.49 91.99 4 11.76
14137. Rafiul (rafiul41) 53 81.49 98.57 14 26.42
14138. Jeydin21 (jeydin21) 22 81.49 101.32 9 40.91
14139. Theo (mewtish) 439 81.49 108.53 115 26.20
14140. Krystal (sunshinenmyeyes) 21 81.49 103.02 6 28.57
14141. Desideratus (desideratus) 2 81.49 82.12 1 50.00
14142. LivewireHush (scarlet_static) 1 81.48 81.48 0 0.00
14143. Tu (tuawesome) 11 81.48 96.84 5 45.45
14144. Jack (jackshadow) 98 81.48 101.71 25 25.51
14145. Izzy (izzythompson) 107 81.47 107.91 25 23.36
14146. Sambhalang (samkchandy) 55 81.47 101.62 19 34.55
14147. Teez (evofury) 7 81.47 89.43 3 42.86
14148. Josh (joshmgeorge) 20 81.46 91.80 6 30.00
14149. lil_vince (lil_vince) 7 81.46 91.67 1 14.29
14150. IceTea (iceteaxxd) 6 81.45 88.78 1 16.67
14151. Nid (cyanid_) 9 81.45 97.80 2 22.22
14152. Antoni (aaahello) 4 81.45 88.25 3 75.00
14153. Matt (mattdaddy27) 5 81.45 85.07 1 20.00
14154. Mohammad Hossein (mh1998) 120 81.45 99.89 38 31.67
14155. Devesh (dev344) 42 81.45 92.43 12 28.57
14156. Nathan (sharkking487) 9 81.45 95.08 6 66.67
14157. Arararararararararagi (manaso) 550 81.45 110.97 134 24.36
14158. discordia (discordia1) 3 81.44 90.56 1 33.33
14159. Achyut (achyut69) 1 81.44 81.44 0 0.00
14160. Erick (smittywerben) 98 81.44 101.20 31 31.63
14161. icon (iconicck) 7 81.43 93.08 1 14.29
14162. abh1sh3k (abh1sh3k) 73 81.43 96.30 41 56.16
14163. BobTuring (bobturing) 15 81.43 106.07 10 66.67
14164. Adhy (adhy) 8 81.43 94.29 0 0.00
14165. Max (madmax89) 31 81.42 90.96 6 19.35
14166. Peter (kraivyne) 6 81.42 91.00 1 16.67
14167. arman (invoker870) 4 81.42 95.66 4 100.00
14168. Few (fewhakko) 7 81.42 93.06 1 14.29
14169. brocco (brocollie) 39 81.42 99.88 12 30.77
14170. Ron (ronald2) 11 81.42 99.70 6 54.55
14171. aidil (aidilqayyim) 9 81.42 91.31 0 0.00
14172. bangka (bangkabelitung) 124 81.42 102.82 26 20.97
14173. Jan (draggonnfs) 11 81.42 97.90 2 18.18
14174. grace (katrvey) 15 81.41 95.61 2 13.33
14175. Adalyee (adalyee) 4 81.41 90.76 0 0.00
14176. storm-gg (waytooclose) 1 81.41 81.41 0 0.00
14177. waryburger (waryburger) 13 81.41 94.80 4 30.77
14178. Polla (pollaz1) 2 81.41 88.55 0 0.00
14179. Bjoern (mrmuetze) 5 81.40 85.81 1 20.00
14180. Mihkel (tikstiks) 43 81.40 101.94 17 39.53
14181. Snow (snowjack) 7 81.40 91.98 2 28.57
14182. . (speed1x) 4 81.40 91.76 1 25.00
14183. J (nothisisjeff) 133 81.40 102.58 30 22.56
14184. Timothy (noma624) 4 81.40 86.48 2 50.00
14185. Julia (julia22202) 1 81.40 81.40 0 0.00
14186. Phillip (solonjhee) 4 81.40 90.79 1 25.00
14187. serg (bobanuts) 13 81.39 93.33 7 53.85
14188. Crash (crash_complete) 100 81.39 105.41 34 34.00
14189. Ignacio (darkylove) 5 81.39 96.48 5 100.00
14190. Félix (percevent) 1 81.39 81.39 0 0.00
14191. flourish (fl0urish) 20 81.39 112.48 8 40.00
14192. Michael (azumifan) 10 81.39 88.88 4 40.00
14193. Jay (jaydhanani36) 24 81.39 94.88 9 37.50
14194. Shishcobober (shishcobober2) 54 81.38 98.73 12 22.22
14195. Larry (lunchspecial) 13 81.38 100.32 5 38.46
14196. Ruff (roofy2004) 15 81.38 92.97 4 26.67
14197. Timofey (t1m0n) 130 81.38 95.69 39 30.00
14198. mo (ceiba) 26 81.38 95.98 5 19.23
14199. Manol (ari3s) 1,198 81.38 111.90 329 27.46
14200. Random (bogdanmironov) 20 81.38 93.98 4 20.00
14201. salad (notyoursalad) 20 81.38 93.49 6 30.00
14202. chez (chezzion) 20 81.38 96.16 2 10.00
14203. shashi (sekhar184131) 52 81.38 98.42 13 25.00
14204. Sunbites (sunbites_4610) 28 81.38 102.48 15 53.57
14205. Luna (xluna420) 29 81.38 95.01 17 58.62
14206. Mike (mikystevan) 12 81.37 91.93 3 25.00
14207. Ryan (bankzzy) 1 81.37 81.37 0 0.00
14208. Rosinante D. (thusspokegappy) 1 81.37 81.37 1 100.00
14209. Mohib (mohib33) 36 81.36 96.23 18 50.00
14210. William (wiigocadee) 1 81.36 81.36 0 0.00
14211. Eric (insecureforsure) 106 81.36 101.87 31 29.25
14212. Nicholas (legendarykeys) 45 81.36 101.45 13 28.89
14213. Jojopup123 (joanne225) 2 81.36 90.36 0 0.00
14214. Jorryn (vicmg) 38 81.35 98.09 7 18.42
14215. Jayden (speedxer) 6 81.35 86.37 3 50.00
14216. kool (koolfiger) 1 81.35 81.35 1 100.00
14217. 雪 (bbgotme) 1 81.35 81.35 0 0.00
14218. KA (keshavgrwl96) 48 81.35 104.98 7 14.58
14219. Augusto (ahidalgob) 25 81.34 91.01 15 60.00
14220. Spavid (dadkos34) 11 81.34 115.73 7 63.64
14221. Andreee (farskyz) 1 81.34 81.34 0 0.00
14222. bec (twentyonepotato) 20 81.34 94.81 4 20.00
14223. Rubin (rubintypes) 41 81.34 95.39 12 29.27
14224. David (davidjnovak) 25 81.34 102.99 5 20.00
14225. ARK (qwerty account) (arkfr... 773 81.34 105.10 196 25.36
14226. Piplup (piplup_) 161 81.33 105.83 32 19.88
14227. noms (bloopdaferd) 20 81.33 98.05 4 20.00
14228. greg (grant24) 4 81.33 96.94 0 0.00
14229. Ali (imtew_much) 713 81.33 106.21 192 26.93
14230. Marco (acopazzo) 13 81.33 91.74 8 61.54
14231. Karan (iamkaran2) 181 81.32 104.00 40 22.10
14232. tstats[depsy] (depsy) 161 81.31 102.27 41 25.47
14233. milluki (milluki) 1 81.31 81.31 0 0.00
14234. Drew (withersoldier) 2 81.31 87.31 0 0.00
14235. Mike (pit820) 14 81.30 101.90 7 50.00
14236. Bruh (yeetzy) 1 81.30 81.30 1 100.00
14237. William (wmilberry) 9 81.30 90.18 0 0.00
14238. totnamjoon (off_the_page) 9 81.30 90.70 2 22.22
14239. Halis (fezira) 5 81.29 91.29 0 0.00
14240. Aizakku (isaace) 3 81.29 88.37 1 33.33
14241. George (george9412) 1 81.29 81.29 0 0.00
14242. Jordan (jordansmithnz) 9 81.29 99.18 2 22.22
14243. Jessie (jpoopknitting) 5 81.28 88.94 3 60.00
14244. Cheney (cheneyc9999) 41 81.28 104.20 16 39.02
14245. Tyler (omni_aspect) 91 81.28 124.76 28 30.77
14246. Matt (demigod2005yr) 1 81.27 81.27 0 0.00
14247. Ultimate (ultimate_pootato) 4 81.27 84.50 1 25.00
14248. eenterr (eenterr) 11 81.27 88.20 2 18.18
14249. Mojo (mojo1289) 26 81.26 100.11 12 46.15
14250. Isaac (haidilaohotpot) 32 81.26 91.41 7 21.88
14251. Myles (pixelen) 13 81.26 99.86 3 23.08
14252. andrew (andrew91vu) 1 81.26 81.26 1 100.00
14253. uwu (mr_mint) 407 81.26 113.39 124 30.47
14254. Louise (kyarakutaa) 7 81.26 93.40 3 42.86
14255. Bob (wmwmwmwm) 125 81.26 115.25 31 24.80
14256. ddo (detdetjo) 50 81.26 94.55 15 30.00
14257. bigdaddy (kaden_) 6 81.26 92.83 1 16.67
14258. Daniel (sergiogahyrof) 7 81.26 91.69 4 57.14
14259. jasmin (wawfles) 11 81.25 93.03 3 27.27
14260. sixten (calvin2) 41 81.25 98.70 11 26.83
14261. Glenn (spanishomelette) 3 81.25 94.95 1 33.33
14262. Suspicious Food Tin (timotc) 6 81.25 90.83 1 16.67
14263. Pernesz (pery) 9 81.24 95.08 5 55.56
14264. Nemanja (coldsiemens) 1 81.24 81.24 0 0.00
14265. Vimim (tovtype) 98 81.24 96.95 20 20.41
14266. Crayon (crayonsc) 35 81.24 98.78 9 25.71
14267. art (artushhheee) 3 81.23 83.92 0 0.00
14268. Andy (avocadocream) 29 81.23 101.99 6 20.69
14269. dotMPEG (tsirotinsky) 5 81.23 86.94 3 60.00
14270. Sundara Subramanian (sundar... 157 81.23 97.99 37 23.57
14271. Brohath (zevo100) 46 81.22 101.34 8 17.39
14272. Ike11000 (ike11000) 1 81.22 81.22 0 0.00
14273. Slow_and_steady_ (iamskk) 3 81.22 82.48 1 33.33
14274. Vickus (natowns24) 12 81.22 96.81 3 25.00
14275. Plutonium (nooter_booter) 5 81.21 91.23 0 0.00
14276. VillePille (surpoz) 5 81.21 89.20 1 20.00
14277. Wicho (w1ch0) 5 81.21 90.23 0 0.00
14278. aarush_ (aarush_) 20 81.21 92.81 6 30.00
14279. jfkdlsaeng (jfkdlsaeng) 16 81.21 103.47 3 18.75
14280. Jordan (mrkentman) 59 81.21 100.73 20 33.90
14281. Colin (cwandell31) 65 81.21 113.46 18 27.69
14282. jjpjimmy (jjpjimmy) 14 81.21 98.59 6 42.86
14283. Per (dubgeiser) 8 81.20 84.91 1 12.50
14284. Ofek (too_slow_to_go) 8 81.20 88.83 2 25.00
14285. Jack (jack__toast) 41 81.20 96.08 9 21.95
14286. Adrian (r3ko5) 23 81.20 98.50 4 17.39
14287. Adnrew (arapoib) 3 81.20 102.02 0 0.00
14288. Gergő (gergo225) 96 81.20 100.46 29 30.21
14289. April (apesbang) 161 81.20 101.04 48 29.81
14290. odezzki (odezzki) 36 81.20 96.98 11 30.56
14291. steven (bigdong696969) 2 81.20 82.48 0 0.00
14292. duong (anhhungcolao) 554 81.19 101.07 145 26.17
14293. khalil (credendo) 157 81.19 100.11 48 30.57
14294. Brzina (torpedo99) 2 81.19 86.66 0 0.00
14295. j (hanjam) 12 81.19 88.20 4 33.33
14296. SONIC (sonic_hyper) 5 81.19 96.11 2 40.00
14297. krabbygail (goldenxy) 24 81.19 97.59 12 50.00
14298. raymond (raymondgggg) 41 81.18 100.20 4 9.76
14299. laurens (laurensjvdb) 2 81.18 83.27 2 100.00
14300. Andrei (aandreixon) 23 81.18 95.37 6 26.09
14301. nil.rajmane@gmail.com (nila... 65 81.18 106.73 23 35.38
14302. JJ (sunnyxiao29) 5 81.18 85.60 2 40.00
14303. Travis (fcdrummer01) 3 81.18 87.93 0 0.00
14304. trick20 (trick2001) 1,490 81.17 116.17 386 25.91
14305. Sam (xxdiggyxx) 1 81.17 81.17 0 0.00
14306. Ayaz (holografick) 6 81.17 83.65 2 33.33
14307. reebad (r33bad) 2 81.17 88.99 2 100.00
14308. Arif (aripin_cmk) 4 81.17 85.41 1 25.00
14309. Swagboy (beckseamons) 22 81.17 99.60 6 27.27
14310. Michael (thedoctor506) 8 81.16 88.77 1 12.50
14311. Carson (terminator2424) 17 81.16 105.42 5 29.41
14312. Nathan (faustytr) 3 81.16 92.52 2 66.67
14313. Alex (xanderamb) 19 81.16 97.48 9 47.37
14314. Tsuguto (tkogamer) 40 81.16 100.12 8 20.00
14315. this quote is sh*t (slowass... 110 81.15 106.27 24 21.82
14316. Kris (draggun) 4 81.15 92.38 1 25.00
14317. iwayway (iwayway) 6 81.15 90.61 0 0.00
14318. hackthemoon (hackthemoon) 256 81.15 104.71 63 24.61
14319. Lincoln (soupyy34) 131 81.15 110.05 35 26.72
14320. Joshua (blink180dude) 8 81.14 95.14 1 12.50
14321. dawid (nuclearmansnothot) 165 81.14 110.78 47 28.48
14322. Domking (domking) 5 81.14 92.79 2 40.00
14323. Zuhes (zuhes7) 12 81.14 89.96 5 41.67
14324. Askur (askur00) 16 81.14 89.99 7 43.75
14325. Kanazaki (kanazaki) 19 81.14 95.68 7 36.84
14326. Jonas (aplit) 3 81.14 85.47 1 33.33
14327. N4aten (bobthebot) 5 81.13 98.78 2 40.00
14328. Jed (jedmedina) 47 81.13 112.14 11 23.40
14329. abdul (khoir359) 6 81.13 84.97 0 0.00
14330. roshan (bhattaroshan) 40 81.13 89.51 11 27.50
14331. (๑•﹏•)⋆* ⁑⋆* ... 408 81.12 107.74 110 26.96
14332. ケニー (schnitzelbr0t) 484 81.12 103.48 122 25.21
14333. Matt (mattdowning91) 1 81.12 81.12 0 0.00
14334. Hucare (hucare_) 3 81.12 89.44 1 33.33
14335. dom (domo56) 2 81.12 83.36 0 0.00
14336. fusaishi (litaoge) 12 81.11 93.13 7 58.33
14337. Ethan (pottatis) 1 81.11 81.11 1 100.00
14338. Diego (mrcatisgod) 1 81.11 81.11 0 0.00
14339. celine (cald) 4 81.11 91.78 1 25.00
14340. Quan (li_quan) 2 81.11 86.13 0 0.00
14341. Prosper (prosperous) 4 81.10 89.12 1 25.00
14342. Avernu (avernu) 21 81.10 101.36 7 33.33
14343. Dat (ltdat1618) 7 81.10 90.69 6 85.71
14344. SIlvester (silvesterfake) 16 81.10 92.59 2 12.50
14345. (tieninator07) 3 81.10 85.96 0 0.00
14346. P (kwerta) 600 81.10 105.65 164 27.33
14347. Copernicus (copernicsus) 62 81.09 112.51 22 35.48
14348. butane (butanebutton) 33 81.09 96.80 23 69.70
14349. Dammsugaren (dammsugaren) 32 81.09 95.00 11 34.38
14350. Sultan (sosa_102) 1 81.09 81.09 0 0.00
14351. Smelly (burdturglar) 452 81.09 98.74 127 28.10
14352. Alex (tabkc7) 379 81.09 102.66 87 22.96
14353. Jude (jfendo) 216 81.09 109.76 63 29.17
14354. Loukas (koloz123) 4 81.08 86.83 2 50.00
14355. Eirik (chickenboomer) 4 81.08 89.44 2 50.00
14356. Denton (jetray122) 2 81.08 82.82 1 50.00
14357. David (inspectahmellow) 7 81.08 96.02 3 42.86
14358. Murilo (hitmonrillo) 2 81.08 85.32 0 0.00
14359. Lemonade on Meth (riqlemonade) 588 81.07 116.90 170 28.91
14360. AtomicSkunk (georgel8314) 21 81.07 93.04 6 28.57
14361. Laith (laith_gg) 1 81.07 81.07 1 100.00
14362. Emek (emekc) 7 81.07 97.40 3 42.86
14363. fanatic (rijulbidhan) 19 81.07 91.36 8 42.11
14364. Katie (xkaytea) 25 81.07 97.91 7 28.00
14365. Flank (jtall4747) 12 81.07 99.94 1 8.33
14366. Connor (fumania) 6 81.07 88.92 2 33.33
14367. Jake (jkdriven) 41 81.06 98.75 10 24.39
14368. Jeeb (jeebmaster9000) 6 81.06 96.88 2 33.33
14369. sanny (scd92318) 224 81.05 115.54 66 29.46
14370. something (destroyer27777) 12 81.05 92.11 1 8.33
14371. ︎ ︎ ︎ ︎ ︎ ︎ ︎... 1 81.05 81.05 1 100.00
14372. Joketts (joketts) 25 81.05 95.82 9 36.00
14373. tomas (mrtomaspl) 6 81.05 89.82 2 33.33
14374. Kurochi (kurochi_cyril) 160 81.05 100.01 54 33.75
14375. kr02lc (kreadzz) 40 81.05 109.00 17 42.50
14376. Shlock07 (shlocktheshlock) 2 81.05 89.42 0 0.00
14377. John (josborne) 3 81.04 88.37 0 0.00
14378. auoaeu (aoeuhe) 1,283 81.04 106.58 358 27.90
14379. Ocean (975miles) 9 81.04 87.61 0 0.00
14380. Plague (plaguey) 75 81.03 95.88 10 13.33
14381. Gurra (halogurra) 78 81.03 111.92 19 24.36
14382. DH (deeh_c) 355 81.03 109.85 107 30.14
14383. And (andzer0) 306 81.03 105.64 98 32.03
14384. q (scullyy) 89 81.03 108.18 51 57.30
14385. theaveragedude (the_avg_dude) 32 81.03 98.09 8 25.00
14386. Thomas (thomasgp98) 3 81.03 84.22 0 0.00
14387. Sollyy (itssollyy) 3 81.02 83.26 0 0.00
14388. Charles (chuckly) 26 81.02 95.26 5 19.23
14389. Bean (cornbreadman) 12 81.02 106.92 9 75.00
14390. abhilash (lash_32768) 1 81.02 81.02 0 0.00
14391. Jake (jakeowens) 175 81.02 105.93 48 27.43
14392. v (typer953) 57 81.01 109.00 19 33.33
14393. Fabrizio (fab_) 11 81.01 99.69 4 36.36
14394. Filip (kicklets) 7 81.01 96.69 2 28.57
14395. Sugma (xpholio) 1 81.01 81.01 0 0.00
14396. Mihajlo (ckicka2005) 1 81.01 81.01 1 100.00
14397. Kristian (guraf) 4 81.01 86.52 1 25.00
14398. stalkers (stalkers0418) 1,689 81.01 126.99 516 30.55
14399. Ryan (ryannnnnnnnn) 2 81.01 81.22 1 50.00
14400. augh (goodmint) 31 81.00 101.90 9 29.03
14401. Jakubi (xmask) 3 81.00 81.14 1 33.33
14402. GG (smrndmgy) 13 80.99 100.57 9 69.23
14403. a (xdxdxd1234) 32 80.99 92.84 4 12.50
14404. Gilwen (gilwenmountain) 2 80.99 94.11 2 100.00
14405. foenem (mkmares_qwerty) 15 80.99 96.05 3 20.00
14406. Haribo (haribooo) 25 80.99 94.75 4 16.00
14407. Martin (martinmadis) 7 80.99 92.53 2 28.57
14408. Mister (mystery_qwerty) 28 80.99 91.56 12 42.86
14409. Arun (thenooboflegend) 137 80.99 95.93 36 26.28
14410. Virgil (clinz63) 5 80.99 84.55 1 20.00
14411. cam (cam69) 24 80.98 100.23 13 54.17
14412. pewpewdevildog (pewpewdevil... 30 80.98 92.13 7 23.33
14413. Meow (meowreaper) 1 80.98 80.98 1 100.00
14414. peedmypants420 (peedmypants... 10 80.98 95.32 4 40.00
14415. Skooma (skoomtastic) 6 80.97 96.27 2 33.33
14416. Lawrence (yogaisbc) 1 80.97 80.97 1 100.00
14417. Koii (koii2003) 10 80.97 89.35 5 50.00
14418. Cookrieme (lonarexiz) 14 80.97 93.41 5 35.71
14419. Soxi (soxi_colemak) 15 80.97 101.82 5 33.33
14420. George (mrgiorgoulis) 904 80.97 123.10 248 27.43
14421. Mr Grate (mrgrate) 4 80.96 93.69 2 50.00
14422. Rav (impaledbison) 142 80.96 105.07 37 26.06
14423. Jaxon (fusion13) 188 80.96 104.87 54 28.72
14424. FREE PALESTINE (os1506) 21 80.95 92.68 5 23.81
14425. Karolos (kariolos) 1 80.95 80.95 1 100.00
14426. Steven (melkies) 50 80.94 90.94 16 32.00
14427. M (mttt001) 10 80.94 90.24 4 40.00
14428. elio! (gabspyz) 21 80.94 95.30 5 23.81
14429. Tze Ning (zzzzzningd) 94 80.94 100.84 27 28.72
14430. Agnar (agnar) 142 80.94 100.22 46 32.39
14431. Daniel (mage3214) 2 80.94 81.88 0 0.00
14432. Vlad (hunter4858) 9 80.93 94.16 1 11.11
14433. JFuzion (jfuzion) 1 80.93 80.93 1 100.00
14434. Jeremy (jeremytreadway) 1 80.93 80.93 0 0.00
14435. Sally (barbiequeen5) 2 80.93 82.39 1 50.00
14436. sanayaa (sanayaa) 57 80.93 98.66 18 31.58
14437. Fabian (zyzyx) 10 80.93 88.70 4 40.00
14438. Kaylo (kaylo060) 21 80.92 97.99 6 28.57
14439. maleika (maleika) 1 80.92 80.92 1 100.00
14440. Anupam (plaanupam) 703 80.92 103.09 201 28.59
14441. qwerty (longhongc) 30 80.92 94.76 6 20.00
14442. John (the_miserable_omega) 4 80.92 85.22 1 25.00
14443. Sean (tensai888) 10 80.92 97.21 3 30.00
14444. Jacob (emptypaintbrush) 71 80.91 105.37 27 38.03
14445. Will (urbanmist) 32 80.91 94.96 13 40.63
14446. Ed (eddyoungster) 2 80.91 89.64 1 50.00
14447. Ben Dover (cheeesehoe) 1 80.91 80.91 0 0.00
14448. tstats[nightisbad] (nightis... 1 80.91 80.91 0 0.00
14449. Matt (gimmethekeys) 1 80.91 80.91 0 0.00
14450. Martin (kompik) 5 80.91 86.54 3 60.00
14451. Gabriel (gbvicente) 121 80.91 100.96 26 21.49
14452. Sebastian (shrekbastian) 74 80.90 100.80 33 44.59
14453. Subramanya (subramanya) 1 80.89 80.89 1 100.00
14454. Ja (zentojamorn) 40 80.89 106.66 12 30.00
14455. ♪╠¥ö§€ƒ╣♫ (ye... 47 80.89 99.01 15 31.91
14456. Aibek (aosmonov) 60 80.89 99.42 24 40.00
14457. Santiago (helix_02) 11 80.88 101.02 4 36.36
14458. Daniel (neon95) 4 80.88 86.85 0 0.00
14459. i am slower than you (koplkop) 3 80.88 85.88 0 0.00
14460. daebro (daebro) 12 80.87 95.02 6 50.00
14461. Marissa (marissalim) 7 80.87 93.73 2 28.57
14462. Amendity (amendity) 402 80.87 103.31 104 25.87
14463. mooth (sooruva) 10 80.87 90.19 4 40.00
14464. Son (memorrick) 343 80.86 101.31 96 27.99
14465. Dorel (dorelm) 40 80.86 107.01 12 30.00
14466. 💓 (samhurwitz) 60 80.86 107.05 55 91.67
14467. Nneeku (nneeku) 8 80.86 95.55 2 25.00
14468. Juan (j206) 4 80.86 102.48 2 50.00
14469. SighingSlider (sighingslider) 7 80.86 90.84 3 42.86
14470. Jacob (sl_jacob) 20 80.86 92.15 2 10.00
14471. salah (salahf5) 2 80.86 81.07 0 0.00
14472. Rennard (rennard) 13 80.85 93.38 5 38.46
14473. Nicholas (nxcholas) 23 80.85 89.97 6 26.09
14474. गुरु (jokerster) 145 80.85 103.90 37 25.52
14475. silver_soul (jooeeee) 74 80.85 105.61 18 24.32
14476. Danil (a_str0) 4 80.85 83.74 0 0.00
14477. Chilly (chillycloth) 1 80.84 80.84 0 0.00
14478. Darian (darian_adiwarna) 35 80.84 104.45 11 31.43
14479. Aidan (jfsport) 2 80.84 84.00 0 0.00
14480. Aksel (magicrex) 1 80.83 80.83 0 0.00
14481. DOO (datblakgai) 166 80.83 108.80 48 28.92
14482. Horphex (horphex) 6 80.83 89.68 1 16.67
14483. Sphynx (sphynxy) 125 80.83 103.32 32 25.60
14484. Alessandro (rocchia) 9 80.82 94.54 2 22.22
14485. ryan (ryanleung1029) 1 80.82 80.82 0 0.00
14486. Nico (nicob_1212) 1 80.82 80.82 0 0.00
14487. mangkaw (mangkaw) 53 80.82 98.48 15 28.30
14488. Aditya (typingspree31) 146 80.82 96.02 28 19.18
14489. Free Palestine (chaoticorder) 4 80.82 94.36 2 50.00
14490. Leah (leahlovesjisung) 30 80.82 93.79 13 43.33
14491. tstats[anotherbandkid] (ano... 12 80.81 91.66 3 25.00
14492. soda, pop, tonic ( which on... 66 80.81 99.27 16 24.24
14493. DJPIXEL (dj_pixel_) 6 80.81 94.11 1 16.67
14494. Thomas (thomasconnector) 1 80.81 80.81 1 100.00
14495. jumpingjilligan (maxy97322) 8 80.81 101.56 4 50.00
14496. Sabari (sabari314) 105 80.81 104.15 35 33.33
14497. Connor (jincwe) 3 80.81 94.84 0 0.00
14498. Liam (lime_da_bestest) 118 80.81 100.72 29 24.58
14499. Ben (bk100) 579 80.80 116.21 173 29.88
14500. Neo (aonixn) 93 80.80 100.94 24 25.81
14501. 7amada (7amada) 29 80.80 91.86 6 20.69
14502. James (jmesyang) 1 80.80 80.80 0 0.00
14503. J (goshadow) 1 80.80 80.80 0 0.00
14504. hotbx (hotbxlockbx) 40 80.80 93.90 15 37.50
14505. Abdelrahman (aabounegm) 5 80.80 89.87 5 100.00
14506. :) (jeof05) 4 80.80 87.12 0 0.00
14507. Jeremy (orcane) 66 80.80 106.75 15 22.73
14508. 🖤 (stabilized) 2 80.80 91.34 0 0.00
14509. Derek (rasehead) 1 80.79 80.79 0 0.00
14510. HHpotatoes (hhpotatoes) 74 80.79 101.88 17 22.97
14511. snowdenwald (snowdenwald) 38 80.78 97.50 9 23.68
14512. IM-Z (therealxenogen) 6 80.78 163.72 1 16.67
14513. run1x (mrscrubbywaffle) 1 80.78 80.78 1 100.00
14514. poop (cheepb) 2 80.78 86.46 1 50.00
14515. John (johnrupesh) 95 80.78 101.45 25 26.32
14516. Nezgar (nezgar) 5 80.78 85.03 2 40.00
14517. Kevin (theguyk) 2 80.77 84.17 0 0.00
14518. Harry (harry_k) 429 80.77 118.63 110 25.64
14519. Hans5958 (hans5958) 13 80.77 99.43 4 30.77
14520. Ryan On (ryanon0127) 5 80.77 87.63 2 40.00
14521. Roar (raor) (mrmcmurple) 7 80.76 97.86 2 28.57
14522. Jason (jasonfong06) 7 80.76 91.70 3 42.86
14523. Bish (haogy101) 7 80.76 93.31 4 57.14
14524. adityasaini (adityasaini) 4 80.76 91.64 1 25.00
14525. Matthew (bigbananakiwi) 2 80.76 86.65 1 50.00
14526. sungit2g (sungit2g) 12 80.75 96.03 3 25.00
14527. Lokesh (lucky_21) 5 80.75 87.58 3 60.00
14528. Park (miriampark7) 4 80.75 85.63 1 25.00
14529. Ben (yungmartyb) 1 80.75 80.75 0 0.00
14530. Tinkle (tinklesticks) 2 80.75 81.54 1 50.00
14531. yixuan (ixuan) 260 80.75 104.97 87 33.46
14532. H J (ojinjin) 68 80.74 99.95 17 25.00
14533. Kameloc (twoddle2) 30 80.74 92.64 8 26.67
14534. Steel (steeltissue) 9 80.74 92.51 2 22.22
14535. King (izhh) 5 80.74 90.01 2 40.00
14536. Letter (letterofpower) 30 80.73 100.93 1 3.33
14537. Xul (gyrofluff) 6 80.73 94.37 4 66.67
14538. Chuse (chuse) 7 80.73 86.41 2 28.57
14539. Leex (shyen1337) 3 80.73 85.41 1 33.33
14540. R4ven (r4ven) 23 80.73 94.83 4 17.39
14541. Derry (siribackwards) 92 80.72 100.69 28 30.43
14542. Flap (flapk) 4 80.72 84.92 1 25.00
14543. Barok (bar_ok) 5 80.72 95.27 0 0.00
14544. Element (elementoop) 3 80.72 91.63 1 33.33
14545. myself (sakib9) 98 80.72 104.36 36 36.73
14546. Kek_LordDvorak (kek_lorddvo... 26 80.72 101.06 6 23.08
14547. werdnalliw (werdnalliw) 9 80.71 97.37 3 33.33
14548. 200wpmgrind (200wpmgrind) 6 80.71 90.55 3 50.00
14549. Logos (abode243) 103 80.71 99.86 26 25.24
14550. David (hugger69) 13 80.71 87.96 3 23.08
14551. Cássio (ssscassio) 23 80.70 91.47 3 13.04
14552. j (jk993) 3 80.69 87.38 0 0.00
14553. Cole (fluke1890) 8 80.68 89.23 1 12.50
14554. Azn (aznrayxz) 4 80.68 90.43 1 25.00
14555. Manvik (mastikhorgamer) 7 80.68 89.74 2 28.57
14556. Luda (ludavis) 246 80.68 103.51 68 27.64
14557. S (nyansyde) 7 80.68 90.91 0 0.00
14558. Mark (max_2027_67) 2 80.68 81.15 1 50.00
14559. Duke (dukemagnum) 12 80.68 94.56 1 8.33
14560. Gyuri (gyuri) 6 80.67 84.43 3 50.00
14561. tstats[timtam420] (timtam420) 352 80.67 107.20 86 24.43
14562. Jochwa (djoshuahebert) 41 80.67 96.33 12 29.27
14563. 420Benny (splergie) 6 80.67 87.44 2 33.33
14564. g (gvrmaine) 1 80.67 80.67 0 0.00
14565. Robbie (symba369) 275 80.67 104.63 84 30.55
14566. Bat-Amgalan (mambatukaa) 127 80.67 97.79 36 28.35
14567. Jonjon (jonjonlilbas) 102 80.67 107.30 24 23.53
14568. Karl (refllexz) 29 80.67 96.08 7 24.14
14569. Robert - NFS (robert2345) 2 80.67 91.15 2 100.00
14570. G (pastachilli) 4 80.67 91.97 0 0.00
14571. yak (hecticyak) 2 80.67 90.34 1 50.00
14572. Nathan (vanderha) 97 80.66 102.72 18 18.56
14573. winter (winterruwu) 2 80.66 80.78 0 0.00
14574. Ryo (troublecuber) 28 80.66 93.66 3 10.71
14575. Sam (samstarfish2013) 2 80.66 83.88 2 100.00
14576. Josh (standedjoshh) 9 80.65 99.62 8 88.89
14577. sweetyukibo (sweetyukibo) 6 80.65 91.47 0 0.00
14578. H (harshitos) 1 80.65 80.65 0 0.00
14579. @fahmi_2504 (fahmiramadhan) 7 80.65 87.89 0 0.00
14580. (lassolass) 40 80.65 97.62 13 32.50
14581. Rex (rrrreeexx) 7 80.64 94.30 2 28.57
14582. Elliot (privateplague) 118 80.64 100.26 29 24.58
14583. narikami (narikami) 3 80.64 92.09 2 66.67
14584. sknny (sknny) 20 80.64 95.30 13 65.00
14585. buhaN (buhan1337) 83 80.64 95.53 28 33.73
14586. Invis (invis_lurker) 120 80.63 119.82 28 23.33
14587. TrChik (trchik) 3 80.63 83.96 3 100.00
14588. Max (maxmeza) 23 80.63 99.01 6 26.09
14589. w (shwilliam) 201 80.63 99.98 49 24.38
14590. Notorious (neodivin) 5 80.63 93.72 2 40.00
14591. willy (monvment) 36 80.63 98.14 14 38.89
14592. Grace (s0porific) 3 80.62 83.17 1 33.33
14593. buzz (buzzdale2) 8 80.62 88.17 2 25.00
14594. Galih (sobig_f) 103 80.62 117.66 35 33.98
14595. Fajar (rizqy96) 4 80.62 94.37 2 50.00
14596. Gabriel (wdarknessw) 378 80.62 103.25 103 27.25
14597. rome (1ensh1) 19 80.62 92.22 4 21.05
14598. kaka (kentuckle) 5 80.61 96.55 2 40.00
14599. Steady (steady32) 9 80.61 90.08 2 22.22
14600. Maik (pronikolaidis) 4 80.61 83.55 3 75.00
14601. Stella (stellaoctangula) 12 80.60 99.24 1 8.33
14602. Nik (iiirxs) 152 80.60 113.83 37 24.34
14603. Sean Paolo (seanpaolo_22) 133 80.60 99.23 42 31.58
14604. flashy (flashy1996) 15 80.60 90.19 6 40.00
14605. datmeko (uralbeking) 7 80.60 86.83 2 28.57
14606. Jaynam (penguj) 2 80.60 83.73 0 0.00
14607. Andrei (andreibanc) 25 80.59 96.47 5 20.00
14608. Samadou (samadou_10) 32 80.59 102.96 12 37.50
14609. Kelvin (algebrah) 1 80.59 80.59 0 0.00
14610. BK (bk21) 7 80.59 88.69 1 14.29
14611. Alex (tec9rushb) 8 80.59 89.70 2 25.00
14612. T (raket124) 173 80.58 95.37 46 26.59
14613. Tobias (bolleeer) 103 80.57 100.99 18 17.48
14614. Sambath (vatana7) 1 80.57 80.57 0 0.00
14615. Sander (sandyon) 2 80.57 87.74 1 50.00
14616. Jimmy Nguyen (jimmytypes) 2 80.57 84.46 0 0.00
14617. Sam (shy_shy_tomato) 6 80.56 100.24 0 0.00
14618. Vodon (vodon) 15 80.56 90.56 2 13.33
14619. Kazef (kazsuz) 2 80.56 91.73 0 0.00
14620. guy (guius) 8 80.56 85.80 4 50.00
14621. Jim (sprinks41) 9 80.55 93.60 2 22.22
14622. Lluna (lluna) 10 80.55 89.98 1 10.00
14623. Alex (snowbdd9f1) 80 80.55 97.30 26 32.50
14624. Atte (aaaveetee) 1 80.55 80.55 0 0.00
14625. Eric (doze11) 6 80.55 92.12 4 66.67
14626. Erna (ernasolberg69) 8 80.55 96.66 0 0.00
14627. lol (yowennnn) 31 80.55 99.53 11 35.48
14628. shxvnk (shxvnk) 10 80.55 87.17 3 30.00
14629. Audrey (catholicguilt) 61 80.55 102.84 17 27.87
14630. Eric (erictie) 10 80.54 107.49 2 20.00
14631. Tanver (tanverrupos) 125 80.54 107.40 34 27.20
14632. Romeo (vatecoucher21) 3 80.54 83.68 0 0.00
14633. garetmi (gammex) 20 80.54 97.55 3 15.00
14634. Brandon (brandon_b) 125 80.53 102.73 28 22.40
14635. Travis (travdong) 800 80.52 107.92 197 24.63
14636. rothdu (rothdu) 40 80.52 97.55 9 22.50
14637. Laurence (laurencee_desu) 8 80.52 89.34 1 12.50
14638. Victoria (vghanma) 1 80.52 80.52 0 0.00
14639. Sam (sam77777) 330 80.52 101.75 75 22.73
14640. Mike (tonz30) 69 80.52 96.27 18 26.09
14641. Manuel (mannymnz) 10 80.52 96.89 4 40.00
14642. Jack (hyydenjakcz) 51 80.51 99.72 12 23.53
14643. Joosep (jet_e) 10 80.51 88.84 2 20.00
14644. XXRobzz (xxr0bzz) 11 80.51 91.83 5 45.45
14645. Naufal (tehonionpotato) 3 80.51 93.60 1 33.33
14646. WeiChen (50wpmbtw) 9 80.51 92.35 4 44.44
14647. Patrick (pheonix74) 4 80.51 84.39 2 50.00
14648. arichnad (arichnad) 16 80.51 103.64 2 12.50
14649. Ásþór (asibasi) 30 80.50 97.65 8 26.67
14650. DarkWinterFurry (darkwinter... 21 80.50 96.63 6 28.57
14651. Charles (charcharryu) 1 80.50 80.50 0 0.00
14652. StellarDoc11 (tarth15) 27 80.50 96.70 17 62.96
14653. Eejay (blazesfolife) 9 80.50 87.33 4 44.44
14654. Jaime (jaimeathedisco) 20 80.50 94.06 5 25.00
14655. Skinny (skinnysausage) 1 80.49 80.49 0 0.00
14656. Simber (simber) 1 80.49 80.49 1 100.00
14657. Joel (clashofkeys) 3 80.49 84.24 1 33.33
14658. Accuracy (dozwolonymein) 46 80.49 98.83 11 23.91
14659. Kurt (kurtv13) 8 80.49 87.66 1 12.50
14660. John (harrumph) 5 80.49 92.61 2 40.00
14661. Jem (jemanema) 115 80.49 101.20 28 24.35
14662. Osaji (osaji) 26 80.48 93.53 7 26.92
14663. Taison (lyraxh) 8 80.48 92.54 2 25.00
14664. JS (cwr_sej) 22 80.47 95.47 3 13.64
14665. Carlos (lagoon_monster) 23 80.47 90.44 6 26.09
14666. akiesh (akiesh) 1 80.47 80.47 0 0.00
14667. sai (smuna13) 31 80.47 96.11 5 16.13
14668. Orca (virtualorca) 31 80.47 92.02 11 35.48
14669. Nyle (nyle_14) 12 80.47 87.87 4 33.33
14670. Chen (chen_) 119 80.47 96.44 30 25.21
14671. Aryan (alemantrix) 10 80.47 97.33 1 10.00
14672. michael (michaelma) 2 80.47 81.20 0 0.00
14673. dinqissa (dinqissa) 1,287 80.46 128.64 324 25.17
14674. brayn (nmchanab) 18 80.46 86.34 8 44.44
14675. CHONG YU JIE (yujie_is_typing) 8 80.46 88.27 1 12.50
14676. Ben (benjaminweschler) 56 80.46 107.50 18 32.14
14677. Person (chaon7) 10 80.45 93.79 8 80.00
14678. J (yunatan) 420 80.45 106.63 141 33.57
14679. stibitzer (stibitzer) 6 80.45 85.79 2 33.33
14680. Shlim (javah1) 11 80.44 93.36 1 9.09
14681. Sal-Kal (sal_kal) 97 80.44 101.38 36 37.11
14682. Josh (remember000this) 8 80.44 87.38 1 12.50
14683. Christian (chrixsi) 16 80.44 95.55 6 37.50
14684. blekekok (blekekok) 10 80.42 118.74 1 10.00
14685. Bibek (bibek_) 32 80.42 94.70 4 12.50
14686. Sami (t1sami) 6 80.41 86.72 1 16.67
14687. Robin (dontcallmenymphadora) 39 80.41 96.52 11 28.21
14688. Mitheelesh (sophomania2803) 14 80.41 91.65 7 50.00
14689. hmm (jerm_killer) 20 80.40 95.34 5 25.00
14690. ig @mk.loco (mkplayz) 33 80.40 96.05 6 18.18
14691. Viwarrior (viwarrior) 27 80.40 95.48 7 25.93
14692. Lara (chuiicdhk) 1,289 80.40 120.64 413 32.04
14693. ry (therylyndshow) 28 80.40 97.18 8 28.57
14694. Sicao (sicao) 3 80.39 86.86 2 66.67
14695. Iyanically (cryptic_cosmic) 34 80.39 96.72 10 29.41
14696. Jacob (jakkbb) 57 80.38 94.07 32 56.14
14697. Khertz (khertz) 4 80.38 96.71 0 0.00
14698. Jyri (xurnub) 1 80.38 80.38 0 0.00
14699. Ranch (ranchie) 203 80.38 107.34 60 29.56
14700. SpeedKing (1t2t3t4t) 5 80.38 88.14 2 40.00
14701. Mehrshad (mehr74) 28 80.37 117.25 4 14.29
14702. Kevin (kevinpamberg) 3 80.37 88.14 2 66.67
14703. asdf (zainamjad) 21 80.37 89.28 5 23.81
14704. Wolfie (aaradhya10) 23 80.37 95.30 15 65.22
14705. Wesley (wesleylong) 68 80.37 101.53 13 19.12
14706. Gaussian (ndrous20) 668 80.36 105.39 154 23.05
14707. Nihilyst (nihilyst21) 1 80.36 80.36 0 0.00
14708. Neo-lap (neolaptop) 9 80.36 100.56 1 11.11
14709. William (thekraken412) 1 80.36 80.36 0 0.00
14710. Scott (humji) 1 80.36 80.36 0 0.00
14711. rykuzo (binhsorrow) 2 80.36 83.92 2 100.00
14712. josh (vapeypoo) 8 80.36 88.94 1 12.50
14713. Corentin (risemu) 52 80.36 96.49 9 17.31
14714. lillian (fartgaret) 52 80.35 127.53 20 38.46
14715. Nyxious (demonicious) 69 80.35 96.37 22 31.88
14716. Amogh (amogh_14) 241 80.35 103.45 75 31.12
14717. Lukáš (lukashanak) 2 80.35 83.21 2 100.00
14718. kward937 (kward937) 15 80.34 95.99 4 26.67
14719. Technetium (technetium_) 14 80.34 91.89 5 35.71
14720. John (johnnymauser) 17 80.34 96.58 3 17.65
14721. hola (foocaaat) 7 80.34 94.51 3 42.86
14722. Jose (jduran7) 50 80.34 103.63 14 28.00
14723. Barry (cloolboy) 4 80.34 88.53 1 25.00
14724. delfador42 (delfador42) 9 80.34 86.20 4 44.44
14725. Whyn (why8n) 150 80.33 101.06 44 29.33
14726. Abizer (abizern) 78 80.33 98.83 24 30.77
14727. egg (egguard) 36 80.33 98.02 7 19.44
14728. bean (bean_man123) 1 80.33 80.33 0 0.00
14729. CHOO (thefuturist) 1 80.33 80.33 0 0.00
14730. Christian (kickstyping4thewin) 8 80.33 89.03 3 37.50
14731. Alec (ayic) 2 80.33 82.32 0 0.00
14732. Kadie (darkskies0107) 10 80.32 86.44 3 30.00
14733. awalvie (awalvie) 15 80.32 94.93 4 26.67
14734. D (consumption) 349 80.32 104.62 92 26.36
14735. Emmanuel (manye) 2 80.32 85.86 2 100.00
14736. type beats (blackjack245) 23 80.31 99.10 9 39.13
14737. GreatLama (greatlama) 11 80.31 93.50 4 36.36
14738. the (theguy27) 141 80.31 95.69 34 24.11
14739. Kevin (kevinptt0323) 5 80.30 85.36 1 20.00
14740. June (ju_1304) 48 80.30 99.19 10 20.83
14741. Tobbe (tobbedman) 720 80.30 107.01 190 26.39
14742. KoD (kodz) 2 80.30 85.93 0 0.00
14743. Aleksa (zdravce988) 4 80.30 95.78 0 0.00
14744. MUKUND (mukundk) 3 80.29 83.64 3 100.00
14745. Dave (davekane) 1 80.29 80.29 0 0.00
14746. babe (doggosnutsack) 6 80.28 92.03 2 33.33
14747. Samuel (justanotherasianont... 14 80.28 96.12 5 35.71
14748. Max (maxzims) 3 80.28 95.85 0 0.00
14749. Jeremy (ryusaki626) 12 80.28 93.91 7 58.33
14750. Thanathas (tamasama077) 2 80.28 86.93 0 0.00
14751. Sven (swen999) 76 80.27 94.06 25 32.89
14752. Giovanni (giovannigando) 32 80.27 89.92 8 25.00
14753. alex (officewarehouse) 3 80.27 86.74 3 100.00
14754. sunny (sunnyx23) 5 80.27 93.55 2 40.00
14755. Frozen_Robot (frozen_robot) 8 80.27 90.84 1 12.50
14756. skywalker123 (skywalker123) 27 80.26 99.38 2 7.41
14757. chinguun (chinguun_0301) 311 80.26 100.16 75 24.12
14758. ben (benwang1) 649 80.26 108.54 175 26.96
14759. seasaara (csawmer_) 1 80.26 80.26 0 0.00
14760. Aman (ashriv88) 29 80.26 104.84 8 27.59
14761. Key (malformant) 318 80.26 106.62 91 28.62
14762. Peter (portiz121803) 377 80.26 114.51 77 20.42
14763. Austin (galactiac) 3 80.26 90.83 0 0.00
14764. Mark (cyclingguy536) 9 80.26 92.96 1 11.11
14765. David (davidsayshello) 9 80.25 92.81 3 33.33
14766. Rachel (rffree) 113 80.25 103.17 31 27.43
14767. clout (clouted) 12 80.25 97.03 3 25.00
14768. maap_yach (crstlgo09) 25 80.25 102.51 7 28.00
14769. Peace in world (marcog7) 176 80.25 105.47 45 25.57
14770. Liew (00hong) 2 80.25 80.58 1 50.00
14771. Luke (lukeov) 18 80.24 99.87 5 27.78
14772. Justine (noob3tc) 5 80.24 88.88 1 20.00
14773. Tong (hiddenbanana) 24 80.24 94.25 5 20.83
14774. Jan (kenaj) 3 80.24 86.60 0 0.00
14775. Macmed (macmed) 3 80.24 87.80 0 0.00
14776. zo (zohway) 3 80.24 89.06 0 0.00
14777. Gum (gumwrapper) 9 80.23 85.30 3 33.33
14778. Yah (reveri) 16 80.23 91.94 5 31.25
14779. Obi-Wan (6x_ebitda) 115 80.23 94.63 32 27.83
14780. Syrus (abbys_sof) 20 80.23 91.80 7 35.00
14781. Matthew (programcrazy) 5 80.22 97.57 2 40.00
14782. dond (dond_feller4) 4 80.22 91.77 3 75.00
14783. Max (getmackt) 9 80.22 88.06 6 66.67
14784. Logan (thewhiteowl69) 80 80.22 105.64 21 26.25
14785. Nick (xinini) 2 80.21 83.88 1 50.00
14786. my z key broke 😐 (membra... 1 80.21 80.21 0 0.00
14787. Nicholas (nkaechele) 12 80.21 89.26 3 25.00
14788. Notis (notkatsa) 2 80.21 87.97 1 50.00
14789. Patrick (pjawesomegaming) 8 80.20 104.78 4 50.00
14790. Madison (nightlight17) 2 80.19 85.06 1 50.00
14791. Vision (vision_of_infinity) 36 80.19 92.45 9 25.00
14792. Keith (flanneldemigod) 168 80.19 97.28 50 29.76
14793. Soirstylo (soirstylo) 407 80.19 101.00 134 32.92
14794. Jonathan (jonathan_200605) 10 80.18 94.41 8 80.00
14795. Slick Willy (dick_snapper) 6 80.18 84.99 2 33.33
14796. Hassan (hamoro) 602 80.18 105.89 135 22.43
14797. Nathaniel (nebuejin) 7 80.18 87.04 1 14.29
14798. grace (girlalmighty) 16 80.18 95.98 1 6.25
14799. tstats[armanto] (armanto) 10 80.17 91.01 4 40.00
14800. Waddles (waddles_) 1 80.17 80.17 0 0.00
14801. james (awesome4aces115) 1,053 80.17 133.39 275 26.12
14802. vaibhav (vaibhav6996) 341 80.17 101.41 196 57.48
14803. don (seichan_04) 5 80.16 89.55 1 20.00
14804. SuKu (suku_586) 3 80.15 88.18 1 33.33
14805. Azif (fangalpha) 420 80.15 113.36 112 26.67
14806. Kiwi (kiwiiii) 5 80.15 89.82 1 20.00
14807. poparaliais (poparaliais) 12 80.15 95.19 4 33.33
14808. nevergiveup (touristlevelis... 16 80.13 97.26 4 25.00
14809. Jeff (keeperofbees) 7 80.13 87.33 4 57.14
14810. Matthew (wormshurm) 63 80.13 114.31 17 26.98
14811. Lukas (gotorono) 17 80.12 91.94 5 29.41
14812. alisha (alishalovesyou) 17 80.12 95.88 2 11.76
14813. Conor (tryingtotchtype) 1 80.12 80.12 1 100.00
14814. Alex (stradivarius64) 4 80.12 102.97 1 25.00
14815. Bread (heftybread) 3 80.12 83.37 1 33.33
14816. you (gotten) 6 80.12 91.16 2 33.33
14817. justin (rold_jisas) 23 80.12 91.40 5 21.74
14818. KeeG9x (keeg9x) 44 80.11 103.44 17 38.64
14819. John (kircher32245) 34 80.11 111.73 14 41.18
14820. Michael (fkafkaneko) 11 80.11 99.04 4 36.36
14821. cod3hulk (tomave) 4 80.11 85.32 1 25.00
14822. Erwin (oldskoollogik) 10 80.11 94.16 4 40.00
14823. Amar (mrfartboss) 9 80.11 96.47 7 77.78
14824. fries (spotifries) 13 80.11 89.57 3 23.08
14825. supermonkey (sup3rm0nk3y) 203 80.10 98.23 44 21.67
14826. John (lifeofacow) 5 80.10 91.35 2 40.00
14827. Leo (leo_typing) 20 80.10 97.05 3 15.00
14828. Joey (jmschrum) 56 80.10 95.99 17 30.36
14829. fastfingas (petryk21) 8 80.09 91.38 0 0.00
14830. Rohit (kharkongor) 222 80.09 102.96 63 28.38
14831. I lost (lxtxmx1) 67 80.09 112.37 10 14.93
14832. Hessel (hessel_s) 11 80.09 87.86 3 27.27
14833. hanuyoo (spicymiso) 2 80.09 91.98 1 50.00
14834. Aleksa (alexample) 48 80.08 93.30 16 33.33
14835. Zak (zajawe) 93 80.08 97.50 27 29.03
14836. Alvin (al12611975) 1 80.08 80.08 0 0.00
14837. Aleks (ixine) 5 80.08 86.55 2 40.00
14838. LikeASir (typelikeasir) 2 80.08 84.50 2 100.00
14839. gog (guanquan) 23 80.07 96.45 12 52.17
14840. Darko (darkec) 1 80.07 80.07 0 0.00
14841. Norman (codificat) 30 80.07 92.63 10 33.33
14842. Ali (cloudy_coyote) 3 80.07 88.68 0 0.00
14843. 111 (grimiv) 142 80.07 95.86 30 21.13
14844. Valk (blankfox) 14 80.06 94.68 4 28.57
14845. katie (okaykatieokay) 43 80.06 94.36 8 18.60
14846. Briana (briana169) 1 80.05 80.05 0 0.00
14847. Lai (lai_) 37 80.05 94.35 11 29.73
14848. Joel (fonke) 12 80.04 100.64 4 33.33
14849. Sebastian (sebz1) 106 80.04 109.14 22 20.75
14850. ---| (karthivi95) 85 80.04 97.90 22 25.88
14851. MrBoombastic (mr_boombaastic) 2 80.04 82.87 0 0.00
14852. Bluem (7jcs) 1 80.04 80.04 1 100.00
14853. Zoomer (somerandomkid76) 100 80.04 100.18 27 27.00
14854. Incinous (pxlla) 4 80.04 87.52 1 25.00
14855. Kobe (kobefireball) 2 80.04 80.43 0 0.00
14856. James Wolfe (primalnacl) 54 80.03 99.85 20 37.04
14857. BigMan (attel) 10 80.03 89.70 4 40.00
14858. Ahmed (__ahmed__) 12 80.03 87.58 6 50.00
14859. UltimaTech (ultimatech_) 1 80.03 80.03 1 100.00
14860. Madison (mnbutler) 1 80.03 80.03 0 0.00
14861. Asta (astadweller) 7 80.03 105.85 4 57.14
14862. chris (walchrisc) 36 80.03 92.80 15 41.67
14863. ToSteR (toastedberd) 5 80.03 85.46 1 20.00
14864. Robert (robbstark) 182 80.03 99.10 49 26.92
14865. Safe (floorrip) 2 80.03 85.88 0 0.00
14866. AA Batteries (aa_batteries) 20 80.02 91.42 3 15.00
14867. Nicolas (ha27) 8 80.02 84.55 4 50.00
14868. HARN0LD (harn0ld) 7 80.01 87.39 1 14.29
14869. Squock (squock) 5 80.01 92.31 1 20.00
14870. Goushique (goushique) 18 80.01 96.97 7 38.89
14871. Books (samngoertzen) 3 80.01 83.16 1 33.33
14872. Mbenga (mbenga) 12 80.01 100.05 2 16.67
14873. Perry (pyam0419) 1 80.01 80.01 1 100.00
14874. Sigurdur (siggimatti) 1 80.01 80.01 0 0.00
14875. Vipul (vipulr) 9 80.01 100.98 4 44.44
14876. Halifay (halifay) 13 80.01 88.26 1 7.69
14877. Felix (feliksen) 7 80.00 88.60 2 28.57
14878. Elias (eliasmarcelin0) 19 80.00 103.45 6 31.58
14879. Jay (jay_rush) 7 80.00 89.08 5 71.43
14880. Lathoa (lathoa) 32 79.99 95.29 17 53.13
14881. Austin (austincolibaba) 1 79.99 79.99 0 0.00
14882. Axel (zedronar) 2 79.99 81.08 2 100.00
14883. Matt (flamingbear) 12 79.98 89.80 7 58.33
14884. gunga (gungafarts) 8 79.98 87.75 1 12.50
14885. an average vietnamese typis... 34 79.98 113.28 9 26.47
14886. greytick (greytick) 1 79.98 79.98 0 0.00
14887. Lukas (lukasprestonchow) 74 79.98 108.37 32 43.24
14888. tstats[medo_1010] (medo_1010) 648 79.98 116.37 171 26.39
14889. Kang (kangplz) 3 79.98 83.55 2 66.67
14890. haidanos (haidanos) 50 79.98 94.44 12 24.00
14891. Rebecca (beccaloveyou) 5 79.97 98.39 5 100.00
14892. Franklin (fpstone) 18 79.97 96.83 3 16.67
14893. Hmmm2100 (hahha2100) 18 79.96 91.86 8 44.44
14894. kum (kinararidwan) 114 79.96 102.02 37 32.46
14895. shakk (shakk612) 14 79.95 97.70 5 35.71
14896. Michael (schuh98) 2 79.95 83.85 2 100.00
14897. Hayden (stoptake) 11 79.95 96.38 5 45.45
14898. j (jyygl) 5 79.94 99.25 1 20.00
14899. Feli (dottedladybug) 170 79.94 98.75 39 22.94
14900. Joseph (gauntdarkness) 50 79.94 112.32 7 14.00
14901. Max (tehbomb123) 681 79.94 109.36 142 20.85
14902. ω (kerdax) 42 79.94 97.66 8 19.05
14903. Calvin Low (benderium_123) 881 79.94 100.19 244 27.70
14904. Abonkwe (abonkwe) 27 79.94 96.83 9 33.33
14905. Sean (polosauris) 87 79.93 102.48 22 25.29
14906. Sendy (sendyakbar) 12 79.93 88.87 3 25.00
14907. Dennis (ridicolos) 125 79.93 96.80 37 29.60
14908. Seif Eldin (terrascoper) 1 79.93 79.93 0 0.00
14909. percival (samuelnirina) 156 79.93 98.48 37 23.72
14910. Kusahgra (kushagra813) 85 79.93 94.23 23 27.06
14911. ShinyPants (shinypants7112) 4 79.93 85.50 4 100.00
14912. Dyslexic_J (jamjar_) 113 79.92 98.77 23 20.35
14913. jim (jimdocks) 5 79.92 102.60 2 40.00
14914. Dark (dark_byte) 1,198 79.92 114.42 340 28.38
14915. Josiah (josiah_cw) 19 79.92 89.81 2 10.53
14916. Atsubyo (atsubyo) 28 79.91 104.59 4 14.29
14917. (narzzz) 62 79.91 102.99 14 22.58
14918. BoiledAir7 (sawt) 8 79.91 90.67 0 0.00
14919. Joash (raz3rdarkkill) 48 79.91 98.60 13 27.08
14920. sendiri (sendiri) 18 79.90 96.20 5 27.78
14921. davorin (dsego) 4 79.90 84.09 2 50.00
14922. Bogart (bogartii) 17 79.90 87.55 5 29.41
14923. dong (dongdong7) 181 79.89 105.06 51 28.18
14924. Broll (billwong28) 46 79.89 93.43 11 23.91
14925. Me (sandwichshop) 20 79.89 88.49 11 55.00
14926. Aaron (kountervibe) 1 79.89 79.89 0 0.00
14927. Underscores4Fun (koskos) 27 79.88 96.72 6 22.22
14928. Prince (wayward_prince) 43 79.88 109.68 13 30.23
14929. buff (buffyc) 2 79.88 83.86 0 0.00
14930. Dara (adoran) 38 79.87 100.97 8 21.05
14931. Bùi (blackfl_12) 223 79.87 98.80 72 32.29
14932. jboog (jboog) 10 79.87 91.88 8 80.00
14933. Jonathan (jontheprinter) 92 79.87 100.22 24 26.09
14934. Ariana (electorch) 6 79.87 86.73 1 16.67
14935. Liam (lwebb167) 33 79.87 89.06 9 27.27
14936. Serv (servgd) 136 79.86 99.30 42 30.88
14937. Rataro (yuugokku) 7 79.86 97.29 1 14.29
14938. 1ntellectualL10n (martinledl) 14 79.86 88.19 6 42.86
14939. Iñaki (inakigv) 1 79.86 79.86 0 0.00
14940. Thanh (d_t_nguyen) 3 79.86 82.63 1 33.33
14941. Andrew (asianpenguin2) 4 79.86 89.53 1 25.00
14942. Amit (amitkarmakar13) 36 79.85 99.43 14 38.89
14943. Jessica (slacker1998) 2 79.85 83.68 1 50.00
14944. clamchowderco] (clamchowderco) 257 79.84 105.41 80 31.13
14945. Leo (leotwelve) 891 79.84 101.29 223 25.03
14946. Adam (guynnoco) 1 79.84 79.84 0 0.00
14947. Uran (enderlordyt) 1 79.84 79.84 0 0.00
14948. Gabby (kirbykirbykirby) 53 79.84 94.44 10 18.87
14949. James (jimmyt50) 13 79.84 95.11 1 7.69
14950. Endi (glados909) 2 79.84 85.89 2 100.00
14951. Use an appropriate name. (a... 201 79.83 104.60 58 28.86
14952. Nicolai (nicolaifeldthaus) 19 79.83 92.38 5 26.32
14953. v (fnut) 28 79.83 97.62 21 75.00
14954. Argon (argon273) 49 79.83 112.84 13 26.53
14955. Imagawa (yosshi) 95 79.83 97.27 20 21.05
14956. tstats[rrooyy] (rrooyy) 4 79.83 87.76 0 0.00
14957. Cod3 (cod3_catz) 5 79.83 88.58 1 20.00
14958. AwesomeAsian69 (awesomeasia... 1 79.83 79.83 0 0.00
14959. Joe (qwertyuiop4) 5 79.83 85.90 1 20.00
14960. Who (hunatank) 9 79.83 97.18 1 11.11
14961. Subhaan (subhaan) 21 79.82 97.22 4 19.05
14962. Coalpi (coalpi) 8 79.82 94.02 3 37.50
14963. Tauske (tauske) 1 79.82 79.82 0 0.00
14964. Wally101 (walrusboy101) 46 79.82 96.57 10 21.74
14965. Jake (hero7785) 13 79.81 88.50 4 30.77
14966. Charles (charles_good) 70 79.81 92.43 21 30.00
14967. 0O00O0O0O0O0O0 (bunnystacker) 1,107 79.81 111.72 304 27.46
14968. Dave (fadedave) 7 79.80 88.63 5 71.43
14969. Matthew (thooorin) 5 79.80 85.19 3 60.00
14970. Churr0s (churr0s) 1 79.80 79.80 1 100.00
14971. LordTouchMe (iamjustarealga... 3 79.80 87.38 1 33.33
14972. Roko (rokoroks) 11 79.80 89.47 3 27.27
14973. sadwipe (sadwipe) 31 79.80 91.18 7 22.58
14974. Dunking3022 (dunking3022) 3 79.79 81.60 2 66.67
14975. Kleptz (cptsprinklez) 28 79.79 95.31 12 42.86
14976. L33T (01l33t) 2 79.79 84.52 1 50.00
14977. uko (darjaw) 66 79.79 97.46 29 43.94
14978. Wei (charles2007) 11 79.79 94.12 10 90.91
14979. UnSeen212 (unseen212) 3 79.79 87.92 2 66.67
14980. Blue (rodtypes) 20 79.79 99.27 8 40.00
14981. Josh (hsoj1) 24 79.79 87.24 5 20.83
14982. Lucien (lulugaming_da_proty... 12 79.78 88.35 7 58.33
14983. Xavonium (xavonium) 4 79.78 87.59 4 100.00
14984. Yunus (usslang) 1 79.78 79.78 1 100.00
14985. Chatic (chatic) 10 79.77 92.56 1 10.00
14986. Jed (dankravioli) 1 79.77 79.77 1 100.00
14987. Aditya (soulofshades) 2 79.77 79.89 0 0.00
14988. Chase (mobinn) 1 79.77 79.77 0 0.00
14989. Tigran (tigranhakobyan) 6 79.77 90.24 3 50.00
14990. Sssaajj (sanjisan) 488 79.77 111.07 138 28.28
14991. Michael (kimbo1414) 66 79.77 105.45 14 21.21
14992. Peter (kamikaze1336) 34 79.76 104.47 13 38.24
14993. Tiantoes (tiantoes) 1 79.76 79.76 0 0.00
14994. Penguin (superpenguin9) 6 79.76 89.94 3 50.00
14995. Erik (hadooo) 20 79.76 91.64 4 20.00
14996. Mazhar Andalib (mazharandalib) 923 79.75 117.58 284 30.77
14997. Harm (harm_) 7 79.75 84.91 6 85.71
14998. Philip (philr12) 21 79.75 91.13 5 23.81
14999. asdf (rushlync) 26 79.75 92.70 6 23.08
15000. James (th3james) 38 79.75 97.93 10 26.32
15001. Qi (williamz) 4 79.74 87.24 0 0.00
15002. Sanjeevwa (sanjeevwa) 72 79.74 96.38 20 27.78
15003. Exhessity (exhessity) 1 79.74 79.74 0 0.00
15004. Chris (chriss_maoo) 7 79.74 98.75 5 71.43
15005. JHDW (jhdw) 3 79.74 82.88 3 100.00
15006. Eliana (elianaswagmama) 23 79.74 104.01 10 43.48
15007. Parth (demolisher_1209) 16 79.74 97.31 7 43.75
15008. Julien (fioul) 5 79.74 86.48 3 60.00
15009. Jake (jakepf00dvorak) 20 79.74 89.12 5 25.00
15010. Zakk (zakkcp) 177 79.74 99.70 35 19.77
15011. Mentafind (mentafind) 10 79.73 93.59 5 50.00
15012. Alex (memento108) 3 79.73 83.19 1 33.33
15013. joe (cbel3111) 21 79.73 98.67 5 23.81
15014. Jason (pradogy) 19 79.73 102.33 2 10.53
15015. ZiyanTheZink (ziyan_the_zink) 8 79.73 87.71 8 100.00
15016. Julianna (yannamoo8) 6 79.73 95.95 2 33.33
15017. Shawn (vglunatic) 16 79.72 98.14 6 37.50
15018. AnesDZ (anes201) 33 79.72 93.98 11 33.33
15019. EenPotjeMetJam (eenpotjemet... 7 79.72 87.81 2 28.57
15020. smug (smugwise_the_brave) 44 79.71 100.87 21 47.73
15021. P (pizzapita) 10 79.71 85.24 2 20.00
15022. Jazz (jazzfunk37) 54 79.71 95.65 18 33.33
15023. jmzg (jmzg) 300 79.71 106.92 80 26.67
15024. Eugene (kpopgay) 86 79.70 104.00 20 23.26
15025. . (wheelzaboo) 20 79.70 90.70 4 20.00
15026. Jv (jv_2002) 7 79.70 86.93 2 28.57
15027. Jerry (stopgetalife) 1 79.70 79.70 1 100.00
15028. Rahul (rahul0379) 3 79.70 86.63 0 0.00
15029. Emerson (diamondud3) 3 79.70 87.03 1 33.33
15030. Alex (titleist_pro_v1x) 32 79.70 98.94 18 56.25
15031. Guest (guest002) 11 79.70 86.69 2 18.18
15032. anavel (anavel03) 7 79.69 94.15 2 28.57
15033. Tiger (lilnhan) 39 79.69 92.83 6 15.38
15034. LaShawn (lashawnious) 6 79.69 98.71 2 33.33
15035. 而自遇見你 惡夢就... 2 79.69 81.25 1 50.00
15036. Shanti Swaroop (shanti_swar... 101 79.69 94.45 26 25.74
15037. Balint (balint2004) 8 79.69 92.34 2 25.00
15038. Aryan (a_r_y_a_n) 2 79.69 82.19 0 0.00
15039. Nurislam (hypuclam) 2 79.69 83.88 1 50.00
15040. jun (jun0sck) 914 79.68 112.41 228 24.95
15041. vii (viixivii0) 5 79.68 83.61 0 0.00
15042. nostango (nostango) 50 79.68 93.83 16 32.00
15043. Asif (orthocresol) 45 79.68 91.61 10 22.22
15044. Charles (armdev) 30 79.68 96.91 14 46.67
15045. aki (akiiiwashere) 11 79.68 98.76 5 45.45
15046. Please use an appropriate n... 476 79.68 127.43 99 20.80
15047. Andrew (axi_andrew) 7 79.68 88.11 1 14.29
15048. Zack (zrobjohn) 3 79.67 88.04 0 0.00
15049. Bob (user4) 3 79.67 82.51 0 0.00
15050. AgniArse (n3ug13rd3) 21 79.67 89.44 5 23.81
15051. Matthew (emen_) 15 79.66 96.68 14 93.33
15052. ZanderL (mcmickeylyc) 85 79.66 95.90 27 31.76
15053. Jared (excline) 6 79.66 84.53 2 33.33
15054. Necdet Ali (necdetaliozdur) 20 79.65 87.68 7 35.00
15055. Steven (eeekom) 78 79.65 108.10 22 28.21
15056. Hungry (hungry_stingray) 5 79.65 88.08 2 40.00
15057. Sajal (sajald77) 12 79.65 92.69 1 8.33
15058. Taylor (tdogyhyh) 2 79.65 84.00 0 0.00
15059. bigfatchickan (suchaslowpoke) 3 79.64 88.27 1 33.33
15060. Cece (e_m_p_t_y) 10 79.64 91.52 1 10.00
15061. Name (defaultname) 50 79.63 111.87 15 30.00
15062. Twistees (twisteesboy) 29 79.63 98.98 15 51.72
15063. william (williamivandy) 11 79.62 91.90 2 18.18
15064. David (tintedrange) 790 79.62 110.32 216 27.34
15065. andy (ajggormly) 435 79.62 105.99 112 25.75
15066. Eric (keywe) 14 79.62 89.57 5 35.71
15067. Kevin (kevin_zhang) 86 79.61 99.68 21 24.42
15068. Chipper (chipperdiglett) 12 79.61 91.71 7 58.33
15069. Chris (pr1m3) 1 79.61 79.61 0 0.00
15070. Henry (hchen1021) 12 79.60 92.97 3 25.00
15071. Midnight (midnightshadows) 103 79.60 116.27 33 32.04
15072. THATGUYtm (thatguytm) 11 79.60 96.61 6 54.55
15073. Birdman (birdman13) 944 79.60 104.40 314 33.26
15074. KH (gpx2ero) 302 79.60 102.83 77 25.50
15075. Oliver (olliewests) 4 79.60 83.58 2 50.00
15076. Akash (akashshrm02) 2 79.60 88.49 0 0.00
15077. bat (origluun) 38 79.59 92.82 8 21.05
15078. adamz (zhaanga09) 49 79.58 100.71 17 34.69
15079. Trevor (super64guy) 1 79.58 79.58 0 0.00
15080. Hasen (hasen) 1 79.58 79.58 0 0.00
15081. momo (yaomomo) 22 79.58 94.87 9 40.91
15082. Andrew (ronioz) 16 79.58 91.93 6 37.50
15083. Toni (tony_playz) 8 79.57 98.36 8 100.00
15084. ^_^ (fuuje) 13 79.57 94.16 5 38.46
15085. Jake (lawyer18) 2 79.57 91.44 0 0.00
15086. Abhinav (knovelgen) 6 79.57 85.36 1 16.67
15087. mikeeeee (typintypist) 2 79.57 84.48 1 50.00
15088. ᕙ(˵ ಠ ਊ ಠ ˵)ᕗ (... 27 79.57 99.41 9 33.33
15089. Reylo4Evr (neqailaz) 1 79.57 79.57 0 0.00
15090. Sherzod (asdfgh5889) 12 79.57 104.19 6 50.00
15091. Andrew (10001k) 9 79.57 91.21 2 22.22
15092. Jumbo (jumbolegend) 1 79.56 79.56 0 0.00
15093. Bigakaboom (bigakaboom) 2 79.56 83.54 2 100.00
15094. Alex (ahed1) 5 79.56 88.32 2 40.00
15095. Matthew (kelsier) 4 79.56 87.36 1 25.00
15096. Jeremy (jrmyh) 4 79.55 100.50 0 0.00
15097. tstats[minilaytr] (minilaytr) 16 79.55 94.68 4 25.00
15098. Pluto (pluto094) 3 79.55 90.00 0 0.00
15099. Shelyn (shelynxj) 7 79.55 84.81 3 42.86
15100. Woody (woody_wins_) 147 79.55 98.33 25 17.01
15101. Husam (husam_) 2 79.55 82.58 1 50.00
15102. David (frilless) 2 79.55 86.94 0 0.00
15103. Prydae (prydae_1) 426 79.54 125.78 109 25.59
15104. Soham (sohammukherjee2011) 7 79.54 93.22 2 28.57
15105. Do (dekul1205) 10 79.54 92.60 1 10.00
15106. chiru (phenggot200darken) 46 79.54 99.71 9 19.57
15107. smmbam (smmbam) 11 79.53 88.35 3 27.27
15108. ejay (spacebars_) 10 79.53 86.11 2 20.00
15109. kauko (kaukokolka) 20 79.52 97.28 17 85.00
15110. Alex (asleslie) 3 79.52 85.62 1 33.33
15111. Zack (goodguyzack) 12 79.52 94.65 9 75.00
15112. John (jstokes001) 1 79.52 79.52 0 0.00
15113. dom (domaniquepham) 15 79.52 96.00 6 40.00
15114. Carl (carlalalala) 21 79.52 94.90 11 52.38
15115. [SMURTEX] (slenex_yt) 3 79.51 82.76 2 66.67
15116. Wen Ree (cataclysm234) 125 79.51 103.72 37 29.60
15117. Mashrur (mashrur45) 5 79.51 87.39 1 20.00
15118. Markos (marky35707) 4 79.51 90.41 1 25.00
15119. ragnarok (ragnarokiscomming) 38 79.51 98.60 9 23.68
15120. Miguel (spiritdesire) 19 79.50 88.61 5 26.32
15121. Shub (shub01) 16 79.50 90.94 2 12.50
15122. Lequim (lequim) 1 79.50 79.50 0 0.00
15123. zenyatta (zenyattamondatta) 8 79.50 95.48 2 25.00
15124. athresh (athresh) 58 79.49 101.22 12 20.69
15125. rain (qwimnetypes) 28 79.48 100.29 10 35.71
15126. Kay (kaylakhots) 26 79.48 95.62 17 65.38
15127. Sam (samhsmith) 7 79.47 86.29 3 42.86
15128. Chiemeka (iamlordaubrey) 2 79.47 83.37 0 0.00
15129. Stas (tracersm) 3,332 79.46 100.16 825 24.76
15130. Screen (screendoor) 7 79.46 87.53 0 0.00
15131. Ahmad (aalay5558) 5 79.46 92.55 3 60.00
15132. rasmus (ragusa12) 3 79.46 87.72 0 0.00
15133. MTGAP | Tokimahery (tokimah... 169 79.45 105.28 60 35.50
15134. Erfan (erfan_hedayati) 1 79.45 79.45 0 0.00
15135. Jacques (acesfracked) 39 79.45 91.61 13 33.33
15136. Ra (rayap1010) 1,246 79.45 106.83 346 27.77
15137. Tin Pham (milkshake69) 2 79.45 81.87 0 0.00
15138. unknown (zoom777) 3 79.44 90.86 2 66.67
15139. Gavin (meizlizard) 3 79.44 81.27 1 33.33
15140. Jake (darkxfade240) 49 79.43 93.73 12 24.49
15141. putt12343 (putt12343) 4 79.43 86.87 1 25.00
15142. AJamal31 (ajamal31) 15 79.43 107.30 5 33.33
15143. Dankerino (dankerinohd) 33 79.43 94.15 11 33.33
15144. Colin (modernbonsai) 120 79.43 96.21 28 23.33
15145. Jose (nino1) 5 79.43 89.14 1 20.00
15146. btonkh (le_shindeplouf) 25 79.43 96.20 25 100.00
15147. James (justjames) 18 79.43 96.08 6 33.33
15148. Stam (stam_01) 97 79.43 106.06 32 32.99
15149. ryleigh (thestonedpotato) 145 79.42 108.00 35 24.14
15150. testo (tillman1981) 8 79.42 91.89 3 37.50
15151. Jackson (jacksonsheldon) 3 79.42 84.84 1 33.33
15152. HanPlox (hanplox) 2 79.42 85.55 1 50.00
15153. j0 (s4ltys34l) 1 79.42 79.42 1 100.00
15154. Nilias (nilias121) 39 79.42 92.58 11 28.21
15155. Abdulla (rifah99) 22 79.42 89.28 2 9.09
15156. tstats[bomb_guard] (bomb_gu... 2 79.42 79.70 0 0.00
15157. Jumri (azarashii) 2 79.42 83.31 0 0.00
15158. Karsen (karguy3) 58 79.41 98.34 19 32.76
15159. Nilacake (nilacake) 18 79.41 96.53 5 27.78
15160. Anurag (mak42) 119 79.41 100.27 34 28.57
15161. Lobster🦞 (itisu127) 166 79.41 105.53 73 43.98
15162. y (y1266) 3 79.40 88.73 0 0.00
15163. Bartłomiej (baryla69baryla69) 35 79.40 90.78 14 40.00
15164. Nick (1chompy_) 32 79.40 90.82 11 34.38
15165. Nabeel (nobleboi10) 178 79.39 104.39 95 53.37
15166. Gabor (bgabor) 12 79.39 90.01 5 41.67
15167. Michael (kame3200) 141 79.39 106.30 31 21.99
15168. Athanasia (athanasialaras) 4 79.39 82.50 1 25.00
15169. Padwes (padz_kurawa) 12 79.39 96.53 5 41.67
15170. John (gelwg1) 6 79.38 92.17 3 50.00
15171. pinto (pintozza) 22 79.38 92.36 8 36.36
15172. Alex (bjartex) 308 79.38 124.45 83 26.95
15173. Valdo (valdo_) 13 79.37 93.09 0 0.00
15174. ivano (lostmusician) 1 79.37 79.37 0 0.00
15175. bobbyshmurdafan6 (83hades) 5 79.36 93.72 0 0.00
15176. Pietro (qiit) 302 79.36 114.14 57 18.87
15177. Photastic (photastic) 1 79.36 79.36 0 0.00
15178. Zoe (zoi77) 14 79.36 98.83 4 28.57
15179. Logan (laucian) 149 79.36 101.18 39 26.17
15180. Jabez (senpaijabz) 2 79.36 79.56 1 50.00
15181. Ivan (ivangoh321) 33 79.35 88.46 7 21.21
15182. Dennis (he66pro) 1 79.35 79.35 1 100.00
15183. Anuar (ryuojin) 3 79.35 85.10 2 66.67
15184. ed (sxxos) 7 79.35 88.26 3 42.86
15185. Kinfi4 (kinfi4) 100 79.35 100.07 21 21.00
15186. Alistair (futuresenator) 131 79.34 109.35 36 27.48
15187. Caleb (calebbueckert) 103 79.33 100.90 24 23.30
15188. Kyle (_dukz) 17 79.33 88.09 8 47.06
15189. Victoria (speedrun_dreamstyle) 20 79.33 95.19 16 80.00
15190. Elias (dillenn) 6 79.33 84.88 2 33.33
15191. oni (onifire) 200 79.33 100.32 47 23.50
15192. Violet (ackerman_l1) 259 79.33 96.04 65 25.10
15193. chepe (albetrash) 144 79.32 101.22 46 31.94
15194. gabbrueh (gabbrueh) 5 79.32 85.91 5 100.00
15195. Mun Hin (dodo_bird) 3 79.32 85.40 0 0.00
15196. Jonas (jjonnaas) 2 79.31 80.44 1 50.00
15197. Soren (sorentypes) 17 79.31 95.54 5 29.41
15198. yong (coaleo) 161 79.31 122.20 37 22.98
15199. Garrett (joejoefriez) 10 79.31 98.91 2 20.00
15200. Average Keyboard User (purp... 4 79.31 87.05 1 25.00
15201. Seyed Mostafa (meshkati) 5 79.30 89.72 1 20.00
15202. Sam (litesam) 9 79.30 89.82 1 11.11
15203. Poonnawich (pnwkrdsup) 5 79.30 88.32 2 40.00
15204. tstats[abhishekyeskholiya] ... 27 79.30 95.45 8 29.63
15205. Lawrence (buffoony) 273 79.30 105.10 91 33.33
15206. Leon (leonchen125) 5 79.29 98.54 3 60.00
15207. Tammy (mausaye) 20 79.29 91.70 5 25.00
15208. pp (marais) 3 79.29 81.92 2 66.67
15209. Jordan (coffeeaddict99) 14 79.28 87.97 5 35.71
15210. Lukas (dundis3000) 16 79.28 90.02 3 18.75
15211. Nokzendi (nokzendi) 58 79.28 99.03 13 22.41
15212. thepenguinmonkey (thepengui... 36 79.28 90.02 7 19.44
15213. Tom (rubik1908) 67 79.27 103.94 18 26.87
15214. skr_j (saikiranj) 2,650 79.27 116.22 778 29.36
15215. Benjamin (ben_jam_in_franklin) 24 79.27 95.57 3 12.50
15216. Roberto (neowolf) 9 79.26 89.16 4 44.44
15217. snails (slow_learner_2000) 1 79.26 79.26 0 0.00
15218. lettuce (lettuceandahalf) 20 79.25 104.07 5 25.00
15219. Andry (andry60351) 5 79.25 83.96 0 0.00
15220. INCOMPETENT (incompetent_co... 151 79.25 108.16 50 33.11
15221. Varenuk (varenuk) 3 79.24 88.13 0 0.00
15222. Jordan (jordanlreynolds99) 66 79.24 99.33 23 34.85
15223. Fabulous (sim5501) 4 79.23 83.54 3 75.00
15224. Ritam (ritam_123) 12 79.23 87.23 6 50.00
15225. Faizan (faizan1) 1 79.23 79.23 1 100.00
15226. David (davidrecinos41) 2 79.23 79.72 0 0.00
15227. Fammis (fammis) 5 79.22 106.83 2 40.00
15228. Karina (syj4434) 59 79.22 100.26 25 42.37
15229. Patrik (pbody) 202 79.22 100.66 52 25.74
15230. scpals (scpals) 32 79.22 102.64 10 31.25
15231. Luis (lalm07) 6 79.22 87.55 0 0.00
15232. Jason (921jason921) 10 79.21 104.20 3 30.00
15233. Aurel (aurelganteng) 14 79.21 94.24 6 42.86
15234. Quick Fox (key_of_boards) 13 79.21 90.87 1 7.69
15235. Smokey (smokeytheoni) 99 79.21 97.50 24 24.24
15236. Chris (dtarzan) 3 79.21 81.80 1 33.33
15237. PKDDDroid (pkdddroid) 9 79.21 88.71 3 33.33
15238. James (james0306) 19 79.21 95.95 2 10.53
15239. Donton (donton) 6 79.21 85.96 2 33.33
15240. z (bazackk4) 20 79.21 97.12 9 45.00
15241. SPQR (tringuyen29) 418 79.21 108.89 99 23.68
15242. boom (boompotato123) 13 79.20 93.78 3 23.08
15243. Arthur (arthur_morgan1899) 5 79.20 88.47 1 20.00
15244. Michael (michaelyang) 22 79.20 92.91 5 22.73
15245. edisondotme (annuit02) 1 79.20 79.20 0 0.00
15246. green (xgreenbanana) 2 79.20 80.63 0 0.00
15247. BradyONE (bradyone) 11 79.20 92.22 2 18.18
15248. rafi (sandbomber) 139 79.20 105.03 31 22.30
15249. HawkEye (hawk_eye) 53 79.20 104.88 12 22.64
15250. Capivara (capivaradafarialima) 95 79.19 98.76 27 28.42
15251. timefaker (timeassassin) 622 79.19 109.16 151 24.28
15252. Andrew (chanmandrew) 1 79.19 79.19 0 0.00
15253. Joseph (mrpuffels) 2 79.19 88.15 1 50.00
15254. Tyler (rhodetyl000) 9 79.18 82.95 5 55.56
15255. Thelegend27 (_thelegend_27_) 4 79.18 87.92 2 50.00
15256. nyet (slickman) 441 79.18 102.59 109 24.72
15257. GG (goldy_boi) 3 79.18 90.60 0 0.00
15258. Jasckon (camochameleon56) 41 79.18 95.06 11 26.83
15259. César (c3sar36) 100 79.18 113.30 28 28.00
15260. meme (crimsonvava) 5 79.17 93.91 1 20.00
15261. Uwu (uwudesuka) 27 79.16 91.70 12 44.44
15262. TOH (tohjh) 52 79.16 88.53 22 42.31
15263. kilkuwu (kilkuwu) 35 79.16 93.29 9 25.71
15264. koya (koya8) 3 79.16 84.95 0 0.00
15265. Tulaib (toolayb) 17 79.16 94.43 9 52.94
15266. Aishiteru (daedalus__) 21 79.16 96.03 11 52.38
15267. Christian (theponce88) 3 79.15 81.97 0 0.00
15268. houka (houka) 12 79.15 97.01 6 50.00
15269. Aleks (zooby_san) 4 79.15 84.97 0 0.00
15270. Coitado (coitado_man) 1 79.15 79.15 0 0.00
15271. Pavan (pavantyperacer) 401 79.15 104.92 110 27.43
15272. yang (yangtyper) 19 79.14 87.49 5 26.32
15273. Aakash (aakash3697) 12 79.14 92.07 4 33.33
15274. Adam (adam1101) 11 79.14 95.26 5 45.45
15275. ihba (ihba) 106 79.14 106.61 35 33.02
15276. Fusionbolt (fusionbolt) 53 79.14 102.79 21 39.62
15277. Max (maxcampman) 109 79.13 101.57 29 26.61
15278. zilzil (zilzilp) 2 79.13 89.01 2 100.00
15279. Rupesh (nedlog_rupesh) 14 79.13 94.25 5 35.71
15280. aranav (aranavkacker) 3 79.13 83.44 2 66.67
15281. Florian (flodaking) 4 79.12 85.29 3 75.00
15282. BigJuicySlimy (javewave) 15 79.12 89.09 4 26.67
15283. Mark (inthe) 92 79.12 97.23 18 19.57
15284. kennzo (kennzo_homme) 2 79.12 86.92 1 50.00
15285. rogov (netherking1357) 6 79.11 97.80 1 16.67
15286. Saiyn (saiynssgssyr) 592 79.11 107.93 141 23.82
15287. Fangio (fangio) 336 79.11 98.48 73 21.73
15288. Herman (hermanleong) 3 79.11 89.14 2 66.67
15289. Dungus (duungus) 53 79.11 110.87 14 26.42
15290. Tekin (liggrod) 21 79.11 90.39 9 42.86
15291. Marko (itsmko) 1 79.10 79.10 1 100.00
15292. Daniel (fflake) 3 79.10 90.59 0 0.00
15293. Christian (nadesuke) 2 79.10 86.56 0 0.00
15294. JCGP (jgcp) 13 79.09 88.83 5 38.46
15295. Ed (essencerato) 1 79.09 79.09 1 100.00
15296. Zachary (zjroote) 10 79.09 89.99 1 10.00
15297. Mims (mimzi_who) 154 79.08 104.21 44 28.57
15298. Inigo (brotheringo) 4 79.08 83.88 1 25.00
15299. fintelia (fintelia) 9 79.08 85.71 2 22.22
15300. Joshua (josheevee) 2 79.08 82.24 0 0.00
15301. Matt (masecla22) 3 79.08 81.88 0 0.00
15302. Cheyenne (cheycc) 163 79.08 112.92 40 24.54
15303. Night Fury (naimur_rahman) 11 79.08 84.74 3 27.27
15304. Weebmachine (weebmachine) 409 79.08 99.41 91 22.25
15305. Sam (sam629) 6 79.08 94.38 4 66.67
15306. Joenutz (improvise101) 6 79.08 91.71 2 33.33
15307. Stanciu (electronized) 2 79.08 80.42 1 50.00
15308. lisa (lisa99116) 10 79.07 106.05 1 10.00
15309. Zakaru (gaudo1991) 350 79.07 99.87 80 22.86
15310. Ruben (rubsi) 27 79.07 96.43 11 40.74
15311. GodSped (falsender) 426 79.07 115.22 108 25.35
15312. Teeratat (kiwi2002) 54 79.07 96.85 12 22.22
15313. LilTexan (lil_texan) 8 79.07 85.81 3 37.50
15314. Maximal (maximalelder) 17 79.06 93.36 7 41.18
15315. Karisma (kputera) 2 79.06 86.03 1 50.00
15316. David (ddas445) 1 79.06 79.06 0 0.00
15317. Azael (azael69) 1 79.06 79.06 0 0.00
15318. Reyna (reyeg4) 28 79.06 97.05 13 46.43
15319. yjuk (yjuk) 13 79.05 90.37 6 46.15
15320. Dominic (5doum) 1 79.05 79.05 1 100.00
15321. 962 Pixels (962pixels) 17 79.05 90.33 8 47.06
15322. Benedikt (dikt73) 11 79.04 93.16 6 54.55
15323. Ana (anophoo) 17 79.04 89.13 4 23.53
15324. cookie (cookienbo) 32 79.04 107.54 9 28.13
15325. Jayden (jmanspider09) 4 79.04 86.57 0 0.00
15326. Sean (xslslx) 17 79.03 96.98 3 17.65
15327. Lil (memebigboy69xx) 10 79.03 86.52 5 50.00
15328. pistil (pistilmen) 1 79.03 79.03 0 0.00
15329. Deven (kikaliyo) 24 79.02 94.66 5 20.83
15330. too slow (jordanaavery) 2 79.02 80.25 1 50.00
15331. Maks (maks244) 2 79.02 87.38 1 50.00
15332. ishakan (ishakan) 3 79.01 86.29 0 0.00
15333. Xbeeft (xbeeft) 12 79.01 95.87 9 75.00
15334. dr (drpolish) 4 79.01 82.38 2 50.00
15335. andy (andypaling) 4 79.01 81.67 2 50.00
15336. Zephaniah (pandu11) 8 79.01 92.13 5 62.50
15337. Arsuta (aryasuta13) 160 79.00 100.36 44 27.50
15338. Patrick (jppat) 2 79.00 86.75 0 0.00
15339. jimy (iceposident) 25 79.00 97.71 8 32.00
15340. medo (medocool) 40 79.00 94.62 10 25.00
15341. Ace (ace_dragonheart) 13 79.00 103.32 2 15.38
15342. David Roberts (davidrobertsla) 17 78.99 99.30 15 88.24
15343. Leoinas (leoinas7) 3 78.99 83.20 0 0.00
15344. Nate (mistrpopo) 3 78.99 86.68 0 0.00
15345. Hrant (hrant0) 61 78.98 92.64 16 26.23
15346. Nervous (unselfishnervousha... 201 78.98 103.76 60 29.85
15347. E (etyperacer) 7 78.98 88.92 2 28.57
15348. toomuchads (toomuchads) 197 78.98 103.47 50 25.38
15349. Bread (breadofpower) 2 78.98 79.99 2 100.00
15350. kuan-yu (edisonhello) 39 78.97 90.36 5 12.82
15351. Dharma (cdharmateja) 35 78.97 95.88 20 57.14
15352. Prithvi (psprithvi) 188 78.97 96.93 59 31.38
15353. Cody (kingbear2) 98 78.97 100.59 21 21.43
15354. Pyro (pyromaniac_from_the_sun) 11 78.97 92.43 2 18.18
15355. Jay-Ar (itsjerr) 7 78.97 99.77 2 28.57
15356. berbseedle (thatonebedsheet... 2 78.96 84.74 0 0.00
15357. shaik (shahul_shaik) 7 78.95 88.30 2 28.57
15358. Andrii (dreamay) 1 78.95 78.95 1 100.00
15359. TypingNoob (bekarihh) 43 78.95 95.59 11 25.58
15360. Traviz (traviz) 16 78.95 102.56 10 62.50
15361. Maltesich (fawmen) 2 78.95 85.35 0 0.00
15362. Krish (kkrish100) 30 78.94 101.73 7 23.33
15363. Amura (amaar) 3 78.94 86.10 1 33.33
15364. ᕙ( ͡◉ ͜ ʖ ͡◉)ᕗ ... 198 78.94 106.93 55 27.78
15365. Cathy (strawberrylatte) 81 78.94 101.11 15 18.52
15366. Percy (adladd) 10 78.94 89.23 1 10.00
15367. Valtishqq (valti46) 19 78.93 90.25 5 26.32
15368. Saba (samsungexynos) 38 78.93 104.43 10 26.32
15369. Alex (philister) 4 78.93 80.12 2 50.00
15370. chedted (chedted) 9 78.93 91.73 2 22.22
15371. Snehit (strx_) 11 78.93 93.42 2 18.18
15372. ShricZ (shricz) 5 78.93 86.57 5 100.00
15373. stabby stab (darkholdwizerd) 10 78.93 95.12 3 30.00
15374. ogcoolpepper (ogcoolpepper) 4 78.93 82.04 0 0.00
15375. Wx (oh_hi) 7 78.92 92.84 2 28.57
15376. Manel (mrnuke) 280 78.92 93.22 76 27.14
15377. Igor (zig84) 87 78.92 97.26 25 28.74
15378. _louob_ (_louob_) 2 78.91 81.91 0 0.00
15379. Alaa (diamondtda) 7 78.91 87.99 2 28.57
15380. Cliptic (cliptic_) 3 78.91 86.22 2 66.67
15381. Why (whyare) 42 78.91 132.92 10 23.81
15382. Vlad (vlad7777) 2 78.91 95.02 1 50.00
15383. Theo (the_o_choked) 30 78.91 92.61 7 23.33
15384. Stefan (stephen27) 17 78.90 86.31 3 17.65
15385. Eduardo (4lc1d3) 19 78.90 91.53 2 10.53
15386. Amine (xabri) 2 78.90 87.48 1 50.00
15387. Lee (leeulrich) 3 78.89 83.75 1 33.33
15388. mingi (gatangae) 90 78.89 95.67 26 28.89
15389. abnf (abnf) 33 78.89 90.44 9 27.27
15390. Alexander (leprechaun777) 1 78.89 78.89 1 100.00
15391. Hyper (yo_hyper) 2 78.89 80.81 1 50.00
15392. 13grainbreads (13grainbreads) 5 78.89 82.56 1 20.00
15393. Daniel (omegadan_) 9 78.89 89.95 2 22.22
15394. Ravi (131raviarya) 54 78.88 91.44 11 20.37
15395. OranH77 (oranh77) 19 78.88 94.08 6 31.58
15396. Timothy (iyamdeanser) 13 78.88 90.54 4 30.77
15397. 𝗢𝗠𝗘𝗡(hates wome... 208 78.88 104.17 53 25.48
15398. eric (erictheass3) 6 78.87 85.99 1 16.67
15399. Andrew (andrewlwm) 14 78.87 96.84 5 35.71
15400. marco (marcofia) 10 78.87 89.46 3 30.00
15401. SGpro (sgpro) 4 78.87 88.37 1 25.00
15402. GedSVK (gedsvk) 2 78.87 87.63 2 100.00
15403. urmom (mars3000) 18 78.86 86.55 3 16.67
15404. RMC (rmcproductions) 65 78.86 92.79 16 24.62
15405. Sean (manbeervark) 11 78.85 91.44 3 27.27
15406. tuan (fajerso) 11 78.85 97.62 1 9.09
15407. Upmanyu (abhishek2175) 704 78.85 100.51 191 27.13
15408. Austin (austinkg) 22 78.85 90.68 3 13.64
15409. Alex (alexlava) 12 78.85 90.18 2 16.67
15410. mathemage (mathemage) 16 78.84 86.38 3 18.75
15411. Shalowley (keepitcookie) 35 78.84 99.14 6 17.14
15412. Mark (markstone_141) 57 78.84 92.53 19 33.33
15413. Noah (noah_13) 1 78.84 78.84 0 0.00
15414. Thomas (f0x169) 14 78.84 90.96 3 21.43
15415. Caine (cainegt) 15 78.83 88.48 3 20.00
15416. Ivan (iamiam) 8 78.83 84.94 0 0.00
15417. Removeris (removeris) 10 78.83 92.67 1 10.00
15418. ALEXUNDER (alex_under667) 5 78.82 95.47 3 60.00
15419. Erly (erlynorbel) 7 78.82 86.03 5 71.43
15420. rome (renzo2kpro) 3 78.82 84.35 1 33.33
15421. Yellow (yellowleaf) 15 78.82 106.30 6 40.00
15422. Striker (strikerfury) 3 78.81 85.53 2 66.67
15423. chiirin (chiirin) 3 78.80 83.07 1 33.33
15424. David (dave_h12) 146 78.80 95.38 36 24.66
15425. Kiran (kkdatkiran) 34 78.80 90.49 8 23.53
15426. Patrick (senseiblaze) 9 78.79 94.77 0 0.00
15427. Microwism (microwism) 5 78.79 88.40 2 40.00
15428. Wilson (starkeyqiu) 220 78.79 106.02 56 25.45
15429. reckful brought (micbee) 2 78.79 78.94 0 0.00
15430. Sebastien (_stigson) 5 78.78 88.12 1 20.00
15431. Cameron (cameron__) 9 78.78 91.76 4 44.44
15432. David (davers4) 47 78.77 110.18 13 27.66
15433. Kim (qwerko) 16 78.77 95.21 6 37.50
15434. Yangyang (renasceim) 8 78.77 87.42 2 25.00
15435. Nicholas (nchlslv) 1 78.77 78.77 0 0.00
15436. mike (capzor) 3 78.77 82.69 0 0.00
15437. Chris (segunobunaga) 2 78.77 81.07 0 0.00
15438. Kanna (kannamanna) 58 78.76 96.45 16 27.59
15439. Ben (foereaper4k) 427 78.76 108.34 89 20.84
15440. john (john_end) 4 78.76 82.93 1 25.00
15441. William (speier70) 13 78.76 84.82 3 23.08
15442. Said (villager4) 3 78.76 84.36 0 0.00
15443. darsh0106 (mynamekaa) 6 78.76 84.13 1 16.67
15444. JJ (peppermints) 83 78.76 90.57 16 19.28
15445. PeterParker20 (piter11116) 17 78.75 94.08 6 35.29
15446. stormchaserwhienne (stormch... 19 78.75 102.54 6 31.58
15447. sam (skhavari) 4 78.75 88.61 1 25.00
15448. Dan (typheratrix) 95 78.74 106.76 21 22.11
15449. Marcus (h_mph) 5 78.74 87.35 0 0.00
15450. Kash79 (kashyap79) 53 78.74 87.71 14 26.42
15451. frank (frankpc) 194 78.74 99.97 55 28.35
15452. Ming (mings7) 7 78.74 93.41 3 42.86
15453. Sawill (sawill) 28 78.73 94.61 6 21.43
15454. mgamble (mgamble) 48 78.73 96.41 10 20.83
15455. Robin (robinkim2020) 6 78.73 95.01 1 16.67
15456. Angelo (angelo13c) 174 78.73 93.46 50 28.74
15457. Ruben (nando520024) 6 78.73 88.76 1 16.67
15458. Jason (_bagel_) 102 78.73 97.77 31 30.39
15459. James (kimandoxs) 3 78.72 99.65 0 0.00
15460. ezza (winko_) 57 78.72 93.18 18 31.58
15461. cbdm (cbdm) 7 78.72 95.08 0 0.00
15462. NamhomEG (namhomeg) 3 78.72 84.13 1 33.33
15463. 🌹パレスチナと🥀 ... 108 78.72 110.50 26 24.07
15464. Anthony (azndeadman2001) 2 78.72 80.42 0 0.00
15465. Lucas (ldahmm) 7 78.71 89.34 3 42.86
15466. Joshua (joshuajerremy) 1 78.71 78.71 1 100.00
15467. Carl (nerarith) 4 78.71 80.26 2 50.00
15468. free palestine (hamada_ali) 147 78.71 98.61 33 22.45
15469. Matthew (matty21988) 4 78.71 83.01 0 0.00
15470. ... (yomer) 2 78.71 80.63 2 100.00
15471. Kristijonas (nasyrke) 42 78.70 90.81 16 38.10
15472. MajesticBudder (majesticbud... 41 78.70 91.54 6 14.63
15473. YanSay (yansay) 6 78.70 86.26 1 16.67
15474. C (cmmg1) 10 78.70 89.17 2 20.00
15475. Xebion (xebion) 253 78.70 98.81 72 28.46
15476. LoneRusher (lonerusher) 237 78.70 99.87 61 25.74
15477. procrastinator (fatcatheart... 2 78.70 95.05 1 50.00
15478. HUng (hunggnuh0407) 9 78.69 93.25 2 22.22
15479. Marco (msukhatme) 1 78.69 78.69 0 0.00
15480. Nick (technologicnick) 2 78.69 79.80 0 0.00
15481. Chris (godocho) 2 78.69 80.11 0 0.00
15482. irving (irvingnivri) 27 78.68 91.03 5 18.52
15483. 𝕲𝖍𝖔𝖘𝖙♠️ ... 102 78.68 104.10 21 20.59
15484. isekai (krimsonly) 189 78.67 101.72 54 28.57
15485. Vaibhav (vaibhavvyas) 16 78.67 99.57 5 31.25
15486. TheUnder (theunderdoge) 18 78.67 94.26 4 22.22
15487. WowRobertisWinning (rtruong) 2 78.67 80.91 2 100.00
15488. sszebrat (sszebrat) 8 78.67 92.96 4 50.00
15489. Yusuke (tokyoprogramming) 277 78.67 102.68 79 28.52
15490. Aryav (aryav123) 617 78.67 116.81 184 29.82
15491. AB (vital26) 5 78.66 88.95 0 0.00
15492. bombplay1 (bombplay1) 123 78.65 102.78 35 28.46
15493. punished buster (punishedbu... 15 78.65 89.42 4 26.67
15494. John (john_sharks) 27 78.65 85.76 5 18.52
15495. Suikyo (suikyo) 1,491 78.65 117.51 391 26.22
15496. Flusercluck (explocow) 22 78.65 99.84 6 27.27
15497. Jem (j_enchev) 23 78.65 91.00 5 21.74
15498. Hans (b3n1s) 67 78.65 99.20 13 19.40
15499. Miyamura (grapewiggler) 42 78.65 94.86 14 33.33
15500. Matteo (dy539) 13 78.64 85.29 2 15.38
15501. parth (parthvaghela) 523 78.64 107.65 155 29.64
15502. suhai (xxrapidfirexx) 63 78.64 97.00 16 25.40
15503. Casper (venomizedcasper) 252 78.64 101.53 66 26.19
15504. Mari (hisokaslave) 8 78.64 96.98 0 0.00
15505. tstats[ayyaz7] (ayyaz7) 108 78.63 96.91 26 24.07
15506. Sanket (sanket30016) 1 78.63 78.63 0 0.00
15507. cheryl (cheryl08) 59 78.63 92.94 10 16.95
15508. Josh (mophii) 2 78.63 80.11 1 50.00
15509. Radford (theegg) 3 78.62 82.23 1 33.33
15510. Chua (big_boy_pack) 60 78.62 98.35 51 85.00
15511. Simon (slimsonkysreformed) 16 78.62 92.41 5 31.25
15512. Wiktor (wicker6) 28 78.62 98.43 6 21.43
15513. La (lanumu) 8 78.62 97.21 4 50.00
15514. Jemo (mille_colombes) 35 78.62 96.08 11 31.43
15515. among us (among_us) 3 78.62 83.14 2 66.67
15516. MewX (mewx) 13 78.62 104.09 10 76.92
15517. Mohamed (medsebri) 578 78.62 113.89 155 26.82
15518. Alec (killjoy722) 14 78.62 93.61 4 28.57
15519. punit (thakelatyper) 184 78.62 101.62 35 19.02
15520. Nairi (demerton) 21 78.61 95.43 3 14.29
15521. baron (baronvie) 3 78.61 90.31 1 33.33
15522. A (thedirtysouth) 3 78.61 88.25 0 0.00
15523. Mandy (nchaiphuong) 1 78.61 78.61 1 100.00
15524. Danny (minwoo7690) 2 78.61 80.84 1 50.00
15525. David (bpsccheney) 14 78.61 86.04 5 35.71
15526. buckles (buckles7809) 585 78.61 104.99 158 27.01
15527. Kareememe (skerolt) 13 78.60 95.62 7 53.85
15528. eugene paul (itdrmts) 79 78.60 91.60 26 32.91
15529. seven (seven_mark) 387 78.60 98.33 94 24.29
15530. Darth (rakin000) 152 78.60 94.12 28 18.42
15531. byrtolet (byrtolet) 21 78.60 92.97 8 38.10
15532. OneRandom (one_random_typer) 679 78.59 100.25 166 24.45
15533. Wonder Bread (wonder590) 3 78.59 80.20 0 0.00
15534. Kate (larleek) 16 78.59 92.43 6 37.50
15535. Abe (plantboy808) 3 78.59 97.23 1 33.33
15536. Michael (mikey2312) 5 78.59 101.12 2 40.00
15537. Federico (zigish) 2 78.59 79.43 1 50.00
15538. Steve (feedthejoe) 7 78.58 85.42 1 14.29
15539. Milos (miloskonjarnik) 6 78.58 82.96 2 33.33
15540. Catalin (georgecatalin) 286 78.58 103.56 64 22.38
15541. Marcus (mckhaann) 9 78.58 88.93 2 22.22
15542. Mohammad (11osos11) 14 78.57 93.47 6 42.86
15543. Daan (thedr3aded) 12 78.57 96.17 4 33.33
15544. Oleksandr (andrusenko) 4 78.56 86.81 1 25.00
15545. Toby (_toblerone_) 23 78.56 97.86 5 21.74
15546. Viktor (viksaniksa) 1 78.56 78.56 1 100.00
15547. no (mmineo10) 6 78.56 87.76 2 33.33
15548. Cuong (cuongdao) 125 78.55 99.60 32 25.60
15549. Izzy (izzypistilli) 22 78.55 92.93 10 45.45
15550. Lloyd (rketch) 75 78.55 93.07 18 24.00
15551. Kaleb (leonenthedk) 6 78.55 88.77 2 33.33
15552. CLICKCLACKCLICKCLACK (sophi... 1 78.55 78.55 0 0.00
15553. b (brgr2022) 4 78.55 80.27 1 25.00
15554. scr4tch (connerkainnerkai) 36 78.54 90.96 12 33.33
15555. al2qx (al2qx) 19 78.54 92.57 6 31.58
15556. Isaac (chunkyipa) 1 78.54 78.54 0 0.00
15557. Max (maxiebond) 1 78.54 78.54 1 100.00
15558. I'm stuck (666769) 23 78.54 93.34 5 21.74
15559. Bento (bentobox9) 2 78.54 81.81 1 50.00
15560. Thinh (thinhtr) 861 78.53 103.84 261 30.31
15561. DooDoo (ininjashadows) 17 78.53 106.89 3 17.65
15562. salvation (mo7a_1913) 143 78.52 105.70 34 23.78
15563. Eris (hyururi) 3 78.52 82.15 2 66.67
15564. Vela (somkungza) 51 78.52 99.25 15 29.41
15565. John (johnmanga) 8 78.52 84.30 1 12.50
15566. Guest (train9013c) 580 78.51 103.44 134 23.10
15567. MCowSevt (sevt) 1 78.51 78.51 1 100.00
15568. Alan (fireslayer1090) 24 78.51 91.78 5 20.83
15569. ahnfnsr (ahnfnsr) 86 78.51 96.99 17 19.77
15570. Andrius (andriusius) 8 78.51 87.19 1 12.50
15571. Pina (pinapelzx) 22 78.50 94.66 5 22.73
15572. Abhay (bloodyhero) 3 78.50 84.52 2 66.67
15573. Marshall (bigboycold) 8 78.50 88.30 3 37.50
15574. Khoa (khoadeptrai111) 75 78.49 113.93 21 28.00
15575. Marcel (supermarcel10) 6 78.49 94.28 4 66.67
15576. jad (jadtriestyping) 34 78.49 92.55 3 8.82
15577. Elsawy (elsawy636) 32 78.48 87.78 6 18.75
15578. Karsen (karguy2) 3 78.48 82.54 0 0.00
15579. Loading.... (xbooza) 67 78.48 92.17 14 20.90
15580. Ez (ezpass) 897 78.48 112.82 292 32.55
15581. David (dvdtan20) 28 78.47 89.37 3 10.71
15582. Rod_Regus (rod_regus) 15 78.47 87.83 1 6.67
15583. Kumar (kumar_thapa1) 22 78.47 87.01 7 31.82
15584. Róbert (worder01) 66 78.47 94.60 13 19.70
15585. Mewn (mewn) 38 78.47 95.27 12 31.58
15586. Amir (48u_54l1m) 41 78.46 90.37 10 24.39
15587. Alex (deeseebro) 4 78.46 83.92 2 50.00
15588. Ronaldo (ronaldo_02) 123 78.45 106.21 38 30.89
15589. Ilias (skysrex) 11 78.45 95.94 5 45.45
15590. Nathan (nlaha) 18 78.45 85.88 7 38.89
15591. joey (fryhyi) 1 78.45 78.45 0 0.00
15592. Kate (kate366) 171 78.45 102.02 45 26.32
15593. Reynol (arsen714) 72 78.45 103.03 13 18.06
15594. Sean (seandominic14) 126 78.45 93.72 38 30.16
15595. 10 (10thetypist) 23 78.44 88.28 4 17.39
15596. Anton (antonjr04) 100 78.44 104.05 27 27.00
15597. Soft (soft_hand) 5 78.44 92.11 1 20.00
15598. Artichamp (abhrajit_saha) 34 78.44 93.13 8 23.53
15599. kunal (kunaldongre) 61 78.43 96.99 15 24.59
15600. jeshen (jeshencx) 15 78.43 93.04 4 26.67
15601. Mish (mrandersonneo) 6 78.43 89.43 0 0.00
15602. shitron (nefaeria) 6 78.43 93.13 2 33.33
15603. Burner (burnerburner) 9 78.43 89.24 4 44.44
15604. Turi (haditoori) 758 78.43 109.56 235 31.00
15605. bee (aliceisjesus) 3 78.42 98.09 1 33.33
15606. J-Money (jacobbeaudway) 902 78.42 108.96 239 26.50
15607. Scott (mogyoon) 2 78.42 81.01 0 0.00
15608. Donzelle (donnie12) 8 78.42 85.42 0 0.00
15609. Cassie (cassienae) 2 78.42 79.16 0 0.00
15610. Aslan (aslanchan7) 7 78.42 87.15 1 14.29
15611. Nguyen (dra_go) 3 78.42 91.66 2 66.67
15612. Domo (mewto012) 2 78.42 80.88 1 50.00
15613. Steve (stevehawk) 6 78.41 90.30 6 100.00
15614. Blyon (avocado_punched) 9 78.41 88.34 2 22.22
15615. s (gurub) 15 78.41 109.93 5 33.33
15616. yanzhi (cakeuuuu) 29 78.40 91.18 10 34.48
15617. Hopeless (styrix358) 16 78.40 97.33 2 12.50
15618. Fetoora (tuhnsoo) 1 78.40 78.40 1 100.00
15619. zonked (zonked) 6 78.40 85.15 2 33.33
15620. Jonas (superare) 20 78.39 103.63 3 15.00
15621. Dang Hai (haidanghoang178) 1,165 78.39 104.53 301 25.84
15622. Jesse Klaver (typeracernoob... 11 78.39 93.18 4 36.36
15623. Peter (petejim) 196 78.39 100.60 42 21.43
15624. Chris (bigzaddy) 12 78.39 96.94 0 0.00
15625. Dennis (dheitinga) 11 78.38 91.00 7 63.64
15626. Prateek (prateekp987) 2 78.38 83.09 2 100.00
15627. ༼ つ ◕_◕ ༽つ (the... 28 78.38 95.76 8 28.57
15628. :] (acision) 50 78.38 93.71 15 30.00
15629. Nuno (n4n0x01) 92 78.38 96.25 30 32.61
15630. Jacy (bohdan_danyltsiv) 137 78.37 97.40 31 22.63
15631. Davit (dyeghiaz) 2 78.37 83.54 0 0.00
15632. David (dgiddens928) 42 78.37 101.41 9 21.43
15633. Peter (appapollo) 181 78.36 99.10 45 24.86
15634. Mohammed (md_islam) 48 78.36 90.68 12 25.00
15635. JN (jnnnn) 24 78.36 85.25 7 29.17
15636. Friz64 (friz64) 12 78.36 95.91 0 0.00
15637. Psycho (psychobrainman) 11 78.36 85.98 3 27.27
15638. Gary (prtuc2) 39 78.36 91.13 10 25.64
15639. John Paulo (guehnwyvar) 70 78.35 97.79 25 35.71
15640. kaare (kaare) 27 78.35 105.45 8 29.63
15641. Quagsire (quagsireyaj) 34 78.35 98.72 15 44.12
15642. hadi (airsmite) 12 78.35 91.25 11 91.67
15643. Farhan (maximaximaxi) 2 78.35 80.62 0 0.00
15644. Njord (njord19) 14 78.34 95.75 4 28.57
15645. Neyo (kouheisan) 3 78.34 86.32 2 66.67
15646. MrBusiness (leboii) 1 78.34 78.34 1 100.00
15647. Falitac (falitac) 129 78.34 103.16 46 35.66
15648. Ro (posterd) 4 78.34 82.91 0 0.00
15649. Fowwer (fowwer) 8 78.34 96.78 2 25.00
15650. Wizrud (wizurd_) 35 78.33 91.31 6 17.14
15651. Alejandro (akakmx) 90 78.33 98.39 23 25.56
15652. chalk (chalkboard) 35 78.33 91.20 11 31.43
15653. Advith (advithshetty02) 72 78.33 98.03 19 26.39
15654. Taylor (kryxilis) 3 78.32 89.32 0 0.00
15655. jburd (htimseiluj) 14 78.32 90.79 5 35.71
15656. Saky (saky74) 3 78.32 82.22 2 66.67
15657. made (madestoel123) 5 78.32 84.79 1 20.00
15658. ange (doveyange) 1 78.32 78.32 0 0.00
15659. Sheesh (0hpl3as3) 3 78.32 84.32 1 33.33
15660. Ian (ianharold99) 18 78.32 98.71 2 11.11
15661. Francisco (mondragon2424) 2 78.32 78.47 1 50.00
15662. Gabriel (derpydood) 4 78.31 80.16 2 50.00
15663. Lenny (yourboylenny) 13 78.30 92.04 9 69.23
15664. Alex (alexyoung) 31 78.30 95.77 4 12.90
15665. Tan (ghtann) 27 78.30 90.45 5 18.52
15666. Nairwick (nairwick) 260 78.30 117.19 52 20.00
15667. J (jsroo3) 4 78.30 79.75 1 25.00
15668. Alex (fordalex) 1 78.30 78.30 1 100.00
15669. Chris (themainchris) 22 78.30 90.84 9 40.91
15670. Delvin (delvinsabrin) 28 78.30 88.74 6 21.43
15671. Xyhop (xyhop) 15 78.29 92.72 8 53.33
15672. (benkemal) 7 78.29 83.55 3 42.86
15673. Tushar (tushar23651) 541 78.29 102.15 140 25.88
15674. Kristian Emil (kruller) 4 78.29 83.51 2 50.00
15675. Slobodan (calorifically) 3 78.29 94.37 2 66.67
15676. ok nerd (irumpelstiltskin) 13 78.28 91.59 6 46.15
15677. jonson (lyfissht) 17 78.28 98.03 5 29.41
15678. Bob (frenchburrito) 14 78.28 93.62 4 28.57
15679. Simone (pointy_) 5 78.28 86.52 0 0.00
15680. Zyan25 (zyan2525) 7 78.27 84.26 6 85.71
15681. spocky (spocky_cheeto) 1 78.27 78.27 0 0.00
15682. Senpai (senpaisenpai) 1 78.27 78.27 0 0.00
15683. BlumberKid (blumberkid) 1 78.27 78.27 0 0.00
15684. Cameron (cameron_friday) 4 78.27 87.93 1 25.00
15685. Puri (narthar) 365 78.26 113.10 104 28.49
15686. Tushar (god_fingers) 3 78.26 80.89 1 33.33
15687. tomthegamer150 (tomthegamer) 87 78.26 101.82 23 26.44
15688. mm (smsa5000) 116 78.26 96.20 20 17.24
15689. Paolo (oloapss) 9 78.26 95.17 5 55.56
15690. Mohchih (mohchih) 92 78.25 107.79 24 26.09
15691. M (thefastlightningtyper) 9 78.25 89.43 4 44.44
15692. alam (alamjael) 92 78.25 102.63 18 19.57
15693. poon (jamiepoon2003) 15 78.25 85.76 5 33.33
15694. Alexandro (terribletyper0) 17 78.24 93.75 5 29.41
15695. bino_ (bino_) 25 78.23 88.15 6 24.00
15696. Kamil (finessegod_) 47 78.23 100.02 12 25.53
15697. kon (konkretzz) 4 78.23 90.03 1 25.00
15698. Mausam (the_witcher) 98 78.22 93.13 33 33.67
15699. Keith (yung_hep) 1 78.22 78.22 1 100.00
15700. Ridans (ridans) 33 78.22 98.63 7 21.21
15701. zapelots (zapelots) 559 78.22 105.52 157 28.09
15702. alex (mimzy1995ns) 76 78.22 95.37 20 26.32
15703. Sarah (shetzah) 43 78.22 99.93 8 18.60
15704. Joshua (pachathighceps) 5 78.22 94.11 2 40.00
15705. Nicolas (insont) 19 78.22 90.78 7 36.84
15706. Gracie (graciemyers123) 7 78.22 88.73 4 57.14
15707. Daddy (liondj7) 7 78.21 84.24 1 14.29
15708. Shafiq (shafiq7911) 11 78.21 88.78 1 9.09
15709. UltimaticCatz (ultimaticcatz) 9 78.20 97.07 6 66.67
15710. Jorge (jquiroz728) 8 78.19 89.73 2 25.00
15711. bstridr (bellie__) 17 78.19 93.57 5 29.41
15712. shudawg (1122) 14 78.18 87.79 3 21.43
15713. Garfield (garfield_fluff_jr) 8 78.18 83.92 1 12.50
15714. Manraj (man_123lama) 12 78.18 90.53 3 25.00
15715. chubbybala (chubbybala) 56 78.18 90.73 14 25.00
15716. Lesya (lesyalackey) 5 78.18 85.71 1 20.00
15717. Jasper (t3sted) 14 78.18 99.78 6 42.86
15718. Shourya (shourya_goddesh) 5 78.18 86.80 1 20.00
15719. ㅤ (bazar397) 58 78.18 93.56 14 24.14
15720. Clay (cduck621) 91 78.17 97.06 27 29.67
15721. Darwin (starfosh) 1 78.17 78.17 1 100.00
15722. Leroy (ancientnoodles) 11 78.17 84.74 7 63.64
15723. Daniels (dasis5) 3 78.17 84.12 1 33.33
15724. jdyn (ayskiri) 109 78.16 128.28 29 26.61
15725. Ash (ashzs) 3 78.16 96.26 1 33.33
15726. VibrantVanilla (vibrantvani... 22 78.16 97.13 6 27.27
15727. Sebas (typingtiran) 20 78.16 93.99 6 30.00
15728. Global (global_typer69) 1,930 78.16 113.55 525 27.20
15729. Train (trainm8) 552 78.16 108.31 138 25.00
15730. Alberto (thearod5) 14 78.16 93.92 4 28.57
15731. Brian (pocket_ace) 213 78.15 94.60 56 26.29
15732. Deez (coolio458) 53 78.15 95.69 12 22.64
15733. andrei5 (mute_6) 428 78.15 107.63 110 25.70
15734. Kade (buph_kade) 259 78.15 113.29 53 20.46
15735. Abylaikhan (ho1den) 156 78.14 110.78 30 19.23
15736. Kris (ktale007) 3 78.14 81.29 1 33.33
15737. M (rugg0064) 1 78.14 78.14 0 0.00
15738. Abhishek (abkrth) 56 78.14 93.47 15 26.79
15739. 32587 (32587cj) 9 78.13 85.48 2 22.22
15740. Rakshit_dvorak (rakshit007) 33 78.13 95.08 14 42.42
15741. Noname (pioustube) 1 78.13 78.13 0 0.00
15742. Alex (suyggyu) 1 78.13 78.13 0 0.00
15743. Tio (izero200) 4 78.13 88.05 0 0.00
15744. Scorbutsale (scorbutsale) 8 78.13 85.23 1 12.50
15745. max (chaxmase) 52 78.13 97.32 15 28.85
15746. Wang (69wangjiaming69) 5 78.12 87.70 3 60.00
15747. hyhu (hyhy233) 48 78.12 91.45 11 22.92
15748. Abdelrahman (7gab) 141 78.12 109.15 31 21.99
15749. Adam (flamindemon) 2 78.12 87.28 0 0.00
15750. Dinkin (blindguy_mcsqueezy) 159 78.11 111.16 36 22.64
15751. 𝔸𝕤𝕖𝕖𝕞 (aseemg) 5 78.11 85.93 0 0.00
15752. Destroyer of fruits (destro... 2 78.11 78.30 2 100.00
15753. Mr.Pemguimn (nhatltm) 741 78.10 132.09 250 33.74
15754. Mikel (mikelhector) 43 78.10 96.72 19 44.19
15755. dalia (daliafraga) 86 78.09 92.72 21 24.42
15756. Luffy (niloy2k76) 14 78.09 88.07 5 35.71
15757. Bob (bobtyping) 15 78.09 83.84 2 13.33
15758. Alpuds (alpuds) 47 78.09 102.76 16 34.04
15759. Utmarteas (utmarteas) 1 78.09 78.09 0 0.00
15760. They23 (they23) 3 78.09 84.23 1 33.33
15761. prince (ohnoheisgoodxd) 12 78.09 87.80 12 100.00
15762. aruj (b0b1000) 181 78.09 110.29 64 35.36
15763. Scratchyjo (scratchyjo) 3 78.08 86.53 1 33.33
15764. Late Night Snack (latenight... 1 78.08 78.08 1 100.00
15765. Ben (baboo_) 3 78.08 84.23 0 0.00
15766. lockheed (lock_heed) 9 78.06 87.35 2 22.22
15767. Marx (marxjp) 100 78.06 99.36 25 25.00
15768. Jorge (jfgf11) 35 78.06 99.90 6 17.14
15769. Rhemix (swagzzzzz) 613 78.06 121.71 140 22.84
15770. Marius (mariukas_) 48 78.06 88.41 10 20.83
15771. John (infzer0) 11 78.05 88.10 3 27.27
15772. Lawrence (thunder_drain) 49 78.05 103.66 12 24.49
15773. Benedek (antokben) 9 78.04 89.53 4 44.44
15774. Arsh (piratexx) 32 78.04 90.39 23 71.88
15775. MrSteal (mrstealyospam) 2 78.04 87.55 1 50.00
15776. Sparkils (sparkils) 2 78.04 79.00 0 0.00
15777. Squeak (oweozz) 11 78.03 95.34 2 18.18
15778. Rosencrantz (foolbright) 5 78.03 92.59 1 20.00
15779. Imme (immevdb) 7 78.03 81.23 3 42.86
15780. Roelof (roeloflucka) 79 78.03 93.32 20 25.32
15781. Aren (sarckelle) 5 78.03 83.51 5 100.00
15782. Cole (_noskilljusthax) 2 78.03 85.94 0 0.00
15783. High889 (high889) 3 78.02 82.56 1 33.33
15784. Echo (echo316) 37 78.02 103.61 7 18.92
15785. Em (blugrassgreensky) 2 78.02 83.99 1 50.00
15786. Davin (davinnnnn) 8 78.01 86.51 0 0.00
15787. Downsouthspy (drax_) 19 78.01 92.76 7 36.84
15788. Rocco (roccoduck) 57 78.01 100.66 12 21.05
15789. Paul (warrenpya) 2 78.01 78.91 0 0.00
15790. Andrew Li (combatwombat123) 34 78.00 91.51 12 35.29
15791. Benko (benkay) 10 78.00 96.20 6 60.00
15792. Carter (rightwingextremist) 1 78.00 78.00 1 100.00
15793. Cindy (cwycindy) 150 77.99 106.44 51 34.00
15794. Pablo (p1blis81) 424 77.99 113.98 97 22.88
15795. Voob (voobit) 1 77.99 77.99 0 0.00
15796. Van (nickislit14) 12 77.99 87.63 7 58.33
15797. pp (urppsmolhaha) 58 77.99 93.40 15 25.86
15798. Lukas (kukess) 11 77.98 84.74 7 63.64
15799. droLnomeD (drolnomed) 26 77.98 97.47 5 19.23
15800. Eva (niejingtan) 105 77.98 98.85 32 30.48
15801. andrei (loomit) 7 77.98 98.36 1 14.29
15802. Mohammad (mewsamurai) 4 77.98 83.70 2 50.00
15803. Choosecake (choosecake) 7 77.97 87.56 1 14.29
15804. Mich2700 (mich2700) 1 77.97 77.97 0 0.00
15805. Dill (monkeyman1637) 19 77.97 91.81 8 42.11
15806. Marie (marsiepatootie) 12 77.96 99.61 4 33.33
15807. Jarek (yorrickus) 9 77.96 85.98 5 55.56
15808. Umair (umairkhan) 22 77.96 86.52 7 31.82
15809. Param (pparam5241) 12 77.95 89.41 6 50.00
15810. ALL (0gets) 2 77.95 85.18 1 50.00
15811. Dimitris (glumfish) 1 77.95 77.95 1 100.00
15812. u (stirlo21) 74 77.95 90.01 8 10.81
15813. Tuu (cetarin) 181 77.94 102.11 35 19.34
15814. yes (mymotherleftmewheniwas2) 1 77.94 77.94 0 0.00
15815. Shayaan (shaynedoan) 4 77.94 90.87 2 50.00
15816. Wizard (wizardtypist) 3 77.93 82.36 1 33.33
15817. Em (chuchu) 96 77.93 94.83 27 28.13
15818. Jeremy (jerms716) 18 77.93 92.87 4 22.22
15819. Gabriel (warbros123) 21 77.93 98.53 9 42.86
15820. boocoo (boocoo) 19 77.92 94.32 3 15.79
15821. Me (me_myself) 5 77.92 87.13 1 20.00
15822. imsynthex (imsynthex) 9 77.92 96.36 5 55.56
15823. Lloyd (llgraves) 159 77.92 104.62 33 20.75
15824. Dave (hottodogu) 5 77.92 86.95 1 20.00
15825. gae (subtoentaloop) 29 77.92 99.76 7 24.14
15826. Yuuto (yuutofood) 13 77.91 95.80 4 30.77
15827. zhiyu (losterzu) 26 77.91 96.71 10 38.46
15828. tiramisu (typist786) 17 77.91 86.36 5 29.41
15829. Sugeeth (sugeeth14) 48 77.91 110.96 14 29.17
15830. Tahmeed Ibne (vedistaan) 2 77.91 88.65 1 50.00
15831. Suze (suze_com) 3 77.90 80.35 1 33.33
15832. Vivek (vivekjoshi556) 39 77.90 96.07 11 28.21
15833. Kenzie (kenziesupertoad) 4 77.90 85.39 3 75.00
15834. Jack (jacknachos) 40 77.89 96.09 12 30.00
15835. Moataz (mizosoft) 21 77.89 88.08 7 33.33
15836. Aaron (bigfategg) 26 77.89 91.84 7 26.92
15837. Jose (m_jose) 18 77.88 92.10 4 22.22
15838. Stretch (stretch_flex) 9 77.88 87.90 2 22.22
15839. Nathan (nzhang5075) 19 77.88 89.79 4 21.05
15840. hanno (busterity) 68 77.88 96.33 16 23.53
15841. k̷̓͋̈́̒͗͋̅͌̄̈́͆̉... 2 77.88 79.48 0 0.00
15842. Wilson (hilson_we) 6 77.88 83.21 0 0.00
15843. Leung (noobie_markie) 24 77.87 92.11 4 16.67
15844. Steven (hondasivakgaming) 19 77.87 104.50 6 31.58
15845. TardPancake (beastowner69) 6 77.87 90.01 2 33.33
15846. matan (malsonic) 883 77.87 127.21 240 27.18
15847. tochidoh (tochidoh) 16 77.87 85.93 3 18.75
15848. Eugene (sushiwaumai) 133 77.86 97.92 37 27.82
15849. bubbleTEA (stefsbored) 128 77.86 102.63 34 26.56
15850. simpull (simpl) 1 77.86 77.86 0 0.00
15851. Gustavo (gust4vodev) 1 77.86 77.86 0 0.00
15852. Art (artkhl) 257 77.85 99.68 70 27.24
15853. Tom (t0mas_colemak) 7 77.85 90.98 2 28.57
15854. cuago (cuago) 5 77.85 95.08 2 40.00
15855. Diepday (linhleo372) 451 77.85 105.99 130 28.82
15856. AK (a2526) 14 77.85 90.30 4 28.57
15857. neromantic (neromantic) 14 77.85 89.09 4 28.57
15858. Rikard (atmoscube) 4 77.85 88.45 0 0.00
15859. Oleg (oleg20111511) 15 77.84 91.21 3 20.00
15860. Alexis (lxsmndl) 7 77.84 98.72 4 57.14
15861. Nobody (anhddo) 625 77.83 102.38 159 25.44
15862. Willie (williewho) 7 77.83 89.60 0 0.00
15863. Balka (balka) 13 77.83 91.39 1 7.69
15864. Alex (_alwang_) 7 77.83 89.12 2 28.57
15865. System (jsystem75) 1 77.83 77.83 0 0.00
15866. Anhar (bantharfanta) 4 77.83 86.37 3 75.00
15867. David (asian_masterium) 10 77.82 92.39 0 0.00
15868. Jake (jmp2814) 8 77.82 87.63 1 12.50
15869. Tipper_Typer (tipper_typer) 49 77.81 100.87 13 26.53
15870. LuminousEgg (luminousegg) 53 77.81 99.56 15 28.30
15871. khadie (khadiekun) 8 77.81 90.53 4 50.00
15872. Bob (metsandcavs) 11 77.81 87.78 2 18.18
15873. John (sirfightsalot) 26 77.81 92.38 7 26.92
15874. thelegendary08 (thelegendar... 7 77.81 85.36 4 57.14
15875. Finley (blindfish) 988 77.81 112.40 233 23.58
15876. Harry (taytayalldaytay) 14 77.81 88.24 4 28.57
15877. Loukas (loukatar) 10 77.81 86.97 1 10.00
15878. Lucy (masterlu789) 131 77.80 97.50 24 18.32
15879. pipelined (polarilacari) 100 77.80 97.33 28 28.00
15880. John (mernst) 28 77.80 89.80 5 17.86
15881. Henry (henry11hei) 2 77.80 83.12 1 50.00
15882. Roshan (roshan_satare) 235 77.79 97.82 73 31.06
15883. Adedhuman (adedhuman) 13 77.79 86.45 3 23.08
15884. Outlaw (midnight_tuna) 21 77.79 97.52 3 14.29
15885. Blitzgate (blitzgate) 26 77.79 92.30 6 23.08
15886. Daniel (chiknugg) 2 77.79 78.10 0 0.00
15887. Simon (thesherlocklayout) 6 77.78 84.45 1 16.67
15888. Juan (marksman10) 3 77.78 83.85 2 66.67
15889. Abhimanyue (obsidian_abhi) 46 77.78 109.26 6 13.04
15890. Jack (jfragg) 366 77.78 110.28 73 19.95
15891. kenneth (zanekao) 2 77.78 80.56 1 50.00
15892. Moyosore (mokarios) 149 77.77 94.02 44 29.53
15893. A (pinebug) 6 77.77 84.73 1 16.67
15894. Mr. (jayskeels) 3 77.77 81.75 1 33.33
15895. dwikydd (dwikydd) 40 77.77 91.83 12 30.00
15896. Daniel (danvs60) 138 77.77 99.08 36 26.09
15897. T•rt•ise (gocool21) 4 77.77 87.09 0 0.00
15898. Jorge (nogoodlul) 3 77.77 79.43 1 33.33
15899. Kevin (kgonzales2319) 2 77.77 79.26 1 50.00
15900. thomas (maxipixels) 41 77.76 102.62 13 31.71
15901. PizzaPortal (pizzaportal) 16 77.76 107.24 7 43.75
15902. Niofer (niofer) 42 77.76 98.52 8 19.05
15903. Pacchan (panda892) 1 77.76 77.76 0 0.00
15904. Sriram (lil_india) 1 77.76 77.76 0 0.00
15905. Kawsa (sold_mom_for_rp) 1 77.76 77.76 0 0.00
15906. Ivan (ivasil) 5 77.76 82.43 1 20.00
15907. Hai (michaeldp) 9 77.76 84.77 3 33.33
15908. Awaken (awaken_) 6 77.76 86.74 4 66.67
15909. Nik (nik_farhan) 70 77.75 109.32 21 30.00
15910. Simon (fishmango) 6 77.75 90.70 3 50.00
15911. Hassan (urboyhassan) 94 77.75 96.01 19 20.21
15912. Jethro (jetthrower) 282 77.75 103.96 80 28.37
15913. Jonski (napalleum) 1 77.75 77.75 0 0.00
15914. John (wegelius) 12 77.75 102.18 3 25.00
15915. pz (pingzhi) 27 77.75 87.56 4 14.81
15916. jude (jude17) 5 77.75 81.37 2 40.00
15917. Omni (kenkaster001) 3 77.75 85.19 2 66.67
15918. scsdawg (scsdawg) 23 77.75 102.55 5 21.74
15919. dqwlol (dqwlol) 13 77.75 89.56 4 30.77
15920. Straubrey (straubrey) 6 77.75 92.54 2 33.33
15921. Deepak (gdn_td) 12 77.74 92.49 5 41.67
15922. Jazz (melotea) 227 77.74 108.78 52 22.91
15923. Mikaela (mikaela_e) 380 77.74 105.39 99 26.05
15924. walid (walid1997) 30 77.74 90.60 8 26.67
15925. Diego (thebeastboi__) 78 77.74 99.57 31 39.74
15926. Yani (yani916) 31 77.74 89.96 7 22.58
15927. Curo (curo) 32 77.73 91.73 8 25.00
15928. I can't type anymore (jjwiz... 10 77.73 95.37 5 50.00
15929. Nick (nickh789) 2 77.72 84.68 2 100.00
15930. Dr. Sector (sharkychompers) 569 77.71 99.77 139 24.43
15931. eric (mordor5555) 20 77.70 96.66 7 35.00
15932. Necrophos (komaroffski) 36 77.70 98.40 9 25.00
15933. Herve Tran (royale81) 16 77.70 90.70 8 50.00
15934. DJ (magentaisnice) 5 77.70 83.93 1 20.00
15935. ak1ra (liamprogamerz) 225 77.70 95.76 56 24.89
15936. Anton (antonium) 31 77.70 102.65 12 38.71
15937. raziel (jemjoyous) 100 77.70 106.50 45 45.00
15938. muhammad afiq (afiq101) 10 77.69 84.78 3 30.00
15939. Everly (scribblenerd) 64 77.69 99.34 18 28.13
15940. Samit (samitkapoor) 31 77.69 97.04 8 25.81
15941. SamSkey (samskey) 22 77.68 94.82 7 31.82
15942. sammysamm (sammysamm) 49 77.68 94.92 12 24.49
15943. Yousif (sheibani) 6 77.68 86.02 1 16.67
15944. PG (pgfunny124) 2 77.68 89.32 0 0.00
15945. Matthew (mttw) 2 77.68 83.43 1 50.00
15946. Ivan (seivo) 4 77.67 94.36 1 25.00
15947. rohan (maverick_mind69) 22 77.67 100.86 4 18.18
15948. Soumyadip (pelitza) 24 77.66 90.71 3 12.50
15949. sat (sattypants) 110 77.66 104.01 31 28.18
15950. Phantom (phantomx0990) 3 77.66 84.17 0 0.00
15951. exdarku (exdarku) 2 77.66 86.20 1 50.00
15952. Chicken (chickendinnr) 1 77.66 77.66 1 100.00
15953. Omar (omarbahgat2003) 158 77.66 99.04 36 22.78
15954. Jayson (thezeful) 203 77.65 100.03 80 39.41
15955. Marco (oblq) 26 77.65 92.52 6 23.08
15956. Artemis (artemyx) 7 77.65 86.21 5 71.43
15957. wowza (aidan3540) 2 77.65 78.49 1 50.00
15958. Will (freewillie18) 341 77.64 110.09 90 26.39
15959. Hari (hari191197) 18 77.64 98.67 6 33.33
15960. Saurus (saurus) 10 77.64 86.30 4 40.00
15961. Ohh (trappy24) 22 77.64 97.74 5 22.73
15962. joy (jyyjng) 9 77.63 88.30 3 33.33
15963. Anoos (ushagaming) 16 77.63 97.08 4 25.00
15964. Uni (whenuniqueusername) 6 77.63 87.48 0 0.00
15965. DIlectrix (thebeast_typer) 2 77.63 77.85 2 100.00
15966. Andrè (andrree) 1,020 77.62 109.45 251 24.61
15967. miyu (naevis) 7 77.62 87.40 0 0.00
15968. Aaron (aaronec2) 6 77.62 85.88 0 0.00
15969. Sk (sk07) 2 77.62 78.07 1 50.00
15970. Guest (slowpokest) 33 77.61 104.52 7 21.21
15971. Hans (ts6d) 46 77.61 94.56 13 28.26
15972. Eric (ec052002) 1 77.61 77.61 0 0.00
15973. Taradiddle (taradiddle) 110 77.60 92.71 24 21.82
15974. botlof (botl0f) 40 77.60 93.18 7 17.50
15975. kunal (kunav) 450 77.59 106.05 123 27.33
15976. Home (joeyhockey77) 1 77.59 77.59 0 0.00
15977. Peter (aufbau) 2 77.59 78.87 0 0.00
15978. Nizar (oxlord) 27 77.58 93.17 8 29.63
15979. GreenUmbrella (greenumbrella) 53 77.58 94.99 16 30.19
15980. Anlun (anlun) 62 77.58 100.03 22 35.48
15981. Johnathan (uneasybbj) 3 77.58 78.57 0 0.00
15982. Dani (danisoltesz) 5 77.58 83.25 3 60.00
15983. Malakai (malakaidunaway) 5 77.58 88.69 0 0.00
15984. jai jai bhola (iamsatanic) 638 77.58 122.36 152 23.82
15985. Don't bully me plz (dontbul... 615 77.58 114.62 165 26.83
15986. Zack (zqlimy) 20 77.58 90.06 4 20.00
15987. ToncaIlPunta (toncailpunta) 10 77.57 89.05 4 40.00
15988. Joash (lastassassin1) 16 77.57 91.54 5 31.25
15989. Kevin (kevchen0908) 24 77.57 90.92 4 16.67
15990. stephan (wierdio) 1 77.57 77.57 0 0.00
15991. Proud (adityaqudaedah) 1 77.57 77.57 0 0.00
15992. hellooooo (hk_in_london) 100 77.56 97.51 23 23.00
15993. Alex (alex_ofl) 24 77.56 90.76 5 20.83
15994. FROST (frostxdemons) 72 77.56 95.16 26 36.11
15995. Rzn (rzn_) 5 77.55 91.82 0 0.00
15996. akhil (hailk11) 81 77.55 95.64 21 25.93
15997. J (jrequa) 6 77.55 86.67 3 50.00
15998. wonderbubble (chom_chu_) 1 77.54 77.54 1 100.00
15999. Ting (t_mist) 4 77.54 84.15 0 0.00
16000. stacie (stackieeeee) 16 77.54 91.73 4 25.00
16001. Pszymek (pszym) 54 77.54 109.82 16 29.63
16002. tstats[tomek1337] (tomek1337) 2 77.54 80.40 0 0.00
16003. wond (wond_k_) 53 77.53 91.39 15 28.30
16004. Marc (xmarcxx) 19 77.53 95.11 3 15.79
16005. Ben (bakchansoo) 12 77.53 100.28 5 41.67
16006. thatchipz (thatchipz) 7 77.53 90.88 4 57.14
16007. Mclovin (victor_123321) 2 77.53 85.15 1 50.00
16008. Yuko (naoyuko) 33 77.53 84.74 7 21.21
16009. Vyom (vyomk27) 1 77.52 77.52 0 0.00
16010. Bean (beanx316) 3 77.52 80.48 0 0.00
16011. Kritim (kkr_) 13 77.52 87.83 5 38.46
16012. Micah (micahlandry) 4 77.52 100.57 3 75.00
16013. Lin (ltf0501) 214 77.51 96.15 44 20.56
16014. George (lirick) 1 77.51 77.51 0 0.00
16015. Idris (kakashirero) 727 77.51 114.03 233 32.05
16016. aerisslowers (pietrucha33) 35 77.51 98.83 9 25.71
16017. Muffin™ (muffintm) 14 77.50 100.88 7 50.00
16018. Mr.GrayBoi (mistergrayboi) 11 77.50 89.76 3 27.27
16019. Judar (judar) 4 77.50 81.21 4 100.00
16020. Ahmad (ahmahsen) 1 77.50 77.50 0 0.00
16021. StaliaN (stalian) 10 77.50 88.68 0 0.00
16022. Brzzz (brzzz) 81 77.49 94.81 19 23.46
16023. Eicy (moreseicy) 26 77.49 87.64 7 26.92
16024. Test Project 3 (turkishtyper) 75 77.49 101.79 5 6.67
16025. xd (palmate) 407 77.49 108.63 110 27.03
16026. Sweater (swtr) 25 77.49 98.12 7 28.00
16027. Shebes (shebes) 2 77.49 82.81 2 100.00
16028. Ae (aezharhu) 120 77.48 99.77 28 23.33
16029. James (jamesjamesjamesjames... 18 77.48 89.76 6 33.33
16030. Kratagya (chutiyatyper) 210 77.48 98.83 40 19.05
16031. Рамеш від'я (myguy... 2 77.48 80.41 2 100.00
16032. dvorak64 (steveoc64) 1 77.48 77.48 0 0.00
16033. Jadon (j20lardo06) 365 77.48 98.73 81 22.19
16034. Luke (luthedog) 275 77.47 103.12 66 24.00
16035. Gaurav (gaurav_38) 160 77.47 96.85 42 26.25
16036. Token (token_typer) 10 77.47 91.63 3 30.00
16037. asayla (asayla) 1 77.47 77.47 0 0.00
16038. Samuel (sammiedodgers) 3 77.47 81.72 0 0.00
16039. Enixam (caban) 2 77.47 80.09 0 0.00
16040. Richrad (laci279) 140 77.46 93.26 32 22.86
16041. abhay (cs_abhay) 26 77.46 93.86 6 23.08
16042. Arevilov (arevilov_3) 13 77.46 87.21 3 23.08
16043. Chetan (chetanhaobijam) 80 77.46 101.48 14 17.50
16044. ItsDuckyLol (itsduckylol) 45 77.45 91.02 9 20.00
16045. Daniele (berdelicious) 10 77.45 86.86 1 10.00
16046. Mohd (nihal2193) 2 77.45 77.79 1 50.00
16047. UWU (blizztera) 39 77.44 89.14 15 38.46
16048. Late (nikolaholmes) 8 77.44 88.48 1 12.50
16049. forever_extinct (forever_ex... 33 77.44 103.84 7 21.21
16050. Shiftoss (shiftoss) 1 77.44 77.44 0 0.00
16051. Shadab (acclr8) 9 77.43 86.85 4 44.44
16052. Mattis (juicedrabbit) 31 77.43 94.02 9 29.03
16053. Sargis (sargispro) 11 77.43 90.66 1 9.09
16054. JKerb (jakerb19) 15 77.43 97.77 5 33.33
16055. Xel (xelqqii) 20 77.42 93.35 6 30.00
16056. Slow_AF (flaming_gladius) 9 77.42 85.15 1 11.11
16057. Cole (ckoehler) 9 77.42 93.98 3 33.33
16058. Simas (simgint) 8 77.42 88.72 3 37.50
16059. J (jrazn) 7 77.41 86.84 3 42.86
16060. fdsafdsa (szesz) 1,150 77.40 103.32 283 24.61
16061. Juan (blindspot) 1 77.40 77.40 0 0.00
16062. Adam (abrokke) 62 77.39 98.47 12 19.35
16063. Sm (sm12333) 4 77.39 79.94 0 0.00
16064. Dinesh (dineshkandy) 10 77.39 98.37 1 10.00
16065. Sausage (sausage_person) 12 77.39 89.43 3 25.00
16066. ckaasfds (kopiipase) 1 77.39 77.39 0 0.00
16067. Kevin (kazhu) 1 77.39 77.39 0 0.00
16068. Dwi (yvbinjk) 7 77.39 95.27 3 42.86
16069. Kieran (manawa) 40 77.39 100.48 15 37.50
16070. Ryan (rtblast70) 6 77.39 84.28 1 16.67
16071. anas (ana_1s) 141 77.38 95.36 31 21.99
16072. Hung (qhung312) 21 77.38 86.83 4 19.05
16073. Rajat (rajatbhatnagar) 5 77.38 91.47 2 40.00
16074. Espen Oliver (masterabsinthe) 5 77.38 89.65 4 80.00
16075. Stephen (dondodedondi) 1 77.38 77.38 0 0.00
16076. blinno (blinno) 5 77.38 100.25 5 100.00
16077. Anton (mountainhills) 12 77.38 96.28 2 16.67
16078. John (johnzeds) 49 77.38 95.20 8 16.33
16079. Jared (filmman2k3) 17 77.38 104.35 7 41.18
16080. Waflr (waflr) 5 77.37 81.37 1 20.00
16081. Ashtra (ashtra) 1 77.37 77.37 0 0.00
16082. Matt (mattsanruk) 7 77.37 89.41 2 28.57
16083. Quan (tmquan98) 124 77.36 117.83 25 20.16
16084. Kamil (oreg0s) 3 77.36 83.12 1 33.33
16085. JustJie (570897055) 1 77.36 77.36 0 0.00
16086. Jatin (jatin_sharma_2005) 105 77.36 92.75 21 20.00
16087. Juicy (juicypolez) 5 77.36 99.01 2 40.00
16088. Zing (zingclassy) 2 77.36 78.64 0 0.00
16089. Joseph (jdog_ld) 16 77.35 93.51 5 31.25
16090. Jimmy (jimmy_voe) 189 77.35 102.55 42 22.22
16091. ziomek (dombrol) 8 77.35 88.43 1 12.50
16092. fml (fmldave89) 53 77.35 111.42 13 24.53
16093. Seth (thefoxarmy) 12 77.35 90.64 4 33.33
16094. paranoid (enemy1337) 40 77.34 95.89 9 22.50
16095. Michael (ms_12) 60 77.34 98.72 13 21.67
16096. Little (littlepump1) 137 77.34 95.64 38 27.74
16097. Katrina (katkatkat) 3 77.34 80.27 1 33.33
16098. Gustavo (gustavo_caria) 5 77.34 89.36 1 20.00
16099. Puleva (puleva) 9 77.33 93.73 2 22.22
16100. | (canvaslol) 206 77.33 99.52 57 27.67
16101. Soma (soma_shirei) 1 77.33 77.33 0 0.00
16102. MD Gaziur Rahman Noor (mdga... 13 77.33 96.84 6 46.15
16103. William (wazambelina) 9 77.33 83.45 2 22.22
16104. Dan (rock_god_dan) 2 77.32 80.25 1 50.00
16105. Neeraj (neeraj_kumar_coder) 23 77.32 93.18 4 17.39
16106. Ethan (persom_) 64 77.32 97.04 14 21.88
16107. Samuel Hong (hunterx30s) 2 77.32 78.18 0 0.00
16108. Miguel (migsarm16) 4 77.31 88.04 3 75.00
16109. ulreich (prozeal_) 7 77.31 88.18 1 14.29
16110. David - Robert (batedcrayon) 1 77.31 77.31 1 100.00
16111. Ugnius (zorgas) 15 77.30 91.65 5 33.33
16112. Save Gaza! (scisaif) 2 77.30 79.17 0 0.00
16113. SlipperySlope (eeilu) 32 77.30 88.62 10 31.25
16114. PHP JMC (cmjhunneil) 2 77.30 86.33 1 50.00
16115. Otto (otto_types) 143 77.30 99.20 40 27.97
16116. mmmmm (kamenrider345) 38 77.30 95.24 11 28.95
16117. Aruji (aruji) 14 77.30 86.27 0 0.00
16118. jaycuaa (jaycuaa) 18 77.30 92.44 1 5.56
16119. Ariscottle (ariscottle3106) 67 77.29 103.00 19 28.36
16120. Olexiy (lexk) 130 77.29 98.63 38 29.23
16121. PrairieBaron (atbaron) 38 77.29 93.98 9 23.68
16122. Sinh (lekhanhsinhvn) 1 77.29 77.29 1 100.00
16123. Wynton (wyntonrude17) 25 77.29 100.57 6 24.00
16124. Zi Hao (im_getting_there) 612 77.29 111.29 165 26.96
16125. Darnell (darnell_2502) 4 77.29 81.08 1 25.00
16126. Henry (noodles10) 8 77.28 90.74 2 25.00
16127. Jerry (jerry300) 9 77.28 82.85 1 11.11
16128. Albert (lnseed) 32 77.28 96.30 6 18.75
16129. Xantrum (xantrum1) 18 77.28 96.73 7 38.89
16130. DevReve (wassim321) 1 77.28 77.28 0 0.00
16131. Pu (pulak) 1 77.28 77.28 1 100.00
16132. Ambrosia (ambiic) 4 77.28 85.58 1 25.00
16133. Ben (caaakeeey) 381 77.28 101.82 103 27.03
16134. Aiden (maccraker) 17 77.27 92.27 6 35.29
16135. vverbov22 (vverbov22) 6 77.27 88.58 3 50.00
16136. Marsal (marsalsz) 95 77.27 100.24 30 31.58
16137. Riley (rileygramlich) 18 77.27 91.31 6 33.33
16138. temazh (temazh) 22 77.26 90.59 6 27.27
16139. Pere_Gil (pere_gil) 29 77.26 89.26 3 10.34
16140. Jesse (jesse1998114) 4 77.26 81.60 0 0.00
16141. Joy (joypark21) 227 77.26 118.02 55 24.23
16142. vix (vrinze) 42 77.26 92.64 9 21.43
16143. Jason (d4tb0i) 89 77.26 93.93 17 19.10
16144. Veeridel (del_234) 4 77.26 85.29 0 0.00
16145. Macaroni (spacial_macaroni) 8 77.25 82.60 1 12.50
16146. Christine (christinebostrom9) 1 77.25 77.25 0 0.00
16147. omar (omarkasem) 1 77.25 77.25 0 0.00
16148. J (jossama) 5 77.25 80.71 1 20.00
16149. thunderbeast (thunderbeast_) 96 77.25 101.59 32 33.33
16150. Naut38 (naut38) 1,697 77.24 105.51 354 20.86
16151. Serial (serial_typer) 246 77.24 101.55 65 26.42
16152. Stefan (stefanbm) 192 77.24 91.80 50 26.04
16153. ayush (orange_master) 13 77.23 88.57 3 23.08
16154. darthinfinix (darthinfinix) 95 77.23 106.85 26 27.37
16155. DomeBoy (domeboy) 4 77.23 84.83 0 0.00
16156. Tino (timppara) 9 77.22 92.41 1 11.11
16157. Nguyen (corei9001) 5 77.22 82.62 0 0.00
16158. Thi (thiorcoffee) 2 77.22 90.12 2 100.00
16159. k1p (muggz) 17 77.21 100.70 3 17.65
16160. Naz (zdkraner) 9 77.21 93.95 1 11.11
16161. mooshi (mooshituslo) 1 77.21 77.21 1 100.00
16162. Rjay (crustybacon) 1 77.21 77.21 0 0.00
16163. Sashko (alexmandev_3) 120 77.21 95.02 36 30.00
16164. 🐌 (adas291) 32 77.21 86.48 12 37.50
16165. TinklyBell (tinklybell1608) 10 77.21 85.94 4 40.00
16166. Albert (bertikcertik) 3 77.21 85.27 0 0.00
16167. Rafeeq (raf_al) 61 77.21 97.70 17 27.87
16168. Antatia (bi0hazrd_522) 28 77.21 94.53 6 21.43
16169. Mayank (person_mayank) 82 77.20 94.78 19 23.17
16170. Silly (sillygeeses) 7 77.20 84.99 2 28.57
16171. Died273 (died273) 4 77.20 91.32 1 25.00
16172. Tim (timbob5380) 8 77.20 89.26 4 50.00
16173. Caleb (balecus53) 59 77.20 91.56 9 15.25
16174. Wes (wespiard) 20 77.20 92.99 12 60.00
16175. Chuck (typer_inflation) 298 77.19 103.01 82 27.52
16176. 🪐 (saturnus3) 1 77.19 77.19 0 0.00
16177. Alex (bissector) 1 77.19 77.19 1 100.00
16178. Arees (arees) 143 77.19 97.64 39 27.27
16179. Fire (fire_rice) 132 77.19 98.72 32 24.24
16180. karovD (fablem_workman) 41 77.18 97.88 12 29.27
16181. 2115 to (2115togeng) 1 77.18 77.18 0 0.00
16182. Jonathan (jgetachew) 1 77.18 77.18 0 0.00
16183. Noah (dead_dogs) 6 77.18 89.22 0 0.00
16184. Almahbuby (bubanz1101) 3 77.18 78.88 1 33.33
16185. Oliver (arscenic) 19 77.17 93.89 8 42.11
16186. Prem (merpx) 261 77.16 94.66 64 24.52
16187. guy (zagu) 6 77.16 78.91 2 33.33
16188. kat (kat_dj) 4 77.16 86.88 3 75.00
16189. InfernoHues (infernohues) 1 77.16 77.16 0 0.00
16190. Everest (likethemountain) 27 77.16 95.76 7 25.93
16191. Daniel (dreilly2231) 110 77.16 91.77 32 29.09
16192. Rikrish (dardbador) 6 77.15 83.47 1 16.67
16193. Vishal (vpm911) 37 77.15 98.92 5 13.51
16194. gaoshan (crazydonkehhhhh) 12 77.15 92.17 3 25.00
16195. Astra (astrame) 20 77.14 89.27 4 20.00
16196. Anisur (anis_017) 241 77.14 99.18 43 17.84
16197. Mikhail (mayham92) 454 77.14 99.85 117 25.77
16198. c (cvu24) 4 77.14 81.44 0 0.00
16199. Mordo (elmordo) 111 77.13 91.23 21 18.92
16200. Benjamin (bennegrus) 1 77.13 77.13 0 0.00
16201. paraluman (paraluman) 2 77.13 80.80 0 0.00
16202. Enormity (enormity_op) 459 77.13 94.31 127 27.67
16203. emily (emily_chwn) 21 77.13 84.14 2 9.52
16204. kristjon (kristjon) 8 77.13 81.04 0 0.00
16205. MK (uosom) 25 77.12 98.12 7 28.00
16206. Pineapple (pineapple_pie1) 72 77.12 95.82 20 27.78
16207. Nono (nono11jp) 24 77.12 92.84 7 29.17
16208. bell (bell125) 3 77.12 82.06 2 66.67
16209. Brady (bradymoller) 19 77.12 91.29 3 15.79
16210. AKW (alice1120) 13 77.12 86.74 3 23.08
16211. Cloud (cloud_bolssom) 965 77.12 115.77 235 24.35
16212. Samay (upadsamay387) 22 77.11 93.07 3 13.64
16213. Andrea (tinola) 240 77.11 96.22 51 21.25
16214. Vignesh (viggie) 688 77.11 100.75 191 27.76
16215. Saim (spirit_) 32 77.11 101.49 9 28.13
16216. Jokrr (jokrr7) 29 77.10 88.67 10 34.48
16217. Soul (soul_eater22) 12 77.10 98.34 2 16.67
16218. Zeltraa (zeltraa) 252 77.10 101.67 68 26.98
16219. Priyanshu (neo_trinity) 486 77.10 111.23 142 29.22
16220. Zanzaru (zanzaru) 4 77.10 94.36 0 0.00
16221. let israel win (keletheking) 9 77.09 87.22 4 44.44
16222. XYZ (xyzabc1799) 8 77.09 83.44 1 12.50
16223. André (valp) 13 77.09 87.81 3 23.08
16224. あしくさい (asikusai) 9 77.09 86.21 2 22.22
16225. Evelyn (evelynji) 67 77.09 92.55 20 29.85
16226. Ayman (akwah) 210 77.09 100.36 58 27.62
16227. Abdullahi (abdullahi_samiir) 14 77.08 86.44 2 14.29
16228. Graison (grais0n) 1 77.08 77.08 0 0.00
16229. Daniel (sirwatson) 3 77.08 79.87 0 0.00
16230. Robert (roberty579) 6 77.08 87.21 1 16.67
16231. ravi (sravi4701) 346 77.08 100.40 78 22.54
16232. NahFam (thekojiman) 3 77.08 81.82 2 66.67
16233. Harry (harrycomp16) 100 77.08 98.27 29 29.00
16234. Annie (anniesimp) 33 77.07 91.33 10 30.30
16235. Bytes (bytesandbots) 16 77.07 94.58 5 31.25
16236. Alfredo (alfredosojr) 9 77.07 96.34 0 0.00
16237. Liema (nidoc) 12 77.07 86.73 12 100.00
16238. youm (youm) 177 77.07 98.06 40 22.60
16239. mhtnx (vim_sen) 1 77.07 77.07 0 0.00
16240. Nethum (nethum) 3 77.07 81.50 0 0.00
16241. Marrie (marriemitsu) 1 77.07 77.07 0 0.00
16242. netram88 (netram88) 152 77.07 96.55 53 34.87
16243. Darth (darthverde) 222 77.07 106.82 56 25.23
16244. Jayden (shiakose) 6 77.07 86.19 3 50.00
16245. Evan (theworkmanmuffin) 36 77.06 88.49 11 30.56
16246. Hải (microwaveablepasta) 20 77.06 98.74 5 25.00
16247. seer23 (seer23) 29 77.05 91.69 21 72.41
16248. Hans (typer_error) 6 77.05 83.22 2 33.33
16249. Sidewalk (euantis) 8 77.05 87.09 3 37.50
16250. Sadat (based_chungus) 350 77.05 101.30 95 27.14
16251. Shift (shiftw) 42 77.05 94.54 14 33.33
16252. Anchit (anchit) 148 77.04 92.45 37 25.00
16253. Mathias (mattitheguy) 11 77.04 98.32 6 54.55
16254. Ava (berry_blue) 17 77.04 97.01 3 17.65
16255. Venom (_venom) 32 77.04 94.46 10 31.25
16256. Julio (julio7125) 18 77.04 94.08 2 11.11
16257. Thiago (terjan) 114 77.03 105.66 38 33.33
16258. Carlos (lufnys) 365 77.03 121.66 88 24.11
16259. Typer (haydyn49) 9 77.03 83.65 1 11.11
16260. Stijn (stijnmeijssen) 241 77.03 105.23 48 19.92
16261. TJ (tjheinzo) 2 77.03 79.26 1 50.00
16262. Kelsey (krognicle) 2 77.03 84.23 0 0.00
16263. HonorTiltProof (honortiltpr... 1 77.02 77.02 1 100.00
16264. abhi (abhi_sama) 56 77.02 96.89 18 32.14
16265. Daniel (dansku01) 48 77.01 101.93 16 33.33
16266. Tien (mr_tien) 105 77.01 110.31 24 22.86
16267. Stevne (juninight29) 457 77.01 94.28 80 17.51
16268. Bob (bobgolf) 3 77.01 79.98 0 0.00
16269. Dele (delenit0r) 14 77.00 88.65 2 14.29
16270. Brian (desbrigs) 62 77.00 97.29 12 19.35
16271. Ning (nekophobia) 3 77.00 80.70 2 66.67
16272. Clare (clareb31) 8 77.00 89.86 3 37.50
16273. po1nt (_po1nt_) 43 77.00 87.37 13 30.23
16274. Jakob (jaker8024) 6 76.99 86.64 3 50.00
16275. mayimbe (mayimbe194) 124 76.99 98.10 28 22.58
16276. Jake (yakoubhachimi) 1 76.99 76.99 0 0.00
16277. Dilly (chronixz) 4 76.99 81.61 0 0.00
16278. alvin (nganinator) 4 76.99 88.33 1 25.00
16279. Dominic (hobomonkey5) 11 76.98 93.29 3 27.27
16280. Benjie (superbench03) 12 76.98 92.94 2 16.67
16281. vineet (headspace_men) 7 76.98 87.41 3 42.86
16282. Tarso (noaxispe) 3 76.98 80.60 2 66.67
16283. Jonnathan (aljeak_) 2 76.98 77.30 1 50.00
16284. Cyrus (cyrus19) 10 76.98 92.04 5 50.00
16285. Piper (crazy_panda) 2 76.98 83.76 2 100.00
16286. Spr_ingg (spr_ingg) 4 76.97 80.93 1 25.00
16287. Aryan (aryandeore) 18 76.97 99.81 6 33.33
16288. Adam (adamsawahgamer) 73 76.97 95.48 23 31.51
16289. juuuws (juuuws) 3 76.97 79.96 1 33.33
16290. Anuj (anujsharma411) 44 76.97 90.37 16 36.36
16291. Koupka (koupka) 607 76.96 108.13 168 27.68
16292. Brad (bborrell) 3 76.96 82.29 1 33.33
16293. Aaron (aaronrockindude) 1 76.96 76.96 0 0.00
16294. sven (svenac20) 6 76.96 87.71 2 33.33
16295. Zach (zmeister0828) 11 76.96 100.75 3 27.27
16296. Zhu (viviora) 144 76.96 92.51 44 30.56
16297. Akshat (akshatsingh1_) 25 76.95 99.84 6 24.00
16298. Thomas (jitensha03) 19 76.95 97.83 10 52.63
16299. Giraffe (giraffelords36) 1 76.95 76.95 1 100.00
16300. Glenn (burappi) 1 76.95 76.95 0 0.00
16301. mrw1 (mrw1) 20 76.95 91.52 7 35.00
16302. cogz (nooodlefish) 3 76.95 82.33 1 33.33
16303. Dennis (1nys) 40 76.95 100.45 12 30.00
16304. Mohammed (ledger67) 130 76.95 94.65 23 17.69
16305. Typing (typinglegend16) 12 76.95 88.29 3 25.00
16306. jc.ekrem (jc_ekrem) 34 76.95 95.13 11 32.35
16307. deydey (iskalaberkberk0427) 14 76.94 88.34 4 28.57
16308. Omar (omarmoralesjr810) 2 76.94 82.95 1 50.00
16309. Fakrul (blizzardwind) 1 76.94 76.94 0 0.00
16310. Bob (lobmys) 31 76.93 97.01 10 32.26
16311. Berty (bertybert) 43 76.93 94.02 18 41.86
16312. René (sirrene) 9 76.93 90.16 9 100.00
16313. Rahul (rahul1q) 5 76.93 89.24 2 40.00
16314. Jony (jonycolemak) 148 76.91 97.93 37 25.00
16315. ATRAN (atranhehe) 125 76.91 98.36 25 20.00
16316. mulluch (mulluchian) 34 76.90 97.63 6 17.65
16317. tiffany (skipperdee) 10 76.90 94.64 3 30.00
16318. Avatar 2 (kingkiller) 6 76.90 92.15 2 33.33
16319. Hoe Hoe (yeyonghe) 321 76.90 98.46 74 23.05
16320. Tadas (tadasmak) 50 76.89 91.00 10 20.00
16321. Jako (frafdothehero) 51 76.89 93.34 10 19.61
16322. Techy504 (techy504) 1 76.89 76.89 0 0.00
16323. life (armaansoni) 138 76.89 96.81 40 28.99
16324. Declan (dg05) 358 76.89 103.23 83 23.18
16325. Paddy (paddyl) 13 76.89 85.30 4 30.77
16326. Chuby_j (chuby_j) 7 76.89 86.03 7 100.00
16327. Leo (lileo261) 3 76.89 80.86 1 33.33
16328. Bartek (reaction73) 3 76.89 82.04 1 33.33
16329. Rishabh (thomasshellby) 74 76.88 96.49 19 25.68
16330. ............. (zalvary) 4 76.87 84.78 2 50.00
16331. ViktorT (vitr_88) 17 76.87 85.70 7 41.18
16332. r (buckage) 2 76.87 76.99 2 100.00
16333. Katrina (kweinma) 1 76.87 76.87 1 100.00
16334. izzat (jakkjubiss) 2 76.87 82.11 0 0.00
16335. Abu (abu_hussain_03) 885 76.87 100.68 231 26.10
16336. grigoar (grigoar) 100 76.87 98.92 25 25.00
16337. The Ro Driver (the_ro_driver) 7 76.87 92.27 2 28.57
16338. Pavel (trialtry) 30 76.87 88.17 12 40.00
16339. Robbie (qweens) 20 76.86 89.79 8 40.00
16340. Jagadeeswar (jd_300) 233 76.86 103.43 66 28.33
16341. Blackmooer (colinluca) 19 76.86 89.94 7 36.84
16342. Jonah (jonahtzy) 33 76.86 106.28 12 36.36
16343. Ashvik (ardude566) 14 76.86 99.77 5 35.71
16344. Jon (hongatory) 6 76.86 84.05 0 0.00
16345. Ilikeracing (ilikeracing) 2 76.86 99.43 0 0.00
16346. Apollo (ahollo) 651 76.86 101.33 170 26.11
16347. Kivon (kivonsclipz) 11 76.86 91.87 3 27.27
16348. Bryce (bryce_verberne) 11 76.86 93.82 7 63.64
16349. Edrin (itsedrin) 5 76.86 84.17 2 40.00
16350. Nasos (nasos2311) 9 76.86 88.92 2 22.22
16351. Zosia Nicholson (zosianicho... 70 76.85 104.60 11 15.71
16352. Snugget (snaiel) 3 76.85 88.52 1 33.33
16353. dree (dre3) 14 76.85 92.75 3 21.43
16354. Joseph (avoirjoseph) 6 76.85 82.35 4 66.67
16355. Eveningthing (evntd) 175 76.85 98.27 43 24.57
16356. Matthew (theoriginalbrick) 2 76.85 81.58 1 50.00
16357. Mikkel (mixmox) 1 76.84 76.84 0 0.00
16358. Damian (damianm8) 21 76.84 86.71 6 28.57
16359. Wind (windywind) 2 76.84 84.60 2 100.00
16360. Jason (typing_boi69) 309 76.83 105.07 71 22.98
16361. james (chilty14) 118 76.82 105.39 33 27.97
16362. DarkShadowSage (nlopez20) 5 76.82 94.83 0 0.00
16363. Attican (r4ne) 12 76.82 86.53 2 16.67
16364. BMO (balot2020) 114 76.82 100.44 24 21.05
16365. Rishav (rishavmngo) 841 76.82 105.41 211 25.09
16366. Kornel (kornelt) 40 76.82 94.03 9 22.50
16367. Heitor (tutesthetyper) 3 76.82 79.46 0 0.00
16368. too_slow (rakki7) 8 76.82 83.32 2 25.00
16369. Tawalisi (tawalisi_1500) 75 76.81 92.68 18 24.00
16370. David (hanid3) 129 76.81 98.32 37 28.68
16371. Jonathan (jimbothegreat) 27 76.80 99.57 10 37.04
16372. punj (punj) 12 76.80 87.62 2 16.67
16373. monners (monners) 1,449 76.80 100.38 468 32.30
16374. Jessy (___jessy___) 4 76.80 79.14 2 50.00
16375. Evan (crcd) 90 76.80 92.91 20 22.22
16376. Jose Antonio (jarceantonio) 27 76.80 94.80 7 25.93
16377. Fifi (fififishcake) 10 76.80 87.30 3 30.00
16378. DarkLight (darklight17) 13 76.79 89.70 1 7.69
16379. Darren (dtwcdarren) 26 76.79 98.14 4 15.38
16380. clgq (clgq) 220 76.79 99.89 44 20.00
16381. Cocoa (thatclassykid) 24 76.79 88.95 6 25.00
16382. Tren (_tren) 14 76.78 89.28 4 28.57
16383. gofpopexe (gofpopexe) 1 76.78 76.78 0 0.00
16384. Robi (robi_trabl) 2 76.78 78.05 1 50.00
16385. Dipesh (dipeshm77) 82 76.78 91.55 18 21.95
16386. James (mysticalentity) 2 76.78 77.61 0 0.00
16387. Reyes (oriim) 4 76.77 90.02 2 50.00
16388. Martin (niquid) 32 76.77 90.93 9 28.13
16389. Ball Sweat (typing_man_man) 37 76.77 89.99 8 21.62
16390. Ciontel (ciontel) 4 76.77 86.34 0 0.00
16391. Byron (peace942) 5 76.77 79.94 0 0.00
16392. Fred (fblue) 3 76.76 103.11 1 33.33
16393. Matthew (matthuwu) 5 76.76 80.98 4 80.00
16394. oleg (prot64) 12 76.76 92.01 3 25.00
16395. D.k. (kumardeep22) 2 76.76 80.27 0 0.00
16396. PRANADALA (pranadala) 39 76.76 88.57 17 43.59
16397. fratelecarol (fratelecarol) 643 76.75 110.95 185 28.77
16398. Rexoblob (rexoblob) 14 76.75 85.95 2 14.29
16399. David (wdnch) 29 76.75 91.79 9 31.03
16400. Tom (javor) 10 76.74 83.89 5 50.00
16401. A (qkrdnwls6) 27 76.74 96.10 26 96.30
16402. S3LVA (r06ramanat) 9 76.74 81.92 4 44.44
16403. Fat (fattyfatboi) 6 76.74 85.96 3 50.00
16404. HallMaster007 (hallmaster007) 2 76.74 79.67 1 50.00
16405. Eric (eric_05) 11 76.73 88.25 6 54.55
16406. Brian (sonicf312) 2 76.73 80.38 1 50.00
16407. Dan (monkyman12) 8 76.73 88.56 2 25.00
16408. liv (lilolive) 7 76.73 86.36 0 0.00
16409. Hento (ceckerli) 3 76.73 96.73 1 33.33
16410. Pengwen (zhaopengwen) 4 76.72 80.56 2 50.00
16411. Thelonious (thelonious) 27 76.72 93.34 7 25.93
16412. Corin (corlexc) 10 76.72 93.20 0 0.00
16413. nishant (nishp19) 270 76.72 93.47 81 30.00
16414. m!nji_ (sophai) 2 76.72 92.75 0 0.00
16415. Squeeb (squeeb) 3 76.71 101.57 1 33.33
16416. the1stpsycho (the1stpsycho) 19 76.71 93.81 6 31.58
16417. Aditya (aditya9219) 98 76.70 96.26 24 24.49
16418. Jens (imcre4tiive) 5 76.70 95.82 1 20.00
16419. Makhambet (markiz) 23 76.70 94.37 4 17.39
16420. nanashi (greenjohnny135) 51 76.69 101.72 9 17.65
16421. Brad (2slo2calm) 3 76.69 77.18 0 0.00
16422. matt (wokpikmin555) 1 76.69 76.69 1 100.00
16423. Ayush (syndrome_) 1 76.69 76.69 0 0.00
16424. James (kuznecoff) 13 76.69 90.62 2 15.38
16425. Tianyi (dreamatd) 156 76.69 93.47 31 19.87
16426. Andre (bouncybear6969) 3 76.69 79.19 0 0.00
16427. Sunil (sunilbv) 4 76.69 92.33 2 50.00
16428. Liz (elizabethl3_13) 17 76.68 100.50 5 29.41
16429. Lukas (imfluf) 2 76.68 84.46 1 50.00
16430. Daniel (danyroza) 6 76.68 91.84 1 16.67
16431. testsubject (shamushasha) 117 76.67 101.28 30 25.64
16432. Drama (dramajr) 18 76.67 98.62 5 27.78
16433. Aaron (the_bus) 126 76.67 89.91 35 27.78
16434. Ikenna (odogwu) 280 76.67 107.78 79 28.21
16435. erka (erkaboy) 22 76.66 92.59 5 22.73
16436. Nehal (nehaldamania) 7 76.66 83.83 4 57.14
16437. Alex (apw024) 3 76.66 78.95 0 0.00
16438. Mathias (pijaye) 7 76.66 90.03 2 28.57
16439. Preetish (preetishmajumdar) 164 76.66 96.70 38 23.17
16440. mt005 (mt005) 65 76.65 98.86 15 23.08
16441. endless (dm475) 130 76.65 105.94 40 30.77
16442. Heh (tophatheh) 14 76.65 85.82 3 21.43
16443. Tiffany (luckydaboss) 1 76.65 76.65 0 0.00
16444. Nagaro (nagaro) 171 76.65 95.66 47 27.49
16445. Sabin (zealousy) 3 76.65 77.66 2 66.67
16446. Jason (haisaru) 11 76.64 90.30 5 45.45
16447. Tyler (tdude212) 6 76.64 87.04 2 33.33
16448. epicgdog (epicgdog) 1 76.64 76.64 0 0.00
16449. Regular Plumbus (oldplumbus) 2 76.64 78.36 0 0.00
16450. S (agnimandur) 1 76.63 76.63 0 0.00
16451. Bismith (bismith) 150 76.63 93.22 33 22.00
16452. Fahad (skyclasher_24) 487 76.63 101.47 142 29.16
16453. douzhen (akariin) 184 76.63 97.59 56 30.43
16454. Tom (tomshilling) 14 76.63 100.33 3 21.43
16455. Semi (semi805) 6 76.62 79.92 1 16.67
16456. Krazy (tilatik) 6 76.62 86.69 0 0.00
16457. Jared (jigglyj) 2 76.62 83.60 0 0.00
16458. sages (sagesss) 1 76.62 76.62 1 100.00
16459. streamix (streamix) 24 76.62 89.62 9 37.50
16460. Shehab (shehab_is_legendary) 1 76.61 76.61 0 0.00
16461. Chezhiyan (chezhiyan) 7 76.61 86.48 2 28.57
16462. JC (jollibeech) 41 76.61 90.80 23 56.10
16463. treesrnice (treesrnice) 3 76.60 84.15 1 33.33
16464. Slow Typer (4rs3n1c) 38 76.60 90.14 19 50.00
16465. Sayandip (sayandip199309) 883 76.60 99.45 232 26.27
16466. szk3y (szk3y) 2 76.60 77.69 0 0.00
16467. Xd (pm7373) 1 76.60 76.60 1 100.00
16468. PimpSlapper (pimpslapper) 2 76.60 77.49 0 0.00
16469. Adarsh (adarshkr) 12 76.60 85.31 4 33.33
16470. Daniel (smartdevilno) 1,058 76.60 99.37 250 23.63
16471. Nothing (humblepikachu) 15 76.59 94.32 7 46.67
16472. Ben (jingler) 2 76.59 79.40 1 50.00
16473. Ben (chewy_bran) 31 76.59 91.69 7 22.58
16474. Tristan (tris_tan) 4 76.59 81.35 0 0.00
16475. SOBO (sobo) 30 76.58 88.18 6 20.00
16476. Brandon (kosaido) 26 76.58 88.82 11 42.31
16477. Kevin (kevincamilo) 640 76.58 100.17 130 20.31
16478. Wsthms (charlesseo) 1 76.58 76.58 0 0.00
16479. Lucas (st3ezy) 1,291 76.58 102.58 318 24.63
16480. RaspberryPi1 (yodabyteram) 4 76.58 86.04 0 0.00
16481. konnie (ibeatonwhitewomen) 9 76.58 84.53 3 33.33
16482. Gur (gur111) 3 76.57 81.55 3 100.00
16483. Derryck (derryck) 4 76.57 81.60 3 75.00
16484. Simone (simone79) 41 76.57 83.88 12 29.27
16485. V¹ҡҡʏ (littlevikky_) 139 76.57 96.00 31 22.30
16486. Mia (miajasmine) 20 76.56 93.78 5 25.00
16487. mmlt (mvejlund) 4 76.56 80.48 0 0.00
16488. winter (kitzy) 113 76.56 105.23 24 21.24
16489. Bob (bobthethird) 4 76.56 81.09 2 50.00
16490. boss (tsukuyo) 6 76.55 84.25 1 16.67
16491. Bryan.. XD (bryan_xd) 96 76.54 106.42 24 25.00
16492. onel (onel11) 8 76.54 88.84 2 25.00
16493. Sh3y4sh (thegoldeneagle) 45 76.54 95.34 14 31.11
16494. iGeo (oddhampton) 9 76.54 81.87 1 11.11
16495. cung (cungdongma) 27 76.54 91.42 10 37.04
16496. Cosmic (cosmicuser) 1 76.54 76.54 1 100.00
16497. Soul (soulsforsweet) 181 76.54 97.16 38 20.99
16498. CTLim (ctlim02) 45 76.54 96.78 11 24.44
16499. hammer11 (thomas11) 7 76.53 88.27 2 28.57
16500. Stella (iceeigloo) 7 76.53 91.08 2 28.57
16501. Alexander (caesarsgambit) 4 76.53 81.65 0 0.00
16502. jono (jonohubbard) 14 76.53 95.38 5 35.71
16503. bogo (bogo10) 3 76.53 78.98 1 33.33
16504. Manuel (mansrz) 11 76.53 87.52 3 27.27
16505. Guest (superman_ha_ha) 333 76.52 108.40 80 24.02
16506. Aviv (el_duckino) 24 76.52 95.29 9 37.50
16507. Bruno (brunokoppel) 15 76.52 94.22 5 33.33
16508. Endy (legaljeans) 17 76.52 90.58 6 35.29
16509. Victor (kizamui) 55 76.52 94.02 15 27.27
16510. Sklort (skl0rt) 7 76.52 90.80 2 28.57
16511. Franco (rubikute) 589 76.52 102.05 143 24.28
16512. Jethro (jethrofort) 61 76.51 101.59 20 32.79
16513. mak (urhg66) 1 76.51 76.51 0 0.00
16514. Tianshu (yts1999) 16 76.51 86.39 0 0.00
16515. Wawan Cahyo (wildanie12) 3 76.50 80.85 1 33.33
16516. Remark (remark21) 23 76.50 86.85 8 34.78
16517. Markus (markustelser) 31 76.50 87.84 14 45.16
16518. Yakhe (ken007) 22 76.50 91.59 10 45.45
16519. davy (octopu5) 321 76.50 102.10 103 32.09
16520. Nicolas (supercarlover888) 2 76.50 85.73 1 50.00
16521. Shrulk (shrulk) 1 76.49 76.49 0 0.00
16522. Griff (gfargo) 2 76.49 79.36 1 50.00
16523. Dobby (dobbycb) 1 76.49 76.49 0 0.00
16524. Marwoleath (marwoleath) 51 76.49 90.97 7 13.73
16525. Touchtyping (touchtypingpro... 294 76.49 112.79 95 32.31
16526. Pearson (pearsonsm) 4 76.48 93.66 2 50.00
16527. Jude (philivey) 230 76.48 96.88 47 20.43
16528. Typo (foop101) 17 76.48 92.59 5 29.41
16529. kektor (kektorkuan) 7 76.48 93.22 2 28.57
16530. Dorian (dodo2208) 2 76.48 79.03 0 0.00
16531. Crricket (crricket) 25 76.48 96.17 8 32.00
16532. Lūkass (lukasslv) 62 76.48 100.84 14 22.58
16533. Haikal (haykalsaliba) 2 76.48 78.66 1 50.00
16534. lewis (remmurd) 3 76.47 78.36 0 0.00
16535. Nick (darapidninja) 16 76.47 88.79 16 100.00
16536. mitchell (miceol) 70 76.47 105.71 9 12.86
16537. Nilesh (_nex_) 11 76.47 85.69 1 9.09
16538. rafe (raffeevs) 1 76.47 76.47 0 0.00
16539. potlid43 (potlid43) 7 76.47 91.57 2 28.57
16540. mischgu (mischgu) 5 76.47 81.63 3 60.00
16541. Charles (cloudhaze) 2 76.47 76.67 1 50.00
16542. kyle (poyser) 222 76.46 94.26 54 24.32
16543. Liam (ltrainferry) 5 76.46 88.36 1 20.00
16544. Cuong (vucuong21) 8 76.46 83.94 2 25.00
16545. Ring2020 (ring2020) 110 76.46 96.84 24 21.82
16546. Stephanie (naderly) 23 76.46 85.93 4 17.39
16547. Daniel (danielyawn) 22 76.46 94.10 2 9.09
16548. Aditya (zwelgop) 69 76.45 101.48 18 26.09
16549. Gabe (lukeimyourdaddy) 10 76.45 82.42 6 60.00
16550. Maksim (morysoff) 176 76.45 97.66 48 27.27
16551. Ifat (helloitsifat) 21 76.45 89.41 4 19.05
16552. Vishnu (vishnu6174) 106 76.45 94.22 22 20.75
16553. Adam (damadamadamm) 13 76.45 81.23 3 23.08
16554. Pichu (pichu_pals) 8 76.45 89.63 8 100.00
16555. Goodwill (vadrone) 3 76.45 88.82 0 0.00
16556. Yeldos (yeldosmanap) 7 76.44 80.53 2 28.57
16557. Anders (snazzy) 8 76.44 86.72 1 12.50
16558. Karibas (albiones) 16 76.44 89.10 4 25.00
16559. Jamie (jswain) 1 76.44 76.44 0 0.00
16560. Wanizame (wanizame) 10 76.44 92.92 2 20.00
16561. Professional (professional_... 58 76.44 95.55 16 27.59
16562. Rodrigo (sicutdeux) 5 76.43 87.52 0 0.00
16563. Armisael (brandonbro) 54 76.43 101.40 19 35.19
16564. Andy (largahblarga) 1 76.43 76.43 0 0.00
16565. Joey (joeyp123) 81 76.43 93.49 14 17.28
16566. Dalia (flowhy_) 55 76.42 93.03 17 30.91
16567. William (wbulovas) 4 76.42 88.47 3 75.00
16568. Maninder (mani_ms1) 125 76.42 101.69 32 25.60
16569. HiteshM (hiteshm_riptide) 148 76.42 99.36 45 30.41
16570. Mainek (zoochan) 2 76.42 78.47 1 50.00
16571. buntly (twitch_knighthamtv) 1 76.42 76.42 0 0.00
16572. bruh (swordsbeef) 3 76.42 85.19 0 0.00
16573. Lawn (sofusboisen) 4 76.42 79.76 2 50.00
16574. Bracklet (bracklet) 1 76.42 76.42 0 0.00
16575. Ollie (stillcanttouchtype) 3 76.41 85.45 0 0.00
16576. mcshizney (mcshizney) 7 76.41 91.63 1 14.29
16577. dominic (bobomopre) 1 76.41 76.41 0 0.00
16578. mikduc (samurai_dodo) 9 76.41 90.47 2 22.22
16579. Francisco Amat (saryon) 64 76.40 96.96 22 34.38
16580. Elektra (mjpaark) 1 76.40 76.40 0 0.00
16581. Cole (cwburke) 1 76.40 76.40 0 0.00
16582. 2dnas (2dnas) 12 76.40 86.96 2 16.67
16583. Mile161 (mile161) 2 76.40 79.30 0 0.00
16584. Lo_key (lo_key) 24 76.39 87.66 4 16.67
16585. Tomislav (sovageng) 19 76.39 85.69 6 31.58
16586. Isahi (420blaziken_) 1 76.39 76.39 0 0.00
16587. why (iwanttokommitdead) 5 76.39 97.91 5 100.00
16588. meerkat (dr_meerkat) 290 76.39 93.80 69 23.79
16589. fair (fairpixa) 1 76.38 76.38 0 0.00
16590. parteek (parteek) 1 76.38 76.38 1 100.00
16591. Lia (calumhood_) 9 76.38 90.15 4 44.44
16592. zvgz (eclfppcmommarsuwof) 13 76.38 83.94 5 38.46
16593. Rasmus (kennystarfighter_) 289 76.38 103.76 73 25.26
16594. Gevorg (cgev) 3 76.38 78.52 1 33.33
16595. BASIL (basilps123) 98 76.37 88.86 26 26.53
16596. Alyssa (stewalyssa) 18 76.37 90.75 6 33.33
16597. Ella (tigger1854) 10 76.37 98.85 4 40.00
16598. Dust (l4sts0ul) 1 76.37 76.37 0 0.00
16599. Katie (katriarchy) 5 76.37 85.50 3 60.00
16600. doubleplusgood (doubleplusg... 22 76.36 96.66 3 13.64
16601. Chris (chriss777) 1 76.36 76.36 1 100.00
16602. babi (baggymist22063) 1 76.36 76.36 0 0.00
16603. asdsfdg (asdfgdsf) 136 76.36 101.33 34 25.00
16604. Cristian (cristian0017) 7 76.35 82.74 1 14.29
16605. PlusJ (plusj) 5 76.35 86.76 2 40.00
16606. Aljaž (lojzetka) 4 76.35 84.65 1 25.00
16607. Ryan (ryanylee02) 5 76.35 84.50 1 20.00
16608. Alexandre (profenom) 1 76.34 76.34 0 0.00
16609. Hang (hangben) 1 76.34 76.34 0 0.00
16610. 1 (reforme) 37 76.34 89.24 9 24.32
16611. Skywalker (szqskywalker) 2 76.34 85.91 0 0.00
16612. Jhun Chester (jaycel19) 7 76.33 94.15 1 14.29
16613. Weeb (fredfaye) 7 76.33 84.20 0 0.00
16614. Mohamed (abo4ams) 46 76.33 85.06 13 28.26
16615. Dominic (dark_demon) 1 76.33 76.33 0 0.00
16616. Joshua (joshuagil23) 1 76.33 76.33 1 100.00
16617. Punder (punderland) 61 76.33 92.25 13 21.31
16618. Wilson (wilsontanvis) 4 76.32 84.34 1 25.00
16619. Chicken (werdenbot) 5 76.32 88.74 1 20.00
16620. Cait (lamby17_) 14 76.32 85.02 4 28.57
16621. yoshiki (kalog46) 1 76.32 76.32 0 0.00
16622. Turtle (stevetheturtle) 23 76.32 86.07 5 21.74
16623. Sjors (wordmasterofbooks) 4 76.32 90.58 0 0.00
16624. Dan (typefffast) 18 76.31 86.86 5 27.78
16625. andrewski (toxic127) 1 76.31 76.31 0 0.00
16626. swfan (curleyx) 66 76.31 96.83 20 30.30
16627. Xemnas (cuzto) 242 76.31 107.97 53 21.90
16628. Jackson (jacksonmississippi) 47 76.30 102.90 13 27.66
16629. Zak (joyridinglordofdeath) 3 76.30 80.26 1 33.33
16630. Pragyan (swordfish999) 49 76.30 101.92 7 14.29
16631. Pratyaksh (nickpratyaksh) 18 76.30 92.12 18 100.00
16632. Dweeb (dweb) 46 76.30 94.48 22 47.83
16633. rehsur (rehsur) 17 76.30 88.43 5 29.41
16634. NaTsu879 (lonely_painter) 2 76.30 78.30 0 0.00
16635. Sestain (sestain) 33 76.29 91.21 9 27.27
16636. mik (miiik) 131 76.29 93.31 39 29.77
16637. chandamandal (chandamandal) 1 76.29 76.29 1 100.00
16638. Burr (burrasaurs) 24 76.29 97.72 10 41.67
16639. Decent (nicokart) 20 76.29 92.04 3 15.00
16640. Eternal (_eternal_) 8 76.28 87.02 6 75.00
16641. Uladzislau (vlad_13_borisov) 135 76.28 90.16 28 20.74
16642. Mishel (holosight) 824 76.27 113.70 190 23.06
16643. alisa (alisalmao) 11 76.27 89.83 5 45.45
16644. Gabe (gabrielvelarde) 2 76.27 79.21 0 0.00
16645. L (thereddone) 348 76.26 96.47 78 22.41
16646. Lorenzo (leroiken11) 40 76.26 97.84 6 15.00
16647. GIBBBBBBY (gibbous) 4 76.26 81.63 1 25.00
16648. Armo (acduston13) 3 76.26 84.67 3 100.00
16649. Swarmy (swarmy) 103 76.26 94.01 20 19.42
16650. Daniel (smurfzilla) 12 76.26 101.05 5 41.67
16651. Henry (henry_lim) 65 76.25 88.43 13 20.00
16652. Hien (hien1201) 26 76.25 83.82 5 19.23
16653. 🚀 🚀 🚀 (patrickhirsh) 610 76.25 107.91 117 19.18
16654. Halo (halo06) 1 76.25 76.25 0 0.00
16655. jurre (currythedestroyer) 2 76.25 79.70 2 100.00
16656. Theodore (theo52) 102 76.24 96.07 30 29.41
16657. Nawaf (iinkz) 13 76.24 83.79 3 23.08
16658. Dany (dany191) 1 76.24 76.24 0 0.00
16659. Nabeel (nabeelz) 809 76.24 99.79 205 25.34
16660. Pedro (simplypedro) 8 76.24 90.72 3 37.50
16661. Huy (huygtran123) 13 76.23 81.73 5 38.46
16662. TouchTyping (cheesticks) 4 76.23 94.04 2 50.00
16663. Phi (surphi10) 2 76.23 80.42 0 0.00
16664. Atreides (atreidaus) 53 76.23 92.57 13 24.53
16665. Yexsys (yexsys) 28 76.23 105.00 6 21.43
16666. 👽 (sofreakingslow) 63 76.22 93.76 16 25.40
16667. Matt Tierney (mtierney111) 32 76.22 100.14 9 28.13
16668. Archie (the_real_ace) 5 76.22 81.68 1 20.00
16669. Pongo (pongofant) 2 76.22 82.00 1 50.00
16670. Rafli (razorndasmu) 5 76.21 90.19 1 20.00
16671. Julia (mantitties) 1 76.21 76.21 0 0.00
16672. Mehedi (exilour) 1 76.21 76.21 1 100.00
16673. Kaibar (kaibar) 2 76.21 104.41 1 50.00
16674. Yash (yash23) 93 76.20 107.73 26 27.96
16675. Payton (taeilz) 1 76.20 76.20 0 0.00
16676. Erie (eridu) 21 76.20 101.65 6 28.57
16677. Marcki (marcki) 21 76.20 84.17 4 19.05
16678. Gemeine (nemememky) 138 76.20 99.22 37 26.81
16679. John (meep_beep) 132 76.19 98.47 39 29.55
16680. Mostafah (mosty295) 20 76.19 89.70 8 40.00
16681. Ethan (baldskeppyhalo) 5 76.19 79.84 0 0.00
16682. Adam (adamhitchcock) 4 76.19 96.94 1 25.00
16683. Puntlander (jamaquube) 33 76.19 87.05 8 24.24
16684. Sebastian (themanblevins) 3 76.19 80.68 1 33.33
16685. Seanpanpan (seanpanpan) 2 76.19 77.28 0 0.00
16686. Ellen (eeecp) 27 76.18 88.15 6 22.22
16687. onii-chan (cinnamonorange) 911 76.18 110.02 234 25.69
16688. Pinekkone (pinekkone) 167 76.18 97.78 48 28.74
16689. Andrew (littleangels37) 6 76.18 91.85 3 50.00
16690. tstats[xander360] (xander360) 272 76.18 101.76 59 21.69
16691. Ralo (rindt_) 13 76.18 84.63 3 23.08
16692. Kaliarti (kaliarti) 4 76.18 86.41 1 25.00
16693. Oehan (oehan) 4 76.18 83.83 0 0.00
16694. Luis (luisyt) 11 76.17 88.39 3 27.27
16695. isaac (justisaac5) 12 76.17 87.24 0 0.00
16696. guest (ks3rr) 13 76.17 83.50 4 30.77
16697. poobastank (poobastank) 44 76.17 93.24 7 15.91
16698. Patrick (patrickmcd) 1 76.17 76.17 0 0.00
16699. evsk (evsk) 1 76.17 76.17 1 100.00
16700. Fronzilla (jimmyhaffaren) 10 76.17 93.27 3 30.00
16701. Tangguh (tangguh_) 18 76.17 95.25 5 27.78
16702. neverm0r (datamagi) 188 76.17 107.05 51 27.13
16703. Znypr (znypr) 17 76.17 89.49 4 23.53
16704. Erik (onezero_) 5 76.16 89.23 1 20.00
16705. ada (smdge) 34 76.16 99.45 9 26.47
16706. Axe (axe_bicycle) 1 76.16 76.16 0 0.00
16707. Clifford (hlclifford) 4 76.16 85.93 2 50.00
16708. Heyuan (heyuan) 2 76.16 78.41 1 50.00
16709. Zain (rasnouk) 10 76.14 86.30 2 20.00
16710. Lank (franklank) 11 76.14 84.40 1 9.09
16711. Liozyyy (undead_zay) 4 76.14 80.72 2 50.00
16712. tayoshu (tayoshu) 217 76.14 93.51 57 26.27
16713. Oussama (oussamanh) 7 76.13 81.06 3 42.86
16714. Sinuro (0sty) 27 76.13 102.22 13 48.15
16715. Luao (fencerperson) 13 76.13 88.62 3 23.08
16716. Azhar (azharnawaz) 4 76.13 81.37 2 50.00
16717. Neb (cyanidetoast) 298 76.13 106.29 76 25.50
16718. gabral (gabral123) 18 76.12 92.11 4 22.22
16719. Renzo (raccon) 41 76.12 99.26 13 31.71
16720. OG3G (og3g) 8 76.12 91.46 0 0.00
16721. wichael (realwichael) 1 76.12 76.12 0 0.00
16722. Barry (oniyxx) 6 76.12 81.18 1 16.67
16723. EkBros (ekbros9_) 39 76.11 96.31 8 20.51
16724. loli (annalise00) 38 76.11 91.46 9 23.68
16725. Elia (d0inky) 7 76.10 85.91 1 14.29
16726. vinc4n (vinc4n) 5 76.10 82.33 1 20.00
16727. Hsu (eh643027) 7 76.09 84.75 1 14.29
16728. Martin (crimsonmartin) 22 76.09 86.37 4 18.18
16729. tuna (tunacore) 3 76.09 85.82 0 0.00
16730. goofy (technicuwu) 2 76.09 80.55 0 0.00
16731. Sky (skytheguyhigh) 2 76.09 78.02 2 100.00
16732. TribalAxe (darkulas) 199 76.08 96.52 50 25.13
16733. Kunal (kunal299) 51 76.08 94.11 15 29.41
16734. tstats[prashik0] (prashik0) 376 76.08 113.73 106 28.19
16735. Allan (allanwchang) 320 76.08 99.54 78 24.38
16736. Jan (janm2001) 9 76.08 87.25 2 22.22
16737. Alex (servicer) 41 76.07 96.92 12 29.27
16738. Vinson (vinsonbudiman) 9 76.07 92.56 1 11.11
16739. Ewan (erytzz) 1 76.06 76.06 0 0.00
16740. bambam (bambamshazam) 23 76.06 86.53 8 34.78
16741. BÄrsä (borje) 326 76.06 97.48 83 25.46
16742. Nizar (ahegao_hunter) 7 76.06 93.55 1 14.29
16743. jesse (jessef_9000) 26 76.06 96.94 10 38.46
16744. Achyut (achyut_india) 20 76.06 90.28 5 25.00
16745. Arnold (victorvolts_123) 473 76.05 110.59 116 24.52
16746. Christopher (baby_chou) 3 76.05 102.08 0 0.00
16747. Brandon (aceryeung) 229 76.05 109.67 53 23.14
16748. Rachin (33rachin) 7 76.05 84.62 3 42.86
16749. Vintus_Pancere (vintus_panc... 1 76.05 76.05 0 0.00
16750. Hiro-X (shaum257) 1 76.05 76.05 1 100.00
16751. GRNCheetah (grncheetah) 1 76.05 76.05 1 100.00
16752. Angus (patroc1us) 6 76.05 81.96 1 16.67
16753. TSpin (all_type) 20 76.05 87.81 4 20.00
16754. Riley (rbogren) 18 76.05 91.37 2 11.11
16755. V (xgerr) 13 76.04 87.99 6 46.15
16756. Joseph (bigboybo28) 59 76.04 93.30 21 35.59
16757. Dairy (derryne) 24 76.04 88.27 9 37.50
16758. Derrick (dummy_123) 3 76.04 78.41 0 0.00
16759. Hxwk (hxwkoncrack) 93 76.04 97.73 20 21.51
16760. Elmo (elmotlk) 7 76.04 83.37 1 14.29
16761. Tristan (crazy_bisket) 6 76.04 84.65 3 50.00
16762. Steven (engine210) 30 76.04 91.14 8 26.67
16763. POCARI (hdpocari) 13 76.03 87.72 6 46.15
16764. Frederik (drlambogamer) 22 76.03 86.46 12 54.55
16765. (palpha) 145 76.03 102.57 70 48.28
16766. Doomguy (vader_) 16 76.03 92.64 6 37.50
16767. Dominc (devdominic) 6 76.02 95.00 1 16.67
16768. gavin (gmann655) 2 76.02 79.60 0 0.00
16769. Gohan (prasadbhoir6786) 58 76.02 111.14 13 22.41
16770. Owen (owen12) 6 76.02 94.50 2 33.33
16771. Beata (beata111) 68 76.02 96.11 22 32.35
16772. Dalle (ash_ish) 35 76.01 100.43 9 25.71
16773. Koen (koen1) 1 76.01 76.01 1 100.00
16774. Zephyr (introstealer) 95 76.01 96.54 25 26.32
16775. Harshal (bitbeast18) 558 76.01 106.44 132 23.66
16776. Paolo (powlu) 70 76.00 95.56 23 32.86
16777. 「 n e X u s 」 ム (n_e_... 2 76.00 79.91 1 50.00
16778. you touch my (xdidox) 1 76.00 76.00 0 0.00
16779. Tuuli (tuulensilli) 5 76.00 82.74 1 20.00
16780. Christopher (chrizopaz) 6 75.99 87.13 2 33.33
16781. ahmed (admica) 4 75.99 81.54 0 0.00
16782. Jeremy (jmetzger55) 9 75.99 94.88 1 11.11
16783. D'Oracle (divinelyfearless) 1 75.99 75.99 0 0.00
16784. Felipe (felipflop) 6 75.99 78.41 3 50.00
16785. Clarb (clarb) 7 75.99 86.98 2 28.57
16786. Yash (yomat) 9 75.98 84.35 2 22.22
16787. Harry (harnea) 2 75.98 81.29 1 50.00
16788. hasan (hasan2000) 10 75.98 85.32 2 20.00
16789. Jimmy (dumplingrecipe) 3 75.98 84.66 0 0.00
16790. Tasty (tastytomato) 8 75.97 81.83 5 62.50
16791. Gal (galtzi1910) 2 75.97 76.03 1 50.00
16792. zoomrickyyy (zoomricky) 10 75.97 87.21 5 50.00
16793. trip (triphereon) 15 75.97 84.35 6 40.00
16794. glenu (whetherman) 2 75.97 78.86 0 0.00
16795. Clown (clownius_v) 2 75.96 77.46 1 50.00
16796. DTConks (dtconks) 24 75.96 93.58 6 25.00
16797. ethan (ethanwander83) 18 75.96 97.64 3 16.67
16798. Antonio (antoniopelayo) 3 75.96 79.51 0 0.00
16799. Danny (h4ndeye) 286 75.95 100.40 69 24.13
16800. Hugo (cortexior) 11 75.95 82.43 3 27.27
16801. Blake (raccoonswoon) 81 75.95 96.01 22 27.16
16802. rhys (rhys22199) 3 75.95 90.88 1 33.33
16803. drew (drewthejedi) 11 75.95 82.44 4 36.36
16804. @diegosalasix (reclamadcr) 5 75.95 82.39 0 0.00
16805. Hytres (hytres) 2 75.95 79.94 1 50.00
16806. Natapon (tetracarboxylic) 23 75.94 84.84 4 17.39
16807. Emilio (ayasesenpai) 9 75.94 85.47 4 44.44
16808. Random (thisistheusername0) 1 75.94 75.94 0 0.00
16809. Hello Layth :) (ayoubantita... 104 75.94 102.31 32 30.77
16810. byron (bozzarf) 363 75.94 99.43 104 28.65
16811. Jongchan (bot_chan) 56 75.94 95.03 9 16.07
16812. karim (karimkohel) 10 75.93 79.71 2 20.00
16813. Goon (dragonszn) 3 75.93 86.93 1 33.33
16814. BlueNerds (bluenerds) 2 75.92 84.44 1 50.00
16815. Francis (coronadoloser76) 44 75.92 91.72 11 25.00
16816. Spl4yceSMH (spl4yce) 77 75.91 98.77 18 23.38
16817. Kenneth (kennethraphael) 66 75.91 94.69 21 31.82
16818. DreamTheater (uniplayer) 1 75.91 75.91 0 0.00
16819. JD (ahiajd) 72 75.91 90.58 12 16.67
16820. Insta:remy_xin (xin_shadow) 2 75.91 81.96 0 0.00
16821. Phalgooni (phalguni) 3 75.90 78.51 3 100.00
16822. Vinh (ninjapro) 15 75.90 92.57 7 46.67
16823. Jenbi (jenbi) 22 75.89 89.04 3 13.64
16824. Sashreek (cygnus206) 30 75.89 94.27 11 36.67
16825. Asif (asif04) 117 75.89 90.87 33 28.21
16826. Parth (parthpsh) 44 75.89 94.56 36 81.82
16827. Nikolas (the_sleepy) 10 75.89 79.36 1 10.00
16828. tam (iufosonzz) 3 75.89 76.98 0 0.00
16829. Trent (twesley20) 14 75.89 82.77 3 21.43
16830. Erick (erickp32) 3 75.88 85.51 0 0.00
16831. Xhu (okxhu) 39 75.88 91.51 11 28.21
16832. William (williamy34) 76 75.88 91.46 23 30.26
16833. Trevor (trevman) 4 75.88 83.88 0 0.00
16834. Ray (castello666) 2 75.88 75.98 0 0.00
16835. Ken (netski1400) 115 75.87 93.05 28 24.35
16836. Rema1000 (rqsxxth) 6 75.87 94.39 3 50.00
16837. SeppahBaws (seppahbaws) 6 75.87 91.02 1 16.67
16838. Blake (blake4605) 122 75.87 93.24 35 28.69
16839. june (alltoowell) 2 75.87 79.46 0 0.00
16840. Pacham (pachamcham) 114 75.86 91.54 41 35.96
16841. Kyle (asianshroudy) 5 75.86 83.46 2 40.00
16842. nailfc (nailfc) 8 75.86 80.54 3 37.50
16843. Jarrett (typeguy14) 61 75.85 93.35 24 39.34
16844. hs (hakanserce) 38 75.85 91.08 8 21.05
16845. fuc (ihumpdogs) 7 75.85 80.47 3 42.86
16846. Gowtham (triforceofpi) 4 75.85 83.06 2 50.00
16847. James (jrm371) 32 75.85 103.51 11 34.38
16848. Joseph (phantom5k) 8 75.83 82.85 4 50.00
16849. Elliott (s1ldafort) 83 75.83 95.84 23 27.71
16850. the sun is over asia now (n... 17 75.83 91.35 1 5.88
16851. OmicronVirus (deathisnthend) 378 75.83 96.49 92 24.34
16852. Ralph (stunnar) 4 75.83 81.23 0 0.00
16853. Hashrin (hashrin) 12 75.83 94.51 4 33.33
16854. Bennett (bnnttnwhk) 209 75.83 95.27 50 23.92
16855. Jacobo (inztincz) 905 75.82 117.56 224 24.75
16856. Peter (upsala_koy) 127 75.82 92.01 33 25.98
16857. Jay (jjthomso_yt) 5 75.82 79.49 1 20.00
16858. Pranaya (pranaya989) 2 75.82 78.81 1 50.00
16859. Х. (falcon0338) 10 75.82 86.27 5 50.00
16860. doggie (doggie0985) 23 75.82 97.69 7 30.43
16861. timmy (timmy14) 33 75.81 88.63 11 33.33
16862. Airree (airree) 9 75.81 81.59 4 44.44
16863. Ekshore (ekshore) 12 75.81 92.10 3 25.00
16864. Morgan (kryptik_boogie) 1 75.81 75.81 0 0.00
16865. Walden (walnutwaldo20) 11 75.81 122.35 3 27.27
16866. OneEyedMac (rex_rex) 52 75.80 102.57 15 28.85
16867. Eesa (eesa10) 16 75.80 88.29 4 25.00
16868. Bryan (bryangne) 9 75.80 92.70 2 22.22
16869. gleb (glebusking) 5 75.79 80.72 0 0.00
16870. Theodoros (theodoros_1234) 2 75.79 81.15 1 50.00
16871. PMC (pmcc) 642 75.78 105.79 144 22.43
16872. cryo. (quaintoutcast) 5 75.78 84.86 4 80.00
16873. JOE (joe345) 5 75.78 93.74 0 0.00
16874. Kaloyan (doublelv) 5 75.78 80.47 2 40.00
16875. Eico (eico66) 33 75.77 90.03 11 33.33
16876. sigit (licardi) 77 75.77 96.00 23 29.87
16877. bach (shuriken) 164 75.77 92.07 41 25.00
16878. wpmhog (wpmhog) 255 75.77 99.93 55 21.57
16879. ZULU (zultrixz) 6 75.77 82.78 2 33.33
16880. Vivi (veevaa) 26 75.77 88.21 8 30.77
16881. Umair (umair121) 145 75.76 95.98 34 23.45
16882. Aidan (slippp3r) 7 75.76 83.61 1 14.29
16883. ColeMacca (weenyboi) 32 75.76 89.97 8 25.00
16884. Des (desl) 1,638 75.76 114.00 458 27.96
16885. Car (ufoes) 41 75.76 93.51 7 17.07
16886. namln.com (luunhatnam) 3 75.76 78.23 0 0.00
16887. Jamie (jelly_jam_pudding) 15 75.75 94.00 4 26.67
16888. Anthony (anthonydsr) 8 75.75 87.91 3 37.50
16889. RAAM (raam_d_prince) 250 75.74 112.07 57 22.80
16890. 雲煙成雨 (1eonardo) 1,167 75.74 108.83 302 25.88
16891. Exsuz (exsuz) 1 75.74 75.74 1 100.00
16892. Hank (purplehank7) 4 75.74 78.17 0 0.00
16893. Areppa (areppa) 91 75.73 92.87 12 13.19
16894. Sawyer (sawyer_) 7 75.73 84.67 4 57.14
16895. Alexander (solchild) 22 75.73 85.78 8 36.36
16896. Nick (scienceman57) 1 75.73 75.73 0 0.00
16897. Nyrico (angelocuartel) 3 75.73 87.50 1 33.33
16898. Alex (buttonmeister) 9 75.73 88.94 4 44.44
16899. Utku (utkumaden) 19 75.71 89.14 5 26.32
16900. Lois (vieze_rat) 5 75.71 83.59 0 0.00
16901. nat (vanilla7) 21 75.71 94.08 9 42.86
16902. Tony (muuyfeo) 3 75.71 79.61 0 0.00
16903. joshi (jehoshuah) 3 75.71 82.75 0 0.00
16904. Felix (felizocker) 93 75.70 99.48 20 21.51
16905. Junito (exter72) 21 75.70 97.03 6 28.57
16906. James (james123wu) 101 75.70 101.56 24 23.76
16907. juan (juanjaho) 13 75.70 91.69 2 15.38
16908. Dragos (dragoselu) 3 75.69 95.00 2 66.67
16909. lost.zombie (lostzombie) 6 75.69 80.83 3 50.00
16910. Jacob (gaycob) 10 75.69 83.48 1 10.00
16911. Matthew (matty_venus) 9 75.69 88.12 2 22.22
16912. M (iamake) 97 75.69 93.02 24 24.74
16913. iron (iron_pickaxe) 14 75.68 90.47 3 21.43
16914. JONAS (___jonas___) 4 75.68 78.71 0 0.00
16915. Joshua (_f1shy_) 6 75.68 85.51 1 16.67
16916. Pavan (pa163361) 76 75.67 90.46 43 56.58
16917. Juan (juanma9191) 1 75.67 75.67 1 100.00
16918. Mohamad (mohamadasghari) 219 75.67 107.10 50 22.83
16919. Rankoll (rankoll) 30 75.66 86.90 10 33.33
16920. Jack (putridllama) 5 75.66 80.70 0 0.00
16921. garry (ganesh1998) 476 75.66 95.27 134 28.15
16922. beroo (_nwahz) 21 75.66 91.21 11 52.38
16923. teddy (teddyweaber) 1 75.66 75.66 0 0.00
16924. Jayzee (simpy_nimble) 6 75.66 92.11 5 83.33
16925. Rimuru (ashborn_tempest) 15 75.66 88.56 3 20.00
16926. eurobeats (super0) 8 75.66 103.85 1 12.50
16927. rota (rota22) 7 75.66 80.79 1 14.29
16928. sudden (explosionsarenice) 11 75.65 87.12 3 27.27
16929. Shea (shea378) 4 75.65 89.61 0 0.00
16930. Edward (edwmai18) 9 75.64 98.80 3 33.33
16931. Sarawr (mooneclipsedragon) 6 75.64 80.39 1 16.67
16932. Sakura (foreheady) 19 75.64 84.72 1 5.26
16933. Tabitha (tabi87) 1 75.64 75.64 0 0.00
16934. iChoke@TheEnd (vidivinci) 380 75.64 101.99 102 26.84
16935. imslowaf (imslowafuwu) 26 75.64 89.54 8 30.77
16936. Khairosh (khairosh) 7 75.64 87.50 3 42.86
16937. ArkoSammy12 (arkosammy_1208) 99 75.64 105.60 27 27.27
16938. Ivan (kuleee) 3 75.63 79.89 1 33.33
16939. gaule (gaule) 3 75.63 84.73 1 33.33
16940. alem (gewaltxd) 11 75.63 91.61 7 63.64
16941. Jace (jaceypoop) 4 75.63 78.98 0 0.00
16942. some___loner (noble_addiction) 16 75.62 94.11 5 31.25
16943. kaede (kaede1) 28 75.62 94.24 3 10.71
16944. Balmorax (balmorax) 499 75.62 101.56 141 28.26
16945. sherry (sherry4) 130 75.61 93.31 37 28.46
16946. Gon (frixgon) 1,260 75.61 98.65 316 25.08
16947. Gema (hakushoddd) 1 75.61 75.61 0 0.00
16948. Barry (barry21) 55 75.61 90.86 9 16.36
16949. Benjamin (bigbentypes246) 56 75.61 90.98 15 26.79
16950. Guilherme (luxidu) 35 75.60 86.45 11 31.43
16951. Evelyn (evelyn_mh) 16 75.60 100.92 4 25.00
16952. miranda (tfond) 40 75.60 83.95 10 25.00
16953. Pradip (pradipg) 17 75.60 109.39 13 76.47
16954. Sharifa (sharifajpg) 5 75.60 81.40 3 60.00
16955. An (pastwords) 44 75.59 93.48 16 36.36
16956. Illya (maldron) 250 75.59 94.95 54 21.60
16957. Conk (conkermilk) 2 75.59 92.15 1 50.00
16958. Tapioca (davidararipe) 61 75.58 93.62 19 31.15
16959. name (username04) 40 75.58 94.66 10 25.00
16960. Moe (moetez1) 7 75.58 82.91 3 42.86
16961. zzzzz (amzzzz771) 9 75.58 91.75 0 0.00
16962. hunter (hunter667) 9 75.57 86.09 4 44.44
16963. Yarnell (ytoei) 23 75.57 92.09 5 21.74
16964. XPmain (thehashtag) 6 75.57 84.63 2 33.33
16965. Tommy (sparkxd) 17 75.57 97.13 3 17.65
16966. Jayden (agdplayer64x) 7 75.57 91.94 3 42.86
16967. Exxon (exxon) 3 75.56 83.44 1 33.33
16968. FootedPear (ryanpear0) 145 75.56 99.15 40 27.59
16969. Patrick (ptarka05) 6 75.56 87.83 2 33.33
16970. Anirudh (flaes) 1 75.56 75.56 0 0.00
16971. Usman (grim_09) 131 75.56 98.51 49 37.40
16972. Mimsqueeze (mimsqueeze) 23 75.56 94.60 6 26.09
16973. Ryan (gurkenglas9) 6 75.55 84.24 1 16.67
16974. Irfan (irfanshaikh) 5 75.54 84.76 2 40.00
16975. Anit (anit2007) 12 75.54 87.36 5 41.67
16976. Jack (j4ck6643) 9 75.54 82.97 5 55.56
16977. aa (elk111) 14 75.54 91.55 3 21.43
16978. Josh (sorry_typeracer) 16 75.54 94.59 5 31.25
16979. Junaid (junaidahmad3) 65 75.54 96.89 9 13.85
16980. Tevanuk (tevanuk) 3 75.54 78.75 0 0.00
16981. John (enhoj22) 41 75.54 84.41 8 19.51
16982. LoyalPotato (loyalpotato) 17 75.54 86.17 4 23.53
16983. rambalaji (rambalaji) 33 75.54 98.37 11 33.33
16984. Jackson (jacksonks) 2 75.54 95.74 2 100.00
16985. Matthew (msloehr) 11 75.53 84.88 2 18.18
16986. psyklo10 (psyklo10) 3 75.53 80.24 2 66.67
16987. Jaemeriiaa (jaemeriiaa) 6 75.53 88.69 1 16.67
16988. faster (jjzxc1) 16 75.52 81.13 3 18.75
16989. Malthe (malthesers) 1 75.52 75.52 0 0.00
16990. Matthew (befurl) 13 75.52 97.63 5 38.46
16991. Markus (yoshicp) 13 75.52 92.36 6 46.15
16992. boo (lolitsme) 27 75.52 88.70 6 22.22
16993. Harry (jeeeerrrpop) 14 75.51 87.90 8 57.14
16994. Daniel (beefichor) 110 75.51 90.58 22 20.00
16995. Eunmin (mgood2) 1 75.51 75.51 0 0.00
16996. Mark (exec_prod) 6 75.51 82.70 1 16.67
16997. jojo (spacelion121319) 97 75.50 99.53 23 23.71
16998. deniz (dendiz) 10 75.50 91.80 2 20.00
16999. ⓔⓓⓐⓝⓘ (edaniguy90) 14 75.50 90.57 7 50.00
17000. Sophie (lesophie) 2 75.50 78.46 1 50.00
17001. Jimmy (jimster123) 182 75.50 93.43 52 28.57
17002. ron (ronj23) 48 75.50 89.81 9 18.75
17003. Noel (nowellrl) 4 75.50 85.22 0 0.00
17004. Ryo (ryonamba) 24 75.49 94.31 3 12.50
17005. JRT (jrt829) 75 75.49 87.67 15 20.00
17006. Big Daddy (chef_yeet) 6 75.49 82.76 2 33.33
17007. M (xyx2x) 1 75.49 75.49 0 0.00
17008. jayden (dershlibob) 5 75.49 81.81 2 40.00
17009. tropics (tropicswpm56) 32 75.48 88.81 11 34.38
17010. fastest (_fastest_typist) 29 75.48 96.56 11 37.93
17011. Caleb (cabona) 5 75.48 87.08 3 60.00
17012. Ramazan (zheksenov) 6 75.48 88.08 2 33.33
17013. Luke (luckersx) 1 75.48 75.48 0 0.00
17014. Musty (muysty) 2 75.48 84.18 1 50.00
17015. Alan (erical77) 518 75.47 100.47 125 24.13
17016. proovend (proovend) 4 75.47 77.23 1 25.00
17017. Hoshi (b1ink) 19 75.47 90.90 6 31.58
17018. Akash (swfu_akash) 821 75.47 106.67 221 26.92
17019. Gabbie (gg13) 45 75.47 91.30 9 20.00
17020. Anton (tricksterequiem) 4 75.46 91.43 2 50.00
17021. Ben (achillesari) 3 75.46 79.07 0 0.00
17022. Rahul (rahulburrito) 65 75.46 105.93 13 20.00
17023. Mohit (themp3dark) 6 75.45 82.12 3 50.00
17024. Jerome (jerome251998) 68 75.45 93.36 14 20.59
17025. Bryce (flipno) 18 75.45 84.72 3 16.67
17026. Fyter (fyter) 20 75.44 87.74 2 10.00
17027. A-Dizzle (adizzle) 3 75.44 87.05 2 66.67
17028. lindsey (lindsey94) 4 75.44 79.66 0 0.00
17029. Endku (endku) 9 75.43 85.21 1 11.11
17030. Hue (hue_man) 112 75.43 88.83 27 24.11
17031. joshua ray (j2samodal) 5 75.43 80.29 2 40.00
17032. Anto (babafroga) 10 75.43 82.58 6 60.00
17033. Tuong (tuong_slow) 183 75.42 104.24 59 32.24
17034. M (mileung) 106 75.42 95.23 30 28.30
17035. Appel (appelboer) 33 75.42 93.39 11 33.33
17036. Shohan (ansshohan) 96 75.41 95.52 23 23.96
17037. Anthony (avald30) 10 75.41 86.72 3 30.00
17038. Bas (basawasa) 204 75.41 98.24 55 26.96
17039. Martin (martin_juan) 12 75.41 85.51 3 25.00
17040. Vaj (taychee) 403 75.40 105.23 105 26.05
17041. Jacob (krucinskij) 18 75.40 87.78 4 22.22
17042. Farbod (varbov) 1 75.40 75.40 1 100.00
17043. Micaldos (micaldos) 6 75.40 85.02 2 33.33
17044. MaxVerstappen33 (newrookie15) 421 75.40 116.69 123 29.22
17045. No (jopear) 81 75.39 89.26 17 20.99
17046. Rohan (dragami) 75 75.39 110.37 20 26.67
17047. digimastersp (digimastersp) 6 75.39 81.68 5 83.33
17048. ludwigg (froggg) 42 75.39 100.33 6 14.29
17049. Marko (greasy_feta_cheese) 4 75.39 81.54 1 25.00
17050. ama (pcfcace) 11 75.39 83.51 2 18.18
17051. Daivat (daivatvaishnani) 83 75.39 89.09 19 22.89
17052. Batkhishig (btkshg) 36 75.39 86.78 9 25.00
17053. Lonzo (lonzoballs) 5 75.39 83.39 0 0.00
17054. Ezel (aldidoanta) 1 75.39 75.39 0 0.00
17055. PAT (pat0216) 121 75.39 93.33 31 25.62
17056. Bikram (wood_cutter) 181 75.38 92.39 53 29.28
17057. Alaa (alaaalmasri00) 11 75.38 84.42 3 27.27
17058. Leith (leith_) 15 75.38 95.65 12 80.00
17059. Lazy (flashinlazer) 1 75.38 75.38 0 0.00
17060. Cuong (nespro) 3 75.38 80.51 0 0.00
17061. Leyton (leytons) 4 75.38 92.01 2 50.00
17062. Starfox (tommyhlu) 4 75.37 94.09 1 25.00
17063. Mevin (mevinn) 9 75.37 87.74 3 33.33
17064. Muhd Khalid (lid313) 97 75.37 95.70 25 25.77
17065. Eunice (eunice20) 6 75.37 80.66 3 50.00
17066. Nicky (wownickywow) 8 75.37 83.30 3 37.50
17067. Plohka (plohka) 17 75.36 89.86 6 35.29
17068. Jonas (jokoko) 2 75.36 85.89 0 0.00
17069. Captain (captainrick) 2 75.36 86.07 1 50.00
17070. Steve (stevie169) 164 75.35 91.97 33 20.12
17071. Bram (bramster007) 5 75.35 82.51 1 20.00
17072. Rick (rickdicker) 4 75.35 87.16 4 100.00
17073. emo (omylime) 3 75.35 81.27 1 33.33
17074. Zunbileg (ozbileg) 45 75.35 90.81 14 31.11
17075. Orm Tammemäe (romex123) 5 75.35 83.40 2 40.00
17076. A. Moe Gus (iltg) 31 75.34 90.82 10 32.26
17077. Kei (aznkei) 75 75.34 90.66 17 22.67
17078. Roger (rogergnay) 1 75.34 75.34 0 0.00
17079. Bren (bnern) 17 75.34 89.60 4 23.53
17080. Junaed (junaed_siam) 3 75.34 81.82 1 33.33
17081. Ishaque (ishaque) 58 75.33 88.93 12 20.69
17082. Teuku (hahasrul) 14 75.33 91.06 4 28.57
17083. akisakura (fuyusakura) 1 75.33 75.33 0 0.00
17084. Anthony (ant333man) 11 75.33 83.16 3 27.27
17085. George (tormanovi) 357 75.32 96.30 83 23.25
17086. cn_vbs (cn_vbs) 1 75.32 75.32 0 0.00
17087. ChivalKnight (chivalknight) 31 75.32 88.79 8 25.81
17088. Umbi (umbe10) 13 75.32 87.85 7 53.85
17089. Bakerman (mthnglac) 3 75.32 79.85 2 66.67
17090. mithilesh (mithilesh3110) 7 75.31 82.42 2 28.57
17091. sion (crossblade06) 34 75.31 87.13 11 32.35
17092. Sameer (firefoxqb) 185 75.31 106.14 48 25.95
17093. Kollol (cyanomax) 2 75.31 85.60 2 100.00
17094. Ron (swavyron) 1 75.31 75.31 0 0.00
17095. zensei (_zensei_) 8 75.30 82.15 0 0.00
17096. iOrange (orangec) 2 75.30 77.45 0 0.00
17097. Ogg (ogg_) 48 75.30 89.29 16 33.33
17098. Nyambat (nyambat) 7 75.30 81.84 2 28.57
17099. tstats[aisultan] (aisultan) 19 75.30 92.89 4 21.05
17100. spoon (spooderrr) 46 75.30 96.38 6 13.04
17101. vukeli (vukeli) 4 75.30 79.03 1 25.00
17102. Robert (hypersnitch) 13 75.28 95.13 2 15.38
17103. Martin (gibom) 35 75.28 87.30 10 28.57
17104. Jeremy (orenthion) 1 75.28 75.28 1 100.00
17105. Ikramuzzaman (2017331054) 5 75.28 82.53 1 20.00
17106. Aditya (aditya2712) 241 75.28 97.27 62 25.73
17107. Philipp (haxaffe) 5 75.27 79.60 2 40.00
17108. Ian (iantu) 227 75.26 92.57 51 22.47
17109. Mike (fuccuppo) 9 75.26 88.22 1 11.11
17110. Kijurin (kijurin) 37 75.26 90.83 12 32.43
17111. Justin (orccrusher99) 14 75.25 91.81 1 7.14
17112. Alex (running_wind) 6 75.25 85.79 0 0.00
17113. Slacky (slackyisbacky) 1 75.25 75.25 1 100.00
17114. Satvik (satvikbansal) 4 75.25 81.22 0 0.00
17115. Fra (bachoseven) 1 75.25 75.25 1 100.00
17116. Daniel (daniel1212) 10 75.25 80.90 2 20.00
17117. Frosted (frosted_bruh) 45 75.24 89.17 7 15.56
17118. Wayne (boucherwayne78) 7 75.24 87.88 6 85.71
17119. SenPIe (thesenpie) 23 75.24 88.77 5 21.74
17120. rosie (paparosie) 5 75.24 82.19 3 60.00
17121. Andy (akapgan) 55 75.24 94.72 15 27.27
17122. bobaglow (boabglow) 23 75.24 94.87 3 13.04
17123. Sasha (dtelesman1) 8 75.24 86.18 1 12.50
17124. Veena (venawartmander) 4 75.24 80.21 1 25.00
17125. josca (josca) 87 75.23 92.86 32 36.78
17126. Nick (vergil_00) 29 75.23 93.45 11 37.93
17127. Daniel (tempguan) 563 75.23 97.60 143 25.40
17128. Andy (andyc716) 3 75.23 80.89 0 0.00
17129. Zach (zachattack8910) 19 75.23 92.82 2 10.53
17130. Michael Loh (mclec950125) 27 75.23 84.45 7 25.93
17131. Jason (nooneuknow) 25 75.22 85.66 5 20.00
17132. Sam (asianshampoo) 3 75.22 79.91 2 66.67
17133. kingcokes (kingcokes) 25 75.22 89.36 3 12.00
17134. Tanya (tyarbrough71) 20 75.22 89.96 4 20.00
17135. Shivanju (shivanju) 198 75.21 91.37 47 23.74
17136. gusss (ursu718) 3 75.21 76.17 2 66.67
17137. Numpunk (numpunk) 10 75.21 89.86 4 40.00
17138. john (kingtypemaster) 63 75.21 90.36 31 49.21
17139. J (jihoomoon) 135 75.21 94.54 36 26.67
17140. Garamonde (garamonde) 30 75.21 90.51 10 33.33
17141. billie (eillib) 102 75.20 94.93 19 18.63
17142. Luka (soleesoki) 200 75.20 102.31 58 29.00
17143. Pranav (bodiez) 42 75.20 101.24 16 38.10
17144. Potato (p0tat0fri3s) 1 75.20 75.20 0 0.00
17145. Alex (aleex) 4 75.20 81.36 1 25.00
17146. Jude (joodels) 7 75.20 78.92 3 42.86
17147. Joe (joenuts007) 3 75.20 78.09 0 0.00
17148. Rommy (arbantas) 7 75.19 84.28 1 14.29
17149. Jacob (jacobr2d3) 71 75.19 98.05 24 33.80
17150. Aarsh (upward_leap) 3 75.18 85.29 0 0.00
17151. Kevin (gtwatt) 20 75.18 86.56 8 40.00
17152. Đình (dinhhhaii51) 17 75.18 91.60 2 11.76
17153. Alan (alan001) 356 75.18 101.81 82 23.03
17154. Vaibhav (vibhix) 29 75.17 90.60 6 20.69
17155. lurak (lurak2131) 287 75.17 97.18 69 24.04
17156. Duc (setokouse) 27 75.17 91.05 11 40.74
17157. Derek (_de_re_k_) 6 75.17 83.59 1 16.67
17158. Hafiz (huseynoff) 160 75.17 94.31 44 27.50
17159. prgobet (prgobet) 64 75.17 97.38 26 40.63
17160. Shockacs (shockacs) 2 75.17 79.11 0 0.00
17161. Foole (rizzbor) 61 75.17 87.89 15 24.59
17162. Arzenith (arzou) 15 75.16 91.02 9 60.00
17163. jveee (jv223) 109 75.16 94.50 30 27.52
17164. Shmoo! (kingshmoo) 9 75.16 91.79 2 22.22
17165. fuad036 (fuad036) 6 75.16 78.77 6 100.00
17166. Tezzori (tezzori_ikki) 3 75.16 83.44 1 33.33
17167. shumkar (shbarpiev) 16 75.16 92.56 2 12.50
17168. Evan (thewhailure) 13 75.16 85.95 3 23.08
17169. Dylan (tlwnl) 2 75.16 79.29 0 0.00
17170. szxlfik (szxlfik) 3 75.15 78.71 2 66.67
17171. Michal (fly_you_fools) 11 75.15 85.18 6 54.55
17172. Krisztian (ktypist_) 4 75.15 76.73 1 25.00
17173. Leonid (leosmrdljak) 107 75.15 95.88 55 51.40
17174. Ben (wippidy) 37 75.15 91.62 9 24.32
17175. Gagan Deep (gagan0123) 4 75.15 88.11 1 25.00
17176. Nyxxiee (nyxxiee_) 6 75.15 81.54 3 50.00
17177. Owen (spectrixbruh) 6 75.14 90.72 1 16.67
17178. Ham (hwu164) 2 75.14 75.69 0 0.00
17179. monkeytypebeast (bestworldw... 1 75.14 75.14 0 0.00
17180. yinlor (yinlor) 13 75.14 99.66 5 38.46
17181. Keti (keti_hawk) 25 75.14 89.15 4 16.00
17182. Christian (trotuele) 38 75.14 88.13 7 18.42
17183. chaotix (mcomm7) 33 75.13 89.31 6 18.18
17184. Krystin (spetz) 7 75.13 83.69 2 28.57
17185. BlazeAries (blaze_aries) 30 75.13 87.61 8 26.67
17186. tstats[kvb826] (kvb826) 156 75.13 98.35 37 23.72
17187. Raphael (oxidation) 1 75.12 75.12 0 0.00
17188. Nils (snils) 206 75.12 103.87 49 23.79
17189. xxav (xxav) 52 75.12 94.39 11 21.15
17190. emma (emmmmmmmaaaaa) 17 75.12 86.68 1 5.88
17191. GuzaSama (guzasama) 2 75.12 89.24 1 50.00
17192. Tareque Hasan (tahsin24) 2 75.12 79.61 1 50.00
17193. Kiryu (kiryugozi) 75 75.11 105.19 18 24.00
17194. Eric (ericnosarcasm) 338 75.11 99.88 82 24.26
17195. Tom (twatters) 117 75.11 102.40 31 26.50
17196. Aoden (aoden) 4 75.11 94.65 0 0.00
17197. void (soberr) 10 75.10 84.99 3 30.00
17198. Silvia (silvia_thenan) 21 75.10 95.89 6 28.57
17199. Kc (kchehez) 48 75.10 94.90 6 12.50
17200. Sondr (pngstr) 46 75.10 88.56 11 23.91
17201. ng (minhtuhay123) 27 75.09 90.87 6 22.22
17202. Peter (hoopla27) 12 75.09 89.49 3 25.00
17203. Patrick (ricccccckkkkkk) 195 75.08 103.73 56 28.72
17204. Emre (emre0) 16 75.08 85.62 3 18.75
17205. Jack (dante17) 8 75.08 82.12 1 12.50
17206. Haniel (ivious) 197 75.08 100.08 45 22.84
17207. Duukki (duukki) 6 75.08 93.65 2 33.33
17208. zerotwo727 (4itch) 1 75.08 75.08 1 100.00
17209. xCocoaCrazy (xcocoacrazy) 23 75.08 93.17 9 39.13
17210. kaqzea (kaqzea) 5 75.08 86.35 2 40.00
17211. Cris (cris001) 3 75.07 75.92 2 66.67
17212. Azamat (div2der) 66 75.07 98.16 18 27.27
17213. ildgaf (ildgaf) 6 75.07 82.35 0 0.00
17214. coen (vivalad) 1 75.07 75.07 1 100.00
17215. Vanser (paskerdewdz) 1 75.07 75.07 0 0.00
17216. cobrobdob (rocketjuice) 2 75.07 77.04 1 50.00
17217. Nate (legendward) 2 75.07 79.96 1 50.00
17218. Pavan (kpavankotesh) 24 75.07 92.38 11 45.83
17219. Matous (pelisek16) 11 75.06 85.32 4 36.36
17220. Ayush (the_dealer) 11 75.06 89.50 2 18.18
17221. John (linkstart15) 17 75.06 98.57 3 17.65
17222. Claire (claire_t_bear) 13 75.06 95.21 4 30.77
17223. Jacob (destroyer183) 13 75.06 90.90 4 30.77
17224. uxiator (uxiator) 2 75.06 78.11 1 50.00
17225. Aaron (aasworth) 40 75.05 94.35 10 25.00
17226. vroom (ch_alex) 6 75.05 91.35 2 33.33
17227. Oliver (olliebe4r) 1 75.05 75.05 0 0.00
17228. Gary (gary_dahmer) 10 75.04 86.38 2 20.00
17229. Pervasive (pervasive) 3 75.04 82.02 2 66.67
17230. wigglyworm (wigglyworm) 11 75.04 92.04 2 18.18
17231. Will (lynxwill_bov) 76 75.04 103.88 14 18.42
17232. Toonafisch (toonafisch) 74 75.04 94.90 19 25.68
17233. Chris (cascade_) 72 75.03 95.11 14 19.44
17234. Brian (brianhsu7476) 150 75.03 87.85 46 30.67
17235. Sujith (sujith2005) 3 75.03 85.45 0 0.00
17236. gyfan10 (gyfan10) 37 75.03 93.31 8 21.62
17237. Dany (danypeter) 17 75.03 93.78 11 64.71
17238. Riley (riela_) 18 75.02 92.74 6 33.33
17239. Heather (heannn) 171 75.02 100.65 44 25.73
17240. none_of_ur_business (underc... 59 75.02 95.70 16 27.12
17241. Brody (echo3006) 163 75.02 112.02 36 22.09
17242. Ryan (ryan2723) 351 75.02 92.49 55 15.67
17243. Andrew (andrewwin2003) 61 75.02 94.54 16 26.23
17244. Type (cainvelasquez) 9 75.01 87.46 6 66.67
17245. Jaden (ggjaden) 8 75.01 88.57 1 12.50
17246. Sam687 (samuel687) 3 75.01 78.20 3 100.00
17247. ryouinuma (ryouinuma) 7 75.01 82.12 0 0.00
17248. Marcos (marcosjlr) 109 75.01 88.71 19 17.43
17249. HamsterSales (hamstersales) 8 75.01 88.02 2 25.00
17250. Anvar (only_aloner) 294 75.01 93.34 101 34.35
17251. Tech (ninja_typer) 173 75.01 94.87 45 26.01
17252. Brendo (rebelx) 8 75.01 82.25 0 0.00
17253. Noah (noahbradderz) 10 75.01 90.58 1 10.00
17254. icy (icyxo) 10 75.00 84.26 4 40.00
17255. Thao (ncthao) 81 75.00 98.37 31 38.27
17256. Hai (haitathoc) 193 75.00 97.12 37 19.17
17257. M (kapsa) 53 75.00 87.15 11 20.75
17258. Wilbert (wil_bwrt) 3 74.99 82.16 0 0.00
17259. ghaws (ghaws) 279 74.99 97.04 79 28.32
17260. lap (roeloflucka2) 10 74.99 85.86 2 20.00
17261. Ai (aibah) 392 74.98 107.26 108 27.55
17262. Bob (echonex) 11 74.98 85.88 6 54.55
17263. Aaryan (tvirus) 1 74.98 74.98 1 100.00
17264. Andy (astraay) 1 74.97 74.97 1 100.00
17265. Nayely (nayelytyperacer) 7 74.96 96.47 1 14.29
17266. Luke (lukechevy) 14 74.96 84.94 2 14.29
17267. sks (sks6174) 302 74.96 100.54 73 24.17
17268. vioco (vioco) 15 74.96 85.06 1 6.67
17269. Kevin Rendell (hankami37) 76 74.96 92.66 19 25.00
17270. Agilan (agilan2001) 4 74.96 77.64 1 25.00
17271. hhh (hhhaaahhhaa) 12 74.95 89.15 3 25.00
17272. Sean (sfeendog) 24 74.95 86.11 1 4.17
17273. Braden (brad9181) 40 74.95 93.51 10 25.00
17274. asdas (strexle) 4 74.95 78.63 3 75.00
17275. null (null_zjx) 2 74.95 79.41 1 50.00
17276. My (z0rtzp1zku) 27 74.94 87.09 9 33.33
17277. nicole (nkkicole) 43 74.94 94.36 10 23.26
17278. HYP34 (hyper_typer200) 3 74.94 78.12 1 33.33
17279. Jasper (kaasisbaas) 5 74.94 79.07 2 40.00
17280. Carlos (user0x539) 1 74.94 74.94 1 100.00
17281. Caleb (yjcc) 6 74.94 93.52 1 16.67
17282. Sageofidiocy (sageofidiocy) 4 74.94 80.57 0 0.00
17283. Chris (cuntychris) 2 74.94 77.32 2 100.00
17284. Lil J (notlilj) 5 74.93 87.41 0 0.00
17285. gixxer (somewhat_noob) 31 74.93 89.03 5 16.13
17286. Matthew (solosice) 2 74.93 76.45 1 50.00
17287. Athos (cdelafere) 8 74.93 83.14 1 12.50
17288. Gage (gagedorl) 6 74.93 90.86 1 16.67
17289. PATH (aperson2003) 6 74.93 83.80 0 0.00
17290. s3yf (unclemeat) 115 74.93 95.88 33 28.70
17291. Chris (hotdogdaniel) 4 74.93 79.39 1 25.00
17292. debwl (dbwls) 3 74.92 78.21 1 33.33
17293. Paul (_separate) 3 74.92 83.57 0 0.00
17294. KaptainFroggy_YT (jellybean... 10 74.92 86.08 1 10.00
17295. Edgar (sgtplasma) 4 74.92 91.80 1 25.00
17296. Insulin (insulingaming) 21 74.91 85.61 7 33.33
17297. Darren (skootskii) 6 74.91 91.46 2 33.33
17298. Andy (tempestxciii) 48 74.91 92.10 29 60.42
17299. Kaya Toast (kaya_toast) 3 74.91 101.09 3 100.00
17300. Ternimus (ternimus) 25 74.91 83.79 10 40.00
17301. 1337 (dotnet) 8 74.91 83.01 3 37.50
17302. Tir8 (tir8) 18 74.90 88.75 5 27.78
17303. Jo/yf (yousseff) 17 74.90 86.04 7 41.18
17304. Ivusin (ivusin) 5 74.90 82.12 0 0.00
17305. SchizoKami (notaniki) 8 74.90 80.70 2 25.00
17306. Ab (abdir) 166 74.90 106.79 40 24.10
17307. Bob (baine001) 34 74.90 95.54 5 14.71
17308. Rodolfo (rojunman) 65 74.89 90.30 20 30.77
17309. V (vvww) 5 74.89 85.30 1 20.00
17310. Alex (alexaaaaa) 18 74.89 88.16 3 16.67
17311. Lucas (tublessdart) 3 74.89 76.74 1 33.33
17312. rryann (rrrrryannnnnn) 5 74.89 77.90 0 0.00
17313. Elo (eloh) 340 74.88 94.57 80 23.53
17314. Mahdi (mahdiranjbar) 22 74.88 86.31 1 4.55
17315. SoupThyme (soupthyme) 8 74.88 88.17 6 75.00
17316. shravan (gammarays) 25 74.87 91.22 6 24.00
17317. Gerald (tycholoko) 17 74.87 98.40 4 23.53
17318. Bacte (bacte73) 24 74.87 86.26 9 37.50
17319. Andrew (poor_hobo) 6 74.87 81.45 0 0.00
17320. GS PVH (skyvn97) 4 74.87 90.95 4 100.00
17321. scxrpion (scxrpion) 2 74.87 86.74 1 50.00
17322. thinkingds (sohandeshar) 134 74.86 90.29 30 22.39
17323. Thomas (thomasbd) 2 74.86 84.41 2 100.00
17324. IAGamingWay (iagamingway) 19 74.86 87.68 14 73.68
17325. Lawrence (mrlab) 36 74.86 90.63 7 19.44
17326. Francesco (francesco_vergol... 2 74.85 75.62 0 0.00
17327. martin (tredecies) 1 74.85 74.85 0 0.00
17328. D1eg8 (drm86) 12 74.85 86.61 5 41.67
17329. yashwi (potato0o0) 106 74.85 103.60 30 28.30
17330. Trying to get 98% consisten... 166 74.85 96.25 40 24.10
17331. Stelister (stelister) 235 74.84 96.01 71 30.21
17332. tstats[jaadunath] (jaadunath) 29 74.84 90.85 8 27.59
17333. MuiePonta (pelerin) 6 74.84 90.20 1 16.67
17334. Raghavan G V (raghavangv) 54 74.83 96.79 15 27.78
17335. Andrei (rooky127) 3 74.83 82.64 2 66.67
17336. Nathan (light_mqueen) 2 74.83 89.68 1 50.00
17337. George (georgedmi) 12 74.83 83.00 0 0.00
17338. Zear (zear5) 30 74.83 92.83 7 23.33
17339. 🥬 (freshkale_workman) 92 74.83 91.91 24 26.09
17340. B1gjake1 (jacobone) 6 74.83 79.63 0 0.00
17341. Shubham (shubham1428) 2 74.83 87.91 1 50.00
17342. Andre (andr_ehh) 619 74.82 106.51 161 26.01
17343. Jeffrey (weijini) 48 74.82 92.32 8 16.67
17344. jason (yacine77) 108 74.82 95.29 24 22.22
17345. Atichon (ultraballminorz) 20 74.81 85.55 4 20.00
17346. Deranged (de_ranged) 5 74.81 81.22 2 40.00
17347. Isse (attalion) 10 74.81 83.32 3 30.00
17348. kira (kirayes) 1 74.81 74.81 1 100.00
17349. Hamschi (hamschi) 7 74.81 82.02 3 42.86
17350. Conner (seacitysound) 3 74.81 76.86 0 0.00
17351. AcidSid009 (acidsid) 507 74.80 114.33 144 28.40
17352. DC (applespammer) 11 74.80 89.84 0 0.00
17353. aaaaaaa (aaaaaaayyy) 6 74.80 98.88 2 33.33
17354. Cesar I. (aberuwu) 2 74.80 78.48 1 50.00
17355. Dimitri (dimitrins) 3 74.79 81.77 2 66.67
17356. Evan (nullly) 21 74.79 96.62 5 23.81
17357. Malaikev (fonsdal) 223 74.79 97.38 56 25.11
17358. Bethanoo (fuzomania) 4 74.79 76.40 0 0.00
17359. PacaJack (pacajack) 2 74.79 78.89 1 50.00
17360. asian (asian219381) 1 74.79 74.79 1 100.00
17361. xandi (xandic) 1 74.79 74.79 0 0.00
17362. MavrosOplarxigos (oplarxigos) 395 74.79 91.21 137 34.68
17363. Achinta (ysachinta) 2 74.79 79.02 1 50.00
17364. Andie (andieeee) 222 74.78 123.19 72 32.43
17365. Wilson (wilson_ang) 8 74.78 81.57 2 25.00
17366. Liad (ozonzono) 37 74.78 93.74 6 16.22
17367. Ahmad (ahmad4) 17 74.78 92.88 8 47.06
17368. Subodh (subodhk) 2 74.77 76.09 1 50.00
17369. Micheal (mbroaders) 34 74.77 89.88 9 26.47
17370. Anthony (tonymontaro) 30 74.77 84.87 5 16.67
17371. miko (mikesxan) 45 74.77 89.17 18 40.00
17372. Marco (chino01) 58 74.77 90.11 11 18.97
17373. 🤑 (liljasonmoney) 11 74.77 81.68 4 36.36
17374. Sam (sharris11) 307 74.77 94.62 51 16.61
17375. Regan (heroofthevillage) 6 74.77 81.66 2 33.33
17376. Bogoya (bogoya) 49 74.76 88.06 12 24.49
17377. Song (songjoon) 2 74.76 80.24 1 50.00
17378. Fluffster (wlmao) 10 74.76 105.39 2 20.00
17379. DiveDeep (ethanelm) 4 74.76 89.77 0 0.00
17380. Cthulhu (survivcthulhu) 34 74.76 92.38 6 17.65
17381. Mustafa (mushy_) 2 74.76 84.97 1 50.00
17382. Robert (furyon700) 28 74.75 98.64 5 17.86
17383. Slava (not_okay) 54 74.75 83.76 9 16.67
17384. Stephy (stephy2202) 8 74.75 86.71 0 0.00
17385. Drapanji (onedrapo) 10 74.75 83.68 1 10.00
17386. typerinfection (z4k1n470r) 349 74.75 107.61 76 21.78
17387. cold (coldmind) 195 74.74 95.91 51 26.15
17388. jay (anakanjay) 8 74.74 86.20 0 0.00
17389. rohan (rohan_verma__) 197 74.73 92.87 36 18.27
17390. guid (guid07) 8 74.73 95.01 5 62.50
17391. Elias (el_typo_jr) 1,300 74.73 109.47 302 23.23
17392. Vincent (binsentkarlo) 4 74.73 82.60 2 50.00
17393. BLitZioNiC (andyzhu68) 1 74.73 74.73 0 0.00
17394. Jessica (jsilvers27) 19 74.73 85.84 5 26.32
17395. Luvie (luvie1310) 42 74.73 91.75 15 35.71
17396. китаец (artur_) 50 74.72 86.59 13 26.00
17397. Dvorak on (freddysg) 86 74.72 99.52 85 98.84
17398. Ranger (turbo_99) 90 74.72 88.50 31 34.44
17399. Adrian (adrian4k_) 16 74.72 83.52 5 31.25
17400. Mor (morti_20) 1,394 74.72 107.73 331 23.74
17401. Kazz (nutkazz) 40 74.72 91.56 12 30.00
17402. Tanvir (tanvir_025) 114 74.72 94.24 35 30.70
17403. The Russian (imdarussian) 51 74.72 89.34 14 27.45
17404. AgentGarbo (agentgarbo) 31 74.72 93.62 7 22.58
17405. mazen (dweedar) 10 74.71 84.17 2 20.00
17406. Nishchit (mr0bn0xi0us) 502 74.71 96.85 125 24.90
17407. Youngbin (limesoda14) 10 74.71 80.37 1 10.00
17408. troy (little_bro) 1 74.71 74.71 0 0.00
17409. Relay (relay5131) 2 74.71 75.98 0 0.00
17410. Milan (starzzdrak) 1 74.71 74.71 1 100.00
17411. Gavyn (scoutpack151) 2 74.71 81.36 1 50.00
17412. Jere (depressedone) 1 74.71 74.71 1 100.00
17413. firealpaca1 (firealpaca1) 16 74.71 93.12 7 43.75
17414. ... (hardadriano1) 2 74.70 75.52 0 0.00
17415. Harry (harpreetsingh005) 80 74.70 97.01 16 20.00
17416. Aidan (coconutwaffle) 74 74.69 93.12 21 28.38
17417. Araite (araite) 1 74.69 74.69 0 0.00
17418. Chelsea (oxfordkarma) 8 74.69 84.46 4 50.00
17419. Wojciech (wpietron) 24 74.68 91.22 7 29.17
17420. Cynthia (cynthiaparkk) 13 74.68 93.23 5 38.46
17421. typing chad (typing_chad) 17 74.68 97.67 0 0.00
17422. Dima (zormik) 215 74.68 97.22 67 31.16
17423. Kevin (ardioc) 5 74.68 81.78 1 20.00
17424. Ailton (ailtonn) 1 74.68 74.68 0 0.00
17425. X (inclassstudent) 2 74.68 79.46 0 0.00
17426. Nicolas (guaro_py) 1 74.68 74.68 1 100.00
17427. madelief (little_huchu) 4 74.68 83.03 2 50.00
17428. Deron (deronpianoplayer) 35 74.68 92.40 10 28.57
17429. tengen (tete_12) 3 74.68 85.53 1 33.33
17430. Basone01 (basone01) 28 74.68 89.74 11 39.29
17431. Glad (glad99) 32 74.68 94.57 7 21.88
17432. Tardy (tardyislazy) 35 74.67 90.22 11 31.43
17433. InboxRatio (inboxratio) 39 74.67 87.59 13 33.33
17434. Teun (tve9) 4 74.67 77.76 2 50.00
17435. Bataa (bataa_cdj) 189 74.67 95.66 46 24.34
17436. Hamza (nerodine) 56 74.67 89.30 16 28.57
17437. 😺♗ 𝔼q𝐔𝔸ţi... 19 74.67 94.70 4 21.05
17438. streetcar (dohrn1i) 33 74.67 94.43 17 51.52
17439. Tobi (t0b5) 18 74.66 86.43 1 5.56
17440. Brandon (itsbarn) 15 74.66 90.19 1 6.67
17441. Avaxar (avaxar) 25 74.66 95.61 13 52.00
17442. m3d (m3dsh) 29 74.66 91.81 10 34.48
17443. Viper (viper04) 12 74.65 89.52 5 41.67
17444. George (madfang) 6 74.65 91.23 1 16.67
17445. Marat (crunkz) 2 74.65 80.42 1 50.00
17446. Giannis (lil_spani) 10 74.65 89.88 6 60.00
17447. dax (daxwastaken) 18 74.65 89.39 6 33.33
17448. noooit (noooit) 3 74.65 80.85 0 0.00
17449. ZZ (zztypes) 3 74.64 81.90 1 33.33
17450. player (writer35) 558 74.64 119.79 139 24.91
17451. Dominic (mickeyice3) 333 74.64 94.43 85 25.53
17452. tstats[agarwaltanish10] (ag... 1 74.64 74.64 0 0.00
17453. Eskah (eskah) 25 74.64 91.62 5 20.00
17454. Sid (judgementdey) 10 74.64 82.74 3 30.00
17455. TheXFalcon (xavier_poh) 162 74.63 96.80 46 28.40
17456. Pokemon (pokemonkillr) 1 74.63 74.63 0 0.00
17457. Hello (clappy) 38 74.63 89.63 13 34.21
17458. Jared (pizzj) 12 74.63 85.20 3 25.00
17459. Artichoke (poofydragon) 40 74.62 93.73 11 27.50
17460. Muhammed (a_mhmmd) 28 74.62 86.10 7 25.00
17461. rodrigo (rodtronx) 33 74.61 86.41 4 12.12
17462. Tchaqazbilla (abdesslam47) 13 74.61 81.75 2 15.38
17463. kimhong01 (kimmong) 30 74.61 82.27 7 23.33
17464. cute loser (quesket) 38 74.61 97.88 8 21.05
17465. Sochi (noizi) 30 74.61 94.52 6 20.00
17466. idkhi (krisstesink) 8 74.61 83.99 8 100.00
17467. Luis (regneva17) 145 74.60 97.73 35 24.14
17468. Ace (hiken_ace) 21 74.60 84.97 14 66.67
17469. thomas (tmastri) 46 74.60 94.22 6 13.04
17470. Wolfinaa (wolfinaa) 2 74.60 85.32 2 100.00
17471. Daniel (daniel1353) 5 74.59 87.30 3 60.00
17472. Chris (greenbomber) 1 74.59 74.59 0 0.00
17473. asdftr (buhdo) 36 74.59 90.21 10 27.78
17474. tstats[Cisco516] (cisco516) 7 74.58 82.53 1 14.29
17475. maikim (maikim) 42 74.58 90.26 12 28.57
17476. tadeo (qwerm) 10 74.58 87.66 3 30.00
17477. Jesse (jessecan) 3 74.58 83.56 3 100.00
17478. ivan (ivanferraro) 19 74.57 86.42 3 15.79
17479. Shiloh (lickington) 5 74.57 86.67 0 0.00
17480. Henry (typingtaxi) 6 74.57 80.11 2 33.33
17481. Sprout (skyshedbloxian) 1 74.57 74.57 0 0.00
17482. Doron (doron) 1 74.56 74.56 0 0.00
17483. joe (mcmillybear) 259 74.55 98.01 70 27.03
17484. Rasmus (rasmus_v) 151 74.55 90.96 27 17.88
17485. Juan (juanpadoodle) 11 74.55 85.11 3 27.27
17486. Raidon (laxprax) 1 74.55 74.55 0 0.00
17487. Bean (beanervibez) 1 74.55 74.55 0 0.00
17488. Ahmad (apathicss) 27 74.55 90.43 17 62.96
17489. Larisa (larisa402) 19 74.54 91.57 4 21.05
17490. Moghit (moghit44) 107 74.54 117.63 29 27.10
17491. Uksza (uksza) 7 74.54 93.15 1 14.29
17492. Ben (bentontypesfast) 2 74.54 82.86 0 0.00
17493. SP (spharish) 1 74.53 74.53 0 0.00
17494. Luke (herding) 1 74.53 74.53 0 0.00
17495. Vadacurry (vadacurry) 11 74.53 86.71 3 27.27
17496. Irfan (iamtester4) 2 74.53 77.08 1 50.00
17497. nixon (cxboy) 7 74.52 83.36 7 100.00
17498. The don (photondestroyer) 92 74.52 91.86 18 19.57
17499. Crimsoonn (crimsoonn) 3 74.52 78.14 1 33.33
17500. রিফাত (rifat_072) 16 74.52 89.88 6 37.50
17501. Zack (smagroda) 44 74.52 85.25 16 36.36
17502. Lion (lionpride) 1 74.52 74.52 0 0.00
17503. William (normalizejoey) 111 74.52 96.34 45 40.54
17504. Anirudh (anirudh06) 84 74.52 88.13 37 44.05
17505. Spam (ssspeed) 91 74.52 94.23 29 31.87
17506. Jokūbas (jokstercube) 35 74.51 91.00 14 40.00
17507. Edward (edward54321) 2 74.51 81.75 0 0.00
17508. Marek (marekc256) 6 74.51 86.20 3 50.00
17509. Sam (samz19) 5 74.50 85.34 1 20.00
17510. Teng (hentaiba3) 48 74.50 90.18 24 50.00
17511. Jacob (jakedup) 1 74.49 74.49 1 100.00
17512. matex72 (matex72) 11 74.49 85.32 1 9.09
17513. G (alldetected) 2 74.49 74.62 0 0.00
17514. tstats[hegde_atri] (hegde_a... 14 74.49 89.64 2 14.29
17515. Enreden (enreden) 33 74.49 95.51 11 33.33
17516. Katie (zippolighter) 5 74.49 79.06 0 0.00
17517. Adam (adakam12) 3 74.48 95.30 2 66.67
17518. Lluis (lluisteixido) 7 74.48 86.87 2 28.57
17519. MsStPeter (msstpeter) 48 74.48 91.51 14 29.17
17520. Alan (alan186) 6 74.48 86.15 0 0.00
17521. Lukas (poseidoncoder) 4 74.48 83.44 2 50.00
17522. Jory (filkyjory) 6 74.47 80.20 2 33.33
17523. light (pinkyhurts) 37 74.47 87.95 10 27.03
17524. Chan (pizzx) 47 74.47 91.29 6 12.77
17525. Json (jskfreerunner) 108 74.47 92.35 27 25.00
17526. White (bruh_neighbor_moment) 2 74.47 77.94 0 0.00
17527. Renaldi (plbu) 17 74.46 92.40 3 17.65
17528. Charles (ckypros) 8 74.46 87.07 4 50.00
17529. Xander (xander93) 1 74.46 74.46 0 0.00
17530. Fire (tytysoeng) 1 74.46 74.46 0 0.00
17531. Sergio (sertheveteran) 1 74.46 74.46 0 0.00
17532. Ed (edwinl707) 7 74.46 84.49 3 42.86
17533. Gravity (vgravity) 11 74.46 86.75 0 0.00
17534. Vitap (vitapramdevputra) 2 74.46 74.50 0 0.00
17535. Johnny (muzuki) 3 74.45 80.05 1 33.33
17536. nikita (nikitapelagecha) 8 74.45 87.92 4 50.00
17537. Fabian (fabiangubler) 5 74.45 80.47 2 40.00
17538. Densetsu (densetsunobattousai) 869 74.44 98.91 266 30.61
17539. Josh (capitanwalrus) 19 74.44 91.59 3 15.79
17540. Hey (heythere0) 21 74.44 84.88 3 14.29
17541. Saul Goodman (blarg_23) 9 74.44 82.07 2 22.22
17542. Blue (blue03yt) 30 74.44 102.28 14 46.67
17543. Julie (codex13) 186 74.43 104.40 37 19.89
17544. Vishal (vishal_kr_saw) 150 74.43 90.92 61 40.67
17545. TeeDoe (teedoe) 3 74.43 80.16 1 33.33
17546. Cavouc (cavouc) 4 74.43 78.86 2 50.00
17547. Paweł (biah2206) 3 74.43 84.84 1 33.33
17548. Esman (hedwyn_the_nomad) 208 74.42 97.71 60 28.85
17549. clock145 (clock145) 103 74.42 93.09 29 28.16
17550. Joe (joekerhd) 5 74.42 87.92 1 20.00
17551. Schnoz (alcade) 2 74.42 86.55 0 0.00
17552. drago (drag00me) 461 74.42 92.57 117 25.38
17553. Tejas (crimcrim) 767 74.42 104.26 196 25.55
17554. Joe (jgizzi21) 280 74.41 98.73 60 21.43
17555. Cade (cadelanktree) 8 74.41 94.52 4 50.00
17556. magnus (robertavmagic) 117 74.41 91.66 22 18.80
17557. Professor (professorprotons) 6 74.41 82.13 4 66.67
17558. AsadCoder (darkterror07) 60 74.40 103.10 14 23.33
17559. Aniket (aniket2988) 2 74.40 85.03 0 0.00
17560. Cin_min (needs_alife) 8 74.40 81.97 1 12.50
17561. Colin (8_wpm) 6 74.39 78.54 2 33.33
17562. Karina (asapkarina) 41 74.39 102.85 13 31.71
17563. Pickle (iceberger17) 20 74.39 95.44 5 25.00
17564. Shreyas (shreyas_jani) 50 74.38 93.45 15 30.00
17565. Seth (kliney4) 26 74.38 85.33 7 26.92
17566. ning (niing) 17 74.38 89.55 7 41.18
17567. Jonas (jonas19) 5 74.38 84.15 1 20.00
17568. Bobross (bobrossrtx) 4 74.38 77.62 1 25.00
17569. AbdulQader (abdulqader) 332 74.38 95.49 75 22.59
17570. Arsa (arsa2312) 4 74.38 81.11 1 25.00
17571. Angel (sireisenburgh) 2 74.38 74.82 1 50.00
17572. Ace (aceofcaps) 11 74.37 89.36 2 18.18
17573. DInokyd (dinokyd) 20 74.37 91.00 6 30.00
17574. echo (cptfryingpan) 2 74.37 77.61 0 0.00
17575. Harjot (harjot_singh) 54 74.37 90.06 13 24.07
17576. กูคือความ... 5 74.37 79.77 1 20.00
17577. Sourav (yashsaha555) 565 74.37 101.39 141 24.96
17578. David (dchoboy) 10 74.37 85.77 2 20.00
17579. Alex (alex_575) 4 74.37 82.59 2 50.00
17580. Lucas (lucasbush3) 82 74.36 94.67 34 41.46
17581. Michael (mkelnei) 24 74.36 90.09 7 29.17
17582. Mich (michdaevinci) 30 74.36 93.16 7 23.33
17583. Seth (wongaa) 26 74.35 94.23 9 34.62
17584. Mazze (shadyone) 23 74.35 86.87 10 43.48
17585. Sandesh (labradoodle) 9 74.35 82.33 1 11.11
17586. Rainfluff (rainfluff) 13 74.35 84.86 7 53.85
17587. Mat (matrix303) 9 74.34 84.46 2 22.22
17588. Hullu (hilivilperi) 3 74.34 79.25 0 0.00
17589. Mnkx (mnkx) 1 74.34 74.34 0 0.00
17590. adr (poison_pwn) 22 74.34 86.87 2 9.09
17591. Danica (7158dandan) 297 74.34 94.79 85 28.62
17592. Henk (fattieruns) 29 74.33 86.55 8 27.59
17593. Joseph (tamejtm) 4 74.33 79.33 0 0.00
17594. Masood (004993) 10 74.33 88.86 10 100.00
17595. Wawa (wawasc) 25 74.33 92.01 2 8.00
17596. Val (bxl_vie_1212gordon) 1 74.33 74.33 0 0.00
17597. baboom (baboom3) 2 74.33 74.71 1 50.00
17598. Logan (lgan) 4 74.33 92.95 4 100.00
17599. uzi (r3yna) 32 74.33 92.13 12 37.50
17600. Mike Adrian (mikeadrian) 82 74.33 86.09 15 18.29
17601. Måns (kethem) 5 74.33 92.79 1 20.00
17602. Hoesmad (woshinidie123) 10 74.32 86.93 2 20.00
17603. Mr.IF (mr_if) 460 74.32 98.33 122 26.52
17604. Xmen (xmen1404) 3 74.32 82.17 1 33.33
17605. Robert (selbor) 112 74.31 99.87 31 27.68
17606. Mohammad (moreda1999) 135 74.31 95.54 36 26.67
17607. RoadTo100 (adininoxyz) 4 74.31 84.31 0 0.00
17608. Hamada (hamadasalhab) 68 74.31 93.99 17 25.00
17609. Ayush (ayush729p) 6 74.31 78.57 4 66.67
17610. Raf (edorableraf) 7 74.31 84.72 3 42.86
17611. Witre (witred) 10 74.31 91.50 6 60.00
17612. Zekrew (zekrew) 3 74.30 82.10 2 66.67
17613. Thunder (thunder2910) 7 74.30 83.17 2 28.57
17614. xiphias (xiphias_) 2 74.30 75.52 0 0.00
17615. Vlada (vlaki) 7 74.30 82.40 4 57.14
17616. ahgirl (ahgirl123) 11 74.29 90.03 2 18.18
17617. Raghav (raghav8822) 20 74.29 84.35 4 20.00
17618. waleed (waleedbinkhalid) 3 74.29 81.89 1 33.33
17619. ujai (ujai) 1 74.29 74.29 0 0.00
17620. RUPESH (rupeshdodiya123) 4 74.29 85.82 1 25.00
17621. Jessica (khalia12) 3 74.29 83.08 0 0.00
17622. Amelie (amelierosemcd) 4 74.29 83.24 0 0.00
17623. Bertus (bertus009) 2 74.29 75.27 1 50.00
17624. Zilla1218 (zilla1218) 8 74.28 81.82 2 25.00
17625. Helen (iamhelenkeller) 7 74.28 78.59 1 14.29
17626. Dran (creyon) 8 74.28 78.86 1 12.50
17627. Jamie (jalaymie) 9 74.28 83.95 3 33.33
17628. Darth (darthhideoustheugly) 24 74.28 82.49 6 25.00
17629. unit (chuwii) 10 74.28 82.53 1 10.00
17630. Jerrynick (goldenxbulletz) 70 74.28 98.94 16 22.86
17631. hello (ajblizzard77) 60 74.28 101.44 20 33.33
17632. Mis (miscellaneous) 9 74.27 100.99 1 11.11
17633. Benjamin (strangelyroblo) 28 74.27 91.81 7 25.00
17634. 🤟 Aguero 😁 (vadamulu) 1 74.27 74.27 0 0.00
17635. Fabio (fabiom26) 1 74.27 74.27 0 0.00
17636. Zockie (zockie) 24 74.27 85.32 7 29.17
17637. Yoshi (justayoshi) 33 74.27 91.65 6 18.18
17638. Bradshaw (ripshawryan) 5 74.27 83.20 3 60.00
17639. Dani (danivideda) 12 74.27 91.47 4 33.33
17640. #$# (ah_ha) 110 74.27 95.44 30 27.27
17641. Michael (yinyanyo3) 2 74.27 76.52 0 0.00
17642. Fredric (lockheart456) 39 74.26 89.07 9 23.08
17643. amk (kingyboi42) 3 74.26 82.21 1 33.33
17644. All-Rounder_28 (allrounder28) 32 74.26 96.16 9 28.13
17645. Hugh Janus (chrispoulos) 37 74.26 85.62 11 29.73
17646. Law (law_sm) 28 74.26 93.68 9 32.14
17647. Manas (kingmanas) 39 74.26 87.08 8 20.51
17648. Luis Victor (anubis_9) 48 74.25 86.48 11 22.92
17649. Geetansh (pandaculture) 31 74.25 87.42 5 16.13
17650. Joakim (draghman) 7 74.25 107.32 6 85.71
17651. Tajwar (dxadcircuit) 20 74.25 91.38 6 30.00
17652. Angelo (im_quasar) 1 74.25 74.25 0 0.00
17653. Frostx (frostx) 1 74.25 74.25 0 0.00
17654. Dark (darkelevent) 68 74.25 91.95 13 19.12
17655. Aditya (aditya_sharma) 18 74.24 87.80 5 27.78
17656. Niue (miloszz) 129 74.24 91.13 26 20.16
17657. Mitch (nitchmichols) 1 74.24 74.24 0 0.00
17658. Alva (alvath) 1 74.24 74.24 0 0.00
17659. Max (shaforodowntown) 1 74.24 74.24 0 0.00
17660. Imponed (jg814867) 14 74.24 88.90 3 21.43
17661. DuckyFul (duckydatyper) 67 74.24 103.99 9 13.43
17662. La (elpapa_lapapa) 2 74.24 76.86 1 50.00
17663. Raiym (rayimbek) 25 74.23 89.30 7 28.00
17664. iSchrye (ischrye) 2 74.23 80.93 1 50.00
17665. Ismail (group4k) 3 74.23 79.11 2 66.67
17666. Samantha (epoxicx) 33 74.23 101.00 7 21.21
17667. Filip (hummelur) 769 74.23 98.25 205 26.66
17668. Cartonito (cartonito) 143 74.23 98.40 45 31.47
17669. Hoang (poulet0306) 11 74.22 85.22 4 36.36
17670. goraput (boom1749) 747 74.22 110.13 187 25.03
17671. Biza (biza) 106 74.22 86.67 24 22.64
17672. Felipe (krakon_3) 40 74.21 90.43 8 20.00
17673. Joseph (magical_gibus) 4 74.21 89.85 2 50.00
17674. Ara Ara (vinhwiu) 922 74.21 106.60 239 25.92
17675. Person (ineedagoodname) 2 74.21 76.33 0 0.00
17676. Jimmy (jimmyceballos) 17 74.20 97.68 3 17.65
17677. not smart (hygienic) 15 74.20 81.17 1 6.67
17678. HEMEL (sm_hemel) 127 74.20 89.27 23 18.11
17679. damon (illbenascar) 2 74.20 76.31 0 0.00
17680. sdagsad (asvasdba) 326 74.19 100.78 119 36.50
17681. Kougrafighter (kougrafighter) 1 74.19 74.19 0 0.00
17682. Abel (brainstorm122004) 4 74.19 80.47 1 25.00
17683. Erik (trixx7) 25 74.18 91.72 7 28.00
17684. Ethan (crissps) 19 74.18 92.35 5 26.32
17685. Shivam (exergo) 626 74.18 97.88 164 26.20
17686. Sophia (sophia_8) 64 74.18 89.24 12 18.75
17687. Icy (icyblack) 6 74.18 82.61 0 0.00
17688. Adrian (cheeseshrub) 34 74.18 98.28 8 23.53
17689. Vishnu Chauhan (vishnuchauhan) 26 74.18 83.78 9 34.62
17690. Phycxz (phycxz) 3 74.18 81.06 2 66.67
17691. Juan (robbyro10) 24 74.18 85.25 11 45.83
17692. iglo31 (iglo31) 85 74.18 95.01 20 23.53
17693. Mike (m1kep) 16 74.17 97.26 6 37.50
17694. Alex (teflondon361) 1 74.17 74.17 0 0.00
17695. Nels (nels_senti) 22 74.17 91.68 9 40.91
17696. Angela (mytypingskillsarent... 10 74.17 85.14 2 20.00
17697. Heaven (heavenx) 8 74.17 82.09 4 50.00
17698. Kotai (kotai) 232 74.16 100.37 56 24.14
17699. Josephine (jodoe) 1 74.16 74.16 0 0.00
17700. Andre (avmoura) 7 74.16 96.49 1 14.29
17701. Tommy (tomcrott) 1 74.16 74.16 0 0.00
17702. PremuimRice (premuimrice) 3 74.16 78.04 0 0.00
17703. Varun (runat_10) 1 74.15 74.15 1 100.00
17704. Grzegorz (gorix) 24 74.15 88.36 3 12.50
17705. Elif (e_gamer) 1 74.15 74.15 0 0.00
17706. Little (littlesailor123) 11 74.15 89.09 1 9.09
17707. Knob (im_a_nob) 6 74.15 87.24 1 16.67
17708. Slamsal (slamsal) 66 74.14 92.06 27 40.91
17709. James (j4mce) 1 74.14 74.14 0 0.00
17710. Oikawa (kakashihatake1205) 76 74.14 92.12 22 28.95
17711. FraYo (frayo) 5 74.14 80.18 2 40.00
17712. Havenix (havenix) 22 74.14 87.97 4 18.18
17713. Alex (bigbrian123) 7 74.14 78.12 0 0.00
17714. krishna (krishnad) 23 74.14 86.54 2 8.70
17715. Munkhsuld (mbior) 29 74.13 82.99 8 27.59
17716. Eli (xutt) 7 74.13 85.84 6 85.71
17717. Nikolaus (zweehn) 1 74.13 74.13 0 0.00
17718. Byunghyun (stringbottle) 213 74.13 97.47 52 24.41
17719. AD (blastoise13524) 70 74.13 116.72 26 37.14
17720. iice (oofr) 6 74.13 84.53 0 0.00
17721. Rishit (rishitlogar) 19 74.12 89.84 2 10.53
17722. Benji (triforce04) 3 74.12 77.31 0 0.00
17723. Amin (amin_eatemad) 25 74.12 87.59 4 16.00
17724. Qiwei (liqiwei) 3 74.12 80.43 1 33.33
17725. LuJkE (itsthot) 3 74.11 82.04 1 33.33
17726. Ville (f1ftw123) 1 74.11 74.11 0 0.00
17727. Putu (pratamamp) 4 74.11 82.22 2 50.00
17728. memmoman (memmo) 20 74.11 96.62 7 35.00
17729. Brydon (the_blackfish) 6 74.11 80.90 1 16.67
17730. daMidu (da_midu) 3 74.11 82.16 1 33.33
17731. Sai (sait3ja) 4 74.11 78.31 2 50.00
17732. Matthew (mattisdabomb77) 65 74.10 92.88 14 21.54
17733. Ishan (kooshnoo) 3 74.09 82.68 1 33.33
17734. CJ (cj2305) 105 74.09 91.63 26 24.76
17735. marsistX (marsistx) 194 74.09 88.95 45 23.20
17736. Sajed (saji652) 14 74.08 88.00 2 14.29
17737. jerry (jerrydang1) 4 74.08 84.85 2 50.00
17738. niven (niven_11) 11 74.08 86.80 4 36.36
17739. Wali (captorcarbon) 367 74.07 102.29 103 28.07
17740. SLSL (slslz) 767 74.07 116.03 185 24.12
17741. umer (umer901) 13 74.07 96.04 2 15.38
17742. Daniel (danex2210) 2 74.07 81.97 1 50.00
17743. shakthi (shakthi1731u) 164 74.07 98.50 34 20.73
17744. Jakis (polishboy12221) 10 74.07 78.86 2 20.00
17745. Hi (hime_) 80 74.07 89.29 19 23.75
17746. Martin (mpenkov) 28 74.06 97.89 3 10.71
17747. monster (flamewarz) 30 74.06 94.11 11 36.67
17748. Gunnar (rs_gunny) 2 74.06 77.78 0 0.00
17749. Muhammad (xxvv) 35 74.05 89.87 8 22.86
17750. Benjamin (telekinesis) 8 74.05 90.41 5 62.50
17751. ༄༊࿆Lazy (siddharthmmore) 4 74.05 77.58 2 50.00
17752. Gibus (ghastless_gibus) 197 74.05 101.30 54 27.41
17753. Ngoune (tyrex1) 407 74.04 100.87 97 23.83
17754. Kunal (thegamerkunal) 48 74.04 94.75 10 20.83
17755. Dominic (porvoolink) 5 74.04 84.69 2 40.00
17756. Luis (chapibol) 714 74.04 95.14 152 21.29
17757. Ginger (ravens_loft) 295 74.04 99.14 74 25.08
17758. Twis (twis23) 157 74.04 100.88 40 25.48
17759. rk2699 (radhu) 14 74.04 87.00 2 14.29
17760. A (jenniesana) 12 74.03 91.46 5 41.67
17761. atomic (atom1c) 3 74.03 76.14 1 33.33
17762. Robin (robaxtom) 14 74.03 86.61 5 35.71
17763. alan (alanthebest1212) 8 74.03 86.16 5 62.50
17764. Luka (luxx_15) 4 74.03 79.63 2 50.00
17765. Martin (palchone) 90 74.03 92.01 26 28.89
17766. Ahead (ahadwhat) 74 74.03 100.10 41 55.41
17767. Regent (fagol) 8 74.03 86.91 3 37.50
17768. Jáchym (fastfingerrs) 18 74.02 82.90 7 38.89
17769. Jake (jarljake) 7 74.02 80.88 0 0.00
17770. Alex (just_alex) 7 74.02 94.29 2 28.57
17771. urbad (urbadlolgetgood) 5 74.02 84.22 1 20.00
17772. Deanna (deanna123) 37 74.02 97.24 6 16.22
17773. P (patrickkayne) 36 74.01 94.57 4 11.11
17774. Sergi (rolodophone) 12 74.01 86.62 4 33.33
17775. John (jjov17) 20 74.01 86.42 1 5.00
17776. TheProperAsian (theproperas... 13 74.01 86.30 7 53.85
17777. Icarus (ezzeldeen_27) 1 74.01 74.01 0 0.00
17778. Moukim (moukim) 18 74.01 83.56 2 11.11
17779. Soren (cuckslayer) 139 74.01 96.73 40 28.78
17780. choppery (choppery) 12 74.00 82.39 3 25.00
17781. Kenway (kenway316) 261 74.00 102.42 59 22.61
17782. mong (el_tecla) 1 74.00 74.00 0 0.00
17783. Mitchell (mitchell721) 33 74.00 100.07 5 15.15
17784. Duy Anh (typingisgod) 1 74.00 74.00 0 0.00
17785. Jonas (jonasv888) 18 74.00 83.99 7 38.89
17786. Badger (badgerr) 2 74.00 83.05 2 100.00
17787. Nemanja (nemanja6) 4 74.00 79.23 1 25.00
17788. dumbdwei (cringe69) 90 73.99 93.49 17 18.89
17789. oshan (ice_cold) 8 73.99 83.66 1 12.50
17790. mohan (mohan2002) 924 73.99 99.58 240 25.97
17791. Ömer (zero18) 7 73.99 79.36 1 14.29
17792. Gabriel (hong_kong_) 85 73.99 93.90 27 31.76
17793. j (luckyslayer) 14 73.99 88.54 3 21.43
17794. king (23bish) 3 73.98 81.95 0 0.00
17795. Amy (amysync) 5 73.98 82.42 3 60.00
17796. Patrik (oishinek) 2 73.98 75.70 0 0.00
17797. Sens (gokamiso) 68 73.98 90.14 14 20.59
17798. thavin (thavinxz) 26 73.98 88.35 8 30.77
17799. WiteLightningHWD (hwds1) 23 73.98 99.26 7 30.43
17800. Diego (isqube) 68 73.98 92.41 15 22.06
17801. Taylor (trifortay) 2 73.98 79.02 0 0.00
17802. Ahnaf (stallion1145) 844 73.97 102.60 198 23.46
17803. Raj (raj_37) 5 73.97 83.88 1 20.00
17804. Jack (jackcoleero) 20 73.96 87.48 7 35.00
17805. Vinh (hi_ugly) 6 73.96 84.68 3 50.00
17806. Giorillium (goodguygio) 22 73.96 91.86 3 13.64
17807. Marcia (eedoit) 7 73.95 79.23 3 42.86
17808. Bryan (legendarywind) 5 73.95 80.76 0 0.00
17809. C4 (wantsomedeath) 3 73.95 83.26 1 33.33
17810. Placebo (placebo_ct) 6 73.95 79.85 1 16.67
17811. Ruben (jamessmplayer) 2 73.95 74.60 0 0.00
17812. Evan (the_evanator) 1 73.95 73.95 0 0.00
17813. xahriman (xahriman) 46 73.95 93.32 11 23.91
17814. Jacinth (levesis) 171 73.95 103.89 45 26.32
17815. Gavyn (styxzee) 2 73.95 76.49 1 50.00
17816. Alytoni (alytoni) 1 73.94 73.94 0 0.00
17817. Fray (frayazu) 4 73.94 80.37 1 25.00
17818. makeout (wastingtimexd) 2,795 73.94 107.97 648 23.18
17819. FOO (mintaly_unstable) 96 73.94 91.14 25 26.04
17820. Curse (curse10) 2 73.93 75.57 0 0.00
17821. zahra (yoonoh) 9 73.93 85.12 6 66.67
17822. Andororo (andororo) 6 73.93 76.72 0 0.00
17823. Pink (pinkfluffyllama) 2 73.93 73.99 1 50.00
17824. neblig (bsy_af) 3 73.92 79.68 1 33.33
17825. cooper (cooperwoop) 26 73.92 95.55 10 38.46
17826. No (randomnamehere) 2 73.92 73.96 1 50.00
17827. Posty (postymaloney) 6 73.92 79.46 0 0.00
17828. Keenan (keenanhardy) 2 73.92 77.33 0 0.00
17829. neeraj (neeraj902) 949 73.92 100.09 248 26.13
17830. sadbanana (sadbanana0) 2 73.92 76.74 0 0.00
17831. Jaska (jarlewski) 1,182 73.91 103.28 295 24.96
17832. Thomas (thomastran02) 7 73.90 84.27 0 0.00
17833. Scott (spditsme) 2 73.90 79.06 0 0.00
17834. Joshua (myhoohasmells) 1 73.90 73.90 0 0.00
17835. the1466 (the1466) 5 73.89 80.65 1 20.00
17836. Sarah (sarahsyg) 6 73.89 80.33 2 33.33
17837. Tsurugi (k6kyoin) 4 73.89 90.57 2 50.00
17838. asdfasdf (ddgg007) 10 73.89 94.26 2 20.00
17839. fluffy (d0nuts) 1 73.89 73.89 0 0.00
17840. LingLingAlex (linglingalex) 1 73.89 73.89 0 0.00
17841. Johnny (johnnytct) 12 73.89 87.05 6 50.00
17842. L (unlucky_luca) 5 73.88 83.48 2 40.00
17843. Marius (mariusniveri) 63 73.88 87.67 12 19.05
17844. George (karmatimer) 22 73.88 83.44 7 31.82
17845. Richard (ricehard) 2 73.87 75.66 0 0.00
17846. Md (copticmatic) 2 73.86 75.09 1 50.00
17847. Juri (jurida) 514 73.86 106.69 110 21.40
17848. Samuel (kyoka_sui) 47 73.86 91.01 6 12.77
17849. Ibrahim (ibro_foreal) 6 73.86 76.59 0 0.00
17850. Ethan (ethanos42) 53 73.85 98.37 23 43.40
17851. XD (oma3) 177 73.85 88.79 45 25.42
17852. Helmut (helmutlang) 1 73.85 73.85 0 0.00
17853. Firelord (jetray) 157 73.85 90.26 33 21.02
17854. Silvan (sili2000) 2 73.85 81.92 0 0.00
17855. Dhruv (djdhruv) 4 73.84 88.09 3 75.00
17856. Mythical (ultrabow) 11 73.84 88.39 2 18.18
17857. M. (thehoaxshow) 3 73.84 78.29 0 0.00
17858. Pope (rcpope) 4 73.84 89.38 0 0.00
17859. Ashutosh (ashutosh6997) 112 73.84 96.29 21 18.75
17860. Jedidiah (jedidia60) 5 73.84 77.69 2 40.00
17861. rat (justarat90) 10 73.84 84.60 4 40.00
17862. Rahid (rahid_) 2 73.84 74.34 2 100.00
17863. Chris (kiousaras13) 15 73.83 92.21 6 40.00
17864. Balgow (balgow) 112 73.83 93.69 25 22.32
17865. bigman (xdbigman) 14 73.82 86.91 7 50.00
17866. Blaize (bomoko) 26 73.82 85.93 8 30.77
17867. Faris (silverskied) 53 73.82 88.52 10 18.87
17868. Lokinoha (lokinoha) 30 73.79 85.08 3 10.00
17869. Seraphear (_seraphear) 120 73.79 85.75 31 25.83
17870. Gabe (roastedleather) 13 73.79 88.67 4 30.77
17871. Nakura (nakura_sushi) 45 73.79 91.47 14 31.11
17872. alfie (alfieisback) 48 73.79 90.07 15 31.25
17873. Saagster (saagster) 10 73.79 86.21 3 30.00
17874. John Le (zingerburgerkfc) 149 73.78 99.74 43 28.86
17875. URDI (ghotifilet49) 1 73.77 73.77 1 100.00
17876. AloneStranger (yasdf007) 16 73.77 79.56 7 43.75
17877. ally (ally004) 3 73.77 82.80 1 33.33
17878. DetectiveRegen (detectivere... 5 73.76 82.36 0 0.00
17879. tstats[vita_melk] (vita_melk) 92 73.76 93.93 28 30.43
17880. Parsarch (parsrch) 3 73.76 75.63 3 100.00
17881. Katherine (katherinekelly2012) 40 73.76 88.93 27 67.50
17882. Doug (pontiacbandit) 15 73.75 83.23 3 20.00
17883. ndk100 (ndk100) 3 73.75 79.18 1 33.33
17884. shaad (shaaad) 1 73.75 73.75 0 0.00
17885. Timmy (timmy127) 5 73.74 77.16 1 20.00
17886. Basel (basel_mohamed) 5 73.74 83.86 1 20.00
17887. seaweedOrca (h17unicorn) 160 73.74 96.97 34 21.25
17888. Ryan (rcanete26) 2 73.74 78.23 0 0.00
17889. hyunho (shinesky0420) 2 73.74 78.46 1 50.00
17890. Semanta (the_who) 16 73.73 90.55 4 25.00
17891. taffy (kkristof97) 2 73.73 75.13 1 50.00
17892. sinexus (sinexus) 5 73.73 80.60 4 80.00
17893. haaa (h505) 29 73.73 84.84 7 24.14
17894. tesseractive (jupyter) 16 73.73 87.07 2 12.50
17895. harshit (harshit712) 202 73.73 102.39 54 26.73
17896. Tam (tam04101993) 64 73.73 93.39 18 28.13
17897. MR. Nobody (ahsanakbar) 2 73.72 75.11 1 50.00
17898. njwn (njwnsr) 9 73.71 80.62 2 22.22
17899. Psalmer (psalmer) 27 73.71 91.94 10 37.04
17900. Christoffer (hivefive) 1 73.71 73.71 0 0.00
17901. Jacob (jacobogbeide) 129 73.71 97.76 28 21.71
17902. Amaru (amaruescalante) 10 73.70 86.36 2 20.00
17903. itzsamxp (itzsamxp) 3 73.70 76.81 2 66.67
17904. poemich (jerkyice) 75 73.69 87.59 28 37.33
17905. Samin Yasir Sahil (iamyrmthr6) 4 73.69 78.73 1 25.00
17906. Viktor (quicksorting) 13 73.69 87.08 2 15.38
17907. Gingy (busterchoppie) 1 73.69 73.69 0 0.00
17908. Filip (opticalswitches) 2 73.69 74.43 0 0.00
17909. Daniel (theyluvdaniell) 28 73.68 89.94 5 17.86
17910. zr (oilyfishball123) 25 73.68 81.96 7 28.00
17911. isaac (darealjoemama) 123 73.68 95.49 38 30.89
17912. Luc (hellperson) 5 73.68 81.16 0 0.00
17913. Alex (aleksandr797) 240 73.67 94.57 67 27.92
17914. Hideto (hikimarun) 28 73.67 90.96 8 28.57
17915. Johan (turbongus) 3 73.67 90.54 0 0.00
17916. Motch (treemes) 75 73.67 89.76 16 21.33
17917. Dhaval (dhaval06) 237 73.67 96.31 71 29.96
17918. Jonathan (bods_88) 3 73.67 79.64 1 33.33
17919. MoshuFingers (scotscottie) 20 73.67 85.55 7 35.00
17920. Erik (xuj1) 12 73.67 78.63 2 16.67
17921. Anadi vyas (anadivyas) 126 73.67 88.67 19 15.08
17922. Hazem (hazemmy) 7 73.66 80.34 1 14.29
17923. abdo (phcox_hunter) 1 73.66 73.66 0 0.00
17924. Rocco (grapefruit95) 7 73.66 80.40 0 0.00
17925. chesco (chesco97) 83 73.66 91.37 27 32.53
17926. John Patrick (aboxthetyper) 17 73.66 89.12 2 11.76
17927. Sujit (sujit2000) 36 73.65 92.42 12 33.33
17928. Anatoli (errormaker) 236 73.65 90.04 42 17.80
17929. cat (hecknolol2) 13 73.64 102.17 3 23.08
17930. ritwik (ritwik3856) 77 73.63 97.00 18 23.38
17931. STÖCKHÖLM (ikea) 4 73.63 76.38 0 0.00
17932. gegg (guy_sama) 11 73.63 85.42 3 27.27
17933. Matthew (mooncatcher) 50 73.63 96.51 9 18.00
17934. Nii (yhuandebeste) 2 73.63 79.12 2 100.00
17935. Alekva (alekva) 407 73.62 98.37 104 25.55
17936. soup (dirtsoup) 7 73.62 85.25 0 0.00
17937. prithee peace (yeeyeeyeet) 5 73.62 81.78 0 0.00
17938. Joe (schlegs88) 5 73.62 78.88 2 40.00
17939. Rashid (beats_exe) 100 73.62 101.36 28 28.00
17940. James (sagpro_23) 9 73.62 80.70 2 22.22
17941. adugna (adex_22) 62 73.62 99.67 17 27.42
17942. Discharger (fty1777) 2 73.61 77.90 0 0.00
17943. Icchan (icchan84) 52 73.61 92.15 13 25.00
17944. Davit (shartavadavit0) 18 73.61 84.05 4 22.22
17945. Jason (laysonchillz) 10 73.61 83.60 3 30.00
17946. Laughing Fox (inkeet) 15 73.61 82.93 6 40.00
17947. 🥺👉👈 (daddy_mememas... 74 73.61 93.12 18 24.32
17948. Carmelo (lightning_mctype) 2 73.61 80.40 1 50.00
17949. White (beast_5) 60 73.60 92.86 15 25.00
17950. Eric (mainsterr) 51 73.60 99.37 30 58.82
17951. Jacob (pjacobh) 3 73.60 79.91 0 0.00
17952. Eric (toniseo) 12 73.60 81.10 6 50.00
17953. Nick (slotharms) 101 73.59 89.85 16 15.84
17954. JM (tuftycrayfish) 423 73.59 94.14 103 24.35
17955. femonemonemo (femonemo) 104 73.59 84.40 19 18.27
17956. UberTraffic (ubertraffic) 16 73.59 85.85 3 18.75
17957. HellDen (hell_den17) 2 73.59 76.97 1 50.00
17958. Keyser Söze (johnomaha) 1 73.58 73.58 0 0.00
17959. afq984 (afq984) 7 73.58 79.62 3 42.86
17960. Orion (maggiea718) 10 73.58 82.82 3 30.00
17961. FHVirus (fhvirus) 7 73.58 87.81 1 14.29
17962. Cristian (marutabeibi) 6 73.57 77.15 5 83.33
17963. Alikhan (alikhanzhamankhan_... 3 73.57 77.15 0 0.00
17964. Roshan (roshan_) 9 73.57 88.07 4 44.44
17965. Police (policecow) 1 73.57 73.57 0 0.00
17966. matthew (mattchy) 61 73.56 83.49 21 34.43
17967. Adamelvis (adamelvis) 122 73.56 92.18 27 22.13
17968. Gal (sirdouchebag) 8 73.56 92.70 0 0.00
17969. Axaul (axaul) 2 73.56 74.93 0 0.00
17970. Amin (amin_farzane) 20 73.55 80.67 4 20.00
17971. Elias (eddyede) 198 73.55 97.68 38 19.19
17972. windywendi (windywendi) 3 73.55 79.63 1 33.33
17973. PhantasmagoricBeef (phantas... 1 73.55 73.55 0 0.00
17974. Gustav (gurra73333) 4 73.55 86.20 0 0.00
17975. Karcinogen (karsenj05) 13 73.55 82.67 3 23.08
17976. Medkha (medkhabt) 6 73.54 81.63 2 33.33
17977. ⠀ (ploop123) 46 73.54 92.60 14 30.43
17978. Jake (gooserman) 15 73.54 86.44 3 20.00
17979. Landon (landonthull) 17 73.54 88.77 7 41.18
17980. Hau (hauhauh) 48 73.54 86.29 15 31.25
17981. guest (n1lotpal) 272 73.54 91.42 77 28.31
17982. Jonas (calmdownnnnn) 60 73.54 93.43 10 16.67
17983. Eugene (eugene1) 11 73.53 93.31 4 36.36
17984. Phungtastic (phungtastic) 11 73.53 78.86 2 18.18
17985. Kohlis (kohlis) 3 73.53 75.97 0 0.00
17986. Giridhar (griffintaimer) 1 73.53 73.53 0 0.00
17987. shivam (tambourinetower) 2 73.53 80.00 1 50.00
17988. Paul (paulg2k_csgo) 31 73.53 87.80 7 22.58
17989. S (suhaib_silwadi) 375 73.52 100.38 104 27.73
17990. hi (florzie_101) 11 73.52 91.20 4 36.36
17991. Hani (hanibchl) 23 73.52 88.05 9 39.13
17992. the (rank1zen) 307 73.52 99.73 67 21.82
17993. Surendra (zurendra9) 45 73.52 86.32 9 20.00
17994. LeTwash (letwash) 31 73.51 92.03 9 29.03
17995. cha (chachu007) 14 73.51 87.04 2 14.29
17996. Jynx (jynx__) 197 73.51 93.48 47 23.86
17997. Doggy (mr_woofles) 47 73.50 113.18 14 29.79
17998. Denys (owlydesigner) 7 73.50 81.86 1 14.29
17999. Fprase (fprase) 3 73.50 87.38 1 33.33
18000. rohaya (rohaya) 5 73.50 79.30 1 20.00
18001. Matt (bigrocku) 20 73.50 87.94 6 30.00
18002. Daniel (hellgrown) 2 73.50 80.08 1 50.00
18003. Ahmad (ahmadmozaffar) 759 73.50 114.70 185 24.37
18004. arif (hmmmnotokay) 26 73.50 93.97 7 26.92
18005. Tamie (cocota2) 4 73.50 80.34 2 50.00
18006. Grzesiu (grzesiubonzo) 665 73.49 102.26 151 22.71
18007. Rayni (raynikay) 3 73.48 73.61 0 0.00
18008. Jassy (jassy69) 4 73.48 79.58 1 25.00
18009. Patrick (jpporter) 2 73.48 75.45 0 0.00
18010. Soós (pbaalt) 19 73.48 88.45 5 26.32
18011. Aluumina (aluumina) 9 73.48 84.41 1 11.11
18012. Kevin (fvnction) 8 73.47 89.17 2 25.00
18013. William (wei9798) 9 73.47 79.52 1 11.11
18014. Iemand (darckshy) 68 73.47 89.53 24 35.29
18015. Cray (kweikwei) 348 73.47 86.68 89 25.57
18016. dayman (gangbeast_21) 72 73.47 99.43 19 26.39
18017. ¯\_(ツ)_/¯ (babanin) 9 73.46 82.31 5 55.56
18018. Tahj (mathpunsaresin) 17 73.46 84.85 5 29.41
18019. Glory (gaminglory) 6 73.46 84.45 1 16.67
18020. Please use an appropriate n... 24 73.46 85.63 4 16.67
18021. Mapko (buffi) 16 73.46 85.72 1 6.25
18022. Jesse (bleedobsidian) 9 73.46 91.01 4 44.44
18023. typeracer (typeracer550) 11 73.46 82.87 3 27.27
18024. Parvez (pz1971) 37 73.45 83.35 14 37.84
18025. Gert (hansonagarrett) 204 73.45 92.08 47 23.04
18026. NalynnZ (nalynnz) 3 73.45 80.03 2 66.67
18027. Taksa-orn (proudpi) 22 73.44 96.63 3 13.64
18028. Morris (mqrr) 6 73.44 86.86 1 16.67
18029. Kylle (iomeotic) 19 73.44 91.31 6 31.58
18030. Simeon (alode) 1 73.44 73.44 0 0.00
18031. Max (maxarfvidsson) 27 73.44 91.78 7 25.93
18032. Gde (gde1indra) 162 73.44 96.08 45 27.78
18033. Jackson (neatoburrito) 328 73.44 109.38 89 27.13
18034. Jawad (jawadwahmed) 18 73.44 90.04 5 27.78
18035. Mike (mrskopelos27) 2 73.44 77.58 1 50.00
18036. Bodzio (boguslav) 23 73.43 84.22 9 39.13
18037. Avery (skipperbud) 30 73.43 86.16 7 23.33
18038. James (leeroy909) 4 73.43 83.91 0 0.00
18039. LacticMilk (richardios275) 16 73.43 87.53 2 12.50
18040. pyotr (pyotrb) 4 73.43 77.52 3 75.00
18041. Jared (willetsjared) 29 73.42 90.09 7 24.14
18042. Kuloa (koldou) 1 73.42 73.42 0 0.00
18043. Nishant (nishantdesai1306) 25 73.42 89.86 5 20.00
18044. Karim Alaswad (karim_alaswa... 16 73.42 88.89 5 31.25
18045. Jakawat (jakawat) 25 73.41 88.08 6 24.00
18046. Corné (corneduring) 130 73.41 88.98 34 26.15
18047. : (gwaporosh) 8 73.41 87.51 3 37.50
18048. ʕ·͡ᴥ·ʔ (memesis) 168 73.40 99.64 48 28.57
18049. Aleph (catblahfishblah) 195 73.40 103.21 58 29.74
18050. paco (pacowaco) 14 73.40 80.99 8 57.14
18051. sdatta (sdatta) 14 73.40 86.28 3 21.43
18052. R0merol (farisfaikar_r) 50 73.40 88.74 16 32.00
18053. Racharg (freedobby) 39 73.40 90.50 7 17.95
18054. Kicker (kickermasu) 67 73.39 89.17 16 23.88
18055. FunkyChicken (mastalampe) 13 73.39 80.82 4 30.77
18056. Joshua (justdatotherguy) 81 73.39 90.18 23 28.40
18057. RENIEL RENZ (leiner_ross15) 37 73.39 83.94 12 32.43
18058. denzel (dennzzz) 12 73.39 79.80 2 16.67
18059. Mukkuru (mukkuru) 3 73.39 85.55 1 33.33
18060. *** (ccccalvinn) 11 73.38 89.03 2 18.18
18061. Aaron (heckndarn) 357 73.38 94.06 81 22.69
18062. Nidhal (yagamee) 302 73.38 99.18 76 25.17
18063. turbosprezarka (turbospreza... 1 73.38 73.38 1 100.00
18064. Steven (steventheplayer) 43 73.38 91.68 16 37.21
18065. Robert (elitists) 6 73.38 99.84 1 16.67
18066. coraline (coraline19) 7 73.38 83.91 2 28.57
18067. Gobind (meri_marzi) 85 73.38 112.74 14 16.47
18068. Samuel (samuel_7) 297 73.38 100.85 64 21.55
18069. plantyoon (lunarboris) 5 73.38 85.81 2 40.00
18070. Tarneem (tarneem) 7 73.38 85.76 3 42.86
18071. Sejer (sejert) 24 73.37 93.53 9 37.50
18072. Keong (baygonstroberi) 7 73.37 85.13 3 42.86
18073. Sam (sweatycactus) 4 73.37 82.34 0 0.00
18074. Bailey (baileyeet) 14 73.37 101.71 2 14.29
18075. Nazariy (vyleet) 13 73.37 90.29 6 46.15
18076. shmoney (gupty_gang) 51 73.37 87.11 13 25.49
18077. Simon (darkfiremoon) 2 73.37 74.83 0 0.00
18078. Lila_lut (lei_ruth) 12 73.36 84.32 4 33.33
18079. Kadz (kadzz) 2 73.36 77.89 0 0.00
18080. U (ugotme) 2 73.36 78.08 0 0.00
18081. JS (automaticquail) 1 73.36 73.36 0 0.00
18082. Danny (danyeeast) 53 73.36 92.36 13 24.53
18083. Jin (jin_an) 44 73.36 87.55 14 31.82
18084. Tom (spicersoanner) 18 73.36 85.77 3 16.67
18085. Yuliana (yuli_a) 8 73.35 83.05 0 0.00
18086. XanderManCan (tacticaltoast) 325 73.35 94.52 71 21.85
18087. i_type_fast_with_good_postu... 597 73.35 112.75 169 28.31
18088. Femiiiiiiiiii (femiboom) 5 73.35 83.11 0 0.00
18089. Jose Ortiz (jortiz1496) 492 73.34 102.32 117 23.78
18090. Avrick (avmend) 31 73.34 91.73 11 35.48
18091. Obama (captnawesome) 23 73.34 84.29 6 26.09
18092. Abhinav (bigweeb69) 6 73.34 79.48 0 0.00
18093. DF (df__) 578 73.34 102.26 174 30.10
18094. Dominique (domdknguyen26) 2 73.34 76.51 0 0.00
18095. * (000100020003) 223 73.34 95.03 56 25.11
18096. Indic (sanatanify) 12 73.33 81.29 4 33.33
18097. Jack (jackwitherell) 1 73.33 73.33 1 100.00
18098. Geis (geis) 1 73.33 73.33 0 0.00
18099. mousie (mousiecandy) 13 73.33 87.29 2 15.38
18100. Unique (netb) 439 73.33 108.57 102 23.23
18101. Jonas (fanibu) 6 73.33 78.99 1 16.67
18102. John (johnykenny) 126 73.32 98.23 29 23.02
18103. Orban (killhorizon23) 12 73.32 87.90 2 16.67
18104. oscar (oscarhinxdd) 160 73.32 91.72 39 24.38
18105. Banzexxx (banzexxx) 57 73.32 83.01 12 21.05
18106. nam (ngxnam) 17 73.31 86.36 4 23.53
18107. LiKeRoMaNiA (likeromania) 24 73.31 82.12 4 16.67
18108. Setons (setonsgrandpa) 25 73.31 87.43 9 36.00
18109. Anthony (daslayer05) 11 73.30 81.53 2 18.18
18110. Marlo (the_law_ph) 13 73.30 84.36 3 23.08
18111. hau (hau1228) 23 73.30 93.59 5 21.74
18112. jinay (noisy_88) 274 73.30 95.67 79 28.83
18113. Juan (yosohs) 24 73.30 88.23 4 16.67
18114. Natalie (natatat48) 9 73.30 87.92 0 0.00
18115. Lemon (mrlemon) 57 73.30 104.64 13 22.81
18116. KaRMa (ikillyou22) 18 73.30 84.79 9 50.00
18117. Mon (monmcgt) 16 73.29 86.12 3 18.75
18118. Richard (killerscotchy) 10 73.29 94.07 5 50.00
18119. Feces (monkey_feces) 1 73.29 73.29 0 0.00
18120. MooMoo (_moomoo_) 4 73.29 81.69 1 25.00
18121. Enlightened (liku45) 2 73.29 78.61 0 0.00
18122. araceli nicole (xrxcxlx) 124 73.28 104.45 74 59.68
18123. Vlad (vlados_shikos) 12 73.28 91.62 0 0.00
18124. enzo (sockenzo) 1 73.28 73.28 0 0.00
18125. oatmilk (oatmilque) 1 73.28 73.28 0 0.00
18126. ghostofnav (jokerhyper) 36 73.28 86.50 9 25.00
18127. Christina (libermay) 11 73.28 79.37 2 18.18
18128. Alex (alex_mingguk) 51 73.27 95.76 13 25.49
18129. Julian (robthephysician) 460 73.27 99.01 108 23.48
18130. Patryk (patryk5361) 17 73.27 86.85 5 29.41
18131. Matts (emzee_a) 24 73.27 86.74 8 33.33
18132. James (lenny_mess) 5 73.27 79.98 1 20.00
18133. Dan (danmurf) 18 73.27 92.78 8 44.44
18134. Glenn (shroom_slice) 9 73.26 92.67 3 33.33
18135. Erik (vike92) 1 73.26 73.26 0 0.00
18136. koscia (koscia) 1 73.26 73.26 0 0.00
18137. Unanymous (iceman0bc) 3 73.26 78.07 2 66.67
18138. kuan-Yu (austin737) 16 73.26 91.99 4 25.00
18139. Nitin (xintacious) 196 73.26 95.09 34 17.35
18140. Ice (juicedicee) 33 73.25 92.19 9 27.27
18141. Farhan (ft10) 92 73.25 88.82 20 21.74
18142. Juan (juanmartinez111) 123 73.25 92.70 30 24.39
18143. Adam (acidcypher) 6 73.25 81.27 2 33.33
18144. ANne (missinglevi) 6 73.25 86.69 6 100.00
18145. Max (selfmelody) 6 73.25 81.43 2 33.33
18146. jolene (jolenech) 10 73.25 85.18 2 20.00
18147. Max (mexx_) 5 73.25 89.50 2 40.00
18148. Zak (zak1388) 10 73.24 96.74 5 50.00
18149. Salzd (salzd) 24 73.24 85.12 4 16.67
18150. Arka (arkacsedu) 69 73.23 90.46 13 18.84
18151. An Tri (astronimical) 1 73.23 73.23 0 0.00
18152. Tan (zdfhzx) 2 73.23 73.67 0 0.00
18153. Come (cosmeec) 16 73.23 89.68 6 37.50
18154. Qubz (qubz) 7 73.22 83.15 1 14.29
18155. Atabek (atabekarapov14) 9 73.22 91.25 2 22.22
18156. Cohleen (pumpkingirl) 2 73.22 73.70 1 50.00
18157. DaTa (good_vibes) 22 73.22 86.49 8 36.36
18158. Soleh (xolehahhh) 2 73.22 82.68 1 50.00
18159. Ibs (brjoker) 4 73.21 79.53 3 75.00
18160. cantfindname (cantfindname) 18 73.21 93.60 3 16.67
18161. ℕ (noctua) 1 73.21 73.21 0 0.00
18162. Skystrike7 (skystrike7) 6 73.21 90.09 2 33.33
18163. Dan (deltaenergy) 8 73.21 78.37 0 0.00
18164. Kevin (kevinm162) 7 73.21 87.71 4 57.14
18165. Justin (laskov) 6 73.21 81.19 0 0.00
18166. kchou (kchou0907) 15 73.20 87.02 0 0.00
18167. Sebstian (sedasti) 484 73.20 96.76 121 25.00
18168. yuccai (yucca) 2 73.20 74.67 0 0.00
18169. maya (mclo) 2 73.20 81.67 0 0.00
18170. Mez69 (mezx69) 371 73.20 96.28 84 22.64
18171. Omar (prospart) 7 73.20 76.35 2 28.57
18172. vile11s (vile11s) 1 73.19 73.19 1 100.00
18173. George (gmorf) 5 73.19 79.48 1 20.00
18174. Bleu (bleublix) 74 73.19 88.78 20 27.03
18175. l0gically (l0gically) 11 73.19 80.82 5 45.45
18176. pup (mkpup) 18 73.19 86.67 5 27.78
18177. Tushar (tjajodia) 168 73.18 102.66 45 26.79
18178. Alex (alexkgarner) 1 73.18 73.18 0 0.00
18179. Mistakes Were Made (rhino1998) 38 73.18 88.72 11 28.95
18180. Ray (raycaballero) 1 73.18 73.18 0 0.00
18181. Safwan (safwanislam111) 14 73.17 80.91 3 21.43
18182. Kevin (kevink1844) 24 73.16 86.49 7 29.17
18183. Rahul (raul_jr3) 1 73.16 73.16 1 100.00
18184. Keigo (keigo_yoshiura) 8 73.16 81.53 2 25.00
18185. venky (venkywonka) 93 73.15 97.61 20 21.51
18186. pablazo (pablazo) 1 73.15 73.15 1 100.00
18187. Eddie (eddie_08) 281 73.15 96.94 76 27.05
18188. Amfomy (amfomy) 19 73.15 89.66 7 36.84
18189. odelll (ode_qwerty) 2 73.15 75.09 0 0.00
18190. John (jcboss10) 6 73.15 82.62 2 33.33
18191. oliver (oliver_tacmon) 3 73.14 75.14 2 66.67
18192. Ollie (ogreig) 53 73.14 94.76 26 49.06
18193. JoY (j0y_y) 23 73.14 86.50 4 17.39
18194. Kim (ntk02) 64 73.14 96.18 16 25.00
18195. Shaina (shainaziza) 70 73.14 99.61 24 34.29
18196. Hafizh (pislm) 6 73.14 84.56 1 16.67
18197. Brekzit (brekzit__) 9 73.13 86.55 2 22.22
18198. Ducky (duckyz1) 99 73.13 93.61 23 23.23
18199. Mister_ (axad007) 6 73.13 85.54 1 16.67
18200. Niteesh (niteeshguptha) 6 73.13 81.37 1 16.67
18201. Vanshraj (vrsempire601) 837 73.13 102.11 208 24.85
18202. Lur3t (lur3t) 163 73.13 96.84 33 20.25
18203. Dio (dio_b_) 11 73.13 81.35 11 100.00
18204. Reaching (breakingpoint1) 1,947 73.12 106.82 508 26.09
18205. ItsNo06 (itsno06) 5 73.12 80.73 0 0.00
18206. Deepta (mind_palace) 15 73.12 82.66 2 13.33
18207. Cameron (camd1zy) 3 73.12 75.85 1 33.33
18208. panagiotis (pana23161) 2 73.12 75.22 0 0.00
18209. Nikita (mohwai) 8 73.12 86.14 2 25.00
18210. Mika (mikakareefu) 1 73.11 73.11 0 0.00
18211. Rui (deathnight1234) 10 73.11 83.53 8 80.00
18212. Alisher (saegl) 6 73.11 90.83 4 66.67
18213. khalid (khalidabououalid) 375 73.11 102.63 109 29.07
18214. Symawi (symawi) 7 73.11 82.84 1 14.29
18215. Austin (quanglamtran346) 330 73.10 91.16 91 27.58
18216. Jonathan (baldunker1) 7 73.10 79.71 1 14.29
18217. Callum (callum__) 5 73.10 91.41 0 0.00
18218. Alex (sefader) 1 73.10 73.10 1 100.00
18219. Drew (dmart) 22 73.10 88.84 2 9.09
18220. Borislav (borko_panterata) 13 73.10 85.99 3 23.08
18221. Ethroc (someweirdcuck) 4 73.09 79.44 0 0.00
18222. Karta (thundermoon_911) 14 73.09 85.37 3 21.43
18223. Danchik (danchikg) 10 73.09 82.78 3 30.00
18224. Rob (gh0st3423) 9 73.09 91.53 2 22.22
18225. Joop (lapingvino) 2 73.09 82.98 0 0.00
18226. Itai (zytell) 16 73.08 91.76 3 18.75
18227. Jesse (jesser1440) 19 73.08 85.06 5 26.32
18228. Inic (gadomane) 14 73.08 89.15 4 28.57
18229. Y (yungkitchensink) 2 73.08 91.25 0 0.00
18230. mikaelawashere (mikaelawash... 18 73.08 89.02 5 27.78
18231. arache (howeyzeh) 48 73.07 105.12 15 31.25
18232. artie (4rtie) 7 73.07 92.15 2 28.57
18233. Toowe (toowe) 95 73.07 96.91 20 21.05
18234. Wafles (waflebars) 24 73.07 89.73 6 25.00
18235. Lazyteam (lazyteam) 19 73.07 87.39 4 21.05
18236. rainblizz (rainblizz) 4 73.07 75.65 1 25.00
18237. Miguel (m1ggy01) 6 73.07 85.18 1 16.67
18238. Iwo (iwoo) 2 73.07 77.17 0 0.00
18239. dippyflippy (_xtremeultra_) 1 73.06 73.06 0 0.00
18240. Lucian (the_eighth_wonder) 76 73.05 92.05 13 17.11
18241. Jacob (kowalski_boi) 1 73.05 73.05 0 0.00
18242. storm trooper (chandu998) 1 73.05 73.05 1 100.00
18243. Rajat (argentum_1807) 36 73.05 86.53 9 25.00
18244. The Dank Duck (jephjeff) 17 73.05 83.54 4 23.53
18245. ♛₴𝕥o͓̽ᖇო·₴... 149 73.04 91.82 40 26.85
18246. Abdallah (abdallah7) 12 73.04 93.08 3 25.00
18247. Derek (frigorific) 65 73.04 93.62 20 30.77
18248. Liam (laum) 1 73.03 73.03 1 100.00
18249. Ben (heyyoubenji) 2 73.03 73.09 0 0.00
18250. AAMMEERRIICCAA (aammeerriic... 2 73.03 74.96 1 50.00
18251. Cheese (arandomasiankid) 103 73.03 102.32 34 33.01
18252. Serguk (serguk) 5 73.03 79.04 2 40.00
18253. Mark (10100) 178 73.02 91.49 57 32.02
18254. Big (chunky_chunga) 1 73.02 73.02 0 0.00
18255. Jonathan (jonathanatx) 11 73.02 86.93 5 45.45
18256. arti (artiarti) 8 73.02 79.65 1 12.50
18257. Amirata (amiratak88) 6 73.01 75.48 2 33.33
18258. Christian (cardonacx) 24 73.01 88.45 10 41.67
18259. Kingdomfight (kingdomfight) 161 73.01 88.19 35 21.74
18260. Hydro (noynyt) 6 73.01 87.08 5 83.33
18261. Alex (t3dr) 15 73.01 83.83 3 20.00
18262. jujufrost (jujufrost) 22 73.01 86.19 3 13.64
18263. Mac (redsmac) 101 73.01 91.46 26 25.74
18264. uncle jiggy (unclejiggy) 3 73.00 80.90 1 33.33
18265. Andrew (andrew03) 7 73.00 87.01 0 0.00
18266. Constantinos (488pista) 167 73.00 87.52 37 22.16
18267. Ryen (ryenwang) 5 73.00 81.24 2 40.00
18268. demberel (demberel94) 92 73.00 89.49 31 33.70
18269. Emil (lime123) 5 73.00 86.22 0 0.00
18270. Burpled (rfthefinal) 11 73.00 86.16 4 36.36
18271. magsterz (feelokay) 2 73.00 74.60 2 100.00
18272. withan46 (withan46) 105 72.99 85.45 27 25.71
18273. Andrew (happie) 28 72.99 87.96 3 10.71
18274. Stefan (jhus) 2 72.99 74.04 2 100.00
18275. Maloha (maloha7) 1 72.98 72.98 0 0.00
18276. F (frogliker) 57 72.98 85.65 11 19.30
18277. Ryan (glasses928) 3 72.98 84.22 1 33.33
18278. J (irocamora) 190 72.98 92.41 50 26.32
18279. TataraZ (tataraz) 2 72.98 80.52 1 50.00
18280. Optimus (optimusprime98) 419 72.97 90.55 104 24.82
18281. LittleYun (littleyun) 31 72.96 91.74 8 25.81
18282. Matthew (majernja) 585 72.96 97.57 128 21.88
18283. CircuitMoon (subhampal) 2 72.96 76.16 2 100.00
18284. Kathryn (kathryns) 555 72.96 94.60 119 21.44
18285. Tilly (tilly14) 14 72.96 88.14 2 14.29
18286. emma (wooemma) 5 72.96 91.94 2 40.00
18287. jeans (jelowo) 9 72.95 95.07 2 22.22
18288. kyo (kyosenpie321) 2 72.95 77.25 1 50.00
18289. Logan (36beastgod) 293 72.94 94.91 86 29.35
18290. Hughie (pynfirnite) 1 72.94 72.94 0 0.00
18291. eight (eight293) 4 72.94 75.76 1 25.00
18292. arjayar (arjayar) 4 72.94 76.58 1 25.00
18293. iglo3141 (iglo3141) 361 72.94 98.38 110 30.47
18294. toes_n_fingers (joe_froggy) 21 72.93 90.93 1 4.76
18295. Lauris (toxic_bowl) 82 72.93 85.55 23 28.05
18296. Chris (hypernovachris) 5 72.93 77.16 1 20.00
18297. Chandler (chandlerbing123) 13 72.93 82.38 4 30.77
18298. Bohdan (bogdanr) 1 72.93 72.93 0 0.00
18299. Alex (thegamingalex) 2 72.93 73.21 1 50.00
18300. Kushagra (kgtypes) 8 72.93 84.36 2 25.00
18301. Martin (chubbinub) 4 72.93 79.32 1 25.00
18302. Daniel (danielpaanderson) 350 72.92 93.82 66 18.86
18303. Lukasz (lpodolski) 18 72.92 84.84 1 5.56
18304. Derek (derekkeiley) 706 72.92 92.32 151 21.39
18305. Mohamed (mohamedemad13) 40 72.92 87.51 10 25.00
18306. Sindri (sindri300) 9 72.91 81.04 4 44.44
18307. Elibay (elibay98) 11 72.91 79.15 5 45.45
18308. Mario (dmfz) 120 72.91 91.79 32 26.67
18309. Brett (savagesapien) 85 72.91 94.56 18 21.18
18310. arachnodactyly (arachnodact... 15 72.91 82.82 0 0.00
18311. The (the_omnivert) 17 72.91 84.03 5 29.41
18312. six (y33t3r) 8 72.91 86.79 2 25.00
18313. chris (aito_cornaro) 46 72.90 92.41 11 23.91
18314. Milan (nalim) 16 72.90 78.94 2 12.50
18315. GMHazem (gm_hazem02) 29 72.90 90.73 5 17.24
18316. Jjajangmyeon (izzu) 27 72.90 88.04 7 25.93
18317. big slo (denvr) 60 72.90 91.51 13 21.67
18318. Alex (pheudo) 11 72.90 90.30 6 54.55
18319. quando rondo (sombowde) 7 72.90 80.88 0 0.00
18320. Kevin (skillz9600) 7 72.90 84.57 2 28.57
18321. darryl (3dsss) 2 72.90 74.48 0 0.00
18322. zehvvu (zehvvu) 12 72.89 77.47 6 50.00
18323. Himanshu (pluto_ish) 27 72.89 93.45 20 74.07
18324. nilb (nilb) 1,568 72.89 97.28 362 23.09
18325. badtyper (badtyper_) 114 72.89 95.98 25 21.93
18326. Mia (mia_pie) 6 72.89 83.34 1 16.67
18327. Fentenal (m3ntality) 2 72.89 75.00 0 0.00
18328. Tiffany (potatosmeller) 77 72.88 90.90 13 16.88
18329. Mohamed (mohamedsobhi777) 13 72.88 87.88 3 23.08
18330. Pauli (pauli___) 65 72.88 92.75 19 29.23
18331. Basketbla (basketbla) 130 72.87 92.74 40 30.77
18332. Azka (azka_s) 1 72.87 72.87 0 0.00
18333. Natalie (thebestaround0509) 6 72.87 94.76 4 66.67
18334. Brandon (brandonjcox) 4 72.87 82.31 0 0.00
18335. 6fingers (rktspcr) 8 72.87 89.26 2 25.00
18336. RUDRANSH! (flame_ethnic) 5 72.87 85.70 2 40.00
18337. Seth (vadneylol) 2 72.87 82.16 1 50.00
18338. De9mond (uniwite) 68 72.86 87.43 13 19.12
18339. tico (slowcheetah) 3 72.86 73.99 0 0.00
18340. ch_tyt (ch_tyt) 56 72.86 90.96 13 23.21
18341. Sam Aka 💀 (sam_at_40wpm) 3,000 72.86 109.73 802 26.73
18342. Gijs (gijs__g) 22 72.86 89.63 7 31.82
18343. mark (victicious) 2 72.86 76.83 0 0.00
18344. Jack (blackened_angel) 3 72.85 83.13 0 0.00
18345. Peyton (peytonhm) 1 72.85 72.85 0 0.00
18346. Sam (masamuel) 1 72.85 72.85 0 0.00
18347. jeff (jeffersongtg) 117 72.85 92.29 31 26.50
18348. Jpjt (jyrah) 274 72.85 90.92 48 17.52
18349. Sanket (newbie24082002) 215 72.85 99.53 59 27.44
18350. Ins (insanic10) 299 72.84 101.64 71 23.75
18351. Mort (captain_fredrickson) 75 72.84 88.77 12 16.00
18352. Hannah (flambewater) 3 72.84 74.18 1 33.33
18353. vocal (vocal) 13 72.84 97.74 3 23.08
18354. NOkia (bruhmomemtum) 6 72.84 78.20 2 33.33
18355. Minhquan (notminhquan) 4 72.84 79.34 0 0.00
18356. Nathan (njd913) 4 72.84 82.31 1 25.00
18357. Hamz (thehamzarocks) 59 72.83 86.93 19 32.20
18358. Piyabuht (nekktheredsand) 30 72.83 90.63 8 26.67
18359. Jenna (jennafer323) 61 72.83 106.88 16 26.23
18360. Leah (leah_bro) 2 72.83 76.34 0 0.00
18361. Tuffy. (teddytaffy) 1 72.83 72.83 0 0.00
18362. Zeryx (zeryx_typing) 29 72.83 83.07 5 17.24
18363. myaonfya (myaonfya) 137 72.83 107.41 29 21.17
18364. elijah (elijahtheracecar) 18 72.82 90.55 2 11.11
18365. Francesco (deto_man) 3 72.82 83.31 1 33.33
18366. Nemanja2304 (nemanja2304) 3 72.82 76.52 3 100.00
18367. Osian (dubzzy0) 6 72.82 85.94 2 33.33
18368. Melody (selkie) 4 72.81 77.15 1 25.00
18369. Richard (richard_king) 259 72.81 95.59 51 19.69
18370. Mr.T (aysanoglu) 3 72.81 74.66 0 0.00
18371. Madiyor (madiyor) 94 72.81 96.09 30 31.91
18372. Kazoo (kosu_kat) 19 72.81 79.97 6 31.58
18373. Ccucumber12 (ccucumber12) 19 72.80 84.56 5 26.32
18374. Jam (cayajam) 8 72.80 86.99 1 12.50
18375. Rohan (barney564) 23 72.80 85.29 10 43.48
18376. gta (asldkfj) 36 72.80 90.31 7 19.44
18377. Mac (justmac) 28 72.79 87.18 1 3.57
18378. Jons (jonserino) 7 72.79 79.11 4 57.14
18379. XzXc (xzxc4444) 20 72.79 82.97 5 25.00
18380. c (blaf) 311 72.79 92.70 68 21.86
18381. nubby (nubbydawg) 2 72.79 76.98 1 50.00
18382. Jorge (crovas) 18 72.78 80.38 3 16.67
18383. paldoo (paldoo) 27 72.78 92.21 6 22.22
18384. tstats[_skrt_skrt_] (_skrt_... 57 72.78 86.42 11 19.30
18385. Thomas (thomas70) 182 72.78 92.60 40 21.98
18386. Ian (fadedrobin) 19 72.78 100.95 6 31.58
18387. Dipto (d_d_d) 2 72.78 76.29 1 50.00
18388. nathan (jebaithan) 1 72.78 72.78 0 0.00
18389. theoryofawesome (theoryofaw... 5 72.78 78.69 2 40.00
18390. Highfire1 (higfire1) 58 72.78 88.41 17 29.31
18391. Paige (pfernandes_) 182 72.77 95.96 40 21.98
18392. Lewis (lewisisabo) 392 72.77 98.70 89 22.70
18393. typetard (frenchfriessalty) 4 72.76 79.93 0 0.00
18394. ここ (coco_jumbo) 8 72.76 80.08 6 75.00
18395. Will Of The Wind (will_of_t... 4 72.75 79.98 3 75.00
18396. Ábel (ephraimgodw) 2 72.75 75.79 0 0.00
18397. tstats[sneakyturtle333634] ... 7 72.75 77.12 2 28.57
18398. Edgar (carrot9510) 5 72.75 81.38 5 100.00
18399. Avi (suppppp) 21 72.75 83.95 5 23.81
18400. AmmarDab3an (ammardab3an) 21 72.75 84.14 5 23.81
18401. Luciano (lucidokz) 45 72.75 99.55 9 20.00
18402. Tommy (tomdollars) 3 72.74 74.00 0 0.00
18403. H A N S (hans_bk) 46 72.74 86.03 12 26.09
18404. Christian (christian9182) 9 72.74 78.95 4 44.44
18405. tstats[peanutbutter_665] (p... 105 72.74 111.66 22 20.95
18406. Oscar (zeropuu) 17 72.74 87.67 5 29.41
18407. Nicholas (massive_nick) 40 72.74 94.89 20 50.00
18408. Harry (harrygoatleaf) 2 72.74 79.58 1 50.00
18409. Mars (marsattacks97) 4 72.73 77.39 0 0.00
18410. Jacky (jackyjac) 11 72.73 85.78 4 36.36
18411. Ethan (babyjrprado) 5 72.72 84.16 0 0.00
18412. Omar (manual_gears) 1 72.72 72.72 0 0.00
18413. Pseudo (pseudo_here) 46 72.71 92.25 9 19.57
18414. Lauge (laugejuul14) 3 72.71 79.47 1 33.33
18415. vic (vikk1234) 3 72.71 78.08 0 0.00
18416. Andrej (andy144) 87 72.71 86.08 19 21.84
18417. hyungjin (optimizion) 10 72.70 80.84 3 30.00
18418. e10 (ethodo) 4 72.70 82.54 0 0.00
18419. TOfu (dubunism) 4 72.70 79.79 1 25.00
18420. Christopher (truestarsense) 1 72.70 72.70 0 0.00
18421. Joshua (joshuavtk) 1 72.70 72.70 0 0.00
18422. Jim (jimvang8790) 15 72.70 79.05 4 26.67
18423. Jacob (werjac) 26 72.70 90.04 5 19.23
18424. Bram (yogurt55) 134 72.70 95.52 36 26.87
18425. yeet to space (sn00py1310) 49 72.69 97.84 17 34.69
18426. Kristian (jivkovk) 4 72.69 82.68 1 25.00
18427. Mathew (mdwelborn) 4 72.69 79.98 2 50.00
18428. Cue (cuewitiwat) 213 72.69 97.79 50 23.47
18429. Nuggs (itsmenuggetz) 28 72.68 94.97 10 35.71
18430. Le' (letyper_) 8 72.68 84.41 2 25.00
18431. Bro (termog) 41 72.68 87.45 14 34.15
18432. Hitendra (hitendra) 51 72.68 96.01 37 72.55
18433. Dvimrak (bchadwick87) 5 72.68 76.57 1 20.00
18434. sammy (sam_i_am01) 3 72.68 79.60 1 33.33
18435. Afra (afra_666) 6 72.68 77.98 1 16.67
18436. waifu (helpme_pls) 99 72.67 90.51 28 28.28
18437. guts (ramosjoshua214) 11 72.67 85.27 3 27.27
18438. Ella (wrenegadecath) 1 72.67 72.67 1 100.00
18439. Technician (tech23) 195 72.67 96.23 60 30.77
18440. Vate Henecos (bruddinha) 3 72.66 79.37 1 33.33
18441. EthKrae (ethkrae) 19 72.66 82.02 5 26.32
18442. Your (lor14510) 3 72.66 77.19 2 66.67
18443. Hunter (hlikesramen) 3 72.66 74.44 1 33.33
18444. Jonathan (jnybo) 11 72.66 88.55 4 36.36
18445. Guest (weruio) 131 72.66 98.31 36 27.48
18446. ahmed (sw7ezztyper) 16 72.66 85.21 8 50.00
18447. Loopy (loopyz) 4 72.66 85.71 2 50.00
18448. Marvuw (hotdog1234444) 639 72.65 99.79 145 22.69
18449. ahmet (ahmetyilmaz2002) 60 72.65 95.04 13 21.67
18450. Osama (aldemeery) 8 72.65 79.15 1 12.50
18451. MrKK (jeldikk) 22 72.65 85.64 4 18.18
18452. V3ness (venessang) 102 72.65 104.46 21 20.59
18453. Mai (napping_koala) 65 72.64 87.88 18 27.69
18454. ren (krenz) 17 72.64 87.66 5 29.41
18455. volt (voltb) 25 72.64 90.28 5 20.00
18456. visily (enlive3) 19 72.63 96.60 6 31.58
18457. Naufal (naufalmahing) 482 72.63 103.64 97 20.12
18458. Sean (sangpm) 4 72.63 82.14 3 75.00
18459. Reggie (reggiedada) 4 72.63 79.97 2 50.00
18460. Lộc (loccb90) 67 72.62 92.56 15 22.39
18461. Ahnaf (ahnaf_habib) 10 72.62 82.00 4 40.00
18462. nunya (karlremarks) 14 72.62 83.55 5 35.71
18463. Miesepeter (akizow) 2 72.62 73.40 2 100.00
18464. zoey (zjskating) 11 72.61 83.33 3 27.27
18465. James (james_jjv) 19 72.61 87.24 7 36.84
18466. Ahmed (ahmedslayer123) 1 72.61 72.61 1 100.00
18467. Cyber (alifarra) 29 72.61 91.83 11 37.93
18468. Willy (gfif01) 11 72.60 82.65 5 45.45
18469. Beebit (beebit) 18 72.60 84.62 4 22.22
18470. Wilson (friwilly) 11 72.60 85.46 3 27.27
18471. Jake (mjakecarlo) 22 72.60 88.75 9 40.91
18472. Kauã (fernandes10) 30 72.60 86.93 9 30.00
18473. Nawfox (nawfox) 9 72.60 76.53 3 33.33
18474. Ryan (grampsu) 4 72.60 81.10 2 50.00
18475. Alan (bl4n) 62 72.59 90.70 12 19.35
18476. soda (sodafortwo) 22 72.59 81.35 7 31.82
18477. wz (taywzzzz) 172 72.59 94.27 50 29.07
18478. Rahmat (rahmatullah_anik) 1 72.58 72.58 0 0.00
18479. Alex (foxtail8000) 18 72.58 93.46 5 27.78
18480. Igor (igotim) 9 72.58 80.97 2 22.22
18481. Sam (creature_feature) 2 72.58 75.11 1 50.00
18482. Stas (onixflip) 133 72.57 92.06 25 18.80
18483. Yogi (yogivaleja) 6 72.57 88.17 1 16.67
18484. Martin (maniacal_martin) 22 72.57 82.83 2 9.09
18485. Figo (bmfc4444) 23 72.57 88.64 6 26.09
18486. fakaped (fakaped) 537 72.56 97.01 149 27.75
18487. scuba (scuba2x) 259 72.56 111.17 61 23.55
18488. Christian (christianwells) 11 72.56 85.43 4 36.36
18489. Mathias (mathias64) 61 72.56 99.60 13 21.31
18490. Geo (gsampoerna3) 6 72.56 75.37 0 0.00
18491. Möhri (moehri) 19 72.55 88.80 15 78.95
18492. Sir (sirmaax) 21 72.55 103.30 6 28.57
18493. Sam (june_waves) 6 72.55 80.27 1 16.67
18494. Haakon (kaarekul) 4 72.55 82.61 2 50.00
18495. khalil (khalilfa) 419 72.55 99.04 99 23.63
18496. Jens (unlols) 5 72.54 79.80 2 40.00
18497. Coco (ummena) 102 72.54 88.10 34 33.33
18498. au_hermit (au_hermit) 9 72.53 85.28 4 44.44
18499. scarFace (gray25905634) 32 72.53 92.65 7 21.88
18500. Jeremy (slorsx89) 26 72.53 86.15 6 23.08
18501. Adrian (bobsgotepicskills) 86 72.53 90.96 17 19.77
18502. Stevie (stevie81572) 1 72.53 72.53 0 0.00
18503. lucho (monopolyy) 1 72.53 72.53 1 100.00
18504. Senpai Z (zlashers) 422 72.53 94.19 100 23.70
18505. vishal (vishal2005) 3 72.53 81.26 0 0.00
18506. animalpsyche (animalpsyche) 100 72.52 89.83 24 24.00
18507. Ash (flamingo_god) 1 72.52 72.52 1 100.00
18508. Caleb (monkeyboy1379) 1 72.52 72.52 1 100.00
18509. Ashwani (ashwani45) 103 72.52 92.69 26 25.24
18510. austin (aiven) 15 72.52 79.62 5 33.33
18511. Keenan (agentk9) 10 72.52 77.13 4 40.00
18512. Shiheng (sbiengo_sama) 57 72.51 86.59 21 36.84
18513. Ethen (__ethen_03) 55 72.51 89.58 11 20.00
18514. Niconii (nicopai_) 7 72.51 80.62 3 42.86
18515. Kennedy (kennedykozak) 11 72.51 88.09 4 36.36
18516. Zack (hackyzack17) 2 72.51 92.71 0 0.00
18517. Migs (migbasilio) 1 72.51 72.51 0 0.00
18518. AtomRong (atomrong) 1 72.51 72.51 1 100.00
18519. Blac (nice_tea) 21 72.50 93.12 6 28.57
18520. Tee (teegenius196) 1 72.50 72.50 0 0.00
18521. Gabe (silentsnake2398) 41 72.50 85.63 9 21.95
18522. Mario (mariojr16) 60 72.50 90.82 16 26.67
18523. Yuji (yujixyuji) 400 72.50 95.07 109 27.25
18524. Joshua (gottajet) 35 72.50 85.28 7 20.00
18525. Mathias (mattsric) 205 72.49 89.88 56 27.32
18526. Will (slamdado) 257 72.49 95.56 50 19.46
18527. Jitender (jitendercool) 3 72.49 80.53 0 0.00
18528. SM (webadnan) 2 72.49 74.30 2 100.00
18529. Liampbjray (liampbjray) 209 72.48 97.45 50 23.92
18530. uzi (cray_f) 724 72.48 98.88 172 23.76
18531. Piyush (lanslord11) 524 72.48 93.05 132 25.19
18532. ralf (rhalfik) 33 72.48 92.53 10 30.30
18533. Beilvert (jubeilvert) 16 72.48 87.99 1 6.25
18534. w8 (w8lkinusa) 15 72.48 82.39 4 26.67
18535. Jack (theboakey) 13 72.48 82.02 3 23.08
18536. Keagan (ngerks) 167 72.48 91.24 42 25.15
18537. Allen (kochengoren) 9 72.48 83.08 1 11.11
18538. Pawan (pawanpdn) 323 72.47 97.19 83 25.70
18539. Lovre (mrlovre) 7 72.47 77.93 1 14.29
18540. Swiggity (themoleinator) 2 72.47 75.54 0 0.00
18541. Trevor (trev_23) 9 72.47 90.02 0 0.00
18542. Jeffrey (seedotgrass) 38 72.47 83.95 11 28.95
18543. Kavin (cuboidmaniac) 3 72.46 73.64 1 33.33
18544. TinyTim (lavoiet) 24 72.46 84.98 4 16.67
18545. hhdhwuus (hhdhwuus) 43 72.46 88.67 9 20.93
18546. scor (scorbalope) 24 72.46 84.15 4 16.67
18547. meemw (markenmaw) 28 72.46 87.37 5 17.86
18548. Varshinee (raventhunderblac... 2 72.46 79.93 2 100.00
18549. sturge (sturgee) 54 72.45 105.79 14 25.93
18550. ochko (ochkofficial) 12 72.45 85.87 6 50.00
18551. Mayank (divine_godspeed) 57 72.45 89.99 6 10.53
18552. SeCre (secre13) 11 72.45 84.37 2 18.18
18553. ReRo (the_rero) 9 72.45 92.42 3 33.33
18554. Jordan (invictusj) 170 72.45 93.13 43 25.29
18555. Artin (artinmk) 2 72.45 76.41 0 0.00
18556. Mouad (mouadmzn) 4 72.45 79.42 0 0.00
18557. Vojtěch (vojtar) 10 72.44 85.03 1 10.00
18558. Nesto (nesto2042) 23 72.44 91.45 2 8.70
18559. Amanuel (mannyioi) 6 72.44 78.42 4 66.67
18560. Mustakim (winterflew) 61 72.44 91.63 20 32.79
18561. Bethany (bethanyyyy114) 5 72.44 78.85 1 20.00
18562. FTL (xxfangtingxx) 37 72.44 86.56 8 21.62
18563. Sameer Gupta (sammyonswitch) 23 72.44 85.09 4 17.39
18564. Darko (dakiking) 2 72.44 75.56 2 100.00
18565. Victor (kingofdawn) 25 72.43 94.11 8 32.00
18566. Elias (eliasjr) 16 72.43 86.45 5 31.25
18567. Neeecu (neeecu) 62 72.43 90.15 14 22.58
18568. Muhaiminul Islam (ninadgns) 1 72.43 72.43 0 0.00
18569. NeoX (neoxbit) 8 72.43 84.81 0 0.00
18570. William (wsz_riptide) 4 72.42 84.34 2 50.00
18571. micaela (janismine) 1 72.42 72.42 0 0.00
18572. Ggg (gdcomb) 1 72.42 72.42 1 100.00
18573. orthohalmak (orthohalmak) 28 72.42 81.88 8 28.57
18574. metrodous (metrodous_yt_6) 9 72.42 89.79 3 33.33
18575. Rowan (rusicus) 40 72.42 93.01 10 25.00
18576. Allison (vllisunshine) 16 72.42 85.96 3 18.75
18577. Sam (ie_dead) 43 72.41 101.69 9 20.93
18578. Zoltatorrez (zoltatorrez) 80 72.41 88.50 15 18.75
18579. Burint (brenolz) 293 72.41 95.11 75 25.60
18580. tstats[beedi] (beedi) 128 72.41 96.51 38 29.69
18581. ButTtTKiccKeRr (buttkickker) 4 72.41 82.00 2 50.00
18582. saddam (xtremety) 2 72.41 78.31 2 100.00
18583. AJ (ajk810) 2 72.41 83.15 0 0.00
18584. Ren (6cdh) 8 72.40 85.76 1 12.50
18585. Saniya (sashimisan_) 7 72.40 79.03 1 14.29
18586. Aaron (biogence) 151 72.39 93.03 28 18.54
18587. Holly (runningnurse) 7 72.39 86.88 2 28.57
18588. Roy (rocko95) 45 72.39 87.37 8 17.78
18589. Lisa (lissandra) 15 72.39 88.48 11 73.33
18590. Maluck (maluck) 14 72.39 83.91 3 21.43
18591. Carlo (carlofernandez) 24 72.39 86.73 5 20.83
18592. aardvark (aardvark_warrior) 2 72.39 81.97 1 50.00
18593. nully (kuwurakkuheddo_) 7 72.38 96.01 0 0.00
18594. Hector (datafli) 3 72.38 80.22 0 0.00
18595. Duy (phamanhduy1990) 12 72.38 80.25 0 0.00
18596. asian (hugeterror) 23 72.38 88.52 5 21.74
18597. Kitchen (kitchen_operator) 83 72.38 88.51 17 20.48
18598. Mikey (rctyogo) 8 72.38 77.07 0 0.00
18599. Ian (exeboi) 7 72.37 81.54 1 14.29
18600. Person (person753) 129 72.37 96.25 42 32.56
18601. Zxar (cubercubed) 12 72.37 82.10 4 33.33
18602. Bartacus (bartacus) 8 72.37 79.63 3 37.50
18603. Alpha (alpha_atk) 8 72.37 89.76 5 62.50
18604. Eli (elity) 42 72.37 88.07 8 19.05
18605. Adam (iadam368) 12 72.36 81.95 10 83.33
18606. Laurits (laulaudk) 1 72.36 72.36 0 0.00
18607. (zeoxsys) 1 72.36 72.36 0 0.00
18608. nyep (xd_tdm) 1 72.36 72.36 1 100.00
18609. Denis (soaresden) 5 72.36 82.51 2 40.00
18610. Gabe (yokingszn) 88 72.36 87.43 30 34.09
18611. Hehsbb (hehsbb) 13 72.35 91.82 3 23.08
18612. kayla (senlin) 8 72.35 86.69 5 62.50
18613. Rully (rully_monas) 49 72.35 94.39 11 22.45
18614. emre (emrevlog) 15 72.35 82.38 4 26.67
18615. zanydruid (zanydruid) 10 72.35 85.14 2 20.00
18616. Qida (ieatpizza) 47 72.35 85.02 8 17.02
18617. Rishabh (fire_tornado3) 11 72.34 80.86 2 18.18
18618. Ceb (cebq) 14 72.34 94.40 4 28.57
18619. Magzhan (mako_siaa) 63 72.34 94.20 20 31.75
18620. Malthus (malthusfb) 1 72.34 72.34 0 0.00
18621. hyunki (kirene) 32 72.34 82.12 10 31.25
18622. Fernando Morato (fernandomo... 26 72.34 86.29 4 15.38
18623. MellowSky (gadeleon) 2 72.34 78.86 1 50.00
18624. epic (densehelium) 51 72.33 84.11 16 31.37
18625. Vin (vibnarcus) 12 72.33 80.35 4 33.33
18626. Balazs (templomos51) 16 72.33 87.23 5 31.25
18627. Moy (moy231) 23 72.33 83.90 6 26.09
18628. Al (plnit) 2 72.33 84.10 1 50.00
18629. MAB (al00) 5 72.32 73.44 1 20.00
18630. ayorgo (ayorgo) 664 72.32 90.79 168 25.30
18631. Ethan (chung_ethan) 44 72.32 142.94 8 18.18
18632. Xristos (xristos_gav) 113 72.32 94.03 22 19.47
18633. Chenna (chenna06) 3 72.31 81.09 0 0.00
18634. my mom (botmon99) 6 72.31 82.30 3 50.00
18635. Eric (thiccbrick) 35 72.31 104.53 11 31.43
18636. MAK (geotyper704) 1 72.31 72.31 1 100.00
18637. Normal (marlon_caleb) 49 72.31 87.34 10 20.41
18638. boris (borisu) 3 72.31 79.91 2 66.67
18639. Connor (_cyber_) 1 72.30 72.30 1 100.00
18640. K N (ananthan2k) 7 72.30 76.00 0 0.00
18641. Nazmin (naz_1212) 13 72.29 98.19 2 15.38
18642. patembe (patembe) 8 72.29 82.45 4 50.00
18643. Light (lighteous_) 22 72.29 94.98 6 27.27
18644. Nazar (aimogenius) 64 72.28 91.22 9 14.06
18645. Martin (generalkoski) 1 72.28 72.28 0 0.00
18646. Blue (bluemoonzz) 3 72.28 80.48 0 0.00
18647. ElVash (elvash) 15 72.27 86.84 6 40.00
18648. naser (memel0rd420) 13 72.27 86.80 3 23.08
18649. Stacie (slyfoxxli) 12 72.27 88.64 4 33.33
18650. Dahlia (d4hli4) 4 72.27 75.65 1 25.00
18651. Nissan GT-R (amalyano) 26 72.27 82.02 6 23.08
18652. Lolli (lollo2000) 6 72.27 81.03 1 16.67
18653. Jimmy (vancouver_canada) 6 72.27 81.44 1 16.67
18654. akirasendoh07 (akirasendoh07) 536 72.26 103.37 141 26.31
18655. Rishi (_slow_typer) 14 72.26 87.07 3 21.43
18656. Simmons2 (simmonsgarbageacc... 12 72.26 91.07 9 75.00
18657. m0gu (mogumogu_) 59 72.25 91.01 12 20.34
18658. Zkye (trestiel) 29 72.24 93.09 9 31.03
18659. Kathy (kathy_starfire) 18 72.24 96.57 3 16.67
18660. Blast (blast_craft) 7 72.24 78.63 2 28.57
18661. Spartan Warrior (gerogeka1111) 31 72.24 91.01 7 22.58
18662. Kaldius (kaldius) 5 72.24 85.77 0 0.00
18663. Ashray (ashraygupta1) 59 72.23 88.29 12 20.34
18664. Mavis (firkinmugs) 29 72.22 83.97 9 31.03
18665. Kelvin (duongkelvin75) 5 72.22 74.15 2 40.00
18666. Sri Akshya (sri_akshya) 3 72.22 81.98 0 0.00
18667. Lim (ac1ds) 169 72.21 91.88 40 23.67
18668. (mbwins10) 1 72.21 72.21 1 100.00
18669. Abdallah (abdallah1) 62 72.21 83.46 13 20.97
18670. frog! (froggysauce) 41 72.21 92.18 17 41.46
18671. Hayden (r1plee) 23 72.21 94.04 8 34.78
18672. Brenda (6renda) 16 72.21 88.25 4 25.00
18673. Mark (geronimus) 3 72.20 83.40 1 33.33
18674. Joji (imaprettyboy) 2 72.20 73.93 1 50.00
18675. Wake (awriter) 82 72.19 98.43 20 24.39
18676. Andrei (andyspeed) 42 72.19 89.57 13 30.95
18677. a (im_typing_with_my_d) 121 72.19 89.85 27 22.31
18678. Dan (fireliar) 23 72.18 79.24 3 13.04
18679. Dimo (dimofte) 180 72.18 94.27 49 27.22
18680. Ayedread (ade15) 36 72.18 84.09 7 19.44
18681. mr.purpose24 (hacker51) 70 72.18 88.66 20 28.57
18682. Aryan (lost_arrow) 14 72.18 85.15 1 7.14
18683. solsol (scakes) 12 72.18 83.36 2 16.67
18684. Luc (typemasterluc) 2 72.18 72.21 1 50.00
18685. typo_racer (haffe) 4 72.18 84.52 0 0.00
18686. rezoan90 (rezoan90) 2 72.18 73.79 1 50.00
18687. JesseCarl (jessecarl) 27 72.17 85.85 6 22.22
18688. Steven (venste_) 12 72.17 79.59 1 8.33
18689. Benjamin (kullaaaa) 31 72.16 84.44 8 25.81
18690. Surreal (surreal_cereal) 25 72.16 83.61 8 32.00
18691. CoolGuy (cool_guy5583) 29 72.16 85.76 12 41.38
18692. Alarming (alarmngracer) 12 72.15 88.97 4 33.33
18693. CrazyConrad (crazyconrad) 7 72.15 82.64 5 71.43
18694. Arunkumar (arunkumar49) 26 72.15 87.49 12 46.15
18695. Laxman (laxman_) 13 72.15 80.25 8 61.54
18696. Speed is relative (hvan1998) 119 72.15 87.01 20 16.81
18697. Andy (andyrox) 219 72.15 94.51 74 33.79
18698. Thang (lhg81hc) 63 72.15 86.11 14 22.22
18699. Siah (siahbautista) 2 72.15 77.93 1 50.00
18700. Lin (rorarola) 1 72.14 72.14 0 0.00
18701. Tobe (jeeko_pogi) 21 72.14 84.97 4 19.05
18702. Đỗ (bigcatyoyo) 203 72.13 90.30 47 23.15
18703. A (lvorg) 57 72.13 88.19 17 29.82
18704. j (potatostock) 43 72.13 94.08 11 25.58
18705. Horatius (rithkop) 1 72.13 72.13 0 0.00
18706. plupl (pluppypluplplupus) 9 72.13 88.91 1 11.11
18707. papachuro (papachuro) 3 72.13 77.85 2 66.67
18708. Collie (collie321) 7 72.12 98.28 4 57.14
18709. Lord (lord_v) 44 72.12 85.07 11 25.00
18710. sitong (sitong) 3 72.12 72.81 0 0.00
18711. Nobuhiro (nobuhiro777) 11 72.12 86.47 3 27.27
18712. Sciencio (pinkdiam0nd) 8 72.11 84.67 0 0.00
18713. kolja (callmemink) 4 72.11 78.77 1 25.00
18714. Michael (mhmadhatter) 17 72.11 83.46 3 17.65
18715. Anton (noviru) 35 72.11 87.33 9 25.71
18716. Joe (jj_zhaaaaang) 5 72.11 79.79 0 0.00
18717. Zx (zxloh) 123 72.11 89.44 25 20.33
18718. CrazyhourXD (crazyhourxd) 12 72.11 79.77 3 25.00
18719. slow typist (typehero22) 5 72.10 80.29 1 20.00
18720. Đejms (db007) 10 72.10 87.18 4 40.00
18721. Lily (lukewarmwater) 1 72.10 72.10 0 0.00
18722. thotbox (thotb0x) 229 72.10 95.36 58 25.33
18723. Amarpreet Singh (amar123200) 293 72.10 100.16 84 28.67
18724. Selyaka (ddamyanov) 72 72.09 93.35 29 40.28
18725. Andy (andytypeslol) 6 72.09 77.45 1 16.67
18726. Rory (roricus) 21 72.09 84.29 5 23.81
18727. Matthew (matt15151) 2 72.09 89.53 1 50.00
18728. Katherine (doylesgirl73) 2 72.09 77.54 0 0.00
18729. Jerwin (jherwynne) 14 72.08 87.29 3 21.43
18730. JD (snag1) 101 72.08 93.45 23 22.77
18731. Shilo (shilomazouz) 12 72.08 78.43 4 33.33
18732. Bovinova (bovinovain) 8 72.08 82.86 3 37.50
18733. Yupa (valleyofthewin) 29 72.08 80.06 2 6.90
18734. Wengison (wengison) 4 72.08 74.08 0 0.00
18735. allen (modeski) 4 72.08 86.83 2 50.00
18736. Dennis (ocrayat16) 54 72.07 91.36 12 22.22
18737. TheGod (bboytheqt) 23 72.07 83.34 7 30.43
18738. Abhirup Das (abhirupdas200) 26 72.07 99.17 8 30.77
18739. Amin (aminarman) 6 72.07 75.72 3 50.00
18740. Chun (chunni) 1 72.06 72.06 1 100.00
18741. ZPGStudios (zpgstudios) 2 72.06 81.58 1 50.00
18742. Instinct_man (instinct_man) 1 72.06 72.06 0 0.00
18743. Nuan (nuan56) 33 72.06 91.79 7 21.21
18744. Steve (ijustwanttotype) 5 72.06 77.84 1 20.00
18745. Razor (razor_1) 40 72.05 91.34 11 27.50
18746. Connor (connorking) 1 72.05 72.05 1 100.00
18747. Branimir (brankeros_17) 1 72.05 72.05 0 0.00
18748. Cassie Lynn (cassielynz_00) 43 72.05 86.65 14 32.56
18749. Nazarii (nazarii_z) 82 72.05 91.99 18 21.95
18750. Tilt (brianrk25) 50 72.05 85.73 49 98.00
18751. nbv (cumming4u) 161 72.04 93.91 42 26.09
18752. George (wavy_shakespeare) 28 72.04 88.76 12 42.86
18753. Scattish (willierocknroll) 315 72.04 98.97 70 22.22
18754. and (andy_r8) 57 72.04 92.15 15 26.32
18755. diana (dianitax) 4 72.03 80.44 1 25.00
18756. Churro (minishcap) 6 72.02 79.61 3 50.00
18757. LEO (leolelele) 3 72.02 90.44 2 66.67
18758. WhaLeS (_whal3s) 1 72.02 72.02 0 0.00
18759. sbie (sbie) 2 72.02 75.40 1 50.00
18760. oogy (owogy) 187 72.02 97.89 56 29.95
18761. k (ker1ne) 9 72.02 82.34 3 33.33
18762. Count (countlizzard) 5 72.02 81.64 0 0.00
18763. Kaijou (kaijou) 8 72.01 87.79 6 75.00
18764. Hong Yi (hongyi8877) 6 72.01 81.57 2 33.33
18765. sun (ny_dkxh) 407 72.01 98.09 124 30.47
18766. Barry (shahkulu) 40 72.01 93.19 23 57.50
18767. Vteawt (vteawt) 6 72.01 79.66 3 50.00
18768. Worn_out (sks2k0001) 6 72.01 76.85 6 100.00
18769. Warut (moowarut) 2 72.01 73.66 0 0.00
18770. Chaz (chazmus) 1 72.01 72.01 1 100.00
18771. Shreyas (shreyastalathi) 81 72.01 88.25 14 17.28
18772. Jeff (lcrox) 2 72.01 73.29 1 50.00
18773. kraken (pronto1) 161 72.00 90.43 38 23.60
18774. Adarsh (mrr0b0t797) 4 72.00 73.78 1 25.00
18775. Gabriel (gbrl1) 1 72.00 72.00 1 100.00
18776. lubbdubb (achyut_tripathi) 4 72.00 75.55 0 0.00
18777. Abdulaziz (abduqodirov) 46 71.99 94.54 7 15.22
18778. Boyang (boyangliuu) 5 71.99 76.03 1 20.00
18779. Noah (noahboa1234) 8 71.99 82.40 2 25.00
18780. Patrick (saboe) 8 71.99 82.65 3 37.50
18781. HackzPlayz (hackzplayz) 9 71.99 79.63 3 33.33
18782. Zach (obeiah) 2 71.99 84.77 0 0.00
18783. Suktinis (destrain) 22 71.99 85.13 4 18.18
18784. aniM (dymek) 1 71.98 71.98 0 0.00
18785. Andreas (dray101) 4 71.98 83.48 1 25.00
18786. NinjaTurtleDude (ninjaturtl... 1 71.98 71.98 0 0.00
18787. Alex (shemet) 6 71.98 84.65 0 0.00
18788. Free-Palestine (mohammed_id... 250 71.97 99.72 70 28.00
18789. Ben (benpoopy) 66 71.97 95.15 22 33.33
18790. Hsu (naruto60509) 2 71.97 83.02 2 100.00
18791. Ivan (aivan2) 43 71.97 85.96 11 25.58
18792. Game (game_works) 4 71.96 84.97 4 100.00
18793. Tim (phuc131) 8 71.96 80.07 0 0.00
18794. tstats[ippatev] (ippatev) 21 71.96 95.75 9 42.86
18795. Sam (loverofpi) 3 71.96 84.91 1 33.33
18796. Jude (judeavery) 3 71.96 74.29 0 0.00
18797. Lukas (husafasamus) 6 71.96 80.88 0 0.00
18798. Alex (putzig) 3 71.96 73.93 0 0.00
18799. Justin (jbui123) 3 71.95 74.99 3 100.00
18800. pb64 (pb64) 13 71.94 78.38 12 92.31
18801. Nischay (nitrospeed2709) 22 71.94 82.60 8 36.36
18802. Jayseek (saltymood) 38 71.94 93.63 10 26.32
18803. czus (czus) 249 71.94 98.74 66 26.51
18804. melluwellu (giantme1on) 5 71.94 73.60 1 20.00
18805. Kevin Jeonghun (itskevinjeong) 9 71.94 77.38 5 55.56
18806. God (jpaul100) 22 71.94 86.02 6 27.27
18807. Martin (stroj) 7 71.93 92.01 2 28.57
18808. md (duom_1432) 106 71.93 102.87 24 22.64
18809. TvHead (tvhead) 3 71.93 81.47 2 66.67
18810. Cochet (saucyzzzz) 1 71.93 71.93 1 100.00
18811. Amarnath (stormprod) 37 71.93 99.10 11 29.73
18812. Cam (archlinuxuser) 9 71.92 81.60 3 33.33
18813. SantiX (santix1225) 17 71.92 91.77 7 41.18
18814. eric (ericpr) 331 71.92 98.26 80 24.17
18815. Akshat (kim375) 5 71.92 82.15 2 40.00
18816. Mikasa (tahabashar11) 8 71.92 86.20 3 37.50
18817. Joshua (busbud) 140 71.92 94.50 35 25.00
18818. Doomer (thedoomer) 40 71.92 86.24 14 35.00
18819. Arvind (arvindlamba454) 150 71.92 104.43 47 31.33
18820. Speedy (kuulex) 11 71.92 82.73 2 18.18
18821. Draco (fish0228) 20 71.91 88.72 18 90.00
18822. QuicoDel8 (quico) 7 71.91 77.65 1 14.29
18823. Corona Time (shamalamakiwi) 34 71.91 91.61 10 29.41
18824. Leo (teslaomega) 9 71.91 83.98 3 33.33
18825. Derek (thewarrior_13th) 7 71.91 84.58 1 14.29
18826. Toasted (toasted_) 30 71.91 84.30 8 26.67
18827. Arijit (arijitgupta42) 84 71.91 91.82 28 33.33
18828. Jo (oyangjo) 19 71.91 92.45 4 21.05
18829. Atiruj (starwp) 6 71.91 82.64 5 83.33
18830. Martin (lmaozedonggg) 5 71.90 80.90 0 0.00
18831. milop (milop) 27 71.90 85.46 9 33.33
18832. Timmy (timexwatch) 261 71.90 99.49 61 23.37
18833. luka (lukabrlek) 1 71.90 71.90 0 0.00
18834. Lewis (lcole) 9 71.90 88.28 1 11.11
18835. Theo (the_o) 17 71.89 85.31 4 23.53
18836. Simmons1 (_simmons) 54 71.89 88.11 16 29.63
18837. adderal junkie (dari0) 499 71.89 108.06 137 27.45
18838. Jotaro (sammy82) 2 71.89 74.38 2 100.00
18839. Santiago (ramstrykre) 1 71.89 71.89 0 0.00
18840. Maddie (mfighter) 1 71.89 71.89 1 100.00
18841. Kenewbi (kenewbi) 22 71.89 88.57 7 31.82
18842. AM (je11ow) 2 71.89 86.72 0 0.00
18843. Wilson (springmaple) 2 71.89 78.73 2 100.00
18844. Paskal (skapalpaskal) 1 71.88 71.88 0 0.00
18845. Scold (scold_) 4 71.88 83.71 1 25.00
18846. Aisyah (momogi13) 3 71.88 75.88 1 33.33
18847. Krafci (krafcisky) 3 71.88 75.67 1 33.33
18848. bbbbbbbbbbbbbbbbbbbbbbbbbbb... 14 71.88 83.14 3 21.43
18849. James (raking123) 48 71.88 89.41 11 22.92
18850. Rafi (rkyum) 10 71.88 79.04 2 20.00
18851. ­ ­­ (enqq) 297 71.88 99.63 75 25.25
18852. figher2016 (fighter2016) 3 71.87 81.44 0 0.00
18853. Bastian (sebastianovoam) 8 71.87 77.67 2 25.00
18854. root (1_root_1) 24 71.87 83.63 6 25.00
18855. pizzapablo (pizzapablo) 12 71.87 82.45 12 100.00
18856. Z-Dvorak (zzdarke) 29 71.87 91.63 8 27.59
18857. Sid (criptonate) 16 71.87 79.86 6 37.50
18858. Evan (egggyman) 2 71.86 80.75 0 0.00
18859. robby (robby27) 12 71.86 82.56 4 33.33
18860. travman (sunshinemamba) 72 71.85 91.04 16 22.22
18861. Gio (raskid) 13 71.85 93.26 3 23.08
18862. sky (skymario) 81 71.85 98.21 15 18.52
18863. Luvion (luvionjin) 5 71.85 77.36 1 20.00
18864. Omer (omersudo) 17 71.85 81.97 2 11.76
18865. Rab (rabuhana) 13 71.85 76.09 3 23.08
18866. butter (rtporpmal) 280 71.85 94.90 62 22.14
18867. omajez (omajez) 8 71.84 86.98 5 62.50
18868. Alice (shadowsofwaxwingsslain) 63 71.84 88.86 13 20.63
18869. superss2104 (superss2104) 40 71.84 89.48 7 17.50
18870. yeogi (yeogi) 6 71.84 77.70 0 0.00
18871. Yosuke (7wolves) 3 71.84 87.81 3 100.00
18872. stef (ihasstuff) 17 71.84 80.29 7 41.18
18873. Shahariar (ashikkkkk) 8 71.84 90.08 1 12.50
18874. Nate (angularblade) 14 71.83 91.98 4 28.57
18875. Siddharth (agrawal97siddharth) 3 71.83 75.48 1 33.33
18876. Benson (flowery_robot) 11 71.83 88.55 6 54.55
18877. Vishishta (vishik_685) 19 71.83 81.02 7 36.84
18878. Red (rzhvnbrg) 5 71.83 81.84 5 100.00
18879. josh (killer_queen_beats_hi... 167 71.82 84.13 37 22.16
18880. choi (ateezofficial) 11 71.82 83.52 2 18.18
18881. damafps (damafps) 25 71.82 84.57 5 20.00
18882. Alex (alexxxkachow) 2 71.82 73.90 0 0.00
18883. Gio (apex_shrimp) 31 71.81 80.33 6 19.35
18884. marc (kangdashman) 7 71.81 83.39 4 57.14
18885. Raisin (annielam) 7 71.81 82.58 1 14.29
18886. Manan (mdoshi) 6 71.81 81.52 1 16.67
18887. mohammadreza (mohammadrezae... 11 71.81 79.62 0 0.00
18888. Bala Klava (brullsker) 28 71.81 80.60 7 25.00
18889. jkrkvld (jkrkvld) 7 71.81 83.46 1 14.29
18890. Parking (parkingmeter) 3 71.80 81.32 1 33.33
18891. Basti (schinken38) 127 71.79 98.09 35 27.56
18892. Shadow (skyronman) 9 71.79 82.75 3 33.33
18893. Funday (funday11best) 15 71.79 87.42 12 80.00
18894. Funnier04 (funnier04) 10 71.79 82.51 5 50.00
18895. Donovan (maggigorengayam) 9 71.78 79.00 2 22.22
18896. Shishank (hulk98) 6 71.78 82.30 1 16.67
18897. LeftHandedKatana (lefthande... 2 71.78 74.69 2 100.00
18898. Steven (faiching89) 4 71.78 76.74 1 25.00
18899. Eugene (rawners) 20 71.77 80.27 8 40.00
18900. Vishnu (vishnu_is_goated) 24 71.77 89.48 8 33.33
18901. Sweefty (sweefty) 12 71.76 79.31 2 16.67
18902. Joao (joaofonst) 2 71.76 74.72 2 100.00
18903. John (fakelicense) 6 71.76 77.55 2 33.33
18904. Alex (arslans) 1 71.75 71.75 0 0.00
18905. LE (opcleaver0) 3 71.75 74.34 0 0.00
18906. Mayank (mayank1508) 125 71.75 85.59 24 19.20
18907. Piyush (piyushc) 10 71.75 78.77 1 10.00
18908. Anthony (asenarith) 3 71.74 76.80 1 33.33
18909. tadiyos (lt_tad) 3 71.74 79.93 1 33.33
18910. fiji water (astranger24) 1 71.74 71.74 1 100.00
18911. Sambhav (sam_b_hav) 1 71.74 71.74 0 0.00
18912. Jake (wyol) 7 71.74 77.83 2 28.57
18913. Alex (gincat) 6 71.74 79.54 1 16.67
18914. cse_kyle (cse_kyle) 8 71.73 85.69 2 25.00
18915. R (hellothere1233) 4 71.73 77.93 1 25.00
18916. Ruel Ryan (ruelryan) 162 71.73 87.17 41 25.31
18917. TrainTrains (traintrains) 12 71.73 89.48 4 33.33
18918. Vamsi Krishna (gordongecko) 9 71.72 78.42 4 44.44
18919. Warden (tmt_warden) 1 71.72 71.72 0 0.00
18920. Kay (kaypinky) 4 71.71 89.24 2 50.00
18921. Le Van (tlong900) 21 71.71 82.41 8 38.10
18922. Delbert (zeckxel) 51 71.71 83.87 15 29.41
18923. Triton (tritonthetrident) 38 71.71 85.72 12 31.58
18924. Courtney (croy726) 5 71.71 80.84 4 80.00
18925. Ariel :) (alyas94) 16 71.71 85.48 4 25.00
18926. Jav (jav77) 70 71.71 83.14 13 18.57
18927. Abdullah (abdullahbb102) 32 71.71 94.92 4 12.50
18928. ILoveFelix (ilovefelix) 2 71.71 74.89 0 0.00
18929. John (armon99) 1 71.70 71.70 0 0.00
18930. manhhuy01 (manhhuy01) 6 71.70 78.52 3 50.00
18931. Sam (sirgalahad7) 17 71.70 80.23 2 11.76
18932. Michael (mdz64) 4 71.69 78.65 1 25.00
18933. dreezy (dreeezy) 3 71.69 73.61 1 33.33
18934. Finna (captfinn) 36 71.69 81.44 7 19.44
18935. Benjin (benjin7) 357 71.68 101.08 71 19.89
18936. eye8 (othereye) 7 71.68 85.06 1 14.29
18937. Erik (vofflan) 521 71.67 89.07 119 22.84
18938. Rushabh Kanadiya (guitarher... 5 71.67 81.90 5 100.00
18939. Lii4 (chjh21005) 9 71.67 79.78 2 22.22
18940. Kittatro (saysikerightnow) 9 71.67 79.31 2 22.22
18941. jek (jekkey) 465 71.67 98.76 95 20.43
18942. falco.gs (fhoover) 1 71.67 71.67 0 0.00
18943. Malia (maliuhh) 6 71.66 81.77 0 0.00
18944. Matt (purple_gorilla21) 40 71.66 88.96 9 22.50
18945. Mr (antoniskan) 3 71.66 74.90 3 100.00
18946. Justin (cocok97) 4 71.66 75.99 2 50.00
18947. Sam (the___sam) 33 71.65 84.52 5 15.15
18948. Mouse (atypingmouse) 41 71.65 87.41 12 29.27
18949. Andrew (andrewmosey) 7 71.65 77.13 5 71.43
18950. Filip (finicky_) 24 71.65 91.15 7 29.17
18951. not (not_vidhu) 217 71.65 95.81 67 30.88
18952. Oual (crankcrash) 9 71.65 90.64 3 33.33
18953. shadmehr (megacrocodile) 990 71.64 101.76 221 22.32
18954. Chad (noodlestrings) 7 71.64 92.70 1 14.29
18955. Sebastian (kernfusionator) 1 71.64 71.64 1 100.00
18956. Jiamin (jiamind) 3 71.64 75.81 1 33.33
18957. Fredrik (fredrikvorpenes) 2 71.64 80.13 0 0.00
18958. sangvar (greeker) 27 71.64 87.19 13 48.15
18959. Reagan (reagss) 7 71.63 85.39 3 42.86
18960. Stephanie (cuber155) 22 71.63 86.32 7 31.82
18961. GodIsGood (cruz989) 6 71.63 81.27 1 16.67
18962. McKay (heyitsyaboi) 177 71.63 97.28 47 26.55
18963. Renata (thebluesavvy1) 24 71.63 87.25 3 12.50
18964. Aleks (aleks8) 187 71.63 87.09 52 27.81
18965. Cammyy_ (cammyy_) 18 71.63 85.80 4 22.22
18966. Carson (dramagirl82) 16 71.62 80.60 5 31.25
18967. Mehedi Hasan Emo (hasanemo654) 7 71.61 79.77 2 28.57
18968. melanie (melanxi) 6 71.61 89.10 2 33.33
18969. Jamiel (jamiel_exe) 10 71.61 81.78 1 10.00
18970. funss (funss) 15 71.61 85.11 1 6.67
18971. tstats[faiz_legend] (faiz_l... 29 71.60 94.41 6 20.69
18972. Jake (coike2323) 5 71.60 82.67 1 20.00
18973. Jordan (js_jordan) 402 71.60 107.02 87 21.64
18974. 0% (horiz0n) 5 71.60 76.62 3 60.00
18975. Jay (kov_) 446 71.60 109.40 102 22.87
18976. Casper (knugus) 2 71.60 72.62 1 50.00
18977. Phong (phong1902) 67 71.59 95.44 15 22.39
18978. Mike (mikespits) 1 71.59 71.59 0 0.00
18979. Txeru (txeru) 25 71.58 79.32 25 100.00
18980. stand with russia (hellofki... 23 71.58 82.20 9 39.13
18981. Alpha (lolcat81) 3 71.58 76.67 0 0.00
18982. Yeraen (yeraen) 1 71.58 71.58 0 0.00
18983. Artem (suplexxx) 1 71.58 71.58 0 0.00
18984. S J (abhi_28) 57 71.58 92.30 20 35.09
18985. Striker09125 (eiren233) 7 71.58 77.32 2 28.57
18986. kaloyan (kalci) 209 71.58 96.61 46 22.01
18987. batwayne1 (batwayne1) 8 71.57 79.54 4 50.00
18988. Taybuscus (taybuscus) 32 71.57 88.24 8 25.00
18989. TMGAMING (ggatorade) 13 71.57 81.81 4 30.77
18990. kenneth (kennethnhan) 109 71.57 86.96 23 21.10
18991. Nason (nason420) 1 71.57 71.57 0 0.00
18992. How do I tell her I love he... 104 71.57 94.02 26 25.00
18993. dead (bob_mcbobberbob) 9 71.57 81.53 3 33.33
18994. Bennie (beneficial_bean) 29 71.56 89.70 9 31.03
18995. Daniel (minqz) 1 71.56 71.56 0 0.00
18996. Bob (allanbarry) 29 71.56 81.63 12 41.38
18997. Hungb (hungb) 2 71.56 72.90 0 0.00
18998. Siddharth (siddharthrajpal) 15 71.55 78.09 4 26.67
18999. Satyam (sprayinglight0) 118 71.55 89.92 27 22.88
19000. Tomasz (toumash) 19 71.55 84.89 8 42.11
19001. Hector (hectic131) 2 71.55 73.35 1 50.00
19002. Dana (dwhite84) 26 71.54 98.14 10 38.46
19003. p2 (peep0) 1 71.54 71.54 0 0.00
19004. vamoshi (vamoshi) 3 71.54 73.12 0 0.00
19005. mtn (m0untain) 35 71.54 88.19 8 22.86
19006. ktns (ktns) 11 71.53 77.39 3 27.27
19007. Mike (so_cool31220) 4 71.53 83.81 1 25.00
19008. Noam (okahama) 16 71.53 86.41 3 18.75
19009. Adril (btsbiot) 64 71.53 99.21 17 26.56
19010. @ii (notchaman) 3 71.53 78.97 2 66.67
19011. Paul (piece408) 2 71.53 75.47 0 0.00
19012. Matty (matty_b_raps) 24 71.53 86.84 3 12.50
19013. gojo (gojo9112) 457 71.52 90.00 111 24.29
19014. Tony (itsonlytony) 10 71.52 82.11 1 10.00
19015. Eli (ok_eli) 1 71.52 71.52 0 0.00
19016. brendon (brend0n) 1 71.52 71.52 1 100.00
19017. Lammy (benstickobi595) 1 71.52 71.52 1 100.00
19018. L (lpuczynski) 82 71.52 88.48 21 25.61
19019. Ethan (ethan_w_c) 1 71.51 71.51 0 0.00
19020. kannon (poobear40) 2 71.51 72.86 0 0.00
19021. hein (heinthant) 200 71.51 92.61 40 20.00
19022. Felix (twiizy) 10 71.51 82.27 4 40.00
19023. not_that (darkmaster_30) 12 71.51 82.43 7 58.33
19024. Jack (randomdize) 55 71.50 103.47 13 23.64
19025. Belgutei (belgutei_0323) 2 71.49 75.96 0 0.00
19026. Mr T (tycho77) 5 71.49 73.76 0 0.00
19027. Saral (scrummaster) 9 71.49 78.66 2 22.22
19028. Imaad (iszaffar) 4 71.49 80.01 4 100.00
19029. dark (rycae) 25 71.49 82.90 9 36.00
19030. Shafy (shafy) 13 71.49 83.43 2 15.38
19031. Kean (kean_saneki) 12 71.48 89.26 2 16.67
19032. Alice (communistbean) 8 71.48 84.65 4 50.00
19033. Maun (bubblojoe) 7 71.48 77.11 0 0.00
19034. TurboThiems (turboo_) 5 71.48 77.26 2 40.00
19035. Michael (wevvt) 4 71.48 85.38 2 50.00
19036. Aslan (dzhindzholia) 5 71.47 79.49 1 20.00
19037. AtomToast (atomtoast) 4 71.47 75.35 2 50.00
19038. ksilentstorm (ksilentstorm) 1 71.47 71.47 0 0.00
19039. Amanda (amandaaaa_) 8 71.47 87.00 0 0.00
19040. Illayne (illayne) 8 71.47 89.95 0 0.00
19041. Helmi Abdul (helmiabdul) 71 71.47 80.29 15 21.13
19042. Richard (allacrity) 210 71.47 86.02 40 19.05
19043. Luminer (luminerr) 17 71.46 82.06 7 41.18
19044. Hussein (hussein987) 113 71.46 102.45 33 29.20
19045. Alan (papizene) 28 71.45 85.65 5 17.86
19046. Janis (janisl1993) 224 71.45 92.82 56 25.00
19047. Tanuj (tanuj2552) 5 71.45 74.49 0 0.00
19048. Capablanca (capablanca373) 2 71.45 75.46 0 0.00
19049. Christoffer (chrippa01) 25 71.44 81.61 3 12.00
19050. Bob (ieatyou1) 7 71.44 91.82 0 0.00
19051. fakakon (fakakon) 3 71.44 73.83 2 66.67
19052. Marcin (sakyuz) 2 71.44 73.21 1 50.00
19053. GrandMaster (grandmaster101) 45 71.43 84.29 7 15.56
19054. Justin (pancakemaster216) 2 71.43 74.35 0 0.00
19055. Tohru (tohruu) 16 71.43 90.78 3 18.75
19056. Cole (coleleighs) 2 71.43 72.38 1 50.00
19057. Nicola (bertucciagialla) 1 71.43 71.43 0 0.00
19058. Chukwuka (javalon007) 13 71.43 85.21 5 38.46
19059. ILoveLofi (ginpaku) 65 71.43 94.39 15 23.08
19060. ReconMarine (reconmarine117) 19 71.43 81.01 7 36.84
19061. maciek (zadtrie) 23 71.42 91.85 8 34.78
19062. Tanwa (tanwa) 7 71.42 83.53 1 14.29
19063. Smitty W. (ifartfire) 32 71.42 84.18 7 21.88
19064. Kyle (thekyle0) 4 71.42 75.12 0 0.00
19065. Dejan (narandza) 2 71.42 73.76 1 50.00
19066. Player (sellnox) 9 71.41 77.53 2 22.22
19067. A-Train (k4sh1zy) 69 71.41 88.39 16 23.19
19068. J (imkidding) 1 71.41 71.41 0 0.00
19069. Lushtifer (inanutshell) 138 71.41 89.45 41 29.71
19070. sprwhk (sprwhwk) 47 71.41 85.58 14 29.79
19071. ℑ𝔫𝔢𝔵𝔢𝔠𝔯... 13 71.40 78.73 4 30.77
19072. Matyi (filepmatyi) 15 71.40 83.46 3 20.00
19073. uled (uled) 44 71.40 98.57 18 40.91
19074. Zulsorai (zulsorai) 138 71.40 92.36 33 23.91
19075. Kev (kevwins) 2 71.40 72.73 1 50.00
19076. HiImGosu (heyimgosu) 1 71.39 71.39 0 0.00
19077. helpjepp (helpjepp) 1 71.39 71.39 0 0.00
19078. Jayden (silvernote) 1 71.39 71.39 1 100.00
19079. L (just_a_random_guy_123) 12 71.39 83.11 2 16.67
19080. Santiago (santiago101604) 59 71.39 99.24 15 25.42
19081. Elvar (elvar333) 12 71.39 89.57 2 16.67
19082. The Zaffles (zaffles) 139 71.39 94.11 33 23.74
19083. beepbeep (beep__beep) 14 71.38 83.19 2 14.29
19084. Tuan (tuan) 15 71.38 79.85 2 13.33
19085. Travis (7yl3r) 4 71.38 77.20 0 0.00
19086. Tarek (o_stady) 174 71.37 84.92 38 21.84
19087. Clay (clay10swag) 5 71.37 76.91 0 0.00
19088. George (cleaves) 7 71.37 78.71 1 14.29
19089. root (chroot) 312 71.36 125.93 79 25.32
19090. atlas (h1ng3) 1 71.36 71.36 0 0.00
19091. BadxX (badxx) 6 71.36 79.99 3 50.00
19092. Lazar (lazer123) 7 71.36 82.15 3 42.86
19093. ballz (ballzbazz) 26 71.36 78.39 6 23.08
19094. vincentius (vgpabm) 14 71.35 83.20 11 78.57
19095. Stan (stan3999) 18 71.35 84.71 3 16.67
19096. VNLEASHED (unlevshed) 25 71.35 89.14 9 36.00
19097. Yogesh (bestyogesh) 77 71.34 88.11 13 16.88
19098. Hemant (hemu_sakunde) 1,870 71.34 102.54 490 26.20
19099. Fearless Jutt (lozer098) 268 71.34 92.65 53 19.78
19100. Youssef (youssef_ait_bihi) 45 71.34 95.44 9 20.00
19101. Andrea (aerdna12) 2 71.34 72.92 0 0.00
19102. ssiKY (ssiky) 18 71.33 83.25 3 16.67
19103. Malik (madx) 15 71.33 78.46 5 33.33
19104. Maxim (saipade) 5 71.32 76.27 2 40.00
19105. Dev (darkpi) 27 71.32 85.34 3 11.11
19106. nikolas (nicknt) 48 71.32 87.21 8 16.67
19107. tiglas (tiglas) 20 71.32 80.57 4 20.00
19108. ASAP LiL Fat Chalsy (chalscc) 7 71.32 79.18 1 14.29
19109. Pavel Kotsev (pkotsev) 20 71.31 78.87 3 15.00
19110. Andrew (fyir) 41 71.31 90.35 13 31.71
19111. Krishna (aurum_est_potestas) 54 71.31 86.05 15 27.78
19112. Isc (isc30) 7 71.31 80.56 2 28.57
19113. Noah Ignacio (nachos_7575) 71 71.31 83.47 14 19.72
19114. Makar (gatimoro) 18 71.30 81.28 8 44.44
19115. Yomie (yomie) 8 71.30 82.02 7 87.50
19116. Tastic (t_tastic) 87 71.30 99.59 49 56.32
19117. anth (ant_h) 91 71.30 86.76 23 25.27
19118. zyrch (zyrch) 85 71.30 89.12 26 30.59
19119. Toby (vestrax) 1 71.29 71.29 0 0.00
19120. Brendan (reeeaver) 4 71.29 78.70 1 25.00
19121. Harshpreet (preetikaur12) 1 71.29 71.29 0 0.00
19122. PRINCE (pk226894) 6 71.29 75.98 1 16.67
19123. Ryan Smith (chickenhelmet) 49 71.29 92.21 16 32.65
19124. BengaDH (skebengat) 106 71.29 90.26 28 26.42
19125. Mark (rampagingmoose) 2 71.29 71.44 0 0.00
19126. Marty (lagoskid) 38 71.28 91.47 17 44.74
19127. Ruda (epic_333) 3 71.28 72.47 0 0.00
19128. Adam (waffelele) 8 71.28 79.81 8 100.00
19129. Typical (deltakoma) 4 71.28 74.69 1 25.00
19130. Jimwell (alohaxjim) 6 71.28 81.75 1 16.67
19131. Luis (justluisb) 1 71.28 71.28 0 0.00
19132. Suhan (suhan_pradhan) 13 71.27 85.49 2 15.38
19133. Joses (radcaly) 17 71.27 86.41 3 17.65
19134. Yape (yape) 1 71.27 71.27 0 0.00
19135. Will (wombat50ng) 3 71.27 81.99 0 0.00
19136. CoolMan14 (coolman14) 11 71.27 83.27 8 72.73
19137. Spyros (covertcommunist) 4 71.27 83.60 2 50.00
19138. Logan (anonymous_934) 2 71.27 72.59 2 100.00
19139. IMZA (runawayse) 10 71.26 79.33 1 10.00
19140. Chester (chesterization) 73 71.26 82.53 12 16.44
19141. kamincai (kamincai) 1 71.26 71.26 1 100.00
19142. Le Kang (kangkanglw) 39 71.26 89.85 11 28.21
19143. Chris (chrishene) 10 71.26 80.98 2 20.00
19144. Nabil (nabilmuafa) 15 71.26 84.26 4 26.67
19145. Likkon (likkon_maddik) 14 71.25 84.31 6 42.86
19146. Ziad (0ziadmohamed0) 57 71.25 82.89 16 28.07
19147. Nicholas (omzero) 24 71.25 82.80 5 20.83
19148. Jordan (jfilip56) 4 71.25 78.06 2 50.00
19149. type (typesuck) 3 71.25 73.85 0 0.00
19150. Furaha (furfur_beast) 9 71.25 78.95 1 11.11
19151. YNCBearz (bear19930414) 77 71.24 85.35 16 20.78
19152. johnick44 (johnick44) 40 71.24 83.16 7 17.50
19153. Itay (itay_amit) 3 71.24 74.26 0 0.00
19154. Leonardo (sonoleo) 18 71.24 80.80 4 22.22
19155. XxKarmaX (xxkarmax) 4 71.24 80.97 0 0.00
19156. Shivam Kumar (shivam51) 10 71.23 84.01 3 30.00
19157. Connor (frantelle) 16 71.23 87.40 6 37.50
19158. Matthew (thefinchler) 33 71.23 80.89 6 18.18
19159. tapan (psydelix) 11 71.23 79.97 2 18.18
19160. Martin (martinmaster) 169 71.23 84.46 44 26.04
19161. Ahmed (ahmekal) 62 71.22 84.14 13 20.97
19162. fred777i (fred777i) 14 71.22 98.19 2 14.29
19163. Keiji (keiji453) 1 71.22 71.22 1 100.00
19164. . (4n0nym0us_h4ck3r) 2 71.22 75.17 1 50.00
19165. Iam (aaaallleen) 17 71.21 85.18 3 17.65
19166. Laz (lazzo) 8 71.21 79.05 1 12.50
19167. James (james000) 9 71.21 80.42 0 0.00
19168. Mic (jesusluvr) 60 71.21 91.52 16 26.67
19169. Michael (sephknowhim) 1 71.21 71.21 0 0.00
19170. tourist (tourist18) 84 71.21 80.80 22 26.19
19171. Mahedi (12362) 105 71.21 92.76 29 27.62
19172. Amir (amir_bc) 8 71.21 84.87 2 25.00
19173. Adam (nefrepitou) 8 71.21 80.53 6 75.00
19174. Osama (default_1011) 10 71.20 81.14 4 40.00
19175. Muffin (muffinboi5) 7 71.20 85.58 7 100.00
19176. luckylian123 (luckylian123) 57 71.20 94.04 18 31.58
19177. Mark (lilpep_the_6th) 5 71.19 79.70 3 60.00
19178. Vesa (vesaninja) 6 71.19 83.46 2 33.33
19179. John (dregz) 3 71.19 73.94 1 33.33
19180. Rudolf (trudo) 12 71.18 78.48 4 33.33
19181. Van (vanberen) 14 71.18 81.55 6 42.86
19182. Luffy-dono (luffy_dono) 156 71.18 88.70 37 23.72
19183. jon (angbunehneh) 9 71.18 79.16 3 33.33
19184. saba (midvert) 26 71.18 83.67 14 53.85
19185. enminnrawr (zxcvbnm2001) 1,394 71.18 101.07 344 24.68
19186. Catman (catman847) 96 71.18 86.41 24 25.00
19187. Af (aepaef17) 69 71.18 90.75 18 26.09
19188. Ahmed (meguta) 6 71.18 83.43 2 33.33
19189. Nathan (nayteo) 16 71.17 84.45 0 0.00
19190. Sylwester (rex1313) 317 71.17 108.84 90 28.39
19191. Raven (rvnfx) 11 71.17 90.00 9 81.82
19192. Pavan (sai_pavan) 264 71.17 93.84 60 22.73
19193. Xumo (xumovoid) 1 71.17 71.17 1 100.00
19194. Burak (burakkor434) 93 71.17 87.02 19 20.43
19195. Alex (delvern) 275 71.16 87.59 71 25.82
19196. wayexzee (wayexzee) 21 71.16 80.68 5 23.81
19197. ali (ali79taba) 135 71.16 84.93 46 34.07
19198. Stig (no1irishstig) 7 71.16 93.29 5 71.43
19199. Leah (lilybethlily) 4 71.16 81.28 0 0.00
19200. Kaymart (barrix) 29 71.15 97.00 10 34.48
19201. Danica (pandanica) 4 71.15 77.39 1 25.00
19202. poepmannetje (poepmannetje) 20 71.15 86.19 4 20.00
19203. Ayrton (ayrton1110) 3 71.14 73.42 1 33.33
19204. Claire (house_cat) 32 71.14 81.98 7 21.88
19205. Rdk (olegus) 169 71.14 90.42 47 27.81
19206. Souvik (rascalam) 94 71.14 95.50 22 23.40
19207. Eddie (ger_eddie) 21 71.14 77.07 4 19.05
19208. Noobiest (noobiestmaster) 27 71.14 93.38 7 25.93
19209. brandon (milks0ck) 1 71.13 71.13 1 100.00
19210. Lorenzo (lolgab) 1 71.13 71.13 1 100.00
19211. Eden (edenboboi) 3 71.13 74.62 0 0.00
19212. Ben (bmj774) 6 71.13 79.72 0 0.00
19213. Ankan (nc3rtainity) 253 71.12 90.25 63 24.90
19214. Rodrigo (pacha2880) 30 71.12 81.85 7 23.33
19215. Adam (acassidy24) 47 71.11 90.39 11 23.40
19216. Lam (rebmal101) 7 71.11 78.45 4 57.14
19217. Tim (timmaayyt) 7 71.10 86.30 0 0.00
19218. Weziq (weziq) 4 71.10 77.94 1 25.00
19219. GoneRogue (josephlee) 16 71.10 82.98 5 31.25
19220. GODLIKE (acrimeisnotfine) 37 71.09 93.38 13 35.14
19221. Goose (reichmatthew) 2 71.09 71.33 1 50.00
19222. Jack Pascoe (mrprotyperman69) 25 71.09 90.59 18 72.00
19223. Zid (zid1312) 3 71.08 75.14 3 100.00
19224. ciber (cibernike) 6 71.08 74.67 3 50.00
19225. Lucas (lukasyoi2) 366 71.08 103.01 121 33.06
19226. Terry (jiatinglu99) 4 71.08 73.18 0 0.00
19227. Prathamesh (mystic_1) 28 71.08 82.88 9 32.14
19228. Toko (n17n) 3 71.07 87.86 1 33.33
19229. Macy (macylace) 335 71.07 95.60 81 24.18
19230. Parker (seriousnewt8) 18 71.07 87.01 4 22.22
19231. Sola (solaonix) 1 71.07 71.07 1 100.00
19232. Renee (rtvhyde) 4 71.07 78.43 0 0.00
19233. alec (mrwisntworking) 3 71.07 84.49 1 33.33
19234. ( ' - ' ) (pengun) 7 71.07 79.26 4 57.14
19235. Doychin (dodosaurus) 4 71.07 77.50 1 25.00
19236. Ximiz (ximiz) 5 71.06 77.40 1 20.00
19237. karimulla (karimulla12) 67 71.05 96.75 18 26.87
19238. Erik (erickano) 186 71.05 92.13 52 27.96
19239. Sam (sammusubi27) 111 71.05 87.34 30 27.03
19240. Olan (olan10001) 16 71.05 87.13 4 25.00
19241. Caleb (reflux2k) 2 71.05 75.35 1 50.00
19242. Chadgoomba (chadgoomba) 7 71.04 89.42 1 14.29
19243. CHAU (rookylk) 3 71.04 78.68 2 66.67
19244. Mandem (madem) 411 71.04 120.82 115 27.98
19245. duh fast af (umrca) 2 71.04 74.24 1 50.00
19246. Aztixz (aztix) 15 71.04 79.30 4 26.67
19247. Tom (lambertsfan5858) 6 71.04 79.38 2 33.33
19248. Work (worklife) 18 71.03 78.05 1 5.56
19249. Praggapan (silentmachine) 342 71.03 97.40 90 26.32
19250. Adil (adika_r) 70 71.03 83.63 22 31.43
19251. Eugene (i_am_neo) 1 71.03 71.03 1 100.00
19252. Hydrix (hydrix03) 8 71.03 79.63 2 25.00
19253. Taiki (vegantaiki) 35 71.03 89.24 11 31.43
19254. Zeus (zeuseus) 1 71.02 71.02 1 100.00
19255. harcipulyka (harcipulyka) 12 71.02 79.90 3 25.00
19256. Pana (pana1312) 4 71.02 72.17 1 25.00
19257. Quan (martinrockon) 107 71.01 96.20 27 25.23
19258. Abid Hasan (abid_hasan_abir) 3 71.01 77.83 1 33.33
19259. md mahadie (mdmahadiehasanh... 79 71.01 88.44 21 26.58
19260. omar (nightkappa73) 87 71.01 91.41 17 19.54
19261. A (taffing) 21 71.01 82.13 0 0.00
19262. Putra (hoodedproxy) 13 71.01 81.07 4 30.77
19263. Robby (robdog1) 4 71.01 83.04 1 25.00
19264. Aditya (adibhandari) 293 71.00 92.80 85 29.01
19265. Nurasyl (nurrrrasyl) 1 71.00 71.00 0 0.00
19266. jib (huwakiin) 17 71.00 79.33 10 58.82
19267. chalantorn (tonchalantron) 19 71.00 86.51 14 73.68
19268. Elliot (ghostisghost) 6 71.00 86.79 6 100.00
19269. Matt (shootposting) 1 70.99 70.99 0 0.00
19270. Duc (cmd1293) 2 70.99 75.77 2 100.00
19271. Philos (philos_1) 2 70.99 77.50 2 100.00
19272. Dev (devgupta55) 595 70.99 94.07 134 22.52
19273. Phillip (kinkking123) 15 70.99 92.41 6 40.00
19274. Ashiquzzaman (ashiquzzaman33) 11 70.98 78.21 1 9.09
19275. Night (anemonighteye) 225 70.98 104.02 55 24.44
19276. chris (chwis) 3 70.98 77.75 0 0.00
19277. Pias (piasroy) 4 70.98 72.36 0 0.00
19278. Marek (cxmu03) 6 70.98 79.05 0 0.00
19279. Mohamed (mdmod) 3 70.98 77.76 1 33.33
19280. Yifan (gyyy1995) 8 70.98 80.34 3 37.50
19281. the_faceless (the_faceless) 4 70.97 82.89 1 25.00
19282. Shark (sharktornado) 1 70.97 70.97 0 0.00
19283. Jitesh (jitesh117) 2 70.97 71.70 0 0.00
19284. Thomas (sniped_) 5 70.97 83.66 2 40.00
19285. Maksym (trickstermaks) 34 70.96 91.34 7 20.59
19286. millstypes (millstypes) 20 70.96 83.81 7 35.00
19287. Felix (felixthefroggo) 1 70.96 70.96 0 0.00
19288. Mike (miym) 113 70.96 83.42 19 16.81
19289. bruh (lambertwp) 119 70.96 90.71 30 25.21
19290. kabbo (kabbo25) 62 70.96 99.11 17 27.42
19291. Tarun (tpunhani) 88 70.95 94.01 23 26.14
19292. Alex (atduffaut) 145 70.95 96.04 37 25.52
19293. sharavsambuu (sharavsambuu) 80 70.95 86.67 22 27.50
19294. suancreative (suancreative) 3 70.95 75.62 1 33.33
19295. Norps (norps) 13 70.94 80.82 2 15.38
19296. Dev (devsaluja15) 1 70.94 70.94 0 0.00
19297. tango (rangotango) 58 70.94 97.78 34 58.62
19298. Raymoz (raymoz) 3 70.94 84.19 0 0.00
19299. Kenneth (feyro) 3 70.94 78.72 3 100.00
19300. Narasimha Nadh (nadh_7) 50 70.93 86.99 15 30.00
19301. DaVinky (xxlarrylegendxx) 111 70.93 89.07 38 34.23
19302. André (agdf) 25 70.93 78.58 6 24.00
19303. Souptacks (souptacks) 140 70.92 96.32 29 20.71
19304. Sebastian (tbgseb) 9 70.92 80.55 3 33.33
19305. Dante (flukierclient) 13 70.92 84.30 4 30.77
19306. John (kingpigeon) 228 70.92 96.62 56 24.56
19307. ilias (iliasnik21) 1 70.92 70.92 0 0.00
19308. Michael Jay (rsbluee) 1 70.92 70.92 1 100.00
19309. Zach (xachg) 10 70.92 79.00 4 40.00
19310. Adam (vincentadam) 58 70.91 82.22 13 22.41
19311. Yaroslav (eloren) 25 70.91 90.81 3 12.00
19312. simon (chainsawteeth) 83 70.91 83.14 21 25.30
19313. Hoppy (crunchydog) 8 70.91 77.43 1 12.50
19314. himaji (himaji) 7 70.91 81.64 2 28.57
19315. Jimmy Le🇻🇳🇺🇸 (c... 127 70.91 88.72 30 23.62
19316. Shubham (shubham_) 78 70.90 87.93 16 20.51
19317. Long (bachthime) 89 70.89 92.99 19 21.35
19318. Letsy (glitchyletsy) 9 70.89 95.09 4 44.44
19319. Michael (truongm21) 2 70.89 71.70 0 0.00
19320. bryan (joebidens_son) 17 70.88 92.65 12 70.59
19321. phantas (phantaslock) 3 70.88 75.86 1 33.33
19322. Dylan (dc4lif3) 3 70.88 77.31 1 33.33
19323. Barrett (jahspp) 14 70.88 81.45 4 28.57
19324. Dan (x_danma) 11 70.87 82.87 2 18.18
19325. Jake (kuch13) 6 70.87 76.80 1 16.67
19326. trollingck (trollingck) 2 70.87 72.86 0 0.00
19327. Jamie (sneepdeep) 1 70.87 70.87 0 0.00
19328. Aryaan (argentumv) 2 70.87 85.40 1 50.00
19329. Chris (chrisbones) 9 70.86 83.97 2 22.22
19330. hanni3 (dontwakeme) 3 70.86 82.41 2 66.67
19331. lynn (lynniee) 3 70.86 75.05 0 0.00
19332. Cijarot (cijarot) 9 70.86 81.09 2 22.22
19333. Britney (britney1550) 4 70.85 79.79 2 50.00
19334. author (authorrr) 6 70.85 81.81 5 83.33
19335. uhhhhhhh (membrane_ripper) 98 70.85 92.82 23 23.47
19336. Hoang Tuan (wumi4) 3 70.85 74.88 1 33.33
19337. Prashant (prashant_204) 21 70.85 92.45 4 19.05
19338. Cammy (cammy04) 88 70.85 82.82 15 17.05
19339. Nicolas (typekaiser) 632 70.85 101.49 165 26.11
19340. Mohammad Imam (1mam) 37 70.85 85.12 13 35.14
19341. Xavier (qiltz) 55 70.84 86.25 15 27.27
19342. Vasilis (2004vas) 4 70.84 80.51 1 25.00
19343. Subeesh (subeesh18) 7 70.84 76.99 2 28.57
19344. Khondokar (draenor06) 8 70.84 90.06 4 50.00
19345. Johannes (typerjojo) 9 70.83 83.59 0 0.00
19346. miko (pisleo) 13 70.83 81.82 1 7.69
19347. chris (fscj4raxhel) 383 70.83 93.52 77 20.10
19348. bob (bobsmith111) 3 70.83 77.33 1 33.33
19349. Syd (angryscreech) 5 70.83 75.98 3 60.00
19350. Sudip (donda) 350 70.82 97.84 83 23.71
19351. Jesse (yojesse__) 85 70.82 101.01 19 22.35
19352. Apple (omnipotential_magic) 16 70.82 80.22 1 6.25
19353. mush (mushkatsu) 19 70.82 91.54 2 10.53
19354. Zchob (zchob) 7 70.82 77.31 5 71.43
19355. Hagibobo (hagibobo) 1 70.82 70.82 0 0.00
19356. Savannah (peaches39) 29 70.82 85.20 8 27.59
19357. K (rynetemp) 35 70.81 102.61 9 25.71
19358. Muhammad Dwi (krauchelli) 1 70.81 70.81 1 100.00
19359. lei (__lwan) 5 70.81 82.30 3 60.00
19360. Vihaan (vihaan89) 3 70.81 85.71 1 33.33
19361. Pradeep (pradeep80) 268 70.81 117.68 62 23.13
19362. Jeff (ffej5333) 3 70.81 76.81 0 0.00
19363. Ballistic (8a11istic) 22 70.81 78.96 7 31.82
19364. honk (fallguys) 93 70.80 94.61 26 27.96
19365. Justin (ragegaze) 3 70.80 80.53 1 33.33
19366. RiCyber (curiouscrow) 161 70.80 83.70 52 32.30
19367. Darijuan (darijuan) 18 70.80 83.48 7 38.89
19368. Benjamin (drwumboo) 17 70.79 85.34 5 29.41
19369. Ashraful (noid621376) 15 70.79 86.65 5 33.33
19370. Shukhrat (shux121995) 128 70.79 87.26 28 21.88
19371. liam (liamtangg) 4 70.79 80.75 2 50.00
19372. RacerABM (racerabm) 114 70.79 96.05 32 28.07
19373. Palish (palish) 86 70.78 87.40 22 25.58
19374. Giralt (giralt) 3 70.78 85.27 0 0.00
19375. HowToTypin9 (supergodnes) 47 70.78 91.14 11 23.40
19376. vinicius (nagahori) 13 70.78 79.14 3 23.08
19377. llihcchill (llihcchill) 22 70.78 84.76 6 27.27
19378. Marvin (partass) 348 70.78 89.22 85 24.43
19379. ken (kuanying) 4 70.78 76.60 0 0.00
19380. Silas (silvanus) 7 70.77 74.59 2 28.57
19381. Raghav (raghavlaad) 51 70.77 91.80 13 25.49
19382. Jonas (jnshey) 1 70.77 70.77 0 0.00
19383. Joe (icorion) 2 70.77 76.56 0 0.00
19384. Karen (karent_x3) 21 70.76 83.96 5 23.81
19385. char (calcifer_6) 5 70.76 79.31 4 80.00
19386. Kažkas (kazkass) 19 70.76 77.12 5 26.32
19387. Laco (ian860824) 1 70.76 70.76 0 0.00
19388. Damian (waninggibbous) 7 70.76 73.86 3 42.86
19389. Toxic (toxicbaby3000) 429 70.76 101.95 103 24.01
19390. Khang (manhkhangvn) 4 70.76 78.79 0 0.00
19391. Monotarinai (monotarinai) 290 70.76 93.83 73 25.17
19392. Corey (coreygallagher1194) 5 70.75 77.26 1 20.00
19393. Suns (49suns) 20 70.75 80.14 2 10.00
19394. Jordan (brownbox) 87 70.75 84.85 29 33.33
19395. Zap (drdecember) 29 70.75 86.00 7 24.14
19396. SkyDarkBomber (skydarkbomber) 3 70.75 78.81 1 33.33
19397. Brian (the_bc) 13 70.75 80.04 5 38.46
19398. Zach (kaito_zach) 6 70.75 77.33 0 0.00
19399. Zenyth (zenyth) 17 70.74 74.32 3 17.65
19400. Steven (thethicckid) 1 70.74 70.74 1 100.00
19401. Misael (llillill) 9 70.74 80.59 3 33.33
19402. CapooLife (awesomevincent) 7 70.74 89.72 1 14.29
19403. Igor (igor2003) 47 70.74 88.92 11 23.40
19404. Jameson (jamesonnizo) 2 70.73 74.08 0 0.00
19405. EnderMite (endermite) 3 70.73 76.42 1 33.33
19406. Charkz (charkz) 1 70.73 70.73 0 0.00
19407. (leunn) 9 70.73 81.49 3 33.33
19408. Madison (speedbltch) 102 70.73 93.44 24 23.53
19409. Alex (zimbo21003) 16 70.73 83.78 2 12.50
19410. MH (mh_parag) 87 70.73 88.82 22 25.29
19411. Heide (vnit) 247 70.73 96.53 52 21.05
19412. Jekamiah (j4k3y_yall) 4 70.73 78.02 0 0.00
19413. Kenzen (kenzen18) 80 70.72 87.53 23 28.75
19414. Johan (thehutt) 30 70.72 81.34 19 63.33
19415. Viraj (viruthefire) 1 70.72 70.72 1 100.00
19416. senz (offsets) 5 70.72 76.63 0 0.00
19417. EC (yapenchong1) 3 70.71 72.51 1 33.33
19418. martinspp (martinspp) 1 70.71 70.71 1 100.00
19419. smakkacow (smakkacow) 9 70.71 77.11 0 0.00
19420. David (sirlaser) 2 70.71 78.70 2 100.00
19421. raven (mr_raven) 85 70.70 87.57 28 32.94
19422. oddrationale (oddrationale) 7 70.70 82.87 1 14.29
19423. Anubhav (etra_567) 194 70.70 103.25 47 24.23
19424. Adam (armen32cz) 18 70.69 84.31 0 0.00
19425. Justin (dainese) 16 70.69 83.07 4 25.00
19426. Rwu (rwu_) 1 70.69 70.69 0 0.00
19427. S (messmind) 1 70.69 70.69 1 100.00
19428. Vashista (vashista) 870 70.69 98.13 208 23.91
19429. Daedalus (dufficinetic) 89 70.68 87.90 17 19.10
19430. Shaun (sladerrr) 3 70.68 73.58 0 0.00
19431. Paul (paulllx) 46 70.68 94.77 10 21.74
19432. Yana (yanafaisal) 5 70.68 77.96 2 40.00
19433. Keegan (keegan9503) 54 70.68 87.83 14 25.93
19434. FRATNIX (fratnix) 41 70.68 84.35 13 31.71
19435. not (j097) 15 70.68 86.55 3 20.00
19436. Hamid ツ (_hamid_) 2 70.68 85.77 0 0.00
19437. Vishnu (crazy_typeracer) 92 70.67 92.71 24 26.09
19438. nea (neapollotan) 42 70.67 85.42 8 19.05
19439. Evelyn (evline) 344 70.66 86.98 85 24.71
19440. Joshua (jkm711) 15 70.66 86.53 3 20.00
19441. Dingo Dango (dankwanktank) 42 70.65 91.64 14 33.33
19442. david (twistybaer) 366 70.65 94.23 70 19.13
19443. Tom (tomme2009) 1,632 70.65 98.99 349 21.38
19444. Zakir (zakitwelvee) 2 70.65 80.78 0 0.00
19445. Justin (justinsavino) 2 70.65 74.35 2 100.00
19446. Wai Yon (ravesplash) 34 70.65 79.24 17 50.00
19447. twickortweat (talkingbebuu) 2 70.65 75.44 0 0.00
19448. Aidan (aidan605) 11 70.64 78.33 2 18.18
19449. Luke (swarmington5) 3 70.64 80.74 2 66.67
19450. MstrCoconut (mstrcoconut) 2 70.64 73.42 1 50.00
19451. Zodi (zodi_dutoit) 123 70.63 84.61 28 22.76
19452. Nik (fastesttyper101) 48 70.63 95.02 7 14.58
19453. sam (beuk15) 3 70.63 74.83 3 100.00
19454. Viet (noobaxereport) 24 70.63 82.37 5 20.83
19455. Sinan (eul3r) 4 70.62 78.74 1 25.00
19456. Sahariar (noob_sahariar) 264 70.62 98.98 67 25.38
19457. Miracle- (nakatsumiuchiha) 15 70.62 83.42 2 13.33
19458. black. (idkmyfriend) 3 70.62 74.60 1 33.33
19459. Ferrari (fluidcoder) 9 70.62 76.95 4 44.44
19460. Ian (ian_k_john) 7 70.62 89.96 0 0.00
19461. Dhruv (loneninja__) 9 70.62 79.54 2 22.22
19462. melinder (melindayao21) 4 70.62 73.83 3 75.00
19463. Nuwaisir (nuwaisir) 17 70.61 79.55 2 11.76
19464. A (getsavaged) 6 70.61 76.58 4 66.67
19465. Joe (joejoeparen) 13 70.60 95.76 9 69.23
19466. Splixy (splixy) 152 70.60 88.42 37 24.34
19467. Andre (lapp13slaf) 24 70.60 86.02 5 20.83
19468. Winson (winlee620) 2 70.60 71.00 0 0.00
19469. Gemma (gemmaaa) 62 70.60 91.83 17 27.42
19470. Ar7N (ar7n) 141 70.60 98.54 31 21.99
19471. Cookies (poeannn) 11 70.59 80.58 5 45.45
19472. Shahan Sanjid Khan (korosen... 76 70.59 82.86 17 22.37
19473. Will (willchristian00) 1 70.59 70.59 0 0.00
19474. dylan52528 (dylan52528) 14 70.59 85.89 4 28.57
19475. Radu (rhadoo611) 7 70.59 83.19 2 28.57
19476. Shivam (swadhwa) 40 70.59 91.93 13 32.50
19477. Dexter (notundampeddex) 1 70.58 70.58 1 100.00
19478. Griffin (gdawg_10) 11 70.58 81.07 7 63.64
19479. ruohola (ruohola) 2 70.58 75.19 1 50.00
19480. . (scorae) 14 70.57 82.44 2 14.29
19481. Mohammed Julfikar Ali (julf... 25 70.57 89.74 9 36.00
19482. Simon (_wolfram) 1 70.57 70.57 1 100.00
19483. Rusty (rustyspicer) 1 70.57 70.57 0 0.00
19484. Gerard (gerard_m_m) 659 70.57 100.46 185 28.07
19485. wowzaa (wowzaa1) 11 70.57 85.53 1 9.09
19486. kutay (kutaybozkurt) 32 70.56 82.63 12 37.50
19487. Gregory (great_yarn) 2 70.56 73.24 2 100.00
19488. Donovan (24aad) 16 70.55 81.63 2 12.50
19489. Shirito (shirito) 13 70.54 79.82 2 15.38
19490. James (frozenoblivion) 5 70.54 80.47 0 0.00
19491. Tom (voiovinili) 33 70.54 89.53 7 21.21
19492. Kaelib (teegka01) 6 70.53 80.90 1 16.67
19493. T (taison13) 5 70.53 80.05 1 20.00
19494. Bart (madhavgoyal) 24 70.52 85.06 4 16.67
19495. DLaiy (dlaiy) 1 70.52 70.52 0 0.00
19496. Matsvei (tictacfruit) 21 70.52 80.96 5 23.81
19497. fingerSkate (skhmt) 96 70.52 89.55 18 18.75
19498. Morad (morad_the_beast) 52 70.52 80.61 11 21.15
19499. Jon (jonlee17) 9 70.51 81.22 3 33.33
19500. Sushi (sushixr) 144 70.51 93.38 30 20.83
19501. Binscuit (scoutzc) 31 70.51 83.82 8 25.81
19502. Arul (arulseth1998) 10 70.51 83.86 2 20.00
19503. Type (iwant2typefaster) 6 70.51 80.50 1 16.67
19504. Anna (lol_get_rekt_scrub) 2 70.51 72.78 1 50.00
19505. Jiarui (mike9557) 17 70.50 87.09 4 23.53
19506. Akshay (akshayxw69) 38 70.50 85.60 4 10.53
19507. Zurfer (zurfer) 155 70.50 99.29 40 25.81
19508. aalam (alambek) 5 70.50 88.19 2 40.00
19509. Pieces (pieces08) 15 70.49 76.77 7 46.67
19510. Galib (galib2051) 11 70.49 77.81 4 36.36
19511. Chhavi (chhavijain1111) 98 70.49 88.20 19 19.39
19512. Adam (adxam) 28 70.49 81.07 5 17.86
19513. BBB (beermindnor) 910 70.49 96.06 221 24.29
19514. Kin (binbobum12s) 21 70.49 82.74 6 28.57
19515. Sofia (mayi_o4) 12 70.49 87.51 7 58.33
19516. Donn Justin (bulos19) 5 70.49 76.22 0 0.00
19517. Nicole (nhixon) 5 70.49 76.46 2 40.00
19518. Super slow (jan_war) 25 70.49 85.51 6 24.00
19519. ad (ad13) 1 70.48 70.48 1 100.00
19520. David (djtm) 12 70.48 76.98 4 33.33
19521. Mr. Fancy (mr_fancy77) 74 70.48 90.22 18 24.32
19522. Best (bestgemon) 2 70.48 74.09 1 50.00
19523. Idk (ldk_howtobreathe) 6 70.48 76.86 4 66.67
19524. Manikkavel (manikkavel_s) 13 70.47 79.85 2 15.38
19525. Fathan (fathanpathurijal) 14 70.47 80.28 4 28.57
19526. Bad (iwillgetbetterattyping) 7 70.47 79.13 2 28.57
19527. Akshay (ins4nity_god) 1 70.47 70.47 0 0.00
19528. Sagar (theidiotkingboi) 2 70.47 71.77 0 0.00
19529. Intertial (yuvi_birdi) 38 70.47 83.08 7 18.42
19530. Lasse Hededal (hededal) 27 70.46 86.33 7 25.93
19531. Alish (kzmadcat) 11 70.46 84.59 0 0.00
19532. Nathaniel (scryo) 17 70.46 94.65 3 17.65
19533. Cory (jellygoku) 1 70.46 70.46 0 0.00
19534. Edo (edo4th) 3 70.46 77.07 0 0.00
19535. Elijah (bacchus1) 1 70.45 70.45 1 100.00
19536. Max (hoglimogli) 5 70.45 75.37 0 0.00
19537. Pin (bleeep) 55 70.45 82.28 16 29.09
19538. SuperGion915 (supergion915) 18 70.45 82.41 4 22.22
19539. lodo4ka (lodo4ka) 18 70.45 83.82 3 16.67
19540. Yash (thanosyash) 255 70.45 102.01 56 21.96
19541. Jorgim The (jorgimtheguy) 4 70.45 73.78 1 25.00
19542. Gaurav (absurd_man) 376 70.44 93.32 96 25.53
19543. Linus (mrtuxg) 5 70.44 70.98 0 0.00
19544. rose (roseishot) 2 70.44 75.01 0 0.00
19545. Jack (jacjack) 176 70.44 90.27 27 15.34
19546. Evanz (evanzyt) 9 70.44 78.16 4 44.44
19547. Alexander (dencyh) 535 70.44 96.29 140 26.17
19548. Dinja (insanedjoker) 180 70.43 107.33 36 20.00
19549. Ryan (ryachu) 3 70.43 77.09 0 0.00
19550. Spartacus (galvarino) 182 70.43 94.14 41 22.53
19551. ben (hobomojo) 15 70.42 82.91 5 33.33
19552. Online (polar_beans) 4 70.42 77.89 0 0.00
19553. Melioninas (melioninas) 19 70.42 83.65 6 31.58
19554. Suhel (horacio_chopin) 44 70.42 83.00 9 20.45
19555. Butchy (randomguy4ever) 43 70.42 90.17 12 27.91
19556. Safi (safeehalim) 89 70.42 89.21 27 30.34
19557. Pan con Palta (panconpalta123) 12 70.42 91.34 2 16.67
19558. Jupiter8000 (jupiter8000) 148 70.41 96.21 47 31.76
19559. Tom (tcrman) 12 70.41 82.95 1 8.33
19560. A (deoignition) 20 70.41 79.44 2 10.00
19561. eashr37 (eashr37) 3 70.41 75.66 0 0.00
19562. Uhhhhhhh (shidlord) 1 70.41 70.41 0 0.00
19563. Carson (carsonting) 60 70.41 97.55 12 20.00
19564. kakujodai (kakujodai) 5 70.41 80.30 1 20.00
19565. WhySoSlow (milktea_1999) 16 70.41 77.77 3 18.75
19566. Morgan (morgansoares6) 52 70.41 93.60 9 17.31
19567. 23 (jorgexdlol) 20 70.41 82.16 6 30.00
19568. Jackson (anonym00se) 3 70.40 79.84 0 0.00
19569. Polom (polomfileni) 4 70.40 72.10 2 50.00
19570. Lonmanbeast (lonmanbeast) 47 70.39 83.05 9 19.15
19571. CJ (seajayyy) 6 70.39 84.62 0 0.00
19572. Venus (xxvenusxx) 39 70.39 91.87 10 25.64
19573. Happy (paimon__) 33 70.39 86.15 7 21.21
19574. Jeandre (theopgamer) 15 70.39 84.66 15 100.00
19575. andrew (duncan01) 7 70.39 77.11 4 57.14
19576. Martin (martin12249) 2 70.39 72.85 0 0.00
19577. ric (ricman0) 20 70.38 89.12 3 15.00
19578. kyasaa (kyasaa) 39 70.38 81.77 13 33.33
19579. Palta (palta_hass05) 8 70.38 79.93 1 12.50
19580. ERMT (beefwong) 1 70.38 70.38 0 0.00
19581. Siddhant (sids2k) 2 70.38 73.37 1 50.00
19582. Bertie (sunstonesharptor) 29 70.38 84.29 0 0.00
19583. Amin (collypso) 4 70.38 85.36 1 25.00
19584. Zhantore (belayed) 2 70.38 70.54 1 50.00
19585. Brt (brtboi) 35 70.37 90.71 7 20.00
19586. Shane (shanelyons1020) 2 70.37 73.89 1 50.00
19587. ∞ (maely) 2 70.37 78.39 1 50.00
19588. call me hani (tsmal3rb) 6 70.36 76.65 3 50.00
19589. Hans (zozo800) 7 70.36 76.21 0 0.00
19590. Max (kingjahan2) 1 70.36 70.36 0 0.00
19591. Alejandro (vortitex) 2 70.36 75.73 0 0.00
19592. Michal (majklovich) 2 70.36 80.54 1 50.00
19593. 7NNS7 (7nns7) 5 70.35 85.92 2 40.00
19594. Basti (bastigga_) 19 70.35 83.16 5 26.32
19595. Kuripa (kuripa) 3 70.35 74.42 0 0.00
19596. haraj (haraj) 1 70.35 70.35 0 0.00
19597. Siddhesh (sid20) 1 70.35 70.35 0 0.00
19598. Zaptronic (zaptronic) 2 70.35 72.86 1 50.00
19599. Eric (godhand4826) 18 70.34 81.88 3 16.67
19600. Max (maxed0utt) 6 70.34 87.98 0 0.00
19601. Robert (robertgrylls) 21 70.34 83.67 8 38.10
19602. Sai Mani Raj (saimaniraj) 20 70.34 89.57 6 30.00
19603. Spaketi (xngelic) 3 70.34 74.46 1 33.33
19604. Raymond (awedragon) 2 70.34 78.64 1 50.00
19605. Luke (jaberwacky) 3 70.33 76.48 1 33.33
19606. ImSmarterOnWo_rdBomb (imsma... 2 70.33 78.54 1 50.00
19607. Jeff (jeff_1107) 15 70.32 84.71 2 13.33
19608. smuel (14adamssam) 58 70.32 83.66 13 22.41
19609. slick (slickgogo) 2 70.32 73.67 2 100.00
19610. tstats[jcagz] (jcagz) 1 70.32 70.32 0 0.00
19611. Spruty (infrasix) 5 70.32 73.48 5 100.00
19612. Aakash (aakash_rp_621) 8 70.32 75.38 4 50.00
19613. Janet (hasuhime) 12 70.31 85.99 4 33.33
19614. Chen (nyarlathoteppppp) 117 70.31 85.10 31 26.50
19615. Sanmeel (sanmeel) 10 70.31 85.01 4 40.00
19616. Sagar (saucy_d) 8 70.30 80.95 3 37.50
19617. xi (highrizery) 12 70.30 78.21 2 16.67
19618. Lee (derfmongrel) 1,350 70.30 99.77 289 21.41
19619. Bikash (bikash_grg) 41 70.29 88.20 9 21.95
19620. Danny (lifeupsidedown) 216 70.29 87.19 47 21.76
19621. Grzegorz (jag1) 94 70.28 87.93 25 26.60
19622. Aidan (attan090) 7 70.28 79.41 1 14.29
19623. Pen (nutty69) 1 70.28 70.28 1 100.00
19624. noctedie (noctedie) 41 70.28 98.35 13 31.71
19625. bryan (morenomust) 25 70.28 101.44 8 32.00
19626. Topher (burritopher) 9 70.28 82.76 3 33.33
19627. Hoang (huyyyyyyyyyyyyyyyyy) 19 70.28 77.67 4 21.05
19628. Aries (ariesqi) 2 70.28 72.98 0 0.00
19629. moyu (teledodol) 7 70.27 86.32 3 42.86
19630. Albert (waifu420) 3 70.27 76.39 0 0.00
19631. vincent (godofbokchoy) 4 70.27 75.48 2 50.00
19632. Moni (tentwashere) 1 70.27 70.27 1 100.00
19633. CF (cfoodc) 6 70.27 79.24 3 50.00
19634. Moogii (mongoljan) 8 70.27 72.70 0 0.00
19635. David (daychow) 6 70.27 86.51 2 33.33
19636. Santi (coyang) 5 70.26 74.88 0 0.00
19637. Connor (paintrain23) 11 70.26 88.50 3 27.27
19638. Tijme (nemjit) 23 70.26 83.55 4 17.39
19639. Shayan (zackroos) 49 70.26 91.23 9 18.37
19640. Jeev (jeevjoel) 29 70.26 92.63 7 24.14
19641. Max (hihello12327) 37 70.26 87.86 11 29.73
19642. Deimer (ogdeimer) 59 70.26 95.18 15 25.42
19643. peter (peterfan) 106 70.26 93.43 33 31.13
19644. Ng (kinkhai) 77 70.25 89.61 17 22.08
19645. A (martian098) 2 70.25 70.83 1 50.00
19646. Joy (joy_1) 99 70.25 82.13 22 22.22
19647. Tom (tommydws) 4 70.25 72.43 0 0.00
19648. Skift (skift2) 3 70.24 79.03 1 33.33
19649. INDO EUROPEAN (indo_europea... 18 70.24 86.45 9 50.00
19650. bhrigu (typer_21) 8 70.24 80.19 6 75.00
19651. Christina (christina0907) 3 70.24 78.44 2 66.67
19652. ptsd (ptsd92) 7 70.24 79.18 1 14.29
19653. Reenreen (reenreen) 135 70.24 91.67 41 30.37
19654. Andrews (godspeeedd) 83 70.24 96.82 20 24.10
19655. Alexander (zenkarb) 5 70.24 75.53 3 60.00
19656. asgfd (akjghaf) 14 70.23 77.97 2 14.29
19657. Pedro (pedroarcem) 22 70.23 81.52 1 4.55
19658. Isa (dxnamic_) 8 70.23 78.77 1 12.50
19659. Fabian (xylia_fabian) 8 70.23 77.20 3 37.50
19660. Celestrom (celestrom) 49 70.22 88.92 11 22.45
19661. Sonix (8sonix) 163 70.22 105.90 47 28.83
19662. Pasha (pashacccp) 3 70.22 83.93 1 33.33
19663. Road to 90 wpm (qimichanga) 17 70.22 82.54 5 29.41
19664. Yaowee (eggyicecream) 21 70.21 82.18 6 28.57
19665. Antoni (acruz63) 1 70.21 70.21 1 100.00
19666. Gauley (gauley) 9 70.21 77.94 6 66.67
19667. Naomi (naomielianora) 79 70.21 87.18 20 25.32
19668. Megaracer (abhirupdas400) 18 70.20 78.77 2 11.11
19669. E (knight250) 29 70.20 83.28 27 93.10
19670. keval (keval18) 39 70.20 84.11 10 25.64
19671. Abraham (coolbro3451) 1 70.20 70.20 0 0.00
19672. Alex (punksalot04) 2 70.20 71.05 0 0.00
19673. Harry (procuties) 3 70.20 89.80 0 0.00
19674. parag (paragparag) 4 70.20 78.70 1 25.00
19675. Noah (lorenpike) 386 70.20 93.60 75 19.43
19676. Roland (nemvagyokolyangyors) 9 70.20 80.93 2 22.22
19677. Tipsy (tipsy_unicorn) 2 70.19 75.04 0 0.00
19678. noob (noahc207) 67 70.18 99.66 15 22.39
19679. Petr (monsterkick123) 8 70.18 78.54 2 25.00
19680. Michael (myki21) 10 70.18 84.68 3 30.00
19681. Jeremy (ziney) 5 70.18 91.03 2 40.00
19682. isenze (isenze) 44 70.18 79.93 20 45.45
19683. Lilikoi (lilikoiv) 11 70.18 92.10 4 36.36
19684. IckyPixel (kyoneoran) 8 70.18 88.59 4 50.00
19685. obsidianical (obsidianical) 15 70.17 95.54 3 20.00
19686. Murfy (murfychia) 30 70.17 81.58 11 36.67
19687. Kshitij (kshitij_srv) 34 70.17 80.42 6 17.65
19688. Saeed (saeed247) 9 70.17 83.12 2 22.22
19689. fthe (fthe) 172 70.17 94.74 39 22.67
19690. Parker (parkerfd9dy) 102 70.17 89.82 32 31.37
19691. Ulugbek (ulugbek0602) 8 70.17 82.16 2 25.00
19692. joel (jouel1234567) 2,666 70.17 101.92 618 23.18
19693. Kurai (kuraiflame) 7 70.17 76.08 1 14.29
19694. Alvise (anklud) 58 70.17 82.63 13 22.41
19695. Vinayak (vinrana) 214 70.16 89.58 65 30.37
19696. Hamza (hamzaalali) 555 70.16 97.05 110 19.82
19697. Agung (agungae) 3 70.16 73.19 1 33.33
19698. D (g1ddriver) 7 70.16 75.84 0 0.00
19699. Chloe (klohwii) 1 70.16 70.16 0 0.00
19700. . (popdon990) 8 70.16 85.74 3 37.50
19701. z (zivry) 78 70.15 84.52 20 25.64
19702. IsMythic (ismythic) 1 70.15 70.15 0 0.00
19703. cody (tkdanimal) 29 70.15 83.74 5 17.24
19704. Sergio (perezsergioace) 76 70.15 82.21 22 28.95
19705. Daniel (dna89) 51 70.14 85.58 14 27.45
19706. Khai (haikhaiphan) 8 70.14 79.99 2 25.00
19707. Alex (dangercomeswithalex) 20 70.14 87.26 9 45.00
19708. audelyn (gaminghuskies) 1 70.14 70.14 1 100.00
19709. kai (kainetic) 168 70.14 112.57 35 20.83
19710. Sid (sxd_ss) 52 70.14 88.88 13 25.00
19711. Pranay (ant1sipater) 88 70.13 87.97 21 23.86
19712. Max (vibesmvx) 2 70.13 70.74 1 50.00
19713. Can (tpcm) 1 70.13 70.13 0 0.00
19714. Pink Mutt (frugalmussel) 9 70.13 83.31 1 11.11
19715. James (jvlasak) 11 70.12 78.89 2 18.18
19716. Grten (grten) 3 70.12 72.23 1 33.33
19717. Nick (grammynugx) 1 70.12 70.12 0 0.00
19718. William (williamjr2004) 1 70.12 70.12 0 0.00
19719. Sowri Raja Majeti (sowri) 2 70.12 75.23 0 0.00
19720. Riley (defectivepixel) 2 70.12 76.99 0 0.00
19721. ollybollydisco (ollybollydi... 27 70.11 95.54 5 18.52
19722. Al (al_gha23) 115 70.11 85.91 35 30.43
19723. Dullpig (dullpig) 22 70.11 85.49 4 18.18
19724. Jack (eeeeeeeeeeeeeeeeeeeeeee) 4 70.11 82.31 1 25.00
19725. Juanpa (gokias_1234) 210 70.11 91.70 50 23.81
19726. Manuel (stonesitter) 12 70.11 79.12 2 16.67
19727. Drew (drew1008) 58 70.11 84.39 18 31.03
19728. Jerry (j27smith) 23 70.11 100.86 5 21.74
19729. Brian (vance071) 503 70.10 96.56 118 23.46
19730. Farzad (impulsion) 11 70.10 83.00 4 36.36
19731. yes but (krosis2706) 11 70.10 85.72 5 45.45
19732. Invincibolos (invincibolos) 7 70.10 82.53 2 28.57
19733. Niels (magerkonijn) 1 70.10 70.10 1 100.00
19734. V (vladk0) 1 70.10 70.10 0 0.00
19735. Mark (emessdoubleyou) 17 70.10 79.20 4 23.53
19736. alex (alexllc) 12 70.10 125.48 6 50.00
19737. Your Mother (fasttyper69420) 2 70.09 73.77 0 0.00
19738. Gabriel (slenders) 35 70.08 100.56 20 57.14
19739. Andrew (sinnuroko) 6 70.08 77.35 3 50.00
19740. Miles (squarepeanut) 3 70.08 80.62 2 66.67
19741. Jack (yackpancakes) 5 70.08 76.35 2 40.00
19742. Christos (__christos__) 1,623 70.08 94.26 410 25.26
19743. Vlad (foxonwave) 7 70.07 76.67 2 28.57
19744. Banda (bandamaker) 188 70.07 90.92 51 27.13
19745. Your (urtrashkid906) 4 70.07 79.73 4 100.00
19746. William (walbertus) 2 70.06 70.54 0 0.00
19747. me (devilsdaily) 5 70.05 79.42 1 20.00
19748. Alinferno (alinferno) 17 70.05 87.93 15 88.24
19749. pillow (pillowkiller) 1 70.05 70.05 1 100.00
19750. Stuart (orihsenak) 26 70.05 83.71 8 30.77
19751. Julia (melonclementine) 2 70.05 73.84 0 0.00
19752. Ruben (ecerulm_kinesis) 2 70.05 71.42 1 50.00
19753. Shynggyskhan (s_bazarbay) 14 70.05 77.31 4 28.57
19754. alien (itscloveryt) 3 70.04 81.78 1 33.33
19755. 1234 (nemesistroy) 43 70.04 108.55 11 25.58
19756. Nick (cvs_nick) 410 70.04 100.42 96 23.41
19757. Garvežiukas (garvezinis) 26 70.04 98.75 8 30.77
19758. JK17 (jaredkane17) 5 70.04 72.34 0 0.00
19759. James (waterpuree) 8 70.04 80.53 3 37.50
19760. PandaDriver (pandadriver) 3 70.04 73.86 0 0.00
19761. Kiara (liptica_k) 60 70.03 85.59 10 16.67
19762. Zac (eastunder) 12 70.03 90.83 7 58.33
19763. Ezequiel (ezequiel102) 1 70.03 70.03 1 100.00
19764. Dave Israel (mynameisdig) 1 70.03 70.03 1 100.00
19765. Kanzi (kanzi) 22 70.02 80.74 7 31.82
19766. osso (osso94) 43 70.02 94.49 15 34.88
19767. Aidan who just types (aidnb... 5 70.02 74.90 1 20.00
19768. Jack (jacksaff) 6 70.02 78.25 1 16.67
19769. berry (berryroseblood) 4 70.02 76.90 1 25.00
19770. Andrew (andrewhey) 1 70.02 70.02 0 0.00
19771. Fionnan (fionnanos2000) 5 70.02 86.55 1 20.00
19772. Melissa (mel8402) 92 70.02 94.88 14 15.22
19773. M (marinater) 2 70.02 73.39 1 50.00
19774. reicy (reicy794) 5 70.01 76.13 1 20.00
19775. lakshme 5ce (lakshme) 2 70.01 71.05 1 50.00
19776. M (allinnn) 10 70.00 84.05 4 40.00
19777. Hassaan (hassaan0180) 109 70.00 92.29 40 36.70
19778. jason (bekster_) 4 70.00 75.60 1 25.00
19779. FangAbi (fangabi) 6 70.00 79.79 1 16.67
19780. whoam (w1ld13) 24 70.00 82.58 5 20.83
19781. Rain (rainy) 42 70.00 98.38 10 23.81
19782. smile (silversky666) 6 69.99 93.02 1 16.67
19783. Yiming (mymreview) 69 69.99 95.75 24 34.78
19784. Poppa (poppayons) 1 69.99 69.99 1 100.00
19785. Mary (bloody_mary) 13 69.99 85.40 3 23.08
19786. Secre (zenmt) 15 69.98 84.90 7 46.67
19787. Jan (q1xter) 81 69.98 84.94 16 19.75
19788. stefanijaya (stefanijayaa) 2 69.98 76.63 2 100.00
19789. Controller Player (countarc... 24 69.97 88.66 7 29.17
19790. Vedant (ved2254) 34 69.97 80.33 7 20.59
19791. John (arcticanthony) 3 69.96 72.07 0 0.00
19792. kamalesan (kamalesan) 295 69.96 87.80 76 25.76
19793. Rohit (john_titor234432) 158 69.96 95.93 35 22.15
19794. xiu (xihuan) 3 69.96 93.67 0 0.00
19795. Marco (abababaaaa) 27 69.96 86.13 6 22.22
19796. SALTY (saltytap3) 2 69.96 71.39 0 0.00
19797. Evan (trigger8) 3 69.95 77.11 0 0.00
19798. William (tea_chan) 4 69.95 77.70 0 0.00
19799. Mike (mike1835) 6 69.95 75.45 2 33.33
19800. wooson (wooson) 27 69.94 81.80 6 22.22
19801. Xi Jinping (wuhan_virus) 933 69.94 98.12 217 23.26
19802. bleh (wisdoom) 5 69.94 76.44 0 0.00
19803. Jakub (frogixd) 17 69.94 80.54 2 11.76
19804. kamikadze (kamikadze009) 10 69.94 76.05 1 10.00
19805. Dauan (plexxx) 2 69.94 74.05 0 0.00
19806. Miika (hakkerijehu) 74 69.93 85.10 15 20.27
19807. Marky (mark2most) 33 69.93 85.59 4 12.12
19808. joe (zyas) 1 69.93 69.93 0 0.00
19809. Eli (eiervonsatan) 4 69.93 73.71 2 50.00
19810. ScocoPope (scocopal) 308 69.93 89.24 69 22.40
19811. Taher (taher_c) 2 69.93 73.53 2 100.00
19812. allie (bokutobro) 12 69.92 85.31 3 25.00
19813. Eshwar Reddy (eshwar_god) 6 69.92 76.25 1 16.67
19814. OMGnesststats[omgness321] (... 31 69.92 88.99 7 22.58
19815. Muhammad (entamalomak) 21 69.92 79.60 7 33.33
19816. Mudit (awesomenessmax) 10 69.92 81.44 7 70.00
19817. Aparesh (aparex) 137 69.92 87.35 34 24.82
19818. JSlyk (jslyk) 59 69.92 95.16 19 32.20
19819. LAO (legendoflaohan) 32 69.92 85.76 8 25.00
19820. Cyka (murdocisgod2004) 2 69.92 70.96 0 0.00
19821. Robertas (rebutis) 16 69.91 76.43 6 37.50
19822. shashvat (shashvatsawar) 5 69.91 83.39 5 100.00
19823. b (whylxve) 22 69.90 84.13 3 13.64
19824. Jordi (gandalfdablack1) 22 69.90 85.23 5 22.73
19825. Patrick (viperpat) 1 69.90 69.90 0 0.00
19826. Yoel (the_dog) 1 69.90 69.90 1 100.00
19827. Vytenis (jackeddj) 27 69.90 86.67 8 29.63
19828. INDIAN (armaan25) 228 69.89 89.69 53 23.25
19829. Paul (axxmodeus) 9 69.89 80.52 4 44.44
19830. nazmul (nhasan0290) 115 69.89 87.49 30 26.09
19831. Saphrog (saphrog) 39 69.89 87.36 8 20.51
19832. Ramram (ramram01) 6 69.89 76.84 2 33.33
19833. blackjeseos (actuallyfadhli) 19 69.89 86.93 4 21.05
19834. alex (peopel) 8 69.89 78.43 0 0.00
19835. flo (itbeflo) 2 69.89 72.78 1 50.00
19836. Ash (boyfromindia) 15 69.88 88.55 7 46.67
19837. Captain (captainrich) 13 69.88 83.92 4 30.77
19838. KlokkisRacer (klokkis_utfor... 3 69.88 82.37 0 0.00
19839. Moritz (xp0s31d0nx99) 8 69.88 76.74 2 25.00
19840. 2Change (2change) 2 69.88 71.92 1 50.00
19841. Sam (bonksy) 2 69.88 71.27 1 50.00
19842. SalahDin (salastro) 89 69.88 86.63 21 23.60
19843. le (nail123) 2 69.88 76.95 1 50.00
19844. Rinmawia (rinmawia) 221 69.87 90.27 53 23.98
19845. Chaitanya (chaitanya608) 438 69.87 88.03 97 22.15
19846. Gabriel (gabrielvi111) 15 69.87 80.28 1 6.67
19847. veenu (comp_typist) 73 69.86 88.61 17 23.29
19848. Rahma (rahhma) 19 69.86 78.92 10 52.63
19849. Tauntpiersto (piercebigelow) 1 69.86 69.86 0 0.00
19850. Kanha (kjewels) 13 69.85 83.96 1 7.69
19851. Christopher (scizsors) 1 69.85 69.85 0 0.00
19852. Dvorak Klaas (acheron) 25 69.85 83.20 5 20.00
19853. Annilese (qingkang) 5 69.85 79.71 1 20.00
19854. Keo (mightkeo) 198 69.85 91.39 39 19.70
19855. 🐌 (paultippt) 17 69.84 80.51 4 23.53
19856. Mathyou (mathyou_177) 42 69.84 78.80 5 11.90
19857. Betül (betull) 1 69.84 69.84 0 0.00
19858. Dr. Typer (drtypergamer) 1 69.83 69.83 1 100.00
19859. Axolotl (aj0l0tl) 30 69.83 79.56 3 10.00
19860. didi (didi_pot) 30 69.83 81.25 7 23.33
19861. rajnish (rajnishkumar31) 114 69.83 94.96 37 32.46
19862. I24FA (r4ffa) 1 69.82 69.82 1 100.00
19863. Ian (mrfro) 2 69.82 77.73 1 50.00
19864. Iván (ivansitopart) 2 69.82 75.34 0 0.00
19865. Bruh (bruh_widow) 311 69.82 98.08 86 27.65
19866. Knot (knotcj) 12 69.81 85.89 4 33.33
19867. Idrm (idrm) 1 69.81 69.81 1 100.00
19868. n0 (doo1222) 97 69.81 87.51 16 16.49
19869. heikrana (heikrana) 34 69.81 79.50 10 29.41
19870. Lourd (edmund04) 178 69.80 92.58 39 21.91
19871. Camilo (drcabo26) 3 69.80 78.91 0 0.00
19872. Martin (xmerticx) 1 69.80 69.80 0 0.00
19873. Necredibly (necredibly) 5 69.80 74.33 1 20.00
19874. Venus (ching_ching) 90 69.80 86.26 29 32.22
19875. Tenshi (tenshi3_a) 4 69.80 77.98 1 25.00
19876. Vincent (ezbread) 27 69.79 85.89 11 40.74
19877. Horizon (hwinangkoso) 60 69.79 83.28 16 26.67
19878. Luisdi (luisdi) 5 69.79 77.70 1 20.00
19879. Rahul (bug_addict) 1 69.79 69.79 0 0.00
19880. Silve (silve_) 1 69.79 69.79 1 100.00
19881. Nefritees (realnefritees) 19 69.79 82.82 6 31.58
19882. Bartek (barteker19) 11 69.79 80.29 1 9.09
19883. 💵 (mebank) 5 69.78 74.80 0 0.00
19884. Filip (creer) 3 69.78 70.11 1 33.33
19885. Moritz Klositz (moritz_klos... 4 69.78 72.46 1 25.00
19886. Stefan (sheffbee) 5 69.78 75.79 0 0.00
19887. Dylan (drink_windex) 27 69.78 82.91 4 14.81
19888. Yusuf (yusuft2) 4 69.78 77.53 0 0.00
19889. MouldyBaguette (mouldybague... 5 69.78 74.41 0 0.00
19890. Michael (mwalter32123) 118 69.77 84.97 29 24.58
19891. ♠Homer (pimpelkram) 4 69.77 79.79 1 25.00
19892. Lakshya (lakshyasharma) 81 69.76 88.47 21 25.93
19893. Kiet (random22) 2 69.76 69.93 1 50.00
19894. Mick (_mickey_) 11 69.76 83.82 1 9.09
19895. Tushar (tushar_3) 4 69.76 72.81 0 0.00
19896. 2E13 (1d14) 30 69.76 83.87 13 43.33
19897. Yash (rubikstyper) 10 69.76 84.41 1 10.00
19898. Barry Allan (messylingard) 23 69.75 80.82 3 13.04
19899. Matthew (hotdawg200) 35 69.75 83.81 7 20.00
19900. Ardan (kevinardani) 172 69.75 90.59 45 26.16
19901. Felix (babford) 8 69.74 73.92 1 12.50
19902. Marcin (vaster_then_you) 13 69.74 79.24 0 0.00
19903. Paloma (mmmmtype) 19 69.74 80.77 6 31.58
19904. Bertalan (brtln) 31 69.74 86.79 15 48.39
19905. Jason (xaraer) 8 69.74 78.38 2 25.00
19906. Dekaj (d_kaj) 11 69.73 82.56 11 100.00
19907. Adlin (adlin_typer18) 42 69.73 87.84 15 35.71
19908. Hockeypaul (hockeypaul) 4 69.73 76.52 0 0.00
19909. Keith (touchpoint) 132 69.72 86.91 37 28.03
19910. Quintes (quintez) 1 69.72 69.72 0 0.00
19911. barmanrahul (nothisisrahul) 46 69.72 83.74 10 21.74
19912. KIXK (kixk) 11 69.71 76.53 3 27.27
19913. FatherWood (fatherwood) 66 69.71 84.23 16 24.24
19914. Àngela (aciutat) 1 69.71 69.71 0 0.00
19915. fethy (lefty_dz) 1 69.71 69.71 1 100.00
19916. Albert (devmood) 5 69.70 73.04 3 60.00
19917. Jhaztyn (jhaztyn) 3 69.70 71.98 0 0.00
19918. M3D7 (m3d7) 6 69.70 82.32 3 50.00
19919. Erik (pepegacharge009) 316 69.70 91.17 83 26.27
19920. jirka2142 (holocaus_byl_ins... 1 69.70 69.70 0 0.00
19921. sammy (sammysosa151) 6 69.70 98.79 1 16.67
19922. Ahmed (dd3x) 11 69.70 78.90 1 9.09
19923. zooommm23 (zooommm23) 102 69.70 95.74 16 15.69
19924. Vanellope (vio_melancholy) 13 69.70 84.53 2 15.38
19925. Uno (typesmacker) 13 69.70 80.69 5 38.46
19926. Cindy (cindy1889) 34 69.69 83.36 16 47.06
19927. gray (grayg52) 6 69.69 76.79 2 33.33
19928. irand (eppyprime) 7 69.69 78.22 2 28.57
19929. Teerapat (teerapatlaongdee) 11 69.68 85.94 3 27.27
19930. Anon (anonjr) 3 69.68 77.58 1 33.33
19931. Ahmed (taftaf) 7 69.68 80.93 2 28.57
19932. Robochu (robochu) 6 69.68 78.81 2 33.33
19933. Foyez (aflextra) 1 69.68 69.68 1 100.00
19934. brian (barmijo) 72 69.68 92.64 17 23.61
19935. Espii (carlespe13) 32 69.68 82.79 14 43.75
19936. Sam (samsrm) 159 69.68 96.84 30 18.87
19937. Zogurt (zogurt) 16 69.67 84.55 0 0.00
19938. Pham (iamphduc) 302 69.67 87.51 87 28.81
19939. Dmitriy (dj1vs) 209 69.67 89.07 54 25.84
19940. Jonathan (jonathan888) 140 69.67 88.84 32 22.86
19941. Korezu (nyanuwin) 1,090 69.67 97.66 223 20.46
19942. Rickard (rickyspr) 10 69.67 84.42 4 40.00
19943. Joe (8bitsmash) 4 69.67 73.50 2 50.00
19944. Ro (rgpdancer) 3 69.66 78.86 0 0.00
19945. Löncswing (loncswing) 7 69.66 84.84 1 14.29
19946. Björn (bjornboss) 17 69.66 78.60 6 35.29
19947. Sarp (whitechocolatee) 7 69.65 75.99 3 42.86
19948. sol (solshad) 35 69.64 89.60 6 17.14
19949. Nikola (dudeimwhite) 103 69.64 91.65 30 29.13
19950. andrea (guilkk) 1 69.64 69.64 0 0.00
19951. Kunal (kc596) 12 69.64 75.23 1 8.33
19952. Vivek (kill3rking) 615 69.64 91.84 150 24.39
19953. harshil (monsta_001) 1,514 69.64 96.12 372 24.57
19954. Usman (usmanfatal) 5 69.64 74.43 1 20.00
19955. ICE (talje) 2 69.64 71.82 0 0.00
19956. Orange (orange29) 4 69.63 81.10 1 25.00
19957. Richard (_spicyramen_) 4 69.63 82.27 1 25.00
19958. Shoden (shoden) 12 69.63 77.54 4 33.33
19959. Muntazar (muntazer1) 11 69.63 78.11 6 54.55
19960. chromebook user (kuxir97) 120 69.63 92.41 57 47.50
19961. Vishaldeep (vishaldhaliwal) 317 69.62 94.52 76 23.97
19962. Samit (astro_0) 9 69.62 84.19 3 33.33
19963. pj (shmarcus) 3 69.62 73.49 3 100.00
19964. Kshitij (desikheeda) 44 69.62 81.18 14 31.82
19965. hypeiron (hypeiron) 115 69.62 84.78 29 25.22
19966. Max (maxkillas) 2 69.62 72.78 2 100.00
19967. Kael (michael_deleon) 16 69.61 80.45 3 18.75
19968. Peter (vettel_) 9 69.61 73.17 4 44.44
19969. Alex (alexberroverbite) 3 69.61 80.38 3 100.00
19970. Shoaib Sajid (shoaibsajid) 1 69.60 69.60 0 0.00
19971. 69 WPM andy (eerietants) 44 69.60 93.46 13 29.55
19972. Miłosz (refjel) 116 69.59 82.80 31 26.72
19973. StAtomic (atomicplay) 1 69.59 69.59 1 100.00
19974. Yassine (yassinejedidi) 22 69.59 94.63 13 59.09
19975. David (dmed519) 110 69.58 82.05 26 23.64
19976. rrrena (rrrena) 4 69.58 76.40 1 25.00
19977. apoodle_ (molltenlol) 105 69.58 91.33 24 22.86
19978. Phoebo (phooboo) 15 69.57 88.31 4 26.67
19979. JC (jczak) 3 69.57 74.30 0 0.00
19980. Gabe (grahamcracker4) 145 69.57 89.96 40 27.59
19981. Liao (luckykuy) 1 69.57 69.57 1 100.00
19982. Colin (pathetic_worm) 7 69.57 75.73 2 28.57
19983. 真好玩 (simonhre) 14 69.57 81.40 3 21.43
19984. Cain (cainlimbo) 3 69.57 80.10 0 0.00
19985. Syed Ali (mafailure) 170 69.57 92.55 40 23.53
19986. Owen (epic_own_gamer) 8 69.57 78.08 2 25.00
19987. Fritty (fritty) 2 69.57 69.64 0 0.00
19988. コタ (kotasucksatyping) 63 69.56 94.61 13 20.63
19989. k1suxu (k1suxu) 72 69.56 82.14 14 19.44
19990. Nitesh (gokunik) 1 69.56 69.56 0 0.00
19991. Aditya (adityasood) 1 69.56 69.56 0 0.00
19992. Osama (osama_alkhodairy) 5 69.56 75.38 2 40.00
19993. Anthony (smashingted) 192 69.56 92.74 51 26.56
19994. BJ (unusualgoose) 9 69.56 82.01 1 11.11
19995. anfun (anfun) 18 69.55 86.50 7 38.89
19996. JEFF (wimpyjeff) 34 69.55 86.26 10 29.41
19997. James (jamesvereen) 7 69.55 75.68 2 28.57
19998. Owen (wertls) 8 69.55 82.07 7 87.50
19999. Nazeem (bleaful) 2 69.55 75.21 0 0.00
20000. Ndrew138 (ndrewewqe) 261 69.54 89.16 59 22.61
20001. flyaway (saltybaby) 751 69.54 102.10 294 39.15
20002. chandra (sekhar_88) 40 69.54 81.59 9 22.50
20003. Bas (basoomen10) 1 69.54 69.54 0 0.00
20004. Meow (meowchamp) 4 69.54 73.07 1 25.00
20005. Ignacio 🧉 (ignatirabo) 35 69.53 87.28 9 25.71
20006. Alexander (alexanderfzz) 11 69.53 81.17 4 36.36
20007. Lana (lana121) 3 69.53 74.76 0 0.00
20008. uglyjeffrey (uglyjeffrey) 60 69.53 89.36 21 35.00
20009. Ashish (ashishpatel0720) 12 69.53 84.02 4 33.33
20010. failure (pipy26) 2 69.53 78.53 2 100.00
20011. Sven (paindevil07) 100 69.52 80.95 24 24.00
20012. Aye (aexerz) 13 69.52 89.08 3 23.08
20013. Óskar (lillibilli) 9 69.52 82.91 0 0.00
20014. victor (jontakenols) 8 69.52 89.51 0 0.00
20015. omid (omidhopeful) 226 69.52 87.03 48 21.24
20016. Raul (raule_maule) 31 69.52 83.88 7 22.58
20017. Shuccer (shuccer) 254 69.52 97.88 62 24.41
20018. khem (khemsadon) 8 69.52 76.49 3 37.50
20019. Mike (std_psyit_abd) 6 69.52 77.94 2 33.33
20020. li (lilya) 5 69.52 80.78 3 60.00
20021. Novades (novades) 29 69.51 86.45 9 31.03
20022. Yaman (yamyoume) 18 69.51 77.42 4 22.22
20023. Freddy (crazyfreddy) 1 69.51 69.51 0 0.00
20024. Simon (cimon423) 1 69.51 69.51 0 0.00
20025. lorenzo (lolloz98) 15 69.51 77.39 3 20.00
20026. Bob (bob_loblawrl) 116 69.51 82.87 32 27.59
20027. Sophia (officialsophiagarman) 8 69.50 72.49 2 25.00
20028. Alex (swobe) 15 69.50 78.23 4 26.67
20029. Isabela (isa05910) 2 69.50 76.47 0 0.00
20030. Brennan (brennanfisher) 7 69.50 82.18 1 14.29
20031. Halgh (sloofer) 5 69.50 74.22 4 80.00
20032. osuplayer (ivbagbroke) 5 69.50 80.92 1 20.00
20033. Virtual (virtualtrash) 4 69.50 75.26 2 50.00
20034. Vaynez (vaynez) 2 69.49 74.99 1 50.00
20035. Mayoukh (mayoukh) 3 69.49 70.52 0 0.00
20036. Able (interstellarnova) 99 69.49 81.28 19 19.19
20037. shea (pengu1927) 21 69.49 82.01 5 23.81
20038. laffytaffy (mihirsm) 33 69.49 86.36 4 12.12
20039. k (mooneymooves) 45 69.48 88.19 5 11.11
20040. Dom (d0m_) 4 69.48 73.45 1 25.00
20041. CarrotyLemons (carrotylemons) 19 69.48 84.49 7 36.84
20042. Nobody (badd0) 1 69.48 69.48 0 0.00
20043. Chariko (zardula) 1 69.48 69.48 0 0.00
20044. Hannah (hannahkoh) 5 69.48 86.02 0 0.00
20045. Lukas (cerilious) 4 69.48 73.99 0 0.00
20046. tito (titoreo) 93 69.48 94.62 22 23.66
20047. Ricky (cutlert) 4 69.48 73.23 1 25.00
20048. Peter (randomperson927) 1 69.47 69.47 1 100.00
20049. Henrique (kiraly2006) 1 69.47 69.47 0 0.00
20050. patrick (lucky_ninja3412) 21 69.47 92.00 5 23.81
20051. Jed (jed_) 9 69.46 78.42 1 11.11
20052. ahmed saif (ahmedsaif) 16 69.46 76.54 2 12.50
20053. Tsetsen (unknownxxx) 45 69.46 82.45 34 75.56
20054. Hrm_710 (hrmmm) 16 69.46 82.29 2 12.50
20055. HoldShift (holdshift) 8 69.46 80.32 1 12.50
20056. Raphael (purified_salt) 40 69.45 86.39 10 25.00
20057. Alex (mistaman10) 2 69.45 73.89 0 0.00
20058. Keshav (kksu278) 1 69.45 69.45 0 0.00
20059. gia (issgua) 6 69.45 81.65 2 33.33
20060. Zega (zegadb) 27 69.45 84.44 7 25.93
20061. Tommy (tommy_sylver) 63 69.45 90.32 28 44.44
20062. Zachary (peanutbutter146) 83 69.44 84.54 21 25.30
20063. Ahmed (beet790) 56 69.44 83.37 10 17.86
20064. Edward (edwardtw92) 1 69.44 69.44 0 0.00
20065. Ako (akoisthenamee) 1 69.44 69.44 1 100.00
20066. Ivan (ivan_suvorov) 1 69.44 69.44 1 100.00
20067. Ivan (ivan_m21) 1 69.44 69.44 1 100.00
20068. Duck (theduckracer) 2 69.44 74.95 1 50.00
20069. Logan (shadows36) 32 69.44 93.82 10 31.25
20070. Itscol (itscol) 13 69.43 82.14 4 30.77
20071. Kiu Kiu (cream777) 150 69.43 89.79 37 24.67
20072. gamem (wkdgurtna) 27 69.43 92.44 8 29.63
20073. Yuh (yuhboydeath) 1 69.42 69.42 0 0.00
20074. CRISTO (cristomathew7) 20 69.41 83.53 4 20.00
20075. El (eluif4) 3 69.41 72.75 3 100.00
20076. Chinmay (chinmays1999) 53 69.40 78.54 15 28.30
20077. Matt (babyeater58) 3 69.40 73.76 0 0.00
20078. Ben (archerypineapple) 2 69.40 73.55 0 0.00
20079. Ahan (ahanmal) 2 69.40 79.30 0 0.00
20080. Mytx (mythflashx) 11 69.39 75.72 3 27.27
20081. Anne-Sophie (winniethepooh2... 1 69.39 69.39 0 0.00
20082. LubO_o (lub0_o) 14 69.39 84.07 6 42.86
20083. Duh-vorak (denys_147) 1 69.38 69.38 0 0.00
20084. Asier (asierart) 72 69.38 93.17 24 33.33
20085. acjk (jackolant199) 9 69.38 80.23 1 11.11
20086. Thithiesha (thithiesha) 33 69.37 80.85 11 33.33
20087. Mario (tennisiscool) 6 69.37 80.34 2 33.33
20088. Alpha (alpha_sp4rky) 3 69.37 73.90 0 0.00
20089. Mubashar (mubashar_javed) 15 69.37 85.27 5 33.33
20090. eran (eran_raviv) 472 69.37 91.88 89 18.86
20091. leetuser (leetuser) 3 69.36 73.89 1 33.33
20092. Ainsley (giannis199) 27 69.36 83.48 6 22.22
20093. Lucas (lucasmoc47) 1 69.36 69.36 1 100.00
20094. Prince (03000066106) 18 69.35 82.75 8 44.44
20095. Jordan (jordanlangford) 3 69.35 72.77 0 0.00
20096. Luis (luisaes) 1,397 69.35 96.68 315 22.55
20097. A.A.Fouad (snkpl) 26 69.35 81.74 5 19.23
20098. Slicklikedat (slicklikedat) 1 69.35 69.35 0 0.00
20099. rt (rtizzle) 208 69.35 92.94 62 29.81
20100. Ichirou (itskotami) 7 69.34 78.03 2 28.57
20101. Dard (vaderking) 11 69.34 79.72 11 100.00
20102. Nolan (finny210) 3 69.34 75.13 1 33.33
20103. Donovan (dudieusmaximus) 1 69.34 69.34 1 100.00
20104. Ilmi (ikalam89) 1 69.34 69.34 0 0.00
20105. Ajwad Hameem (rajin100000) 11 69.33 81.13 1 9.09
20106. memesthatsucc (memesthatsucc) 5 69.33 80.05 1 20.00
20107. kristian (kriskris15) 6 69.33 72.40 1 16.67
20108. Yuval (yuvalsaricov) 6 69.32 74.10 0 0.00
20109. Julian (k1ngjulien) 2 69.32 69.57 0 0.00
20110. Đức (buinguyendinhduc96) 1 69.32 69.32 0 0.00
20111. becca (buhbecca) 1 69.32 69.32 0 0.00
20112. HudYA (hudyusuf) 1,108 69.32 95.17 250 22.56
20113. Typer (typertyping) 60 69.32 82.00 11 18.33
20114. Yacine (kzeran) 2 69.32 72.76 1 50.00
20115. Brian (btgrant76) 8 69.31 87.74 3 37.50
20116. Xiaorui (dxr1234) 64 69.31 83.39 14 21.88
20117. localasta (rajafathir) 1 69.31 69.31 1 100.00
20118. kamal nath (kamal3772) 1 69.31 69.31 1 100.00
20119. Ritesh (greeaatt_successs) 5 69.31 73.70 2 40.00
20120. taste (lan9erhans) 1 69.30 69.30 0 0.00
20121. Marko (markocar22) 1 69.30 69.30 0 0.00
20122. sand (cloudth) 7 69.30 80.99 1 14.29
20123. sdr4wkc48 (sdr4wkc48) 1,827 69.29 97.55 431 23.59
20124. Erica (canadianhuman) 73 69.29 85.44 16 21.92
20125. Sheeky (akiyoto) 9 69.29 80.79 3 33.33
20126. Jason (ajelliedonut) 2 69.29 77.27 0 0.00
20127. TheGreatYS (thegreatys) 24 69.28 79.06 8 33.33
20128. Ashmie (ashmie) 6 69.28 76.24 0 0.00
20129. Carbon (carbon28) 9 69.28 80.51 3 33.33
20130. Lucas (huy1804) 26 69.28 88.49 7 26.92
20131. Alex B (tisan05) 12 69.28 87.33 6 50.00
20132. Tom (polaricecaps) 386 69.28 98.69 103 26.68
20133. Justanalek (justanalek) 37 69.27 79.65 5 13.51
20134. Ramson (rammun) 10 69.27 80.89 0 0.00
20135. Red (redsharp) 9 69.27 85.58 3 33.33
20136. Phil (sticky1981) 55 69.27 83.62 17 30.91
20137. Quang Trung (rikateamovt1) 9 69.27 76.74 3 33.33
20138. Alcolopa (emilioelmurr) 71 69.27 92.64 13 18.31
20139. luis (bumfuzzled) 14 69.27 84.14 4 28.57
20140. Mateo (asetato) 36 69.26 86.32 8 22.22
20141. sam_sep10l (don_simon) 8 69.26 80.62 1 12.50
20142. hypophrenia (hypophrenia_3) 1 69.26 69.26 0 0.00
20143. Luiz (lznetorox) 36 69.26 85.33 8 22.22
20144. NJ (njc99) 13 69.26 83.05 5 38.46
20145. Sukritha (sukritha) 4 69.26 72.30 0 0.00
20146. drake (drunk3n) 5 69.25 74.47 1 20.00
20147. Bemysword (spligam3r) 1 69.25 69.25 0 0.00
20148. TotalTao (totaltao) 18 69.25 80.99 3 16.67
20149. Mio (i_drive_car_lol) 69 69.24 90.62 17 24.64
20150. ~~~ (2019ygao) 2 69.24 70.62 1 50.00
20151. Riley (0wned21) 4 69.24 75.60 0 0.00
20152. Hoa (billybobstuff) 10 69.24 73.58 3 30.00
20153. Kevin (lordofwreck) 2 69.24 71.75 0 0.00
20154. Saad (ultraman287) 2 69.24 77.30 0 0.00
20155. Arslan (arslan_03) 50 69.23 86.32 11 22.00
20156. S (sh19) 5 69.23 79.76 4 80.00
20157. Tangent (mrtangent) 78 69.23 92.24 16 20.51
20158. Shimon (gastronom) 17 69.22 82.66 5 29.41
20159. Tristan (typeinthebox) 20 69.22 89.57 4 20.00
20160. Flex (flex_luthor) 3 69.22 71.29 2 66.67
20161. breadedsouth (breadedsouth) 33 69.22 101.25 4 12.12
20162. Fastpoke (make_me_better) 42 69.22 86.07 11 26.19
20163. Heyhey898 (heyhey898) 1 69.22 69.22 1 100.00
20164. aracely (rawracelyy) 6 69.22 79.86 1 16.67
20165. Kuldip (flash007) 9 69.22 74.44 3 33.33
20166. indomitable1 (indomitable1) 2 69.22 74.05 0 0.00
20167. Nikan (nikan20) 6 69.21 78.38 0 0.00
20168. Bionodroid (bionodroid) 27 69.21 82.00 3 11.11
20169. Kushveer (1nst1nct) 4 69.20 77.08 4 100.00
20170. Converto (converto) 11 69.20 78.99 3 27.27
20171. Youxun (poe0oeo0iie9) 5 69.20 73.10 0 0.00
20172. JD_FPS (jd_fps) 106 69.20 96.46 22 20.75
20173. Koki (kohki) 184 69.20 84.76 29 15.76
20174. Muhammad (littlememon) 122 69.19 91.91 33 27.05
20175. Aedrick (aedrick) 11 69.19 83.49 1 9.09
20176. TBSTACK (speedytypister) 6 69.19 73.46 0 0.00
20177. Jakub (f_ckshit) 30 69.18 80.81 11 36.67
20178. fast (ersontio) 6 69.18 72.31 1 16.67
20179. Brandon (mo0nfire) 8 69.18 80.56 0 0.00
20180. sugdese (sugdese) 809 69.18 97.58 179 22.13
20181. Ryan (tuffpuppy) 2 69.18 72.44 0 0.00
20182. bbro (bbro) 2 69.18 73.84 1 50.00
20183. Hasnat (lazy_zeus) 4 69.17 79.97 4 100.00
20184. cring (thatguyyoudontknow) 12 69.17 86.43 4 33.33
20185. Sherlock (sherlock_homies) 1 69.17 69.17 0 0.00
20186. Bryce (bs2190) 2 69.17 71.88 1 50.00
20187. Elliot (girtholomew) 52 69.16 78.80 10 19.23
20188. Bernice Hee Shu Qi (bernice... 36 69.16 80.88 6 16.67
20189. Winnie (aznfreakwinnie) 2 69.16 83.58 0 0.00
20190. kelvin (kelvin1712) 2 69.16 76.72 0 0.00
20191. ibean (ibean) 54 69.15 81.27 15 27.78
20192. Surya (suryathoppae) 24 69.15 99.15 5 20.83
20193. PotatoLyfe (potato_lyfe) 115 69.15 92.74 25 21.74
20194. Mr (gunottam) 6 69.15 77.26 1 16.67
20195. kasra (kasra44) 11 69.15 80.61 1 9.09
20196. Marc (thehobbit6937) 87 69.15 90.73 25 28.74
20197. Mandom (xristos980) 50 69.15 80.17 10 20.00
20198. Jacob (floodedcodeboy) 10 69.15 77.93 4 40.00
20199. Marcin (quenthel) 3 69.15 73.33 0 0.00
20200. Naulitus (naulitus) 42 69.15 79.64 11 26.19
20201. Damn (sigge200) 2 69.15 72.47 1 50.00
20202. Cal (mrbegon) 28 69.14 81.09 6 21.43
20203. Tim (auticons) 18 69.14 85.22 3 16.67
20204. Andrew (chessdoudou) 5 69.14 72.90 1 20.00
20205. Suienish (sikoesch) 11 69.14 74.55 2 18.18
20206. Christina (omqchristi) 5 69.13 78.27 1 20.00
20207. spira (ddlcld) 1 69.13 69.13 0 0.00
20208. Felix (felixsantoso) 111 69.12 90.72 23 20.72
20209. paul (dunzo18) 31 69.12 95.05 5 16.13
20210. Chong Shan (chong_shan) 8 69.12 77.89 1 12.50
20211. Alex (medalions) 2 69.12 80.47 1 50.00
20212. Ok (ss__) 10 69.11 82.56 1 10.00
20213. Basil (basilenthusiast) 179 69.11 116.33 53 29.61
20214. Alex (theflyestlai) 76 69.11 91.56 16 21.05
20215. Kopatz (kopatz) 2 69.11 69.75 0 0.00
20216. Isaac (isjfw) 6 69.10 83.84 1 16.67
20217. Cameron (camma) 11 69.10 82.30 1 9.09
20218. suraj giri (surajgirioffl) 67 69.10 79.77 18 26.87
20219. Bala (balaboi) 25 69.10 79.88 8 32.00
20220. azaab (minsato) 37 69.10 85.07 7 18.92
20221. Cho (cho82) 171 69.09 82.44 46 26.90
20222. Trial (trial_name) 9 69.09 84.44 2 22.22
20223. Jakub (fannoth) 2 69.09 70.27 0 0.00
20224. Vladimir (av1ty) 8 69.09 77.19 2 25.00
20225. Bray (turtlebray) 45 69.09 84.76 6 13.33
20226. A (sd_era) 2 69.09 71.86 0 0.00
20227. KiddieX (emyrr) 2 69.09 71.82 0 0.00
20228. siddhanth (s1ddhxnth) 9 69.08 79.43 2 22.22
20229. Kai (kingkaikster) 9 69.08 76.25 1 11.11
20230. Ioannis (johndigolis) 175 69.08 83.30 43 24.57
20231. David (actavis666) 55 69.08 83.53 19 34.55
20232. Brandon (bhender) 2 69.08 69.22 1 50.00
20233. Rare (rare_0001) 22 69.07 82.52 6 27.27
20234. Bryan (pinkypoo) 17 69.07 77.41 3 17.65
20235. benny (bennythecow) 10 69.07 80.10 3 30.00
20236. Cain (gigabite) 197 69.07 90.49 53 26.90
20237. spam (sspammy) 2 69.07 69.67 0 0.00
20238. Michael (michaeleh_colemak) 9 69.06 77.07 3 33.33
20239. Dwarf (znagol) 8 69.06 72.66 1 12.50
20240. Nightmare (zhanarbek) 844 69.06 96.29 197 23.34
20241. Halo (halo1) 18 69.05 87.71 4 22.22
20242. Anurag (anuragbhatt) 26 69.05 87.58 1 3.85
20243. Kamyk (kamiszewskyy) 3 69.05 74.62 1 33.33
20244. shantal (shantal0924) 138 69.04 98.90 31 22.46
20245. rum3r (rum3r) 30 69.04 78.75 6 20.00
20246. fk israel (thegr8kabeer) 3 69.04 69.75 0 0.00
20247. Ankit (ankit_chauhan) 52 69.04 86.35 15 28.85
20248. 017 (k_chun) 93 69.03 87.83 23 24.73
20249. Tarun (twyoooo) 3 69.03 72.11 0 0.00
20250. 🤗 (qwert_noob) 221 69.02 98.48 46 20.81
20251. Kristian (kristiandiana) 19 69.02 80.09 5 26.32
20252. Rahil (rahil3108) 13 69.02 77.45 5 38.46
20253. You're Slow (kronosxfleet) 10 69.01 79.82 2 20.00
20254. Liz (lizard117) 13 69.01 82.68 2 15.38
20255. Sabrina (skatingprincess) 1 69.01 69.01 1 100.00
20256. Yasin (silznce) 2 69.01 70.94 0 0.00
20257. Murad (muradeliyev) 23 69.01 82.24 8 34.78
20258. myshmeh (myshmeh) 253 69.01 84.91 57 22.53
20259. Wahaha (huhduh600) 3 69.00 75.95 0 0.00
20260. ZT (gilborne) 2 69.00 70.11 1 50.00
20261. Paddy (paddyclohessy12) 23 68.99 81.21 7 30.43
20262. Thanos (thanossonofalars) 467 68.99 99.61 105 22.48
20263. RjTvqH (rjtvqh) 42 68.99 84.55 7 16.67
20264. Vanessa (vanessad6379) 1 68.99 68.99 0 0.00
20265. Meet (meet_patel1588) 260 68.99 94.32 57 21.92
20266. muhammad (muhd99) 32 68.99 79.29 10 31.25
20267. Lochan (lochanr) 9 68.98 80.18 4 44.44
20268. Areeb (areebur) 96 68.98 85.24 29 30.21
20269. zaid (xoxygenkillerx) 207 68.98 95.24 50 24.15
20270. imtiaz (imtiaz12) 94 68.98 97.17 28 29.79
20271. Apizza (apizzabear) 1 68.98 68.98 1 100.00
20272. Thomas (xnefas) 1 68.98 68.98 0 0.00
20273. yian (yian31415) 7 68.98 74.87 3 42.86
20274. thach (vngoct1) 7 68.98 79.18 0 0.00
20275. Dan (writfate) 18 68.97 89.26 4 22.22
20276. bob (termina_112) 14 68.97 84.76 8 57.14
20277. omnomnomnom (omnomnomnomnom... 12 68.97 79.26 3 25.00
20278. shuaib (shuaibabrar) 31 68.97 80.48 7 22.58
20279. McNeal (mcnealgwapo) 14 68.96 76.62 3 21.43
20280. Tintallë (nparadigm) 10 68.96 73.79 2 20.00
20281. mayzerto (mayzerto) 285 68.96 85.66 58 20.35
20282. np80658 (np80658) 11 68.96 79.11 2 18.18
20283. Mr.Chow (panza_sancho) 4 68.95 77.99 0 0.00
20284. Xontez (xontez) 1 68.95 68.95 0 0.00
20285. kristjan (wlayzer) 3 68.95 76.68 0 0.00
20286. kiannu (kiannaj) 9 68.95 84.09 2 22.22
20287. Luka (the_lukec) 180 68.95 102.99 42 23.33
20288. Luan (luanxpg9) 106 68.95 79.18 35 33.02
20289. Duncan (dungrimm) 5 68.94 75.81 3 60.00
20290. radu (radu215) 6 68.94 79.98 0 0.00
20291. BOKATHINGYMABOB (bokathingy... 6 68.94 84.81 2 33.33
20292. Nube (nubenoober) 3 68.94 72.79 0 0.00
20293. Pawan (pawan_kumar) 34 68.93 81.90 7 20.59
20294. shane (shanel0l) 106 68.93 84.81 29 27.36
20295. Nolan (cheesedog145) 5 68.93 77.30 0 0.00
20296. Ginger (seanwho42) 9 68.93 84.94 2 22.22
20297. Md Saim (saimahmad) 91 68.92 85.36 25 27.47
20298. Mohammad (abdel3leam) 517 68.92 95.57 103 19.92
20299. Rafail (raphaelpap) 21 68.92 82.57 20 95.24
20300. Diego (diego190401) 13 68.92 84.56 2 15.38
20301. Daniel (kd19lio) 3 68.92 72.78 0 0.00
20302. hubbe (hoffiis) 17 68.92 75.32 4 23.53
20303. Alex (wakeful_celery) 61 68.91 87.98 10 16.39
20304. Lycin (smokzzzgaming) 313 68.91 96.87 73 23.32
20305. turbos996 (the_puffduff) 1 68.90 68.90 0 0.00
20306. spi (ririnasandasimp) 17 68.90 87.88 16 94.12
20307. mike (tonbae) 6 68.90 83.39 1 16.67
20308. David (fantasticdavid) 35 68.89 86.04 8 22.86
20309. māvi (dhsnxz) 7 68.89 73.80 1 14.29
20310. Bree (briannanimal) 23 68.89 87.37 11 47.83
20311. Rushil (rushil13579) 8 68.89 83.54 2 25.00
20312. Darrin (darrinj) 73 68.89 84.45 24 32.88
20313. lerning (hmtusher) 2 68.89 69.00 1 50.00
20314. Jed (jedski) 1 68.88 68.88 1 100.00
20315. Cole (coleland) 2 68.88 74.14 1 50.00
20316. Rin (rinthis) 1 68.88 68.88 0 0.00
20317. Aleksa (mandorinaa) 17 68.88 78.70 5 29.41
20318. gamig (schleepy_boye) 14 68.88 82.06 2 14.29
20319. HumanUnknown (human_unknown) 6 68.87 80.78 3 50.00
20320. WinG9G (vving020515) 95 68.87 85.81 16 16.84
20321. deema (deema9) 1 68.87 68.87 1 100.00
20322. mushykeys (exileflame282004) 41 68.87 85.60 4 9.76
20323. Hunter (nottitan) 4 68.87 73.25 2 50.00
20324. Ryan (ryantam279) 16 68.86 80.26 7 43.75
20325. Samar Singla (samluci666) 113 68.86 91.24 29 25.66
20326. Nasir (nasirkabir) 6 68.86 84.70 0 0.00
20327. Enrique (supraphysiological) 1 68.86 68.86 0 0.00
20328. Yo (yongb) 9 68.86 82.26 2 22.22
20329. arnab (dark_morty) 76 68.86 87.26 24 31.58
20330. Vienna (sexystan69) 90 68.85 92.40 23 25.56
20331. BootleDootle (bootledootle) 6 68.85 81.14 1 16.67
20332. Huan (thehuan2005) 45 68.85 90.34 11 24.44
20333. Ralph (ralphcyrus0015) 10 68.85 80.67 2 20.00
20334. Creepy (creepyreapy) 16 68.85 90.06 1 6.25
20335. Brandon (mibbrandon) 24 68.85 78.08 4 16.67
20336. Jackojacblacco (jackojablacco) 2 68.85 76.66 1 50.00
20337. Siddharth (sid_1310) 99 68.84 89.22 18 18.18
20338. Y (yinted) 5 68.84 73.98 0 0.00
20339. E (boxofpaints) 15 68.84 73.20 6 40.00
20340. raghu (r_strike9437) 674 68.84 90.94 168 24.93
20341. tstats[lord_hunter] (lord_h... 295 68.84 91.91 72 24.41
20342. Schpuunk (schpuunk) 80 68.84 86.62 25 31.25
20343. Bugz (bugzmoney) 18 68.84 98.65 16 88.89
20344. Thịnh (itsmedio2110) 4 68.84 78.86 0 0.00
20345. Olives (olives123) 4 68.83 80.75 0 0.00
20346. Trevor (mouspe) 8 68.83 83.37 2 25.00
20347. Jozef (jozef.gloncak@gmail.... 2 68.83 72.15 0 0.00
20348. vvvvvvv (vvtzvv) 1 68.83 68.83 1 100.00
20349. Souther (souther1) 4 68.83 71.52 3 75.00
20350. Tops (tufeng) 30 68.83 84.90 10 33.33
20351. tstats[totet] (totet) 331 68.83 89.30 67 20.24
20352. Vince (kerokeroro) 26 68.82 82.14 4 15.38
20353. Ethan (ethankramer) 17 68.82 83.58 11 64.71
20354. Thomas (2minute) 32 68.82 76.45 9 28.13
20355. chepchombir (chepchombir) 17 68.82 77.37 6 35.29
20356. Andreas (mangabro) 191 68.81 87.01 39 20.42
20357. Nissan (ni554n) 2 68.81 70.96 1 50.00
20358. Zhomart (jomakasi) 1 68.81 68.81 0 0.00
20359. Nolan (nolanporty) 13 68.81 84.85 1 7.69
20360. Marcus (marcus_t) 23 68.81 78.41 5 21.74
20361. Craig (craiggsell) 27 68.81 77.40 5 18.52
20362. Chris (chris_p) 434 68.80 86.81 113 26.04
20363. MrClumzzy (zxgod) 11 68.80 85.94 4 36.36
20364. Andriy (andoroid) 2 68.80 70.07 0 0.00
20365. Wapiro (ihatejuices) 36 68.80 79.53 6 16.67
20366. Sah (sahsooh) 5 68.79 74.17 2 40.00
20367. ix4l (ix4l19) 31 68.79 79.13 8 25.81
20368. Tiger (alcatrazx) 7 68.78 80.58 4 57.14
20369. Chris (splixerr) 15 68.78 83.10 4 26.67
20370. Jamie (jam8554) 10 68.78 80.90 2 20.00
20371. ExtraSauce (thundertyping) 211 68.78 99.72 47 22.27
20372. kingsley (kings350) 137 68.78 92.82 44 32.12
20373. Joe (joemamma121) 30 68.78 85.35 10 33.33
20374. Kinoktia (kinokita) 176 68.77 88.14 46 26.14
20375. smell (mytoes) 1 68.77 68.77 0 0.00
20376. Siddiqjon (siddiqjonuz) 2 68.77 68.82 1 50.00
20377. TehTrooper (tehtrooper) 85 68.76 83.76 18 21.18
20378. Megu (meguminayaya) 2 68.76 78.46 2 100.00
20379. JumboTub4 (ben_is) 33 68.75 86.78 7 21.21
20380. william (willi30124) 60 68.75 85.89 15 25.00
20381. Renato (nadev) 3 68.74 74.85 0 0.00
20382. Kyle (hyperionkyle89) 2 68.74 69.95 1 50.00
20383. Sirjay (asiafaceboy) 3 68.74 74.44 0 0.00
20384. Tony (piiscool) 1 68.73 68.73 0 0.00
20385. mione (pikapals16) 5 68.72 83.37 2 40.00
20386. Ariel (arielkusnoto) 40 68.72 84.73 8 20.00
20387. (teinej) 6 68.72 75.03 4 66.67
20388. JVY (julvi) 26 68.71 86.06 9 34.62
20389. Cody (thoutravesty) 14 68.71 78.42 3 21.43
20390. R (tumta) 414 68.71 96.67 97 23.43
20391. Perceval-_- (perceval) 271 68.71 86.71 62 22.88
20392. oToToT (ototot3ot) 41 68.70 80.80 10 24.39
20393. Jesse (alfonz) 20 68.70 80.89 5 25.00
20394. David (davidniupa) 3 68.70 72.14 2 66.67
20395. Jackie (johnsonj13) 34 68.70 83.76 14 41.18
20396. DewWhite (dewwhite) 9 68.70 75.98 6 66.67
20397. M (izzyissad) 10 68.69 79.71 2 20.00
20398. An (anvnh) 1 68.69 68.69 1 100.00
20399. Nathan (killzs) 39 68.69 83.40 9 23.08
20400. BonTear (b0ntear) 387 68.69 94.17 88 22.74
20401. Gagik (_the_wind) 17 68.69 78.15 4 23.53
20402. DIego (ogeid) 7 68.68 72.77 1 14.29
20403. RSCArne (rscarne) 8 68.68 81.69 2 25.00
20404. Russian (russian_comrade) 34 68.68 80.59 11 32.35
20405. Nyiela (ncs1020) 1,411 68.67 100.40 346 24.52
20406. galatia (galatia) 4 68.67 74.05 1 25.00
20407. Gita (gist23) 6 68.66 88.02 2 33.33
20408. Lewis (eatass123) 14 68.66 76.87 2 14.29
20409. Toan (nguoichuadangki) 72 68.66 90.40 32 44.44
20410. Anthony (bloonchipper) 22 68.66 95.63 5 22.73
20411. Kristoffer (koffer96) 189 68.66 94.10 41 21.69
20412. sriram (svb1) 13 68.66 74.00 3 23.08
20413. APS (arsh_aps) 26 68.65 83.22 7 26.92
20414. Julia (bunnimochi) 46 68.65 91.66 10 21.74
20415. mostafa (eng_mustafa) 237 68.65 91.63 59 24.89
20416. Meitou (meitou) 5 68.65 83.46 4 80.00
20417. Ximzor (ximzor) 2 68.64 76.32 1 50.00
20418. Cel (celerity_) 63 68.64 93.52 22 34.92
20419. Jimmy (user39_on_anagram) 2 68.64 69.91 0 0.00
20420. Aaron (suckmeoffhoe) 38 68.63 81.94 8 21.05
20421. Ben (brokenace) 7 68.63 83.74 6 85.71
20422. mahdi (carpenterbrother) 89 68.63 83.12 20 22.47
20423. Azatbek (kanybekov66) 1 68.63 68.63 0 0.00
20424. dheeraj (goldsnort) 8 68.63 75.03 4 50.00
20425. Dilhan (disgruntled_lemon) 7 68.63 77.57 4 57.14
20426. Tjerk (tjerkderacer) 2 68.63 70.41 1 50.00
20427. 2qbingxuan (2qbingxuan) 12 68.62 82.92 1 8.33
20428. Andrew (itsmebrush) 4 68.62 81.09 1 25.00
20429. paxuy (paxuy) 21 68.62 80.51 3 14.29
20430. b (byron911) 41 68.62 94.85 11 26.83
20431. Skrub (skrub_bot) 1 68.61 68.61 0 0.00
20432. ANUP (typekashyap) 35 68.61 83.78 9 25.71
20433. Claudio (tato41) 1,350 68.60 93.65 296 21.93
20434. Nurzhan (_bakytov_) 47 68.60 85.27 13 27.66
20435. Božidar Grgur (marcipanko) 220 68.60 87.13 56 25.45
20436. APPLE (ytfox_roller) 12 68.59 90.86 5 41.67
20437. __8k.11Ine_ (yassine999) 49 68.59 87.49 11 22.45
20438. Dmitry (dmitry_turcan) 150 68.58 90.87 32 21.33
20439. Cdrc (blo5) 7 68.58 85.51 0 0.00
20440. Andi (agraumann) 29 68.58 89.33 8 27.59
20441. Jonas (knochen) 6 68.57 74.37 1 16.67
20442. Vincent (hanley51) 2 68.57 74.15 1 50.00
20443. Pine (pinechristmas) 12 68.57 79.11 4 33.33
20444. gayman (vvvvvccvvvvv) 60 68.57 85.55 18 30.00
20445. Nate (critic) 4 68.57 78.37 0 0.00
20446. ChocoDoco (chocodoco) 4 68.57 71.96 2 50.00
20447. Mayumi (kogl_mieko) 31 68.56 84.33 4 12.90
20448. aviad (patish) 4 68.56 70.04 2 50.00
20449. Jamie (jamie_b818) 6 68.56 81.75 3 50.00
20450. steel (steelmax1214) 200 68.56 88.98 63 31.50
20451. Kūfuku (kufuku) 16 68.56 83.08 7 43.75
20452. Gabriel (gatauahmalesbiasalah) 3 68.55 71.58 0 0.00
20453. Casper (casperwang) 17 68.55 82.58 4 23.53
20454. Ahmed (gemmy2212) 5 68.55 77.41 4 80.00
20455. Lightning (thecarsfan) 32 68.55 76.71 7 21.88
20456. Steve (stevocat) 23 68.55 80.20 12 52.17
20457. Willow (02_wl_04) 37 68.55 83.09 19 51.35
20458. ChiBai (f0rg0tten) 8 68.55 87.19 1 12.50
20459. Rakesh Singu (rakeshsingu) 63 68.55 99.02 15 23.81
20460. Doggy (ahousecat6969) 2 68.54 69.69 0 0.00
20461. Jacob (hushdog) 2 68.54 69.49 0 0.00
20462. Winsharp (fimannax) 7 68.54 82.63 3 42.86
20463. JC (i_cannotbewon) 4 68.54 90.31 1 25.00
20464. Andrew (harris75098) 14 68.54 87.73 5 35.71
20465. Sergey (steelassasin) 12 68.54 77.77 1 8.33
20466. Sunny (anzphoenix) 3 68.54 76.83 0 0.00
20467. Ammo (rokudoku) 5 68.54 72.49 0 0.00
20468. Davr (davr) 7 68.54 75.67 2 28.57
20469. Benjamin (benjocar) 2 68.54 70.60 0 0.00
20470. Pasin (_hello_world) 191 68.53 86.91 39 20.42
20471. Firzan (firzanarmani) 17 68.53 78.11 3 17.65
20472. Trent (tsteele07) 269 68.53 84.78 63 23.42
20473. Stammgast (lv_vl) 2 68.53 74.17 0 0.00
20474. Frank (frankyfrank) 1 68.53 68.53 1 100.00
20475. Batteekha (batteekha) 154 68.53 83.98 39 25.32
20476. jackmaoff (jackmaoff) 20 68.53 81.63 6 30.00
20477. Halley (halxey) 167 68.52 91.47 131 78.44
20478. Kevin (pb9000) 3 68.52 73.45 0 0.00
20479. Aanshu (noob_typist_404) 32 68.52 79.94 12 37.50
20480. Jindro (jijolindo) 6 68.52 91.41 2 33.33
20481. Andres (kikikiros) 3 68.52 76.82 0 0.00
20482. ... (zviki) 57 68.52 80.82 17 29.82
20483. Mmonster (mmonsterv11) 163 68.52 97.83 38 23.31
20484. Perfect (tpspark42) 2 68.52 72.81 1 50.00
20485. Digs (digsdigging) 2 68.52 70.79 0 0.00
20486. omar (itsramo) 4 68.51 76.29 1 25.00
20487. warm (warmthunder51) 62 68.50 88.67 15 24.19
20488. Siddhant (indianracer385) 21 68.50 88.40 0 0.00
20489. fesd (fesd20) 57 68.50 84.83 16 28.07
20490. Solo (solohan) 14 68.50 78.24 6 42.86
20491. Febri (skafkas) 2 68.50 75.11 1 50.00
20492. Юрий (devilvslife) 1 68.50 68.50 1 100.00
20493. julsdgreat (julsdgreat) 515 68.50 92.99 127 24.66
20494. Luthfi (luthfiidrus1612) 31 68.50 78.85 10 32.26
20495. Walson (wals) 244 68.49 98.93 64 26.23
20496. uwu (mdby_enn) 8 68.49 76.33 1 12.50
20497. blandfoodman (blandfoodman) 23 68.48 83.20 6 26.09
20498. Xavieku (xavieku) 36 68.48 80.50 14 38.89
20499. suchir (eternalzx) 6 68.48 75.87 2 33.33
20500. Bob (bobjesus) 14 68.48 80.73 7 50.00
20501. Angel (ange1zzzu) 1 68.47 68.47 0 0.00
20502. Brandon (spudslayer1990) 2 68.47 75.67 2 100.00
20503. Gurgug (lilskrimp) 1 68.47 68.47 0 0.00
20504. Marc (andesandwich) 148 68.47 88.25 41 27.70
20505. Dnyanendra (danyk_16) 23 68.47 80.39 6 26.09
20506. Yumin (yumin) 4 68.46 82.16 1 25.00
20507. Alfie (alfiefogg) 10 68.46 76.79 1 10.00
20508. Patric (potric) 11 68.46 88.98 2 18.18
20509. Grim (grimtorcher) 97 68.46 91.23 24 24.74
20510. Rotem (hi_im_rotem_2006) 27 68.45 83.53 7 25.93
20511. Ismail (isma3il) 4 68.45 77.90 2 50.00
20512. Vibes (big_vibe) 3 68.44 79.07 0 0.00
20513. Kevin (kidview) 31 68.44 86.43 1 3.23
20514. Vincent (kingvince160) 1 68.44 68.44 0 0.00
20515. Rikos99 (rikos_omegalul) 12 68.44 80.83 4 33.33
20516. David (depc) 4 68.44 73.06 3 75.00
20517. Max (ficko) 5 68.44 72.69 0 0.00
20518. chino (chino69) 12 68.44 77.35 3 25.00
20519. Last (galya_88) 14 68.43 77.39 3 21.43
20520. risheek. (discord) (risheek7) 5 68.42 80.04 2 40.00
20521. Edison (eddie_boy) 6 68.42 82.33 0 0.00
20522. Debbie (jaedee_debbie) 12 68.42 82.96 4 33.33
20523. gabriel (super_racer1) 132 68.42 88.37 25 18.94
20524. Valoix (valoixgaming) 70 68.42 81.02 63 90.00
20525. Ludwig (simontypo) 42 68.42 86.75 15 35.71
20526. Ted (t3ddybgam3) 2 68.42 70.87 0 0.00
20527. Hjalmar (hjalmardur) 4 68.42 72.48 0 0.00
20528. Damjan (damjank) 3 68.41 75.01 1 33.33
20529. Badr (tbadr) 1 68.41 68.41 0 0.00
20530. Santiago (santicer06) 2 68.41 75.78 0 0.00
20531. Orblil (orblil) 49 68.41 97.62 13 26.53
20532. a (stanrude) 52 68.41 82.05 11 21.15
20533. Muhammad Omar (omar_farooq) 15 68.40 80.53 3 20.00
20534. Han (hsujanet1527) 1 68.40 68.40 1 100.00
20535. internet asian boy (hell0_i... 1 68.40 68.40 0 0.00
20536. shaun (shaunbot_123) 208 68.40 91.34 55 26.44
20537. Peter (litoprobka) 3 68.40 75.66 3 100.00
20538. Leo (ljrobispado) 16 68.40 75.88 4 25.00
20539. ahmed (ahmed393) 43 68.39 76.61 4 9.30
20540. Ethan (thandrew) 9 68.39 84.41 2 22.22
20541. Ed (positrone) 5 68.39 73.20 2 40.00
20542. Nabalazs (nabalazs) 9 68.39 78.04 3 33.33
20543. Manos (chatzakes) 9 68.39 77.44 2 22.22
20544. yuupoipoi (mimicclone) 754 68.39 89.95 175 23.21
20545. Amit (amitu7) 44 68.39 83.04 11 25.00
20546. no (archerypro459) 1 68.38 68.38 0 0.00
20547. saurabh (practisemore) 5 68.38 76.83 2 40.00
20548. kamoo (k4moo) 47 68.38 82.15 9 19.15
20549. Shane (smokedbread) 8 68.37 77.59 4 50.00
20550. Zandro (zandrocraft) 176 68.37 96.44 42 23.86
20551. Rui (zehs) 4 68.37 72.88 1 25.00
20552. AFourTeen (a14inc) 1 68.37 68.37 0 0.00
20553. Guest (dbluedb) 19 68.37 92.87 1 5.26
20554. Axurio (axurio) 14 68.36 80.57 6 42.86
20555. Jeffrey (vlasfack) 31 68.36 81.39 7 22.58
20556. brr type man (brrrtypeman) 5 68.36 76.54 5 100.00
20557. Nafidz (arckngel) 146 68.36 82.47 29 19.86
20558. danydoo (danydoo) 55 68.36 79.40 14 25.45
20559. Talha (digitaldruglord) 42 68.36 75.84 9 21.43
20560. Evan (syzer7) 3 68.36 72.60 0 0.00
20561. Jack_potta (jack_potta) 16 68.36 79.53 4 25.00
20562. Daniel (mickeyyaya) 4 68.35 81.68 0 0.00
20563. Tofumaster (khenglon) 18 68.35 78.49 3 16.67
20564. Tuguldur (tugulduruuu) 5 68.35 73.84 2 40.00
20565. Jansson (_jansson_) 4 68.35 82.09 0 0.00
20566. Ignite (ignite777) 22 68.34 86.69 11 50.00
20567. Coder (the_coder_bro) 173 68.34 85.61 38 21.97
20568. Katstats[karthikkumar]rthik... 247 68.34 96.09 52 21.05
20569. Aleksi (jeboust) 1 68.34 68.34 0 0.00
20570. GeekTek (geektek) 1 68.34 68.34 1 100.00
20571. Mehedi Islam (mehediislamri... 194 68.34 96.00 40 20.62
20572. Leigh (leightm) 5 68.34 85.00 3 60.00
20573. Cloudios (cloudios) 14 68.34 84.57 4 28.57
20574. Alan (xilog) 6 68.34 79.38 0 0.00
20575. Fabricio (fabrox) 27 68.33 87.52 7 25.93
20576. Sam (salinko) 1 68.33 68.33 0 0.00
20577. Cameron (yungjoon) 2 68.33 78.02 1 50.00
20578. Squidyguin (squidyguin) 3 68.33 69.86 0 0.00
20579. Aleksa (stojke) 2 68.33 69.27 1 50.00
20580. Shaun (h0giebear) 6 68.33 73.74 2 33.33
20581. Porsit (porsit) 8 68.33 83.04 2 25.00
20582. Buri (buri_was_taken) 187 68.32 90.47 40 21.39
20583. phauxy (phauxy) 375 68.32 91.33 103 27.47
20584. Alec (shifty_py) 4 68.32 76.19 1 25.00
20585. v1step (v1ztep) 361 68.32 95.38 54 14.96
20586. Gustavo (pizza_water) 10 68.32 75.34 2 20.00
20587. xavier (xavierguertin) 5 68.31 73.77 1 20.00
20588. Aneesh (rationaliguana99) 6 68.31 71.91 2 33.33
20589. Alessandro (shrykull_scars) 4 68.31 77.22 0 0.00
20590. Trxnia (trxnia) 4 68.31 71.97 3 75.00
20591. Parth (plukhi17) 1 68.31 68.31 0 0.00
20592. eqqi (eqqidvorak) 5 68.31 71.36 1 20.00
20593. Charlie (cubez) 307 68.31 91.92 100 32.57
20594. Hebes (freaken_chicken) 2 68.31 71.46 0 0.00
20595. raptor (raptor234) 567 68.30 92.85 127 22.40
20596. Matty (mattypatty) 1 68.30 68.30 0 0.00
20597. z (zhempal) 1 68.30 68.30 0 0.00
20598. Clarissa (clarissaclaa) 12 68.30 75.16 1 8.33
20599. bigpapa (bigpapathapa) 5 68.30 75.18 2 40.00
20600. BobSty (bobsty) 5 68.30 77.21 3 60.00
20601. Brandon (baddoodle) 235 68.30 93.63 48 20.43
20602. Mohammad (mohammad__) 47 68.29 90.05 15 31.91
20603. Brendan (coalie) 1 68.29 68.29 0 0.00
20604. Libby (inkgenious) 9 68.29 74.25 2 22.22
20605. Alaa Awamleh (alaa_awamleh) 351 68.29 87.28 104 29.63
20606. Matthew (mdsauer53) 1 68.28 68.28 0 0.00
20607. Genie (shazamrockshake) 1 68.28 68.28 0 0.00
20608. Doyle (zdubhghaill) 33 68.28 82.14 6 18.18
20609. John (kasi95) 12 68.28 78.22 4 33.33
20610. Vishal Singh (vizzzard) 81 68.28 88.22 21 25.93
20611. Adam (adamt_543) 2 68.28 68.31 2 100.00
20612. Novandru (novandru98) 123 68.27 87.85 23 18.70
20613. Amarant (amarant_) 42 68.27 84.99 7 16.67
20614. Rain (rain_19) 86 68.27 87.65 32 37.21
20615. Enjoi (enjoisxd) 264 68.27 87.51 58 21.97
20616. Umair (tastyorange) 8 68.26 83.37 1 12.50
20617. Maria (marlab) 492 68.26 84.60 123 25.00
20618. FixioMG (fixio) 441 68.26 87.61 103 23.36
20619. Plordpai (plordpai) 2 68.26 74.28 1 50.00
20620. Method (method16) 1 68.26 68.26 0 0.00
20621. Dman27 (dman27) 7 68.26 73.26 4 57.14
20622. Lucas (slappy_rgs) 105 68.26 89.22 20 19.05
20623. Essam (chickennugget665) 2 68.26 69.58 0 0.00
20624. zxc (idcidcidcidc) 67 68.25 86.89 15 22.39
20625. roy (roylimas) 5 68.25 69.73 1 20.00
20626. Rafae (rafae110) 5 68.25 79.09 1 20.00
20627. Vignesh (avkvignesh) 9 68.25 73.88 2 22.22
20628. Divya (divya_16) 4 68.24 74.44 4 100.00
20629. Sanh (sanhnguyennt) 5 68.24 73.70 3 60.00
20630. Rizwan (mrpassionate) 109 68.24 83.82 20 18.35
20631. TacticalT8R (mrcardmont) 6 68.24 79.97 1 16.67
20632. Anton (bujjaa) 14 68.24 75.23 1 7.14
20633. Corrupt (onlyicorrupt) 63 68.23 83.74 14 22.22
20634. Leo (geckuchicken) 21 68.23 85.15 7 33.33
20635. meh (qwertysux) 1 68.23 68.23 1 100.00
20636. Tyson (cooldude1800) 12 68.23 76.51 4 33.33
20637. Albin (dunderalf) 4 68.22 71.25 0 0.00
20638. Mustafa (muzzy750) 1 68.22 68.22 0 0.00
20639. Kage (kagealan) 3 68.22 76.25 0 0.00
20640. Soufiane (shinigami25) 1,598 68.22 98.18 367 22.97
20641. Rhune (rhunetro) 33 68.21 80.14 6 18.18
20642. Abigail (abby_yobby) 1 68.21 68.21 0 0.00
20643. Colby (sparklesdudley) 6 68.21 81.74 1 16.67
20644. Thiemo (thiemok) 35 68.21 80.50 7 20.00
20645. Chirag (chirag_2580) 160 68.21 95.05 39 24.38
20646. Peter (picklepete) 3 68.21 70.29 0 0.00
20647. Dan (danezu) 106 68.21 91.13 15 14.15
20648. Presidente (dr0g4d0) 1 68.20 68.20 1 100.00
20649. FEDERICO (fedecochi) 7 68.20 71.13 3 42.86
20650. mike (mike4madness) 26 68.20 76.06 6 23.08
20651. Youssef (nuggetdip) 19 68.20 77.01 4 21.05
20652. youtube.com/TechieDheeraj (... 7 68.19 72.01 1 14.29
20653. Speedo (pacmaniac) 8 68.19 76.34 2 25.00
20654. Max (macksx) 11 68.19 80.97 3 27.27
20655. Jared (jagunlimited81) 1 68.19 68.19 1 100.00
20656. Ignfroggy (ignfroggy) 3 68.19 79.84 0 0.00
20657. Aries Vince (arvj9) 62 68.19 95.23 18 29.03
20658. Mudit (n___) 31 68.19 79.50 8 25.81
20659. tstats[mattinaglass] (matti... 15 68.19 89.61 4 26.67
20660. Yash (yomiiiii) 48 68.18 94.89 11 22.92
20661. real_remi (bobbobbio) 5 68.18 87.34 1 20.00
20662. megatron (ahnomi) 70 68.18 83.66 18 25.71
20663. Rishan (rishancredo) 5 68.18 78.62 1 20.00
20664. xhqrry has two fingers (xhq... 28 68.18 78.08 8 28.57
20665. Gaurav (parthbudds) 9 68.18 76.20 2 22.22
20666. Dan (danjohnson1209) 3 68.18 69.44 1 33.33
20667. Type (goodtoad) 1 68.18 68.18 1 100.00
20668. Sam (sammy3118) 6 68.18 70.65 0 0.00
20669. mr (mr_pineapple069) 48 68.17 86.05 17 35.42
20670. AG (rollingpanda0) 68 68.17 81.99 15 22.06
20671. ANNEw (butzy) 3 68.17 68.76 0 0.00
20672. voidtab (battini) 11 68.17 74.50 3 27.27
20673. JD (jigglyjd) 176 68.17 86.85 41 23.30
20674. Geeth (falsethunder) 168 68.17 99.39 32 19.05
20675. Elgrekost (elgrekost) 15 68.17 81.63 13 86.67
20676. Daniel (danielstebbins) 8 68.17 74.75 3 37.50
20677. Jack (jackmcg27) 64 68.17 83.79 20 31.25
20678. Norman (noromoon) 69 68.17 87.48 15 21.74
20679. Ryan (8baller) 118 68.17 87.21 29 24.58
20680. Hugh (drhugh) 11 68.16 77.81 3 27.27
20681. Xavier (blademaster5) 3 68.16 69.69 0 0.00
20682. Drakka (drakkathedark) 67 68.15 85.17 18 26.87
20683. Binay (binayginodia) 122 68.15 86.16 24 19.67
20684. Oliver (crocell) 7 68.15 78.91 2 28.57
20685. Sarvang (sarlok393) 47 68.15 88.54 16 34.04
20686. Raiyc (raiyc) 3 68.15 74.70 2 66.67
20687. Pieter Jelle (pieterjelle) 1 68.15 68.15 1 100.00
20688. Eggman (im_eggman) 2 68.15 73.17 0 0.00
20689. Icey (iceystars99) 1 68.15 68.15 0 0.00
20690. Istaz (iztaz) 5 68.14 79.40 2 40.00
20691. Zakir (z_slayer) 19 68.14 78.35 8 42.11
20692. Jimmy (hapahunta) 5 68.14 84.66 0 0.00
20693. Lavell (adenda2) 14 68.14 77.63 1 7.14
20694. stegmarb (stegmarb) 68 68.14 95.63 16 23.53
20695. Anne (princess_lichen) 4 68.14 74.62 1 25.00
20696. Ashish (grimjaw7) 86 68.13 79.06 14 16.28
20697. Duong (dnx04) 5 68.13 78.22 0 0.00
20698. Shivam (shivy08) 95 68.13 84.06 38 40.00
20699. Rock (trailersg) 37 68.13 77.88 9 24.32
20700. Jorawar (dumb_daas) 496 68.13 100.49 130 26.21
20701. Mattin (mattinpeik) 1 68.12 68.12 0 0.00
20702. Travis (lightningslow) 13 68.12 95.23 3 23.08
20703. Sawyer (stmcpherso) 14 68.11 73.44 6 42.86
20704. Abdurrachman (rrachman) 16 68.11 81.75 6 37.50
20705. Pheontern (pheontern) 130 68.11 83.11 29 22.31
20706. urbadheehee (urbadheehee) 6 68.11 79.46 1 16.67
20707. Hector (hampsterking9000) 3 68.11 74.51 1 33.33
20708. NutMonger (nutmonger) 36 68.10 82.42 8 22.22
20709. Corbin (xx_nut_xx) 3 68.10 71.22 1 33.33
20710. Kevin (the_pacifist) 3 68.10 74.21 1 33.33
20711. Aadil (aadil0392) 34 68.10 86.23 10 29.41
20712. Ahnta (ahnta) 22 68.10 80.16 3 13.64
20713. Landon (realpizza) 4 68.10 72.69 2 50.00
20714. Andriy (bonbonita) 4 68.10 73.35 1 25.00
20715. Danny (danny_whal) 78 68.09 91.79 22 28.21
20716. Param (parmy) 3 68.09 69.89 1 33.33
20717. Vincent (vwong21) 2 68.09 69.45 1 50.00
20718. Michel (mraskin) 2 68.09 69.53 0 0.00
20719. Meow (vic12116) 256 68.08 91.86 65 25.39
20720. qrill (qrill) 4 68.08 74.42 1 25.00
20721. Himanshu (himanshu_sahni) 188 68.08 86.14 38 20.21
20722. Gnr. Garst (gnr_garst) 3 68.07 76.33 2 66.67
20723. Rajesh (curseraj) 321 68.07 90.70 81 25.23
20724. sam (guest99898) 1 68.07 68.07 1 100.00
20725. David (litening72) 24 68.07 78.79 4 16.67
20726. jasmine (jasminneee) 9 68.07 73.03 2 22.22
20727. Not the chosen (qrota_1) 5 68.06 74.68 1 20.00
20728. Jakub (prism1349) 30 68.06 81.64 4 13.33
20729. Alexey (aleksn7) 33 68.06 82.70 5 15.15
20730. Danai (dan9s_) 3 68.06 74.88 0 0.00
20731. YoMoMGae (yomomgae) 4 68.05 77.11 1 25.00
20732. Arsalnovt (arsalnovt) 39 68.05 85.08 11 28.21
20733. moni (pzza404) 28 68.05 97.90 7 25.00
20734. Harshit (harshitjindal) 113 68.05 96.18 23 20.35
20735. gelis (gelis07) 3 68.04 75.28 0 0.00
20736. DeeDee (deedee09) 240 68.04 81.17 49 20.42
20737. Patrick (monkyoo) 484 68.04 90.91 108 22.31
20738. AubReina (nta0789) 1 68.04 68.04 1 100.00
20739. Dew2118 (dew_2118) 81 68.03 79.07 15 18.52
20740. Kun (imdavidboi) 1 68.03 68.03 0 0.00
20741. weeb (king_of_rice) 4 68.03 74.49 2 50.00
20742. ∞ (technolojesus) 35 68.03 75.84 8 22.86
20743. Innocent (saquelain) 1,048 68.02 98.94 222 21.18
20744. Mohamed (mohamedafify) 5 68.02 74.15 0 0.00
20745. Colemak2021 (learningcolmak... 2 68.02 69.11 0 0.00
20746. Mohammed (creative506) 3 68.02 75.58 0 0.00
20747. slippedfinger (alpha_centauri) 22 68.02 78.73 4 18.18
20748. Alex (zander77777) 2 68.02 71.76 0 0.00
20749. ayky (alexisyeo) 2 68.01 70.65 1 50.00
20750. Viacheslav (krevetko) 140 68.01 85.12 26 18.57
20751. Jack (jacktypeman) 8 68.00 79.52 4 50.00
20752. Alfred (opoy) 2 68.00 69.85 1 50.00
20753. Nick (nickman666) 1 68.00 68.00 1 100.00
20754. Matt (mattyb15) 1 68.00 68.00 1 100.00
20755. Kenny (kenny1232) 11 68.00 86.22 3 27.27
20756. Sanju (boomier) 4 68.00 71.26 1 25.00
20757. Affan (raging_fire37) 3 68.00 69.87 0 0.00
20758. Ernie (ernievc) 6 67.99 74.25 2 33.33
20759. Cal (golemite) 1 67.99 67.99 0 0.00
20760. Atom (atom_atom) 43 67.99 85.90 12 27.91
20761. bloodseeker (bloods33ker136) 5 67.99 81.20 1 20.00
20762. Tommy (typrtommy) 3 67.98 73.51 3 100.00
20763. J (petalss) 52 67.98 84.54 11 21.15
20764. ari (aryanonye) 82 67.98 75.77 19 23.17
20765. owen (beemochop) 51 67.98 83.75 6 11.76
20766. Kirsty (k1rsty) 5 67.97 75.20 2 40.00
20767. TREMAINE (tremaine_m) 10 67.97 83.15 1 10.00
20768. Aero (aerosoul) 44 67.97 81.86 4 9.09
20769. Plunker (plunker) 4 67.97 82.83 3 75.00
20770. CalciumCarbonate (calcium_) 2 67.97 70.61 0 0.00
20771. AM (amesh8301) 163 67.96 87.20 39 23.93
20772. Shivanshu (cvanshu) 137 67.96 85.78 28 20.44
20773. Ozymandias (ozymandias_qc) 18 67.96 79.21 5 27.78
20774. Jak (jak_man) 4 67.96 72.85 0 0.00
20775. Haris (undead_slayer) 128 67.96 83.43 58 45.31
20776. Nikhil (nik9) 309 67.95 95.29 81 26.21
20777. Lily (andisapple32) 150 67.95 86.36 33 22.00
20778. kRystal (krystal69) 20 67.95 88.79 13 65.00
20779. Ryan (ninjacowwizard) 24 67.95 86.75 6 25.00
20780. Priyam (priyam_raj) 64 67.94 83.35 14 21.88
20781. f2realw (f2realw) 136 67.94 85.12 48 35.29
20782. SpongeBob (cerealkila) 8 67.94 76.72 1 12.50
20783. Fourty (fractionals) 4 67.94 78.35 2 50.00
20784. Rise (rise_again) 4 67.94 70.73 4 100.00
20785. weeAzuL (weeazul) 59 67.93 85.65 15 25.42
20786. El cote (alyeet) 6 67.93 84.87 2 33.33
20787. Charles (djexecutioner) 1 67.93 67.93 0 0.00
20788. Kiddoz (kiddoz) 169 67.93 83.31 31 18.34
20789. Gintoki (ginnoji) 26 67.93 84.94 6 23.08
20790. SMdG (hyperlord) 130 67.93 80.91 34 26.15
20791. Shreyas (shrysptl22) 4 67.93 73.07 1 25.00
20792. dani (daniellielikesanime) 59 67.92 82.65 10 16.95
20793. Shrubber (shrubber) 15 67.92 77.28 3 20.00
20794. Omar (omar4321) 3 67.91 76.28 1 33.33
20795. Adam (bezwzglednyadas) 22 67.91 81.29 6 27.27
20796. Sangga (chemicalchaos291) 12 67.91 77.48 2 16.67
20797. Aniq (aniq_asd) 8 67.91 73.26 1 12.50
20798. Darrick (xkj888418) 2 67.91 74.57 0 0.00
20799. Chan (cognacchan) 60 67.90 85.03 14 23.33
20800. Ravi (raviparasar1997@gmail... 41 67.90 84.08 10 24.39
20801. Javago (javago) 2 67.90 71.34 1 50.00
20802. Sondi (sondi2234) 4 67.90 77.52 0 0.00
20803. Thomas (speedbro) 55 67.89 89.07 15 27.27
20804. Huy (giahuy7753) 31 67.89 82.99 5 16.13
20805. Matt (mplumado) 13 67.89 80.38 3 23.08
20806. tsds (tsds) 20 67.89 85.02 4 20.00
20807. nadeem (nadeemgujjar) 46 67.89 80.09 10 21.74
20808. Jeff (navigation07) 67 67.89 84.05 14 20.90
20809. AvocadoTM (avocadotm) 172 67.89 87.86 39 22.67
20810. Mike (mirkzzz) 227 67.88 83.80 27 11.89
20811. (◍•ᴗ•◍) (ibi4645) 944 67.88 111.04 561 59.43
20812. Jordan (jmoneymyer) 9 67.88 75.83 0 0.00
20813. Big (boosted_ape) 100 67.88 81.52 30 30.00
20814. Toasty (somewhat_toasty) 15 67.88 80.30 3 20.00
20815. Nana (tianananana) 17 67.88 75.34 2 11.76
20816. Emon (emonn) 107 67.88 85.64 22 20.56
20817. Sasha (sasha_satanenko) 9 67.88 80.08 3 33.33
20818. Guilherme (gui_szk) 3 67.87 73.06 0 0.00
20819. Oskar (dailypants) 157 67.87 82.88 36 22.93
20820. Juan (chayanneofficial) 6 67.86 73.04 1 16.67
20821. emuko (arju_12) 1 67.86 67.86 1 100.00
20822. Vorakan (ppaaul_) 11 67.86 81.65 2 18.18
20823. Jordan White (yepple_) 14 67.86 86.94 4 28.57
20824. Aldas (aldas25) 2 67.86 68.33 0 0.00
20825. Unknownbean (unknownbean) 12 67.85 84.27 0 0.00
20826. Juan (juan_mo) 71 67.85 88.99 12 16.90
20827. Evelyn (username0531) 1 67.85 67.85 1 100.00
20828. Rapunzel (subash_) 13 67.85 74.34 2 15.38
20829. Terkozz (terkozz) 12 67.85 88.89 3 25.00
20830. rrono (3an_3an) 447 67.85 97.43 149 33.33
20831. Kit (yukit123) 3 67.85 70.01 1 33.33
20832. Peppa (peppa_24) 5 67.84 80.82 1 20.00
20833. Anonymous (mcqueen_v2) 4 67.84 77.34 1 25.00
20834. Leonardo (saborfaze) 17 67.84 80.34 3 17.65
20835. No (11ucky) 2 67.84 69.21 0 0.00
20836. Mediumsecy (mediumsecy) 139 67.84 84.20 27 19.42
20837. Sree (clyublexx) 5 67.84 76.79 1 20.00
20838. Travis (travis4d) 11 67.83 78.73 5 45.45
20839. 1 (shootingmonkey1) 283 67.83 89.64 66 23.32
20840. Doodle (doodle_doot) 8 67.83 79.27 4 50.00
20841. austin (apschween) 2 67.83 75.04 0 0.00
20842. Piccolo (makankasappa) 20 67.83 79.11 6 30.00
20843. KenDvorak (kensan73dvorak) 11 67.83 83.35 1 9.09
20844. Brandon (zombieapocalypse) 80 67.83 82.53 20 25.00
20845. Daniel (dasno) 31 67.83 78.14 4 12.90
20846. Ben (koppix) 2,154 67.83 87.41 450 20.89
20847. Sulov (sul49) 60 67.82 86.22 19 31.67
20848. Wesgar (wesgar) 45 67.82 77.78 15 33.33
20849. Raph (wolfzlol) 2 67.82 73.04 1 50.00
20850. Dan (dankarnus) 15 67.82 79.85 2 13.33
20851. Jun (junisfast) 4 67.82 72.42 1 25.00
20852. Kristina (krisl9) 3 67.82 72.35 0 0.00
20853. Liam (2020lhall) 11 67.81 78.57 2 18.18
20854. Mark (mark666) 35 67.81 96.93 16 45.71
20855. ridan (ridanrekas) 10 67.81 75.92 2 20.00
20856. Lil (lildathrill) 5 67.81 77.57 1 20.00
20857. Spencer (mr_rigid) 13 67.81 80.76 4 30.77
20858. Raymond (thiccthighs) 21 67.81 81.28 1 4.76
20859. Wild (wildwolfas) 6 67.81 72.64 0 0.00
20860. Gabryel John (gabryeljison) 8 67.81 81.97 4 50.00
20861. ELectr8c (3l3ctr1c) 5 67.80 81.13 2 40.00
20862. Leandros (leloukoz) 2 67.80 71.30 0 0.00
20863. Mice (micebishop) 1 67.80 67.80 0 0.00
20864. Otimos (faketaxiia) 1 67.80 67.80 1 100.00
20865. Connor (animegorl2000) 7 67.80 83.61 0 0.00
20866. Kim (rsoler) 202 67.80 88.43 35 17.33
20867. avighna (avighna) 57 67.79 92.03 13 22.81
20868. JS (thenotorious619) 98 67.79 85.59 23 23.47
20869. Ellie (jellylie2005) 38 67.79 79.65 6 15.79
20870. King of Pirates (kaizokuouu... 10 67.79 72.49 1 10.00
20871. lil_lobster (lil_lobster) 14 67.79 75.32 2 14.29
20872. Jill (jconn00) 47 67.79 82.93 9 19.15
20873. Juan (alcaann) 38 67.79 83.93 13 34.21
20874. jonathon (laptoptouchpad) 14 67.78 82.46 0 0.00
20875. Zaynab (itsyou) 284 67.78 88.47 74 26.06
20876. Tatum (beryl_bee) 4 67.78 77.35 0 0.00
20877. Henry (ceeefore) 24 67.78 81.57 3 12.50
20878. Existence (existence_vip) 4 67.78 71.66 1 25.00
20879. voopx (coopnorth) 24 67.78 87.05 5 20.83
20880. this is feimser (feimser) 21 67.78 76.21 8 38.10
20881. BusinessMan (businessman4) 6 67.78 72.40 5 83.33
20882. Saurabh (rustie_123) 25 67.77 76.88 5 20.00
20883. Blank (sydale) 6 67.77 85.18 2 33.33
20884. Joshua (joshuac_47) 16 67.77 92.72 8 50.00
20885. Kennon (trainertaco) 45 67.77 80.69 10 22.22
20886. fakhry (fakhryodi) 40 67.77 87.57 10 25.00
20887. Azhar (azharbhat) 53 67.76 85.16 10 18.87
20888. Ashley Harrison (amharrison15) 17 67.76 81.64 2 11.76
20889. Tumpor (tumpor) 1 67.76 67.76 0 0.00
20890. Draco (draco_the_toad) 89 67.75 92.70 29 32.58
20891. Brandon (bduick) 19 67.75 79.33 4 21.05
20892. _Wapi_ (veqisgay) 6 67.75 71.59 2 33.33
20893. Accuracy (servesh) 9 67.74 84.12 1 11.11
20894. clooverhoover (olivesandlem... 38 67.74 95.00 9 23.68
20895. Erik (rocketdog_23) 132 67.73 82.27 17 12.88
20896. Dank Memes (rezzex) 5 67.73 72.65 2 40.00
20897. Marcos (marcos100) 2 67.73 73.60 0 0.00
20898. Pieter (umbravanlocks) 41 67.73 82.16 6 14.63
20899. Emmanuel (blaez_) 40 67.73 78.58 16 40.00
20900. Jelly belly (jellybabysexys... 95 67.73 85.59 20 21.05
20901. Deamon (deamontyper) 14 67.73 81.94 4 28.57
20902. Garet (garet) 2 67.72 72.13 0 0.00
20903. Yazan (yazan_al) 42 67.72 78.93 12 28.57
20904. Jonathan (bobjoni1233) 64 67.72 77.62 12 18.75
20905. Yuich (yuichi123) 9 67.71 80.79 2 22.22
20906. luckyone (luckyyone) 5 67.71 70.83 0 0.00
20907. Type (type_racer_15) 37 67.71 81.06 8 21.62
20908. Z (hackerpro) 2 67.71 72.08 0 0.00
20909. Simon (ciscomalware) 8 67.71 76.06 6 75.00
20910. David (david_nguyen21) 40 67.70 82.03 4 10.00
20911. Troy (troy517545) 191 67.70 89.16 40 20.94
20912. Batian (batiti51) 52 67.69 81.84 10 19.23
20913. Arnab (arnab_api) 121 67.69 82.62 22 18.18
20914. frost (frost99) 59 67.69 80.87 12 20.34
20915. Alex (chucky9022_) 16 67.69 85.49 3 18.75
20916. coolslowboy (coolslowboy) 13 67.69 75.14 4 30.77
20917. Sky (soranohana) 3 67.69 73.54 0 0.00
20918. duck (duckupus) 4 67.68 75.86 1 25.00
20919. Ivan_Eagle (ivan_julia) 1,351 67.68 93.42 347 25.68
20920. Aidan (aidsiskindagoated) 16 67.68 78.03 2 12.50
20921. Adébáyọ̀ (annonp) 32 67.67 89.19 8 25.00
20922. Moaz (mo3adh) 329 67.67 95.42 64 19.45
20923. austin (acirelle) 1 67.67 67.67 0 0.00
20924. Dominik (goldenboi) 2 67.67 68.12 0 0.00
20925. PL (patrick_legrand) 24 67.67 81.32 7 29.17
20926. Akko (blue_akko) 3 67.67 72.70 0 0.00
20927. Julen (bi0hazard_jck) 18 67.67 79.32 3 16.67
20928. Mubtasim (mubtasim91) 13 67.67 83.87 2 15.38
20929. Megan (foreverpurple) 4 67.66 72.23 0 0.00
20930. Bentusian (bentusian) 1 67.66 67.66 0 0.00
20931. Zhan (zhanzhaksylyk) 1 67.66 67.66 0 0.00
20932. Schlomo (schlomon) 4 67.66 78.27 2 50.00
20933. Noxcoma (noxcoma_) 7 67.66 79.50 4 57.14
20934. George (gkoubbe) 63 67.65 83.45 19 30.16
20935. Soyuzbek (soyuzbek) 207 67.65 91.86 47 22.71
20936. Louisa (lulu28) 2 67.65 71.13 1 50.00
20937. Maya (mayam915) 1 67.65 67.65 1 100.00
20938. A (jllkii123) 28 67.65 77.16 9 32.14
20939. FrankSauve (franksauve) 12 67.65 80.68 4 33.33
20940. Raul (eatmydusthoe) 39 67.64 83.68 7 17.95
20941. Raj (raxoltron) 285 67.64 95.29 84 29.47
20942. Matthew (mpb0401) 32 67.64 80.40 5 15.63
20943. Ilhan (monzf) 4 67.64 101.23 4 100.00
20944. titty (happyfaceman) 19 67.64 81.72 5 26.32
20945. Ryan (ryanknav) 3 67.64 76.60 0 0.00
20946. Anton (mojo98) 23 67.63 91.28 6 26.09
20947. ♦☺♦ (lookdownnotjustup) 76 67.63 80.45 19 25.00
20948. 2Lenne (hannaloresa) 8 67.63 75.08 3 37.50
20949. Peter (mubida23) 7 67.63 77.99 2 28.57
20950. Duy (senacen) 6 67.63 76.56 1 16.67
20951. shantanu (shantothegreat) 29 67.63 85.57 5 17.24
20952. Ayush (typer_ayush) 188 67.63 87.28 74 39.36
20953. Aman (amanminerulez) 11 67.63 75.29 2 18.18
20954. McBurger (mcburger) 84 67.62 88.62 15 17.86
20955. kim (kyunreal) 6 67.61 74.94 2 33.33
20956. Your (lftam319) 9 67.61 72.18 1 11.11
20957. Doniyor (doni_dev) 114 67.61 89.35 38 33.33
20958. Catherine (lautherine) 7 67.61 84.84 2 28.57
20959. Tim (eternalwind) 77 67.61 81.57 15 19.48
20960. Mat (rabbitkiller38) 4 67.60 71.39 1 25.00
20961. Mayank (maaynx) 7 67.60 92.71 4 57.14
20962. Ayman (7times) 85 67.60 93.12 24 28.24
20963. AMG F1 (amg_gts) 18 67.59 79.05 4 22.22
20964. Paige (patrickwest) 67 67.59 75.71 15 22.39
20965. The_King (the_king111) 6 67.59 76.73 0 0.00
20966. Tys0100 (tys0100) 11 67.58 74.94 0 0.00
20967. José (dqcheetqh) 10 67.58 75.03 4 40.00
20968. Anas (ananzeh) 26 67.58 77.81 5 19.23
20969. Prajna (cptdeka10) 4 67.58 75.66 1 25.00
20970. Arif (arif224) 23 67.57 78.65 7 30.43
20971. T (0_________0) 28 67.56 79.57 6 21.43
20972. Dicky (dcstormrage) 20 67.56 78.77 7 35.00
20973. Derek (ddw004) 3 67.56 74.44 0 0.00
20974. PeriodicHAiL (periodichail) 64 67.55 79.08 17 26.56
20975. Luke (lukeatme) 21 67.55 80.97 12 57.14
20976. hamzah (hamzahzzs) 67 67.55 88.27 17 25.37
20977. Jatin (kumar_jatin) 14 67.55 80.78 3 21.43
20978. Przemysław (girenkol) 18 67.55 81.69 2 11.11
20979. Ibrahim (aboyasser) 2 67.55 76.66 1 50.00
20980. qwerab (qwerab) 96 67.54 79.30 19 19.79
20981. Nathan (natehobo) 6 67.54 73.01 1 16.67
20982. Minhon (minhon23) 1 67.54 67.54 0 0.00
20983. bruh (k3nny11) 19 67.54 85.28 4 21.05
20984. Haiman (h41man_01) 5 67.54 74.15 1 20.00
20985. InDosaN (indosan) 2 67.54 69.37 0 0.00
20986. Jonas (zamurai88) 92 67.53 85.70 23 25.00
20987. Sully (habs_sully1) 4 67.53 72.99 1 25.00
20988. matthew (xhiffer) 1 67.53 67.53 0 0.00
20989. Concreap (dareapyboi) 1 67.53 67.53 0 0.00
20990. Emanuel (emanuelchristo) 66 67.53 80.57 19 28.79
20991. beefchow (beefchow) 10 67.52 79.17 2 20.00
20992. theonesomebodey (theonesome... 19 67.52 98.84 3 15.79
20993. Mike (mikayelb) 166 67.52 83.69 33 19.88
20994. None (v8_eatr) 66 67.51 81.96 22 33.33
20995. ITSPUJIS (itspujis) 17 67.51 89.04 2 11.76
20996. ansendice (asendice) 46 67.51 88.62 10 21.74
20997. Alex (alexey0) 88 67.50 81.50 25 28.41
20998. Sticky (st1ckyman) 18 67.50 78.03 4 22.22
20999. Beep (orange_capri_sun) 1 67.50 67.50 0 0.00
21000. Nafiul (n_crypted) 46 67.50 80.70 6 13.04
21001. moon (moon_anna) 69 67.49 84.12 23 33.33
21002. Nak (nakulo) 90 67.49 93.41 19 21.11
21003. karl (type_of_all_types) 12 67.49 76.69 5 41.67
21004. Cezou (cezou) 3 67.49 75.13 1 33.33
21005. Captain (captainalliance) 22 67.49 80.26 7 31.82
21006. Joe (tormund) 24 67.48 79.33 7 29.17
21007. Evan (ezet208) 4 67.48 83.78 0 0.00
21008. Justin (moneybagg) 15 67.48 76.20 4 26.67
21009. C4MFZ (c4mfz) 38 67.48 81.72 7 18.42
21010. Melo (melolem) 12 67.48 75.52 4 33.33
21011. Didoff (didoff) 45 67.48 82.16 10 22.22
21012. Aldar Kose (hkoldas) 28 67.48 80.81 10 35.71
21013. George (stamoulohta) 619 67.48 86.52 148 23.91
21014. Henxo (henzomaso) 4 67.48 86.33 1 25.00
21015. Md. Mamun (mamun_sheikh) 304 67.47 98.83 76 25.00
21016. Dvorak (learningdvorak101) 8 67.47 72.03 2 25.00
21017. Tiago (glinski) 7 67.47 79.50 2 28.57
21018. Chub (chubbyhands) 9 67.47 80.70 3 33.33
21019. Marc (ackermanick) 11 67.46 76.19 2 18.18
21020. Tasnimul (tasnimul) 59 67.46 87.84 13 22.03
21021. tstats[typingsid02] (typing... 73 67.46 80.59 14 19.18
21022. Abu Shaikh (abu_nibir) 51 67.46 78.11 11 21.57
21023. MB (mb_the_lighting) 19 67.45 78.18 6 31.58
21024. eevee (frazyx) 1 67.45 67.45 0 0.00
21025. Elen (eliivapuu) 3 67.45 77.55 1 33.33
21026. Simon (soinom) 14 67.45 75.51 7 50.00
21027. Shahil Suresh (roylar_range... 1,309 67.44 100.45 287 21.93
21028. olliedudd (olliedudd) 96 67.44 88.02 15 15.63
21029. Scoob (scooterscoob) 2 67.44 70.82 0 0.00
21030. Oscar (oguana) 32 67.44 82.83 6 18.75
21031. kentei (itskentai) 22 67.43 80.27 7 31.82
21032. Ankit (ankit0) 60 67.43 78.74 16 26.67
21033. mashed_potato (hello_world199) 27 67.43 80.09 7 25.93
21034. Matt (chillmaster) 43 67.43 78.20 10 23.26
21035. SHIVA (vishu_01) 54 67.43 87.77 17 31.48
21036. PUO (puomaster) 126 67.43 83.55 40 31.75
21037. Salman (meistr) 7 67.43 83.15 0 0.00
21038. karsten (karstensen) 28 67.42 83.26 5 17.86
21039. cuzimogni (cuzimogni) 21 67.42 76.32 1 4.76
21040. A.B.G (ahmed_burham_pro) 75 67.42 79.63 12 16.00
21041. El Psy Kongroo (fiive_starboy) 8 67.42 91.53 3 37.50
21042. Phire (phire_xic) 26 67.42 92.24 7 26.92
21043. Ezona (sambumbuslayer) 10 67.42 91.04 5 50.00
21044. Vigor (snakehater) 2 67.42 69.74 1 50.00
21045. Keima (lereias_1) 330 67.41 89.92 77 23.33
21046. atoms (overblown) 52 67.41 81.64 27 51.92
21047. juyvs (juyvss) 1 67.41 67.41 0 0.00
21048. adham (adham123) 5 67.41 76.13 0 0.00
21049. adm (1adm1) 1 67.41 67.41 0 0.00
21050. Joe (littlejoeward) 13 67.41 78.05 2 15.38
21051. Hatcheco (hatcheco) 7 67.41 77.32 2 28.57
21052. Levi (levi5678) 5 67.40 88.13 1 20.00
21053. Elvis (flareblu_workman) 8 67.40 81.95 3 37.50
21054. Dont (amosdaragon69) 2 67.40 68.58 1 50.00
21055. Diamond (diamond_desu) 37 67.40 85.76 13 35.14
21056. Jacob (deety) 1 67.39 67.39 0 0.00
21057. Zen (zen_xs) 1 67.39 67.39 0 0.00
21058. tstats[learning_dvorac] (le... 115 67.38 96.32 32 27.83
21059. Colemak (colemaknub) 187 67.38 98.86 34 18.18
21060. Akkmaharaj (akkmaharaj) 120 67.37 87.37 24 20.00
21061. Emilio (nenglara) 5 67.37 94.92 0 0.00
21062. i am the best (kzara6) 28 67.37 84.81 10 35.71
21063. Lukas (lukaslechner) 100 67.37 81.90 21 21.00
21064. Wassim (wxssim) 57 67.36 91.45 19 33.33
21065. Jonas (piglin) 8 67.36 76.75 2 25.00
21066. Kagero (kagero_) 19 67.36 85.93 4 21.05
21067. Lowie (lowie_987) 19 67.36 78.19 6 31.58
21068. Mitoyaa (mitoromu_) 2 67.36 69.26 0 0.00
21069. S (spencers0730) 3 67.35 76.51 0 0.00
21070. syrianii (syrianii) 14 67.35 77.07 2 14.29
21071. han (stuckinatimezone) 376 67.35 93.54 98 26.06
21072. Ali (huuu957) 4 67.35 72.06 1 25.00
21073. Lance Toby (ybot28) 27 67.35 83.38 9 33.33
21074. Ovidiu (ov_ant) 7 67.35 82.40 3 42.86
21075. rialagma (rialagma) 2 67.35 69.79 1 50.00
21076. William (not_your_username) 21 67.34 92.22 4 19.05
21077. Eufalasio (eufalasio_11) 538 67.34 90.04 121 22.49
21078. Mattias (illmajol) 3 67.34 78.58 0 0.00
21079. bawty rippa (bbbrandon) 1 67.34 67.34 0 0.00
21080. dotdotdot (atuladhar1) 848 67.34 97.85 188 22.17
21081. Dysprosium (ayush_1511) 49 67.34 80.07 18 36.73
21082. Sagnik (sagniks) 6 67.33 86.11 4 66.67
21083. Marty (wender97) 3 67.33 70.51 0 0.00
21084. Eugene (genedaman94) 179 67.33 98.65 38 21.23
21085. Patrick (ugonnaeatthatcrois... 26 67.33 80.51 6 23.08
21086. Casper (bighero86) 236 67.32 88.10 59 25.00
21087. chetanya (cheti) 10 67.32 76.32 2 20.00
21088. Lukas (lubeis) 5 67.32 76.89 1 20.00
21089. Jon (coltirl) 14 67.32 88.69 1 7.14
21090. mtj (mtj420) 2 67.32 71.30 2 100.00
21091. 999 WPM (usedarktheme) 8 67.32 77.84 0 0.00
21092. Mahatej Varma (mahatejvarma) 42 67.32 84.94 11 26.19
21093. Per (perlydersen) 124 67.31 81.15 29 23.39
21094. aleX (waisa) 15 67.31 88.72 3 20.00
21095. Alex (alex_ryan) 25 67.31 88.67 2 8.00
21096. wilmanbarrios (wilmanbarrios) 446 67.31 90.42 88 19.73
21097. Vincentius (benaldii) 3 67.31 69.00 1 33.33
21098. Thomas (ilikebigtitties69) 19 67.31 74.40 7 36.84
21099. Priyanshu (priyanshu88064) 102 67.31 80.68 20 19.61
21100. RidThe (ridthetwoladders) 2 67.31 78.97 0 0.00
21101. Digi (digisoul4) 2 67.31 67.64 1 50.00
21102. MD ADNAN (adnantech17) 22 67.30 74.11 3 13.64
21103. Akshy (akshy) 15 67.30 81.54 5 33.33
21104. Darshan (darshanlakkundi) 3 67.30 75.68 3 100.00
21105. Prakul (prax99) 2 67.30 67.92 1 50.00
21106. Smaran (simpilly05) 14 67.30 83.22 3 21.43
21107. jataro's dolphin (i_believe... 441 67.30 104.12 110 24.94
21108. Steven (nerobot) 62 67.30 84.68 9 14.52
21109. Oink (oinklmao) 16 67.30 80.08 5 31.25
21110. Tod (mbollinger9) 6 67.30 75.03 3 50.00
21111. Fan (firesale) 57 67.30 81.33 15 26.32
21112. Chocorion (chocorion) 14 67.29 79.93 3 21.43
21113. PingingCarrot16 (pingingcar... 29 67.29 89.20 7 24.14
21114. Amaanudeen (amaanudeen) 3 67.29 70.80 2 66.67
21115. Victor (sadlad) 18 67.29 77.58 4 22.22
21116. Jayden (jdawwgg) 79 67.29 96.29 20 25.32
21117. Aidan (fastflangies) 19 67.29 78.57 8 42.11
21118. Devin (slinky88) 20 67.29 80.61 6 30.00
21119. Michael (humormike) 6 67.28 72.25 3 50.00
21120. Sanji (kuroashi) 147 67.28 83.38 32 21.77
21121. yung (woahthereyungman) 7 67.27 88.61 0 0.00
21122. Jake (itsemerald) 5 67.27 73.66 0 0.00
21123. kuromi (istrying) 5 67.27 78.41 0 0.00
21124. Demogorgon (typeracer0110) 373 67.27 98.13 91 24.40
21125. VP (illermike) 170 67.27 82.20 40 23.53
21126. Surya (suryapun) 4 67.27 72.03 0 0.00
21127. khoinhalam (khoinhalam) 100 67.27 88.86 19 19.00
21128. Betting (buffhorse_) 383 67.27 90.37 73 19.06
21129. Tcoman (tcoman1) 10 67.27 72.54 6 60.00
21130. Ex (not_a_razer) 153 67.26 85.02 34 22.22
21131. Al (alexkjenkins) 12 67.26 78.04 1 8.33
21132. Ali (hardstone) 204 67.26 90.58 38 18.63
21133. twikel (twikel) 5 67.26 73.27 2 40.00
21134. FadesHandle (fadeshandle) 3 67.26 74.24 1 33.33
21135. godaberi (godaberi) 11 67.26 76.93 4 36.36
21136. Michael (tempt) 6 67.26 72.36 1 16.67
21137. Alex (maveriiic) 9 67.25 72.41 1 11.11
21138. Arthur (arthur_007) 7 67.25 79.15 1 14.29
21139. Davit (sonofar) 1,472 67.25 105.98 34 2.31
21140. sidharth (sidharth_71) 138 67.25 95.07 41 29.71
21141. Haji (hajikoit1_) 5 67.25 80.66 0 0.00
21142. 🙃 (kryptoprocta) 318 67.25 92.30 76 23.90
21143. Gevashkar (gevashkar) 25 67.25 80.89 10 40.00
21144. sircle (sircle) 24 67.25 75.73 5 20.83
21145. Neo (neosteps) 88 67.25 90.16 26 29.55
21146. chris (pumpino) 5 67.25 80.32 0 0.00
21147. Ishaan (ishaank10) 139 67.25 86.79 32 23.02
21148. Javin (zakurukito) 15 67.24 77.60 3 20.00
21149. Jared (creepywizard) 1 67.24 67.24 0 0.00
21150. Cát Gia (nahidk) 10 67.24 77.31 2 20.00
21151. Saad (saad_mohammed7) 14 67.24 81.95 4 28.57
21152. NeVMiku (nevmiku) 10 67.23 81.07 3 30.00
21153. Arin (arinkothari) 372 67.23 90.90 76 20.43
21154. Faisal (faisal0) 3 67.23 74.04 1 33.33
21155. Eugene (takahashi19) 1 67.23 67.23 0 0.00
21156. Pheakdey (swagmav69) 6 67.23 73.03 1 16.67
21157. Yet (yet1208) 186 67.23 92.88 35 18.82
21158. trucle (tructruc) 3 67.22 69.34 0 0.00
21159. Hasano (hasano14) 24 67.22 83.21 8 33.33
21160. Billy (super1ha1) 6 67.22 74.05 1 16.67
21161. tstats[ipawan] (ipawan) 2 67.22 69.89 1 50.00
21162. JL (tsg03) 104 67.22 86.92 24 23.08
21163. Shugoshin (shugoshin) 5 67.22 78.11 1 20.00
21164. Wildan (wildan_fachriz24) 12 67.22 81.35 4 33.33
21165. Anthony (ddragon217) 3 67.21 72.51 1 33.33
21166. sakuraphael (joseraphael) 8 67.21 85.28 2 25.00
21167. viper (viper3315) 59 67.21 78.35 10 16.95
21168. Vlad (ciorap88) 19 67.21 84.01 4 21.05
21169. Camel (bandar314@yahoo.com) 35 67.21 84.63 7 20.00
21170. Yujiro (f_zzy) 2 67.21 70.25 0 0.00
21171. oTTo (otto43) 10 67.20 83.26 1 10.00
21172. Dr. (saddathasan) 27 67.20 79.49 6 22.22
21173. Jimmy (jiminator) 76 67.20 79.55 17 22.37
21174. dirtydan (dirtyjdan) 13 67.19 71.63 4 30.77
21175. Leo (80_wpm) 5 67.19 71.77 2 40.00
21176. Dkoctro (dkoctro) 1 67.19 67.19 0 0.00
21177. Tey (teyy) 3 67.19 69.61 1 33.33
21178. Micah (flyinmnkys) 6 67.19 76.58 0 0.00
21179. niki (bateshot) 5 67.18 71.35 1 20.00
21180. Purpl3 (froghie) 37 67.18 89.56 14 37.84
21181. JKJ123 (jkj123) 18 67.18 83.98 1 5.56
21182. Foxrumor (foxrumor) 12 67.18 81.98 5 41.67
21183. deadass (rajteezy) 20 67.18 77.23 2 10.00
21184. Max (marvelnoodles) 17 67.18 81.76 5 29.41
21185. Crims0n (crimsonnn) 22 67.18 77.18 3 13.64
21186. Janssen (mentalpower_ada) 17 67.17 76.86 7 41.18
21187. random (myrandomusername) 323 67.17 92.40 83 25.70
21188. YLime (lacua) 55 67.17 78.65 10 18.18
21189. Connor (swedish_master) 34 67.17 81.52 6 17.65
21190. Duy (epicbrick) 5 67.16 80.53 1 20.00
21191. Vee (itveve) 1 67.16 67.16 0 0.00
21192. speedboi (speedboi11307) 5 67.16 74.33 1 20.00
21193. Icy687 (icy687) 3 67.16 75.23 3 100.00
21194. Kushal (kushalkumar) 7 67.15 74.01 2 28.57
21195. Tharun (tharun66) 98 67.15 90.07 11 11.22
21196. Shiv (chi_ken) 3 67.15 74.38 2 66.67
21197. Harshit (techallbyharshit) 10 67.15 80.30 2 20.00
21198. HM (opwpahfohuaehiodbfaiwvb... 12 67.15 76.08 2 16.67
21199. Mehul (mehulparmar459@gmail... 5 67.15 71.62 1 20.00
21200. Andre (sundown765) 4 67.14 74.65 0 0.00
21201. r (blazinrt) 5 67.14 72.24 2 40.00
21202. Alex (rashicakes) 1 67.14 67.14 0 0.00
21203. Lightning (just_lightning_) 262 67.14 94.27 42 16.03
21204. Mars (ezfastboi) 6 67.13 78.10 1 16.67
21205. Lvvy (lvvyy) 1 67.13 67.13 0 0.00
21206. b1shop (nnebsi) 8 67.13 80.40 1 12.50
21207. Ragnar (ragnar000lothbrok) 203 67.13 80.75 46 22.66
21208. VSwede (officialvswede) 4 67.13 76.22 0 0.00
21209. mayr (mayruwu) 175 67.12 89.65 51 29.14
21210. that (stepbro) 6 67.12 71.96 1 16.67
21211. Geo (geojumper) 8 67.12 72.43 2 25.00
21212. lightning (lightning_knight) 2 67.12 75.87 0 0.00
21213. Charlie (crystal_gamer) 11 67.12 75.96 3 27.27
21214. Evan (evennumber2) 3 67.12 77.33 0 0.00
21215. origix (origix) 4 67.11 71.02 3 75.00
21216. 鐘 (obarisk) 5 67.11 69.97 2 40.00
21217. thespaghetti27 (thespaghett... 36 67.11 90.39 12 33.33
21218. Bis (b1s_qu1t) 21 67.11 82.41 3 14.29
21219. fre (fre_24) 6 67.11 76.99 2 33.33
21220. Zitti (zittti) 76 67.10 82.79 18 23.68
21221. Kamron (kbegmatov96) 13 67.10 76.24 5 38.46
21222. Tsen (myungjunjun) 3 67.10 76.03 0 0.00
21223. atef (atef_7534) 640 67.10 111.47 160 25.00
21224. Hunter (huntercoolboi) 1 67.09 67.09 0 0.00
21225. Sean (guac_schmac) 4 67.09 79.07 2 50.00
21226. Emily (kaasmier) 4 67.09 71.64 2 50.00
21227. Sam (sam_staz) 2 67.09 70.32 0 0.00
21228. Luca (tracked) 85 67.08 89.32 16 18.82
21229. Jesse (jesse_kim) 48 67.08 86.23 20 41.67
21230. Bryan (pianudolores) 4 67.08 70.92 1 25.00
21231. adibhehe (adibhehe) 12 67.08 81.21 12 100.00
21232. roshan (kipislekker1) 4 67.08 68.56 3 75.00
21233. Lim (chiyennn) 26 67.07 75.89 7 26.92
21234. nishi (nishi_san) 72 67.07 80.80 16 22.22
21235. Arun (voidvortex) 1 67.07 67.07 0 0.00
21236. HiScore (hiscore) 4 67.07 84.04 0 0.00
21237. Kreingkrai (kengkreingkrai) 129 67.06 81.93 33 25.58
21238. Yaroslav (yaros) 22 67.06 77.23 9 40.91
21239. Omkar (omkardalvi001) 14 67.06 77.26 1 7.14
21240. Byte_Zero (flo_one) 3 67.06 72.07 0 0.00
21241. Avaneesh (avaneeshasokan) 305 67.06 86.43 76 24.92
21242. Kat (inoobo) 10 67.06 79.48 1 10.00
21243. Mateusz (matusz019) 15 67.05 80.46 6 40.00
21244. Phle (plegethas) 14 67.05 73.91 1 7.14
21245. Sniffff (can_i_sniffff) 9 67.05 81.71 4 44.44
21246. Andrew (an0nym0us_27) 2 67.05 69.37 1 50.00
21247. Wowa (vovsanka) 38 67.04 77.60 6 15.79
21248. Zisos (zisos78) 6 67.04 76.04 3 50.00
21249. Henry (henry88k) 15 67.03 76.77 3 20.00
21250. Dear (dearme) 141 67.03 81.48 33 23.40
21251. Minleg (bminleg) 8 67.03 77.46 2 25.00
21252. Shuggi (shuggi) 3 67.03 72.62 0 0.00
21253. javier (jf1442) 319 67.03 87.53 62 19.44
21254. Sop (coachprincesssoppy) 44 67.02 80.39 11 25.00
21255. ichbin (ichbin) 1 67.02 67.02 0 0.00
21256. Regan (regank1) 10 67.02 74.49 2 20.00
21257. Obstfliege (obstfliege) 4 67.02 70.53 0 0.00
21258. Kerem (tearsfears) 49 67.01 81.93 8 16.33
21259. かりつた (shizuyoru) 13 67.01 73.74 2 15.38
21260. Cole (colemakingprocess) 3,919 67.00 110.43 896 22.86
21261. Jacob (jmbogo19) 65 67.00 86.37 17 26.15
21262. David (davidpo) 4 67.00 75.47 1 25.00
21263. 0verhaul (0verhaul) 69 66.99 104.17 17 24.64
21264. Kawasaki (kawasaki_314) 7 66.99 79.73 3 42.86
21265. trqvcr (trqvcr) 79 66.99 96.27 17 21.52
21266. Memresable (memresable) 11 66.98 78.90 3 27.27
21267. Eric (edestroyer2604) 57 66.98 77.31 14 24.56
21268. Dabror (dk9mstar) 4 66.98 71.77 3 75.00
21269. Anton (antonidas) 9 66.98 73.92 3 33.33
21270. Karlo (m4china) 3 66.98 72.95 0 0.00
21271. Josh (jwill323) 2 66.98 68.05 0 0.00
21272. Kyjro (codertimeing) 29 66.98 85.09 6 20.69
21273. bayu (bayurespati) 1,574 66.98 100.21 355 22.55
21274. Willjum (willjum) 3 66.98 83.14 0 0.00
21275. HoangH7 (h7starlight) 4 66.97 74.54 0 0.00
21276. Elijah (goodgodlygaming) 1 66.97 66.97 0 0.00
21277. Nate (ngb125) 117 66.97 86.42 27 23.08
21278. Samuel (samharr) 109 66.96 84.35 19 17.43
21279. may (maciem14) 78 66.96 93.54 20 25.64
21280. Subid (theslowtyper8) 4 66.95 74.49 1 25.00
21281. sussyplayer (sussyplayer696... 84 66.95 81.79 13 15.48
21282. Pink (pinkbass) 292 66.95 92.34 69 23.63
21283. Amir (thebluebear) 5 66.95 78.79 0 0.00
21284. levi ackerman (leviackerman) 2 66.95 72.66 2 100.00
21285. Kalervo (dilbodeadhorseflog... 127 66.94 81.70 23 18.11
21286. Juey (spyrox) 39 66.94 79.54 6 15.38
21287. islamb20 (islamb20) 1 66.94 66.94 0 0.00
21288. Paul (paul1106) 22 66.93 75.52 5 22.73
21289. Nic (matcaps) 68 66.93 81.78 16 23.53
21290. Daredevil (piyush_123) 10 66.93 71.86 3 30.00
21291. elvi (puddingbb) 24 66.92 74.43 6 25.00
21292. deji the tank (bulgewarden) 17 66.92 83.63 7 41.18
21293. Sabrina (getrektttt) 139 66.92 96.43 37 26.62
21294. Gourango (gsrajeni) 31 66.92 83.64 6 19.35
21295. Owen (yellzy) 1 66.92 66.92 1 100.00
21296. Malcolm (weatherman7921) 73 66.92 81.16 12 16.44
21297. Scer_1 (scer) 78 66.92 86.01 18 23.08
21298. Rask (frederik0147) 97 66.92 77.36 16 16.49
21299. Ricardo (ricardo1610) 26 66.92 78.50 5 19.23
21300. Saumya (saumya69) 25 66.91 75.92 6 24.00
21301. Julia (thejulia) 123 66.91 81.06 21 17.07
21302. Casey (covertmidget) 27 66.90 81.79 15 55.56
21303. mgupta (mgupta1410) 4 66.90 69.12 1 25.00
21304. Noobmau (noobmau) 2 66.90 71.70 0 0.00
21305. Scotth (simurgh101) 5 66.89 76.99 2 40.00
21306. Ezequiel (ezk84) 5 66.88 75.11 0 0.00
21307. jTnqr (jtnqr) 3 66.88 77.43 2 66.67
21308. salah (kaltab) 20 66.88 76.47 3 15.00
21309. Semih (byshadow93) 17 66.88 78.09 6 35.29
21310. Gmlord (gmlord) 7 66.88 83.75 1 14.29
21311. Cheembs (cottagethepottage) 3 66.88 71.88 2 66.67
21312. Alireza (afateh) 2 66.88 75.88 0 0.00
21313. Mihael (mrki141) 6 66.87 71.71 2 33.33
21314. Michael (valibukk) 19 66.87 75.21 7 36.84
21315. nub (buildernub) 133 66.87 87.70 33 24.81
21316. Alex (alexdallama) 1 66.87 66.87 1 100.00
21317. Josh (joshmv) 3 66.87 74.16 0 0.00
21318. Eugenio (efrias21) 1 66.86 66.86 0 0.00
21319. ⊂( ▀ ͜͞ʖ▀)つ (sch... 1 66.86 66.86 0 0.00
21320. Bootstrap (gaurav021992) 33 66.86 86.57 19 57.58
21321. Gabby (gabbychan) 27 66.85 83.75 8 29.63
21322. Ahmed (ahmed_elamory) 7 66.85 73.96 2 28.57
21323. Wrenpy (kuwabaro) 3 66.85 80.46 1 33.33
21324. Orestis (orestisdr) 5 66.84 68.97 1 20.00
21325. Tsogtbayar (tsogtbayarbox) 3 66.84 73.33 1 33.33
21326. Ansh (ansh_001) 19 66.84 82.44 7 36.84
21327. Mason (mtyperxd) 12 66.84 79.98 5 41.67
21328. poop (dompozo) 70 66.84 88.05 23 32.86
21329. Jamliv (lvpec) 26 66.83 82.05 5 19.23
21330. Daniel (turnercommadan) 10 66.83 71.80 3 30.00
21331. Enea (enea) 16 66.83 79.51 1 6.25
21332. Mat (mat78) 60 66.83 82.16 7 11.67
21333. Colton (coltonj) 2 66.83 67.30 0 0.00
21334. Rold (roldmargruv) 37 66.82 82.54 22 59.46
21335. Rowan (spindlecreek) 31 66.82 80.48 5 16.13
21336. Tasman (t4sm4n) 10 66.82 73.75 1 10.00
21337. rajus (rajusthedarklord) 13 66.82 71.70 2 15.38
21338. Daniel (rektrobot) 4 66.81 73.58 0 0.00
21339. Chinmay_Tiwari (chinmay_tiw... 3 66.81 69.22 0 0.00
21340. GabWasTaken (bored_dude) 75 66.81 89.49 10 13.33
21341. Tyler Rankin (rxnkin) 32 66.81 80.96 6 18.75
21342. Zöri (pevisa) 24 66.81 82.21 8 33.33
21343. Jeaffffffffffffff (deadvull) 8 66.81 78.62 0 0.00
21344. amirhossein (amirho) 17 66.81 80.25 3 17.65
21345. Dagger (daggerbxii) 51 66.80 86.83 12 23.53
21346. szymi_gold (szymi_gold) 715 66.80 90.85 156 21.82
21347. Sid (sid121212) 1 66.80 66.80 0 0.00
21348. Garv (garv1908) 16 66.80 75.57 3 18.75
21349. Shane (maggiepie) 7 66.80 91.98 2 28.57
21350. Aechbie (hb69) 6 66.79 76.66 1 16.67
21351. adam (adamcute122) 2 66.79 72.67 2 100.00
21352. bq666 (bq666) 30 66.79 88.30 6 20.00
21353. Ahmed (deadmoonsoldier) 44 66.78 79.70 9 20.45
21354. Annie (anniesshl) 17 66.78 80.13 7 41.18
21355. hollow knight (phoenixwleft) 18 66.78 78.17 4 22.22
21356. Typomaster (axioo123) 21 66.77 81.85 6 28.57
21357. Lucas (lucasppestana) 23 66.77 83.21 5 21.74
21358. Sarah (sarahnivans) 11 66.77 75.36 1 9.09
21359. Alexandar (alexandargrav) 17 66.77 83.11 4 23.53
21360. Kingz (kingzcostz) 1 66.77 66.77 0 0.00
21361. Osyrs (3556) 12 66.77 76.57 2 16.67
21362. Helloween (tranduclocbkmail1) 601 66.77 83.92 146 24.29
21363. Deepanshu (deepanshu9) 17 66.77 79.33 7 41.18
21364. NikeTheProSk8r (nikethepros... 3 66.76 69.32 0 0.00
21365. Bugs (_bunny) 102 66.76 79.04 30 29.41
21366. shinchan (shinchan6nohara9) 2 66.76 68.97 1 50.00
21367. Charles (ph4ntom) 3 66.75 74.31 1 33.33
21368. ghoudiy (ghoudiy) 127 66.75 92.12 20 15.75
21369. Pomochko (pomochko) 15 66.75 83.92 1 6.67
21370. Jan (honfi) 1 66.75 66.75 0 0.00
21371. Clicky (ottoble) 14 66.75 77.79 1 7.14
21372. Ethan (eg083) 115 66.75 86.35 30 26.09
21373. Harvey (precisiongoat) 85 66.75 78.73 16 18.82
21374. Matthew (realmtd) 7 66.74 80.11 2 28.57
21375. Carokins (carokins) 1 66.74 66.74 0 0.00
21376. john (typeman_1234) 395 66.74 93.52 89 22.53
21377. Desiigner (desiignerkekw) 4 66.74 77.61 0 0.00
21378. Yeraly (yeraly_) 73 66.74 86.94 15 20.55
21379. Learning Bone (learning_bone) 9 66.73 71.89 4 44.44
21380. Uladzislau (tumilok) 41 66.73 79.42 12 29.27
21381. ABM (abm150) 159 66.72 80.76 43 27.04
21382. Squeeby (jhettman) 3 66.71 69.88 1 33.33
21383. TheGoosinator (ggustavs) 1 66.71 66.71 1 100.00
21384. Maxim (diablero) 2 66.71 70.70 0 0.00
21385. Shankar (shankar1190) 5 66.70 78.30 0 0.00
21386. Alex (acblackburn) 6 66.70 77.90 1 16.67
21387. Pieter (pvanuffelen) 8 66.70 78.27 3 37.50
21388. Maxim (malincik) 8 66.70 74.99 5 62.50
21389. Andrew (andrew4763) 4 66.70 72.57 0 0.00
21390. 誌綸 (tdog0507) 46 66.69 89.78 13 28.26
21391. Adam (seleulu) 4 66.69 76.55 1 25.00
21392. Shreyash (shreystar32) 1 66.68 66.68 0 0.00
21393. Vincent (breadcheese2021) 4 66.68 78.99 1 25.00
21394. Shukuphido (shukuphido) 1,154 66.68 83.29 259 22.44
21395. Văn (pqvan20) 344 66.68 87.03 90 26.16
21396. vincent (canadian_boi) 2 66.68 68.81 1 50.00
21397. Andrea (dr3vv) 7 66.67 75.03 3 42.86
21398. Cyan (cyan_cloud) 8 66.67 78.62 3 37.50
21399. Muffyn (muffyngg) 4 66.67 69.46 1 25.00
21400. Ngoc (windblossom0520) 3 66.66 69.95 0 0.00
21401. shahan (shahanj) 80 66.66 95.57 25 31.25
21402. Ryan (tamekaiyote) 2 66.66 74.95 0 0.00
21403. Optimize (optimizevfx) 1 66.65 66.65 0 0.00
21404. ara ara (sage_of_six_trees) 25 66.65 78.06 8 32.00
21405. V (vinn9) 3 66.64 67.67 1 33.33
21406. Memperor (memeemperor) 143 66.64 89.19 31 21.68
21407. v0rtex- (bouraoui) 24 66.64 75.47 8 33.33
21408. Luin (luingear) 8 66.64 78.72 1 12.50
21409. Slyther (slyth3r_) 1 66.64 66.64 0 0.00
21410. Oscar (oscrrmrz) 74 66.64 105.52 18 24.32
21411. Scar (scarskald) 52 66.64 88.05 15 28.85
21412. Juice (4804210474) 22 66.64 83.91 4 18.18
21413. King3131 (king3131) 5 66.64 73.54 2 40.00
21414. CaptainPotatoes (captainpot... 2 66.64 76.63 1 50.00
21415. rizzRacer (rizz94) 2 66.63 68.99 0 0.00
21416. Jake (jmanq) 139 66.63 97.12 38 27.34
21417. RobotGG (robotez) 3 66.63 71.27 0 0.00
21418. Oliver (oviewill) 30 66.63 75.87 6 20.00
21419. kopok (kopokopok) 26 66.62 82.88 4 15.38
21420. lysrac (lysrac) 35 66.62 88.81 5 14.29
21421. JackSparrow (jack__sparrow) 8 66.62 74.43 0 0.00
21422. Andrew (andrewfischr) 128 66.61 81.81 21 16.41
21423. Timothy (timothyqwerty) 1 66.61 66.61 0 0.00
21424. Owen (oskin_) 3 66.61 69.97 2 66.67
21425. siddharth (siddharthr) 25 66.61 79.20 6 24.00
21426. Emily (emj9) 155 66.61 81.25 32 20.65
21427. Marco (biomean) 5 66.61 77.37 1 20.00
21428. Yo (typin) 1 66.60 66.60 0 0.00
21429. F (_ft__) 71 66.60 88.11 19 26.76
21430. pebble (baumkuchen) 4 66.60 73.49 1 25.00
21431. Malupet si (bugret) 23 66.60 80.73 9 39.13
21432. Angelo (2teletabiez) 23 66.60 78.87 3 13.04
21433. sterling (sterling17) 6 66.60 75.72 3 50.00
21434. Harold (haac96) 2 66.60 67.44 1 50.00
21435. Vagrant Niff (vagrantniff) 1 66.59 66.59 0 0.00
21436. Robo (robo0110101) 6 66.59 74.37 3 50.00
21437. August (boxcybrawler) 33 66.59 75.12 8 24.24
21438. Tom (rusteze) 17 66.59 76.41 3 17.65
21439. Nick (nickjj) 12 66.59 83.92 3 25.00
21440. S (moxeemango) 6 66.59 75.77 3 50.00
21441. Abhishek (abhishekxix) 82 66.58 86.62 21 25.61
21442. William (willkosasih) 10 66.58 71.19 1 10.00
21443. James (peeetah1) 2 66.58 71.61 1 50.00
21444. mitchy2093 (mitchy2093) 1 66.58 66.58 0 0.00
21445. euan (euanvzn) 2 66.58 68.33 0 0.00
21446. James (jjhertz) 283 66.58 98.35 65 22.97
21447. Francesca (fmbuckley) 3 66.58 76.63 1 33.33
21448. Ananta (anantaraha) 538 66.58 86.50 124 23.05
21449. Daniel (kool_beenz) 786 66.57 95.05 158 20.10
21450. Lily ^& (lysbparker) 3 66.57 72.44 3 100.00
21451. elif (eliff) 19 66.57 80.99 7 36.84
21452. Yumzy (lusileven) 7 66.56 75.43 0 0.00
21453. Saran (bssarankumar) 10 66.56 77.50 0 0.00
21454. suchcookies (suchcookies) 3 66.56 68.37 0 0.00
21455. password (passworder) 25 66.56 73.09 4 16.00
21456. Aniket (aniiket) 9 66.55 69.93 3 33.33
21457. Hovari (hovari) 155 66.55 92.22 33 21.29
21458. fast (turteled) 2 66.55 71.29 0 0.00
21459. Mayan (mayan__) 46 66.55 82.19 9 19.57
21460. Wall (csgoscam) 10 66.55 88.01 2 20.00
21461. Nessie (nessie14) 2 66.55 71.30 0 0.00
21462. darren (raisinnbrann) 83 66.53 91.99 17 20.48
21463. Matt (mrwizard487) 6 66.53 68.93 2 33.33
21464. Poop (poopbuttpoop) 45 66.53 81.77 12 26.67
21465. syed (areeb290805) 10 66.53 86.01 4 40.00
21466. maghet (maghet) 6 66.53 72.59 3 50.00
21467. Sean (157644) 6 66.52 72.03 0 0.00
21468. Danny (evolt) 23 66.52 79.73 6 26.09
21469. Sheep (celibustbike) 60 66.52 84.43 19 31.67
21470. Tim (phrozact) 4 66.52 70.23 1 25.00
21471. Hunter (ragingtimebomb) 13 66.51 79.48 2 15.38
21472. Jack (jackthesnacc) 285 66.51 93.97 72 25.26
21473. Krutik (krutikp) 12 66.51 74.50 3 25.00
21474. Lior (liorg225) 11 66.51 77.57 4 36.36
21475. Turuo (turuo) 31 66.51 79.81 7 22.58
21476. mike (1749mike) 9 66.50 84.60 3 33.33
21477. Jeff (rcmaximus) 7 66.50 76.45 1 14.29
21478. Alex (rxndom) 2 66.50 67.32 0 0.00
21479. Jan (jmarrin) 4 66.50 76.78 0 0.00
21480. jon (fishy159) 66 66.50 79.64 16 24.24
21481. hutab (hutab) 33 66.50 81.97 14 42.42
21482. Amit (a_myth) 82 66.50 75.29 15 18.29
21483. Marek (mxrkz) 110 66.50 80.86 27 24.55
21484. Ahmad (vectors_master) 418 66.50 95.59 83 19.86
21485. mohammad (ballisticfpz) 7 66.49 71.37 0 0.00
21486. Masy (masy404) 42 66.49 82.20 36 85.71
21487. Lecailloux (lecailloux) 16 66.49 78.15 5 31.25
21488. 劉韋論 (evan1liu) 166 66.48 83.25 27 16.27
21489. Rachelle (foolishoni) 60 66.48 83.52 8 13.33
21490. QUACK (zooming235) 3 66.48 68.64 0 0.00
21491. Sam (samandthefourdogs) 337 66.48 96.26 73 21.66
21492. sam (samtheguy10) 248 66.48 88.11 50 20.16
21493. Douglas (douglaswaugh) 54 66.47 78.71 11 20.37
21494. wayson (wayson) 3 66.47 69.35 0 0.00
21495. Mahmoud (mahmoudalbadarin) 19 66.47 75.35 5 26.32
21496. マロン (marron) 5 66.47 75.41 1 20.00
21497. Patty (flappypatty420) 21 66.47 89.11 5 23.81
21498. Ali (oorkade) 20 66.47 77.30 11 55.00
21499. Willy (thatboywilly149) 1 66.46 66.46 0 0.00
21500. Harry (superdickson) 1 66.46 66.46 0 0.00
21501. Edwin (skitargduva) 8 66.46 77.75 1 12.50
21502. Chimney (chimneywastaken) 213 66.45 82.42 52 24.41
21503. Scwexxy (imscreecher) 269 66.45 91.74 51 18.96
21504. Thuong (thuongle19) 19 66.45 76.38 4 21.05
21505. dantheman27 (dantheman8529) 25 66.45 82.17 7 28.00
21506. AstroNomix (astronomix) 60 66.45 84.54 15 25.00
21507. Philip (philipyoung) 311 66.45 88.12 69 22.19
21508. meow (dalayalia) 43 66.45 82.85 10 23.26
21509. Keen (commander_keen) 1 66.45 66.45 1 100.00
21510. Sami (britishrifleman) 20 66.45 88.52 1 5.00
21511. undefined (epsylon) 6 66.45 99.50 0 0.00
21512. Jacob (intellectualbrick) 46 66.45 84.42 14 30.43
21513. Jonathan (jyap042) 20 66.44 74.22 4 20.00
21514. Luke (luketorti) 1 66.44 66.44 0 0.00
21515. Gray (grayorgrey) 1 66.44 66.44 0 0.00
21516. RobertDeMilho (robertdm) 1 66.44 66.44 0 0.00
21517. Mohamad (mhsyazani) 127 66.43 88.47 30 23.62
21518. Mandeep (mani7246) 33 66.43 80.56 10 30.30
21519. Zero (theking410) 1 66.43 66.43 0 0.00
21520. Jared (going2prison) 11 66.43 81.00 2 18.18
21521. Justin (j98101237) 37 66.43 85.65 10 27.03
21522. Manguy McPersonface (manguy... 12 66.43 79.78 3 25.00
21523. VitaliK (vitalik_2961) 55 66.42 79.02 12 21.82
21524. Daisy (daisy_sun) 55 66.42 84.75 14 25.45
21525. tstats[ilyadancshp] (ilyada... 12 66.42 72.36 3 25.00
21526. Anjal (deadashell) 172 66.42 85.75 35 20.35
21527. D1ck F1ngers (d_wratten18) 21 66.42 76.23 6 28.57
21528. Jc (jcamp0) 23 66.42 79.00 7 30.43
21529. Greatest (_greatestever_) 26 66.41 79.48 9 34.62
21530. Kacper (czolgista007) 1 66.41 66.41 1 100.00
21531. Tómas Ingi (tomasingi) 104 66.41 80.69 25 24.04
21532. Patt (rymt) 313 66.40 95.56 78 24.92
21533. bloncing (bloncing) 20 66.40 77.28 4 20.00
21534. Nuwan (nuwang69) 7 66.40 78.52 0 0.00
21535. Nick (justintolerable) 7 66.39 71.65 0 0.00
21536. Minwoo (lotuszero) 23 66.39 78.64 3 13.04
21537. Murk (marchell0) 125 66.39 91.85 33 26.40
21538. . (tamagobaka) 2 66.39 73.76 1 50.00
21539. dev (hyprstitious) 6 66.39 78.73 2 33.33
21540. trias (trobles) 3 66.38 74.50 1 33.33
21541. cuddly (cuddly_poetatoe) 6 66.38 72.36 0 0.00
21542. JaydenPrbhd (jayden_prbhd010) 34 66.37 89.82 6 17.65
21543. E (ninjanahtey) 1 66.37 66.37 0 0.00
21544. akari (akari223) 1 66.37 66.37 1 100.00
21545. Mriganka (mriganka) 47 66.37 85.86 8 17.02
21546. Buba Dorj (dbuba99) 2 66.37 68.08 0 0.00
21547. Jonah (cuz_im_batman) 24 66.36 86.85 5 20.83
21548. Entrook (entrook) 1 66.36 66.36 0 0.00
21549. Chelsea (chelseaaaa) 1 66.36 66.36 1 100.00
21550. Josh (belewcookies) 90 66.36 82.95 22 24.44
21551. Sim (simron_) 497 66.36 91.69 118 23.74
21552. ron (ronk17) 21 66.36 73.32 4 19.05
21553. Ruby (_truby) 40 66.36 91.66 9 22.50
21554. krunal (triplekbro) 26 66.36 84.00 14 53.85
21555. Oussama (osmaxwell) 4 66.36 78.34 1 25.00
21556. Giuseppe Bottazzi (051znn) 8 66.35 79.92 1 12.50
21557. small (smalllittlesheep) 327 66.35 87.34 70 21.41
21558. Skyer (skypeasant) 4 66.35 79.14 4 100.00
21559. efthymios (poios_malphite) 25 66.34 77.36 5 20.00
21560. kcor (kcorism17) 6 66.34 70.94 1 16.67
21561. Hamza (hamzayt577) 17 66.34 77.24 1 5.88
21562. Alix (sarahallisa) 11 66.34 73.78 3 27.27
21563. Pete (pete2015) 6 66.34 70.78 0 0.00
21564. jugal kishor (jugal_sahu) 3 66.33 69.83 2 66.67
21565. eagle (e4gle) 384 66.33 84.30 98 25.52
21566. Akshay (mr_dadwal) 1 66.33 66.33 1 100.00
21567. Fred (fredxster) 47 66.33 80.12 4 8.51
21568. KroNox (kronoxver) 6 66.33 80.00 3 50.00
21569. MinetasticAR (minetasticar) 2 66.33 74.67 0 0.00
21570. Oscar (oheim) 4 66.32 71.26 1 25.00
21571. Ameen (ameen_a21) 15 66.31 80.24 2 13.33
21572. Pranav (pranav0307) 4 66.31 68.26 0 0.00
21573. Nguyen (nanoforge) 612 66.29 86.18 128 20.92
21574. Bra Steve (bra_steve) 10 66.29 74.10 3 30.00
21575. Exzede (exzede) 118 66.28 88.97 32 27.12
21576. Vashni (vashek03) 5 66.28 84.15 1 20.00
21577. rideler (rideler) 83 66.28 79.87 19 22.89
21578. Xander (xanderthegreater) 1 66.28 66.28 0 0.00
21579. Bit (bitnerik) 38 66.28 77.37 6 15.79
21580. Pouya (pouyav) 10 66.28 79.53 2 20.00
21581. Harrisandman (harrisandman) 15 66.27 81.69 8 53.33
21582. Guest (alvinaruto) 19 66.27 81.23 7 36.84
21583. Nikolaus (testingcolemak) 14 66.27 78.24 3 21.43
21584. i am Dog (endi_69) 10 66.26 77.61 4 40.00
21585. Mr (mrrius99) 27 66.26 76.42 12 44.44
21586. Ricardo (rambolis) 20 66.25 75.78 2 10.00
21587. Luke (blame_luke) 6 66.25 89.08 2 33.33
21588. kensen (kawatashi) 9 66.25 74.89 1 11.11
21589. potato0329 (potato0329) 8 66.25 70.44 5 62.50
21590. john (maxwelllllllllll) 11 66.25 81.59 4 36.36
21591. Schakrin (wavezzx) 16 66.25 78.39 4 25.00
21592. Omid (zerodarkshadow) 206 66.25 89.98 52 25.24
21593. Tom (totallytom) 3 66.25 67.01 0 0.00
21594. Jacob (klosure) 3 66.25 69.32 0 0.00
21595. Gustavo (yoosteen) 138 66.25 76.67 29 21.01
21596. aindriu (morrisa8) 44 66.24 80.89 8 18.18
21597. Lachlan (cancer88) 16 66.24 83.27 3 18.75
21598. Hannah (_hannahxr) 19 66.24 76.41 5 26.32
21599. yourrrfattt (yourrrfattt) 16 66.24 79.56 6 37.50
21600. lalit (daredevil_5859) 23 66.23 90.40 6 26.09
21601. Jack (ditabyte) 74 66.23 87.38 17 22.97
21602. bokonet (mehrshadk05) 12 66.23 74.85 7 58.33
21603. Rafal (rafaldrath) 2 66.23 72.63 2 100.00
21604. Shivesh Tiwari (yuvanastra) 39 66.22 87.77 13 33.33
21605. Epik Dino (epikdinosaur) 19 66.22 76.67 4 21.05
21606. Maccy (amaccy) 16 66.22 74.11 6 37.50
21607. Alcor (alcorinf) 4 66.22 70.84 0 0.00
21608. Ikhbayar (u_mad_bruh_ikhee) 7 66.22 69.75 1 14.29
21609. Calvin (teddycom1) 13 66.22 73.30 3 23.08
21610. Bat-Ulzii (ulziibox) 13 66.22 79.15 12 92.31
21611. ibizabroker (ibizabroker) 24 66.21 73.69 5 20.83
21612. Sir (dsfee) 124 66.21 82.33 33 26.61
21613. Iranian (iliveiniran) 6 66.21 70.76 2 33.33
21614. luis (lozalui004) 44 66.21 79.33 5 11.36
21615. WAD (_waddup_) 37 66.20 82.54 14 37.84
21616. Melisa (colorsunimaginable) 6 66.20 72.84 3 50.00
21617. Vanja (vanjamc) 3 66.19 70.15 1 33.33
21618. Manav (manavkush) 3 66.19 70.27 1 33.33
21619. Dhruv (dhruvarora) 198 66.18 85.87 45 22.73
21620. Giovanni (qwertyg01) 10 66.18 75.37 3 30.00
21621. Alessio (rqidz) 4 66.17 77.84 4 100.00
21622. besher (besher) 2 66.17 68.21 0 0.00
21623. 69wpm (a04a04283) 1 66.17 66.17 0 0.00
21624. Roy (harlos9090) 8 66.17 72.42 2 25.00
21625. Marlon (mgr47) 448 66.17 88.02 105 23.44
21626. Neel (jydoenwat) 371 66.17 88.00 76 20.49
21627. alaa (salaa) 62 66.16 75.03 9 14.52
21628. Jose (jgeer) 32 66.16 75.42 6 18.75
21629. ziolson (ziolo1) 7 66.16 81.41 2 28.57
21630. namdo (huynhnamdo96) 30 66.16 74.23 4 13.33
21631. Oily (oilyoogway) 4 66.16 68.99 0 0.00
21632. venki (venki15) 128 66.16 82.92 60 46.88
21633. Andres (dandidandi) 4 66.15 70.70 1 25.00
21634. aj (pinoy_cebu7) 2 66.15 67.91 0 0.00
21635. carl (captain_deadpooooool) 59 66.15 78.04 14 23.73
21636. Onny (onny_gwozed) 5 66.15 77.62 1 20.00
21637. Ethan (clobbster) 4 66.15 71.36 1 25.00
21638. Manik2375 (manik2375) 320 66.15 94.18 89 27.81
21639. James (fintero) 42 66.15 83.16 12 28.57
21640. Tuomo (ystavani_marko) 49 66.14 79.55 11 22.45
21641. Armaan_Gill (armaan_gill) 22 66.14 77.47 4 18.18
21642. Peter (vajco) 8 66.13 71.40 1 12.50
21643. AJ (a__j) 1 66.13 66.13 0 0.00
21644. Maddie (mdjjones) 5 66.12 68.86 0 0.00
21645. Boikom (boikom) 6 66.12 70.60 0 0.00
21646. Denish (denishkayastha) 1 66.12 66.12 1 100.00
21647. Abdelrahman (abdelrhaman_sh... 167 66.12 84.12 46 27.54
21648. heawwi (heawwi) 5 66.11 71.93 2 40.00
21649. Choong Hyun (chlee) 175 66.11 91.89 44 25.14
21650. notoverhere (notoverhere) 56 66.11 85.42 12 21.43
21651. Y (firewatermelon) 6 66.11 78.10 0 0.00
21652. 69 (i_am_better_than_u_lol) 37 66.11 85.48 27 72.97
21653. Viktor (c0re_dump) 59 66.11 84.70 14 23.73
21654. elp (slothisasin) 2 66.11 67.52 0 0.00
21655. Addiv (kuge) 2 66.10 67.25 1 50.00
21656. Florin (montecolumns) 1 66.10 66.10 0 0.00
21657. Weng (calmturtle) 1 66.10 66.10 1 100.00
21658. Travis (azgoalie) 57 66.10 88.17 13 22.81
21659. Umid (umid2000) 22 66.10 77.89 4 18.18
21660. Eric (llmangoll) 32 66.10 82.09 17 53.13
21661. lucas (moisturisingcream) 29 66.09 77.83 7 24.14
21662. guitrstrngscr (_resh_) 11 66.09 80.60 2 18.18
21663. Evan (etiger) 8 66.09 77.21 0 0.00
21664. Vallabh (micronic) 1 66.09 66.09 0 0.00
21665. cheems (pachaczb_dvorak) 53 66.09 78.30 11 20.75
21666. SB (sbjeans) 86 66.09 78.51 24 27.91
21667. David (davgoeck) 7 66.08 73.70 3 42.86
21668. saar (flappy_dude) 11 66.08 79.26 1 9.09
21669. nick (koot) 16 66.08 82.26 4 25.00
21670. Jakub (sayunoka) 4 66.07 72.25 1 25.00
21671. Iftekharul (_sayeed) 9 66.07 88.91 2 22.22
21672. Shakil Kabir (kopbdshakil) 88 66.07 81.52 23 26.14
21673. Alan (alan2406) 422 66.06 92.54 84 19.91
21674. Tristan (trigg770) 4 66.06 74.14 1 25.00
21675. WaFik (wafik) 13 66.06 78.01 3 23.08
21676. Paul (qdozaq) 5 66.06 72.97 1 20.00
21677. Harshit (awpsun) 46 66.06 83.01 11 23.91
21678. Owen (scriptyvevo) 2 66.06 70.19 0 0.00
21679. mrob2304 (mrob2304) 1 66.05 66.05 0 0.00
21680. Ralph (ralph7c2) 6 66.05 75.74 0 0.00
21681. Benjamin (be_jamin) 2 66.05 69.07 1 50.00
21682. Uways (uways) 38 66.04 86.43 7 18.42
21683. Regan (schwett) 4 66.04 69.18 1 25.00
21684. None of (perpetuity_0) 4 66.04 73.19 1 25.00
21685. dev (devgiri0082) 29 66.03 76.84 0 0.00
21686. Cristi (alecucristi) 6 66.03 72.58 0 0.00
21687. Ashish (iamprogrammar) 19 66.03 73.90 5 26.32
21688. Pawan (kpawans00533) 41 66.03 78.43 5 12.20
21689. Terry (eleftheriosonic) 113 66.03 86.58 29 25.66
21690. João Pedro (jaydaltro) 1 66.03 66.03 0 0.00
21691. Vijay (vijays4404) 188 66.03 94.65 45 23.94
21692. Leslie (mamaleslie81) 22 66.02 82.40 4 18.18
21693. Marvin (mrvn) 1 66.02 66.02 0 0.00
21694. KindledCroissant (kindledcr... 1 66.02 66.02 1 100.00
21695. Steffen (fellroy) 1 66.02 66.02 0 0.00
21696. Moellie (moelong1) 90 66.02 87.05 20 22.22
21697. Sophia (sophianotfound) 49 66.02 93.43 8 16.33
21698. Temos (captainteemo) 1 66.01 66.01 0 0.00
21699. Hoang (sanh01) 3 66.01 70.94 1 33.33
21700. Eboy (e_nonymous) 68 66.01 84.79 15 22.06
21701. Ji (rk42745417) 18 66.00 77.48 1 5.56
21702. cheryl (cherylkaiser) 17 66.00 72.71 4 23.53
21703. Iason (thebabo) 13 66.00 76.03 7 53.85
21704. Aleksa (aleksa55) 22 66.00 82.61 4 18.18
21705. Gayathri (gayathri_prabhu) 110 65.99 83.77 27 24.55
21706. Cormac (cormacdaman57) 1 65.99 65.99 1 100.00
21707. David (davidthegreat) 54 65.99 86.81 16 29.63
21708. Ren (reniyuh) 6 65.99 72.83 2 33.33
21709. A (dasupakiwi) 54 65.99 83.81 13 24.07
21710. 樊 (krinzkolo) 114 65.99 82.97 24 21.05
21711. Nirav Jain (jainnirav88) 7 65.98 70.70 2 28.57
21712. Rylez (rylezyt) 21 65.98 78.13 7 33.33
21713. Yambo (yamboyam) 1 65.98 65.98 0 0.00
21714. Fizh (fizh29) 1 65.98 65.98 0 0.00
21715. Brandon (bkavanaugh6) 6 65.98 75.66 1 16.67
21716. caden (breezynotcheezy) 29 65.98 92.27 11 37.93
21717. Michael (dunsterville) 4 65.97 77.67 0 0.00
21718. cody (astro8192) 9 65.97 69.41 3 33.33
21719. Mintful (worst_typist11) 13 65.97 74.52 2 15.38
21720. meena (ifeellikeshemarmoore) 5 65.97 77.10 1 20.00
21721. Kuaz (qaz855175b) 25 65.96 78.22 6 24.00
21722. Mark (mamochiro) 98 65.96 81.44 21 21.43
21723. Vinoth (vinoth46) 1 65.96 65.96 1 100.00
21724. Pavel (sonaru) 13 65.96 72.84 7 53.85
21725. pun (punoar) 10 65.96 76.07 1 10.00
21726. Tappy_333 (pat29403) 9 65.96 73.36 2 22.22
21727. Pakko (iam_mzaa) 55 65.96 82.37 14 25.45
21728. Gary (ggaarryy12340) 13 65.96 76.03 3 23.08
21729. gerleva (_mr_e_) 29 65.95 74.99 5 17.24
21730. Muhammad Hassaan Wajid (has... 3 65.95 68.13 0 0.00
21731. LotHtoJ (laessig) 1 65.95 65.95 0 0.00
21732. Hansel (hansels) 9 65.95 73.11 2 22.22
21733. Ayyoob M (ub114) 1 65.95 65.95 0 0.00
21734. Joy (_joy_) 47 65.94 80.34 8 17.02
21735. lyrehcsings (cherylsings) 6 65.94 75.45 2 33.33
21736. Tomas (wtfxdc) 6 65.94 72.80 1 16.67
21737. robin (robin1919) 1 65.94 65.94 1 100.00
21738. René (rene12vamrak) 1 65.94 65.94 0 0.00
21739. Aidan (aidan0829) 4 65.94 70.76 3 75.00
21740. Tendinits (tendinits) 78 65.94 93.38 27 34.62
21741. Tahsin (tahsin82) 4 65.93 74.28 2 50.00
21742. Klice (klice) 2 65.93 77.07 0 0.00
21743. emily (emmyentropy) 3 65.93 77.08 0 0.00
21744. Asdfg (inosol) 2 65.93 68.07 0 0.00
21745. Kercy (phoenixgod213) 7 65.92 75.33 5 71.43
21746. Stone (kimpors) 103 65.92 82.07 25 24.27
21747. Roi (rugh) 9 65.92 72.25 2 22.22
21748. parto (partoptr) 3 65.91 67.55 1 33.33
21749. Kieran (godquack) 41 65.91 76.75 10 24.39
21750. Hidispenser (hidispenser) 2 65.91 78.06 0 0.00
21751. 𝐃𝐫𝐞𝐰 (andreanfi... 9 65.91 78.16 3 33.33
21752. mj (dunnobru) 2 65.90 72.98 0 0.00
21753. Dawka (dawka0499) 2 65.90 74.40 0 0.00
21754. Rami (ramb_) 1 65.90 65.90 0 0.00
21755. Noah (typer_noah) 67 65.90 81.61 13 19.40
21756. Aarsh (revolt1ng) 37 65.90 77.70 8 21.62
21757. Ultrabars- (ultrabars) 7 65.90 94.79 0 0.00
21758. Alicia Peas (bundt) 20 65.90 77.87 5 25.00
21759. Jacob (lugia1572) 8 65.90 72.20 1 12.50
21760. sachin (sachin986) 301 65.89 88.38 66 21.93
21761. Kirby (kirbyjs) 55 65.89 84.06 12 21.82
21762. Sergej (segi) 30 65.89 88.13 2 6.67
21763. Jacob (labotski) 31 65.89 79.97 5 16.13
21764. azef (azef) 7 65.89 70.09 3 42.86
21765. Ujjwal (ujjwal3756) 1 65.88 65.88 0 0.00
21766. fergisson (fergiss) 19 65.88 76.47 6 31.58
21767. Brandon (dreonic) 142 65.88 81.96 28 19.72
21768. Mr Plow (el_putino_1917) 66 65.87 84.86 16 24.24
21769. Mik (kimses12) 3 65.87 70.41 0 0.00
21770. _Nasta_ (anas_hamrouni) 14 65.87 80.54 7 50.00
21771. Reyan (reyanman) 5 65.87 70.48 2 40.00
21772. Ryan (theryanshan) 11 65.87 72.83 1 9.09
21773. You (you3345) 4 65.86 67.56 0 0.00
21774. Dog (tropicaldog17) 44 65.86 86.50 9 20.45
21775. RadAlienware (rad_alienware) 30 65.86 79.53 6 20.00
21776. Dennis (bejdenn) 12 65.86 78.17 3 25.00
21777. mikey (grenadejumper) 14 65.86 84.01 3 21.43
21778. P1qo (p1qo) 6 65.86 76.88 2 33.33
21779. Ferresmash (ferdinandohrn) 11 65.85 81.88 5 45.45
21780. Sulthan Cendikia (sulthance... 144 65.85 86.19 39 27.08
21781. Joel (lil_wheeelz) 15 65.85 78.92 15 100.00
21782. Paul (m4trixtr) 1 65.85 65.85 0 0.00
21783. Joshua (twinklestarchild) 40 65.85 82.61 13 32.50
21784. Dawid (ilordawid) 76 65.85 83.70 13 17.11
21785. Choon (mr_krab) 2 65.84 69.98 0 0.00
21786. Amit (red2black) 27 65.84 78.92 8 29.63
21787. John (helion_) 7 65.84 69.52 2 28.57
21788. spoon (thrownspoon) 39 65.82 83.09 6 15.38
21789. Mr (mrghost_yes) 9 65.82 71.83 3 33.33
21790. sara (hungrypotato) 2 65.82 69.85 0 0.00
21791. Abhishek (abazaz722) 1 65.82 65.82 1 100.00
21792. Kristin (krisis7) 13 65.81 73.89 2 15.38
21793. AsiaSeries (adeepra) 72 65.81 75.63 19 26.39
21794. a____________s (anavadya_13) 1 65.81 65.81 1 100.00
21795. Go6ko (go6koiba4a69xx) 1 65.81 65.81 0 0.00
21796. Bart (bartok) 37 65.81 84.14 14 37.84
21797. Funeral Party (scudvirus2018) 380 65.81 83.94 76 20.00
21798. Esketitutu (esketitutu) 14 65.80 81.17 8 57.14
21799. Pasta (pastayes) 1 65.80 65.80 1 100.00
21800. Tyler (ty11_24) 2 65.80 66.47 1 50.00
21801. Raghupati (double_toned) 23 65.79 76.35 8 34.78
21802. gaitonde (gaitonde) 428 65.79 88.42 93 21.73
21803. Vu (kroken_keyboard) 577 65.79 90.61 127 22.01
21804. Jorgle (jmgcito) 17 65.78 83.65 5 29.41
21805. Daniel (unreal_beam) 8 65.78 72.61 1 12.50
21806. Abhishek (abhikumar98) 32 65.78 76.72 7 21.88
21807. Kirito (laksh_4uh) 16 65.78 85.19 1 6.25
21808. Aj (drome) 16 65.78 74.61 3 18.75
21809. Machmori (explainingkamui) 67 65.78 80.63 16 23.88
21810. Billy (hines5791) 4 65.78 73.65 2 50.00
21811. usu (usufails) 7 65.77 75.78 1 14.29
21812. Cameron (goldenpenguin) 15 65.77 77.11 3 20.00
21813. adder (sabienadderley03) 6 65.77 80.46 0 0.00
21814. Tom (tom1110) 34 65.77 90.73 8 23.53
21815. Batbold (burabatbolf) 87 65.77 85.29 26 29.89
21816. end (end_pro) 39 65.76 82.72 7 17.95
21817. Wasim (ahsaanfd1) 5 65.76 80.84 0 0.00
21818. Hxrry (hxrry) 11 65.76 93.48 4 36.36
21819. uecchi (gagputa) 4 65.76 70.16 2 50.00
21820. abv (yexela) 6 65.76 76.76 1 16.67
21821. Ethan (waterman111) 3 65.75 68.87 3 100.00
21822. Mo3az (moaazsolomon) 6 65.74 76.96 0 0.00
21823. cocoju (cocoju) 107 65.74 82.06 18 16.82
21824. XA25 (xa25) 3 65.74 72.83 1 33.33
21825. A (thekingwindsor) 3 65.74 71.48 0 0.00
21826. mikaanz (mikaanz) 5 65.74 73.13 2 40.00
21827. RayDaren (raydaren) 2 65.73 75.19 0 0.00
21828. Matthijs (matthijsb) 26 65.73 80.99 5 19.23
21829. Henry (henrytidholm) 10 65.72 72.10 5 50.00
21830. ajit (ajit9999) 293 65.72 88.62 85 29.01
21831. Valeria (valeriacervel) 34 65.72 79.41 6 17.65
21832. jahed (jahedk) 3 65.72 76.81 0 0.00
21833. Chayton (omenop) 24 65.71 78.74 18 75.00
21834. Phobic (phobic21) 12 65.71 81.82 7 58.33
21835. Carson (carson_a_r) 12 65.70 74.98 7 58.33
21836. Martín (albugineo) 3 65.70 77.88 1 33.33
21837. Dan (danclevia) 23 65.70 70.93 4 17.39
21838. David (subpar_typing) 4 65.70 70.84 2 50.00
21839. Jose (sand62) 9 65.70 78.27 3 33.33
21840. Kakini007 (kakini) 197 65.70 96.34 34 17.26
21841. OULAHBIB (suicv) 145 65.69 82.91 30 20.69
21842. Jello (foolishfacade) 1 65.69 65.69 0 0.00
21843. Relletro (relletro) 10 65.69 77.66 3 30.00
21844. VJ (pinexpp1edeath) 4 65.69 73.12 0 0.00
21845. Patrick (pjtimmon) 7 65.69 72.08 2 28.57
21846. iamyellowhead (iamyellowhead) 15 65.68 81.44 8 53.33
21847. Vin (badboi14) 5 65.68 72.57 2 40.00
21848. Shoaib😂🔫 (zvje2da) 3 65.68 70.88 1 33.33
21849. Nun (lackingnight) 25 65.68 83.90 3 12.00
21850. Radek (raddzio) 275 65.68 87.49 62 22.55
21851. tobias (atomstodin) 16 65.68 82.78 5 31.25
21852. Rawest_Dawg (raw_dawg) 110 65.67 84.57 24 21.82
21853. Arata (aratatakeda) 46 65.67 84.28 5 10.87
21854. Sam (samsmoke) 132 65.66 80.27 28 21.21
21855. Zane (za_schu) 15 65.66 81.82 3 20.00
21856. Tran Thai Anh (anh_tran123) 27 65.66 73.83 5 18.52
21857. Marijuana (marijuanah) 3 65.66 71.44 0 0.00
21858. angry (angryfingers) 30 65.65 76.93 8 26.67
21859. William (keneth10) 9 65.65 79.01 1 11.11
21860. Ahmad (eqbalshekib) 19 65.64 81.49 7 36.84
21861. Napat (omakaze) 36 65.64 80.86 7 19.44
21862. Dominik (envirel) 2 65.64 67.78 1 50.00
21863. dugnutt (dugnutt) 24 65.63 77.38 6 25.00
21864. MikiX (polish_wonderboy) 1 65.63 65.63 0 0.00
21865. Abhishek (coderguy1) 50 65.63 76.68 7 14.00
21866. Carter (cartermanator) 35 65.63 82.45 5 14.29
21867. Kaoru (engineerlink) 23 65.63 79.01 5 21.74
21868. Ethan (wolfiedude14) 36 65.62 83.28 30 83.33
21869. Viktor (vixtorr) 9 65.62 76.38 6 66.67
21870. Drew (vegan_freedom_fighter) 151 65.62 85.30 30 19.87
21871. Loopy (loopy_oopy) 105 65.62 81.35 24 22.86
21872. Nikolino (nikolinolive) 70 65.62 84.29 40 57.14
21873. Aibar (aiburito) 5 65.61 74.59 1 20.00
21874. om (om0305) 18 65.61 76.69 5 27.78
21875. Vinayak (vinayak_7989) 66 65.61 87.99 21 31.82
21876. Connecting... (toodey) 163 65.61 84.33 36 22.09
21877. Francisca (borg58hd) 9 65.61 76.23 3 33.33
21878. Adam (koltaia30) 22 65.61 79.72 8 36.36
21879. Owen (qwert8143) 6 65.60 75.50 4 66.67
21880. ben (bendoverr05) 21 65.60 84.34 3 14.29
21881. pagep (pagep) 1 65.60 65.60 0 0.00
21882. Nitowl12_ (nitowl12) 6 65.60 73.65 2 33.33
21883. xil (xilvantheous) 4 65.60 67.48 0 0.00
21884. Richard (jjjxxx) 79 65.59 80.38 16 20.25
21885. Jorden (nostera) 8 65.59 71.12 1 12.50
21886. Shokhrukh (shokhrukh18) 84 65.59 76.66 32 38.10
21887. Michael (yt_m1gamer2020) 7 65.59 71.76 3 42.86
21888. Diar322 (diar322) 1 65.59 65.59 0 0.00
21889. Gazeekoo (gazeekoo) 54 65.59 78.26 12 22.22
21890. Erick (ep1ore) 83 65.59 80.51 20 24.10
21891. Shubhi (shoebee) 14 65.59 79.00 6 42.86
21892. Echo (echoet) 9 65.59 81.47 4 44.44
21893. Jay (dicknm) 667 65.58 87.64 143 21.44
21894. Stitch (lostowo) 124 65.58 91.29 48 38.71
21895. Ru (xeruu) 1 65.58 65.58 0 0.00
21896. BLLA (bellaperez) 178 65.58 85.48 44 24.72
21897. SeeJay (seejay_ferraro) 18 65.57 71.64 4 22.22
21898. Noah (noahcheeseman) 3 65.57 70.62 1 33.33
21899. daksh (daksh_2106) 683 65.57 85.69 148 21.67
21900. Hamza (lasthamzastanding) 7 65.56 70.42 2 28.57
21901. Murat (nocs782) 230 65.56 85.93 49 21.30
21902. DanGaL2017 (dangal2017) 35 65.56 77.19 10 28.57
21903. Sushruth (punkin04) 2 65.55 69.75 1 50.00
21904. Redwan (redwan_360) 62 65.55 82.39 15 24.19
21905. Mads (mads721i) 2 65.55 70.47 0 0.00
21906. Denis (newdenispro) 61 65.54 84.82 14 22.95
21907. Ksawery (xenzy) 1 65.54 65.54 0 0.00
21908. Tsunami (bmo12) 76 65.53 80.85 23 30.26
21909. Grant (gboi881) 125 65.53 80.93 28 22.40
21910. McScoops (mcscoops) 3 65.53 69.32 3 100.00
21911. Presiyan (presiyan15) 81 65.53 81.78 13 16.05
21912. Edmund (emmit3) 214 65.53 90.91 46 21.50
21913. Miko (mikofinland) 13 65.53 74.90 3 23.08
21914. Aviral (programmer_typist) 34 65.52 85.78 7 20.59
21915. Mohamed (mohamedessam_52) 1 65.52 65.52 0 0.00
21916. Treffig (treffig) 5 65.52 70.74 2 40.00
21917. N0VA (nooova) 27 65.52 81.62 7 25.93
21918. Timmy (547k4) 4 65.52 77.25 1 25.00
21919. Tan (tang_) 19 65.52 77.88 7 36.84
21920. 10SlowFingers (aabhas) 44 65.51 84.16 6 13.64
21921. Pinny (p1nny_) 11 65.51 73.05 8 72.73
21922. rishh_ (imrishitpant) 606 65.51 113.82 148 24.42
21923. querty (thisiscamelcase) 16 65.51 79.53 2 12.50
21924. שפיצער (spitzer722) 32 65.51 85.56 7 21.88
21925. SpeedySloth (speedyslothmeh) 4 65.50 74.05 2 50.00
21926. Justin (justinparra18) 1 65.50 65.50 0 0.00
21927. gameing (gameing_) 35 65.50 79.51 8 22.86
21928. Danyal (danazeem) 7 65.50 76.85 5 71.43
21929. Jasnam (jazzygoesomnom) 305 65.50 89.79 68 22.30
21930. Hussam (samwa7sh800) 118 65.50 80.64 29 24.58
21931. Poyraz (xaryop) 4 65.50 66.77 0 0.00
21932. Marvin (marbinelyo) 10 65.49 74.64 3 30.00
21933. Erim (erimmos) 11 65.49 72.94 6 54.55
21934. Ciarbin (ciarbin) 4 65.49 72.05 0 0.00
21935. Jaroslav (baegus) 2 65.49 65.93 0 0.00
21936. J (xiji) 5 65.48 72.74 0 0.00
21937. Urolbek (faithful_1707) 41 65.48 77.01 8 19.51
21938. Arun (alpha_mo) 1 65.48 65.48 1 100.00
21939. Edwin (keyhem_) 15 65.48 75.19 4 26.67
21940. Just (ottovon) 26 65.47 85.37 4 15.38
21941. Typeracerer (typeracerer2020) 1,120 65.47 84.73 242 21.61
21942. SAM (clencod) 17 65.47 84.76 3 17.65
21943. Dias (vdios) 7 65.47 70.89 3 42.86
21944. xhulio (lighting11) 19 65.47 79.97 5 26.32
21945. Abed (abed42) 121 65.46 98.65 30 24.79
21946. Mohammed (guitarist999) 175 65.45 89.34 44 25.14
21947. sab (sabpap) 110 65.45 83.24 25 22.73
21948. . (i_am_a_tryhard) 5 65.45 69.19 3 60.00
21949. Guido (ssawuschka) 1 65.45 65.45 0 0.00
21950. Minh (mjnhpzo) 2 65.45 66.53 0 0.00
21951. Mino (minoaslowtyper) 2 65.45 68.09 1 50.00
21952. Elvira (5oap) 4 65.45 71.87 1 25.00
21953. Yasif (yasif345) 8 65.45 71.95 1 12.50
21954. heh (itno) 253 65.44 85.02 66 26.09
21955. asphyxia (wylx) 51 65.44 93.04 12 23.53
21956. masterassassin3 (masterassa... 145 65.44 79.45 27 18.62
21957. TheEwaffle (theewaffle) 3 65.44 66.99 0 0.00
21958. Pushkar (azuloto) 49 65.44 77.81 9 18.37
21959. nizar (konizar) 6 65.44 73.10 0 0.00
21960. Shome (shmoe9806) 22 65.43 73.86 5 22.73
21961. Kaiden (ksetay) 24 65.43 84.12 5 20.83
21962. Rabber (polrabber) 62 65.43 85.79 15 24.19
21963. Jørgen (jorgen1999) 170 65.43 93.01 33 19.41
21964. Jasper (jasperclemente) 1 65.43 65.43 0 0.00
21965. Drake (dark_wing) 4 65.43 77.75 2 50.00
21966. alax (urlonglostdog) 16 65.43 74.34 2 12.50
21967. Aaron (ajmoore0351) 25 65.43 79.31 5 20.00
21968. Jesse (soval) 69 65.43 87.63 8 11.59
21969. Abdzag (abdzag) 287 65.42 91.30 70 24.39
21970. tobiah (darktilrisen) 1 65.42 65.42 0 0.00
21971. engager (engager) 32 65.41 73.88 2 6.25
21972. Adrian (thebossboi1324) 148 65.41 98.95 46 31.08
21973. Kevin (kevin_moses) 2 65.41 67.27 1 50.00
21974. Gábor (kecske116) 7 65.41 75.69 0 0.00
21975. Mike (daemonevox) 3 65.41 70.21 1 33.33
21976. 7kay3lee7 (kayleelynette) 4 65.41 68.69 1 25.00
21977. Ryan (roadrash09) 2 65.40 107.69 1 50.00
21978. Ed (ed2005) 8 65.40 74.19 2 25.00
21979. St (amirey) 55 65.40 84.57 14 25.45
21980. LenY (lenyx24) 3 65.40 83.09 0 0.00
21981. somrand (somrand) 2 65.40 69.97 1 50.00
21982. user1458 (user1458) 16 65.39 70.68 4 25.00
21983. DanCanDoIt (dancandoit27) 4 65.39 72.56 4 100.00
21984. Chris (thesazh) 2 65.39 72.35 1 50.00
21985. Aaron (auztistic) 3 65.38 70.31 1 33.33
21986. Xeo (astroloser) 4 65.38 72.11 1 25.00
21987. Steven (txp2037) 9 65.38 78.27 3 33.33
21988. Seilacara (eunaosei) 75 65.38 80.23 19 25.33
21989. Chinmay (chinmay26) 57 65.37 78.72 12 21.05
21990. Jonathan (jonathankeyboard) 5 65.37 76.57 0 0.00
21991. Omar (samura1) 292 65.37 92.38 69 23.63
21992. Karsmatic (karsmatic) 4 65.37 73.15 2 50.00
21993. Luke (stuartlittle6) 4 65.36 71.70 1 25.00
21994. Mo (moahmed0987) 8 65.36 77.42 8 100.00
21995. Georg (gmpfeifer) 5 65.35 73.67 0 0.00
21996. Dominik (domynig) 8 65.35 79.25 3 37.50
21997. Joe (niconiconicasio) 3 65.34 71.84 0 0.00
21998. kenneth (kenneth29) 29 65.34 77.45 3 10.34
21999. Brenden (embracesc2) 812 65.34 96.19 186 22.91
22000. Max (maxim_brown) 46 65.34 81.60 8 17.39
22001. muthukumar (muthukumarp) 1 65.33 65.33 0 0.00
22002. Micheal (gtukario) 4 65.33 72.63 0 0.00
22003. wcbyte (wileyc19) 1 65.33 65.33 0 0.00
22004. Nick (soltymong) 81 65.33 87.18 21 25.93
22005. e (freshcabbage) 16 65.33 80.76 5 31.25
22006. Jyotirmay (goldenguts) 148 65.32 83.62 36 24.32
22007. Sumit (sysoutme) 19 65.32 71.25 3 15.79
22008. nat2980 (nat2980) 9 65.32 76.01 1 11.11
22009. Maxi (maxi25) 33 65.32 79.69 7 21.21
22010. ginger (gingercat) 2 65.32 73.40 0 0.00
22011. Marko (markosc523) 5 65.32 75.31 2 40.00
22012. cozy (cozy_c) 10 65.32 85.84 6 60.00
22013. Californium (californium) 10 65.32 75.11 2 20.00
22014. Appalling Camel (appalling_... 3 65.31 68.24 0 0.00
22015. It's me! (tuppence) 29 65.31 84.15 7 24.14
22016. Bangerzz (bangerzz) 20 65.31 86.98 2 10.00
22017. rotscatpill (orangetinman) 22 65.31 74.83 7 31.82
22018. Made Dandy (mathzie) 9 65.31 77.06 3 33.33
22019. tbj77 (tbj77) 1,270 65.30 86.93 317 24.96
22020. abdulkhakim (ihkim) 16 65.30 80.25 3 18.75
22021. Sibert (sibert) 3 65.30 66.81 2 66.67
22022. jobe (jojojobebebe) 6 65.30 74.13 2 33.33
22023. Owen (furyng) 9 65.30 71.37 9 100.00
22024. Fox (obviouslyweeb) 3 65.30 69.14 0 0.00
22025. tarun (ronythakur) 3 65.29 73.55 1 33.33
22026. Rj (generalrj) 2 65.29 65.67 0 0.00
22027. Bettydaweirdo (bettydaweirdo) 2 65.29 72.56 0 0.00
22028. Vrum (vrumvrum56) 9 65.28 73.57 0 0.00
22029. Alan (typing_alan) 19 65.28 76.68 5 26.32
22030. Jetless (jetless27) 34 65.28 84.05 7 20.59
22031. Vanisse (cyphen) 5 65.27 69.70 4 80.00
22032. Deadlocz (deadlocz) 6 65.27 77.91 1 16.67
22033. Blake (hanlentt) 121 65.27 95.25 26 21.49
22034. smowat (smowat) 16 65.26 78.31 2 12.50
22035. Ivan (ivan_h) 3 65.26 67.93 0 0.00
22036. Sapnil (sapnil9) 1 65.26 65.26 0 0.00
22037. Naresh (naresh12) 96 65.26 77.79 24 25.00
22038. Zurchonic (zurchonic) 2 65.26 67.40 0 0.00
22039. Crystal (crystallyn84) 2 65.26 70.34 0 0.00
22040. Sonase (sonase19) 40 65.25 82.62 10 25.00
22041. Gui (apollovx) 17 65.25 81.25 3 17.65
22042. Daniel (shifu254) 3 65.25 70.45 0 0.00
22043. Nathan (wilson_w_wilson) 4 65.24 73.26 2 50.00
22044. Abdul Hannan (detective_ahg) 190 65.24 85.22 36 18.95
22045. cmp (justinpark3046) 4 65.23 82.99 0 0.00
22046. Abderrahim (aaissa) 80 65.23 88.06 16 20.00
22047. Ketan (ketan1314) 66 65.22 82.35 26 39.39
22048. Kevin (kevinrodas) 1 65.22 65.22 0 0.00
22049. Mohammad (mdunicorn) 2 65.22 67.04 0 0.00
22050. undeadclicker (undeadclicker) 5 65.22 71.87 0 0.00
22051. Markus (ark_sum) 108 65.22 80.27 22 20.37
22052. woejang (woejang) 3 65.22 67.64 1 33.33
22053. Blade0307 (blade0307) 83 65.21 78.14 14 16.87
22054. marco (xqz_u) 31 65.21 74.50 9 29.03
22055. Fake (fake_hooman) 1 65.21 65.21 1 100.00
22056. Javokhir (developer_007) 5 65.21 73.90 2 40.00
22057. superfish (aprettysuperfish) 4 65.21 79.90 1 25.00
22058. Zyad (zyad0magdy) 68 65.20 84.21 15 22.06
22059. Koneko (moon_l1ght) 8 65.20 73.77 2 25.00
22060. fynn (metallicbow) 8 65.20 73.53 2 25.00
22061. Ali (salloum) 3 65.20 68.93 1 33.33
22062. Gianni (lxarduinixl) 6 65.20 72.44 0 0.00
22063. s'gettifingers (spaghetti_f... 340 65.19 82.46 83 24.41
22064. Mark (pap1) 416 65.19 88.03 103 24.76
22065. Erdenebat (speed8019) 1,091 65.19 93.55 259 23.74
22066. yata (yatapvd) 1 65.19 65.19 0 0.00
22067. Desmond (night9sky) 16 65.19 76.91 4 25.00
22068. zoo (zoo868e) 100 65.19 77.56 25 25.00
22069. Logan (sircrazy) 5 65.19 74.17 1 20.00
22070. Gozie (gozie_) 2 65.19 72.44 1 50.00
22071. limeslime (limeslime_) 1 65.18 65.18 1 100.00
22072. Wieds (wieds) 66 65.17 80.83 16 24.24
22073. Ryan (rloftus) 17 65.17 70.70 2 11.76
22074. jordan (7jrdn) 8 65.17 73.99 3 37.50
22075. Ron (4ronse) 2 65.17 68.19 1 50.00
22076. Alvin (alvinarsyh) 6 65.16 67.92 1 16.67
22077. April (apping) 105 65.16 80.75 27 25.71
22078. Not Fast (ernmanke) 11 65.16 71.85 4 36.36
22079. Abuela (abuela) 8 65.15 74.33 1 12.50
22080. Nate (scourse) 9 65.15 78.22 0 0.00
22081. Teodor (teo_climber) 27 65.14 77.28 5 18.52
22082. kalxoz (kalxoz97) 49 65.14 76.15 11 22.45
22083. Monish (monish2c) 4 65.14 69.19 1 25.00
22084. Rebekah (rebekahtomski) 21 65.13 74.34 4 19.05
22085. Jonathan (mrschubidu) 88 65.13 87.20 24 27.27
22086. Ujjwal (megamindx) 125 65.13 96.09 24 19.20
22087. isham (isham) 5 65.12 71.82 1 20.00
22088. Fake Tree (faketree) 4 65.12 71.36 1 25.00
22089. camelCase (saisrikantta2) 688 65.12 85.31 137 19.91
22090. Viki (vikiperle08) 58 65.11 88.92 15 25.86
22091. Me (thecanuck) 4 65.11 72.30 2 50.00
22092. Mysterious (mysteriousacadia) 4 65.11 75.33 0 0.00
22093. Mahay (mahay316) 177 65.11 78.97 40 22.60
22094. Mudathir (mudathir) 6 65.11 74.38 2 33.33
22095. MIke (3nd4u) 43 65.10 86.03 16 37.21
22096. Fedrick (freddybofte) 13 65.10 83.39 0 0.00
22097. M (razorneck) 7 65.10 73.64 2 28.57
22098. Rogerboss (rogerboss) 1 65.09 65.09 0 0.00
22099. Meysam (meysam1231) 14 65.09 77.31 3 21.43
22100. Whitecap (whitecap) 40 65.08 79.41 7 17.50
22101. WhysoSussy? (yasqueen) 6 65.08 72.99 4 66.67
22102. ok (banadagril) 4 65.08 73.27 0 0.00
22103. vatsu (nify) 508 65.08 104.74 104 20.47
22104. Gian Carlo (squishygian) 5 65.07 72.68 0 0.00
22105. Teddie (teddie37) 26 65.07 76.47 7 26.92
22106. Juver (escoltajuverf) 6 65.07 77.15 1 16.67
22107. Bearrick (bearrick) 1 65.07 65.07 0 0.00
22108. eileen (crazyteal1) 6 65.07 73.65 1 16.67
22109. Eren Yeager (itzadit) 9 65.06 73.43 1 11.11
22110. Justin (keyboard_experience) 2 65.06 69.69 0 0.00
22111. nart (nartyaltchin) 75 65.06 81.93 17 22.67
22112. Stephen (s_dog2001) 152 65.06 92.50 44 28.95
22113. Daniel (aussiegrillgamr) 8 65.06 71.39 2 25.00
22114. Lidia (pinguinthecity) 7 65.06 117.56 6 85.71
22115. Landon (amtreeboi) 2 65.05 66.30 0 0.00
22116. Toblaz (toblaz) 1 65.05 65.05 0 0.00
22117. Druhan (insert_meme_here) 3 65.04 72.91 0 0.00
22118. Chase (cvcalderon) 2 65.04 68.85 0 0.00
22119. ade (adefiqri12) 1 65.04 65.04 0 0.00
22120. JT (gonroz) 6 65.04 74.78 1 16.67
22121. lenux005 (lenux005) 25 65.03 88.56 5 20.00
22122. Aditya (timmyaditya) 24 65.03 82.51 13 54.17
22123. HollowAri (zokkuu) 7 65.03 70.72 1 14.29
22124. Vivian Le (riru) 33 65.03 76.29 3 9.09
22125. Connor (gothorpe) 17 65.03 75.03 7 41.18
22126. Shahryar (srashid3) 227 65.03 90.08 51 22.47
22127. Gnv (noob_master_6_9) 21 65.01 74.86 5 23.81
22128. Pastasciutta (littleppig) 1 65.01 65.01 0 0.00
22129. arnav (trahimam) 183 65.01 87.32 44 24.04
22130. Paganini (paganinibr) 3 65.01 68.67 0 0.00
22131. Dan (cantdecidedan) 872 65.01 96.90 230 26.38
22132. hn (hahahana) 5 65.00 68.93 1 20.00
22133. Krishna (chaithu97) 55 65.00 76.19 18 32.73
22134. alibaba (alibaba_) 6 65.00 71.45 1 16.67
22135. xnfra (xnfra) 16 65.00 77.21 1 6.25
22136. thia (kingbarney) 9 65.00 81.63 2 22.22
22137. Johnny (kadkalakooki) 4 65.00 74.30 0 0.00
22138. Imnatoshi (hanmayujiro) 66 65.00 78.94 9 13.64
22139. simon (simonnoin) 22 64.99 78.06 8 36.36
22140. Mitch (mitchtin) 1 64.99 64.99 0 0.00
22141. Mark (markisimo) 7 64.99 74.27 1 14.29
22142. Barel (lenshom) 13 64.99 79.09 9 69.23
22143. MangalicA (mangalica) 9 64.99 78.08 1 11.11
22144. Kyle (kylegt) 4 64.98 70.56 1 25.00
22145. jody (jody10) 7 64.98 79.75 1 14.29
22146. Travis (travisrussell) 3 64.98 74.22 1 33.33
22147. Asir Mosaddek (amsakib) 23 64.98 78.36 16 69.57
22148. Valian (valian) 17 64.98 72.90 2 11.76
22149. Håvard (haavga) 81 64.98 83.48 13 16.05
22150. Black (black_pineapple) 11 64.98 76.86 3 27.27
22151. Harsha (harshatalla) 12 64.98 79.11 3 25.00
22152. Julian (mataleao) 12 64.98 71.78 2 16.67
22153. Kristán (panika_system) 3 64.97 66.92 1 33.33
22154. Mine (minepro3004) 1 64.97 64.97 1 100.00
22155. Dorian (thrashdivision) 3 64.97 86.94 1 33.33
22156. vijay (950vijay) 4 64.97 71.39 0 0.00
22157. John (rlawldjs) 12 64.96 72.23 2 16.67
22158. bode (mywaifubestwaifu) 25 64.96 101.73 5 20.00
22159. Laura (lauraab) 1 64.96 64.96 0 0.00
22160. Sam (ye3et) 7 64.96 67.42 1 14.29
22161. fordatab (fordatab) 5 64.96 100.84 2 40.00
22162. Hau (jackie1997) 275 64.96 94.14 69 25.09
22163. MrFade14 (mrfade14) 3 64.95 70.76 0 0.00
22164. Jose (lupi1) 15 64.95 72.81 2 13.33
22165. Ariyan (_ariyankhan_) 2 64.94 69.31 0 0.00
22166. charlotte (charltypes) 39 64.94 75.92 16 41.03
22167. Eli (e_lightning) 86 64.94 81.41 20 23.26
22168. Nandies (lilnandies) 12 64.93 73.44 3 25.00
22169. nomar (nomar_76) 10 64.93 84.43 3 30.00
22170. Yas'-' (yaser_) 42 64.92 79.80 6 14.29
22171. infinite (infinite_wotah) 1,802 64.92 93.98 374 20.75
22172. v(._.)v (justbeatya) 32 64.92 78.96 6 18.75
22173. Hehe (kumotz) 39 64.91 85.18 17 43.59
22174. Cavit Mert (cvtmrt) 14 64.91 77.65 13 92.86
22175. Ryan (rbrownie) 1 64.91 64.91 0 0.00
22176. Aman (multiversal_aspirator) 30 64.91 70.77 6 20.00
22177. Liny (counting_star) 30 64.90 79.23 7 23.33
22178. Daniel (nodasch) 19 64.90 81.91 4 21.05
22179. leonardo (leonardouwu) 19 64.90 74.78 3 15.79
22180. hi (appleeee) 7 64.89 69.68 1 14.29
22181. Binamra (binamra) 31 64.89 91.97 6 19.35
22182. Isaac (isaackane) 6 64.89 80.76 1 16.67
22183. Muhammad (exampz) 23 64.88 81.70 4 17.39
22184. noodle (zhyua001) 1 64.88 64.88 1 100.00
22185. Average (isuckattypoing) 8 64.88 69.93 5 62.50
22186. milord (milordbruh) 7 64.87 76.22 5 71.43
22187. Ernesto (smoking_kills) 16 64.87 80.72 2 12.50
22188. Geoff (axorted) 1 64.87 64.87 0 0.00
22189. Jonas Heitz (der_junker) 6 64.87 78.16 1 16.67
22190. Amir (iamir) 35 64.87 80.80 8 22.86
22191. Bazoo (bazoo) 2 64.87 65.84 0 0.00
22192. Shermill Roger (paybtawsan) 2 64.87 65.77 2 100.00
22193. J (fingerbanger96) 15 64.86 75.83 6 40.00
22194. Chewing (chewingtinfoil) 1 64.86 64.86 0 0.00
22195. Thomas (iamstrategy) 1 64.86 64.86 1 100.00
22196. Rahul (itzrall) 31 64.86 85.59 8 25.81
22197. Chico (jlkuio) 2 64.86 66.96 1 50.00
22198. CJ (cjcurata) 4 64.86 67.35 1 25.00
22199. Baris (demir2k) 1 64.85 64.85 1 100.00
22200. Sherniiaz (shero2002) 122 64.85 81.09 32 26.23
22201. Antonio (antonio_blueballs) 22 64.85 77.25 6 27.27
22202. Raphael (crazydrmad) 7 64.85 81.98 2 28.57
22203. Ilya (ethar) 6 64.85 68.82 2 33.33
22204. Alberto (angry_grandad) 93 64.84 78.67 20 21.51
22205. Rathalos (honored1234) 28 64.83 77.41 5 17.86
22206. Isla (oodley) 15 64.83 75.61 5 33.33
22207. Matija (ch4p0) 17 64.83 74.47 4 23.53
22208. Juan (wolf_1) 43 64.83 77.32 8 18.60
22209. Mouhamed (karlosalol) 21 64.83 79.28 5 23.81
22210. nirmit (nirmit0) 221 64.83 80.08 40 18.10
22211. milyn (alymilyn) 32 64.82 74.86 10 31.25
22212. Ooflord (ooflord) 6 64.82 86.33 1 16.67
22213. luiz (lzcr) 17 64.82 75.95 7 41.18
22214. Rinat (rinatzh) 10 64.82 77.10 1 10.00
22215. Jacobi (jevtrout) 23 64.82 77.03 5 21.74
22216. zindabaad (zindabaad111) 2 64.82 70.44 0 0.00
22217. professor (tm_professor) 11 64.81 72.98 8 72.73
22218. zhender (zhender) 4 64.81 88.63 3 75.00
22219. eiphosa (eiphosa) 6 64.81 72.54 3 50.00
22220. Nicolas (acut3) 49 64.80 81.89 9 18.37
22221. Zambo (zambo_dev) 4 64.80 66.23 2 50.00
22222. Rauhan (rauhan1998) 680 64.80 92.59 160 23.53
22223. Ivan (ivanh922114) 30 64.80 76.01 7 23.33
22224. Buddhist Missionary (sucpikle) 5 64.80 69.28 1 20.00
22225. Bekzat (blkssmv) 108 64.80 78.97 29 26.85
22226. Joe (chogpamp) 16 64.80 74.06 4 25.00
22227. hafit (streekytyper) 17 64.80 76.06 4 23.53
22228. George (zorkkins) 342 64.79 82.91 69 20.18
22229. Liny (veronasie) 13 64.79 76.08 3 23.08
22230. Andy (andy3j) 683 64.79 83.31 161 23.57
22231. Yếm Hồng (tdinh33) 13 64.78 76.37 1 7.69
22232. Shinixsan (shinixsan) 1 64.78 64.78 1 100.00
22233. Keelan (keelanf_28) 154 64.78 88.03 39 25.32
22234. Mystik (magic_mystik) 14 64.77 77.07 6 42.86
22235. Alexander (helmers) 3 64.77 71.52 1 33.33
22236. Laith (unclezebra) 1 64.76 64.76 1 100.00
22237. Thịnh (wizardhire) 4 64.75 79.71 1 25.00
22238. bueno (bueno94) 53 64.75 79.33 15 28.30
22239. Toastify (tcatechofficial) 1 64.75 64.75 1 100.00
22240. Jeff (mingij) 6 64.75 72.03 1 16.67
22241. SparkleFace (sparkle_face) 4 64.75 68.03 0 0.00
22242. Vi (thevi25) 2 64.75 66.62 0 0.00
22243. Savv (savvey) 14 64.75 70.45 2 14.29
22244. rt (smigglewiggle23) 3 64.74 68.75 3 100.00
22245. Wujy (wujy) 4 64.74 76.69 1 25.00
22246. Wexxort (wexxort) 16 64.73 75.85 3 18.75
22247. Peder (darthpejder) 5 64.73 69.05 3 60.00
22248. andrea (lotta98) 51 64.73 78.07 10 19.61
22249. Carter (carter04julian) 1 64.73 64.73 1 100.00
22250. János (tokumeikun) 7 64.73 77.99 1 14.29
22251. RougeGod (socratic74) 22 64.73 71.35 6 27.27
22252. Aaron (noobschizz) 12 64.73 72.41 2 16.67
22253. Duong (doduong) 2 64.73 67.22 1 50.00
22254. Darkos (darkoser0) 6 64.72 73.03 3 50.00
22255. LongGone (byejack123) 9 64.72 72.28 0 0.00
22256. felix (sanfelix) 126 64.72 87.31 26 20.63
22257. Ali (fanstic) 21 64.72 74.96 3 14.29
22258. PJ (pjk519) 33 64.72 80.31 8 24.24
22259. Nial (nialj618) 1 64.72 64.72 0 0.00
22260. Perhs (mrbunnym) 33 64.72 85.51 7 21.21
22261. asasel010 (asasel010) 5 64.72 72.54 0 0.00
22262. thanh (hust9x) 60 64.71 75.47 12 20.00
22263. Mateus (mateusmelo) 21 64.71 77.77 7 33.33
22264. Daniel (itypekindaquick) 48 64.71 76.29 9 18.75
22265. Ashutosh (ashutosh026) 3 64.70 75.64 0 0.00
22266. Matthew (memermatt) 3 64.70 67.31 3 100.00
22267. Nabil (nabilhuda) 19 64.70 78.06 5 26.32
22268. Lesibana (profles) 121 64.70 87.16 25 20.66
22269. Abrar (computernerdgenius) 13 64.70 75.47 4 30.77
22270. Jacque (jrobyabich) 517 64.70 87.53 107 20.70
22271. My dik is hard (kubatmoffic... 1 64.70 64.70 0 0.00
22272. Greg (greg605) 1 64.70 64.70 0 0.00
22273. speed (speed_boiiii) 10 64.70 76.25 3 30.00
22274. Miilo (miilo_) 7 64.69 80.96 4 57.14
22275. Sean (axelsandrods) 15 64.69 78.91 4 26.67
22276. sigma (adelshehadeh) 30 64.69 79.48 5 16.67
22277. Arman (148038) 5 64.69 69.26 0 0.00
22278. Azee (speedy65) 25 64.68 70.93 9 36.00
22279. Shane (sdoyle4499) 8 64.68 78.52 1 12.50
22280. Will (general_iroh) 6 64.68 71.57 2 33.33
22281. wlof (wlof) 85 64.68 77.55 19 22.35
22282. Naren Manikandan (nane_m) 41 64.68 77.56 8 19.51
22283. Femke (fffemke) 69 64.68 80.73 19 27.54
22284. Yasser (yesserspeed) 40 64.68 78.61 12 30.00
22285. Matthew (mattify) 4 64.68 76.81 0 0.00
22286. big daddy (shivdatt_op) 809 64.68 98.52 170 21.01
22287. Nightmare (nightmare_foxy) 10 64.67 79.04 2 20.00
22288. Andres (atv2307) 273 64.67 86.53 65 23.81
22289. Omar (omarr84) 81 64.67 77.21 15 18.52
22290. Nabil (twin_n) 21 64.66 86.03 2 9.52
22291. pwxown (pwxown123) 94 64.66 79.70 21 22.34
22292. Gahnou (ghanou09) 4 64.65 68.21 0 0.00
22293. Shannon (scthemonk) 22 64.65 76.23 5 22.73
22294. Heksinator (cleverpleb) 2 64.65 65.63 1 50.00
22295. Vlad (engurararazov) 5 64.65 68.69 0 0.00
22296. Eduardo (laloaguirre720) 49 64.65 80.95 14 28.57
22297. Alfred (racer421) 2 64.65 64.82 0 0.00
22298. grammy (spicybbqsauce) 29 64.64 78.51 4 13.79
22299. Daniel (kohrt) 6 64.64 76.90 1 16.67
22300. jjjjjj (jitu8149) 67 64.64 79.78 20 29.85
22301. warya (warya) 99 64.64 89.28 77 77.78
22302. Timothy (timothy5597) 27 64.63 79.24 4 14.81
22303. kes (barubelajarhehe) 83 64.63 77.86 18 21.69
22304. nathannnnnn (palaceisbad) 3 64.63 71.34 1 33.33
22305. Patrick (maxmad53) 5 64.63 69.43 1 20.00
22306. thefalconeye (thefalconeye) 2 64.63 65.43 1 50.00
22307. evaqate (evaqate) 20 64.63 77.87 3 15.00
22308. Yoshimitsu (deep_impact) 11 64.62 71.69 3 27.27
22309. Bryan (xxavalonxx) 41 64.62 75.39 11 26.83
22310. alex j (alexjonelis) 33 64.61 82.88 14 42.42
22311. J (glazingdonuts) 1 64.61 64.61 0 0.00
22312. Shahaf (mrpoopydoopy) 14 64.61 77.15 5 35.71
22313. Shahbaz (thisisshahbazsb) 616 64.61 80.03 133 21.59
22314. ninja (ehsaas) 6 64.60 70.76 2 33.33
22315. SH (shrony) 49 64.60 75.41 11 22.45
22316. Artur (xxxartikxxx) 1 64.60 64.60 0 0.00
22317. usagi704 (usagi704) 287 64.60 79.58 53 18.47
22318. Gurveer (gundo_1) 10 64.60 76.70 0 0.00
22319. Mark (markgeorge) 28 64.59 73.57 4 14.29
22320. swat (swatxian) 10 64.59 74.83 5 50.00
22321. Citrus (citrus08) 1 64.59 64.59 0 0.00
22322. Johan (joey67) 20 64.59 77.28 8 40.00
22323. ICEMAN (kimoas) 3 64.59 72.45 1 33.33
22324. long (longlonglong) 32 64.58 80.46 7 21.88
22325. Farzad (ferion) 2 64.58 67.60 0 0.00
22326. Allen (onelonelyguy101) 135 64.58 89.69 30 22.22
22327. Aiden (asiangarlic) 14 64.58 76.07 9 64.29
22328. lxvxnderry (lxvxnderry) 3 64.58 71.33 1 33.33
22329. Bobby (bobnfuz) 10 64.57 78.62 1 10.00
22330. Tommy (mr_max_dog) 2 64.57 71.99 2 100.00
22331. William (wmpmills) 1 64.57 64.57 0 0.00
22332. J (jkim55k) 10 64.57 72.18 5 50.00
22333. David (jabadahub25) 121 64.57 82.98 28 23.14
22334. Leo (xxlxx) 5 64.57 67.45 1 20.00
22335. sumit (sumitmgr345) 172 64.57 82.26 37 21.51
22336. Turbo (avash101) 11 64.56 75.66 1 9.09
22337. Behind (xx_blaze_xx) 3 64.56 65.62 0 0.00
22338. Nirzhor (cyclonite) 3 64.56 72.31 0 0.00
22339. HelixFossil1 (helixfossil1) 3 64.56 69.53 1 33.33
22340. DataCrusader (faruzzy) 90 64.55 74.22 28 31.11
22341. Matthew (poobcum) 247 64.55 85.36 56 22.67
22342. Aqib (aqib1990) 10 64.55 73.11 1 10.00
22343. halvard (kulsol02) 1 64.55 64.55 0 0.00
22344. Scott (typist2021) 211 64.55 79.52 56 26.54
22345. John (subarutato) 4 64.55 67.51 1 25.00
22346. Tejas (tejasfarera) 11 64.54 74.75 3 27.27
22347. Don (odonjeque) 114 64.54 78.76 15 13.16
22348. Jason (jason1994) 1 64.54 64.54 0 0.00
22349. Finn (finnph) 1 64.54 64.54 0 0.00
22350. Bristopher (bristopherwoods) 3 64.54 73.88 1 33.33
22351. Yowmang (yowmang) 4 64.54 72.26 0 0.00
22352. uann (uann1) 101 64.53 78.68 27 26.73
22353. really cute ;) (qwnnnnnnn) 7 64.53 74.50 2 28.57
22354. kaneki (akiyama_shinchi) 2 64.53 69.18 0 0.00
22355. shrimp (shrimpcraackers) 9 64.52 69.11 2 22.22
22356. Cheap (gorid) 11 64.52 77.33 1 9.09
22357. Ahmad Fatih (afaf_tech19) 111 64.51 86.62 27 24.32
22358. Kavi (kavit) 1 64.51 64.51 0 0.00
22359. Tingaling (ellehebe) 1 64.51 64.51 0 0.00
22360. cyriled (cyriled) 1 64.51 64.51 0 0.00
22361. Spike (sp4rks) 33 64.51 83.90 10 30.30
22362. Snowpheasant (snowpheasant) 5 64.50 77.78 2 40.00
22363. nadeem (nadeemgujjar560) 37 64.50 80.02 11 29.73
22364. Speeeeed (nkpaintsil) 3 64.50 66.24 0 0.00
22365. Will (willdawarrior77) 2 64.50 67.41 0 0.00
22366. Ulises (xindrome) 38 64.49 78.34 6 15.79
22367. Nady (serufidesu) 28 64.49 79.91 6 21.43
22368. amelia (ameliality) 2 64.49 65.44 1 50.00
22369. aidan (aidansamson) 1 64.49 64.49 1 100.00
22370. Andra (andrasense) 3 64.49 68.41 0 0.00
22371. Dosnt (laxrpy) 17 64.49 74.15 2 11.76
22372. Prakhar (menate) 12 64.49 81.58 4 33.33
22373. k2K (worthwhile) 123 64.48 85.47 22 17.89
22374. Daniel (weabutakku) 13 64.48 82.18 4 30.77
22375. Fares (farfosi) 4 64.48 77.53 4 100.00
22376. Oyo (marauder316) 9 64.47 71.11 2 22.22
22377. Rohan (ashavijaysukne) 7 64.47 72.68 1 14.29
22378. Joe (f1rest0rm) 207 64.47 83.59 39 18.84
22379. PriesaFire (nguyentriton) 1 64.47 64.47 0 0.00
22380. Bill (youngbilliam) 4 64.47 68.81 0 0.00
22381. Tu Thien (logan1912) 22 64.47 77.71 3 13.64
22382. N (precised_aim) 2 64.47 72.83 1 50.00
22383. HerrBlinkenlicht (herrblink... 19 64.46 80.41 1 5.26
22384. R4g3 (zepyxlofficial) 5 64.46 71.72 1 20.00
22385. Mr (glock19) 41 64.46 83.03 5 12.20
22386. Himanshu (neutron_star) 7 64.46 69.47 0 0.00
22387. ronaldo (devildodo) 6 64.46 69.38 2 33.33
22388. Codastix (pranavthetypist) 3 64.46 68.03 1 33.33
22389. Nanar (nanarboursal) 441 64.45 93.36 91 20.63
22390. cagdas (cagirtas) 30 64.45 74.85 8 26.67
22391. Zhuldyzay (zhuz12) 698 64.45 90.58 156 22.35
22392. Kleuz (kleuz) 9 64.45 75.81 3 33.33
22393. Talon (cclaww) 14 64.45 81.97 3 21.43
22394. Jakob Kammerlander (plssnipe) 18 64.45 76.75 3 16.67
22395. Ara (goatrager) 42 64.45 89.79 10 23.81
22396. Duirky (sublollipop) 13 64.45 73.22 4 30.77
22397. D (dabirik) 43 64.45 78.66 11 25.58
22398. Bingsong (bingsongbingsong) 80 64.45 79.07 11 13.75
22399. Kuruto (kurut0) 2 64.45 69.79 2 100.00
22400. Mamdouh (mmdh) 32 64.44 80.67 11 34.38
22401. Omunyokol (omunyokol) 83 64.44 84.09 14 16.87
22402. mercy (mercy_13) 22 64.44 77.52 4 18.18
22403. scut-黄光积 (yh_1314) 3 64.44 65.58 0 0.00
22404. Edvin (cowsmacker69) 9 64.44 79.56 4 44.44
22405. NessQuik (nessquik) 145 64.44 83.88 34 23.45
22406. Jack (lankyfranky) 5 64.44 73.09 0 0.00
22407. Louie (louise_shang) 2 64.44 65.30 0 0.00
22408. Nischal (nischal165) 68 64.43 76.15 18 26.47
22409. scrubs (scrubs1906) 161 64.43 80.41 41 25.47
22410. ashtunu (ashtunu) 12 64.43 72.57 5 41.67
22411. North (northtm) 2 64.43 75.75 0 0.00
22412. Shivam Kumar (sks123_) 1,096 64.42 97.44 234 21.35
22413. John (jacks3141) 11 64.42 74.66 2 18.18
22414. dorj (dorjoo) 11 64.42 76.18 2 18.18
22415. Ivo (ivosu_10) 7 64.42 74.63 2 28.57
22416. talayracing (talayracing) 2 64.42 67.07 0 0.00
22417. mt. (monthon993) 15 64.41 70.75 4 26.67
22418. ឡានប្រណាំ... 714 64.41 95.30 162 22.69
22419. shark (sharkpause) 281 64.41 87.15 60 21.35
22420. mursh (mursh) 26 64.41 88.03 8 30.77
22421. Gagan (ggnbakshi38) 183 64.41 83.49 48 26.23
22422. otve (otve) 19 64.41 85.98 6 31.58
22423. haquaman_workman (haquaman_... 49 64.40 75.09 9 18.37
22424. Ellis (ellismk123) 24 64.40 74.17 3 12.50
22425. Marvin (marxman16) 4 64.40 70.28 3 75.00
22426. Krishna (shinigami00) 61 64.40 79.03 18 29.51
22427. Ba Viet (sweetweet) 1 64.40 64.40 0 0.00
22428. Ari (arihsieh) 5 64.40 70.61 0 0.00
22429. Peter (peterhawthorne) 4 64.40 74.83 1 25.00
22430. Tyler (slashrage) 100 64.40 80.95 19 19.00
22431. skycandy (skycandy1) 110 64.40 79.11 24 21.82
22432. maltinyu (maltinyu) 605 64.40 94.88 136 22.48
22433. P00nsl4y3r (p00nsl4y3r) 23 64.39 76.17 4 17.39
22434. TuxKnight (tuxknight) 7 64.39 73.77 1 14.29
22435. DevChris (devchris1314) 1 64.39 64.39 0 0.00
22436. djchicken (djchicken) 7 64.39 74.42 1 14.29
22437. Travis (sonicspeed06) 11 64.39 71.09 5 45.45
22438. Moodrammer (moodrammer) 22 64.39 73.30 5 22.73
22439. noneov (aidentypefast) 10 64.38 72.27 7 70.00
22440. Eva (vagabionda) 7 64.37 70.41 1 14.29
22441. invader (megawutt) 21 64.37 75.30 8 38.10
22442. ROG (roggy) 337 64.37 84.70 72 21.36
22443. mymodded (mymodded) 1 64.37 64.37 0 0.00
22444. Kyle (koshu) 9 64.37 77.50 0 0.00
22445. Jhonny (jhonny_space0ut) 286 64.37 79.65 63 22.03
22446. SkepticalBubble (skepticalb... 6 64.37 68.76 2 33.33
22447. Fearless (mjsuriya) 2 64.36 64.60 0 0.00
22448. Cam (cukelllz) 1 64.36 64.36 0 0.00
22449. kajak_CZ (kajak_cz) 164 64.36 80.99 37 22.56
22450. Hannes (asiansticka) 4 64.36 71.12 1 25.00
22451. Aristeu (aristeu) 6 64.35 69.50 0 0.00
22452. paul (paularoni) 11 64.35 77.32 1 9.09
22453. Yousef (yusopro) 14 64.35 69.72 7 50.00
22454. Dawid (dadik) 15 64.35 75.96 5 33.33
22455. sheng (shenglol) 4 64.35 65.50 1 25.00
22456. Steph (donnerblumen) 3 64.35 71.04 1 33.33
22457. Aashish (albatross007) 379 64.34 87.17 83 21.90
22458. Pear (pear_smo) 13 64.33 75.18 2 15.38
22459. 💨💨💨 (ppraisethesun) 6 64.33 67.90 1 16.67
22460. Abhinav :P (abhi_typist) 173 64.33 84.06 42 24.28
22461. Cat (misslittlequack) 6 64.33 78.22 0 0.00
22462. Martin (drudi1902) 13 64.32 73.50 3 23.08
22463. DangLin (dang_lin_wang) 4 64.32 70.75 2 50.00
22464. you (you) (rajeevkgp) 1 64.31 64.31 0 0.00
22465. Vi (nocivi38) 7 64.31 67.65 6 85.71
22466. Kelvin (kelvinohhh) 24 64.30 78.99 6 25.00
22467. sexyman (_may_) 8 64.30 78.92 2 25.00
22468. rieru (rieru) 5 64.30 71.91 2 40.00
22469. zurakin (zurakin) 6 64.30 70.52 2 33.33
22470. Eram (verstecken) 1 64.30 64.30 1 100.00
22471. ben (bentypemaster) 34 64.30 76.00 4 11.76
22472. STOIC (sachindra_111) 5 64.30 74.45 1 20.00
22473. hilmi (thefroggy) 6 64.30 66.14 1 16.67
22474. Risheet (risheet_7) 87 64.30 81.23 25 28.74
22475. Alif (aliftheruslan) 10 64.30 72.04 2 20.00
22476. podlesk (podlesk) 8 64.29 74.83 2 25.00
22477. tstats[joelscao] (joelscao) 2 64.29 69.67 0 0.00
22478. hbomb (hbomber) 57 64.28 84.49 25 43.86
22479. Natalie (nataliejw4) 3 64.28 71.50 1 33.33
22480. Bolam Blom (bolam_blom) 4 64.28 68.04 0 0.00
22481. Cesar (cesarloachamin) 16 64.28 69.29 2 12.50
22482. shashank (trash_typer_74) 9 64.28 73.35 2 22.22
22483. Wob (wobber) 174 64.28 88.08 53 30.46
22484. Enzo (springgs) 4 64.28 66.67 2 50.00
22485. so (i_am_sov) 6 64.28 74.82 3 50.00
22486. Parikshit (7767064953) 9 64.27 73.04 2 22.22
22487. aaaaaaaaaaaaaa (aaaaaaaaooo... 17 64.27 76.32 6 35.29
22488. Anastasya (athh97) 21 64.27 81.22 5 23.81
22489. Topu (topuraihan) 6 64.27 73.27 0 0.00
22490. Redking344 (redking344) 13 64.27 77.27 13 100.00
22491. Blaku (blaku03) 23 64.26 75.66 10 43.48
22492. tstats[alexander98] (alexan... 222 64.26 83.02 35 15.77
22493. tstats[kalirocketdev] (kali... 23 64.26 83.78 5 21.74
22494. Eren (flochforster) 2 64.26 64.93 0 0.00
22495. Mv (marcellv) 3 64.26 66.91 2 66.67
22496. Ruben (rubennijhuis) 8 64.25 98.57 2 25.00
22497. Anha (anha05) 38 64.25 77.88 6 15.79
22498. Flowless (flowlessrusher) 14 64.25 71.24 14 100.00
22499. Ph (hidenki) 3 64.25 67.92 0 0.00
22500. I am speeed (scarea) 3 64.24 65.57 1 33.33
22501. iStealCatNips (i_steal_cat_... 15 64.24 84.66 1 6.67
22502. Timmy (asianhacker9000) 4 64.24 78.11 0 0.00
22503. Juan (jlah) 4 64.22 71.23 1 25.00
22504. Abada (abada) 4 64.22 69.43 0 0.00
22505. Rashad (rashad19) 15 64.22 76.51 4 26.67
22506. Derek (sashimi_exe) 3 64.22 73.37 1 33.33
22507. john (bubbles_tv) 1 64.22 64.22 0 0.00
22508. Toni (toek) 4 64.22 68.51 0 0.00
22509. YonYon (yonyon205) 3 64.22 67.00 2 66.67
22510. Peter (_vroom_vroom_vroom_) 5 64.21 71.44 1 20.00
22511. Rohit (murphy053) 12 64.21 71.45 0 0.00
22512. Daniel (danny_dvlpr) 4 64.21 74.10 1 25.00
22513. Lux (miintyonyt) 7 64.20 67.53 2 28.57
22514. Odo (odo_bean) 81 64.20 80.14 21 25.93
22515. Sam (samuel_h) 5 64.19 73.71 1 20.00
22516. JCalibs (jcalibs_13) 3 64.19 71.09 1 33.33
22517. Gabe (gabrielbj29) 13 64.19 83.31 4 30.77
22518. Aidan (88its_dvorak) 18 64.19 73.41 7 38.89
22519. Mohamed (_mohammed_taha_) 27 64.18 72.47 2 7.41
22520. peaNUTS (prabeshdai) 73 64.18 80.00 15 20.55
22521. Ben (random_peepsle12) 33 64.17 74.53 7 21.21
22522. David (circuitnerd) 99 64.17 79.48 24 24.24
22523. Taa (vrztaa) 131 64.17 77.04 30 22.90
22524. Chirath (cp_guy) 27 64.17 78.68 6 22.22
22525. Ikkue (ikkue) 1 64.17 64.17 1 100.00
22526. Bijay (shresthabijay) 241 64.17 86.84 48 19.92
22527. Astoshan (astoshan) 69 64.17 83.24 17 24.64
22528. Dee (nerdie_) 2 64.17 70.88 0 0.00
22529. Ian (ic0d) 6 64.16 75.21 0 0.00
22530. Enderus (enderus) 4 64.16 67.15 1 25.00
22531. Jaden (sasmiku) 5 64.16 70.74 1 20.00
22532. elongatedsquirrel (nba_youn... 98 64.16 90.95 29 29.59
22533. Allen (alphadvorak) 2 64.16 65.58 0 0.00
22534. duc (duchihi) 5 64.15 68.41 1 20.00
22535. Edwin (biggchinoxxl) 276 64.15 95.43 49 17.75
22536. satya (satya1110) 453 64.15 88.47 104 22.96
22537. Amith (amith_c_04) 3 64.15 67.67 0 0.00
22538. carl (blackhole24) 16 64.15 74.82 5 31.25
22539. wiku (wiku025) 9 64.15 73.00 4 44.44
22540. Juan (dostoevsky) 9 64.14 73.59 1 11.11
22541. Fries (imfriez) 1 64.14 64.14 1 100.00
22542. Chan (yunelle) 4 64.14 67.60 0 0.00
22543. Bil3ygr (bil3ygr) 43 64.14 90.28 9 20.93
22544. Necdet Ali (necdetaliozdur_... 150 64.14 80.31 31 20.67
22545. Kaushik (kaushik13) 38 64.13 85.68 10 26.32
22546. hulkari (hulkari) 54 64.13 76.81 16 29.63
22547. peemer (bot00014) 4 64.13 68.14 0 0.00
22548. . (boop_69) 6 64.12 78.64 3 50.00
22549. ohad (ohad8353) 8 64.12 82.33 3 37.50
22550. qweasdyxc (qweasdyxc) 11 64.12 73.23 1 9.09
22551. Indeed (indeed001) 642 64.12 90.83 148 23.05
22552. Insany (insanyngame) 33 64.11 73.28 17 51.52
22553. Amadej (ramadox) 5 64.11 69.36 1 20.00
22554. William (ithan) 39 64.11 85.13 9 23.08
22555. bvk (bvkv) 19 64.11 72.09 1 5.26
22556. Nutel (nutel65) 5 64.11 67.53 0 0.00
22557. Nitesh (niteshtiwari) 116 64.11 92.22 28 24.14
22558. konkord (konkord895) 5 64.11 68.13 2 40.00
22559. the ayo (the_one_and_only_l... 14 64.11 77.97 5 35.71
22560. xsharawi (xsharawi) 10 64.10 84.60 2 20.00
22561. D (dylanite13) 5 64.10 72.63 2 40.00
22562. shau (shauwei_0510) 21 64.10 79.74 4 19.05
22563. Ben (realolympian) 27 64.10 78.05 6 22.22
22564. Vaito (tunerfrick) 2 64.10 65.68 2 100.00
22565. Ali (tsunali) 3 64.10 77.17 3 100.00
22566. ilmari (jejj) 5 64.10 75.68 0 0.00
22567. Cefe (cefe_origol) 10 64.10 68.13 4 40.00
22568. g (eggwen) 20 64.09 73.29 6 30.00
22569. Muahmmad (arul2101) 17 64.09 87.76 5 29.41
22570. Akira (8amb1) 7 64.09 72.13 4 57.14
22571. ni (nischalace) 39 64.08 81.41 12 30.77
22572. maro (yenic) 22 64.08 74.52 3 13.64
22573. Abhi (abhinavsanthosh_162008) 103 64.08 83.67 23 22.33
22574. Emma (aria_tran) 45 64.07 84.73 11 24.44
22575. roee (masterroee3) 21 64.07 80.91 5 23.81
22576. Barack (ceo_of_communism) 1 64.07 64.07 1 100.00
22577. Khende (khende) 9 64.07 71.29 9 100.00
22578. Rahat (chiefrahat) 3 64.06 68.96 0 0.00
22579. TheVan (thevan) 4 64.06 67.29 1 25.00
22580. s3lec (inputselec) 11 64.06 75.39 1 9.09
22581. Ashutosh (vegeta_2001) 3 64.06 68.39 1 33.33
22582. Ashveck (ashveck) 17 64.06 75.90 3 17.65
22583. Almaz (almazzz1) 835 64.05 91.42 225 26.95
22584. Christina (cjkoikara) 8 64.05 66.55 0 0.00
22585. StrawHat (strawhat_amine) 3 64.05 64.75 1 33.33
22586. Colin (peppyduckling) 1 64.04 64.04 0 0.00
22587. Maneeb (maneebdin) 501 64.04 92.30 111 22.16
22588. Lukas (bondevik) 2 64.03 70.26 1 50.00
22589. Likhon (likhon5) 1 64.02 64.02 0 0.00
22590. Cuong (cqtshadow) 5 64.02 73.75 1 20.00
22591. Steven (peebsdasavage) 6 64.02 72.65 0 0.00
22592. Emrick (tsicko) 2 64.02 73.41 0 0.00
22593. lelle (davinkyy) 53 64.01 79.83 12 22.64
22594. anand (anandzzz1973) 39 64.01 81.59 15 38.46
22595. Akhil (deathstroke99) 51 64.01 75.90 9 17.65
22596. desarly (desarlymarshall) 127 64.01 87.04 32 25.20
22597. Jacob (slipperysloper) 3 64.01 71.99 1 33.33
22598. KMMOPJ1 (blueflammednezha) 26 64.00 78.53 7 26.92
22599. Mike (chomeror) 13 64.00 74.22 0 0.00
22600. Sias (shiasu) 1 64.00 64.00 0 0.00
22601. kentlim (lsk133) 494 64.00 83.45 109 22.06
22602. Potate (potatocloud) 9 64.00 69.77 2 22.22
22603. thunder (thundersico) 3 64.00 67.60 0 0.00
22604. weird_virus (imsajan) 422 64.00 89.54 86 20.38
22605. Tang (tangvt97) 736 63.99 83.23 145 19.70
22606. Lepry (leprykun) 50 63.99 82.98 17 34.00
22607. Rezaul (vuzinga) 104 63.99 74.44 13 12.50
22608. Michael (idobemikey) 11 63.99 73.06 4 36.36
22609. Ethaan (bambamarama) 18 63.99 74.84 4 22.22
22610. Ansar (paxaq) 311 63.98 87.63 69 22.19
22611. NO_LYF (no_lyf) 46 63.98 79.18 14 30.43
22612. Ian (pugami) 7 63.98 76.88 3 42.86
22613. i choke too much (vxnd_ttxa) 1 63.97 63.97 0 0.00
22614. Carlos (carloszapata) 874 63.97 90.14 207 23.68
22615. Rodrigo (rodgodkiller) 18 63.97 78.87 4 22.22
22616. Uurdmandakh (uurdmandakh) 155 63.97 83.30 35 22.58
22617. Fitive (fitive_gaming) 76 63.96 82.64 20 26.32
22618. PoonPounder (p00np0under) 35 63.96 76.58 12 34.29
22619. Shaun (silentfate) 1 63.96 63.96 0 0.00
22620. Soulreaper (soulreaperdeath... 21 63.96 76.14 4 19.05
22621. Elias (the_dovah) 7 63.95 70.04 0 0.00
22622. Anthony (saga_) 3 63.95 79.22 1 33.33
22623. Lovro (lolvrol) 7 63.95 72.16 1 14.29
22624. Alnebras04 (alnebras04) 55 63.95 91.13 9 16.36
22625. Exooo (ranold) 3 63.94 66.48 0 0.00
22626. Francis (fccipriano) 2 63.94 70.10 0 0.00
22627. MK-47 (construct) 296 63.94 82.81 63 21.28
22628. TetraVoltX (wing_x) 5 63.94 69.03 1 20.00
22629. zizonesol (zizonesol) 34 63.93 75.75 10 29.41
22630. James (horjamez) 30 63.93 76.14 7 23.33
22631. Josh (jjrandle1013) 10 63.92 72.34 1 10.00
22632. DryGer (dryger27_) 5 63.92 72.18 0 0.00
22633. Felzii (missartemis_97) 11 63.92 74.53 2 18.18
22634. I_like_Billie_Eilish (agiun... 7 63.91 71.88 0 0.00
22635. Lex (akitgwapa) 3 63.91 69.38 1 33.33
22636. OrangeKomodo (orangekomodo) 105 63.91 82.86 24 22.86
22637. Otakranio (otakranio) 17 63.91 83.28 4 23.53
22638. Puan (puanpro) 65 63.91 75.39 14 21.54
22639. JIHAD (jihad_14) 9 63.91 68.29 4 44.44
22640. Mike (mmlvx) 34 63.91 74.88 11 32.35
22641. Marko (bru_) 11 63.90 72.94 1 9.09
22642. IIIKTG (lllktg) 6 63.90 73.70 0 0.00
22643. Ryan (moseqa) 35 63.90 82.02 3 8.57
22644. yopman (yopman) 2 63.90 68.17 0 0.00
22645. Fast (too_fast_foru) 37 63.89 73.55 5 13.51
22646. Jairo (asophiel) 10 63.89 80.53 2 20.00
22647. Vu (taptyping) 96 63.89 85.16 18 18.75
22648. LolipopAlexx (amazingskep_1) 15 63.89 75.35 3 20.00
22649. TechnoTurtle (technoturtle) 5 63.89 69.52 5 100.00
22650. Tim (t84nightfall) 2 63.89 71.43 0 0.00
22651. kman (kwangyel) 2 63.89 68.19 0 0.00
22652. Razor (mr6pack) 408 63.88 83.35 70 17.16
22653. Aman (mag1k_iwnl) 42 63.88 79.92 14 33.33
22654. Dreamside (dreamside0010) 99 63.88 88.51 18 18.18
22655. Sindre| (sinros01) 9 63.87 71.75 5 55.56
22656. killerkoli (mattiemb) 13 63.87 75.90 2 15.38
22657. Alosson (tiger6654) 138 63.87 80.56 32 23.19
22658. George (sellers1234) 8 63.87 70.09 1 12.50
22659. ching (chingchongchangchink) 12 63.87 85.01 1 8.33
22660. Brandon (brandongva) 9 63.86 70.24 4 44.44
22661. Very Noob (very_noob) 1 63.86 63.86 1 100.00
22662. you (nigamot) 18 63.86 84.68 3 16.67
22663. egg (pipidozer) 9 63.86 76.25 2 22.22
22664. Jonathan (daddyiz) 4 63.86 73.27 1 25.00
22665. minnie (hiitzmemini) 11 63.85 76.15 2 18.18
22666. Davinti (swaggaming) 1 63.85 63.85 0 0.00
22667. Adam (_adamart_) 6 63.85 73.82 0 0.00
22668. Abhishek (amishra7292) 2 63.85 67.25 1 50.00
22669. Brihoness (brihoness) 34 63.84 76.24 9 26.47
22670. Md. Tahsinul Anwar (tahsinu... 17 63.84 76.47 4 23.53
22671. Albert (thehacker08) 21 63.84 73.19 3 14.29
22672. dayy (turtlestan) 5 63.84 72.04 2 40.00
22673. U (uqs1) 19 63.83 74.67 2 10.53
22674. shut (chunkypeanutbutter) 1 63.83 63.83 0 0.00
22675. Cream (marom) 8 63.83 78.03 4 50.00
22676. Oken (okenthelfocken) 66 63.81 85.41 14 21.21
22677. hello (prateekskl99) 4 63.81 70.79 1 25.00
22678. ShadowBoy (epicshadowboy) 1 63.81 63.81 0 0.00
22679. braden (cablebox) 131 63.81 100.35 33 25.19
22680. Overlay1 (overlay1) 22 63.80 72.48 2 9.09
22681. bowei (botheburp) 7 63.80 70.46 1 14.29
22682. BigBoiB (bigboib) 23 63.79 70.28 5 21.74
22683. Zain (zainabb) 222 63.79 84.08 56 25.23
22684. yamax (yamax) 5 63.79 70.22 0 0.00
22685. Max (the_maxinater) 9 63.79 72.65 2 22.22
22686. Shanu (shanu777) 3 63.79 73.03 1 33.33
22687. Ritu (anritu) 16 63.79 75.69 4 25.00
22688. YaBoi (yab0i) 33 63.78 74.61 4 12.12
22689. Kritik (chaoseyy) 28 63.77 78.56 5 17.86
22690. MostPassiveUser (mostpassiv... 5 63.77 68.04 2 40.00
22691. fr33ak (fr33ak) 24 63.77 73.96 5 20.83
22692. AtmoSci (noctilucent) 152 63.77 86.13 30 19.74
22693. Peter (spinbot) 11 63.77 75.08 3 27.27
22694. Bla (blablabla_) 6 63.77 73.04 0 0.00
22695. Gabriel (akgabe) 11 63.76 69.70 4 36.36
22696. Axel (scorchill) 225 63.76 79.16 42 18.67
22697. Anas (cloudo) 1 63.76 63.76 0 0.00
22698. Huân (lixboi) 2 63.76 64.89 0 0.00
22699. SjåDæmSjøgølls (seethem... 11 63.76 76.19 2 18.18
22700. Vincent (turbovince) 56 63.76 73.14 14 25.00
22701. Chrollo (chrollo283) 63 63.76 77.11 12 19.05
22702. Jan (jantajov) 2 63.76 67.83 1 50.00
22703. ozzyy (ozzyy_163) 26 63.75 77.18 10 38.46
22704. Chris (kryss_404) 10 63.75 72.70 2 20.00
22705. Abby (tuffbluff) 4 63.75 74.07 2 50.00
22706. idost (idost) 59 63.75 72.70 14 23.73
22707. Wiktor (wiktorelka) 5 63.75 71.33 2 40.00
22708. tstats[pkmkb] (pkmkb) 11 63.75 70.73 0 0.00
22709. Jesse (psychoticcooki) 6 63.75 67.78 2 33.33
22710. Billy (onlychance) 6 63.75 74.61 4 66.67
22711. dsc.gg/uk-train (hellomynam... 29 63.75 82.58 19 65.52
22712. xtian (xtian91) 20 63.74 73.79 4 20.00
22713. Kamen (kamen08) 40 63.74 82.01 11 27.50
22714. Monica (moni1101) 17 63.74 73.62 4 23.53
22715. Burger (somental) 14 63.74 75.80 2 14.29
22716. Karthik (slickfalcon) 8 63.74 71.56 3 37.50
22717. Grzegorz (ulxori) 210 63.74 81.66 51 24.29
22718. Eiji (eijin) 1 63.73 63.73 0 0.00
22719. Nahush (nahush28) 68 63.73 79.12 17 25.00
22720. Seb (aniuortes) 3 63.73 66.15 0 0.00
22721. cython (cython) 14 63.72 74.83 2 14.29
22722. Ahmed (4hmed4dnan) 4 63.72 70.29 2 50.00
22723. Glenn (nemenis) 4 63.72 73.62 0 0.00
22724. dafiyoung (dafiyoung) 62 63.71 78.24 14 22.58
22725. TryingToBeHooman (tryingtob... 15 63.71 79.15 5 33.33
22726. JjMiReLeS (jjmireles) 6 63.71 70.15 0 0.00
22727. Matin (jivago) 9 63.71 73.39 2 22.22
22728. Will (awesomeguy1427) 29 63.71 76.10 5 17.24
22729. Ketan (ketan_p01) 2 63.70 65.77 0 0.00
22730. Thomas (tjavi) 1 63.70 63.70 0 0.00
22731. Justin (shouganai_1243) 12 63.69 79.47 1 8.33
22732. Andrew (wtypo25) 4 63.69 69.10 0 0.00
22733. saad (saad88) 22 63.69 69.51 4 18.18
22734. Viniter (viniter_) 18 63.69 76.00 4 22.22
22735. Laith (chaoscontrol_jr) 744 63.69 87.44 210 28.23
22736. Gaphnix (gaphnix) 11 63.68 66.80 4 36.36
22737. Faisal (md_faisal) 62 63.68 83.04 20 32.26
22738. Free (just_free2318) 437 63.68 89.68 93 21.28
22739. krupa (krups) 22 63.68 84.15 3 13.64
22740. TheRyanatorGames (theryanat... 1 63.68 63.68 0 0.00
22741. Mahmoud (mahmoud_zaineldin) 45 63.68 80.32 8 17.78
22742. Friden (mrtokke) 20 63.68 77.22 5 25.00
22743. ZJG11 (zjg1) 5 63.68 73.84 2 40.00
22744. Conor (conorwalsh1601) 31 63.68 82.96 8 25.81
22745. Jay (dj_jay) 62 63.68 79.34 7 11.29
22746. P4t1enT (arya_juniko) 173 63.67 89.63 31 17.92
22747. sourabh (datikas) 24 63.67 69.33 5 20.83
22748. Chili (chilichonga) 15 63.67 73.30 2 13.33
22749. Noobie (nooobie_typer) 173 63.66 84.90 41 23.70
22750. Andy (run_from_andy) 142 63.66 79.97 23 16.20
22751. Jack (mopex) 10 63.66 75.95 2 20.00
22752. Lmnoq (lmnoq) 1 63.66 63.66 1 100.00
22753. Ishan (ishanxlr8) 3 63.66 73.25 1 33.33
22754. Mirtininkas (mirtininkas) 89 63.66 90.64 18 20.22
22755. kenestrophic (kenestrophic) 13 63.66 78.12 3 23.08
22756. Novotny (novynevi) 9 63.66 75.49 2 22.22
22757. Chih-hai (oceansfavor) 58 63.66 72.27 10 17.24
22758. Samuel (ssesena) 146 63.65 85.03 34 23.29
22759. Mamdouh (mamdouh_75) 248 63.65 80.10 54 21.77
22760. Charles (future965) 21 63.65 72.71 1 4.76
22761. Tushar (willingtushar) 4 63.65 72.17 1 25.00
22762. Yosa (uknowyosa) 1 63.65 63.65 1 100.00
22763. Im slow (justmecha) 16 63.65 84.48 6 37.50
22764. JackbroDaeGamer (jackbrothe... 22 63.65 75.57 7 31.82
22765. alan (alanlaw999) 4 63.65 82.90 2 50.00
22766. Akshat Aggarwal (master_mlnd) 3 63.65 69.80 1 33.33
22767. Saurav (srvsaha) 85 63.65 86.02 20 23.53
22768. Robert (b0ssofthisgym) 10 63.65 70.73 3 30.00
22769. Finally (finallyyes) 192 63.64 84.59 66 34.38
22770. Bruno (marmota07) 1 63.64 63.64 1 100.00
22771. Cameron (iliveinabox117) 62 63.64 81.42 9 14.52
22772. Bruh (hannibanani) 14 63.64 77.28 3 21.43
22773. Pupill (pupill) 9 63.64 71.95 7 77.78
22774. Viking (not_xp3og) 4 63.64 75.12 1 25.00
22775. Rohith (specialabyss6_) 2 63.64 65.74 0 0.00
22776. Sam (slimwhit) 8 63.63 66.68 1 12.50
22777. Dimitris (dimgag) 10 63.63 72.21 2 20.00
22778. Mohd (md_shariq1) 1 63.62 63.62 0 0.00
22779. Alfred (junior162007) 120 63.62 87.24 26 21.67
22780. Alex (therodge) 7 63.62 76.47 1 14.29
22781. vminh (tvmint) 103 63.62 80.44 25 24.27
22782. Shinuki (shinukiayato) 1 63.61 63.61 0 0.00
22783. Ross (rossmawd) 45 63.61 75.23 11 24.44
22784. Rafael (brafs165) 12 63.60 74.44 3 25.00
22785. Akshiet (learningworm) 2 63.60 66.88 0 0.00
22786. Michael (kedalg) 1,170 63.59 86.26 222 18.97
22787. ThePastor (pastor3974) 29 63.59 89.87 5 17.24
22788. pastarishi (pastarishi) 65 63.59 87.94 21 32.31
22789. Tea (teawee) 7 63.59 73.30 2 28.57
22790. kj (kellydebow) 90 63.59 87.37 19 21.11
22791. Mnohem (mnohem) 4 63.59 72.37 2 50.00
22792. Hadiff (abubu) 2 63.59 68.06 1 50.00
22793. Bruh? (funkun) 143 63.58 82.77 30 20.98
22794. Renato Emeric (renatoemeric11) 69 63.58 77.77 10 14.49
22795. Jake (wetfart1738) 9 63.58 71.90 4 44.44
22796. Bùi (thundergod1311) 132 63.57 81.48 30 22.73
22797. Jacob (pinpoint) 11 63.57 74.22 5 45.45
22798. Hai (hiitshai) 4 63.57 74.06 1 25.00
22799. Ri (rijizin) 7 63.57 69.93 1 14.29
22800. Amr (amr_alnas) 10 63.57 75.60 2 20.00
22801. tstats[rtupps] (rtupps) 59 63.56 84.67 9 15.25
22802. D. (dissonvnt) 41 63.56 84.21 6 14.63
22803. Speedwalker (speedwalker68) 21 63.56 74.65 2 9.52
22804. Ruka (snijders) 6 63.56 76.09 2 33.33
22805. Carlos (carlos_007) 32 63.56 75.91 8 25.00
22806. András (bundikah) 4 63.56 72.73 3 75.00
22807. Usman (usmanayubkhan) 15 63.55 76.46 1 6.67
22808. krs (krss) 47 63.55 76.97 15 31.91
22809. Lupescu (gigabite13) 1 63.55 63.55 0 0.00
22810. Brecken (breckenmueller) 13 63.55 72.29 3 23.08
22811. Parafinico (parafinico) 6 63.55 69.27 3 50.00
22812. Nils Backman (naip12) 12 63.54 87.15 4 33.33
22813. Alex (burningpain) 1 63.54 63.54 0 0.00
22814. guts (soupyguts) 1 63.54 63.54 0 0.00
22815. Jonas (jonasjul) 1 63.54 63.54 0 0.00
22816. Manas (who_mana) 147 63.53 77.04 35 23.81
22817. Sep (jltariman) 10 63.53 71.43 1 10.00
22818. RoSchnitzel (sab_lyptical42) 123 63.53 84.00 15 12.20
22819. Keira (keiramc) 1 63.53 63.53 0 0.00
22820. Sawataro (sawatar_o) 5 63.53 73.32 0 0.00
22821. Paolo (paolo23) 5 63.52 66.16 1 20.00
22822. Nishanth (nishanth_s) 7 63.52 71.25 1 14.29
22823. Murray (kamenz) 3 63.52 65.87 0 0.00
22824. Starmaster (starmasterx) 10 63.52 71.88 7 70.00
22825. Nishant (tarzanjunior) 11 63.51 73.05 4 36.36
22826. Isaac (tkdwarrior) 10 63.51 70.53 3 30.00
22827. Michael (michaelcox) 2 63.51 66.50 0 0.00
22828. Posa2000 (posa2000) 13 63.51 74.50 0 0.00
22829. Run (runring) 12 63.51 74.68 3 25.00
22830. Rido (ridoho) 48 63.50 82.35 14 29.17
22831. Templeton (templetontsai) 10 63.50 68.46 0 0.00
22832. Mach 20 (mach20) 49 63.50 80.62 10 20.41
22833. hack89 (hack89) 22 63.50 68.59 5 22.73
22834. Saruulbuyan (erozionzeal) 2 63.50 65.03 0 0.00
22835. Enrico (serafino89) 7 63.49 71.39 2 28.57
22836. UnreliableSpare (unreliable... 48 63.49 77.75 9 18.75
22837. LM (trashtocash) 26 63.49 76.56 3 11.54
22838. Joao Antonio (joaoagouveia) 1 63.49 63.49 1 100.00
22839. Timothy (timothy273) 26 63.49 75.00 7 26.92
22840. Satwik Kashyap (annhilat0r) 66 63.49 79.64 10 15.15
22841. Jason (samuraishinobi) 16 63.49 72.14 3 18.75
22842. Jack (balancedman) 5 63.49 77.38 0 0.00
22843. Rajan (icecoldreaper07) 5 63.49 69.83 0 0.00
22844. RB3 (rlbryant1982) 13 63.48 70.94 1 7.69
22845. Alex (skoda888) 185 63.47 81.13 40 21.62
22846. whaterman (whaterman) 15 63.47 78.50 8 53.33
22847. nikola (nikininja13) 17 63.47 79.07 4 23.53
22848. crooow (urrmomscockroach) 1 63.47 63.47 0 0.00
22849. Sergei (unicrus) 20 63.47 70.86 4 20.00
22850. Claudia (aaaaccdillruyz) 456 63.46 79.59 100 21.93
22851. Karl (karl_marx_1818) 65 63.46 90.14 14 21.54
22852. Lks (elluki) 1 63.46 63.46 1 100.00
22853. Venkata Sai Bhanu Sachin (b... 1 63.46 63.46 1 100.00
22854. Coughingmouse (cexora) 44 63.46 84.33 3 6.82
22855. Shimbo (shimbobaby) 28 63.45 80.47 19 67.86
22856. abi19911 (abi19911) 90 63.44 87.02 15 16.67
22857. Ivana (ivanab) 1 63.44 63.44 0 0.00
22858. Layo (layopro) 6 63.44 77.37 0 0.00
22859. Eric (joker4120) 36 63.43 79.83 8 22.22
22860. Charlie (l_plater) 1 63.43 63.43 0 0.00
22861. west (supernova_00) 194 63.43 87.52 32 16.49
22862. ramu kumar (ramu_kumar) 33 63.43 76.93 10 30.30
22863. Yogeshwar (mad_steins) 40 63.43 76.81 5 12.50
22864. zyf (zyf_) 2 63.42 64.98 0 0.00
22865. James (frodobaggins_) 18 63.42 75.84 5 27.78
22866. Sephiroth (jukethehitman) 317 63.41 94.41 61 19.24
22867. Matthew (drogoton) 10 63.40 75.90 3 30.00
22868. Liam (lime_da_bestest_colemak) 278 63.40 83.34 56 20.14
22869. muhammed (katsh) 16 63.40 80.33 4 25.00
22870. caleb the twig (caleb_the_t... 1 63.40 63.40 0 0.00
22871. Siberius (siberiusalpha) 26 63.40 76.80 7 26.92
22872. Gabriel (dekkoz) 159 63.39 78.50 24 15.09
22873. Samael Monserrat (wwmon) 1 63.39 63.39 1 100.00
22874. Andy (wah_wah_wah) 317 63.39 86.97 75 23.66
22875. knives (knives1117) 2 63.39 67.08 0 0.00
22876. Dylan (dylearn) 14 63.38 72.86 0 0.00
22877. Samo (samothepro) 4 63.38 70.42 4 100.00
22878. samy (samy_) 14 63.38 70.66 2 14.29
22879. Shayan (shanoo92) 51 63.38 83.59 26 50.98
22880. Nate (shortysama) 9 63.38 70.06 3 33.33
22881. clackity (phys1cs) 95 63.37 80.85 19 20.00
22882. Dexter (dexterkun16) 7 63.37 79.79 2 28.57
22883. feet (ant_1105) 2 63.37 67.60 0 0.00
22884. Rei (45kin) 2 63.37 73.00 0 0.00
22885. James (otes10) 14 63.36 71.53 1 7.14
22886. Nicky (charskun) 1 63.36 63.36 0 0.00
22887. Detha (detha_) 8 63.36 70.97 2 25.00
22888. nikki (nikki0420) 28 63.36 72.05 8 28.57
22889. ahmed (ahmed98) 17 63.36 76.22 2 11.76
22890. Marco (marquouo) 8 63.36 69.56 2 25.00
22891. Asma Azim (blackpanther_1) 14 63.35 70.42 4 28.57
22892. 77 (slithernoah) 7 63.35 77.05 1 14.29
22893. Aditya (prakashaditya) 101 63.35 72.65 20 19.80
22894. James (ryandaryno) 11 63.35 75.88 3 27.27
22895. Ava (argerami) 54 63.35 81.39 17 31.48
22896. based (thelettuceman) 3 63.34 66.04 0 0.00
22897. melanie (mellaniee) 4 63.34 69.39 0 0.00
22898. Josh (punyo) 1 63.34 63.34 1 100.00
22899. Nithish Kumar (nithish20) 2 63.34 64.51 0 0.00
22900. Black (blackt) 15 63.33 69.68 7 46.67
22901. Marvin (super_nam) 4 63.33 69.22 1 25.00
22902. Riadath (riadath) 5 63.32 67.14 0 0.00
22903. Vaughn (vlonebay) 3 63.32 64.48 1 33.33
22904. Eric (sumtypaway) 29 63.32 84.41 6 20.69
22905. Shrav (shravstars15) 4 63.32 70.37 0 0.00
22906. Steve (duckmuscles) 1 63.32 63.32 0 0.00
22907. The (theking2004p1y) 5 63.32 72.78 1 20.00
22908. Shai (shai15) 78 63.32 73.43 14 17.95
22909. Mufassir (hashtag_pro) 8 63.32 72.68 0 0.00
22910. reasonable (reasonablegoat) 4 63.31 67.19 0 0.00
22911. Vibhav (vibhav_1262) 112 63.31 84.29 25 22.32
22912. Eric (20wpmboi) 15 63.31 74.55 3 20.00
22913. Tommy (txmmy) 6 63.31 75.24 1 16.67
22914. S (saga_db) 1 63.30 63.30 0 0.00
22915. John (apathy_incarnate) 49 63.30 76.19 11 22.45
22916. Lyanne (stiftvilt) 6 63.30 69.36 0 0.00
22917. St1nk (st1nkk) 9 63.29 78.74 4 44.44
22918. Jainam (jainam123) 61 63.29 71.55 13 21.31
22919. Igor (disstream2) 75 63.29 72.84 16 21.33
22920. Arkajyoti (arkajyotijha) 2 63.29 67.79 1 50.00
22921. Matthew (rookie_avali) 4 63.29 81.50 0 0.00
22922. Ritesh (ritesh_98) 238 63.29 86.74 52 21.85
22923. Okh (okh10001) 188 63.29 79.24 40 21.28
22924. tstats[suraj03] (suraj03) 4 63.29 69.41 0 0.00
22925. Michael (michaell018) 10 63.28 74.19 3 30.00
22926. SnopeySnope (snopeysnope) 370 63.28 91.58 86 23.24
22927. Astricd (wunwun2468) 4 63.27 66.69 0 0.00
22928. Ngor (nagwick) 204 63.27 80.57 55 26.96
22929. Ceejay (ceejay3626) 1 63.26 63.26 0 0.00
22930. Learn to pro (learntopro) 49 63.26 73.66 8 16.33
22931. Mon (m_nguyen05) 41 63.26 73.72 10 24.39
22932. khlaid (kmaf) 30 63.25 84.38 6 20.00
22933. Reece Taylor (reeceybro28) 305 63.25 89.01 54 17.70
22934. Thun (thun10121) 6 63.25 76.79 1 16.67
22935. Dev (devparkk) 11 63.25 73.30 4 36.36
22936. Ashvik (llamma) 7 63.25 81.13 4 57.14
22937. leibniz (anamaya11) 45 63.25 75.53 9 20.00
22938. TNT92fin (tnt92fin) 142 63.24 76.72 24 16.90
22939. Will (carbohydra) 139 63.23 76.63 40 28.78
22940. JheMee (ayyjhey) 357 63.23 87.78 68 19.05
22941. Mohamed (camposha) 21 63.23 73.53 3 14.29
22942. Momen (momenarafa) 341 63.23 84.52 79 23.17
22943. Sumnima (sumnimal) 5 63.23 69.49 2 40.00
22944. Aidan (amess92304) 72 63.23 77.48 18 25.00
22945. gujjar (gujjarji) 165 63.23 86.20 35 21.21
22946. Yoav (yoav24681) 13 63.22 71.62 2 15.38
22947. Mohsen (mohsentypo) 46 63.22 74.60 17 36.96
22948. Caxix (caxix) 344 63.21 81.84 72 20.93
22949. Ridoy (rkprite09) 325 63.21 82.07 64 19.69
22950. boop (owiwchu) 21 63.21 72.16 2 9.52
22951. Isaac (isaacmnz2) 6 63.21 70.23 1 16.67
22952. Alonso (igoalonso) 12 63.20 75.70 3 25.00
22953. Nghĩa (dtnghia031199) 4 63.20 73.67 1 25.00
22954. Tide (firefly441) 146 63.20 80.67 40 27.40
22955. Nicolas (gauzy) 1 63.20 63.20 0 0.00
22956. ahmed (ahmedfoad246) 16 63.20 73.12 3 18.75
22957. Chris (bgy11) 2 63.20 72.57 0 0.00
22958. Prince Amir (orionic_arkhalis) 4 63.19 69.14 1 25.00
22959. Edu (edlofe) 124 63.19 84.05 29 23.39
22960. Bruh (bruhletuce) 20 63.19 72.75 6 30.00
22961. Chris (mils8545) 173 63.19 77.63 31 17.92
22962. Maserati (latitude_5a) 71 63.18 77.28 13 18.31
22963. Romin (rominpasa) 8 63.18 70.54 1 12.50
22964. Aaryn (ahong0319) 3 63.18 69.12 1 33.33
22965. Achintya (cubefreak777) 1 63.18 63.18 0 0.00
22966. Mohamed (mednoun) 44 63.18 72.10 5 11.36
22967. Samir (wickedl4ndo) 95 63.18 83.99 24 25.26
22968. J (ckfhd1234) 660 63.17 77.12 133 20.15
22969. tstats[mishras839392] (mish... 398 63.17 89.46 68 17.09
22970. Andrew (fffire) 1 63.17 63.17 0 0.00
22971. JEDIDIAH (dyna_myte) 3 63.17 69.45 0 0.00
22972. Hassan (hassanjazzy143) 45 63.17 72.98 5 11.11
22973. Lowell (lolwel21) 4 63.17 67.07 2 50.00
22974. mike (mike017) 2 63.17 66.02 1 50.00
22975. Zach (saccery) 2 63.16 63.94 2 100.00
22976. Viktor (lunken42) 5 63.16 76.22 0 0.00
22977. WILMER (handsometomato) 1,195 63.16 94.88 222 18.58
22978. Neyman-Pearson (zhenchao) 3 63.16 63.57 0 0.00
22979. Matteo (atteo1000) 386 63.16 101.09 79 20.47
22980. Lux (veyro) 31 63.15 73.35 10 32.26
22981. Aniket (aero81101) 18 63.15 75.15 2 11.11
22982. Tausif (fishey3) 43 63.15 81.36 8 18.60
22983. gurzil (gurzil) 8 63.15 72.90 0 0.00
22984. Márton (marconka) 3 63.14 73.58 1 33.33
22985. Angel (olivias69) 46 63.14 70.96 8 17.39
22986. aver (aversioneer) 36 63.14 76.69 5 13.89
22987. Regan (smalltymehero) 29 63.14 73.04 5 17.24
22988. Lily (lilythemc) 12 63.14 73.81 0 0.00
22989. Lorky (lorkylav) 10 63.14 71.86 4 40.00
22990. Harry (qqwwddvv852) 16 63.13 75.62 3 18.75
22991. Jakob (jakobgran) 40 63.13 80.59 9 22.50
22992. RAVINDER (rsainichd) 6 63.13 69.21 2 33.33
22993. Yanni (yannishams) 105 63.13 80.82 32 30.48
22994. MrConvoluted (theduckman) 4 63.13 67.11 1 25.00
22995. Aaron (akuch32) 8 63.13 68.59 2 25.00
22996. Márton (marcityperacer) 62 63.13 78.57 18 29.03
22997. Radu (radutist) 1 63.12 63.12 0 0.00
22998. David (u_david) 3 63.12 65.66 2 66.67
22999. Marc (thygreat) 6 63.12 71.39 6 100.00
23000. lollylols1 (lollylols1) 3 63.12 67.72 1 33.33
23001. MrPoop (mother_lover) 48 63.11 77.28 10 20.83
23002. OTL (floormint) 35 63.11 69.79 7 20.00
23003. Murali (muraliprasanth) 4 63.11 70.36 1 25.00
23004. Josh (josh_carlin) 40 63.11 78.61 8 20.00
23005. Marc (marcp3k) 1 63.11 63.11 1 100.00
23006. Drago (dragosan) 3 63.11 68.33 2 66.67
23007. Matteo (dogshitteo) 4 63.11 72.00 0 0.00
23008. be4r (be4r_) 30 63.11 71.10 3 10.00
23009. God (nicechop) 18 63.11 71.61 2 11.11
23010. kalisto (kalisto) 70 63.11 76.21 10 14.29
23011. Ralston (ralstonnub) 134 63.11 80.68 35 26.12
23012. Kyryll (kiruxaker) 6 63.10 69.93 1 16.67
23013. Yokaii (rartiko) 12 63.10 75.81 0 0.00
23014. Dzulfikar (dzulfikaraf) 1 63.10 63.10 0 0.00
23015. Lili (candazaac) 4 63.10 68.46 0 0.00
23016. NC3 (nickkcastaneda) 37 63.10 81.42 13 35.14
23017. Jodye (vice_pat) 14 63.09 73.20 3 21.43
23018. lhdrive (kickmic) 931 63.09 85.92 189 20.30
23019. Karina (kmontellano) 2 63.09 70.70 0 0.00
23020. Aryan (aryan_16) 70 63.09 74.93 11 15.71
23021. G Dragon (g.w.l.griffiths@b... 23 63.08 76.97 5 21.74
23022. Kalin (kalin_a) 44 63.08 73.69 8 18.18
23023. Matthew (mmongillo) 53 63.08 74.16 12 22.64
23024. Honda (konradowtf) 15 63.08 72.29 3 20.00
23025. Ahmed (uproo) 32 63.08 80.86 8 25.00
23026. Fin (resarded) 34 63.08 85.66 10 29.41
23027. Soni (soni801) 1 63.08 63.08 0 0.00
23028. Amr (amrstien) 15 63.08 74.55 3 20.00
23029. Linda (lindanguyen_) 4 63.08 72.32 1 25.00
23030. ko (nakanidashite) 41 63.08 85.91 12 29.27
23031. Samuel (slee2) 38 63.08 81.66 4 10.53
23032. Mr. (superfat) 31 63.07 75.11 4 12.90
23033. MysticNovaLord (mysticnoval... 61 63.07 89.59 16 26.23
23034. Wendy (wracicot) 4 63.07 67.86 1 25.00
23035. !dreamer#9577@dscrd (jaixhi... 34 63.06 77.68 8 23.53
23036. Ahnaf (ahnaf_goku) 6 63.06 68.22 3 50.00
23037. JoePuttatoe (joeputtatoe626_) 80 63.06 86.93 20 25.00
23038. Daito (daitozen) 4 63.06 65.70 1 25.00
23039. Sheep (sheeplmao) 5 63.06 68.64 1 20.00
23040. Fábio (vallkorion) 75 63.06 74.29 17 22.67
23041. ProBlasters (pro_blasters) 10 63.06 76.56 4 40.00
23042. Hagen (hag3nl) 31 63.06 70.23 8 25.81
23043. opintial (opintial) 3 63.06 63.93 0 0.00
23044. Mr. (mrgoldenball) 2 63.06 63.23 1 50.00
23045. gauraav (genesisck9) 2 63.06 63.45 1 50.00
23046. Jeannie (jeanniejackson) 450 63.05 86.56 102 22.67
23047. Varun Goyal (govarun) 26 63.05 73.07 5 19.23
23048. Stewart (timberland9x) 10 63.05 83.95 0 0.00
23049. Ryan (lindaluhu) 5 63.04 75.45 2 40.00
23050. KronosBruh (kronosbruh) 40 63.04 86.20 7 17.50
23051. Andrew (joe_exotic6969) 14 63.03 72.57 1 7.14
23052. Blade_s0567 (mar_s) 14 63.03 77.25 3 21.43
23053. Gianmarco (gianma) 10 63.02 75.96 0 0.00
23054. ROOZBEH (verybadboy) 211 63.02 89.59 37 17.54
23055. Hasibuan (voyager28) 14 63.01 75.61 4 28.57
23056. Max (maxaldo) 6 63.01 77.67 2 33.33
23057. Heper (hepersopon) 5 63.01 67.29 0 0.00
23058. codeless (codeless) 1 63.01 63.01 0 0.00
23059. Faiq (faiq_lak) 329 63.01 93.11 75 22.80
23060. Igor (igorfardoc) 6 63.00 67.02 1 16.67
23061. Spencer (silentfoe9) 17 63.00 71.16 7 41.18
23062. vormin (vormin) 19 63.00 72.46 5 26.32
23063. grac (gracthegrac) 8 63.00 77.21 4 50.00
23064. Emperor (aranjani) 196 63.00 83.71 41 20.92
23065. Beeymax (mayumii) 4 63.00 71.38 1 25.00
23066. Irfan (irfan_is_the_best) 399 62.99 78.00 85 21.30
23067. Atlas (atlaskd) 1 62.99 62.99 0 0.00
23068. yusuf (barackobunga) 2 62.98 66.58 0 0.00
23069. Sans (s4nsx) 11 62.98 73.17 4 36.36
23070. zalpro (zalpro) 25 62.98 77.19 4 16.00
23071. Annie (annie48) 46 62.98 72.91 11 23.91
23072. Joshua (magic_happened) 5 62.98 73.99 1 20.00
23073. allison (_allisonsun) 25 62.98 73.15 5 20.00
23074. totaland (totaland) 47 62.97 75.38 8 17.02
23075. Benny (bennyni101) 10 62.97 70.58 1 10.00
23076. hi (wmc2000) 2 62.97 63.19 1 50.00
23077. tstats[mishrakunal012] Kuna... 1 62.96 62.96 0 0.00
23078. Malchez Link (malchez) 28 62.96 77.95 5 17.86
23079. Vishwajeet Prasad (vishwaje... 232 62.95 82.22 69 29.74
23080. Henry (hongquan448) 24 62.95 74.42 5 20.83
23081. sebi (ysebi) 30 62.95 73.01 6 20.00
23082. jojodoru (oshihiteo) 3 62.95 65.21 2 66.67
23083. wood warrior (wood_warrior) 26 62.95 73.98 5 19.23
23084. Ravel (raveltan) 82 62.95 73.82 20 24.39
23085. Emil (mielies1) 3 62.95 65.16 0 0.00
23086. Tony (garutoh) 2 62.95 72.46 1 50.00
23087. Asbestos (swarmfirehd) 7 62.94 74.83 5 71.43
23088. issac (tanthanhkaka) 5 62.94 67.86 1 20.00
23089. Ima (ima_baka) 1 62.94 62.94 0 0.00
23090. bweb (bweb) 5 62.94 84.11 1 20.00
23091. nitram (kros9987) 31 62.93 74.77 4 12.90
23092. Somto (megamined) 110 62.93 79.33 15 13.64
23093. Ahmed (raiyan369999) 1 62.93 62.93 0 0.00
23094. Prithbiraj (prithy) 930 62.93 90.33 239 25.70
23095. Jim (jimdavia99) 11 62.93 69.59 2 18.18
23096. Tams (tamstams16) 4 62.93 70.54 2 50.00
23097. pitch (znxxx) 6 62.92 67.77 0 0.00
23098. Pavel (fugives) 10 62.92 77.97 7 70.00
23099. Balazs (balazs11) 4 62.92 73.74 0 0.00
23100. Yunus Emre (yemre95) 45 62.91 81.30 6 13.33
23101. K (wh0mst) 31 62.91 73.50 4 12.90
23102. REs (reessss) 3 62.91 66.60 0 0.00
23103. Petar (monkeypants274) 13 62.91 68.32 3 23.08
23104. Ali (its_alihosam) 5 62.91 71.37 3 60.00
23105. mou.saam(insta) (mousamlimbu) 92 62.91 81.16 34 36.96
23106. chakuch (chakuch) 9 62.90 84.18 1 11.11
23107. Daggy (daggygod) 1 62.90 62.90 0 0.00
23108. Niggo (virtualnick) 1 62.90 62.90 0 0.00
23109. Suttikoon (suttikoonpp) 15 62.90 78.18 3 20.00
23110. Benjamin (benjaneb) 4 62.89 71.63 0 0.00
23111. Joesph (joecool3) 8 62.89 74.02 1 12.50
23112. Chinsetgel (chinsetgel_mgl_3) 15 62.89 72.51 1 6.67
23113. Indian hacker man (asain_du... 99 62.89 80.45 17 17.17
23114. mark (chuahuonga) 19 62.88 76.36 3 15.79
23115. nhim (chikiro) 52 62.88 83.20 7 13.46
23116. Hữu Tiến (huutienbk) 4 62.88 68.24 0 0.00
23117. Ivan (ivanv1997) 128 62.88 72.06 21 16.41
23118. Torben (hansi36) 9 62.88 71.73 7 77.78
23119. hetang (typr_1) 101 62.88 76.47 33 32.67
23120. Bryan (xoticfate) 1 62.88 62.88 1 100.00
23121. jay (jayyelle) 2 62.88 70.29 0 0.00
23122. Artis (formoned) 1 62.88 62.88 1 100.00
23123. BonkyKayn (bonky_kayn) 2 62.88 66.50 1 50.00
23124. Martin (ostlangarn) 10 62.88 68.66 2 20.00
23125. Abulqadir (kaore) 3 62.88 64.68 1 33.33
23126. Patrik (pgdth) 8 62.88 70.45 3 37.50
23127. Ahmad Gamal (agazzaz) 8 62.88 68.58 1 12.50
23128. Nurbek (cheburekkek) 11 62.87 72.12 2 18.18
23129. Garvit (garvitar) 3 62.87 69.16 1 33.33
23130. Wael ಠಿ_ಠ (wael199) 68 62.87 83.46 45 66.18
23131. Duck (ducklist) 6 62.87 77.49 3 50.00
23132. Abdullatif (ak_type_master) 88 62.87 73.73 10 11.36
23133. sk (kasem132) 243 62.87 81.56 49 20.16
23134. jesad (jesadilvan) 20 62.87 75.20 6 30.00
23135. Gabriel (gabrielke) 3 62.86 65.02 1 33.33
23136. Gawiweu (edugg98) 28 62.86 78.32 8 28.57
23137. Kaden (lifeshappy) 147 62.86 83.41 37 25.17
23138. Maters (maters48) 1,109 62.86 86.95 210 18.94
23139. MoreZigLessZag (morezig) 56 62.86 78.11 14 25.00
23140. riggers (riggers) 30 62.85 81.35 6 20.00
23141. Toby (ratolp) 2 62.85 64.06 0 0.00
23142. Penguin (penguint) 2 62.85 69.11 1 50.00
23143. John (dyst0pia) 36 62.85 76.86 26 72.22
23144. Jafer (jafer2000) 13 62.85 78.09 1 7.69
23145. Kevin (kevgelblitz) 3 62.84 64.45 0 0.00
23146. Gabber (gabbergandalf) 11 62.84 67.87 3 27.27
23147. Anuar (silver_anubis) 6 62.84 67.68 2 33.33
23148. Alex (whitehoundd) 1 62.84 62.84 0 0.00
23149. Baibars (sazin_me) 16 62.84 70.92 7 43.75
23150. Ashen (ashencone) 58 62.84 74.01 10 17.24
23151. Ser (juzser) 7 62.84 66.60 2 28.57
23152. Abdullah (bunajim) 40 62.84 80.58 12 30.00
23153. Sigurdur (siggi84) 7 62.84 69.10 5 71.43
23154. Arian (arianrz82) 148 62.83 82.06 32 21.62
23155. Iverson (iverson28) 4 62.83 64.93 1 25.00
23156. Xavier (redanky) 13 62.82 69.36 3 23.08
23157. Leonardo (leo121) 165 62.82 77.03 33 20.00
23158. (sherixn) 4 62.82 71.34 0 0.00
23159. Blu (blu_mint) 5 62.82 69.23 1 20.00
23160. Haider (hiderbider) 1 62.82 62.82 0 0.00
23161. Growtopia (growtopiagt) 4 62.82 72.68 2 50.00
23162. Deni (zingaraaa) 106 62.81 75.46 23 21.70
23163. Mark (tehone4u) 63 62.81 81.39 15 23.81
23164. Daniel (speks97) 2 62.81 65.15 0 0.00
23165. aEr0 (_aero) 110 62.80 76.35 22 20.00
23166. Richit (richit690) 186 62.80 87.34 37 19.89
23167. Kutay (batselot) 14 62.80 72.14 3 21.43
23168. Ahmed (elghrbawy) 2 62.80 64.70 1 50.00
23169. david (davidbeshay) 1 62.79 62.79 0 0.00
23170. Daulet (daukabase) 21 62.79 76.99 3 14.29
23171. Bika (bikaandrow) 2 62.79 67.96 0 0.00
23172. Addis (mryoungaddis) 19 62.78 74.75 2 10.53
23173. Guest (nherbe_3) 219 62.78 91.45 40 18.26
23174. Teddy (rampagingteddy) 10 62.78 69.10 1 10.00
23175. Kevin (chips1337) 1 62.78 62.78 1 100.00
23176. mahdy (mahdy7) 7 62.78 72.73 1 14.29
23177. Springfield (springfield1903) 591 62.77 87.37 151 25.55
23178. alixsch (alixsch) 9 62.77 76.70 5 55.56
23179. Mahmudul Hasan🕋🕌 (abo... 11 62.76 76.06 0 0.00
23180. Jason (jasew) 21 62.75 91.63 4 19.05
23181. AKIS (harkar) 123 62.75 79.12 29 23.58
23182. Eric (martellen) 1 62.75 62.75 0 0.00
23183. JeiJei (jemjem09) 14 62.75 77.99 4 28.57
23184. Liko (likofortino) 8 62.75 75.78 5 62.50
23185. Thirdy (thirdsus) 4 62.75 67.59 0 0.00
23186. Ramya (envisage) 7 62.74 70.31 1 14.29
23187. Prdel (dendritic_cell) 34 62.74 69.68 9 26.47
23188. Matheus (coelhow) 2 62.74 65.07 0 0.00
23189. Felipe (felipe2896) 5 62.74 79.39 1 20.00
23190. v33 (__v33__) 24 62.74 72.64 3 12.50
23191. Jake (laketype) 425 62.73 84.26 73 17.18
23192. Daniel (daniel_ga_1309) 3 62.73 67.21 2 66.67
23193. Max (axe_) 4 62.73 66.36 2 50.00
23194. Isak (stitchy_) 30 62.73 83.31 10 33.33
23195. Agent (jterzian2) 4 62.73 67.74 0 0.00
23196. Dai ca (porrydeptrai) 8 62.73 83.67 7 87.50
23197. Jason (airify) 3 62.72 68.36 3 100.00
23198. rainmaker (rainmaker6) 8 62.72 70.53 0 0.00
23199. eroblaze (eroblaze) 5 62.72 68.91 0 0.00
23200. Josh (jshearer34) 8 62.72 72.81 1 12.50
23201. Kunihiko (keuno) 31 62.72 72.90 7 22.58
23202. Jed (jedaiski) 3 62.71 65.41 1 33.33
23203. Zack (averyackz) 32 62.71 85.23 8 25.00
23204. Joe (imatschoolrn123) 6 62.71 66.52 0 0.00
23205. Alex (ramini0000) 12 62.71 68.95 2 16.67
23206. Hashem (hashem__) 4 62.71 64.88 0 0.00
23207. Anik (eternatus) 134 62.70 74.70 36 26.87
23208. Yassin (meddyassin) 25 62.70 77.10 7 28.00
23209. Yuval (yuvf) 1 62.70 62.70 1 100.00
23210. Nathan (memewhat123) 58 62.69 77.17 7 12.07
23211. Long (longgho) 7 62.69 75.29 2 28.57
23212. TO THE MOON (wart) 25 62.69 72.89 5 20.00
23213. Jack (jx34tech) 92 62.69 87.97 18 19.57
23214. Elias (elias_17) 10 62.68 76.26 3 30.00
23215. Gus (battm4n) 10 62.68 75.55 2 20.00
23216. Robert (bobbert_63) 1 62.68 62.68 0 0.00
23217. Asylkhan (beeppuck) 4 62.68 66.27 0 0.00
23218. Karolis (karolingas01) 3 62.68 64.49 1 33.33
23219. Alyssa (destroyer090) 47 62.68 76.82 4 8.51
23220. Saket (saketraj) 74 62.68 74.42 10 13.51
23221. Raffa (raffadanendraa) 377 62.67 86.98 76 20.16
23222. lunarised (lunarised) 23 62.67 71.71 7 30.43
23223. Luis (luismec90) 93 62.67 89.49 26 27.96
23224. yessine (yessine14) 37 62.66 77.81 9 24.32
23225. sofia (zoophyy) 5 62.66 83.25 3 60.00
23226. Thomas (tumpz) 2 62.66 64.56 2 100.00
23227. Koosh (kooshatron) 5 62.65 66.48 3 60.00
23228. Benjamin (benjaminsanta) 181 62.65 83.80 44 24.31
23229. USS Freedom (sfmqur) 6 62.65 66.98 2 33.33
23230. leon (bangingmyheadonthewall) 51 62.65 83.51 8 15.69
23231. Aditya (aditya23112002) 5 62.65 66.42 1 20.00
23232. VoiceOfTheWorld (voiceofthe... 84 62.64 77.93 17 20.24
23233. John (johndzxu) 11 62.64 71.05 2 18.18
23234. DINKL3B3RGG (cosmovt) 103 62.64 79.64 20 19.42
23235. Timothy (smithtimmytim) 3 62.64 64.33 2 66.67
23236. Aether (aetherkiller) 3 62.64 69.02 1 33.33
23237. Vaibhav (genius6) 28 62.63 84.02 11 39.29
23238. Harsh (rao_shab2000) 1 62.63 62.63 1 100.00
23239. Gat (gatmonke) 10 62.63 69.69 0 0.00
23240. Sukh Singh (ssothegreat) 8 62.62 77.47 8 100.00
23241. allie (oatmilf22) 44 62.62 83.78 11 25.00
23242. R (rc_da) 336 62.61 79.40 46 13.69
23243. Xoi (roynadhiier) 3 62.61 65.84 1 33.33
23244. Tukanoo (tukano) 13 62.60 71.68 2 15.38
23245. kian (aryanboy) 1 62.60 62.60 0 0.00
23246. Matthew (allotec) 7 62.60 73.17 1 14.29
23247. ArV (_arv_) 30 62.59 70.62 6 20.00
23248. ISeeRed (iseered) 23 62.59 73.92 5 21.74
23249. David (vgodtyper) 2 62.59 62.82 0 0.00
23250. Alex (alexsoldier122) 1 62.59 62.59 0 0.00
23251. christine (just_trying_to_g... 9 62.59 77.94 1 11.11
23252. Abum (abum) 7 62.59 76.36 1 14.29
23253. Ted (ted3x) 13 62.58 71.51 6 46.15
23254. Petrus (clavigerpc) 133 62.58 83.59 32 24.06
23255. liv (livlyf_) 10 62.58 68.75 1 10.00
23256. Génesis (gen1310) 1 62.57 62.57 0 0.00
23257. Asrar (cruzen) 26 62.56 73.47 3 11.54
23258. maaeab (moemenahmed) 1 62.56 62.56 0 0.00
23259. Nick (shiningspark) 2 62.56 71.12 0 0.00
23260. Diego (snkybkyloike) 45 62.56 79.76 8 17.78
23261. Lavish (lavish10) 17 62.55 75.12 3 17.65
23262. megghraj (thegame365) 24 62.55 77.18 2 8.33
23263. Amy (amyt11) 2 62.55 72.18 0 0.00
23264. Eric (ericlauchiho) 47 62.55 79.71 8 17.02
23265. helios (helios69) 7 62.55 72.28 0 0.00
23266. touko.ursin (oikipoiki) 68 62.55 72.85 17 25.00
23267. Ashish (ashish14) 7 62.55 71.79 1 14.29
23268. Matt (matfia22) 4 62.55 68.61 0 0.00
23269. Yokubo (kontentlust) 4 62.55 64.72 1 25.00
23270. Mars (cerullo) 1 62.54 62.54 0 0.00
23271. Playboifarti (playboifarti) 19 62.54 77.96 3 15.79
23272. WIll (wiillikeer) 14 62.54 70.44 12 85.71
23273. PAW (paw_sensei) 12 62.53 71.78 2 16.67
23274. Lorenzo (cool_and_good) 8 62.52 67.34 1 12.50
23275. David (davejiggy) 32 62.52 75.09 5 15.63
23276. Aaron (rondc108) 140 62.52 81.43 39 27.86
23277. Jesus (jesus08) 16 62.52 72.14 5 31.25
23278. ¹°”ˆ˜¨ 𝐎ϻ ¨˜ˆ... 6 62.52 73.04 2 33.33
23279. naruto (shahzadak09) 3 62.52 70.25 3 100.00
23280. Ulises (umoreno) 17 62.52 69.77 3 17.65
23281. Oncom (oncomlz) 5 62.51 81.77 1 20.00
23282. E. (esheby) 30 62.51 72.56 5 16.67
23283. Antony819 (antony819) 2 62.51 69.28 1 50.00
23284. robby (tddvorak) 175 62.50 92.18 34 19.43
23285. Nilanjan (nilthedev) 287 62.49 86.02 55 19.16
23286. Mangopod (mangopod_) 23 62.49 75.50 6 26.09
23287. Bayu (bayoudra) 6 62.48 73.24 3 50.00
23288. Pablo_35 (pablo35) 3 62.48 69.72 1 33.33
23289. Travis (drather) 6 62.48 66.85 3 50.00
23290. saeed (saeedhosam) 144 62.47 83.14 31 21.53
23291. utsab (utsab987) 563 62.47 82.16 104 18.47
23292. Azizbek (azizbek00) 178 62.47 79.41 34 19.10
23293. Luka (lilsmole) 1 62.47 62.47 0 0.00
23294. Tim (cupboard) 16 62.47 92.64 0 0.00
23295. Kary (karygerxd) 6 62.46 73.19 0 0.00
23296. Junior (corpseslayer) 6 62.46 66.85 3 50.00
23297. Iocus (tisabay) 34 62.46 83.61 3 8.82
23298. Vivek (vivek62) 94 62.46 79.70 18 19.15
23299. Blitz Anschlag (blitzanschlag) 62 62.46 79.08 12 19.35
23300. Gabriel (ryulzaki) 28 62.46 85.54 6 21.43
23301. Morty (moothemighty) 4 62.46 66.79 3 75.00
23302. Aman (amansharma10) 27 62.45 74.86 5 18.52
23303. Daniel (fun1905) 1 62.45 62.45 1 100.00
23304. Biplob (biplob_phukan) 1 62.45 62.45 0 0.00
23305. Sanjar0126 (sanjar0126) 28 62.45 73.64 10 35.71
23306. Cucu (cucu_grey) 36 62.44 72.44 7 19.44
23307. Elijah (elijahp24) 21 62.44 75.71 5 23.81
23308. to sam ja (ivanbire) 3 62.44 75.88 0 0.00
23309. duglass (rahafduglass) 210 62.43 84.02 46 21.90
23310. Guber (guberxz) 30 62.43 73.55 9 30.00
23311. Florian (florianfor3) 1 62.43 62.43 0 0.00
23312. suddernpy (suddernpy) 65 62.43 77.90 20 30.77
23313. Liam (liamc2) 16 62.42 74.73 2 12.50
23314. Nadav (nadavb9) 150 62.42 97.22 36 24.00
23315. Roi (roi1255) 14 62.42 69.74 3 21.43
23316. Priyanshi (priyanshi_gupta) 162 62.42 80.17 34 20.99
23317. Ravindra (ravindrats) 128 62.42 75.49 19 14.84
23318. Hammad (sonic_slow) 1 62.42 62.42 1 100.00
23319. tstats[easybeef] (easybeef) 44 62.42 80.11 5 11.36
23320. Alex (zyt3ch) 4 62.42 84.54 1 25.00
23321. Chris (chrisp3oh) 5 62.41 70.81 0 0.00
23322. Kellan (krusher7) 15 62.41 71.72 2 13.33
23323. _ (2sloww) 23 62.41 72.21 4 17.39
23324. gusher (wizardlordbob) 93 62.40 77.98 16 17.20
23325. Cuong (qt1003) 137 62.40 83.16 24 17.52
23326. Gianluca (butter_waffle) 1 62.40 62.40 0 0.00
23327. Justin (asianplayz) 2 62.40 64.55 0 0.00
23328. Jenny (key_board_cat) 1 62.40 62.40 1 100.00
23329. sharaf (sharaf_makk) 788 62.40 80.90 137 17.39
23330. KilinWei (kilinwei) 73 62.39 74.09 19 26.03
23331. Rajveer (typerfastboi27_) 22 62.39 85.13 5 22.73
23332. nitro (nitrocircus) 8 62.39 71.19 2 25.00
23333. Big (kralefegaming) 10 62.39 72.87 2 20.00
23334. AmbrosiA (ambrosialeeann) 9 62.39 70.58 2 22.22
23335. Stacks (_stacksqueue2) 28 62.39 77.73 6 21.43
23336. Ficfiris (ficfiris) 55 62.38 72.94 10 18.18
23337. Ravindu (ravindu08) 55 62.38 75.68 11 20.00
23338. Hugo (21039) 23 62.37 73.88 4 17.39
23339. Rafid (rafid20) 2 62.37 64.63 0 0.00
23340. _trillbits_ (trillbits) 7 62.36 66.87 1 14.29
23341. Matthew (steviewonderful) 5 62.36 67.50 2 40.00
23342. Niv (nivkapadia) 48 62.36 77.66 13 27.08
23343. Jayden (jayden_1) 7 62.36 72.11 1 14.29
23344. Ian (zento_x) 37 62.35 72.81 5 13.51
23345. area_51 (amritspkt65) 22 62.35 76.13 5 22.73
23346. Boo (boo42069) 105 62.35 83.38 31 29.52
23347. Skewlankus (skewlankus) 48 62.34 79.15 11 22.92
23348. perm (perm_typeracer) 31 62.34 72.55 3 9.68
23349. fakedpoet (fakedpoet) 76 62.34 72.34 10 13.16
23350. Byungil (skylord418) 1 62.34 62.34 0 0.00
23351. Nasir (nasir_hussain) 11 62.33 73.65 3 27.27
23352. ROWLAND (rownet) 73 62.33 76.25 14 19.18
23353. FJB (joyousmischief) 1 62.33 62.33 0 0.00
23354. kill_palestine (hellisgood) 756 62.32 81.88 166 21.96
23355. Alvin (kishoarima) 27 62.32 71.27 4 14.81
23356. Matt (mattyrice) 4 62.32 74.38 0 0.00
23357. stickyrice (aaawiiee) 1 62.32 62.32 0 0.00
23358. James (jynx0) 7 62.31 68.19 2 28.57
23359. Joshua (joshuamtinker) 22 62.31 87.21 3 13.64
23360. Kuma (kumatero1) 26 62.31 75.93 5 19.23
23361. Shervin (shervin_typing) 1 62.31 62.31 0 0.00
23362. baby (babyshadow) 390 62.30 85.03 91 23.33
23363. Exxotix (exxotix) 36 62.30 90.93 16 44.44
23364. Cesar (messyces) 1 62.30 62.30 1 100.00
23365. Lakos (vanlakos) 2 62.30 64.73 1 50.00
23366. maestro (maestro2048) 8 62.29 69.90 3 37.50
23367. Eifie (eifietheward) 19 62.29 88.50 2 10.53
23368. syz (syzzzzzzz) 30 62.29 78.08 3 10.00
23369. kassionitro (kassionitro) 4 62.29 70.14 1 25.00
23370. hideki (llawlietswaifu) 6 62.29 72.50 1 16.67
23371. cj (cjanti) 3 62.29 69.65 2 66.67
23372. φσ (phi_sigma) 956 62.29 81.65 191 19.98
23373. Max (xdevilwastaken) 3 62.28 69.20 0 0.00
23374. Jake (jdogcat1) 50 62.28 79.84 9 18.00
23375. Ali (naseria1) 39 62.28 80.64 10 25.64
23376. Gilbert (gargoyletabbi) 485 62.28 83.90 99 20.41
23377. Cojo (zagoat) 10 62.27 70.51 1 10.00
23378. Austin (teddy_0351) 3 62.27 67.75 2 66.67
23379. Rabia (abdessalam) 19 62.27 68.83 1 5.26
23380. Sam (live2cube) 3 62.27 64.33 0 0.00
23381. Proxima (proxima009) 9 62.27 66.39 4 44.44
23382. Arslan (malikarslan) 24 62.27 80.47 7 29.17
23383. Joshua (mis_hurd) 2 62.27 64.36 0 0.00
23384. Jugemu (yerden01) 4 62.27 66.69 1 25.00
23385. Alex (alexwpm) 83 62.26 81.84 15 18.07
23386. yen (yennn) 141 62.26 82.47 24 17.02
23387. Σπύρος (asos11) 1,020 62.26 91.38 198 19.41
23388. artist (apg21092002) 417 62.26 85.03 75 17.99
23389. Rasul (rasulyakhyaev) 2 62.26 64.49 1 50.00
23390. Mario (mrio) 4 62.26 71.85 1 25.00
23391. Avinash (avee_nash) 7 62.25 73.06 1 14.29
23392. kelian (kekelian) 15 62.25 68.11 3 20.00
23393. Marc (tomatenmarc) 59 62.25 80.39 11 18.64
23394. jungle_cruser (redscorn) 62 62.25 71.72 9 14.52
23395. Milton (shurikenronlojd) 6 62.25 76.93 3 50.00
23396. Hasan (hasanpranto) 6 62.24 67.15 1 16.67
23397. Sue (suevang) 19 62.24 78.76 2 10.53
23398. Yes (grovymango) 1 62.24 62.24 0 0.00
23399. fang (fangyibkk) 5 62.24 71.85 0 0.00
23400. rat (lilratbb) 5 62.23 77.63 1 20.00
23401. noah (armedwhale) 3 62.23 66.60 1 33.33
23402. Haji (fart_dude) 3 62.22 65.21 0 0.00
23403. im bored (googooalp) 61 62.22 80.26 16 26.23
23404. Jack (jack_ery) 1 62.22 62.22 0 0.00
23405. Satakun (game_of_charging) 1 62.21 62.21 0 0.00
23406. prehistoriczebra (penguin45) 44 62.21 84.74 13 29.55
23407. Taylor (falceb) 4 62.21 89.28 1 25.00
23408. A (akane49) 85 62.21 76.63 22 25.88
23409. Abas (abasf14687) 26 62.20 80.39 9 34.62
23410. Ali (kraken_wrath) 11 62.20 76.04 2 18.18
23411. InvisWasTaken (inviswastaken) 3 62.20 68.90 1 33.33
23412. VijayaKumar (intvijay) 2 62.20 63.39 1 50.00
23413. Vin (gracien) 11 62.19 69.47 2 18.18
23414. Typer (pjottur) 92 62.19 76.73 17 18.48
23415. Tâm (letam120300) 1 62.19 62.19 0 0.00
23416. Kris (krilleliten) 4 62.19 69.79 0 0.00
23417. Caio (raposo) 12 62.19 70.93 3 25.00
23418. Rose (thehashparticle) 2 62.19 63.47 0 0.00
23419. Randy (hype_rion) 19 62.18 83.28 3 15.79
23420. Daniel (swietlikkielce) 72 62.18 84.78 15 20.83
23421. hassanal (scarymonstrs) 4 62.18 69.24 2 50.00
23422. Jun Wen (junwen) 3 62.18 70.39 0 0.00
23423. Matias (mazubazu) 4 62.18 71.72 1 25.00
23424. Rage (ragelad) 387 62.18 101.17 73 18.86
23425. Max (maxpoppe) 4 62.18 64.70 0 0.00
23426. Akizumi (linaaron) 176 62.18 92.48 39 22.16
23427. Chan (sc_chan) 2 62.18 66.22 1 50.00
23428. Mekrigen (mekrigen) 36 62.17 73.53 7 19.44
23429. manthan (manthan123) 327 62.17 83.55 71 21.71
23430. kek (slongdongbong) 11 62.17 68.98 2 18.18
23431. Nicholas (denicholas) 14 62.17 73.16 5 35.71
23432. Elgamal (elgamal) 162 62.17 86.27 31 19.14
23433. Locomotion22 (locomotion22) 71 62.16 85.55 16 22.54
23434. RyZe (ryzehopz) 32 62.16 80.30 10 31.25
23435. LogicBS (logicbs) 340 62.16 84.02 72 21.18
23436. Sameer (sameercarpenter) 101 62.16 77.14 21 20.79
23437. leem (xpar65) 6 62.16 65.43 2 33.33
23438. Santhosh (54nth05h) 20 62.15 74.50 7 35.00
23439. Sofia (lazebrakmata) 2 62.15 64.70 0 0.00
23440. Sahaj (sahaj01) 219 62.15 80.34 44 20.09
23441. THE STARDUST (void07) 32 62.15 79.19 7 21.88
23442. Vera (verabee9183) 44 62.15 79.52 9 20.45
23443. William (willyutoo) 6 62.15 64.62 0 0.00
23444. Omar (omarkhair) 16 62.14 70.09 3 18.75
23445. Jonas (jonasbalante123) 7 62.14 65.93 3 42.86
23446. Ivan (floki12_) 13 62.13 78.83 6 46.15
23447. Akshay (akshay2604) 9 62.13 78.22 3 33.33
23448. Sierra (sierrasetliff) 12 62.12 73.14 3 25.00
23449. David (dusanlp_69) 1 62.12 62.12 1 100.00
23450. bayarjargal (bayaraajr) 60 62.12 79.39 27 45.00
23451. Paul (pasham999) 89 62.12 72.83 20 22.47
23452. Eduardo (eduardocg) 3 62.12 64.83 0 0.00
23453. Charles (kyaw12) 9 62.11 75.40 4 44.44
23454. Evan (ebilton) 6 62.11 72.12 1 16.67
23455. sleepy (sleeeepy_) 14 62.11 67.65 3 21.43
23456. zizu08 (zizu08) 1 62.11 62.11 0 0.00
23457. Vinny's (vinnymason928) 1 62.11 62.11 0 0.00
23458. Sanjay (joker979) 10 62.11 78.00 3 30.00
23459. Professor (steveisawesomer) 38 62.10 74.28 10 26.32
23460. King (kingmaverick07) 215 62.10 80.35 46 21.40
23461. HolyHit (holyhit) 1 62.10 62.10 0 0.00
23462. RiceStealer (ricefieldstealer) 1 62.10 62.10 0 0.00
23463. Liang (nimble_ngo) 1 62.10 62.10 0 0.00
23464. Mipow (mipow_kun) 15 62.09 70.62 6 40.00
23465. Abhas (imabhas) 70 62.09 83.76 11 15.71
23466. aha (aha_aha2) 18 62.09 71.71 3 16.67
23467. Krona (krona_) 1 62.09 62.09 0 0.00
23468. student bored in school (ri... 20 62.09 69.34 4 20.00
23469. andygreg (chelloh) 14 62.09 77.69 4 28.57
23470. Bill (billsquare) 14 62.09 71.04 3 21.43
23471. Yam (chunchumh) 3 62.08 67.06 0 0.00
23472. thapakazi (ceasors) 1 62.08 62.08 0 0.00
23473. Victor (notoriousvic) 5 62.08 75.81 2 40.00
23474. Mercury (mercuryqs) 6 62.07 65.00 1 16.67
23475. Ab (zoro_ab) 6 62.07 70.07 1 16.67
23476. Joseph (iwsif) 1 62.07 62.07 0 0.00
23477. Suraj (st1ck14) 8 62.07 70.68 3 37.50
23478. Leo (funnicat) 2 62.07 70.16 2 100.00
23479. Joey (jxmp) 7 62.06 74.59 3 42.86
23480. Alb (alb_themighty) 21 62.06 74.98 3 14.29
23481. J (leathface23) 216 62.06 76.95 37 17.13
23482. Petar (petar17) 866 62.06 82.20 163 18.82
23483. Amogh (therealmog) 4 62.05 74.36 0 0.00
23484. Anshu79 (anshu79) 57 62.05 79.78 15 26.32
23485. Type (racer4587) 15 62.05 92.43 4 26.67
23486. Alex (pancaxee) 5 62.05 71.99 1 20.00
23487. Michal (mlvy2589) 1 62.05 62.05 1 100.00
23488. Celeste (celeste_b) 162 62.05 81.69 29 17.90
23489. Chris (wupops) 42 62.04 82.00 12 28.57
23490. cat (kitkat79) 11 62.04 73.21 2 18.18
23491. Jack (jackaka) 1 62.04 62.04 0 0.00
23492. Diogo (diogob) 1 62.04 62.04 1 100.00
23493. Aljaz (aljazb) 55 62.04 75.25 12 21.82
23494. AP (phea0001) 53 62.04 75.37 10 18.87
23495. boppin (boples) 4 62.03 70.21 0 0.00
23496. Bumsu (bumsu) 12 62.03 74.68 3 25.00
23497. Tran (qsang) 25 62.03 78.26 6 24.00
23498. Maximillian (maximillian_) 1 62.03 62.03 0 0.00
23499. noodle (just_a_noodle) 5 62.03 72.60 1 20.00
23500. Angela (angelaho40) 4 62.03 65.50 0 0.00
23501. Tam (josephtambmt) 49 62.03 78.99 8 16.33
23502. Guestwith9 (guestwith9) 2 62.03 65.71 0 0.00
23503. David Abdelnour (davidabdel... 188 62.02 81.16 44 23.40
23504. aman (amanrai2802) 408 62.02 87.08 107 26.23
23505. saturn (sat3rns) 9 62.02 79.21 9 100.00
23506. Cj (cjp2739) 3 62.02 68.00 2 66.67
23507. uberstrike (uberstrikeghost... 2 62.02 65.74 1 50.00
23508. yash (yashhh) 5 62.01 71.18 2 40.00
23509. Liam (gearupman) 6 62.01 71.39 0 0.00
23510. Rafar (rafar504) 120 62.01 79.30 16 13.33
23511. Michael (mddover) 24 62.01 72.46 6 25.00
23512. M (mma05) 7 62.01 76.14 1 14.29
23513. Knut (typeracer5000) 2 62.01 70.61 1 50.00
23514. Aang (dorjeaang) 8 62.01 71.21 1 12.50
23515. Rageon (rageon718) 34 62.01 72.55 12 35.29
23516. Yohannes (wintersolider) 403 62.01 90.83 91 22.58
23517. Noah (zipzapimoncrack) 3 62.01 62.70 1 33.33
23518. Tezz (tezzguru) 2 62.01 66.66 1 50.00
23519. co-pilot (keyboardlogger) 3 62.00 67.10 0 0.00
23520. Avalanche (arnobel) 69 62.00 70.75 17 24.64
23521. tobias (memebigboyisbig) 17 62.00 68.54 5 29.41
23522. sumukha_puranik (sumukha) 7 62.00 73.24 0 0.00
23523. Troy (ic3b3rg) 57 61.99 76.21 17 29.82
23524. soleus (soleusplantaris) 1 61.99 61.99 0 0.00
23525. Pixel (2pixles) 11 61.99 76.25 4 36.36
23526. Soerth (soerth) 7 61.99 65.39 0 0.00
23527. Enrrique (enriqu3714) 3 61.99 68.00 1 33.33
23528. bu (bubu2006) 3 61.98 63.78 0 0.00
23529. Valerious (valeriousking) 2 61.98 75.36 1 50.00
23530. charli (xdbiscuits) 8 61.98 70.96 2 25.00
23531. Jackson (wok_) 2 61.98 63.01 1 50.00
23532. ... (7mza) 6 61.98 65.04 2 33.33
23533. Nick (wugangabbot) 375 61.97 80.29 81 21.60
23534. Ryan (rya02) 29 61.97 77.57 7 24.14
23535. baxis (baxis) 7 61.97 66.80 0 0.00
23536. Meghan (meghanbmcl) 3 61.97 68.88 0 0.00
23537. Batstark (batstark) 4 61.97 64.11 0 0.00
23538. Zhen (zhenshin) 1 61.96 61.96 0 0.00
23539. Okhelloandhi (okhelloandhi) 8 61.96 73.06 2 25.00
23540. Viktor Helgi (viktorhelgi) 106 61.96 77.14 26 24.53
23541. Saurav (saurav555) 72 61.95 86.03 16 22.22
23542. Lino (captaincrack) 1 61.95 61.95 0 0.00
23543. Hugo (phudgestuff) 15 61.95 72.18 3 20.00
23544. Dennis (doxalite) 12 61.95 80.44 4 33.33
23545. Vu (vuquynghia2) 201 61.95 80.41 40 19.90
23546. bigpotato24 (bigpotato24) 19 61.94 76.92 5 26.32
23547. Karan (no_one_special) 2 61.94 66.22 1 50.00
23548. Luke (lusouup) 5 61.94 74.16 1 20.00
23549. Haany (asterp01) 19 61.94 77.11 2 10.53
23550. Austin (bear666) 10 61.94 70.19 5 50.00
23551. Rıfat (rifguli) 2 61.94 67.41 2 100.00
23552. Marco (ankush12) 1,568 61.93 102.47 315 20.09
23553. Matthew Froehlick (mfro) 14 61.93 75.36 4 28.57
23554. Uddaya (uddaya) 33 61.93 77.17 8 24.24
23555. duy (69discombobulates) 29 61.93 72.52 12 41.38
23556. Freshanatha (freshanatha) 8 61.92 68.83 4 50.00
23557. Quer (queroin) 9 61.91 83.24 0 0.00
23558. Dhruv (dhruv8601) 89 61.91 84.57 12 13.48
23559. Mr. (mrdayton) 15 61.91 72.87 11 73.33
23560. Rederdex (rederdex) 2 61.91 64.66 0 0.00
23561. Mike (mtwomey) 7 61.91 71.88 2 28.57
23562. Kalman (ferrmo) 4 61.91 64.01 2 50.00
23563. AUDEAMUS (audeamus) 20 61.90 79.57 1 5.00
23564. Licery (licery) 22 61.90 73.75 7 31.82
23565. Madi (madi_davey) 5 61.89 67.30 2 40.00
23566. اعجاذ حسين (s183ds... 8 61.89 70.76 2 25.00
23567. aeris (nintendou) 2 61.89 64.57 2 100.00
23568. Veseyron (veseyron) 6 61.89 69.33 1 16.67
23569. Chaos (chaosfyre) 4 61.89 69.26 1 25.00
23570. tstats[harryrich02] (harryr... 33 61.89 73.09 5 15.15
23571. Salvador (ick1salvado) 15 61.88 71.80 3 20.00
23572. Mats (matserbedre) 1 61.88 61.88 1 100.00
23573. samongcs (thesamuelong10) 74 61.88 74.72 16 21.62
23574. Karl (karlpuno) 158 61.87 83.89 29 18.35
23575. WH (will0wisp1) 1 61.87 61.87 0 0.00
23576. Julio (aero_jb) 14 61.86 70.74 4 28.57
23577. jenny (kosyourmother) 2 61.86 72.99 1 50.00
23578. smino (lucskosur420) 29 61.86 78.26 5 17.24
23579. 🗿 (rjh7) 68 61.86 82.25 11 16.18
23580. Aaron (aaron5457) 215 61.86 78.02 38 17.67
23581. Sam (sevans_) 5 61.85 69.65 1 20.00
23582. attractive monkey (necr01337) 2 61.85 64.63 1 50.00
23583. Intesar (intesar) 12 61.83 71.13 3 25.00
23584. Marios (mr_kk13) 8 61.83 70.13 4 50.00
23585. Eric (iamanormaldog) 1 61.83 61.83 1 100.00
23586. death zigoq (winzu44) 1 61.83 61.83 0 0.00
23587. Tony (xiao_hong) 9 61.82 70.94 0 0.00
23588. Miguel (bellcros) 116 61.81 84.62 32 27.59
23589. Krunch (kommanderk) 58 61.81 75.27 9 15.52
23590. Sadge (forebe) 18 61.81 70.05 17 94.44
23591. Sir (ieza) 1 61.81 61.81 1 100.00
23592. rivo (rivayet) 2 61.81 63.56 0 0.00
23593. Arman (modares) 1 61.81 61.81 0 0.00
23594. Michael (mikeyargueta) 6 61.81 72.42 2 33.33
23595. Ranak (rakibulranak) 318 61.81 85.48 66 20.75
23596. Nils (nil0y) 5 61.80 67.80 0 0.00
23597. John (bigjohn7256) 4 61.80 71.71 2 50.00
23598. Fearless (fearless_soul) 5 61.80 79.57 3 60.00
23599. Chanokchon (mantarays) 44 61.80 70.32 9 20.45
23600. Paul (paul27) 3 61.79 64.21 1 33.33
23601. Josh (josh0561) 3 61.79 63.02 1 33.33
23602. migueles (miqriba) 12 61.78 69.03 3 25.00
23603. PheniX (2504435) 5 61.78 66.98 2 40.00
23604. kage (kage_bigfoot) 22 61.78 74.47 7 31.82
23605. Md Aminul (ami_pronoy) 4 61.78 63.12 2 50.00
23606. sgfd (fish_speckle) 10 61.78 73.27 3 30.00
23607. Choco (slowest_sloth) 35 61.78 79.38 5 14.29
23608. Md Ibrahim Hossain (komlaka... 56 61.78 69.79 12 21.43
23609. Blessed (king_blessed) 35 61.78 81.10 9 25.71
23610. Andres (highmes) 3 61.78 68.06 0 0.00
23611. Piyush (piyush41y08h) 300 61.77 80.33 57 19.00
23612. Zeerox (zeerox) 12 61.77 73.61 1 8.33
23613. glassnet (glassnet) 5 61.77 66.33 3 60.00
23614. Aiden (urmom696969) 6 61.77 77.43 1 16.67
23615. Shadow (shadow_devil) 55 61.76 81.37 9 16.36
23616. nielr (danyl) 42 61.76 81.42 6 14.29
23617. Lilly (lillymallory13) 1 61.76 61.76 1 100.00
23618. Pavel (vladmrovich) 16 61.76 70.99 3 18.75
23619. manjeet (mjydv4548) 11 61.76 69.53 1 9.09
23620. Bozsó (bozso) 22 61.75 77.13 5 22.73
23621. sean (sean_p_k) 5 61.75 64.95 0 0.00
23622. Henr1ES (henri2022) 5 61.75 68.83 0 0.00
23623. Raisul (raisulmushfeq) 3 61.75 63.18 0 0.00
23624. Epic (epic360_boy) 4 61.75 69.96 0 0.00
23625. GerDi (gerdii) 11 61.75 80.20 5 45.45
23626. Madiyar (madi_k) 4 61.75 66.75 1 25.00
23627. Allan (allanersaj) 2 61.75 61.87 1 50.00
23628. Toe Typer (ifingeryour) 169 61.75 81.58 34 20.12
23629. Saurabh (saurabh002) 52 61.74 68.98 12 23.08
23630. shahrukh (shahrukh77) 27 61.74 74.00 8 29.63
23631. Khannen (khannen) 4 61.74 72.73 1 25.00
23632. Mr. (mrasp) 51 61.74 78.31 13 25.49
23633. Rovic (robecks) 1 61.74 61.74 1 100.00
23634. l (luckymagex) 2 61.74 67.13 0 0.00
23635. Luke (lukejr0123) 8 61.73 70.77 3 37.50
23636. Vittal (iamvittaln) 4 61.73 67.43 0 0.00
23637. Damian (_damian_) 4 61.73 67.43 0 0.00
23638. Levi (sniperkiller2) 36 61.73 73.39 9 25.00
23639. ching (nameiso) 5 61.72 72.86 1 20.00
23640. organic (organic__filter) 32 61.72 73.36 6 18.75
23641. Its (itslexemic) 15 61.72 75.78 10 66.67
23642. 0mg (j4s0nb0urn3) 3 61.72 65.98 0 0.00
23643. Soz (soz3177) 2 61.72 73.03 0 0.00
23644. Dexter (dextergamer) 12 61.71 68.56 4 33.33
23645. csgo (csaddict) 11 61.71 73.47 1 9.09
23646. Ayush (ayush08) 18 61.71 73.77 5 27.78
23647. Leong (leong_ckai) 70 61.71 76.80 12 17.14
23648. Ulaai (ulaai) 3 61.71 65.43 1 33.33
23649. Smulca (vicker) 362 61.71 84.40 99 27.35
23650. John (jstar218) 5 61.70 66.50 2 40.00
23651. Neculai (m1s1) 1 61.70 61.70 0 0.00
23652. Adhitya (adhityanugraha96) 13 61.70 69.17 1 7.69
23653. Taco Master (taco989) 14 61.70 69.95 5 35.71
23654. Temir (timchis_13) 6 61.70 73.41 1 16.67
23655. AK (ak24) 8 61.69 72.46 4 50.00
23656. dsfdsf (moropopi) 1 61.69 61.69 0 0.00
23657. Yurekemi (wertzwertz12) 2 61.69 67.46 0 0.00
23658. Caleb (tekksic) 10 61.68 76.23 3 30.00
23659. kevqiii (chairccc) 6 61.68 73.60 4 66.67
23660. hiva (gemje) 5 61.68 65.11 2 40.00
23661. Dvorak 9/16/2021 (mj_dvorak) 295 61.68 82.16 51 17.29
23662. Radu (rdrnd) 25 61.68 71.44 7 28.00
23663. Kaleeyse (kaleeysem) 13 61.67 70.94 2 15.38
23664. Frederik (freeder1k) 21 61.67 72.48 2 9.52
23665. Judah (chewyglue) 6 61.66 72.09 0 0.00
23666. gogo (jg80990) 3 61.66 61.82 2 66.67
23667. Hieu (spicy888) 44 61.65 76.67 9 20.45
23668. ︻デ═一▸ (santoshmsk) 20 61.65 74.72 7 35.00
23669. Im (imkrypton) 1 61.65 61.65 0 0.00
23670. Goodbye Liebour (fryed) 1 61.65 61.65 0 0.00
23671. Dorji (dexdom2th) 2 61.65 62.99 0 0.00
23672. Vidhu Shikhar (vidhu_joshi) 14 61.65 76.79 3 21.43
23673. Rishabh (rishabhkr) 3 61.65 65.99 0 0.00
23674. Darkmacsek9 (darkmacsek9) 7 61.64 78.43 0 0.00
23675. prasanjith (prasanjith) 31 61.64 73.03 3 9.68
23676. Jonathan (joni1234) 10 61.63 82.52 3 30.00
23677. yasser (yasserhr) 45 61.63 76.44 5 11.11
23678. nate (allin110) 3 61.62 62.69 0 0.00
23679. Kachow (suvigya) 8 61.62 70.75 1 12.50
23680. Zachary (zacharide) 80 61.61 83.03 21 26.25
23681. Logiq (logiqq) 13 61.61 73.55 1 7.69
23682. Bubbz (jaydenfiesta) 10 61.61 70.96 3 30.00
23683. MustardNuts (mustardnuts) 7 61.61 76.90 2 28.57
23684. Daniel (dalord) 12 61.61 70.51 2 16.67
23685. dox3 (dox3m) 38 61.60 75.79 12 31.58
23686. Nathan (nper4lta) 20 61.60 75.32 4 20.00
23687. A (spectre_zero) 14 61.60 70.94 2 14.29
23688. Charleston (voltricity) 3 61.59 66.83 2 66.67
23689. A (fancy_potato) 12 61.59 85.97 3 25.00
23690. Dyanel (dyanel) 18 61.59 73.40 4 22.22
23691. Clever (cleverdom) 8 61.59 65.90 0 0.00
23692. Stefan (random_user231) 3 61.59 65.25 0 0.00
23693. subhojeet (subho12134) 8 61.59 69.23 0 0.00
23694. Tina (tprentis22) 30 61.58 70.91 4 13.33
23695. Infinity (infinity15) 2 61.58 68.23 0 0.00
23696. colby (colbyfuchs) 3 61.58 74.11 1 33.33
23697. joon (joonleey) 25 61.58 69.72 5 20.00
23698. sasuke_uchihha (ironman1123) 12 61.57 67.97 0 0.00
23699. Uziel1595 (uziel1595) 33 61.57 74.97 7 21.21
23700. Magishian (magishian) 437 61.57 103.97 117 26.77
23701. The Medium (themedium) 39 61.57 71.27 6 15.38
23702. cottonaudie (cottonaudie) 5 61.56 69.07 3 60.00
23703. lahmacun (lahmacun228) 9 61.56 67.50 2 22.22
23704. mostafa (mostafa_tantawy) 223 61.56 75.65 43 19.28
23705. Jay (royjay) 47 61.56 78.11 8 17.02
23706. q4say (q4say) 109 61.55 75.48 27 24.77
23707. Ricky (rickythedude) 10 61.55 68.54 1 10.00
23708. aaron (m0nk3man) 4 61.55 74.03 1 25.00
23709. pasha (pasha8800) 73 61.55 74.60 25 34.25
23710. Morph (morpheus1008) 1 61.55 61.55 0 0.00
23711. tstats[montedeu] (montedeu) 10 61.55 69.85 1 10.00
23712. Simon (simonskos) 6 61.55 64.78 3 50.00
23713. Nikola (dropndrag) 13 61.55 72.51 2 15.38
23714. Vaibhav (whybhav) 4 61.55 63.95 1 25.00
23715. direw (direw) 3 61.55 64.72 0 0.00
23716. Denis (deniii) 152 61.54 78.10 33 21.71
23717. Namoonia (sasti_chars) 29 61.54 81.66 4 13.79
23718. Brenndyn (fatpig69) 2 61.54 63.57 0 0.00
23719. rocky (r0ckyy) 12 61.53 71.32 1 8.33
23720. Shubham (shubham_112013) 9 61.53 65.26 0 0.00
23721. Jarod (toxedo999) 2 61.53 61.71 0 0.00
23722. zero (zero1010_) 7 61.53 69.61 2 28.57
23723. Tài (haharious) 4 61.53 63.80 0 0.00
23724. Dylan (lavafxlx) 15 61.52 80.05 12 80.00
23725. Jan (jan3112) 13 61.52 71.74 3 23.08
23726. Henok (henokb) 2 61.52 68.89 0 0.00
23727. Aritouch (theekung_69) 1 61.52 61.52 0 0.00
23728. Benjamin Martin (benjamin_m... 138 61.52 78.08 31 22.46
23729. YoloPlayz (yoloplayz10) 16 61.52 76.33 4 25.00
23730. 0 (timswin) 4 61.51 77.62 1 25.00
23731. the shoe eater (devourer_of... 4 61.51 68.88 0 0.00
23732. ed sheeran (guccigangtae) 9 61.50 73.34 0 0.00
23733. sam (sam_star99) 3 61.50 74.13 0 0.00
23734. mohamed (gadmet) 4 61.50 73.24 0 0.00
23735. Xiangyu (wangxiangyu) 5 61.49 66.80 2 40.00
23736. One Finger (elionefinger) 3 61.49 68.82 0 0.00
23737. matuush (matuush) 16 61.49 70.01 12 75.00
23738. John Anthony (therewere3) 785 61.48 80.92 155 19.75
23739. A (b04501012) 192 61.48 75.43 36 18.75
23740. Derek (kroni) 11 61.48 75.12 1 9.09
23741. Rabi (rabiulislam9) 242 61.47 86.22 57 23.55
23742. berserker02 (berserker02) 10 61.47 73.12 3 30.00
23743. Keon (keonra) 5 61.46 66.00 0 0.00
23744. MrOkapus (mrokapus) 22 61.46 72.13 7 31.82
23745. S (kingofthenerdz3) 2 61.46 68.33 1 50.00
23746. Arjun (pikabell) 15 61.46 80.30 3 20.00
23747. MaBec (_mabecma_) 102 61.46 82.75 16 15.69
23748. ahmed (ahmedmadgy711) 51 61.45 77.19 15 29.41
23749. jonas (frallan34) 30 61.45 76.37 8 26.67
23750. nisa (aesthetekim) 3 61.45 66.95 3 100.00
23751. Bean (waialiki) 1 61.45 61.45 0 0.00
23752. santi (santimcc) 23 61.44 69.22 2 8.70
23753. Adam (adammomen) 126 61.44 76.63 19 15.08
23754. Bob (xminer99) 100 61.44 88.97 22 22.00
23755. mandar (mandar139) 7 61.44 70.05 0 0.00
23756. Abdelrahman (kandiler) 4 61.44 64.81 1 25.00
23757. Max (_maxkoo_) 28 61.43 67.11 4 14.29
23758. Fahad (obakfahad) 5 61.42 68.66 1 20.00
23759. Kato (dreamy_soul) 4 61.42 67.81 3 75.00
23760. Riley (detectiverocket) 6 61.42 68.04 1 16.67
23761. Skiddy (skiddybadoosh) 65 61.42 79.59 10 15.38
23762. Jeff (jooffy) 51 61.42 79.18 9 17.65
23763. Osso (ossobuko) 12 61.42 66.17 2 16.67
23764. Edmilson (milson602) 250 61.41 81.46 51 20.40
23765. Kreoniz (kreoniz) 150 61.41 74.47 31 20.67
23766. mushi (musfiq) 8 61.40 68.23 1 12.50
23767. José (josehenrique91) 9 61.39 77.13 1 11.11
23768. Oatmeal (cp_oatmeal) 310 61.39 77.60 67 21.61
23769. rhamy (dilldoee) 1 61.39 61.39 0 0.00
23770. jami (jamson) 4 61.39 67.12 1 25.00
23771. Noah (l0cket) 33 61.39 75.56 4 12.12
23772. Om (omsharma612) 97 61.39 80.97 14 14.43
23773. Minh (votinh1210) 6 61.39 65.63 1 16.67
23774. Daniel (zuse90) 9 61.38 67.11 2 22.22
23775. Kelsey (pokewolf) 13 61.38 75.16 3 23.08
23776. Gustav (ultragurkatv) 15 61.38 71.73 2 13.33
23777. Arles (synthicalarles) 12 61.38 73.45 12 100.00
23778. jia-da-kong (jiadakong) 223 61.38 74.63 57 25.56
23779. Oscar (oscrrrrrrr) 26 61.37 84.67 9 34.62
23780. Kaat (norbertathedragon) 20 61.37 79.97 2 10.00
23781. CrackedEight (crackedeight) 4 61.37 69.95 1 25.00
23782. Mikael (mikael_abe) 10 61.37 71.25 1 10.00
23783. pouya (pooyamz) 401 61.37 89.60 79 19.70
23784. Dennis (dendendenlee) 27 61.36 73.31 6 22.22
23785. tec (dxnny) 2 61.36 62.41 2 100.00
23786. Grzegorz (xreere) 17 61.36 75.94 0 0.00
23787. Ethan (eminum99) 3 61.35 64.81 2 66.67
23788. beans (beans_baked) 3 61.35 63.53 1 33.33
23789. Nafizul (nhk451f) 25 61.34 74.11 8 32.00
23790. hansvin (hans_vin) 1 61.34 61.34 0 0.00
23791. DirtJohnson (dirtjohnson) 18 61.34 69.49 4 22.22
23792. AMM (gamesplaytest) 128 61.33 82.90 25 19.53
23793. Brandon (brandoncc) 7 61.33 78.87 2 28.57
23794. Hazem (zomaaa23) 212 61.33 79.01 41 19.34
23795. xKubsoN (xkubson) 2 61.33 70.89 1 50.00
23796. Mokhirjon (zvermafia) 1 61.32 61.32 0 0.00
23797. Peter (swankypete) 1 61.32 61.32 0 0.00
23798. IHopeAndTry (rohitistyping) 1 61.32 61.32 1 100.00
23799. XD (hphuonghehe) 45 61.31 74.68 8 17.78
23800. Kyle (awesomeinator42) 3 61.31 64.65 0 0.00
23801. tstats[mozra3] (mozra3) 68 61.31 79.26 19 27.94
23802. Nave (naveleon) 76 61.31 81.54 15 19.74
23803. v (gamegodv) 68 61.31 75.63 18 26.47
23804. Phoexv (fathih) 6 61.31 74.58 0 0.00
23805. William (mdracer) 2 61.30 65.18 0 0.00
23806. Jeff (jschillr) 24 61.30 75.63 7 29.17
23807. jam (jamhill) 31 61.29 72.31 5 16.13
23808. alireza (warlord_08) 3 61.29 62.35 0 0.00
23809. Nicholson (nic8ag) 79 61.29 79.46 18 22.78
23810. El (kandel) 36 61.28 82.47 5 13.89
23811. Hassan (hassanalmatar) 20 61.28 70.99 3 15.00
23812. llllllllll (gndndfs) 39 61.28 74.07 10 25.64
23813. Luke (frag_pumpkin) 45 61.28 71.66 6 13.33
23814. l1gh7vel (l1gh7vel) 1 61.28 61.28 0 0.00
23815. Sanity (zjhaun) 8 61.28 67.37 3 37.50
23816. Zach (zachyp) 4 61.28 69.52 0 0.00
23817. Adam (deinonysus) 184 61.28 82.81 33 17.93
23818. Chris (chrischu) 25 61.28 76.66 5 20.00
23819. runnamok (runnamok) 12 61.28 67.08 5 41.67
23820. swetha (swethaesp) 4 61.28 70.38 2 50.00
23821. Mats (mats1104) 3 61.27 66.07 2 66.67
23822. zeeko (zeekomeeko) 27 61.27 71.82 8 29.63
23823. Ravi (raviivar) 5 61.27 68.41 1 20.00
23824. Mark (ziggle) 425 61.27 85.42 78 18.35
23825. Rany (rany_games) 14 61.27 76.12 6 42.86
23826. Nick (nicoboo) 511 61.26 76.56 91 17.81
23827. Swah (swahaha) 8 61.26 76.45 1 12.50
23828. ABDELLATIF (hktitof) 49 61.26 79.90 11 22.45
23829. AggieMet (aggiemet) 29 61.26 83.31 9 31.03
23830. Kian (noob123af) 23 61.26 73.06 3 13.04
23831. Jaynul A (nishatme) 14 61.26 70.82 2 14.29
23832. Ovidiu (ovidiu0720) 81 61.25 72.17 15 18.52
23833. los (typossarevalid) 475 61.25 90.33 229 48.21
23834. Jaz (jazwolff) 27 61.25 73.60 3 11.11
23835. Brus (greksmek) 4 61.25 71.19 0 0.00
23836. Dregni (dregni) 8 61.25 66.52 1 12.50
23837. asphyxia (aag3098) 31 61.25 71.52 4 12.90
23838. Kin (kinandra) 4 61.25 66.94 0 0.00
23839. Gino (gino758) 10 61.25 69.78 2 20.00
23840. KING (thecalamitousduck) 76 61.24 81.33 9 11.84
23841. KJ (kjlaw) 4 61.24 64.36 1 25.00
23842. Noobmaster69 (n00bmaster_69_) 8 61.24 66.70 0 0.00
23843. Priyansh (mrpriyansh) 47 61.24 71.20 7 14.89
23844. Eli (smoothautumn78) 5 61.24 68.53 1 20.00
23845. Ninaad (saklas_33) 1,519 61.24 112.88 308 20.28
23846. amtrax (amtrax) 2 61.24 61.26 1 50.00
23847. Ajitesh (adji2057) 12 61.24 71.33 4 33.33
23848. grandsheber (justbagdat) 98 61.23 72.56 37 37.76
23849. James (quangos) 1 61.23 61.23 1 100.00
23850. daddy (evilaristotle) 9 61.23 66.51 2 22.22
23851. ( ͡° ͜ʖ ͡°) (warrine... 29 61.23 78.26 5 17.24
23852. Edwin Chiriboga (tilt_ed) 9 61.23 72.37 0 0.00
23853. Ghanem (ghanemzein) 5 61.23 68.37 0 0.00
23854. Lukas (luqq) 4 61.22 65.03 3 75.00
23855. gradbear (aspiron) 2 61.22 75.58 1 50.00
23856. Jackson (j4cks0n) 5 61.22 65.48 0 0.00
23857. Nitesh (malster) 11 61.21 65.03 3 27.27
23858. Tomaz (dragart) 61 61.21 70.29 12 19.67
23859. Kroma (_kromaa_) 2 61.21 62.84 0 0.00
23860. KundiV1 (tommy3605) 2 61.21 62.34 1 50.00
23861. Mayank (mmayank74) 61 61.20 79.37 10 16.39
23862. Keshav (typingtitan) 5 61.20 72.56 0 0.00
23863. sheeeeeeeeeeeeeeeeeeeeeeeee... 30 61.20 82.46 6 20.00
23864. Appa (abdallah99) 2 61.20 67.21 0 0.00
23865. sarmasar (sarmasar) 1 61.19 61.19 1 100.00
23866. ABIZABI (abizabi) 7 61.19 69.52 1 14.29
23867. Hali (the_holy_hali) 7 61.18 67.79 7 100.00
23868. Nicola (shougt) 11 61.18 71.48 2 18.18
23869. Jacq (jvjacq) 34 61.18 79.35 8 23.53
23870. Killuminati (ahmedali25jan) 18 61.17 68.86 3 16.67
23871. lemon (lemongrabbb) 9 61.17 74.87 1 11.11
23872. Wong (60484916) 18 61.17 75.15 2 11.11
23873. Bauyrzhan (shaykan) 13 61.17 77.26 7 53.85
23874. Trianglateral (luckyashraj) 43 61.16 69.95 7 16.28
23875. Bibin Prakash (bibinprakash) 4 61.16 64.99 1 25.00
23876. Trung (rohan86) 40 61.16 71.09 8 20.00
23877. ninfueng (ninfueng) 105 61.16 79.26 19 18.10
23878. František (alphabettt) 9 61.16 73.38 1 11.11
23879. Brian (bgriffeth) 10 61.15 76.62 3 30.00
23880. icebear (icebearnose) 5 61.15 64.39 1 20.00
23881. lucho (colombimbo) 16 61.15 69.48 3 18.75
23882. Scribbled (scribbled_trashhh) 69 61.15 78.07 9 13.04
23883. Mert (chineeswall) 16 61.15 75.71 3 18.75
23884. krisko_bg (krisko_bg) 1 61.15 61.15 0 0.00
23885. Keks (keksfromnextdoor) 14 61.15 67.80 4 28.57
23886. CurB (cur_b) 2 61.15 63.66 0 0.00
23887. kirito (boscomk3) 198 61.14 78.68 38 19.19
23888. Houtan (amdbluee) 5 61.14 71.15 2 40.00
23889. 1t2ht (1t2ht) 2 61.14 61.56 0 0.00
23890. chris (chrisp03) 112 61.13 78.93 28 25.00
23891. JnanaDeep (jnana_deep8) 1 61.13 61.13 0 0.00
23892. me (ninjagamer0060) 16 61.12 72.74 2 12.50
23893. NuclearBacon (nuclearbaconyt) 27 61.11 88.84 7 25.93
23894. Meinte (trinityy6) 9 61.11 69.72 3 33.33
23895. ruby (rubymuzz) 43 61.10 85.57 8 18.60
23896. Davis (davis10) 15 61.09 76.07 4 26.67
23897. Safraz (hypertyper94) 304 61.09 77.24 60 19.74
23898. Mariah (vellichorne) 4 61.09 72.78 0 0.00
23899. Ionut (ztonaz) 18 61.09 69.98 4 22.22
23900. Michael (michaz) 24 61.09 68.34 4 16.67
23901. Joakim (wakakins) 17 61.08 81.68 1 5.88
23902. kenjorine canon (lumibea) 1 61.08 61.08 0 0.00
23903. Nicholas (nicholasozarka) 5 61.08 67.81 1 20.00
23904. Slowpoke (slowpoketypo) 17 61.07 70.17 2 11.76
23905. tuvumba (tuvumba) 9 61.07 66.94 7 77.78
23906. Jed (oh_no_yes) 5 61.07 65.67 0 0.00
23907. Clairvoyant (r2zenith) 4 61.07 68.33 0 0.00
23908. Korey (serveo21) 75 61.06 75.04 15 20.00
23909. shmuel (shmuel555) 1 61.06 61.06 0 0.00
23910. Moze (m0ze) 1 61.06 61.06 0 0.00
23911. chupapi (nerve784126) 201 61.06 82.21 45 22.39
23912. ~ (katana4teen) 358 61.06 83.59 84 23.46
23913. aerooo (babatunde_olatunji) 25 61.05 82.57 9 36.00
23914. yaQvadrat (yaqvadrat) 19 61.05 72.86 4 21.05
23915. Andrew (andrewsim) 257 61.05 75.38 59 22.96
23916. Ryan (rybruh) 6 61.05 71.01 0 0.00
23917. HEMANTA (hemantahazariraipu... 18 61.05 75.25 7 38.89
23918. Muhammad (hydra_assassin) 22 61.05 71.95 6 27.27
23919. Rae (rae149) 21 61.05 79.21 5 23.81
23920. Connor (con1847) 2 61.05 64.42 2 100.00
23921. Benedek (k_dot_b) 4 61.05 63.60 1 25.00
23922. JFL (mialiu0804) 156 61.04 79.19 32 20.51
23923. Harry (undeadkiller112) 6 61.04 73.61 2 33.33
23924. Moe (mohannd_h) 17 61.03 69.28 5 29.41
23925. Ren (yirenwang) 67 61.03 80.26 13 19.40
23926. Dvorak Keyboard (douglasawe... 16 61.03 75.64 5 31.25
23927. Ksairos (ksairs) 179 61.03 78.26 44 24.58
23928. Blox (bloxid) 1 61.03 61.03 0 0.00
23929. Ali (lasthunter69) 37 61.03 78.22 7 18.92
23930. Chris (operationbegone) 4 61.03 67.61 0 0.00
23931. Ved (yur_amma_on_me) 5 61.03 68.84 5 100.00
23932. Josué (morfeu_123) 4 61.03 65.09 2 50.00
23933. Gerben05 (gerbenklapwijk) 1,273 61.02 85.18 228 17.91
23934. nguyen (nguyenanh2004) 54 61.02 75.38 9 16.67
23935. M7moudGadallah (7ooda) 6 61.02 65.42 2 33.33
23936. jer (slugbug2) 2 61.02 63.16 0 0.00
23937. Luca (brentspiner) 7 61.02 68.52 3 42.86
23938. Edvaize (edvaize) 16 61.02 67.72 4 25.00
23939. LubedCube (lubed_cube) 36 61.01 71.97 10 27.78
23940. Kostaice (kostaice) 63 61.01 75.67 6 9.52
23941. Hiren (userhiren) 22 61.01 76.98 6 27.27
23942. Hai (vroyibg) 41 61.00 72.31 8 19.51
23943. Thuan (asianboiii) 11 61.00 81.28 0 0.00
23944. MrDot (mr_dot) 44 61.00 78.75 11 25.00
23945. Jiezlin (jiezlin) 15 61.00 68.52 3 20.00
23946. mathbook (mathbookpeace) 2 61.00 64.35 0 0.00
23947. Bobirjon (bob_pro) 42 61.00 72.84 11 26.19
23948. Roman (tyronefromdetroit_7) 20 61.00 69.36 2 10.00
23949. Taiyo (taiyo1) 2 61.00 63.26 0 0.00
23950. Lorenzo (xxx69420xxx) 12 60.99 77.93 7 58.33
23951. Ned (13_w) 46 60.99 78.00 5 10.87
23952. ariferrari (ariferrari) 39 60.99 75.90 6 15.38
23953. Santiago (santi_ooo) 24 60.99 73.81 8 33.33
23954. DD (ddcute) 26 60.98 70.77 9 34.62
23955. Shelby (zalak_b) 36 60.98 76.07 2 5.56
23956. smoky_ (sahuvipul) 504 60.98 93.75 143 28.37
23957. MiamMiam (miammiam100) 216 60.97 76.28 43 19.91
23958. Coco (yordle) 5 60.97 69.33 1 20.00
23959. Isabella (refundmybirth_21) 50 60.97 79.86 12 24.00
23960. Ella (kokookie) 7 60.97 69.76 4 57.14
23961. jamilxt (jamilxt) 51 60.96 73.84 14 27.45
23962. Mark (mark69420) 7 60.96 68.18 1 14.29
23963. Yunusali (khakimjanovich) 140 60.96 81.15 21 15.00
23964. JK (ettanin) 88 60.96 73.11 11 12.50
23965. Craig (craigo76) 13 60.95 72.70 1 7.69
23966. Jimmy (jimmy890302) 69 60.95 74.41 9 13.04
23967. ahmed (ahmedadel2020) 4 60.95 66.10 1 25.00
23968. Mehmet (superfasttyper_0102) 15 60.94 76.74 3 20.00
23969. Type (magicgos) 2 60.94 67.83 0 0.00
23970. Abdi (bravenoob) 69 60.94 77.62 13 18.84
23971. Phuc (nhphucqt) 8 60.94 67.42 2 25.00
23972. Gurshaant Singh (waffleflau... 78 60.94 76.30 29 37.18
23973. Putrid (putridacid) 63 60.94 80.25 11 17.46
23974. Ayan (ayan_007) 645 60.94 78.25 128 19.84
23975. Connor (magicsniper7) 4 60.94 64.71 1 25.00
23976. Adam1t (adam1t) 27 60.93 77.96 5 18.52
23977. Kuro (horikta) 215 60.93 85.46 48 22.33
23978. killer (killerz4564) 153 60.93 78.89 40 26.14
23979. Ryan (hougs) 53 60.93 76.34 9 16.98
23980. Vatsala (vatsala) 37 60.92 71.61 7 18.92
23981. boiax (boiax) 290 60.92 86.95 65 22.41
23982. Marius (m4ryu5) 25 60.92 69.66 5 20.00
23983. Ajit (raiajit) 1 60.92 60.92 0 0.00
23984. m_1_1_m (m_1_1_m) 5 60.91 73.54 1 20.00
23985. Masquerade (masq_uerade) 7 60.91 78.23 2 28.57
23986. Doan (zzzhzzz) 236 60.91 83.62 47 19.92
23987. Justa (justaboss101) 11 60.90 69.75 2 18.18
23988. karrar (saffa990) 16 60.90 72.01 5 31.25
23989. Wilson (tigermatos) 66 60.90 74.58 12 18.18
23990. Ekko (blue9995566) 10 60.90 65.76 0 0.00
23991. Elwin (elwin05) 64 60.90 69.70 14 21.88
23992. Jejo (jejo03) 236 60.89 83.78 45 19.07
23993. Viper (tomp2) 3 60.89 66.03 0 0.00
23994. orgilmunh (orgilmunh) 1 60.89 60.89 1 100.00
23995. Lili (lili640) 2 60.88 61.68 0 0.00
23996. Sam (latenightsnacks) 1 60.88 60.88 0 0.00
23997. Justin (ggwp_123) 139 60.88 71.69 16 11.51
23998. Mustafa (leo_messi_) 191 60.88 80.00 38 19.90
23999. Last (last220) 3 60.88 64.09 1 33.33
24000. josiah (josiah_is_weird) 39 60.87 73.25 8 20.51
24001. Kacper (lilfridge69) 13 60.87 71.86 2 15.38
24002. Lik (lik007) 14 60.87 76.98 5 35.71
24003. Henrik (grimmzl) 47 60.87 73.04 12 25.53
24004. Won (wontong) 1 60.87 60.87 0 0.00
24005. PuiPui (puipuicar) 6 60.87 73.47 1 16.67
24006. jaye (twojaye) 2 60.87 61.50 2 100.00
24007. sirjan (sirwolf208) 43 60.86 67.55 15 34.88
24008. Rayhan (rayhanihsan) 5 60.86 66.26 2 40.00
24009. Steve (stevegocoding) 101 60.86 77.89 18 17.82
24010. wiz (_wiz_) 20 60.86 71.40 5 25.00
24011. Jay (destroyer1101) 25 60.86 73.96 6 24.00
24012. Tursunali (ali_khan) 86 60.85 86.76 18 20.93
24013. Lou (onyok2010) 11 60.85 71.22 11 100.00
24014. Sergi (maspi) 2 60.85 61.29 0 0.00
24015. usually (usually99) 1 60.85 60.85 0 0.00
24016. Kelvin (kelvin666) 37 60.85 71.14 10 27.03
24017. Sassy (taingdavy) 187 60.84 83.06 35 18.72
24018. Oliver (rgroli) 878 60.84 81.20 147 16.74
24019. Bridget (bahns) 35 60.83 80.96 8 22.86
24020. Thomas (door_kun) 1 60.83 60.83 0 0.00
24021. Tachibana (tachibanayui) 7 60.83 79.17 2 28.57
24022. Jason (wepanator) 39 60.83 76.15 8 20.51
24023. C (bigcdub) 31 60.82 79.98 9 29.03
24024. Francis (francis_7777) 144 60.82 79.70 27 18.75
24025. Luis (luis_vs_the_world) 11 60.82 71.17 2 18.18
24026. Connor (cmcl) 10 60.82 68.27 2 20.00
24027. Ainsley (outree) 2 60.82 61.86 1 50.00
24028. Will (willbo2006) 25 60.82 78.54 4 16.00
24029. SteffVz (steffvz) 3 60.82 65.72 1 33.33
24030. Afifu (healme) 12 60.81 74.00 4 33.33
24031. Md. Tarek Hasan (tarek_racer) 130 60.80 78.86 19 14.62
24032. Kiluath (kiluath) 5 60.80 63.99 2 40.00
24033. Kris (tymptra) 75 60.80 73.49 14 18.67
24034. Noah (noaboston) 24 60.80 79.31 3 12.50
24035. Ascyt (ascyt) 14 60.80 75.36 4 28.57
24036. jackens (jackens) 4 60.80 70.15 1 25.00
24037. WooshWoosh (wiertsmenator) 15 60.79 71.51 4 26.67
24038. gleen (gleenryan) 18 60.79 76.00 5 27.78
24039. Bella (papidiabolus) 25 60.79 74.82 3 12.00
24040. Chapri 👛👛 (sunilswain) 61 60.79 85.74 13 21.31
24041. Vi Kiet (vikiet1456) 257 60.79 77.48 60 23.35
24042. Kyle (rexi_typed_you) 23 60.79 69.06 13 56.52
24043. Josh (josgo888) 92 60.79 78.38 19 20.65
24044. Azal (azalro) 3 60.79 67.34 0 0.00
24045. Nishit (nishit130) 41 60.79 77.15 9 21.95
24046. DK (nwbpwn9000) 2 60.79 62.87 1 50.00
24047. Md Ubaid (mdubaid_ulllah000) 2,082 60.78 99.99 478 22.96
24048. naman (naman14) 9 60.78 71.23 1 11.11
24049. koren (mits321) 4 60.78 64.48 1 25.00
24050. Nicky (denmam69) 3 60.78 62.38 0 0.00
24051. Deshant (djtype2124) 1,199 60.78 93.83 248 20.68
24052. Prathamesh (prathamesh0927) 74 60.78 78.34 10 13.51
24053. Naravich (icekang) 2 60.78 62.72 0 0.00
24054. Mina (bigoppai) 3 60.77 62.12 2 66.67
24055. Fesak10Fingers (fesak8) 14 60.77 73.05 7 50.00
24056. Shrey (shrey4869) 1 60.77 60.77 0 0.00
24057. Riser (riser1) 30 60.77 74.61 8 26.67
24058. Michal (snowykey) 16 60.76 74.55 4 25.00
24059. Spotter (mythical_spotter) 1 60.76 60.76 1 100.00
24060. D1FFeR (ec0426) 21 60.76 77.31 2 9.52
24061. Rudraksh (delusionaloptimist) 10 60.76 70.58 2 20.00
24062. Kelven (agentbowtie) 27 60.76 73.89 7 25.93
24063. Yothin (yothinix) 10 60.75 66.75 0 0.00
24064. Diego (daigo356) 22 60.75 69.67 6 27.27
24065. Seungil (biam83) 5 60.75 66.72 0 0.00
24066. Mae (practice_type) 14 60.75 71.19 2 14.29
24067. Alex (alex_lele) 6 60.75 73.47 1 16.67
24068. (thebob2713) 22 60.75 77.24 6 27.27
24069. Heet (tadu21) 1 60.74 60.74 0 0.00
24070. pickleify (pickleify) 1 60.74 60.74 0 0.00
24071. jay (jaymorant) 115 60.74 77.11 21 18.26
24072. fella (fellasaurus) 1,060 60.73 78.25 171 16.13
24073. Aisha (aishanick) 455 60.73 88.76 68 14.95
24074. Luis (siulul) 9 60.73 71.15 2 22.22
24075. Ahmed (severianx) 3 60.73 65.07 0 0.00
24076. Junior (mkunaji) 86 60.73 73.93 23 26.74
24077. Visura (visuraprabod) 20 60.73 66.98 3 15.00
24078. yogesh (yogipapu15) 15 60.72 69.48 3 20.00
24079. Vin (hellotherevin) 3 60.72 65.12 0 0.00
24080. Charles (pools_closed_due_t... 1 60.72 60.72 0 0.00
24081. krishan (krishan_pro) 57 60.72 76.63 14 24.56
24082. typingboob (typingboob) 22 60.72 71.43 4 18.18
24083. abdul (abdullateef4u) 24 60.71 69.87 4 16.67
24084. Shalin (29wpm) 10 60.71 65.34 0 0.00
24085. Andrew (andrew530) 3 60.71 71.41 0 0.00
24086. Md. Tarikul (tarikul_01) 70 60.71 80.32 13 18.57
24087. ._. (pookao19) 6 60.71 68.46 4 66.67
24088. sus99hant (sus99hant) 21 60.70 73.89 4 19.05
24089. Nitin (nitinaturdsk) 10 60.70 66.78 0 0.00
24090. Andi (fianputra157) 3 60.70 67.18 0 0.00
24091. Napplebee (napplebee) 43 60.70 73.73 7 16.28
24092. blitter (blitter56) 8 60.69 72.16 2 25.00
24093. insxmnimaniac (insxmnimaniac) 1 60.69 60.69 0 0.00
24094. Mihail (mondic) 4 60.69 63.07 0 0.00
24095. KentelGodo (hannoobz) 6 60.68 68.68 2 33.33
24096. Pranav (pranavsetpal) 75 60.68 82.66 11 14.67
24097. Diriector (diriector_doc) 2 60.68 65.33 2 100.00
24098. Danky (dankyv1) 39 60.68 71.60 11 28.21
24099. Abyo (abyo) 11 60.68 69.98 1 9.09
24100. ishan (gmd_cuber) 10 60.68 66.53 3 30.00
24101. Deepak (deepakthegreat) 29 60.67 79.63 5 17.24
24102. lawrence (lawrence_nguyen) 3 60.67 64.37 0 0.00
24103. yehojo (yehojo) 2 60.67 64.02 1 50.00
24104. Velonik (velonik_12) 16 60.67 66.60 4 25.00
24105. isaac (isaac3416) 5 60.67 73.85 1 20.00
24106. Minnot (omar10211) 48 60.66 80.63 9 18.75
24107. doraemon (reazulislam) 28 60.66 71.48 5 17.86
24108. Vagesh (don1909) 59 60.66 68.67 9 15.25
24109. NEKROME2.0 (nekrometwo) 9 60.66 69.28 4 44.44
24110. TennisGOAT (tennislegend1234) 201 60.66 79.23 32 15.92
24111. Norik (kingjulian1) 90 60.66 74.38 14 15.56
24112. indian_lad365 (indian_lad365) 7 60.65 67.10 1 14.29
24113. Rahul (snickrdodle) 14 60.65 76.71 1 7.14
24114. Athul (night_shark) 5 60.65 69.48 1 20.00
24115. scqrch (scqrch) 21 60.65 66.30 4 19.05
24116. DaFluffyOwl (dafluffyowl) 1 60.65 60.65 0 0.00
24117. Myka (mosin_warrior) 70 60.65 73.74 9 12.86
24118. mackysmach (mackysmach) 126 60.64 82.05 35 27.78
24119. Crehan (crayon144) 36 60.64 68.61 11 30.56
24120. vm (vm_gojiya) 91 60.63 79.07 17 18.68
24121. Curie (silverfox420) 3 60.63 64.06 0 0.00
24122. Clone (clonex1) 39 60.63 73.61 7 17.95
24123. Human (supertypergrey) 376 60.62 88.02 59 15.69
24124. Alisher (tourist671) 42 60.62 74.81 14 33.33
24125. Yury (auaster) 4 60.62 66.96 0 0.00
24126. Romit (junior12345) 82 60.62 77.28 19 23.17
24127. Samui (hisself) 2 60.62 98.48 1 50.00
24128. Dan (danwest124) 14 60.62 69.92 1 7.14
24129. salem (salem_coder) 261 60.62 91.78 59 22.61
24130. Thomaskov (thomas861205) 38 60.61 71.40 5 13.16
24131. FeelsGoodMan (jeffryvanessa1) 49 60.61 74.19 17 34.69
24132. I Be (itsthamista) 1 60.61 60.61 0 0.00
24133. clobre (clobro) 1 60.61 60.61 0 0.00
24134. Bryan (lufrewaffle) 27 60.61 70.68 5 18.52
24135. Vasyl (dardhard) 4 60.61 70.93 0 0.00
24136. Avi (avir) 4 60.61 69.08 0 0.00
24137. Illumin80 (illumin80) 141 60.60 73.33 25 17.73
24138. Olli (olzi) 5 60.60 75.57 1 20.00
24139. emna (em203) 337 60.60 73.33 60 17.80
24140. Simon (unclesimon) 33 60.59 93.68 18 54.55
24141. kabir raj (kabir26) 36 60.59 69.06 6 16.67
24142. Aidian (aidothepro) 5 60.59 69.32 1 20.00
24143. Yi (escapetiger) 2 60.59 61.80 0 0.00
24144. smfbruh (4ex7) 2 60.59 65.02 0 0.00
24145. Charles Leclerc (bruhgoslow) 120 60.58 79.13 22 18.33
24146. Ole Bendik (olebanan) 2 60.58 62.06 0 0.00
24147. shmz (shamyob) 17 60.58 70.22 2 11.76
24148. Nazib (tony_129) 35 60.58 76.14 9 25.71
24149. Ben (slouchingstork) 14 60.58 65.30 2 14.29
24150. Orka (orka) 979 60.58 78.98 186 19.00
24151. IRUSN4F (irusnaf) 4 60.57 62.43 2 50.00
24152. Nasar (nasarlagenda) 26 60.57 75.75 6 23.08
24153. unboundx (unboundxzackk) 1 60.57 60.57 0 0.00
24154. Adham (adham2002) 16 60.57 78.39 3 18.75
24155. Tristan (thavelick) 3 60.57 64.75 0 0.00
24156. Mayur S (mayur_chirttaragi) 30 60.57 72.35 4 13.33
24157. Brody (mudspud) 5 60.56 70.07 1 20.00
24158. Andrew (jucidy) 4 60.56 81.58 1 25.00
24159. 3 (astoria2213) 17 60.56 70.47 6 35.29
24160. Wildebeest (wildebeest1) 70 60.56 75.04 7 10.00
24161. Chirdis (chirdis) 1 60.56 60.56 0 0.00
24162. colemaker (colemaker) 2 60.56 63.17 0 0.00
24163. Dikshit (dikshitupadhya) 14 60.55 68.94 1 7.14
24164. Vi (vichea) 5 60.55 65.93 4 80.00
24165. RingereQQ (ringereqq) 4 60.55 66.79 4 100.00
24166. Darcy (vendus13) 7 60.55 70.42 1 14.29
24167. Faiq Ayubi (froxt) 31 60.54 91.50 8 25.81
24168. mdnh (tongil123) 6 60.54 65.19 0 0.00
24169. Rowan (neonowlbar) 8 60.54 66.98 2 25.00
24170. Tim (speedy_neutron) 8 60.53 65.61 1 12.50
24171. Amare (endmaster64) 54 60.53 75.57 53 98.15
24172. oni (onigiri_) 5 60.53 66.01 3 60.00
24173. Matthew (necroxity_2021) 1 60.52 60.52 0 0.00
24174. hamger (broncos1388) 20 60.52 76.54 2 10.00
24175. Izhar Ali (izhar368) 44 60.52 71.40 7 15.91
24176. Nmn (nmn147) 46 60.52 73.44 11 23.91
24177. Snide (genuineburrito) 1 60.51 60.51 0 0.00
24178. 6typeR (hacker888) 117 60.51 74.92 26 22.22
24179. Rany (ranystephan) 97 60.51 87.69 16 16.49
24180. Felipe (felipekde) 10 60.51 69.68 1 10.00
24181. ravi (culdesaccer) 8 60.51 80.93 1 12.50
24182. Andrew (andvorak) 13 60.50 65.81 3 23.08
24183. Son (mcc_sasuke) 19 60.50 75.08 5 26.32
24184. Victor (malvikus) 3 60.50 63.11 0 0.00
24185. Johann (jona_die_jood) 9 60.50 69.16 0 0.00
24186. Jonathan (happyspartan) 6 60.50 63.98 3 50.00
24187. Gallagher (gallaghercat11) 9 60.49 70.36 1 11.11
24188. Shu (shuuouma) 262 60.49 76.10 43 16.41
24189. Spire (spire20) 1 60.49 60.49 1 100.00
24190. Matt (mchoe2000) 4 60.49 66.46 2 50.00
24191. nlthebiebs (nlfthebiebs) 25 60.49 70.42 3 12.00
24192. Norbert (makori) 5 60.48 67.83 1 20.00
24193. ibrahim (ibrahiem) 99 60.48 77.42 17 17.17
24194. Maarten (arteeh) 4 60.48 92.50 1 25.00
24195. Dean (routerboy6126) 5 60.48 71.72 0 0.00
24196. Adam (_adam_bomb) 9 60.48 66.79 1 11.11
24197. Ryan (cloutmasterz) 4 60.48 68.84 2 50.00
24198. Thomas (nunu464) 29 60.48 74.57 9 31.03
24199. astrid (astridtherat) 7 60.47 76.33 1 14.29
24200. may9 (may9) 49 60.47 71.84 12 24.49
24201. applecards (applecards) 26 60.47 75.67 5 19.23
24202. J (i_am_speeed) 3 60.47 67.12 0 0.00
24203. Clfong (clfong) 14 60.46 74.27 1 7.14
24204. Szymon (szymii112) 5 60.45 72.36 3 60.00
24205. Ken (_k3n) 2 60.45 65.73 2 100.00
24206. Imperator (imperator_357) 279 60.44 70.78 46 16.49
24207. Ludvig (krang) 33 60.44 73.16 9 27.27
24208. Yohann (yohann27) 5 60.44 63.53 0 0.00
24209. Joe (bubustrick) 114 60.43 75.14 24 21.05
24210. kevin (noob98) 10 60.43 66.98 4 40.00
24211. Adarax (typerax) 1 60.43 60.43 0 0.00
24212. Kwikk (mrkwikk) 156 60.43 82.18 31 19.87
24213. Manas (manasmahanand) 38 60.43 70.92 11 28.95
24214. Joe (9ighty) 6 60.43 73.37 1 16.67
24215. beek (beekul) 53 60.43 77.01 8 15.09
24216. Alnas (alnasnasu) 2 60.43 65.96 0 0.00
24217. Azar (nxp_azar) 100 60.43 76.57 51 51.00
24218. The Teacher (theteacher1) 5 60.42 75.84 2 40.00
24219. Kyle (vertwon) 12 60.42 68.26 2 16.67
24220. remz (remzhacker) 1 60.42 60.42 0 0.00
24221. Logan (imoshie) 2 60.42 60.64 0 0.00
24222. nitai (nitai777) 3 60.41 64.61 1 33.33
24223. Fyroo (abelkarbel) 11 60.41 68.47 5 45.45
24224. Kumar (iarrive) 2 60.41 62.45 0 0.00
24225. Kickass (vivekvikysharma) 328 60.40 79.05 61 18.60
24226. Yael (yaeltellez) 3 60.40 65.36 1 33.33
24227. rtr (darxidemlg) 1 60.40 60.40 1 100.00
24228. S Aditya (s_aditya) 9 60.40 63.90 2 22.22
24229. waseem ahmad bhat (waseemraja) 149 60.40 91.39 29 19.46
24230. Peter (pklly) 29 60.39 78.07 5 17.24
24231. Nayan (hatke42) 11 60.39 71.07 4 36.36
24232. benjamin (hombreba) 3 60.39 66.20 0 0.00
24233. Magister (masterbert02) 12 60.39 66.97 6 50.00
24234. MrBoombastic (sloth_express) 12 60.39 66.59 0 0.00
24235. Gribbit (gribbit) 9 60.39 69.26 2 22.22
24236. Sumnerbean (sumnerbean) 22 60.39 80.14 6 27.27
24237. Mohit (mohit_singhal) 2 60.39 65.48 0 0.00
24238. joann (joannyo) 215 60.38 91.45 51 23.72
24239. Issaranuwat (aatsaranuwis) 13 60.38 78.48 4 30.77
24240. ニシャント (neokun) 347 60.38 81.30 66 19.02
24241. Captn (the_nobody3786) 11 60.38 80.89 2 18.18
24242. Ava (ava_gina) 51 60.38 69.62 4 7.84
24243. Vincent (uincent) 3 60.38 62.18 0 0.00
24244. Zakaria (zakosan) 2 60.38 66.90 0 0.00
24245. Austin (sausie) 2 60.38 61.78 0 0.00
24246. desk (desk_wall) 2 60.38 64.40 0 0.00
24247. heam (heamkream) 44 60.38 73.61 22 50.00
24248. K (4pple) 8 60.37 77.79 2 25.00
24249. Gui (ult_guiks) 2 60.37 61.87 2 100.00
24250. fihee (fihee) 45 60.36 79.78 12 26.67
24251. Malik (maliksami) 4 60.36 67.73 1 25.00
24252. Oonga (legoarmyguy223) 3 60.36 61.64 3 100.00
24253. nope251 (nope251) 52 60.36 72.92 5 9.62
24254. Emeer (emeer_macapili) 83 60.35 74.60 16 19.28
24255. qiqete (qiqete) 5 60.34 64.37 0 0.00
24256. hhg (hhg2) 138 60.34 73.66 34 24.64
24257. Himanshu (himanshupander) 6 60.34 68.40 2 33.33
24258. charles (charles1106) 9 60.34 70.96 2 22.22
24259. amin (anmiimna) 48 60.34 73.40 8 16.67
24260. Sandeep (sandeep_balachandran) 2 60.34 60.60 1 50.00
24261. Rexza (rawr2002) 5 60.34 63.47 2 40.00
24262. Miguel (miguel_leadersarena) 14 60.34 71.96 0 0.00
24263. matt (kingspyfox) 12 60.34 68.35 3 25.00
24264. Murcury (murcury_) 200 60.33 76.85 40 20.00
24265. GeeBee_29 (geebee29) 10 60.33 71.57 1 10.00
24266. lin (lty2002) 38 60.33 83.67 10 26.32
24267. Smack (smack_ke) 34 60.33 69.10 6 17.65
24268. Leo (vonald) 2 60.33 64.37 1 50.00
24269. ChmpionL (lu_fattori) 560 60.33 75.24 5 0.89
24270. Christiano (christiano_rona... 2,891 60.33 91.23 578 19.99
24271. Sara (sarachespara) 13 60.32 69.77 5 38.46
24272. Giorgio (gioac96) 1 60.32 60.32 1 100.00
24273. spacy (spacyarie) 3 60.32 71.90 1 33.33
24274. Madara (madara_uchihaking) 105 60.32 77.13 64 60.95
24275. Manye (davemanye) 21 60.32 81.18 8 38.10
24276. David (dlefarth) 13 60.31 68.44 2 15.38
24277. Faurazeko (faurazeko) 3 60.31 66.04 1 33.33
24278. 333pwn (333pwn) 3 60.31 71.98 1 33.33
24279. Stank (stankyard) 121 60.30 78.38 33 27.27
24280. Sabix (veam) 2 60.30 60.56 1 50.00
24281. Axel (axei) 14 60.30 71.97 0 0.00
24282. LilCup (epoli0319) 13 60.30 70.53 3 23.08
24283. Isaac (libstwo) 15 60.30 73.62 3 20.00
24284. Feariscool (fearisdumb) 202 60.30 79.45 45 22.28
24285. Bom (bom_dia) 6 60.30 72.66 4 66.67
24286. Lukas (lukasdw) 3 60.29 60.67 0 0.00
24287. al (alpasto) 7 60.29 73.04 1 14.29
24288. Zul (szeph) 2 60.29 62.61 2 100.00
24289. SMoon (smoon343) 235 60.29 75.76 39 16.60
24290. bataa (batuchka) 202 60.29 83.32 49 24.26
24291. Filip (flameouken) 100 60.28 77.14 25 25.00
24292. Jerson (jersonpogikaayo) 6 60.28 67.99 0 0.00
24293. Joceline (josmanga1) 6 60.27 68.77 0 0.00
24294. Masked (masked_error) 34 60.27 72.97 11 32.35
24295. Ill (fencing) 1 60.27 60.27 0 0.00
24296. Ayy (ayush_parihar) 86 60.27 76.90 12 13.95
24297. amaan (andrewescott) 3 60.26 64.51 0 0.00
24298. djole (djole) 8 60.26 64.04 2 25.00
24299. prans (prans12) 27 60.26 75.26 3 11.11
24300. Mr.Typist (typer456new) 211 60.26 78.29 27 12.80
24301. alp atakan (alpatakan) 2 60.26 60.60 2 100.00
24302. AlphaQ (zbooya) 91 60.25 72.02 16 17.58
24303. 輸是個甚麼東西 (lodg... 6 60.25 69.63 0 0.00
24304. Kristjan (chrisk_04) 42 60.25 78.47 5 11.90
24305. Swifty2997 (swifty2997) 615 60.25 76.13 100 16.26
24306. Stephan (stephanvdmerwe) 1 60.25 60.25 1 100.00
24307. Jan (nexxo) 1 60.25 60.25 0 0.00
24308. Jiong Liang (odliang_15) 112 60.25 76.37 21 18.75
24309. raj (the_karna) 95 60.25 77.72 21 22.11
24310. matvei (xbabushka) 20 60.24 81.32 9 45.00
24311. bbdnoir (bbd_noir) 4 60.24 68.72 0 0.00
24312. Akuma (akumaayush) 57 60.24 73.22 4 7.02
24313. Alexander (traveler_exe) 1 60.24 60.24 0 0.00
24314. fantdm4@gmail.com (evolnizark) 80 60.24 80.99 25 31.25
24315. Andrew (baconpapi) 4 60.24 66.36 0 0.00
24316. Vaidas (kybynas) 1 60.22 60.22 1 100.00
24317. FruityCigar (fruitycigar) 8 60.22 71.49 3 37.50
24318. rona is on a bike (xnevermi... 2 60.22 60.61 0 0.00
24319. natsuki (natsuki_x) 3 60.21 62.78 0 0.00
24320. NotFlame (flameon0703) 11 60.21 65.97 1 9.09
24321. Diana (dustystar96) 10 60.21 69.18 0 0.00
24322. Jr (rattllingsecret) 39 60.20 74.34 26 66.67
24323. Mario (bujmar) 14 60.20 68.93 0 0.00
24324. Sander (salamanderboi) 4 60.20 71.25 0 0.00
24325. Jerzy (mr_avocado) 232 60.20 76.74 42 18.10
24326. Anku (gurooatwork) 1,410 60.20 81.11 263 18.65
24327. Aafeef (aafeef25) 19 60.20 78.86 17 89.47
24328. Ed (edfed) 7 60.20 82.46 2 28.57
24329. eumis (eumis) 2 60.20 68.76 1 50.00
24330. Christina (christinacitta) 18 60.19 67.70 2 11.11
24331. ai fachri (a_ifachri) 7 60.19 67.16 2 28.57
24332. Aaron (ayildiztas) 24 60.19 77.03 2 8.33
24333. LastSlice (cezara) 756 60.19 84.84 118 15.61
24334. Caothu (caothunet) 6 60.18 66.90 1 16.67
24335. Jean (jeanerino) 36 60.18 72.11 10 27.78
24336. Harry (tls278) 28 60.18 68.78 8 28.57
24337. Sunil (w0rds) 32 60.18 79.30 5 15.63
24338. Nil (niljovanovic) 7 60.17 68.39 1 14.29
24339. DJ (dino_dj) 16 60.17 68.01 4 25.00
24340. Advaanture (advaanture) 11 60.17 71.62 2 18.18
24341. Markus (markusizergin) 3 60.17 68.58 1 33.33
24342. Fiel (pyel) 2 60.17 65.97 0 0.00
24343. Mostafa (mostafadelgouda) 8 60.16 69.22 4 50.00
24344. Free Palestine (hemo313) 3 60.16 65.49 2 66.67
24345. Doniyorbek (doniyorbek7376) 231 60.16 76.52 39 16.88
24346. Gabboxl (gabboxl) 7 60.15 61.71 1 14.29
24347. jarif (jarif12) 3 60.15 67.11 1 33.33
24348. Hektor (dr_sparkles) 29 60.15 75.88 14 48.28
24349. Johny (johnyt) 433 60.15 88.77 81 18.71
24350. Biscuit (ddxddx) 3 60.14 66.01 2 66.67
24351. Austin (apollo2020) 25 60.14 69.22 4 16.00
24352. stephen (chonky_boi) 7 60.14 68.16 1 14.29
24353. Andrius (ciornas) 102 60.14 70.34 23 22.55
24354. Ika (kitkatslr) 7 60.13 63.17 1 14.29
24355. Joseph (tn6mrawesome) 4 60.13 64.29 2 50.00
24356. Vidu (pererav) 17 60.13 68.97 3 17.65
24357. jesper (jeppe_p) 6 60.13 70.88 1 16.67
24358. VH (jaywild) 118 60.13 77.47 23 19.49
24359. ilyassq (illiazo) 8 60.13 71.24 2 25.00
24360. Nikita (skorlupka) 5 60.12 65.11 1 20.00
24361. takenbyWine (takenbywine) 57 60.12 72.22 10 17.54
24362. Dimitri Yakovic (grazenburg_) 1 60.12 60.12 0 0.00
24363. Ben Taher (alhassantaher) 2 60.12 64.07 0 0.00
24364. Ahad (ahad_abd) 1 60.12 60.12 0 0.00
24365. Josh (unkret) 92 60.11 77.86 23 25.00
24366. SIX (six_p) 20 60.11 66.78 3 15.00
24367. snb (jftsnb) 18 60.11 69.69 5 27.78
24368. Sharaf (sharaf) 6 60.11 68.23 0 0.00
24369. Tayden (vanage) 3 60.11 64.06 2 66.67
24370. Mejster (mrmejster) 6 60.11 68.26 2 33.33
24371. Maks (makso02) 7 60.10 71.42 7 100.00
24372. gamal (gamal123) 1 60.09 60.09 0 0.00
24373. Garrett (garrettn1899) 13 60.09 67.62 2 15.38
24374. Yurii (kruason) 91 60.08 71.26 19 20.88
24375. Michael (notillusion) 3 60.08 64.34 0 0.00
24376. Adil (adisan_lc) 404 60.08 84.64 74 18.32
24377. Dode (dode_pep) 4 60.08 63.21 0 0.00
24378. Frank (jaxfrank) 79 60.08 73.33 15 18.99
24379. Christos (lexmarkx) 165 60.07 81.49 33 20.00
24380. Aaron (aaronfrdumb) 30 60.07 74.98 8 26.67
24381. Code (codeiii) 95 60.07 74.80 17 17.89
24382. Khenh (khnhnguyen) 69 60.07 93.28 19 27.54
24383. Adarsh (krishnan7) 879 60.06 81.55 147 16.72
24384. K (kqp3) 1 60.06 60.06 0 0.00
24385. Murphy (pouyacr72) 16 60.05 75.64 2 12.50
24386. David (annefrankisdead) 5 60.05 73.65 0 0.00
24387. Jacob (jacobascool) 166 60.05 77.46 27 16.27
24388. cat (catnigga) 1 60.05 60.05 0 0.00
24389. Scadeer (scadeer) 1 60.05 60.05 1 100.00
24390. Sean (nefhx3) 1 60.05 60.05 0 0.00
24391. Ripon Kumar (riponcse) 41 60.05 79.24 9 21.95
24392. Nenad (sima_car) 27 60.05 73.97 3 11.11
24393. Blixenn17 (sinonion17) 2 60.05 61.01 0 0.00
24394. Mariol (mcakalli) 24 60.04 70.31 5 20.83
24395. Leo (me10250) 89 60.04 89.03 19 21.35
24396. loveleen (loveleenasalia) 134 60.04 71.25 19 14.18
24397. Kristóf (kristofy) 3 60.04 66.10 0 0.00
24398. Hassan (hassanamoudi) 5 60.03 66.00 1 20.00
24399. Leo (kugiyasan) 5 60.03 71.36 1 20.00
24400. Shibasis (shibasisp) 2 60.03 63.06 0 0.00
24401. ꧁🎧웃 ֆɨɖɖɦǟռȶ... 29 60.03 78.10 7 24.14
24402. TeddY (jirayut) 16 60.03 70.89 6 37.50
24403. alv (alvdev) 170 60.02 71.50 28 16.47
24404. Adam (420adam) 7 60.02 70.34 1 14.29
24405. stanley (stanleyz4) 2 60.02 60.87 0 0.00
24406. DholaSain (cptmujahid) 3 60.02 68.80 0 0.00
24407. Kayak (kayakcanoe) 18 60.02 71.41 2 11.11
24408. Vinni (vinnico) 120 60.01 75.13 17 14.17
24409. Gaurab (logan_pi) 118 60.01 79.22 25 21.19
24410. Slim (slimkevin) 23 60.00 67.03 4 17.39
24411. tstats[madkingxxx] (madking... 159 60.00 82.12 34 21.38
24412. Karthik (darthmortem) 38 60.00 73.95 6 15.79
24413. Julien (taxes_) 16 60.00 72.28 6 37.50
24414. Matija (matija564) 2 60.00 62.20 1 50.00
24415. Krimmson (wrk4thjkr) 200 60.00 79.12 24 12.00
24416. PenguKeith (pengukeith) 2 60.00 64.77 1 50.00
24417. orainchy (orainchy) 2 60.00 61.95 1 50.00
24418. spy (noobtypebuddy) 1 59.99 59.99 0 0.00
24419. jk5621 (jk5621) 995 59.99 82.95 188 18.89
24420. Shvilesh (shvilesh) 5 59.99 75.51 1 20.00
24421. Hayford (flace) 64 59.99 71.74 13 20.31
24422. Emateos (emateos) 19 59.98 67.63 9 47.37
24423. Ash (ashbacchus) 46 59.98 73.65 5 10.87
24424. Bunjee (bunjeeman27) 3 59.98 72.79 0 0.00
24425. Imaan (imaan_m) 2 59.98 70.86 0 0.00
24426. Roman (freasy) 124 59.97 77.91 21 16.94
24427. Ian (iango23) 19 59.97 75.34 5 26.32
24428. jw (jw_c) 208 59.97 81.28 35 16.83
24429. Ilham (ilhamahmad) 4 59.97 65.33 0 0.00
24430. Anshul (anshul_khangar) 1 59.97 59.97 0 0.00
24431. Irarref (_ofking) 24 59.97 73.49 4 16.67
24432. boby (bobybomby) 8 59.97 77.34 3 37.50
24433. Moola_80wpm (moola_80wpm) 41 59.96 71.36 7 17.07
24434. Jona (ravioli_cheesecake12) 14 59.96 72.73 0 0.00
24435. Alec Gian (alecgian) 10 59.96 74.87 2 20.00
24436. Nyp3r (nyp3r) 31 59.96 70.85 3 9.68
24437. Mohammadamin (bmz8880) 5 59.96 69.42 0 0.00
24438. FaptasticFingers (faptastic... 1 59.95 59.95 0 0.00
24439. troi lanh uoc dc nam tay e ... 20 59.95 98.35 9 45.00
24440. cooter (c0oter) 3 59.94 64.09 1 33.33
24441. Naveen Kumar (naveen_1729) 20 59.94 73.35 1 5.00
24442. naomi (naomii_) 22 59.94 71.03 5 22.73
24443. Anavo (anavailable) 101 59.94 75.16 1 0.99
24444. lev (zoevespa) 1 59.94 59.94 0 0.00
24445. :) (erincur123) 177 59.94 75.84 32 18.08
24446. Tzo (tzoatplay) 11 59.94 66.31 2 18.18
24447. Alex (alextheo) 9 59.94 66.13 1 11.11
24448. sho (shoshosho1) 30 59.93 75.22 10 33.33
24449. Edward (eduward0_) 1 59.93 59.93 0 0.00
24450. Illusive (uneducated_scholar) 3 59.93 66.22 0 0.00
24451. pranav (pranav24) 37 59.93 71.62 13 35.14
24452. Vegard (ninjawegard) 13 59.92 67.88 3 23.08
24453. Mack (mack49) 17 59.92 83.06 4 23.53
24454. MOHANA (kanthetimohana) 33 59.92 70.37 0 0.00
24455. Billy (blipdip) 8 59.92 71.11 3 37.50
24456. Jack (jackkieny) 11 59.92 68.80 3 27.27
24457. AYJayeh (ayjayeh) 84 59.91 73.78 20 23.81
24458. khy (itskhylmao) 33 59.91 75.57 27 81.82
24459. Abhijeet (free_wanderer) 132 59.91 79.97 30 22.73
24460. Saurav (seldom69) 46 59.91 73.26 8 17.39
24461. Sadaq (sadaq) 10 59.91 66.25 2 20.00
24462. Mate (hhmate) 63 59.90 74.78 10 15.87
24463. Vu Huy (blaccod) 6 59.90 66.43 0 0.00
24464. Nicolas (nqber) 1 59.90 59.90 1 100.00
24465. Gleb (gsavchenko) 32 59.90 68.84 3 9.38
24466. Antonín (toniczech) 9 59.90 65.92 2 22.22
24467. PedroS235 (pedro_s235) 104 59.89 74.66 17 16.35
24468. Ducu (ducu) 54 59.89 67.96 10 18.52
24469. Ender (endermood) 5 59.89 64.38 1 20.00
24470. Nate (mmmcac) 9 59.89 68.24 1 11.11
24471. Rodolfo (clamchowder_) 1 59.89 59.89 0 0.00
24472. KOU (koulangkaya) 45 59.89 72.75 7 15.56
24473. Wilhelm (wilhelm_the_typing... 4 59.89 61.63 0 0.00
24474. AmiLemon (amilemon) 2 59.89 61.55 0 0.00
24475. Bloxxer (bloxxerboi_rblx) 220 59.88 88.77 46 20.91
24476. Trevor (uneasythrower24) 11 59.88 65.69 1 9.09
24477. Cris (the_thesaurusrex) 4 59.88 66.02 1 25.00
24478. Andrew (onetwoandyroo) 1 59.88 59.88 0 0.00
24479. Joseph (mwita7) 16 59.88 73.55 0 0.00
24480. Tian (mtianms) 3 59.88 64.59 1 33.33
24481. mizu (mizu0607) 1 59.88 59.88 0 0.00
24482. Charlie (boogiememeboi) 1 59.88 59.88 1 100.00
24483. Saptarshi (lamda_cdm_10) 233 59.88 77.26 50 21.46
24484. Vladislav (iivlad) 38 59.87 74.39 8 21.05
24485. Lun Mang (halberd237) 111 59.87 75.82 12 10.81
24486. Frode (fr0so) 21 59.87 68.70 2 9.52
24487. Nate (haploeco) 64 59.87 80.29 10 15.63
24488. Champion (error404_winner) 11 59.86 69.21 2 18.18
24489. Jakob (wcd1) 1 59.86 59.86 0 0.00
24490. aziz (azizkhanfar304) 290 59.86 75.53 57 19.66
24491. Divyesh (divyeshm) 116 59.86 78.23 22 18.97
24492. Euan (bossmankrabs) 3 59.86 64.97 1 33.33
24493. Eldin (eldin_) 9 59.86 74.36 2 22.22
24494. Erza (erza_loves_coffee) 88 59.85 73.42 9 10.23
24495. Donovan (donnyredzone) 28 59.85 71.22 4 14.29
24496. Dani (danivenk) 2 59.85 61.46 0 0.00
24497. Waaa (iiblazed) 7 59.85 64.50 1 14.29
24498. Bruce (buholaha) 2 59.85 60.57 1 50.00
24499. Eduardo (eduardofreitas) 33 59.84 71.35 4 12.12
24500. GOAT (qwerty1111) 3 59.84 64.44 0 0.00
24501. Jake (jokedac) 3 59.83 65.28 0 0.00
24502. Shukrullo (vodiylik) 3 59.83 64.07 0 0.00
24503. Ezz Abuzaid (ezzabuzaid) 82 59.83 72.53 20 24.39
24504. jhairssteven (jhairssteven) 25 59.83 74.61 3 12.00
24505. Harjot (harjot2000) 139 59.83 74.70 25 17.99
24506. roserayne (roserayne) 1 59.83 59.83 1 100.00
24507. ... (willnyeasianguy) 1 59.83 59.83 0 0.00
24508. hossameldien (hossam23177) 50 59.83 75.25 9 18.00
24509. Ashfaque (eshan_) 10 59.83 64.80 9 90.00
24510. Sir RB (rblogan3) 26 59.83 70.13 5 19.23
24511. Sebastian (jschavesr) 41 59.82 74.99 3 7.32
24512. Jacob (jlucibello) 2 59.82 63.58 1 50.00
24513. cheeks (almanfh) 1 59.82 59.82 0 0.00
24514. Martine (martine_338) 19 59.82 72.35 14 73.68
24515. tstats[jangstyle] (jangstyle) 3 59.82 60.88 0 0.00
24516. Big k (lawda) 839 59.82 91.62 168 20.02
24517. Arda (ardat96) 43 59.82 73.44 11 25.58
24518. Mina (minajacob) 2 59.81 64.77 0 0.00
24519. tstats[meratanak] (meratanak) 25 59.81 74.00 8 32.00
24520. maciej (maciek3290) 11 59.80 66.69 2 18.18
24521. Viktordido (viktor_dido27) 1 59.80 59.80 0 0.00
24522. Turningworld (turningworld) 19 59.80 70.52 8 42.11
24523. Chilly (racerrrrrrr) 275 59.80 76.35 44 16.00
24524. B (benfield) 25 59.79 70.46 1 4.00
24525. Mohamed (mohamedsameh) 78 59.79 70.64 13 16.67
24526. Heitor (fearlessss) 1 59.79 59.79 0 0.00
24527. Oscar (shopsketch) 12 59.79 65.19 1 8.33
24528. Jaden (jxden) 1 59.79 59.79 0 0.00
24529. Ramdizzle (ramdizzle) 13 59.79 69.14 5 38.46
24530. DeStuert (bully_hunter) 17 59.79 68.60 2 11.76
24531. Blake (mysticz8) 12 59.78 71.07 2 16.67
24532. Aniket (mrjerry1q98) 5 59.78 66.54 0 0.00
24533. Emman (3mm4n) 22 59.78 69.58 6 27.27
24534. PoisonDart (poisondart) 1 59.78 59.78 0 0.00
24535. Sasha (moongue) 201 59.78 78.71 34 16.92
24536. meiol (olete) 382 59.78 72.14 67 17.54
24537. Daddy D (vr00m_) 46 59.78 79.80 8 17.39
24538. bacon (peter_1860) 13 59.77 71.72 5 38.46
24539. John (procrastinator4life) 2 59.77 61.12 0 0.00
24540. Ben (men_biller) 1 59.76 59.76 0 0.00
24541. Kristen (kristenb225) 3 59.76 62.34 0 0.00
24542. Guest (lolteamtroll) 8 59.76 70.84 4 50.00
24543. Themi (themis3000) 28 59.76 68.45 5 17.86
24544. Harrison (fathole) 2 59.76 64.90 0 0.00
24545. KOSTOV (kostov) 475 59.75 87.63 87 18.32
24546. CWCCX.Artist (cwccx_artist) 3 59.75 62.76 0 0.00
24547. Pikachu (someone_cool) 2 59.75 69.63 0 0.00
24548. mello (mellofiy) 1 59.75 59.75 0 0.00
24549. Ultraa (ultrabladez) 9 59.75 73.02 2 22.22
24550. Rakuuen (rakuuen) 4 59.75 65.45 1 25.00
24551. Afsal (npafsal) 206 59.75 75.39 55 26.70
24552. Ashraya (ashrayas) 12 59.74 68.86 2 16.67
24553. yonatan (yonatanlib) 39 59.74 71.03 2 5.13
24554. Aadarsh (aadarshmani) 54 59.74 71.17 8 14.81
24555. Dean (dino22) 220 59.74 71.91 94 42.73
24556. Colemark (iamkenzo) 1 59.74 59.74 0 0.00
24557. Himanshu (himanshumishra3198) 43 59.74 68.65 11 25.58
24558. Muhsin (muhsinaldoori) 14 59.73 73.30 3 21.43
24559. akaxls (xlsbestplayer) 24 59.73 73.11 6 25.00
24560. Naren (narenr2005) 5 59.73 63.90 0 0.00
24561. Rutvij (rutvij2811) 2 59.73 60.64 0 0.00
24562. Abdulmohsin (mhasen) 17 59.73 68.65 2 11.76
24563. Chrism4 (chrisman44) 818 59.72 86.15 147 17.97
24564. Sourav (_sourav_sarkar_) 76 59.72 81.10 13 17.11
24565. joe (joe_mam101) 14 59.72 72.27 3 21.43
24566. ScanCode (scancode8) 12 59.72 74.49 1 8.33
24567. Ajay (ur_fav_man_ajoy) 2 59.72 60.95 1 50.00
24568. shubham (shubham2468) 184 59.71 81.13 33 17.93
24569. Harish (harish1995) 1 59.71 59.71 1 100.00
24570. رحيم (rahim06) 35 59.71 70.11 3 8.57
24571. bleh (dan1ce) 105 59.71 74.99 38 36.19
24572. Nursultan (nursultan23) 285 59.71 80.71 41 14.39
24573. Ivan (pugaelmen) 3 59.71 65.95 2 66.67
24574. Ekezuke (ekezuke) 72 59.71 77.24 19 26.39
24575. hy0605 (hy0605) 6 59.70 65.19 1 16.67
24576. Abdelghani (aogino) 18 59.70 78.53 5 27.78
24577. jerk (doofenshmirtzevil_inc) 62 59.69 71.50 16 25.81
24578. Diego (demo5567) 1 59.69 59.69 0 0.00
24579. Igor (orderil) 1 59.69 59.69 0 0.00
24580. Travis (tr4v1sty) 1 59.69 59.69 0 0.00
24581. Joe (joe_kazama) 2 59.69 62.18 1 50.00
24582. Unique (unique1402) 21 59.69 79.81 7 33.33
24583. Typing (typotyper1738) 10 59.69 80.18 1 10.00
24584. Ryley (zqroh) 22 59.68 71.13 4 18.18
24585. Roast (lemonshine) 37 59.68 76.45 7 18.92
24586. Clemens (cleminator) 22 59.68 66.31 5 22.73
24587. Azri Akmal (azriakmalk) 4 59.68 68.95 1 25.00
24588. Hisham (7ommus) 16 59.68 75.97 3 18.75
24589. Mohab Tharwat (mohab97) 63 59.68 88.49 15 23.81
24590. geo (geogeo120) 2 59.68 61.19 0 0.00
24591. Admaster (admaster) 133 59.67 80.33 29 21.80
24592. Astex (astex_97) 2 59.67 62.88 0 0.00
24593. typer (practise_to_type) 97 59.66 74.46 38 39.18
24594. Rim (rimkyul) 10 59.66 69.25 7 70.00
24595. Syimyk (sam_j5) 53 59.66 72.04 11 20.75
24596. Ali (alirn76) 4 59.66 64.01 4 100.00
24597. NickR (nicholasr) 1 59.65 59.65 0 0.00
24598. pbj (thepbj) 9 59.65 75.79 2 22.22
24599. 😷 (ashraaf_k) 9 59.64 71.64 2 22.22
24600. TeenPro (teenpro) 8 59.64 76.47 4 50.00
24601. Luke (harrislp1979) 27 59.64 73.20 8 29.63
24602. Mait (mangomaits) 1 59.64 59.64 1 100.00
24603. Warren (war_30) 27 59.64 76.94 5 18.52
24604. _Lxwrxncx_ (_lxwrxncx_) 4 59.64 63.37 2 50.00
24605. charlie (ck840204) 4 59.63 64.98 1 25.00
24606. Kabadahija (kabadahija30) 56 59.63 72.51 3 5.36
24607. Iluminuss (iluminuss) 1 59.63 59.63 0 0.00
24608. Brayden (blackbat1645) 1 59.63 59.63 1 100.00
24609. Daniel (dannyxrpm) 18 59.63 74.23 9 50.00
24610. Ivan (sakhman) 199 59.63 80.39 32 16.08
24611. Sar (shift2alt) 45 59.62 70.68 13 28.89
24612. Koiysn (koiysn) 10 59.62 75.71 1 10.00
24613. lone (lone17) 89 59.62 86.34 21 23.60
24614. brendi (noobgodbrendi) 9 59.61 75.59 2 22.22
24615. ayusha (hm_yes) 3 59.61 66.00 0 0.00
24616. asburton (asburtongrove) 1 59.61 59.61 0 0.00
24617. Signical (signicial) 1 59.61 59.61 0 0.00
24618. Ben (benjals9) 42 59.61 78.49 10 23.81
24619. aerospike (aerospike) 214 59.61 83.07 43 20.09
24620. Slicky (slickyslide) 17 59.60 66.31 4 23.53
24621. Omer (omer_nukic) 359 59.60 81.13 70 19.50
24622. Michael (todfelton) 7 59.60 64.53 0 0.00
24623. GOTTAGOFAST (b_200910028) 87 59.59 77.09 18 20.69
24624. Wujue (wujue) 54 59.59 68.26 12 22.22
24625. bendo (bendh) 250 59.59 78.89 40 16.00
24626. cockn (pugzip) 12 59.59 71.73 4 33.33
24627. Cristian (crism123dm) 57 59.58 78.16 9 15.79
24628. 12Codes🍁 (bestial) 170 59.58 81.16 32 18.82
24629. aa (aanyc) 59 59.58 71.25 9 15.25
24630. Lee (whaocool) 1 59.58 59.58 0 0.00
24631. Hampus (bogge_) 6 59.58 61.98 1 16.67
24632. John (jolomaho) 9 59.58 63.47 1 11.11
24633. Sven (nevslehcim) 5 59.57 71.30 1 20.00
24634. Byron (chicken_little1) 263 59.57 72.01 40 15.21
24635. Debasmit (inmessi) 45 59.57 68.40 14 31.11
24636. Michael (m1ch4el) 281 59.57 75.55 41 14.59
24637. Ollt (ollt) 4 59.57 68.29 0 0.00
24638. Luisovc1812 (luisovc1812) 8 59.57 70.10 0 0.00
24639. Alexander (idkwhatimdoin9) 10 59.57 71.31 1 10.00
24640. Force (lv_force_vl) 3 59.56 67.03 1 33.33
24641. Dhwaj (dhwxj) 6 59.56 67.16 4 66.67
24642. Waske (waskepro_official) 4 59.56 65.74 1 25.00
24643. limdaepicpber (limdaepicpber) 8 59.56 67.50 4 50.00
24644. Alex (heikale) 12 59.56 75.92 1 8.33
24645. Antete (antete) 4 59.56 66.02 0 0.00
24646. vitvlkv (vitvlkv) 121 59.56 73.08 18 14.88
24647. lili (lilihsu) 7 59.55 65.12 0 0.00
24648. Munta (munta) 8 59.55 73.23 2 25.00
24649. bachira (bachira) 10 59.55 65.03 2 20.00
24650. salsa (spencer_salsa) 162 59.55 83.30 31 19.14
24651. kandarp (kandarp_5) 76 59.55 79.34 17 22.37
24652. 666Rising (666rising) 3 59.55 62.07 1 33.33
24653. flats (f1ats) 5 59.55 66.51 3 60.00
24654. Jeff (3deer6) 26 59.55 75.12 4 15.38
24655. Sebastian (racermaster_) 21 59.55 72.22 2 9.52
24656. Max (maxy_boi) 22 59.54 69.60 11 50.00
24657. Louis (lorencoo) 1 59.54 59.54 0 0.00
24658. 100 WPM Dream (jokubas1224) 4 59.54 70.72 0 0.00
24659. Nathan (gengeza) 2 59.54 60.34 1 50.00
24660. Mikke (skrammelkonto) 122 59.54 70.20 41 33.61
24661. Elias (eliasstr53) 3 59.54 61.28 2 66.67
24662. Jacky (lo2238) 1 59.53 59.53 0 0.00
24663. Leif (leif26) 1 59.53 59.53 0 0.00
24664. SCUT-黄光积 (hy_1314) 67 59.53 76.94 5 7.46
24665. Felipe Bell (felipebell) 4 59.52 64.99 1 25.00
24666. Jacob (lowkdr) 6 59.52 65.71 1 16.67
24667. Ahmad (fadedxtc) 6 59.51 67.85 0 0.00
24668. LaBond (labond123) 1 59.50 59.50 0 0.00
24669. Potato (nyll) 1 59.50 59.50 0 0.00
24670. Dwiko (diorite90) 110 59.50 76.33 27 24.55
24671. Smith (iamhablo) 10 59.50 62.24 1 10.00
24672. milki (milkepro) 47 59.49 85.99 9 19.15
24673. Julian (julianjelfs) 12 59.49 69.87 1 8.33
24674. Vicky (viqnt) 2 59.49 63.83 0 0.00
24675. BOTbkchod (bot_bakchod) 147 59.48 72.91 27 18.37
24676. Darth (darth480) 2 59.48 74.31 0 0.00
24677. Victoria (vicksun) 26 59.47 67.92 2 7.69
24678. Adarsh (adimall) 6 59.47 65.69 3 50.00
24679. Al (alriad) 44 59.47 68.28 11 25.00
24680. lee (wndnjs4389) 11 59.47 71.56 2 18.18
24681. loow (loowt) 15 59.47 72.54 2 13.33
24682. Shivam (shivamg) 3 59.47 63.85 0 0.00
24683. Cassi (slowerthanmolasses) 30 59.47 73.09 4 13.33
24684. Max (maxube21) 45 59.46 70.51 12 26.67
24685. Daniel (annyoung) 1 59.46 59.46 0 0.00
24686. Rohit (krullun) 8 59.45 64.83 0 0.00
24687. lee (navalta) 1 59.45 59.45 0 0.00
24688. Abdulaziz (aligonijr) 13 59.45 73.40 3 23.08
24689. squidite (squidite) 7 59.45 74.20 1 14.29
24690. Dominic M Asio (robodom711) 6 59.45 71.09 0 0.00
24691. Stick (stick69) 34 59.45 71.92 6 17.65
24692. leo (ytxqz) 24 59.45 71.56 3 12.50
24693. Priyanshu (psxuchiha) 25 59.44 72.99 1 4.00
24694. Marcus (marcustham) 26 59.44 69.46 5 19.23
24695. Zed (zedhabibi) 7 59.44 64.52 6 85.71
24696. Bart (satancat) 1 59.44 59.44 0 0.00
24697. Sergey (tsykurawork) 35 59.44 69.71 8 22.86
24698. NO (veryaveragetyper) 7 59.44 63.19 2 28.57
24699. Roger (rogerboston) 27 59.43 77.53 4 14.81
24700. jimmy (zojim) 2 59.42 63.51 0 0.00
24701. taichi (sjwsl) 12 59.41 68.42 2 16.67
24702. trendy (strongly_typed_trendy) 1,175 59.41 90.32 215 18.30
24703. lukasz (lukaszx) 1 59.41 59.41 0 0.00
24704. Rishab (kamado_) 184 59.41 76.05 51 27.72
24705. sabian (sabiansaige) 25 59.41 75.28 4 16.00
24706. Denny (what_tf_is_up_kyle) 21 59.41 80.73 5 23.81
24707. Dmitry (scrinium) 5 59.41 64.91 2 40.00
24708. Nathaniel (wiiman) 10 59.41 68.13 4 40.00
24709. Jon (jonksig) 5 59.40 64.70 1 20.00
24710. bachu (bachu2020) 44 59.38 82.72 12 27.27
24711. 🏎️t.me/abdulhamidsulto... 10 59.38 70.55 3 30.00
24712. Piyush (p1yu5h) 30 59.38 67.88 7 23.33
24713. Braxton (brontar) 3 59.38 68.94 0 0.00
24714. Raiza (raaizar) 1 59.37 59.37 0 0.00
24715. taya (tamey0urimpala) 4 59.37 62.62 2 50.00
24716. Ben (thebenman7dv) 420 59.36 82.27 52 12.38
24717. Bektas (k1ngst0ne) 14 59.36 75.37 3 21.43
24718. Muhammad Musharaf (musharaf35) 30 59.36 74.04 8 26.67
24719. Mani (93z9a) 10 59.36 68.10 1 10.00
24720. Albert (yellowmoose) 4 59.36 63.24 1 25.00
24721. David (davalav) 4 59.36 65.00 2 50.00
24722. Taras (gavair) 348 59.35 75.10 59 16.95
24723. KK (kemal_k) 5 59.35 66.80 2 40.00
24724. John Lizuer (dimasalangchae) 65 59.35 80.66 16 24.62
24725. krisztofer (poofartmaster) 10 59.35 65.80 1 10.00
24726. Yoru (yoruu12) 47 59.34 68.29 5 10.64
24727. Venky (venkypk) 2 59.34 62.37 0 0.00
24728. Ali (divine_typer) 7 59.34 69.82 1 14.29
24729. T (mrtvigs) 2 59.34 62.13 1 50.00
24730. Nicholas (swissbanklord) 16 59.33 76.21 3 18.75
24731. ICE TEA (ice_tea911) 32 59.33 70.89 5 15.63
24732. zitsy (zitsy) 4 59.33 66.01 1 25.00
24733. Angeline (mangosteen18) 89 59.33 75.46 11 12.36
24734. Lê Hùng Luận (lehungluan) 7 59.32 65.57 1 14.29
24735. Gio (banzy) 272 59.32 73.91 45 16.54
24736. gre (gregoryrogel) 31 59.32 72.30 5 16.13
24737. OCD (ocdonedid) 2 59.32 64.78 0 0.00
24738. Philemon (blubblubgoldfish1... 3 59.31 60.96 2 66.67
24739. Rajshekar (rajshekar__) 5 59.31 61.69 0 0.00
24740. Prateek (prateek2112) 1 59.31 59.31 1 100.00
24741. Ezio (ezio129) 25 59.31 71.68 4 16.00
24742. Ayham (ayhamgh) 81 59.30 74.04 19 23.46
24743. . (hiradesuwu) 39 59.30 73.00 11 28.21
24744. charlene (charlenemiao) 55 59.30 72.28 7 12.73
24745. Kasra (kasra15) 11 59.30 69.25 1 9.09
24746. vamshidhar (vamshidhar18) 432 59.30 84.00 87 20.14
24747. Crystallyen (crystallyen) 4 59.30 67.42 1 25.00
24748. Sophia (need_to_run) 14 59.29 64.64 0 0.00
24749. Hour (soslow_) 241 59.29 76.81 34 14.11
24750. canwithbeans (canikomaniko1) 13 59.28 72.87 2 15.38
24751. Foolish (justashish4556) 23 59.28 66.86 8 34.78
24752. etherene (etherene) 3 59.28 70.48 0 0.00
24753. Darkness_ (darkness_) 6 59.28 65.42 2 33.33
24754. Ryan (kingdr) 14 59.28 75.19 4 28.57
24755. dayy (lordie) 314 59.28 85.17 63 20.06
24756. cheikh (cheikhbr) 921 59.28 84.57 158 17.16
24757. ImranKhanZindabad (asadjani) 239 59.28 76.84 39 16.32
24758. harsh (harshlunagaria) 3 59.28 63.44 2 66.67
24759. Aaron (ayeayeron) 74 59.28 72.33 20 27.03
24760. Xuan Thong (fxcvs) 15 59.27 71.21 6 40.00
24761. elbert (elbert1104) 34 59.27 70.35 6 17.65
24762. Brian (franklybrian) 1 59.27 59.27 0 0.00
24763. 2SCucumber (vincicheung361) 1 59.27 59.27 0 0.00
24764. Ryokuuy (ryokuuy) 3 59.27 66.23 0 0.00
24765. Tí cần không bạn (ron... 12 59.27 74.33 2 16.67
24766. Amine (ov4h) 32 59.26 74.26 8 25.00
24767. Fadil (mr_fadil48) 80 59.26 79.27 15 18.75
24768. mike (yyu2017) 1 59.26 59.26 0 0.00
24769. Soroush (soroush_xyz) 5 59.26 70.06 0 0.00
24770. Suntery (jennk1) 52 59.26 71.39 9 17.31
24771. Simon (plantsdragon) 48 59.25 73.54 11 22.92
24772. arsh (plutarsh) 1 59.25 59.25 1 100.00
24773. ScaryCarrie c: (scary_carrie) 19 59.25 70.82 3 15.79
24774. keira g (keiragg) 2 59.25 64.37 1 50.00
24775. Shivam (sj_pro) 160 59.24 78.17 38 23.75
24776. Tomas (t0mcuhhh) 6 59.24 76.53 1 16.67
24777. Denis (dwake) 3 59.24 70.91 1 33.33
24778. peshraw (peshraw) 73 59.24 76.67 12 16.44
24779. Avery (bigger_chungus) 2 59.24 67.02 1 50.00
24780. thebennies (thebennieswho) 2 59.24 60.27 0 0.00
24781. Alex (stupidbtch67) 5 59.23 63.00 0 0.00
24782. funky (teletubbystan) 10 59.22 65.18 3 30.00
24783. Kermilian (kermilian_05) 52 59.22 75.08 10 19.23
24784. Rahul (rocketiscracked) 76 59.21 82.91 22 28.95
24785. IDK (sarpain) 9 59.21 64.14 2 22.22
24786. Jonathan (nebulium) 11 59.21 70.68 2 18.18
24787. Jonathan (jonna1308) 6 59.21 70.27 0 0.00
24788. Hannah (hanthetyper) 6 59.21 74.74 0 0.00
24789. Hasit (invincible678) 32 59.20 87.45 5 15.63
24790. Adam (eveve05) 1 59.20 59.20 0 0.00
24791. Deependra (deepak_typer) 3 59.20 64.00 1 33.33
24792. Zohaib (atazoa) 1,144 59.20 93.35 222 19.41
24793. Josh (jgeoppo) 10 59.19 68.05 2 20.00
24794. Florian (pixhd) 1 59.19 59.19 1 100.00
24795. .... (_otto_) 47 59.19 72.27 7 14.89
24796. Varun (salmonwings8207) 39 59.19 72.60 10 25.64
24797. me_astr (me_astr) 407 59.18 78.75 79 19.41
24798. aymen (aymenalwh) 105 59.18 73.96 22 20.95
24799. dakshesh (the_teslafan) 15 59.18 78.72 9 60.00
24800. DrCharlesS (scpdrcs) 7 59.17 64.65 2 28.57
24801. Denis (denisjames) 6 59.17 65.44 0 0.00
24802. Asmus (asmus__) 30 59.17 75.14 6 20.00
24803. siceon7 (siceon7) 1 59.16 59.16 1 100.00
24804. Microwave (microwave69420) 1 59.16 59.16 1 100.00
24805. mafia (mafia207) 14 59.16 74.02 3 21.43
24806. jay (icantfeel) 22 59.15 70.25 5 22.73
24807. ur mom (jolly_retard6666) 6 59.15 69.30 2 33.33
24808. adarsh_rzh (adarsh_rzh) 28 59.15 75.44 8 28.57
24809. Avi (avitoohband) 155 59.14 86.06 33 21.29
24810. Zhavokhir (zhav0kh1r) 14 59.14 74.62 8 57.14
24811. G_low (g_low) 33 59.13 89.87 11 33.33
24812. paveN (paven_) 73 59.13 73.67 15 20.55
24813. Arsh (batman4ever) 162 59.13 76.64 32 19.75
24814. Brrrdman (birdmanmcinnes) 188 59.13 77.24 22 11.70
24815. Protik (protiknag) 9 59.13 67.77 0 0.00
24816. Luca Plat (lucaplat) 4 59.13 66.04 1 25.00
24817. Zisis (atrogzisis) 3 59.12 64.18 1 33.33
24818. Ben (benwarner) 6 59.12 65.60 2 33.33
24819. Venkatasai (saivenkata521) 2 59.12 61.67 0 0.00
24820. Rituparna (ri2parna) 3 59.11 62.92 0 0.00
24821. Peter (rudson) 1 59.11 59.11 1 100.00
24822. Bhaskar (bhaskar942) 31 59.11 73.79 3 9.68
24823. Zhijian (zliangal) 170 59.10 75.41 33 19.41
24824. Cyptre (cyptre) 24 59.10 77.64 6 25.00
24825. Haley (halllw) 15 59.10 72.13 6 40.00
24826. solarwind (solarwind75) 3 59.10 75.82 1 33.33
24827. Beheshta (beheshta) 49 59.10 74.48 7 14.29
24828. cubeian (cubeian) 48 59.09 74.41 5 10.42
24829. J (chalcha) 1 59.09 59.09 0 0.00
24830. Sang Sabil (sangsabil217) 7 59.09 67.01 1 14.29
24831. BlueCar (greencar) 71 59.09 72.07 10 14.08
24832. Navait (nkumar031) 289 59.08 83.48 59 20.42
24833. Akbar (akbarovi) 65 59.08 73.25 8 12.31
24834. Bryn (ami_kawashima) 3 59.08 62.04 0 0.00
24835. Temirlan (nalrimet) 7 59.08 67.01 1 14.29
24836. lolswag420 (lolswag420) 4 59.08 61.87 2 50.00
24837. Simon (simonk33) 2 59.08 61.67 0 0.00
24838. joe (aidanbbm) 15 59.08 72.05 0 0.00
24839. SAIF (sci_fi_saif) 12 59.07 66.34 2 16.67
24840. Nikita (chervovn04) 109 59.07 74.29 20 18.35
24841. Scyx (scyx3) 176 59.07 84.67 33 18.75
24842. Advik (advik123) 26 59.07 66.98 7 26.92
24843. eriktarek (erikabd) 1 59.07 59.07 0 0.00
24844. Kevin Carl (kevincarl09) 38 59.07 67.53 7 18.42
24845. Sour (yung246) 73 59.07 70.00 12 16.44
24846. Nik (teriki) 2 59.07 61.05 0 0.00
24847. Dras (dras227) 210 59.06 77.90 39 18.57
24848. DDIR (pn10401006) 121 59.06 72.98 23 19.01
24849. Sahil (prosahil) 7 59.05 77.11 1 14.29
24850. phantom (hrithikhack007) 223 59.05 82.47 33 14.80
24851. Galtorix (galtorix) 4 59.05 60.14 0 0.00
24852. Anis (anis22) 140 59.05 74.17 29 20.71
24853. Joshua (racingjsj) 4 59.05 65.40 0 0.00
24854. Ioishi (loishi) 9 59.04 64.67 3 33.33
24855. ur (slowtyperfromcz) 9 59.04 65.63 3 33.33
24856. Arnold (arnolddddd) 2 59.04 59.11 0 0.00
24857. wpnwbn (wpnwbn) 2 59.03 59.21 1 50.00
24858. Pintu (pintukanjia) 249 59.02 79.17 52 20.88
24859. Ulday (ulday) 2 59.02 61.00 0 0.00
24860. dankerkys (dankerkys) 12 59.02 79.64 7 58.33
24861. Nathan (kingdunlop) 5 59.01 62.73 1 20.00
24862. Fiha (fiha16) 23 59.01 71.53 11 47.83
24863. Daniel (spades_syn) 7 59.01 66.50 2 28.57
24864. Khanh (erile) 14 59.01 66.74 0 0.00
24865. speed420 (uhfees) 23 59.01 71.97 2 8.70
24866. vrush (vrush05) 6 59.01 63.18 0 0.00
24867. Benjamin (banjo_) 138 59.00 75.43 25 18.12
24868. bailey (darkness04) 26 59.00 98.72 11 42.31
24869. Seamus (shaydogga) 1 59.00 59.00 0 0.00
24870. khari (libsj) 1 59.00 59.00 0 0.00
24871. Josh (zumoariri) 11 59.00 67.80 2 18.18
24872. cadde (cadde) 134 59.00 75.03 18 13.43
24873. paul (paulzzzz) 6 58.98 68.92 1 16.67
24874. Corgious (aiwoon) 9 58.98 65.71 1 11.11
24875. Semyon (saymon211) 1 58.98 58.98 0 0.00
24876. Oddpie (oddpie) 6 58.98 65.84 0 0.00
24877. Shiv (shivam9_) 42 58.98 73.97 13 30.95
24878. Damian (damianp123) 2 58.97 62.41 2 100.00
24879. Lydia (lydia_sol) 3 58.97 61.80 1 33.33
24880. Drake (gangket) 104 58.97 75.94 13 12.50
24881. sussy (sussybaka11) 8 58.97 65.35 0 0.00
24882. cvxz (cvxz) 112 58.96 80.48 22 19.64
24883. mongs (theworstyuki) 5 58.96 71.62 4 80.00
24884. Jonas (jonxasbro) 6 58.96 68.98 0 0.00
24885. Dipankar (dipankarkumar275) 164 58.94 74.22 30 18.29
24886. MD ASHIQUL (rajib470) 10 58.94 66.19 0 0.00
24887. Tyrocune (tyrocune) 34 58.94 69.64 8 23.53
24888. Shuncey (shuncey) 1 58.94 58.94 0 0.00
24889. Jalen (jsaucegawd) 1 58.94 58.94 0 0.00
24890. bsbs (bsbs03) 1 58.93 58.93 0 0.00
24891. Shriyans (shriyanspatnaik) 1 58.93 58.93 0 0.00
24892. Nullius (nullius) 9 58.93 63.36 2 22.22
24893. Leon (leonthehandsome) 5 58.93 64.77 0 0.00
24894. david (davideman4) 5 58.92 66.99 1 20.00
24895. Amanda (aj1111) 18 58.92 79.24 3 16.67
24896. Bishwash (bishwashadhikari) 11 58.92 75.13 3 27.27
24897. HandyManny (casteristic) 1 58.92 58.92 0 0.00
24898. Keshav (keshavjindaljp) 1 58.92 58.92 0 0.00
24899. zahid (zahid_hasan_sahin) 19 58.92 70.72 5 26.32
24900. Fidel Alberto Ramos (Perú)... 156 58.91 77.73 21 13.46
24901. Kiran (kiran11621) 4 58.91 64.09 1 25.00
24902. Cosmin (cosmyd) 32 58.91 69.20 3 9.38
24903. chris :) (chrissypop) 3 58.91 67.99 0 0.00
24904. astro (black_astro) 1 58.91 58.91 1 100.00
24905. Utkarsh (utkarsh_n) 15 58.91 70.75 3 20.00
24906. Mrinmoy (mrinmoyss) 4 58.90 63.78 0 0.00
24907. JO (pinkvelociraptor) 28 58.89 72.90 9 32.14
24908. Andreas (ak9729) 6 58.89 69.40 1 16.67
24909. cloudwalker (ismailkhan78642) 6 58.89 66.35 2 33.33
24910. tia (teayah) 26 58.89 71.81 9 34.62
24911. @imshdx_ (shadox999) 2 58.88 65.44 0 0.00
24912. hydroPUMP (hydropump) 10 58.88 68.14 1 10.00
24913. Rohan (rohanji) 5 58.88 67.31 3 60.00
24914. Daniel (danrike22) 15 58.88 70.13 0 0.00
24915. Raymond (raymondrudman) 2 58.88 62.01 0 0.00
24916. Heem (rayhim) 8 58.87 64.19 2 25.00
24917. Kipper (ziuncati) 393 58.87 78.11 68 17.30
24918. Nick (nicknyaumwe) 4 58.86 64.98 1 25.00
24919. barrybee789 (barrybee789) 37 58.86 70.13 4 10.81
24920. Homer (aerowang) 122 58.86 72.20 16 13.11
24921. sev (sev4tou) 31 58.85 66.58 7 22.58
24922. Jd (jdthebeanbag) 12 58.85 67.14 1 8.33
24923. Abdulhadi (surebeta) 28 58.85 68.04 3 10.71
24924. shubhkarman (death_zeal) 1 58.85 58.85 0 0.00
24925. Syed (syedmadad) 25 58.85 77.71 2 8.00
24926. Narayan (narayan2002) 21 58.85 73.49 16 76.19
24927. Rahul (endeavour_the_one) 117 58.85 79.26 18 15.38
24928. Sharjil (sharjil2k02) 5 58.85 69.25 0 0.00
24929. Miras (ninth_hokage) 5 58.84 68.75 2 40.00
24930. lior (liorlubek) 52 58.84 78.33 10 19.23
24931. kaya (kayax) 1 58.84 58.84 0 0.00
24932. Rachael (rachaelpoedia) 49 58.83 68.90 7 14.29
24933. Christian (speciial) 46 58.83 70.93 6 13.04
24934. Eines (hawkeines) 1 58.83 58.83 0 0.00
24935. blublueagle (blublueagle) 9 58.83 66.49 2 22.22
24936. Y Lee (leengau) 50 58.82 77.50 7 14.00
24937. Renstyfus (renstyfus) 3 58.82 69.49 0 0.00
24938. Dr (drchhun) 96 58.82 76.93 15 15.63
24939. Alexandre (ignorantez) 3 58.81 68.95 1 33.33
24940. ShyKnee (samflysure) 31 58.81 67.96 3 9.68
24941. Josh (joshua798) 1 58.81 58.81 0 0.00
24942. zsolesz71 (zsolesz71) 5 58.81 71.38 1 20.00
24943. Chetan (chetankawarkhe) 84 58.80 81.44 16 19.05
24944. John (1underman123) 3 58.80 67.80 1 33.33
24945. Michael Rostom (michaelrous... 25 58.80 65.85 3 12.00
24946. null (apstamp45) 11 58.80 65.36 1 9.09
24947. Z (zixosa) 3 58.80 59.77 0 0.00
24948. Preet (rahal) 16 58.80 71.89 4 25.00
24949. Gareton (gareton) 109 58.80 69.82 14 12.84
24950. Essy (supersonics123) 64 58.80 77.23 10 15.63
24951. Filip (churllix) 93 58.80 73.19 10 10.75
24952. Dusan (dusan321) 1 58.79 58.79 0 0.00
24953. Hanami (hanamiaiko) 3 58.79 60.94 1 33.33
24954. Zubair Ali (zubairali) 84 58.79 76.34 11 13.10
24955. Andrew (greenhoodiee) 2 58.79 63.21 0 0.00
24956. Antonin (nebula__) 14 58.78 70.98 6 42.86
24957. ALIF (ronin98) 39 58.78 70.46 6 15.38
24958. Beedle (bernod) 47 58.77 76.64 8 17.02
24959. jithin (jithinjoseph) 14 58.77 69.50 0 0.00
24960. john (jpom16) 42 58.77 71.89 9 21.43
24961. decadent movement (lkmatter) 14 58.77 64.66 1 7.14
24962. bhuvi (bhuvi1606) 14 58.77 69.81 3 21.43
24963. HADI (adilmuhammadi) 141 58.77 73.52 28 19.86
24964. Trevor (fifty_eight) 4 58.77 65.61 0 0.00
24965. Ali (alijoon) 152 58.77 74.40 18 11.84
24966. robin (golden_eggs) 2 58.77 61.08 0 0.00
24967. Ryan (dudemcbroguy) 2 58.77 60.67 0 0.00
24968. Caleb (ghostlyaardvark) 6 58.76 61.53 0 0.00
24969. Zachary (hejukaza) 90 58.76 95.38 22 24.44
24970. Oatseveryday (oatseveryday) 5 58.75 65.71 1 20.00
24971. George (relaxed_20) 12 58.75 69.93 1 8.33
24972. Morgan (mscoot) 1 58.75 58.75 1 100.00
24973. HasadBoii (hasadboii) 443 58.75 79.65 228 51.47
24974. Rizky (rzkyog) 2 58.75 69.23 1 50.00
24975. Jack (jtchen0528) 2 58.74 63.99 1 50.00
24976. Nick (nick1236) 105 58.74 78.21 16 15.24
24977. iAmKaviar (iamkaviar) 85 58.74 76.60 15 17.65
24978. Ketan (ketanprakash001) 1 58.73 58.73 0 0.00
24979. Jonathan (john_ee) 17 58.73 66.67 4 23.53
24980. Ash (itsash) 2 58.73 65.96 0 0.00
24981. idontflinch (mistergold) 3 58.72 61.76 0 0.00
24982. Rex (rexwb) 1 58.72 58.72 1 100.00
24983. thehiep (thehiep8x) 1 58.72 58.72 0 0.00
24984. Dan (stun100) 3 58.72 68.80 0 0.00
24985. Anshuman (anshu_8) 431 58.72 79.48 78 18.10
24986. MD. Rashedul (porosh45) 34 58.72 75.48 5 14.71
24987. y (ys26908) 8 58.72 67.24 0 0.00
24988. Dreeows (tanziomee) 15 58.72 72.73 3 20.00
24989. Justin (jauntsmirk) 5 58.72 62.47 0 0.00
24990. tstats[levo2001] (levo2001) 9 58.71 68.94 3 33.33
24991. sergieric (sergieric) 11 58.71 68.94 3 27.27
24992. Hanica (hanicanii) 20 58.71 70.94 6 30.00
24993. Get Racc'd (getraccd_) 11 58.70 67.67 2 18.18
24994. Om (omkashyap007) 965 58.70 85.07 170 17.62
24995. Ozan Can (romuyloyloy) 7 58.70 65.89 1 14.29
24996. Connor (ct2019) 174 58.70 76.12 32 18.39
24997. Helena (helena_mp) 21 58.69 67.44 3 14.29
24998. Victor (tucky50) 1 58.69 58.69 0 0.00
24999. Phong (phonglt) 3 58.68 60.78 1 33.33
25000. Alazar (mealazar) 69 58.68 74.71 9 13.04
25001. Eric (ebiman9726) 96 58.68 86.59 14 14.58
25002. Ifan (ifan98) 3 58.68 62.38 0 0.00
25003. Esther (ueatmypoop) 10 58.68 70.63 1 10.00
25004. Shagato (5hagat0) 6 58.68 61.56 1 16.67
25005. Paul Kenneth (kennetoy2302) 84 58.67 78.21 20 23.81
25006. Ville (gowalski) 1 58.67 58.67 0 0.00
25007. w0ng (w0ng_dvorak) 156 58.66 74.69 20 12.82
25008. Vishal (vishalparkour) 2 58.66 68.28 2 100.00
25009. Austin (captan535) 6 58.66 67.87 2 33.33
25010. asd (asdasd4) 1 58.66 58.66 0 0.00
25011. ZER039 (samyak039) 1 58.66 58.66 0 0.00
25012. Ryu (ryu_00) 2 58.66 60.97 0 0.00
25013. Neeraj (neeraj1) 142 58.66 77.60 22 15.49
25014. Aidan (aidandapenguin) 19 58.65 66.71 1 5.26
25015. wael (wael2) 11 58.65 67.80 1 9.09
25016. Gjd (gwvj) 188 58.64 77.19 33 17.55
25017. Luis (ealjkl) 7 58.64 65.38 3 42.86
25018. vtopfam (vtopfam) 1 58.64 58.64 0 0.00
25019. (amithps66) 254 58.64 72.68 36 14.17
25020. JEWels (juewls) 84 58.63 76.87 16 19.05
25021. TruwChainz (truwchainz) 1 58.63 58.63 1 100.00
25022. Ely (touch_typer) 2 58.62 59.62 0 0.00
25023. Rystian (cap_redhawk) 8 58.61 65.51 2 25.00
25024. edna (ednanaanaa) 25 58.61 71.78 5 20.00
25025. Chidum (flashstriker007) 24 58.61 79.08 4 16.67
25026. Bhavya (dark_knight_2914) 17 58.60 70.67 10 58.82
25027. Zach (yo_zs) 10 58.60 73.16 1 10.00
25028. Yogender (ritik159) 1 58.60 58.60 0 0.00
25029. gwubb (gwubb) 2 58.60 66.14 0 0.00
25030. Zaid (zaid1012) 118 58.59 78.01 30 25.42
25031. Déádlý (muandmj) 2 58.59 64.02 1 50.00
25032. Khang (rebels1) 4 58.59 65.30 0 0.00
25033. Ian (langabriel) 6 58.59 71.25 6 100.00
25034. Nadun (nadunys) 2 58.58 61.31 1 50.00
25035. Kapi (kapi_boi) 73 58.57 79.33 13 17.81
25036. MrRidiculous (mrjacobj56) 1 58.57 58.57 1 100.00
25037. zeffxy (zeffxy) 5 58.57 68.83 2 40.00
25038. AvD (avd3369) 8 58.57 67.07 1 12.50
25039. Shad (shad_psycho) 2 58.56 63.61 2 100.00
25040. Ferricks (ferri_ks) 53 58.55 75.31 11 20.75
25041. Qwerty (nhaye23) 12 58.55 69.03 0 0.00
25042. Stuge (stugefin) 8 58.55 64.99 0 0.00
25043. Eyal (eyalnir7) 8 58.54 72.15 4 50.00
25044. hekima (ashery) 180 58.54 80.96 33 18.33
25045. Rake (imrakhat) 6 58.54 74.71 5 83.33
25046. Nah (halo375) 19 58.54 69.88 5 26.32
25047. ⠀ (lain_) 19 58.53 71.36 4 21.05
25048. Tumarbek (tom4ke) 7 58.53 67.92 1 14.29
25049. Bedilbek (bedilbek) 13 58.52 66.75 4 30.77
25050. Yaas (yaas63) 25 58.52 69.76 3 12.00
25051. Will (will_stz) 4 58.52 63.20 1 25.00
25052. hrithik (hrithikmanoj) 24 58.52 66.37 5 20.83
25053. Itsuki1 (itsuki1) 174 58.52 79.18 42 24.14
25054. Justin (yummy_spin05) 14 58.51 67.48 2 14.29
25055. Ⓜ️ⓐⓗⓓⓘ😉 (mah... 138 58.50 72.18 23 16.67
25056. Guo (s9723) 9 58.50 66.42 1 11.11
25057. Angelica (arrico128) 6 58.50 65.19 2 33.33
25058. Banana (vadai) 3 58.50 61.02 0 0.00
25059. Aeron James (ajutzu) 1 58.50 58.50 0 0.00
25060. David (bisbalian) 4 58.50 61.48 1 25.00
25061. Kyle (zan9etsu) 42 58.49 73.38 12 28.57
25062. saket (saket1harsh2) 140 58.49 73.53 23 16.43
25063. BathTime (daddysbathtime) 8 58.49 71.26 1 12.50
25064. HeliuMz (heliumz) 6 58.49 65.13 2 33.33
25065. Sahol (hawk_eyee) 2 58.49 61.80 0 0.00
25066. Nathaniel (nathaniel999) 13 58.48 64.92 4 30.77
25067. DAPAT (dapat) 1 58.48 58.48 0 0.00
25068. vladim (vladim) 2 58.48 69.85 2 100.00
25069. Shuxuan (shuxuan) 70 58.48 75.22 13 18.57
25070. Suven (psuv) 25 58.48 65.17 0 0.00
25071. tommy bhau (pseudonetwork) 65 58.48 74.19 17 26.15
25072. Pineapple711 (pineapple711) 2 58.48 73.71 0 0.00
25073. slow typer (slooowest_typer) 21 58.47 72.63 2 9.52
25074. BooceJooce (boocejooce) 114 58.47 75.19 21 18.42
25075. MHR (mhrofficial) 35 58.47 72.91 6 17.14
25076. Teddy (teddyb24) 2 58.47 59.84 2 100.00
25077. Sara (s_sh) 4 58.46 65.81 2 50.00
25078. Rahil (prplplay) 17 58.46 67.38 2 11.76
25079. H.Y. (periodology) 2 58.46 61.54 1 50.00
25080. Pavel (oxxxyd) 4 58.46 62.88 0 0.00
25081. rifath (rifath1729) 1 58.45 58.45 0 0.00
25082. Shubham (ikamthania) 177 58.44 72.12 25 14.12
25083. Nungkha (nungkha) 121 58.43 81.79 22 18.18
25084. Taylorlum3 (taylorlum3) 6 58.43 75.99 0 0.00
25085. Jess (jessnguy) 12 58.42 72.71 1 8.33
25086. Heet (heetpatel219) 377 58.42 74.57 78 20.69
25087. Andrei (andythemenace) 3 58.42 64.45 0 0.00
25088. Raul (rromer41) 31 58.41 71.35 0 0.00
25089. Alex (alexk123) 8 58.41 66.35 0 0.00
25090. Yi-Chen (yichenlo) 8 58.41 72.91 1 12.50
25091. Tobias (jensen9430) 3 58.41 66.80 2 66.67
25092. Khuslen (khyl) 18 58.41 69.39 3 16.67
25093. Thint (rma251209) 10 58.41 69.25 2 20.00
25094. Erdal (notasingleduck) 11 58.41 65.39 3 27.27
25095. weidel (weidel) 11 58.41 70.42 1 9.09
25096. Juhair (error6251) 15 58.40 64.62 0 0.00
25097. Jigar (hiraj) 3 58.40 63.44 0 0.00
25098. Eddynsky (eddynsky432) 303 58.40 74.83 51 16.83
25099. Frazier (fmacdonald) 2 58.40 60.24 0 0.00
25100. mainto (manito7) 613 58.39 80.44 106 17.29
25101. Nini (notthedestroyer) 15 58.39 69.36 2 13.33
25102. Sujal (_sujal_panwar_) 1 58.39 58.39 0 0.00
25103. ngmnm (ngmnm) 5 58.39 63.23 1 20.00
25104. Taukekhan (taukekhan) 3 58.39 67.53 0 0.00
25105. Some1uknow (some1uknow) 15 58.38 66.62 2 13.33
25106. PK (pavanuppari) 4 58.38 65.69 1 25.00
25107. Roxx III (deathsoul117004) 9 58.37 66.05 2 22.22
25108. Rishi (qasz) 165 58.37 75.00 27 16.36
25109. JC (bid4peace) 72 58.37 72.69 12 16.67
25110. powder (p0wder) 6 58.37 64.47 0 0.00
25111. duebdab (ultraduebdab) 6 58.36 76.96 2 33.33
25112. OhmFreeTime (ohmmeejaa25) 7 58.36 68.11 2 28.57
25113. Serhii (sergomashina) 17 58.36 63.57 5 29.41
25114. David (davidstakic) 81 58.36 77.56 13 16.05
25115. Jared (jm1289) 12 58.36 66.30 3 25.00
25116. Aniket (aniket_pithadia) 70 58.35 78.86 12 17.14
25117. Jim (jim90247) 20 58.35 68.09 2 10.00
25118. Captain2 (captain_) 8 58.35 66.17 8 100.00
25119. Aaron (aaronesc) 1 58.35 58.35 0 0.00
25120. Frank (fizero) 101 58.35 71.93 10 9.90
25121. b (b_rabbit019) 8 58.34 71.40 0 0.00
25122. niko (nikoooo) 18 58.33 75.13 3 16.67
25123. nazmush (nazmushsayadat) 14 58.33 70.14 0 0.00
25124. Quang (puangpro__6969) 33 58.32 69.23 15 45.45
25125. Yani (theghak) 479 58.32 84.49 86 17.95
25126. Yugant (yuga009) 3 58.32 72.88 0 0.00
25127. Bianca (uhbia) 1 58.31 58.31 1 100.00
25128. Ruufa (narwhal_cream) 24 58.31 73.16 5 20.83
25129. _ (gamichan19) 1 58.31 58.31 0 0.00
25130. Jahir (jahir___) 23 58.31 72.42 6 26.09
25131. PB (yukiiiipboy) 2 58.31 60.11 1 50.00
25132. Vlaad (vladiii) 1 58.30 58.30 0 0.00
25133. premnath (premnath) 1 58.30 58.30 0 0.00
25134. DeafChef (deafchefsteph) 109 58.30 72.80 16 14.68
25135. Light (light655) 79 58.30 72.48 19 24.05
25136. Tamuna (tamuna314) 7 58.30 61.79 1 14.29
25137. eldrick (eldricck) 3 58.29 68.03 1 33.33
25138. FartESport (fartesport) 7 58.29 69.57 3 42.86
25139. uggs (ugo_alo) 15 58.29 71.36 1 6.67
25140. Pau (skuhls) 12 58.29 63.18 1 8.33
25141. ain (ainzel) 2 58.29 64.95 0 0.00
25142. Nick (nirosmit) 99 58.28 74.31 14 14.14
25143. abdullah (abdullah1233) 31 58.28 72.10 7 22.58
25144. Kaori (kaori13) 24 58.28 69.11 4 16.67
25145. Martin (martin_lol) 4 58.28 63.22 0 0.00
25146. King JF (foongtastic) 299 58.27 74.24 51 17.06
25147. RHell (kasiarhell) 486 58.27 79.25 73 15.02
25148. Darkblask23 (darkblask23) 2 58.27 65.59 0 0.00
25149. TheVictor (wrmor) 1 58.27 58.27 0 0.00
25150. রাতুল (1415926535... 39 58.27 72.11 5 12.82
25151. Sujay (bluebeetle) 12 58.27 66.64 1 8.33
25152. Cyden (cyden) 10 58.26 99.51 3 30.00
25153. Corbin (sealcircle) 6 58.26 66.83 2 33.33
25154. Fogli (fogli) 6 58.26 66.27 2 33.33
25155. De Leo (theleo) 145 58.25 76.01 22 15.17
25156. abdullah (billnyezenazispy) 36 58.25 67.76 10 27.78
25157. Alex (alexonboba) 4 58.24 62.37 4 100.00
25158. Electro (electrotech17) 11 58.24 67.01 2 18.18
25159. Rocks D. (rocksdxebec00) 32 58.24 69.36 6 18.75
25160. Ryan (cratis) 4 58.24 63.50 1 25.00
25161. jiirrarr (jiirrarr) 11 58.24 67.54 3 27.27
25162. Matthew (imhaisee) 4 58.24 62.05 3 75.00
25163. t (teaxnuba) 1 58.24 58.24 1 100.00
25164. anAVGtyper (mallunahi) 17 58.24 73.19 0 0.00
25165. Marcos (ultizin) 4 58.24 65.38 0 0.00
25166. Free Palestine (mohamad01) 10 58.24 66.06 1 10.00
25167. vinnie (gun_xox) 11 58.23 78.34 2 18.18
25168. Gunjan (lucifergd192) 6 58.23 64.50 0 0.00
25169. Brendan (shagsterrodgers) 1 58.23 58.23 0 0.00
25170. Rickith (rickith) 11 58.23 63.72 0 0.00
25171. Francisco (xikinho21) 3 58.23 60.35 2 66.67
25172. Machine (longshort) 29 58.23 75.27 6 20.69
25173. Ramsudhan (sudhanlee) 784 58.22 75.26 115 14.67
25174. Jordi (joorrrrrrrr) 9 58.22 68.81 4 44.44
25175. christian (matebookd) 3 58.22 64.67 1 33.33
25176. Anish (bira_01) 35 58.22 69.92 8 22.86
25177. Parker (i_hunger101) 16 58.21 64.72 3 18.75
25178. Kirubel (kirubelt) 87 58.21 71.02 14 16.09
25179. Surajit (surajit) 18 58.21 69.77 1 5.56
25180. Chuck (dvorakmrcharles) 13 58.20 66.18 1 7.69
25181. Rod (rod22) 4 58.20 70.56 1 25.00
25182. tken (tken_tokyo) 8 58.20 66.17 0 0.00
25183. Yu Zhe (yuzhetang) 1 58.20 58.20 1 100.00
25184. Kaiserkaiser3 (kaiserkaiser3) 1 58.20 58.20 0 0.00
25185. subham (alexus78) 35 58.19 67.36 9 25.71
25186. ReddyIsHere (reddy_is_here) 11 58.19 66.40 1 9.09
25187. ken (itypeslowasf) 1 58.19 58.19 0 0.00
25188. つべ (tube_jp) 354 58.19 84.85 45 12.71
25189. cynthia (cynthiween) 23 58.19 69.99 6 26.09
25190. Shantanu (shatanu) 12 58.18 70.27 1 8.33
25191. Ivan Richard (ugololeivan) 8 58.18 64.31 1 12.50
25192. tstats[mannyblaze] (mannybl... 21 58.17 80.57 3 14.29
25193. H (hkk09) 5 58.17 70.87 0 0.00
25194. Sanjay (sanjaysins) 27 58.17 71.85 5 18.52
25195. Elliot (elliot_cooper) 25 58.17 72.73 5 20.00
25196. Jayson (jayson22) 481 58.16 80.73 122 25.36
25197. Jason (jason_the_human) 37 58.16 70.65 8 21.62
25198. Sobuj (greensobuj) 296 58.16 82.93 59 19.93
25199. Rupert (rupert_6969) 4 58.16 61.51 0 0.00
25200. sathwik_0777 (sathwik_7770) 123 58.16 73.70 18 14.63
25201. Sand (bizzarehuman) 24 58.16 70.20 3 12.50
25202. Laiyon (laiyon) 11 58.16 63.98 2 18.18
25203. Dannei (dannidarling) 4 58.16 65.22 0 0.00
25204. cecilie (ceci754f) 3 58.15 62.82 1 33.33
25205. BigRocks (mrpluto23) 7 58.15 65.68 2 28.57
25206. Aarya (aaryatambe) 8 58.15 70.37 0 0.00
25207. BeanLord (beanlordishere) 3 58.15 63.81 2 66.67
25208. Hamza (hamza_type) 89 58.14 74.37 16 17.98
25209. Giovanni (vecchiogio) 9 58.14 67.38 1 11.11
25210. Hieu (sn1rep) 43 58.14 70.61 6 13.95
25211. Arun (arunro45) 473 58.13 81.44 88 18.60
25212. Hikaru (hikaruk) 34 58.13 67.83 4 11.76
25213. Benjamin (izno) 80 58.12 84.79 19 23.75
25214. Hello (chroma56) 4 58.12 62.24 1 25.00
25215. yinho (yinhotype) 8 58.11 74.04 2 25.00
25216. Aidan (tryingacrobat52) 3 58.11 59.50 0 0.00
25217. Melvin :) (malevolant_melvin) 3 58.10 61.98 0 0.00
25218. zach (zinfinte57) 12 58.10 62.94 3 25.00
25219. Bonnie (bonbon601) 3 58.10 60.42 1 33.33
25220. Russel (russelxxv) 1 58.09 58.09 0 0.00
25221. Rishay (rishayg) 28 58.09 68.07 6 21.43
25222. Fandom (fandom_girl) 26 58.09 72.28 7 26.92
25223. Oskar (belmondziak) 5 58.08 64.18 1 20.00
25224. Mia (miatkd) 3 58.08 63.07 0 0.00
25225. Ashish (superman_11) 7 58.08 63.14 1 14.29
25226. Slow Spider (slow_spider) 9 58.08 64.00 0 0.00
25227. Ruslan (ruslancik97) 17 58.07 73.76 3 17.65
25228. Ian (ianduu) 25 58.07 68.37 7 28.00
25229. Tempest (tempestreu) 50 58.07 71.47 10 20.00
25230. Rafiq (rafiq) 2 58.07 67.75 0 0.00
25231. Biscuitised (morgan221) 2 58.07 59.85 0 0.00
25232. Orenji (orenji_0987) 323 58.06 80.35 32 9.91
25233. Amir (amirtrex) 16 58.06 70.86 3 18.75
25234. Never :q! (mista_t) 73 58.06 77.11 12 16.44
25235. Venus (planet_venus) 2 58.06 60.34 0 0.00
25236. Justin (basicjc) 136 58.05 70.56 25 18.38
25237. Volta (volta_xty) 1 58.05 58.05 0 0.00
25238. Russell (rtx420) 18 58.05 65.91 4 22.22
25239. Dante (therealdante13) 131 58.04 71.86 19 14.50
25240. Lea (lea_134) 1 58.04 58.04 1 100.00
25241. Blessed (itsblessedxx) 1 58.04 58.04 0 0.00
25242. Adam (gh00st) 3 58.04 66.21 1 33.33
25243. Kacper (mlociak) 11 58.04 63.38 2 18.18
25244. ScreaM (scream2002) 101 58.04 81.96 12 11.88
25245. Vincent (tyt14) 27 58.04 77.77 3 11.11
25246. Kelton (kelkidman) 7 58.04 60.80 0 0.00
25247. sss (1whiteblack1) 115 58.04 72.81 11 9.57
25248. typo11 (typo11) 7 58.04 67.57 2 28.57
25249. vikash (vikash_hembram) 3 58.04 65.09 1 33.33
25250. Haytham (bwaredevoodoo) 5 58.04 80.20 1 20.00
25251. nurmyrza (nurzoik) 10 58.03 68.49 4 40.00
25252. Quang (baoquanggogreen) 13 58.03 73.96 2 15.38
25253. George (georgepj) 13 58.03 67.45 1 7.69
25254. Carrot (elelin) 41 58.03 72.36 11 26.83
25255. kaya (kayawaffle) 3 58.02 60.31 0 0.00
25256. Prem (batprem) 32 58.02 67.59 3 9.38
25257. Vikram (vikram_) 45 58.02 71.27 7 15.56
25258. Hoang (hoangama) 28 58.01 67.55 3 10.71
25259. patrick (mastercraft33) 12 58.01 67.78 3 25.00
25260. Bash (nidaljaafar1) 13 58.01 71.52 3 23.08
25261. Flex (flexiblerhyme30) 32 58.01 71.49 8 25.00
25262. G̸̡̢̠̼̻̟̠̠̎͊͜ͅ... 2 58.01 62.05 0 0.00
25263. Mattia (mattiasalvetti) 6 58.01 62.99 2 33.33
25264. Vineet (raovineet14) 44 58.01 66.38 5 11.36
25265. Ashtrovex (ashtroflex) 5 58.01 75.19 5 100.00
25266. Yu (mjtunes) 168 58.00 79.34 26 15.48
25267. Mav (mavert) 6 58.00 62.51 2 33.33
25268. Hugo (bothugo) 2 58.00 59.08 2 100.00
25269. Santosh (santoshm33) 8 58.00 68.89 2 25.00
25270. Carsyn (carsynw) 5 57.99 63.27 1 20.00
25271. namie (notyournamie) 8 57.99 64.04 1 12.50
25272. Quacky Mac (lucky_ducky) 2 57.98 67.82 2 100.00
25273. Nicole (nicoleoioioi) 3 57.98 60.35 1 33.33
25274. jungkook (elizabethngg) 143 57.97 97.74 19 13.29
25275. . (keelanlambert) 14 57.97 69.44 5 35.71
25276. Zac (zactus_) 33 57.97 70.02 4 12.12
25277. Asm (asmsaikat) 295 57.96 74.40 41 13.90
25278. Wei Quan (laiweiquan) 3 57.96 60.80 1 33.33
25279. Caba (megiorr69) 10 57.96 64.52 3 30.00
25280. baekos (baekos) 58 57.96 73.40 9 15.52
25281. CopiCat (copicat) 164 57.96 76.60 20 12.20
25282. 10 🆆🅿🅼 (sostdeo) 128 57.95 67.55 20 15.63
25283. Adam (adamnordin) 2 57.95 58.19 0 0.00
25284. Cheesetoast (cheesetoastman) 14 57.95 75.78 2 14.29
25285. Linh (linhbo5369) 17 57.95 70.03 5 29.41
25286. Cristian (electpit) 12 57.95 65.71 0 0.00
25287. Andy (andy_andy) 28 57.94 67.91 4 14.29
25288. Viktor (viktor3257) 4 57.94 61.92 0 0.00
25289. Ngita (ngita) 110 57.94 72.79 16 14.55
25290. Seth (sefer) 2 57.94 60.07 1 50.00
25291. (ashish_antil248) 48 57.93 74.74 8 16.67
25292. podolsero (podolsero) 10 57.92 67.14 4 40.00
25293. laljan (laljan) 58 57.92 68.66 10 17.24
25294. XGRAPHIC (xgraphic) 5 57.92 64.58 5 100.00
25295. Andrew (ajw5196) 31 57.92 77.89 5 16.13
25296. MAYANK (kartosbrotherinlaw) 83 57.92 71.85 14 16.87
25297. Joshua (the_rockstar) 8 57.92 61.96 3 37.50
25298. Dan (danvnbls) 5 57.91 66.85 0 0.00
25299. IRDunno (irdunno) 23 57.91 70.18 7 30.43
25300. Roman (roman_kovalchuk) 38 57.91 67.17 2 5.26
25301. Kuerbiskosar (kuerbiskosar) 7 57.91 64.88 3 42.86
25302. Star (starplatypus) 2 57.91 58.23 1 50.00
25303. Luis (sirkarpador) 1 57.91 57.91 1 100.00
25304. Ab (shk_faysal) 9 57.91 66.70 3 33.33
25305. muhammad (moulizax) 13 57.91 69.42 1 7.69
25306. David (realdavidcruz) 3 57.90 63.58 1 33.33
25307. MRBC (mrbc) 48 57.90 76.42 6 12.50
25308. John (fsxsteamboss) 44 57.90 70.69 7 15.91
25309. EJDush (ejdush) 2 57.89 59.67 0 0.00
25310. joseph (jmuganga544) 55 57.88 73.97 11 20.00
25311. Kopa_Samsu (aaourav0) 247 57.88 75.43 69 27.94
25312. Nistha Nakarmi (simply_nisu) 232 57.88 77.49 39 16.81
25313. Ishaant (ishaant) 255 57.88 75.88 50 19.61
25314. nick (chiefotto) 5 57.88 62.38 0 0.00
25315. +923326006034 (janan9233260... 34 57.88 72.31 6 17.65
25316. Coolman (alibekesanov) 23 57.87 70.58 3 13.04
25317. Lucia (kenyousmile) 26 57.86 69.03 2 7.69
25318. brahmastra (brahmastra) 520 57.86 73.44 83 15.96
25319. The (malthelegend104) 6 57.86 83.94 1 16.67
25320. Nimble fingers (deadjarus) 69 57.85 71.03 6 8.70
25321. Sniper (drjustbrick) 1 57.85 57.85 1 100.00
25322. Dewi (dibdabdebby) 7 57.85 64.25 7 100.00
25323. Kanawat (kanawatt) 2 57.85 64.22 0 0.00
25324. Olvi73 (oliverck73) 5 57.85 65.06 1 20.00
25325. Gareth (gathlic) 8 57.85 66.68 4 50.00
25326. jzbor (jzbor) 6 57.84 62.06 0 0.00
25327. Arman (blazzer1yr) 18 57.84 62.58 0 0.00
25328. James (__james) 19 57.84 68.73 4 21.05
25329. Radriar (slowtype_e) 432 57.84 78.83 62 14.35
25330. Harish (harish_roxx) 137 57.84 79.51 25 18.25
25331. Mew. (mewddth) 2 57.84 62.00 1 50.00
25332. Lynne (lynne17) 1 57.83 57.83 0 0.00
25333. jason (kimjongdos) 1 57.83 57.83 0 0.00
25334. Nico (ncc5) 4 57.83 62.75 0 0.00
25335. yoshiking (y05h1k1ng) 10 57.82 70.64 2 20.00
25336. Cheg (sheedipants) 16 57.82 66.81 5 31.25
25337. Lilac (borntosurvive27) 3 57.81 58.63 0 0.00
25338. Matheus (narrogai) 8 57.81 65.51 4 50.00
25339. Arnav (hyp3rn00b10) 142 57.80 77.58 21 14.79
25340. Samyak (blk_ht_hk_r) 18 57.80 67.76 7 38.89
25341. yannick (yannickbaze) 8 57.80 62.95 1 12.50
25342. Ben (_0icydrizzlez0_) 2 57.77 60.62 0 0.00
25343. zain (zain_nawaz) 65 57.76 82.48 14 21.54
25344. Matěj (mates542cz) 24 57.76 71.58 3 12.50
25345. Kaung Pyae (meandmyfriend4) 32 57.76 70.40 6 18.75
25346. tom (tommmy6) 6 57.76 70.28 0 0.00
25347. NikBlox (nikblox) 2 57.76 61.36 1 50.00
25348. t (raccoon_emoji) 10 57.76 71.48 4 40.00
25349. Brenden (brenden_2021) 8 57.76 68.21 2 25.00
25350. Chhanun (dragonasia6) 1 57.75 57.75 0 0.00
25351. Trystan (tdude_37) 1 57.75 57.75 0 0.00
25352. plip (plip) 79 57.74 69.34 15 18.99
25353. Anar (pomegarnet) 39 57.74 74.56 7 17.95
25354. Andre (toothpickjanitor) 3 57.74 61.55 0 0.00
25355. Winson (s1nc3d4rk_) 6 57.73 66.20 2 33.33
25356. Ilana (ilana12) 48 57.72 68.22 6 12.50
25357. Dolton (caramelsauces) 3 57.72 66.66 2 66.67
25358. Peerawitch (maaaai) 11 57.72 62.67 0 0.00
25359. Ben (punkturkyy) 1 57.71 57.71 0 0.00
25360. Jindřich (7xxf) 1 57.71 57.71 0 0.00
25361. jupeti2 (jupeti2) 5 57.71 62.37 0 0.00
25362. Lucas (lucaz_) 10 57.71 64.45 2 20.00
25363. Nicediceroll (nicediceroll) 2 57.71 61.65 0 0.00
25364. xLukeAzade (xlukeazade123) 12 57.70 67.27 1 8.33
25365. Gerardo (sewingbunion9) 643 57.70 82.69 100 15.55
25366. sahil (sahil9057) 9 57.70 68.34 1 11.11
25367. long (yourdad_69420) 2 57.70 60.16 0 0.00
25368. tstats[spyro1411] (spyro1411) 245 57.69 69.17 35 14.29
25369. Guilherme (guilhaugusto) 20 57.68 67.00 2 10.00
25370. Hari Chandan Das (harichand... 19 57.68 67.19 1 5.26
25371. ぜんじろう (yablu) 40 57.68 68.31 16 40.00
25372. Grayson (beanbagman) 11 57.67 70.21 8 72.73
25373. Bhavya (iconic_typer) 74 57.67 69.49 7 9.46
25374. Jacklyn (jlyn_nn) 3 57.67 63.41 1 33.33
25375. Buenas Tardes (buenastardes) 3 57.66 62.80 0 0.00
25376. thefoodboi (thefoodboi) 1 57.66 57.66 0 0.00
25377. Pp (typerace2002) 83 57.65 70.89 14 16.87
25378. petnob (petnob1987) 12 57.65 65.15 2 16.67
25379. BigBoss (catalin2522) 10 57.65 63.67 0 0.00
25380. Manan (dpmanan) 8 57.64 64.80 2 25.00
25381. Azaza (azazamaster) 60 57.64 67.70 11 18.33
25382. Gnanendar (gnanickky) 26 57.64 64.69 3 11.54
25383. keb (kerringtonbridges) 33 57.64 74.94 6 18.18
25384. Lucid (lucideous) 17 57.64 71.20 4 23.53
25385. Abhishek (vbunny) 70 57.64 72.57 11 15.71
25386. vslip (vslipyt) 8 57.64 64.28 3 37.50
25387. Max (maxies) 10 57.63 65.60 3 30.00
25388. Rafsun (rafsun_100) 3 57.63 61.14 0 0.00
25389. Ishu (holistic_karma) 18 57.62 67.72 5 27.78
25390. Historical (historicalskink) 5 57.62 64.39 1 20.00
25391. Mithun (mithu16_2001) 137 57.62 73.14 51 37.23
25392. dom (domxrare) 11 57.61 68.66 2 18.18
25393. DatGG (tristanko) 48 57.61 75.52 4 8.33
25394. sam (samb2006) 1 57.61 57.61 0 0.00
25395. Ashish (reach_aashu) 1 57.61 57.61 1 100.00
25396. Midnight (midnight510) 6 57.61 61.33 0 0.00
25397. Goop (goooop) 18 57.61 80.47 3 16.67
25398. Ujjwal (half_blooded) 71 57.60 69.28 6 8.45
25399. Teerapad (ornerycash) 2 57.60 60.17 1 50.00
25400. Shawn (shawtyper) 19 57.59 73.79 4 21.05
25401. Amal (amalsan) 19 57.59 65.26 5 26.32
25402. Shakres (yukikow14) 3 57.59 65.46 0 0.00
25403. John (soegnam) 1 57.59 57.59 0 0.00
25404. sanchayay (sanchayay) 116 57.58 72.87 22 18.97
25405. Deathnote (sanjay_kumar) 200 57.58 83.36 38 19.00
25406. swapneel (swapneel_das) 1,715 57.58 85.07 258 15.04
25407. Dennetix (dennetix) 148 57.57 69.45 28 18.92
25408. Rafea (datguyrafea) 2 57.57 61.77 1 50.00
25409. RATATA (yiracan2) 4 57.57 66.20 0 0.00
25410. Raheeb (hoenchioma) 29 57.57 71.02 2 6.90
25411. Nibblet (nibbletdaking) 700 57.57 79.28 83 11.86
25412. Joey (joeykuo) 14 57.56 70.30 6 42.86
25413. Clayton (grizzleybear62) 11 57.56 67.18 2 18.18
25414. lit (paul615) 8 57.56 64.58 2 25.00
25415. Chino (chinotorres_142) 58 57.56 72.90 13 22.41
25416. SAM (lsh66191239) 4 57.55 64.79 0 0.00
25417. danny (xsoii) 55 57.54 71.43 8 14.55
25418. Viktor (heizu) 6 57.54 73.52 0 0.00
25419. ben (enivre) 15 57.54 73.46 2 13.33
25420. Muhammad (junaidqazi) 129 57.53 73.06 19 14.73
25421. Nex (n3x7s) 1 57.53 57.53 1 100.00
25422. Thooq (thooq) 10 57.53 61.23 2 20.00
25423. Adam (waba_waba) 79 57.52 70.61 11 13.92
25424. ht (htbs) 4 57.52 62.95 1 25.00
25425. mads (madsor) 17 57.51 73.27 7 41.18
25426. Gaute (gaute_03) 1 57.51 57.51 0 0.00
25427. Pouya (pouyal) 564 57.51 77.34 79 14.01
25428. Hoang (yungrax) 32 57.50 68.37 6 18.75
25429. Halo (fishmona) 55 57.50 74.46 8 14.55
25430. ASP00KY (aspooky) 20 57.49 77.33 8 40.00
25431. rebecca (kona_coffee) 4 57.49 61.42 0 0.00
25432. fyre_chicken (fyre_chicken) 3 57.49 60.86 0 0.00
25433. Artur (ester_versuch) 85 57.49 67.43 11 12.94
25434. Shania (shaniacans) 10 57.49 66.15 1 10.00
25435. Hamza (dribbble) 64 57.48 73.87 18 28.13
25436. Satyam (echosatyam) 19 57.48 68.85 3 15.79
25437. ignatius (ig_gy) 14 57.48 66.97 1 7.14
25438. Naziman (naziman) 7 57.48 62.98 2 28.57
25439. superultimate23 (superultim... 34 57.47 73.37 6 17.65
25440. Jordan (jordann31) 5 57.47 66.66 0 0.00
25441. The killer (haaassan) 16 57.46 69.64 2 12.50
25442. Jess (jessdiritowhale) 6 57.46 66.35 0 0.00
25443. Aayush (aayushjoshi) 957 57.46 86.20 187 19.54
25444. Jack (horton_hears_a_j3w) 6 57.46 65.47 2 33.33
25445. slow_racer (left_arm_chinaman) 30 57.46 66.57 2 6.67
25446. zreem (zreem) 14 57.46 90.96 0 0.00
25447. Valentin (bg4uk) 97 57.45 73.73 16 16.49
25448. Mikael (vompo) 2 57.45 58.08 1 50.00
25449. Smoto (grozmot) 10 57.45 62.65 2 20.00
25450. Hit360D (hit360d) 8 57.45 73.98 5 62.50
25451. Adam (agbell) 6 57.45 67.60 1 16.67
25452. San (sanletem) 2 57.45 57.52 1 50.00
25453. Pakistan is my Love (sancbae) 34 57.44 71.80 19 55.88
25454. Dena (cestdena) 3 57.44 62.35 0 0.00
25455. Todd (toddism1) 4 57.44 61.74 2 50.00
25456. Ankush (ankush_12) 118 57.44 73.02 20 16.95
25457. Onat (onatozer) 2 57.43 57.89 1 50.00
25458. cippuda (cippuda) 2 57.43 65.90 1 50.00
25459. Manel (manuelp) 6 57.42 64.83 1 16.67
25460. Scalion (scalion) 1 57.42 57.42 0 0.00
25461. Abdujalol (abdujalolerkinov) 171 57.42 73.89 39 22.81
25462. mllm (mllm1771) 9 57.42 75.24 0 0.00
25463. Dirk (kreefdirk) 5 57.41 63.25 0 0.00
25464. Bottlecapbottom (bottlecapb... 40 57.41 67.03 4 10.00
25465. Jake (relaxing) 17 57.41 68.16 3 17.65
25466. Harlis (ahk_master) 16 57.41 69.80 1 6.25
25467. Sai Venkat (ksvr) 45 57.41 71.60 7 15.56
25468. Serji (serji) 8 57.40 65.22 2 25.00
25469. Someone (gluroy) 226 57.40 72.77 40 17.70
25470. Sam (derpysquidboy) 1 57.40 57.40 0 0.00
25471. Snail (type_of_a_typer) 237 57.40 70.43 27 11.39
25472. Sven (sven0101) 85 57.39 72.30 16 18.82
25473. perfvil (sellected) 1 57.39 57.39 1 100.00
25474. Roope (randommaster) 19 57.38 62.82 6 31.58
25475. Tristan (bombomb) 9 57.38 80.13 5 55.56
25476. Thor (thorern00) 303 57.37 78.15 45 14.85
25477. krystall (krrystall) 33 57.37 74.94 7 21.21
25478. Curly (curly98) 363 57.37 77.64 58 15.98
25479. River (lttriver) 2 57.37 58.71 0 0.00
25480. Monsquinch (monsquinch) 3 57.36 61.00 2 66.67
25481. utaaaa (datwuzuzerland) 1 57.36 57.36 0 0.00
25482. JP (supertyperguy2020) 1,449 57.35 74.45 202 13.94
25483. Lazar (kh00m4) 16 57.35 66.84 3 18.75
25484. Connor Gil (gillionayre) 8 57.35 64.39 2 25.00
25485. Richard (heferous) 30 57.35 78.52 3 10.00
25486. James (james7739) 4 57.35 59.57 0 0.00
25487. Nicholas (gigamammothtyper123) 31 57.35 75.42 3 9.68
25488. Archer (drugzy) 5 57.35 63.97 1 20.00
25489. minh huu (minhhuudoan) 2 57.35 60.58 1 50.00
25490. bruh (lmnhat2002vn) 115 57.34 74.51 19 16.52
25491. halloo (crystaalsnow) 9 57.34 66.08 2 22.22
25492. Boo_layout_noob (boolayoutn... 1 57.33 57.33 0 0.00
25493. gremory29 (gremory29) 2 57.33 64.71 2 100.00
25494. Jay (cutecanadian) 34 57.33 69.82 8 23.53
25495. Smudge on megamak uwu (snudge) 320 57.33 99.57 68 21.25
25496. Kevin (baven) 10 57.33 69.97 3 30.00
25497. Kevin (malthross) 3 57.32 62.44 1 33.33
25498. Aryan (n00bzz) 5 57.32 64.26 0 0.00
25499. Thunderer (thunderer) 3 57.32 66.35 1 33.33
25500. CJ (the_winner_is_here) 21 57.31 70.20 4 19.05
25501. The Try (thetryhardguy01_) 11 57.31 67.01 3 27.27
25502. Ace (ace_axk) 7 57.31 69.44 5 71.43
25503. Luka (smilyee) 38 57.30 69.74 7 18.42
25504. Bilguun (blgn94) 9 57.30 63.92 2 22.22
25505. Jay (jvmatt) 4 57.30 68.47 1 25.00
25506. Pena (pena_perse) 27 57.29 65.58 3 11.11
25507. Dominik (killersshark) 15 57.29 65.49 4 26.67
25508. garin (garinholiyana) 10 57.29 60.52 0 0.00
25509. runa (dawn_89) 203 57.29 71.67 30 14.78
25510. Snger (jim_my) 87 57.29 73.85 18 20.69
25511. parsa (parsa_ktz) 145 57.29 72.28 26 17.93
25512. rujipas (paopeaw) 2 57.29 63.55 1 50.00
25513. Patiphan (nongper) 46 57.28 78.00 11 23.91
25514. Radoslav (radosaurus) 4 57.28 64.55 3 75.00
25515. Pragan (pragan) 4 57.28 63.78 0 0.00
25516. besto (besto) 56 57.28 72.09 13 23.21
25517. AppleSnap (applesnap_1) 20 57.27 68.16 5 25.00
25518. DP (dragonphoenix) 204 57.27 68.25 33 16.18
25519. Lan (bldymsscr) 2 57.27 60.80 0 0.00
25520. themar (themar) 10 57.26 66.13 1 10.00
25521. gdonke (gdonke) 112 57.26 69.55 20 17.86
25522. EpikPanda (imanepikpanda) 28 57.26 67.36 7 25.00
25523. GwenXYZ (bhuyquang1) 2 57.26 58.14 0 0.00
25524. katie (shartball) 34 57.25 70.69 5 14.71
25525. AYUSH (apx_morris) 3 57.25 62.87 0 0.00
25526. Pierre (pierre15) 1 57.24 57.24 1 100.00
25527. sakthi2021 (sakthi2021) 4 57.24 65.83 1 25.00
25528. p4n (ihateant1212) 3 57.24 63.02 3 100.00
25529. Kish (kisharora) 35 57.23 69.68 10 28.57
25530. Ken (haseo_ken) 1 57.23 57.23 1 100.00
25531. plantfan330 (plantfan330) 100 57.23 75.26 15 15.00
25532. Ilya (jamesakke) 5 57.23 60.64 1 20.00
25533. ariel (44tech_) 8 57.22 66.09 0 0.00
25534. Stefan (x2stefan) 131 57.22 78.77 23 17.56
25535. Alex Rodriguez (realralex) 1 57.22 57.22 0 0.00
25536. Habib (habib7777) 14 57.22 65.14 2 14.29
25537. Hramich (hramich) 12 57.22 64.07 2 16.67
25538. TrueShot (trueshotvr) 5 57.22 62.77 1 20.00
25539. lior (sudden_lee) 10 57.22 66.57 0 0.00
25540. yossi (exseibar) 50 57.21 72.88 3 6.00
25541. Krishna (qrishna59) 3 57.21 68.83 0 0.00
25542. rahul (rahularctic) 3 57.20 67.00 0 0.00
25543. MrFunk (mrfunkee_) 24 57.20 68.06 6 25.00
25544. Ethan (emanfrazier) 4 57.20 75.71 1 25.00
25545. Gri0s (grios) 2 57.20 60.61 2 100.00
25546. Carl (andrecar002) 18 57.18 67.48 1 5.56
25547. rozan (rozenbk) 1 57.18 57.18 0 0.00
25548. Thanasis (vidani) 16 57.18 68.22 3 18.75
25549. Ali (donlafi) 15 57.18 62.64 3 20.00
25550. harih (masterharish) 9 57.17 64.92 4 44.44
25551. Damien (damiien) 1 57.17 57.17 1 100.00
25552. Rob (ebqs) 35 57.16 68.45 4 11.43
25553. Pectuu (pectuu_) 1 57.16 57.16 0 0.00
25554. Jakob (jakob170201) 7 57.16 63.22 0 0.00
25555. Sahil (sahil_sa) 120 57.16 68.32 14 11.67
25556. Luke (kipkat) 145 57.16 76.83 24 16.55
25557. Cary (cary2060) 1 57.15 57.15 0 0.00
25558. Mato (xholm) 40 57.15 66.17 7 17.50
25559. Bladehunter (bladeyz) 7 57.15 67.24 1 14.29
25560. Guilly (guiltykrow) 5 57.14 66.45 0 0.00
25561. yomum (ahmet_ergun) 188 57.13 72.24 23 12.23
25562. Shivansh (shivansh_up) 1 57.13 57.13 0 0.00
25563. abhishek (abhisheksaxenasep) 21 57.13 65.40 4 19.05
25564. Alexander Grill (grill__alex) 9 57.13 64.94 1 11.11
25565. Adrian (revertion) 4 57.13 70.09 2 50.00
25566. Beebo (ohbeebo) 2 57.13 58.06 0 0.00
25567. Shocker (shockerzap) 3 57.12 57.72 2 66.67
25568. Levi (levimeijer) 9 57.12 63.73 1 11.11
25569. Eric (almiightyeric) 17 57.12 69.75 2 11.76
25570. Issam (issam_08) 40 57.11 69.35 5 12.50
25571. Vinícius (batovs) 28 57.11 71.95 6 21.43
25572. Ryan (ryanlondon) 32 57.11 72.48 6 18.75
25573. Tiago (tiagval) 39 57.11 75.43 7 17.95
25574. Cinema (northernblues) 2 57.11 58.56 0 0.00
25575. hello lads (heymanurgood) 3 57.11 57.61 0 0.00
25576. Debarka (Himu) (ignis_05) 359 57.11 84.67 78 21.73
25577. 8N (_8n_) 75 57.11 75.12 14 18.67
25578. sandhikagalih (sandhikagalih) 3 57.11 61.17 0 0.00
25579. Azzy (clavanonoyes) 24 57.11 65.30 1 4.17
25580. Saif (saif_kitaz) 27 57.10 64.80 4 14.81
25581. Shriyash (tybaazi) 5 57.10 64.12 2 40.00
25582. Martin (kitikonti) 1 57.10 57.10 0 0.00
25583. askela (akiii) 5 57.10 67.11 0 0.00
25584. Bipin (bipin_emp123) 36 57.10 66.94 5 13.89
25585. beastboy (beastboy1787) 8 57.09 68.76 0 0.00
25586. Bashar (theyoungthunder) 1 57.09 57.09 0 0.00
25587. AKSHAT (akshat1234) 190 57.09 74.28 89 46.84
25588. Ellie (ellie_mp3) 15 57.09 65.26 1 6.67
25589. aCOLEMAK-ist (xphoenixgod) 5 57.09 62.91 0 0.00
25590. Sam (sbush) 12 57.09 69.86 1 8.33
25591. Alex (abohac99) 9 57.09 63.74 2 22.22
25592. noah (noahruether) 83 57.09 77.52 16 19.28
25593. will (will7460) 6 57.08 62.03 0 0.00
25594. Kusainov (kusainov2005) 2 57.08 57.95 0 0.00
25595. Teodor (maniacth) 93 57.08 72.10 16 17.20
25596. Mohammed Waseemuddin (ertug... 21 57.08 67.66 5 23.81
25597. Arttu (patu556) 12 57.07 63.03 0 0.00
25598. Plosing13591 (ge_ge) 4 57.06 67.27 1 25.00
25599. Brady (dittowog) 4 57.05 60.75 2 50.00
25600. Yes (yesyesman) 1 57.05 57.05 0 0.00
25601. Vrapas (vrapas) 3 57.05 61.35 2 66.67
25602. kila (kila_lol) 39 57.04 68.22 3 7.69
25603. Exelendary (exelendary) 1 57.04 57.04 0 0.00
25604. Mish (powerpuffgirl23) 10 57.04 66.98 5 50.00
25605. shinkou (kashinkou) 43 57.04 75.24 23 53.49
25606. 1938 (1938) 24 57.04 83.79 2 8.33
25607. nh (nhvk) 4 57.03 62.06 0 0.00
25608. Lo (sonia0852) 4 57.02 65.10 2 50.00
25609. J (jairo_113) 31 57.02 69.78 11 35.48
25610. Ethan (zshooter0077) 95 57.02 74.36 18 18.95
25611. Aaron (a_aron) 227 57.01 74.64 32 14.10
25612. Vinícius (yamatano) 36 57.01 64.62 4 11.11
25613. Torunn (torunntrost) 6 57.01 62.75 6 100.00
25614. Phil (beastfromthe_east) 17 57.01 71.19 3 17.65
25615. MAGNUS (magnus03) 32 57.01 80.73 6 18.75
25616. Halemo (halemogpa) 25 57.01 72.54 3 12.00
25617. YT (tim72) 77 57.01 73.11 8 10.39
25618. Felipe (felipazo_06) 21 57.00 77.43 7 33.33
25619. Heather (tilly_day) 26 57.00 64.98 7 26.92
25620. Hudson (hudson_the_cat) 149 57.00 75.70 24 16.11
25621. Jai (tjpv) 1 57.00 57.00 0 0.00
25622. Praveen (smoothfingers) 15 57.00 63.71 1 6.67
25623. FastTypist448 (fast_typist448) 8 57.00 67.21 2 25.00
25624. Vanu (vanu88) 11 56.99 68.98 2 18.18
25625. rdnblg (rdnblg2) 53 56.99 69.65 14 26.42
25626. tourist (amey_9) 180 56.99 72.26 26 14.44
25627. price (prince23) 1,063 56.99 86.44 175 16.46
25628. Eric (ericniyigaba) 28 56.98 73.22 3 10.71
25629. bhufsianm (muhfiasbin) 5 56.97 60.28 1 20.00
25630. DunDun (dundunbread) 134 56.97 70.21 22 16.42
25631. Joseba (jouelcamper555) 19 56.97 73.52 2 10.53
25632. Grosse (grossescheisse) 37 56.96 72.20 6 16.22
25633. .-. (jyuawago) 2 56.96 58.24 0 0.00
25634. roderick (roderickang) 1 56.96 56.96 0 0.00
25635. omar (omar_elsayed) 876 56.95 84.40 125 14.27
25636. maggie (mooski) 3 56.95 64.39 0 0.00
25637. Ahmad (darklungs) 2 56.95 59.11 1 50.00
25638. Hee (yeecinn13) 2 56.94 58.80 0 0.00
25639. Parv (parvmodi) 42 56.93 65.66 6 14.29
25640. Cameron (spinnie123) 34 56.93 67.96 4 11.76
25641. ChyShabo (chyshabo) 3 56.93 58.65 0 0.00
25642. A Owadud (akash655) 25 56.93 69.73 1 4.00
25643. Inrieal. (inrieal) 39 56.93 67.74 4 10.26
25644. Dominic (domg913) 2 56.93 62.02 2 100.00
25645. JBrocksfellas (jbrocksfellas) 90 56.92 70.32 30 33.33
25646. Ethan (ethanluu) 18 56.92 64.89 6 33.33
25647. Carlos (karldan) 53 56.92 69.23 7 13.21
25648. Wouter (sirwout) 1 56.92 56.92 0 0.00
25649. sinchan (sinchan_rai) 1 56.92 56.92 0 0.00
25650. Ryder (ryderodonnell) 1 56.92 56.92 0 0.00
25651. Ibnu (asqallani) 14 56.91 69.74 3 21.43
25652. BeltBoy (singbearcar) 223 56.91 71.34 29 13.00
25653. Siddharth (cyberraptor) 2 56.91 57.27 1 50.00
25654. Vincent (doogley) 15 56.90 64.03 5 33.33
25655. Jacqui (applejakkes) 6 56.90 62.58 1 16.67
25656. Andrea (andrea_oboe) 10 56.90 70.35 2 20.00
25657. Luukster (luukster) 4 56.90 62.33 0 0.00
25658. Kieron (kierdee) 2 56.90 60.60 0 0.00
25659. Diya (dmatulizo13) 67 56.89 75.19 15 22.39
25660. zakkayyy (zakkayyy) 1 56.89 56.89 1 100.00
25661. Amelia (amelia_j_s) 20 56.88 64.06 7 35.00
25662. Reanu (terrenceskill) 21 56.88 67.87 3 14.29
25663. ارمغان (armaghan_ahmed) 125 56.87 71.22 17 13.60
25664. Stevey (steveaiva) 19 56.87 67.42 2 10.53
25665. JanTheMan (jan_the_man) 66 56.87 68.25 6 9.09
25666. ktp (ktp2222) 221 56.87 78.72 27 12.22
25667. andrei (andrake) 2 56.87 59.01 0 0.00
25668. Tony (tjzhao) 21 56.87 70.88 4 19.05
25669. Sam (indecisam) 6 56.86 62.23 2 33.33
25670. Shamim (shamimiqram) 23 56.86 68.83 3 13.04
25671. Pickle (mrpicklebody) 25 56.86 68.81 2 8.00
25672. David (nayzr) 6 56.86 58.69 0 0.00
25673. AIbek (3xter) 35 56.86 65.05 2 5.71
25674. mrweissguy (mrweissguy) 6 56.86 58.65 0 0.00
25675. Luke (luklear) 5 56.85 62.27 0 0.00
25676. Jill (zilzili) 3 56.85 67.65 1 33.33
25677. Eduardo (elbodrogo1977) 527 56.85 75.80 75 14.23
25678. Fangxing (fangoling) 12 56.85 64.79 3 25.00
25679. Storm (stormheezen) 11 56.84 61.01 3 27.27
25680. Emma (emmalischka) 76 56.84 65.02 13 17.11
25681. Abdullah Al (uniquesociety) 16 56.84 65.49 10 62.50
25682. Khaeran S. (dark_ze7en) 10 56.83 69.45 0 0.00
25683. Sriram (sriramrox) 95 56.83 78.78 30 31.58
25684. Re4per (light_exe) 390 56.83 77.25 62 15.90
25685. Daniel (daknk) 30 56.82 65.72 6 20.00
25686. blueberry (katie_18) 1 56.82 56.82 0 0.00
25687. kian (imkian) 14 56.82 63.34 0 0.00
25688. Danya (danya_z) 6 56.81 63.64 4 66.67
25689. Eoghan (eoghanshox420) 11 56.81 63.23 3 27.27
25690. Oliver (olliepop04) 1 56.81 56.81 0 0.00
25691. Harry (hai1912001) 232 56.80 72.32 18 7.76
25692. Hussain (hussainkhan) 42 56.80 71.57 4 9.52
25693. Charlie (dangdude) 6 56.80 60.78 0 0.00
25694. AJ-_- (nickelthemarcoman) 1 56.80 56.80 0 0.00
25695. 亨利 (henry034) 3 56.80 59.15 1 33.33
25696. Ava (spyder_) 14 56.80 71.70 1 7.14
25697. eigo (eigo) 5 56.79 60.84 0 0.00
25698. Dominik (misiekwiev13) 21 56.79 66.42 2 9.52
25699. Xingyu (pumpkinlighter) 16 56.79 67.13 3 18.75
25700. Master (master_gossip) 2 56.79 58.82 0 0.00
25701. ben (benlee27) 8 56.79 68.79 3 37.50
25702. 詠璿 (justforfun0906) 37 56.78 67.11 7 18.92
25703. midayis (midayis) 14 56.77 80.76 4 28.57
25704. Agamemnon (agamemnon_) 92 56.76 74.35 9 9.78
25705. madhukar (madhukar00) 1 56.76 56.76 0 0.00
25706. KYLECUMBER (kylecumber) 3 56.76 62.02 0 0.00
25707. Julia (juliaar) 32 56.76 70.15 7 21.88
25708. Teo (teotheterminator) 10 56.76 65.88 3 30.00
25709. Sara (sara_9876554432112345... 3 56.76 61.56 3 100.00
25710. Violet (znn7) 9 56.76 64.14 2 22.22
25711. Dylan (spacedroplet) 5 56.75 60.87 0 0.00
25712. samuel (grimtale) 2 56.75 59.74 0 0.00
25713. Potato (potato_wink9) 1 56.75 56.75 0 0.00
25714. Josue (mangalarge) 8 56.75 73.75 1 12.50
25715. Farkhan (farkhann) 9 56.75 72.20 0 0.00
25716. Alex (5xlegend) 4 56.75 65.44 1 25.00
25717. GeekThrill (geekthrill) 35 56.74 69.14 2 5.71
25718. Terrence (itzardtypes) 1 56.74 56.74 0 0.00
25719. Sam (sandwhales) 7 56.74 65.24 3 42.86
25720. Pablo (poloniusz) 2 56.74 61.96 1 50.00
25721. Elton John (tonundrum) 27 56.74 72.00 7 25.93
25722. Poopy4757 (poopy4757) 8 56.74 69.62 1 12.50
25723. Ahmed (goushaa) 84 56.74 73.59 11 13.10
25724. Saidul (saidul_islam) 4 56.74 64.20 1 25.00
25725. nayan (nayan268) 7 56.74 60.79 2 28.57
25726. Ogatinasu (ogatinasu) 15 56.73 71.25 5 33.33
25727. Emil (lime03) 3 56.73 58.34 1 33.33
25728. Tate (wizard5) 9 56.73 65.88 2 22.22
25729. Rodrigo (rodrianton) 1 56.73 56.73 0 0.00
25730. pastamath (pastalavista) 25 56.73 70.46 8 32.00
25731. Dannyngve (dannyngve) 3 56.71 63.62 3 100.00
25732. dag (dagweg) 7 56.71 64.66 0 0.00
25733. Lam (trungld) 2 56.71 59.38 0 0.00
25734. Ankit (savage_floppy) 24 56.70 68.18 18 75.00
25735. Nikola (limuncovek) 6 56.70 63.80 0 0.00
25736. Jessia (jessia25) 1 56.70 56.70 0 0.00
25737. ghost (theghostbehindyou) 764 56.69 83.86 111 14.53
25738. Kamil (krimy225) 5 56.68 62.06 1 20.00
25739. Jon (erikzh) 3 56.68 57.41 0 0.00
25740. Puskar (puskar_pandey) 5 56.68 61.71 3 60.00
25741. Prajwal (prajwalr) 239 56.67 75.22 38 15.90
25742. theFurlong (thefurlong) 4 56.67 61.31 0 0.00
25743. Adam (adamrocks21) 15 56.67 62.33 2 13.33
25744. raging_wolf (raging_wolf) 33 56.67 69.97 3 9.09
25745. deez (mintpurple) 4 56.66 60.67 0 0.00
25746. Ian (mail_order_bride) 21 56.66 70.02 2 9.52
25747. Johannes (xcillingx) 35 56.66 68.86 5 14.29
25748. Tony (toanie) 1 56.66 56.66 0 0.00
25749. brian (bsill) 9 56.65 68.00 2 22.22
25750. raman (raman123) 1 56.65 56.65 0 0.00
25751. Remi (remi_11) 130 56.64 72.04 24 18.46
25752. lokesh (vidhvanshak) 86 56.64 67.64 16 18.60
25753. TTTT (aa7608327) 11 56.64 65.96 3 27.27
25754. Alexander (abba64) 1 56.64 56.64 0 0.00
25755. Håkon (gipper321) 1 56.64 56.64 0 0.00
25756. Carlos (saint1124) 2 56.64 62.01 1 50.00
25757. Wendy (crystalblue123) 127 56.64 70.84 21 16.54
25758. Tanner (tannercraytor) 15 56.64 66.81 5 33.33
25759. Ben (benlestage3) 2 56.63 58.78 0 0.00
25760. Jakaria (jakaria_sami) 14 56.63 67.65 5 35.71
25761. woni (woni) 5 56.62 71.39 0 0.00
25762. igig (eztau) 10 56.62 61.33 1 10.00
25763. Meliflua (meliflua) 160 56.62 68.03 21 13.13
25764. Derriel (ddcj90) 46 56.61 68.83 9 19.57
25765. Do (dothanhtungnb602) 7 56.61 58.93 0 0.00
25766. Callow (callowblack) 20 56.60 67.29 4 20.00
25767. Sandwich (marlonbrandoseyes) 109 56.59 72.15 18 16.51
25768. lilbaxtian (lilbaxtian) 6 56.58 61.09 0 0.00
25769. Daniil (hate_machine) 24 56.57 66.83 13 54.17
25770. RoA (romori) 61 56.57 67.65 12 19.67
25771. taylor (pastford) 581 56.57 78.50 80 13.77
25772. Aditya (strong91105) 2 56.57 63.10 2 100.00
25773. Ori (echoloche) 10 56.56 63.57 4 40.00
25774. Ritik (beast2402) 1,099 56.56 79.71 155 14.10
25775. by (by_law) 7 56.56 64.55 3 42.86
25776. सुरेन्द्र... 19 56.55 69.09 1 5.26
25777. Milan (m_i_n_o) 32 56.55 71.07 4 12.50
25778. Rohan (ron_tesla) 1 56.55 56.55 0 0.00
25779. borkes (borkes) 3 56.55 60.89 1 33.33
25780. Totally Not A Cat (totallyn... 74 56.55 71.88 15 20.27
25781. Nameless (plot_da_pro) 14 56.55 66.67 8 57.14
25782. Ali Haider (alihaider12qw) 3 56.55 58.76 1 33.33
25783. Priyanshu (_priyanshu_) 49 56.54 67.30 10 20.41
25784. ARC6 (arc_6) 5 56.54 66.08 0 0.00
25785. GpJay (gpjay) 17 56.54 63.60 3 17.65
25786. Louis (funnyblouboi) 1 56.54 56.54 1 100.00
25787. Ledion (ledisad) 4 56.53 60.13 1 25.00
25788. Djalla (jonkoos) 2 56.53 61.74 0 0.00
25789. Robin (robdernub) 1 56.53 56.53 1 100.00
25790. Yersin (y3r51n) 5 56.53 67.80 2 40.00
25791. Pritom (pritom_99) 23 56.53 67.80 4 17.39
25792. Umidjon (nouser493) 22 56.52 68.89 17 77.27
25793. ayrus (ayrus01) 16 56.52 64.17 3 18.75
25794. Christian (allen2021) 106 56.52 69.24 10 9.43
25795. FireGumz (firegumz) 27 56.51 74.00 4 14.81
25796. Vincent (vincexodus) 348 56.51 76.11 52 14.94
25797. akash (akash__) 4 56.51 60.74 0 0.00
25798. Govind (404fixer) 82 56.51 69.93 11 13.41
25799. himanshu (himanshu_giri) 14 56.50 68.15 4 28.57
25800. Poop (poopeey) 5 56.48 61.15 1 20.00
25801. tesseract (tesseract1996) 30 56.48 70.51 4 13.33
25802. Void (decusd) 1 56.48 56.48 0 0.00
25803. Allan (pronewb2325) 39 56.48 68.06 8 20.51
25804. Marty (budmike54) 5 56.47 64.85 3 60.00
25805. Segs (mahrush) 19 56.47 68.10 9 47.37
25806. inspirations (inspirations) 294 56.47 73.98 52 17.69
25807. PraWin (praveenapk) 16 56.47 63.73 3 18.75
25808. James (kasprovy) 13 56.47 62.01 0 0.00
25809. adil (silawatadil) 70 56.47 72.29 15 21.43
25810. Prathamesh (rajputprathames... 8 56.46 62.47 3 37.50
25811. rodals (rodals) 1 56.46 56.46 0 0.00
25812. Daniyar (tobirama_senju) 1 56.46 56.46 0 0.00
25813. zeyad (egyptian_1211) 5 56.46 61.44 1 20.00
25814. Ben (dukedukeduke) 6 56.46 64.01 5 83.33
25815. Nomis (simsslabimbum) 6 56.46 64.12 1 16.67
25816. Jayden (slawsome) 56 56.45 67.73 2 3.57
25817. Kimberly (kimbear_) 46 56.45 67.46 6 13.04
25818. Pratul NHK (zer_fus) 126 56.45 71.39 20 15.87
25819. D A R K Z (reaching130wpm) 11 56.45 66.84 0 0.00
25820. Raj Gaurav (01indian) 59 56.45 67.56 15 25.42
25821. Bakushou (bakushou) 19 56.45 67.79 2 10.53
25822. Tommy (ching_wong_un) 4 56.45 63.04 0 0.00
25823. Ethan (ethro) 10 56.44 76.27 1 10.00
25824. Fernando (fer_8888) 13 56.44 67.73 2 15.38
25825. Sophie (sophiebrown6) 8 56.44 62.10 0 0.00
25826. Manish (manishspot) 12 56.44 62.18 2 16.67
25827. IpohGirl (ipohgirl8) 20 56.44 73.40 6 30.00
25828. Stuart (stuart000little) 31 56.44 66.17 4 12.90
25829. ayy (ayy_cocotype17) 11 56.44 69.27 10 90.91
25830. Casey (ewoozy) 3 56.44 66.49 1 33.33
25831. John (johnhemrom) 100 56.44 68.01 8 8.00
25832. Angi (shorti_74) 6 56.44 64.12 1 16.67
25833. Kucing (nyandesuyo) 8 56.43 67.79 1 12.50
25834. Jordan (j_kid) 1 56.42 56.42 0 0.00
25835. Je (jxnnele) 22 56.42 72.57 17 77.27
25836. Thomas (ldsg99999) 11 56.41 64.43 2 18.18
25837. M (ml19) 1 56.41 56.41 0 0.00
25838. Vova (v_hg_p) 42 56.41 76.53 4 9.52
25839. epicsyrian (epicsyrian) 18 56.40 63.46 1 5.56
25840. Allen (allen8811) 8 56.40 63.85 2 25.00
25841. Baki (p4n7r0n1c) 10 56.40 63.13 0 0.00
25842. ▬|═══ﺤ (vikas112) 52 56.40 69.92 4 7.69
25843. harsh spacebar broke lol (d... 34 56.40 71.78 6 17.65
25844. Luna (kavuko_) 13 56.40 65.72 3 23.08
25845. Liam (liamzammit) 15 56.40 66.78 0 0.00
25846. Dhvanik (dj_viradiya) 59 56.39 67.67 12 20.34
25847. I3B (i_3b) 9 56.39 62.30 8 88.89
25848. eren (erenisdevil) 64 56.38 71.95 9 14.06
25849. Samo (sakra) 7 56.38 69.37 1 14.29
25850. Usmon (usmon_h) 15 56.38 61.23 13 86.67
25851. Phantom (phantomzamber) 10 56.38 67.12 2 20.00
25852. Chad (chadkorrea) 30 56.38 68.64 5 16.67
25853. Joey (j0ash08) 32 56.37 66.32 16 50.00
25854. G.A.F (mochillavila) 20 56.37 69.29 2 10.00
25855. purple (purplejust) 67 56.37 72.09 17 25.37
25856. Thomas (thms_andrsn) 14 56.36 66.63 3 21.43
25857. lucky3495 (lucky3495) 3 56.36 57.90 2 66.67
25858. EXTREMEBEAST537 (extremebea... 3 56.36 59.90 1 33.33
25859. Swerpy (swerpy) 2 56.36 60.22 1 50.00
25860. PhiBi2002 (phibi2002) 1 56.36 56.36 0 0.00
25861. jacob (jacobn279) 4 56.36 69.99 2 50.00
25862. Yuklin (okinashii) 2 56.36 57.77 0 0.00
25863. Rohith (pebblepot) 17 56.35 72.16 3 17.65
25864. A (terrible_penguin) 12 56.35 68.76 1 8.33
25865. Jude (grixvous) 1 56.35 56.35 1 100.00
25866. niecia (nieecia) 4 56.35 63.93 1 25.00
25867. speedyqwertalez (i_am_a_nooby) 285 56.35 69.17 32 11.23
25868. ArklightF0x (arklightf0x) 142 56.35 73.74 30 21.13
25869. Spencer (doucwhatic) 6 56.35 61.54 1 16.67
25870. Tanakrit (mogoon) 32 56.34 65.62 7 21.88
25871. Ladybug (lady_bug_) 420 56.34 73.43 64 15.24
25872. Me (emailgmailcom) 78 56.34 78.24 6 7.69
25873. Jacob (karagiannis1) 22 56.34 65.64 1 4.55
25874. Nae (naeakuma) 4 56.33 67.11 0 0.00
25875. Tamerlan (zhanglet) 61 56.33 71.36 10 16.39
25876. zaoad (zaoad) 227 56.33 71.43 26 11.45
25877. Wil (kingwilyn) 15 56.33 68.50 3 20.00
25878. ﹤୨♡୧﹥ (pa1ntwater) 28 56.32 68.26 2 7.14
25879. Yentl (yp30) 2 56.32 58.80 1 50.00
25880. Amorphous (tawseef) 198 56.31 69.72 20 10.10
25881. Saikiran (sai_kiran_07) 20 56.31 72.76 3 15.00
25882. Olivia (uglyratt) 5 56.31 61.96 1 20.00
25883. ozzy (ozzyk) 11 56.30 70.90 1 9.09
25884. PandoraOG (pandoraog) 25 56.30 62.92 2 8.00
25885. Nash (nashsauter) 1 56.30 56.30 0 0.00
25886. William (epwill) 1 56.30 56.30 0 0.00
25887. Giovanni (zombieagain) 47 56.30 67.89 3 6.38
25888. mo (yo_mo) 31 56.29 68.65 3 9.68
25889. Hasan (hassanese) 392 56.29 80.33 51 13.01
25890. Jason (ason6678) 8 56.29 65.87 6 75.00
25891. Ryan (typerace_ryan) 44 56.29 68.69 9 20.45
25892. Takeru (takeruokuyama) 2 56.28 56.67 0 0.00
25893. ScarlettSu (scarlettsu) 6 56.28 68.74 2 33.33
25894. Babon (babonbunting) 10 56.27 68.82 2 20.00
25895. Pipe (pipeuwu) 3 56.27 60.66 0 0.00
25896. Kai (kulturekiah) 9 56.27 64.13 2 22.22
25897. Yams (yams_) 9 56.25 62.87 1 11.11
25898. Yasir (nay_yar110) 54 56.25 79.15 5 9.26
25899. Lan (thien_hai13) 10 56.25 66.09 1 10.00
25900. Logan (jimmybiscuit39) 15 56.25 68.32 3 20.00
25901. Mukul (mega_mukul) 41 56.23 63.26 6 14.63
25902. Ajeje (locreee) 13 56.22 75.48 4 30.77
25903. Gabriel (itsgiorno) 124 56.22 68.35 27 21.77
25904. Shreesh (shreesh_racer) 64 56.22 66.89 9 14.06
25905. Skreemmy (skreemmy) 11 56.22 63.71 2 18.18
25906. Budwecan (budwecan) 5 56.21 60.50 3 60.00
25907. Zoe (zhanchi) 250 56.21 69.42 31 12.40
25908. bean boy (binhthetyper) 101 56.20 74.30 17 16.83
25909. Slice Dice (slicedice) 71 56.20 71.87 10 14.08
25910. Chirp (chirpflewgone) 187 56.19 75.05 34 18.18
25911. Aadhi (aadhi936) 20 56.19 60.15 1 5.00
25912. Eva (allyve) 7 56.19 65.43 3 42.86
25913. Ḿ (m_10) 115 56.19 72.39 18 15.65
25914. Advit Upadhyay (advit0708) 8 56.18 60.59 2 25.00
25915. Peter (kushlord) 4 56.18 63.97 0 0.00
25916. Elizur Daniel (elizur_daniel) 6 56.18 64.12 2 33.33
25917. T (kaampachees) 5 56.17 62.75 0 0.00
25918. MegaTron (megatron100101) 308 56.17 75.29 44 14.29
25919. Epoi (epoi_311) 6 56.17 66.81 0 0.00
25920. Ryan (skulliex) 5 56.17 68.19 1 20.00
25921. Gaurav (moodcode) 15 56.17 68.33 3 20.00
25922. mar (marhaage) 4 56.16 69.37 0 0.00
25923. SeldRiyo (seldriyo) 19 56.16 63.31 3 15.79
25924. Ankush (ankushmishra) 4 56.16 63.89 0 0.00
25925. Alan (creamedpants) 6 56.15 67.28 5 83.33
25926. hksgiroro (hksgiroro) 17 56.15 67.76 4 23.53
25927. Osama (ojscofield) 1 56.15 56.15 0 0.00
25928. samy (samy_mohsen) 99 56.15 73.77 14 14.14
25929. rafy (rafybeatskids) 1 56.14 56.14 0 0.00
25930. Quang (quang81191) 1 56.14 56.14 0 0.00
25931. Jonathan (jwoo516) 1 56.14 56.14 0 0.00
25932. Itay (itzir) 108 56.14 67.00 15 13.89
25933. Stanley (stanley_gogo) 9 56.14 68.06 1 11.11
25934. dabbytabby (roadto110wpm) 5 56.14 60.61 0 0.00
25935. ⁤ (collin_) 7 56.14 62.88 3 42.86
25936. Stefan (unknow_stef) 60 56.13 70.78 7 11.67
25937. batmunkh (batmunkh) 9 56.13 61.46 0 0.00
25938. Mardon (mapukhuanna) 7 56.13 60.84 1 14.29
25939. Jakub (jakgin) 3 56.13 59.40 2 66.67
25940. Naga (nagaspar) 50 56.12 81.07 14 28.00
25941. Jagadeshrao (jagadeshrao) 546 56.12 80.01 83 15.20
25942. Ben@ (uniconsole) 81 56.12 74.39 11 13.58
25943. Varun (wolfie12) 45 56.12 65.03 4 8.89
25944. Kaushik (kaushikdontula) 2 56.12 61.28 2 100.00
25945. Ajay (metacorb) 35 56.11 66.16 4 11.43
25946. Dave (davethreed) 56 56.11 68.03 5 8.93
25947. tstats[0anonymous0123] (0an... 48 56.11 69.40 5 10.42
25948. Diego (dieagui) 3 56.11 62.24 1 33.33
25949. beep (doinyamom1337) 41 56.11 68.56 6 14.63
25950. nathanael (flyeroscer) 20 56.10 74.40 4 20.00
25951. Dipu Kumar (the_marvello_op) 3 56.10 62.67 1 33.33
25952. Solomon (deputycommissioner... 1 56.10 56.10 0 0.00
25953. Hashmia (haaashmiah) 8 56.10 67.50 3 37.50
25954. Jon (jonbeka) 21 56.10 64.37 3 14.29
25955. primrose (abigaillll) 10 56.10 62.15 2 20.00
25956. Abhijith (iabz) 22 56.09 71.82 3 13.64
25957. NAILs (sleepyt0wne) 4 56.09 64.66 0 0.00
25958. Jasper (ajaystr) 26 56.09 65.46 4 15.38
25959. Danyl (seataco) 49 56.09 76.80 16 32.65
25960. Maliir (maliir) 7 56.09 62.33 1 14.29
25961. Annwesha (annwesha) 72 56.09 66.98 8 11.11
25962. Oleg (ninele7) 3 56.08 60.92 0 0.00
25963. Manny (blimps) 18 56.08 68.05 3 16.67
25964. QWERTY (howtfdoyoutype200wpm) 1 56.08 56.08 1 100.00
25965. Francisco (francisc0) 28 56.08 74.36 2 7.14
25966. Jherome Eduard (bl4nkk) 48 56.07 73.22 5 10.42
25967. Djordje (djordjeostoic) 2 56.07 56.97 0 0.00
25968. Dallas (danki) 1 56.07 56.07 0 0.00
25969. Swastik (swastik220705) 35 56.06 66.22 6 17.14
25970. dryeab (dryeab) 5 56.06 65.47 5 100.00
25971. Amigo (amigom) 4 56.06 59.93 0 0.00
25972. Teeraphon (lasthomeless) 27 56.06 65.26 1 3.70
25973. aawan (aawan_viator) 74 56.05 66.59 11 14.86
25974. Christopher Szabo (bluepizza2) 7 56.04 68.96 1 14.29
25975. Ugur (apparro) 3 56.04 64.98 1 33.33
25976. Alexgiomuel (bionicmjallday... 34 56.04 72.97 4 11.76
25977. EddyEndo (jackpoteddie) 8 56.04 63.51 1 12.50
25978. Thav (epic_boyo_123) 20 56.04 66.75 2 10.00
25979. Dave (daviddatroll) 3 56.03 57.95 1 33.33
25980. Kandinsky (kandinskie) 2 56.03 66.19 0 0.00
25981. Gunzo (gunzo_27) 1 56.03 56.03 0 0.00
25982. Charmen (charmen) 9 56.03 64.20 3 33.33
25983. aspen (flooot) 4 56.03 65.15 0 0.00
25984. 1776 (17_abe_76) 30 56.03 71.86 4 13.33
25985. MAHIR (mahirlabib) 122 56.01 69.25 22 18.03
25986. Nechmo (nechmo111) 7 56.01 63.94 0 0.00
25987. Madhusudan (mainali449) 10 56.01 63.04 2 20.00
25988. tstats[abyl_10] (abyl_10) 24 56.01 65.69 4 16.67
25989. casadaro (solocro) 6 56.01 61.94 0 0.00
25990. your (papaheav) 1 56.00 56.00 1 100.00
25991. tony (tony_starc303) 70 55.99 66.73 9 12.86
25992. Do (tai230) 36 55.99 66.85 4 11.11
25993. Anonimo (ibzjem7v) 3 55.99 60.87 0 0.00
25994. ahmed (elkfafy) 35 55.99 71.17 2 5.71
25995. Banun (banun) 20 55.99 68.91 2 10.00
25996. Dhanraj (thedan123) 2 55.99 61.93 0 0.00
25997. princeton (santabiii) 10 55.99 62.80 2 20.00
25998. Aditya (fire_smasher1) 111 55.98 72.06 18 16.22
25999. Mike (yoshyosh) 18 55.98 66.75 0 0.00
26000. Lewis (the_mysterium) 66 55.98 69.81 12 18.18
26001. Zander (zshark216) 2 55.98 56.79 0 0.00
26002. Lucas (larkluco) 19 55.97 63.86 4 21.05
26003. Pro (kvis) 8 55.97 60.53 1 12.50
26004. Eva (evyrose2008) 13 55.97 70.18 1 7.69
26005. Jman (jkarlik22) 14 55.97 81.36 3 21.43
26006. Hari (hari_dev) 47 55.96 69.05 0 0.00
26007. MAMUN (wmamunhossain) 90 55.95 70.80 15 16.67
26008. Jimmy Butler (ilyrxtro) 3 55.95 62.98 1 33.33
26009. Crystalrep (crystalrep) 14 55.95 77.32 14 100.00
26010. Darma (pcfounder) 3 55.95 56.96 0 0.00
26011. Luke (lukeg1209) 525 55.95 73.45 73 13.90
26012. Daniel (isnakolah) 6 55.94 61.47 0 0.00
26013. Ninja (n0inja_randy) 3 55.94 60.16 0 0.00
26014. Ch1LLz (_chillz) 2 55.94 59.89 1 50.00
26015. Andreas (andi_0324) 68 55.94 69.73 8 11.76
26016. Merwin (merwin_samuel) 5 55.93 59.21 1 20.00
26017. Ayush (ayushgandhi) 16 55.93 61.41 4 25.00
26018. damn (_victor667_) 7 55.93 65.76 0 0.00
26019. Alex (kietdjae) 4 55.93 56.99 1 25.00
26020. Thuxerinho (thuxerinho) 2 55.93 61.69 1 50.00
26021. Filthy (filthyballer) 38 55.92 66.87 5 13.16
26022. John (brodros) 1 55.92 55.92 1 100.00
26023. MANGESH (atom2) 2 55.92 62.17 1 50.00
26024. hariz (harizgong) 1 55.92 55.92 0 0.00
26025. Alex (jigglytophat) 13 55.92 64.94 2 15.38
26026. Natalia (natalia153) 17 55.91 65.61 4 23.53
26027. Evgeny (x1p234) 176 55.91 70.16 16 9.09
26028. Mohaka (mohaka) 86 55.91 72.49 8 9.30
26029. ziyummmm (ziyummmm) 2 55.91 62.87 0 0.00
26030. vamsi (vamsibharadwaj) 33 55.90 64.41 3 9.09
26031. Saeed (saeedfx) 7 55.90 65.90 0 0.00
26032. IVAN (ivil) 35 55.90 66.31 6 17.14
26033. Dipendra (lord_jarvis) 4 55.90 67.63 1 25.00
26034. Mr.John (mrjohnwick) 14 55.90 67.63 5 35.71
26035. junior (junior2000) 14 55.89 67.02 4 28.57
26036. Collins (princey) 56 55.88 66.59 7 12.50
26037. Dolphin (dophin) 2 55.88 56.46 2 100.00
26038. Bun (bunnypuc) 339 55.88 79.53 57 16.81
26039. SkillfulRheyme4 (skillfulrh... 9 55.88 71.53 2 22.22
26040. Jeevun (masterjeev) 25 55.88 71.86 5 20.00
26041. KachoriJalebi (kachori_jalebi) 16 55.87 68.90 3 18.75
26042. mira (mlp1214) 53 55.87 70.34 9 16.98
26043. Dude (damonjammin) 42 55.87 72.80 6 14.29
26044. Shawn (filipinofriend) 1 55.86 55.86 0 0.00
26045. Aminul (fardin1bd) 8 55.85 63.03 0 0.00
26046. Eric (cloud99) 1 55.85 55.85 0 0.00
26047. Karis (ktoothman) 1 55.85 55.85 0 0.00
26048. Harshith (ghvsama_123) 594 55.84 77.48 103 17.34
26049. mazen (mazen25287) 127 55.84 73.12 13 10.24
26050. Kostas (svoleas) 6 55.84 61.17 1 16.67
26051. Himal (panthimal) 192 55.84 71.33 22 11.46
26052. spudnick (spudnick47) 1 55.83 55.83 1 100.00
26053. Daniela (danirmz) 308 55.83 84.33 37 12.01
26054. Nicholas (bsg8) 11 55.83 65.16 2 18.18
26055. Ivan (t3ry444y) 44 55.82 65.34 4 9.09
26056. Swarnim (futuretonystark) 16 55.82 68.88 4 25.00
26057. Aarvaan (aarvaan) 348 55.82 76.10 47 13.51
26058. Adam (kedgehog) 4 55.82 61.96 0 0.00
26059. MH (nibir4422322321) 60 55.81 68.67 5 8.33
26060. Amarpreet (bhangu_05) 54 55.81 68.43 4 7.41
26061. Simonas (slapukas321) 9 55.81 66.77 1 11.11
26062. rafał (rafixxx) 2 55.81 62.98 1 50.00
26063. KJ (1648460) 1 55.81 55.81 0 0.00
26064. imi (imitavor) 29 55.81 68.16 2 6.90
26065. Ali (ali_pro) 1,180 55.80 80.05 154 13.05
26066. beatrace (beatrace21) 236 55.80 76.63 23 9.75
26067. Egor (hawkeg) 21 55.80 66.58 6 28.57
26068. Evan (eh30) 10 55.79 62.67 1 10.00
26069. Rohith (jikki) 14 55.79 67.63 4 28.57
26070. mamounitor (mamounitor) 57 55.79 85.75 11 19.30
26071. SNovaK (snovak) 1 55.79 55.79 0 0.00
26072. yooko (0ctagon) 18 55.79 62.50 3 16.67
26073. Kocsis (tisq13) 20 55.78 67.66 4 20.00
26074. Alfie (alfie_op) 54 55.78 68.77 12 22.22
26075. zarkasi (mozar) 5 55.78 67.61 1 20.00
26076. MAXIM (skramt) 144 55.78 74.49 12 8.33
26077. Mike (mmiller_52) 13 55.77 63.65 1 7.69
26078. Zond (zohend) 16 55.77 64.33 4 25.00
26079. 🦈 (okamiro) 9 55.77 63.11 2 22.22
26080. Lucan (lucan616) 4 55.76 60.05 1 25.00
26081. pingukalinu (pingukalinu) 55 55.76 70.78 4 7.27
26082. Hendeen (hendeen) 24 55.76 68.23 3 12.50
26083. thummachart (thummachart) 7 55.76 61.91 0 0.00
26084. Tuna (rippleshark) 17 55.76 66.02 3 17.65
26085. 173adrimor (173adrimor) 13 55.76 69.79 4 30.77
26086. max (max2817max) 63 55.76 73.16 6 9.52
26087. Justin (idkman_69) 4 55.76 60.13 1 25.00
26088. ATHARVA (atharva07) 62 55.75 65.99 7 11.29
26089. Shierwin (shierwin) 1 55.75 55.75 0 0.00
26090. Annie (yourirregulartomboy) 2 55.75 62.19 1 50.00
26091. Zaynah (arianagrandeyuh27) 2 55.75 59.27 0 0.00
26092. Sonwa (sonwa) 156 55.74 66.69 17 10.90
26093. Greg (corei8) 2 55.74 58.48 1 50.00
26094. ab (abhi800) 9 55.74 67.88 0 0.00
26095. Sebastian (badwine) 16 55.73 71.77 2 12.50
26096. matt (jrm8999) 1 55.73 55.73 1 100.00
26097. Jones (jones72) 1 55.73 55.73 0 0.00
26098. H (nin9zer0) 8 55.73 63.56 1 12.50
26099. simmi (simmi999777) 15 55.73 68.89 3 20.00
26100. Mason (contourflyer2) 16 55.73 65.17 0 0.00
26101. Mario (mario241) 6 55.72 66.04 1 16.67
26102. Sakil_BD (sakil_bdd) 3 55.72 58.93 1 33.33
26103. Akshay (salty_nacho) 1 55.71 55.71 0 0.00
26104. Daddy (pep1) 1 55.71 55.71 0 0.00
26105. Qaplan (qaplan) 61 55.71 64.73 24 39.34
26106. Pikakid (pikakid_twitch) 2 55.71 60.76 0 0.00
26107. Daniel (thedmango) 2 55.71 57.43 0 0.00
26108. Sour (sourbar) 14 55.71 64.40 2 14.29
26109. Abby (numberonethumbtack) 5 55.69 67.14 1 20.00
26110. Learner (dumb_waste) 1 55.69 55.69 0 0.00
26111. Issaree (boranorben) 42 55.68 66.93 2 4.76
26112. colin (crustyrustonline) 41 55.67 79.48 7 17.07
26113. Avsome (youtooz_sellout) 1 55.67 55.67 0 0.00
26114. The Dude A-Rides (monesta) 6 55.67 66.21 4 66.67
26115. Matt (mhorsfield) 11 55.66 67.88 3 27.27
26116. H!P! (harsh_patel) 390 55.66 75.09 54 13.85
26117. WhooAre_you (whooare_you) 3 55.66 73.50 1 33.33
26118. Adi (cylify) 3 55.66 56.08 0 0.00
26119. Aly (kixiris) 9 55.66 68.66 9 100.00
26120. twin (oiaao) 12 55.65 63.02 2 16.67
26121. unholy (virus_) 34 55.65 69.72 6 17.65
26122. Manoj (m00npie) 12 55.65 62.73 3 25.00
26123. pear (pearuchiha) 7 55.65 63.90 1 14.29
26124. Nop (nopdop) 2 55.65 56.28 1 50.00
26125. Kshitij (kshitij21) 21 55.65 65.01 6 28.57
26126. BrammetjeBaas (vyx_spaghettt) 25 55.64 61.76 1 4.00
26127. Ceptlog (ceptlog) 4 55.64 64.66 0 0.00
26128. Pongpan (pongpan) 549 55.64 69.71 77 14.03
26129. hafidbuilds (hafidium) 254 55.64 68.63 35 13.78
26130. KJ (kushagra_j) 8 55.64 73.52 1 12.50
26131. Loydox8930 (loydox8930) 3 55.64 63.31 0 0.00
26132. Alperen (apleren) 14 55.64 63.54 2 14.29
26133. UzanR (uzanr) 25 55.63 64.73 2 8.00
26134. yashar (yashar1) 65 55.63 67.03 8 12.31
26135. Marc (mrthegreattypist) 12 55.62 64.08 1 8.33
26136. (slimaniimededdineabderrah... 36 55.62 66.87 5 13.89
26137. rao (raonavdeep) 19 55.62 67.92 5 26.32
26138. ritesh (ritesh_k) 3 55.61 59.32 0 0.00
26139. Lugia (lugia_) 1 55.61 55.61 0 0.00
26140. Aleksandar (virage94) 27 55.61 67.37 4 14.81
26141. Jake (jake360) 5 55.60 64.38 0 0.00
26142. Luke_mcc (clonemyster) 2 55.60 57.15 1 50.00
26143. mushbert (mushbert) 45 55.60 69.40 12 26.67
26144. Peter (ironman2711) 28 55.60 74.55 6 21.43
26145. bhavesh (bhanucsgo) 124 55.60 75.51 23 18.55
26146. Andrew (andrewpalet) 2 55.59 59.56 0 0.00
26147. ray (raytrace) 18 55.59 69.30 0 0.00
26148. Toko (xisderr) 83 55.58 75.68 10 12.05
26149. ALI (legend_haddad) 175 55.58 73.03 27 15.43
26150. Diaa (diaa001) 13 55.58 73.80 2 15.38
26151. Omar (oamrelhorbity) 18 55.58 61.77 3 16.67
26152. Saad (saadahmed12858) 14 55.57 63.93 2 14.29
26153. Bumbur (radekzadek) 4 55.57 66.57 1 25.00
26154. Mashuke Alam (jim_99) 1 55.57 55.57 0 0.00
26155. hector (hexbreezy) 1 55.57 55.57 0 0.00
26156. Erlend (weserl) 20 55.56 65.71 2 10.00
26157. uska95 (uska95) 10 55.56 67.71 1 10.00
26158. impr0ving (impr0ving) 5 55.56 59.29 0 0.00
26159. Dan (dncn) 18 55.56 71.74 5 27.78
26160. Borna (borna433) 1 55.56 55.56 1 100.00
26161. Sazzad Hossain (invisible_r... 4 55.56 61.67 2 50.00
26162. Lunar (lunar3clipse) 6 55.56 66.32 0 0.00
26163. KiraThePerplexed (kiradonut) 4 55.56 60.44 1 25.00
26164. Gratias (gratias1) 3 55.56 61.06 0 0.00
26165. Aebel (monkeeeee) 3 55.56 59.20 1 33.33
26166. Anthony (goldfrog) 906 55.56 88.54 116 12.80
26167. Manolo (fiendz) 1 55.55 55.55 0 0.00
26168. Michael (m1cky82) 2 55.54 61.23 1 50.00
26169. Marek (gpro2005) 1 55.53 55.53 1 100.00
26170. 𝔏𝔦𝔪𝔬𝔟𝔢... 41 55.53 64.94 2 4.88
26171. Anurag (debroglie) 67 55.53 70.62 15 22.39
26172. Qing Chi (pumbinking) 6 55.52 60.29 1 16.67
26173. Debdip Das (dipto_debdip) 5 55.52 57.94 0 0.00
26174. Boris (vhoma) 19 55.52 60.80 1 5.26
26175. Bo (dut227) 2 55.52 56.15 0 0.00
26176. Ayush (improve_buddy) 421 55.51 76.44 84 19.95
26177. Ritesh (novathor) 45 55.51 67.50 7 15.56
26178. Noel (noel_svartsjo) 4 55.51 62.69 1 25.00
26179. Lily (_lily) 4 55.51 66.71 0 0.00
26180. aman729272 (aman729272) 124 55.50 64.91 19 15.32
26181. Changnam (rotoflemf) 9 55.50 60.24 1 11.11
26182. kpsmelvin (kpsmelvin) 35 55.50 67.04 5 14.29
26183. Juan (fullmetal474) 1 55.50 55.50 1 100.00
26184. Parsa (parsasq) 52 55.49 70.14 9 17.31
26185. Beksultan (beksultan2001) 7 55.49 65.69 0 0.00
26186. Gavin (sl0wnsteady) 2 55.49 55.53 0 0.00
26187. aidan (aidooo) 2 55.48 57.95 0 0.00
26188. Adam (adam_sandler) 1 55.48 55.48 1 100.00
26189. ryderrt (ryderrt) 7 55.48 76.31 0 0.00
26190. Akira (s_akira) 235 55.47 72.59 34 14.47
26191. bella (beliss08) 15 55.47 63.96 1 6.67
26192. Gabi (ockra_) 11 55.45 69.33 3 27.27
26193. Iveth (perlybomb) 46 55.45 67.74 8 17.39
26194. harish (harishravi) 5 55.45 61.12 0 0.00
26195. Seeking (seekingtotype) 4 55.45 63.50 0 0.00
26196. day (const_bored) 7 55.44 73.18 4 57.14
26197. Typing (slow_seizure_man) 14 55.44 70.04 3 21.43
26198. Ricardo (golden_boi) 36 55.44 64.47 4 11.11
26199. jihoon007 (jihoon007) 102 55.44 69.05 19 18.63
26200. Aidar (aidar13) 66 55.43 69.99 10 15.15
26201. Tan (aalliance11) 2 55.43 57.80 1 50.00
26202. Chico (momothedoge) 1 55.43 55.43 0 0.00
26203. Alex (alexbananex) 7 55.43 62.05 2 28.57
26204. Sebastian (karuispa) 7 55.43 65.63 1 14.29
26205. vachana (pvloveks) 3 55.42 58.99 0 0.00
26206. Carlos (carloshdelreal) 11 55.42 62.57 1 9.09
26207. Mike (kb_acolite99) 347 55.42 79.45 45 12.97
26208. Hari (hari_prasath_25) 7 55.42 61.37 2 28.57
26209. Aditya (adityapatel103) 1,393 55.42 72.33 175 12.56
26210. p055am (p055am) 16 55.41 70.01 6 37.50
26211. onlyskee (onlyskeelol) 6 55.41 61.64 2 33.33
26212. Kanav (kanav__trying) 12 55.41 64.20 0 0.00
26213. Racer (racer_9) 280 55.41 80.13 30 10.71
26214. Vinka (vinka_anggita) 1 55.41 55.41 1 100.00
26215. Neo (meoo) 205 55.41 83.19 29 14.15
26216. Jon (jojinismafia) 4 55.41 64.45 0 0.00
26217. Yoel (chessmaster55) 107 55.40 74.37 13 12.15
26218. Pawan (pawanmsr) 18 55.40 62.03 3 16.67
26219. Nicholas (nikorosu) 14 55.40 62.39 2 14.29
26220. arthur (arthurc999) 28 55.40 69.27 4 14.29
26221. Chittaarth (chitt09) 4 55.40 66.21 4 100.00
26222. MatiPati (matipati) 6 55.40 71.70 1 16.67
26223. Rakesh (rakesh69) 472 55.40 92.05 87 18.43
26224. Avil (avilvineko) 9 55.40 60.77 0 0.00
26225. John (whalenj) 132 55.39 69.39 16 12.12
26226. ghostly (xghostly) 2 55.39 61.04 1 50.00
26227. Johnny (johneeeee) 18 55.39 70.04 2 11.11
26228. Brandon (fireinthesoul) 4 55.38 60.80 0 0.00
26229. Arjyom (apepenkov) 1 55.38 55.38 0 0.00
26230. kelonline (kelonline) 13 55.38 60.60 0 0.00
26231. A Newbie (a_newbie_a) 9 55.38 62.64 1 11.11
26232. Sn1kt (sn1kt) 107 55.38 74.57 17 15.89
26233. Vidit (vdop) 47 55.38 78.81 9 19.15
26234. tstats[parth812] (parth812) 758 55.37 79.60 100 13.19
26235. Now you gonna see this is h... 5 55.37 63.93 1 20.00
26236. itsKrish01 (itskrish01) 47 55.37 70.36 12 25.53
26237. eat4free (leewei05) 3 55.37 57.63 0 0.00
26238. Alvin M. (spoderman2100) 13 55.37 65.27 3 23.08
26239. bbb (bugbearbey) 6 55.36 62.80 0 0.00
26240. roy (shote) 35 55.35 64.44 1 2.86
26241. Bonu (bonu21) 101 55.35 65.06 14 13.86
26242. varun (vakot) 651 55.34 74.36 98 15.05
26243. bl4ck (emil_black) 2 55.34 56.20 0 0.00
26244. Ollie (ollie438) 3 55.33 62.14 0 0.00
26245. Jujee (jujee_poo) 194 55.33 78.03 47 24.23
26246. mandryx (mandryx) 7 55.33 63.62 1 14.29
26247. cyberrex aka (_cyberrex) 1 55.33 55.33 0 0.00
26248. Ankur (ankur94516) 476 55.32 75.25 70 14.71
26249. Le (yorkist) 39 55.32 68.36 9 23.08
26250. abdalkarim (aboodz) 2 55.32 59.54 0 0.00
26251. harsh wardhan (harshsingh1703) 4 55.31 58.53 1 25.00
26252. Jason (zinzin27bs) 45 55.30 70.56 3 6.67
26253. YEP (lumpytacos) 3 55.30 63.40 1 33.33
26254. Jillian (jillianbonfoeyoops... 19 55.30 67.40 10 52.63
26255. Brojo (brojokm) 7 55.29 59.84 0 0.00
26256. Brayan (veraniego) 98 55.29 68.54 16 16.33
26257. Nirmith (nirmith_akash) 293 55.29 72.81 41 13.99
26258. Grenien (grenien) 2 55.29 55.51 0 0.00
26259. Ashish (ashk98) 169 55.28 78.17 30 17.75
26260. Jim (rl_magikz) 12 55.28 68.01 4 33.33
26261. chuck1ehead (chuck1ehead) 28 55.27 73.89 4 14.29
26262. Abdelrahman (awebdo) 35 55.27 65.87 2 5.71
26263. whuwxl (whuwxl) 14 55.27 60.98 2 14.29
26264. BeeTheKay (beethekay) 3 55.27 59.13 1 33.33
26265. Imambek (imambek) 1 55.27 55.27 0 0.00
26266. TechHolmes (mohmmde) 102 55.27 74.15 17 16.67
26267. w0wdead (wowdead) 20 55.27 70.12 18 90.00
26268. TITAN (titan_daddy) 59 55.26 73.24 12 20.34
26269. Kevin (toofpaste) 5 55.25 65.23 0 0.00
26270. Poop_57 (fuzzydestroyer) 8 55.25 72.68 2 25.00
26271. Brylle (latios12349) 32 55.25 64.48 1 3.13
26272. aagils (aagils) 2 55.25 59.57 2 100.00
26273. alex (larrythesnail82) 9 55.24 64.03 2 22.22
26274. Joe (disconnnect) 2 55.24 58.08 0 0.00
26275. jm (imjm) 1 55.23 55.23 1 100.00
26276. Xray (xrayburst) 57 55.22 65.11 9 15.79
26277. Awnvar (awnvar) 33 55.22 70.53 4 12.12
26278. Navid (navid_rahman) 4 55.22 57.29 1 25.00
26279. a1dan (aidanxd) 1 55.21 55.21 0 0.00
26280. Subid (slowth_369) 18 55.21 68.55 2 11.11
26281. Sabyasachi (sabyasachi_048) 1 55.20 55.20 0 0.00
26282. Quick (quick_finger) 1 55.19 55.19 0 0.00
26283. Tom (tomllic) 6 55.19 63.80 2 33.33
26284. Satyam (satyamslow) 61 55.19 70.12 10 16.39
26285. Huy (cross546) 973 55.19 74.45 116 11.92
26286. Lizbeth (belthiz) 18 55.18 67.98 0 0.00
26287. Shamus (bbtoskar) 3 55.18 64.71 1 33.33
26288. Shelpeck (shelpeck) 120 55.18 75.44 17 14.17
26289. Mostafa (mostfkhttb11) 3 55.17 63.94 0 0.00
26290. Ujjval (ross_specter) 291 55.17 73.45 36 12.37
26291. Jacob (remoobekaj) 1 55.17 55.17 0 0.00
26292. Caleb (qwerty345) 27 55.16 63.69 11 40.74
26293. Bubly (skelpadderidderen) 7 55.16 72.81 0 0.00
26294. sedney (sedneyl) 7 55.16 62.94 0 0.00
26295. Abdulelah (hansan) 263 55.16 73.03 36 13.69
26296. विघ्नेश (no_l... 178 55.15 70.44 23 12.92
26297. El (elnotelanor) 13 55.15 61.23 1 7.69
26298. unleashed (unleashedcode) 2 55.15 60.61 0 0.00
26299. Alex (alex_the_flash) 5 55.15 66.00 1 20.00
26300. neville (neville_dnbh) 17 55.15 69.03 4 23.53
26301. Mukhtar (nejaiski) 14 55.15 66.18 3 21.43
26302. chicken (turborider4) 6 55.14 59.63 1 16.67
26303. Abhiram (contigo) 2 55.14 57.32 0 0.00
26304. Laisvidas (meizind) 10 55.14 59.71 1 10.00
26305. antobot (antobot) 277 55.14 73.96 52 18.77
26306. Surely (surely_) 290 55.14 74.36 36 12.41
26307. mw3m (mw3m) 47 55.14 68.65 4 8.51
26308. Kayson (theengineer101) 5 55.14 58.64 0 0.00
26309. Samir (samirissa) 46 55.13 72.45 9 19.57
26310. zaarium (zaarium) 4 55.13 59.25 0 0.00
26311. hola (sensei_1st) 4 55.13 60.65 0 0.00
26312. Agus (bigbangfuzion) 5 55.12 61.96 0 0.00
26313. Nyamsick Adrian (minyamisu) 932 55.12 84.26 134 14.38
26314. Cuprian (cuprian) 1 55.12 55.12 0 0.00
26315. asdf (blackbirdsigloo) 1,494 55.12 84.64 184 12.32
26316. Arafat (arafat_hasan) 2 55.12 56.10 0 0.00
26317. Joe (joemama8144) 4 55.12 60.74 2 50.00
26318. Quan (quan_1) 3 55.11 56.52 0 0.00
26319. Kempo (kempochinois) 9 55.10 63.60 0 0.00
26320. Benny (fransiskusbenny) 39 55.10 68.73 5 12.82
26321. TYPE KITA (carracers) 161 55.10 77.27 23 14.29
26322. Suparno (letsbecool) 3 55.10 59.53 2 66.67
26323. Trying (whatisyourtalent) 26 55.09 72.75 5 19.23
26324. Jonathan (minifoke) 9 55.09 63.01 0 0.00
26325. Diego (faustian_nero) 8 55.09 61.86 0 0.00
26326. Avery (averyiscoolish) 1 55.09 55.09 0 0.00
26327. Eduardo (sr142898) 2 55.08 57.12 0 0.00
26328. Ankit (akjung478) 45 55.07 65.23 4 8.89
26329. Bricks (skyzeroblade) 5 55.07 68.15 5 100.00
26330. Nick (lemech) 34 55.07 71.39 6 17.65
26331. Shahobiddin (khusniddinov_uz1) 27 55.07 65.38 6 22.22
26332. heehee (heehee2) 23 55.06 70.12 2 8.70
26333. Yaniv (yaniv691) 55 55.06 67.69 13 23.64
26334. Shaishav (shaishav) 205 55.06 73.35 41 20.00
26335. Road (oldayanisnoob) 120 55.06 71.90 25 20.83
26336. Alec (daftpain) 1 55.06 55.06 0 0.00
26337. Harsh (harsh1924) 14 55.06 63.78 2 14.29
26338. Kawisara (kawi_sk) 4 55.06 67.54 1 25.00
26339. Maverick (wizgamer) 2 55.06 56.69 0 0.00
26340. Gabe (garff) 20 55.05 61.52 1 5.00
26341. R (fjasifjaficaom) 190 55.04 70.78 27 14.21
26342. Siddharth (darksun27) 30 55.04 65.57 6 20.00
26343. Midhun (midhunvmurali) 103 55.04 66.05 7 6.80
26344. quiskit (quiskit) 4 55.04 60.00 1 25.00
26345. Anas (01anas) 140 55.03 72.26 18 12.86
26346. Griffin (avalanchovy) 14 55.03 61.97 1 7.14
26347. Dragos (dragos_valak12) 76 55.03 79.22 8 10.53
26348. Mikita (byxmend) 101 55.02 68.44 13 12.87
26349. LYF (lyf_) 7 55.02 73.20 1 14.29
26350. Flavio Dai (tryonetry) 4 55.02 61.72 1 25.00
26351. j (jy22019) 22 55.02 63.28 0 0.00
26352. 0hyeah (0hyeah) 30 55.01 67.44 4 13.33
26353. Thomas (taimeru) 18 55.01 67.73 1 5.56
26354. Striker21 (striker21) 1 55.00 55.00 0 0.00
26355. Bigass (assfart) 1 55.00 55.00 0 0.00
26356. Bartek (undg) 71 55.00 69.51 17 23.94
26357. Black (blackhacker) 3 55.00 58.67 0 0.00
26358. mobin (irmobin) 177 55.00 71.46 36 20.34
26359. KC Abhinav (kcabdn) 287 55.00 78.53 42 14.63
26360. Eli (silversweedie) 167 54.99 78.70 14 8.38
26361. XXV6 (xxv6) 12 54.99 61.17 2 16.67
26362. War (sorted99) 26 54.99 64.29 3 11.54
26363. Vaibhav (vaibhav12301) 4 54.99 65.86 0 0.00
26364. Melon (mailmelon) 32 54.98 67.17 4 12.50
26365. Krishnan (qrownora) 1 54.98 54.98 0 0.00
26366. Mindmaster (mindmaster03) 3 54.98 58.89 1 33.33
26367. saniya (supersaniya) 128 54.98 68.48 18 14.06
26368. justin (justinjose2007007) 4 54.98 62.65 1 25.00
26369. haykalive (haykalive) 17 54.97 64.35 7 41.18
26370. Lenny (lenny227) 1 54.97 54.97 0 0.00
26371. Crimson (noodle_fingers) 1 54.97 54.97 0 0.00
26372. Jiawei (jiaweilin) 41 54.96 69.59 5 12.20
26373. Aswin (humble_boy) 3 54.96 59.43 1 33.33
26374. Jakub (sovly) 5 54.96 61.81 1 20.00
26375. August (myracule) 86 54.96 68.28 8 9.30
26376. MrLolu (mrlolux) 10 54.95 62.36 1 10.00
26377. mecharekk (mecharekk) 3 54.95 56.98 0 0.00
26378. agent narwhal (puppyz) 1 54.95 54.95 0 0.00
26379. Humberto (curvekiller) 1 54.95 54.95 0 0.00
26380. nother (nother) 30 54.95 66.47 6 20.00
26381. Saied (saied_en) 254 54.94 75.03 47 18.50
26382. shafay (shafay) 4 54.94 61.37 1 25.00
26383. adiguna (adiguna7) 2 54.94 60.41 0 0.00
26384. sam (justlikethat) 95 54.93 69.83 8 8.42
26385. CommanderJiJi (jeromealmogu... 23 54.93 67.14 3 13.04
26386. Ayush (akushwaha11) 13 54.92 65.68 1 7.69
26387. George (geogeorge456) 47 54.92 73.21 8 17.02
26388. Zay (stiki_boi) 4 54.92 59.06 1 25.00
26389. NadAlaba (nadalaba) 87 54.91 79.56 16 18.39
26390. Bertie (shkablameo) 19 54.91 64.61 2 10.53
26391. Trung (danghoangtrung) 797 54.90 82.09 95 11.92
26392. Sadia (riyan_sadia) 8 54.90 64.09 0 0.00
26393. Cathleen (cathleenavrilian) 5 54.90 62.14 0 0.00
26394. Anna (sajtiann) 6 54.90 60.87 1 16.67
26395. scopersz (scopersz) 6 54.90 66.33 1 16.67
26396. Mohammed (modh_) 666 54.88 72.02 56 8.41
26397. AUpSideDownCup (aupsidedown... 12 54.88 63.74 7 58.33
26398. sachin (timsixit) 56 54.87 71.89 9 16.07
26399. Edmund (hhy1996) 6 54.87 64.05 2 33.33
26400. luce (leuvis) 9 54.87 61.26 1 11.11
26401. arjun (arjun_gamine) 59 54.87 70.02 7 11.86
26402. JA (l_ja) 13 54.87 70.36 11 84.62
26403. D (darueru241) 83 54.85 66.05 13 15.66
26404. Niklas (reeklas) 29 54.85 60.60 21 72.41
26405. Umalis (umali) 29 54.85 66.59 7 24.14
26406. jeremiejig (jeremiejig) 3 54.85 55.73 0 0.00
26407. Slime (slime_reaper) 5 54.85 68.28 2 40.00
26408. Sumanta (sumanta001) 324 54.84 75.46 45 13.89
26409. Benjamin (echobox) 17 54.84 65.52 1 5.88
26410. 🏎️Ziad (ziad_hamdy) 58 54.82 73.70 4 6.90
26411. 0 (studdab) 39 54.82 63.38 2 5.13
26412. Thighology (thighology) 1 54.82 54.82 1 100.00
26413. Zane (axkz) 2 54.82 55.69 0 0.00
26414. Mohamed (m_gemy) 3 54.82 56.16 1 33.33
26415. Tareq Mahmud (hridoy_089) 1 54.82 54.82 0 0.00
26416. Tawanda (bigx) 56 54.82 69.17 11 19.64
26417. Rasmis (ahtavarasmus) 20 54.82 67.23 6 30.00
26418. Rassulkhair (rassulkhair) 30 54.81 64.62 4 13.33
26419. Ceci (ceci_tyson) 2 54.81 57.50 0 0.00
26420. alcoholnotfree (wonwoohu) 6 54.81 65.26 2 33.33
26421. Abir (proabir) 7 54.81 62.09 0 0.00
26422. Gourav (gourav001) 14 54.81 59.37 1 7.14
26423. Skye (starrysky101) 2 54.81 55.56 0 0.00
26424. Tiku (tiku888) 6 54.80 66.80 1 16.67
26425. Warren (warren98) 4 54.80 67.04 1 25.00
26426. followme (ethish) 3 54.79 63.31 1 33.33
26427. Julian (jpaglia61) 3 54.79 56.78 0 0.00
26428. Lsteryoshi (lsteryoshi) 2 54.79 58.61 1 50.00
26429. Wasabi (distartor) 35 54.78 65.83 7 20.00
26430. Olivia (xlivsteer07x) 110 54.78 72.62 34 30.91
26431. Fuel plane (1pavanb) 36 54.78 67.90 14 38.89
26432. Shiyue (molllllllly) 8 54.78 62.52 2 25.00
26433. JAFFAR (thetypingfreak) 227 54.78 82.22 47 20.70
26434. Sepia (sepiadrunfada) 17 54.78 60.78 1 5.88
26435. Hugo (nuvions) 8 54.78 61.70 0 0.00
26436. Wakil (wakil7) 26 54.77 66.89 6 23.08
26437. Ronald (funnyturtles) 8 54.76 59.50 3 37.50
26438. nomad_valhalla (me_manas17) 91 54.76 70.61 18 19.78
26439. alulss (alulss) 3 54.76 73.93 0 0.00
26440. Rajat (arakanfudo) 45 54.76 68.75 42 93.33
26441. RAJ (3nkrypt) 365 54.76 77.62 38 10.41
26442. M (faster_than_your_father_... 82 54.75 65.14 13 15.85
26443. Amit (amit__123) 1,534 54.75 92.21 259 16.88
26444. Hand (typedhype) 5 54.74 60.43 1 20.00
26445. LUka (lukazmaj) 12 54.74 62.67 3 25.00
26446. Prizy (prizypower) 13 54.74 67.99 8 61.54
26447. kat (itskat_boba) 10 54.74 59.60 0 0.00
26448. koleraba (noob4love) 3 54.73 61.31 0 0.00
26449. Ruby (wimbleruby) 3 54.73 63.84 0 0.00
26450. snail_twin_turbo (sloth_99) 9 54.73 59.47 1 11.11
26451. Josh (ghostrider5346) 13 54.72 62.87 3 23.08
26452. Jeel (speedracers_brother) 17 54.72 62.20 0 0.00
26453. Stricky (oscar_foxtrot) 2 54.72 55.76 2 100.00
26454. Iya (iyaiyayoh) 5 54.72 61.45 0 0.00
26455. Jack (jthomas720) 4 54.72 62.18 1 25.00
26456. Hikmat (hikmat) 6 54.71 59.44 0 0.00
26457. Daniel (danntheman21) 33 54.70 68.78 5 15.15
26458. akshay (akannaa19) 5 54.70 60.28 1 20.00
26459. MrWaffle (mrwaffle_) 1 54.70 54.70 0 0.00
26460. Noori (noori_) 6 54.70 64.25 0 0.00
26461. Axel (axel_ram) 2 54.70 54.82 0 0.00
26462. Vignesh (rosvicky) 25 54.69 65.25 5 20.00
26463. PeckingNoob (peckingnoob) 1 54.69 54.69 0 0.00
26464. Misia (avolvage) 1 54.69 54.69 1 100.00
26465. Arslan (apex0096) 1 54.69 54.69 0 0.00
26466. MAF1F (afif5287) 442 54.69 70.66 61 13.80
26467. Quan (graycard) 4 54.69 57.29 0 0.00
26468. shaun (shaunrtyu) 4 54.69 58.01 0 0.00
26469. Patrick (pmurfdesign) 8 54.68 61.91 0 0.00
26470. luckyapp (luckyapp) 1 54.68 54.68 0 0.00
26471. EternalTempest (eternaltemp... 16 54.68 63.88 2 12.50
26472. AL (alhasandude) 253 54.68 69.13 32 12.65
26473. Ahmad (ahmad7salah) 274 54.68 71.87 30 10.95
26474. Kenneth (dlguswp101) 2 54.67 57.44 0 0.00
26475. Divyanshu (div7s) 1 54.67 54.67 0 0.00
26476. Chance (tdskittles) 5 54.67 56.38 1 20.00
26477. Krombaa (nadergharsallah) 12 54.67 64.51 4 33.33
26478. Adam (ezrice) 4 54.67 61.50 1 25.00
26479. Aidan (leankirito) 17 54.66 61.51 4 23.53
26480. Genie (igenie) 2 54.66 55.02 0 0.00
26481. J (jj024) 215 54.64 74.63 20 9.30
26482. Scarlancy (scarlancy) 3 54.64 59.01 1 33.33
26483. xy (hihiki) 5 54.63 59.52 0 0.00
26484. Ashraful (ashraful_alam) 24 54.63 65.51 3 12.50
26485. Alexander (alexloading) 3 54.63 60.59 0 0.00
26486. shieru (nowelz) 2 54.63 69.27 2 100.00
26487. Danish (stampynoob) 3 54.61 56.12 0 0.00
26488. Eeegh (eeegh) 22 54.61 69.70 2 9.09
26489. potter (potterwastaken) 2 54.61 57.60 0 0.00
26490. Sporak (cheeseballoon) 2 54.60 56.10 0 0.00
26491. Ardhendu (a_0vi) 1 54.59 54.59 1 100.00
26492. Atakan (atakannguven) 10 54.59 70.02 4 40.00
26493. Jacob (jacobru) 10 54.58 66.40 0 0.00
26494. BOBA (bobavfett) 50 54.58 66.60 6 12.00
26495. caesar (caesar03) 94 54.57 68.15 12 12.77
26496. ghxstly-_-kid (ghxstlykid) 81 54.57 69.56 6 7.41
26497. omarmejiaa (omarmejiaa) 42 54.57 67.02 6 14.29
26498. Spyros (spyrosmk) 1 54.57 54.57 0 0.00
26499. Kabir (kabir_1234) 632 54.57 75.30 88 13.92
26500. Georgia (fobpatdmcr) 7 54.57 63.01 1 14.29
26501. blaze (blaze_012) 128 54.57 65.92 10 7.81
26502. Dio (adroid28) 5 54.56 62.42 0 0.00
26503. TheCuber (mine_star2046) 16 54.56 65.77 5 31.25
26504. muhsenG (muhseng) 2 54.56 57.20 1 50.00
26505. Kalybay (kalybai) 13 54.54 59.02 2 15.38
26506. John (xtrospective) 9 54.54 63.01 1 11.11
26507. Begatim Bytyqi (begatim) 92 54.54 67.76 18 19.57
26508. Kishan (kishan150) 1 54.54 54.54 0 0.00
26509. Jordan (jordank17) 2 54.54 57.66 0 0.00
26510. Manish (mkn0079) 680 54.53 80.27 103 15.15
26511. Ariel (alil) 1 54.53 54.53 1 100.00
26512. Vitor (graysheep) 15 54.52 69.52 1 6.67
26513. Aditya (skaarfacee) 11 54.52 59.44 1 9.09
26514. Ahmad (moghaazi) 7 54.52 57.47 0 0.00
26515. Elizabeth (i_am_piece_of_tr... 8 54.52 62.50 2 25.00
26516. dey (deyy) 6 54.52 66.97 1 16.67
26517. Lev (straward) 2 54.52 58.30 0 0.00
26518. Bdott (bdott_) 2 54.51 60.42 0 0.00
26519. Mariam (mariamgharraph) 199 54.51 80.79 28 14.07
26520. Frank (frankiboi) 3 54.51 56.20 1 33.33
26521. Bruce (bs99) 9 54.51 59.89 1 11.11
26522. Ahmed (panda679) 3 54.50 62.24 0 0.00
26523. Banzz (banzz05) 1 54.50 54.50 0 0.00
26524. Kate (kate_haha) 11 54.50 62.95 5 45.45
26525. Yvess (yvessu) 6 54.50 63.16 0 0.00
26526. Dhananjay (dk35840) 20 54.49 62.39 5 25.00
26527. Srinidhi (eren_eager) 25 54.48 66.73 3 12.00
26528. Gabriel (gabrieltoledo) 4 54.47 57.01 0 0.00
26529. Locus (locus_) 39 54.47 62.33 3 7.69
26530. RouxSauced (rouxsauced) 3 54.47 55.87 0 0.00
26531. Alek (alexno) 9 54.47 58.19 0 0.00
26532. OhMyTomat (ohmytomat) 1 54.46 54.46 0 0.00
26533. Ravshan (ravshan) 28 54.45 66.09 3 10.71
26534. Haley (hurley328) 4 54.45 59.14 1 25.00
26535. Vexisu (vexisu) 1 54.45 54.45 0 0.00
26536. Rohan (rohan625) 12 54.45 63.51 0 0.00
26537. Sravan (sravanstg) 40 54.45 64.70 8 20.00
26538. arindam (ari2007b) 222 54.45 71.91 27 12.16
26539. Bob (bobsvegana) 66 54.44 69.12 6 9.09
26540. illa (iladnas) 41 54.44 68.45 6 14.63
26541. Shil (shilegend) 115 54.43 68.00 12 10.43
26542. Sharath (sharathnirmala) 29 54.43 67.72 4 13.79
26543. Omari (omari_) 1 54.43 54.43 0 0.00
26544. DaddyChill (nightynine) 30 54.43 68.67 2 6.67
26545. Jasmine (jasmine5752) 30 54.43 62.52 5 16.67
26546. BAZINGA (shruthi_) 41 54.42 61.89 3 7.32
26547. Cassie (humanalien) 4 54.42 60.31 1 25.00
26548. Pash (akratics) 9 54.41 68.42 1 11.11
26549. bhanu (codingbegginer) 165 54.41 73.49 18 10.91
26550. Cookies (cookies523) 1 54.41 54.41 1 100.00
26551. Gusklipsch (gusklipsch) 8 54.41 58.33 0 0.00
26552. Phil (forsegle) 11 54.41 59.54 3 27.27
26553. tstats[suraj_hs] (suraj_hs) 13 54.41 66.78 0 0.00
26554. Aaryan sharma (aaryan21) 10 54.40 61.02 1 10.00
26555. Himanshu (crestfalln) 13 54.40 58.65 2 15.38
26556. elnaz (elnaznsi) 68 54.40 71.98 45 66.18
26557. Lebron (sirsneakycheeks) 4 54.40 62.01 0 0.00
26558. Amar (amardhaliwal7) 14 54.40 69.89 1 7.14
26559. Daynn_ (daynn_) 2 54.40 57.53 1 50.00
26560. elite (beatagent) 210 54.39 69.35 19 9.05
26561. Goyna (demon__rage__) 186 54.39 67.86 29 15.59
26562. yihuididi (yihuididi) 28 54.38 65.53 3 10.71
26563. C (crazynuf) 2 54.38 60.43 0 0.00
26564. john (er3g10us) 38 54.38 70.00 10 26.32
26565. ea (fluxheat) 43 54.37 68.09 7 16.28
26566. Crudux-Crue (raman_rr) 38 54.37 65.22 3 7.89
26567. Ashish (ashish_jnvm) 1 54.37 54.37 0 0.00
26568. cathy (cathyyyyy) 12 54.37 63.02 1 8.33
26569. Aditya (rust_eze) 8 54.36 67.70 1 12.50
26570. Martin (martin3099) 1 54.36 54.36 0 0.00
26571. Erl (erlisgod) 34 54.36 63.01 4 11.76
26572. MooMoo (moo_24) 111 54.35 69.62 13 11.71
26573. Rad (renaissance_g) 4 54.35 58.60 0 0.00
26574. ISuck (isuckettyping) 2 54.35 54.44 1 50.00
26575. Svetlin (thepb) 8 54.35 64.09 1 12.50
26576. privinit (privinit) 1 54.34 54.34 1 100.00
26577. Blitz (blitzwanker) 1 54.34 54.34 0 0.00
26578. ༼ つ ◕_◕ ༽つ (nyr... 63 54.34 72.31 12 19.05
26579. Lorenzo (rynzen) 4 54.33 60.60 2 50.00
26580. Svetoslav (svera) 56 54.33 64.66 6 10.71
26581. Owen (innitbruv) 11 54.33 64.21 3 27.27
26582. Jawad (sixtysicks66) 62 54.33 70.75 16 25.81
26583. a (_mau) 2 54.32 58.31 1 50.00
26584. ciccox (ciccox) 1 54.32 54.32 0 0.00
26585. Nigel (nigeljames) 62 54.32 75.40 9 14.52
26586. dean (mrselndyfox) 4 54.31 57.44 1 25.00
26587. Andrei (therain) 1 54.31 54.31 0 0.00
26588. Thomas (trinitymeister) 11 54.31 64.41 2 18.18
26589. takaki (takaki216) 5 54.30 62.00 2 40.00
26590. Tom (tvdb2003) 48 54.30 65.33 3 6.25
26591. sarang (lovejoy) 23 54.30 63.10 1 4.35
26592. m0nst3r (m0nst3r9) 33 54.30 67.43 7 21.21
26593. Lucia (luciloo) 4 54.30 58.61 1 25.00
26594. Jerin (jerinjames) 19 54.29 63.63 5 26.32
26595. Nova (nova_6178) 2 54.29 58.82 0 0.00
26596. M (maqqnus) 1 54.29 54.29 0 0.00
26597. Tylor (goofy_goober2006) 7 54.29 67.30 0 0.00
26598. Salah (salah135) 61 54.29 68.67 4 6.56
26599. Meet (mete2119) 4 54.28 59.96 0 0.00
26600. Exab (exab) 15 54.28 65.26 6 40.00
26601. Chacho (chacho12) 5 54.28 57.89 2 40.00
26602. Claudio (rainclaudio25) 1 54.27 54.27 0 0.00
26603. mosharaf (mosharaf) 2 54.27 55.01 0 0.00
26604. Jump (jump420) 84 54.27 71.43 13 15.48
26605. Prex (prex) 87 54.27 72.12 26 29.89
26606. Banh Bao (teezy1) 5 54.27 61.55 0 0.00
26607. Lanlana (llnfriend) 34 54.26 74.15 17 50.00
26608. Ryan (ryan3760) 30 54.26 67.48 3 10.00
26609. Mike (mikereze) 27 54.26 68.54 1 3.70
26610. Karrrrtik (kartikkkk) 421 54.26 79.03 112 26.60
26611. Christian (neva_type) 3 54.26 61.22 0 0.00
26612. Nezih (etck) 1 54.26 54.26 0 0.00
26613. vinh (tienvinh) 122 54.25 68.51 13 10.66
26614. momchil (momchils6) 6 54.25 67.28 6 100.00
26615. xD (shabanllokmja) 33 54.25 67.51 4 12.12
26616. Andrew (typegad) 10 54.25 63.49 4 40.00
26617. Stitch (stitch2) 5 54.25 63.83 0 0.00
26618. shahmeer (shahmeernoob) 25 54.24 62.93 3 12.00
26619. Austin (millerlite) 39 54.24 65.94 3 7.69
26620. Singh (singh_ram) 98 54.23 74.05 10 10.20
26621. Darnell (dw_doc) 6 54.23 60.59 1 16.67
26622. Tarun (tarun_valasa) 11 54.23 71.25 2 18.18
26623. Petr (chytris) 104 54.22 65.73 12 11.54
26624. kp (kp_7890) 4 54.22 66.98 1 25.00
26625. Andrew (cookwies) 2 54.22 55.74 0 0.00
26626. cmyang (cmyang) 6 54.22 67.37 2 33.33
26627. Feriiii (feriiiiiiii) 38 54.22 63.41 5 13.16
26628. lulu (llaurenlouise) 22 54.21 64.12 3 13.64
26629. Trey (trxtier) 19 54.21 75.98 2 10.53
26630. Abid (abid_zzz) 3 54.21 57.51 0 0.00
26631. Andrei (kulturedschwein) 42 54.20 74.25 4 9.52
26632. Sandeep Kumar (sandy14k9) 179 54.20 72.41 19 10.61
26633. Ian Jerome (ianjerome) 26 54.20 62.58 7 26.92
26634. Kris (kris510) 40 54.20 61.05 4 10.00
26635. Jordan (godlysharky) 22 54.19 68.49 1 4.55
26636. killerman (killerman_007) 40 54.19 73.81 12 30.00
26637. Pratik (p3nx1lz) 1 54.19 54.19 0 0.00
26638. Rimuru (rim_uru) 41 54.19 64.16 3 7.32
26639. Joe (dostojoe) 57 54.19 67.73 4 7.02
26640. wilson (wilso499) 2 54.19 54.35 1 50.00
26641. zyx3D (zyx3d) 5 54.18 59.96 0 0.00
26642. Pavan (pavan1000) 203 54.18 65.46 17 8.37
26643. r (rmeev_) 5 54.17 71.00 1 20.00
26644. Alex (carrot_ironfoundersson) 8 54.17 59.41 1 12.50
26645. Subhankar (subhankarch) 3 54.17 60.39 0 0.00
26646. Justin (jubnx) 45 54.17 69.90 5 11.11
26647. Musa (lupuspark) 1 54.17 54.17 0 0.00
26648. Alex (cush_palace) 4 54.17 61.07 0 0.00
26649. Perestoronina (mashavtnke) 12 54.17 65.45 1 8.33
26650. Ryan (rdem) 22 54.17 65.22 0 0.00
26651. Burning (burningyolo) 58 54.16 67.23 7 12.07
26652. Mike (mike6) 12 54.16 64.34 0 0.00
26653. Arvid (arvid_a) 9 54.16 60.78 0 0.00
26654. Ying-Chen (nash_equilibrium) 55 54.16 64.73 6 10.91
26655. Rashen (rashen33) 2 54.16 59.02 0 0.00
26656. Aniket (aniketb97) 21 54.15 64.20 3 14.29
26657. aditya (adityaraj322) 74 54.15 69.19 13 17.57
26658. Alex (wizardoftime) 6 54.15 59.92 0 0.00
26659. abi (rqizel) 2 54.15 55.35 0 0.00
26660. Nils (nw13) 5 54.14 55.32 2 40.00
26661. Mustang (mustangmaster) 10 54.14 62.65 0 0.00
26662. Peter (187streetlegends) 2 54.14 61.24 0 0.00
26663. Landi (landiepileptic) 14 54.14 71.27 1 7.14
26664. Nyx (darkforrest) 5 54.13 62.28 2 40.00
26665. Vicente (vincetroid) 16 54.12 62.49 1 6.25
26666. Kartik Jolapara (kj_mickey) 17 54.12 66.00 3 17.65
26667. Heriberto (c4rt4sbarajas) 11 54.12 68.73 2 18.18
26668. Rahul (badrii) 4 54.12 58.89 0 0.00
26669. RamBow (rambowrice) 6 54.12 62.53 0 0.00
26670. roscoe (skolchem) 39 54.11 65.03 5 12.82
26671. Rotaberq (rotaberq) 3 54.10 57.81 0 0.00
26672. Manos (me1nos) 19 54.10 68.47 0 0.00
26673. Christopher (jr1995) 1 54.09 54.09 0 0.00
26674. amer (zx_iii) 13 54.09 60.29 1 7.69
26675. Stanisław (bosastopaa) 142 54.09 75.08 18 12.68
26676. Cavid (cavid) 39 54.09 63.91 4 10.26
26677. Mihai (mizaqe) 14 54.08 62.61 1 7.14
26678. Dominique - Axl (able_04) 11 54.08 61.96 0 0.00
26679. Jessica (marbilu) 1 54.07 54.07 0 0.00
26680. Zero (zerolelouch) 13 54.07 65.77 2 15.38
26681. maxwell (maxwellcude) 3 54.07 55.96 1 33.33
26682. Feliks (fgpfelix) 3 54.06 54.43 0 0.00
26683. pd9999 (pd9999) 3 54.06 59.95 0 0.00
26684. Ro (dixirion) 2 54.06 54.78 1 50.00
26685. Daniel (throwmycage) 69 54.05 67.60 5 7.25
26686. Neon (dragonkingscrown) 3 54.05 64.54 0 0.00
26687. bacy (bacy) 27 54.05 66.97 2 7.41
26688. Rushaan (redrush12) 2 54.05 59.19 0 0.00
26689. Mohamad (kda_yamo) 2 54.05 56.77 0 0.00
26690. Juan (badluck_guan) 1 54.04 54.04 0 0.00
26691. Skye (simpleskye) 1 54.04 54.04 0 0.00
26692. Oskar (postmanpott) 1 54.04 54.04 0 0.00
26693. ilham (ill_hum) 6 54.04 61.83 0 0.00
26694. Varsovie (vendrige) 2 54.04 58.22 1 50.00
26695. KMN (kanatbekov_24) 80 54.03 65.83 6 7.50
26696. ALAKI (alaki_uka) 9 54.03 68.52 1 11.11
26697. Michael (wayongg) 2 54.03 56.04 1 50.00
26698. adrian (rixoner) 173 54.03 72.78 29 16.76
26699. Jet (jetwinjo) 31 54.03 62.24 4 12.90
26700. Khaled (wtcherr) 11 54.03 58.00 0 0.00
26701. Eshcole (volcanic515) 3 54.02 58.81 0 0.00
26702. TheDasher (thedasherz) 7 54.02 61.00 1 14.29
26703. Sushanth (sushanthgeorgesur... 10 54.02 67.00 3 30.00
26704. edy (dogusyildiz) 4 54.02 63.52 2 50.00
26705. Jeff (_jeff_) 11 54.02 59.42 1 9.09
26706. Abhijeet17o (abhijeet17o) 17 54.02 65.45 6 35.29
26707. Adavidapa (adavidapa) 6 54.02 57.40 4 66.67
26708. Lukas (lukbuz) 3 54.02 55.43 0 0.00
26709. Charlie (charliehuang24) 1 54.01 54.01 0 0.00
26710. unknowndivide (unknowndivide) 3 54.01 59.70 0 0.00
26711. boris (bobi412) 17 54.01 61.83 1 5.88
26712. Coffee (coffeezzz) 3 54.01 55.90 0 0.00
26713. DybVv (vuong02011996) 19 54.00 63.71 4 21.05
26714. Faded (fadedcrown95) 11 54.00 65.66 3 27.27
26715. David (davelish) 2,094 54.00 76.71 280 13.37
26716. Kitnipan (remaintion) 3 54.00 57.24 0 0.00
26717. Marck (marckyeee) 1 54.00 54.00 0 0.00
26718. Aryan (ordinarytranquil) 4 54.00 62.76 1 25.00
26719. Muhammad Amin (mast1999) 38 53.99 77.14 17 44.74
26720. ghostway (ghostway) 6 53.99 66.17 0 0.00
26721. Gokula (citizen34) 3 53.99 57.11 0 0.00
26722. Marti (ytram) 323 53.99 74.03 44 13.62
26723. Iliya (iliyacloud) 17 53.99 71.22 2 11.76
26724. Ralph John (ralph_saintaugu... 13 53.99 63.37 2 15.38
26725. Ádám (amegmi) 2 53.99 54.30 0 0.00
26726. lawrence (yujiro144) 46 53.98 67.15 6 13.04
26727. Sujal (sujal_fast) 41 53.98 69.14 4 9.76
26728. Adelrik (adelrik) 2 53.98 56.80 1 50.00
26729. Kyle (sadkhaki) 37 53.97 64.96 3 8.11
26730. Maria (efbnko) 1 53.97 53.97 0 0.00
26731. david (davidisthebest48) 1 53.97 53.97 0 0.00
26732. Helixsa (siam33162) 85 53.97 73.49 9 10.59
26733. Adithiya (havlen1) 26 53.96 63.02 2 7.69
26734. xǝl∀ (alnotreally) 2 53.96 54.93 2 100.00
26735. Shivansh (zneth) 6 53.96 61.57 1 16.67
26736. Caffeine (caffeinereptile) 7 53.96 59.59 1 14.29
26737. Murad (memento_mori_s) 404 53.95 75.11 51 12.62
26738. Kunpeng (wankupi) 3 53.95 57.98 2 66.67
26739. Evanovache (evanovache) 4 53.95 63.86 0 0.00
26740. Bit (bitbytez) 5 53.95 61.95 0 0.00
26741. ayeitsme (ughg) 30 53.95 75.07 3 10.00
26742. freemind1992 (freemind1992) 3 53.95 62.76 1 33.33
26743. Gggreg (cardriver) 4 53.94 56.56 1 25.00
26744. Nik (florid) 2 53.94 54.64 0 0.00
26745. Matt (januality) 1 53.93 53.93 0 0.00
26746. Bence (beta_hun) 1 53.93 53.93 1 100.00
26747. Shikigami (ersunema) 3 53.92 56.88 0 0.00
26748. ash (akx_sh) 6 53.92 68.76 4 66.67
26749. Mohammad (zargar91) 17 53.91 67.82 2 11.76
26750. Pavle (bezimeni04) 4 53.91 58.42 1 25.00
26751. Luca (whitebronco) 160 53.90 77.26 16 10.00
26752. Tyrell (elter) 20 53.90 73.70 6 30.00
26753. Zailent (eclipse_zailent) 1 53.90 53.90 0 0.00
26754. Mohit (meeoww) 9 53.90 65.82 1 11.11
26755. Andrew JK Brown (droid2) 17 53.90 62.49 2 11.76
26756. m (mawcks) 4 53.90 70.77 0 0.00
26757. jelly (jelsyfish) 2 53.90 55.83 0 0.00
26758. knoppix (ninopereira) 104 53.89 66.91 10 9.62
26759. notkinruyuu (notkinruyuu) 280 53.89 82.03 33 11.79
26760. daZai (dazzai) 184 53.89 65.20 38 20.65
26761. Rico (cujodog09) 1 53.89 53.89 0 0.00
26762. Chris (cactichris123) 4 53.89 77.97 3 75.00
26763. Ntusekho (2cmngadi) 5 53.89 64.24 0 0.00
26764. pedro (pedrovales) 34 53.88 63.93 3 8.82
26765. Silas (experiencedcrafter) 4 53.88 58.76 1 25.00
26766. Abdhul (sedoninju) 40 53.88 63.77 9 22.50
26767. zircks (zircks) 2 53.88 58.38 0 0.00
26768. leon (notveryfast6) 1 53.87 53.87 0 0.00
26769. Pendejo (pendejo13) 89 53.87 64.62 7 7.87
26770. FusionHimSelf (fusionraider1) 11 53.87 66.54 2 18.18
26771. katrina mae (katrinamae_cru... 16 53.87 67.65 11 68.75
26772. Jordan (jojo2ooo) 1 53.86 53.86 0 0.00
26773. meher (smc181002) 18 53.86 72.15 3 16.67
26774. Omar (desouky22) 5 53.86 59.76 1 20.00
26775. Jetsada (tertul44) 5 53.85 57.79 1 20.00
26776. Yatin (yatin18) 7 53.85 58.46 2 28.57
26777. vradhi (vradhi_108) 2 53.85 57.75 0 0.00
26778. Soggy (soggyspartan) 4 53.85 60.18 0 0.00
26779. Melvin (melvinmelgar) 15 53.84 60.90 0 0.00
26780. Deepanshu (namelesswonder) 58 53.83 69.93 6 10.34
26781. Elaine (elainehuang) 9 53.83 63.11 0 0.00
26782. #1 Racist (gnadus) 289 53.83 69.93 26 9.00
26783. Jordi (jordi0lle) 267 53.83 72.75 24 8.99
26784. Leo (leo123457) 21 53.83 63.42 18 85.71
26785. Feela (feela) 7 53.83 59.97 0 0.00
26786. sillysyl (sillysyl) 4 53.82 59.00 0 0.00
26787. Cassius (cassius_vlok) 9 53.82 62.37 0 0.00
26788. benzhayeed (typemaster2004) 3 53.81 56.86 0 0.00
26789. ayyyyyy (loom2801) 2 53.81 57.77 0 0.00
26790. Samuel (sam9182) 2 53.81 54.23 1 50.00
26791. suff (suffy2) 39 53.80 71.86 9 23.08
26792. ducky (duckyboy0) 45 53.80 62.97 2 4.44
26793. ktzzzuuuu (ktzzz) 63 53.80 72.69 12 19.05
26794. Lisa (lis__) 3 53.80 56.51 1 33.33
26795. Swapnil (darklonewolf) 6 53.80 56.81 1 16.67
26796. Christopher (canorve) 20 53.80 63.70 1 5.00
26797. Filicia (filicia) 3 53.80 55.48 0 0.00
26798. tstats[nabil365] (nabil365) 19 53.79 68.65 3 15.79
26799. T2DR (amogussus) 7 53.79 59.66 4 57.14
26800. Regan (regantm) 1 53.79 53.79 0 0.00
26801. James Paul (ap1ng) 1,527 53.79 75.04 206 13.49
26802. Manuel (haiyaaa) 18 53.79 66.55 2 11.11
26803. Kevin (kevinchang823) 10 53.78 60.36 1 10.00
26804. Karan (karansinghgi18) 104 53.78 67.03 11 10.58
26805. butttickler (james29091998) 283 53.77 72.02 41 14.49
26806. sangay (sangay2018) 34 53.77 65.47 1 2.94
26807. Skafi (madps) 17 53.77 64.22 2 11.76
26808. ib (ibvenus) 2 53.77 58.39 0 0.00
26809. John (dent12) 34 53.75 67.20 7 20.59
26810. Erekle (erekle7) 15 53.75 63.12 1 6.67
26811. kimi (kimix) 1 53.75 53.75 0 0.00
26812. Izor (creator_12) 1 53.74 53.74 1 100.00
26813. Jessy (wisticram) 2 53.74 61.00 0 0.00
26814. Geo (heroic_librarian) 6 53.74 59.51 1 16.67
26815. Joshua (hegemony_cricket) 2 53.73 56.46 0 0.00
26816. thatguy (thatguy577) 7 53.73 59.78 1 14.29
26817. Emery (thetruffinmuffin) 9 53.73 61.37 1 11.11
26818. Binly (inahee) 74 53.72 66.76 11 14.86
26819. Keith (keith_qwerty) 7 53.72 60.65 0 0.00
26820. Harry (moto1310) 80 53.72 77.87 22 27.50
26821. Dinmarc (tmlololol) 11 53.71 62.56 0 0.00
26822. Vuong (thevuong) 2 53.71 59.31 1 50.00
26823. 1 (su304) 1 53.71 53.71 0 0.00
26824. Fahrin (fahrin93) 6 53.71 58.29 6 100.00
26825. Jesse (jesse0908) 5 53.70 58.84 0 0.00
26826. Kristof (driftydifty) 8 53.70 56.53 2 25.00
26827. zWinGaH (winzahg) 2 53.70 58.21 1 50.00
26828. Kristoffer (tryyyy) 2 53.70 57.18 0 0.00
26829. Ali (alibahrawy34) 1 53.69 53.69 0 0.00
26830. Kristoffer (marcusaurelius99) 2 53.69 53.82 0 0.00
26831. Ham (hammah713) 180 53.69 68.86 31 17.22
26832. Aziz (azizxushvaqtov07) 13 53.68 66.45 4 30.77
26833. Dmitriy (dimasidorenko) 42 53.68 62.39 7 16.67
26834. Vincent (vinc20w) 1 53.68 53.68 0 0.00
26835. Aleksandar (yoursis) 10 53.68 62.93 3 30.00
26836. Mickey (mickeymini) 3 53.67 67.51 0 0.00
26837. Jack (turtlejack) 37 53.67 63.28 5 13.51
26838. Viktor (viktorpisatelq) 1 53.67 53.67 0 0.00
26839. ONCEbot (atomiconce) 1 53.67 53.67 0 0.00
26840. Dany (lunakar) 2 53.67 53.80 0 0.00
26841. Sharos (sharos) 11 53.66 60.31 2 18.18
26842. Sujeev (sujeev) 54 53.66 70.40 7 12.96
26843. WongMan4U (wongmanforyou) 3 53.66 56.39 1 33.33
26844. Cornelio (tirdsaba) 44 53.66 65.54 7 15.91
26845. Nazmus (nxbot) 21 53.66 64.11 2 9.52
26846. My (qwertytheuiop) 16 53.65 61.79 5 31.25
26847. anna (bananatan) 1 53.65 53.65 1 100.00
26848. Nader (nader12) 158 53.65 66.29 17 10.76
26849. Shane (shane_umayanga) 17 53.64 60.22 1 5.88
26850. TypeNightmare (bozijovel) 44 53.64 64.85 0 0.00
26851. Sulaiman (agarasulaiman) 6 53.64 59.30 0 0.00
26852. Shaan (mitnick) 2 53.64 58.68 0 0.00
26853. Erik (mcmanerik) 15 53.63 60.87 1 6.67
26854. Pouf (pouf_1) 66 53.62 67.14 18 27.27
26855. Callum (cal_a_mari) 750 53.61 72.43 87 11.60
26856. shorty (shortygiant) 22 53.61 65.82 4 18.18
26857. Slow (slow_keyboard) 8 53.61 61.35 1 12.50
26858. Kaholaz (kaholaz) 2 53.61 55.26 0 0.00
26859. Matti (lerssi_) 3 53.60 59.00 0 0.00
26860. Eren Yeager (tarzan_19) 9 53.60 62.16 2 22.22
26861. Busali (busali2008) 1 53.59 53.59 0 0.00
26862. matthew (ananiku) 3 53.59 55.60 0 0.00
26863. Georgios (vlassonio) 23 53.59 64.12 5 21.74
26864. Jannatul (adon22) 21 53.58 61.97 2 9.52
26865. Surya (surya_p) 107 53.57 72.21 17 15.89
26866. Rafa (alphadog69) 6 53.57 59.78 0 0.00
26867. Saugat (saugat_regmi) 84 53.57 66.73 7 8.33
26868. Peter (1_peter_1) 40 53.56 60.60 5 12.50
26869. Lemons (lemonslmfao) 19 53.56 61.72 10 52.63
26870. Faaris (fxzz) 16 53.56 66.41 0 0.00
26871. Alex (slybilia) 1 53.55 53.55 1 100.00
26872. Nikos (skalkoto) 1 53.55 53.55 0 0.00
26873. Tobias (tobiast) 5 53.55 57.92 0 0.00
26874. liperdi (liperdi) 26 53.55 59.36 2 7.69
26875. Kaan (mirackhle) 9 53.54 64.81 2 22.22
26876. Mads (planntt) 8 53.54 59.53 2 25.00
26877. Valliappan (its_me04) 6 53.54 60.22 0 0.00
26878. inaki333 (inaki333) 5 53.53 58.86 0 0.00
26879. James (jamessmurray) 14 53.53 60.11 1 7.14
26880. Camot (jcamot) 4 53.52 68.13 1 25.00
26881. Flash (flashlegion) 17 53.52 67.42 2 11.76
26882. Swati (swati0609) 11 53.52 63.87 1 9.09
26883. Harry (ruggers) 2 53.52 58.36 1 50.00
26884. Minh (blue002) 52 53.51 60.69 9 17.31
26885. ShowMeDaWay (showmak) 28 53.51 68.49 12 42.86
26886. Styo (styofox) 19 53.50 61.59 2 10.53
26887. Just a potato (quocbinhgt3007) 141 53.50 82.16 26 18.44
26888. hossam (hossam_ramadan) 144 53.50 64.40 12 8.33
26889. reuben (reuben_elias) 427 53.50 75.62 48 11.24
26890. binh (dunkbing) 4 53.50 59.32 0 0.00
26891. aloysius (okitkat) 5 53.49 71.70 0 0.00
26892. dewy (dewy03) 1 53.49 53.49 0 0.00
26893. Mike (teamwolf11) 1 53.49 53.49 1 100.00
26894. Hayaku (m0tt0_hayaku) 35 53.49 66.39 3 8.57
26895. karina (kar1na_) 38 53.48 66.34 5 13.16
26896. Cotle (cotle) 9 53.48 66.33 2 22.22
26897. Marouane (maromaro02) 38 53.48 64.09 2 5.26
26898. ritesh (ritesh123) 142 53.48 71.82 18 12.68
26899. ir4un (ir4un) 9 53.48 67.08 2 22.22
26900. Joe (naman189089) 5 53.47 58.90 1 20.00
26901. zuritor (zuritor) 8 53.47 73.04 8 100.00
26902. Diego (diegogamer0528) 37 53.47 65.44 11 29.73
26903. Manish (manish_89) 100 53.47 66.48 18 18.00
26904. Himanshu (himanharsh) 200 53.47 66.82 25 12.50
26905. Panupong (pnp__) 2 53.47 54.85 0 0.00
26906. Travis (bizmos) 1 53.47 53.47 0 0.00
26907. Ghxsty (ghxsty) 2 53.47 59.13 0 0.00
26908. Mason (mgbaird) 85 53.46 72.25 11 12.94
26909. TornaxO7 (tornax) 18 53.46 58.04 1 5.56
26910. Markus (markusj99) 3 53.46 56.76 3 100.00
26911. mr (mrantik1) 205 53.46 69.72 28 13.66
26912. yun (genuak) 4 53.46 55.53 0 0.00
26913. hock siong (axiang2000) 6 53.45 64.64 1 16.67
26914. Chad (chadley69) 10 53.45 64.49 1 10.00
26915. Jeffrey (jeffreedom29) 1 53.45 53.45 1 100.00
26916. Gnany (gnanickky1) 16 53.45 70.07 3 18.75
26917. Adrian (adrian_himself) 74 53.45 67.49 9 12.16
26918. Ferc (ferco) 7 53.44 66.24 2 28.57
26919. Jay (jerdman) 4 53.44 60.68 1 25.00
26920. Mason (mpk072) 2 53.44 55.23 1 50.00
26921. Abijith (believertn) 16 53.43 64.48 2 12.50
26922. CybrZero (cybrzero) 12 53.43 65.98 2 16.67
26923. DemonKing (zxzf) 378 53.43 69.03 53 14.02
26924. Tsubaki (shtoo7) 1 53.43 53.43 0 0.00
26925. Ryji (rmccs) 2 53.43 59.28 0 0.00
26926. Gilson (gilsoncav) 7 53.42 58.53 1 14.29
26927. Lego (legogurke) 7 53.42 60.28 1 14.29
26928. Olle (wolle) 1 53.42 53.42 0 0.00
26929. SHRI (srinivasdokare) 43 53.41 69.96 4 9.30
26930. Paul (bisente006) 31 53.41 69.77 10 32.26
26931. Cristina (csnyder934) 1 53.41 53.41 0 0.00
26932. noniino (noniino) 10 53.41 57.38 2 20.00
26933. Tom (tom09876) 129 53.41 65.75 11 8.53
26934. Abi (abiunsy) 3 53.40 61.49 0 0.00
26935. An Ackerman (iamvr) 173 53.39 65.81 15 8.67
26936. Ashish (landxcape) 71 53.39 63.98 5 7.04
26937. Bakdauet (omir) 23 53.38 63.11 2 8.70
26938. Timotej (mistimmo) 17 53.38 67.53 1 5.88
26939. Ethereal (dragonfly654) 4 53.38 62.55 0 0.00
26940. Annette (ahhooah) 10 53.37 57.11 0 0.00
26941. Bella (bella_lasagna) 1 53.37 53.37 0 0.00
26942. ALi (_octopus_) 1 53.37 53.37 0 0.00
26943. Ethan (theweirdo1924) 1 53.37 53.37 0 0.00
26944. Bonifacijus (bonifacijus) 68 53.37 74.15 6 8.82
26945. Hernan (edry12) 72 53.36 72.58 15 20.83
26946. • simon • (simonnjr) 1 53.36 53.36 1 100.00
26947. Owen (ojt_11) 7 53.35 57.37 2 28.57
26948. Leah (leahcarj) 2 53.35 59.67 0 0.00
26949. Maksym (f_w_c) 2 53.35 54.30 1 50.00
26950. Jack (jackripper9) 22 53.35 78.77 4 18.18
26951. Alexander Miller (iowahawke... 5 53.34 57.67 1 20.00
26952. Hamidbek (hamidbek) 164 53.34 73.18 18 10.98
26953. bsmith4972 (bsmith4972) 158 53.34 72.48 18 11.39
26954. GEMargad (gemrgd_23) 149 53.34 72.14 16 10.74
26955. Sarah (sarah_the_slow_typer) 57 53.34 67.58 7 12.28
26956. Casper (casperliuliuliu) 94 53.34 71.76 12 12.77
26957. Almight (almight) 2 53.34 55.65 1 50.00
26958. shailendra (shailendraji) 21 53.33 61.89 1 4.76
26959. Brett (kaaji03) 6 53.33 62.04 0 0.00
26960. Scooby (scoobydooby) 42 53.33 65.51 2 4.76
26961. Julian (julianeadie) 32 53.33 63.03 3 9.38
26962. Snoozeds (snoozeds) 5 53.32 63.87 0 0.00
26963. Alex (alexsanderror) 3 53.32 59.25 0 0.00
26964. Nasser (nass_1000) 84 53.32 67.50 5 5.95
26965. Suryakanta (skroy) 180 53.32 67.71 18 10.00
26966. Soham (okaysoham) 132 53.32 69.41 21 15.91
26967. derfet (derfet) 55 53.31 66.08 6 10.91
26968. Abhideep (imabhideep) 185 53.31 74.40 20 10.81
26969. Ania (to16nks) 6 53.31 60.79 0 0.00
26970. Sultan (sultanreal) 115 53.31 71.90 15 13.04
26971. Jan (hautix) 10 53.31 63.27 0 0.00
26972. vicky (vickysiva007) 26 53.30 61.37 5 19.23
26973. Gamer (gamer_equine) 120 53.30 67.48 19 15.83
26974. opal (opalisbored) 11 53.30 61.93 2 18.18
26975. Kelvin (egg_plant_pete) 41 53.29 65.86 3 7.32
26976. Jordan (jorjorg11) 16 53.27 59.14 3 18.75
26977. Vee (v_typer) 1 53.27 53.27 0 0.00
26978. tstats[rajveer_100] (rajvee... 133 53.27 68.16 18 13.53
26979. Aseel (aseel_draz) 2 53.27 56.48 0 0.00
26980. Victor (victorzasz) 100 53.26 65.77 8 8.00
26981. Raimbek (rk_avilbekov) 36 53.26 65.38 6 16.67
26982. Klobásník (boumex) 6 53.26 61.03 0 0.00
26983. Vishal (mr_sharma01) 107 53.26 65.53 17 15.89
26984. Abhinav (abhinav42) 28 53.26 61.88 3 10.71
26985. . (mioumioumiou) 17 53.25 62.40 2 11.76
26986. Tasnim (misteryoda) 3 53.24 61.13 1 33.33
26987. Tonkata (_tonkata_) 11 53.24 63.97 2 18.18
26988. Antunisia (part0tet0d0) 2 53.24 53.26 1 50.00
26989. Goal_200wpm (goal_200wpm) 20 53.24 62.40 3 15.00
26990. Brian (briankusuma) 7 53.23 61.68 2 28.57
26991. apolcube (japollopntr77) 6 53.23 64.22 0 0.00
26992. ASHISH (ashish_typer) 218 53.23 74.14 23 10.55
26993. Gamesepic123 (gamesepic123) 3 53.22 60.29 1 33.33
26994. Rhevan (rhevan) 31 53.22 61.49 10 32.26
26995. Luklein (luklein) 7 53.22 58.46 7 100.00
26996. parks (prakerr) 1 53.22 53.22 1 100.00
26997. Harri (teddybaker) 50 53.22 63.67 7 14.00
26998. typist (typist149) 14 53.22 64.25 1 7.14
26999. Gerlat (wtcher1066) 7 53.21 57.79 1 14.29
27000. Kellan (kellan_) 4 53.21 58.29 1 25.00
27001. Kyle (break_fast) 70 53.21 73.14 9 12.86
27002. John (johhpreston) 7 53.21 60.15 2 28.57
27003. SLEEPINGzZZ (sleepingzzz) 32 53.20 64.03 5 15.63
27004. jake (jakez) 28 53.20 64.79 6 21.43
27005. happy15crazy (happy15crazy) 5 53.20 61.62 0 0.00
27006. Valentin (nivanpylte) 1 53.20 53.20 1 100.00
27007. Sagar (xdronzer) 46 53.20 69.80 5 10.87
27008. Radu Codescu (the_eagle) 19 53.19 59.77 4 21.05
27009. lucas (godofthegods111) 7 53.19 58.04 1 14.29
27010. Nahin (nahin_r) 7 53.19 55.77 0 0.00
27011. Hannah (bored_hannah) 11 53.18 63.25 1 9.09
27012. Amr (amr98) 67 53.18 61.40 6 8.96
27013. yoyo (i0y0) 12 53.17 60.04 0 0.00
27014. PaleWhale (palewhale) 5 53.17 60.17 1 20.00
27015. Teddy (stargazingteddy) 29 53.16 63.88 4 13.79
27016. distopia (far_sunflower) 27 53.15 64.05 1 3.70
27017. Kyle (kevenmegevin321) 5 53.15 62.67 0 0.00
27018. Mateusz (wirelesss) 15 53.15 60.94 4 26.67
27019. Vanza (vanzasetia) 139 53.14 67.42 10 7.19
27020. Noah (champion8795) 1 53.14 53.14 0 0.00
27021. Vinny (bullz3y3) 442 53.14 69.73 55 12.44
27022. Tugssaikhan (gantsogtt) 42 53.14 69.83 9 21.43
27023. Adres (adres) 30 53.12 62.32 4 13.33
27024. pavan kumar (pavan2406) 186 53.12 64.60 24 12.90
27025. DegageSpoon9280 (degagespoo... 49 53.11 63.13 6 12.24
27026. Mike (groinofsteel) 1 53.11 53.11 1 100.00
27027. Fudl (fudl) 15 53.11 65.49 2 13.33
27028. Nelson (guaxini) 19 53.11 61.88 1 5.26
27029. Casual (casualhat) 21 53.11 59.52 4 19.05
27030. Matt (robertwill) 22 53.11 65.01 2 9.09
27031. Nikhil (niks_2012) 7 53.10 60.84 1 14.29
27032. Denis (iamdenis03) 1 53.09 53.09 1 100.00
27033. Africa (ethiopian1252) 62 53.09 67.45 6 9.68
27034. mahmoud (boda05) 2 53.09 55.09 0 0.00
27035. bianca (bi4nc4hannah) 27 53.08 64.87 10 37.04
27036. Johnny (im_fast_af_boyyy) 3 53.08 60.21 0 0.00
27037. Sander (pettersen3008) 1 53.08 53.08 1 100.00
27038. yuh (billbrown86) 16 53.08 64.54 2 12.50
27039. ESJvR (esjvr) 4 53.07 58.68 1 25.00
27040. Hisham (hisham_m) 14 53.06 67.24 4 28.57
27041. Venus (venus_liki) 4 53.06 59.81 1 25.00
27042. Sonia (sonialj) 26 53.05 62.78 4 15.38
27043. Petersoon (peterson_brasil) 7 53.04 61.74 1 14.29
27044. Samuel (sammassam) 469 53.04 67.55 49 10.45
27045. Arthur (art8urch3ng) 38 53.03 68.61 5 13.16
27046. omar (fireclaw5) 1 53.03 53.03 0 0.00
27047. Prosper Solomon (solomontz) 11 53.03 60.65 2 18.18
27048. M (magmag00) 120 53.03 64.51 7 5.83
27049. rufus (rufi999) 36 53.03 63.74 3 8.33
27050. Qing En (twea) 86 53.02 69.37 14 16.28
27051. Raphael (elysian_fields) 3 53.02 59.97 2 66.67
27052. Shannon (s0lanum) 11 53.02 59.06 2 18.18
27053. Samuel (budbeats) 114 53.01 79.01 16 14.04
27054. Mudu (muduxd) 342 53.00 70.03 38 11.11
27055. Petros (trakis_pe) 13 53.00 69.23 6 46.15
27056. Pedro (peter50latam) 238 53.00 80.22 22 9.24
27057. Ricky (rictsa05) 22 53.00 62.20 2 9.09
27058. Daniel (ntc1337) 2 53.00 53.80 2 100.00
27059. Sayu_ (sayu_) 90 53.00 63.14 7 7.78
27060. Nick (serpuns) 7 53.00 60.25 2 28.57
27061. Akram (akrammiru) 13 53.00 59.55 1 7.69
27062. Dominic (dominic2382) 25 53.00 64.69 5 20.00
27063. AlexiaWasFound (iam_selc) 16 52.99 66.04 0 0.00
27064. Alice (juicy0250) 2 52.99 53.01 1 50.00
27065. josh (jojothebear03) 15 52.98 62.29 4 26.67
27066. Pan (pan_grammoun) 7 52.98 58.63 1 14.29
27067. Nikos (skatzos) 4 52.98 61.65 0 0.00
27068. Liam (liamdaman) 7 52.98 62.90 1 14.29
27069. Jacob (robleroj76) 2 52.97 55.01 0 0.00
27070. Aniket (quantom_) 2 52.97 55.08 2 100.00
27071. Mathias (bluecolibri) 4 52.97 55.30 0 0.00
27072. tstats[abdul_hakeem123] (ab... 114 52.97 69.36 19 16.67
27073. Aisha (needforspeed_) 125 52.96 76.27 14 11.20
27074. Viktor (niandog) 40 52.96 66.25 5 12.50
27075. Nguyen (lqinfinity) 1 52.96 52.96 1 100.00
27076. Jakob (jagebuuu) 17 52.96 62.75 2 11.76
27077. Essi (essi4678) 113 52.96 68.44 24 21.24
27078. Clark (clark_d) 19 52.95 70.41 1 5.26
27079. sarthak (sarthak14327) 40 52.95 64.00 3 7.50
27080. Pratik (torpido99) 17 52.94 67.84 4 23.53
27081. Trevor (goode_bag) 1 52.94 52.94 0 0.00
27082. ahmed (ponochio_) 16 52.92 60.51 4 25.00
27083. Quang (quanglc00) 8 52.92 56.00 4 50.00
27084. Halftimenerd1 (halftimenerd1) 45 52.92 64.01 7 15.56
27085. Konnie (goldentiny) 7 52.91 61.67 1 14.29
27086. DataDev (tinysingh) 20 52.91 68.36 2 10.00
27087. Wen-Yuan (michael1017) 4 52.91 58.27 0 0.00
27088. timoteo (imfastafboi9) 2 52.90 54.87 1 50.00
27089. purple (purplecity) 3 52.89 54.78 0 0.00
27090. Nikolaj (mexination) 12 52.88 65.16 0 0.00
27091. Mahmud Sajjad (msabeer) 1 52.88 52.88 0 0.00
27092. Nawaraj Bista (nawaking) 40 52.87 65.54 4 10.00
27093. Luffy (fawnful) 41 52.87 65.34 4 9.76
27094. Mahesh (asc_91) 4 52.87 55.72 0 0.00
27095. Oscar (koppernatt) 1 52.87 52.87 0 0.00
27096. Frans (frns) 1 52.87 52.87 0 0.00
27097. Sohan (itypenow) 3 52.86 55.64 0 0.00
27098. Cielo (pjocielo) 1 52.86 52.86 0 0.00
27099. Jacob (raazl) 3 52.85 54.59 0 0.00
27100. Angu (r3dcamo) 2 52.85 53.32 0 0.00
27101. Kerubi (kerubii) 4 52.85 55.85 0 0.00
27102. walid (kasemwalid) 112 52.84 67.71 13 11.61
27103. Mahmoud (mahmoud_elsaeed) 2 52.84 56.91 1 50.00
27104. Alex (zoggthefantastic) 1 52.84 52.84 0 0.00
27105. Indian_Lad (shashank5665) 21 52.83 60.74 2 9.52
27106. Shourya (ninja1918) 2 52.83 56.19 0 0.00
27107. Alfman (alfman) 1 52.83 52.83 0 0.00
27108. Bryce (ribit500) 25 52.83 65.53 2 8.00
27109. Ong (bebooo) 2 52.83 55.28 0 0.00
27110. jerry (sheep0109) 274 52.82 75.40 41 14.96
27111. Hugo (paulz_420) 53 52.82 71.52 10 18.87
27112. Adfrian (adfrianrais) 8 52.81 56.34 0 0.00
27113. Ty (quachgiaty) 1 52.81 52.81 0 0.00
27114. Fave (fave_22) 27 52.81 59.18 2 7.41
27115. ashl5t (ashl5t) 22 52.80 80.22 18 81.82
27116. Alfredo (bc762147) 1 52.80 52.80 0 0.00
27117. Samar (mesam22) 13 52.80 61.53 1 7.69
27118. Pavan (pavan_06) 160 52.80 71.46 22 13.75
27119. Ariful (ariful_farhad) 11 52.79 59.37 0 0.00
27120. Khushal (its_warhead) 8 52.79 59.54 1 12.50
27121. Trần Khải Hưng (hunglc... 7 52.77 58.18 2 28.57
27122. Hong (hong41) 179 52.77 69.79 16 8.94
27123. Nabeel (nabz126) 43 52.76 64.38 6 13.95
27124. bouse7th (bouse7th) 68 52.76 62.77 6 8.82
27125. nolan (nolwoods) 25 52.76 60.10 2 8.00
27126. robert (robertford) 13 52.75 60.62 1 7.69
27127. Kayano (kayano_chi) 5 52.74 56.12 0 0.00
27128. DottyShark31762 (dottyshark... 9 52.74 64.56 2 22.22
27129. OverTheRocks (overtherocks) 5 52.74 64.04 1 20.00
27130. Fiesty (fiesty_cushion) 570 52.74 73.65 73 12.81
27131. Prakhar (username_copied) 8 52.73 65.56 2 25.00
27132. HoloCorp (starmaster) 1 52.73 52.73 0 0.00
27133. Dauren (d0ka) 17 52.73 65.05 1 5.88
27134. Claudia (cdnnnn) 6 52.73 65.36 0 0.00
27135. Pradhumn (darkinferno) 228 52.72 72.05 34 14.91
27136. Tomas (tomas_649) 7 52.72 61.73 0 0.00
27137. Morple (roubry) 24 52.71 61.83 5 20.83
27138. Hiraya (sheesh_24) 46 52.70 64.06 4 8.70
27139. William (yuwan1) 12 52.70 77.01 2 16.67
27140. deembun (deembun) 2 52.70 57.85 0 0.00
27141. Ray (astray_ray) 1 52.69 52.69 0 0.00
27142. bresgamo (sneymo) 61 52.69 71.24 6 9.84
27143. Diana (dianajk) 2 52.69 52.99 0 0.00
27144. Ken (ittipat) 1 52.68 52.68 0 0.00
27145. trash (thiccumthebig) 9 52.68 64.20 0 0.00
27146. Jonathan (jclausen05) 1 52.67 52.67 0 0.00
27147. iam (iamtypinglin) 3 52.67 53.70 0 0.00
27148. Fvthy (fathyamer) 20 52.67 61.81 2 10.00
27149. Miky (mikymoose) 85 52.66 61.80 9 10.59
27150. YosuaFranly (dragonunik18) 6 52.66 61.22 1 16.67
27151. Ayush (ayush011) 5 52.66 58.45 4 80.00
27152. Alex (amarcus0100) 48 52.65 66.83 10 20.83
27153. Manuel (manuelsandoya) 272 52.65 70.76 21 7.72
27154. Roni (rondeexe) 2 52.65 56.63 0 0.00
27155. Declan (dec13) 12 52.64 61.24 6 50.00
27156. Ben (bensilasf) 3 52.64 63.70 1 33.33
27157. Shayaan (shayaan206) 12 52.64 65.44 0 0.00
27158. yurii (yurcifer) 69 52.64 67.57 8 11.59
27159. 貓 (cutewhitecat) 91 52.64 64.64 22 24.18
27160. Ccori (superfifi930970) 1 52.63 52.63 1 100.00
27161. Jitander (jitander) 3 52.63 63.10 0 0.00
27162. Ahmed (a_h5s_h) 27 52.62 63.78 0 0.00
27163. codding (codding_beast) 4 52.62 54.85 0 0.00
27164. NejcSLO (nfaca411) 60 52.62 67.34 9 15.00
27165. heavy (heavyshaker) 88 52.61 64.34 17 19.32
27166. AWE (awicek) 282 52.61 65.77 26 9.22
27167. 🔖. (dumplinling) 8 52.61 59.24 0 0.00
27168. Kasper (suttergren) 25 52.61 59.06 1 4.00
27169. Kristofer (gardeborg) 5 52.60 60.27 2 40.00
27170. jinkook (marikabing) 3 52.60 53.29 0 0.00
27171. SN (littlemaster) 1 52.60 52.60 0 0.00
27172. Rehan (rehan_vibes) 39 52.60 70.22 25 64.10
27173. Noz (nozrael) 4 52.60 59.22 1 25.00
27174. Nina (nina_lopes) 14 52.60 60.17 6 42.86
27175. Marinos (marinosdim) 34 52.59 63.36 1 2.94
27176. wlitchw (wlitchw) 11 52.59 63.68 3 27.27
27177. Nam3tA3n (nam3tak3n) 34 52.59 67.16 1 2.94
27178. Sen (sen_1257) 5 52.59 58.53 0 0.00
27179. Bayram (turkmen) 5 52.58 56.27 1 20.00
27180. Gatsu (ace27) 696 52.58 71.68 76 10.92
27181. C:\cmd (geodev) 7 52.57 62.27 3 42.86
27182. . (crazyhow7) 28 52.57 69.43 1 3.57
27183. Josh (jnavin54) 28 52.55 63.45 3 10.71
27184. Ben (hurstsys) 27 52.55 62.41 1 3.70
27185. Walter (eskaytee) 10 52.55 64.00 0 0.00
27186. Zaid (zaidnashihamin) 154 52.55 70.49 25 16.23
27187. mikey (_12mr_) 2 52.55 53.49 0 0.00
27188. darn it (tricks_got) 5 52.54 69.81 3 60.00
27189. wgreenihrcorp2 (wgreenihrco... 26 52.54 64.24 8 30.77
27190. Jan (janwalther) 4 52.54 54.73 1 25.00
27191. Tino (imtino) 3 52.54 60.85 2 66.67
27192. Obada (oaah) 1 52.54 52.54 0 0.00
27193. Ryusei (ryu_525) 14 52.54 63.11 2 14.29
27194. Berto (bertoisfast) 310 52.53 73.06 28 9.03
27195. Bek (bekkk) 36 52.53 61.41 7 19.44
27196. Xun (n1ko9471) 6 52.53 59.46 0 0.00
27197. raf (raf55) 1 52.53 52.53 0 0.00
27198. Hailey (haileyuwu) 2 52.53 57.63 0 0.00
27199. Mohammed (alazzouny) 12 52.53 65.41 1 8.33
27200. Rawan (rbadri) 5 52.53 63.47 1 20.00
27201. Manu (manuuuuuuu) 5 52.53 55.81 3 60.00
27202. kae (kaelul) 10 52.52 63.96 5 50.00
27203. hamza (hamza_8) 70 52.52 63.63 5 7.14
27204. bharat (bharatcoder007) 20 52.51 64.83 4 20.00
27205. Dani (dani321456) 6 52.51 57.55 4 66.67
27206. Michał (michal_miszcz_123) 16 52.51 62.38 3 18.75
27207. Maxxxi420 (maxxxi420) 1 52.51 52.51 1 100.00
27208. Dulguun (b180950039) 13 52.50 56.00 2 15.38
27209. Nabin (npboss) 19 52.50 62.93 4 21.05
27210. Niels (luniejuul) 1 52.49 52.49 0 0.00
27211. Leo (truckerdeluxe) 1 52.49 52.49 0 0.00
27212. Tripp (tripptypes) 18 52.49 67.36 5 27.78
27213. Andrea (maxistarling) 4 52.49 55.65 0 0.00
27214. bigwayv (bigwayv) 3 52.48 55.33 0 0.00
27215. tobia (tobiabig) 23 52.48 61.88 3 13.04
27216. Golujs2000 (avinashjs2000) 204 52.48 70.17 20 9.80
27217. Gilbernet (gilbertonava7) 362 52.48 66.62 31 8.56
27218. Piotrek (piotrek97) 4 52.48 57.81 1 25.00
27219. xdd (n1kk1) 161 52.47 77.70 22 13.66
27220. Boss (likeaboss4579) 5 52.47 56.08 1 20.00
27221. sulux (sulux_14) 33 52.45 60.62 0 0.00
27222. ahmed (borr3y) 16 52.45 59.20 2 12.50
27223. dany (klaviier) 2 52.45 52.97 0 0.00
27224. Pragyan (satisfiedmagma) 623 52.44 74.96 91 14.61
27225. Lynan (thonlynan) 18 52.44 67.20 4 22.22
27226. Lee (leemyoung) 5 52.44 61.49 1 20.00
27227. mmills18 (mmills18) 6 52.43 63.05 0 0.00
27228. Anton (fantoniko) 30 52.43 56.30 1 3.33
27229. Mason (shankydanky) 3 52.42 54.75 0 0.00
27230. Mauro (mauronaval) 126 52.42 68.40 15 11.90
27231. Fluffy (musketeer) 26 52.41 67.78 6 23.08
27232. kati (ktiisler) 8 52.41 59.32 3 37.50
27233. Harikrishnan R (ismashmykey... 18 52.40 59.77 4 22.22
27234. Vincent Jeremy (larcener) 4 52.39 58.81 3 75.00
27235. Moniba (moniba) 12 52.39 58.81 0 0.00
27236. Stephanie (stephanie83) 5 52.39 58.42 1 20.00
27237. kadyn (kadynnn) 13 52.38 62.29 4 30.77
27238. Afiq (afiqapon91) 30 52.38 64.89 2 6.67
27239. Murad (murad90) 274 52.37 68.14 29 10.58
27240. CrashRAcer1 (crashracer1) 244 52.36 77.70 26 10.66
27241. Mid9ht (mid9ht) 1 52.36 52.36 1 100.00
27242. Houssen (huzzen) 1 52.36 52.36 0 0.00
27243. Raju (iamrajukhan) 16 52.36 60.58 1 6.25
27244. Gautam (gbasak) 31 52.35 60.03 0 0.00
27245. Evan (estarr14) 27 52.35 63.45 2 7.41
27246. pheck (pheck_) 7 52.35 59.14 2 28.57
27247. Kayoro (kayoro_24) 5 52.34 60.48 1 20.00
27248. Erdnaxela (lil_toogood) 8 52.34 62.00 2 25.00
27249. Mr (luke44661) 71 52.33 64.36 5 7.04
27250. Gregory (prosher) 15 52.33 57.16 1 6.67
27251. Máté (kadmate) 6 52.32 58.67 1 16.67
27252. Sargis (saqo1997) 11 52.31 57.47 0 0.00
27253. Valeria (valeriale) 106 52.30 64.35 8 7.55
27254. Lee-Andria (leelo135) 17 52.29 67.67 0 0.00
27255. yassine (yassie) 197 52.29 74.36 26 13.20
27256. fartmaster69 (theblacksword... 2 52.29 56.17 1 50.00
27257. Matt (the25thbam) 4 52.29 57.28 0 0.00
27258. Gaurav (machinepainter) 6 52.29 54.35 1 16.67
27259. Cam (camtain) 8 52.29 63.81 2 25.00
27260. Pablo (thotwalker2020) 2 52.29 60.44 0 0.00
27261. Tomás (tom_cor) 5 52.28 53.55 0 0.00
27262. Dave (davethewave1234) 1 52.28 52.28 0 0.00
27263. Hieu (hieu999) 1 52.28 52.28 1 100.00
27264. Jon Bob (thejonbob) 17 52.27 66.06 4 23.53
27265. kaihq (kaihq) 5 52.26 58.78 1 20.00
27266. Lawrence (zekaeski) 13 52.26 67.67 3 23.08
27267. Ahmed (taymour77) 5 52.26 61.28 1 20.00
27268. justvoid (justvoid0) 6 52.26 55.92 1 16.67
27269. aditya (addy2001) 7 52.25 54.27 1 14.29
27270. Marco (superquack10) 16 52.25 65.21 3 18.75
27271. Othmane (tibicha) 4 52.25 59.56 0 0.00
27272. Gary (vision_123) 132 52.25 63.59 25 18.94
27273. Top500 (top500pro) 3 52.25 61.19 0 0.00
27274. Top1nambur (top1nambur) 2 52.25 58.66 0 0.00
27275. Zach (zachary2001) 2 52.24 57.58 0 0.00
27276. Mohammad Abdul Ahad (maahad... 1 52.24 52.24 0 0.00
27277. Anubhav (a_a_pandey) 8 52.24 64.04 2 25.00
27278. May (suddy) 12 52.24 60.03 2 16.67
27279. Akshay (akshaymkupnoor) 69 52.23 63.48 4 5.80
27280. Ruslan (4flamee) 3 52.23 55.09 0 0.00
27281. johan (sagapam) 69 52.22 63.49 9 13.04
27282. rocket (rocketz) 2 52.22 53.62 0 0.00
27283. Pika (pikalight) 1 52.22 52.22 0 0.00
27284. Khesar (babywicker) 29 52.22 67.79 1 3.45
27285. surdyyy (surdyyy) 8 52.21 57.70 1 12.50
27286. Bibek (bibek_khyaju) 6 52.20 63.40 0 0.00
27287. sawamura (sawamura) 79 52.20 65.36 12 15.19
27288. angie (angelow) 7 52.20 65.76 0 0.00
27289. ZAKARIAAAAAAAAAAAAAAAAAAAAA... 8 52.20 60.56 0 0.00
27290. Conner (conbrad33) 6 52.20 65.92 2 33.33
27291. Pranav (pranav16) 46 52.19 62.95 3 6.52
27292. Winternet (winternet) 1 52.19 52.19 0 0.00
27293. sanzh (easy140bpm) 2 52.19 55.70 0 0.00
27294. ju (lordofthecoochie) 10 52.19 56.78 0 0.00
27295. shishir (spark__) 5 52.19 54.34 1 20.00
27296. Egbadon (egbadon) 36 52.18 61.46 7 19.44
27297. Hayrra (hedooxx) 283 52.18 64.88 17 6.01
27298. Carlos (snorlax7652) 7 52.18 78.27 4 57.14
27299. D (tsaf_epyt) 4 52.17 64.97 1 25.00
27300. Anunnaki (anunnaki77) 86 52.17 65.05 17 19.77
27301. Jaysson (jayyssaahn) 2 52.17 57.81 1 50.00
27302. tstats[manthan_noob] (sixty... 473 52.16 77.53 252 53.28
27303. Adam (kolcow) 7 52.16 61.32 3 42.86
27304. Ivy (sil80) 5 52.15 53.57 2 40.00
27305. AW50M3 (aw50m3) 6 52.15 61.41 0 0.00
27306. Michael (niightgamez) 1 52.14 52.14 0 0.00
27307. the goat (thegoat420) 2 52.13 56.33 0 0.00
27308. Agah (agah) 9 52.13 56.95 1 11.11
27309. Mohamed (mohamed5550) 24 52.12 64.16 2 8.33
27310. Babblecat (babblecat) 6 52.12 59.67 0 0.00
27311. アヒオ (knalb) 156 52.12 68.99 14 8.97
27312. Akbor (akbor_ab) 20 52.12 65.11 2 10.00
27313. John (happyguy2000) 855 52.12 66.38 69 8.07
27314. Tal (t_b_m) 2 52.12 53.67 0 0.00
27315. Winter (jamesbandit) 48 52.11 62.60 3 6.25
27316. Le Hoang (gampingbua) 139 52.11 67.45 14 10.07
27317. Kostia (kostia) 27 52.10 63.27 4 14.81
27318. Tareq (tareq_2007) 141 52.09 68.23 17 12.06
27319. Esi (tsoob) 40 52.09 60.79 3 7.50
27320. Oliver (dos_santos) 4 52.09 59.99 4 100.00
27321. Antonio (xxaposxx) 223 52.08 73.08 27 12.11
27322. Hannah Mei (hannahmei_steury) 9 52.08 64.05 2 22.22
27323. Belarus (belarus03) 4 52.08 55.64 1 25.00
27324. ashish (ashishroka) 113 52.07 69.18 17 15.04
27325. Homie (homie39) 6 52.07 58.04 1 16.67
27326. Mariusz (nonton) 1 52.07 52.07 0 0.00
27327. Motan (motanrobert) 8 52.07 63.52 1 12.50
27328. Leax (leax) 3 52.07 54.23 0 0.00
27329. Sarah (saucypeanut) 3 52.07 54.26 0 0.00
27330. Hasan (hasan95) 22 52.07 66.30 1 4.55
27331. Tim (timduh) 21 52.07 59.04 3 14.29
27332. NoFace (nofacecastle) 10 52.07 68.97 1 10.00
27333. Max (max_akyl) 106 52.06 67.35 11 10.38
27334. Seman (semantan06) 3 52.06 56.24 1 33.33
27335. bananana (bana_na) 56 52.06 61.46 5 8.93
27336. Jahangir (jalom102) 5 52.06 55.78 0 0.00
27337. Prin (littlewalken27) 270 52.06 67.30 33 12.22
27338. Sudhir (sudhir_123) 1,414 52.06 70.54 131 9.26
27339. Daniel (dkincorperated) 8 52.06 61.59 2 25.00
27340. i like typing (a_hole) 37 52.05 68.57 25 67.57
27341. hinotori (hinotori) 1 52.05 52.05 0 0.00
27342. Top_one (jiyunchy) 2 52.05 52.14 1 50.00
27343. IanL (jeedaiian) 104 52.04 63.63 14 13.46
27344. yali (ilayali02) 1 52.04 52.04 0 0.00
27345. Rey (misscypher) 2 52.04 52.85 1 50.00
27346. Gabriel (blastergnc) 1 52.03 52.03 0 0.00
27347. Adesh (thechosenadesh) 4 52.03 59.11 1 25.00
27348. Thomas (tomithink) 2 52.02 54.39 0 0.00
27349. geek's (geekstfm) 1 52.02 52.02 0 0.00
27350. Angara (angarariver) 1 52.01 52.01 0 0.00
27351. Mykhailo (pushkarov) 120 52.01 64.43 20 16.67
27352. daikonsama (daikonsama) 42 52.00 66.66 6 14.29
27353. anurag tara (fastest_racer) 728 52.00 74.95 85 11.68
27354. adrian (yeahaight) 43 52.00 75.05 5 11.63
27355. Erza (ewalk91098) 37 51.99 60.30 5 13.51
27356. Mohit (dumb_avocado) 50 51.99 65.89 5 10.00
27357. Nicu (nicuyay) 2 51.99 57.48 0 0.00
27358. tstats[manuelnara] (manueln... 40 51.98 66.44 4 10.00
27359. Christine (christinezaki) 2 51.98 58.22 0 0.00
27360. Tomek (mr__t) 3 51.98 58.06 0 0.00
27361. Tigran (grig_tigran) 5 51.97 54.11 1 20.00
27362. deez (epicguy69) 7 51.97 57.61 0 0.00
27363. overlord_dude (overlord_dude) 1 51.97 51.97 0 0.00
27364. jorje (zhonti) 11 51.97 67.79 4 36.36
27365. Ian (vidar11) 1 51.97 51.97 0 0.00
27366. Derhein (derhein24) 11 51.97 68.52 2 18.18
27367. Roman (madness1st) 21 51.97 60.99 2 9.52
27368. Buchock (buchok) 233 51.97 76.01 23 9.87
27369. Long (bakabu12345) 2 51.96 55.68 2 100.00
27370. Gaurvanshi (gaurvanshi) 6 51.96 55.15 0 0.00
27371. Julius (juliuscl2004) 154 51.95 73.37 22 14.29
27372. Ian (refined_silver) 167 51.95 69.42 81 48.50
27373. Sid (sidd31) 17 51.94 57.05 1 5.88
27374. Behind (trigstur) 1 51.94 51.94 0 0.00
27375. Sarp (sarpo5512) 1 51.94 51.94 1 100.00
27376. kevin (kelvinscale) 13 51.94 60.85 3 23.08
27377. Wahid (wahidhamidi707) 12 51.94 63.58 1 8.33
27378. hi (ihssm) 589 51.93 72.18 62 10.53
27379. jellio (lo_mava) 1 51.93 51.93 0 0.00
27380. Ankith101 (ankith101) 44 51.93 69.48 7 15.91
27381. Frosty_Speed (frosty_s_speed) 66 51.92 79.48 9 13.64
27382. manish (typo_beginner19) 161 51.92 68.50 15 9.32
27383. Damos (damos22) 65 51.92 61.68 7 10.77
27384. rmholz (aremholz) 1 51.92 51.92 1 100.00
27385. HJ (hjteq) 16 51.91 58.80 1 6.25
27386. Akhil (akhilrawat001) 2 51.90 54.58 0 0.00
27387. lgwk (lgwk) 22 51.89 58.73 0 0.00
27388. Anthony (wwuly) 53 51.89 74.07 5 9.43
27389. Daman (damanwrld) 2 51.89 56.92 0 0.00
27390. Rimka (kiingofkebab) 6 51.87 57.25 1 16.67
27391. arham (arham_doshi) 27 51.86 59.27 2 7.41
27392. JOHN (thunderstormsamset) 3 51.86 56.02 0 0.00
27393. lofr1t (lofr1t) 45 51.85 61.95 5 11.11
27394. masek (kiwollo) 5 51.85 61.13 0 0.00
27395. Karl (albertosama) 4 51.84 56.47 0 0.00
27396. wasim (wasim7198) 90 51.84 60.60 8 8.89
27397. fer (ferreginaa) 5 51.83 61.01 0 0.00
27398. Abe (abe299) 42 51.83 67.85 6 14.29
27399. saba (saba_on_mentos) 14 51.83 66.27 1 7.14
27400. Amsyar (amsyar44447) 1 51.82 51.82 1 100.00
27401. Asil (asilkhalifa) 1 51.82 51.82 0 0.00
27402. Foster (clovexr) 4 51.82 54.48 0 0.00
27403. George (georgecook) 7 51.82 62.61 0 0.00
27404. badgyalting (pl200834) 114 51.81 67.65 26 22.81
27405. medham (mohemedham) 16 51.81 61.48 0 0.00
27406. Dino (dinzxd) 3 51.81 55.14 1 33.33
27407. Lukas (paulanergarten) 3 51.81 55.43 0 0.00
27408. Zechariah (zs1l3nt) 5 51.80 68.15 2 40.00
27409. Jarvis (jarvistheai) 1 51.80 51.80 0 0.00
27410. David (corerev) 2 51.80 53.12 0 0.00
27411. NIght (nightyin) 6 51.80 55.38 2 33.33
27412. Justin (jpsmith) 34 51.79 63.86 2 5.88
27413. nongginga (nongginga) 5 51.79 58.09 0 0.00
27414. Batuhan (sh4yn) 1 51.78 51.78 0 0.00
27415. Guy (guyprws) 1 51.78 51.78 0 0.00
27416. Foxes (moazkhaled) 8 51.78 54.48 1 12.50
27417. Brian (briannstiven) 11 51.77 55.70 5 45.45
27418. OmaR (mandoo120) 51 51.77 63.83 7 13.73
27419. Alamgir (alamgirvigu) 8 51.77 61.15 1 12.50
27420. Ondřej (ondrfol) 1 51.77 51.77 0 0.00
27421. Kike (darkskyflow) 19 51.76 59.51 9 47.37
27422. Natsu (n4tsu_dragneel) 105 51.76 66.60 12 11.43
27423. Eduardo (eduojeda55) 6 51.75 58.17 0 0.00
27424. Alex (alexrichardson) 22 51.75 62.18 3 13.64
27425. cupnode (cupnode) 13 51.74 69.65 1 7.69
27426. Gaurav (gauravvv2204) 50 51.74 64.50 4 8.00
27427. Jörg (dislookskewl) 3 51.74 57.51 1 33.33
27428. Fakieshot (fakieshot) 465 51.74 69.91 54 11.61
27429. Anshit (anshitgrg) 29 51.73 68.42 3 10.34
27430. Gabriel (cheekychicken10) 2 51.73 53.04 0 0.00
27431. Sajib (dipto) 244 51.72 73.31 39 15.98
27432. Krushna (krush111878) 286 51.72 72.17 34 11.89
27433. Falisha (falisha) 2 51.72 52.04 0 0.00
27434. Arif (bilai) 3 51.72 53.90 1 33.33
27435. roshan kumar paswan (rajros... 1 51.72 51.72 0 0.00
27436. Sahabuddin (blitzbibi) 27 51.72 59.97 4 14.81
27437. Juan Raphael (homonovus97) 12 51.72 56.83 1 8.33
27438. rocket (dk0063) 216 51.71 67.99 12 5.56
27439. idk man (ithatme) 100 51.71 71.99 8 8.00
27440. allLuck (allluck) 10 51.71 63.43 0 0.00
27441. xain (xainq) 44 51.71 62.42 7 15.91
27442. Flame On Me (lamtrinhan1503) 11 51.70 58.03 1 9.09
27443. Fathan (falonez) 3 51.69 58.69 0 0.00
27444. pemba (pttpemba) 15 51.69 65.83 2 13.33
27445. muffin (pintu_otaku) 3 51.68 55.89 0 0.00
27446. geoff_g (roy_the_gizm0) 40 51.68 63.53 6 15.00
27447. Tahsun Rahman (tahsun) 6 51.68 63.04 3 50.00
27448. Evan (evantyper) 1 51.68 51.68 0 0.00
27449. Jason Hean (jackson95) 92 51.67 63.76 7 7.61
27450. Бақытжан (baqytjan) 190 51.67 65.90 21 11.05
27451. moschisch (moschisch) 17 51.67 62.87 1 5.88
27452. Harrison (hs676) 6 51.67 65.93 2 33.33
27453. Bongos (bongos_h2o) 7 51.67 61.99 0 0.00
27454. Guest404 (sam_sapeol) 2 51.66 53.18 0 0.00
27455. Takoyaki (jayisloco) 20 51.65 59.88 2 10.00
27456. Rose (roselenataylor) 3 51.65 52.33 1 33.33
27457. Kristel (pugspark) 6 51.65 57.88 0 0.00
27458. Rafiq (rapqz) 1 51.64 51.64 0 0.00
27459. Joseph (gh0stty) 5 51.64 56.20 0 0.00
27460. wenlong (wenlong) 172 51.64 69.27 12 6.98
27461. Matteo (fail_2000) 1 51.63 51.63 1 100.00
27462. abfh (abfh) 18 51.63 67.52 4 22.22
27463. Ivan (breadguru) 52 51.62 61.47 7 13.46
27464. tstats[rajendra_thakur] (ra... 14 51.62 60.27 0 0.00
27465. Arifa (meowx2) 3 51.62 55.23 2 66.67
27466. Tom (gameling) 2 51.62 52.65 1 50.00
27467. Paula (ems1324) 15 51.61 59.01 4 26.67
27468. Lea (j0s7_s0m3b0d7) 1 51.61 51.61 0 0.00
27469. magicsail (magicsail) 4 51.61 55.86 0 0.00
27470. R1CZ4RD (riczard) 41 51.61 61.81 4 9.76
27471. ousssama (cybereagle2001) 123 51.60 65.74 14 11.38
27472. Deku (dekachu) 65 51.60 66.17 5 7.69
27473. Suvan (1080pixelz) 47 51.60 66.04 4 8.51
27474. Anish (phantom2201) 7 51.58 57.63 2 28.57
27475. Nachito007 (nachito007) 24 51.58 67.15 4 16.67
27476. Leander (leandertaler) 1 51.58 51.58 1 100.00
27477. जय नेपाल 💪... 46 51.58 59.75 6 13.04
27478. Emrys (zyronwhite123) 26 51.57 63.23 0 0.00
27479. Carissa (carissarks) 1 51.57 51.57 0 0.00
27480. Eufil (asuna_kirito25) 1 51.57 51.57 0 0.00
27481. jeffery (nctu_jeffery) 7 51.57 54.91 0 0.00
27482. David (imdaveed) 8 51.57 59.76 1 12.50
27483. Angel (angelrami003) 42 51.55 64.20 2 4.76
27484. rohan (rohanktksu) 198 51.54 81.98 17 8.59
27485. yuth (yuth_isme) 38 51.54 62.91 7 18.42
27486. madi (marstooswag) 5 51.53 55.30 4 80.00
27487. anas (anas771989) 38 51.53 61.11 3 7.89
27488. Wojtek (wojtekwro) 4 51.52 57.45 0 0.00
27489. duyanh (duyanh3897) 25 51.52 78.80 0 0.00
27490. Bebo (dark__knight_pro) 13 51.52 59.49 3 23.08
27491. Pranjal (haanhaargaya) 287 51.52 65.06 25 8.71
27492. siuto (siuto) 2 51.52 57.09 1 50.00
27493. kungkungkukungkukuku (jmsmn... 24 51.51 67.69 5 20.83
27494. haziq aiman (onichan69) 3 51.51 57.08 0 0.00
27495. Harshit (harshu19) 84 51.51 62.38 6 7.14
27496. Shawdowv(Guest) (shawdowv) 1 51.50 51.50 1 100.00
27497. Yusuf (northernbay4) 78 51.50 68.37 12 15.38
27498. Tyriq (omgitstyriq) 3 51.50 61.49 0 0.00
27499. Firstene (magikarpusedfly) 3 51.49 59.35 1 33.33
27500. joe (joebuscus) 2 51.49 52.83 0 0.00
27501. Ike (ike2001) 2 51.49 52.17 1 50.00
27502. Akimbo (akimboshara) 5 51.49 56.81 0 0.00
27503. Roman (cosmic_mythos) 22 51.49 65.98 4 18.18
27504. MHoang (hoang993007) 5 51.49 57.37 2 40.00
27505. WATB (hermandolezal) 4 51.49 53.91 0 0.00
27506. SIlver (itzsilver) 1 51.48 51.48 0 0.00
27507. zildanzabani (aceraven7) 2 51.48 58.15 1 50.00
27508. Chizi (chiziivictor) 75 51.48 61.42 10 13.33
27509. Youwho1234567 (youwho1234567) 3 51.48 53.81 1 33.33
27510. vishnukumar (vishnu_kumar) 3 51.47 54.08 1 33.33
27511. Youssef (fcijuniorr01) 5 51.47 57.83 5 100.00
27512. Kieyas (kieyas) 3 51.46 55.90 0 0.00
27513. Grover (grover8323) 274 51.46 64.06 18 6.57
27514. Revan (revankarma) 1 51.46 51.46 0 0.00
27515. Amy (thedoctastardis) 12 51.45 64.22 1 8.33
27516. Stephanie (stephycatz69) 7 51.45 64.50 0 0.00
27517. Kushal (kushal_) 4 51.45 58.93 1 25.00
27518. Bernie (berniesanders69) 4 51.45 54.53 2 50.00
27519. Godstime (gozi3) 10 51.44 60.81 4 40.00
27520. Suraj (suarj) 4 51.44 54.75 1 25.00
27521. Mole (mementomole) 34 51.44 68.42 8 23.53
27522. random (randomnoob07) 13 51.43 63.13 3 23.08
27523. Subhajit (tumpasona) 92 51.43 64.83 11 11.96
27524. KW (kwpl) 5 51.42 56.51 2 40.00
27525. Lachlan (lochstar) 8 51.42 57.58 2 25.00
27526. amanmishra (amanmishra) 218 51.42 74.25 23 10.55
27527. BOBBY (bobbyquinn23) 62 51.41 68.45 6 9.68
27528. BruhBruh (burningbird999) 1 51.41 51.41 0 0.00
27529. Neo (neonter) 1 51.41 51.41 0 0.00
27530. David (du6e) 28 51.41 62.73 1 3.57
27531. sasuke (sasukee) 25 51.40 64.01 1 4.00
27532. Pramit (pramittt) 19 51.40 64.18 1 5.26
27533. Syazani (syazaniii) 2 51.40 54.45 0 0.00
27534. Devender (dev2002) 3 51.40 58.67 0 0.00
27535. Chatura (atakatus) 44 51.40 62.07 4 9.09
27536. Callum (rockwallaby) 9 51.39 59.32 0 0.00
27537. memers (thememers) 93 51.39 63.72 12 12.90
27538. Zach (jubjub_lol) 4 51.39 54.29 0 0.00
27539. Adnan (adnanasn) 14 51.39 55.75 0 0.00
27540. Peachbird (peachbird) 21 51.38 65.66 6 28.57
27541. Chris (typistgod14) 8 51.38 65.34 3 37.50
27542. Fragobert (fragobert) 1 51.38 51.38 0 0.00
27543. Vlaviano (moryoka) 1 51.38 51.38 0 0.00
27544. Finuz (finuz) 18 51.38 59.80 1 5.56
27545. Jacob (jacobtolstrup) 57 51.37 64.43 5 8.77
27546. Joy (jjoy12) 5 51.37 59.98 0 0.00
27547. alexjr977 (alexjr977) 25 51.37 64.88 1 4.00
27548. samsolt (samsolt) 15 51.36 62.87 3 20.00
27549. Rahul (rahuls1995) 152 51.35 64.62 15 9.87
27550. Pepper (ocean_orca) 12 51.35 56.35 2 16.67
27551. ayush (ayush_raj) 6 51.35 57.77 1 16.67
27552. Sir (sirknight) 2 51.35 56.24 0 0.00
27553. rutvik (wanna_be_pro) 50 51.34 63.61 3 6.00
27554. Nawar (murci) 1 51.34 51.34 0 0.00
27555. Sri (sriistired) 5 51.34 55.76 0 0.00
27556. Adarsh M A (adarshm39) 986 51.33 67.55 130 13.18
27557. Shashikanth Reddy (shashika... 6 51.33 59.73 0 0.00
27558. Jojj (jojjj) 4 51.32 54.98 1 25.00
27559. fasterthanu (reign_az_) 1 51.32 51.32 0 0.00
27560. JeffJeff (jeffjeffgames) 11 51.31 59.72 0 0.00
27561. Voak (voak) 69 51.31 65.07 11 15.94
27562. Niko (kale_bog_vremena) 17 51.31 68.39 0 0.00
27563. Myil (pink_coder0518) 210 51.31 91.51 28 13.33
27564. Najmul (wahid99) 1 51.30 51.30 0 0.00
27565. Arvid (warpzep) 12 51.29 68.22 0 0.00
27566. JP (jpdb) 2 51.29 55.35 0 0.00
27567. Adrian (aadoy_) 28 51.28 67.82 2 7.14
27568. Atul (asquare893) 2 51.28 54.99 0 0.00
27569. Robert (bertazz) 17 51.27 59.81 1 5.88
27570. repyx (lordgado) 49 51.27 69.40 7 14.29
27571. gDan (gdan) 25 51.27 66.77 5 20.00
27572. Abdullah (abdullahahmad) 2 51.27 52.98 0 0.00
27573. SBD (eleets) 6 51.26 60.46 0 0.00
27574. emma (certifiedberries) 6 51.26 55.55 1 16.67
27575. Karl (kallekiwi) 1 51.25 51.25 0 0.00
27576. kuchukas (kuchukas) 27 51.25 62.64 2 7.41
27577. Jillian (zolemnx) 8 51.25 59.15 0 0.00
27578. Tom (ax99) 354 51.25 75.45 31 8.76
27579. Twinkle (sirius_07) 36 51.24 59.36 1 2.78
27580. Ronnie (zoroaki) 11 51.24 70.59 2 18.18
27581. PaulC10333 (paul_c10333) 1 51.23 51.23 1 100.00
27582. Clifford (drizzleup) 3 51.23 58.95 0 0.00
27583. Tristin (kingtdiggitty) 4 51.23 56.02 0 0.00
27584. Pedro (phld) 3 51.22 56.06 0 0.00
27585. clarz (claerchen) 4 51.22 57.56 1 25.00
27586. Isaak (verysexyman) 51 51.21 66.12 5 9.80
27587. Nelson (nelson_typer) 86 51.21 62.08 6 6.98
27588. Ganesh (gat786) 45 51.21 70.90 3 6.67
27589. MI (misabic) 5 51.20 53.61 1 20.00
27590. Vavro (vavro) 17 51.20 64.38 0 0.00
27591. ahmad (h0gan_2020) 91 51.20 74.25 17 18.68
27592. Rohit (xdeadly) 8 51.20 60.89 2 25.00
27593. Tahir Tasnoor (sluggardbark... 1 51.20 51.20 0 0.00
27594. Phillip (pc15pdx) 11 51.19 59.15 2 18.18
27595. Ale (aleplayz) 2 51.19 52.40 0 0.00
27596. Louis 🤴🏾 (matiny) 35 51.19 61.84 2 5.71
27597. BadMeetsEvi1 (hgrgr43g12) 1 51.18 51.18 0 0.00
27598. dd (6768695865) 17 51.17 57.76 1 5.88
27599. Anvar (kekstroke) 7 51.17 56.33 0 0.00
27600. Jeffreypaul (jeffreypaul) 6 51.17 54.67 1 16.67
27601. Ashley (wyq_ashley) 6 51.16 62.55 0 0.00
27602. alloine0220 (d1rtyd33d_5) 128 51.16 70.41 11 8.59
27603. Rodrigo (schoofielddawg1476) 1 51.16 51.16 0 0.00
27604. Martin (mqrtyn) 1 51.16 51.16 0 0.00
27605. Captain M (captain254) 21 51.15 60.53 2 9.52
27606. 蔡 (mrzz) 6 51.15 59.61 0 0.00
27607. DragonChasto846 (dragonchat... 1 51.15 51.15 0 0.00
27608. Virus (virusinmotion) 64 51.15 67.44 11 17.19
27609. Sofia (sofia_anical) 15 51.15 58.12 3 20.00
27610. Aether (its_deep) 45 51.14 66.72 13 28.89
27611. William (godliam) 11 51.13 62.24 4 36.36
27612. boomer (lightaway) 10 51.13 62.66 0 0.00
27613. Andy (doctorhammer) 3 51.13 55.58 0 0.00
27614. PRANJAL (pranjalgogoi1999) 8 51.13 56.26 0 0.00
27615. Abdurrahman (abood_abu_jawad) 7 51.13 55.89 1 14.29
27616. Ivan (john_the_unigoat) 10 51.11 64.19 0 0.00
27617. 700 (700shots) 3 51.11 54.05 1 33.33
27618. Mouad (mouadox) 3 51.11 51.42 0 0.00
27619. Temir (temir248) 2 51.11 54.83 0 0.00
27620. Andre (slimas9) 6 51.11 53.95 0 0.00
27621. Lakshay (lakshay882) 94 51.10 65.68 19 20.21
27622. Leitão (leitao_feliz) 5 51.09 57.97 1 20.00
27623. FireHydra (firehydra) 7 51.09 52.86 1 14.29
27624. MaskDuck (duongmt) 16 51.09 61.14 6 37.50
27625. spider (spidergod) 83 51.09 68.94 10 12.05
27626. Muaz (mfone) 7 51.08 66.08 1 14.29
27627. Moises (moi_ses123) 3 51.08 57.50 1 33.33
27628. Rae (kmacc) 29 51.08 67.51 2 6.90
27629. Amer (amer202) 119 51.08 70.58 14 11.76
27630. tilen (tilen219) 10 51.07 61.54 2 20.00
27631. Hibiscus (hibiscuswaimeae) 3 51.07 56.92 0 0.00
27632. typsterr (typsterr) 352 51.06 70.21 32 9.09
27633. Jarod (rouleau) 1 51.05 51.05 1 100.00
27634. avishek (gaberiel0770) 5 51.05 55.74 1 20.00
27635. Ivan (xaboff) 52 51.03 66.11 8 15.38
27636. Kif (kifm) 13 51.03 57.81 0 0.00
27637. Jason (jason_1) 6 51.03 60.63 1 16.67
27638. Krux (The Real League of Ty... 80 51.02 64.22 16 20.00
27639. Robert (lekia) 62 51.02 64.11 8 12.90
27640. edyn (sylvyn) 15 51.02 60.10 1 6.67
27641. Jose Ruel (braveheart143) 176 51.01 66.73 24 13.64
27642. Timothy (dilexed) 54 51.00 66.76 7 12.96
27643. Aftab (aftab535) 5 51.00 60.45 1 20.00
27644. Pedrovski (frosteye) 7 51.00 60.31 5 71.43
27645. Arnav (variable_seal) 74 51.00 71.05 7 9.46
27646. mahmoud (modokatr) 67 51.00 66.27 3 4.48
27647. Omar El-Farouk (omarelfarou... 15 51.00 60.30 4 26.67
27648. bipin (bipin2019) 1 51.00 51.00 0 0.00
27649. Chayanne (avila760) 1 51.00 51.00 0 0.00
27650. Jojo (timerz) 1 50.99 50.99 0 0.00
27651. Altair (altairaltair) 38 50.98 65.80 7 18.42
27652. Alexis (mang_) 2 50.98 52.64 1 50.00
27653. The Marvello (themarvello) 4 50.98 57.25 0 0.00
27654. Luc1d (luc1d_on_typeracer) 3 50.97 57.49 1 33.33
27655. Michal (sedmilhar) 5 50.97 54.33 2 40.00
27656. kiara (kia_via_dia_arara) 9 50.97 66.15 2 22.22
27657. Shahriar (shahriar_shojib) 7 50.96 59.36 0 0.00
27658. Rob (aftershock7) 1 50.96 50.96 0 0.00
27659. Alkinoos (alkonline66) 17 50.96 56.16 0 0.00
27660. Light (lightmaster001) 5 50.95 53.06 1 20.00
27661. Emily (emilyvol6) 3 50.94 56.00 0 0.00
27662. Krishna Kumar (krish_n_a) 5 50.94 52.38 0 0.00
27663. sanvi (sanvi_exe) 4 50.94 54.76 0 0.00
27664. Farzin (wickedjargon) 2 50.94 56.41 2 100.00
27665. Sunny (sunny6464n) 108 50.94 61.70 11 10.19
27666. Jeff (st1m) 15 50.93 56.63 1 6.67
27667. Krish (krish7) 88 50.93 64.61 6 6.82
27668. Rachel (tweetybirdbird) 15 50.92 64.90 2 13.33
27669. Samantha (sbscruton) 9 50.92 59.48 0 0.00
27670. Saleh (foxtheonly) 13 50.91 65.86 1 7.69
27671. Arman (arminhammer) 54 50.91 66.58 4 7.41
27672. Ghribi (kaspersaif) 7 50.91 59.63 1 14.29
27673. Kennie (ikentalk) 8 50.91 59.56 3 37.50
27674. Pranav (pranavmurray) 4 50.91 53.79 0 0.00
27675. Jouii (squigglysploosh) 6 50.90 61.24 2 33.33
27676. Aishuak (aishonnnn) 12 50.90 57.67 9 75.00
27677. oribiya-chan (oribiya) 13 50.90 58.97 1 7.69
27678. Bdog (bdogblue) 11 50.90 56.78 2 18.18
27679. Helmut (psyonara_dvorak) 25 50.89 61.43 3 12.00
27680. David (wiiun) 1 50.89 50.89 0 0.00
27681. Jo (jelli017) 10 50.89 60.38 2 20.00
27682. Vinesh (vineshdodiya) 28 50.89 58.39 3 10.71
27683. Alan (acfrost3) 20 50.89 60.32 2 10.00
27684. Sunpeng (limsunpeng07) 4 50.89 54.61 3 75.00
27685. Eren (krishi__) 11 50.89 57.46 1 9.09
27686. nootnoot (ezoid_nootnoot) 29 50.89 68.92 7 24.14
27687. Ron (ronsar) 20 50.89 60.12 3 15.00
27688. Flying (flyingdemon) 31 50.88 67.32 6 19.35
27689. Vishal (vishalsaxena) 48 50.88 63.70 4 8.33
27690. Alicja (gymnast2008) 30 50.88 62.59 3 10.00
27691. Dennis (dennis_lehmann) 1 50.88 50.88 0 0.00
27692. Ankush (ankushchavhan7596) 44 50.88 60.17 7 15.91
27693. Dylan (dylanjp) 4 50.88 60.55 2 50.00
27694. Kartik (artist007) 28 50.87 65.19 4 14.29
27695. martin (amezquitamartin) 4 50.87 54.98 0 0.00
27696. Disqusting (disqusting_mclo... 43 50.87 64.71 5 11.63
27697. Stian (awpchicken) 1 50.87 50.87 1 100.00
27698. Nguyen (gohweiz) 9 50.87 70.08 6 66.67
27699. Bayu (bayufajariyanto) 12 50.86 60.25 1 8.33
27700. Themis Evangelinos (sellak) 20 50.86 60.79 2 10.00
27701. Aelyos learns to type (aely... 721 50.85 71.29 82 11.37
27702. Victor (mlad) 14 50.85 56.38 0 0.00
27703. Aji (ajimathew) 46 50.84 66.62 11 23.91
27704. Brot (oh_brot) 1 50.84 50.84 0 0.00
27705. Virgil (vanvirgil_) 6 50.84 59.38 1 16.67
27706. Jozef (neophyx) 6 50.84 60.31 2 33.33
27707. Baka (bakabawi) 2 50.84 58.31 1 50.00
27708. Nhaatj (iopaosi) 14 50.82 77.90 2 14.29
27709. Parag (paranolverizer) 12 50.82 61.17 4 33.33
27710. Daniel (fsajijkt) 1 50.82 50.82 0 0.00
27711. Yu (astridjin) 14 50.82 59.93 3 21.43
27712. Jakub Janowski (qbajanowski) 194 50.82 67.80 13 6.70
27713. Vanja (njavex) 7 50.82 59.97 2 28.57
27714. Unicorn017 (unicorn017) 17 50.81 61.68 4 23.53
27715. Will (will_to_type) 6 50.81 60.75 0 0.00
27716. DenDu (dendu_respekt) 12 50.81 61.92 6 50.00
27717. Ad (shmldb) 1,417 50.80 70.42 122 8.61
27718. Ara (aracelis) 4 50.80 57.45 1 25.00
27719. Jeoondra (jeoondra) 1 50.80 50.80 0 0.00
27720. Shubham (_anonymous) 118 50.80 66.89 10 8.47
27721. Punit (punitsubudhi) 191 50.80 69.90 35 18.32
27722. Silk (silkdragon) 9 50.79 58.69 2 22.22
27723. Jens (jenspenneman) 1 50.79 50.79 0 0.00
27724. Abdou (abdoulabani1) 64 50.78 70.52 5 7.81
27725. Tushar (dark_thunder) 1 50.78 50.78 0 0.00
27726. Kapa (kassyk) 1,347 50.77 71.76 131 9.73
27727. Jynn (jynngecko) 60 50.77 66.67 18 30.00
27728. Dominic (skrrt_pull_up) 3 50.77 63.76 2 66.67
27729. Axeor (axeor) 4 50.75 55.32 1 25.00
27730. Emma (embi_) 4 50.75 53.89 1 25.00
27731. bhavya (bhav_) 8 50.74 58.27 4 50.00
27732. Milka (mille993) 728 50.73 67.13 66 9.07
27733. Josh (jubskiko) 1 50.73 50.73 0 0.00
27734. nkunder (nkunder16) 17 50.73 60.35 2 11.76
27735. Samy (sakashi96) 6 50.72 55.92 0 0.00
27736. naraha (typer_anu_layout) 1 50.71 50.71 0 0.00
27737. Shendo (shend0) 311 50.71 71.03 26 8.36
27738. Dev (devk232) 173 50.71 72.67 16 9.25
27739. Alori (aeshaefi) 2 50.70 51.19 0 0.00
27740. rap (raprics8) 53 50.70 64.69 4 7.55
27741. Keia (alu15) 2 50.69 52.08 0 0.00
27742. Mohammed (mshousha29) 61 50.69 65.12 7 11.48
27743. Nirved (nirved_06) 5 50.68 55.88 0 0.00
27744. CHICKENWINGCHILD (chickenwi... 4 50.68 53.27 0 0.00
27745. Hazique Mirza (ziquemirza) 30 50.67 59.09 1 3.33
27746. Shubham (stickyfingas) 4 50.67 58.32 0 0.00
27747. Frantisek (fandaa7) 1 50.66 50.66 0 0.00
27748. Jaxon Tatton (superjax101st) 81 50.66 74.88 47 58.02
27749. jaemy (jaemywest) 9 50.65 57.32 0 0.00
27750. Kevin (yolonce) 10 50.65 57.92 2 20.00
27751. humisar (humisar) 500 50.65 83.11 55 11.00
27752. Rajat (buttocks121) 186 50.65 67.17 24 12.90
27753. UBERWURST (kangjushang) 32 50.65 61.50 1 3.13
27754. Francisco (fanaya2001) 17 50.65 69.94 1 5.88
27755. Usmon (usmonjonh) 27 50.64 70.38 14 51.85
27756. Two (two_toned_69) 14 50.63 57.31 1 7.14
27757. BEMZ (bemz_mc) 45 50.63 63.38 10 22.22
27758. Bob (bobrossisfresh792) 3 50.63 59.58 2 66.67
27759. Dontmindme (dontmindmepls) 49 50.62 62.40 5 10.20
27760. vignesh (noob_typer16) 16 50.62 57.65 2 12.50
27761. Gheorghe (alpha0) 2 50.62 52.14 0 0.00
27762. Muhammad (masonomar) 6 50.61 54.19 3 50.00
27763. Tarashankar (tarashankar) 11 50.61 59.65 0 0.00
27764. Zahra (zahra_a) 55 50.60 62.20 14 25.45
27765. vayuputra (vayuputra) 55 50.60 67.75 9 16.36
27766. Tayyab (tayyabismail149) 23 50.60 65.69 7 30.43
27767. omar (omarkarboul) 20 50.59 56.75 1 5.00
27768. A (viking_) 2 50.59 54.98 0 0.00
27769. dinesh (dinesh66) 3 50.59 52.37 1 33.33
27770. komkanit (komcal) 4 50.59 57.12 1 25.00
27771. Hien (feederchuluc96) 12 50.59 58.26 1 8.33
27772. Tutuko (tutuko) 229 50.58 60.75 20 8.73
27773. Abdy (a7xsg) 131 50.58 63.28 11 8.40
27774. Jospeh (joseph_blota) 6 50.58 57.05 0 0.00
27775. John Brent (slow_turtle6278) 3 50.57 51.75 1 33.33
27776. Karol W. (xpeq7) 4 50.57 51.44 1 25.00
27777. Nithin (nithinsanjey) 14 50.56 64.28 1 7.14
27778. Dao (heavenrefining) 58 50.56 70.17 21 36.21
27779. Rei (hashi_datura) 2 50.56 50.96 0 0.00
27780. cam (cam_fung) 1 50.56 50.56 0 0.00
27781. Migs (m1gs) 13 50.56 57.45 3 23.08
27782. Ingo (ingo1337) 4 50.56 57.42 0 0.00
27783. Omega (enmendurana) 90 50.55 65.74 6 6.67
27784. Mohamed (midoukl) 11 50.55 53.40 0 0.00
27785. Chris (chrisrapid) 29 50.54 57.17 5 17.24
27786. Xavier (hillary4jail16) 2 50.54 52.09 0 0.00
27787. Vernnamae (vernnamae03) 14 50.54 54.91 1 7.14
27788. - (ndca) 332 50.53 70.75 36 10.84
27789. Nada (nada2004) 11 50.53 58.89 1 9.09
27790. jazz (jazzhand) 35 50.53 60.06 2 5.71
27791. Kimi (kimichanga) 28 50.52 59.86 6 21.43
27792. HK_BAKA (hkuzumaki) 10 50.52 60.59 2 20.00
27793. appu (appu46) 34 50.52 61.25 5 14.71
27794. jeff (jvaliente) 2 50.51 57.27 1 50.00
27795. Arber (hitit) 77 50.51 71.80 3 3.90
27796. BuslimSMD (silvercrow0) 11 50.51 54.85 2 18.18
27797. gaming4fun67 (gaming4fun67) 2 50.50 52.55 0 0.00
27798. Justin (peguegue) 3 50.50 55.46 1 33.33
27799. Damon (damon1864) 3 50.50 64.68 1 33.33
27800. David (sidrid) 14 50.50 58.78 1 7.14
27801. Maddie (madd204) 5 50.50 54.67 0 0.00
27802. vitus (vituschabreholm) 3 50.49 51.61 0 0.00
27803. Bymbadulam (boa_7515) 126 50.49 67.68 12 9.52
27804. Suvhoraj (blazing_cuber) 29 50.49 67.66 3 10.34
27805. Isaac (softwilly) 4 50.49 56.65 0 0.00
27806. Melvin (lechero) 3 50.48 58.89 0 0.00
27807. chanon (chanonlatt) 12 50.48 54.81 3 25.00
27808. Guy (thatguyrsa) 3 50.48 56.11 0 0.00
27809. Yashi (_o_wobless) 22 50.47 64.30 2 9.09
27810. B (mxnxmoon) 5 50.47 54.19 0 0.00
27811. forrest (rares9110) 17 50.47 57.78 3 17.65
27812. Biswajit (biswajit_maity) 6 50.47 55.38 0 0.00
27813. Gaurav (blockcipherr) 23 50.47 62.49 1 4.35
27814. Death_Dragon (dead_beast) 191 50.47 63.61 15 7.85
27815. Bình (juliecorstarr) 267 50.46 97.36 25 9.36
27816. Antonio (tonibudal) 8 50.46 54.72 1 12.50
27817. jawad (jiqlsh) 8 50.46 58.64 1 12.50
27818. Shinoto (shinoto) 2 50.46 54.16 0 0.00
27819. Alex (apasanta) 1 50.46 50.46 0 0.00
27820. Zia (mechatronic_beast) 22 50.46 60.44 2 9.09
27821. Aheartz (idul_aheartz06) 275 50.46 67.02 28 10.18
27822. Maxim (mista7) 286 50.45 71.01 29 10.14
27823. Josh (okey101) 4 50.44 51.40 0 0.00
27824. Typer_Guru (trinity_max) 3 50.43 51.94 2 66.67
27825. Prasad (prasad1999) 7 50.43 56.63 1 14.29
27826. Mohammad (mostat) 143 50.43 62.14 14 9.79
27827. Zak (villzzz420) 885 50.43 76.75 109 12.32
27828. cpt (cpt_chucky) 1 50.42 50.42 0 0.00
27829. snipe (snipe75) 20 50.42 67.45 1 5.00
27830. Bodyguard (bxdygxard) 42 50.42 64.07 3 7.14
27831. Jin (jinjohn) 10 50.41 55.92 2 20.00
27832. jason (anybuzzin) 1 50.41 50.41 0 0.00
27833. Jakob (1awesomeblossom) 5 50.40 56.71 0 0.00
27834. Splitslayer Chill (ikramnisar) 23 50.39 68.04 5 21.74
27835. mel (_melissa9_) 1 50.39 50.39 0 0.00
27836. Willll (yongzew) 105 50.39 59.96 3 2.86
27837. K (phua8686) 9 50.39 54.70 0 0.00
27838. Notsuo (rrhousti93) 2 50.39 53.85 2 100.00
27839. Rakha (rrsplay) 2 50.38 50.59 0 0.00
27840. Anxiete (anxiete) 4 50.38 56.55 1 25.00
27841. lordsnivy209 (lordsnivy209) 2 50.38 53.93 0 0.00
27842. Santosh (wow123__) 33 50.37 60.55 4 12.12
27843. Landon (fireman_227) 2 50.36 57.61 0 0.00
27844. Parsa (pr8222) 22 50.36 59.40 1 4.55
27845. ZavZav (zasvern) 4 50.36 55.12 0 0.00
27846. Alex (aralizer) 26 50.35 58.37 2 7.69
27847. kd (kdrai007) 274 50.33 71.53 31 11.31
27848. gcdashsj (gcdashsj) 1 50.33 50.33 0 0.00
27849. Felipe (feglex) 1 50.33 50.33 1 100.00
27850. Shinon (hitoshi_shinon) 3 50.33 56.38 0 0.00
27851. Christof (christofvanhove) 3 50.32 56.25 0 0.00
27852. PinapL (joshiedean63) 78 50.32 67.80 12 15.38
27853. Arash (me_races) 620 50.32 81.54 88 14.19
27854. Foren (foren) 74 50.32 67.71 14 18.92
27855. Storm (st0rm7) 83 50.31 62.57 8 9.64
27856. Aarohi (aarohi24) 9 50.30 59.76 2 22.22
27857. Jay (cyber_ace) 11 50.30 58.69 1 9.09
27858. polongas (polongas) 119 50.30 67.81 10 8.40
27859. swapneel (swapneel1121) 1,431 50.29 77.76 151 10.55
27860. Alexandre (apeloquin) 9 50.28 55.18 0 0.00
27861. अध्ययन Adhyan (... 786 50.28 74.54 95 12.09
27862. Kronos (zanthen) 5 50.27 55.75 4 80.00
27863. Devanshu (iamdevanshu) 23 50.26 55.88 3 13.04
27864. Alif (alif_) 7 50.25 55.41 0 0.00
27865. assaf297 (assaf297) 1 50.24 50.24 0 0.00
27866. John (zidis) 6 50.24 57.55 1 16.67
27867. Oliver (typer2947) 73 50.23 64.61 6 8.22
27868. Narwal (bnarwal) 12 50.22 66.76 4 33.33
27869. Jeffrey (xcjeffrey) 8 50.21 60.42 0 0.00
27870. typos (typos247) 3 50.21 52.70 0 0.00
27871. Abhi Baby (payalc) 4 50.20 58.06 0 0.00
27872. Nínive Letícia (ninive_le... 2 50.20 50.61 1 50.00
27873. Ayush (ayushtank) 2 50.20 51.98 0 0.00
27874. Dr_ (abrarsikder_123) 10 50.19 66.71 2 20.00
27875. tromboner (just_tromboner42... 1 50.19 50.19 0 0.00
27876. breddreamer (rasel_hasan) 141 50.19 63.16 9 6.38
27877. Nicholas (erpanter) 4 50.19 56.46 0 0.00
27878. stranger (courage_iberg) 26 50.18 65.73 4 15.38
27879. Kris (krislee2202) 6 50.18 58.36 1 16.67
27880. Stray (tiemevanderhoek) 23 50.18 67.84 6 26.09
27881. Mohammad (mohammadkhosravi) 13 50.17 54.27 0 0.00
27882. Joe (watchtheskies) 3 50.17 56.05 0 0.00
27883. Neckkoooooo (otakgirl_) 4 50.16 50.97 0 0.00
27884. Chris (cdyson1313) 4 50.16 56.02 0 0.00
27885. sauce (sam0the0samurai) 5 50.16 52.24 0 0.00
27886. Iver Andreas (ssk1ppy) 6 50.16 55.10 2 33.33
27887. Viet (viettp) 80 50.16 64.18 6 7.50
27888. tstats[pumabvb] (pumabvb) 1 50.15 50.15 0 0.00
27889. Jon (goneoffbread) 2 50.15 55.01 0 0.00
27890. Rui Alexandre (tapadinhas) 208 50.13 64.52 16 7.69
27891. harley (questionable0891) 60 50.13 65.93 7 11.67
27892. DAJ (daj8112) 1 50.13 50.13 0 0.00
27893. Yegor (yegorshevchenko) 22 50.13 58.10 2 9.09
27894. Ankit (anktwd) 49 50.12 57.62 2 4.08
27895. Ricards (xricheeh) 15 50.12 57.84 0 0.00
27896. Chee (pcheekz) 29 50.12 67.30 7 24.14
27897. Steve (stevehauser11) 3 50.12 50.89 0 0.00
27898. Ravi (ravi10000) 4 50.12 63.84 0 0.00
27899. stav (onions127) 6 50.11 59.77 2 33.33
27900. Nayeem (obaydul_hasan_nayeem) 141 50.10 61.74 18 12.77
27901. oley (oley11) 120 50.08 65.33 10 8.33
27902. GodHimself (jesuschristtypes) 1 50.08 50.08 0 0.00
27903. Danial (6reload) 13 50.07 55.97 4 30.77
27904. Adrian (hellfi_18) 9 50.07 55.41 3 33.33
27905. rakibul hasan (rakibulhasan... 4 50.07 54.38 1 25.00
27906. zien (ziensoo) 9 50.06 54.64 2 22.22
27907. Hung (biggestahung) 6 50.06 55.56 0 0.00
27908. Hamang (hamangpincong) 30 50.05 60.76 5 16.67
27909. Ezzy (ezzzyz) 43 50.05 60.08 3 6.98
27910. R (rswow) 5 50.04 59.03 0 0.00
27911. Vincent (rubixon) 116 50.04 59.86 9 7.76
27912. guitar (guitarplayer_6) 1 50.04 50.04 0 0.00
27913. Nikita (thicc_not_thick) 1 50.04 50.04 0 0.00
27914. Oleksandr (c_u_b_e) 63 50.04 60.06 5 7.94
27915. Kai (ceteris_paribus) 2 50.04 51.84 0 0.00
27916. Dakota (boda69) 26 50.03 58.64 3 11.54
27917. Hello (venox11) 7 50.03 57.26 3 42.86
27918. Levon (lyovandra) 1 50.02 50.02 0 0.00
27919. Habibullah (habibullahhussa... 148 50.02 71.90 19 12.84
27920. James (jameshasconnected) 19 50.01 67.16 1 5.26
27921. J (22jcoluby) 46 50.01 61.79 3 6.52
27922. ali (alifat) 56 50.00 58.55 5 8.93
27923. Willem (wilm) 5 49.99 54.68 0 0.00
27924. Marc (mrives) 15 49.99 56.43 2 13.33
27925. freePalestine (mohameddd) 873 49.99 71.46 95 10.88
27926. Jon-Michael (jm_george99) 7 49.99 58.27 2 28.57
27927. Alvaro (patomalo) 72 49.99 64.65 8 11.11
27928. JJ (jajo_00) 133 49.98 64.19 15 11.28
27929. Rahul (pirate_racer) 26 49.98 58.33 0 0.00
27930. mati (pitoloco) 17 49.98 64.89 1 5.88
27931. acidxburn87 (acidxburn87) 10 49.97 56.93 2 20.00
27932. Mohamed Mostafa (mo_dodo) 2 49.97 54.78 1 50.00
27933. Gonzalo (gonzalocl1024) 7 49.96 59.91 0 0.00
27934. Pocong (pocongjomblo) 1 49.96 49.96 0 0.00
27935. Petar (_petar_) 2 49.96 51.80 0 0.00
27936. JACK (jackemon) 298 49.95 74.00 36 12.08
27937. Grant (dahl192) 1 49.95 49.95 0 0.00
27938. melon (themelongirl) 6 49.95 55.88 0 0.00
27939. Myles (pord) 131 49.94 62.45 8 6.11
27940. Alh (gotank) 14 49.93 58.71 2 14.29
27941. Creamy Koala (creamy_koala) 2 49.93 51.96 0 0.00
27942. f (bigbarney) 3 49.93 53.19 3 100.00
27943. Dario (oodarioo) 140 49.93 65.51 17 12.14
27944. Derek (rexyoda) 7 49.92 59.75 2 28.57
27945. Arif (areyf) 30 49.92 60.02 6 20.00
27946. Jake (jake2005) 2 49.92 56.53 0 0.00
27947. Alistair (alistairmross) 10 49.91 56.06 1 10.00
27948. Carlisle (pixellexe) 1 49.91 49.91 1 100.00
27949. Bart (itwashishat) 85 49.91 73.32 11 12.94
27950. Harsh Kumar (rkcrocks144) 2 49.91 55.88 0 0.00
27951. tstats[yam] (yammagar) 1 49.90 49.90 0 0.00
27952. racist (milfed) 47 49.90 72.48 7 14.89
27953. Naomi (nmb813) 69 49.90 61.75 5 7.25
27954. Vidur (f0rs4k3n) 5 49.89 51.67 1 20.00
27955. David (davidpit) 1,219 49.89 73.21 180 14.77
27956. berk (birb_v2) 58 49.89 57.95 3 5.17
27957. Felix (metr_x) 350 49.89 63.73 35 10.00
27958. me (hseruslihkus) 19 49.88 59.32 2 10.53
27959. BEGMB (begmb) 6 49.86 59.67 6 100.00
27960. Emma (ebunny136) 2 49.86 50.15 1 50.00
27961. Jitendra (techjittu) 46 49.86 61.77 5 10.87
27962. JD (jhaaydee) 14 49.85 62.89 1 7.14
27963. mats (matserino) 50 49.84 65.02 6 12.00
27964. Kandanai (karnnypicture) 3 49.84 51.07 0 0.00
27965. cold_blood (cold_blood) 7 49.84 52.51 0 0.00
27966. Aryan (aryan1504) 60 49.83 65.67 4 6.67
27967. Adam (aren23) 5 49.83 56.67 0 0.00
27968. Srdjan (srle1312) 163 49.83 61.52 14 8.59
27969. Mushfiq (talha76) 1 49.83 49.83 0 0.00
27970. Aakash (blaze_type) 7 49.83 54.99 1 14.29
27971. Jose (jtrrazo_21) 3 49.81 53.39 2 66.67
27972. Teal (teal5) 4 49.81 60.03 0 0.00
27973. ccct (fastleopard) 383 49.80 67.92 45 11.75
27974. ZXCRYO (btscarbon) 53 49.79 63.50 8 15.09
27975. HARI (hariom_01) 9 49.78 54.01 1 11.11
27976. ghina (ghinaz) 3 49.78 60.34 2 66.67
27977. korn (itthikorn777) 44 49.77 59.56 5 11.36
27978. Sergio (sergi910) 1 49.77 49.77 0 0.00
27979. Miad (miad_hasan) 1 49.77 49.77 0 0.00
27980. nannan (weepee) 4 49.77 56.94 1 25.00
27981. Mark (markparadise) 13 49.76 58.13 1 7.69
27982. Ashvini (danger_anna) 57 49.76 66.80 11 19.30
27983. robot (robotbb) 27 49.76 64.32 4 14.81
27984. morty (morty_lh) 95 49.76 66.69 11 11.58
27985. Siddharth28 (siddharth28) 9 49.75 71.43 1 11.11
27986. Just, give me more time! (s... 2 49.75 52.59 0 0.00
27987. Drixppy (drixppy) 9 49.75 57.11 2 22.22
27988. Baby (baby3am) 8 49.74 62.94 1 12.50
27989. Skeletons (arsen4500) 1 49.74 49.74 0 0.00
27990. Ankit Sarkar (ankitsarkar) 43 49.74 65.46 40 93.02
27991. Sebastian (sebiai) 2 49.74 54.67 0 0.00
27992. jurek (jvrvk) 2 49.73 53.77 0 0.00
27993. Jimbo (jarrydschray) 16 49.73 56.49 1 6.25
27994. PK (pkhou) 35 49.72 64.29 3 8.57
27995. Claude (igie007) 3 49.72 54.20 0 0.00
27996. Rommel (seekercuriousityxx) 54 49.72 68.76 7 12.96
27997. Octavian (octavianb) 2 49.71 51.42 0 0.00
27998. Knight (knight_shadow) 7 49.70 52.80 2 28.57
27999. mangya (mangya) 25 49.69 61.35 4 16.00
28000. Pro Star (prostar1) 5 49.68 56.40 0 0.00
28001. Rijey (anilarq) 21 49.68 59.05 2 9.52
28002. Ben (speedysnail2005) 1 49.68 49.68 0 0.00
28003. Bennett (sol4rflare) 1 49.68 49.68 0 0.00
28004. Arman (aroman) 5 49.68 56.97 1 20.00
28005. Nour Hakim (scarfc) 314 49.67 66.74 46 14.65
28006. h3llo (alowqo) 13 49.67 57.54 3 23.08
28007. J'Lenn (monkeydjiggy) 3 49.67 60.84 0 0.00
28008. taramysh (tentech) 9 49.66 55.46 3 33.33
28009. derrick (lewi0332) 72 49.66 64.55 4 5.56
28010. The (mrperfectionista) 81 49.66 59.15 8 9.88
28011. Ruiji (taburnalluigi) 7 49.66 65.68 4 57.14
28012. Esli (no_name0312) 5 49.65 51.46 1 20.00
28013. Charles (charles0420) 16 49.65 60.40 2 12.50
28014. Peeter (detectiveleht) 20 49.65 58.24 6 30.00
28015. Elijah (e___) 22 49.63 68.96 1 4.55
28016. Mike (mikety1) 609 49.63 66.84 47 7.72
28017. Uddi (uddi_racer19) 23 49.63 63.28 2 8.70
28018. Hans (phantomreel) 262 49.62 64.27 30 11.45
28019. Michael Antariksa (maikeru10) 2 49.62 53.84 0 0.00
28020. Ignas (harord) 7 49.61 55.01 3 42.86
28021. RJ (zayles) 1 49.61 49.61 0 0.00
28022. Marwan (marwans) 77 49.61 61.62 6 7.79
28023. Tor (tortle4444) 135 49.61 66.13 12 8.89
28024. notorioustype (thenotorious... 30 49.61 57.62 3 10.00
28025. Wonder (wonderjaxe) 14 49.60 60.57 1 7.14
28026. Harsh (todorokishotoua15) 91 49.60 70.59 71 78.02
28027. Spanchsan (spanchsan) 17 49.59 60.26 2 11.76
28028. Mona (picolee) 28 49.59 62.35 6 21.43
28029. Hamza (hhaammzzaa) 7 49.59 60.56 1 14.29
28030. bbygirlturtle (bbygirlturtle) 34 49.59 67.23 7 20.59
28031. iwillcomboyou (iwillcomboyou) 89 49.59 67.62 6 6.74
28032. Jan (natrix_) 25 49.58 61.04 12 48.00
28033. Baramee (6666666666666666) 111 49.58 67.82 7 6.31
28034. Sarafraj (sarafraj) 32 49.57 57.20 1 3.13
28035. jean (jhyppoli) 242 49.57 68.52 16 6.61
28036. Erm (the7erm) 2 49.57 57.01 1 50.00
28037. minh (nminhanh420) 3 49.56 49.84 0 0.00
28038. David (prosic723) 9 49.56 53.39 0 0.00
28039. ben (kashikura) 9 49.56 56.28 0 0.00
28040. Norm (norm_guy) 162 49.55 64.09 17 10.49
28041. Smooth (undeadplayer) 10 49.55 54.41 1 10.00
28042. Rider (rider2) 4 49.55 54.21 0 0.00
28043. Don Quixote (crunchjunkie) 80 49.55 62.57 12 15.00
28044. Tamir (recoon44) 88 49.55 67.66 8 9.09
28045. Awz. (awzcubensis) 63 49.55 65.54 11 17.46
28046. Aiden (shmaiden) 2 49.55 50.34 0 0.00
28047. Egor (psinka) 4 49.54 54.30 0 0.00
28048. Stephen (slyspy) 47 49.54 65.64 1 2.13
28049. Shobaik (shobaik_04) 39 49.54 60.38 6 15.38
28050. Madsin (madsin) 7 49.54 54.25 1 14.29
28051. Ella (ellavampyrella) 19 49.53 57.56 2 10.53
28052. Nick (xogtwo) 10 49.53 63.35 2 20.00
28053. Daniel (dax1536c) 5 49.53 55.79 0 0.00
28054. Tamas (razor15) 4 49.53 52.76 0 0.00
28055. Annabelle (pickle_jickle) 1 49.53 49.53 0 0.00
28056. sadsaturdays (sadsaturdays) 271 49.53 64.10 33 12.18
28057. abdul (kaium55) 8 49.53 71.85 1 12.50
28058. Joni (jiipee) 6 49.52 58.35 0 0.00
28059. duckg (poweryourmind) 5 49.52 59.25 1 20.00
28060. Vikram (galvarino_) 84 49.52 58.85 5 5.95
28061. Thomas (froskeprinsen) 3 49.52 52.05 1 33.33
28062. TcJon (tcjon) 52 49.52 66.33 5 9.62
28063. Logan (loganthewizkid) 9 49.52 56.04 3 33.33
28064. Muhammed Murad (mkmusafir) 9 49.51 56.04 1 11.11
28065. Ahmad (truemagix) 7 49.51 53.77 1 14.29
28066. Haris (sarakas) 2 49.51 49.53 0 0.00
28067. Mel (mel7) 2 49.51 56.10 2 100.00
28068. Acid (acidderp) 3 49.50 53.62 0 0.00
28069. Yellow (gracet_b) 8 49.50 57.33 1 12.50
28070. Yesitsme (kingbee11) 19 49.49 62.49 3 15.79
28071. *You're (yourmumlikesmytyping) 14 49.49 57.54 0 0.00
28072. Jirafa (jirafious) 6 49.49 57.91 1 16.67
28073. Zheng Hao (a_random_slow_ty... 8 49.48 61.31 1 12.50
28074. julia (misailuj) 5 49.48 56.05 2 40.00
28075. Komol Kunty Rajib (rajib_ra... 7 49.47 54.31 0 0.00
28076. Waseem (was11) 15 49.47 52.75 2 13.33
28077. A (melori) 8 49.47 62.82 1 12.50
28078. max (dogman50012) 2 49.47 51.73 0 0.00
28079. Lila (littlebaddiebcwhynot) 6 49.47 56.95 1 16.67
28080. Erlan (erlansaputra) 1 49.46 49.46 0 0.00
28081. Rob (robreadger) 1 49.46 49.46 1 100.00
28082. Sharktooth (sharktoothx) 3 49.45 54.01 0 0.00
28083. Kellan (mrkt59) 5 49.45 52.92 1 20.00
28084. Nagy (lurgul) 10 49.45 58.65 3 30.00
28085. Ascend (obaht) 17 49.44 56.41 1 5.88
28086. Chirag (chirag2907) 13 49.44 54.35 2 15.38
28087. sayba (nusaiba4) 79 49.43 60.51 6 7.59
28088. Kirti (kirti773) 42 49.43 76.98 3 7.14
28089. Owl (owl2023) 137 49.43 62.19 15 10.95
28090. Anoop (anooprajreddym) 9 49.42 62.38 1 11.11
28091. Rikey (reycon) 53 49.41 68.63 6 11.32
28092. Jon (kixoidiot) 8 49.41 59.15 1 12.50
28093. Halvor (halvornj) 1 49.41 49.41 0 0.00
28094. max (low_wpm) 117 49.40 60.43 11 9.40
28095. Abood (hirotto) 15 49.40 59.27 1 6.67
28096. Anh Khoa (anhkhoa218) 14 49.40 57.38 2 14.29
28097. chander (chanderpal) 13 49.40 54.75 0 0.00
28098. Feb (feb_ryan) 3 49.39 54.12 1 33.33
28099. Rockfeller (rock_messi) 7 49.39 56.39 0 0.00
28100. Mohammed Afeef (cosmicpegas... 1 49.39 49.39 0 0.00
28101. Toan (caotoan999) 1 49.39 49.39 0 0.00
28102. Rana (rana2706) 10 49.39 57.20 1 10.00
28103. Will (burntriceboi) 87 49.38 76.15 15 17.24
28104. tH$eAgle (adepa) 146 49.37 65.26 22 15.07
28105. Moritz (mango_1212) 85 49.37 66.17 13 15.29
28106. Wambo(dong) (aceizzhi) 3 49.36 60.20 1 33.33
28107. B (p1geonkid) 15 49.35 56.50 2 13.33
28108. nathan (bobhehehe69) 3 49.35 58.80 1 33.33
28109. Nelson (kuribohno) 4 49.35 53.29 1 25.00
28110. Lord Of Titans (lord_of_tit... 166 49.35 65.97 26 15.66
28111. B3rt4 (brz_j) 2 49.34 49.73 0 0.00
28112. Martin (marh1694) 5 49.33 58.88 3 60.00
28113. Othman (othmanaldefer) 187 49.32 63.23 18 9.63
28114. Genius (genius0teacher) 15 49.32 63.60 12 80.00
28115. chyzellechan (chyzellechan) 4 49.31 60.54 0 0.00
28116. Katherine (theown13) 5 49.30 55.09 0 0.00
28117. Anuar (sagidollaev_) 15 49.29 57.08 13 86.67
28118. yabsira sisay (yabsira) 18 49.29 57.04 1 5.56
28119. SaIidat (salidat) 6 49.29 56.43 1 16.67
28120. Sami (sami_66) 38 49.28 56.52 3 7.89
28121. kiwiwi (gothickiwi) 14 49.28 61.10 1 7.14
28122. RageRaptor (rageraptor) 47 49.28 57.18 3 6.38
28123. Filth (filthyslush) 1 49.27 49.27 0 0.00
28124. Kelly (kile07) 18 49.27 65.65 2 11.11
28125. el (aeeia) 1 49.26 49.26 0 0.00
28126. InSaein (insaein) 10 49.26 56.55 1 10.00
28127. Ravi (ravimajhi) 712 49.25 70.10 83 11.66
28128. BeastBoy (beastboykadil) 31 49.25 61.30 2 6.45
28129. Gergo (hexa_ik) 2 49.25 52.30 0 0.00
28130. Anna (ana2007) 15 49.25 60.41 2 13.33
28131. xavier (xavieregan) 9 49.24 53.80 5 55.56
28132. Prajwal10s (prajwal10s) 10 49.24 60.50 2 20.00
28133. Sang (m_sang) 2 49.24 53.65 0 0.00
28134. Gourav (mrgaurav2001) 169 49.24 70.68 35 20.71
28135. hela (helabwr) 9 49.23 52.41 2 22.22
28136. Claire (akward7ur7le) 1 49.23 49.23 0 0.00
28137. Amirun (amumrzmh) 10 49.23 55.98 1 10.00
28138. Maurice (halpibad) 12 49.23 60.22 1 8.33
28139. Adur (adurto) 5 49.23 58.05 2 40.00
28140. Ayman (ayman_isam) 5 49.21 57.85 1 20.00
28141. kostis (oh_yeah_go) 66 49.21 58.90 5 7.58
28142. Jayshil (just_chillll) 8 49.21 54.26 1 12.50
28143. Tyler47 (tytycrewz) 17 49.20 60.67 5 29.41
28144. Alejandro (aljandro2o) 2 49.20 56.73 1 50.00
28145. Xuanming (caoxuanming) 71 49.19 58.45 8 11.27
28146. Thomas (thomas_wong) 2 49.19 49.96 0 0.00
28147. Jayus (jayusi) 4 49.19 56.26 0 0.00
28148. Gabish (gabish01) 2 49.19 51.14 1 50.00
28149. Kayden (semitart) 23 49.19 59.08 4 17.39
28150. SambelB2P (fianjansen) 1 49.18 49.18 0 0.00
28151. Ice794 (ice_794) 2 49.18 54.40 0 0.00
28152. Tu Tu (tpperware) 12 49.18 57.57 7 58.33
28153. Master21 (master217994) 6 49.18 55.65 1 16.67
28154. Jalex (_jalex) 28 49.17 59.33 1 3.57
28155. Su (tsunamitdw) 2 49.17 49.83 1 50.00
28156. Khalid (khalidramadan) 1 49.17 49.17 0 0.00
28157. Darro (darro) 1 49.17 49.17 0 0.00
28158. DavidFinlForm (davidfinalform) 9 49.17 55.02 0 0.00
28159. Sam (saimbintalib) 2 49.17 58.94 0 0.00
28160. Crown (crownmp) 4 49.16 56.57 0 0.00
28161. tstats[rueo] (rueo) 44 49.16 60.77 5 11.36
28162. Lam (lamnv) 304 49.15 65.21 33 10.86
28163. Tushar (kensei22) 22 49.13 54.08 1 4.55
28164. Shiji (shiji_singh) 47 49.13 57.16 4 8.51
28165. Nurasyl (black2ing) 295 49.12 62.45 30 10.17
28166. Tomas (clickity_clark) 39 49.12 62.17 3 7.69
28167. Jonathan (z33nine) 11 49.12 54.47 0 0.00
28168. Nawazish (ghostlead420) 67 49.12 65.26 5 7.46
28169. ryo (hyperu) 2 49.12 50.16 0 0.00
28170. Dan (diamond98) 25 49.10 56.25 2 8.00
28171. hai (theemak) 16 49.10 59.67 1 6.25
28172. Sabba7 (bodynasser) 22 49.08 61.23 3 13.64
28173. Parag (parag_gn) 108 49.08 62.97 11 10.19
28174. Joe (nookgun) 3 49.07 54.08 0 0.00
28175. Jacob (kick0003) 2 49.07 49.93 0 0.00
28176. Marco (mauboru) 1 49.06 49.06 1 100.00
28177. Budder40 (budder40) 10 49.06 55.03 1 10.00
28178. Brill (brill85) 1 49.05 49.05 1 100.00
28179. Coraline (coralinebutton) 4 49.05 50.48 0 0.00
28180. Shashanka (shashankanath) 20 49.04 61.21 13 65.00
28181. Peter (metalhead2021) 190 49.04 63.15 12 6.32
28182. sabir (supercypok) 2 49.04 52.70 0 0.00
28183. vexx32 (vexx32) 55 49.03 62.26 7 12.73
28184. sai (syrus_dhark) 21 49.02 61.33 1 4.76
28185. Michael (henderslender11) 109 49.02 62.28 12 11.01
28186. Slow (tal4565) 7 49.02 59.93 0 0.00
28187. Curl2908 (curl2908) 357 49.01 64.90 37 10.36
28188. Ian (its_ianj) 1 49.01 49.01 0 0.00
28189. Ash (ash_ketchump) 34 49.01 65.62 4 11.76
28190. Ian (raveian) 8 49.00 58.79 1 12.50
28191. Zach (zachog) 4 49.00 61.98 0 0.00
28192. Josh (complex_j) 14 48.99 56.83 1 7.14
28193. Sam (sam22258) 6 48.99 58.59 0 0.00
28194. Miccalo (miccalo_dv) 817 48.99 92.52 98 12.00
28195. Brian (brian81877) 2 48.99 51.55 0 0.00
28196. A (axeborn) 8 48.98 56.06 0 0.00
28197. William (will_exe) 15 48.98 55.17 2 13.33
28198. mohit (madara989) 664 48.97 70.39 68 10.24
28199. Lukas (lukaas506) 17 48.97 58.62 2 11.76
28200. Jesse (thepaperman) 7 48.95 57.55 4 57.14
28201. Sheraz (sherazahmad720) 111 48.95 60.17 20 18.02
28202. Jenni (jenni02) 1 48.94 48.94 0 0.00
28203. ahmed (sakakill) 9 48.93 53.72 0 0.00
28204. Celiakos (celiakos) 90 48.93 57.91 8 8.89
28205. Shalz (shalzin) 6 48.93 59.79 2 33.33
28206. Dev (devkoli) 47 48.93 64.49 3 6.38
28207. Elvy (elvy_) 9 48.93 57.40 3 33.33
28208. Forestii (forestii) 4 48.93 50.57 4 100.00
28209. reena (reenasmart21) 4 48.92 54.55 0 0.00
28210. Aditya (dhruvaditya) 159 48.91 64.25 11 6.92
28211. umbercuc (umbercuc) 6 48.90 54.12 0 0.00
28212. PMD_cLark* (revenge1) 5 48.90 55.58 0 0.00
28213. Aryan (aryan7_king) 74 48.89 66.04 5 6.76
28214. Blank (blank28) 4 48.89 61.51 0 0.00
28215. Karim (karimkarim) 156 48.88 64.66 18 11.54
28216. Yutio (yutio) 52 48.88 58.20 3 5.77
28217. Gaurav (gaurav2607) 82 48.88 63.59 12 14.63
28218. Csutka (csutkabali) 4 48.87 55.84 0 0.00
28219. fiaz (fiazmahmud) 24 48.87 57.71 4 16.67
28220. 3li (3licraft) 3 48.87 51.23 2 66.67
28221. Harvey (lawyer001) 1 48.87 48.87 0 0.00
28222. Aicez (cluelessbruh) 14 48.86 57.72 0 0.00
28223. Mukhamejan (mukhamejan) 8 48.86 54.17 1 12.50
28224. ZIRRO (zirro7825) 1 48.86 48.86 0 0.00
28225. Daulet (dtk6) 11 48.86 62.58 4 36.36
28226. Mubarak (sgtcuredpanda) 8 48.86 52.03 0 0.00
28227. Veros (deadtwinkz) 7 48.85 57.41 3 42.86
28228. Shrekcob (shrekcob) 1 48.85 48.85 0 0.00
28229. mirnyz (mirnyz) 4 48.85 55.63 4 100.00
28230. Judah (ghostboyjude) 8 48.85 56.79 1 12.50
28231. Marcis (ggirt) 2 48.85 49.74 0 0.00
28232. Miles (gazza111) 2 48.85 53.26 1 50.00
28233. Divyanshu (div34357) 1 48.83 48.83 0 0.00
28234. Cyrus (chonky_garfield) 10 48.83 58.08 4 40.00
28235. g (gunner69) 6 48.83 53.92 1 16.67
28236. Zach (zachninjakiller6) 8 48.80 56.09 1 12.50
28237. Joel (joel10) 12 48.79 54.87 3 25.00
28238. Angel (kablockacha) 13 48.79 59.98 2 15.38
28239. jens (jenspie) 3 48.79 53.77 0 0.00
28240. ariyaninj (aryaninj) 42 48.78 70.89 9 21.43
28241. Buster (artistinthehoodie) 11 48.78 61.22 0 0.00
28242. Abhay (ab_hay) 458 48.78 84.09 56 12.23
28243. Mert (mertkasikci) 1 48.78 48.78 1 100.00
28244. ruditheracer (ruditheracer) 2 48.78 52.76 0 0.00
28245. 🇧🇬️(⌐■_■) ... 2 48.78 51.76 0 0.00
28246. Reggie (_fast_car_noises_) 15 48.77 55.87 1 6.67
28247. Edilbek (edok_mal4) 27 48.77 65.67 3 11.11
28248. Gnany (gnanyadapa) 30 48.77 65.93 5 16.67
28249. ali (alianggie) 34 48.76 61.25 3 8.82
28250. Sabyasachi (saba10000) 7 48.75 56.54 0 0.00
28251. Liz (lovelyliz) 4 48.74 53.78 0 0.00
28252. mouni (mouni576) 5 48.73 59.14 1 20.00
28253. Kieran (sackerpunch) 6 48.73 57.12 2 33.33
28254. tamjid (tamjid_hasnat) 16 48.73 52.93 1 6.25
28255. umang patel (fiasty) 33 48.73 59.55 3 9.09
28256. ×͜×KRISHNA _ (krishna00) 9 48.72 54.87 1 11.11
28257. hello (hello_people123) 18 48.72 58.75 4 22.22
28258. Kumar Charan (mr_kc) 87 48.71 62.51 5 5.75
28259. Prison (prisonmike69) 3 48.70 50.27 0 0.00
28260. Leang (leangsopoar) 12 48.69 55.53 0 0.00
28261. Armin (armino112) 467 48.69 62.75 40 8.57
28262. Edigar (edigar) 7 48.68 55.06 0 0.00
28263. Hk (hk2257853) 34 48.68 61.73 4 11.76
28264. Th3Frog (th3frog) 13 48.68 55.40 3 23.08
28265. Dani (daniespi) 4 48.68 54.16 3 75.00
28266. Daniel (akr115) 40 48.67 58.68 3 7.50
28267. Celia (ccelo) 37 48.67 68.06 5 13.51
28268. Thomas (tszkoda) 8 48.67 52.40 3 37.50
28269. Joseph (josephmestas) 2 48.67 57.71 1 50.00
28270. Spencer (instaflip) 6 48.67 52.49 0 0.00
28271. Arschwurst (arschwurst) 241 48.67 62.81 26 10.79
28272. Josh (cobra04) 1,434 48.66 69.06 94 6.56
28273. mu (typetypetypetypetype) 7 48.66 56.53 0 0.00
28274. Ahanaf Shahriar (shahriar013) 32 48.65 59.37 1 3.13
28275. Navdeep (navk007) 77 48.64 64.54 10 12.99
28276. IllMind (lllmind) 151 48.64 65.10 24 15.89
28277. Teun (typingthunder) 51 48.63 57.89 2 3.92
28278. complexcherry (complexcherry) 1 48.63 48.63 0 0.00
28279. Yan (zeezyy) 13 48.62 56.88 12 92.31
28280. Suchit (suchit_reddi) 11 48.62 57.44 3 27.27
28281. Abhishek (abhi_bharti) 23 48.62 60.93 2 8.70
28282. Ryley (r_sand11) 8 48.61 63.35 0 0.00
28283. clausrogisch (clausrogisch) 16 48.61 54.54 1 6.25
28284. Lauren (lsmithers619) 167 48.58 64.91 21 12.57
28285. Phreakyx (axsali) 1 48.58 48.58 0 0.00
28286. Deltaology (deltaology) 120 48.58 66.64 9 7.50
28287. Callum (calleazyy) 1 48.56 48.56 0 0.00
28288. lukas (s_lukas) 1 48.56 48.56 0 0.00
28289. mis7ake (mis7ake) 3 48.55 54.08 0 0.00
28290. Miras (mirabil) 538 48.54 66.52 47 8.74
28291. ti (popy_15) 3 48.54 51.06 0 0.00
28292. Yelnur (ye1nur) 23 48.54 56.06 4 17.39
28293. v (vinay747) 81 48.54 64.34 9 11.11
28294. Vala (valarn) 78 48.53 59.43 4 5.13
28295. Clement (clem_jestin) 34 48.53 55.28 2 5.88
28296. dev (devsick) 1 48.52 48.52 0 0.00
28297. Seth (sethicz109) 5 48.52 58.18 1 20.00
28298. sebastian (seviago) 10 48.51 54.96 2 20.00
28299. joey (legend_joey) 84 48.51 65.32 14 16.67
28300. Sticky (littletea) 14 48.50 56.36 3 21.43
28301. moca (mxca) 7 48.50 56.63 1 14.29
28302. Daniel (stompy361) 3 48.50 50.10 0 0.00
28303. MasterlyHoney (masterlyhone... 21 48.50 59.55 0 0.00
28304. Squeeeeeps (squeeeeeps) 20 48.49 57.70 2 10.00
28305. Erick (laudato) 4 48.48 56.80 2 50.00
28306. Manuel (ganilson) 2 48.48 49.74 0 0.00
28307. Aleksandra (zhisniacova) 1 48.48 48.48 0 0.00
28308. Raul (raulziiiin) 1 48.48 48.48 0 0.00
28309. xtian (babbageclunk) 8 48.48 54.31 1 12.50
28310. Sludge (sludgeneedbeer) 28 48.47 58.31 4 14.29
28311. Eman (kaido187) 23 48.47 60.13 3 13.04
28312. Duc (sungjinwoo2001) 12 48.47 56.11 1 8.33
28313. faf (faf222) 17 48.46 60.26 1 5.88
28314. ashish (ashis0013shaw) 1 48.46 48.46 0 0.00
28315. Mercapto (fast_typer10) 23 48.45 63.92 1 4.35
28316. Demon (demon_hunter_bd) 20 48.45 55.67 1 5.00
28317. SuperDucky1875 (superducky1... 11 48.45 58.20 2 18.18
28318. ProRick2358Y (prysp) 65 48.44 61.07 5 7.69
28319. Peter (panalis) 1 48.44 48.44 0 0.00
28320. Ketki (ketki611) 3 48.43 52.20 0 0.00
28321. keshav (keshavsarraf) 1 48.43 48.43 0 0.00
28322. James (arctos) 36 48.43 59.08 1 2.78
28323. Sean (kokamell16_) 21 48.43 58.12 2 9.52
28324. Edgars (edzo34) 2 48.42 55.70 1 50.00
28325. Sonbeat (sonbeat_94) 5 48.42 59.81 0 0.00
28326. luz (luzyb92109) 513 48.41 76.32 62 12.09
28327. Dannica (danni_bear_) 10 48.41 56.20 1 10.00
28328. boop (xkeons) 34 48.41 57.88 0 0.00
28329. Franz (franzl_fang) 10 48.41 56.11 1 10.00
28330. JudgementCole (judgementcole) 13 48.40 55.99 2 15.38
28331. mike (purdah1234) 461 48.40 62.78 41 8.89
28332. Furkan (zerdlai) 3 48.40 60.24 1 33.33
28333. Dark (arunabh_kalita) 24 48.40 57.61 4 16.67
28334. Alex (aselia_azim) 44 48.40 59.10 4 9.09
28335. Andrés (and9686) 4 48.40 51.52 2 50.00
28336. Relja Bulat (relja0804) 10 48.39 56.28 2 20.00
28337. Harsh (the_slow_one_123) 27 48.38 62.29 3 11.11
28338. Nithish (tasten_drucker) 1 48.37 48.37 1 100.00
28339. blake (pandashasjoinedthegame) 2 48.37 48.93 0 0.00
28340. Gajen (techgajen) 343 48.36 66.84 40 11.66
28341. Sagar (sagarcool) 15 48.35 56.00 2 13.33
28342. Andrew (kooey_u) 11 48.35 53.86 3 27.27
28343. clock (clockq) 4 48.35 51.08 1 25.00
28344. Dastan (nur_4_earth) 1 48.34 48.34 0 0.00
28345. Mohamed Abdallahi (lim_elno... 43 48.33 64.18 8 18.60
28346. candice (wotah_zonea_8) 1 48.33 48.33 0 0.00
28347. Stefarno (stefarno) 9 48.32 58.00 1 11.11
28348. VR-un (knight343) 4 48.32 52.44 2 50.00
28349. MYMANIA (nongaim123) 2 48.32 55.47 0 0.00
28350. PracticeTouch (practicingto... 52 48.31 61.34 2 3.85
28351. Asaan (asaan) 86 48.31 63.74 5 5.81
28352. Abdulrahman karkalar (safi3... 1,375 48.30 79.45 130 9.45
28353. Mike (anaperius) 26 48.30 59.36 13 50.00
28354. Vít (stepky) 4 48.30 49.95 0 0.00
28355. Sander (sandiboii) 2 48.30 48.40 0 0.00
28356. raider (raider93) 7 48.30 57.16 0 0.00
28357. Sourav (sourav008) 81 48.30 58.60 8 9.88
28358. Lord (mafiosnik) 16 48.29 55.35 2 12.50
28359. Savatar (sava7ar) 3 48.29 70.06 0 0.00
28360. tstats[zanies07] (zanies07) 11 48.29 52.62 2 18.18
28361. Tovic (todave) 436 48.28 63.56 39 8.94
28362. sarthak (shivasarthak) 9 48.28 61.59 0 0.00
28363. Speed_Aditya (aditya_raj) 3 48.28 60.74 0 0.00
28364. Hudson (hubbons) 1 48.26 48.26 1 100.00
28365. Karan (commando_typer) 109 48.26 59.18 12 11.01
28366. Arunreas (arunreas) 115 48.26 65.49 19 16.52
28367. DapperDjent (dapper_djent) 4 48.25 52.67 0 0.00
28368. Noah (lightsaber71) 4 48.25 64.48 1 25.00
28369. Prithvi (prithvi18) 525 48.25 69.84 104 19.81
28370. Ahmed (ahmedhallool) 61 48.24 57.93 5 8.20
28371. Aniruddh (arl17) 95 48.24 57.24 7 7.37
28372. johny2021 (johny2021) 11 48.23 55.17 2 18.18
28373. Martin (datlos) 28 48.22 58.75 0 0.00
28374. Aris (lysaris) 4 48.22 49.93 0 0.00
28375. Court (courtmw) 177 48.22 64.02 16 9.04
28376. John Paul (jp_ramolete16) 782 48.21 65.69 84 10.74
28377. Chadwick (supasurreal) 53 48.21 61.87 6 11.32
28378. Paul (pgailey) 5 48.20 52.56 0 0.00
28379. Nikolay (niki12120) 55 48.20 61.14 26 47.27
28380. Homieboy (abcjohnabdjohn) 11 48.20 58.06 2 18.18
28381. Jamie (jamiekwok) 37 48.19 54.99 1 2.70
28382. mohamed (mohamed_1800) 224 48.19 61.16 16 7.14
28383. doctor (timelordvader) 83 48.19 60.36 7 8.43
28384. DoodieMan (doodieman) 4 48.19 56.63 0 0.00
28385. Bosco (boscorj) 16 48.18 61.48 7 43.75
28386. katie (katieee1) 1 48.18 48.18 0 0.00
28387. glowred (greytime) 6 48.17 52.97 1 16.67
28388. Deron (deron_09) 12 48.17 66.68 3 25.00
28389. Thomas (khoaph) 3 48.16 50.94 3 100.00
28390. soopasoop (soopasoop) 12 48.16 54.91 1 8.33
28391. stream (stream_cipher) 9 48.16 61.11 1 11.11
28392. Torron (torronlester) 17 48.16 57.63 1 5.88
28393. Yan (tzunyan) 4 48.16 52.51 0 0.00
28394. Danial (d0d1ek) 1 48.15 48.15 0 0.00
28395. yaotly (yaotli) 20 48.15 54.06 2 10.00
28396. Runar Eskild (reskild) 6 48.15 54.13 0 0.00
28397. John (kobas) 22 48.14 56.56 1 4.55
28398. Alphan (alphan) 3 48.14 59.96 1 33.33
28399. awabin (awabin) 177 48.13 81.11 22 12.43
28400. Dav (davidskarm) 1 48.13 48.13 0 0.00
28401. Johannes (yoshgasm) 12 48.13 54.04 0 0.00
28402. Aasish (ghisingo) 15 48.12 56.37 6 40.00
28403. Jawad (dragonrot) 1 48.11 48.11 0 0.00
28404. Sayan (snbk97) 3 48.11 51.26 0 0.00
28405. 1 (1etmedie) 1 48.10 48.10 0 0.00
28406. Sarthak (sarthaksidhant) 2 48.10 49.41 2 100.00
28407. Dhia Eddine (bl1ndk) 35 48.10 56.94 1 2.86
28408. Wazukyan (aswertgvc) 2 48.09 55.46 0 0.00
28409. Abdul Qayyum (aqal1003) 1 48.08 48.08 0 0.00
28410. Jonah (jkeates) 3 48.07 52.62 0 0.00
28411. vylnf (vylnf213) 14 48.07 53.60 0 0.00
28412. Anton (foroi) 64 48.07 60.56 10 15.63
28413. Pranav (pgracer25) 636 48.06 81.39 59 9.28
28414. CaptainVR (captainvr) 1 48.06 48.06 0 0.00
28415. 1_Death (1_death) 387 48.05 65.71 45 11.63
28416. Banana (lippicp) 3 48.05 54.78 0 0.00
28417. Alo (alooo) 65 48.04 59.26 3 4.62
28418. Nicelec (nicelec_1st) 4 48.04 60.59 0 0.00
28419. Amr (amr_emara) 8 48.03 54.59 0 0.00
28420. tayyab (tayyab246) 139 48.02 62.96 18 12.95
28421. vaimelio (vaimelio) 5 48.02 57.28 1 20.00
28422. Michael (blindingfast) 2 48.02 52.76 0 0.00
28423. Mile (kiticmile69) 6 48.02 58.27 1 16.67
28424. Ayera (ayera_04) 23 48.02 55.03 2 8.70
28425. Tima (tima_geek02) 5 48.01 59.64 3 60.00
28426. Michael (trotskyy) 3 48.00 50.97 0 0.00
28427. batbaven (baislow) 434 47.99 62.51 42 9.68
28428. Dustan (dustank) 22 47.99 57.80 1 4.55
28429. Zaid (zaid_ansari) 7 47.99 54.72 1 14.29
28430. Grifit (grifit) 11 47.99 61.03 3 27.27
28431. harold (sha_man) 14 47.99 53.10 1 7.14
28432. Mohammed (manchi) 8 47.98 53.35 0 0.00
28433. Limey (limeycunt) 182 47.98 65.24 19 10.44
28434. Gajendra (gajutyper) 5 47.98 51.39 1 20.00
28435. Sanwal (sanwal_junejo0007) 43 47.98 61.30 2 4.65
28436. Brian (mcflobbergobber) 1 47.98 47.98 0 0.00
28437. Ivan (cactus9800) 15 47.98 53.65 0 0.00
28438. Nuteee (nutee) 18 47.97 61.56 0 0.00
28439. Yora (yorad) 3 47.97 52.53 1 33.33
28440. Positive (positiv) 6 47.96 56.46 1 16.67
28441. shamol (shamolali) 13 47.96 56.89 3 23.08
28442. Alireza (a_ashkanipour) 2 47.96 52.29 1 50.00
28443. Hussein (husseinabbas) 200 47.96 61.49 17 8.50
28444. Lets Gooooo!!! (mattymooo2021) 53 47.95 61.64 6 11.32
28445. pogi (pogy) 38 47.95 69.18 9 23.68
28446. Amy (sunnyaim) 1 47.95 47.95 0 0.00
28447. aditya105 (aditya105) 162 47.95 65.08 17 10.49
28448. Pro (theproplayer1278) 6 47.94 52.38 0 0.00
28449. Dennis (iwantahug) 2 47.94 48.32 0 0.00
28450. Salem (slomy0010) 36 47.93 57.16 3 8.33
28451. fajar (jarrrr) 1 47.93 47.93 0 0.00
28452. Yousuf Ali (yousuf_97) 17 47.92 55.94 5 29.41
28453. Nikola (_not_) 31 47.92 54.44 1 3.23
28454. satvik (satvikp) 1 47.91 47.91 0 0.00
28455. brad (bradacook) 4 47.91 50.59 1 25.00
28456. based_hitler_69 (sav_ru) 19 47.90 54.69 1 5.26
28457. Nalahatra (nalahatra) 29 47.90 67.43 2 6.90
28458. Dennis (denniskoskei) 2 47.90 48.82 1 50.00
28459. tstats[pervez1020] (pervez1... 329 47.90 62.58 39 11.85
28460. MoonSpoon (moonspoon1337) 84 47.90 63.15 5 5.95
28461. Yuvraj (yoowee) 9 47.89 52.61 3 33.33
28462. Nitrogen (nitrogen_addict) 38 47.89 59.10 3 7.89
28463. Jakm (jahkm) 49 47.89 60.92 8 16.33
28464. Yo (krispykreme2012) 2 47.89 50.15 0 0.00
28465. lukas (preston_frag) 7 47.88 55.34 0 0.00
28466. B (sploops) 4 47.88 58.74 0 0.00
28467. Nandika (gzxccalibur) 18 47.87 53.21 3 16.67
28468. LordxChongo (lordxchongo) 12 47.86 62.71 7 58.33
28469. Jason (alfa871212) 22 47.86 57.44 5 22.73
28470. Mel (mel0214) 165 47.85 59.66 15 9.09
28471. himanshu (himanshukumar_ce) 39 47.85 60.52 4 10.26
28472. Nurdaulet (ashimbekov) 1 47.85 47.85 0 0.00
28473. Bryo (alta1r) 11 47.85 70.23 7 63.64
28474. hafizh (effortlesshuman) 608 47.85 70.07 51 8.39
28475. Pedrocas420 (pedrocas420) 2 47.85 48.32 0 0.00
28476. Prasanta (skyline049) 15 47.84 56.81 3 20.00
28477. Ali (alimron) 6 47.83 56.51 1 16.67
28478. Georgios (aktorion) 47 47.83 56.80 2 4.26
28479. Roger (walki_bv) 39 47.82 54.94 3 7.69
28480. Marzuq (itsmarzuq) 66 47.82 55.89 3 4.55
28481. Masquerade (fidtzy) 47 47.82 58.84 6 12.77
28482. vinoth0708 (vinoth0708) 570 47.82 77.10 59 10.35
28483. Christopher (codaki) 36 47.81 59.99 5 13.89
28484. Butu (butu) 1 47.81 47.81 1 100.00
28485. Yasunobu (yasunobu) 18 47.80 54.12 4 22.22
28486. jason (ihatewyoming) 6 47.80 62.44 4 66.67
28487. Moonlight (emn12) 2 47.80 51.70 0 0.00
28488. Asis (asis1998) 82 47.80 66.18 11 13.41
28489. Zhaparka (retsinnal) 9 47.80 57.95 0 0.00
28490. David (anakonda06) 4 47.80 51.24 1 25.00
28491. Edward (minecrafterman) 18 47.79 57.55 0 0.00
28492. M220 (m220) 1 47.79 47.79 0 0.00
28493. Nabil (nabil_lam) 53 47.79 70.11 4 7.55
28494. Royce (panda_7) 227 47.79 60.49 24 10.57
28495. Vannei (kymaz) 3 47.79 48.69 1 33.33
28496. X0137 (x0137) 4 47.78 53.52 0 0.00
28497. James (jfor8080) 3 47.78 49.97 0 0.00
28498. Sra1 (sra1) 4 47.77 55.40 0 0.00
28499. Liam (je1q) 138 47.77 64.13 17 12.32
28500. Kaplana (kaplana) 116 47.77 69.91 26 22.41
28501. Oliver (okay_google) 2 47.77 52.42 0 0.00
28502. Priyabrata (s_h_a_r_k) 21 47.76 53.66 2 9.52
28503. wpm + x (x_wpm_more) 21 47.76 56.55 1 4.76
28504. Karim (karim_ch) 1 47.76 47.76 0 0.00
28505. Hen_r.y (h_enry) 25 47.75 55.20 3 12.00
28506. Islam (iotegaliyev) 1 47.74 47.74 0 0.00
28507. Leonardo (finex2126) 160 47.74 65.33 18 11.25
28508. Ahmed (gemy_amin) 105 47.74 62.50 10 9.52
28509. bla3oss (bla_3oss) 4 47.73 54.30 0 0.00
28510. R3d (1ch1g0) 5 47.72 55.24 1 20.00
28511. SJ (sjmoon110718) 8 47.72 55.17 0 0.00
28512. Harry (harrythegreat9) 3 47.72 52.21 2 66.67
28513. Anthony (anthonyjhwu) 32 47.72 56.60 2 6.25
28514. ugly (uglygaming) 2 47.72 50.87 0 0.00
28515. eilonshi (eilonshi) 180 47.71 63.97 28 15.56
28516. Petapa Sakti (arief2014) 3 47.70 48.29 0 0.00
28517. Parnian (parnian) 19 47.70 56.28 0 0.00
28518. Milan (themilan) 4 47.70 50.31 0 0.00
28519. edward (edwardkarra) 8 47.70 66.00 5 62.50
28520. Serhii (pemakhov) 2 47.69 48.30 0 0.00
28521. lency (lencyb21) 16 47.68 55.06 2 12.50
28522. leah (leah8jean) 12 47.68 62.05 2 16.67
28523. Mohammad (mohammadkh) 2 47.68 49.74 0 0.00
28524. Scooty2Hooty (scooty2hooty) 6 47.67 50.80 1 16.67
28525. tstats[ravishankarr] (ravis... 877 47.67 69.41 96 10.95
28526. C (ciaram21) 5 47.67 51.13 1 20.00
28527. Ben (blob1010) 17 47.67 59.97 2 11.76
28528. Haxwhy (haxwhy) 3 47.66 50.77 0 0.00
28529. abdullah (abdullah3325569) 449 47.65 68.71 50 11.14
28530. Azriel (jing_long) 8 47.65 54.03 1 12.50
28531. Wiktor (wivvik) 45 47.64 60.21 5 11.11
28532. vion (evions) 29 47.64 66.10 2 6.90
28533. h1b80xwl0g1c (h1b80xwl0g1c) 15 47.64 51.18 1 6.67
28534. Ganesh (ganeshadsul) 5 47.63 53.46 2 40.00
28535. denis (j4yz11) 148 47.63 60.64 12 8.11
28536. Evan (bababooouy) 3 47.63 50.14 1 33.33
28537. Feniks (xfeniks) 2 47.62 49.24 0 0.00
28538. Ghulam (malikgd65) 211 47.62 70.61 20 9.48
28539. Las (laspil) 2 47.62 48.18 2 100.00
28540. Yan Yan (fatheryanyan) 5 47.61 52.06 1 20.00
28541. Ankit (ankp) 123 47.61 59.30 13 10.57
28542. Naol (naolchala) 4 47.61 58.71 1 25.00
28543. Nikki (yip14) 14 47.61 52.15 2 14.29
28544. Ahmed (ahmedkn) 2 47.60 47.82 0 0.00
28545. Amiro (amiro74) 13 47.60 52.70 7 53.85
28546. Tamjid (getrektfab) 9 47.59 54.10 2 22.22
28547. holymama (mykeyboardcrash) 6 47.58 53.54 0 0.00
28548. Flappy (flappysnake) 9 47.57 54.12 0 0.00
28549. Balloon (balloon75) 12 47.57 55.91 2 16.67
28550. JuaanNgemtod (juuaaaaan) 1 47.57 47.57 0 0.00
28551. Jonas (jonasjuni) 1 47.57 47.57 0 0.00
28552. Pui (suaingam) 8 47.57 61.61 0 0.00
28553. G (gtyper123) 28 47.56 60.45 5 17.86
28554. WHO (candleshands) 3 47.56 51.07 0 0.00
28555. d1r3ct0r (d1r3ct0r) 1 47.56 47.56 0 0.00
28556. kacper szybki (kacper1) 137 47.55 60.56 12 8.76
28557. Ruben (k3y5) 2 47.55 51.63 0 0.00
28558. Villan (v1llan) 21 47.54 54.75 2 9.52
28559. Miro7543 (miro7543) 8 47.54 56.35 1 12.50
28560. McMurdo42 (mcmurdo42) 6 47.54 56.49 1 16.67
28561. khaled (khaledmuhammad) 2 47.54 49.90 1 50.00
28562. 貧乏神 (hichkas_01) 339 47.53 69.09 39 11.50
28563. Filip (filipge) 12 47.53 54.71 1 8.33
28564. Classical (cl123) 9 47.53 56.91 1 11.11
28565. Anthony (fireant131) 1 47.52 47.52 0 0.00
28566. Evan (war_king) 5 47.52 53.10 1 20.00
28567. Ihor (_ihor) 118 47.52 60.02 15 12.71
28568. basil (1trying_to_be_fast1) 3 47.51 51.04 0 0.00
28569. Ethan (paprikapp) 6 47.51 62.13 0 0.00
28570. Afroz (afroz23) 18 47.50 55.85 2 11.11
28571. orangie (orangie_) 21 47.50 57.56 2 9.52
28572. ... (hirunaka) 5 47.49 53.03 2 40.00
28573. mamoud (__mahmoud__) 930 47.49 66.46 83 8.92
28574. DK ALONE (speed_typing) 50 47.49 62.38 4 8.00
28575. john (fadedrunner) 1 47.49 47.49 0 0.00
28576. Jan (de_necromancer) 33 47.49 60.21 5 15.15
28577. Bharat Kumar (bharat12345) 10 47.48 53.78 1 10.00
28578. D (davmarksman) 63 47.48 57.48 4 6.35
28579. rohit (rohitzerofour) 19 47.47 67.35 2 10.53
28580. Chiaki (chickhiaki) 191 47.47 68.55 18 9.42
28581. Leroy (breezytwitch) 5 47.47 52.80 0 0.00
28582. PeteJai (yupuiho) 14 47.47 57.47 0 0.00
28583. qwq (iomeow) 14 47.47 51.77 0 0.00
28584. Connor (congoman) 50 47.47 59.95 4 8.00
28585. BrocK (bhagvat17) 23 47.46 55.63 0 0.00
28586. Газиз (gazizaskar_) 13 47.45 56.19 0 0.00
28587. malis (monmalis) 6 47.45 55.04 0 0.00
28588. Garima (summerqueen15) 2 47.45 51.96 0 0.00
28589. Jeffryl (jeffryl26) 35 47.44 55.36 5 14.29
28590. Roper (ropergames) 97 47.44 75.03 8 8.25
28591. Slok (slokregmi___) 16 47.44 53.82 4 25.00
28592. aman (honeytyper) 6 47.43 51.20 0 0.00
28593. Sam An (liasss) 8 47.43 53.44 0 0.00
28594. PRINCE (princeamir) 3 47.43 49.13 1 33.33
28595. Justine (justine_02003) 23 47.42 61.22 1 4.35
28596. Daddy (badassabd) 26 47.42 64.22 4 15.38
28597. Shantanu (wckd1) 8 47.41 51.30 1 12.50
28598. vernon (harsha90571) 1 47.41 47.41 0 0.00
28599. Derek (derekomgmok) 3 47.41 49.77 0 0.00
28600. Ralph (rotifer_) 12 47.40 65.63 2 16.67
28601. Ferret (kingko) 11 47.40 55.87 1 9.09
28602. ItzInstinct (itzinstinct) 1 47.40 47.40 0 0.00
28603. Haley (21stcenturyasian) 16 47.40 57.95 0 0.00
28604. nirav (niravkaka) 2 47.39 53.16 0 0.00
28605. An (an_dtr) 24 47.38 58.87 1 4.17
28606. Eduardo (chekedu) 9 47.38 63.29 0 0.00
28607. BountifulFever5 (nguyenanhn... 10 47.38 50.27 1 10.00
28608. Ben (midnitekuro) 1 47.38 47.38 1 100.00
28609. Sha (wieng423) 1 47.38 47.38 0 0.00
28610. ammu (notammu) 14 47.38 57.88 3 21.43
28611. Naresh (learnrapid) 27 47.38 57.06 5 18.52
28612. Sahil (sahilb7) 18 47.37 60.08 3 16.67
28613. aryan (interestedpartridge) 3 47.37 48.85 0 0.00
28614. Tano (ccastro123) 1 47.35 47.35 0 0.00
28615. zafreeti (budexxx6) 4 47.35 55.26 0 0.00
28616. Gunter (gunter1963) 41 47.35 58.60 5 12.20
28617. Kong (qbored) 21 47.35 53.83 1 4.76
28618. Bad (badminton87) 10 47.34 65.76 2 20.00
28619. Iqbal Ahmad (iqbal2021) 242 47.34 66.06 27 11.16
28620. Bradley (bradleyjohnson) 4 47.33 53.71 0 0.00
28621. juliana (lilfl3shy) 37 47.32 54.72 5 13.51
28622. Abubakar (abubakaravg) 222 47.32 65.58 18 8.11
28623. sander (starkseven) 3 47.32 49.10 0 0.00
28624. Nathan (nathan_benedict) 3 47.31 57.59 1 33.33
28625. cj (frfrstopcappin) 4 47.31 52.13 0 0.00
28626. ChaosRelik (chaosrelik) 6 47.31 51.03 1 16.67
28627. Daniel (swampy28) 24 47.30 58.57 3 12.50
28628. hadi (hadisulfe) 988 47.30 70.68 101 10.22
28629. Elias (pgo_13) 4 47.29 61.83 1 25.00
28630. AttackKing (garypop) 17 47.29 53.59 3 17.65
28631. Lea (offset36) 3 47.28 55.61 0 0.00
28632. Mohamed (momo5482) 5 47.26 56.02 0 0.00
28633. Fedor (raxker) 42 47.26 53.67 1 2.38
28634. FA (fa00) 147 47.26 57.78 20 13.61
28635. Lah (friedrichzzz) 1 47.26 47.26 0 0.00
28636. KarstenPH (karstenplayz) 35 47.26 64.77 10 28.57
28637. The_rock (the_rock97) 25 47.25 61.99 2 8.00
28638. Philipp (phimaster0303) 1 47.25 47.25 0 0.00
28639. blue (blueisblue) 5 47.24 54.08 1 20.00
28640. sen (senoryx) 12 47.24 55.93 4 33.33
28641. Believer09 (believer09) 4 47.24 50.98 0 0.00
28642. Hankey (doodthenoodle) 2 47.22 50.96 1 50.00
28643. Rostislav (mexanoz) 47 47.21 62.70 4 8.51
28644. Livacy (livacy) 1 47.21 47.21 0 0.00
28645. Jinny (sctfgreentae) 4 47.20 50.99 0 0.00
28646. pwned (pwned1337) 284 47.20 63.14 41 14.44
28647. aditya (aditya1003) 223 47.19 56.89 20 8.97
28648. Jan (latino_dino) 12 47.18 54.15 0 0.00
28649. Lucia (lucialima) 32 47.18 56.25 2 6.25
28650. Thomas (447tomtom) 111 47.18 60.62 11 9.91
28651. Brayden (nerbray) 2 47.18 47.69 0 0.00
28652. Pratik (pratikwadhai) 6 47.17 52.78 2 33.33
28653. Tomasz (tserbinowski) 18 47.16 53.88 1 5.56
28654. Tomlynn (carriganth) 16 47.15 51.63 2 12.50
28655. Ecila246 (ecila246) 9 47.14 50.78 0 0.00
28656. Islam (islam_anwer) 10 47.14 55.32 1 10.00
28657. Panagiotis (asifo) 11 47.14 59.28 0 0.00
28658. Madi (madix00) 2 47.14 50.14 0 0.00
28659. Zo (mckinnie6245) 2 47.13 49.33 0 0.00
28660. Syed (hello_guest) 111 47.13 62.11 12 10.81
28661. Myron (piececontrol_inq) 17 47.13 53.19 3 17.65
28662. Darkchuby (chubyxdxd) 10 47.13 60.03 2 20.00
28663. Madi (fastcoder05) 15 47.12 53.16 0 0.00
28664. Rodrigo (rodplaying) 21 47.12 53.06 1 4.76
28665. Mohamed (mohamed_emara) 76 47.12 59.99 7 9.21
28666. adarshdhital007 (adarshdhit... 122 47.11 73.85 17 13.93
28667. Igor (ikrz) 2 47.11 48.01 1 50.00
28668. Ashraz (ashraz) 6 47.11 56.66 0 0.00
28669. Matthew (neropuncher) 1 47.09 47.09 0 0.00
28670. Jacob (jabub) 1 47.09 47.09 0 0.00
28671. evil007 (evil007) 172 47.08 66.58 18 10.47
28672. Leo (senpaileo) 3 47.08 50.98 0 0.00
28673. Atanas (aginev) 19 47.08 56.07 3 15.79
28674. hasan (hassan_yousefi) 3 47.08 48.68 0 0.00
28675. Guddu Jaisawal (suraj_6732786) 680 47.07 70.92 65 9.56
28676. Krishan Pal (kris987) 8 47.06 52.15 1 12.50
28677. Shaan (captainshaani) 20 47.06 59.55 5 25.00
28678. sahani prasad (sahani) 18 47.05 53.19 2 11.11
28679. ANDRAGOMOR (andrago_) 35 47.05 59.31 1 2.86
28680. Luke (lukethepuke) 20 47.04 54.23 1 5.00
28681. Lucifer (lucifer_96) 10 47.04 55.74 2 20.00
28682. Axlly (axlly) 5 47.04 51.20 0 0.00
28683. Toby (tobiasharry) 1 47.04 47.04 0 0.00
28684. BOOGIE (bobarex) 128 47.02 60.34 10 7.81
28685. Alireza (kolento79) 3 47.02 49.42 1 33.33
28686. Moin (iamrjrobin) 2 47.02 48.88 0 0.00
28687. Guest👽 (sinatraa68) 308 47.01 67.19 20 6.49
28688. jojo (starboi_) 1 47.01 47.01 0 0.00
28689. brum (feetlover) 2 47.01 51.17 0 0.00
28690. Mig (timenextluck) 24 47.00 58.99 4 16.67
28691. Aravinthan (aravinthan) 10 47.00 60.79 2 20.00
28692. typoMaster (tt_qureshi) 155 46.99 60.36 12 7.74
28693. Alberth (windwings) 2 46.99 56.80 2 100.00
28694. Aster (rodry37) 1 46.99 46.99 0 0.00
28695. Zamami (shadaokami) 117 46.98 62.74 11 9.40
28696. ☺☻☺ (yahyahoo) 4 46.98 50.82 0 0.00
28697. Rytis (rytux369) 2 46.98 49.31 1 50.00
28698. Roger (roger670) 1 46.97 46.97 0 0.00
28699. zfrxst (zfrxst0wpm) 2 46.97 57.07 0 0.00
28700. rick (alaric_saltzman) 4 46.97 50.37 0 0.00
28701. kx_167 (kx_167) 17 46.96 58.80 2 11.76
28702. ugi (ugiex) 6 46.96 58.87 1 16.67
28703. Kirill (mr_beer) 15 46.95 49.72 0 0.00
28704. Rajashekar (rajashekar0203) 4 46.95 50.89 0 0.00
28705. AmgdHussein (amgd_hussein) 45 46.95 55.74 5 11.11
28706. Mohammad (mohammadrokib) 4 46.95 50.68 0 0.00
28707. valeriu (valeriu) 18 46.95 52.89 1 5.56
28708. manikanta (manikanta35231) 2 46.95 48.58 0 0.00
28709. Arno (computer_9) 3 46.94 49.08 0 0.00
28710. Andrew (holocene_learning_d... 349 46.94 70.28 38 10.89
28711. Mrinal Anand (mrinal_anand) 623 46.93 63.65 61 9.79
28712. ur mom (soysaucesparkle) 1 46.93 46.93 0 0.00
28713. Helena (helenaa_26) 348 46.92 65.21 41 11.78
28714. Abda (abdaishere) 2 46.92 51.69 2 100.00
28715. The (the_phoenix) 8 46.92 52.48 0 0.00
28716. Jayanth (jayanththelegit) 144 46.91 64.69 12 8.33
28717. suaad (suaad) 25 46.91 56.53 2 8.00
28718. Summer (sccb_14) 10 46.89 54.56 8 80.00
28719. phasawat (puppaprubchok) 10 46.89 52.78 3 30.00
28720. Oliwer (financialojay) 9 46.88 52.64 3 33.33
28721. Fyfe (zitwitcool) 26 46.88 57.80 4 15.38
28722. manizman (amznima) 10 46.88 58.82 1 10.00
28723. MAYANK (mayank10) 27 46.87 54.25 2 7.41
28724. Kriss (smashingpinkey) 16 46.87 56.34 2 12.50
28725. Matt (mattmen) 55 46.87 68.13 3 5.45
28726. Sam (sam_a17) 5 46.86 57.14 0 0.00
28727. Antón (antoonn_07) 5 46.85 52.90 0 0.00
28728. steven (styper3030) 11 46.85 60.78 1 9.09
28729. Bibek (bibek_gautam) 2 46.85 48.61 2 100.00
28730. Andrew (acr21) 2 46.85 49.58 0 0.00
28731. abdullah (abdullah_foysal) 5 46.85 52.28 0 0.00
28732. rhinoracer (rhinoracer) 9 46.84 51.71 1 11.11
28733. ed81 (ed81) 53 46.84 55.30 6 11.32
28734. Olivier (racoon9009) 13 46.84 51.10 2 15.38
28735. Yuudai (zilchdear) 23 46.84 54.53 2 8.70
28736. bilegt (bilegtkka) 3 46.84 48.34 0 0.00
28737. Austin (auzzyauger) 17 46.83 56.19 0 0.00
28738. Dracule (deelipsingh77) 1 46.83 46.83 0 0.00
28739. zeroguard (z3r0gu4rd) 50 46.83 55.81 7 14.00
28740. ashiq hussain wani (ashiqwani) 141 46.83 58.56 14 9.93
28741. Angela (angela_typeracer) 289 46.82 67.20 24 8.30
28742. gram (imaginewastaken) 3 46.82 53.28 0 0.00
28743. teeradon (kimcahill) 2 46.82 50.34 0 0.00
28744. Imad (ikhan9059) 17 46.81 55.83 2 11.76
28745. Improwise (improwise) 4 46.81 57.01 2 50.00
28746. seabass (sebasawesome) 2 46.81 48.83 0 0.00
28747. Thomas (banone) 96 46.80 57.35 10 10.42
28748. Arsen (arsijo) 4 46.80 52.97 0 0.00
28749. jamal (jamalkhan651432) 230 46.78 61.93 21 9.13
28750. Neeschal (neeschal) 2 46.78 51.25 0 0.00
28751. Nat (natenat) 1 46.78 46.78 0 0.00
28752. Syrgak (syrgak) 6 46.78 52.19 0 0.00
28753. nahte (hawkzle) 31 46.78 61.20 6 19.35
28754. Nadia (nadiapun) 8 46.78 57.72 1 12.50
28755. Ahsin (abid1) 6 46.77 52.95 1 16.67
28756. Navid Sadeghi (navid_sadeghi) 102 46.77 62.15 40 39.22
28757. Arman (armashka_) 4 46.77 58.25 0 0.00
28758. Sagar (mystic0570) 7 46.77 54.53 0 0.00
28759. Ezra 🖤⛓ (blurr_yfa_ce) 10 46.77 51.09 1 10.00
28760. Fran (frannyg) 8 46.76 60.90 1 12.50
28761. Ishaan (ishaanmahajan) 40 46.76 56.86 24 60.00
28762. Michael (ozquez) 2 46.76 50.87 0 0.00
28763. sv (sv_1419) 45 46.75 56.05 3 6.67
28764. timo (tpkq) 1 46.75 46.75 1 100.00
28765. Mehrab (mehrab23) 4 46.75 58.65 0 0.00
28766. Adley (milf_slayer) 78 46.74 56.68 6 7.69
28767. Le (lenam12345) 269 46.74 69.89 20 7.43
28768. user_012 (tsitohaina) 81 46.73 57.43 19 23.46
28769. Dylan (yorkingharp67) 178 46.73 65.72 28 15.73
28770. Soham (soham_grover) 17 46.72 60.57 3 17.65
28771. Destiny (asaak) 10 46.72 55.39 0 0.00
28772. nigus (nuge_2425) 3 46.71 49.33 0 0.00
28773. Abok (aboookt) 3 46.71 54.58 0 0.00
28774. Gabriel (gfz1k) 3 46.70 49.01 0 0.00
28775. Arek (arekzaleski) 2 46.70 47.13 0 0.00
28776. Joe (joegoggin27) 3 46.69 48.96 0 0.00
28777. Cameron (lilcamwin) 8 46.69 54.35 0 0.00
28778. Celest (celestialpha) 24 46.69 61.26 3 12.50
28779. han (chenhan) 10 46.69 51.66 0 0.00
28780. xinhui (xinhuixu) 14 46.69 50.57 4 28.57
28781. Salma (chick_nugget) 2 46.69 47.05 1 50.00
28782. blahblah (pfftpftpfft) 3 46.68 48.41 0 0.00
28783. Nje (pettsonator) 3 46.68 48.01 0 0.00
28784. Neon (neonman6) 374 46.68 68.65 50 13.37
28785. Ram (laiforever) 31 46.67 55.48 3 9.68
28786. Naruto_Uzumaki (aeochs) 5 46.65 50.37 5 100.00
28787. rita (rita_mahato) 82 46.65 62.06 7 8.54
28788. segun (segun99) 16 46.65 54.38 1 6.25
28789. Srijonchi (srijonchi) 2 46.64 50.40 2 100.00
28790. OwenF (owenf) 30 46.64 72.39 0 0.00
28791. Danny ak7 (dannymr28) 1 46.62 46.62 0 0.00
28792. Dario (dariovondrasek) 72 46.61 57.65 9 12.50
28793. Parvez (parvez31) 91 46.60 57.86 14 15.38
28794. Louai (louai_zahran) 11 46.60 51.98 0 0.00
28795. Shivam (shivamgoyal241) 1 46.60 46.60 0 0.00
28796. Rowel Abrasado (hallelujahptl) 53 46.60 61.52 7 13.21
28797. mai (mai74) 184 46.60 62.15 18 9.78
28798. August (august148) 222 46.60 59.21 29 13.06
28799. Zac (zackiey) 6 46.59 53.44 2 33.33
28800. Sumzar (sumzar) 1 46.59 46.59 0 0.00
28801. tstats[qwerty443] (qwerty443) 9 46.58 54.27 1 11.11
28802. fosty (fostyfog) 19 46.57 62.62 5 26.32
28803. Raiko (vilo1) 17 46.57 53.96 3 17.65
28804. Atiar (pigonantibiotics) 6 46.56 49.92 0 0.00
28805. Marcin (cinekw) 1 46.56 46.56 0 0.00
28806. Mason (luvmasxn) 184 46.55 64.74 32 17.39
28807. Fahim (shahriar193) 3 46.55 50.20 1 33.33
28808. Hanif (amuza12) 1 46.55 46.55 1 100.00
28809. Ivan (loui127) 5 46.54 51.56 0 0.00
28810. clinkz (clinkkz) 5 46.54 49.09 0 0.00
28811. Emilyyyy (emilyyyy26) 13 46.53 58.56 2 15.38
28812. Dishant (dishant_10) 132 46.52 62.50 11 8.33
28813. sagar (sgr5) 93 46.52 59.06 12 12.90
28814. Aryaman (aryaman_verma) 476 46.52 62.82 37 7.77
28815. Predator (predator_01) 2 46.52 48.93 0 0.00
28816. cabell ֎ (cabell) 2 46.52 50.10 0 0.00
28817. leftmask35 (leftmask35) 20 46.51 54.27 2 10.00
28818. Mostafa (m2a_nj) 328 46.51 62.79 35 10.67
28819. m3dou_ (faheemmeharaj123) 13 46.49 84.24 6 46.15
28820. aveda (aveda) 1 46.49 46.49 0 0.00
28821. Jappie (jappiegrappie) 1 46.49 46.49 1 100.00
28822. maher (maherbmf) 16 46.49 59.05 2 12.50
28823. anonRED (somebody_red) 8 46.49 54.12 1 12.50
28824. Nam (thenewdawn97) 7 46.49 55.32 1 14.29
28825. reda (oncelearner) 2 46.49 50.81 0 0.00
28826. Maksym (branchofsin) 3 46.48 53.18 1 33.33
28827. Isabelle (catgirl_007) 6 46.48 48.95 0 0.00
28828. Shino (shinobami) 47 46.48 58.53 4 8.51
28829. Staris (starix) 6 46.47 56.17 0 0.00
28830. Orlando (ultraonlinexd) 10 46.47 61.79 0 0.00
28831. ziad (ziadbensaada) 111 46.47 65.15 6 5.41
28832. Anthony (pacho_11) 1 46.47 46.47 0 0.00
28833. pedro (pmedley) 153 46.45 61.03 10 6.54
28834. Mahir (mahirafnan) 13 46.45 52.94 2 15.38
28835. Maysa (maysa_27) 1 46.45 46.45 0 0.00
28836. raegan (rotoole15) 3 46.44 49.74 0 0.00
28837. sɯɐ (einzu) 11 46.44 56.55 0 0.00
28838. Sahil (chazos) 11 46.44 51.71 3 27.27
28839. Bruno (runichan) 3 46.44 48.58 0 0.00
28840. Treeler (trackertree) 3 46.43 54.96 0 0.00
28841. meowskullsfeetfreaks (k7x1e) 3 46.43 51.92 3 100.00
28842. Vipin (kumarvipin) 17 46.43 54.09 1 5.88
28843. Almas (almas016) 58 46.43 54.00 10 17.24
28844. naige (pnolan55) 47 46.41 56.33 4 8.51
28845. 白起小哥哥 (45989871) 14 46.41 60.91 2 14.29
28846. Oscar (oscardangal) 3 46.40 49.84 0 0.00
28847. Msdon (masonarg) 3 46.40 46.76 0 0.00
28848. Dios (gembili666) 6 46.39 53.93 6 100.00
28849. fares (faressonar) 226 46.39 63.08 24 10.62
28850. Sion (retardation69) 59 46.39 55.17 5 8.47
28851. Alex (aalleexx1) 9 46.38 56.81 0 0.00
28852. rahul (rku05) 208 46.38 63.97 22 10.58
28853. rea (trying_to_get_better) 1 46.38 46.38 0 0.00
28854. Hcaz (gosuperzach) 11 46.38 55.27 3 27.27
28855. Aaron (aaronoct) 7 46.38 55.11 0 0.00
28856. Jonathan (joniln) 2 46.38 48.76 1 50.00
28857. Daniel (danoco) 12 46.37 53.78 0 0.00
28858. aimas (aimas) 6 46.35 48.76 1 16.67
28859. Samuel (sambabzz) 754 46.34 68.51 65 8.62
28860. rishi (rishiwho) 1 46.34 46.34 0 0.00
28861. Edith (edith44) 4 46.34 57.52 0 0.00
28862. Twix (commit147) 4 46.34 52.22 1 25.00
28863. Tanishq (lovely_singh) 3 46.34 48.31 1 33.33
28864. levi (levi2) 1 46.34 46.34 1 100.00
28865. Muhammadsiddiq (muhammadsid... 24 46.34 54.97 4 16.67
28866. Mukklan (mukklan) 4 46.34 55.93 1 25.00
28867. Boog (pinchejoseph) 58 46.33 59.24 13 22.41
28868. Sarang (sargfromind) 31 46.32 57.91 4 12.90
28869. Mobinul (mobinhmmh1) 91 46.32 53.13 7 7.69
28870. Garrett (ezekiel6430) 5 46.32 51.63 0 0.00
28871. huge (xxxtentaciontrippiere... 10 46.31 58.45 2 20.00
28872. Bogdan (bartfast42) 11 46.30 51.02 1 9.09
28873. avisheek (avisheek) 30 46.30 84.29 1 3.33
28874. MD Shahadat Hossain (md_sha... 60 46.29 56.41 8 13.33
28875. Le Linh (linhkhanhslee) 12 46.29 55.39 1 8.33
28876. Tyler (failuretolaunch) 3 46.29 49.73 0 0.00
28877. NongAugust (augustzuz) 6 46.29 54.44 3 50.00
28878. Anil (anil1631988) 10 46.29 57.44 2 20.00
28879. Che (klimkeyboard) 3 46.28 51.60 0 0.00
28880. Andrew (andrewdanoob) 3 46.28 51.53 0 0.00
28881. Callum (cblake2205) 1 46.27 46.27 0 0.00
28882. Nate (highvoltage32) 1 46.27 46.27 0 0.00
28883. Guus (untitledgoos) 3 46.27 49.49 1 33.33
28884. Aru (s3rikbaeva) 37 46.26 61.90 5 13.51
28885. Lukas (barorak) 3 46.26 49.03 0 0.00
28886. SOme (coolhacker420) 4 46.26 49.61 0 0.00
28887. Arshad (o0arshad0o) 8 46.25 50.76 0 0.00
28888. Akeisara (ake_e_e) 79 46.24 56.67 9 11.39
28889. Om (thiscuriousbeing) 4 46.23 49.85 1 25.00
28890. sys (sysuser) 171 46.22 57.02 11 6.43
28891. Pavel (curlink) 3 46.22 48.53 0 0.00
28892. angula (dixiehugh) 3 46.21 49.63 0 0.00
28893. Shreyan (sdutta4) 1 46.21 46.21 0 0.00
28894. Xcentrick (hardiksince1987) 7 46.21 56.73 0 0.00
28895. Tyson (tysonking33) 27 46.20 59.86 0 0.00
28896. ana (anachokheli) 27 46.19 57.77 1 3.70
28897. Prashant (pra0337) 184 46.19 59.84 14 7.61
28898. pog (big_dick_ron27) 2 46.18 50.26 0 0.00
28899. Ajay (ajay_sharma) 2 46.18 47.94 0 0.00
28900. Gomelx (gomelx) 2 46.18 47.93 0 0.00
28901. Noob (bloodylord) 41 46.17 63.67 11 26.83
28902. Glen (alabaster45) 391 46.16 60.31 34 8.70
28903. Raakulan (raakulan_94) 72 46.15 55.56 6 8.33
28904. Mahfuz (almahfuz) 3 46.15 49.71 1 33.33
28905. Charon (just_you_and_me) 300 46.15 58.80 31 10.33
28906. Jweel (jweel_kar) 31 46.14 55.89 4 12.90
28907. Sophie (sophbee) 1 46.14 46.14 0 0.00
28908. tstats[an1ma] (an1ma) 22 46.13 57.44 2 9.09
28909. Darin (darin_ss) 27 46.12 65.96 1 3.70
28910. Ariful (arifulhaque24434) 317 46.11 59.56 35 11.04
28911. Abdulla (coldeye3) 3 46.10 53.27 1 33.33
28912. tstats[f6rz9d] (f6rz9d) 5 46.10 51.26 0 0.00
28913. Anna (slewa) 92 46.10 57.98 5 5.43
28914. mahmoud (mzridi) 106 46.10 56.89 9 8.49
28915. juggy (cannary) 56 46.10 61.48 6 10.71
28916. My fingers are so damn fat ... 2 46.09 46.32 0 0.00
28917. deepak (fireyfingers) 98 46.09 60.31 6 6.12
28918. sunil (sunilislaz) 46 46.08 74.78 6 13.04
28919. maickel (maickelkuhhh) 4 46.07 50.19 0 0.00
28920. Dulat (shershen) 3 46.06 50.68 0 0.00
28921. gia hân (giahannguyenhoang) 1 46.05 46.05 1 100.00
28922. ✧・゚: * Kiks (nikki338) 2 46.05 46.26 0 0.00
28923. Kasidit (ganadosa) 97 46.05 58.89 6 6.19
28924. Nurlanbek (xtil_06) 164 46.04 58.91 8 4.88
28925. nikole (nmkxos) 9 46.03 53.71 2 22.22
28926. Thomas (proff001) 1 46.03 46.03 0 0.00
28927. ELGstud (elg_stud) 24 46.02 58.15 2 8.33
28928. alberto (th3biscuit) 45 46.02 59.03 6 13.33
28929. G L O O M Y (gloomy24) 90 46.02 57.15 6 6.67
28930. Ammar (s_ammar) 111 46.01 58.12 12 10.81
28931. ando (hophosho) 1 46.01 46.01 0 0.00
28932. dimcho (dimisoma12) 7 46.00 51.92 0 0.00
28933. Linkso (linkso) 4 45.99 48.80 0 0.00
28934. number1 (number1racer) 21 45.99 54.31 2 9.52
28935. Gwen (planetzero) 39 45.99 60.23 4 10.26
28936. Aditya (aditya_trans63) 2 45.99 46.31 0 0.00
28937. jupiter (joaelis) 20 45.98 72.31 2 10.00
28938. clover (fat_baby_hippo_312) 166 45.98 73.16 18 10.84
28939. Yogesh (yogesh9770) 32 45.98 70.07 4 12.50
28940. Tobi_Uchiha_Rama (tobi_uchi... 56 45.98 55.22 9 16.07
28941. Peter (petepp) 251 45.97 62.30 25 9.96
28942. Justin (05justino) 1 45.96 45.96 0 0.00
28943. presu (kanjotribe) 1 45.96 45.96 1 100.00
28944. Pharrell (pharrell000000) 58 45.96 65.41 8 13.79
28945. Sebastian (clicthekeys) 26 45.95 75.91 0 0.00
28946. Zozvo (zozvo) 15 45.95 60.35 1 6.67
28947. Tawan (tawans) 1 45.94 45.94 0 0.00
28948. Aditya (aditya1024) 6 45.94 48.46 0 0.00
28949. N (lin_snarp) 31 45.93 60.44 3 9.68
28950. jelos0n (jelos) 1 45.92 45.92 1 100.00
28951. Knight (knightfury18) 7 45.92 55.04 1 14.29
28952. Elius H Himel (eliushhimel) 8 45.91 52.79 0 0.00
28953. Peyush (peyush) 20 45.90 55.42 2 10.00
28954. Richie (richiemoring) 41 45.90 58.78 2 4.88
28955. Kacsa (kacsa_janos) 354 45.90 67.84 39 11.02
28956. Shamseer (shamsu) 86 45.89 62.67 11 12.79
28957. Stazenko (stazenko) 6 45.89 50.35 0 0.00
28958. Bong (bongman48) 18 45.89 58.47 2 11.11
28959. Astro (astro_here) 6 45.88 51.53 1 16.67
28960. Ahmad (ahmad770) 18 45.87 59.17 2 11.11
28961. Kuchiro (lalelilolu) 1 45.87 45.87 0 0.00
28962. Afzaal (afzaalahmad) 20 45.86 59.37 3 15.00
28963. G00N (600n) 7 45.85 51.56 0 0.00
28964. Tarun (tarun6119) 15 45.85 53.58 2 13.33
28965. Brendon (brenster) 25 45.85 63.78 1 4.00
28966. Ggg243 (ggg243) 1 45.84 45.84 0 0.00
28967. Henrique (henri3287) 52 45.84 56.94 3 5.77
28968. joshua (joshunatoir) 3 45.83 48.56 0 0.00
28969. Dimitar (mitronix) 7 45.83 58.62 1 14.29
28970. Quinco (quinco) 48 45.83 61.29 5 10.42
28971. Bao Han (lilhaan48) 2 45.82 46.71 2 100.00
28972. veer pratap singh (_veerpra... 73 45.82 56.22 28 38.36
28973. Betelgeuse (betelgeuse2310) 40 45.81 60.24 2 5.00
28974. Fred (fcbsd) 9 45.81 55.29 3 33.33
28975. vbk (vbk_) 433 45.78 65.26 44 10.16
28976. neo (neo007) 3 45.78 48.02 0 0.00
28977. Khusan (khusan) 65 45.76 59.99 12 18.46
28978. fast (fasttyper3256) 1 45.75 45.75 0 0.00
28979. ObsessiveDuck09 (obsessive_... 4 45.74 48.59 0 0.00
28980. Dhruv (codenta) 788 45.74 66.54 72 9.14
28981. Iftakhar (tanvir021) 19 45.74 51.75 1 5.26
28982. Stranger (stranger_danger1224) 22 45.73 62.99 1 4.55
28983. jinye (jinye) 2 45.73 47.15 0 0.00
28984. abdullah (abdullahomg77) 1 45.72 45.72 1 100.00
28985. Arefin (afrabby) 6 45.72 47.05 0 0.00
28986. AgentGameknight (gameknight... 1 45.71 45.71 0 0.00
28987. Ashutosh (free_electron) 1 45.71 45.71 0 0.00
28988. anjerukare (anjerukare) 1 45.71 45.71 1 100.00
28989. Lilah (livymud) 20 45.69 50.64 5 25.00
28990. Amara (vainguardian29) 7 45.69 53.44 0 0.00
28991. Robbie (idkloltype) 34 45.68 56.43 4 11.76
28992. Vinit (vspundir) 22 45.68 55.23 1 4.55
28993. Julian (julianmonk) 3 45.68 50.09 0 0.00
28994. Gleb (ari10000krat) 1 45.68 45.68 0 0.00
28995. William (billiam98) 4 45.68 55.55 0 0.00
28996. Matthew (matthew_sellens) 5 45.67 56.02 1 20.00
28997. Muhamed (hjewdjsdjsdjs) 13 45.66 50.38 1 7.69
28998. Vijay S (lord_viju) 13 45.66 53.24 1 7.69
28999. Rachel (rachel_chu) 4 45.66 48.45 1 25.00
29000. kaydence (smhkaydence) 8 45.66 51.97 1 12.50
29001. subham (syt03) 792 45.64 64.98 99 12.50
29002. Pavel (pavelko) 13 45.63 53.63 3 23.08
29003. Pluto (pluto_the_typer) 6 45.62 48.11 0 0.00
29004. Garv (garvgopalia) 13 45.62 52.92 2 15.38
29005. Mehmed (mehmed_) 7 45.62 54.48 1 14.29
29006. João (d4rkdreamspt) 4 45.60 53.12 0 0.00
29007. Leon (leon882888) 3 45.60 47.40 0 0.00
29008. Joel (unwono) 2 45.59 45.63 1 50.00
29009. Hackai (hackai) 24 45.58 57.47 4 16.67
29010. Diogo (diogosilva) 11 45.58 51.08 1 9.09
29011. Your (numiko) 1 45.58 45.58 0 0.00
29012. Tony (adbaldini) 124 45.57 59.79 9 7.26
29013. kosmonautas (spacepeasant) 4 45.57 51.25 0 0.00
29014. DABBER (dabber2) 1 45.56 45.56 0 0.00
29015. Wasif (waxif_dad) 216 45.56 63.11 26 12.04
29016. Brian (brianlii) 5 45.56 51.58 1 20.00
29017. Annie (caroullri6) 6 45.55 53.07 0 0.00
29018. Touhid (touhid23du) 8 45.55 52.03 0 0.00
29019. Shashi (shashianand230) 420 45.54 61.30 51 12.14
29020. Ahmed (killer549) 3 45.54 47.39 1 33.33
29021. Ramazan (kalash) 3 45.54 49.26 0 0.00
29022. Aleksije (jastar) 42 45.53 58.60 8 19.05
29023. Sidharth (_ceres_) 150 45.53 57.20 12 8.00
29024. Chris (tschy) 65 45.52 58.67 5 7.69
29025. Ash (rndmash) 5 45.51 48.14 1 20.00
29026. Abdullah (abdullahshah_) 34 45.51 55.04 1 2.94
29027. Sultan (sultanbro) 16 45.50 52.54 2 12.50
29028. jacob (jacobshane) 1 45.50 45.50 0 0.00
29029. Hugo (hugosaer) 1 45.49 45.49 1 100.00
29030. Vinicius (vidal404) 1 45.49 45.49 1 100.00
29031. Chris (s3r4ph) 23 45.49 59.01 2 8.70
29032. Sat (satwargamer) 6 45.49 52.39 1 16.67
29033. Nicole (nickizard) 40 45.48 69.96 3 7.50
29034. avocadoLover (avocado_lover) 190 45.48 74.11 22 11.58
29035. Kavita (kavita_chaubey) 9 45.48 50.76 0 0.00
29036. duniel (danieljonghyun) 2 45.47 46.72 0 0.00
29037. Sarthak (sarthak_dms) 1 45.47 45.47 0 0.00
29038. celia (ghettogarbagemonster) 3 45.46 54.83 1 33.33
29039. emily (em0p6) 61 45.46 57.24 31 50.82
29040. Cyrus (cyrusnthng) 24 45.46 59.36 2 8.33
29041. O (oking167) 5 45.46 49.43 0 0.00
29042. Jáky (jaky_) 33 45.45 53.33 4 12.12
29043. Ashish (ashish_m) 13 45.45 49.79 3 23.08
29044. Pasta_Devoured (pasta_devou... 19 45.44 52.68 17 89.47
29045. lynn (lynno) 1 45.44 45.44 1 100.00
29046. Scott (chivalrousbanana) 54 45.44 57.59 4 7.41
29047. Coffee Boy (xuantungbrian) 43 45.43 53.92 1 2.33
29048. Tris (karma_nii) 1 45.43 45.43 0 0.00
29049. Roberto (soniic99) 109 45.43 61.69 10 9.17
29050. Eslam (eslamalien) 22 45.43 54.72 2 9.09
29051. Abhishek (erabh) 44 45.41 56.49 9 20.45
29052. Robert (robville804) 1 45.41 45.41 0 0.00
29053. James (youngthe) 38 45.40 55.40 4 10.53
29054. Gholamreza (rezadar) 4 45.40 51.81 0 0.00
29055. Ryan (dandaflaff) 21 45.39 58.45 2 9.52
29056. bayu (bayun2445) 27 45.38 55.99 2 7.41
29057. Anton (amsavchenko) 2 45.38 45.69 0 0.00
29058. jooonyh (johnfast) 6 45.38 55.20 0 0.00
29059. Sahil (sahilmandoliya) 9 45.37 53.15 0 0.00
29060. Hadriel (evo_echo) 6 45.37 54.66 1 16.67
29061. Nrimanta (nwiziyanow) 45 45.37 63.69 12 26.67
29062. Abhinav (dudeja55) 5 45.35 51.75 0 0.00
29063. Daulet (m_daulet) 13 45.34 54.88 2 15.38
29064. David (zybazoubek) 6 45.33 56.70 0 0.00
29065. Exoticz (exoticzonyt) 2 45.32 46.75 1 50.00
29066. Namaztak (namaztak) 2 45.32 52.06 0 0.00
29067. Viktor (niktor76) 8 45.31 53.59 1 12.50
29068. Burhanuddin Merchant (burza) 1 45.31 45.31 0 0.00
29069. Feruz (akhbekdev) 59 45.31 56.41 6 10.17
29070. Mykola (mykolatkachuk1231) 2 45.31 47.30 0 0.00
29071. zaman (kzaman) 5 45.30 52.11 0 0.00
29072. XFootballManX (meme_licker_21) 10 45.30 53.26 0 0.00
29073. SWAPAN (dapana610) 13 45.30 53.35 1 7.69
29074. Jakub (scrappycz) 3 45.29 47.29 0 0.00
29075. Abdul (netf121212) 13 45.29 52.81 2 15.38
29076. Philipp (dasdrache) 221 45.29 57.92 22 9.95
29077. van (van8878) 10 45.29 54.38 0 0.00
29078. Zia (zia1) 113 45.28 66.04 6 5.31
29079. imtrash (kipakers) 1 45.28 45.28 0 0.00
29080. David (barrard) 4 45.28 48.89 0 0.00
29081. Redheesh (redheeshrj) 4 45.27 49.33 0 0.00
29082. Azad ul Kabir (akash455) 4 45.27 55.70 1 25.00
29083. devansh (speedcuber05) 23 45.27 54.06 4 17.39
29084. Clay Cain (fredrafferty) 30 45.26 55.43 2 6.67
29085. Shohidujjaman (sajib975) 35 45.26 56.39 33 94.29
29086. G (goutham_k) 143 45.25 59.16 13 9.09
29087. ZestyFilmCreations_YT (tris... 2 45.25 51.16 0 0.00
29088. Yeeet (flamestar21) 17 45.24 56.30 4 23.53
29089. Marko (markodob) 171 45.23 58.88 12 7.02
29090. Youc (youc_tagh) 1 45.23 45.23 0 0.00
29091. bella (bella4088888888) 103 45.23 57.43 53 51.46
29092. Dennis (dwiebe) 16 45.22 55.19 3 18.75
29093. Tristan (trist4n2005) 1 45.22 45.22 0 0.00
29094. snake_case (_snake_case) 115 45.22 54.77 5 4.35
29095. Brandon (brandonabsent) 4 45.21 57.25 0 0.00
29096. Master (master_2010) 111 45.20 60.91 10 9.01
29097. Auzem (auzem) 1 45.20 45.20 0 0.00
29098. Faizan Ali (faizanii) 15 45.20 58.41 2 13.33
29099. Simon (mosie) 9 45.20 53.26 3 33.33
29100. oussama (oussama2000) 1,495 45.19 62.04 141 9.43
29101. Sticfigure (sticfigure) 10 45.19 50.61 1 10.00
29102. Zeyad (zeyad_mohamed) 130 45.17 58.82 12 9.23
29103. arryacc (arryacc) 14 45.17 49.87 2 14.29
29104. skepsi87 (skepsi87) 29 45.16 58.23 5 17.24
29105. Luc (darth_luc) 28 45.16 60.29 2 7.14
29106. Todd (cooldude_69) 65 45.16 57.99 3 4.62
29107. Muhammad Shobuz (mr_uranus) 2 45.16 51.96 0 0.00
29108. Dan (dstreety) 3 45.15 51.13 1 33.33
29109. Sakko (sakko_) 1 45.15 45.15 0 0.00
29110. Phuong Anh (smallcat2020) 9 45.14 50.55 6 66.67
29111. Arthur (agouraptor) 39 45.13 60.46 2 5.13
29112. ryan jason (kapsutka) 8 45.12 53.59 0 0.00
29113. Nikita (zubrailx) 6 45.11 49.17 0 0.00
29114. tstats[arjav_jain] (arjav_j... 3 45.11 45.93 0 0.00
29115. Rahim Abdur (arbijoy1717) 174 45.10 55.32 14 8.05
29116. Big (big_peen_budhai) 6 45.09 49.75 1 16.67
29117. SlyBlue (slyblue) 4 45.09 48.42 0 0.00
29118. paschalis (platoon132002) 18 45.08 48.92 4 22.22
29119. Julish (julish13) 613 45.08 59.66 58 9.46
29120. Jayden (bluuser) 6 45.08 52.59 0 0.00
29121. Jannik (jako79) 5 45.07 48.81 2 40.00
29122. Farzaan (farzaan) 7 45.07 48.74 1 14.29
29123. Stefan (stefan_150) 5 45.06 47.19 2 40.00
29124. archer (archerlkm) 18 45.06 54.93 3 16.67
29125. Amanda (111_amanda_111) 13 45.06 59.62 0 0.00
29126. sam (samx90s) 9 45.05 53.84 1 11.11
29127. Ra (rapenting) 1 45.05 45.05 0 0.00
29128. Sajal (sajal0809) 39 45.05 55.95 3 7.69
29129. Elias (itzner) 14 45.04 59.21 3 21.43
29130. Muhammed (naseebnex) 5 45.02 48.73 0 0.00
29131. zach (zdub25) 1 45.02 45.02 0 0.00
29132. starscr3am (starscr3am) 7 45.02 50.24 0 0.00
29133. Dustin (hyper_explosive) 6 45.02 50.09 0 0.00
29134. @abdmhamzah (abdmhamzah) 3 45.01 65.30 0 0.00
29135. Sinai (sinaifonseca) 2 45.01 46.20 0 0.00
29136. Velislav (disaster_veli) 9 45.01 49.39 1 11.11
29137. mapieko (mapieko) 13 45.00 52.55 1 7.69
29138. Amdadul (imlak) 36 45.00 59.61 3 8.33
29139. Keihlan (keihlan) 16 45.00 52.82 0 0.00
29140. Ramiro (baginius3000) 3 44.99 54.82 0 0.00
29141. Ashen (ashen12) 2 44.99 51.97 0 0.00
29142. kizzgotnorest (kizznorest) 7 44.99 51.53 2 28.57
29143. Madiyar (mightymadik) 3 44.98 45.89 0 0.00
29144. ellie (ellmell13) 49 44.98 58.14 4 8.16
29145. Tormod (tormodfh) 74 44.98 57.24 5 6.76
29146. Arshavir (arshavir777) 6 44.96 48.89 0 0.00
29147. POZ (poooz) 7 44.95 49.30 0 0.00
29148. Murtaza (chichawww) 22 44.95 57.21 1 4.55
29149. Abhilash (abhilash_kumar) 6 44.95 57.01 1 16.67
29150. Mahmudul (mahmudul_hhh) 20 44.95 56.64 3 15.00
29151. Mena (mony40) 106 44.95 58.70 13 12.26
29152. parker (withouthue) 8 44.95 55.55 0 0.00
29153. Ivo (ruberiot) 5 44.95 49.89 0 0.00
29154. BOOST~~~ (somen_chandra) 46 44.94 59.62 6 13.04
29155. Jmin (gillf) 5 44.94 48.57 0 0.00
29156. Zhamshid (Jam1lbek) (jam1lbek) 69 44.94 61.14 12 17.39
29157. eyosias (eyosi_sol) 5 44.93 53.05 3 60.00
29158. haugust (haugust) 2 44.93 47.50 0 0.00
29159. Varkhim (searsokvarkhim) 4 44.93 49.47 1 25.00
29160. john mat (john_mat) 16 44.92 57.52 0 0.00
29161. P. Leboid (eccentricpleboid) 10 44.91 56.60 0 0.00
29162. Ivan (vanchi822) 3 44.90 51.44 0 0.00
29163. Theo (monkeytheo) 6 44.89 48.81 1 16.67
29164. Dmitrii (typescore) 54 44.89 59.06 12 22.22
29165. Eldritch (ficuno) 47 44.89 64.24 4 8.51
29166. Kriss (iamkriss) 4 44.89 47.96 0 0.00
29167. Manmohan (reattempt) 1 44.88 44.88 0 0.00
29168. Rahaf (rahafalahdab) 243 44.88 57.00 25 10.29
29169. anshika (anshi_ka) 5 44.87 54.18 0 0.00
29170. amine (aminerdene17) 7 44.86 50.51 0 0.00
29171. Muhammad (muhammad95959) 50 44.84 52.48 7 14.00
29172. NIETian (tushgaurav) 17 44.84 54.75 10 58.82
29173. Sad1y (sad1y) 3 44.83 49.26 1 33.33
29174. Asif ur rahman (asif_ur_rah... 15 44.83 56.60 2 13.33
29175. Nakul (nakush) 5 44.81 47.02 0 0.00
29176. AYOUB (ayoub_dkhissi) 170 44.81 59.13 29 17.06
29177. Sam (sama13) 6 44.80 51.12 1 16.67
29178. Surya (shanky_111) 56 44.80 57.17 4 7.14
29179. anpan (anpann) 10 44.80 55.90 3 30.00
29180. aeriall (icebear123) 1 44.80 44.80 1 100.00
29181. Lefos (lefos357) 8 44.79 49.90 1 12.50
29182. Omik (litynity) 39 44.79 61.33 7 17.95
29183. Carmondai (carmondai) 83 44.78 53.04 5 6.02
29184. xchli (xchli) 2 44.78 50.05 0 0.00
29185. Dejan (paranoid112122) 12 44.78 52.58 2 16.67
29186. Gustave (_stavegu_) 1 44.77 44.77 0 0.00
29187. Yaroslav (yasi04) 1 44.76 44.76 1 100.00
29188. shavalli (shavalli) 76 44.75 59.47 7 9.21
29189. alaa (alaa_eddin) 96 44.75 53.13 16 16.67
29190. Sam (sam_0) 1 44.74 44.74 0 0.00
29191. rajan (rajan_singh123) 33 44.73 53.91 22 66.67
29192. ugur (u280) 5 44.72 46.42 0 0.00
29193. sayed (sayedeesam) 404 44.72 58.89 42 10.40
29194. Parth (cracker2111) 56 44.72 61.90 7 12.50
29195. Mahbub (mahbubdev) 14 44.72 54.29 0 0.00
29196. laptop (laptopsakti) 9 44.72 46.66 2 22.22
29197. Jamshidbek (jamshid_4510) 21 44.72 51.70 8 38.10
29198. Abudlla.Marofi04 (jonsnow21) 214 44.71 58.46 25 11.68
29199. Arpit (demonnboy) 2 44.71 45.10 0 0.00
29200. Aeriana (aer000) 37 44.70 57.57 3 8.11
29201. Amirzhan (dungeon_beast13) 95 44.70 55.07 13 13.68
29202. nvmabotthat (quack_yena) 2 44.70 44.86 1 50.00
29203. RacerTracer (racertracer) 200 44.69 63.25 14 7.00
29204. ekupro (ekupro) 19 44.68 51.89 2 10.53
29205. manorosandy (ster_sandys) 2 44.68 47.09 1 50.00
29206. Mattias (matejko203) 203 44.67 64.95 18 8.87
29207. Seany (yaboiseanyt) 6 44.67 54.70 0 0.00
29208. askeladd (askeladd_619) 274 44.67 58.97 24 8.76
29209. Thien Nam Anh (benvu3005) 63 44.66 56.34 3 4.76
29210. Lego (outboxer009) 32 44.65 51.82 3 9.38
29211. poornoday (poornoday) 24 44.64 52.55 3 12.50
29212. Shubham (shubham2007) 38 44.64 60.49 1 2.63
29213. jacie (jackieblackie3) 7 44.63 49.30 0 0.00
29214. Kian (kian32) 333 44.63 56.51 41 12.31
29215. Gabriel (gabrielot) 17 44.63 52.55 7 41.18
29216. Vinay (noob101098) 2 44.63 45.53 1 50.00
29217. jimmy (jimnish) 9 44.62 49.44 1 11.11
29218. Soua (technogunn) 1 44.62 44.62 0 0.00
29219. Vinay (devinay) 4 44.61 48.26 2 50.00
29220. Carlota (carlota02) 2 44.61 45.87 0 0.00
29221. NongKao (thisiskao09) 14 44.60 51.80 2 14.29
29222. Challenger (challenger21008) 5 44.59 45.90 0 0.00
29223. SPACE (spacegamer428) 14 44.58 54.05 2 14.29
29224. Bilal (maxty) 7 44.57 56.16 1 14.29
29225. Safi (safiikram) 51 44.56 55.00 5 9.80
29226. no (khomi) 1 44.54 44.54 0 0.00
29227. Thijs (qazygv) 193 44.54 63.88 18 9.33
29228. Nero (ner0plu3) 1 44.52 44.52 0 0.00
29229. Attila (attila1) 64 44.52 54.91 5 7.81
29230. Adrian (evadetoxinz) 10 44.52 55.32 2 20.00
29231. I'm Slow : (daiplatinue) 4 44.52 53.01 2 50.00
29232. BareDK (baredk) 2 44.52 44.90 2 100.00
29233. merc824 (merc824) 3 44.51 48.94 0 0.00
29234. zayden (zaydenz12) 5 44.51 55.42 0 0.00
29235. squishyiop (squishyiop) 21 44.51 62.06 1 4.76
29236. Atomic (atomicf) 76 44.50 70.81 18 23.68
29237. Rouven (therealr5) 129 44.49 58.46 14 10.85
29238. army (armygirl123) 17 44.48 54.38 1 5.88
29239. mashrafi (qweer) 91 44.48 58.57 9 9.89
29240. ErrorOp (error_op) 195 44.48 63.07 19 9.74
29241. Bunbund (blorfo) 7 44.47 46.30 0 0.00
29242. iosif (y_o_s) 115 44.47 62.54 8 6.96
29243. Vilantas (zenblax) 33 44.47 49.97 7 21.21
29244. TrOn (tron_691) 21 44.46 50.92 1 4.76
29245. Pasindu (pasindusandima) 1 44.46 44.46 0 0.00
29246. Tata (patata_tata) 3 44.46 47.49 0 0.00
29247. JC (joker801) 29 44.46 49.46 2 6.90
29248. Lucius (spirituslucius) 7 44.45 53.26 0 0.00
29249. daniel (danfinch07) 30 44.44 52.86 4 13.33
29250. Anisath Kirubakaran (anisath) 33 44.44 52.69 4 12.12
29251. average (average_dude) 3 44.44 47.93 0 0.00
29252. Petros (petros2711) 5 44.43 48.72 1 20.00
29253. Brayan (bassclefly) 5 44.43 48.82 1 20.00
29254. Big (beanbeanbean123) 14 44.41 50.10 0 0.00
29255. abdelrahman (muslim21) 1 44.41 44.41 0 0.00
29256. dvorak (dvorak0211) 117 44.41 68.11 16 13.68
29257. Marni (marniparnie) 67 44.41 60.24 5 7.46
29258. TruffleJr (silvqrfrost) 15 44.40 49.69 1 6.67
29259. Тагир (nonxfx) 4 44.40 49.84 1 25.00
29260. alios99 (alios99) 4 44.39 48.33 0 0.00
29261. Vikram (fast_life) 16 44.39 51.31 2 12.50
29262. Pustinek (pustinek) 15 44.39 50.07 1 6.67
29263. B (pbhavin8584) 45 44.39 54.74 0 0.00
29264. Kush (kushtek) 51 44.37 64.78 11 21.57
29265. Absect (absect) 237 44.37 59.62 22 9.28
29266. May (stenotbest) 1 44.37 44.37 0 0.00
29267. JEREYO05 (jereyo05) 26 44.37 54.27 3 11.54
29268. Jacqueline (typegozoom) 15 44.36 52.21 1 6.67
29269. Marco (marcov641) 2 44.36 47.38 0 0.00
29270. karim (shinobikarim) 9 44.35 51.56 2 22.22
29271. Tobias (iseeicetea) 8 44.35 54.29 0 0.00
29272. Parker (pistolpeterulez) 7 44.35 51.33 1 14.29
29273. MehproPlayz (mythicfx) 17 44.32 56.04 7 41.18
29274. Pro (proishere) 3 44.32 45.05 2 66.67
29275. Nich (squiddyjohnlong) 3 44.31 46.53 0 0.00
29276. vliv (hyte) 1 44.31 44.31 0 0.00
29277. g (georgecolin1221) 124 44.30 62.98 11 8.87
29278. Lutful (lutful) 45 44.30 50.79 6 13.33
29279. gi (gi_prim) 11 44.29 53.95 1 9.09
29280. Kirumi (shady_blaze0o0) 3 44.28 48.41 0 0.00
29281. Free Israel (1ocaltechsuppor1) 15 44.28 50.02 2 13.33
29282. raysar (raysar) 1 44.27 44.27 0 0.00
29283. Gamer (joksb2k) 10 44.27 47.89 2 20.00
29284. Mssd (mssd200927) 3 44.27 52.52 0 0.00
29285. Ahmed (ahmed_emad21) 4 44.25 48.21 0 0.00
29286. JBK (jeyabalakrishnan) 44 44.24 53.65 3 6.82
29287. Elahe (elldora) 25 44.24 58.61 1 4.00
29288. Derek (derekyeh) 12 44.24 53.35 0 0.00
29289. The (navya2008) 28 44.23 62.77 6 21.43
29290. Andrew (dodapotato) 30 44.22 58.53 2 6.67
29291. AA (typee45) 32 44.22 54.69 6 18.75
29292. BaoOtakun (baootakun) 3 44.21 45.52 0 0.00
29293. Casper (volvoracer87) 13 44.21 51.63 1 7.69
29294. haylie (hayizme) 10 44.21 53.93 0 0.00
29295. Big Khagan (bigkhagan) 3 44.20 46.02 3 100.00
29296. Salvador (bigsalvador) 1 44.20 44.20 0 0.00
29297. koen (super_stinky) 8 44.20 55.33 1 12.50
29298. kanak (k_a_n_a_k) 42 44.20 58.78 3 7.14
29299. Tanya (tee_85) 153 44.20 70.27 14 9.15
29300. Korone (koroneinugami) 5 44.20 49.32 1 20.00
29301. Travis (dune_dark) 2 44.19 54.22 0 0.00
29302. crip (cipti) 109 44.18 56.16 13 11.93
29303. YT (pri3t4iz) 6 44.18 55.57 0 0.00
29304. mansur (tmansur) 2 44.17 48.38 0 0.00
29305. Slava (gilescope) 91 44.17 53.96 23 25.27
29306. Bekzodbek (bekzod003) 51 44.17 63.11 12 23.53
29307. curtavian (curtavi) 40 44.17 53.78 3 7.50
29308. 0902bo (boowie27) 7 44.16 47.85 0 0.00
29309. sara (saramcr) 12 44.16 49.02 0 0.00
29310. Amir (dead_developer) 17 44.15 49.57 2 11.76
29311. Ben (steamhawk) 7 44.15 57.42 1 14.29
29312. kjr (jianrong2004) 70 44.15 53.45 3 4.29
29313. Rikatoariki (rikatoariki) 1 44.15 44.15 0 0.00
29314. Lon (lonekawu) 2 44.14 45.26 2 100.00
29315. Yxjou (yxjou) 9 44.13 51.90 0 0.00
29316. mohammad (mohammad_aub_1_9_... 2 44.12 48.71 0 0.00
29317. Aubrey (awbrey) 23 44.11 59.96 2 8.70
29318. Atul (atzac) 18 44.10 54.99 1 5.56
29319. Alexander (pharos) 46 44.10 64.34 15 32.61
29320. Zor (zor365) 62 44.10 52.23 6 9.68
29321. raptor (raptor233) 2 44.09 55.92 1 50.00
29322. Darkhan (zhora577) 51 44.09 68.11 3 5.88
29323. Vito (vito_t) 15 44.09 54.98 3 20.00
29324. Juan (juandz) 21 44.08 51.71 4 19.05
29325. SackHeadSam (sackheadsam) 48 44.07 63.52 4 8.33
29326. Martin (manthee1) 3 44.07 47.07 1 33.33
29327. Cristiano (ronaldo_is_back) 6 44.06 52.47 0 0.00
29328. Temirlan (temirlan178) 1 44.06 44.06 0 0.00
29329. Nouman (khanusama) 1 44.06 44.06 0 0.00
29330. Nur (mehedyhassan865) 13 44.05 59.49 2 15.38
29331. Rodrigo (romendoin) 4 44.04 53.17 1 25.00
29332. dbarr (drbarr) 15 44.04 52.90 2 13.33
29333. Alyssa (abm10) 14 44.04 57.29 0 0.00
29334. HasiTheAvenger (hasitheaven... 3 44.03 46.54 1 33.33
29335. amadda (amaddaps) 1 44.03 44.03 0 0.00
29336. ossama (oss123) 2 44.03 44.57 0 0.00
29337. judo (judowrld) 177 44.02 65.59 41 23.16
29338. CopyNinja09 (copyninja_) 43 44.02 52.03 2 4.65
29339. Bence (lordbenczor) 1 44.02 44.02 0 0.00
29340. Andy (andygeo) 101 44.02 56.23 14 13.86
29341. jack (jack824) 1 44.01 44.01 0 0.00
29342. Chronic (cheng01) 236 44.01 59.37 12 5.08
29343. Anastacia (anastaciagurina) 10 43.99 50.57 0 0.00
29344. Charly (cpn29) 9 43.98 51.26 1 11.11
29345. Melwan (melwan) 72 43.98 55.31 3 4.17
29346. xiaobao (xiaobaomontgomery) 221 43.98 59.12 16 7.24
29347. jurc (cruj) 23 43.97 51.92 2 8.70
29348. Jack (boehler66) 2 43.96 47.22 0 0.00
29349. Ian (prince_zuko1) 1 43.96 43.96 0 0.00
29350. HunTer (hunter420) 26 43.96 50.06 3 11.54
29351. doin ye mom (sally_noober12... 1 43.95 43.95 1 100.00
29352. nela camelia (agatha67) 55 43.95 57.62 5 9.09
29353. Nishal (nishalns) 13 43.95 54.06 1 7.69
29354. Zahid (zahidconcha) 4 43.95 52.14 1 25.00
29355. Marko (akagodyr) 60 43.94 54.88 6 10.00
29356. Yenthe (yenthefromghent) 7 43.94 47.18 2 28.57
29357. asdf (asdfdsasdfdsasdf) 23 43.93 53.89 2 8.70
29358. Khabibkhanov (khabibkhanov) 8 43.93 48.86 1 12.50
29359. Carlos (carloscruz42) 1 43.93 43.93 0 0.00
29360. matin (mdmatin4) 122 43.93 58.57 6 4.92
29361. yet (yettoname) 5 43.93 50.16 0 0.00
29362. Zhapyr (tuchka) 4 43.92 49.98 0 0.00
29363. Soph (soap28) 125 43.92 57.08 6 4.80
29364. bee (tggb) 8 43.92 46.47 0 0.00
29365. Pratham (pratham522) 12 43.90 49.01 1 8.33
29366. Caleb (captaincujab) 1 43.89 43.89 0 0.00
29367. Shamsuddin (rony0092) 12 43.88 49.68 1 8.33
29368. Konstantinos (sotos01) 239 43.87 61.41 160 66.95
29369. Demon (thedemon54) 264 43.87 70.33 21 7.95
29370. ante321 (ante321) 9 43.87 48.62 1 11.11
29371. Jimothy (typeman_69_420) 81 43.87 64.60 3 3.70
29372. john (funkefeet) 77 43.86 57.07 8 10.39
29373. keyjulll (klutuk) 2 43.86 49.37 0 0.00
29374. Hitarth (hitarthk) 2 43.85 48.89 0 0.00
29375. Felix (felix0003) 2 43.85 64.46 1 50.00
29376. John (supercriticalco2) 17 43.84 57.04 4 23.53
29377. pentti (rocket_boi) 11 43.82 50.60 3 27.27
29378. Potato (potatooe) 11 43.82 59.47 0 0.00
29379. Habibur (habiburrahman_mu) 33 43.81 68.34 8 24.24
29380. Ven (v4vendetta) 314 43.81 57.95 23 7.32
29381. Janat (ppppp5541) 148 43.81 64.95 9 6.08
29382. Frara (frara) 131 43.81 61.93 10 7.63
29383. Matt Gabriel (gaboooooo) 2 43.81 47.12 0 0.00
29384. Azhar (azhartyper123) 9 43.80 52.03 2 22.22
29385. Shabylkhan (saken03) 22 43.80 53.67 3 13.64
29386. mir (mir_rahat) 15 43.79 50.13 3 20.00
29387. J (valorantjoon) 1 43.79 43.79 0 0.00
29388. Juri (bloodych) 1 43.79 43.79 0 0.00
29389. Asger (asgerbf) 3 43.78 49.15 2 66.67
29390. Shadd (shaddahmed) 3 43.78 46.29 0 0.00
29391. Marco (gras8) 3 43.77 45.36 0 0.00
29392. Ramon (rambo_290703) 4 43.77 46.55 0 0.00
29393. Mike Oxlong (cmc_05) 13 43.77 50.10 4 30.77
29394. Jv (jemish_variya) 10 43.76 48.84 0 0.00
29395. Ivan (grapfik) 3 43.76 45.31 1 33.33
29396. Amar (masteramar) 63 43.76 57.07 4 6.35
29397. Wattery (xwattery) 22 43.75 53.56 0 0.00
29398. Deadman (deadrohan19) 44 43.74 55.56 3 6.82
29399. Manish (hi_son) 41 43.74 62.48 6 14.63
29400. hristo (hritren) 1 43.74 43.74 0 0.00
29401. Aashish (dunsman) 10 43.74 50.15 1 10.00
29402. Avijeet (iavijeet) 4 43.74 45.70 2 50.00
29403. Kelvin (enexpand_23) 2 43.74 46.98 0 0.00
29404. Malo (malodrome) 11 43.73 50.29 2 18.18
29405. lol (coolkid55) 4 43.73 52.33 1 25.00
29406. Shadow (shadowrose01) 20 43.73 49.09 1 5.00
29407. Ujjwal (ujjwal_choudhary) 1 43.72 43.72 0 0.00
29408. Joel (joelhanson) 2 43.72 44.59 1 50.00
29409. thundr (thundr001) 30 43.71 54.01 1 3.33
29410. YOU WONT KNOW (commandernoypi) 1 43.71 43.71 0 0.00
29411. mohsencs (mohsencs) 4 43.71 50.94 2 50.00
29412. Meirkhan (meirkhans) 3 43.71 45.98 1 33.33
29413. Takiur (tm0n3y) 4 43.71 47.89 0 0.00
29414. david (chu0724) 114 43.70 59.72 19 16.67
29415. Saitama (saitama001) 4 43.70 46.36 0 0.00
29416. Rosen (littlepero) 16 43.70 51.18 2 12.50
29417. Aniket (aniket__sharma_) 18 43.69 55.91 3 16.67
29418. Racer09 (__nn____ds__) 323 43.69 56.33 24 7.43
29419. helga (pataki29) 198 43.68 61.30 18 9.09
29420. merlot (merlotsuma) 30 43.68 54.50 3 10.00
29421. Hoasm (hoasm_gnaba) 76 43.67 54.88 11 14.47
29422. Prabuddha (learning2type1414) 1 43.67 43.67 0 0.00
29423. Henry (henry_21) 1,177 43.66 63.16 96 8.16
29424. Basma (airiii) 24 43.66 59.14 4 16.67
29425. Try (_tryhard_) 1 43.66 43.66 0 0.00
29426. I don't know (chessbro) 14 43.65 59.57 0 0.00
29427. Zenith (zenith1g) 32 43.65 54.54 1 3.13
29428. Pico (pico8) 6 43.65 47.54 0 0.00
29429. Rawat (rawat_shiv) 21 43.64 51.01 3 14.29
29430. Ethan (s1ip2r) 2 43.64 45.22 2 100.00
29431. Arpit (ak_31loaded) 22 43.64 50.14 2 9.09
29432. Dimas (kirito_69) 11 43.62 50.84 0 0.00
29433. Gavin (the_gavin12) 1 43.62 43.62 0 0.00
29434. Hai (haiphan) 4 43.62 53.39 0 0.00
29435. Altynbek (altoon) 2 43.59 45.30 0 0.00
29436. Freddy (fredyael) 3 43.58 47.07 2 66.67
29437. gabriel (mangamole) 2 43.58 43.78 0 0.00
29438. Kamjue (camweb_01) 7 43.58 46.51 1 14.29
29439. Rejinten (rejinten) 4 43.58 47.86 1 25.00
29440. Arjun (arjunnaidu) 4 43.57 47.67 0 0.00
29441. Hania (hrychania) 16 43.57 54.40 0 0.00
29442. Sulaymon (sulaymon) 5 43.57 44.90 1 20.00
29443. NayoTomato (nayotomato) 3 43.57 45.84 0 0.00
29444. BadTyper (very_really_bad_t... 23 43.56 50.40 3 13.04
29445. Kieran (polaris03) 3 43.56 48.02 0 0.00
29446. akum! (solargiants) 36 43.54 55.01 3 8.33
29447. Diego (decoarguello) 5 43.54 47.75 0 0.00
29448. Papa (big_papa69) 68 43.54 54.77 7 10.29
29449. idk (idkxdxd) 6 43.54 46.27 2 33.33
29450. Sidharth (just_like_you) 2 43.53 44.71 0 0.00
29451. Afshin (afshin) 4 43.53 50.63 1 25.00
29452. Ayyaz Sajjad (ayyazsajjad) 154 43.53 55.35 18 11.69
29453. Tuguldur (tuug_16) 4 43.53 47.57 4 100.00
29454. Isaac (ksspook) 69 43.52 62.22 4 5.80
29455. CP Addict (xariniov9) 2 43.52 45.40 0 0.00
29456. Blank (orzlyxd) 5 43.51 51.72 1 20.00
29457. Dian (dianeka) 3 43.51 49.93 1 33.33
29458. Luis (dardon) 1 43.50 43.50 0 0.00
29459. huhkdog (huhkdog) 5 43.49 52.37 1 20.00
29460. Ben (bensolo1_chess) 2 43.49 52.17 0 0.00
29461. Kevin (busterz) 38 43.48 52.58 3 7.89
29462. zeta (zeta235) 4 43.48 48.74 0 0.00
29463. dxriuz_dvorak (dxriuzdvorak) 24 43.47 51.24 4 16.67
29464. Joshua (bubulone) 1 43.47 43.47 0 0.00
29465. DreamCat04 (dreamcat04) 15 43.47 50.37 3 20.00
29466. NotNamedMark (notnamedmark) 3 43.45 52.50 0 0.00
29467. Jibon (ninja0x) 19 43.44 50.64 2 10.53
29468. Nedi (silencion) 15 43.44 49.61 2 13.33
29469. Taufiq Dhanial (conradchill) 18 43.44 47.60 2 11.11
29470. William Vince (wvince02) 47 43.43 53.01 1 2.13
29471. pavan (pavan_) 547 43.42 63.01 46 8.41
29472. SHURA (theshura) 2 43.42 50.60 0 0.00
29473. Becz (adosz_56) 9 43.41 52.12 0 0.00
29474. Fabi (fabilula) 34 43.40 57.05 3 8.82
29475. Chardiggity (clehmann) 1 43.40 43.40 0 0.00
29476. Tactics Typer (tacticstyper) 5 43.40 51.23 1 20.00
29477. Margulan (mokarelol) 2 43.40 47.22 0 0.00
29478. Jorge (armando_villatoro) 4 43.40 54.20 0 0.00
29479. Cyberstrike (cyberstrike) 36 43.39 56.02 3 8.33
29480. Ana Beatriz (anaporumtriz) 22 43.37 50.26 3 13.64
29481. Kyle (kyle_15) 32 43.36 57.37 1 3.13
29482. Angel (yomommaspimp) 3 43.36 47.88 0 0.00
29483. V_aura_V (v_aura_v) 2 43.36 44.57 0 0.00
29484. Adhyay (adyr_152) 10 43.35 56.80 1 10.00
29485. seema (seema1607) 5 43.34 51.39 1 20.00
29486. Jasjit (jasjit) 6 43.34 55.60 0 0.00
29487. Julia (sneakyjelly) 2 43.34 46.85 0 0.00
29488. TheMates (themates) 9 43.33 52.72 0 0.00
29489. Samson (deathreturns) 9 43.31 49.54 1 11.11
29490. Krystall (krystaller) 86 43.30 55.06 6 6.98
29491. arimauta (arimauta) 50 43.28 56.71 1 2.00
29492. Revil (vasat401) 7 43.28 48.83 0 0.00
29493. Mob (akmob) 1 43.27 43.27 0 0.00
29494. Vitalie (veeveeoh) 9 43.27 53.45 1 11.11
29495. Baizak (baizak) 17 43.26 50.86 2 11.76
29496. A (amartindale) 26 43.26 54.67 2 7.69
29497. Naman (namanjain) 174 43.25 52.87 20 11.49
29498. Azharly (azharlyxx) 1 43.24 43.24 0 0.00
29499. Rushikesh (manwatkar) 13 43.24 50.75 0 0.00
29500. Amir (justinpaper) 38 43.23 53.12 7 18.42
29501. KIRA (_arik_) 22 43.23 49.99 4 18.18
29502. Gh0st (gh0sted_oo) 1 43.21 43.21 0 0.00
29503. EG (eg_immortal) 70 43.21 59.90 18 25.71
29504. ROAD TO 100!!! (ronkoe) 15 43.20 49.68 2 13.33
29505. Anmol (anmoljaat_) 38 43.19 52.69 9 23.68
29506. aibek (aibek210603) 17 43.19 49.76 2 11.76
29507. Micey (miceymyc) 2 43.19 45.11 2 100.00
29508. harambe (harambetypes) 11 43.18 57.80 1 9.09
29509. Hari Krishnan (shk_1) 3 43.18 45.88 0 0.00
29510. andre (razukandre) 2 43.18 47.83 0 0.00
29511. lightlleaf (lightlleaf) 1 43.17 43.17 1 100.00
29512. Joseph (bnnes714) 63 43.16 61.62 7 11.11
29513. Goodly (goodlytexas) 6 43.16 60.12 0 0.00
29514. stash (stash_) 29 43.16 53.76 2 6.90
29515. Danii (danii_not8) 2 43.16 47.35 0 0.00
29516. Pachara (yopachara) 2 43.15 46.42 0 0.00
29517. Rajput (rajput77) 2 43.15 46.36 0 0.00
29518. Ndu (ndubizu19) 1 43.15 43.15 0 0.00
29519. Jack (jack2711) 2 43.15 43.83 0 0.00
29520. Darren (zincj) 72 43.14 76.38 7 9.72
29521. Putte (puttepowertyper) 7 43.14 53.09 0 0.00
29522. Muhammad (afi__afi) 20 43.13 52.91 1 5.00
29523. Jackson (jackfast) 35 43.12 50.53 1 2.86
29524. parham (parhamparsa) 404 43.12 66.08 46 11.39
29525. kostasss (kostasss) 15 43.12 54.86 2 13.33
29526. Abhishek (abhi_720) 34 43.12 54.78 1 2.94
29527. laamiya (laamiya) 23 43.11 49.09 2 8.70
29528. Syam (aaasssppp) 39 43.11 56.85 10 25.64
29529. Greggory (kaneki26) 1 43.11 43.11 0 0.00
29530. Rafid (rafid2908) 2 43.11 46.71 0 0.00
29531. Almonds (almonds_and_nutella) 8 43.10 51.67 1 12.50
29532. Aakash (pedulal123) 2 43.10 44.06 0 0.00
29533. Nany (a_nany) 11 43.09 48.62 1 9.09
29534. Desodred (desodred) 4 43.08 50.09 1 25.00
29535. Chris (chris4285) 1 43.08 43.08 0 0.00
29536. Sunyog (sunyog) 27 43.08 65.20 5 18.52
29537. Buyandelger (b200970010) 76 43.06 56.30 11 14.47
29538. Turtle Speed (turtle_speed31) 186 43.06 66.14 20 10.75
29539. Simp4turtles (bingoringo) 5 43.06 49.15 0 0.00
29540. ellie (elllllzzz) 6 43.05 48.68 0 0.00
29541. Akashi (coppokim) 29 43.05 53.25 6 20.69
29542. Krish (krish_agn) 33 43.05 56.27 14 42.42
29543. Ho (zahid11704023) 7 43.05 49.77 1 14.29
29544. daniiar (thedoni) 19 43.04 55.14 1 5.26
29545. Sora (sosora) 16 43.03 51.62 3 18.75
29546. Max (maxstacks) 8 43.02 48.25 2 25.00
29547. Aman Daudung (daudung_5) 11 43.02 47.92 1 9.09
29548. Mirek (miras_ms) 6 43.01 47.31 1 16.67
29549. Terminator (terminator_01) 1 43.01 43.01 0 0.00
29550. Naha's (naha_26) 194 43.00 59.57 22 11.34
29551. aera (qkrdlfk) 6 42.99 49.10 0 0.00
29552. Mateusz (matswiatek) 67 42.99 54.32 1 1.49
29553. Warhio (warhio) 3 42.98 48.69 0 0.00
29554. n (kantotoro) 17 42.98 64.59 2 11.76
29555. Sharon (sharon102) 12 42.97 49.98 1 8.33
29556. M4K3 (m4k3801) 4 42.92 45.73 0 0.00
29557. haytch (haytch) 13 42.91 58.66 1 7.69
29558. Nurlybek (noproblem29) 1 42.91 42.91 1 100.00
29559. Tdaddy (tdaddy) 5 42.91 53.11 0 0.00
29560. Romeo (r0mpan) 29 42.89 51.68 10 34.48
29561. Ronny (the_mandalorian) 32 42.89 56.64 2 6.25
29562. hani (arkado_h) 2 42.89 43.86 0 0.00
29563. thewayistay (thewayistay) 2 42.88 45.66 0 0.00
29564. Mounir (mounir_typing) 65 42.88 52.12 6 9.23
29565. Sujith (sai_sujith) 17 42.87 51.31 2 11.76
29566. Eli (citrus_eel) 1 42.87 42.87 0 0.00
29567. NO (kinda_weird_bro) 41 42.86 56.04 6 14.63
29568. MeBookJava (mebookjava) 1 42.84 42.84 0 0.00
29569. Imad (imad_uo) 70 42.83 52.47 6 8.57
29570. moni (kenma_k0zume) 6 42.83 47.44 0 0.00
29571. Guest (imadethisfornoreason) 35 42.83 57.07 1 2.86
29572. Filemon (the_squad7) 166 42.82 51.87 9 5.42
29573. Jasur (jasur_257) 5 42.81 47.86 1 20.00
29574. Fabricio (ffontesb) 36 42.81 52.95 7 19.44
29575. sachin (sachin1234502) 7 42.80 46.07 0 0.00
29576. Harry (hazbogga) 1 42.79 42.79 0 0.00
29577. Javi (vatojavier) 12 42.78 54.57 2 16.67
29578. Garrett (garrettkc) 4 42.77 53.06 0 0.00
29579. Louzani (lk_kheir) 45 42.77 54.30 2 4.44
29580. eman borham (ema_burham) 19 42.77 47.67 1 5.26
29581. suhayb (suhayb) 102 42.76 63.37 36 35.29
29582. Enzie (enzapenguin) 2 42.76 48.75 0 0.00
29583. joi (ryerice) 1 42.76 42.76 0 0.00
29584. Emiesh (emiway247) 41 42.75 52.52 12 29.27
29585. leo (leokkqqjj) 139 42.74 55.83 14 10.07
29586. Cherry (s9crs) 19 42.74 51.96 1 5.26
29587. SW1FT808 (sussyboi808) 163 42.73 59.01 16 9.82
29588. Jahid (jahidk9) 20 42.73 53.85 5 25.00
29589. Ahnaf (shahriarme) 25 42.73 52.76 1 4.00
29590. Kai zheng (nebs_2ge) 1 42.72 42.72 0 0.00
29591. izzy (izzyy2) 22 42.71 53.34 13 59.09
29592. Emerald-Rose (emmarose_deleon) 164 42.71 56.25 23 14.02
29593. lacktoast (cheaky46) 3 42.70 45.48 0 0.00
29594. Himanshu (himanshukpr) 49 42.69 50.83 4 8.16
29595. Utsah (utsah470) 24 42.68 56.65 2 8.33
29596. S (mavzero) 7 42.68 48.99 0 0.00
29597. lixir (catjam) 23 42.68 57.23 2 8.70
29598. Kutya (ysakovvvs) 33 42.67 52.62 4 12.12
29599. Mathfeli (mathfeli) 7 42.67 45.75 0 0.00
29600. J (jklp69) 2 42.67 45.93 0 0.00
29601. Miyoko (heena_rawat) 18 42.67 49.28 1 5.56
29602. Miguel (long_legs_ahh) 2 42.66 43.51 0 0.00
29603. lilbabygay_ (lilbabygay_) 2 42.65 43.32 0 0.00
29604. Salah-eddine (sharrach) 114 42.64 60.14 22 19.30
29605. YourDeath (yabeach) 1 42.64 42.64 0 0.00
29606. its_zaaid (its_zaaid) 10 42.63 48.50 0 0.00
29607. Jitendra Kumar Dixit (jkdixit) 194 42.62 56.77 14 7.22
29608. Lior (miliday) 21 42.62 52.07 3 14.29
29609. comkichi (comkichi) 18 42.61 50.88 2 11.11
29610. bryan (bryan2010) 1,452 42.61 71.87 116 7.99
29611. Petar (sevihasanidjos) 13 42.60 50.92 1 7.69
29612. LEB (fhgfl) 20 42.59 51.78 0 0.00
29613. Kevin (kevinthedon) 5 42.59 50.43 0 0.00
29614. kyoppiy (kyoppiy) 74 42.58 56.90 3 4.05
29615. Julise (mintytea) 26 42.58 54.26 4 15.38
29616. Paul (paulinka7217) 1 42.58 42.58 0 0.00
29617. yellow (yellow00) 12 42.58 51.61 2 16.67
29618. Saumya (quinn_1) 22 42.57 52.66 3 13.64
29619. kewuan (bruhletmein) 3 42.57 45.94 0 0.00
29620. S M (plaban13) 87 42.56 54.11 7 8.05
29621. Aryan (jai_ho420) 33 42.56 57.11 2 6.06
29622. James (james2021) 1 42.56 42.56 0 0.00
29623. Jão (jumamjir) 15 42.56 50.04 1 6.67
29624. Bibek (bibek77) 8 42.56 49.39 0 0.00
29625. Oluwatomi (chidori21) 8 42.56 51.56 0 0.00
29626. Sangryool (sangryool) 3 42.55 57.35 1 33.33
29627. KINA (keithisnotalive) 1 42.54 42.54 0 0.00
29628. MGKPs (mgkps) 3 42.52 46.24 0 0.00
29629. Ari Rez (frizzledizzle) 2 42.52 42.53 0 0.00
29630. Henry (hezzmasterflash) 7 42.50 53.06 0 0.00
29631. Oliver (oliver_22_11) 9 42.50 46.92 3 33.33
29632. Alexgander (arrantfox) 7 42.50 48.79 2 28.57
29633. Bekzat (bekzat_abdikarimov) 4 42.50 56.61 0 0.00
29634. Unknown (hikaru0628) 24 42.50 55.08 5 20.83
29635. Omar (22omar) 7 42.48 50.36 0 0.00
29636. Kareem (kareemshehata) 18 42.48 53.48 0 0.00
29637. Md. Shafiul Islam (sohan110... 71 42.47 53.53 6 8.45
29638. sul (ofb_hunted) 8 42.46 46.61 0 0.00
29639. nishank (nish4nk) 2 42.46 44.56 0 0.00
29640. Amazing (amazingabu) 5 42.45 54.17 3 60.00
29641. mkk (litt1e_ave1) 119 42.44 54.15 31 26.05
29642. Pyare (pyarexpress) 3 42.41 44.21 0 0.00
29643. Free Palestine (1omar1) 228 42.41 62.17 23 10.09
29644. Maksim (shchmax) 2 42.41 47.22 2 100.00
29645. light (skepnap) 37 42.39 54.79 1 2.70
29646. Abigayle (awesomeness2470) 9 42.39 53.24 0 0.00
29647. Cameron (camalb02) 36 42.39 53.06 1 2.78
29648. MKarma (im69d) 48 42.38 53.25 7 14.58
29649. Su (sudipta276) 71 42.38 49.73 7 9.86
29650. Tran (ttphu28) 61 42.37 51.99 5 8.20
29651. Marco (funfulin01) 1 42.37 42.37 0 0.00
29652. vikas (steady_tortoise) 16 42.35 53.68 1 6.25
29653. Neeraj (zapidox) 7 42.35 48.05 1 14.29
29654. Munkhzorig (munkhzorig_0918) 17 42.33 48.37 1 5.88
29655. Antonek (kubanczyk) 1 42.33 42.33 0 0.00
29656. Ayden (blaze_adawg) 1 42.32 42.32 0 0.00
29657. Mario (applie_turnover) 14 42.31 54.34 2 14.29
29658. Vlad (vladungu56) 5 42.30 49.07 2 40.00
29659. LeeLoo (leeloooooooooooo) 5 42.30 48.52 0 0.00
29660. L (aka_l) 1 42.30 42.30 0 0.00
29661. RAJIV RANJAN (rajiv_ranjan_1) 81 42.30 59.29 6 7.41
29662. Julo (julo56) 2 42.29 44.81 1 50.00
29663. Johny (mijq) 74 42.29 51.10 7 9.46
29664. gfy (tiga6) 132 42.29 59.89 14 10.61
29665. roy (lin_ring) 1 42.28 42.28 0 0.00
29666. Jon (cuber1) 4 42.27 44.55 1 25.00
29667. Samuel (theodoruss) 1 42.25 42.25 1 100.00
29668. Muh (syafwan000) 2 42.25 49.15 0 0.00
29669. Haiden (manthetypewriter) 61 42.24 56.89 11 18.03
29670. Brayden (soygoblin) 15 42.23 49.86 0 0.00
29671. Mohsin Ali (gillbest) 75 42.23 51.00 8 10.67
29672. Protocol (protocol93344) 6 42.22 54.06 2 33.33
29673. Ken (kenrender) 48 42.21 50.38 3 6.25
29674. CillerCiller (cillerciller_yt) 2 42.21 43.18 0 0.00
29675. Nemanja (conemanija) 22 42.20 53.90 2 9.09
29676. Bruno (brutal_posso1) 201 42.20 55.63 9 4.48
29677. daisy_lilly (daisy_lilly) 4 42.18 54.22 0 0.00
29678. akmal (akmalhisyam) 13 42.18 45.43 2 15.38
29679. Pedro (lobin) 3 42.18 43.45 0 0.00
29680. HUN (botyi22) 19 42.17 51.32 0 0.00
29681. Tweethashtag (tweethashtag2... 6 42.17 48.07 1 16.67
29682. My Brother, Don't Stop Tryi... 62 42.16 55.08 6 9.68
29683. Martin (thechuchutrain99) 5 42.16 46.13 0 0.00
29684. edamame88 (edamame88) 1 42.15 42.15 0 0.00
29685. Akshay (akshay_c123) 130 42.15 57.12 13 10.00
29686. Agate (agate) 6 42.15 48.91 0 0.00
29687. gondaloz (gondaloz) 4 42.13 44.35 0 0.00
29688. Furkan (baytak) 2 42.13 42.36 0 0.00
29689. Pranav (_vanarp) 115 42.10 58.37 9 7.83
29690. Riley (dedalus) 7 42.09 53.39 1 14.29
29691. Tour2738 (tour2738) 10 42.08 46.69 1 10.00
29692. Pintu (pintusingh26) 4 42.08 44.79 0 0.00
29693. Edward (sp4rxxx) 1 42.08 42.08 0 0.00
29694. soufiane (soufianebth) 8 42.05 47.20 4 50.00
29695. Brandon (branthrax123) 1 42.03 42.03 0 0.00
29696. bishwash (bishwash_patel) 11 42.02 62.78 2 18.18
29697. Toshi (totora) 19 42.01 54.13 1 5.26
29698. Kuba (kubzas) 13 42.00 46.55 3 23.08
29699. p1ng_speed (p1ng_) 1 42.00 42.00 0 0.00
29700. Abdelrahman (abdo_mano) 82 42.00 52.63 3 3.66
29701. RSN (risan_rsn) 5 41.97 52.73 2 40.00
29702. Akira (oven_bunny) 6 41.97 52.46 1 16.67
29703. esther (golfetta) 1 41.96 41.96 0 0.00
29704. Deepan (deepan_hacker) 47 41.96 49.96 0 0.00
29705. Gunel (gunel12) 10 41.96 46.67 1 10.00
29706. Abhishek (abhichauhan) 74 41.95 57.20 4 5.41
29707. Rajesh (rajeshpanjiyar) 23 41.95 51.41 3 13.04
29708. Ammar (ammarsya4) 4 41.94 43.50 0 0.00
29709. Dauletbek (dauksh) 1 41.94 41.94 0 0.00
29710. Kuanysh (kuanyshby) 7 41.91 50.46 2 28.57
29711. Saugat (saugat2003) 9 41.90 47.18 0 0.00
29712. Erin Lanz (erinxmaligaya_) 159 41.90 60.44 13 8.18
29713. jachym (jachymneumipsat) 12 41.89 48.44 0 0.00
29714. Hermogenes (hrivas) 8 41.88 52.28 0 0.00
29715. Elle (1dk_sara) 1 41.88 41.88 0 0.00
29716. Skathi (yangnakz) 1 41.88 41.88 0 0.00
29717. Abhijeet (abhibaj007) 72 41.88 48.83 7 9.72
29718. Trilo (bishh_27) 14 41.87 45.67 0 0.00
29719. Tiago (teratogo) 2 41.87 43.61 0 0.00
29720. Islam (s_l_m) 4 41.85 46.52 0 0.00
29721. Hegsy24 (hegsy24) 2 41.85 42.77 0 0.00
29722. tanon (tanon710s) 1 41.84 41.84 1 100.00
29723. ur (mrchubbypancake) 2 41.84 41.90 0 0.00
29724. Vishal Mishra (firethunder2) 476 41.83 71.50 45 9.45
29725. devil_02 (_ebad_) 35 41.83 52.55 4 11.43
29726. Jordan (jordy2394) 22 41.80 49.40 2 9.09
29727. Zakarya (zakarya420) 166 41.80 53.76 10 6.02
29728. ChandraMouli (chandramouli) 3 41.80 43.38 0 0.00
29729. Simon (rehy) 10 41.78 46.28 2 20.00
29730. EXT YOYO (ext_yoyo) 9 41.78 59.87 2 22.22
29731. Pasquiggles (pasquiggles) 6 41.78 48.91 0 0.00
29732. sukhoi su-57 (shezy) 278 41.77 63.73 29 10.43
29733. JY (zhangjinyuan) 2 41.75 45.99 1 50.00
29734. Siddarth (siddthekid1) 12 41.74 50.66 2 16.67
29735. Antonio (joancoma05) 10 41.74 45.85 1 10.00
29736. arTCap (rusaterbang01) 2 41.74 42.32 1 50.00
29737. Fast (filpix) 4 41.73 46.54 2 50.00
29738. Feakl (feakl) 8 41.73 51.64 1 12.50
29739. Hevesi (preeim) 1 41.72 41.72 0 0.00
29740. Oliver (snorkypant) 1 41.72 41.72 0 0.00
29741. kcaj (jackaylward) 2 41.72 43.05 0 0.00
29742. Helder (helder_98) 2 41.71 42.24 1 50.00
29743. Warley (patrickwarley) 34 41.71 54.24 1 2.94
29744. CHi (chiyippi) 23 41.69 54.33 3 13.04
29745. Rafa (rafimm) 9 41.68 50.41 2 22.22
29746. nolan (nolantof) 1 41.67 41.67 0 0.00
29747. Tady (concernednecron) 148 41.67 55.59 15 10.14
29748. rosa (rtrindade) 4 41.67 44.30 0 0.00
29749. Erik (hotman_04) 3 41.66 49.81 0 0.00
29750. Colm (slowandslow22) 1 41.66 41.66 0 0.00
29751. Blue (blue_cow) 53 41.66 60.57 11 20.75
29752. Carlkristie (carlkristie) 47 41.65 56.32 7 14.89
29753. Flying fingers (tg_gamer) 225 41.64 58.08 15 6.67
29754. hero (iknowhtml) 259 41.63 56.15 18 6.95
29755. p3t9a (p3t9a) 1 41.63 41.63 0 0.00
29756. Txemi (txemi) 5 41.63 45.35 0 0.00
29757. keytiX (keyti) 27 41.62 49.69 2 7.41
29758. MIr (triple_mmm) 8 41.62 47.02 0 0.00
29759. Orion (nettle) 78 41.62 49.86 10 12.82
29760. mataio (mataioo) 56 41.61 51.48 8 14.29
29761. Tehb (tehbb) 13 41.60 51.87 1 7.69
29762. Reetu Raj (eternal77) 41 41.57 50.39 7 17.07
29763. rararara (sadsatan) 4 41.57 46.98 0 0.00
29764. tstats[blannk] (blannk) 7 41.57 56.84 0 0.00
29765. The (afsanster) 12 41.56 47.57 3 25.00
29766. Preston (prestonsteffenjr) 340 41.55 50.69 15 4.41
29767. moosophy (pepperoni_cat) 176 41.53 51.71 14 7.95
29768. Tim (timhoxton) 24 41.53 49.70 1 4.17
29769. Ollie (geniegg) 1 41.53 41.53 0 0.00
29770. Mukul (mukul27wno) 10 41.53 47.22 0 0.00
29771. Dave (davidneymar) 24 41.52 49.83 0 0.00
29772. fea (sofea_m) 16 41.50 52.66 2 12.50
29773. turtle45 (turtle45) 1 41.50 41.50 0 0.00
29774. Ian (ianlofland) 1 41.50 41.50 0 0.00
29775. sqbaee (sqbaee) 40 41.50 47.72 5 12.50
29776. Asma (speedy10123667567) 161 41.48 63.99 13 8.07
29777. Realslow24 (realslow24) 2 41.47 42.72 0 0.00
29778. VK (vk_7) 8 41.47 56.71 5 62.50
29779. umun (animatedeffect) 1 41.46 41.46 0 0.00
29780. серб (gabagool__) 1 41.46 41.46 0 0.00
29781. Ros (ric_ros_839) 42 41.46 48.75 5 11.90
29782. Syed Ashfaq (satmath) 15 41.45 46.08 2 13.33
29783. Darius (dariussgt22) 1 41.45 41.45 0 0.00
29784. Yerkegul (yerkesha) 10 41.44 45.16 2 20.00
29785. Mostafa (moghorab) 75 41.44 54.20 10 13.33
29786. Angus (lilchenchen) 4 41.44 45.52 0 0.00
29787. Zsombor (melidon) 10 41.43 54.56 1 10.00
29788. vrum vrum (elex_) 115 41.42 55.54 9 7.83
29789. Philis (fillegunnar) 3 41.42 45.06 0 0.00
29790. Alexander (mummenschanz) 1 41.42 41.42 0 0.00
29791. ST (subsonic86) 79 41.41 52.36 2 2.53
29792. ava (ava_er) 16 41.40 56.37 2 12.50
29793. Marcus (fakedefulty) 34 41.40 57.26 3 8.82
29794. Ayuxh (raix29) 8 41.40 45.76 2 25.00
29795. Yvette (mamachoi) 5 41.39 44.23 0 0.00
29796. Force (foce3954) 10 41.38 45.94 1 10.00
29797. WizzzyTM (wizzzytm) 5 41.35 45.02 0 0.00
29798. spiderman (spiderman943) 17 41.35 54.61 2 11.76
29799. Mariam (jishko) 6 41.34 47.31 0 0.00
29800. Joshua (suresoar) 3 41.34 43.06 0 0.00
29801. PANTIOS (pantios) 5 41.34 54.31 0 0.00
29802. Tricia (tricia20) 4 41.34 42.93 1 25.00
29803. George (jejopa) 2 41.34 43.49 0 0.00
29804. crisna (crisnaxx) 7 41.33 46.13 1 14.29
29805. Artiur (artursaliyev) 329 41.33 59.03 29 8.81
29806. albert (umibozu666) 1 41.30 41.30 1 100.00
29807. Jakob (mrsuperhorse) 13 41.30 46.20 1 7.69
29808. pyc (lznuscrfb) 4 41.28 43.90 0 0.00
29809. Jan (_jan_) 1 41.28 41.28 0 0.00
29810. Poon (auxin001) 1 41.28 41.28 0 0.00
29811. Rajiv (rajiv_431) 26 41.26 51.78 3 11.54
29812. crz316 (crz316) 42 41.23 49.16 2 4.76
29813. Travis (ttomich) 3 41.23 43.38 1 33.33
29814. Christopher (catmando00) 3 41.22 46.55 0 0.00
29815. Rachael (fleefloop) 3 41.22 46.43 1 33.33
29816. marciano (marcboss06) 13 41.22 48.94 2 15.38
29817. b1otch (b1otch) 4 41.21 46.53 1 25.00
29818. Ryan (adorben) 3 41.19 42.27 1 33.33
29819. Himanshu (himsingh11) 385 41.18 65.23 33 8.57
29820. Kenny (kenny053) 35 41.17 49.69 6 17.14
29821. Taslima (smita123) 48 41.17 52.87 27 56.25
29822. Ana (sturmshatten) 25 41.16 52.14 3 12.00
29823. Sihaubl (sihabul) 5 41.13 45.01 1 20.00
29824. Adelkaa (fuska007) 4 41.13 42.71 1 25.00
29825. Arinjay Salgia (onehandchamp) 4 41.12 44.66 0 0.00
29826. Kevin (kevinfjbecker) 28 41.11 48.17 4 14.29
29827. Justin (tacder) 28 41.09 53.07 2 7.14
29828. Mike (mxtinkxm) 19 41.09 60.87 2 10.53
29829. handroid (handroid) 2 41.08 41.20 1 50.00
29830. Isaac (bluexpro) 2 41.08 41.20 0 0.00
29831. Siddhant (siddhantprateek) 3 41.06 44.76 1 33.33
29832. a_hsla.1 (floating_aqua_212) 2 41.06 41.32 0 0.00
29833. Daniel Mulligan (parubujotuce) 126 41.06 58.84 12 9.52
29834. Khalilur (shafiq_02) 9 41.05 50.25 1 11.11
29835. rafew (rafew) 2 41.05 43.89 0 0.00
29836. Joe Smith (slowtypingdino) 40 41.04 54.47 1 2.50
29837. A7med (a7med_1) 21 41.01 50.88 1 4.76
29838. zawa9 (faston) 3 41.00 48.18 1 33.33
29839. Mohammad Anwaar Ul Hassan (... 5 41.00 45.93 1 20.00
29840. Dev (devyadavv) 22 40.99 49.24 0 0.00
29841. Trivendram (crazyzoker) 6 40.98 55.13 0 0.00
29842. cole (cole_makker) 95 40.98 54.30 9 9.47
29843. brian (mr_ritz) 7 40.97 45.28 1 14.29
29844. Tony (watery_tony) 13 40.97 49.03 0 0.00
29845. jun (junhan) 3 40.96 45.18 0 0.00
29846. gst (gsttyping) 42 40.96 49.51 4 9.52
29847. Kacper (coomkacz12345678) 4 40.96 48.31 0 0.00
29848. Hi3rra (hi3rra) 13 40.96 47.74 0 0.00
29849. Duffy (duffylam) 73 40.95 55.51 5 6.85
29850. Gansukh (gansuh) 9 40.95 48.44 2 22.22
29851. zahra (zaaahra) 1 40.93 40.93 0 0.00
29852. Chen (timew8s4no1) 1 40.93 40.93 0 0.00
29853. Ra (rayl19) 1 40.93 40.93 0 0.00
29854. x1300252 (x1300252) 92 40.92 49.60 9 9.78
29855. Kuidurgu (kuidurgu01) 104 40.91 50.60 22 21.15
29856. teh (tiancheng) 1 40.91 40.91 1 100.00
29857. Lucas (rlnb) 66 40.90 51.73 4 6.06
29858. TASHI (erehh19) 94 40.90 56.90 41 43.62
29859. Адиль (ad1lek) 4 40.90 50.76 2 50.00
29860. bhautik (bhautik0126) 356 40.90 60.91 29 8.15
29861. Tristan (muffinheadtris) 14 40.88 51.95 1 7.14
29862. icening (icening) 19 40.88 45.93 4 21.05
29863. Zhalgas (zhalgas_04) 24 40.88 46.99 12 50.00
29864. Bendegúz (negyzetracs) 8 40.87 50.07 1 12.50
29865. maximo (maximoc04) 2 40.85 41.45 0 0.00
29866. Lydia (lydia_a) 5 40.85 44.15 1 20.00
29867. Geux (geux) 148 40.84 58.94 14 9.46
29868. Imran (imran_maso) 3 40.84 43.67 0 0.00
29869. R (richigro) 5 40.83 53.66 2 40.00
29870. Alex Jane (alex_jane) 144 40.83 54.29 15 10.42
29871. Rift (rifterk) 3 40.83 45.71 0 0.00
29872. Alice (hautecouturexx) 5 40.80 62.85 5 100.00
29873. Abrar Shah (abrar_shah) 24 40.80 52.55 4 16.67
29874. kevin (titiloka) 27 40.80 47.19 2 7.41
29875. Hridoy (hridoymahmud71) 29 40.79 46.96 2 6.90
29876. Abdullah (abdullahsoulat) 3 40.78 41.58 0 0.00
29877. Mubaarak (mubaarak_199) 2 40.78 47.92 0 0.00
29878. UE (hanue) 11 40.76 53.32 0 0.00
29879. Manthan (mkp28082003) 2 40.76 43.33 0 0.00
29880. xxxodarap (xxxodarap) 8 40.76 48.25 1 12.50
29881. hilpitome (hilpitome) 598 40.75 61.77 57 9.53
29882. Rappe (jnr352) 2 40.75 42.22 0 0.00
29883. ikkyu (ikkyu) 25 40.75 49.04 3 12.00
29884. Bartłomiej (bodidogg) 195 40.74 56.56 19 9.74
29885. Vihanga (vihangatheturtle) 3 40.73 47.08 0 0.00
29886. anas (qanass) 571 40.72 61.25 43 7.53
29887. Keagan (keagonian_16) 7 40.71 51.08 0 0.00
29888. Josie (josuealfredo) 4 40.71 48.77 1 25.00
29889. marvin (mendelmarvin1) 5 40.67 43.81 0 0.00
29890. Kunal (kunaldutta) 83 40.67 55.60 10 12.05
29891. Gabriel Owen (owen2) 9 40.64 48.23 2 22.22
29892. Wiphoothorn (poomws) 67 40.64 54.05 5 7.46
29893. sasquatch (sasquatchplatypus) 33 40.63 53.57 5 15.15
29894. Jhonnathan Ramirez (siaxais) 29 40.62 57.90 0 0.00
29895. Rania (rania_mostafak) 10 40.61 45.85 0 0.00
29896. ASHIK (samael99) 79 40.58 52.49 5 6.33
29897. Willem (woosterum) 9 40.55 53.05 0 0.00
29898. Scott (scottjones25) 165 40.52 52.80 10 6.06
29899. Olexsandr (icefih) 4 40.52 43.67 1 25.00
29900. AI (ailinda) 18 40.51 48.88 1 5.56
29901. Scotf (scottgraham) 118 40.50 53.40 8 6.78
29902. Lily (redborne24) 6 40.50 43.94 1 16.67
29903. Herman (minions96) 1 40.48 40.48 0 0.00
29904. Manh Nguyen Sy (simonnguyen) 1 40.48 40.48 0 0.00
29905. Rohit (rohit_1706) 116 40.48 61.61 10 8.62
29906. Afterlife (afterlife71) 378 40.47 52.78 31 8.20
29907. Winni (winnii26) 1 40.47 40.47 1 100.00
29908. Abdelmohaymn (abdelmohaymn) 180 40.46 56.67 16 8.89
29909. NGONO (mnae) 57 40.43 57.79 2 3.51
29910. Victor (typetwister) 1 40.43 40.43 1 100.00
29911. Jasdeep (jasdeepp21) 7 40.43 45.52 0 0.00
29912. wakolabot (idc_0306) 16 40.42 45.20 4 25.00
29913. Elad (madror1) 7 40.36 48.77 7 100.00
29914. anik (anikakash) 20 40.35 52.45 3 15.00
29915. Auguto (alegato) 6 40.34 44.81 0 0.00
29916. Housefly (housefly) 6 40.34 48.10 0 0.00
29917. Vedanta Sharan (vedbro) 27 40.34 58.81 3 11.11
29918. kalvin (kalvin2171) 8 40.33 54.57 0 0.00
29919. QwertyQurht (qwertyqurht) 2 40.32 45.08 2 100.00
29920. Jeff (i_bad) 8 40.31 47.83 0 0.00
29921. McQueen (aquino_jk) 60 40.31 51.18 4 6.67
29922. Rushil Dhar (rushildhar) 8 40.30 44.99 4 50.00
29923. LostIn (lol1sotkillboss) 2 40.30 41.37 0 0.00
29924. Muruganantham (bossmuruga) 147 40.29 56.74 14 9.52
29925. Farhan Osman (farhan16) 14 40.28 44.01 0 0.00
29926. nathaniel (disbigspider) 4 40.28 42.40 0 0.00
29927. Owen (owentemp) 12 40.26 50.02 1 8.33
29928. Fauggesim (fauggesim) 845 40.25 56.57 60 7.10
29929. sara (sara1994) 385 40.25 51.56 27 7.01
29930. Geraldine (dendenmuushi) 15 40.23 49.05 1 6.67
29931. Doslan (dosu) 12 40.23 44.69 0 0.00
29932. Makküsu (makkusu) 2 40.23 42.61 1 50.00
29933. Anush Rao (anushrao) 8 40.21 48.49 0 0.00
29934. Adler (nosynevada) 4 40.21 45.56 0 0.00
29935. deletboi.exe (deletboi_exe) 2 40.21 41.82 0 0.00
29936. Chester (cheddafps) 1 40.20 40.20 0 0.00
29937. AjTopper (ajtopper) 15 40.19 47.31 0 0.00
29938. abdelrhman (kahraba92) 20 40.18 47.43 1 5.00
29939. Anurag TypeRacer (9craft_) 1 40.18 40.18 0 0.00
29940. bashar (fuddle_) 31 40.18 53.64 2 6.45
29941. Tenzin (tenzinfrost) 74 40.17 54.77 6 8.11
29942. Lalith Sharma (lalith_sharma7) 41 40.17 51.70 6 14.63
29943. Will (orketscience) 14 40.16 45.21 0 0.00
29944. B (awadf) 7 40.15 45.67 1 14.29
29945. manoj (mjbx) 5 40.15 43.13 0 0.00
29946. Eric (ericyau82) 3 40.13 41.77 0 0.00
29947. Abhishek (abhishake12201) 22 40.09 56.72 3 13.64
29948. Slickster (slickster_) 4 40.09 46.92 0 0.00
29949. Zabrah (ikaoktav1697) 2 40.09 40.12 0 0.00
29950. Ritika Garg (ve_ronica) 11 40.07 44.80 1 9.09
29951. Goldie (goldie87) 140 40.06 54.84 12 8.57
29952. Atiqur (atiqrr) 7 40.06 44.65 1 14.29
29953. Jacob (randomtown) 6 40.03 46.97 1 16.67
29954. Nycto (nycto_night) 1 40.03 40.03 0 0.00
29955. Mrigank (tickatron) 10 40.03 53.52 1 10.00
29956. Dastan (skitllz) 15 40.02 44.09 0 0.00
29957. Sadhav (sadhavsingh) 4 40.02 48.75 1 25.00
29958. ant (fourmi) 84 40.01 47.87 3 3.57
29959. antos (szybkipisaczelo) 6 40.00 44.69 2 33.33
29960. K Sooraj (ultron_ksk) 8 39.98 47.39 0 0.00
29961. Itachi (thanos_18) 26 39.95 53.90 4 15.38
29962. Naitik (naitik_lisa) 30 39.95 48.93 2 6.67
29963. Jui (laboni) 65 39.94 54.88 41 63.08
29964. Prad (_rad0n_) 16 39.93 52.75 1 6.25
29965. Md Ziaur Rahman (juall) 29 39.92 52.35 2 6.90
29966. Mamazait (kozhoev1) 133 39.92 69.99 6 4.51
29967. Andrew (cuetime) 8 39.88 43.97 1 12.50
29968. Aman (aman_7002) 39 39.87 47.18 5 12.82
29969. Kiki (kiki_) 22 39.86 46.78 0 0.00
29970. Akhil (akhil_kunadiya) 58 39.86 51.82 2 3.45
29971. justice (totorek) 42 39.86 51.27 2 4.76
29972. Byran (zset) 2 39.86 51.38 0 0.00
29973. DULAL (dulal744574) 77 39.85 52.82 7 9.09
29974. Joe (typer_1_2_3) 1 39.84 39.84 0 0.00
29975. getnthr (bspur11) 4 39.83 43.29 0 0.00
29976. Ayush (ayushprem) 3 39.83 42.20 1 33.33
29977. AbdElazeem (abd_alazeem) 80 39.81 52.41 6 7.50
29978. lokill (lokillfm) 3 39.80 45.36 1 33.33
29979. Hamza (yamac_kocovali) 102 39.80 52.43 9 8.82
29980. Viggi (viggi_002) 13 39.79 47.24 0 0.00
29981. Shubham (shubham_p) 234 39.79 60.59 16 6.84
29982. Abhishek (abhis004) 2 39.78 51.05 1 50.00
29983. Sin (sin_x) 5 39.78 46.61 0 0.00
29984. Zecro (zecro_48) 69 39.76 53.61 2 2.90
29985. Ankh (ankhaann) 224 39.73 52.09 14 6.25
29986. Ashok Kaji (ashokkaji) 25 39.72 52.32 4 16.00
29987. anonym (thefencr) 114 39.71 53.58 5 4.39
29988. Arthur (squekk) 71 39.70 50.47 28 39.44
29989. khasan (khasan) 5 39.70 42.24 0 0.00
29990. Owen (opw3319) 1 39.69 39.69 0 0.00
29991. KaKundam (toilagun2004) 2 39.68 40.17 0 0.00
29992. Audric (callmeric) 3 39.68 50.53 0 0.00
29993. Empio (ppdodoqqq) 71 39.68 50.24 12 16.90
29994. sdfg (nerus_k) 886 39.68 58.49 76 8.58
29995. Samandar1 (samandar1) 324 39.67 55.67 19 5.86
29996. abdullakh (abdullakh) 13 39.67 45.82 5 38.46
29997. Zombie (zombiecoder) 42 39.67 50.32 3 7.14
29998. Lucas (twinbros) 17 39.66 55.29 14 82.35
29999. md abdullah (mamun220) 93 39.66 51.76 9 9.68
30000. Abdul Rafay (abdulpak) 15 39.64 47.44 2 13.33
30001. fdgojasfd (ajaypokharel) 8 39.63 46.76 2 25.00
30002. Ayaan Iftikhar YT (yeet_ayaan) 12 39.63 46.20 3 25.00
30003. Rajesh (rcham) 78 39.63 50.50 3 3.85
30004. jumpscarez (jumpscarez) 11 39.62 50.22 1 9.09
30005. Big (wakibeast211) 4 39.62 42.93 0 0.00
30006. antloflow (antloflow) 7 39.60 47.14 0 0.00
30007. I.M. (wonderl4nd_puff) 3 39.60 41.41 0 0.00
30008. Shiva (shivabalutia) 4 39.60 42.82 0 0.00
30009. V (celestialparfait) 1 39.56 39.56 0 0.00
30010. Raghav (rkaushal_03) 34 39.54 47.95 2 5.88
30011. Arrtea (akrx) 14 39.53 46.25 0 0.00
30012. Mayank (typingbadal) 15 39.53 47.50 1 6.67
30013. Candace (candacefumeh) 12 39.52 45.60 10 83.33
30014. J. Dong (likelihood) 5 39.52 42.31 0 0.00
30015. Sascha (dsm716) 19 39.51 45.26 2 10.53
30016. matiullah (qais_007) 259 39.51 49.78 14 5.41
30017. Nakoa Blue (goldtiger7) 37 39.50 48.51 1 2.70
30018. goombamario (goombamario) 100 39.49 53.33 12 12.00
30019. Devansh (devansh_dua) 20 39.48 47.96 2 10.00
30020. Manikandan (cmkrss) 5 39.47 46.54 1 20.00
30021. LightUnicorn839 (lightunico... 37 39.47 49.88 1 2.70
30022. Khawla Halim (khawla_hlm) 39 39.46 46.23 3 7.69
30023. AnExoticIdiot (anexoticidiot) 2 39.45 42.73 0 0.00
30024. Naeem (naeemsalarzai) 129 39.45 56.18 15 11.63
30025. Pedro (pedrobaptista29) 3 39.44 40.45 0 0.00
30026. joker (joker72426) 2 39.43 41.38 0 0.00
30027. Ali (alimann) 9 39.43 48.29 6 66.67
30028. Rochak (rochak27) 4 39.42 44.79 0 0.00
30029. Love (dontrun01) 280 39.41 55.21 22 7.86
30030. Code_slayer_25 (code_slayer... 123 39.40 49.86 10 8.13
30031. Abu Raziel (abu_raziel) 1 39.39 39.39 0 0.00
30032. Donn (seabase) 14 39.38 50.03 0 0.00
30033. 9aswara (victorious1) 133 39.38 59.84 9 6.77
30034. skye (nilumi) 14 39.38 47.23 1 7.14
30035. luqehr (luqehr) 5 39.36 40.93 0 0.00
30036. Yung (yungmyg) 50 39.36 48.94 4 8.00
30037. Tom (tomwoolf) 4 39.34 42.49 0 0.00
30038. Jakob (joker_ha) 2 39.34 40.70 0 0.00
30039. Dawn (kidlatako) 47 39.33 50.51 5 10.64
30040. apostolos (orou) 89 39.31 55.93 12 13.48
30041. Mark (waybeyondhope) 15 39.29 52.66 2 13.33
30042. Dan (danodin) 1 39.29 39.29 0 0.00
30043. Mohit Justin (mohitjustintudu) 14 39.29 51.02 2 14.29
30044. Jay kay (imnoob167) 422 39.27 56.91 26 6.16
30045. Adhidevan (adhidevansreejith) 3 39.26 41.89 2 66.67
30046. raha (rahaaaa) 4 39.26 44.46 2 50.00
30047. Captain (ccap) 44 39.26 50.94 37 84.09
30048. Gustavo (gustavoythp) 2 39.24 40.76 0 0.00
30049. yahya (yahya121) 1 39.23 39.23 0 0.00
30050. Marek (axolotl720) 1 39.23 39.23 0 0.00
30051. Kovács (namox22) 5 39.22 42.34 0 0.00
30052. Hassan (bipedalfrog) 13 39.21 48.49 1 7.69
30053. Acwyg (arjung0055) 8 39.21 48.40 0 0.00
30054. Spy (spy71) 67 39.20 90.45 4 5.97
30055. Jack (666jack) 10 39.20 47.99 0 0.00
30056. wade (waderf) 70 39.16 53.37 5 7.14
30057. Slow (slow_typer111) 76 39.16 49.82 2 2.63
30058. Angela (mee_123) 229 39.15 51.08 9 3.93
30059. Ahmad (ah_abualrob) 10 39.15 45.42 1 10.00
30060. Aashish kumar (messy84) 11 39.15 43.07 3 27.27
30061. Yordanes (yordanes) 49 39.14 48.74 1 2.04
30062. Tj0027 (tj0027) 7 39.14 43.81 0 0.00
30063. Aaron (anathanbruh) 1 39.14 39.14 0 0.00
30064. Varit (varitfinn) 2 39.14 40.38 1 50.00
30065. player (player172) 32 39.13 96.44 9 28.13
30066. Tristan (tmanthetyper) 6 39.13 45.02 0 0.00
30067. Katrina (katrina07) 2 39.13 41.20 0 0.00
30068. Swapneel (anactualdick) 5 39.13 45.33 1 20.00
30069. Amy (amyjean) 2 39.12 46.52 0 0.00
30070. DuduSensei (dudusensei) 2 39.12 54.70 1 50.00
30071. Fire (fireking8877) 1 39.11 39.11 0 0.00
30072. Daniel (trader29) 4 39.11 44.00 1 25.00
30073. Fast (fingery) 2 39.10 53.00 0 0.00
30074. HK_TeddyBear (hk_teddybear) 33 39.10 52.69 4 12.12
30075. Shadowfader (shadowfader) 28 39.09 45.19 3 10.71
30076. JayGMZ (jaygmz) 13 39.08 47.93 2 15.38
30077. AP (priyanthushara) 102 39.05 54.29 7 6.86
30078. Mackwein (e_p_i_c) 1 39.05 39.05 0 0.00
30079. Алексей (risengod23) 4 39.03 42.29 2 50.00
30080. noman (noman121) 15 39.03 52.42 5 33.33
30081. sergei (youserj) 181 39.02 49.81 15 8.29
30082. raeraven (raeraven) 27 39.02 47.24 4 14.81
30083. APR (apr_fernando) 9 39.01 48.84 2 22.22
30084. OoOoOoOoOoOoO (extralen) 5 39.01 45.47 0 0.00
30085. filip (filko) 67 38.99 49.03 9 13.43
30086. Akshat (typeracer107) 5 38.99 45.25 0 0.00
30087. molnar (molnaredom) 54 38.99 47.17 7 12.96
30088. Minimatrix (minimatrix) 2 38.99 40.57 0 0.00
30089. Abhinav (abhinav28061) 16 38.97 44.36 2 12.50
30090. Terminal (terminall_07) 4 38.97 42.25 0 0.00
30091. Natan (nati_130) 19 38.97 46.37 0 0.00
30092. 2Slow (2slowkevin) 50 38.96 48.24 5 10.00
30093. PWian racer from chennai (o... 50 38.96 62.84 6 12.00
30094. Thor (thorthegodoflightning) 23 38.96 53.92 1 4.35
30095. spectrophobia (spectrophobia) 23 38.95 51.19 1 4.35
30096. Justin (thisjustinj) 15 38.93 47.26 0 0.00
30097. Andreas (drivknuten) 116 38.92 44.93 9 7.76
30098. Oldrock (oldrock) 4 38.92 44.63 0 0.00
30099. Julien (julien123) 17 38.91 44.81 1 5.88
30100. Md. Mojnu (mojnu20) 22 38.91 43.96 2 9.09
30101. Laurie (lkampster) 1 38.91 38.91 0 0.00
30102. Yevhen (m1rev) 117 38.90 57.69 9 7.69
30103. Lil (lil_wymn20) 29 38.90 46.32 3 10.34
30104. Trai (yezurey) 66 38.89 60.11 4 6.06
30105. saumitra (smtrd3) 10 38.89 44.76 0 0.00
30106. heck (aw_heck) 51 38.89 53.45 6 11.76
30107. green (sleepingducksanddrag... 22 38.89 45.78 2 9.09
30108. jame (jame_oxford_11) 5 38.88 42.52 2 40.00
30109. Deepesh (codingdeepesh) 220 38.88 55.79 18 8.18
30110. Half Blood (hwm007) 4 38.87 45.26 0 0.00
30111. Duc (maitheduc2002) 52 38.86 46.84 4 7.69
30112. Jonwin (jonawi) 7 38.86 43.90 0 0.00
30113. Lucas (luke210o) 2 38.85 40.61 0 0.00
30114. Joel (clarkwest1) 3 38.84 42.16 0 0.00
30115. das (vinil10) 2 38.82 41.51 0 0.00
30116. Nathan (watameelon) 13 38.81 45.78 1 7.69
30117. Desert (desert_eagle) 123 38.80 50.05 9 7.32
30118. ricky (rickysingh) 2 38.80 40.20 0 0.00
30119. Edgar (edgarflorez) 46 38.79 48.94 3 6.52
30120. Chureerat (jaja_cw) 4 38.77 41.64 0 0.00
30121. Joerg (jcgx) 1 38.75 38.75 0 0.00
30122. fuadul (fuadul) 8 38.73 42.20 2 25.00
30123. Nam (namtran1205) 2 38.72 40.98 0 0.00
30124. Fae (suga_spice) 37 38.72 48.76 12 32.43
30125. qazaqyanke (qazaqyanke) 20 38.72 80.06 1 5.00
30126. John Paul (crazeswag) 2 38.71 42.72 0 0.00
30127. Dorothy (lildottycat) 3 38.70 42.82 1 33.33
30128. kiwomi (kiwomi) 3 38.69 45.47 0 0.00
30129. Aaron (liron2007) 666 38.68 58.60 53 7.96
30130. Kanish (kanish) 1 38.68 38.68 0 0.00
30131. Ford Mustang (ford_mustang) 13 38.68 48.34 1 7.69
30132. peeush (piefkr) 760 38.67 63.72 49 6.45
30133. Grace (gracejin) 37 38.66 51.80 0 0.00
30134. Mohammad (mhmmdkholani) 738 38.66 59.58 58 7.86
30135. Tanawat (rxrmzriw) 528 38.64 61.04 49 9.28
30136. GamersFTV (gamersftv) 10 38.64 45.32 0 0.00
30137. Rydia (rydia_miwita) 303 38.63 54.43 17 5.61
30138. Aayam (aayam_04) 43 38.62 49.65 1 2.33
30139. Gagandeep (gaggising) 2 38.62 42.07 0 0.00
30140. Gaby's (ggaby) 7 38.60 44.05 0 0.00
30141. Sumona (sumona) 16 38.57 43.68 3 18.75
30142. Chinmoy (chinmoy709) 103 38.56 49.37 13 12.62
30143. Shreyas (the_mediocre_gatsby) 3 38.56 41.62 0 0.00
30144. 10time (10time) 30 38.53 58.21 5 16.67
30145. Anmol (anmol_786) 7 38.53 44.30 0 0.00
30146. typing pro (typingze) 8 38.53 44.27 2 25.00
30147. Petr (petajupik) 13 38.52 42.54 1 7.69
30148. Vedang (vedang1312) 8 38.52 43.28 2 25.00
30149. ali (alimuhammadi) 62 38.52 56.60 1 1.61
30150. Azer (imranovazer) 12 38.50 53.02 0 0.00
30151. bayarhuu (bayarhuu14) 6 38.50 45.85 0 0.00
30152. tstats[yeunakho] (yeunakho) 43 38.49 54.04 3 6.98
30153. Tristan (tribby) 4 38.48 40.79 2 50.00
30154. antl_m (antl_m) 1 38.47 38.47 0 0.00
30155. Boipelo (the_big_bp) 35 38.47 45.83 5 14.29
30156. canadavid1 (canadavid1) 28 38.43 49.95 2 7.14
30157. Adarsh (aadi_2301) 25 38.40 48.22 0 0.00
30158. Pabo (camahthegiant) 1 38.35 38.35 1 100.00
30159. couchbanana (couchbanana) 2 38.34 39.02 0 0.00
30160. gela (gelacutie) 22 38.33 50.77 5 22.73
30161. shashank (shashaank) 255 38.33 47.50 22 8.63
30162. Rolf (key_fingerer) 17 38.32 44.42 0 0.00
30163. _____ (___i__) 6 38.32 42.28 2 33.33
30164. omar (omar_sabry) 6 38.32 42.74 2 33.33
30165. Juan (juanma09) 196 38.31 53.45 9 4.59
30166. desa (desa7645) 19 38.31 45.86 0 0.00
30167. mohannad (mohanadtab) 3 38.31 43.46 0 0.00
30168. Kayyy (kayyy99) 28 38.30 49.42 0 0.00
30169. Rakib (rakib0hasan) 394 38.27 49.24 23 5.84
30170. Vigeous (vigeous) 12 38.24 51.93 2 16.67
30171. Aleksei (snejink) 26 38.23 48.56 0 0.00
30172. 🍓 (crustyyy) 7 38.23 41.01 0 0.00
30173. Thunder (thunder05) 39 38.19 50.26 0 0.00
30174. Jacob (remence) 1 38.18 38.18 0 0.00
30175. Ryan (fast_typer69_420) 2 38.18 38.58 0 0.00
30176. Achuyat (achuyat) 26 38.17 48.86 2 7.69
30177. alvin (alvingogo) 1 38.16 38.16 1 100.00
30178. siddharta (sid_123) 1 38.15 38.15 0 0.00
30179. Phuwit (pooweeh) 6 38.14 42.43 5 83.33
30180. Pubordin (pubordin44) 1 38.14 38.14 0 0.00
30181. Makaila (makailaxx) 1 38.12 38.12 0 0.00
30182. zhizin (zhixin0220) 104 38.11 45.77 10 9.62
30183. Affan (fantzy) 89 38.10 55.67 5 5.62
30184. edith (lilloser) 3 38.09 41.41 0 0.00
30185. Menke (menkveld) 6 38.08 44.14 0 0.00
30186. Jen (ladyjen) 24 38.08 46.55 0 0.00
30187. Rikka (rikkaislife) 20 38.07 45.32 8 40.00
30188. Sagi (sagi_hv) 28 38.05 45.18 1 3.57
30189. ស៊ីថេ (sythe_net) 11 38.04 47.70 2 18.18
30190. Daniel (danighosyyt) 1 38.04 38.04 0 0.00
30191. gautam (stupendous_man) 14 38.02 41.02 0 0.00
30192. You (console0) 19 38.00 45.35 1 5.26
30193. Bekboalt (bekbo_0) 220 38.00 47.50 11 5.00
30194. N (guidryy) 14 37.99 53.19 0 0.00
30195. Abdur (genway_dev) 26 37.99 52.23 4 15.38
30196. Almat (bassaroff) 6 37.98 44.94 0 0.00
30197. Simeon08 (simeon08) 1 37.98 37.98 0 0.00
30198. Dmitry (d1pj_123) 5 37.96 40.16 2 40.00
30199. Yato_Gami (hrittik_brittik) 18 37.96 48.22 1 5.56
30200. Ivan (i_bantam) 2 37.95 38.34 0 0.00
30201. Abhinav (typingcompany) 37 37.94 50.03 3 8.11
30202. deepika (dips26) 5 37.93 41.69 0 0.00
30203. Samarth (sam_100) 3 37.93 41.26 0 0.00
30204. Jaidyn (siimba) 6 37.92 44.46 2 33.33
30205. lia (_lia1_) 3 37.91 41.88 0 0.00
30206. BibaSenpai (bibasenpai) 2 37.90 43.20 1 50.00
30207. Yeshua (mr_inconsistent88) 1 37.89 37.89 0 0.00
30208. Cheesie (cheesie_muffin) 5 37.88 39.87 0 0.00
30209. Dan (sonixspeedster) 4 37.88 40.85 0 0.00
30210. Speeder (speeder99) 14 37.87 52.96 0 0.00
30211. Semyon (dsa_ru) 4 37.87 42.26 0 0.00
30212. Vroom 🚗🏍️🏎️... 1 37.86 37.86 0 0.00
30213. Satvik (satty010) 6 37.85 40.91 0 0.00
30214. i am (nikhilt) 3 37.84 38.27 0 0.00
30215. WhiteRose (whiter9se) 29 37.83 45.97 0 0.00
30216. Meet (meet_singh88) 4 37.82 40.11 0 0.00
30217. Invnty (invnty) 350 37.80 53.12 21 6.00
30218. Ethan (boxisfat) 3 37.79 43.45 0 0.00
30219. chuanHui (juchh) 131 37.79 46.43 10 7.63
30220. Alexeï (g4520u10) 78 37.79 51.06 3 3.85
30221. Rokas (rokasspeedy) 6 37.79 44.56 0 0.00
30222. _ (baga_rashy) 10 37.79 43.20 0 0.00
30223. Měkš (_kysel_) 5 37.77 42.82 0 0.00
30224. Anmol (anmolmb) 9 37.76 47.07 1 11.11
30225. Lime (lizzardwizzard) 73 37.75 46.17 3 4.11
30226. Said (porta_said) 61 37.74 48.48 3 4.92
30227. Mukesh (mukesh05) 6 37.74 41.50 0 0.00
30228. Draunzer (draunzer23) 18 37.72 44.38 2 11.11
30229. Kaifishi (kaifishi) 4 37.72 54.27 1 25.00
30230. Sayat (sayko05) 171 37.71 49.80 14 8.19
30231. Bharath (bar_at_5) 5 37.71 48.41 0 0.00
30232. Igor (kziv) 44 37.70 49.32 1 2.27
30233. trac (tractray) 2 37.70 42.86 0 0.00
30234. S (time_limit) 1 37.69 37.69 1 100.00
30235. kamal (kamaluddin) 37 37.68 46.35 1 2.70
30236. Apu (a1p16u21) 253 37.65 53.15 13 5.14
30237. sunny (sunnykr17) 4 37.65 43.43 0 0.00
30238. samer (alexozero) 1 37.64 37.64 0 0.00
30239. henrik74 (henrik74) 3 37.63 43.96 1 33.33
30240. logan (zelo_0348) 13 37.63 43.08 0 0.00
30241. Md. Anamul (anamul_31) 5 37.62 42.09 0 0.00
30242. u slow (spyie) 12 37.62 44.36 3 25.00
30243. M4nu (manuqjapem) 1 37.61 37.61 0 0.00
30244. erbol (erbolxac) 192 37.60 51.06 11 5.73
30245. razwan (razwan) 273 37.59 61.16 20 7.33
30246. Ramsha (lexi25) 9 37.58 49.10 0 0.00
30247. Mohsen (mohsenbing) 24 37.57 44.22 2 8.33
30248. rahul (typer_typer) 66 37.56 45.85 9 13.64
30249. Aaron Martin (reala) 7 37.55 39.14 1 14.29
30250. pro (pro_napro) 103 37.54 47.99 7 6.80
30251. Jo (paulajoo) 1 37.53 37.53 0 0.00
30252. SPOU1 (spou1) 3 37.52 43.93 0 0.00
30253. Jan (hokejan_14) 140 37.51 51.11 8 5.71
30254. jarit (kaastype) 3 37.50 38.36 1 33.33
30255. Gabe (the_typing_noob1121) 2 37.50 41.58 0 0.00
30256. akram (akrambr) 36 37.48 46.06 3 8.33
30257. Akash (wolverine07) 4 37.46 42.80 0 0.00
30258. nitesh (nkpcpr) 16 37.46 42.75 1 6.25
30259. Lostleo2347 (lostleo_onytb) 5 37.45 42.04 1 20.00
30260. Zoya (noximy) 15 37.44 49.61 1 6.67
30261. Shriram (shri_baj) 15 37.43 44.14 1 6.67
30262. Nektarios (kapiras) 29 37.41 50.06 2 6.90
30263. an (an_vu41) 3 37.41 46.10 0 0.00
30264. Mexero (mexero) 12 37.40 41.43 1 8.33
30265. Kadra Don (assem07) 4 37.40 40.37 1 25.00
30266. hello (elllowwww) 4 37.39 55.91 1 25.00
30267. Vlad (vlad_bizin) 1 37.39 37.39 0 0.00
30268. yntylox (yntylox) 35 37.39 55.96 3 8.57
30269. MD Imran (md_imran_hosen) 16 37.36 44.03 2 12.50
30270. CB (cb_cabral) 125 37.36 47.44 11 8.80
30271. el (elchupo) 10 37.35 60.87 2 20.00
30272. Italo (italo_x) 185 37.33 50.70 11 5.95
30273. Liotom (liotom) 1 37.32 37.32 0 0.00
30274. HeMAN (h3m4n) 10 37.31 44.26 0 0.00
30275. Ashot (ashotmovsisyan) 7 37.30 41.21 0 0.00
30276. rahul (rc12chy) 28 37.27 47.21 4 14.29
30277. Joe (pp11thebest) 4 37.27 40.55 1 25.00
30278. riswan (riswan_1212) 7 37.26 41.58 0 0.00
30279. Hzifah (hariaz27) 3 37.26 42.08 2 66.67
30280. Emil (kuddsson69) 2 37.26 37.36 0 0.00
30281. Rudra (sdes) 2 37.26 40.68 1 50.00
30282. roy (roywastaken) 8 37.25 41.76 1 12.50
30283. Mark (markovsy) 1 37.25 37.25 0 0.00
30284. baker (bakervai001) 33 37.25 46.60 1 3.03
30285. nadan (nadanfrenkiel) 1 37.24 37.24 0 0.00
30286. vibhu (vibhuviv) 13 37.24 44.36 0 0.00
30287. Azimjon (rasulovazimjon) 1 37.21 37.21 0 0.00
30288. Aruzhan (arrrujjka) 53 37.20 45.69 5 9.43
30289. DarkInstinct (road_to_ultra... 5 37.19 44.74 0 0.00
30290. Sedlynne (sedlynne) 3 37.19 37.70 0 0.00
30291. Matiss (mazainwastaken) 134 37.18 47.12 5 3.73
30292. m3hdi (m3hdi_v1) 17 37.18 42.78 1 5.88
30293. sagar (sagarlama) 38 37.14 47.80 3 7.89
30294. Luis Francisco (luifrancgom) 36 37.14 50.16 2 5.56
30295. lea (leyley01) 10 37.13 41.61 0 0.00
30296. Josh (joshsmith29) 6 37.13 48.36 0 0.00
30297. Talbiya (talbiya) 10 37.12 43.09 4 40.00
30298. Ammar Ahmed (ammarahmed001) 3 37.11 41.45 0 0.00
30299. Daniel (danucu22) 11 37.10 52.04 2 18.18
30300. Bruna (brunais) 2 37.10 38.73 0 0.00
30301. AimFaze (aimfaze) 1 37.10 37.10 0 0.00
30302. mubara (mubara) 81 37.09 49.18 8 9.88
30303. DexterYT (dexisnothome) 8 37.08 48.48 2 25.00
30304. Elandaleb (elandaleb) 13 37.08 43.84 0 0.00
30305. dhia (dhia1) 6 37.07 45.00 0 0.00
30306. jip (jipgg) 8 37.05 42.94 0 0.00
30307. kiki (kikifrederique) 10 37.05 41.82 3 30.00
30308. yt etherlol (youtube_etherlol) 1 37.04 37.04 0 0.00
30309. qwe (azeem838) 26 37.03 45.04 3 11.54
30310. Dillruba (dishadipa223) 25 37.03 48.39 7 28.00
30311. Darren (darren) 6 37.01 41.32 0 0.00
30312. Daniar (dankas23) 59 37.00 45.43 1 1.69
30313. Dang Hai (dang_hai_ema) 271 36.97 51.90 15 5.54
30314. Rishi (rishipoonia) 57 36.93 53.78 6 10.53
30315. Yelzhan (yelzhansky) 10 36.92 39.88 0 0.00
30316. Kheersagar (kheersagar) 28 36.92 44.69 4 14.29
30317. mithilesh (mithilesh_just_t... 3 36.92 38.38 0 0.00
30318. Quintin (qt_parzival) 4 36.91 39.06 0 0.00
30319. bruh (pirate22) 2 36.91 37.42 0 0.00
30320. Mohammad (naveedroy) 37 36.90 44.41 3 8.11
30321. Yashvir (yashvir_kothari) 7 36.89 41.83 2 28.57
30322. Baxriddinov (mbi_) 223 36.89 49.22 22 9.87
30323. Tamer (smartlead) 11 36.89 42.45 4 36.36
30324. TypeMaster! (imma_typing_ma... 2 36.89 40.14 0 0.00
30325. Started from 3wpm (the_op_p... 603 36.89 60.08 48 7.96
30326. Akash (akashdeep_912) 4 36.87 41.11 0 0.00
30327. Nogaie (micasa_ackarmen11) 135 36.86 46.70 10 7.41
30328. streamsniper146 (streamsnip... 81 36.85 50.15 5 6.17
30329. varitox (varitox) 1 36.84 36.84 0 0.00
30330. Pratyush (its_praty) 2 36.83 39.72 0 0.00
30331. Lengboii (lengboii) 6 36.81 55.86 2 33.33
30332. C1C (jasonthai) 250 36.81 57.17 17 6.80
30333. ashmit (ashmit1769) 2 36.81 37.79 0 0.00
30334. Rakibul (rakib195) 1 36.81 36.81 0 0.00
30335. TeeCee (taboka) 7 36.80 44.45 1 14.29
30336. binay (biany671) 33 36.80 46.06 3 9.09
30337. NK (nkpathak1) 11 36.79 51.42 2 18.18
30338. Yaroslav (nashivan) 300 36.79 48.25 21 7.00
30339. Stonebreaker (stonebreaker) 74 36.78 48.77 6 8.11
30340. porson (porson) 1 36.77 36.77 0 0.00
30341. Abiel (abiel_abrham) 3 36.77 39.03 0 0.00
30342. Federico (marche96) 5 36.75 43.67 1 20.00
30343. Chadin (pinghuskar) 2 36.74 38.85 0 0.00
30344. Koco (koco001) 7 36.74 46.69 1 14.29
30345. Khalifa (khalifa47) 6 36.71 40.38 1 16.67
30346. Mikołaj (sweed4life) 79 36.68 54.86 10 12.66
30347. lhagvaag0d (mr4thousands_) 12 36.67 44.30 5 41.67
30348. Stefan (stefanknez03) 89 36.67 51.52 6 6.74
30349. IDK (iimarch) 17 36.66 47.60 1 5.88
30350. prince (prince_singh) 54 36.66 44.69 6 11.11
30351. bebeconsarna (bebeconsarna) 3 36.64 40.76 1 33.33
30352. Quang Minh (quangng711) 3 36.62 37.89 0 0.00
30353. bader (bhilal) 31 36.62 45.93 2 6.45
30354. Daniele (dprimon) 39 36.62 46.38 3 7.69
30355. yamitori (czas) 4 36.61 37.48 4 100.00
30356. hritik (raj_veer) 2 36.60 37.13 0 0.00
30357. Cauê (cue_fran) 1 36.59 36.59 0 0.00
30358. thetypingnerd852 (thetyping... 29 36.59 48.39 4 13.79
30359. chubby (hoocub) 8 36.55 45.60 1 12.50
30360. palash (loserindcoffice) 2 36.53 39.12 0 0.00
30361. qusdty (qusdty) 9 36.51 43.04 1 11.11
30362. Morshedul (morshedul) 9 36.48 40.19 0 0.00
30363. sofy (sofym3sa) 1 36.48 36.48 0 0.00
30364. devendra (devendra303) 11 36.48 48.45 0 0.00
30365. Indiastopsww3 (vivekpjoshy) 1 36.44 36.44 0 0.00
30366. Anand (anand7711) 3 36.42 39.56 0 0.00
30367. Pawel (el3ctron) 236 36.42 49.38 11 4.66
30368. Amjad (baigsap) 1 36.40 36.40 0 0.00
30369. AnasigN (anblk) 135 36.39 56.10 7 5.19
30370. fares (fares_esam_22) 113 36.38 44.97 4 3.54
30371. Trương (fly1710) 4 36.38 40.24 0 0.00
30372. Fast enough (obahi) 26 36.38 42.02 2 7.69
30373. Nguyen (hungnguyen2912) 13 36.37 43.03 1 7.69
30374. SRW (waifuthebest) 7 36.37 43.20 0 0.00
30375. Ventilyator (propeller187) 3 36.36 39.85 2 66.67
30376. Rabbi (rhdevil) 91 36.35 49.11 6 6.59
30377. Niaz (niaztypist) 12 36.34 43.80 0 0.00
30378. in (uaqlover) 12 36.33 43.17 1 8.33
30379. Dominikus (dnk_dom) 9 36.33 43.04 2 22.22
30380. Wissa (wissaa) 7 36.33 47.37 2 28.57
30381. Chlebíček (chlebicek) 9 36.31 42.49 0 0.00
30382. Aisultan (d_jr) 2 36.30 38.98 0 0.00
30383. Maidul (goal100wpm) 14 36.26 43.79 2 14.29
30384. ONI (oniboo) 1 36.26 36.26 0 0.00
30385. Bermet (bermetibr) 33 36.26 44.93 0 0.00
30386. Markas (markas_123) 6 36.25 40.55 1 16.67
30387. Hubert (georgeger) 3 36.24 37.54 0 0.00
30388. LePetitPili (le_petit_pili) 6 36.21 39.60 6 100.00
30389. Juoshi (karen_ju) 2 36.21 39.67 0 0.00
30390. Izzy B) (juicyfruit101) 2 36.21 36.87 0 0.00
30391. Tim (timlee) 1,024 36.20 51.76 54 5.27
30392. al (allizer) 21 36.20 43.86 1 4.76
30393. Yulia (jewels04) 8 36.17 39.76 0 0.00
30394. Kevin (punch1ine) 1 36.17 36.17 1 100.00
30395. soraya (nilanjona) 11 36.16 42.76 1 9.09
30396. Emzze (emzze) 2 36.15 37.38 0 0.00
30397. Brad (soldtheworld) 4 36.14 41.77 0 0.00
30398. Logan (lcawesomepotato) 2 36.13 39.04 0 0.00
30399. Hamzah (hamzaaho7722) 20 36.13 40.56 2 10.00
30400. Rupok (rupok_kuet) 4 36.13 44.37 1 25.00
30401. James (fisher_man08) 23 36.10 41.98 2 8.70
30402. Nuttanun (nut_tun) 4 36.10 39.23 1 25.00
30403. Saif (niconyte) 1 36.08 36.08 0 0.00
30404. Omar (salthesloth) 5 36.07 42.30 3 60.00
30405. Amritesh (anodyne12371) 48 36.07 51.13 2 4.17
30406. Jackoman (jackoman) 59 36.05 41.70 6 10.17
30407. Yaaaawn (yaaawn) 1 36.04 36.04 0 0.00
30408. محمد (mohammed_mourad) 8 36.03 43.63 0 0.00
30409. Daisy (daiyu_) 1 36.02 36.02 1 100.00
30410. Leloush (goal9871231st) 8 36.01 41.57 2 25.00
30411. Arian (ariankazemi) 15 35.99 40.97 0 0.00
30412. MD (123onick) 12 35.98 42.97 3 25.00
30413. mahmoud shalhoub (mahmoud77) 833 35.97 52.55 83 9.96
30414. Soap (adventuroussoap) 6 35.97 40.05 1 16.67
30415. ale (ale10212) 2 35.97 39.44 1 50.00
30416. Abby (abkwreu) 150 35.96 62.70 7 4.67
30417. Zhibek (besunshine) 3 35.96 49.29 1 33.33
30418. Andrew (n3r3z) 2 35.94 36.93 0 0.00
30419. Pooh (po0h_) 22 35.91 41.97 1 4.55
30420. Catrinet (catrinet) 31 35.90 41.85 0 0.00
30421. sherif (sherifu3) 28 35.89 43.11 1 3.57
30422. Nurti (nurti07) 4 35.89 42.01 0 0.00
30423. Christopher (thecybernile) 1 35.88 35.88 0 0.00
30424. APA COBA!!! (afider) 2 35.87 37.71 0 0.00
30425. Silver (_silver_) 6 35.86 39.92 0 0.00
30426. Nathan (tna_typing) 4 35.83 40.28 1 25.00
30427. Noob (_anto_200) 205 35.83 52.33 22 10.73
30428. Pirated (piratedkeyboard) 2 35.78 39.80 0 0.00
30429. Metiro (m3t1r0) 1 35.77 35.77 0 0.00
30430. Rzechu12 (rzechu12) 3 35.76 49.91 1 33.33
30431. Mahmoud (ma7moud7amdy) 4 35.74 42.15 4 100.00
30432. rakushun (rakushun) 17 35.72 43.52 2 11.76
30433. Ansar (kabdik) 30 35.72 43.17 2 6.67
30434. sren (uchiha_itachi347) 6 35.71 41.21 2 33.33
30435. Abdulrahman (abdulraman_q99) 1 35.71 35.71 0 0.00
30436. Itsbuddy⌨ (legendarybeast... 8 35.70 45.72 1 12.50
30437. Елдынбек (realkotak) 5 35.67 39.61 0 0.00
30438. kazzi (jokerivy) 1 35.67 35.67 0 0.00
30439. WAKing (shashashane) 22 35.66 43.85 1 4.55
30440. Li Han (1774li) 17 35.66 48.17 1 5.88
30441. Sneha (sneha_1610) 38 35.65 46.48 3 7.89
30442. Q3stor (q3stor) 19 35.65 44.80 3 15.79
30443. Tmr (tmr_sa) 81 35.61 45.90 6 7.41
30444. Sebastian (sebastian070) 149 35.60 50.06 32 21.48
30445. Yuriy (jurijo) 4 35.60 39.23 0 0.00
30446. Mohamed (elhedeq) 12 35.60 38.65 0 0.00
30447. Brudda (cumlord57) 1 35.59 35.59 1 100.00
30448. Sahil (shahildhakre) 319 35.58 55.65 23 7.21
30449. Tahar (tmasmaliyev) 8 35.56 50.80 0 0.00
30450. Skourou (skourou) 2 35.53 40.94 0 0.00
30451. Neil (neil3110) 10 35.53 38.45 2 20.00
30452. Peter (ppeett11) 2 35.53 37.12 0 0.00
30453. ilman (ilmannafj) 23 35.49 40.97 1 4.35
30454. Giovanni (gtrgio) 1 35.49 35.49 0 0.00
30455. Glen Ford (boyroader) 18 35.48 42.58 1 5.56
30456. Wailea (waileadude) 2 35.48 38.12 0 0.00
30457. Narberal (narberal) 5 35.47 43.15 0 0.00
30458. Bloodcraze (azraef) 1 35.46 35.46 0 0.00
30459. Samiha (sammoha) 61 35.46 47.58 2 3.28
30460. Jessica (runningfox) 17 35.45 43.28 1 5.88
30461. Bhuvanesh (bhuvaneshh) 40 35.44 43.56 3 7.50
30462. sara (sarafeizyab) 1 35.42 35.42 0 0.00
30463. Artur (korfey) 16 35.42 40.43 0 0.00
30464. Vahid (vahidmoradpour) 49 35.41 43.39 0 0.00
30465. Pro (pro_01) 483 35.40 49.90 41 8.49
30466. Phil (gunner_shents) 54 35.39 41.95 3 5.56
30467. Askhat (askhat0109) 21 35.38 45.87 0 0.00
30468. albit (albit) 119 35.38 48.68 3 2.52
30469. abdelrahman (basyouni74) 79 35.38 44.98 4 5.06
30470. dat (datkitteh) 115 35.37 60.03 11 9.57
30471. Joko (jokondo) 2 35.34 37.07 0 0.00
30472. Vlad (obserrrver) 1 35.32 35.32 0 0.00
30473. Mistermanfith (mistermanfith) 10 35.31 40.73 0 0.00
30474. Eldar (eldartoleubay1) 3 35.30 41.60 2 66.67
30475. keziah (keziah_p) 1 35.29 35.29 0 0.00
30476. rodaina (rodaina) 40 35.28 47.77 4 10.00
30477. Asilbek (acilbek) 55 35.27 47.83 1 1.82
30478. Sparsh (1nvariant) 1 35.26 35.26 0 0.00
30479. Mark (mark_my_name) 3 35.25 36.69 0 0.00
30480. jeyy (jeyy11) 138 35.22 46.29 8 5.80
30481. jhon (millkman) 12 35.21 40.15 1 8.33
30482. Antonio (vaping_tony96) 3 35.21 35.72 0 0.00
30483. Darkreaper (_darkreaper_) 2 35.20 38.92 0 0.00
30484. abracadabra (ariunerdene) 38 35.17 43.51 11 28.95
30485. yida (_yoda_) 4 35.16 41.13 1 25.00
30486. Ziffit (ziffit) 18 35.15 42.01 2 11.11
30487. notsofast (blankawaii_16) 2 35.14 44.54 0 0.00
30488. Benji (kannnix95) 1 35.13 35.13 0 0.00
30489. youcef (youcef_kehal011) 17 35.10 43.25 0 0.00
30490. Asylbek (askodzhenaliev) 38 35.10 43.55 14 36.84
30491. Ash (ashsuper18) 5 35.09 38.82 0 0.00
30492. Lazi (lazi) 1 35.06 35.06 0 0.00
30493. Pro (pro_talon) 26 35.02 41.13 0 0.00
30494. e (evzh) 8 35.01 42.05 0 0.00
30495. Pearl (pcaton94) 5 35.00 40.81 0 0.00
30496. uncal (uncalgg) 4 34.99 37.84 0 0.00
30497. olivia (typie06) 5 34.99 43.50 0 0.00
30498. Lagartixa (lagartixa16) 1 34.97 34.97 0 0.00
30499. Eoyzyc (_eoyzyc_) 10 34.94 46.27 2 20.00
30500. Junch (junchoooo) 1 34.92 34.92 0 0.00
30501. Ali (aliyuhaidaru) 18 34.91 40.32 1 5.56
30502. Philip (philip79) 7 34.90 37.22 0 0.00
30503. Jast (xcess0000) 14 34.88 44.40 3 21.43
30504. Harsh (harsh_dubey) 24 34.88 46.46 1 4.17
30505. Daniele (zspida) 1 34.86 34.86 0 0.00
30506. Salehbin (saleh_mksd) 43 34.86 42.47 0 0.00
30507. HelioSpook (heliospook) 99 34.85 47.95 1 1.01
30508. Gopal (avengergopal) 284 34.83 53.03 25 8.80
30509. Kelly (kellyqin) 73 34.79 44.29 2 2.74
30510. Nabiha (nabiha_fatima01) 55 34.76 40.98 2 3.64
30511. Dr. NedStark (nedstark2_0) 28 34.75 41.48 3 10.71
30512. Mackenzie (music1713) 32 34.75 40.44 0 0.00
30513. Sheena (shehoy19) 2 34.75 43.00 0 0.00
30514. Avy (avygorg) 12 34.69 47.45 0 0.00
30515. akash_mzp (akash04mzp) 130 34.69 47.40 9 6.92
30516. zander (cowymcmooy) 2 34.65 36.19 1 50.00
30517. Khadija (kaijaaa) 13 34.63 42.90 3 23.08
30518. Indiana Mitko (indianamitko) 11 34.61 42.97 1 9.09
30519. undecipherable (undeciphera... 3 34.61 35.56 0 0.00
30520. durehuu (durehuu_123) 103 34.60 61.50 5 4.85
30521. Akshay (ak63) 9 34.58 43.64 2 22.22
30522. Vhae (variesg25) 1 34.57 34.57 0 0.00
30523. choi (choi0228) 2 34.53 35.80 0 0.00
30524. Davidsito (davidsito) 1 34.52 34.52 0 0.00
30525. Hilmoone (hilda_04) 1 34.52 34.52 0 0.00
30526. tenxone (tenxone) 16 34.52 45.02 2 12.50
30527. Musavi (iqbalmusavi) 2 34.48 38.47 0 0.00
30528. Adam (yoooooooooooooooooooo... 4 34.47 38.10 3 75.00
30529. Sebastian (cantdefeatairman) 3 34.46 37.35 3 100.00
30530. Jit (wtf989) 2 34.46 36.91 0 0.00
30531. Vedica (gairolavedica) 71 34.44 45.21 9 12.68
30532. John (word_weaver) 4 34.44 35.55 0 0.00
30533. Kushagr (heavenclaw) 7 34.43 36.78 0 0.00
30534. LEANG (leangsy22) 72 34.43 42.22 5 6.94
30535. Lauro (laurorehr) 1 34.39 34.39 0 0.00
30536. Big Bird (bigbird61) 9 34.39 38.47 0 0.00
30537. Julia (malh) 27 34.34 41.61 2 7.41
30538. Mikhail The Greatest (zdaro... 1 34.32 34.32 1 100.00
30539. yuan (ttkomalake) 7 34.31 37.41 0 0.00
30540. Lorenz (meincrakker) 1 34.31 34.31 0 0.00
30541. moshi (frcmjr) 2 34.30 39.57 0 0.00
30542. Crumb (itzcrisp_xd_yt) 2 34.28 39.04 2 100.00
30543. Nail (nailail) 71 34.27 42.62 3 4.23
30544. Subir (subir_b) 106 34.27 42.26 2 1.89
30545. Lev (kaberan) 12 34.27 39.64 0 0.00
30546. Al-amin (alamin01) 55 34.25 41.20 4 7.27
30547. Connor (connordege) 1 34.24 34.24 0 0.00
30548. Srean (sreantsm) 48 34.24 46.73 3 6.25
30549. Liv (_liiv_) 1 34.23 34.23 0 0.00
30550. Sybetron (sybetron) 10 34.21 43.97 1 10.00
30551. Andrey (kalida) 3 34.18 43.02 0 0.00
30552. Muhammad (sennvacan) 4 34.17 36.04 0 0.00
30553. Md Abdul (kader) 40 34.09 47.88 1 2.50
30554. Pegasus X (pegasusx) 33 34.08 45.58 1 3.03
30555. onionshavewings (onionshave... 3 34.06 35.33 0 0.00
30556. Lemon (gauransh) 1 34.05 34.05 0 0.00
30557. Watson (watson0115) 1 34.05 34.05 0 0.00
30558. Karan (kk11007) 131 34.02 47.04 6 4.58
30559. Captain (captainbravo579) 18 34.02 37.16 0 0.00
30560. ChenTK (tklife1209) 1 34.00 34.00 0 0.00
30561. MUHD (nvzvn) 2 33.98 34.65 0 0.00
30562. Raj (rocket_boyz) 6 33.97 41.69 0 0.00
30563. Chatchai (mhoblack) 2 33.97 36.52 0 0.00
30564. DIVYANSHU (divyanshu310) 1 33.95 33.95 0 0.00
30565. Varun (varun170) 6 33.95 39.05 1 16.67
30566. Asnar (asnarsar) 46 33.94 54.33 5 10.87
30567. bobs (bobsbee) 49 33.91 49.31 4 8.16
30568. Mehraj Mahmood (comiccypressm) 34 33.87 41.16 0 0.00
30569. Olivia (bgts) 1 33.80 33.80 0 0.00
30570. MUHAMMAD (m_haris676) 19 33.80 40.59 6 31.58
30571. TunaFish026 (tunafish026) 6 33.77 38.08 1 16.67
30572. Monjur 101 (monjur_ahmed) 56 33.76 41.70 5 8.93
30573. daniel (notorious13366) 54 33.76 47.73 11 20.37
30574. PPTheJoker (pp_the_joker) 6 33.73 40.06 0 0.00
30575. ponyo (ponyyo2323) 119 33.73 47.94 2 1.68
30576. sohyameow (shoyameow) 6 33.70 35.90 0 0.00
30577. Sela (selawolf) 6 33.69 38.68 0 0.00
30578. yazan (yazan_2000) 53 33.67 45.48 3 5.66
30579. Stanislav (theboystan) 1 33.64 33.64 0 0.00
30580. sadra (sadraaa) 1 33.64 33.64 0 0.00
30581. Aman (aman7015) 1 33.64 33.64 0 0.00
30582. Subhabrata (kikni) 1 33.64 33.64 0 0.00
30583. Banoboo (lasttry) 109 33.62 48.14 9 8.26
30584. grotesque (grotesque986) 4 33.62 41.84 1 25.00
30585. mohammed (aljarrah) 1 33.60 33.60 0 0.00
30586. XΣЯӨ (darius_dragon) 1 33.59 33.59 1 100.00
30587. Beryl (berrr16) 1 33.58 33.58 0 0.00
30588. Dawid (shader_zxa) 1 33.57 33.57 0 0.00
30589. John (ionas22) 15 33.56 38.67 2 13.33
30590. Sebastian (searchsr555) 1 33.56 33.56 1 100.00
30591. Catia (catiarin) 1 33.53 33.53 0 0.00
30592. Thomas (cardano007) 2 33.52 35.16 1 50.00
30593. Decent (decent_dvorak) 6 33.51 45.76 1 16.67
30594. Tair (tako_01) 33 33.51 41.03 2 6.06
30595. CA (smallgoldfish) 5 33.50 36.84 1 20.00
30596. andrey (linus01) 15 33.48 42.38 0 0.00
30597. Jittimon (gibjittimon) 3 33.46 38.75 0 0.00
30598. arsham (arsham11) 5 33.41 36.86 1 20.00
30599. Ned420 (ned420) 6 33.39 36.92 2 33.33
30600. Anas (anasghawanmeh) 404 33.38 44.10 21 5.20
30601. pvx123 (pvx123) 18 33.37 38.19 0 0.00
30602. Assassin (dawson19) 1 33.36 33.36 1 100.00
30603. Sanad (sanad) 38 33.34 42.38 7 18.42
30604. Sufi (sufi7) 180 33.33 67.69 14 7.78
30605. MD Nasir Uddin (nasiruddin1... 24 33.33 45.11 1 4.17
30606. zero2 (deadz) 455 33.32 47.92 40 8.79
30607. nuttendabutt (nuttendabutt) 22 33.31 37.26 2 9.09
30608. Poul ib Uitsatikitseq (13fu... 31 33.27 44.34 1 3.23
30609. silver_hamburger (silver_ha... 58 33.25 44.48 6 10.34
30610. viixonn (viixonn) 3 33.21 37.23 1 33.33
30611. BEST 54 wpm (terass) 7 33.18 37.55 2 28.57
30612. HK (bengal_tiger) 1 33.17 33.17 0 0.00
30613. Ammie (reallyoldfart) 234 33.15 48.11 19 8.12
30614. Vishal (vishal2376) 6 33.15 41.05 0 0.00
30615. just_tito (just_tito) 31 33.10 41.84 1 3.23
30616. Abhi (abhishekdas1025) 4 33.09 34.40 0 0.00
30617. Kamiltoni (ktonig1221) 29 33.07 52.81 3 10.34
30618. giu (rand34) 1 33.07 33.07 0 0.00
30619. veeru (veeru_05) 3 33.06 34.29 0 0.00
30620. HY (hygh) 9 33.02 37.45 0 0.00
30621. Otroti (julianblow) 4 32.99 38.71 0 0.00
30622. the one (qaisianas) 557 32.98 48.81 37 6.64
30623. Mohammad Adeel (adikhanzai) 3 32.97 35.81 0 0.00
30624. Tommy (tommywiseau95) 24 32.91 39.18 1 4.17
30625. พงษ์ปกรจ์... 17 32.88 40.70 11 64.71
30626. Jiranimo (jiranimo) 145 32.86 52.35 19 13.10
30627. Prince (annardana) 1 32.86 32.86 0 0.00
30628. Geoff (lmaousucksobad23) 1 32.84 32.84 0 0.00
30629. tstats[bobfish] (bobfish) 12 32.84 48.64 0 0.00
30630. Klenn C-zar (lordklenzki) 1 32.82 32.82 0 0.00
30631. adithedon (adithedon) 8 32.82 36.11 1 12.50
30632. Singam (akshay_singam) 5 32.82 39.99 0 0.00
30633. shahriar (sadid007) 6 32.81 35.69 0 0.00
30634. Eldiar (monoluntik) 2 32.81 34.20 0 0.00
30635. Paul (paultot) 17 32.80 39.35 2 11.76
30636. Sourav (souravdey_1) 9 32.78 37.54 1 11.11
30637. Garik (garikhayrapetian) 1 32.77 32.77 1 100.00
30638. Anupam (anupampandey) 5 32.77 37.04 0 0.00
30639. HallowSamurai (hallowsamurai) 23 32.77 38.56 1 4.35
30640. stas (stasats) 56 32.77 42.49 0 0.00
30641. Akbar (akbarginanjar) 4 32.72 35.62 2 50.00
30642. subol (subolroy) 6 32.71 38.93 0 0.00
30643. lufi (lufi148) 4 32.69 35.03 2 50.00
30644. Valera (layge) 3 32.66 33.18 0 0.00
30645. proxer05 (proxer05) 5 32.65 34.87 2 40.00
30646. Shadow (methehero_) 6 32.64 39.49 0 0.00
30647. cosette (queen_weeb) 4 32.63 34.88 0 0.00
30648. i am (lynx_noob) 26 32.62 40.50 5 19.23
30649. elay (elaytyping) 13 32.59 36.44 1 7.69
30650. Georgi (mitevw) 29 32.58 41.20 1 3.45
30651. Kostya (lolopodo) 5 32.55 41.55 0 0.00
30652. hewan (ikan_laut) 37 32.55 36.83 5 13.51
30653. Syed Sheraz (syedsherazarshad) 233 32.53 50.38 24 10.30
30654. Jarel (mr_dogwater) 3 32.52 38.64 0 0.00
30655. mitchelle (megets) 4 32.51 45.11 0 0.00
30656. Yohan (yoyo65) 13 32.47 35.84 0 0.00
30657. Kor (kkoo) 5 32.44 35.09 0 0.00
30658. regen45 (regen45) 47 32.41 45.23 4 8.51
30659. Rauan (l1tos) 2 32.40 34.92 0 0.00
30660. tade (tadessetic) 165 32.39 40.53 13 7.88
30661. Dan (dan_is_garbo) 1 32.39 32.39 1 100.00
30662. anh (tuananhq9) 1 32.38 32.38 0 0.00
30663. Pratik (gamerpratik) 2 32.37 33.19 0 0.00
30664. Antombomb (antombomb) 32 32.36 45.83 3 9.38
30665. hieser (hieser) 14 32.33 36.57 2 14.29
30666. Ray (ray_jan) 39 32.33 39.32 1 2.56
30667. Upendra (asarsh) 5 32.32 36.56 1 20.00
30668. RITIK (ritik1999) 33 32.32 38.22 3 9.09
30669. Ved (ved_) 26 32.31 44.43 1 3.85
30670. Enamul (enamul) 8 32.31 38.06 2 25.00
30671. Shreyash (shreyash_he) 26 32.28 37.26 7 26.92
30672. Hardik (hardfight777) 4 32.24 33.65 1 25.00
30673. Isra (israabosada) 214 32.23 44.05 21 9.81
30674. XLASh (xlash) 1 32.20 32.20 0 0.00
30675. tomdin0 (tomdin0) 147 32.19 43.87 9 6.12
30676. Ankit (ankit_10) 159 32.18 44.28 25 15.72
30677. Niraj (nirajkamat) 44 32.17 39.49 2 4.55
30678. Raivo (raivopleika) 26 32.16 43.30 2 7.69
30679. krishna (krishnatallani) 17 32.11 37.24 0 0.00
30680. Marcos (marcosv) 3 32.08 35.69 3 100.00
30681. Chan (cy0309) 6 32.07 34.48 0 0.00
30682. chandu (lavinyoutube) 9 32.06 41.84 1 11.11
30683. Sam (samag) 4 32.00 34.40 0 0.00
30684. RandomBoy (randomracer5) 3 31.99 36.39 0 0.00
30685. ten (ttennnnnnnnn) 6 31.93 34.29 1 16.67
30686. orange (orange_hexagon) 4 31.89 33.78 0 0.00
30687. Zia (zia__) 8 31.87 35.61 5 62.50
30688. Shour (momax) 1 31.85 31.85 1 100.00
30689. Bektur (bektur8888) 8 31.82 37.47 3 37.50
30690. babubhaiya (babubhaiya) 5 31.81 35.16 1 20.00
30691. tstats[v415hn4v] (v415hn4v) 174 31.81 42.50 12 6.90
30692. Arsalan (arsalan_khan) 171 31.79 47.11 31 18.13
30693. abindev (abindev) 52 31.78 41.86 7 13.46
30694. Mudmai (mudmai) 18 31.76 41.09 1 5.56
30695. Armaan (_armaan_singh24) 2 31.76 33.02 0 0.00
30696. Nada (nadazz9) 75 31.75 39.33 6 8.00
30697. Alejandra (alejandrabruh29) 8 31.70 38.65 3 37.50
30698. Jinna (se_sean) 1 31.69 31.69 0 0.00
30699. Yeoh (vinylsen) 1 31.68 31.68 0 0.00
30700. Hossam (hossamhero7) 3 31.68 32.36 0 0.00
30701. bacon (bacnv) 6 31.68 40.43 0 0.00
30702. khoa (khoa2k1) 1 31.67 31.67 0 0.00
30703. sunny (kamal787) 219 31.67 44.09 14 6.39
30704. Drew (supercoolgamer2) 7 31.64 45.15 0 0.00
30705. balzac (dasbalzac) 21 31.63 38.12 3 14.29
30706. Asher (fastwack) 1 31.60 31.60 0 0.00
30707. ashwin (ashwin_m) 1 31.58 31.58 0 0.00
30708. Lintang (8inx) 37 31.58 40.32 6 16.22
30709. MOhI (mohi9731) 5 31.53 36.94 0 0.00
30710. The great (killerlee3245) 3 31.49 33.73 1 33.33
30711. Prem (premkumar12) 77 31.47 40.00 6 7.79
30712. Sukanya (siriros) 31 31.44 40.28 2 6.45
30713. youssef (youssefuser) 215 31.43 40.98 24 11.16
30714. Linda (lindaslabbert) 10 31.42 38.61 0 0.00
30715. Harpreet (singh_is_king) 14 31.42 38.05 1 7.14
30716. Steven (carnivorous_crustat... 46 31.41 43.04 3 6.52
30717. Adam (photoequal) 36 31.41 37.67 2 5.56
30718. Steve (nepets) 2 31.41 34.90 0 0.00
30719. Oleg (meidebshy) 9 31.40 36.86 1 11.11
30720. Inter (intercash) 2 31.34 31.69 0 0.00
30721. raim (raimmillion) 64 31.31 41.25 5 7.81
30722. Julius (juuls_dvorak) 2 31.30 33.30 0 0.00
30723. Marie (slowestone) 17 31.30 39.41 1 5.88
30724. Ashton (ashtonnothsa) 74 31.29 43.04 7 9.46
30725. Shashank (sky08) 65 31.29 46.01 5 7.69
30726. Omar Ahmed (omar947203) 4 31.29 33.00 2 50.00
30727. Naimul (bangladeshi) 90 31.28 44.23 6 6.67
30728. Mahjabin (mahjabin08) 202 31.27 40.62 17 8.42
30729. seba (sebastianbie) 2 31.26 33.31 0 0.00
30730. Fanturn (fanturn) 14 31.25 44.00 1 7.14
30731. Ron (ron107) 8 31.25 40.21 0 0.00
30732. chikke (srujan_chikke) 44 31.23 39.38 5 11.36
30733. julian Schwarz (sjd2042) 2 31.22 31.79 0 0.00
30734. Saptarsi (xanxian) 1 31.21 31.21 0 0.00
30735. Mohaimenul (typun) 7 31.20 37.67 0 0.00
30736. Santiago (santpp85) 8 31.17 35.22 0 0.00
30737. Patryk (patryqu08) 3 31.15 35.15 0 0.00
30738. Никита (mamaxab) 153 31.14 43.39 20 13.07
30739. Mukhametkali (mr_koten) 31 31.14 39.45 8 25.81
30740. Koren794 (koren794) 2 31.14 32.98 0 0.00
30741. Jack (jackiechips) 43 31.13 41.66 7 16.28
30742. Noor (noorrahman) 3 31.09 31.54 0 0.00
30743. Mohamd (mohamed_hussein) 154 31.07 42.68 23 14.94
30744. vaquinha (vaquinha) 1 31.07 31.07 1 100.00
30745. pulkit (pulkitb) 50 31.04 46.89 4 8.00
30746. Adilkhan (legolaz4ever) 1 31.03 31.03 0 0.00
30747. Millie (brunomarstm) 47 31.03 38.12 5 10.64
30748. Abhi_Dvorak (abhyudaya_nair) 1 31.01 31.01 0 0.00
30749. Owen (cvlized) 3 31.00 33.91 0 0.00
30750. Jaloliddin (beebeep) 3 30.99 32.71 0 0.00
30751. Hisoka (lev872) 12 30.98 35.61 2 16.67
30752. Simon (simco) 4 30.96 34.58 0 0.00
30753. Prashant Kumar (prasha3nt) 67 30.95 38.04 5 7.46
30754. Jasur (jasurava) 55 30.89 44.81 9 16.36
30755. Ali (aliansari) 1 30.86 30.86 0 0.00
30756. rinas (dont_look_at_keyboard) 797 30.86 43.85 74 9.28
30757. gavin (gavyoung) 7 30.85 35.86 2 28.57
30758. Tan (goodrace4u) 4 30.81 36.10 0 0.00
30759. Sara (sarasmile) 8 30.78 45.61 2 25.00
30760. MD IBRAHIM (ibrahim827) 1 30.71 30.71 0 0.00
30761. XxDarkSIdexX (xxdarksidexx) 7 30.67 42.46 2 28.57
30762. Ibrokhimjon (ibrokhimjon23) 8 30.67 35.55 2 25.00
30763. Yousef (the_beast_007) 1 30.66 30.66 0 0.00
30764. Lee (pohsien) 8 30.64 39.85 0 0.00
30765. HASG (hamzaelgarhy) 7 30.56 34.64 1 14.29
30766. ___.rishii.____ (rishikesh_... 5 30.56 33.24 1 20.00
30767. romo (romokom) 15 30.55 36.19 1 6.67
30768. Jerry_007 (jerry_007) 415 30.54 42.91 27 6.51
30769. Nathan (n_tber) 26 30.53 43.81 5 19.23
30770. Lexi (silentfungus) 46 30.50 48.74 10 21.74
30771. Khadiza (khadiza) 76 30.49 37.54 6 7.89
30772. Kayla (martina1155) 12 30.41 36.54 1 8.33
30773. strgn (strgn) 233 30.40 42.42 24 10.30
30774. Azimjon (azimjon) 4 30.40 33.18 0 0.00
30775. uTo (kalabam) 4 30.39 34.14 2 50.00
30776. Trevor (trevor10) 31 30.38 39.83 3 9.68
30777. wilson (wilsoncho360) 2 30.38 36.03 0 0.00
30778. Sun_Biel (sun_biel) 1 30.34 30.34 0 0.00
30779. Marcel (marcelmladi) 36 30.32 37.79 9 25.00
30780. Vu1can (kaiayush) 3 30.28 35.16 2 66.67
30781. Divyanshu (dev064) 94 30.25 43.24 14 14.89
30782. Itzopik :D (itsopik_trok) 4 30.17 37.69 0 0.00
30783. Sandy (sandeshgowda0094) 268 30.12 42.20 34 12.69
30784. Intetsu (intetsun6) 37 30.12 36.70 2 5.41
30785. Jasper (sugarryboi) 1 30.09 30.09 0 0.00
30786. matthew (typeredemption) 11 30.09 36.12 3 27.27
30787. Gabriel (bultaqi) 18 30.07 38.05 0 0.00
30788. Faleye Slaven (speedhell) 12 30.04 35.12 2 16.67
30789. Arafat (arafat_islam) 1 30.02 30.02 0 0.00
30790. Hafizuddin (dinios_) 14 30.00 34.26 0 0.00
30791. FREE Palestine (stilllobste... 1 29.98 29.98 0 0.00
30792. Zed (zed_op) 9 29.98 33.93 2 22.22
30793. Michalosnup (michalosnup) 6 29.93 35.49 2 33.33
30794. Liam (lpare45) 2 29.85 33.18 1 50.00
30795. hamza (hamzacer) 5 29.83 35.50 0 0.00
30796. La Rana (la_rana_rene) 1 29.82 29.82 0 0.00
30797. Adam (pop123gyg) 27 29.82 35.90 2 7.41
30798. Pat (cranytorso) 1 29.81 29.81 0 0.00
30799. Sourav (_sourav_) 21 29.80 34.69 1 4.76
30800. irsyad (irsyad99) 1 29.74 29.74 1 100.00
30801. Pema (rimuru_tempest2004) 66 29.73 39.25 10 15.15
30802. daydreamer (rhebbar) 17 29.72 37.49 2 11.76
30803. SKY (avid_learner8) 140 29.64 36.69 20 14.29
30804. shannon (babyface1718) 5 29.64 32.87 2 40.00
30805. Sherzod Nadirov (sherzod_5) 47 29.62 37.67 5 10.64
30806. unknown (oqutaorblx) 1 29.55 29.55 0 0.00
30807. Eragon (eragon_kaizen) 23 29.50 44.11 4 17.39
30808. shams (slo_shams) 12 29.44 34.82 1 8.33
30809. RED (naga30) 13 29.42 45.73 1 7.69
30810. Avi (avi222) 94 29.40 42.46 9 9.57
30811. WHEN THE IMPOSTER IS SUS SU... 10 29.39 30.66 0 0.00
30812. Ahmed (ahmeed_a) 100 29.35 37.04 10 10.00
30813. Vivek (vivektarun1234) 406 29.35 44.08 49 12.07
30814. Shubham (shubham409) 57 29.33 40.73 8 14.04
30815. Marla Marie (marla_17) 1 29.31 29.31 0 0.00
30816. person (w_person) 1 29.29 29.29 0 0.00
30817. angelic (angeliccalling) 38 29.28 43.70 4 10.53
30818. Skipper (samskipper) 81 29.27 39.07 17 20.99
30819. Yashpal (ymanju) 319 29.26 44.59 51 15.99
30820. rodrigo (rodrigo_rocha) 4 29.25 31.69 0 0.00
30821. Jorja (jorja_o) 2 29.24 31.48 0 0.00
30822. lane (hiddenplays) 26 29.22 34.88 0 0.00
30823. ss (aaassssss) 207 29.21 40.15 25 12.08
30824. sara (saraafr) 1 29.21 29.21 0 0.00
30825. Iris (irxs) 190 29.12 46.53 27 14.21
30826. Alex (veifario) 13 29.09 35.68 3 23.08
30827. bill (bill_hunt22) 11 29.01 32.41 0 0.00
30828. fast_as_f*ck (techniqueee1337) 85 28.99 39.45 8 9.41
30829. ilias (iliakesk) 3 28.98 32.81 1 33.33
30830. Seeker (amer1996) 9 28.96 31.71 2 22.22
30831. ?? (form30to100) 280 28.94 45.60 41 14.64
30832. Fher (aether78) 10 28.93 36.77 3 30.00
30833. cameron (bigmoon) 12 28.91 38.12 3 25.00
30834. Bharat Rai (bratrai11) 346 28.91 38.73 37 10.69
30835. S (typer78) 12 28.90 32.21 2 16.67
30836. Subahan (mdsubahan) 8 28.89 33.99 2 25.00
30837. azhi (azhi_i) 12 28.89 32.84 1 8.33
30838. Sandeep (5keleton) 121 28.89 37.89 18 14.88
30839. Guiguizin (paodequeijomolhado) 1 28.86 28.86 1 100.00
30840. Nurzhalgas (nurzhalgas_) 6 28.86 32.68 0 0.00
30841. Paraducks (sras208) 3 28.85 31.75 0 0.00
30842. Kevin (dostoyevksy) 12 28.83 36.73 3 25.00
30843. Zane (zanecoldyt) 3 28.83 29.85 0 0.00
30844. Tobias (tospon) 19 28.73 33.56 6 31.58
30845. Tushar (nutzingfork) 9 28.72 39.76 0 0.00
30846. ASHISH YADAV (ashish001) 12 28.68 32.92 0 0.00
30847. cole (colezyyy) 2 28.63 29.45 0 0.00
30848. Jr (jrlynn) 7 28.50 30.38 2 28.57
30849. A S (ahmad1shmd) 5 28.49 34.36 2 40.00
30850. Pacman (paco1978) 4 28.41 39.35 2 50.00
30851. labaalli (hajjaba) 115 28.37 39.31 15 13.04
30852. Joys (dj25808) 4 28.37 30.89 2 50.00
30853. VSF (vsf123) 29 28.36 34.47 5 17.24
30854. Looserrrrrrrrrrrr (rahulary... 153 28.34 52.04 70 45.75
30855. Juri (rvotaenota13) 2 28.30 30.13 1 50.00
30856. Bonne (ggraznpv) 8 28.30 30.09 1 12.50
30857. ssofia (ssofia_bas) 10 28.29 33.91 2 20.00
30858. zei (zeizuta) 29 28.27 34.59 7 24.14
30859. AyuAnchor (ayu_anchor) 9 28.25 33.97 3 33.33
30860. The (theking2007) 16 28.21 32.89 4 25.00
30861. Holden (holden_ford) 18 28.20 36.15 3 16.67
30862. Roland (rothaler) 1 28.19 28.19 1 100.00
30863. Puffone (puffone) 8 28.18 32.27 2 25.00
30864. Yash (royal_ralhi) 9 28.17 33.08 2 22.22
30865. James (jamesmz_101) 15 28.16 35.49 0 0.00
30866. RHYTHM MOTWANI (rhythm_123) 131 28.09 38.89 26 19.85
30867. Ammon (ammon21110) 1 28.07 28.07 0 0.00
30868. chlovis (chlovis) 50 28.02 41.81 7 14.00
30869. Gojou (gojou_) 232 28.02 43.03 32 13.79
30870. pietro (mepeeper) 1 28.01 28.01 0 0.00
30871. Goal: 70wpm average (pietpo... 8 28.01 31.29 0 0.00
30872. aiman (armm) 9 27.96 33.26 1 11.11
30873. Marianne (taebvm) 1 27.95 27.95 0 0.00
30874. farzi (farzi) 15 27.95 33.76 0 0.00
30875. sadsal12 (sadsal12) 1 27.86 27.86 0 0.00
30876. MANOJ Kumar (manoj_ku_rao) 2 27.78 31.62 0 0.00
30877. wiktor (wiktoroski1995) 19 27.70 36.44 4 21.05
30878. J (mindjar) 137 27.70 37.13 23 16.79
30879. Mehul (mehulraj69) 5 27.64 28.60 0 0.00
30880. San (slowcatnospeed) 55 27.61 34.71 7 12.73
30881. Shynali Otep (shynali) 69 27.58 34.85 10 14.49
30882. Joe (oveslikeagger) 3 27.53 30.51 1 33.33
30883. Aidana (missboss77) 10 27.51 34.67 0 0.00
30884. Alaa (alaasultan) 7 27.43 30.41 1 14.29
30885. Abdallah (lno_namel) 16 27.39 32.21 1 6.25
30886. Felipe (felipeav2) 10 27.37 34.51 1 10.00
30887. mahmud (mahmoudtahaa111) 9 27.37 31.27 3 33.33
30888. Kieran (ultimatescienceboy) 5 27.37 30.81 1 20.00
30889. matan (matanselig) 51 27.31 34.56 6 11.76
30890. Julian (judaslan) 1 27.19 27.19 0 0.00
30891. DamarFathan (d_fathan) 1 27.16 27.16 0 0.00
30892. Otamurod (otamurod_2003) 6 27.15 30.33 0 0.00
30893. G B (believeb) 50 27.09 37.49 33 66.00
30894. Nurlan (tasmaev) 7 27.05 30.54 1 14.29
30895. L.E. (sluis9_halmak) 25 27.04 36.21 10 40.00
30896. himanshu (himanshukamani) 7 27.00 30.95 3 42.86
30897. brett (mru_uward) 5 26.98 30.53 0 0.00
30898. whutthiphon (nongmai) 9 26.95 31.02 0 0.00
30899. Jai (constipater) 2 26.90 28.17 0 0.00
30900. Sharif (sa524402) 21 26.89 37.95 5 23.81
30901. Andre (andre2016) 3 26.87 27.78 0 0.00
30902. nattapakon (63100932) 37 26.83 30.92 12 32.43
30903. Pitt@_____ (shubhamshinde) 16 26.75 32.72 1 6.25
30904. Ultra (ultra_1001) 1 26.73 26.73 0 0.00
30905. Md Ahad Ali (sumon_ahmmed_001) 59 26.71 31.54 9 15.25
30906. Nguyen Phuoc (aurasync) 1 26.70 26.70 0 0.00
30907. kobus (supercatspeed) 17 26.67 32.50 1 5.88
30908. foveacapitus (foveacapitus) 13 26.63 54.50 8 61.54
30909. kdjaiel (nobody42) 39 26.60 35.42 3 7.69
30910. Zagar (ewentuz) 4 26.57 31.23 0 0.00
30911. Yessimkhan (yess_0) 93 26.51 38.62 23 24.73
30912. lyricata (lyricata) 3 26.43 28.31 1 33.33
30913. alex (alexjimma) 16 26.42 31.45 3 18.75
30914. Arslan (elbosynov) 20 26.40 30.86 14 70.00
30915. Tynai (tynka) 4 26.38 28.53 1 25.00
30916. Yeldos (yeldos1) 289 26.38 43.76 48 16.61
30917. Luka (luka778) 2 26.37 26.58 0 0.00
30918. JixS4v (jixs4v) 3 26.34 27.87 0 0.00
30919. blood (bloodripper) 61 26.19 33.65 8 13.11
30920. Eliza (kaeco_) 20 26.16 37.63 3 15.00
30921. Shiva (lord_kartikey) 45 26.15 38.20 12 26.67
30922. NukeADS (nukeads101) 8 26.06 31.23 0 0.00
30923. RoyMcGround (maggyroyrowins... 10 25.99 28.60 1 10.00
30924. hunter (marcyisthebestestgirl) 1 25.96 25.96 0 0.00
30925. Steel9volt (steel9volty) 1 25.82 25.82 0 0.00
30926. nattapakon (zudiyeah) 28 25.82 33.03 1 3.57
30927. Lewis (wyattl1) 2 25.77 26.98 0 0.00
30928. MOMO (momo_20) 1 25.75 25.75 0 0.00
30929. lluis (lluissuros) 10 25.73 28.15 1 10.00
30930. Morgan (morgan_brooke_21) 1 25.70 25.70 1 100.00
30931. jimi (jimiwimi) 1 25.68 25.68 0 0.00
30932. Alan (alan_hsiu) 21 25.65 34.38 0 0.00
30933. Apgan (apgan) 1 25.61 25.61 0 0.00
30934. Arsen (konars_04) 36 25.60 33.86 3 8.33
30935. Md. (ranoy) 70 25.45 38.87 14 20.00
30936. gavin (ga123reee) 6 25.45 28.57 1 16.67
30937. Vahan (vaki) 63 25.42 33.91 14 22.22
30938. Bhumika (bhumika111) 7 25.32 27.27 2 28.57
30939. Chris (immortaljason) 575 25.29 41.41 110 19.13
30940. Gaurav (gauravkr442) 1 25.26 25.26 0 0.00
30941. Anas (anas023) 22 25.22 34.36 7 31.82
30942. sabir (rabugi) 25 25.10 34.92 4 16.00
30943. Andreas (agehring) 163 25.08 33.03 41 25.15
30944. bmwsauber (bmwsauber) 6 25.06 27.53 0 0.00
30945. SIR (sirbabyboycheeks1449) 5 24.99 27.69 1 20.00
30946. Rolandas (rolandas) 11 24.91 32.26 0 0.00
30947. kaly (klay7) 303 24.86 41.55 72 23.76
30948. ReDhaBenkortbi (reda6aboob) 19 24.83 31.11 5 26.32
30949. Multi (multibala) 17 24.67 31.46 5 29.41
30950. Abode (abulrahman_kallas) 87 24.67 37.29 19 21.84
30951. a (ariyuse) 1 24.57 24.57 0 0.00
30952. Ish (ish_) 1 24.55 24.55 0 0.00
30953. chris (founduman) 1 24.53 24.53 0 0.00
30954. Putus (putusbb) 121 24.50 35.84 18 14.88
30955. BÉ HEO (beheo2012) 3 24.48 28.76 1 33.33
30956. poggers (shezzerk) 1 24.42 24.42 0 0.00
30957. Deric Lewis (dragon760) 11 24.40 36.49 3 27.27
30958. I_will_not_tell (hitme1111) 12 24.34 28.31 1 8.33
30959. ayushwan (ayush6203) 245 24.31 36.13 53 21.63
30960. Divyansh (_divyanshwastaken) 39 24.25 33.53 9 23.08
30961. Saaho (saaho) 1 24.24 24.24 0 0.00
30962. youknow (moelesteronyakids) 16 24.12 28.38 4 25.00
30963. Javlonbek (javlonbek) 3 24.11 27.34 2 66.67
30964. Aleeya (alemm5293) 5 24.04 30.17 0 0.00
30965. mirlan (mirlanbek) 15 23.89 30.07 1 6.67
30966. Даниил (p1zda) 3 23.87 25.96 0 0.00
30967. Zamira (zamira89) 19 23.78 27.09 8 42.11
30968. Ziad (zinafzi) 3 23.75 27.93 1 33.33
30969. ahmed (elberawy) 10 23.72 27.94 1 10.00
30970. oussama (oredshadow) 5 23.65 25.62 0 0.00
30971. Aaron (asc_the_fighter) 32 23.57 28.75 7 21.88
30972. Zan (zanimeyt) 1 23.52 23.52 1 100.00
30973. han (hahhan) 8 23.36 26.23 1 12.50
30974. Mohamed (mohamednabil090) 4 23.24 25.57 2 50.00
30975. Mick (kingkasma24) 1 23.12 23.12 0 0.00
30976. Suzaku (suzakucrono) 1 23.00 23.00 0 0.00
30977. meryou (vmerv) 1 22.98 22.98 0 0.00
30978. Ahududu (ahududuyt) 2 22.88 27.29 0 0.00
30979. Quan (quan_2003) 2 22.87 23.16 1 50.00
30980. Rakibul Alam (badboirakib) 112 22.83 33.34 15 13.39
30981. ANKIT (ankit_2002) 10 22.80 27.29 3 30.00
30982. leo (cowboy_john) 2 22.78 24.24 1 50.00
30983. Jan Kozaruk (jackoza) 38 22.60 32.17 21 55.26
30984. hamada (hamada377) 81 22.44 34.08 14 17.28
30985. diamond (diamond) 10 22.41 30.47 5 50.00
30986. Sezim (sezim20_12) 4 22.22 23.47 2 50.00
30987. Abhinav (abhinav199920) 5 22.21 27.18 0 0.00
30988. Dibyajyoti sarkar (delex) 1 22.03 22.03 0 0.00
30989. kamal (kemokingdod) 80 22.02 33.09 15 18.75
30990. Lilac (lilaclily) 49 21.91 28.51 9 18.37
30991. Divyanshu (chakanshu) 4 21.81 31.72 0 0.00
30992. Ramkrishn Rai (0typing_beast) 1 21.76 21.76 1 100.00
30993. sasolisa (sasolisa) 1 21.72 21.72 1 100.00
30994. Lucky (_lucky__verma__) 28 21.62 30.50 5 17.86
30995. noah (mhyrion) 1 21.58 21.58 1 100.00
30996. Mina (minamark) 6 21.51 24.23 2 33.33
30997. Timothy (chicken174) 14 21.46 27.87 3 21.43
30998. Atlasov (atlasnik) 7 21.42 23.78 1 14.29
30999. sanjeev (sanjeev_2020) 182 21.41 35.25 38 20.88
31000. Theo (dhm_learner) 25 21.33 36.47 3 12.00
31001. parasjeet (parasjeet_singh) 24 21.27 30.29 7 29.17
31002. Madhvendra (madhvendra) 73 21.27 37.14 23 31.51
31003. Nadarsha (nadarsha) 73 21.24 29.83 23 31.51
31004. TEMUCHIN (temuchin) 3 21.20 23.14 0 0.00
31005. MONKE (joker9336) 4 21.19 22.92 0 0.00
31006. christopher (chrismoss5) 3 20.95 23.75 0 0.00
31007. Anton (dchk) 2 20.87 21.50 0 0.00
31008. misab (misabshibu) 35 20.67 31.08 14 40.00
31009. Vihaan (vilecn2609) 11 20.52 24.16 10 90.91
31010. Parth (parthl301) 1 20.34 20.34 0 0.00
31011. JEHADUR (jehad) 1 20.30 20.30 0 0.00
31012. austirol (austirol) 73 20.17 33.25 11 15.07
31013. Saurabh (ssb456) 3 20.09 21.64 0 0.00
31014. ahiraj (ahirajsingh) 341 19.98 32.62 43 12.61
31015. KaloiNa (kaloina) 25 19.83 31.05 7 28.00
31016. Yash (ys07) 1 19.65 19.65 0 0.00
31017. fajar (fjr123) 7 19.51 32.42 0 0.00
31018. hello1900 (hello1900) 10 18.77 20.99 4 40.00
31019. Ravid (ravid37) 106 18.76 25.56 13 12.26
31020. Mahmoud (ec41513) 4 18.60 21.56 1 25.00
31021. Mart (devli) 8 18.16 19.86 0 0.00
31022. Serjs (sedoy) 445 18.10 28.68 92 20.67
31023. Iwan (ocalukivan) 25 18.08 42.90 4 16.00
31024. Daryoush (rango__nice) 68 18.08 25.70 14 20.59
31025. Jennifer (ennyvanna) 41 18.02 22.53 7 17.07
31026. Luke (skkywalker62) 1 17.74 17.74 0 0.00
31027. Esraa (esraa14) 33 17.64 28.41 10 30.30
31028. Daniil (hotdan28) 6 17.12 18.92 1 16.67
31029. avg (avgr) 14 16.78 22.67 1 7.14
31030. iwannabebee (iwannabebee) 8 16.65 21.56 1 12.50
31031. Mohammad (robin420024) 10 16.03 19.82 2 20.00
31032. Meta (meta_x0) 2 15.71 23.01 1 50.00
31033. michael (michael1117) 3 14.24 16.77 0 0.00
31034. Nolan (ilovebluecars_13) 17 13.71 17.01 5 29.41
31035. atypicallegend ahmed aziz j... 1 13.63 13.63 0 0.00
31036. Prem (prem6299) 1 13.40 13.40 0 0.00
31037. Nasufp (nasufp) 5 12.21 22.01 0 0.00
31038. Rick (rick_200wpm) 19 10.83 14.09 10 52.63
31039. Sabbir Ahmed Talukdar (sats... 1 10.18 10.18 0 0.00
31040. AerythM (hedgepenguin) 1 8.10 8.10 0 0.00
31041. jubaer (jubaer_maruf) 1 7.36 7.36 0 0.00